Viral receptor-binding site antibodies with diverse germline origins.

PubMed

Schmidt, Aaron G; Therkelsen, Matthew D; Stewart, Shaun; Kepler, Thomas B; Liao, Hua-Xin; Moody, M Anthony; Haynes, Barton F; Harrison, Stephen C

2015-05-21

Vaccines for rapidly evolving pathogens will confer lasting immunity if they elicit antibodies recognizing conserved epitopes, such as a receptor-binding site (RBS). From characteristics of an influenza-virus RBS-directed antibody, we devised a signature motif to search for similar antibodies. We identified, from three vaccinees, over 100 candidates encoded by 11 different VH genes. Crystal structures show that antibodies in this class engage the hemagglutinin RBS and mimic binding of the receptor, sialic acid, by supplying a critical dipeptide on their projecting, heavy-chain third complementarity determining region. They share contacts with conserved, receptor-binding residues but contact different residues on the RBS periphery, limiting the likelihood of viral escape when several such antibodies are present. These data show that related modes of RBS recognition can arise from different germline origins and mature through diverse affinity maturation pathways. Immunogens focused on an RBS-directed response will thus have a broad range of B cell targets. Copyright © 2015 Elsevier Inc. All rights reserved.

Visual scanning behavior is related to recognition performance for own- and other-age faces

PubMed Central

Proietti, Valentina; Macchi Cassia, Viola; dell’Amore, Francesca; Conte, Stefania; Bricolo, Emanuela

2015-01-01

It is well-established that our recognition ability is enhanced for faces belonging to familiar categories, such as own-race faces and own-age faces. Recent evidence suggests that, for race, the recognition bias is also accompanied by different visual scanning strategies for own- compared to other-race faces. Here, we tested the hypothesis that these differences in visual scanning patterns extend also to the comparison between own and other-age faces and contribute to the own-age recognition advantage. Participants (young adults with limited experience with infants) were tested in an old/new recognition memory task where they encoded and subsequently recognized a series of adult and infant faces while their eye movements were recorded. Consistent with findings on the other-race bias, we found evidence of an own-age bias in recognition which was accompanied by differential scanning patterns, and consequently differential encoding strategies, for own-compared to other-age faces. Gaze patterns for own-age faces involved a more dynamic sampling of the internal features and longer viewing time on the eye region compared to the other regions of the face. This latter strategy was extensively employed during learning (vs. recognition) and was positively correlated to discriminability. These results suggest that deeply encoding the eye region is functional for recognition and that the own-age bias is evident not only in differential recognition performance, but also in the employment of different sampling strategies found to be effective for accurate recognition. PMID:26579056

Specialized piRNA Pathways Act in Germline and Somatic Tissues of the Drosophila Ovary

PubMed Central

Malone, Colin D.; Brennecke, Julius; Dus, Monica; Stark, Alexander; McCombie, W. Richard; Sachidanandam, Ravi; Hannon, Gregory J.

2010-01-01

SUMMARY In Drosophila gonads, Piwi proteins and associated piRNAs collaborate with additional factors to form a small RNA-based immune system that silences mobile elements. Here, we analyzed nine Drosophila piRNA pathway mutants for their impacts on both small RNA populations and the subcellular localization patterns of Piwi proteins. We find that distinct piRNA pathways with differing components function in ovarian germ and somatic cells. In the soma, Piwi acts singularly with the conserved flamenco piRNA cluster to enforce silencing of retroviral elements that may propagate by infecting neighboring germ cells. In the germline, silencing programs encoded within piRNA clusters are optimized via a slicer-dependent amplification loop to suppress a broad spectrum of elements. The classes of transposons targeted by germline and somatic piRNA clusters, though not the precise elements, are conserved among Drosophilids, demonstrating that the architecture of piRNA clusters has coevolved with the transposons that they are tasked to control. PMID:19395010

De Novo Truncating Variants in ASXL2 Are Associated with a Unique and Recognizable Clinical Phenotype.

PubMed

Shashi, Vandana; Pena, Loren D M; Kim, Katherine; Burton, Barbara; Hempel, Maja; Schoch, Kelly; Walkiewicz, Magdalena; McLaughlin, Heather M; Cho, Megan; Stong, Nicholas; Hickey, Scott E; Shuss, Christine M; Freemark, Michael S; Bellet, Jane S; Keels, Martha Ann; Bonner, Melanie J; El-Dairi, Maysantoine; Butler, Megan; Kranz, Peter G; Stumpel, Constance T R M; Klinkenberg, Sylvia; Oberndorff, Karin; Alawi, Malik; Santer, Rene; Petrovski, Slavé; Kuismin, Outi; Korpi-Heikkilä, Satu; Pietilainen, Olli; Aarno, Palotie; Kurki, Mitja I; Hoischen, Alexander; Need, Anna C; Goldstein, David B; Kortüm, Fanny

2016-10-06

The ASXL genes (ASXL1, ASXL2, and ASXL3) participate in body patterning during embryogenesis and encode proteins involved in epigenetic regulation and assembly of transcription factors to specific genomic loci. Germline de novo truncating variants in ASXL1 and ASXL3 have been respectively implicated in causing Bohring-Opitz and Bainbridge-Ropers syndromes, which result in overlapping features of severe intellectual disability and dysmorphic features. ASXL2 has not yet been associated with a human Mendelian disorder. In this study, we performed whole-exome sequencing in six unrelated probands with developmental delay, macrocephaly, and dysmorphic features. All six had de novo truncating variants in ASXL2. A careful review enabled the recognition of a specific phenotype consisting of macrocephaly, prominent eyes, arched eyebrows, hypertelorism, a glabellar nevus flammeus, neonatal feeding difficulties, hypotonia, and developmental disabilities. Although overlapping features with Bohring-Opitz and Bainbridge-Ropers syndromes exist, features that distinguish the ASXL2-associated condition from ASXL1- and ASXL3-related disorders are macrocephaly, absence of growth retardation, and more variability in the degree of intellectual disabilities. We were also able to demonstrate with mRNA studies that these variants are likely to exert a dominant-negative effect, given that both alleles are expressed in blood and the mutated ASXL2 transcripts escape nonsense-mediated decay. In conclusion, de novo truncating variants in ASXL2 underlie a neurodevelopmental syndrome with a clinically recognizable phenotype. This report expands the germline disorders that are linked to the ASXL genes. Copyright © 2016. Published by Elsevier Inc.

Neural correlates of incidental memory in mild cognitive impairment: an fMRI study.

PubMed

Mandzia, Jennifer L; McAndrews, Mary Pat; Grady, Cheryl L; Graham, Simon J; Black, Sandra E

2009-05-01

Behaviour and fMRI brain activation patterns were compared during encoding and recognition tasks in mild cognitive impairment (MCI) (n=14) and normal controls (NC) (n=14). Deep (natural vs. man-made) and shallow (color vs. black and white) decisions were made at encoding and pictures from each condition were presented for yes/no recognition 20 min later. MCI showed less inferior frontal activation during deep (left only) and superficial encoding (bilaterally) and in both medial temporal lobes (MTL). When performance was equivalent (recognition of words encoded superficially), MTL activation was similar for the two groups, but during recognition testing of deeply encoded items NC showed more activation in both prefrontal and left MTL region. In a region of interest analysis, the extent of activation during deep encoding in the parahippocampi bilaterally and in left hippocampus correlated with subsequent recognition accuracy for those items in controls but not in MCI, which may reflect the heterogeneity of activation responses in conjunction with different degrees of pathology burden and progression status in the MCI group.

Encoding-related brain activity dissociates between the recollective processes underlying successful recall and recognition: a subsequent-memory study.

PubMed

Sadeh, Talya; Maril, Anat; Goshen-Gottstein, Yonatan

2012-07-01

The subsequent-memory (SM) paradigm uncovers brain mechanisms that are associated with mnemonic activity during encoding by measuring participants' neural activity during encoding and classifying the encoding trials according to performance in the subsequent retrieval phase. The majority of these studies have converged on the notion that the mechanism supporting recognition is mediated by familiarity and recollection. The process of recollection is often assumed to be a recall-like process, implying that the active search for the memory trace is similar, if not identical, for recall and recognition. Here we challenge this assumption and hypothesize - based on previous findings obtained in our lab - that the recollective processes underlying recall and recognition might show dissociative patterns of encoding-related brain activity. To this end, our design controlled for familiarity, thereby focusing on contextual, recollective processes. We found evidence for dissociative neurocognitive encoding mechanisms supporting subsequent-recall and subsequent-recognition. Specifically, the contrast of subsequent-recognition versus subsequent-recall revealed activation in the Parahippocampal cortex (PHc) and the posterior hippocampus--regions associated with contextual processing. Implications of our findings and their relation to current cognitive models of recollection are discussed. Copyright © 2012 Elsevier Ltd. All rights reserved.

The effect of encoding strategy on the neural correlates of memory for faces.

PubMed

Bernstein, Lori J; Beig, Sania; Siegenthaler, Amy L; Grady, Cheryl L

2002-01-01

Encoding and recognition of unfamiliar faces in young adults were examined using positron emission tomography to determine whether different encoding strategies would lead to encoding/retrieval differences in brain activity. Three types of encoding were compared: a 'deep' task (judging pleasantness/unpleasantness), a 'shallow' task (judging right/left orientation), and an intentional learning task in which subjects were instructed to learn the faces for a subsequent memory test but were not provided with a specific strategy. Memory for all faces was tested with an old/new recognition test. A modest behavioral effect was obtained, with deeply-encoded faces being recognized more accurately than shallowly-encoded or intentionally-learned faces. Regardless of encoding strategy, encoding activated a primarily ventral system including bilateral temporal and fusiform regions and left prefrontal cortices, whereas recognition activated a primarily dorsal set of regions including right prefrontal and parietal areas. Within encoding, the type of strategy produced different brain activity patterns, with deep encoding being characterized by left amygdala and left anterior cingulate activation. There was no effect of encoding strategy on brain activity during the recognition conditions. Posterior fusiform gyrus activation was related to better recognition accuracy in those conditions encouraging perceptual strategies, whereas activity in left frontal and temporal areas correlated with better performance during the 'deep' condition. Results highlight three important aspects of face memory: (1) the effect of encoding strategy was seen only at encoding and not at recognition; (2) left inferior prefrontal cortex was engaged during encoding of faces regardless of strategy; and (3) differential activity in fusiform gyrus was found, suggesting that activity in this area is not only a result of automatic face processing but is modulated by controlled processes.

The Psychophysics of Algebra Expertise: Mathematics Perceptual Learning Interventions Produce Durable Encoding Changes

ERIC Educational Resources Information Center

Bufford, Carolyn A.; Mettler, Everett; Geller, Emma H.; Kellman, Philip J.

2014-01-01

Mathematics requires thinking but also pattern recognition. Recent research indicates that perceptual learning (PL) interventions facilitate discovery of structure and recognition of patterns in mathematical domains, as assessed by tests of mathematical competence. Here we sought direct evidence that a brief perceptual learning module (PLM)…

Colon and Endometrial Cancers with Mismatch Repair Deficiency can Arise from Somatic, Rather Than Germline, Mutations

PubMed Central

Haraldsdottir, Sigurdis; Hampel, Heather; Tomsic, Jerneja; Frankel, Wendy L.; Pearlman, Rachel; de la Chapelle, Albert; Pritchard, Colin C.

2014-01-01

Background & Aims Patients with Lynch syndrome carry germline mutations in single alleles of genes encoding the MMR proteins MLH1, MSH2, MSH6 and PMS2; when the second allele becomes mutated, cancer can develop. Increased screening for Lynch syndrome has identified patients with tumors that have deficiency in MMR, but no germline mutations in genes encoding MMR proteins. We investigated whether tumors with deficient MMR had acquired somatic mutations in patients without germline mutations in MMR genes using next-generation sequencing. Methods We analyzed blood and tumor samples from 32 patients with colorectal or endometrial cancer who participated in Lynch syndrome screening studies in Ohio and were found to have tumors with MMR deficiency (based on microsatellite instability and/or absence of MMR proteins in immunohistochemical analysis, without hypermethylation of MLH1), but no germline mutations in MMR genes. Tumor DNA was sequenced for MLH1, MSH2, MSH6, PMS2, EPCAM, POLE and POLD1 with ColoSeq and mutation frequencies were established. Results Twenty-two of 32 patients (69%) were found to have two somatic (tumor) mutations in MMR genes encoding proteins that were lost from tumor samples, based on immunohistochemistry. Of the 10 tumors without somatic mutations in MMR genes, 3 had somatic mutations with possible loss of heterozygosity that could lead to MMR deficiency, 6 were found to be false-positive results (19%), and 1 had no mutations known to be associated with MMR deficiency. All of the tumors found to have somatic MMR mutations were of the hypermutated phenotype (>12 mutations/Mb); 6 had mutation frequencies >200 per Mb, and 5 of these had somatic mutations in POLE, which encodes a DNA polymerase. Conclusions Some patients are found to have tumors with MMR deficiency during screening for Lynch syndrome, yet have no identifiable germline mutations in MMR genes. We found that almost 70% of these patients acquire somatic mutations in MMR genes, leading to a hypermutated phenotype of tumor cells. Patients with colon or endometrial cancers with MMR deficiency not explained by germline mutations might undergo analysis for tumor mutations in MMR genes, to guide future surveillance guidelines. PMID:25194673

T cell receptor alpha variable 12-2 bias in the immunodominant response to Yellow fever virus.

PubMed

Bovay, Amandine; Zoete, Vincent; Dolton, Garry; Bulek, Anna M; Cole, David K; Rizkallah, Pierre J; Fuller, Anna; Beck, Konrad; Michielin, Olivier; Speiser, Daniel E; Sewell, Andrew K; Fuertes Marraco, Silvia A

2018-02-01

The repertoire of human αβ T-cell receptors (TCRs) is generated via somatic recombination of germline gene segments. Despite this enormous variation, certain epitopes can be immunodominant, associated with high frequencies of antigen-specific T cells and/or exhibit bias toward a TCR gene segment. Here, we studied the TCR repertoire of the HLA-A*0201-restricted epitope LLWNGPMAV (hereafter, A2/LLW) from Yellow Fever virus, which generates an immunodominant CD8 + T cell response to the highly effective YF-17D vaccine. We discover that these A2/LLW-specific CD8 + T cells are highly biased for the TCR α chain TRAV12-2. This bias is already present in A2/LLW-specific naïve T cells before vaccination with YF-17D. Using CD8 + T cell clones, we show that TRAV12-2 does not confer a functional advantage on a per cell basis. Molecular modeling indicated that the germline-encoded complementarity determining region (CDR) 1α loop of TRAV12-2 critically contributes to A2/LLW binding, in contrast to the conventional dominant dependence on somatically rearranged CDR3 loops. This germline component of antigen recognition may explain the unusually high precursor frequency, prevalence and immunodominance of T-cell responses specific for the A2/LLW epitope. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Pattern-Recognition Receptors and Gastric Cancer

PubMed Central

Castaño-Rodríguez, Natalia; Kaakoush, Nadeem O.; Mitchell, Hazel M.

2014-01-01

Chronic inflammation has been associated with an increased risk of several human malignancies, a classic example being gastric adenocarcinoma (GC). Development of GC is known to result from infection of the gastric mucosa by Helicobacter pylori, which initially induces acute inflammation and, in a subset of patients, progresses over time to chronic inflammation, gastric atrophy, intestinal metaplasia, dysplasia, and finally intestinal-type GC. Germ-line encoded receptors known as pattern-recognition receptors (PRRs) are critical for generating mature pro-inflammatory cytokines that are crucial for both Th1 and Th2 responses. Given that H. pylori is initially targeted by PRRs, it is conceivable that dysfunction within genes of this arm of the immune system could modulate the host response against H. pylori infection, and subsequently influence the emergence of GC. Current evidence suggests that Toll-like receptors (TLRs) (TLR2, TLR3, TLR4, TLR5, and TLR9), nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs) (NOD1, NOD2, and NLRP3), a C-type lectin receptor (DC-SIGN), and retinoic acid-inducible gene (RIG)-I-like receptors (RIG-I and MDA-5), are involved in both the recognition of H. pylori and gastric carcinogenesis. In addition, polymorphisms in genes involved in the TLR (TLR1, TLR2, TLR4, TLR5, TLR9, and CD14) and NLR (NOD1, NOD2, NLRP3, NLRP12, NLRX1, CASP1, ASC, and CARD8) signaling pathways have been shown to modulate the risk of H. pylori infection, gastric precancerous lesions, and/or GC. Further, the modulation of PRRs has been suggested to suppress H. pylori-induced inflammation and enhance GC cell apoptosis, highlighting their potential relevance in GC therapeutics. In this review, we present current advances in our understanding of the role of the TLR and NLR signaling pathways in the pathogenesis of GC, address the involvement of other recently identified PRRs in GC, and discuss the potential implications of PRRs in GC immunotherapy. PMID:25101079

A hobo transgene that encodes the P-element transposase in Drosophila melanogaster: autoregulation and cytotype control of transposase activity.

PubMed Central

Simmons, Michael J; Haley, Kevin J; Grimes, Craig D; Raymond, John D; Niemi, Jarad B

2002-01-01

Drosophila were genetically transformed with a hobo transgene that contains a terminally truncated but otherwise complete P element fused to the promoter from the Drosophila hsp70 gene. Insertions of this H(hsp/CP) transgene on either of the major autosomes produced the P transposase in both the male and female germlines, but not in the soma. Heat-shock treatments significantly increased transposase activity in the female germline; in the male germline, these treatments had little effect. The transposase activity of two insertions of the H(hsp/CP) transgene was not significantly greater than their separate activities, and one insertion of this transgene reduced the transposase activity of P(ry(+), Delta2-3)99B, a stable P transgene, in the germline as well as in the soma. These observations suggest that, through alternate splicing, the H(hsp/CP) transgene produces a repressor that feeds back negatively to regulate transposase expression or function in both the somatic and germline tissues. The H(hsp/CP) transgenes are able to induce gonadal dysgenesis when the transposase they encode has P-element targets to attack. However, this ability and the ability to induce P-element excisions are repressed by the P cytotype, a chromosomal/cytoplasmic state that regulates P elements in the germline. PMID:12019234

Study and response time for the visual recognition of 'similarity' and identity

NASA Technical Reports Server (NTRS)

Derks, P. L.; Bauer, T. M.

1974-01-01

Four subjects compared successively presented pairs of line patterns for a match between any lines in the pattern (similarity) and for a match between all lines (identity). The encoding or study times for pattern recognition from immediate memory and the latency in responses to comparison stimuli were examined. Qualitative differences within and between subjects were most evident in study times.

Rapidly Evolving Toll-3/4 Genes Encode Male-Specific Toll-Like Receptors in Drosophila.

PubMed

Levin, Tera C; Malik, Harmit S

2017-09-01

Animal Toll-like receptors (TLRs) have evolved through a pattern of duplication and divergence. Whereas mammalian TLRs directly recognize microbial ligands, Drosophila Tolls bind endogenous ligands downstream of both developmental and immune signaling cascades. Here, we find that most Toll genes in Drosophila evolve slowly with little gene turnover (gains/losses), consistent with their important roles in development and indirect roles in microbial recognition. In contrast, we find that the Toll-3/4 genes have experienced an unusually rapid rate of gene gains and losses, resulting in lineage-specific Toll-3/4s and vastly different gene repertoires among Drosophila species, from zero copies (e.g., D. mojavensis) to nineteen copies (e.g., D. willistoni). In D. willistoni, we find strong evidence for positive selection in Toll-3/4 genes, localized specifically to an extracellular region predicted to overlap with the binding site of Spätzle, the only known ligand of insect Tolls. However, because Spätzle genes are not experiencing similar selective pressures, we hypothesize that Toll-3/4s may be rapidly evolving because they bind to a different ligand, akin to TLRs outside of insects. We further find that most Drosophila Toll-3/4 genes are either weakly expressed or expressed exclusively in males, specifically in the germline. Unlike other Toll genes in D. melanogaster, Toll-3, and Toll-4 have apparently escaped from essential developmental roles, as knockdowns have no substantial effects on viability or male fertility. Based on these findings, we propose that the Toll-3/4 genes represent an exceptionally rapidly evolving lineage of Drosophila Toll genes, which play an unusual, as-yet-undiscovered role in the male germline. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Rapidly Evolving Toll-3/4 Genes Encode Male-Specific Toll-Like Receptors in Drosophila

PubMed Central

Levin, Tera C.; Malik, Harmit S.

2017-01-01

Abstract Animal Toll-like receptors (TLRs) have evolved through a pattern of duplication and divergence. Whereas mammalian TLRs directly recognize microbial ligands, Drosophila Tolls bind endogenous ligands downstream of both developmental and immune signaling cascades. Here, we find that most Toll genes in Drosophila evolve slowly with little gene turnover (gains/losses), consistent with their important roles in development and indirect roles in microbial recognition. In contrast, we find that the Toll-3/4 genes have experienced an unusually rapid rate of gene gains and losses, resulting in lineage-specific Toll-3/4s and vastly different gene repertoires among Drosophila species, from zero copies (e.g., D. mojavensis) to nineteen copies (e.g., D. willistoni). In D. willistoni, we find strong evidence for positive selection in Toll-3/4 genes, localized specifically to an extracellular region predicted to overlap with the binding site of Spätzle, the only known ligand of insect Tolls. However, because Spätzle genes are not experiencing similar selective pressures, we hypothesize that Toll-3/4s may be rapidly evolving because they bind to a different ligand, akin to TLRs outside of insects. We further find that most Drosophila Toll-3/4 genes are either weakly expressed or expressed exclusively in males, specifically in the germline. Unlike other Toll genes in D. melanogaster, Toll-3, and Toll-4 have apparently escaped from essential developmental roles, as knockdowns have no substantial effects on viability or male fertility. Based on these findings, we propose that the Toll-3/4 genes represent an exceptionally rapidly evolving lineage of Drosophila Toll genes, which play an unusual, as-yet-undiscovered role in the male germline. PMID:28541576

Cognitive and Neural Effects of Semantic Encoding Strategy Training in Older Adults

PubMed Central

Anderson, B. A.; Barch, D. M.; Jacoby, L. L.

2012-01-01

Prior research suggests that older adults are less likely than young adults to use effective learning strategies during intentional encoding. This functional magnetic resonance imaging (fMRI) study investigated whether training older adults to use semantic encoding strategies can increase their self-initiated use of these strategies and improve their recognition memory. The effects of training on older adults' brain activity during intentional encoding were also examined. Training increased older adults' self-initiated semantic encoding strategy use and eliminated pretraining age differences in recognition memory following intentional encoding. Training also increased older adults' brain activity in the medial superior frontal gyrus, right precentral gyrus, and left caudate during intentional encoding. In addition, older adults' training-related changes in recognition memory were strongly correlated with training-related changes in brain activity in prefrontal and left lateral temporal regions associated with semantic processing and self-initiated verbal encoding strategy use in young adults. These neuroimaging results demonstrate that semantic encoding strategy training can alter older adults' brain activity patterns during intentional encoding and suggest that young and older adults may use the same network of brain regions to support self-initiated use of verbal encoding strategies. PMID:21709173

Germline V repertoires: Origin, maintenance, diversification.

PubMed

Steele, E J; Lindley, R A

2018-06-01

In our view, Melvin Cohn (Scand J Immunol. 2018;87:e12640) has set out the logical guidelines towards a resolution of the very real enigma of the selectability of vertebrate germline Ig V repertoires under the current evolutionary paradigm…" A somatically derived repertoire scrambles this (germline VL + VH) substrate so that its specificities are lost, making it un-selectable in the germline. Consequently, evolution faced an incompatibility." It is argued here in Reply that a reverse transcriptase-based soma-to-germline process (S->G) targeting germline V segment arrays goes some considerable way to resolving fundamental contradictions on the origin, maintenance and then real-time adaptive diversification of these limited sets of V segments encoded within various V repertoire arrays. © 2018 The Foundation for the Scandinavian Journal of Immunology.

Event-related Potentials Reveal Age Differences in the Encoding and Recognition of Scenes

PubMed Central

Gutchess, Angela H.; Ieuji, Yoko; Federmeier, Kara D.

2009-01-01

The present study used event-related potentials (ERPs) to investigate how the encoding and recognition of complex scenes change with normal aging. Although functional magnetic resonance imaging (fMRI) studies have identified more drastic age impairments at encoding than at recognition, ERP studies accumulate more evidence for age differences at retrieval. However, stimulus type and paradigm differences across the two literatures have made direct comparisons difficult. Here, we collected young and elderly adults’ encoding- and recognition-phase ERPs using the same materials and paradigm as a previous fMRI study. Twenty young and 20 elderly adults incidentally encoded and then recognized photographs of outdoor scenes. During encoding, young adults showed a frontocentral subsequent memory effect, with high-confidence hits exhibiting greater positivity than misses. Elderly adults showed a similar subsequent memory effect, which, however, did not differ as a function of confidence. During recognition, young adults elicited a widespread old/new effect, and high-confidence hits were distinct from both low-confidence hits and false alarms. Elderly adults elicited a smaller and later old/new effect, which was unaffected by confidence, and hits and false alarms were indistinguishable in the waveforms. Consistent with prior ERP work, these results point to important age-related changes in recognition-phase brain activity, even when behavioral measures of memory and confidence pattern similarly across groups. We speculate that memory processes with different time signatures contribute to the apparent differences across encoding and retrieval stages, and across methods. PMID:17583986

Recognition without Awareness: Encoding and Retrieval Factors

ERIC Educational Resources Information Center

Craik, Fergus I. M.; Rose, Nathan S.; Gopie, Nigel

2015-01-01

The article reports 4 experiments that explore the notion of recognition without awareness using words as the material. Previous work by Voss and associates has shown that complex visual patterns were correctly selected as targets in a 2-alternative forced-choice (2-AFC) recognition test although participants reported that they were guessing. The…

How color enhances visual memory for natural scenes.

PubMed

Spence, Ian; Wong, Patrick; Rusan, Maria; Rastegar, Naghmeh

2006-01-01

We offer a framework for understanding how color operates to improve visual memory for images of the natural environment, and we present an extensive data set that quantifies the contribution of color in the encoding and recognition phases. Using a continuous recognition task with colored and monochrome gray-scale images of natural scenes at short exposure durations, we found that color enhances recognition memory by conferring an advantage during encoding and by strengthening the encoding-specificity effect. Furthermore, because the pattern of performance was similar at all exposure durations, and because form and color are processed in different areas of cortex, the results imply that color must be bound as an integral part of the representation at the earliest stages of processing.

Structures of Preferred Human IgV Genes-Based Protective Antibodies Identify How Conserved Residues Contact Diverse Antigens and Assign Source of Specificity to CDR3 Loop Variation.

PubMed

Bryson, Steve; Thomson, Christy A; Risnes, Louise F; Dasgupta, Somnath; Smith, Kenneth; Schrader, John W; Pai, Emil F

2016-06-01

The human Ab response to certain pathogens is oligoclonal, with preferred IgV genes being used more frequently than others. A pair of such preferred genes, IGVK3-11 and IGVH3-30, contributes to the generation of protective Abs directed against the 23F serotype of the pneumonococcal capsular polysaccharide of Streptococcus pneumoniae and against the AD-2S1 peptide of the gB membrane protein of human CMV. Structural analyses of Fab fragments of mAbs 023.102 and pn132p2C05 in complex with portions of the 23F polysaccharide revealed five germline-encoded residues in contact with the key component, l-rhamnose. In the case of the AD-2S1 peptide, the KE5 Fab fragment complex identified nine germline-encoded contact residues. Two of these germline-encoded residues, Arg91L and Trp94L, contact both the l-rhamnose and the AD-2S1 peptide. Comparison of the respective paratopes that bind to carbohydrate and protein reveals that stochastic diversity in both CDR3 loops alone almost exclusively accounts for their divergent specificity. Combined evolutionary pressure by human CMV and the 23F serotype of S. pneumoniae acted on the IGVK3-11 and IGVH3-30 genes as demonstrated by the multiple germline-encoded amino acids that contact both l-rhamnose and AD-2S1 peptide. Copyright © 2016 by The American Association of Immunologists, Inc.

Restricted utilization of germ-line VH genes in rabbits: implications for inheritance of VH allotypes and generation of antibody diversity.

PubMed

Knight, K L; Becker, R S; DiPietro, L A

1991-01-01

The presence of inherited VH region allotypic specificities, a1, a2 or a3, on nearly all rabbit immunoglobulins has presented a paradox. We know the germline contains hundreds of VH genes, and if we assume that most of these are used in the generation of antibody diversity, then we must ask how have the a allotype-encoding regions been maintained over time? On the other hand, if we assume that only one (or a small number) of these VH gene(s) is (are) used in VDJ gene rearrangements, then, how is antibody diversity generated? To address these questions, we have cloned and determined the nucleotide sequence of the 3'-most germline VH genes from the a1, a2 and a3 chromosomes and shown in each case that the 3'-most H gene, VH1-a1, VH1-a2, or VH1-a3, encodes an a1, a2 or a3 VH region, respectively. Analysis of rearranged VDJ genes from leukemic B cells showed that VH1 was utilized in these rearrangements. Based on these data, we propose that the allelic inheritance of the VH allotypes is explained by the preferential usage of the VH1 gene in VDJ rearrangements. Support for this hypothesis was obtained from analysis of the mutant rabbit Alicia in which most serum Ig molecules do not have VHa allotypic specificities, but instead have so-called VHa-negative Ig molecules. In this rabbit, VH1 is not expressed as it has been deleted. Analysis of cDNA clones from spleen of Alicia rabbits suggests that the expressed VHa-negative molecules also are encoded by a single germline VH gene. Thus, we suggest that nearly all rabbit VH regions are encoded by one to two germline VH genes and that antibody diversity is generated primarily by somatic hypermutation and gene conversion.

Germline-encoded neutralization of a Staphylococcus aureus virulence factor by the human antibody repertoire.

PubMed

Yeung, Yik Andy; Foletti, Davide; Deng, Xiaodi; Abdiche, Yasmina; Strop, Pavel; Glanville, Jacob; Pitts, Steven; Lindquist, Kevin; Sundar, Purnima D; Sirota, Marina; Hasa-Moreno, Adela; Pham, Amber; Melton Witt, Jody; Ni, Irene; Pons, Jaume; Shelton, David; Rajpal, Arvind; Chaparro-Riggers, Javier

2016-11-18

Staphylococcus aureus is both an important pathogen and a human commensal. To explore this ambivalent relationship between host and microbe, we analysed the memory humoral response against IsdB, a protein involved in iron acquisition, in four healthy donors. Here we show that in all donors a heavily biased use of two immunoglobulin heavy chain germlines generated high affinity (pM) antibodies that neutralize the two IsdB NEAT domains, IGHV4-39 for NEAT1 and IGHV1-69 for NEAT2. In contrast to the typical antibody/antigen interactions, the binding is primarily driven by the germline-encoded hydrophobic CDRH-2 motifs of IGHV1-69 and IGHV4-39, with a binding mechanism nearly identical for each antibody derived from different donors. Our results suggest that IGHV1-69 and IGHV4-39, while part of the adaptive immune system, may have evolved under selection pressure to encode a binding motif innately capable of recognizing and neutralizing a structurally conserved protein domain involved in pathogen iron acquisition.

Wavelet filtered shifted phase-encoded joint transform correlation for face recognition

NASA Astrophysics Data System (ADS)

Moniruzzaman, Md.; Alam, Mohammad S.

2017-05-01

A new wavelet-filtered-based Shifted- phase-encoded Joint Transform Correlation (WPJTC) technique has been proposed for efficient face recognition. The proposed technique uses discrete wavelet decomposition for preprocessing and can effectively accommodate various 3D facial distortions, effects of noise, and illumination variations. After analyzing different forms of wavelet basis functions, an optimal method has been proposed by considering the discrimination capability and processing speed as performance trade-offs. The proposed technique yields better correlation discrimination compared to alternate pattern recognition techniques such as phase-shifted phase-encoded fringe-adjusted joint transform correlator. The performance of the proposed WPJTC has been tested using the Yale facial database and extended Yale facial database under different environments such as illumination variation, noise, and 3D changes in facial expressions. Test results show that the proposed WPJTC yields better performance compared to alternate JTC based face recognition techniques.

HIV-1 gp140 epitope recognition is influenced by immunoglobulin DH gene segment sequence

PubMed Central

Wang, Yuge; Kapoor, Pratibha; Parks, Robert; Silva-Sanchez, Aaron; Alam, S. Munir; Verkoczy, Laurent; Liao, Hua-Xin; Zhuang, Yingxin; Burrows, Peter; Levinson, Michael; Elgavish, Ada; Cui, Xiangqin; Haynes, Barton F.; Schroeder, Harry

2015-01-01

Complementarity determining region 3 of the immunoglobulin (Ig) H chain (CDR-H3) lies at the center of the antigen binding site where it often plays a decisive role in antigen recognition and binding. Amino acids encoded by the diversity (DH) gene segment are the main component of CDR-H3. Each DH has the potential to rearrange into one of six DH reading frames (RFs), each of which exhibits a characteristic amino acid hydrophobicity signature that has been conserved among jawed vertebrates by natural selection. A preference for use of RF1 promotes the incorporation of tyrosine into CDR-H3 while suppressing the inclusion of hydrophobic or charged amino acids. To test the hypothesis that these evolutionary constraints on DH sequence influence epitope recognition, we used mice with a single DH that has been altered to preferentially use RF2 or inverted RF1. B cells in these mice produce a CDR-H3 repertoire that is enriched for valine or arginine in place of tyrosine. We serially immunized this panel of mice with gp140 from HIV-1 JR-FL isolate and then used ELISA or peptide microarray to assess antibody binding to key or overlapping HIV-1 envelope epitopes. By ELISA, serum reactivity to key epitopes varied by DH sequence. By microarray, sera with Ig CDR-H3s enriched for arginine bound to linear peptides with a greater range of hydrophobicity, but had a lower intensity of binding than sera containing Ig CDR-H3s enriched for tyrosine or valine. We conclude that patterns of epitope recognition and binding can be heavily influenced by DH germline sequence. This may help explain why antibodies in HIV infected patients must undergo extensive somatic mutation in order to bind to specific viral epitopes and achieve neutralization. PMID:26687685

Method and apparatus for optical encoding with compressible imaging

NASA Technical Reports Server (NTRS)

Leviton, Douglas B. (Inventor)

2006-01-01

The present invention presents an optical encoder with increased conversion rates. Improvement in the conversion rate is a result of combining changes in the pattern recognition encoder's scale pattern with an image sensor readout technique which takes full advantage of those changes, and lends itself to operation by modern, high-speed, ultra-compact microprocessors and digital signal processors (DSP) or field programmable gate array (FPGA) logic elements which can process encoder scale images at the highest speeds. Through these improvements, all three components of conversion time (reciprocal conversion rate)--namely exposure time, image readout time, and image processing time--are minimized.

Automatic speech recognition research at NASA-Ames Research Center

NASA Technical Reports Server (NTRS)

Coler, Clayton R.; Plummer, Robert P.; Huff, Edward M.; Hitchcock, Myron H.

1977-01-01

A trainable acoustic pattern recognizer manufactured by Scope Electronics is presented. The voice command system VCS encodes speech by sampling 16 bandpass filters with center frequencies in the range from 200 to 5000 Hz. Variations in speaking rate are compensated for by a compression algorithm that subdivides each utterance into eight subintervals in such a way that the amount of spectral change within each subinterval is the same. The recorded filter values within each subinterval are then reduced to a 15-bit representation, giving a 120-bit encoding for each utterance. The VCS incorporates a simple recognition algorithm that utilizes five training samples of each word in a vocabulary of up to 24 words. The recognition rate of approximately 85 percent correct for untrained speakers and 94 percent correct for trained speakers was not considered adequate for flight systems use. Therefore, the built-in recognition algorithm was disabled, and the VCS was modified to transmit 120-bit encodings to an external computer for recognition.

Binary patterns encoded convolutional neural networks for texture recognition and remote sensing scene classification

NASA Astrophysics Data System (ADS)

Anwer, Rao Muhammad; Khan, Fahad Shahbaz; van de Weijer, Joost; Molinier, Matthieu; Laaksonen, Jorma

2018-04-01

Designing discriminative powerful texture features robust to realistic imaging conditions is a challenging computer vision problem with many applications, including material recognition and analysis of satellite or aerial imagery. In the past, most texture description approaches were based on dense orderless statistical distribution of local features. However, most recent approaches to texture recognition and remote sensing scene classification are based on Convolutional Neural Networks (CNNs). The de facto practice when learning these CNN models is to use RGB patches as input with training performed on large amounts of labeled data (ImageNet). In this paper, we show that Local Binary Patterns (LBP) encoded CNN models, codenamed TEX-Nets, trained using mapped coded images with explicit LBP based texture information provide complementary information to the standard RGB deep models. Additionally, two deep architectures, namely early and late fusion, are investigated to combine the texture and color information. To the best of our knowledge, we are the first to investigate Binary Patterns encoded CNNs and different deep network fusion architectures for texture recognition and remote sensing scene classification. We perform comprehensive experiments on four texture recognition datasets and four remote sensing scene classification benchmarks: UC-Merced with 21 scene categories, WHU-RS19 with 19 scene classes, RSSCN7 with 7 categories and the recently introduced large scale aerial image dataset (AID) with 30 aerial scene types. We demonstrate that TEX-Nets provide complementary information to standard RGB deep model of the same network architecture. Our late fusion TEX-Net architecture always improves the overall performance compared to the standard RGB network on both recognition problems. Furthermore, our final combination leads to consistent improvement over the state-of-the-art for remote sensing scene classification.

The effects of age on the neural correlates of episodic encoding.

PubMed

Grady, C L; McIntosh, A R; Rajah, M N; Beig, S; Craik, F I

1999-12-01

Young and old adults underwent positron emission tomographic scans while encoding pictures of objects and words using three encoding strategies: deep processing (a semantic living/nonliving judgement), shallow processing (size judgement) and intentional learning. Picture memory exceeded word memory in both young and old groups, and there was an age-related decrement only in word recognition. During the encoding tasks three brain activity patterns were found that differentiated stimulus type and the different encoding strategies. The stimulus-specific pattern was characterized by greater activity in extrastriate and medial temporal cortices during picture encoding, and greater activity in left prefrontal and temporal cortices during encoding of words. The older adults showed this pattern to a significantly lesser degree. A pattern distinguishing deep processing from intentional learning of words and pictures was identified, characterized mainly by differences in prefrontal cortex, and this pattern also was of significantly lesser magnitude in the old group. A final pattern identified areas with increased activity during deep processing and intentional learning of pictures, including left prefrontal and bilateral medial temporal regions. There was no group difference in this pattern. These results indicate age-related dysfunction in several encoding networks, with sparing of one specifically involved in more elaborate encoding of pictures. These age-related changes appear to affect verbal memory more than picture memory.

Genotype and phenotype spectrum of NRAS germline variants.

PubMed

Altmüller, Franziska; Lissewski, Christina; Bertola, Debora; Flex, Elisabetta; Stark, Zornitza; Spranger, Stephanie; Baynam, Gareth; Buscarilli, Michelle; Dyack, Sarah; Gillis, Jane; Yntema, Helger G; Pantaleoni, Francesca; van Loon, Rosa LE; MacKay, Sara; Mina, Kym; Schanze, Ina; Tan, Tiong Yang; Walsh, Maie; White, Susan M; Niewisch, Marena R; García-Miñaúr, Sixto; Plaza, Diego; Ahmadian, Mohammad Reza; Cavé, Hélène; Tartaglia, Marco; Zenker, Martin

2017-06-01

RASopathies comprise a group of disorders clinically characterized by short stature, heart defects, facial dysmorphism, and varying degrees of intellectual disability and cancer predisposition. They are caused by germline variants in genes encoding key components or modulators of the highly conserved RAS-MAPK signalling pathway that lead to dysregulation of cell signal transmission. Germline changes in the genes encoding members of the RAS subfamily of GTPases are rare and associated with variable phenotypes of the RASopathy spectrum, ranging from Costello syndrome (HRAS variants) to Noonan and Cardiofaciocutaneous syndromes (KRAS variants). A small number of RASopathy cases with disease-causing germline NRAS alterations have been reported. Affected individuals exhibited features fitting Noonan syndrome, and the observed germline variants differed from the typical oncogenic NRAS changes occurring as somatic events in tumours. Here we describe 19 new cases with RASopathy due to disease-causing variants in NRAS. Importantly, four of them harbored missense changes affecting Gly12, which was previously described to occur exclusively in cancer. The phenotype in our cohort was variable but well within the RASopathy spectrum. Further, one of the patients (c.35G>A; p.(Gly12Asp)) had a myeloproliferative disorder, and one subject (c.34G>C; p.(Gly12Arg)) exhibited an uncharacterized brain tumour. With this report, we expand the genotype and phenotype spectrum of RASopathy-associated germline NRAS variants and provide evidence that NRAS variants do not spare the cancer-associated mutation hotspots.

Pattern recognition of electronic bit-sequences using a semiconductor mode-locked laser and spatial light modulators

NASA Astrophysics Data System (ADS)

Bhooplapur, Sharad; Akbulut, Mehmetkan; Quinlan, Franklyn; Delfyett, Peter J.

2010-04-01

A novel scheme for recognition of electronic bit-sequences is demonstrated. Two electronic bit-sequences that are to be compared are each mapped to a unique code from a set of Walsh-Hadamard codes. The codes are then encoded in parallel on the spectral phase of the frequency comb lines from a frequency-stabilized mode-locked semiconductor laser. Phase encoding is achieved by using two independent spatial light modulators based on liquid crystal arrays. Encoded pulses are compared using interferometric pulse detection and differential balanced photodetection. Orthogonal codes eight bits long are compared, and matched codes are successfully distinguished from mismatched codes with very low error rates, of around 10-18. This technique has potential for high-speed, high accuracy recognition of bit-sequences, with applications in keyword searches and internet protocol packet routing.

Sex-lethal enables germline stem cell differentiation by down-regulating Nanos protein levels during Drosophila oogenesis

PubMed Central

Chau, Johnnie; Kulnane, Laura Shapiro; Salz, Helen K.

2012-01-01

Drosophila ovarian germ cells require Sex-lethal (Sxl) to exit from the stem cell state and to enter the differentiation pathway. Sxl encodes a female-specific RNA binding protein and in somatic cells serves as the developmental switch gene for somatic sex determination and X-chromosome dosage compensation. None of the known Sxl target genes are required for germline differentiation, leaving open the question of how Sxl promotes the transition from stem cell to committed daughter cell. We address the mechanism by which Sxl regulates this transition through the identification of nanos as one of its target genes. Previous studies have shown that Nanos protein is necessary for GSC self-renewal and is rapidly down-regulated in the daughter cells fated to differentiate in the adult ovary. We find that this dynamic expression pattern is limited to female germ cells and is under Sxl control. In the absence of Sxl, or in male germ cells, Nanos protein is continuously expressed. Furthermore, this female-specific expression pattern is dependent on the presence of canonical Sxl binding sites located in the nanos 3′ untranslated region. These results, combined with the observation that nanos RNA associates with the Sxl protein in ovarian extracts and loss and gain of function studies, suggest that Sxl enables the switch from germline stem cell to committed daughter cell by posttranscriptional down-regulation of nanos expression. These findings connect sexual identity to the stem cell self-renewal/differentiation decision and highlight the importance of posttranscriptional gene regulatory networks in controlling stem cell behavior. PMID:22645327

Sex-lethal enables germline stem cell differentiation by down-regulating Nanos protein levels during Drosophila oogenesis.

PubMed

Chau, Johnnie; Kulnane, Laura Shapiro; Salz, Helen K

2012-06-12

Drosophila ovarian germ cells require Sex-lethal (Sxl) to exit from the stem cell state and to enter the differentiation pathway. Sxl encodes a female-specific RNA binding protein and in somatic cells serves as the developmental switch gene for somatic sex determination and X-chromosome dosage compensation. None of the known Sxl target genes are required for germline differentiation, leaving open the question of how Sxl promotes the transition from stem cell to committed daughter cell. We address the mechanism by which Sxl regulates this transition through the identification of nanos as one of its target genes. Previous studies have shown that Nanos protein is necessary for GSC self-renewal and is rapidly down-regulated in the daughter cells fated to differentiate in the adult ovary. We find that this dynamic expression pattern is limited to female germ cells and is under Sxl control. In the absence of Sxl, or in male germ cells, Nanos protein is continuously expressed. Furthermore, this female-specific expression pattern is dependent on the presence of canonical Sxl binding sites located in the nanos 3' untranslated region. These results, combined with the observation that nanos RNA associates with the Sxl protein in ovarian extracts and loss and gain of function studies, suggest that Sxl enables the switch from germline stem cell to committed daughter cell by posttranscriptional down-regulation of nanos expression. These findings connect sexual identity to the stem cell self-renewal/differentiation decision and highlight the importance of posttranscriptional gene regulatory networks in controlling stem cell behavior.

Fusion of LBP and SWLD using spatio-spectral information for hyperspectral face recognition

NASA Astrophysics Data System (ADS)

Xie, Zhihua; Jiang, Peng; Zhang, Shuai; Xiong, Jinquan

2018-01-01

Hyperspectral imaging, recording intrinsic spectral information of the skin cross different spectral bands, become an important issue for robust face recognition. However, the main challenges for hyperspectral face recognition are high data dimensionality, low signal to noise ratio and inter band misalignment. In this paper, hyperspectral face recognition based on LBP (Local binary pattern) and SWLD (Simplified Weber local descriptor) is proposed to extract discriminative local features from spatio-spectral fusion information. Firstly, the spatio-spectral fusion strategy based on statistical information is used to attain discriminative features of hyperspectral face images. Secondly, LBP is applied to extract the orientation of the fusion face edges. Thirdly, SWLD is proposed to encode the intensity information in hyperspectral images. Finally, we adopt a symmetric Kullback-Leibler distance to compute the encoded face images. The hyperspectral face recognition is tested on Hong Kong Polytechnic University Hyperspectral Face database (PolyUHSFD). Experimental results show that the proposed method has higher recognition rate (92.8%) than the state of the art hyperspectral face recognition algorithms.

A Spiking Neural Network System for Robust Sequence Recognition.

PubMed

Yu, Qiang; Yan, Rui; Tang, Huajin; Tan, Kay Chen; Li, Haizhou

2016-03-01

This paper proposes a biologically plausible network architecture with spiking neurons for sequence recognition. This architecture is a unified and consistent system with functional parts of sensory encoding, learning, and decoding. This is the first systematic model attempting to reveal the neural mechanisms considering both the upstream and the downstream neurons together. The whole system is a consistent temporal framework, where the precise timing of spikes is employed for information processing and cognitive computing. Experimental results show that the system is competent to perform the sequence recognition, being robust to noisy sensory inputs and invariant to changes in the intervals between input stimuli within a certain range. The classification ability of the temporal learning rule used in the system is investigated through two benchmark tasks that outperform the other two widely used learning rules for classification. The results also demonstrate the computational power of spiking neurons over perceptrons for processing spatiotemporal patterns. In summary, the system provides a general way with spiking neurons to encode external stimuli into spatiotemporal spikes, to learn the encoded spike patterns with temporal learning rules, and to decode the sequence order with downstream neurons. The system structure would be beneficial for developments in both hardware and software.

Cross-Cultural Differences in the Neural Correlates of Specific and General Recognition

PubMed Central

Paige, Laura E.; Ksander, John C.; Johndro, Hunter A.; Gutchess, Angela H.

2017-01-01

Research suggests that culture influences how people perceive the world, which extends to memory specificity, or how much perceptual detail is remembered. The present study investigated cross-cultural differences (Americans vs. East Asians) at the time of encoding in the neural correlates of specific vs. general memory formation. Participants encoded photos of everyday items in the scanner and 48 hours later completed a surprise recognition test. The recognition test consisted of same (i.e., previously seen in scanner), similar (i.e., same name, different features), or new photos (i.e., items not previously seen in scanner). For Americans compared to East Asians, we predicted greater activation in the hippocampus and right fusiform for specific memory at recognition, as these regions were implicated previously in encoding perceptual details. Results revealed that East Asians activated the left fusiform and left hippocampus more than Americans for specific vs. general memory. Follow-up analyses ruled out alternative explanations of retrieval difficulty and familiarity for this pattern of cross-cultural differences at encoding. Results overall suggest that culture should be considered as another individual difference that affects memory specificity and modulates neural regions underlying these processes. PMID:28256199

Cross-cultural differences in the neural correlates of specific and general recognition.

PubMed

Paige, Laura E; Ksander, John C; Johndro, Hunter A; Gutchess, Angela H

2017-06-01

Research suggests that culture influences how people perceive the world, which extends to memory specificity, or how much perceptual detail is remembered. The present study investigated cross-cultural differences (Americans vs East Asians) at the time of encoding in the neural correlates of specific versus general memory formation. Participants encoded photos of everyday items in the scanner and 48 h later completed a surprise recognition test. The recognition test consisted of same (i.e., previously seen in scanner), similar (i.e., same name, different features), or new photos (i.e., items not previously seen in scanner). For Americans compared to East Asians, we predicted greater activation in the hippocampus and right fusiform for specific memory at recognition, as these regions were implicated previously in encoding perceptual details. Results revealed that East Asians activated the left fusiform and left hippocampus more than Americans for specific versus general memory. Follow-up analyses ruled out alternative explanations of retrieval difficulty and familiarity for this pattern of cross-cultural differences at encoding. Results overall suggest that culture should be considered as another individual difference that affects memory specificity and modulates neural regions underlying these processes. Copyright © 2017 Elsevier Ltd. All rights reserved.

DAZ Family Proteins, Key Players for Germ Cell Development

PubMed Central

Fu, Xia-Fei; Cheng, Shun-Feng; Wang, Lin-Qing; Yin, Shen; De Felici, Massimo; Shen, Wei

2015-01-01

DAZ family proteins are found almost exclusively in germ cells in distant animal species. Deletion or mutations of their encoding genes usually severely impair either oogenesis or spermatogenesis or both. The family includes Boule (or Boll), Dazl (or Dazla) and DAZ genes. Boule and Dazl are situated on autosomes while DAZ, exclusive of higher primates, is located on the Y chromosome. Deletion of DAZ gene is the most common causes of infertility in humans. These genes, encoding for RNA binding proteins, contain a highly conserved RNA recognition motif and at least one DAZ repeat encoding for a 24 amino acids sequence able to bind other mRNA binding proteins. Basically, Daz family proteins function as adaptors for target mRNA transport and activators of their translation. In some invertebrate species, BOULE protein play a pivotal role in germline specification and a conserved regulatory role in meiosis. Depending on the species, DAZL is expressed in primordial germ cells (PGCs) and/or pre-meiotic and meiotic germ cells of both sexes. Daz is found in fetal gonocytes, spermatogonia and spermatocytes of adult testes. Here we discuss DAZ family genes in a phylogenic perspective, focusing on the common and distinct features of these genes, and their pivotal roles during gametogenesis evolved during evolution. PMID:26327816

Contributions of intrinsic mutation rate and selfish selection to levels of de novo HRAS mutations in the paternal germline

PubMed Central

Giannoulatou, Eleni; McVean, Gilean; Taylor, Indira B.; McGowan, Simon J.; Maher, Geoffrey J.; Iqbal, Zamin; Pfeifer, Susanne P.; Turner, Isaac; Burkitt Wright, Emma M. M.; Shorto, Jennifer; Itani, Aysha; Turner, Karen; Gregory, Lorna; Buck, David; Rajpert-De Meyts, Ewa; Looijenga, Leendert H. J.; Kerr, Bronwyn; Wilkie, Andrew O. M.; Goriely, Anne

2013-01-01

The RAS proto-oncogene Harvey rat sarcoma viral oncogene homolog (HRAS) encodes a small GTPase that transduces signals from cell surface receptors to intracellular effectors to control cellular behavior. Although somatic HRAS mutations have been described in many cancers, germline mutations cause Costello syndrome (CS), a congenital disorder associated with predisposition to malignancy. Based on the epidemiology of CS and the occurrence of HRAS mutations in spermatocytic seminoma, we proposed that activating HRAS mutations become enriched in sperm through a process akin to tumorigenesis, termed selfish spermatogonial selection. To test this hypothesis, we quantified the levels, in blood and sperm samples, of HRAS mutations at the p.G12 codon and compared the results to changes at the p.A11 codon, at which activating mutations do not occur. The data strongly support the role of selection in determining HRAS mutation levels in sperm, and hence the occurrence of CS, but we also found differences from the mutation pattern in tumorigenesis. First, the relative prevalence of mutations in sperm correlates weakly with their in vitro activating properties and occurrence in cancers. Second, specific tandem base substitutions (predominantly GC>TT/AA) occur in sperm but not in cancers; genomewide analysis showed that this same mutation is also overrepresented in constitutional pathogenic and polymorphic variants, suggesting a heightened vulnerability to these mutations in the germline. We developed a statistical model to show how both intrinsic mutation rate and selfish selection contribute to the mutational burden borne by the paternal germline. PMID:24259709

Contributions of intrinsic mutation rate and selfish selection to levels of de novo HRAS mutations in the paternal germline.

PubMed

Giannoulatou, Eleni; McVean, Gilean; Taylor, Indira B; McGowan, Simon J; Maher, Geoffrey J; Iqbal, Zamin; Pfeifer, Susanne P; Turner, Isaac; Burkitt Wright, Emma M M; Shorto, Jennifer; Itani, Aysha; Turner, Karen; Gregory, Lorna; Buck, David; Rajpert-De Meyts, Ewa; Looijenga, Leendert H J; Kerr, Bronwyn; Wilkie, Andrew O M; Goriely, Anne

2013-12-10

The RAS proto-oncogene Harvey rat sarcoma viral oncogene homolog (HRAS) encodes a small GTPase that transduces signals from cell surface receptors to intracellular effectors to control cellular behavior. Although somatic HRAS mutations have been described in many cancers, germline mutations cause Costello syndrome (CS), a congenital disorder associated with predisposition to malignancy. Based on the epidemiology of CS and the occurrence of HRAS mutations in spermatocytic seminoma, we proposed that activating HRAS mutations become enriched in sperm through a process akin to tumorigenesis, termed selfish spermatogonial selection. To test this hypothesis, we quantified the levels, in blood and sperm samples, of HRAS mutations at the p.G12 codon and compared the results to changes at the p.A11 codon, at which activating mutations do not occur. The data strongly support the role of selection in determining HRAS mutation levels in sperm, and hence the occurrence of CS, but we also found differences from the mutation pattern in tumorigenesis. First, the relative prevalence of mutations in sperm correlates weakly with their in vitro activating properties and occurrence in cancers. Second, specific tandem base substitutions (predominantly GC>TT/AA) occur in sperm but not in cancers; genomewide analysis showed that this same mutation is also overrepresented in constitutional pathogenic and polymorphic variants, suggesting a heightened vulnerability to these mutations in the germline. We developed a statistical model to show how both intrinsic mutation rate and selfish selection contribute to the mutational burden borne by the paternal germline.

Time manages interference in visual short-term memory.

PubMed

Smith, Amy V; McKeown, Denis; Bunce, David

2017-09-01

Emerging evidence suggests that age-related declines in memory may reflect a failure in pattern separation, a process that is believed to reduce the encoding overlap between similar stimulus representations during memory encoding. Indeed, behavioural pattern separation may be indexed by a visual continuous recognition task in which items are presented in sequence and observers report for each whether it is novel, previously viewed (old), or whether it shares features with a previously viewed item (similar). In comparison to young adults, older adults show a decreased pattern separation when the number of items between "old" and "similar" items is increased. Yet the mechanisms of forgetting underpinning this type of recognition task are yet to be explored in a cognitively homogenous group, with careful control over the parameters of the task, including elapsing time (a critical variable in models of forgetting). By extending the inter-item intervals, number of intervening items and overall decay interval, we observed in a young adult sample (N = 35, M age  = 19.56 years) that the critical factor governing performance was inter-item interval. We argue that tasks using behavioural continuous recognition to index pattern separation in immediate memory will benefit from generous inter-item spacing, offering protection from inter-item interference.

Influence of encoding instructions and response bias on cross-cultural differences in specific recognition.

PubMed

Paige, Laura E; Amado, Selen; Gutchess, Angela H

2017-10-01

Prior cross-cultural research has reported cultural variations in memory. One study revealed that Americans remembered images with more perceptual detail than East Asians (Millar et al. in Cult Brain 1(2-4):138-157, 2013). However, in a later study, this expected pattern was not replicated, possibly due to differences in encoding instructions (Paige et al. in Cortex 91:250-261, 2017). The present study sought to examine when cultural variation in memory-related decisions occur and the role of instructions. American and East Asian participants viewed images of objects while making a Purchase decision or an Approach decision and later completed a surprise recognition test. Results revealed Americans had higher hit rates for specific memory, regardless of instruction type, and a less stringent response criterion relative to East Asians. Additionally, a pattern emerged where the Approach decision enhanced hit rates for specific memory relative to the Purchase decision only when administered first; this pattern did not differ across cultures. Results suggest encoding instructions do not magnify cross-cultural differences in memory. Ultimately, cross-cultural differences in response bias, rather than memory sensitivity per se, may account for findings of cultural differences in memory specificity.

Protection of germline gene expression by the C. elegans Argonaute CSR-1.

PubMed

Wedeles, Christopher J; Wu, Monica Z; Claycomb, Julie M

2013-12-23

In Caenorhabditis elegans, the Piwi-interacting small RNA (piRNA)-mediated germline surveillance system encodes more than 30,000 unique 21-nucleotide piRNAs, which silence a variety of foreign nucleic acids. What mechanisms allow endogenous germline-expressed transcripts to evade silencing by the piRNA pathway? One likely candidate in a protective mechanism is the Argonaute CSR-1, which interacts with 22G-small RNAs that are antisense to nearly all germline-expressed genes. Here, we use an in vivo RNA tethering assay to demonstrate that the recruitment of CSR-1 to a transcript licenses expression of the transcript, protecting it from piRNA-mediated silencing. Licensing occurs mainly at the level of transcription, as we observe changes in pre-mRNA levels consistent with transcriptional activation when CSR-1 is tethered. Furthermore, the recruitment of CSR-1 to a previously silenced locus transcriptionally activates its expression. Together, these results demonstrate a rare positive role for an endogenous Argonaute pathway in heritably licensing and protecting germline transcripts.

Complex expression patterns of lymphocyte-specific genes during the development of cartilaginous fish implicate unique lymphoid tissues in generating an immune repertoire

NASA Technical Reports Server (NTRS)

Miracle, A. L.; Anderson, M. K.; Litman, R. T.; Walsh, C. J.; Luer, C. A.; Rothenberg, E. V.; Litman, G. W.

2001-01-01

Cartilaginous fish express canonical B and T cell recognition genes, but their lymphoid organs and lymphocyte development have been poorly defined. Here, the expression of Ig, TCR, recombination-activating gene (Rag)-1 and terminal deoxynucleosidase (TdT) genes has been used to identify roles of various lymphoid tissues throughout development in the cartilaginous fish, Raja eglanteria (clearnose skate). In embryogenesis, Ig and TCR genes are sharply up-regulated at 8 weeks of development. At this stage TCR and TdT expression is limited to the thymus; later, TCR gene expression appears in peripheral sites in hatchlings and adults, suggesting that the thymus is a source of T cells as in mammals. B cell gene expression indicates more complex roles for the spleen and two special organs of cartilaginous fish-the Leydig and epigonal (gonad-associated) organs. In the adult, the Leydig organ is the site of the highest IgM and IgX expression. However, the spleen is the first site of IgM expression, while IgX is expressed first in gonad, liver, Leydig and even thymus. Distinctive spatiotemporal patterns of Ig light chain gene expression also are seen. A subset of Ig genes is pre-rearranged in the germline of the cartilaginous fish, making expression possible without rearrangement. To assess whether this allows differential developmental regulation, IgM and IgX heavy chain cDNA sequences from specific tissues and developmental stages have been compared with known germline-joined genomic sequences. Both non-productively rearranged genes and germline-joined genes are transcribed in the embryo and hatchling, but not in the adult.

Proteogenomic characterization of human colon and rectal cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Bing; Wang, Jing; Wang, Xiaojing

2014-09-18

We analyzed proteomes of colon and rectal tumors previously characterized by the Cancer Genome Atlas (TCGA) and performed integrated proteogenomic analyses. Protein sequence variants encoded by somatic genomic variations displayed reduced expression compared to protein variants encoded by germline variations. mRNA transcript abundance did not reliably predict protein expression differences between tumors. Proteomics identified five protein expression subtypes, two of which were associated with the TCGA "MSI/CIMP" transcriptional subtype, but had distinct mutation and methylation patterns and associated with different clinical outcomes. Although CNAs showed strong cis- and trans-effects on mRNA expression, relatively few of these extend to the proteinmore » level. Thus, proteomics data enabled prioritization of candidate driver genes. Our analyses identified HNF4A, a novel candidate driver gene in tumors with chromosome 20q amplifications. Integrated proteogenomic analysis provides functional context to interpret genomic abnormalities and affords novel insights into cancer biology.« less

Germline Mutations of Inhibins in Early-Onset Ovarian Epithelial Tumors

PubMed Central

Tournier, Isabelle; Marlin, Régine; Walton, Kelly; Charbonnier, Françoise; Coutant, Sophie; Théry, Jean-Christophe; Charbonnier, Camille; Spurrell, Cailyn; Vezain, Myriam; Ippolito, Lorena; Bougeard, Gaëlle; Roman, Horace; Tinat, Julie; Sabourin, Jean-Christophe; Stoppa-Lyonnet, Dominique; Caron, Olivier; Bressac-de Paillerets, Brigitte; Vaur, Dominique; King, Mary-Claire; Harrison, Craig; Frebourg, Thierry

2014-01-01

To identify novel genetic bases of early-onset epithelial ovarian tumors, we used the trio exome sequencing strategy in a patient without familial history of cancer who presented metastatic serous ovarian adenocarcinomas at 21 years of age. We identified a single de novo mutation (c.1157A>G/p.Asn386Ser) within the INHBA gene encoding the βA-subunit of inhibins/activins, which play a key role in ovarian development. In vitro, this mutation alters the ratio of secreted activins and inhibins. In a second patient with early-onset serous borderline papillary cystadenoma, we identified an unreported germline mutation (c.179G>T/p.Arg60Leu) of the INHA gene encoding the α-subunit, the partner of the βA-subunit. This mutation also alters the secreted activin/inhibin ratio, by disrupting both inhibin A and inhibin B biosynthesis. In a cohort of 62 cases, we detected an additional unreported germline mutation of the INHBA gene (c.839G>A/p.Gly280Glu). Our results strongly suggest that inhibin mutations contribute to the genetic determinism of epithelial ovarian tumors. PMID:24302632

The large Maf factor Traffic Jam controls gonad morphogenesis in Drosophila.

PubMed

Li, Michelle A; Alls, Jeffrey D; Avancini, Rita M; Koo, Karen; Godt, Dorothea

2003-11-01

Interactions between somatic and germline cells are critical for the normal development of egg and sperm. Here we show that the gene traffic jam (tj) produces a soma-specific factor that controls gonad morphogenesis and is required for female and male fertility. tj encodes the only large Maf factor in Drosophila melanogaster, an orthologue of the atypical basic Leu zipper transcription factors c-Maf and MafB/Kreisler in vertebrates. Expression of tj occurs in somatic gonadal cells that are in direct contact with germline cells throughout development. In tj mutant gonads, somatic cells fail to inter-mingle and properly envelop germline cells, causing an early block in germ cell differentiation. In addition, tj mutant somatic cells show an increase in the level of expression for several adhesion molecules. We propose that tj is a critical modulator of the adhesive properties of somatic cells, facilitating germline-soma interactions that are essential for germ cell differentiation.

Fuel spill identification using solid-phase extraction and solid-phase microextraction. 1. Aviation turbine fuels.

PubMed

Lavine, B K; Brzozowski, D M; Ritter, J; Moores, A J; Mayfield, H T

2001-12-01

The water-soluble fraction of aviation jet fuels is examined using solid-phase extraction and solid-phase microextraction. Gas chromatographic profiles of solid-phase extracts and solid-phase microextracts of the water-soluble fraction of kerosene- and nonkerosene-based jet fuels reveal that each jet fuel possesses a unique profile. Pattern recognition analysis reveals fingerprint patterns within the data characteristic of fuel type. By using a novel genetic algorithm (GA) that emulates human pattern recognition through machine learning, it is possible to identify features characteristic of the chromatographic profile of each fuel class. The pattern recognition GA identifies a set of features that optimize the separation of the fuel classes in a plot of the two largest principal components of the data. Because principal components maximize variance, the bulk of the information encoded by the selected features is primarily about the differences between the fuel classes.

False memory and level of processing effect: an event-related potential study.

PubMed

Beato, Maria Soledad; Boldini, Angela; Cadavid, Sara

2012-09-12

Event-related potentials (ERPs) were used to determine the effects of level of processing on true and false memory, using the Deese-Roediger-McDermott (DRM) paradigm. In the DRM paradigm, lists of words highly associated to a single nonpresented word (the 'critical lure') are studied and, in a subsequent memory test, critical lures are often falsely remembered. Lists with three critical lures per list were auditorily presented here to participants who studied them with either a shallow (saying whether the word contained the letter 'o') or a deep (creating a mental image of the word) processing task. Visual presentation modality was used on a final recognition test. True recognition of studied words was significantly higher after deep encoding, whereas false recognition of nonpresented critical lures was similar in both experimental groups. At the ERP level, true and false recognition showed similar patterns: no FN400 effect was found, whereas comparable left parietal and late right frontal old/new effects were found for true and false recognition in both experimental conditions. Items studied under shallow encoding conditions elicited more positive ERP than items studied under deep encoding conditions at a 1000-1500 ms interval. These ERP results suggest that true and false recognition share some common underlying processes. Differential effects of level of processing on true and false memory were found only at the behavioral level but not at the ERP level.

Variability in the impairment of recognition memory in patients with frontal lobe lesions.

PubMed

Bastin, Christine; Van der Linden, Martial; Lekeu, Françoise; Andrés, Pilar; Salmon, Eric

2006-10-01

Fourteen patients with frontal lobe lesions and 14 normal subjects were tested on a recognition memory task that required discriminating between target words, new words that are synonyms of the targets and unrelated distractors. A deficit was found in 12 of the patients. Moreover, three different patterns of recognition impairment were identified: (I) poor memory for targets, (II) normal hits but increased false recognitions for both types of distractors, (III) normal hit rates, but increased false recognitions for synonyms only. Differences in terms of location of the damage and behavioral characteristics between these subgroups were examined. An encoding deficit was proposed to explain the performance of patients in subgroup I. The behavioral patterns of the patients in subgroups II and III could be interpreted as deficient post-retrieval verification processes and an inability to recollect item-specific information, respectively.

Somatic and Germline TP53 Alterations in Second Malignant Neoplasms from Pediatric Cancer Survivors.

PubMed

Sherborne, Amy L; Lavergne, Vincent; Yu, Katharine; Lee, Leah; Davidson, Philip R; Mazor, Tali; Smirnoff, Ivan V; Horvai, Andrew E; Loh, Mignon; DuBois, Steven G; Goldsby, Robert E; Neglia, Joseph P; Hammond, Sue; Robison, Leslie L; Wustrack, Rosanna; Costello, Joseph F; Nakamura, Alice O; Shannon, Kevin M; Bhatia, Smita; Nakamura, Jean L

2017-04-01

Purpose: Second malignant neoplasms (SMNs) are severe late complications that occur in pediatric cancer survivors exposed to radiotherapy and other genotoxic treatments. To characterize the mutational landscape of treatment-induced sarcomas and to identify candidate SMN-predisposing variants, we analyzed germline and SMN samples from pediatric cancer survivors. Experimental Design: We performed whole-exome sequencing (WES) and RNA sequencing on radiation-induced sarcomas arising from two pediatric cancer survivors. To assess the frequency of germline TP53 variants in SMNs, Sanger sequencing was performed to analyze germline TP53 in 37 pediatric cancer survivors from the Childhood Cancer Survivor Study (CCSS) without any history of a familial cancer predisposition syndrome but known to have developed SMNs. Results: WES revealed TP53 mutations involving p53's DNA-binding domain in both index cases, one of which was also present in the germline. The germline and somatic TP53- mutant variants were enriched in the transcriptomes for both sarcomas. Analysis of TP53- coding exons in germline specimens from the CCSS survivor cohort identified a G215C variant encoding an R72P amino acid substitution in 6 patients and a synonymous SNP A639G in 4 others, resulting in 10 of 37 evaluable patients (27%) harboring a germline TP53 variant. Conclusions: Currently, germline TP53 is not routinely assessed in patients with pediatric cancer. These data support the concept that identifying germline TP53 variants at the time a primary cancer is diagnosed may identify patients at high risk for SMN development, who could benefit from modified therapeutic strategies and/or intensive posttreatment monitoring. Clin Cancer Res; 23(7); 1852-61. ©2016 AACR . ©2016 American Association for Cancer Research.

Somatic and germline TP53 alterations in second malignant neoplasms from pediatric cancer survivors

PubMed Central

Sherborne, Amy L.; Lavergne, Vincent; Yu, Katharine; Lee, Leah; Davidson, Philip R.; Mazor, Tali; Smirnoff, Ivan; Horvai, Andrew; Loh, Mignon; DuBois, Steven G.; Goldsby, Robert E.; Neglia, Joseph; Hammond, Sue; Robison, Leslie L.; Wustrack, Rosanna; Costello, Joseph; Nakamura, Alice O.; Shannon, Kevin; Bhatia, Smita; Nakamura, Jean L.

2016-01-01

Purpose Second malignant neoplasms (SMNs) are severe late complications that occur in pediatric cancer survivors exposed to radiotherapy and other genotoxic treatments. To characterize the mutational landscape of treatment-induced sarcomas and to identify candidate SMN-predisposing variants we analyzed germline and SMN samples from pediatric cancer survivors. Experimental Design We performed whole exome sequencing (WES) and RNA sequencing on radiation-induced sarcomas arising from two pediatric cancer survivors. To assess the frequency of germline TP53 variants in SMNs, Sanger sequencing was performed to analyze germline TP53 in thirty-seven pediatric cancer survivors from the Childhood Cancer Survivor Study (CCSS) without history of a familial cancer predisposition syndrome but known to have developed SMNs. Results WES revealed TP53 mutations involving p53’s DNA binding domain in both index cases, one of which was also present in the germline. The germline and somatic TP53 mutant variants were enriched in the transcriptomes for both sarcomas. Analysis of TP53 coding exons in germline specimens from the CCSS survivor cohort identified a G215C variant encoding an R72P amino acid substitution in six patients and a synonymous single nucleotide polymorphism A639G in four others, resulting in ten out of 37 evaluable patients (27%) harboring a germline TP53 variant. Conclusions Currently, germline TP53 is not routinely assessed in pediatric cancer patients. These data support the concept that identifying germline TP53 variants at the time a primary cancer is diagnosed may identify patients at high risk for SMN development, who could benefit from modified therapeutic strategies and/or intensive post-treatment monitoring. PMID:27683180

Are children's memory illusions created differently from those of adults? Evidence from levels-of-processing and divided attention paradigms.

PubMed

Wimmer, Marina C; Howe, Mark L

2010-09-01

In two experiments, we investigated the robustness and automaticity of adults' and children's generation of false memories by using a levels-of-processing paradigm (Experiment 1) and a divided attention paradigm (Experiment 2). The first experiment revealed that when information was encoded at a shallow level, true recognition rates decreased for all ages. For false recognition, when information was encoded on a shallow level, we found a different pattern for young children compared with that for older children and adults. False recognition rates were related to the overall amount of correctly remembered information for 7-year-olds, whereas no such association was found for the other age groups. In the second experiment, divided attention decreased true recognition for all ages. In contrast, children's (7- and 11-year-olds) false recognition rates were again dependent on the overall amount of correctly remembered information, whereas adults' false recognition was left unaffected. Overall, children's false recognition rates changed when levels of processing or divided attention was manipulated in comparison with adults. Together, these results suggest that there may be both quantitative and qualitative changes in false memory rates with age. Copyright 2010 Elsevier Inc. All rights reserved.

Can Changes in Eye Movement Scanning Alter the Age-Related Deficit in Recognition Memory?

PubMed Central

Chan, Jessica P. K.; Kamino, Daphne; Binns, Malcolm A.; Ryan, Jennifer D.

2011-01-01

Older adults typically exhibit poorer face recognition compared to younger adults. These recognition differences may be due to underlying age-related changes in eye movement scanning. We examined whether older adults’ recognition could be improved by yoking their eye movements to those of younger adults. Participants studied younger and older faces, under free viewing conditions (bases), through a gaze-contingent moving window (own), or a moving window which replayed the eye movements of a base participant (yoked). During the recognition test, participants freely viewed the faces with no viewing restrictions. Own-age recognition biases were observed for older adults in all viewing conditions, suggesting that this effect occurs independently of scanning. Participants in the bases condition had the highest recognition accuracy, and participants in the yoked condition were more accurate than participants in the own condition. Among yoked participants, recognition did not depend on age of the base participant. These results suggest that successful encoding for all participants requires the bottom-up contribution of peripheral information, regardless of the locus of control of the viewer. Although altering the pattern of eye movements did not increase recognition, the amount of sampling of the face during encoding predicted subsequent recognition accuracy for all participants. Increased sampling may confer some advantages for subsequent recognition, particularly for people who have declining memory abilities. PMID:21687460

Investigating the anticipatory nature of pattern perception in sport.

PubMed

Gorman, Adam D; Abernethy, Bruce; Farrow, Damian

2011-07-01

The aim of the present study was to examine the anticipatory nature of pattern perception in sport by using static and moving basketball patterns across three different display types. Participants of differing skill levels were included in order to determine whether the effects would be moderated by the knowledge and experience of the observer in the same manner reported previously for simple images. The results from a pattern recognition task showed that both expert and recreational participants were more likely to anticipate the next likely state of a pattern when it was presented as a moving video, but only the experts appeared to have the depth of understanding required to elicit the same anticipatory encoding for patterns presented as schematic images. The results extend those reported in previous research and provide further evidence of an anticipatory encoding in pattern perception for images containing complex, interrelated patterns.

A serine proteinase homologue, SPH-3, plays a central role in insect immunity.

PubMed

Felföldi, Gabriella; Eleftherianos, Ioannis; Ffrench-Constant, Richard H; Venekei, István

2011-04-15

Numerous vertebrate and invertebrate genes encode serine proteinase homologues (SPHs) similar to members of the serine proteinase family, but lacking one or more residues of the catalytic triad. These SPH proteins are thought to play a role in immunity, but their precise functions are poorly understood. In this study, we show that SPH-3 (an insect non-clip domain-containing SPH) is of central importance in the immune response of a model lepidopteran, Manduca sexta. We examine M. sexta infection with a virulent, insect-specific, Gram-negative bacterium Photorhabdus luminescens. RNA interference suppression of bacteria-induced SPH-3 synthesis severely compromises the insect's ability to defend itself against infection by preventing the transcription of multiple antimicrobial effector genes, but, surprisingly, not the transcription of immune recognition genes. Upregulation of the gene encoding prophenoloxidase and the activity of the phenoloxidase enzyme are among the antimicrobial responses that are severely attenuated on SPH-3 knockdown. These findings suggest the existence of two largely independent signaling pathways controlling immune recognition by the fat body, one governing effector gene transcription, and the other regulating genes encoding pattern recognition proteins.

Do pattern recognition skills transfer across sports? A preliminary analysis.

PubMed

Smeeton, Nicholas J; Ward, Paul; Williams, A Mark

2004-02-01

The ability to recognize patterns of play is fundamental to performance in team sports. While typically assumed to be domain-specific, pattern recognition skills may transfer from one sport to another if similarities exist in the perceptual features and their relations and/or the strategies used to encode and retrieve relevant information. A transfer paradigm was employed to compare skilled and less skilled soccer, field hockey and volleyball players' pattern recognition skills. Participants viewed structured and unstructured action sequences from each sport, half of which were randomly represented with clips not previously seen. The task was to identify previously viewed action sequences quickly and accurately. Transfer of pattern recognition skill was dependent on the participant's skill, sport practised, nature of the task and degree of structure. The skilled soccer and hockey players were quicker than the skilled volleyball players at recognizing structured soccer and hockey action sequences. Performance differences were not observed on the structured volleyball trials between the skilled soccer, field hockey and volleyball players. The skilled field hockey and soccer players were able to transfer perceptual information or strategies between their respective sports. The less skilled participants' results were less clear. Implications for domain-specific expertise, transfer and diversity across domains are discussed.

CYTOMEGALOVIRUS VECTORS VIOLATE CD8+ T CELL EPITOPE RECOGNITION PARADIGMS

PubMed Central

Hansen, Scott G.; Sacha, Jonah B.; Hughes, Colette M.; Ford, Julia C.; Burwitz, Benjamin J.; Scholz, Isabel; Gilbride, Roxanne M.; Lewis, Matthew S.; Gilliam, Awbrey N.; Ventura, Abigail B.; Malouli, Daniel; Xu, Guangwu; Richards, Rebecca; Whizin, Nathan; Reed, Jason S.; Hammond, Katherine B.; Fischer, Miranda; Turner, John M.; Legasse, Alfred W.; Axthelm, Michael K.; Edlefsen, Paul T.; Nelson, Jay A.; Lifson, Jeffrey D.; Früh, Klaus; Picker, Louis J.

2013-01-01

CD8+ T cell responses focus on a small fraction of pathogen- or vaccine-encoded peptides, and for some pathogens, these restricted recognition hierarchies limit the effectiveness of anti-pathogen immunity. We found that simian immunodeficiency virus (SIV) protein-expressing Rhesus Cytomegalovirus (RhCMV) vectors elicit SIV-specific CD8+ T cells that recognize unusual, diverse and highly promiscuous epitopes, including dominant responses to epitopes restricted by class II major histocompatibility complex (MHC) molecules. Induction of canonical SIV epitope-specific CD8+ T cell responses is suppressed by the RhCMV-encoded Rh189 (US11) gene, and the promiscuous MHC class I- and class II-restricted CD8+ T cell responses only occur in the absence of the Rh157.4-.6 (UL128-131) genes. Thus, CMV vectors can be genetically programmed to achieve distinct patterns of CD8+ T cell epitope recognition. PMID:23704576

Small RNA-Mediated trans-Nuclear and trans-Element Communications in Tetrahymena DNA Elimination.

PubMed

Noto, Tomoko; Mochizuki, Kazufumi

2018-06-18

Epigenetic inheritance of acquired traits is widespread among eukaryotes, but how and to what extent such information is transgenerationally inherited is still unclear. The patterns of programmed DNA elimination in ciliates are epigenetically and transgenerationally inherited, and it has been proposed that small RNAs, which shuttle between the germline and the soma, regulate this epigenetic inheritance. In this study, we test the existence and role of such small-RNA-mediated communication by epigenetically disturbing the pattern of DNA elimination in Tetrahymena. We show that the pattern of DNA elimination is, indeed, determined by the selective turnover of small RNAs, which is induced by the interaction between germline-derived small RNAs and the somatic genome. In addition, we show that DNA elimination of an element is regulated by small-RNA-mediated communication with other eliminated elements. By contrast, no evidence obtained thus far supports the notion that transfer of epigenetic information from the soma to the germline, if any, regulates DNA elimination. Our results indicate that small-RNA-mediated trans-nuclear and trans-element communication, in addition to unknown information in the germline genome, contributes to determining the pattern of DNA elimination. Copyright © 2018 Elsevier Ltd. All rights reserved.

Multi-texture local ternary pattern for face recognition

NASA Astrophysics Data System (ADS)

Essa, Almabrok; Asari, Vijayan

2017-05-01

In imagery and pattern analysis domain a variety of descriptors have been proposed and employed for different computer vision applications like face detection and recognition. Many of them are affected under different conditions during the image acquisition process such as variations in illumination and presence of noise, because they totally rely on the image intensity values to encode the image information. To overcome these problems, a novel technique named Multi-Texture Local Ternary Pattern (MTLTP) is proposed in this paper. MTLTP combines the edges and corners based on the local ternary pattern strategy to extract the local texture features of the input image. Then returns a spatial histogram feature vector which is the descriptor for each image that we use to recognize a human being. Experimental results using a k-nearest neighbors classifier (k-NN) on two publicly available datasets justify our algorithm for efficient face recognition in the presence of extreme variations of illumination/lighting environments and slight variation of pose conditions.

In Vivo Detection of Reactive Oxygen Species and Redox Status in Caenorhabditis elegans.

PubMed

Braeckman, Bart P; Smolders, Arne; Back, Patricia; De Henau, Sasha

2016-10-01

Due to its large families of redox-active enzymes, genetic amenability, and complete transparency, the nematode Caenorhabditis elegans has the potential to become an important model for the in vivo study of redox biology. The recent development of several genetically encoded ratiometric reactive oxygen species (ROS) and redox sensors has revolutionized the quantification and precise localization of ROS and redox signals in living organisms. Only few exploratory studies have applied these sensors in C. elegans and undoubtedly much remains to be discovered in this model. As a follow-up to our recent findings that the C. elegans somatic gonad uses superoxide and hydrogen peroxide (H2O2) signals to communicate with the germline, we here analyze the patterns of H2O2 inside the C. elegans germline. Despite the advantages of genetically encoded ROS and redox sensors over classic chemical sensors, still several general as well as C. elegans-specific issues need to be addressed. The major concerns for the application of these sensors in C. elegans are (i) decreased vitality of some reporter strains, (ii) interference of autofluorescent compartments with the sensor signal, and (iii) the use of immobilization methods that do not influence the worm's redox physiology. We propose that several of the current issues may be solved by designing reporter strains carrying single copies of codon-optimized sensors. Preferably, these sensors should have their emission wavelengths in the red region, where autofluorescence is absent. Worm analysis could be optimized using four-dimensional ratiometric fluorescence microscopy of worms immobilized in microfluidic chips. Antioxid. Redox Signal. 25, 577-592.

An fMRI study of semantic processing in men with schizophrenia

PubMed Central

Kubicki, M.; McCarley, R.W.; Nestor, P.G.; Huh, T.; Kikinis, R.; Shenton, M.E.; Wible, C.G.

2009-01-01

As a means toward understanding the neural bases of schizophrenic thought disturbance, we examined brain activation patterns in response to semantically and superficially encoded words in patients with schizophrenia. Nine male schizophrenic and 9 male control subjects were tested in a visual levels of processing (LOP) task first outside the magnet and then during the fMRI scanning procedures (using a different set of words). During the experiments visual words were presented under two conditions. Under the deep, semantic encoding condition, subjects made semantic judgments as to whether the words were abstract or concrete. Under the shallow, nonsemantic encoding condition, subjects made perceptual judgments of the font size (uppercase/lowercase) of the presented words. After performance of the behavioral task, a recognition test was used to assess the depth of processing effect, defined as better performance for semantically encoded words than for perceptually encoded words. For the scanned version only, the words for both conditions were repeated in order to assess repetition-priming effects. Reaction times were assessed in both testing scenarios. Both groups showed the expected depth of processing effect for recognition, and control subjects showed the expected increased activation of the left inferior prefrontal cortex (LIPC) under semantic encoding relative to perceptual encoding conditions as well as repetition priming for semantic conditions only. In contrast, schizophrenics showed similar patterns of fMRI activation regardless of condition. Most striking in relation to controls, patients showed decreased LIFC activation concurrent with increased left superior temporal gyrus activation for semantic encoding versus shallow encoding. Furthermore, schizophrenia subjects did not show the repetition priming effect, either behaviorally or as a decrease in LIPC activity. In patients with schizophrenia, LIFC underactivation and left superior temporal gyrus overactivation for semantically encoded words may reflect a disease-related disruption of a distributed frontal temporal network that is engaged in the representation and processing of meaning of words, text, and discourse and which may underlie schizophrenic thought disturbance. PMID:14683698

An fMRI study of semantic processing in men with schizophrenia.

PubMed

Kubicki, M; McCarley, R W; Nestor, P G; Huh, T; Kikinis, R; Shenton, M E; Wible, C G

2003-12-01

As a means toward understanding the neural bases of schizophrenic thought disturbance, we examined brain activation patterns in response to semantically and superficially encoded words in patients with schizophrenia. Nine male schizophrenic and 9 male control subjects were tested in a visual levels of processing (LOP) task first outside the magnet and then during the fMRI scanning procedures (using a different set of words). During the experiments visual words were presented under two conditions. Under the deep, semantic encoding condition, subjects made semantic judgments as to whether the words were abstract or concrete. Under the shallow, nonsemantic encoding condition, subjects made perceptual judgments of the font size (uppercase/lowercase) of the presented words. After performance of the behavioral task, a recognition test was used to assess the depth of processing effect, defined as better performance for semantically encoded words than for perceptually encoded words. For the scanned version only, the words for both conditions were repeated in order to assess repetition-priming effects. Reaction times were assessed in both testing scenarios. Both groups showed the expected depth of processing effect for recognition, and control subjects showed the expected increased activation of the left inferior prefrontal cortex (LIPC) under semantic encoding relative to perceptual encoding conditions as well as repetition priming for semantic conditions only. In contrast, schizophrenics showed similar patterns of fMRI activation regardless of condition. Most striking in relation to controls, patients showed decreased LIFC activation concurrent with increased left superior temporal gyrus activation for semantic encoding versus shallow encoding. Furthermore, schizophrenia subjects did not show the repetition priming effect, either behaviorally or as a decrease in LIPC activity. In patients with schizophrenia, LIFC underactivation and left superior temporal gyrus overactivation for semantically encoded words may reflect a disease-related disruption of a distributed frontal temporal network that is engaged in the representation and processing of meaning of words, text, and discourse and which may underlie schizophrenic thought disturbance.

Image Description with Local Patterns: An Application to Face Recognition

NASA Astrophysics Data System (ADS)

Zhou, Wei; Ahrary, Alireza; Kamata, Sei-Ichiro

In this paper, we propose a novel approach for presenting the local features of digital image using 1D Local Patterns by Multi-Scans (1DLPMS). We also consider the extentions and simplifications of the proposed approach into facial images analysis. The proposed approach consists of three steps. At the first step, the gray values of pixels in image are represented as a vector giving the local neighborhood intensity distrubutions of the pixels. Then, multi-scans are applied to capture different spatial information on the image with advantage of less computation than other traditional ways, such as Local Binary Patterns (LBP). The second step is encoding the local features based on different encoding rules using 1D local patterns. This transformation is expected to be less sensitive to illumination variations besides preserving the appearance of images embedded in the original gray scale. At the final step, Grouped 1D Local Patterns by Multi-Scans (G1DLPMS) is applied to make the proposed approach computationally simpler and easy to extend. Next, we further formulate boosted algorithm to extract the most discriminant local features. The evaluated results demonstrate that the proposed approach outperforms the conventional approaches in terms of accuracy in applications of face recognition, gender estimation and facial expression.

Effects of distinctive encoding on correct and false memory: a meta-analytic review of costs and benefits and their origins in the DRM paradigm.

PubMed

Huff, Mark J; Bodner, Glen E; Fawcett, Jonathan M

2015-04-01

We review and meta-analyze how distinctive encoding alters encoding and retrieval processes and, thus, affects correct and false recognition in the Deese-Roediger-McDermott (DRM) paradigm. Reductions in false recognition following distinctive encoding (e.g., generation), relative to a nondistinctive read-only control condition, reflected both impoverished relational encoding and use of a retrieval-based distinctiveness heuristic. Additional analyses evaluated the costs and benefits of distinctive encoding in within-subjects designs relative to between-group designs. Correct recognition was design independent, but in a within design, distinctive encoding was less effective at reducing false recognition for distinctively encoded lists but more effective for nondistinctively encoded lists. Thus, distinctive encoding is not entirely "cost free" in a within design. In addition to delineating the conditions that modulate the effects of distinctive encoding on recognition accuracy, we discuss the utility of using signal detection indices of memory information and memory monitoring at test to separate encoding and retrieval processes.

Exploring the energy landscape of antibody-antigen complexes: protein dynamics, flexibility, and molecular recognition.

PubMed

Thielges, Megan C; Zimmermann, Jörg; Yu, Wayne; Oda, Masayuki; Romesberg, Floyd E

2008-07-08

The production of antibodies that selectively bind virtually any foreign compound is the hallmark of the immune system. While much is understood about how sequence diversity contributes to this remarkable feat of molecular recognition, little is known about how sequence diversity impacts antibody dynamics, which is also expected to contribute to molecular recognition. Toward this goal, we examined a panel of antibodies elicited to the chromophoric antigen fluorescein. On the basis of isothermal titration calorimetry, we selected six antibodies that bind fluorescein with diverse binding entropies, suggestive of varying contributions of dynamics to molecular recognition. Sequencing revealed that two pairs of antibodies employ homologous heavy chains that were derived from common germline genes, while the other two heavy chains and all six of the light chains were derived from different germline genes and are not homologous. Interestingly, more than half of all the somatic mutations acquired during affinity maturation among the six antibodies are located in positions unlikely to contact fluorescein directly. To quantify and compare the dynamics of the antibody-fluorescein complexes, three-pulse photon echo peak shift and transient grating spectroscopy were employed. All of the antibodies exhibited motions on three distinct time scales, ultrafast motions on the <100 fs time scale, diffusive motions on the picosecond time scale, and motions that occur on time scales longer than nanoseconds and thus appear static. However, the exact frequency of the picosecond time scale motion and the relative contribution of the different motions vary significantly among the antibody-chromophore complexes, revealing a high level of dynamic diversity. Using a hierarchical model, we relate the data to features of the antibodies' energy landscapes as well as their flexibility in terms of elasticity and plasticity. In all, the data provide a consistent picture of antibody flexibility, which interestingly appears to be correlated with binding entropy as well as with germline gene use and the mutations introduced during affinity maturation. The data also provide a gauge of the dynamic diversity of the antibody repertoire and suggest that this diversity might contribute to molecular recognition by facilitating the recognition of the broadest range of foreign molecules.

Synergic activation of toll-like receptor (TLR) 2/6 and 9 in response to Ureaplasma parvum & urealyticum in human amniotic epithelial cells.

PubMed

Triantafilou, Martha; De Glanville, Benjamin; Aboklaish, Ali F; Spiller, O Brad; Kotecha, Sailesh; Triantafilou, Kathy

2013-01-01

Ureaplasma species are the most frequently isolated microorganisms inside the amniotic cavity and have been associated with spontaneous abortion, chorioamnionitis, premature rupture of the membranes (PROM), preterm labour (PL) pneumonia in neonates and bronchopulmonary dysplasia in neonates. The mechanisms by which Ureaplasmas cause such diseases remain unclear, but it is believed that inappropriate induction of inflammatory responses is involved, triggered by the innate immune system. As part of its mechanism of activation, the innate immune system employs germ-lined encoded receptors, called pattern recognition receptors (PRRs) in order to "sense" pathogens. One such family of PRRs are the Toll like receptor family (TLR). In the current study we aimed to elucidate the role of TLRs in Ureaplasma-induced inflammation in human amniotic epithelial cells. Using silencing, as well as human embryonic kidney (HEK) transfected cell lines, we demonstrate that TLR2, TLR6 and TLR9 are involved in the inflammatory responses against Ureaplasma parvum and urealyticum serovars. Ureaplasma lipoproteins, such as Multiple Banded antigen (MBA), trigger responses via TLR2/TLR6, whereas the whole bacterium is required for TLR9 activation. No major differences were observed between the different serovars. Cell activation by Ureaplasma parvum and urealyticum seem to require lipid raft function and formation of heterotypic receptor complexes comprising of TLR2 and TLR6 on the cell surface and TLR9 intracellularly.

Synergic Activation of Toll-Like Receptor (TLR) 2/6 and 9 in Response to Ureaplasma parvum & urealyticum in Human Amniotic Epithelial Cells

PubMed Central

Triantafilou, Martha; De Glanville, Benjamin; Aboklaish, Ali F.; Spiller, O. Brad; Kotecha, Sailesh; Triantafilou, Kathy

2013-01-01

Ureaplasma species are the most frequently isolated microorganisms inside the amniotic cavity and have been associated with spontaneous abortion, chorioamnionitis, premature rupture of the membranes (PROM), preterm labour (PL) pneumonia in neonates and bronchopulmonary dysplasia in neonates. The mechanisms by which Ureaplasmas cause such diseases remain unclear, but it is believed that inappropriate induction of inflammatory responses is involved, triggered by the innate immune system. As part of its mechanism of activation, the innate immune system employs germ-lined encoded receptors, called pattern recognition receptors (PRRs) in order to “sense” pathogens. One such family of PRRs are the Toll like receptor family (TLR). In the current study we aimed to elucidate the role of TLRs in Ureaplasma-induced inflammation in human amniotic epithelial cells. Using silencing, as well as human embryonic kidney (HEK) transfected cell lines, we demonstrate that TLR2, TLR6 and TLR9 are involved in the inflammatory responses against Ureaplasma parvum and urealyticum serovars. Ureaplasma lipoproteins, such as Multiple Banded antigen (MBA), trigger responses via TLR2/TLR6, whereas the whole bacterium is required for TLR9 activation. No major differences were observed between the different serovars. Cell activation by Ureaplasma parvum and urealyticum seem to require lipid raft function and formation of heterotypic receptor complexes comprising of TLR2 and TLR6 on the cell surface and TLR9 intracellularly. PMID:23593431

Genetic variation: effect on prostate cancer

PubMed Central

Sissung, Tristan M.; Price, Douglas K.; Del Re, Marzia; Ley, Ariel M.; Giovannetti, Elisa; Danesi, Romano

2014-01-01

Summary The crucial role of androgens in the development of prostate cancer is well established. The aim of this review is to examine the role of constitutional (germline) and tumor-specific (somatic) polymorphisms within important regulatory genes of prostate cancer. These include genes encoding enzymes of the androgen biosynthetic pathway, the androgen receptor gene, genes that encode proteins of the signal transduction pathways that may have a role in disease progression and survival, and genes involved in prostate cancer angiogenesis. Characterization of deregulated pathways critical to cancer cell growth have lead to the development of new treatments, including the CYP17 inhibitor abiraterone and clinical trials using novel drugs that are ongoing or recently completed [1]. The pharmacogenetics of the drugs used to treat prostate cancer will also be addressed. This review will define how germline polymorphisms are known affect a multitude of pathways, and therefore phenotypes, in prostate cancer etiology, progression, and treatment. PMID:25199985

A public antibody lineage that potently inhibits malaria infection through dual binding to the circumsporozoite protein.

PubMed

Tan, Joshua; Sack, Brandon K; Oyen, David; Zenklusen, Isabelle; Piccoli, Luca; Barbieri, Sonia; Foglierini, Mathilde; Fregni, Chiara Silacci; Marcandalli, Jessica; Jongo, Said; Abdulla, Salim; Perez, Laurent; Corradin, Giampietro; Varani, Luca; Sallusto, Federica; Sim, Betty Kim Lee; Hoffman, Stephen L; Kappe, Stefan H I; Daubenberger, Claudia; Wilson, Ian A; Lanzavecchia, Antonio

2018-05-01

Immunization with attenuated Plasmodium falciparum sporozoites (PfSPZs) has been shown to be protective against malaria, but the features of the antibody response induced by this treatment remain unclear. To investigate this response in detail, we isolated IgM and IgG monoclonal antibodies from Tanzanian volunteers who were immunized with repeated injection of Sanaria PfSPZ Vaccine and who were found to be protected from controlled human malaria infection with infectious homologous PfSPZs. All isolated IgG monoclonal antibodies bound to P. falciparum circumsporozoite protein (PfCSP) and recognized distinct epitopes in its N terminus, NANP-repeat region, and C terminus. Strikingly, the most effective antibodies, as determined in a humanized mouse model, bound not only to the repeat region, but also to a minimal peptide at the PfCSP N-terminal junction that is not in the RTS,S vaccine. These dual-specific antibodies were isolated from different donors and were encoded by VH3-30 or VH3-33 alleles that encode tryptophan or arginine at position 52. Using structural and mutational data, we describe the elements required for germline recognition and affinity maturation. Our study provides potent neutralizing antibodies and relevant information for lineage-targeted vaccine design and immunization strategies.

Effects of anticaricaturing vs. caricaturing and their neural correlates elucidate a role of shape for face learning.

PubMed

Schulz, Claudia; Kaufmann, Jürgen M; Walther, Lydia; Schweinberger, Stefan R

2012-08-01

To assess the role of shape information for unfamiliar face learning, we investigated effects of photorealistic spatial anticaricaturing and caricaturing on later face recognition. We assessed behavioural performance and event-related brain potential (ERP) correlates of recognition, using different images of anticaricatures, veridical faces, or caricatures at learning and test. Relative to veridical faces, recognition performance improved for caricatures, with performance decrements for anticaricatures in response times. During learning, an amplitude pattern with caricatures>veridicals=anticaricatures was seen for N170, left-hemispheric ERP negativity during the P200 and N250 time segments (200-380 ms), and for a late positive component (LPC, 430-830 ms), whereas P200 and N250 responses exhibited an additional difference between veridicals and anticaricatures over the right hemisphere. During recognition, larger amplitudes for caricatures again started in the N170, whereas the P200 and the right-hemispheric N250 exhibited a more graded pattern of amplitude effects (caricatures>veridicals>anticaricatures), a result which was specific to learned but not novel faces in the N250. Together, the results (i) emphasise the role of facial shape for visual encoding in the learning of previously unfamiliar faces and (ii) provide important information about the neuronal timing of the encoding advantage enjoyed by faces with distinctive shape. Copyright © 2012 Elsevier Ltd. All rights reserved.

Background feature descriptor for offline handwritten numeral recognition

NASA Astrophysics Data System (ADS)

Ming, Delie; Wang, Hao; Tian, Tian; Jie, Feiran; Lei, Bo

2011-11-01

This paper puts forward an offline handwritten numeral recognition method based on background structural descriptor (sixteen-value numerical background expression). Through encoding the background pixels in the image according to a certain rule, 16 different eigenvalues were generated, which reflected the background condition of every digit, then reflected the structural features of the digits. Through pattern language description of images by these features, automatic segmentation of overlapping digits and numeral recognition can be realized. This method is characterized by great deformation resistant ability, high recognition speed and easy realization. Finally, the experimental results and conclusions are presented. The experimental results of recognizing datasets from various practical application fields reflect that with this method, a good recognition effect can be achieved.

Self-reactive VH4-34–expressing IgG B cells recognize commensal bacteria

PubMed Central

Glauzy, Salomé; Ng, Yen-Shing; Chamberlain, Nicolas; Massad, Christopher; Isnardi, Isabelle; Uzel, Gulbu; Holland, Steven M.; Picard, Capucine

2017-01-01

The germline immunoglobulin (Ig) variable heavy chain 4–34 (VH4-34) gene segment encodes in humans intrinsically self-reactive antibodies that recognize I/i carbohydrates expressed by erythrocytes with a specific motif in their framework region 1 (FWR1). VH4-34–expressing clones are common in the naive B cell repertoire but are rarely found in IgG memory B cells from healthy individuals. In contrast, CD27+IgG+ B cells from patients genetically deficient for IRAK4 or MYD88, which mediate the function of Toll-like receptors (TLRs) except TLR3, contained VH4-34–expressing clones and showed decreased somatic hypermutation frequencies. In addition, VH4-34–encoded IgGs from IRAK4- and MYD88-deficient patients often displayed an unmutated FWR1 motif, revealing that these antibodies still recognize I/i antigens, whereas their healthy donor counterparts harbored FWR1 mutations abolishing self-reactivity. However, this paradoxical self-reactivity correlated with these VH4-34–encoded IgG clones binding commensal bacteria antigens. Hence, B cells expressing germline-encoded self-reactive VH4-34 antibodies may represent an innate-like B cell population specialized in the containment of commensal bacteria when gut barriers are breached. PMID:28500047

Structural and affinity studies of IgM polyreactive natural autoantibodies.

PubMed

Diaw, L; Magnac, C; Pritsch, O; Buckle, M; Alzari, P M; Dighiero, G

1997-01-15

Natural polyreactive autoantibodies (NAA) are an important component of the normal B cell repertoire. One intriguing characteristic of these Abs is their binding to various dissimilar Ags. It has been generally assumed that these Abs bind the Ags with low affinity, and are encoded by germline genes. We have used surface plasmon resonance to determine binding of avidities, and conducted a structural analysis of five murine monoclonal natural autoantibodies displaying a typical polyreactive binding pattern against cytoskeleton Ags and DNA. We show that 1) all the five Abs bind the different Ags with kinetic constants similar to those observed for immune Abs; 2) they express a restricted set of V(H) and V(L) genes, since the same V(H) gene is expressed by three out of the five, and one particular Vkappa gene was expressed twice. In addition, a single D gene segment was used by three of the five Abs; and 3) they express, in most cases, genes in a close germline configuration. Our amino acid sequence and modeling studies show that the distribution of exposed side chains in the NAA paratopes is close to the general pattern observed in the complementarity-determining regions (CDRs) of variable domains from immune Abs. Although CDR3 regions of the heavy chain have been postulated to play a major role in determining polyreactivity on the basis of recombinatorial experiments, our results failed to show any distinctive particularity of this region in terms of length or charge when compared with classical immune Abs.

Absolute Position Encoders With Vertical Image Binning

NASA Technical Reports Server (NTRS)

Leviton, Douglas B.

2005-01-01

Improved optoelectronic patternrecognition encoders that measure rotary and linear 1-dimensional positions at conversion rates (numbers of readings per unit time) exceeding 20 kHz have been invented. Heretofore, optoelectronic pattern-recognition absoluteposition encoders have been limited to conversion rates <15 Hz -- too low for emerging industrial applications in which conversion rates ranging from 1 kHz to as much as 100 kHz are required. The high conversion rates of the improved encoders are made possible, in part, by use of vertically compressible or binnable (as described below) scale patterns in combination with modified readout sequences of the image sensors [charge-coupled devices (CCDs)] used to read the scale patterns. The modified readout sequences and the processing of the images thus read out are amenable to implementation by use of modern, high-speed, ultra-compact microprocessors and digital signal processors or field-programmable gate arrays. This combination of improvements makes it possible to greatly increase conversion rates through substantial reductions in all three components of conversion time: exposure time, image-readout time, and image-processing time.

Molecular Background of Colorectal Tumors From Patients with Lynch Syndrome Associated With Germline Variants in PMS2.

PubMed

Ten Broeke, S W; van Bavel, T C; Jansen, A M L; Gómez-García, E; Hes, F J; van Hest, L P; Letteboer, T G W; Olderode-Berends, M J W; Ruano, D; Spruijt, L; Suerink, M; Tops, C M; van Eijk, R; Morreau, H; van Wezel, T; Nielsen, M

2018-05-11

Germline variants in the mismatch repair genes MLH1, MSH2 (EPCAM), MSH6, or PMS2 cause Lynch syndrome. Patients with these variants have an increased risk of developing colorectal cancers (CRCs) that differ from sporadic CRCs in genetic and histologic features. It has been a challenge to study CRCs associated with PMS2 variants (PMS2-associated CRCs) because these develop less frequently and in patients of older ages than colorectal tumors with variants in the other mismatch repair genes. We analyzed 20 CRCs associated with germline variants in PMS2, 22 sporadic CRCs, 18 CRCs with germline variants in MSH2, and 24 CRCs from patients with germline variants in MLH1. Tumor tissue blocks were collected from Dutch pathology departments in 2017. After extraction of tumor DNA, we used a platform designed to detect approximately 3000 somatic hotspot variants in 55 genes (including KRAS, APC, CTNNB1, and TP53). Somatic variant frequencies were compared using the Fisher's exact test. None of the PMS2-associated CRCs contained any somatic variants in the catenin beta 1 gene (CTNNB1), which encodes β-catenin, whereas 14/24 MLH1-associated CRCs (58%) contained variants in CTNNB1. Half of PMS2-associated CRCs contained KRAS variants, but only 20% of these were in hotspots that encoded G12D or G13D. These hotspot variants occurred more frequently in CRCs associated with variants in MLH1 (37.5%, P=.44) and MSH2 (and 71.4%, P=.035) than with variants in PMS2. In a genetic analysis of 84 colorectal tumors, we found tumors from patients with PMS2-associated Lynch syndrome to be distinct from colorectal tumors associated with defects in other mismatch repair genes. This might account for differences in development and less frequent occurrence. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.

Germline Genetic IKZF1 Variation and Predisposition to Childhood Acute Lymphoblastic Leukemia.

PubMed

Churchman, Michelle L; Qian, Maoxiang; Te Kronnie, Geertruy; Zhang, Ranran; Yang, Wenjian; Zhang, Hui; Lana, Tobia; Tedrick, Paige; Baskin, Rebekah; Verbist, Katherine; Peters, Jennifer L; Devidas, Meenakshi; Larsen, Eric; Moore, Ian M; Gu, Zhaohui; Qu, Chunxu; Yoshihara, Hiroki; Porter, Shaina N; Pruett-Miller, Shondra M; Wu, Gang; Raetz, Elizabeth; Martin, Paul L; Bowman, W Paul; Winick, Naomi; Mardis, Elaine; Fulton, Robert; Stanulla, Martin; Evans, William E; Relling, Mary V; Pui, Ching-Hon; Hunger, Stephen P; Loh, Mignon L; Handgretinger, Rupert; Nichols, Kim E; Yang, Jun J; Mullighan, Charles G

2018-05-14

Somatic genetic alterations of IKZF1, which encodes the lymphoid transcription factor IKAROS, are common in high-risk B-progenitor acute lymphoblastic leukemia (ALL) and are associated with poor prognosis. Such alterations result in the acquisition of stem cell-like features, overexpression of adhesion molecules causing aberrant cell-cell and cell-stroma interaction, and decreased sensitivity to tyrosine kinase inhibitors. Here we report coding germline IKZF1 variation in familial childhood ALL and 0.9% of presumed sporadic B-ALL, identifying 28 unique variants in 45 children. The majority of variants adversely affected IKZF1 function and drug responsiveness of leukemic cells. These results identify IKZF1 as a leukemia predisposition gene, and emphasize the importance of germline genetic variation in the development of both familial and sporadic ALL. Copyright © 2018 Elsevier Inc. All rights reserved.

Learning to recognize face shapes through serial exploration.

PubMed

Wallraven, Christian; Whittingstall, Lisa; Bülthoff, Heinrich H

2013-05-01

Human observers are experts at visual face recognition due to specialized visual mechanisms for face processing that evolve with perceptual expertize. Such expertize has long been attributed to the use of configural processing, enabled by fast, parallel information encoding of the visual information in the face. Here we tested whether participants can learn to efficiently recognize faces that are serially encoded-that is, when only partial visual information about the face is available at any given time. For this, ten participants were trained in gaze-restricted face recognition in which face masks were viewed through a small aperture controlled by the participant. Tests comparing trained with untrained performance revealed (1) a marked improvement in terms of speed and accuracy, (2) a gradual development of configural processing strategies, and (3) participants' ability to rapidly learn and accurately recognize novel exemplars. This performance pattern demonstrates that participants were able to learn new strategies to compensate for the serial nature of information encoding. The results are discussed in terms of expertize acquisition and relevance for other sensory modalities relying on serial encoding.

Separating the FN400 and N400 potentials across recognition memory experiments

PubMed Central

Stróżak, Paweł; Abedzadeh, Delora; Curran, Tim

2016-01-01

There is a growing debate as to whether frontally distributed FN400 potentials reflect familiarity-based recognition or are functionally identical to centro-parietal N400 reflecting semantic processing. We conducted two experiments in which event-related potentials (ERPs) associated with semantic priming and recognition were recorded, either when priming was embedded within a recognition test (Experiment 1), or when these two phases were separated (Experiment 2). In Experiment 1, we observed 300–500 ms differences between primed and unprimed old words as well as differences between old and new primed words, but these two effects did not differ topographically and both showed midline central maxima. In Experiment 2, the N400 for priming was recorded exclusively during encoding and again showed a midline central distribution. The ERP component of recognition was only found for unrelated words (not primed previously during encoding), and also showed a midline central maximum, but, in addition, was present in the left frontal area of the scalp. Conversely, the priming effect was absent in the left frontal cluster. This pattern of results indicate that FN400 and N400 potentials share similar neural generators; but when priming and recognition are not confounded, these potentials do not entirely overlap in terms of topographical distribution and presumably reflect functionally distinct processes. PMID:26776478

Learning graph matching.

PubMed

Caetano, Tibério S; McAuley, Julian J; Cheng, Li; Le, Quoc V; Smola, Alex J

2009-06-01

As a fundamental problem in pattern recognition, graph matching has applications in a variety of fields, from computer vision to computational biology. In graph matching, patterns are modeled as graphs and pattern recognition amounts to finding a correspondence between the nodes of different graphs. Many formulations of this problem can be cast in general as a quadratic assignment problem, where a linear term in the objective function encodes node compatibility and a quadratic term encodes edge compatibility. The main research focus in this theme is about designing efficient algorithms for approximately solving the quadratic assignment problem, since it is NP-hard. In this paper we turn our attention to a different question: how to estimate compatibility functions such that the solution of the resulting graph matching problem best matches the expected solution that a human would manually provide. We present a method for learning graph matching: the training examples are pairs of graphs and the 'labels' are matches between them. Our experimental results reveal that learning can substantially improve the performance of standard graph matching algorithms. In particular, we find that simple linear assignment with such a learning scheme outperforms Graduated Assignment with bistochastic normalisation, a state-of-the-art quadratic assignment relaxation algorithm.

Identification of Grandchildless Loci Whose Products Are Required for Normal Germ-Line Development in the Nematode Caenorhabditis Elegans

PubMed Central

Capowski, E. E.; Martin, P.; Garvin, C.; Strome, S.

1991-01-01

To identify genes that encode maternal components required for development of the germ line in the nematode Caenorhabditis elegans, we have screened for mutations that confer a maternal-effect sterile or ``grandchildless'' phenotype: homozygous mutant hermaphrodites produced by heterozygous mothers are themselves fertile, but produce sterile progeny. Our screens have identified six loci, defined by 21 mutations. This paper presents genetic and phenotypic characterization of four of the loci. The majority of mutations, those in mes-2, mes-3 and mes-4, affect postembryonic germ-line development; the progeny of mutant mothers undergo apparently normal embryogenesis but develop into agametic adults with 10-1000-fold reductions in number of germ cells. In contrast, mutations in mes-1 cause defects in cytoplasmic partitioning during embryogenesis, and the resulting larvae lack germ-line progenitor cells. Mutations in all of the mes loci primarily affect the germ line, and none disrupt the structural integrity of germ granules. This is in contrast to grandchildless mutations in Drosophila melanogaster, all of which disrupt germ granules and affect abdominal as well as germ-line development. PMID:1783292

Mutual information-based facial expression recognition

NASA Astrophysics Data System (ADS)

Hazar, Mliki; Hammami, Mohamed; Hanêne, Ben-Abdallah

2013-12-01

This paper introduces a novel low-computation discriminative regions representation for expression analysis task. The proposed approach relies on interesting studies in psychology which show that most of the descriptive and responsible regions for facial expression are located around some face parts. The contributions of this work lie in the proposition of new approach which supports automatic facial expression recognition based on automatic regions selection. The regions selection step aims to select the descriptive regions responsible or facial expression and was performed using Mutual Information (MI) technique. For facial feature extraction, we have applied Local Binary Patterns Pattern (LBP) on Gradient image to encode salient micro-patterns of facial expressions. Experimental studies have shown that using discriminative regions provide better results than using the whole face regions whilst reducing features vector dimension.

Misremembering what you see or hear: Dissociable effects of modality on short- and long-term false recognition.

PubMed

Olszewska, Justyna M; Reuter-Lorenz, Patricia A; Munier, Emily; Bendler, Sara A

2015-09-01

False working memories readily emerge using a visual item-recognition variant of the converging associates task. Two experiments, manipulating study and test modality, extended prior working memory results by demonstrating a reliable false recognition effect (more false alarms to associatively related lures than to unrelated lures) within seconds of encoding in either the visual or auditory modality. However, false memories were nearly twice as frequent when study lists were seen than when they were heard, regardless of test modality, although study-test modality mismatch was generally disadvantageous (consistent with encoding specificity). A final experiment that varied study-test modality using a hybrid short- and long-term memory test (Flegal, Atkins & Reuter-Lorenz, 2010) replicated the auditory advantage in the short term but revealed a reversal in the long term: The false memory effect was greater in the auditory study-test condition than in the visual study-test condition. Thus, the same encoding conditions gave rise to an opposite modality advantage depending on whether recognition was tested under short-term or long-term memory conditions. Although demonstrating continuity in associative processing across delay, the results indicate that delay condition affects the availability of modality-dependent features of the memory trace and, thus, distinctiveness, leading to dissociable patterns of short- and long-term memory performance. (c) 2015 APA, all rights reserved).

Face Encoding and Recognition in the Human Brain

NASA Astrophysics Data System (ADS)

Haxby, James V.; Ungerleider, Leslie G.; Horwitz, Barry; Maisog, Jose Ma.; Rapoport, Stanley I.; Grady, Cheryl L.

1996-01-01

A dissociation between human neural systems that participate in the encoding and later recognition of new memories for faces was demonstrated by measuring memory task-related changes in regional cerebral blood flow with positron emission tomography. There was almost no overlap between the brain structures associated with these memory functions. A region in the right hippocampus and adjacent cortex was activated during memory encoding but not during recognition. The most striking finding in neocortex was the lateralization of prefrontal participation. Encoding activated left prefrontal cortex, whereas recognition activated right prefrontal cortex. These results indicate that the hippocampus and adjacent cortex participate in memory function primarily at the time of new memory encoding. Moreover, face recognition is not mediated simply by recapitulation of operations performed at the time of encoding but, rather, involves anatomically dissociable operations.

Intact suppression of increased false recognition in schizophrenia.

PubMed

Weiss, Anthony P; Dodson, Chad S; Goff, Donald C; Schacter, Daniel L; Heckers, Stephan

2002-09-01

Recognition memory is impaired in patients with schizophrenia, as they rely largely on item familiarity, rather than conscious recollection, to make mnemonic decisions. False recognition of novel items (foils) is increased in schizophrenia and may relate to this deficit in conscious recollection. By studying pictures of the target word during encoding, healthy adults can suppress false recognition. This study examined the effect of pictorial encoding on subsequent recognition of repeated foils in patients with schizophrenia. The study included 40 patients with schizophrenia and 32 healthy comparison subjects. After incidental encoding of 60 words or pictures, subjects were tested for recognition of target items intermixed with 60 new foils. These new foils were subsequently repeated following either a two- or 24-word delay. Subjects were instructed to label these repeated foils as new and not to mistake them for old target words. Schizophrenic patients showed greater overall false recognition of repeated foils. The rate of false recognition of repeated foils was lower after picture encoding than after word encoding. Despite higher levels of false recognition of repeated new items, patients and comparison subjects demonstrated a similar degree of false recognition suppression after picture, as compared to word, encoding. Patients with schizophrenia displayed greater false recognition of repeated foils than comparison subjects, suggesting both a decrement of item- (or source-) specific recollection and a consequent reliance on familiarity in schizophrenia. Despite these deficits, presenting pictorial information at encoding allowed schizophrenic subjects to suppress false recognition to a similar degree as the comparison group, implying the intact use of a high-level cognitive strategy in this population.

Oscillatory neural network for pattern recognition: trajectory based classification and supervised learning.

PubMed

Miller, Vonda H; Jansen, Ben H

2008-12-01

Computer algorithms that match human performance in recognizing written text or spoken conversation remain elusive. The reasons why the human brain far exceeds any existing recognition scheme to date in the ability to generalize and to extract invariant characteristics relevant to category matching are not clear. However, it has been postulated that the dynamic distribution of brain activity (spatiotemporal activation patterns) is the mechanism by which stimuli are encoded and matched to categories. This research focuses on supervised learning using a trajectory based distance metric for category discrimination in an oscillatory neural network model. Classification is accomplished using a trajectory based distance metric. Since the distance metric is differentiable, a supervised learning algorithm based on gradient descent is demonstrated. Classification of spatiotemporal frequency transitions and their relation to a priori assessed categories is shown along with the improved classification results after supervised training. The results indicate that this spatiotemporal representation of stimuli and the associated distance metric is useful for simple pattern recognition tasks and that supervised learning improves classification results.

Pollen Image Recognition Based on DGDB-LBP Descriptor

NASA Astrophysics Data System (ADS)

Han, L. P.; Xie, Y. H.

2018-01-01

In this paper, we propose DGDB-LBP, a local binary pattern descriptor based on the pixel blocks in the dominant gradient direction. Differing from traditional LBP and its variants, DGDB-LBP encodes by comparing the main gradient magnitude of each block rather than the single pixel value or the average of pixel blocks, in doing so, it reduces the influence of noise on pollen images and eliminates redundant and non-informative features. In order to fully describe the texture features of pollen images and analyze it under multi-scales, we propose a new sampling strategy, which uses three types of operators to extract the radial, angular and multiple texture features under different scales. Considering that the pollen images have some degree of rotation under the microscope, we propose the adaptive encoding direction, which is determined by the texture distribution of local region. Experimental results on the Pollenmonitor dataset show that the average correct recognition rate of our method is superior to other pollen recognition methods in recent years.

The actin-binding protein profilin is required for germline stem cell maintenance and germ cell enclosure by somatic cyst cells

PubMed Central

Shields, Alicia R.; Spence, Allyson C.; Yamashita, Yukiko M.; Davies, Erin L.; Fuller, Margaret T.

2014-01-01

Specialized microenvironments, or niches, provide signaling cues that regulate stem cell behavior. In the Drosophila testis, the JAK-STAT signaling pathway regulates germline stem cell (GSC) attachment to the apical hub and somatic cyst stem cell (CySC) identity. Here, we demonstrate that chickadee, the Drosophila gene that encodes profilin, is required cell autonomously to maintain GSCs, possibly facilitating localization or maintenance of E-cadherin to the GSC-hub cell interface. Germline specific overexpression of Adenomatous Polyposis Coli 2 (APC2) rescued GSC loss in chic hypomorphs, suggesting an additive role of APC2 and F-actin in maintaining the adherens junctions that anchor GSCs to the niche. In addition, loss of chic function in the soma resulted in failure of somatic cyst cells to maintain germ cell enclosure and overproliferation of transit-amplifying spermatogonia. PMID:24346697

Germline CYBB mutations that selectively affect macrophages in kindreds with X-linked predisposition to tuberculous mycobacterial disease

PubMed Central

Bustamante, Jacinta; Arias, Andres A; Vogt, Guillaume; Picard, Capucine; Galicia, Lizbeth Blancas; Prando, Carolina; Grant, Audrey V; Marchal, Christophe C; Hubeau, Marjorie; Chapgier, Ariane; de Beaucoudrey, Ludovic; Puel, Anne; Feinberg, Jacqueline; Valinetz, Ethan; Jannière, Lucile; Besse, Céline; Boland, Anne; Brisseau, Jean-Marie; Blanche, Stéphane; Lortholary, Olivier; Fieschi, Claire; Emile, Jean-François; Boisson-Dupuis, Stéphanie; Al-Muhsen, Saleh; Woda, Bruce; Newburger, Peter E; Condino-Neto, Antonio; Dinauer, Mary C; Abel, Laurent; Casanova, Jean-Laurent

2011-01-01

Germline mutations in CYBB, the human gene encoding the gp91phox subunit of the phagocyte NADPH oxidase, impair the respiratory burst of all types of phagocytes and result in X-linked chronic granulomatous disease (CGD). We report here two kindreds in which otherwise healthy male adults developed X-linked recessive Mendelian susceptibility to mycobacterial disease (MSMD) syndromes. These patients had previously unknown mutations in CYBB that resulted in an impaired respiratory burst in monocyte-derived macrophages but not in monocytes or granulocytes. The macrophage-specific functional consequences of the germline mutation resulted from cell-specific impairment in the assembly of the NADPH oxidase. This ‘experiment of nature’ indicates that CYBB is associated with MSMD and demonstrates that the respiratory burst in human macrophages is a crucial mechanism for protective immunity to tuberculous mycobacteria. PMID:21278736

Deficits in Cross-Race Face Learning: Insights From Eye Movements and Pupillometry

PubMed Central

Goldinger, Stephen D.; He, Yi; Papesh, Megan H.

2010-01-01

The own-race bias (ORB) is a well-known finding wherein people are better able to recognize and discriminate own-race faces, relative to cross-race faces. In 2 experiments, participants viewed Asian and Caucasian faces, in preparation for recognition memory tests, while their eye movements and pupil diameters were continuously monitored. In Experiment 1 (with Caucasian participants), systematic differences emerged in both measures as a function of depicted race: While encoding cross-race faces, participants made fewer (and longer) fixations, they preferentially attended to different sets of features, and their pupils were more dilated, all relative to own-race faces. Also, in both measures, a pattern emerged wherein some participants reduced their apparent encoding effort to cross-race faces over trials. In Experiment 2 (with Asian participants), the authors observed the same patterns, although the ORB favored the opposite set of faces. Taken together, the results suggest that the ORB appears during initial perceptual encoding. Relative to own-race face encoding, cross-race encoding requires greater effort, which may reduce vigilance in some participants. PMID:19686008

Latency of modality-specific reactivation of auditory and visual information during episodic memory retrieval.

PubMed

Ueno, Daisuke; Masumoto, Kouhei; Sutani, Kouichi; Iwaki, Sunao

2015-04-15

This study used magnetoencephalography (MEG) to examine the latency of modality-specific reactivation in the visual and auditory cortices during a recognition task to determine the effects of reactivation on episodic memory retrieval. Nine right-handed healthy young adults participated in the experiment. The experiment consisted of a word-encoding phase and two recognition phases. Three encoding conditions were included: encoding words alone (word-only) and encoding words presented with either related pictures (visual) or related sounds (auditory). The recognition task was conducted in the MEG scanner 15 min after the completion of the encoding phase. After the recognition test, a source-recognition task was given, in which participants were required to choose whether each recognition word was not presented or was presented with which information during the encoding phase. Word recognition in the auditory condition was higher than that in the word-only condition. Confidence-of-recognition scores (d') and the source-recognition test showed superior performance in both the visual and the auditory conditions compared with the word-only condition. An equivalent current dipoles analysis of MEG data indicated that higher equivalent current dipole amplitudes in the right fusiform gyrus occurred during the visual condition and in the superior temporal auditory cortices during the auditory condition, both 450-550 ms after onset of the recognition stimuli. Results suggest that reactivation of visual and auditory brain regions during recognition binds language with modality-specific information and that reactivation enhances confidence in one's recognition performance.

Germline transformation of the butterfly Bicyclus anynana.

PubMed

Marcus, Jeffrey M; Ramos, Diane M; Monteiro, Antónia

2004-08-07

Ecological and evolutionary theory has frequently been inspired by the diversity of colour patterns on the wings of butterflies. More recently, these varied patterns have also become model systems for studying the evolution of developmental mechanisms. A technique that will facilitate our understanding of butterfly colour-pattern development is germline transformation. Germline transformation permits functional tests of candidate gene products and of cis-regulatory regions, and provides a means of generating new colour-pattern mutants by insertional mutagenesis. We report the successful transformation of the African satyrid butterfly Bicyclus anynana with two different transposable element vectors, Hermes and piggyBac, each carrying EGFP coding sequences driven by the 3XP3 synthetic enhancer that drives gene expression in the eyes. Candidate lines identified by screening for EGFP in adult eyes were later confirmed by PCR amplification of a fragment of the EGFP coding sequence from genomic DNA. Flanking DNA surrounding the insertions was amplified by inverse PCR and sequenced. Transformation rates were 5% for piggyBac and 10.2% for Hermes. Ultimately, the new data generated by these techniques may permit an integrated understanding of the developmental genetics of colour-pattern formation and of the ecological and evolutionary processes in which these patterns play a role.

Deep and shallow encoding effects on face recognition: an ERP study.

PubMed

Marzi, Tessa; Viggiano, Maria Pia

2010-12-01

Event related potentials (ERPs) were employed to investigate whether and when brain activity related to face recognition varies according to the processing level undertaken at encoding. Recognition was assessed when preceded by a "shallow" (orientation judgement) or by a "deep" study task (occupation judgement). Moreover, we included a further manipulation by presenting at encoding faces either in the upright or inverted orientation. As expected, deeply encoded faces were recognized more accurately and more quickly with respect to shallowly encoded faces. The ERP showed three main findings: i) as witnessed by more positive-going potentials for deeply encoded faces, at early and later processing stage, face recognition was influenced by the processing strategy adopted during encoding; ii) structural encoding, indexed by the N170, turned out to be "cognitively penetrable" showing repetition priming effects for deeply encoded faces; iii) face inversion, by disrupting configural processing during encoding, influenced memory related processes for deeply encoded faces and impaired the recognition of faces shallowly processed. The present study adds weight to the concept that the depth of processing during memory encoding affects retrieval. We found that successful retrieval following deep encoding involved both familiarity- and recollection-related processes showing from 500 ms a fronto-parietal distribution, whereas shallow encoding affected only earlier processing stages reflecting perceptual priming. Copyright © 2010 Elsevier B.V. All rights reserved.

Identification and transcriptional analysis of two types of lectins (SgCTL-1 and SgGal-1) from mollusk Solen grandis.

PubMed

Wei, Xiumei; Yang, Jianmin; Liu, Xiangquan; Yang, Dinglong; Xu, Jie; Fang, Jinghui; Wang, Weijun; Yang, Jialong

2012-08-01

C-type lectin and galectin are two types of animal carbohydrate-binding proteins which serve as pathogen recognition molecules and play crucial roles in the innate immunity of invertebrates. In the present study, a C-type lectin (designated as SgCTL-1) and galectin (designated as SgGal-1) were identified from mollusk Solen grandis, and their expression patterns, both in tissues and toward three pathogen-associated molecular patterns (PAMPs) stimulation were characterized. The full-length cDNA of SgCTL-1 and SgGal-1 was 1280 and 1466 bp, containing an open reading frame (ORF) of 519 and 1218 bp, respectively. Their deduced amino acid sequences showed high similarity to other members of C-type lectin and galectin superfamily, respectively. SgCTL-1 encoded a single carbohydrate-recognition domain (CRD), and the motif of Ca(2+)-binding site 2 was EPN (Glu(135)-Pro(136)-Asn(137)). While SgGal-1 encoded two CRDs, and the amino acid residues constituted the carbohydrate-binding motifs were well conserved in CRD1 but partially conserved in CRD2. Although SgCTL-1 and SgGal-1 exhibited different tissue expression pattern, they were both constitutively expressed in all tested tissues, including hemocytes, gonad, mantle, muscle, gill and hepatopancreas, and they were both highly expressed in hepatopancreas and gill. Furthermore, the mRNA expression of two lectins in hemocytes was significantly (P < 0.01) up-regulated with different levels after S. grandis were stimulated by lipopolysaccharide (LPS), peptidoglycan (PGN) or β-1,3-glucan. Our results suggested that SgCTL-1 and SgGal-1 from razor clam were two novel members of animal lectins, and they might function as pattern recognition receptors (PRRs) taking part in the process of pathogen recognition. Copyright © 2012 Elsevier Ltd. All rights reserved.

Germline TRAV5D-4 T-Cell Receptor Sequence Targets a Primary Insulin Peptide of NOD Mice

PubMed Central

Nakayama, Maki; Castoe, Todd; Sosinowski, Tomasz; He, XiangLing; Johnson, Kelly; Haskins, Kathryn; Vignali, Dario A.A.; Gapin, Laurent; Pollock, David; Eisenbarth, George S.

2012-01-01

There is accumulating evidence that autoimmunity to insulin B chain peptide, amino acids 9–23 (insulin B:9–23), is central to development of autoimmune diabetes of the NOD mouse model. We hypothesized that enhanced susceptibility to autoimmune diabetes is the result of targeting of insulin by a T-cell receptor (TCR) sequence commonly encoded in the germline. In this study, we aimed to demonstrate that a particular Vα gene TRAV5D-4 with multiple junction sequences is sufficient to induce anti-islet autoimmunity by studying retrogenic mouse lines expressing α-chains with different Vα TRAV genes. Retrogenic NOD strains expressing Vα TRAV5D-4 α-chains with many different complementarity determining region (CDR) 3 sequences, even those derived from TCRs recognizing islet-irrelevant molecules, developed anti-insulin autoimmunity. Induction of insulin autoantibodies by TRAV5D-4 α-chains was abrogated by the mutation of insulin peptide B:9–23 or that of two amino acid residues in CDR1 and 2 of the TRAV5D-4. TRAV13–1, the human ortholog of murine TRAV5D-4, was also capable of inducing in vivo anti-insulin autoimmunity when combined with different murine CDR3 sequences. Targeting primary autoantigenic peptides by simple germline-encoded TCR motifs may underlie enhanced susceptibility to the development of autoimmune diabetes. PMID:22315318

Molecular basis of the allelic inheritance of rabbit immunoglobulin VH allotypes: implications for the generation of antibody diversity.

PubMed

Knight, K L; Becker, R S

1990-03-23

Rabbits are unique in that their immunoglobulin VH regions bear allotypic markers encoded by allelic genes. The presence of these markers on most serum immunoglobulins is difficult to explain, as the germline contains several hundred VH genes. We cloned VH genes from normal rabbits of the VHa allotypes a1, a2, and a3 and from a mutant a2 rabbit, Alicia, which expresses almost no a2 allotype. The D-proximal VH gene VH1 of normal rabbits encoded prototype a1, a2, or a3 allotype VH regions in a1, a2, or a3 rabbits, respectively; VH1 was shown to be preferentially utilized in leukemic rabbit B cells. This VH1 gene was deleted from the germline of the Alicia rabbit. These data suggest that the allelic inheritance of a allotypes results from preferential utilization of VH1 in VDJ rearrangements. We suggest that antibody diversity in rabbit primarily results from somatic hypermutation and gene conversion.

VIPRAM_L1CMS: a 2-Tier 3D Architecture for Pattern Recognition for Track Finding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoff, J. R.; Joshi, Joshi,S.; Liu, Liu,

In HEP tracking trigger applications, flagging an individual detector hit is not important. Rather, the path of a charged particle through many detector layers is what must be found. Moreover, given the increased luminosity projected for future LHC experiments, this type of track finding will be required within the Level 1 Trigger system. This means that future LHC experiments require not just a chip capable of high-speed track finding but also one with a high-speed readout architecture. VIPRAM_L1CMS is 2-Tier Vertically Integrated chip designed to fulfill these requirements. It is a complete pipelined Pattern Recognition Associative Memory (PRAM) architecture includingmore » pattern recognition, result sparsification, and readout for Level 1 trigger applications in CMS with 15-bit wide detector addresses and eight detector layers included in the track finding. Pattern recognition is based on classic Content Addressable Memories with a Current Race Scheme to reduce timing complexity and a 4-bit Selective Precharge to minimize power consumption. VIPRAM_L1CMS uses a pipelined set of priority-encoded binary readout structures to sparsify and readout active road flags at frequencies of at least 100MHz. VIPRAM_L1CMS is designed to work directly with the Pulsar2b Architecture.« less

S6K links cell fate, cell cycle and nutrient response in C. elegans germline stem/progenitor cells

PubMed Central

Korta, Dorota Z.; Tuck, Simon; Hubbard, E. Jane Albert

2012-01-01

Coupling of stem/progenitor cell proliferation and differentiation to organismal physiological demands ensures the proper growth and homeostasis of tissues. However, in vivo mechanisms underlying this control are poorly characterized. We investigated the role of ribosomal protein S6 kinase (S6K) at the intersection of nutrition and the establishment of a stem/progenitor cell population using the C. elegans germ line as a model. We find that rsks-1 (which encodes the worm homolog of mammalian p70S6K) is required germline-autonomously for proper establishment of the germline progenitor pool. In the germ line, rsks-1 promotes cell cycle progression and inhibits larval progenitor differentiation, promotes growth of adult tumors and requires a conserved TOR phosphorylation site. Loss of rsks-1 and ife-1 (eIF4E) together reduces the germline progenitor pool more severely than either single mutant and similarly to reducing the activity of let-363 (TOR) or daf-15 (RAPTOR). Moreover, rsks-1 acts in parallel with the glp-1 (Notch) and daf-2 (insulin-IGF receptor) pathways, and does not share the same genetic dependencies with its role in lifespan control. We show that overall dietary restriction and amino acid deprivation cause germline defects similar to a subset of rsks-1 mutant phenotypes. Consistent with a link between diet and germline proliferation via rsks-1, loss of rsks-1 renders the germ line largely insensitive to the effects of dietary restriction. Our studies establish the C. elegans germ line as an in vivo model to understand TOR-S6K signaling in proliferation and differentiation and suggest that this pathway is a key nutrient-responsive regulator of germline progenitors. PMID:22278922

Neural Processing of Vocal Emotion and Identity

ERIC Educational Resources Information Center

Spreckelmeyer, Katja N.; Kutas, Marta; Urbach, Thomas; Altenmuller, Eckart; Munte, Thomas F.

2009-01-01

The voice is a marker of a person's identity which allows individual recognition even if the person is not in sight. Listening to a voice also affords inferences about the speaker's emotional state. Both these types of personal information are encoded in characteristic acoustic feature patterns analyzed within the auditory cortex. In the present…

A Motion-Based Feature for Event-Based Pattern Recognition

PubMed Central

Clady, Xavier; Maro, Jean-Matthieu; Barré, Sébastien; Benosman, Ryad B.

2017-01-01

This paper introduces an event-based luminance-free feature from the output of asynchronous event-based neuromorphic retinas. The feature consists in mapping the distribution of the optical flow along the contours of the moving objects in the visual scene into a matrix. Asynchronous event-based neuromorphic retinas are composed of autonomous pixels, each of them asynchronously generating “spiking” events that encode relative changes in pixels' illumination at high temporal resolutions. The optical flow is computed at each event, and is integrated locally or globally in a speed and direction coordinate frame based grid, using speed-tuned temporal kernels. The latter ensures that the resulting feature equitably represents the distribution of the normal motion along the current moving edges, whatever their respective dynamics. The usefulness and the generality of the proposed feature are demonstrated in pattern recognition applications: local corner detection and global gesture recognition. PMID:28101001

Towards biological plausibility of electronic noses: A spiking neural network based approach for tea odour classification.

PubMed

Sarkar, Sankho Turjo; Bhondekar, Amol P; Macaš, Martin; Kumar, Ritesh; Kaur, Rishemjit; Sharma, Anupma; Gulati, Ashu; Kumar, Amod

2015-11-01

The paper presents a novel encoding scheme for neuronal code generation for odour recognition using an electronic nose (EN). This scheme is based on channel encoding using multiple Gaussian receptive fields superimposed over the temporal EN responses. The encoded data is further applied to a spiking neural network (SNN) for pattern classification. Two forms of SNN, a back-propagation based SpikeProp and a dynamic evolving SNN are used to learn the encoded responses. The effects of information encoding on the performance of SNNs have been investigated. Statistical tests have been performed to determine the contribution of the SNN and the encoding scheme to overall odour discrimination. The approach has been implemented in odour classification of orthodox black tea (Kangra-Himachal Pradesh Region) thereby demonstrating a biomimetic approach for EN data analysis. Copyright © 2015 Elsevier Ltd. All rights reserved.

The effects of a subpsychotic dose of ketamine on recognition and source memory for agency: implications for pharmacological modelling of core symptoms of schizophrenia.

PubMed

Honey, Garry D; O'loughlin, Chris; Turner, Danielle C; Pomarol-Clotet, Edith; Corlett, Philip R; Fletcher, Paul C

2006-02-01

Ketamine is increasingly used to model the cognitive deficits and symptoms of schizophrenia. We investigated the extent to which ketamine administration in healthy volunteers reproduces the deficits in episodic recognition memory and agency source monitoring reported in schizophrenia. Intravenous infusions of placebo or 100 ng/ml ketamine were administered to 12 healthy volunteers in a double-blind, placebo-controlled, randomized, within-subjects study. In response to presented words, the subject or experimenter performed a deep or shallow encoding task, providing a 2(drug) x 2(depth of processing) x 2(agency) factorial design. At test, subjects discriminated old/new words, and recalled the sources (task and agent). Data were analyzed using multinomial modelling to identify item recognition, source memory for agency and task, and guessing biases. Under ketamine, item recognition and cued recall of deeply encoded items were impaired, replicating previous findings. In contrast to schizophrenia, there was a reduced tendency to externalize agency source guessing biases under ketamine. While the recognition memory deficit observed with ketamine is consistent with previous work and with schizophrenia, the changes in source memory differ from those reported in schizophrenic patients. This difference may account for the pattern of psychopathology induced by ketamine.

Phenotypic and Molecular Analysis of Mes-3, a Maternal-Effect Gene Required for Proliferation and Viability of the Germ Line in C. Elegans

PubMed Central

Paulsen, J. E.; Capowski, E. E.; Strome, S.

1995-01-01

mes-3 is one of four maternal-effect sterile genes that encode maternal components required for normal postembryonic development of the germ line in Caenorhabditis elegans. mes-3 mutant mothers produce sterile progeny, which contain few germ cells and no gametes. This terminal phenotype reflects two problems: reduced proliferation of the germ line and germ cell death. Both the appearance of the dying germ cells and the results of genetic tests indicate that germ cells in mes-3 animals undergo a necrotic-like death, not programmed cell death. The few germ cells that appear healthy in mes-3 worms do not differentiate into gametes, even after elimination of the signaling pathway that normally maintains the undifferentiated population of germ cells. Thus, mes-3 encodes a maternally supplied product that is required both for proliferation of the germ line and for maintenance of viable germ cells that are competent to differentiate into gametes. Cloning and molecular characterization of mes-3 revealed that it is the upstream gene in an operon. The genes in the operon display parallel expression patterns; transcripts are present throughout development and are not restricted to germ-line tissue. Both mes-3 and the downstream gene in the operon encode novel proteins. PMID:8601481

RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.

PubMed

Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F

2005-01-01

In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.

Simultaneous Local Binary Feature Learning and Encoding for Homogeneous and Heterogeneous Face Recognition.

PubMed

Lu, Jiwen; Erin Liong, Venice; Zhou, Jie

2017-08-09

In this paper, we propose a simultaneous local binary feature learning and encoding (SLBFLE) approach for both homogeneous and heterogeneous face recognition. Unlike existing hand-crafted face descriptors such as local binary pattern (LBP) and Gabor features which usually require strong prior knowledge, our SLBFLE is an unsupervised feature learning approach which automatically learns face representation from raw pixels. Unlike existing binary face descriptors such as the LBP, discriminant face descriptor (DFD), and compact binary face descriptor (CBFD) which use a two-stage feature extraction procedure, our SLBFLE jointly learns binary codes and the codebook for local face patches so that discriminative information from raw pixels from face images of different identities can be obtained by using a one-stage feature learning and encoding procedure. Moreover, we propose a coupled simultaneous local binary feature learning and encoding (C-SLBFLE) method to make the proposed approach suitable for heterogeneous face matching. Unlike most existing coupled feature learning methods which learn a pair of transformation matrices for each modality, we exploit both the common and specific information from heterogeneous face samples to characterize their underlying correlations. Experimental results on six widely used face datasets are presented to demonstrate the effectiveness of the proposed method.

Face-Name Association Learning and Brain Structural Substrates in Alcoholism

PubMed Central

Pitel, Anne-Lise; Chanraud, Sandra; Rohlfing, Torsten; Pfefferbaum, Adolf; Sullivan, Edith V.

2011-01-01

Background Associative learning is required for face-name association and is impaired in alcoholism, but the cognitive processes and brain structural components underlying this deficit remain unclear. It is also unknown whether prompting alcoholics to implement a deep level of processing during face-name encoding would enhance performance. Methods Abstinent alcoholics and controls performed a levels-of-processing face-name learning task. Participants indicated whether the face was that of an honest person (deep encoding) or that of a man (shallow encoding). Retrieval was examined using an associative (face-name) recognition task and a single-item (face or name only) recognition task. Participants also underwent a 3T structural MRI. Results Compared with controls, alcoholics had poorer associative and single-item recognition, each impaired to the same extent. Level of processing at encoding had little effect on recognition performance but affected reaction time. Correlations with brain volumes were generally modest and based primarily on reaction time in alcoholics, where the deeper the processing at encoding, the more restricted the correlations with brain volumes. In alcoholics, longer control task reaction times correlated modestly with volumes across several anterior to posterior brain regions; shallow encoding correlated with calcarine and striatal volumes; deep encoding correlated with precuneus and parietal volumes; associative recognition RT correlated with cerebellar volumes. In controls, poorer associative recognition with deep encoding correlated significantly with smaller volumes of frontal and striatal structures. Conclusions Despite prompting, alcoholics did not take advantage of encoding memoranda at a deep level to enhance face-name recognition accuracy. Nonetheless, conditions of deeper encoding resulted in faster reaction times and more specific relations with regional brain volumes than did shallow encoding. The normal relation between associative recognition and corticostriatal volumes was not present in alcoholics. Rather, their speeded reaction time occurred at the expense of accuracy and was related most robustly to cerebellar volumes. PMID:22509954

Cognitive aspects of haptic form recognition by blind and sighted subjects.

PubMed

Bailes, S M; Lambert, R M

1986-11-01

Studies using haptic form recognition tasks have generally concluded that the adventitiously blind perform better than the congenitally blind, implicating the importance of early visual experience in improved spatial functioning. The hypothesis was tested that the adventitiously blind have retained some ability to encode successive information obtained haptically in terms of a global visual representation, while the congenitally blind use a coding system based on successive inputs. Eighteen blind (adventitiously and congenitally) and 18 sighted (blindfolded and performing with vision) subjects were tested on their recognition of raised line patterns when the standard was presented in segments: in immediate succession, or with unfilled intersegmental delays of 5, 10, or 15 seconds. The results did not support the above hypothesis. Three main findings were obtained: normally sighted subjects were both faster and more accurate than the other groups; all groups improved in accuracy of recognition as a function of length of interstimulus interval; sighted subjects tended to report using strategies with a strong verbal component while the blind tended to rely on imagery coding. These results are explained in terms of information-processing theory consistent with dual encoding systems in working memory.

Activity Augmentation of Amphioxus Peptidoglycan Recognition Protein BbtPGRP3 via Fusion with a Chitin Binding Domain

PubMed Central

Wang, Wen-Jie; Cheng, Wang; Luo, Ming; Yan, Qingyu; Yu, Hong-Mei; Li, Qiong; Cao, Dong-Dong; Huang, Shengfeng; Xu, Anlong; Mariuzza, Roy A.; Chen, Yuxing; Zhou, Cong-Zhao

2015-01-01

Peptidoglycan recognition proteins (PGRPs), which have been identified in most animals, are pattern recognition molecules that involve antimicrobial defense. Resulting from extraordinary expansion of innate immune genes, the amphioxus encodes many PGRPs of diverse functions. For instance, three isoforms of PGRP encoded by Branchiostoma belcheri tsingtauense, termed BbtPGRP1~3, are fused with a chitin binding domain (CBD) at the N-terminus. Here we report the 2.7 Å crystal structure of BbtPGRP3, revealing an overall structure of an N-terminal hevein-like CBD followed by a catalytic PGRP domain. Activity assays combined with site-directed mutagenesis indicated that the individual PGRP domain exhibits amidase activity towards both DAP-type and Lys-type peptidoglycans (PGNs), the former of which is favored. The N-terminal CBD not only has the chitin-binding activity, but also enables BbtPGRP3 to gain a five-fold increase of amidase activity towards the Lys-type PGNs, leading to a significantly broadened substrate spectrum. Together, we propose that modular evolution via domain shuffling combined with gene horizontal transfer makes BbtPGRP1~3 novel PGRPs of augmented catalytic activity and broad recognition spectrum. PMID:26479246

Neural correlates of auditory recognition memory in the primate dorsal temporal pole

PubMed Central

Ng, Chi-Wing; Plakke, Bethany

2013-01-01

Temporal pole (TP) cortex is associated with higher-order sensory perception and/or recognition memory, as human patients with damage in this region show impaired performance during some tasks requiring recognition memory (Olson et al. 2007). The underlying mechanisms of TP processing are largely based on examination of the visual nervous system in humans and monkeys, while little is known about neuronal activity patterns in the auditory portion of this region, dorsal TP (dTP; Poremba et al. 2003). The present study examines single-unit activity of dTP in rhesus monkeys performing a delayed matching-to-sample task utilizing auditory stimuli, wherein two sounds are determined to be the same or different. Neurons of dTP encode several task-relevant events during the delayed matching-to-sample task, and encoding of auditory cues in this region is associated with accurate recognition performance. Population activity in dTP shows a match suppression mechanism to identical, repeated sound stimuli similar to that observed in the visual object identification pathway located ventral to dTP (Desimone 1996; Nakamura and Kubota 1996). However, in contrast to sustained visual delay-related activity in nearby analogous regions, auditory delay-related activity in dTP is transient and limited. Neurons in dTP respond selectively to different sound stimuli and often change their sound response preferences between experimental contexts. Current findings suggest a significant role for dTP in auditory recognition memory similar in many respects to the visual nervous system, while delay memory firing patterns are not prominent, which may relate to monkeys' shorter forgetting thresholds for auditory vs. visual objects. PMID:24198324

Familial solitary chondrosarcoma resulting from germline EXT2 mutation.

PubMed

Heddar, Abdelkader; Fermey, Pierre; Coutant, Sophie; Angot, Emilie; Sabourin, Jean-Christophe; Michelin, Paul; Parodi, Nathalie; Charbonnier, Françoise; Vezain, Myriam; Bougeard, Gaëlle; Baert-Desurmont, Stéphanie; Frébourg, Thierry; Tournier, Isabelle

2017-02-01

Germline mutations of EXT2, encoding Exostosin Glycosyltransferase 2, are associated with multiple osteochondromas (MO), an autosomal dominant disease characterized by the development of multiple peripheral cartilaginous benign tumors with a weak risk of malignant transformation. We report here a family with a remarkable clinical presentation characterized by the development of isolated chondrosarcomas, mostly located in ribs. Comparative analysis of exomes from two third-degree affected relatives led us to identify a single common disruptive variation, corresponding to a stop mutation (c.237G > A, p.Trp79*; (NM_000401.3); c.138G > A, p.Trp46*; (NM_207122.1)) within exon 2 of the EXT2 gene. Interestingly, no obvious sign of MO was detected in affected members by radiological examination. This report shows that germline mutations of EXT2 can result, not only in the development of multiple benign osteochondromas, but also in the development of isolated malignant cartilaginous tumors including central tumors, and that the presence of germline EXT2 mutation should be considered in patients suspected to have an inherited predisposition to chondrosarcoma, even in the absence of MO. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Episodic Short-Term Recognition Requires Encoding into Visual Working Memory: Evidence from Probe Recognition after Letter Report

PubMed Central

Poth, Christian H.; Schneider, Werner X.

2016-01-01

Human vision is organized in discrete processing episodes (e.g., eye fixations or task-steps). Object information must be transmitted across episodes to enable episodic short-term recognition: recognizing whether a current object has been seen in a previous episode. We ask whether episodic short-term recognition presupposes that objects have been encoded into capacity-limited visual working memory (VWM), which retains visual information for report. Alternatively, it could rely on the activation of visual features or categories that occurs before encoding into VWM. We assessed the dependence of episodic short-term recognition on VWM by a new paradigm combining letter report and probe recognition. Participants viewed displays of 10 letters and reported as many as possible after a retention interval (whole report). Next, participants viewed a probe letter and indicated whether it had been one of the 10 letters (probe recognition). In Experiment 1, probe recognition was more accurate for letters that had been encoded into VWM (reported letters) compared with non-encoded letters (non-reported letters). Interestingly, those letters that participants reported in their whole report had been near to one another within the letter displays. This suggests that the encoding into VWM proceeded in a spatially clustered manner. In Experiment 2, participants reported only one of 10 letters (partial report) and probes either referred to this letter, to letters that had been near to it, or far from it. Probe recognition was more accurate for near than for far letters, although none of these letters had to be reported. These findings indicate that episodic short-term recognition is constrained to a small number of simultaneously presented objects that have been encoded into VWM. PMID:27713722

Episodic Short-Term Recognition Requires Encoding into Visual Working Memory: Evidence from Probe Recognition after Letter Report.

PubMed

Poth, Christian H; Schneider, Werner X

2016-01-01

Human vision is organized in discrete processing episodes (e.g., eye fixations or task-steps). Object information must be transmitted across episodes to enable episodic short-term recognition: recognizing whether a current object has been seen in a previous episode. We ask whether episodic short-term recognition presupposes that objects have been encoded into capacity-limited visual working memory (VWM), which retains visual information for report. Alternatively, it could rely on the activation of visual features or categories that occurs before encoding into VWM. We assessed the dependence of episodic short-term recognition on VWM by a new paradigm combining letter report and probe recognition. Participants viewed displays of 10 letters and reported as many as possible after a retention interval (whole report). Next, participants viewed a probe letter and indicated whether it had been one of the 10 letters (probe recognition). In Experiment 1, probe recognition was more accurate for letters that had been encoded into VWM (reported letters) compared with non-encoded letters (non-reported letters). Interestingly, those letters that participants reported in their whole report had been near to one another within the letter displays. This suggests that the encoding into VWM proceeded in a spatially clustered manner. In Experiment 2, participants reported only one of 10 letters (partial report) and probes either referred to this letter, to letters that had been near to it, or far from it. Probe recognition was more accurate for near than for far letters, although none of these letters had to be reported. These findings indicate that episodic short-term recognition is constrained to a small number of simultaneously presented objects that have been encoded into VWM.

An Electrophysiological Signature of Unconscious Recognition Memory

PubMed Central

Voss, Joel L.; Paller, Ken A.

2009-01-01

Contradicting the common assumption that accurate recognition reflects explicit-memory processing, we describe evidence for recognition lacking two hallmark explicit-memory features: awareness of memory retrieval and facilitation by attentive encoding. Kaleidoscope images were encoded in conjunction with an attentional diversion and subsequently recognized more accurately than those encoded without diversion. Confidence in recognition was superior following attentive encoding, though recognition was remarkably accurate when people claimed to be unaware of memory retrieval. This “implicit recognition” was associated with frontal-occipital negative brain potentials at 200-400 ms post-stimulus-onset, which were spatially and temporally distinct from positive brain potentials corresponding to explicit recollection and familiarity. This dissociation between behavioral and electrophysiological characteristics of “implicit recognition” versus explicit recognition indicates that a neurocognitive mechanism with properties similar to those that produce implicit memory can be operative in standard recognition tests. People can accurately discriminate repeat stimuli from new stimuli without necessarily knowing it. PMID:19198606

Screening for Novel Germline Rare Mutations Associated with Aggressive Prostate Cancer

DTIC Science & Technology

2015-12-01

amino acid substitution from Threonine (Thr) to Proline (Pro); while rs61756080 results to the amino acid substitution from Glycine (Gly) to Glutamic...Single nucleotide polymorphisms 20 in the gene encoding Krüppel-like factor 7 are associated with type 2 diabetes . Diabetologia. 2005 Jul;48(7

The associative memory deficit in aging is related to reduced selectivity of brain activity during encoding

PubMed Central

Saverino, Cristina; Fatima, Zainab; Sarraf, Saman; Oder, Anita; Strother, Stephen C.; Grady, Cheryl L.

2016-01-01

Human aging is characterized by reductions in the ability to remember associations between items, despite intact memory for single items. Older adults also show less selectivity in task-related brain activity, such that patterns of activation become less distinct across multiple experimental tasks. This reduced selectivity, or dedifferentiation, has been found for episodic memory, which is often reduced in older adults, but not for semantic memory, which is maintained with age. We used functional magnetic resonance imaging (fMRI) to investigate whether there is a specific reduction in selectivity of brain activity during associative encoding in older adults, but not during item encoding, and whether this reduction predicts associative memory performance. Healthy young and older adults were scanned while performing an incidental-encoding task for pictures of objects and houses under item or associative instructions. An old/new recognition test was administered outside the scanner. We used agnostic canonical variates analysis and split-half resampling to detect whole brain patterns of activation that predicted item vs. associative encoding for stimuli that were later correctly recognized. Older adults had poorer memory for associations than did younger adults, whereas item memory was comparable across groups. Associative encoding trials, but not item encoding trials, were predicted less successfully in older compared to young adults, indicating less distinct patterns of associative-related activity in the older group. Importantly, higher probability of predicting associative encoding trials was related to better associative memory after accounting for age and performance on a battery of neuropsychological tests. These results provide evidence that neural distinctiveness at encoding supports associative memory and that a specific reduction of selectivity in neural recruitment underlies age differences in associative memory. PMID:27082043

When fear forms memories: threat of shock and brain potentials during encoding and recognition.

PubMed

Weymar, Mathias; Bradley, Margaret M; Hamm, Alfons O; Lang, Peter J

2013-03-01

The anticipation of highly aversive events is associated with measurable defensive activation, and both animal and human research suggests that stress-inducing contexts can facilitate memory. Here, we investigated whether encoding stimuli in the context of anticipating an aversive shock affects recognition memory. Event-related potentials (ERPs) were measured during a recognition test for words that were encoded in a font color that signaled threat or safety. At encoding, cues signaling threat of shock, compared to safety, prompted enhanced P2 and P3 components. Correct recognition of words encoded in the context of threat, compared to safety, was associated with an enhanced old-new ERP difference (500-700 msec; centro-parietal), and this difference was most reliable for emotional words. Moreover, larger old-new ERP differences when recognizing emotional words encoded in a threatening context were associated with better recognition, compared to words encoded in safety. Taken together, the data indicate enhanced memory for stimuli encoded in a context in which an aversive event is merely anticipated, which could assist in understanding effects of anxiety and stress on memory processes. Copyright © 2012 Elsevier Ltd. All rights reserved.

Modeling the effect of channel number and interaction on consonant recognition in a cochlear implant peak-picking strategy.

PubMed

Verschuur, Carl

2009-03-01

Difficulties in speech recognition experienced by cochlear implant users may be attributed both to information loss caused by signal processing and to information loss associated with the interface between the electrode array and auditory nervous system, including cross-channel interaction. The objective of the work reported here was to attempt to partial out the relative contribution of these different factors to consonant recognition. This was achieved by comparing patterns of consonant feature recognition as a function of channel number and presence/absence of background noise in users of the Nucleus 24 device with normal hearing subjects listening to acoustic models that mimicked processing of that device. Additionally, in the acoustic model experiment, a simulation of cross-channel spread of excitation, or "channel interaction," was varied. Results showed that acoustic model experiments were highly correlated with patterns of performance in better-performing cochlear implant users. Deficits to consonant recognition in this subgroup could be attributed to cochlear implant processing, whereas channel interaction played a much smaller role in determining performance errors. The study also showed that large changes to channel number in the Advanced Combination Encoder signal processing strategy led to no substantial changes in performance.

Person-independent facial expression analysis by fusing multiscale cell features

NASA Astrophysics Data System (ADS)

Zhou, Lubing; Wang, Han

2013-03-01

Automatic facial expression recognition is an interesting and challenging task. To achieve satisfactory accuracy, deriving a robust facial representation is especially important. A novel appearance-based feature, the multiscale cell local intensity increasing patterns (MC-LIIP), to represent facial images and conduct person-independent facial expression analysis is presented. The LIIP uses a decimal number to encode the texture or intensity distribution around each pixel via pixel-to-pixel intensity comparison. To boost noise resistance, MC-LIIP carries out comparison computation on the average values of scalable cells instead of individual pixels. The facial descriptor fuses region-based histograms of MC-LIIP features from various scales, so as to encode not only textural microstructures but also the macrostructures of facial images. Finally, a support vector machine classifier is applied for expression recognition. Experimental results on the CK+ and Karolinska directed emotional faces databases show the superiority of the proposed method.

Directed forgetting of complex pictures in an item method paradigm.

PubMed

Hauswald, Anne; Kissler, Johanna

2008-11-01

An item-cued directed forgetting paradigm was used to investigate the ability to control episodic memory and selectively encode complex coloured pictures. A series of photographs was presented to 21 participants who were instructed to either remember or forget each picture after it was presented. Memory performance was later tested with a recognition task where all presented items had to be retrieved, regardless of the initial instructions. A directed forgetting effect--that is, better recognition of "to-be-remembered" than of "to-be-forgotten" pictures--was observed, although its size was smaller than previously reported for words or line drawings. The magnitude of the directed forgetting effect correlated negatively with participants' depression and dissociation scores. The results indicate that, at least in an item method, directed forgetting occurs for complex pictures as well as words and simple line drawings. Furthermore, people with higher levels of dissociative or depressive symptoms exhibit altered memory encoding patterns.

Through the eyes of the own-race bias: eye-tracking and pupillometry during face recognition.

PubMed

Wu, Esther Xiu Wen; Laeng, Bruno; Magnussen, Svein

2012-01-01

People are generally better at remembering faces of their own race than faces of a different race, and this effect is known as the own-race bias (ORB) effect. We used eye-tracking and pupillometry to investigate whether Caucasian and Asian face stimuli elicited different-looking patterns in Caucasian participants in a face-memory task. Consistent with the ORB effect, we found better recognition performance for own-race faces than other-race faces, and shorter response times. In addition, at encoding, eye movements and pupillary responses to Asian faces (i.e., the other race) were different from those to Caucasian faces (i.e., the own race). Processing of own-race faces was characterized by more active scanning, with a larger number of shorter fixations, and more frequent saccades. Moreover, pupillary diameters were larger when viewing other-race than own-race faces, suggesting a greater cognitive effort when encoding other-race faces.

'Order from disorder sprung': recognition and regulation in the immune system

NASA Astrophysics Data System (ADS)

Mak, Tak W.

2003-06-01

Milton's epic poem Paradise lost supplies a colourful metaphor for the immune system and its responses to pathogens. With the role of Satan played by pathogens seeking to destroy the paradise of human health, GOD intervenes and imposes order out of chaos. In this context, GOD means 'generation of diversity': the capacity of the innate and specific immune responses to recognize and eliminate a universe of pathogens. Thus, the immune system can be thought of as an entity that self-assembles the elements required to combat bodily invasion and injury. In so doing, it brings to bear the power of specific recognition: the ability to distinguish self from non-self, and the threatening from the benign. This ability to define and protect self is evolutionarily very old. Self-recognition and biochemical and barrier defences can be detected in primitive organisms, and elements of these mechanisms are built upon in an orderly way to establish the mammalian immune system. Innate immune responses depend on the use of a limited number of germline-encoded receptors to recognize conserved molecular patterns that occur on the surfaces of a broad range of pathogens. The B and T lymphocytes of the specific immune response use complex gene-rearrangement machinery to generate a diversity of antigen receptors capable of recognizing any pathogen in the universe. Binding to receptors on both innate and specific immune-system cells triggers intricate intracellular signalling pathways that lead to new gene transcription and effector-cell activation. And yet, regulation is imposed on these responses so that Paradise is not lost to the turning of the immune system onto self-tissues, the spectre of autoimmunity. Lymphocyte activation requires multiple signals and intercellular interactions. Mechanisms exist to establish tolerance to self by the selection and elimination of cells recognizing self-antigens. Immune system cell populations are reduced by programmed cell death once the pathogen threat is resolved. Once Paradise has been regained, memory cells remain in the body to sharply reduce the impact of a second exposure to a pathogen. Vaccination programs take advantage of this capacity of the human immune system for immunological memory, sparing millions the suffering associated with disease scourges. Thus does the order of the immune response spring from the disorder of pathogen attacks, and thus is Paradise preserved.

'Order from disorder sprung': recognition and regulation in the immune system.

PubMed

Mak, Tak W

2003-06-15

Milton's epic poem Paradise lost supplies a colourful metaphor for the immune system and its responses to pathogens. With the role of Satan played by pathogens seeking to destroy the paradise of human health, GOD intervenes and imposes order out of chaos. In this context, GOD means 'generation of diversity': the capacity of the innate and specific immune responses to recognize and eliminate a universe of pathogens. Thus, the immune system can be thought of as an entity that self-assembles the elements required to combat bodily invasion and injury. In so doing, it brings to bear the power of specific recognition: the ability to distinguish self from non-self, and the threatening from the benign. This ability to define and protect self is evolutionarily very old. Self-recognition and biochemical and barrier defences can be detected in primitive organisms, and elements of these mechanisms are built upon in an orderly way to establish the mammalian immune system. Innate immune responses depend on the use of a limited number of germline-encoded receptors to recognize conserved molecular patterns that occur on the surfaces of a broad range of pathogens. The B and T lymphocytes of the specific immune response use complex gene-rearrangement machinery to generate a diversity of antigen receptors capable of recognizing any pathogen in the universe. Binding to receptors on both innate and specific immune-system cells triggers intricate intracellular signalling pathways that lead to new gene transcription and effector-cell activation. And yet, regulation is imposed on these responses so that Paradise is not lost to the turning of the immune system onto self-tissues, the spectre of autoimmunity. Lymphocyte activation requires multiple signals and intercellular interactions. Mechanisms exist to establish tolerance to self by the selection and elimination of cells recognizing self-antigens. Immune system cell populations are reduced by programmed cell death once the pathogen threat is resolved. Once Paradise has been regained, memory cells remain in the body to sharply reduce the impact of a second exposure to a pathogen. Vaccination programs take advantage of this capacity of the human immune system for immunological memory, sparing millions the suffering associated with disease scourges. Thus does the order of the immune response spring from the disorder of pathogen attacks, and thus is Paradise preserved.

Advances in image compression and automatic target recognition; Proceedings of the Meeting, Orlando, FL, Mar. 30, 31, 1989

NASA Technical Reports Server (NTRS)

Tescher, Andrew G. (Editor)

1989-01-01

Various papers on image compression and automatic target recognition are presented. Individual topics addressed include: target cluster detection in cluttered SAR imagery, model-based target recognition using laser radar imagery, Smart Sensor front-end processor for feature extraction of images, object attitude estimation and tracking from a single video sensor, symmetry detection in human vision, analysis of high resolution aerial images for object detection, obscured object recognition for an ATR application, neural networks for adaptive shape tracking, statistical mechanics and pattern recognition, detection of cylinders in aerial range images, moving object tracking using local windows, new transform method for image data compression, quad-tree product vector quantization of images, predictive trellis encoding of imagery, reduced generalized chain code for contour description, compact architecture for a real-time vision system, use of human visibility functions in segmentation coding, color texture analysis and synthesis using Gibbs random fields.

Face-name association learning and brain structural substrates in alcoholism.

PubMed

Pitel, Anne-Lise; Chanraud, Sandra; Rohlfing, Torsten; Pfefferbaum, Adolf; Sullivan, Edith V

2012-07-01

Associative learning is required for face-name association and is impaired in alcoholism, but the cognitive processes and brain structural components underlying this deficit remain unclear. It is also unknown whether prompting alcoholics to implement a deep level of processing during face-name encoding would enhance performance. Abstinent alcoholics and controls performed a levels-of-processing face-name learning task. Participants indicated whether the face was that of an honest person (deep encoding) or that of a man (shallow encoding). Retrieval was examined using an associative (face-name) recognition task and a single-item (face or name only) recognition task. Participants also underwent 3T structural MRI. Compared with controls, alcoholics had poorer associative and single-item learning and performed at similar levels. Level of processing at encoding had little effect on recognition performance but affected reaction time (RT). Correlations with brain volumes were generally modest and based primarily on RT in alcoholics, where the deeper the processing at encoding, the more restricted the correlations with brain volumes. In alcoholics, longer control task RTs correlated modestly with smaller tissue volumes across several anterior to posterior brain regions; shallow encoding correlated with calcarine and striatal volumes; deep encoding correlated with precuneus and parietal volumes; and associative recognition RT correlated with cerebellar volumes. In controls, poorer associative recognition with deep encoding correlated significantly with smaller volumes of frontal and striatal structures. Despite prompting, alcoholics did not take advantage of encoding memoranda at a deep level to enhance face-name recognition accuracy. Nonetheless, conditions of deeper encoding resulted in faster RTs and more specific relations with regional brain volumes than did shallow encoding. The normal relation between associative recognition and corticostriatal volumes was not present in alcoholics. Rather, their speeded RTs occurred at the expense of accuracy and were related most robustly to cerebellar volumes. Copyright © 2012 by the Research Society on Alcoholism.

Loss of MAX results in meiotic entry in mouse embryonic and germline stem cells

PubMed Central

Suzuki, Ayumu; Hirasaki, Masataka; Hishida, Tomoaki; Wu, Jun; Okamura, Daiji; Ueda, Atsushi; Nishimoto, Masazumi; Nakachi, Yutaka; Mizuno, Yosuke; Okazaki, Yasushi; Matsui, Yasuhisa; Belmonte, Juan Carlos Izpisua; Okuda, Akihiko

2016-01-01

Meiosis is a unique process that allows the generation of reproductive cells. It remains largely unknown how meiosis is initiated in germ cells and why non-germline cells do not undergo meiosis. We previously demonstrated that knockdown of Max expression, a gene encoding a partner of MYC family proteins, strongly activates expression of germ cell-related genes in ESCs. Here we find that complete ablation of Max expression in ESCs results in profound cytological changes reminiscent of cells undergoing meiotic cell division. Furthermore, our analyses uncovers that Max expression is transiently attenuated in germ cells undergoing meiosis in vivo and its forced reduction induces meiosis-like cytological changes in cultured germline stem cells. Mechanistically, Max depletion alterations are, in part, due to impairment of the function of an atypical PRC1 complex (PRC1.6), in which MAX is one of the components. Our data highlight MAX as a new regulator of meiotic onset. PMID:27025988

Induction of atherosclerosis in mice and hamsters without germline genetic engineering.

PubMed

Bjørklund, Martin Maeng; Hollensen, Anne Kruse; Hagensen, Mette Kallestrup; Dagnaes-Hansen, Frederik; Christoffersen, Christina; Mikkelsen, Jacob Giehm; Bentzon, Jacob Fog

2014-05-23

Atherosclerosis can be achieved in animals by germline genetic engineering, leading to hypercholesterolemia, but such models are constrained to few species and strains, and they are difficult to combine with other powerful techniques involving genetic manipulation or variation. To develop a method for induction of atherosclerosis without germline genetic engineering. Recombinant adeno-associated viral vectors were engineered to encode gain-of-function proprotein convertase subtilisin/kexin type 9 mutants, and mice were given a single intravenous vector injection followed by high-fat diet feeding. Plasma proprotein convertase subtilisin/kexin type 9 and total cholesterol increased rapidly and were maintained at high levels, and after 12 weeks, mice had atherosclerotic lesions in the aorta. Histology of the aortic root showed progression of lesions to the fibroatheromatous stage. To demonstrate the applicability of this method for rapid analysis of the atherosclerosis susceptibility of a mouse strain and for providing temporal control over disease induction, we demonstrated the accelerated atherosclerosis of mature diabetic Akita mice. Furthermore, the versatility of this approach for creating atherosclerosis models also in nonmurine species was demonstrated by inducing hypercholesterolemia and early atherosclerosis in Golden Syrian hamsters. Single injections of proprotein convertase subtilisin/kexin type 9-encoding recombinant adeno-associated viral vectors are a rapid and versatile method to induce atherosclerosis in animals. This method should prove useful for experiments that are high-throughput or involve genetic techniques, strains, or species that do not combine well with current genetically engineered models. © 2014 American Heart Association, Inc.

Medical image classification using spatial adjacent histogram based on adaptive local binary patterns.

PubMed

Liu, Dong; Wang, Shengsheng; Huang, Dezhi; Deng, Gang; Zeng, Fantao; Chen, Huiling

2016-05-01

Medical image recognition is an important task in both computer vision and computational biology. In the field of medical image classification, representing an image based on local binary patterns (LBP) descriptor has become popular. However, most existing LBP-based methods encode the binary patterns in a fixed neighborhood radius and ignore the spatial relationships among local patterns. The ignoring of the spatial relationships in the LBP will cause a poor performance in the process of capturing discriminative features for complex samples, such as medical images obtained by microscope. To address this problem, in this paper we propose a novel method to improve local binary patterns by assigning an adaptive neighborhood radius for each pixel. Based on these adaptive local binary patterns, we further propose a spatial adjacent histogram strategy to encode the micro-structures for image representation. An extensive set of evaluations are performed on four medical datasets which show that the proposed method significantly improves standard LBP and compares favorably with several other prevailing approaches. Copyright © 2016 Elsevier Ltd. All rights reserved.

A self-organized learning strategy for object recognition by an embedded line of attraction

NASA Astrophysics Data System (ADS)

Seow, Ming-Jung; Alex, Ann T.; Asari, Vijayan K.

2012-04-01

For humans, a picture is worth a thousand words, but to a machine, it is just a seemingly random array of numbers. Although machines are very fast and efficient, they are vastly inferior to humans for everyday information processing. Algorithms that mimic the way the human brain computes and learns may be the solution. In this paper we present a theoretical model based on the observation that images of similar visual perceptions reside in a complex manifold in an image space. The perceived features are often highly structured and hidden in a complex set of relationships or high-dimensional abstractions. To model the pattern manifold, we present a novel learning algorithm using a recurrent neural network. The brain memorizes information using a dynamical system made of interconnected neurons. Retrieval of information is accomplished in an associative sense. It starts from an arbitrary state that might be an encoded representation of a visual image and converges to another state that is stable. The stable state is what the brain remembers. In designing a recurrent neural network, it is usually of prime importance to guarantee the convergence in the dynamics of the network. We propose to modify this picture: if the brain remembers by converging to the state representing familiar patterns, it should also diverge from such states when presented with an unknown encoded representation of a visual image belonging to a different category. That is, the identification of an instability mode is an indication that a presented pattern is far away from any stored pattern and therefore cannot be associated with current memories. These properties can be used to circumvent the plasticity-stability dilemma by using the fluctuating mode as an indicator to create new states. We capture this behavior using a novel neural architecture and learning algorithm, in which the system performs self-organization utilizing a stability mode and an instability mode for the dynamical system. Based on this observation we developed a self- organizing line attractor, which is capable of generating new lines in the feature space to learn unrecognized patterns. Experiments performed on UMIST pose database and CMU face expression variant database for face recognition have shown that the proposed nonlinear line attractor is able to successfully identify the individuals and it provided better recognition rate when compared to the state of the art face recognition techniques. Experiments on FRGC version 2 database has also provided excellent recognition rate in images captured in complex lighting environments. Experiments performed on the Japanese female face expression database and Essex Grimace database using the self organizing line attractor have also shown successful expression invariant face recognition. These results show that the proposed model is able to create nonlinear manifolds in a multidimensional feature space to distinguish complex patterns.

Scrambled Eggs: Apoptotic Cell Clearance by Non-Professional Phagocytes in the Drosophila Ovary.

PubMed

Serizier, Sandy B; McCall, Kimberly

2017-01-01

For half of a century, it has been known that non-professional phagocytes, such as fibroblasts, endothelial, and epithelial cells, are capable of efferocytosis (engulfment of apoptotic cells). Non-professional phagocytes differ from professional phagocytes in the range and efficiency of engulfment. Much of the recognition and underlying signaling machinery between non-professional and professional phagocytes is the same, but it is not known how the engulfment capacity of non-professional phagocytes is controlled. Moreover, the signaling networks involved in cell corpse recognition, engulfment, and phagosome maturation are only partially understood. The Drosophila ovary provides an excellent system to investigate the regulation of phagocytic activity by epithelial cells, a major class of non-professional phagocytes. During Drosophila oogenesis, mid-stage egg chambers undergo apoptosis of the germline in response to nutrient deprivation. Epithelial follicle cells then undergo major cell shape changes and concomitantly engulf the germline material. Our previous work has established that Draper and the integrin α-PS3/β-PS heterodimer are required in follicle cells for germline cell clearance. In addition, we have characterized phagosome maturation pathways, and found that the JNK pathway amplifies the engulfment response. In this review, we discuss recent advances on the interplay between engulfment pathways in the follicular epithelium for cell clearance in the Drosophila ovary. We also provide a comparison to apoptotic cell clearance mechanisms in C. elegans and mammals, illustrating strong conservation of efferocytosis mechanisms by non-professional phagocytes.

Scrambled Eggs: Apoptotic Cell Clearance by Non-Professional Phagocytes in the Drosophila Ovary

PubMed Central

Serizier, Sandy B.; McCall, Kimberly

2017-01-01

For half of a century, it has been known that non-professional phagocytes, such as fibroblasts, endothelial, and epithelial cells, are capable of efferocytosis (engulfment of apoptotic cells). Non-professional phagocytes differ from professional phagocytes in the range and efficiency of engulfment. Much of the recognition and underlying signaling machinery between non-professional and professional phagocytes is the same, but it is not known how the engulfment capacity of non-professional phagocytes is controlled. Moreover, the signaling networks involved in cell corpse recognition, engulfment, and phagosome maturation are only partially understood. The Drosophila ovary provides an excellent system to investigate the regulation of phagocytic activity by epithelial cells, a major class of non-professional phagocytes. During Drosophila oogenesis, mid-stage egg chambers undergo apoptosis of the germline in response to nutrient deprivation. Epithelial follicle cells then undergo major cell shape changes and concomitantly engulf the germline material. Our previous work has established that Draper and the integrin α-PS3/β-PS heterodimer are required in follicle cells for germline cell clearance. In addition, we have characterized phagosome maturation pathways, and found that the JNK pathway amplifies the engulfment response. In this review, we discuss recent advances on the interplay between engulfment pathways in the follicular epithelium for cell clearance in the Drosophila ovary. We also provide a comparison to apoptotic cell clearance mechanisms in C. elegans and mammals, illustrating strong conservation of efferocytosis mechanisms by non-professional phagocytes. PMID:29238344

Females scan more than males: a potential mechanism for sex differences in recognition memory.

PubMed

Heisz, Jennifer J; Pottruff, Molly M; Shore, David I

2013-07-01

Recognition-memory tests reveal individual differences in episodic memory; however, by themselves, these tests provide little information regarding the stage (or stages) in memory processing at which differences are manifested. We used eye-tracking technology, together with a recognition paradigm, to achieve a more detailed analysis of visual processing during encoding and retrieval. Although this approach may be useful for assessing differences in memory across many different populations, we focused on sex differences in face memory. Females outperformed males on recognition-memory tests, and this advantage was directly related to females' scanning behavior at encoding. Moreover, additional exposures to the faces reduced sex differences in face recognition, which suggests that males may be able to improve their recognition memory by extracting more information at encoding through increased scanning. A strategy of increased scanning at encoding may prove to be a simple way to enhance memory performance in other populations with memory impairment.

Investigating the encoding-retrieval match in recognition memory: effects of experimental design, specificity, and retention interval.

PubMed

Dewhurst, Stephen A; Knott, Lauren M

2010-12-01

Five experiments investigated the encoding-retrieval match in recognition memory by manipulating read and generate conditions at study and at test. Experiments 1A and 1B confirmed previous findings that reinstating encoding operations at test enhances recognition accuracy in a within-groups design but reduces recognition accuracy in a between-groups design. Experiment 2A showed that generating from anagrams at study and at test enhanced recognition accuracy even when study and test items were generated from different anagrams. Experiment 2B showed that switching from one generation task at study (e.g., anagram solution) to a different generation task at test (e.g., fragment completion) eliminated this recognition advantage. Experiment 3 showed that the recognition advantage found in Experiment 1A is reliably present up to 1 week after study. The findings are consistent with theories of memory that emphasize the importance of the match between encoding and retrieval operations.

Understanding gender bias in face recognition: effects of divided attention at encoding.

PubMed

Palmer, Matthew A; Brewer, Neil; Horry, Ruth

2013-03-01

Prior research has demonstrated a female own-gender bias in face recognition, with females better at recognizing female faces than male faces. We explored the basis for this effect by examining the effect of divided attention during encoding on females' and males' recognition of female and male faces. For female participants, divided attention impaired recognition performance for female faces to a greater extent than male faces in a face recognition paradigm (Study 1; N=113) and an eyewitness identification paradigm (Study 2; N=502). Analysis of remember-know judgments (Study 2) indicated that divided attention at encoding selectively reduced female participants' recollection of female faces at test. For male participants, divided attention selectively reduced recognition performance (and recollection) for male stimuli in Study 2, but had similar effects on recognition of male and female faces in Study 1. Overall, the results suggest that attention at encoding contributes to the female own-gender bias by facilitating the later recollection of female faces. Copyright © 2013 Elsevier B.V. All rights reserved.

Effector-triggered versus pattern-triggered immunity: how animals sense virulent pathogens

PubMed Central

Stuart, Lynda M.; Paquette, Nicholas; Boyer, Laurent

2014-01-01

A fundamental question of any immune system is how it can discriminate between pathogens and non-pathogens. Here, we discuss that this can be mediated by a surveillance system distinct from pattern recognition receptors that recognize conserved microbial patterns and can be based instead on the host’s ability to sense perturbations in host cells induced by bacterial toxins or ‘effectors’ that are exclusively encoded by virulent microorganisms. Such ‘effector-triggered immunity’ was previously thought to be restricted to plants, but recent data indicate that animals also use this strategy. PMID:23411798

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Encoded novel forms of HSP70 or a cytolytic protein increase DNA vaccine potency.

PubMed

Garrod, Tamsin; Grubor-Bauk, Branka; Yu, Stanley; Gargett, Tessa; Gowans, Eric J

2014-01-01

In humans, DNA vaccines have failed to demonstrate the equivalent levels of immunogenicity that were shown in smaller animals. Previous studies have encoded adjuvants, predominantly cytokines, within these vaccines in an attempt to increase antigen-specific immune responses. However, these strategies have lacked breadth of innate immune activation and have led to disappointing results in clinical trials. Damage associated molecular patterns (DAMPs) have been identified as pattern recognition receptor (PRR) agonists. DAMPs can bind to a wide range of PRRs on dendritic cells (DCs) and thus our studies have aimed to utilize this characteristic to act as an adjuvant in a DNA vaccine approach. Specifically, HSP70 has been identified as a DAMP, but has been limited by its lack of accessibility to PRRs in and on DCs. Here, we discuss the promising results achieved with the inclusion of membrane-bound or secreted HSP70 into a DNA vaccine encoding HIV gag as the model immunogen.

Episodic memory functions in first episode psychosis and clinical high risk individuals.

PubMed

Greenland-White, Sarah E; Ragland, J Daniel; Niendam, Tara A; Ferrer, Emilio; Carter, Cameron S

2017-10-01

Individuals with schizophrenia have disproportionate memory impairments when encoding relational versus item-specific information, and when using recollection versus familiarity during retrieval. It is unclear whether this pattern is unique to people with chronic schizophrenia, or if it occurs in individuals after a first episode of psychosis (FE), or when at clinical high-risk for psychosis (CHR). We administered the Relational and Item-Specific Memory task (RiSE) to 22 CHR, 101 FE, and 58 typically developing (TD) participants. We examined group differences in item and relational encoding, and familiarity-based and recollection-based retrieval using parametric analysis and structural equation modeling (SEM). Longitudinal data allowed us to examine relations between baseline RiSE performance and change in clinical symptoms at 1-year follow-up in the FE group. Groups did not differ on familiarity. FE and CHR groups were equally impaired on overall recognition accuracy. Although recollection was impaired in both FE and CHR groups following relational encoding, only the FE group had impaired recollection following item encoding. SEM showed atypical relationships between familiarity and recollection, as well as familiarity and item recognition for both the FE and CHR groups. For FE individuals, better baseline recognition accuracy predicted less severe negative symptoms at 1-year follow-up. Impaired relational and recollective memory may reflect neurodevelopmental abnormalities predating conversion to psychosis. These memory deficits appear related to negative symptom changes. In contrast, item specific recollection deficits appear to occur after the development of full psychosis. Familiarity appears to be a relatively preserved memory function across the psychosis spectrum. Copyright © 2017 Elsevier B.V. All rights reserved.

An acidic microenvironment sets the humoral pattern recognition molecule PTX3 in a tissue repair mode

PubMed Central

Doni, Andrea; Musso, Tiziana; Morone, Diego; Bastone, Antonio; Zambelli, Vanessa; Sironi, Marina; Castagnoli, Carlotta; Cambieri, Irene; Stravalaci, Matteo; Pasqualini, Fabio; Laface, Ilaria; Valentino, Sonia; Tartari, Silvia; Ponzetta, Andrea; Maina, Virginia; Barbieri, Silvia S.; Tremoli, Elena; Catapano, Alberico L.; Norata, Giuseppe D.; Bottazzi, Barbara; Garlanda, Cecilia

2015-01-01

Pentraxin 3 (PTX3) is a fluid-phase pattern recognition molecule and a key component of the humoral arm of innate immunity. In four different models of tissue damage in mice, PTX3 deficiency was associated with increased fibrin deposition and persistence, and thicker clots, followed by increased collagen deposition, when compared with controls. Ptx3-deficient macrophages showed defective pericellular fibrinolysis in vitro. PTX3-bound fibrinogen/fibrin and plasminogen at acidic pH and increased plasmin-mediated fibrinolysis. The second exon-encoded N-terminal domain of PTX3 recapitulated the activity of the intact molecule. Thus, a prototypic component of humoral innate immunity, PTX3, plays a nonredundant role in the orchestration of tissue repair and remodeling. Tissue acidification resulting from metabolic adaptation during tissue repair sets PTX3 in a tissue remodeling and repair mode, suggesting that matrix and microbial recognition are common, ancestral features of the humoral arm of innate immunity. PMID:25964372

Neural Global Pattern Similarity Underlies True and False Memories.

PubMed

Ye, Zhifang; Zhu, Bi; Zhuang, Liping; Lu, Zhonglin; Chen, Chuansheng; Xue, Gui

2016-06-22

The neural processes giving rise to human memory strength signals remain poorly understood. Inspired by formal computational models that posit a central role of global matching in memory strength, we tested a novel hypothesis that the strengths of both true and false memories arise from the global similarity of an item's neural activation pattern during retrieval to that of all the studied items during encoding (i.e., the encoding-retrieval neural global pattern similarity [ER-nGPS]). We revealed multiple ER-nGPS signals that carried distinct information and contributed differentially to true and false memories: Whereas the ER-nGPS in the parietal regions reflected semantic similarity and was scaled with the recognition strengths of both true and false memories, ER-nGPS in the visual cortex contributed solely to true memory. Moreover, ER-nGPS differences between the parietal and visual cortices were correlated with frontal monitoring processes. By combining computational and neuroimaging approaches, our results advance a mechanistic understanding of memory strength in recognition. What neural processes give rise to memory strength signals, and lead to our conscious feelings of familiarity? Using fMRI, we found that the memory strength of a given item depends not only on how it was encoded during learning, but also on the similarity of its neural representation with other studied items. The global neural matching signal, mainly in the parietal lobule, could account for the memory strengths of both studied and unstudied items. Interestingly, a different global matching signal, originated from the visual cortex, could distinguish true from false memories. The findings reveal multiple neural mechanisms underlying the memory strengths of events registered in the brain. Copyright © 2016 the authors 0270-6474/16/366792-11$15.00/0.

Temporal-pattern recognition by single neurons in a sensory pathway devoted to social communication behavior

PubMed Central

Carlson, Bruce A.

2010-01-01

Sensory systems often encode stimulus information into the temporal pattern of action potential activity. However, little is known about how the information contained within these patterns is extracted by postsynaptic neurons. Similar to temporal coding by sensory neurons, social information in mormyrid fish is encoded into the temporal patterning of an electric organ discharge (EOD). In the current study, sensitivity to temporal patterns of electrosensory stimuli was found to arise within the midbrain posterior exterolateral nucleus (ELp). Whole-cell patch recordings from ELp neurons in vivo revealed three patterns of interpulse interval (IPI) tuning: low-pass neurons tuned to long intervals, high-pass neurons tuned to short intervals and band-pass neurons tuned to intermediate intervals. Many neurons within each class also responded preferentially to either increasing or decreasing IPIs. Playback of electric signaling patterns recorded from freely behaving fish revealed that the IPI and direction tuning of ELp neurons resulted in selective responses to particular social communication displays characterized by distinct IPI patterns. The postsynaptic potential responses of many neurons indicated a combination of excitatory and inhibitory synaptic input, and the IPI tuning of ELp neurons was directly related to rate-dependent changes in the direction and amplitude of postsynaptic potentials. These results suggest that differences in the dynamics of short-term synaptic plasticity in excitatory and inhibitory pathways may tune central sensory neurons to particular temporal patterns of presynaptic activity. This may represent a general mechanism for the processing of behaviorally-relevant stimulus information encoded into temporal patterns of activity by sensory neurons. PMID:19641105

Temporal-pattern recognition by single neurons in a sensory pathway devoted to social communication behavior.

PubMed

Carlson, Bruce A

2009-07-29

Sensory systems often encode stimulus information into the temporal pattern of action potential activity. However, little is known about how the information contained within these patterns is extracted by postsynaptic neurons. Similar to temporal coding by sensory neurons, social information in mormyrid fish is encoded into the temporal patterning of an electric organ discharge. In the current study, sensitivity to temporal patterns of electrosensory stimuli was found to arise within the midbrain posterior exterolateral nucleus (ELp). Whole-cell patch recordings from ELp neurons in vivo revealed three patterns of interpulse interval (IPI) tuning: low-pass neurons tuned to long intervals, high-pass neurons tuned to short intervals, and bandpass neurons tuned to intermediate intervals. Many neurons within each class also responded preferentially to either increasing or decreasing IPIs. Playback of electric signaling patterns recorded from freely behaving fish revealed that the IPI and direction tuning of ELp neurons resulted in selective responses to particular social communication displays characterized by distinct IPI patterns. The postsynaptic potential responses of many neurons indicated a combination of excitatory and inhibitory synaptic input, and the IPI tuning of ELp neurons was directly related to rate-dependent changes in the direction and amplitude of postsynaptic potentials. These results suggest that differences in the dynamics of short-term synaptic plasticity in excitatory and inhibitory pathways may tune central sensory neurons to particular temporal patterns of presynaptic activity. This may represent a general mechanism for the processing of behaviorally relevant stimulus information encoded into temporal patterns of activity by sensory neurons.

Identification of a β-glucosidase from the Mucor circinelloides genome by peptide pattern recognition.

PubMed

Huang, Yuhong; Busk, Peter Kamp; Grell, Morten Nedergaard; Zhao, Hai; Lange, Lene

2014-12-01

Mucor circinelloides produces plant cell wall degrading enzymes that allow it to grow on complex polysaccharides. Although the genome of M. circinelloides has been sequenced, only few plant cell wall degrading enzymes are annotated in this species. We applied peptide pattern recognition, which is a non-alignment based method for sequence analysis to map conserved sequences in glycoside hydrolase families. The conserved sequences were used to identify similar genes in the M. circinelloides genome. We found 12 different novel genes encoding members of the GH3, GH5, GH9, GH16, GH38, GH47 and GH125 families in M. circinelloides. One of the two GH3-encoding genes was predicted to encode a β-glucosidase (EC 3.2.1.21). We expressed this gene in Pichia pastoris KM71H and found that the purified recombinant protein had relative high β-glucosidase activity (1.73U/mg) at pH5 and 50°C. The Km and Vmax with p-nitrophenyl-β-d-glucopyranoside as substrate was 0.20mM and 2.41U/mg, respectively. The enzyme was not inhibited by glucose and retained 84% activity at glucose concentrations up to 140mM. Although zygomycetes are not considered to be important degraders of lignocellulosic biomass in nature, the present finding of an active β-glucosidase in M. circinelloides demonstrates that enzymes from this group of fungi have a potential for cellulose degradation. Copyright © 2014 Elsevier Inc. All rights reserved.

Markers of nonselective and specific NK cell activation.

PubMed

Fogel, Leslie A; Sun, Michel M; Geurs, Theresa L; Carayannopoulos, Leonidas N; French, Anthony R

2013-06-15

NK cell activation is controlled by the integration of signals from cytokine receptors and germline-encoded activation and inhibitory receptors. NK cells undergo two distinct phases of activation during murine CMV (MCMV) infection: a nonselective phase mediated by proinflammatory cytokines and a specific phase driven by signaling through Ly49H, an NK cell activation receptor that recognizes infected cells. We sought to delineate cell surface markers that could distinguish NK cells that had been activated nonselectively from those that had been specifically activated through NK cell receptors. We demonstrated that stem cell Ag 1 (Sca-1) is highly upregulated during viral infections (to an even greater extent than CD69) and serves as a novel marker of early, nonselective NK cell activation. Indeed, a greater proportion of Sca-1(+) NK cells produced IFN-γ compared with Sca-1(-) NK cells during MCMV infection. In contrast to the universal upregulation of Sca-1 (as well as KLRG1) on NK cells early during MCMV infection, differential expression of Sca-1, as well as CD27 and KLRG1, was observed on Ly49H(+) and Ly49H(-) NK cells late during MCMV infection. Persistently elevated levels of KLRG1 in the context of downregulation of Sca-1 and CD27 were observed on NK cells that expressed Ly49H. Furthermore, the differential expression patterns of these cell surface markers were dependent on Ly49H recognition of its ligand and did not occur solely as a result of cellular proliferation. These findings demonstrate that a combination of Sca-1, CD27, and KLRG1 can distinguish NK cells nonselectively activated by cytokines from those specifically stimulated through activation receptors.

RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans

PubMed Central

Tops, Bastiaan B. J.; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C.; Plasterk, Ronald H. A.; Ketting, René F.

2005-01-01

In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of ∼250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step. PMID:15653635

CK2(beta)tes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster.

PubMed

Kalmykova, Alla I; Shevelyov, Yuri Y; Polesskaya, Oksana O; Dobritsa, Anna A; Evstafieva, Alexandra G; Boldyreff, Brigitte; Issinger, Olaf-Georg; Gvozdev, Vladimir A

2002-03-01

An earlier described CK2(beta)tes gene of Drosophila melanogaster is shown to encode a male germline specific isoform of regulatory beta subunit of casein kinase 2. Western-analysis using anti-CK2(beta)tes Ig revealed CK2(beta)tes protein in Drosophila testes extract. Expression of a CK2(beta)tes-beta-galactosidase fusion protein driven by the CK2(beta)tes promoter was found in transgenic flies at postmitotic stages of spermatogenesis. Examination of biochemical characteristics of a recombinant CK2(beta)tes protein expressed in Escherichia coli revealed properties similar to those of CK2beta: (a) CK2(beta)tes protein stimulates CK2alpha catalytic activity toward synthetic peptide; (b) it inhibits phosphorylation of calmodulin and mediates stimulation of CK2alpha by polylysine; (c) it is able to form (CK2(beta)tes)2 dimers, as well as (CK2alpha)2(CK2(beta)tes)2 tetramers. Using the yeast two-hybrid system and coimmunoprecipitation analysis of protein extract from Drosophila testes, we demonstrated an association between CK2(beta)tes and CK2alpha. Northern-analysis has shown that another regulatory (beta') subunit found recently in D. melanogaster genome is also testis-specific. Thus, we describe the first example of two tissue-specific regulatory subunits of CK2 which might serve to provide CK2 substrate recognition during spermatogenesis.

Multi-Directional Multi-Level Dual-Cross Patterns for Robust Face Recognition.

PubMed

Ding, Changxing; Choi, Jonghyun; Tao, Dacheng; Davis, Larry S

2016-03-01

To perform unconstrained face recognition robust to variations in illumination, pose and expression, this paper presents a new scheme to extract "Multi-Directional Multi-Level Dual-Cross Patterns" (MDML-DCPs) from face images. Specifically, the MDML-DCPs scheme exploits the first derivative of Gaussian operator to reduce the impact of differences in illumination and then computes the DCP feature at both the holistic and component levels. DCP is a novel face image descriptor inspired by the unique textural structure of human faces. It is computationally efficient and only doubles the cost of computing local binary patterns, yet is extremely robust to pose and expression variations. MDML-DCPs comprehensively yet efficiently encodes the invariant characteristics of a face image from multiple levels into patterns that are highly discriminative of inter-personal differences but robust to intra-personal variations. Experimental results on the FERET, CAS-PERL-R1, FRGC 2.0, and LFW databases indicate that DCP outperforms the state-of-the-art local descriptors (e.g., LBP, LTP, LPQ, POEM, tLBP, and LGXP) for both face identification and face verification tasks. More impressively, the best performance is achieved on the challenging LFW and FRGC 2.0 databases by deploying MDML-DCPs in a simple recognition scheme.

bullwinkle and shark regulate dorsal-appendage morphogenesis in Drosophila oogenesis.

PubMed

Tran, David H; Berg, Celeste A

2003-12-01

bullwinkle (bwk) regulates embryonic anteroposterior patterning and, through a novel germline-to-soma signal, morphogenesis of the eggshell dorsal appendages. We screened for dominant modifiers of the bullwinkle mooseantler eggshell phenotype and identified shark, which encodes an SH2-domain, ankyrin-repeat tyrosine kinase. At the onset of dorsal-appendage formation, shark is expressed in a punctate pattern in the squamous stretch cells overlying the nurse cells. Confocal microscopy with cell-type-specific markers demonstrates that the stretch cells act as a substrate for the migrating dorsal-appendage-forming cells and extend cellular projections towards them. Mosaic analyses reveal that shark is required in follicle cells for cell migration and chorion deposition. Proper shark RNA expression in the stretch cells requires bwk activity, while restoration of shark expression in the stretch cells suppresses the bwk dorsal-appendage phenotype. These results suggest that shark plays an important downstream role in the bwk-signaling pathway. Candidate testing implicates Src42A in a similar role, suggesting conservation with a vertebrate signaling pathway involving non-receptor tyrosine kinases.

The evolution within us

PubMed Central

Cobey, Sarah; Wilson, Patrick; Matsen, Frederick A.

2015-01-01

The B-cell immune response is a remarkable evolutionary system found in jawed vertebrates. B-cell receptors, the membrane-bound form of antibodies, are capable of evolving high affinity to almost any foreign protein. High germline diversity and rapid evolution upon encounter with antigen explain the general adaptability of B-cell populations, but the dynamics of repertoires are less well understood. These dynamics are scientifically and clinically important. After highlighting the remarkable characteristics of naive and experienced B-cell repertoires, especially biased usage of genes encoding the B-cell receptors, we contrast methods of sequence analysis and their attempts to explain patterns of B-cell evolution. These phylogenetic approaches are currently unlinked to explicit models of B-cell competition, which analyse repertoire evolution at the level of phenotype, the affinities and specificities to particular antigenic sites. The models, in turn, suggest how chance, infection history and other factors contribute to different patterns of immunodominance and protection between people. Challenges in rational vaccine design, specifically vaccines to induce broadly neutralizing antibodies to HIV, underscore critical gaps in our understanding of B cells' evolutionary and ecological dynamics. PMID:26194749

Level of processing modulates the neural correlates of emotional memory formation

PubMed Central

Ritchey, Maureen; LaBar, Kevin S.; Cabeza, Roberto

2010-01-01

Emotion is known to influence multiple aspects of memory formation, including the initial encoding of the memory trace and its consolidation over time. However, the neural mechanisms whereby emotion impacts memory encoding remain largely unexplored. The present study employed a levels-of-processing manipulation to characterize the impact of emotion on encoding with and without the influence of elaborative processes. Participants viewed emotionally negative, neutral, and positive scenes under two conditions: a shallow condition focused on the perceptual features of the scenes and a deep condition that queried their semantic meaning. Recognition memory was tested 2 days later. Results showed that emotional memory enhancements were greatest in the shallow condition. FMRI analyses revealed that the right amygdala predicted subsequent emotional memory in the shallow more than deep condition, whereas the right ventrolateral prefrontal cortex demonstrated the reverse pattern. Furthermore, the association of these regions with the hippocampus was modulated by valence: the amygdala-hippocampal link was strongest for negative stimuli, whereas the prefrontal-hippocampal link was strongest for positive stimuli. Taken together, these results suggest two distinct activation patterns underlying emotional memory formation: an amygdala component that promotes memory during shallow encoding, especially for negative information, and a prefrontal component that provides extra benefits during deep encoding, especially for positive information. PMID:20350176

Level of processing modulates the neural correlates of emotional memory formation.

PubMed

Ritchey, Maureen; LaBar, Kevin S; Cabeza, Roberto

2011-04-01

Emotion is known to influence multiple aspects of memory formation, including the initial encoding of the memory trace and its consolidation over time. However, the neural mechanisms whereby emotion impacts memory encoding remain largely unexplored. The present study used a levels-of-processing manipulation to characterize the impact of emotion on encoding with and without the influence of elaborative processes. Participants viewed emotionally negative, neutral, and positive scenes under two conditions: a shallow condition focused on the perceptual features of the scenes and a deep condition that queried their semantic meaning. Recognition memory was tested 2 days later. Results showed that emotional memory enhancements were greatest in the shallow condition. fMRI analyses revealed that the right amygdala predicted subsequent emotional memory in the shallow more than deep condition, whereas the right ventrolateral PFC demonstrated the reverse pattern. Furthermore, the association of these regions with the hippocampus was modulated by valence: the amygdala-hippocampal link was strongest for negative stimuli, whereas the prefrontal-hippocampal link was strongest for positive stimuli. Taken together, these results suggest two distinct activation patterns underlying emotional memory formation: an amygdala component that promotes memory during shallow encoding, especially for negative information, and a prefrontal component that provides extra benefits during deep encoding, especially for positive information.

Tc1 mouse model of trisomy-21 dissociates properties of short- and long-term recognition memory.

PubMed

Hall, Jessica H; Wiseman, Frances K; Fisher, Elizabeth M C; Tybulewicz, Victor L J; Harwood, John L; Good, Mark A

2016-04-01

The present study examined memory function in Tc1 mice, a transchromosomic model of Down syndrome (DS). Tc1 mice demonstrated an unusual delay-dependent deficit in recognition memory. More specifically, Tc1 mice showed intact immediate (30sec), impaired short-term (10-min) and intact long-term (24-h) memory for objects. A similar pattern was observed for olfactory stimuli, confirming the generality of the pattern across sensory modalities. The specificity of the behavioural deficits in Tc1 mice was confirmed using APP overexpressing mice that showed the opposite pattern of object memory deficits. In contrast to object memory, Tc1 mice showed no deficit in either immediate or long-term memory for object-in-place information. Similarly, Tc1 mice showed no deficit in short-term memory for object-location information. The latter result indicates that Tc1 mice were able to detect and react to spatial novelty at the same delay interval that was sensitive to an object novelty recognition impairment. These results demonstrate (1) that novelty detection per se and (2) the encoding of visuo-spatial information was not disrupted in adult Tc1 mice. The authors conclude that the task specific nature of the short-term recognition memory deficit suggests that the trisomy of genes on human chromosome 21 in Tc1 mice impacts on (perirhinal) cortical systems supporting short-term object and olfactory recognition memory. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

The role of pattern recognition receptors in lung sarcoidosis.

PubMed

Mortaz, Esmaeil; Adcock, Ian M; Abedini, Atefhe; Kiani, Arda; Kazempour-Dizaji, Mehdi; Movassaghi, Masoud; Garssen, Johan

2017-08-05

Sarcoidosis is a granulomatous disorder of unknown etiology. Infection, genetic factors, autoimmunity and an aberrant innate immune system have been explored as potential causes of sarcoidosis. The etiology of sarcoidosis remains unknown, and it is thought that it might be caused by an infectious agent in a genetically predisposed, susceptible host. Inflammation results from recognition of evolutionarily conserved structures of pathogens (Pathogen-associated molecular patterns, PAMPs) and/or from reaction to tissue damage associated patterns (DAMPs) through recognition by a limited number of germ line-encoded pattern recognition receptors (PRRs). Due to the similar clinical and histopathological picture of sarcoidosis and tuberculosis, Mycobacterium tuberculosis antigens such early secreted antigen (ESAT-6), heat shock proteins (Mtb-HSP), catalase-peroxidase (katG) enzyme and superoxide dismutase A peptide (sodA) have been often considered as factors in the etiopathogenesis of sarcoidosis. Potential non-TB-associated PAMPs include lipopolysaccharide (LPS) from the outer membrane of Gram-negative bacteria, peptidoglycan, lipoteichoic acid, bacterial DNA, viral DNA/RNA, chitin, flagellin, leucine-rich repeats (LRR), mannans in the yeast cell wall, and microbial HSPs. Furthermore, exogenous non-organic antigens such as metals, silica, pigments with/without aluminum in tattoos, pesticides, and pollen have been evoked as potential causes of sarcoidosis. Exposure of the airways to diverse infectious and non-infectious agents may be important in the pathogenesis of sarcoidosis. The current review provides and update on the role of PPRs and DAMPs in the pathogenesis of sarcoidsis. Copyright © 2017 Elsevier B.V. All rights reserved.

Germline genetics of cancer of unknown primary (CUP) and its specific subtypes.

PubMed

Hemminki, Kari; Chen, Bowang; Kumar, Abhishek; Melander, Olle; Manjer, Jonas; Hallmans, Göran; Pettersson-Kymmer, Ulrika; Ohlsson, Claes; Folprecht, Gunnar; Löffler, Harald; Krämer, Alwin; Försti, Asta

2016-04-19

Cancer of unknown primary site (CUP) is a fatal cancer diagnosed through metastases at various organs. Little is known about germline genetics of CUP which appears worth of a search in view of reported familial associations in CUP. In the present study, samples from CUP patients were identified from 2 Swedish biobanks and a German clinical trial, totaling 578 CUP patients and 7628 regionally matched controls. Diagnostic data specified the organ where metastases were diagnosed. We carried out a genome-wide association study on CUP cases and controls. In the whole sample set, 6 loci reached an allelic p-value in the range of 10-7 and were supported by data from the three centers. Three associations were located next to non-coding RNA genes. rs2660852 flanked 5'UTR of LTA4H (leukotriene A4 hydrolase), rs477145 was intronic to TIAM1 (T-cell lymphoma invasion and metastases) and rs2835931 was intronic to KCNJ6 (potassium channel, inwardly rectifying subfamily J, member 6). In analysis of subgroups of CUP patients (smokers, non-smokers and CUP with liver metastases) genome-wide significant associations were noted. For patients with liver metastases associations on chromosome 6 and 11, the latter including a cluster of genes DHCR7 and NADSYN1, encoding key enzymes in cholesterol and NAD synthesis, and KRTAP5-7, encoding a keratin associated protein. This first GWAS on CUP provide preliminary evidence that germline genes relating to inflammation (LTA4H), metastatic promotion (TIAM1) in association with lipid metabolic disturbance (chromosome 11 cluster) may contribute to the risk of CUP.

The picture superiority effect in associative recognition.

PubMed

Hockley, William E

2008-10-01

The picture superiority effect has been well documented in tests of item recognition and recall. The present study shows that the picture superiority effect extends to associative recognition. In three experiments, students studied lists consisting of random pairs of concrete words and pairs of line drawings; then they discriminated between intact (old) and rearranged (new) pairs of words and pictures at test. The discrimination advantage for pictures over words was seen in a greater hit rate for intact picture pairs, but there was no difference in the false alarm rates for the two types of stimuli. That is, there was no mirror effect. The same pattern of results was found when the test pairs consisted of the verbal labels of the pictures shown at study (Experiment 4), indicating that the hit rate advantage for picture pairs represents an encoding benefit. The results have implications for theories of the picture superiority effect and models of associative recognition.

Tissue-specific time courses of spontaneous mutation frequency and deviations in mutation pattern are observed in middle to late adulthood in Big Blue mice.

PubMed

Hill, Kathleen A; Halangoda, Asanga; Heinmoeller, Petra W; Gonzalez, Kelly; Chitaphan, Chaniga; Longmate, Jeffrey; Scaringe, William A; Wang, Ji-Cheng; Sommer, Steve S

2005-06-01

To better define the time course of spontaneous mutation frequency in middle to late adulthood of the mouse, measurements were made at 10, 14, 17, 23, 25, and 30 months of age in samples of adipose tissue, liver, cerebellum (90% neurons), and the male germline (95% germ cells). A total of 46 million plaque-forming units (pfus) were screened at the six time points and 1,450 circular blue plaques were harvested and sequenced. These data improve resolution and confirm the previously observed occurrence of at least two tissue-specific profiles of spontaneous mutation frequency (elevation with age in adipose tissue and liver, and constancy with age in neurons and male germ cells), a low mutation frequency in the male germline, and a mutation pattern unchanged with age within a tissue. These findings appear to extend to very old age (30 months). Additional findings include interanimal variation in spontaneous mutation frequency is larger in adipose tissues and liver compared with neurons and male germ cells, and subtle but significant differences in the mutation pattern among tissues, consistent with a minor effect of tissue-specific metabolism. The presumptive unaltered balance of DNA damage and repair with age in the male germline has evolutionary consequences. It is of particular interest given the controversy over whether or not increasing germline mutation frequency with paternal age underlies the reports associating older males with a higher incidence of some types of genetic disease. These most detailed measurements available to date regarding the time course of spontaneous mutation frequency and pattern in individual tissues help to constrain hypotheses regarding the role of mutational mechanisms in DNA repair and aging.

The Molecular Chaperone HSP90 Promotes Notch Signaling in the Germline of Caenorhabditis elegans

PubMed Central

Lissemore, James L.; Connors, Elyse; Liu, Ying; Qiao, Li; Yang, Bing; Edgley, Mark L.; Flibotte, Stephane; Taylor, Jon; Au, Vinci; Moerman, Donald G.; Maine, Eleanor M.

2018-01-01

In a genetic screen to identify genes that promote GLP-1/Notch signaling in Caenorhabditis elegans germline stem cells, we found a single mutation, om40, defining a gene called ego-3. ego-3(om40) causes several defects in the soma and the germline, including paralysis during larval development, sterility, delayed proliferation of germline stem cells, and ectopic germline stem cell proliferation. Whole genome sequencing identified om40 as an allele of hsp-90, previously known as daf-21, which encodes the C. elegans ortholog of the cytosolic form of HSP90. This protein is a molecular chaperone with a central position in the protein homeostasis network, which is responsible for proper folding, structural maintenance, and degradation of proteins. In addition to its essential role in cellular function, HSP90 plays an important role in stem cell maintenance and renewal. Complementation analysis using a deletion allele of hsp-90 confirmed that ego-3 is the same gene. hsp-90(om40) is an I→N conservative missense mutation of a highly conserved residue in the middle domain of HSP-90. RNA interference-mediated knockdown of hsp-90 expression partially phenocopied hsp-90(om40), confirming the loss-of-function nature of hsp-90(om40). Furthermore, reduced HSP-90 activity enhanced the effect of reduced function of both the GLP-1 receptor and the downstream LAG-1 transcription factor. Taken together, our results provide the first experimental evidence of an essential role for HSP90 in Notch signaling in development. PMID:29507057

The Molecular Chaperone HSP90 Promotes Notch Signaling in the Germline of Caenorhabditis elegans.

PubMed

Lissemore, James L; Connors, Elyse; Liu, Ying; Qiao, Li; Yang, Bing; Edgley, Mark L; Flibotte, Stephane; Taylor, Jon; Au, Vinci; Moerman, Donald G; Maine, Eleanor M

2018-05-04

In a genetic screen to identify genes that promote GLP-1/Notch signaling in Caenorhabditis elegans germline stem cells, we found a single mutation, om40 , defining a gene called ego-3. ego-3(om40) causes several defects in the soma and the germline, including paralysis during larval development, sterility, delayed proliferation of germline stem cells, and ectopic germline stem cell proliferation. Whole genome sequencing identified om40 as an allele of hsp-90 , previously known as daf-21 , which encodes the C. elegans ortholog of the cytosolic form of HSP90. This protein is a molecular chaperone with a central position in the protein homeostasis network, which is responsible for proper folding, structural maintenance, and degradation of proteins. In addition to its essential role in cellular function, HSP90 plays an important role in stem cell maintenance and renewal. Complementation analysis using a deletion allele of hsp-90 confirmed that ego-3 is the same gene. hsp-90(om40) is an I→N conservative missense mutation of a highly conserved residue in the middle domain of HSP-90 RNA interference-mediated knockdown of hsp-90 expression partially phenocopied hsp-90(om40) , confirming the loss-of-function nature of hsp-90(om40) Furthermore, reduced HSP-90 activity enhanced the effect of reduced function of both the GLP-1 receptor and the downstream LAG-1 transcription factor. Taken together, our results provide the first experimental evidence of an essential role for HSP90 in Notch signaling in development. Copyright © 2018 Lissemore et al.

Deadenylase depletion protects inherited mRNAs in primordial germ cells

PubMed Central

Swartz, S. Zachary; Reich, Adrian M.; Oulhen, Nathalie; Raz, Tal; Milos, Patrice M.; Campanale, Joseph P.; Hamdoun, Amro; Wessel, Gary M.

2014-01-01

A crucial event in animal development is the specification of primordial germ cells (PGCs), which become the stem cells that create sperm and eggs. How PGCs are created provides a valuable paradigm for understanding stem cells in general. We find that the PGCs of the sea urchin Strongylocentrotus purpuratus exhibit broad transcriptional repression, yet enrichment for a set of inherited mRNAs. Enrichment of several germline determinants in the PGCs requires the RNA-binding protein Nanos to target the transcript that encodes CNOT6, a deadenylase, for degradation in the PGCs, thereby creating a stable environment for RNA. Misexpression of CNOT6 in the PGCs results in their failure to retain Seawi transcripts and Vasa protein. Conversely, broad knockdown of CNOT6 expands the domain of Seawi RNA as well as exogenous reporters. Thus, Nanos-dependent spatially restricted CNOT6 differential expression is used to selectively localize germline RNAs to the PGCs. Our findings support a ‘time capsule’ model of germline determination, whereby the PGCs are insulated from differentiation by retaining the molecular characteristics of the totipotent egg and early embryo. PMID:25100654

Immunoglobulin kappa light chain gene promoter and enhancer are not responsible for B-cell restricted gene rearrangement.

PubMed Central

Goodhardt, M; Babinet, C; Lutfalla, G; Kallenbach, S; Cavelier, P; Rougeon, F

1989-01-01

We have produced transgenic mice which synthesize chimeric mouse-rabbit immunoglobulin (Ig) kappa light chains following in vivo recombination of an injected unrearranged kappa gene. The exogenous gene construct contained a mouse germ-line kappa variable (V kappa) gene segment, the mouse germ-line joining (J kappa) locus including the enhancer, and the rabbit b9 constant (C kappa) region. A high level of V-J recombination of the kappa transgene was observed in spleen of the transgenic mice. Surprisingly, a particularly high degree of variability in the exact site of recombination and the presence of non germ-line encoded nucleotides (N-regions) were found at the V-J junction of the rearranged kappa transgene. Furthermore, unlike endogenous kappa genes, rearrangement of the exogenous gene occurred in T-cells of the transgenic mice. These results show that additional sequences, other than the heptamer-nonamer signal sequences and the promoter and enhancer elements, are required to obtain stage- and lineage- specific regulation of Ig kappa light chain gene rearrangement in vivo. Images PMID:2508061

Encoding: the keystone to efficient functioning of verbal short-term memory.

PubMed

Barry, Johanna G; Sabisch, Beate; Friederici, Angela D; Brauer, Jens

2011-11-01

Verbal short-term memory (VSTM) is thought to play a critical role in language learning. It is indexed by the nonword repetition task where listeners are asked to repeat meaningless words like 'blonterstaping'. The present study investigated the effect on nonword repetition performance of differences in efficiency of functioning of some part of the neural architecture mediating VSTM. Hypotheses were stated within Baddeley and Hitch's (1974) multicomponent model of VSTM, with respect to regions of the brain known to be active during tasks tapping into VSTM. We were specifically interested in activations associated with the posterior planum temporale (Spt) which emerge during rehearsal since this region is hypothesized to be central to VTSM (Buchsbaum, Olsen, Koch, & Berman, 2005a). Participants performed a delayed reaction time task in the scanner which explicitly mimicked the three main stages of information-processing involved in VSTM (encoding, rehearsal, recall (here recognition)). The data for each stage were then convolved with scores from a separately measured nonword repetition task. Rather than observing a pattern of individual differences located to specific regions specialized for supporting VSTM, a dissociation in direction of correlation in overlapping regions of the brain was observed during encoding and recognition. Larger hemodynamic responses during encoding were associated with better nonword repetition, and vice versa during recognition. There was little evidence for a network of activations specialized for VSTM. Instead, the main correlations were observed in regions also known to be involved in long-term memory. It seems that individuals who are better at nonword repetition and hence at language learning, activate these regions more efficiently than poorer nonword-repeaters early after stimulus input. These observations are discussed with respect to various models proposed for explaining the phenomenon of VSTM. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

Visual encoding impairment in patients with schizophrenia: contribution of reduced working memory span, decreased processing speed, and affective symptoms.

PubMed

Brébion, Gildas; Stephan-Otto, Christian; Huerta-Ramos, Elena; Ochoa, Susana; Usall, Judith; Abellán-Vega, Helena; Roca, Mercedes; Haro, Josep Maria

2015-01-01

Previous research has revealed the contribution of decreased processing speed and reduced working memory span in verbal and visual memory impairment in patients with schizophrenia. The role of affective symptoms in verbal memory has also emerged in a few studies. The authors designed a picture recognition task to investigate the impact of these factors on visual encoding. Two types of pictures (black and white vs. colored) were presented under 2 different conditions of context encoding (either displayed at a specific location or in association with another visual stimulus). It was assumed that the process of encoding associated pictures was more effortful than that of encoding pictures that were presented alone. Working memory span and processing speed were assessed. In the patient group, working memory span was significantly associated with the recognition of the associated pictures but not significantly with that of the other pictures. Controlling for processing speed eliminated the patients' deficit in the recognition of the colored pictures and greatly reduced their deficit in the recognition of the black-and-white pictures. The recognition of the black-and-white pictures was inversely related to anxiety in men and to depression in women. Working memory span constrains the effortful visual encoding processes in patients, whereas processing speed decrement accounts for most of their visual encoding deficit. Affective symptoms also have an impact on visual encoding, albeit differently in men and women. PsycINFO Database Record (c) 2015 APA, all rights reserved.

Self-organized Evaluation of Dynamic Hand Gestures for Sign Language Recognition

NASA Astrophysics Data System (ADS)

Buciu, Ioan; Pitas, Ioannis

Two main theories exist with respect to face encoding and representation in the human visual system (HVS). The first one refers to the dense (holistic) representation of the face, where faces have "holon"-like appearance. The second one claims that a more appropriate face representation is given by a sparse code, where only a small fraction of the neural cells corresponding to face encoding is activated. Theoretical and experimental evidence suggest that the HVS performs face analysis (encoding, storing, face recognition, facial expression recognition) in a structured and hierarchical way, where both representations have their own contribution and goal. According to neuropsychological experiments, it seems that encoding for face recognition, relies on holistic image representation, while a sparse image representation is used for facial expression analysis and classification. From the computer vision perspective, the techniques developed for automatic face and facial expression recognition fall into the same two representation types. Like in Neuroscience, the techniques which perform better for face recognition yield a holistic image representation, while those techniques suitable for facial expression recognition use a sparse or local image representation. The proposed mathematical models of image formation and encoding try to simulate the efficient storing, organization and coding of data in the human cortex. This is equivalent with embedding constraints in the model design regarding dimensionality reduction, redundant information minimization, mutual information minimization, non-negativity constraints, class information, etc. The presented techniques are applied as a feature extraction step followed by a classification method, which also heavily influences the recognition results.

Encoding processes during retrieval tasks.

PubMed

Buckner, R L; Wheeler, M E; Sheridan, M A

2001-04-01

Episodic memory encoding is pervasive across many kinds of task and often arises as a secondary processing effect in tasks that do not require intentional memorization. To illustrate the pervasive nature of information processing that leads to episodic encoding, a form of incidental encoding was explored based on the "Testing" phenomenon: The incidental-encoding task was an episodic memory retrieval task. Behavioral data showed that performing a memory retrieval task was as effective as intentional instructions at promoting episodic encoding. During fMRI imaging, subjects viewed old and new words and indicated whether they remembered them. Relevant to encoding, the fate of the new words was examined using a second, surprise test of recognition after the imaging session. fMRI analysis of those new words that were later remembered revealed greater activity in left frontal regions than those that were later forgotten - the same pattern of results as previously observed for traditional incidental and intentional episodic encoding tasks. This finding may offer a partial explanation for why repeated testing improves memory performance. Furthermore, the observation of correlates of episodic memory encoding during retrieval tasks challenges some interpretations that arise from direct comparisons between "encoding tasks" and "retrieval tasks" in imaging data. Encoding processes and their neural correlates may arise in many tasks, even those nominally labeled as retrieval tasks by the experimenter.

Memory loss versus memory distortion: the role of encoding and retrieval deficits in Korsakoff patients' false memories.

PubMed

Van Damme, Ilse; d'Ydewalle, Gery

2009-05-01

Recent studies with the Deese/Roediger-McDermott (DRM) paradigm have revealed that Korsakoff patients show reduced levels of false recognition and different patterns of false recall compared to controls. The present experiment examined whether this could be attributed to an encoding deficit, or rather to problems with explicitly retrieving thematic information at test. In a variation on the DRM paradigm, both patients and controls were presented with associative as well as categorised word lists, with the order of recall and recognition tests manipulated between-subjects. The results point to an important role for the automatic/controlled retrieval distinction: Korsakoff patients' false memory was only diminished compared to controls' when automatic or short-term memory processes could not be used to fulfil the task at hand. Hence, the patients' explicit retrieval deficit appears to be crucial in explaining past and present data. Results are discussed in terms of fuzzy-trace and activation-monitoring theories.

Bi-directional gap junction-mediated soma-germline communication is essential for spermatogenesis.

PubMed

Smendziuk, Christopher M; Messenberg, Anat; Vogl, A Wayne; Tanentzapf, Guy

2015-08-01

Soma-germline interactions play conserved essential roles in regulating cell proliferation, differentiation, patterning and homeostasis in the gonad. In the Drosophila testis, secreted signalling molecules of the JAK-STAT, Hedgehog, BMP and EGF pathways are used to mediate soma-germline communication. Here, we demonstrate that gap junctions may also mediate direct, bi-directional signalling between the soma and germ line. When gap junctions between the soma and germ line are disrupted, germline differentiation is blocked and germline stem cells are not maintained. In the soma, gap junctions are required to regulate proliferation and differentiation. Localization and RNAi-mediated knockdown studies reveal that gap junctions in the fly testis are heterotypic channels containing Zpg (Inx4) and Inx2 on the germ line and the soma side, respectively. Overall, our results show that bi-directional gap junction-mediated signalling is essential to coordinate the soma and germ line to ensure proper spermatogenesis in Drosophila. Moreover, we show that stem cell maintenance and differentiation in the testis are directed by gap junction-derived cues. © 2015. Published by The Company of Biologists Ltd.

Functional and Neuroanatomical Specificity of Episodic Memory Dysfunction in Schizophrenia: An fMRI study of the Relational and Item-Specific Encoding Task

PubMed Central

Ragland, J. Daniel; Ranganath, Charan; Harms, Michael P.; Barch, Deanna M.; Gold, James M.; Layher, Evan; Lesh, Tyler A.; MacDonald, Angus W.; Niendam, Tara A.; Phillips, Joshua; Silverstein, Steven M.; Yonelinas, Andrew P.; Carter, Cameron S.

2015-01-01

Importance Individuals with schizophrenia (SZ) can encode item-specific information to support familiarity-based recognition, but are disproportionately impaired encoding inter-item relationships (relational encoding) and recollecting information. The Relational and Item-Specific Encoding (RiSE) paradigm has been used to disentangle these encoding and retrieval processes, which may be dependent on specific medial temporal lobe (MTL) and prefrontal cortex (PFC) subregions. Functional imaging during RiSE task performance could help to specify dysfunctional neural circuits in SZ that can be targeted for interventions to improve memory and functioning in the illness. Objectives To use functional magnetic resonance imaging (fMRI) to test the hypothesis that SZ disproportionately affects MTL and PFC subregions during relational encoding and retrieval, relative to item-specific memory processes. Imaging results from healthy comparison subjects (HC) will also be used to establish neural construct validity for RiSE. Design, Setting, and Participants This multi-site, case-control, cross-sectional fMRI study was conducted at five CNTRACS sites. The final sample included 52 clinically stable outpatients with SZ, and 57 demographically matched HC. Main Outcomes and Measures Behavioral performance speed and accuracy (d’) on item recognition and associative recognition tasks. Voxelwise statistical parametric maps for a priori MTL and PFC regions of interest (ROI), testing activation differences between relational and item-specific memory during encoding and retrieval. Results Item recognition was disproportionately impaired in SZ patients relative to controls following relational encoding. The differential deficit was accompanied by reduced dorsolateral prefrontal cortex (DLPFC) activation during relational encoding in SZ, relative to HC. Retrieval success (hits > misses) was associated with hippocampal (HI) activation in HC during relational item recognition and associative recognition conditions, and HI activation was specifically reduced in SZ for recognition of relational but not item-specific information. Conclusions In this unique, multi-site fMRI study, HC results supported RiSE construct validity by revealing expected memory effects in PFC and MTL subregions during encoding and retrieval. Comparison of SZ and HC revealed disproportionate memory deficits in SZ for relational versus item-specific information, accompanied by regionally and functionally specific deficits in DLPFC and HI activation. PMID:26200928

Emotional content enhances true but not false memory for categorized stimuli.

PubMed

Choi, Hae-Yoon; Kensinger, Elizabeth A; Rajaram, Suparna

2013-04-01

Past research has shown that emotion enhances true memory, but that emotion can either increase or decrease false memory. Two theoretical possibilities-the distinctiveness of emotional stimuli and the conceptual relatedness of emotional content-have been implicated as being responsible for influencing both true and false memory for emotional content. In the present study, we sought to identify the mechanisms that underlie these mixed findings by equating the thematic relatedness of the study materials across each type of valence used (negative, positive, or neutral). In three experiments, categorically bound stimuli (e.g., funeral, pets, and office items) were used for this purpose. When the encoding task required the processing of thematic relatedness, a significant true-memory enhancement for emotional content emerged in recognition memory, but no emotional boost to false memory (exp. 1). This pattern persisted for true memory with a longer retention interval between study and test (24 h), and false recognition was reduced for emotional items (exp. 2). Finally, better recognition memory for emotional items once again emerged when the encoding task (arousal ratings) required the processing of the emotional aspect of the study items, with no emotional boost to false recognition (EXP. 3). Together, these findings suggest that when emotional and neutral stimuli are equivalently high in thematic relatedness, emotion continues to improve true memory, but it does not override other types of grouping to increase false memory.

Improved perception of music with a harmonic based algorithm for cochlear implants.

PubMed

Li, Xing; Nie, Kaibao; Imennov, Nikita S; Rubinstein, Jay T; Atlas, Les E

2013-07-01

The lack of fine structure information in conventional cochlear implant (CI) encoding strategies presumably contributes to the generally poor music perception with CIs. To improve CI users' music perception, a harmonic-single-sideband-encoder (HSSE) strategy was developed , which explicitly tracks the harmonics of a single musical source and transforms them into modulators conveying both amplitude and temporal fine structure cues to electrodes. To investigate its effectiveness, vocoder simulations of HSSE and the conventional continuous-interleaved-sampling (CIS) strategy were implemented. Using these vocoders, five normal-hearing subjects' melody and timbre recognition performance were evaluated: a significant benefit of HSSE to both melody (p < 0.002) and timbre (p < 0.026) recognition was found. Additionally, HSSE was acutely tested in eight CI subjects. On timbre recognition, a significant advantage of HSSE over the subjects' clinical strategy was demonstrated: the largest improvement was 35% and the mean 17% (p < 0.013). On melody recognition, two subjects showed 20% improvement with HSSE; however, the mean improvement of 7% across subjects was not significant (p > 0.090). To quantify the temporal cues delivered to the auditory nerve, the neural spike patterns evoked by HSSE and CIS for one melody stimulus were simulated using an auditory nerve model. Quantitative analysis demonstrated that HSSE can convey temporal pitch cues better than CIS. The results suggest that HSSE is a promising strategy to enhance music perception with CIs.

ERP profiles for face and word recognition are based on their status in semantic memory not their stimulus category.

PubMed

Nie, Aiqing; Griffin, Michael; Keinath, Alexander; Walsh, Matthew; Dittmann, Andrea; Reder, Lynne

2014-04-04

Previous research has suggested that faces and words are processed and remembered differently as reflected by different ERP patterns for the two types of stimuli. Specifically, face stimuli produced greater late positive deflections for old items in anterior compared to posterior regions, while word stimuli produced greater late positive deflections in posterior compared to anterior regions. Given that words have existing representations in subjects׳ long-term memories (LTM) and that face stimuli used in prior experiments were of unknown individuals, we conducted an ERP study that crossed face and letter stimuli with the presence or absence of a prior (stable or existing) memory representation. During encoding, subjects judged whether stimuli were known (famous face or real word) or not known (unknown person or pseudo-word). A surprise recognition memory test required subjects to distinguish between stimuli that appeared during the encoding phase and stimuli that did not. ERP results were consistent with previous research when comparing unknown faces and words; however, the late ERP pattern for famous faces was more similar to that for words than for unknown faces. This suggests that the critical ERP difference is mediated by whether there is a prior representation in LTM, and not whether the stimulus involves letters or faces. Published by Elsevier B.V.

fMRI differences in encoding and retrieval of pictures due to encoding strategy in the elderly.

PubMed

Mandzia, Jennifer L; Black, Sandra E; McAndrews, Mary Pat; Grady, Cheryl; Graham, Simon

2004-01-01

Functional MRI (fMRI) was used to examine the neural correlates of depth of processing during encoding and retrieval of photographs in older normal volunteers (n = 12). Separate scans were run during deep (natural vs. man-made decision) and shallow (color vs. black-and-white decision) encoding and during old/new recognition of pictures initially presented in one of the two encoding conditions. A baseline condition consisting of a scrambled, color photograph was used as a contrast in each scan. Recognition accuracy was greater for the pictures on which semantic decisions were made at encoding, consistent with the expected levels of processing effect. A mixed-effects model was used to compare fMRI differences between conditions (deep-baseline vs. shallow-baseline) in both encoding and retrieval. For encoding, this contrast revealed greater activation associated with deep encoding in several areas, including the left parahippocampal gyrus (PHG), left middle temporal gyrus, and left anterior thalamus. Increased left hippocampal, right dorsolateral, and inferior frontal activations were found for recognition of items that had been presented in the deep relative to the shallow encoding condition. We speculate that the modulation of activity in these regions by the depth of processing manipulation shows that these regions support effective encoding and successful retrieval. A direct comparison between encoding and retrieval revealed greater activation during retrieval in the medial temporal (right hippocampus and bilateral PHG), anterior cingulate, and bilateral prefrontal (inferior and dorsolateral). Most notably, greater right posterior PHG was found during encoding compared to recognition. Focusing on the medial temporal lobe (MTL) region, our results suggest a greater involvement of both anterior MTL and prefrontal regions in retrieval compared to encoding. Copyright 2003 Wiley-Liss, Inc.

Mutational analysis of the RB1 gene and the inheritance patterns of retinoblastoma in Jordan.

PubMed

Yousef, Yacoub A; Tbakhi, Abdelghani; Al-Hussaini, Maysa; AlNawaiseh, Ibrahim; Saab, Ala; Afifi, Amal; Naji, Maysa; Mohammad, Mona; Deebajah, Rasha; Jaradat, Imad; Sultan, Iyad; Mehyar, Mustafa

2018-04-01

Retinoblastoma (RB) is a childhood cancer developing in the retina due to RB1 pathologic variant. Herein we are evaluating the oncogenic mutations in the RB1 gene and the inheritance patterns of RB in the Jordanian patients. In this prospective study, the peripheral blood of 50 retinoblastoma patients was collected, genomic DNA was extracted, mutations were identified using Quantitative multiplex PCR (QM-PCR), Allele-specific PCR, Next Generation Sequencing analysis, and Sanger sequencing. In this cohort of 50 patients, 20(40%) patients had unilateral RB and 30(60%) were males. Overall, 36(72%) patients had germline disease, 17(47%) of whom had the same RB1 pathologic variant detected in one of the parents (inherited disease). In the bilateral group, all (100%) patients had germline disease; 13(43%) of them had inherited mutation. In the unilateral group, 6(30%) had germline disease, 4(20%) of them had inherited mutation. Nonsense mutation generating a stop codon and producing a truncated non-functional protein was the most frequent detected type of mutations (n = 15/36, 42%). Only one (2%) of the patients had mosaic mutation, and of the 17 inherited cases, 16(94%) had an unaffected carrier parent. In conclusion, in addition to all bilateral RB patients in our cohort, 30% of unilateral cases showed germline mutation. Almost half (47%) of germline cases had inherited disease from affected (6%) parent or unaffected carrier (94%). Therefore molecular screening is critical for the genetic counseling regarding the risk for inherited RB in both unilateral and bilateral cases including those with no family history.

The low-frequency encoding disadvantage: Word frequency affects processing demands.

PubMed

Diana, Rachel A; Reder, Lynne M

2006-07-01

Low-frequency words produce more hits and fewer false alarms than high-frequency words in a recognition task. The low-frequency hit rate advantage has sometimes been attributed to processes that operate during the recognition test (e.g., L. M. Reder et al., 2000). When tasks other than recognition, such as recall, cued recall, or associative recognition, are used, the effects seem to contradict a low-frequency advantage in memory. Four experiments are presented to support the claim that in addition to the advantage of low-frequency words at retrieval, there is a low-frequency disadvantage during encoding. That is, low-frequency words require more processing resources to be encoded episodically than high-frequency words. Under encoding conditions in which processing resources are limited, low-frequency words show a larger decrement in recognition than high-frequency words. Also, studying items (pictures and words of varying frequencies) along with low-frequency words reduces performance for those stimuli. Copyright 2006 APA, all rights reserved.

Repetition and brain potentials when recognizing natural scenes: task and emotion differences

PubMed Central

Bradley, Margaret M.; Codispoti, Maurizio; Karlsson, Marie; Lang, Peter J.

2013-01-01

Repetition has long been known to facilitate memory performance, but its effects on event-related potentials (ERPs), measured as an index of recognition memory, are less well characterized. In Experiment 1, effects of both massed and distributed repetition on old–new ERPs were assessed during an immediate recognition test that followed incidental encoding of natural scenes that also varied in emotionality. Distributed repetition at encoding enhanced both memory performance and the amplitude of an old–new ERP difference over centro-parietal sensors. To assess whether these repetition effects reflect encoding or retrieval differences, the recognition task was replaced with passive viewing of old and new pictures in Experiment 2. In the absence of an explicit recognition task, ERPs were completely unaffected by repetition at encoding, and only emotional pictures prompted a modestly enhanced old–new difference. Taken together, the data suggest that repetition facilitates retrieval processes and that, in the absence of an explicit recognition task, differences in old–new ERPs are only apparent for affective cues. PMID:22842817

Efficient Spatio-Temporal Local Binary Patterns for Spontaneous Facial Micro-Expression Recognition

PubMed Central

Wang, Yandan; See, John; Phan, Raphael C.-W.; Oh, Yee-Hui

2015-01-01

Micro-expression recognition is still in the preliminary stage, owing much to the numerous difficulties faced in the development of datasets. Since micro-expression is an important affective clue for clinical diagnosis and deceit analysis, much effort has gone into the creation of these datasets for research purposes. There are currently two publicly available spontaneous micro-expression datasets—SMIC and CASME II, both with baseline results released using the widely used dynamic texture descriptor LBP-TOP for feature extraction. Although LBP-TOP is popular and widely used, it is still not compact enough. In this paper, we draw further inspiration from the concept of LBP-TOP that considers three orthogonal planes by proposing two efficient approaches for feature extraction. The compact robust form described by the proposed LBP-Six Intersection Points (SIP) and a super-compact LBP-Three Mean Orthogonal Planes (MOP) not only preserves the essential patterns, but also reduces the redundancy that affects the discriminality of the encoded features. Through a comprehensive set of experiments, we demonstrate the strengths of our approaches in terms of recognition accuracy and efficiency. PMID:25993498

The effect of mood-context on visual recognition and recall memory.

PubMed

Robinson, Sarita J; Rollings, Lucy J L

2011-01-01

Although it is widely known that memory is enhanced when encoding and retrieval occur in the same state, the impact of elevated stress/arousal is less understood. This study explores mood-dependent memory's effects on visual recognition and recall of material memorized either in a neutral mood or under higher stress/arousal levels. Participants' (N = 60) recognition and recall were assessed while they experienced either the same o a mismatched mood at retrieval. The results suggested that both visual recognition and recall memory were higher when participants experienced the same mood at encoding and retrieval compared with those who experienced a mismatch in mood context between encoding and retrieval. These findings offer support for a mood dependency effect on both the recognition and recall of visual information.

Scene recognition following locomotion around a scene.

PubMed

Motes, Michael A; Finlay, Cory A; Kozhevnikov, Maria

2006-01-01

Effects of locomotion on scene-recognition reaction time (RT) and accuracy were studied. In experiment 1, observers memorized an 11-object scene and made scene-recognition judgments on subsequently presented scenes from the encoded view or different views (ie scenes were rotated or observers moved around the scene, both from 40 degrees to 360 degrees). In experiment 2, observers viewed different 5-object scenes on each trial and made scene-recognition judgments from the encoded view or after moving around the scene, from 36 degrees to 180 degrees. Across experiments, scene-recognition RT increased (in experiment 2 accuracy decreased) with angular distance between encoded and judged views, regardless of how the viewpoint changes occurred. The findings raise questions about conditions in which locomotion produces spatially updated representations of scenes.

Prefrontal Engagement during Source Memory Retrieval Depends on the Prior Encoding Task

PubMed Central

Kuo, Trudy Y.; Van Petten, Cyma

2008-01-01

The prefrontal cortex is strongly engaged by some, but not all, episodic memory tests. Prior work has shown that source recognition tests—those that require memory for conjunctions of studied attributes—yield deficient performance in patients with prefrontal damage and greater prefrontal activity in healthy subjects, as compared to simple recognition tests. Here, we tested the hypothesis that there is no intrinsic relationship between the prefrontal cortex and source memory, but that the prefrontal cortex is engaged by the demand to retrieve weakly encoded relationships. Subjects attempted to remember object/color conjunctions after an encoding task that focused on object identity alone, and an integrative encoding task that encouraged attention to object/color relationships. After the integrative encoding task, the late prefrontal brain electrical activity that typically occurs in source memory tests was eliminated. Earlier brain electrical activity related to successful recognition of the objects was unaffected by the nature of prior encoding. PMID:16839287

Implementation theory of distortion-invariant pattern recognition for optical and digital signal processing systems

NASA Astrophysics Data System (ADS)

Lhamon, Michael Earl

A pattern recognition system which uses complex correlation filter banks requires proportionally more computational effort than single-real valued filters. This introduces increased computation burden but also introduces a higher level of parallelism, that common computing platforms fail to identify. As a result, we consider algorithm mapping to both optical and digital processors. For digital implementation, we develop computationally efficient pattern recognition algorithms, referred to as, vector inner product operators that require less computational effort than traditional fast Fourier methods. These algorithms do not need correlation and they map readily onto parallel digital architectures, which imply new architectures for optical processors. These filters exploit circulant-symmetric matrix structures of the training set data representing a variety of distortions. By using the same mathematical basis as with the vector inner product operations, we are able to extend the capabilities of more traditional correlation filtering to what we refer to as "Super Images". These "Super Images" are used to morphologically transform a complicated input scene into a predetermined dot pattern. The orientation of the dot pattern is related to the rotational distortion of the object of interest. The optical implementation of "Super Images" yields feature reduction necessary for using other techniques, such as artificial neural networks. We propose a parallel digital signal processor architecture based on specific pattern recognition algorithms but general enough to be applicable to other similar problems. Such an architecture is classified as a data flow architecture. Instead of mapping an algorithm to an architecture, we propose mapping the DSP architecture to a class of pattern recognition algorithms. Today's optical processing systems have difficulties implementing full complex filter structures. Typically, optical systems (like the 4f correlators) are limited to phase-only implementation with lower detection performance than full complex electronic systems. Our study includes pseudo-random pixel encoding techniques for approximating full complex filtering. Optical filter bank implementation is possible and they have the advantage of time averaging the entire filter bank at real time rates. Time-averaged optical filtering is computational comparable to billions of digital operations-per-second. For this reason, we believe future trends in high speed pattern recognition will involve hybrid architectures of both optical and DSP elements.

Distinctive Information and False Recognition: The Contribution of Encoding and Retrieval Factors

ERIC Educational Resources Information Center

Arndt, Jason

2006-01-01

Four experiments evaluated the role of encoding-based and retrieval-based factors in the production of false recognition. The association of unusual fonts with study items, the match between study and test font, and the duration of retrieval time allotted to subjects to make recognition memory decisions were varied in order to examine the role…

piRNA-mediated transposon regulation and the germ-line mutation rate in Drosophila melanogaster males.

PubMed

Simmons, Michael J; Peterson, Mark P; Thorp, Michael W; Buschette, Jared T; DiPrima, Stephanie N; Harter, Christine L; Skolnick, Matthew J

2015-03-01

Transposons, especially retrotransposons, are abundant in the genome of Drosophila melanogaster. These mobile elements are regulated by small RNAs that interact with the Piwi family of proteins-the piwi-interacting or piRNAs. The Piwi proteins are encoded by the genes argonaute3 (ago3), aubergine (aub), and piwi. Heterochromatin Protein 1 (HP1), a chromatin-organizing protein encoded by the Suppressor of variegation 205 [Su(var)205] gene, also plays a role in this regulation. To assess the mutational impact of weakening the system for transposon regulation, we measured the frequency of recessive X-linked lethal mutations occurring in the germ lines of males from stocks that were heterozygous for mutant alleles of the ago3, aub, piwi, or Su(var)205 genes. These mutant alleles are expected to deplete the wild-type proteins encoded by these genes by as much as 50%. The mutant alleles of piwi and Su(var)205 significantly increased the X-linked lethal mutation frequency, whereas the mutant alleles of ago3 did not. An increased mutation frequency was also observed in males from one of two mutant aub stocks, but this increase may not have been due to the aub mutant. The increased mutation frequency caused by depleting Piwi or HP1suggests that chromatin-organizing proteins play important roles in minimizing the germ-line mutation rate, possibly by stabilizing the structure of the heterochromatin in which many transposons are situated. Copyright © 2015 Elsevier B.V. All rights reserved.

Eye tracking reveals a crucial role for facial motion in recognition of faces by infants

PubMed Central

Xiao, Naiqi G.; Quinn, Paul C.; Liu, Shaoying; Ge, Liezhong; Pascalis, Olivier; Lee, Kang

2015-01-01

Current knowledge about face processing in infancy comes largely from studies using static face stimuli, but faces that infants see in the real world are mostly moving ones. To bridge this gap, 3-, 6-, and 9-month-old Asian infants (N = 118) were familiarized with either moving or static Asian female faces and then their face recognition was tested with static face images. Eye tracking methodology was used to record eye movements during familiarization and test phases. The results showed a developmental change in eye movement patterns, but only for the moving faces. In addition, the more infants shifted their fixations across facial regions, the better was their face recognition, but only for the moving faces. The results suggest that facial movement influences the way faces are encoded from early in development. PMID:26010387

Discovery of the First Germline-Restricted Gene by Subtractive Transcriptomic Analysis in the Zebra Finch, Taeniopygia guttata.

PubMed

Biederman, Michelle K; Nelson, Megan M; Asalone, Kathryn C; Pedersen, Alyssa L; Saldanha, Colin J; Bracht, John R

2018-05-21

Developmentally programmed genome rearrangements are rare in vertebrates, but have been reported in scattered lineages including the bandicoot, hagfish, lamprey, and zebra finch (Taeniopygia guttata) [1]. In the finch, a well-studied animal model for neuroendocrinology and vocal learning [2], one such programmed genome rearrangement involves a germline-restricted chromosome, or GRC, which is found in germlines of both sexes but eliminated from mature sperm [3, 4]. Transmitted only through the oocyte, it displays uniparental female-driven inheritance, and early in embryonic development is apparently eliminated from all somatic tissue in both sexes [3, 4]. The GRC comprises the longest finch chromosome at over 120 million base pairs [3], and previously the only known GRC-derived sequence was repetitive and non-coding [5]. Because the zebra finch genome project was sourced from male muscle (somatic) tissue [6], the remaining genomic sequence and protein-coding content of the GRC remain unknown. Here we report the first protein-coding gene from the GRC: a member of the α-soluble N-ethylmaleimide sensitive fusion protein (NSF) attachment protein (α-SNAP) family hitherto missing from zebra finch gene annotations. In addition to the GRC-encoded α-SNAP, we find an additional paralogous α-SNAP residing in the somatic genome (a somatolog)-making the zebra finch the first example in which α-SNAP is not a single-copy gene. We show divergent, sex-biased expression for the paralogs and also that positive selection is detectable across the bird α-SNAP lineage, including the GRC-encoded α-SNAP. This study presents the identification and evolutionary characterization of the first protein-coding GRC gene in any organism. Copyright © 2018 Elsevier Ltd. All rights reserved.

The phenotype of mes-2, mes-3, mes-4 and mes-6, maternal-effect genes required for survival of the germline in Caenorhabditis elegans, is sensitive to chromosome dosage.

PubMed Central

Garvin, C; Holdeman, R; Strome, S

1998-01-01

Mutations in mes-2, mes-3, mes-4, and mes-6 result in maternal-effect sterility: hermaphrodite offspring of mes/mes mothers are sterile because of underproliferation and death of the germ cells, as well as an absence of gametes. Mutant germ cells do not undergo programmed cell death, but instead undergo a necrotic-type death, and their general poor health apparently prevents surviving germ cells from forming gametes. Male offspring of mes mothers display a significantly less severe germline phenotype than their hermaphrodite siblings, and males are often fertile. This differential response of hermaphrodite and male offspring to the absence of mes+ product is a result of their different X chromosome compositions; regardless of their sexual phenotype, XX worms display a more severe germline phenotype than XO worms, and XXX worms display the most severe phenotype. The sensitivity of the mutant phenotype to chromosome dosage, along with the similarity of two MES proteins to chromatin-associated regulators of gene expression in Drosophila, suggest that the essential role of the mes genes is in control of gene expression in the germline. An additional, nonessential role of the mes genes in the soma is suggested by the surprising finding that mutations in the mes genes, like mutations in dosage compensation genes, feminize animals whose male sexual identity is somewhat ambiguous. We hypothesize that the mes genes encode maternally supplied regulators of chromatin structure and gene expression in the germline and perhaps in somatic cells of the early embryo, and that at least some of their targets are on the X chromosomes. PMID:9475730

Diversity in recognition of glycans by F-type lectins and galectins: molecular, structural, and biophysical aspects

PubMed Central

Vasta, Gerardo R.; Ahmed, Hafiz; Bianchet, Mario A.; Fernández-Robledo, José A.; Amzel, L. Mario

2013-01-01

Although lectins are “hard-wired” in the germline, the presence of tandemly arrayed carbohydrate recognition domains (CRDs), of chimeric structures displaying distinct CRDs, of polymorphic genes resulting in multiple isoforms, and in some cases, of a considerable recognition plasticity of their carbohydrate binding sites, significantly expand the lectin ligand-recognition spectrum and lectin functional diversification. Analysis of structural/functional aspects of galectins and F-lectins—the most recently identified lectin family characterized by a unique CRD sequence motif (a distinctive structural fold) and nominal specificity for l-Fuc—has led to a greater understanding of self/nonself recognition by proteins with tandemly arrayed CRDs. For lectins with a single CRD, however, recognition of self and nonself glycans can only be rationalized in terms of protein oligomerization and ligand clustering and presentation. Spatial and temporal changes in lectin expression, secretion, and local concentrations in extracellular microenvironments, as well as structural diversity and spatial display of their carbohydrate ligands on the host or microbial cell surface, are suggestive of a dynamic interplay of their recognition and effector functions in development and immunity. PMID:22973821

Unimodal and crossmodal working memory representations of visual and kinesthetic movement trajectories.

PubMed

Seemüller, Anna; Fiehler, Katja; Rösler, Frank

2011-01-01

The present study investigated whether visual and kinesthetic stimuli are stored as multisensory or modality-specific representations in unimodal and crossmodal working memory tasks. To this end, angle-shaped movement trajectories were presented to 16 subjects in delayed matching-to-sample tasks either visually or kinesthetically during encoding and recognition. During the retention interval, a secondary visual or kinesthetic interference task was inserted either immediately or with a delay after encoding. The modality of the interference task interacted significantly with the encoding modality. After visual encoding, memory was more impaired by a visual than by a kinesthetic secondary task, while after kinesthetic encoding the pattern was reversed. The time when the secondary task had to be performed interacted with the encoding modality as well. For visual encoding, memory was more impaired, when the secondary task had to be performed at the beginning of the retention interval. In contrast, memory after kinesthetic encoding was more affected, when the secondary task was introduced later in the retention interval. The findings suggest that working memory traces are maintained in a modality-specific format characterized by distinct consolidation processes that take longer after kinesthetic than after visual encoding. Copyright © 2010 Elsevier B.V. All rights reserved.

Integrative genome-wide analysis of the determinants of RNA splicing in kidney renal clear cell carcinoma.

PubMed

Lehmann, Kjong-Van; Kahles, André; Kandoth, Cyriac; Lee, William; Schultz, Nikolaus; Stegle, Oliver; Rätsch, Gunnar

2015-01-01

We present a genome-wide analysis of splicing patterns of 282 kidney renal clear cell carcinoma patients in which we integrate data from whole-exome sequencing of tumor and normal samples, RNA-seq and copy number variation. We proposed a scoring mechanism to compare splicing patterns in tumor samples to normal samples in order to rank and detect tumor-specific isoforms that have a potential for new biomarkers. We identified a subset of genes that show introns only observable in tumor but not in normal samples, ENCODE and GEUVADIS samples. In order to improve our understanding of the underlying genetic mechanisms of splicing variation we performed a large-scale association analysis to find links between somatic or germline variants with alternative splicing events. We identified 915 cis- and trans-splicing quantitative trait loci (sQTL) associated with changes in splicing patterns. Some of these sQTL have previously been associated with being susceptibility loci for cancer and other diseases. Our analysis also allowed us to identify the function of several COSMIC variants showing significant association with changes in alternative splicing. This demonstrates the potential significance of variants affecting alternative splicing events and yields insights into the mechanisms related to an array of disease phenotypes.

The Role of Anterior Nuclei of the Thalamus: A Subcortical Gate in Memory Processing: An Intracerebral Recording Study.

PubMed

Štillová, Klára; Jurák, Pavel; Chládek, Jan; Chrastina, Jan; Halámek, Josef; Bočková, Martina; Goldemundová, Sabina; Říha, Ivo; Rektor, Ivan

2015-01-01

To study the involvement of the anterior nuclei of the thalamus (ANT) as compared to the involvement of the hippocampus in the processes of encoding and recognition during visual and verbal memory tasks. We studied intracerebral recordings in patients with pharmacoresistent epilepsy who underwent deep brain stimulation (DBS) of the ANT with depth electrodes implanted bilaterally in the ANT and compared the results with epilepsy surgery candidates with depth electrodes implanted bilaterally in the hippocampus. We recorded the event-related potentials (ERPs) elicited by the visual and verbal memory encoding and recognition tasks. P300-like potentials were recorded in the hippocampus by visual and verbal memory encoding and recognition tasks and in the ANT by the visual encoding and visual and verbal recognition tasks. No significant ERPs were recorded during the verbal encoding task in the ANT. In the visual and verbal recognition tasks, the P300-like potentials in the ANT preceded the P300-like potentials in the hippocampus. The ANT is a structure in the memory pathway that processes memory information before the hippocampus. We suggest that the ANT has a specific role in memory processes, especially memory recognition, and that memory disturbance should be considered in patients with ANT-DBS and in patients with ANT lesions. ANT is well positioned to serve as a subcortical gate for memory processing in cortical structures.

One gene - many endocrine and metabolic syndromes: PTEN-opathies and precision medicine.

PubMed

Yehia, Lamis; Eng, Charis

2018-05-23

An average of 10% of all cancers (range 1-40%) are caused by heritable mutations and over the years, have become powerful models for precision medicine practice. Furthermore, such cancer predisposition genes for seemingly rare syndromes have turned out to help explain mechanisms of sporadic carcinogenesis and often inform normal development. The tumor suppressor PTEN encodes a ubiquitously expressed phosphatase that counteracts the PI3K/AKT/mTOR cascade - one of the most critical growth-promoting signaling pathways. Clinically, individuals with germline PTEN mutations have diverse phenotypes and fall under the umbrella term PTEN hamartoma tumor syndrome (PHTS). PHTS encompasses four clinically distinct allelic overgrowth syndromes, namely Cowden, Bannayan-Riley-Ruvalcaba, Proteus, and Proteus-like syndromes. Relatedly, mutations in other genes encoding components of the PI3K/AKT/mTOR pathway downstream of PTEN also predispose patients to partially overlapping clinical manifestations, with similar effects as PTEN malfunction. We refer to these syndromes as "PTEN-opathies." As a tumor suppressor and key regulator of normal development, PTEN dysfunction can cause a spectrum of phenotypes including benign overgrowths, malignancies, metabolic, and neurodevelopmental disorders. Relevant to clinical practice, the identification of PTEN mutations in patients not only establishes a PHTS molecular diagnosis, but also informs on more accurate cancer risk assessment and medical management of those patients and affected family members. Importantly, timely diagnosis is key, as early recognition allows for preventative measures such as high-risk screening and surveillance even prior to cancer onset. This review highlights the translational impact that the discovery of PTEN has had on the diagnosis, management, and treatment of PHTS.

Neural Similarity Between Encoding and Retrieval is Related to Memory Via Hippocampal Interactions

PubMed Central

Ritchey, Maureen; Wing, Erik A.; LaBar, Kevin S.; Cabeza, Roberto

2013-01-01

A fundamental principle in memory research is that memory is a function of the similarity between encoding and retrieval operations. Consistent with this principle, many neurobiological models of declarative memory assume that memory traces are stored in cortical regions, and the hippocampus facilitates the reactivation of these traces during retrieval. The present investigation tested the novel prediction that encoding–retrieval similarity can be observed and related to memory at the level of individual items. Multivariate representational similarity analysis was applied to functional magnetic resonance imaging data collected during encoding and retrieval of emotional and neutral scenes. Memory success tracked fluctuations in encoding–retrieval similarity across frontal and posterior cortices. Importantly, memory effects in posterior regions reflected increased similarity between item-specific representations during successful recognition. Mediation analyses revealed that the hippocampus mediated the link between cortical similarity and memory success, providing crucial evidence for hippocampal–cortical interactions during retrieval. Finally, because emotional arousal is known to modulate both perceptual and memory processes, similarity effects were compared for emotional and neutral scenes. Emotional arousal was associated with enhanced similarity between encoding and retrieval patterns. These findings speak to the promise of pattern similarity measures for evaluating memory representations and hippocampal–cortical interactions. PMID:22967731

The developmental basis for germline mosaicism in mouse and Drosophila melanogaster.

PubMed

Drost, J B; Lee, W R

1998-01-01

Data involving germline mosaics in Drosophila melanogaster and mouse are reconciled with developmental observations. Mutations that become fixed in the early embryo before separation of soma from the germline may, by the sampling process of development, continue as part of germline and/or differentiate into any somatic tissue. The cuticle of adult D. melanogaster, because of segmental development, can be used to estimate the proportion of mutant nuclei in the early embryo, but most somatic tissues and the germlines of both species continue from samples too small to be representative of the early embryo. Because of the small sample of cells/nuclei that remain in the germline after separation of soma in both species, mosaic germlines have percentages of mutant cells that vary widely, with a mean of 50% and an unusual platykurtic, flat-topped distribution. While the sampling process leads to similar statistical results for both species, their patterns of development are very different. In D. melanogaster the first differentiation is the separation of soma from germline with the germline continuing from a sample of only two to four nuclei, whereas the adult cuticle is a representative sample of cleavage nuclei. The presence of mosaicism in D. melanogaster germline is independent of mosaicism in the eye, head, and thorax. This independence was used to determine that mutations can occur at any of the early embryonic cell divisions and still average 50% mutant germ cells when the germline is mosaic; however, the later the mutation occurs, the higher the proportion of completely nonmutant germlines. In contrast to D. melanogaster, the first differentiation in the mouse does not separate soma from germline but produces the inner cell mass that is representative of the cleavage nuclei. Following formation of the primitive streak, the primordial germ cells develop at the base of the allantois and among a clonally related sample of cells, providing the same statistical distribution in the mouse germlines as in D. melanogaster. The proportion of mutations that are fixed during early embryonic development is greatly underestimated. For example, a DNA lesion in a postmeiotic gamete that becomes fixed as a dominant mutation during early embryonic development of the F1 may produce an individual completely mutant in the germ line and relevant somatic tissue or, alternatively, the F1 germline may be completely mutant but with no relevant somatic tissues for detecting the mutation until the F2. In both cases the mutation would be classified as complete in the F1 and F2, respectively, and not recognized as embryonic in origin. Because germ cells differentiate later in mammalian development, there are more opportunities for correlation between germline and soma in the mammal than Drosophila. However, because the germ cells and any somatic tissue, like blood, are derived from small samples, there may be many individuals that test negative in blood but have germlines that are either mosaic or entirely mutant.

Extensive Use of RNA-Binding Proteins in Drosophila Sensory Neuron Dendrite Morphogenesis

PubMed Central

Olesnicky, Eugenia C.; Killian, Darrell J.; Garcia, Evelyn; Morton, Mary C.; Rathjen, Alan R.; Sola, Ismail E.; Gavis, Elizabeth R.

2013-01-01

The large number of RNA-binding proteins and translation factors encoded in the Drosophila and other metazoan genomes predicts widespread use of post-transcriptional regulation in cellular and developmental processes. Previous studies identified roles for several RNA-binding proteins in dendrite branching morphogenesis of Drosophila larval sensory neurons. To determine the larger contribution of post-transcriptional gene regulation to neuronal morphogenesis, we conducted an RNA interference screen to identify additional Drosophila proteins annotated as either RNA-binding proteins or translation factors that function in producing the complex dendritic trees of larval class IV dendritic arborization neurons. We identified 88 genes encoding such proteins whose knockdown resulted in aberrant dendritic morphology, including alterations in dendritic branch number, branch length, field size, and patterning of the dendritic tree. In particular, splicing and translation initiation factors were associated with distinct and characteristic phenotypes, suggesting that different morphogenetic events are best controlled at specific steps in post-transcriptional messenger RNA metabolism. Many of the factors identified in the screen have been implicated in controlling the subcellular distributions and translation of maternal messenger RNAs; thus, common post-transcriptional regulatory strategies may be used in neurogenesis and in the generation of asymmetry in the female germline and embryo. PMID:24347626

Wearable Device-Based Gait Recognition Using Angle Embedded Gait Dynamic Images and a Convolutional Neural Network.

PubMed

Zhao, Yongjia; Zhou, Suiping

2017-02-28

The widespread installation of inertial sensors in smartphones and other wearable devices provides a valuable opportunity to identify people by analyzing their gait patterns, for either cooperative or non-cooperative circumstances. However, it is still a challenging task to reliably extract discriminative features for gait recognition with noisy and complex data sequences collected from casually worn wearable devices like smartphones. To cope with this problem, we propose a novel image-based gait recognition approach using the Convolutional Neural Network (CNN) without the need to manually extract discriminative features. The CNN's input image, which is encoded straightforwardly from the inertial sensor data sequences, is called Angle Embedded Gait Dynamic Image (AE-GDI). AE-GDI is a new two-dimensional representation of gait dynamics, which is invariant to rotation and translation. The performance of the proposed approach in gait authentication and gait labeling is evaluated using two datasets: (1) the McGill University dataset, which is collected under realistic conditions; and (2) the Osaka University dataset with the largest number of subjects. Experimental results show that the proposed approach achieves competitive recognition accuracy over existing approaches and provides an effective parametric solution for identification among a large number of subjects by gait patterns.

Wearable Device-Based Gait Recognition Using Angle Embedded Gait Dynamic Images and a Convolutional Neural Network

PubMed Central

Zhao, Yongjia; Zhou, Suiping

2017-01-01

The widespread installation of inertial sensors in smartphones and other wearable devices provides a valuable opportunity to identify people by analyzing their gait patterns, for either cooperative or non-cooperative circumstances. However, it is still a challenging task to reliably extract discriminative features for gait recognition with noisy and complex data sequences collected from casually worn wearable devices like smartphones. To cope with this problem, we propose a novel image-based gait recognition approach using the Convolutional Neural Network (CNN) without the need to manually extract discriminative features. The CNN’s input image, which is encoded straightforwardly from the inertial sensor data sequences, is called Angle Embedded Gait Dynamic Image (AE-GDI). AE-GDI is a new two-dimensional representation of gait dynamics, which is invariant to rotation and translation. The performance of the proposed approach in gait authentication and gait labeling is evaluated using two datasets: (1) the McGill University dataset, which is collected under realistic conditions; and (2) the Osaka University dataset with the largest number of subjects. Experimental results show that the proposed approach achieves competitive recognition accuracy over existing approaches and provides an effective parametric solution for identification among a large number of subjects by gait patterns. PMID:28264503

Effect of cataract surgery and pupil dilation on iris pattern recognition for personal authentication.

PubMed

Dhir, L; Habib, N E; Monro, D M; Rakshit, S

2010-06-01

The purpose of this study was to investigate the effect of cataract surgery and pupil dilation on iris pattern recognition for personal authentication. Prospective non-comparative cohort study. Images of 15 subjects were captured before (enrolment), and 5, 10, and 15 min after instillation of mydriatics before routine cataract surgery. After cataract surgery, images were captured 2 weeks thereafter. Enrolled and test images (after pupillary dilation and after cataract surgery) were segmented to extract the iris. This was then unwrapped onto a rectangular format for normalization and a novel method using the Discrete Cosine Transform was applied to encode the image into binary bits. The numerical difference between two iris codes (Hamming distance, HD) was calculated. The HD between identification and enrolment codes was used as a score and was compared with a confidence threshold for specific equipment, giving a match or non-match result. The Correct Recognition Rate (CRR) and Equal Error Rates (EERs) were calculated to analyse overall system performance. After cataract surgery, perfect identification and verification was achieved, with zero false acceptance rate, zero false rejection rate, and zero EER. After pupillary dilation, non-elastic deformation occurs and a CRR of 86.67% and EER of 9.33% were obtained. Conventional circle-based localization methods are inadequate. Matching reliability decreases considerably with increase in pupillary dilation. Cataract surgery has no effect on iris pattern recognition, whereas pupil dilation may be used to defeat an iris-based authentication system.

Li-Fraumeni syndrome: cancer risk assessment and clinical management.

PubMed

McBride, Kate A; Ballinger, Mandy L; Killick, Emma; Kirk, Judy; Tattersall, Martin H N; Eeles, Rosalind A; Thomas, David M; Mitchell, Gillian

2014-05-01

Carriers of germline mutations in the TP53 gene, encoding the cell-cycle regulator and tumour suppressor p53, have a markedly increased risk of cancer-related morbidity and mortality during both childhood and adulthood, and thus require appropriate and effective cancer risk management. However, the predisposition of such patients to multiorgan tumorigenesis presents a specific challenge for cancer risk management programmes. Herein, we review the clinical implications of germline mutations in TP53 and the evidence for cancer screening and prevention strategies in individuals carrying such mutations, as well as examining the potential psychosocial implications of lifelong management for a ubiquitous cancer risk. In addition, we propose an evidence-based framework for the clinical management of TP53 mutation carriers and provide a platform for addressing the management of other cancer predisposition syndromes that can affect multiple organs.

Identification of Allelic Imbalance with a Statistical Model for Subtle Genomic Mosaicism

PubMed Central

Xia, Rui; Vattathil, Selina; Scheet, Paul

2014-01-01

Genetic heterogeneity in a mixed sample of tumor and normal DNA can confound characterization of the tumor genome. Numerous computational methods have been proposed to detect aberrations in DNA samples from tumor and normal tissue mixtures. Most of these require tumor purities to be at least 10–15%. Here, we present a statistical model to capture information, contained in the individual's germline haplotypes, about expected patterns in the B allele frequencies from SNP microarrays while fully modeling their magnitude, the first such model for SNP microarray data. Our model consists of a pair of hidden Markov models—one for the germline and one for the tumor genome—which, conditional on the observed array data and patterns of population haplotype variation, have a dependence structure induced by the relative imbalance of an individual's inherited haplotypes. Together, these hidden Markov models offer a powerful approach for dealing with mixtures of DNA where the main component represents the germline, thus suggesting natural applications for the characterization of primary clones when stromal contamination is extremely high, and for identifying lesions in rare subclones of a tumor when tumor purity is sufficient to characterize the primary lesions. Our joint model for germline haplotypes and acquired DNA aberration is flexible, allowing a large number of chromosomal alterations, including balanced and imbalanced losses and gains, copy-neutral loss-of-heterozygosity (LOH) and tetraploidy. We found our model (which we term J-LOH) to be superior for localizing rare aberrations in a simulated 3% mixture sample. More generally, our model provides a framework for full integration of the germline and tumor genomes to deal more effectively with missing or uncertain features, and thus extract maximal information from difficult scenarios where existing methods fail. PMID:25166618

Elevated stress is associated with prefrontal cortex dysfunction during a verbal memory task in women with HIV

PubMed Central

Rubin, Leah H.; Wu, Minjie; Sundermann, Erin E.; Meyer, Vanessa J.; Smith, Rachael; Weber, Kathleen M.; Cohen, Mardge H.; Little, Deborah M.; Maki, Pauline M.

2016-01-01

HIV-infected women may be particularly vulnerable to verbal learning and memory deficits. One factor contributing to these deficits is high perceived stress, which is associated with prefrontal cortical (PFC) atrophy and memory outcomes sensitive to PFC function, including retrieval and semantic clustering. We examined the association between stress and PFC activation during a verbal memory task in 36 HIV-infected women from the Chicago Consortium of the Women’s Interagency HIV Study (WIHS) to better understand the role of the PFC in this stress-related impairment. Participants completed standardized measures of verbal learning and memory and stress (Perceived Stress Scale-10). We used functional magnetic resonance imaging to assess brain function while participants completed encoding and recognition phases of a verbal memory task. HIV-infected women with higher stress (scores in top tertile) performed worse on all verbal memory outcomes including strategic encoding (p’s<0.05) compared to HIV-infected women with lower stress (scores in lower two tertiles). Patterns of brain activation during recognition (but not encoding) differed between women with higher versus lower stress. During recognition, women with higher stress demonstrated greater deactivation in medial PFC and posterior cingulate cortex compared to women with lower stress (p’s<0.05). Greater deactivation in medial PFC marginally related to less efficient strategic retrieval (p=0.06). Similar results were found in analyses focusing on PTSD symptoms. Results suggest that stress might alter the function of the medial PFC in HIV-infected women resulting in less efficient strategic retrieval and deficits in verbal memory. PMID:27094924

Elevated stress is associated with prefrontal cortex dysfunction during a verbal memory task in women with HIV.

PubMed

Rubin, Leah H; Wu, Minjie; Sundermann, Erin E; Meyer, Vanessa J; Smith, Rachael; Weber, Kathleen M; Cohen, Mardge H; Little, Deborah M; Maki, Pauline M

2016-12-01

HIV-infected women may be particularly vulnerable to verbal learning and memory deficits. One factor contributing to these deficits is high perceived stress, which is associated with prefrontal cortical (PFC) atrophy and memory outcomes sensitive to PFC function, including retrieval and semantic clustering. We examined the association between stress and PFC activation during a verbal memory task in 36 HIV-infected women from the Chicago Consortium of the Women's Interagency HIV Study (WIHS) to better understand the role of the PFC in this stress-related impairment. Participants completed standardized measures of verbal learning and memory and stress (perceived stress scale-10). We used functional magnetic resonance imaging to assess brain function while participants completed encoding and recognition phases of a verbal memory task. HIV-infected women with higher stress (scores in top tertile) performed worse on all verbal memory outcomes including strategic encoding (p < 0.05) compared to HIV-infected women with lower stress (scores in lower two tertiles). Patterns of brain activation during recognition (but not encoding) differed between women with higher vs. lower stress. During recognition, women with higher stress demonstrated greater deactivation in medial PFC and posterior cingulate cortex compared to women with lower stress (p < 0.05). Greater deactivation in medial PFC marginally related to less efficient strategic retrieval (p = 0.06). Similar results were found in analyses focusing on PTSD symptoms. Results suggest that stress might alter the function of the medial PFC in HIV-infected women resulting in less efficient strategic retrieval and deficits in verbal memory.

Hypoactive medial prefrontal cortex functioning in adults reporting childhood emotional maltreatment.

PubMed

van Harmelen, Anne-Laura; van Tol, Marie-José; Dalgleish, Tim; van der Wee, Nic J A; Veltman, Dick J; Aleman, André; Spinhoven, Philip; Penninx, Brenda W J H; Elzinga, Bernet M

2014-12-01

Childhood emotional maltreatment (CEM) has adverse effects on medial prefrontal cortex (mPFC) morphology, a structure that is crucial for cognitive functioning and (emotional) memory and which modulates the limbic system. In addition, CEM has been linked to amygdala hyperactivity during emotional face processing. However, no study has yet investigated the functional neural correlates of neutral and emotional memory in adults reporting CEM. Using functional magnetic resonance imaging, we investigated CEM-related differential activations in mPFC during the encoding and recognition of positive, negative and neutral words. The sample (N = 194) consisted of patients with depression and/or anxiety disorders and healthy controls (HC) reporting CEM (n = 96) and patients and HC reporting no abuse (n = 98). We found a consistent pattern of mPFC hypoactivation during encoding and recognition of positive, negative and neutral words in individuals reporting CEM. These results were not explained by psychopathology or severity of depression or anxiety symptoms, or by gender, level of neuroticism, parental psychopathology, negative life events, antidepressant use or decreased mPFC volume in the CEM group. These findings indicate mPFC hypoactivity in individuals reporting CEM during emotional and neutral memory encoding and recognition. Our findings suggest that CEM may increase individuals' risk to the development of psychopathology on differential levels of processing in the brain; blunted mPFC activation during higher order processing and enhanced amygdala activation during automatic/lower order emotion processing. These findings are vital in understanding the long-term consequences of CEM. © The Author (2014). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Electrophysiological correlates of encoding and retrieving emotional events.

PubMed

Koenig, Stefanie; Mecklinger, Axel

2008-04-01

This study examined the impact of emotional content on encoding and retrieval processes. Event-related potentials were recorded in a source recognition memory task. During encoding, a posterior positivity for positive and negative pictures (250-450 ms) that presumably reflects attentional capturing of emotionally valenced stimuli was found. Additionally, positive events, which were also rated as less arousing than negative events, gave rise to anterior and posterior slow wave activity as compared with neutral and negative events and also showed enhanced recognition memory. It is assumed that positive low-arousing events enter controlled and elaborated encoding processes that are beneficial for recognition memory performance. The high arousal of negative events may interfere with controlled encoding mechanisms and attenuate item recognition and the quality of remembering. Moreover, topographically distinct late posterior negativities were obtained for the retrieval of the context features location and time that support the view that this component reflects processes in service of reconstructing the study episode by binding together contextual details with an item and that varies with the kind of episodic detail to be retrieved. (Copyright) 2008 APA.

Structural Basis for Methylarginine-dependent Recognition of Aubergine by Tudor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, H.; Wang, J; Huang, Y

2010-01-01

Piwi proteins are modified by symmetric dimethylation of arginine (sDMA), and the methylarginine-dependent interaction with Tudor domain proteins is critical for their functions in germline development. Cocrystal structures of an extended Tudor domain (eTud) of Drosophila Tudor with methylated peptides of Aubergine, a Piwi family protein, reveal that sDMA is recognized by an asparagine-gated aromatic cage. Furthermore, the unexpected Tudor-SN/p100 fold of eTud is important for sensing the position of sDMA. The structural information provides mechanistic insights into sDMA-dependent Piwi-Tudor interaction, and the recognition of sDMA by Tudor domains in general.

Deadenylase depletion protects inherited mRNAs in primordial germ cells.

PubMed

Swartz, S Zachary; Reich, Adrian M; Oulhen, Nathalie; Raz, Tal; Milos, Patrice M; Campanale, Joseph P; Hamdoun, Amro; Wessel, Gary M

2014-08-01

A crucial event in animal development is the specification of primordial germ cells (PGCs), which become the stem cells that create sperm and eggs. How PGCs are created provides a valuable paradigm for understanding stem cells in general. We find that the PGCs of the sea urchin Strongylocentrotus purpuratus exhibit broad transcriptional repression, yet enrichment for a set of inherited mRNAs. Enrichment of several germline determinants in the PGCs requires the RNA-binding protein Nanos to target the transcript that encodes CNOT6, a deadenylase, for degradation in the PGCs, thereby creating a stable environment for RNA. Misexpression of CNOT6 in the PGCs results in their failure to retain Seawi transcripts and Vasa protein. Conversely, broad knockdown of CNOT6 expands the domain of Seawi RNA as well as exogenous reporters. Thus, Nanos-dependent spatially restricted CNOT6 differential expression is used to selectively localize germline RNAs to the PGCs. Our findings support a 'time capsule' model of germline determination, whereby the PGCs are insulated from differentiation by retaining the molecular characteristics of the totipotent egg and early embryo. © 2014. Published by The Company of Biologists Ltd.

Role of processing speed and depressed mood on encoding, storage, and retrieval memory functions in patients diagnosed with schizophrenia.

PubMed

Brébion, Gildas; David, Anthony S; Bressan, Rodrigo A; Pilowsky, Lyn S

2007-01-01

The role of various types of slowing of processing speed, as well as the role of depressed mood, on each stage of verbal memory functioning in patients diagnosed with schizophrenia was investigated. Mixed lists of high- and low-frequency words were presented, and immediate and delayed free recall and recognition were required. Two levels of encoding were studied by contrasting the relatively automatic encoding of the high-frequency words and the more effortful encoding of the low-frequency words. Storage was studied by contrasting immediate and delayed recall. Retrieval was studied by contrasting free recall and recognition. Three tests of motor and cognitive processing speed were administered as well. Regression analyses involving the three processing speed measures revealed that cognitive speed was the only predictor of the recall and recognition of the low-frequency words. Furthermore, slowing in cognitive speed accounted for the deficit in recall and recognition of the low-frequency words relative to a healthy control group. Depressed mood was significantly associated with recognition of the low-frequency words. Neither processing speed nor depressed mood was associated with storage efficiency. It is concluded that both cognitive speed slowing and depressed mood impact on effortful encoding processes.

Expanding the spectrum of phenotypes associated with germline PIGA mutations: a child with developmental delay, accelerated linear growth, facial dysmorphisms, elevated alkaline phosphatase, and progressive CNS abnormalities.

PubMed

van der Crabben, Saskia N; Harakalova, Magdalena; Brilstra, Eva H; van Berkestijn, Frédérique M C; Hofstede, Floris C; van Vught, Adrianus J; Cuppen, Edwin; Kloosterman, Wigard; Ploos van Amstel, Hans Kristian; van Haaften, Gijs; van Haelst, Mieke M

2014-01-01

Phosphatidyl inositol glycan (PIG) enzyme subclasses are involved in distinct steps of glycosyl phosphatidyl inositol anchor protein biosynthesis. Glycolsyl phosphatidyl inositol-anchored proteins have heterogeneous functions; they can function as enzymes, adhesion molecules, complement regulators and co-receptors in signal transduction pathways. Germline mutations in genes encoding different members of the PIG family result in diverse conditions with (severe) developmental delay, (neonatal) seizures, hypotonia, CNS abnormalities, growth abnormalities, and congenital abnormalities as hallmark features. The variability of clinical features resembles the typical diversity of other glycosylation pathway deficiencies such as the congenital disorders of glycosylation. Here, we report the first germline missense mutation in the PIGA gene associated with accelerated linear growth, obesity, central hypotonia, severe refractory epilepsy, cardiac anomalies, mild facial dysmorphic features, mildly elevated alkaline phosphatase levels, and CNS anomalies consisting of progressive cerebral atrophy, insufficient myelinization, and cortical MRI signal abnormalities. X-exome sequencing in the proband identified a c.278C>T (p.Pro93Leu) mutation in the PIGA gene. The mother and maternal grandmother were unaffected carriers and the mother showed 100% skewing of the X-chromosome harboring the mutation. These results together with the clinical similarity of the patient reported here and the previously reported patients with a germline nonsense mutation in PIGA support the determination that this mutation caused the phenotype in this family. © 2013 Wiley Periodicals, Inc.

Applicability of the Compensatory Encoding Model in Foreign Language Reading: An Investigation with Chinese College English Language Learners

PubMed Central

Han, Feifei

2017-01-01

While some first language (L1) reading models suggest that inefficient word recognition and small working memory tend to inhibit higher-level comprehension processes; the Compensatory Encoding Model maintains that slow word recognition and small working memory do not normally hinder reading comprehension, as readers are able to operate metacognitive strategies to compensate for inefficient word recognition and working memory limitation as long as readers process a reading task without time constraint. Although empirical evidence is accumulated for support of the Compensatory Encoding Model in L1 reading, there is lack of research for testing of the Compensatory Encoding Model in foreign language (FL) reading. This research empirically tested the Compensatory Encoding Model in English reading among Chinese college English language learners (ELLs). Two studies were conducted. Study one focused on testing whether reading condition varying time affects the relationship between word recognition, working memory, and reading comprehension. Students were tested on a computerized English word recognition test, a computerized Operation Span task, and reading comprehension in time constraint and non-time constraint reading. The correlation and regression analyses showed that the strength of association was much stronger between word recognition, working memory, and reading comprehension in time constraint than that in non-time constraint reading condition. Study two examined whether FL readers were able to operate metacognitive reading strategies as a compensatory way of reading comprehension for inefficient word recognition and working memory limitation in non-time constraint reading. The participants were tested on the same computerized English word recognition test and Operation Span test. They were required to think aloud while reading and to complete the comprehension questions. The think-aloud protocols were coded for concurrent use of reading strategies, classified into language-oriented strategies, content-oriented strategies, re-reading, pausing, and meta-comment. The correlation analyses showed that while word recognition and working memory were only significantly related to frequency of language-oriented strategies, re-reading, and pausing, but not with reading comprehension. Jointly viewed, the results of the two studies, complimenting each other, supported the applicability of the Compensatory Encoding Model in FL reading with Chinese college ELLs. PMID:28522984

Applicability of the Compensatory Encoding Model in Foreign Language Reading: An Investigation with Chinese College English Language Learners.

PubMed

Han, Feifei

2017-01-01

While some first language (L1) reading models suggest that inefficient word recognition and small working memory tend to inhibit higher-level comprehension processes; the Compensatory Encoding Model maintains that slow word recognition and small working memory do not normally hinder reading comprehension, as readers are able to operate metacognitive strategies to compensate for inefficient word recognition and working memory limitation as long as readers process a reading task without time constraint. Although empirical evidence is accumulated for support of the Compensatory Encoding Model in L1 reading, there is lack of research for testing of the Compensatory Encoding Model in foreign language (FL) reading. This research empirically tested the Compensatory Encoding Model in English reading among Chinese college English language learners (ELLs). Two studies were conducted. Study one focused on testing whether reading condition varying time affects the relationship between word recognition, working memory, and reading comprehension. Students were tested on a computerized English word recognition test, a computerized Operation Span task, and reading comprehension in time constraint and non-time constraint reading. The correlation and regression analyses showed that the strength of association was much stronger between word recognition, working memory, and reading comprehension in time constraint than that in non-time constraint reading condition. Study two examined whether FL readers were able to operate metacognitive reading strategies as a compensatory way of reading comprehension for inefficient word recognition and working memory limitation in non-time constraint reading. The participants were tested on the same computerized English word recognition test and Operation Span test. They were required to think aloud while reading and to complete the comprehension questions. The think-aloud protocols were coded for concurrent use of reading strategies, classified into language-oriented strategies, content-oriented strategies, re-reading, pausing, and meta-comment. The correlation analyses showed that while word recognition and working memory were only significantly related to frequency of language-oriented strategies, re-reading, and pausing, but not with reading comprehension. Jointly viewed, the results of the two studies, complimenting each other, supported the applicability of the Compensatory Encoding Model in FL reading with Chinese college ELLs.

Two Pathways to Stimulus Encoding in Category Learning?

PubMed Central

Davis, Tyler; Love, Bradley C.; Maddox, W. Todd

2008-01-01

Category learning theorists tacitly assume that stimuli are encoded by a single pathway. Motivated by theories of object recognition, we evaluate a dual-pathway account of stimulus encoding. The part-based pathway establishes mappings between sensory input and symbols that encode discrete stimulus features, whereas the image-based pathway applies holistic templates to sensory input. Our experiments use rule-plus-exception structures in which one exception item in each category violates a salient regularity and must be distinguished from other items. In Experiment 1, we find that discrete representations are crucial for recognition of exceptions following brief training. Experiments 2 and 3 involve multi-session training regimens designed to encourage either part or image-based encoding. We find that both pathways are able to support exception encoding, but have unique characteristics. We speculate that one advantage of the part-based pathway is the ability to generalize across domains, whereas the image-based pathway provides faster and more effortless recognition. PMID:19460948

Testing the encoding elaboration hypothesis: The effects of exemplar ranking on recognition and recall.

PubMed

Schnur, P

1977-11-01

Two experiments investigated the effects of exemplar ranking on retention. High-ranking exemplars are words judged to be prototypical of a given category; low-ranking exemplars are words judged to be atypical of a given category. In Experiment 1, an incidental learning paradigm was used to measure reaction time to answer an encoding question as well as subsequent recognition. It was found that low-ranking exemplars were classified more slowly but recognized better than high-ranking exemplars. Other comparisons of the effects of category encoding, rhyme encoding, and typescript encoding on response latency and recognition replicated the results of Craik and Tulving (1975). In Experiment 2, unanticipated free recall of live previously learned paired associate lists revealed that a list composed of low-ranking exemplars was better recalled than a comparable list composed of high-ranking exemplars. Moreover, this was true only when the lists were studied in the context of appropriate category cues. These findings are discussed in terms of the encoding elaboration hypothesis.

The ties that bind what is known to the recognition of what is new.

PubMed

Nelson, D L; Zhang, N; McKinney, V M

2001-09-01

Recognition success varies with how information is encoded (e.g., level of processing) and with what is already known as a result of past learning (e.g., word frequency). This article presents the results of experiments showing that preexisting connections involving the associates of studied words facilitate their recognition regardless of whether the words are intentionally encoded or are incidentally encoded under semantic or nonsemantic conditions. Words are more likely to be recognized when they have either more resonant connections coming back to them from their associates or more connections among their associates. Such results occur even though attention is never drawn to these associates. Regression analyses showed that these connections affect recognition independently of frequency, so the present results add to the literature showing that prior lexical knowledge contributes to episodic recognition. In addition, equations that use free-association data to derive composite strength indices of resonance and connectivity were evaluated. Implications for theories of recognition are discussed.

Updating representations of learned scenes.

PubMed

Finlay, Cory A; Motes, Michael A; Kozhevnikov, Maria

2007-05-01

Two experiments were designed to compare scene recognition reaction time (RT) and accuracy patterns following observer versus scene movement. In Experiment 1, participants memorized a scene from a single perspective. Then, either the scene was rotated or the participants moved (0 degrees -360 degrees in 36 degrees increments) around the scene, and participants judged whether the objects' positions had changed. Regardless of whether the scene was rotated or the observer moved, RT increased with greater angular distance between judged and encoded views. In Experiment 2, we varied the delay (0, 6, or 12 s) between scene encoding and locomotion. Regardless of the delay, however, accuracy decreased and RT increased with angular distance. Thus, our data show that observer movement does not necessarily update representations of spatial layouts and raise questions about the effects of duration limitations and encoding points of view on the automatic spatial updating of representations of scenes.

The Role of Anterior Nuclei of the Thalamus: A Subcortical Gate in Memory Processing: An Intracerebral Recording Study

PubMed Central

Štillová, Klára; Jurák, Pavel; Chládek, Jan; Chrastina, Jan; Halámek, Josef; Bočková, Martina; Goldemundová, Sabina; Říha, Ivo; Rektor, Ivan

2015-01-01

Objective To study the involvement of the anterior nuclei of the thalamus (ANT) as compared to the involvement of the hippocampus in the processes of encoding and recognition during visual and verbal memory tasks. Methods We studied intracerebral recordings in patients with pharmacoresistent epilepsy who underwent deep brain stimulation (DBS) of the ANT with depth electrodes implanted bilaterally in the ANT and compared the results with epilepsy surgery candidates with depth electrodes implanted bilaterally in the hippocampus. We recorded the event-related potentials (ERPs) elicited by the visual and verbal memory encoding and recognition tasks. Results P300-like potentials were recorded in the hippocampus by visual and verbal memory encoding and recognition tasks and in the ANT by the visual encoding and visual and verbal recognition tasks. No significant ERPs were recorded during the verbal encoding task in the ANT. In the visual and verbal recognition tasks, the P300-like potentials in the ANT preceded the P300-like potentials in the hippocampus. Conclusions The ANT is a structure in the memory pathway that processes memory information before the hippocampus. We suggest that the ANT has a specific role in memory processes, especially memory recognition, and that memory disturbance should be considered in patients with ANT-DBS and in patients with ANT lesions. ANT is well positioned to serve as a subcortical gate for memory processing in cortical structures. PMID:26529407

Eye tracking reveals a crucial role for facial motion in recognition of faces by infants.

PubMed

Xiao, Naiqi G; Quinn, Paul C; Liu, Shaoying; Ge, Liezhong; Pascalis, Olivier; Lee, Kang

2015-06-01

Current knowledge about face processing in infancy comes largely from studies using static face stimuli, but faces that infants see in the real world are mostly moving ones. To bridge this gap, 3-, 6-, and 9-month-old Asian infants (N = 118) were familiarized with either moving or static Asian female faces, and then their face recognition was tested with static face images. Eye-tracking methodology was used to record eye movements during the familiarization and test phases. The results showed a developmental change in eye movement patterns, but only for the moving faces. In addition, the more infants shifted their fixations across facial regions, the better their face recognition was, but only for the moving faces. The results suggest that facial movement influences the way faces are encoded from early in development. (c) 2015 APA, all rights reserved).

Selective attention affects conceptual object priming and recognition: a study with young and older adults.

PubMed

Ballesteros, Soledad; Mayas, Julia

2014-01-01

In the present study, we investigated the effects of selective attention at encoding on conceptual object priming (Experiment 1) and old-new recognition memory (Experiment 2) tasks in young and older adults. The procedures of both experiments included encoding and memory test phases separated by a short delay. At encoding, the picture outlines of two familiar objects, one in blue and the other in green, were presented to the left and to the right of fixation. In Experiment 1, participants were instructed to attend to the picture outline of a certain color and to classify the object as natural or artificial. After a short delay, participants performed a natural/artificial speeded conceptual classification task with repeated attended, repeated unattended, and new pictures. In Experiment 2, participants at encoding memorized the attended pictures and classify them as natural or artificial. After the encoding phase, they performed an old-new recognition memory task. Consistent with previous findings with perceptual priming tasks, we found that conceptual object priming, like explicit memory, required attention at encoding. Significant priming was obtained in both age groups, but only for those pictures that were attended at encoding. Although older adults were slower than young adults, both groups showed facilitation for attended pictures. In line with previous studies, young adults had better recognition memory than older adults.

Selective attention affects conceptual object priming and recognition: a study with young and older adults

PubMed Central

Ballesteros, Soledad; Mayas, Julia

2015-01-01

In the present study, we investigated the effects of selective attention at encoding on conceptual object priming (Experiment 1) and old–new recognition memory (Experiment 2) tasks in young and older adults. The procedures of both experiments included encoding and memory test phases separated by a short delay. At encoding, the picture outlines of two familiar objects, one in blue and the other in green, were presented to the left and to the right of fixation. In Experiment 1, participants were instructed to attend to the picture outline of a certain color and to classify the object as natural or artificial. After a short delay, participants performed a natural/artificial speeded conceptual classification task with repeated attended, repeated unattended, and new pictures. In Experiment 2, participants at encoding memorized the attended pictures and classify them as natural or artificial. After the encoding phase, they performed an old–new recognition memory task. Consistent with previous findings with perceptual priming tasks, we found that conceptual object priming, like explicit memory, required attention at encoding. Significant priming was obtained in both age groups, but only for those pictures that were attended at encoding. Although older adults were slower than young adults, both groups showed facilitation for attended pictures. In line with previous studies, young adults had better recognition memory than older adults. PMID:25628588

Medial temporal lobe function during emotional memory in early Alzheimer's disease, mild cognitive impairment and healthy ageing: an fMRI study.

PubMed

Parra, Mario A; Pattan, Vivek; Wong, Dichelle; Beaglehole, Anna; Lonie, Jane; Wan, Hong I; Honey, Garry; Hall, Jeremy; Whalley, Heather C; Lawrie, Stephen M

2013-03-06

Relative to intentional memory encoding, which quickly declines in Mild Cognitive Impairment (MCI) and Alzheimer's disease (AD), incidental memory for emotional stimuli appears to deteriorate more slowly. We hypothesised that tests of incidental emotional memory may inform on different aspects of cognitive decline in MCI and AD. Patients with MCI, AD and Healthy Controls (HC) were asked to attend to emotional pictures (i.e., positive and neutral) sequentially presented during an fMRI session. Attention was monitored behaviourally. A surprise post-scan recognition test was then administered. The groups remained attentive within the scanner. The post-scan recognition pattern was in the form of (HC = MCI) > AD, with only the former group showing a clear benefit from emotional pictures. fMRI analysis of incidental encoding demonstrated clusters of activation in para-hippocampal regions and in the hippocampus in HC and MCI patients but not in AD patients. The pattern of activation observed in MCI patients tended to be greater than that found in HC. The results suggest that incidental emotional memory might offer a suitable platform to investigate, using behavioural and fMRI measures, subtle changes in the process of developing AD. These changes seem to differ from those found using standard episodic memory tests. The underpinnings of such differences and the potential clinical use of this methodology are discussed in depth.

Improvement of In Vivo Expression of Genes Delivered by Self-Amplifying RNA Using Vaccinia Virus Immune Evasion Proteins

PubMed Central

Beissert, Tim; Koste, Lars; Perkovic, Mario; Walzer, Kerstin C.; Erbar, Stephanie; Selmi, Abderraouf; Diken, Mustafa; Kreiter, Sebastian; Türeci, Özlem; Sahin, Ugur

2017-01-01

Among nucleic acid–based delivery platforms, self-amplifying RNA (saRNA) vectors are of increasing interest for applications such as transient expression of recombinant proteins and vaccination. saRNA is safe and, due to its capability to amplify intracellularly, high protein levels can be produced from even minute amounts of transfected templates. However, it is an obstacle to full exploitation of this platform that saRNA induces a strong innate host immune response. In transfected cells, pattern recognition receptors sense double-stranded RNA intermediates and via activation of protein kinase R (PKR) and interferon signaling initiate host defense measures including a translational shutdown. To reduce pattern recognition receptor stimulation and unleash suppressed saRNA translation, this study co-delivered non-replicating mRNA encoding vaccinia virus immune evasion proteins E3, K3, and B18. It was shown that E3 is far superior to K3 or B18 as a highly potent blocker of PKR activation and of interferon (IFN)-β upregulation. B18, in contrast, is superior in controlling OAS1, a key IFN-inducible gene involved in viral RNA degradation. By combining all three vaccinia proteins, the study achieved significant suppression of PKR and IFN pathway activation in vitro and enhanced expression of saRNA-encoded genes of interest both in vitro and in vivo. This approach promises to overcome key hurdles of saRNA gene delivery. Its application may improve the bioavailability of the encoded protein, and reduce the effective dose and correspondingly the cost of goods of manufacture in the various fields where saRNA utilization is envisioned. PMID:28877647

Improvement of In Vivo Expression of Genes Delivered by Self-Amplifying RNA Using Vaccinia Virus Immune Evasion Proteins.

PubMed

Beissert, Tim; Koste, Lars; Perkovic, Mario; Walzer, Kerstin C; Erbar, Stephanie; Selmi, Abderraouf; Diken, Mustafa; Kreiter, Sebastian; Türeci, Özlem; Sahin, Ugur

2017-12-01

Among nucleic acid-based delivery platforms, self-amplifying RNA (saRNA) vectors are of increasing interest for applications such as transient expression of recombinant proteins and vaccination. saRNA is safe and, due to its capability to amplify intracellularly, high protein levels can be produced from even minute amounts of transfected templates. However, it is an obstacle to full exploitation of this platform that saRNA induces a strong innate host immune response. In transfected cells, pattern recognition receptors sense double-stranded RNA intermediates and via activation of protein kinase R (PKR) and interferon signaling initiate host defense measures including a translational shutdown. To reduce pattern recognition receptor stimulation and unleash suppressed saRNA translation, this study co-delivered non-replicating mRNA encoding vaccinia virus immune evasion proteins E3, K3, and B18. It was shown that E3 is far superior to K3 or B18 as a highly potent blocker of PKR activation and of interferon (IFN)-β upregulation. B18, in contrast, is superior in controlling OAS1, a key IFN-inducible gene involved in viral RNA degradation. By combining all three vaccinia proteins, the study achieved significant suppression of PKR and IFN pathway activation in vitro and enhanced expression of saRNA-encoded genes of interest both in vitro and in vivo. This approach promises to overcome key hurdles of saRNA gene delivery. Its application may improve the bioavailability of the encoded protein, and reduce the effective dose and correspondingly the cost of goods of manufacture in the various fields where saRNA utilization is envisioned.

Shark Ig light chain junctions are as diverse as in heavy chains.

PubMed

Fleurant, Marshall; Changchien, Lily; Chen, Chin-Tung; Flajnik, Martin F; Hsu, Ellen

2004-11-01

We have characterized a small family of four genes encoding one of the three nurse shark Ig L chain isotypes, called NS5. All NS5 cDNA sequences are encoded by three loci, of which two are organized as conventional clusters, each consisting of a V and J gene segment that can recombine and one C region exon; the third contains a germline-joined VJ in-frame and the fourth locus is a pseudogene. This is the second nurse shark L chain type where both germline-joined and split V-J organizations have been found. Since there are only two rearranging Ig loci, it was possible for the first time to examine junctional diversity in defined fish Ig genes, comparing productive vs nonproductive rearrangements. N region addition was found to be considerably more extensive in length and in frequency than any other vertebrate L chain so far reported and rivals that in H chain. We put forth the speculation that the unprecedented efficiency of N region addition (87-93% of NS5 sequences) may be a result not only of simultaneous H and L chain rearrangement in the shark but also of processing events that afford greater accessibility of the V or J gene coding ends to terminal deoxynucleotidyltransferase.

RAS diseases in children

PubMed Central

Niemeyer, Charlotte M.

2014-01-01

RAS genes encode a family of 21 kDa proteins that are an essential hub for a number of survival, proliferation, differentiation and senescence pathways. Signaling of the RAS-GTPases through the RAF-MEK-ERK pathway, the first identified mitogen-associated protein kinase (MAPK) cascade is essential in development. A group of genetic syndromes, named “RASopathies”, had been identified which are caused by heterozygosity for germline mutations in genes that encode protein components of the RAS/MAPK pathway. Several of these clinically overlapping disorders, including Noonan syndrome, Noonan-like CBL syndrome, Costello syndrome, cardio-facio-cutaneous (CFC) syndrome, neurofibromatosis type I, and Legius syndrome, predispose to cancer and abnormal myelopoiesis in infancy. This review focuses on juvenile myelomonocytic leukemia (JMML), a malignancy of early childhood characterized by initiating germline and/or somatic mutations in five genes of the RAS/MAPK pathway: PTPN11, CBL, NF-1, KRAS and NRAS. Natural courses of these five subtypes differ, although hematopoietic stem cell transplantation remains the only curative therapy option for most children with JMML. With whole-exome sequencing studies revealing few secondary lesions it will be crucial to better understand the RAS/MAPK signaling network with its crosstalks and feed-back loops to carefully design early clinical trials with novel pharmacological agents in this still puzzling leukemia. PMID:25420281

Deep--deeper--deepest? Encoding strategies and the recognition of human faces.

PubMed

Sporer, S L

1991-03-01

Various encoding strategies that supposedly promote deeper processing of human faces (e.g., character judgments) have led to better recognition than more shallow processing tasks (judging the width of the nose). However, does deeper processing actually lead to an improvement in recognition, or, conversely, does shallow processing lead to a deterioration in performance when compared with naturally employed encoding strategies? Three experiments systematically compared a total of 8 different encoding strategies manipulating depth of processing, amount of elaboration, and self-generation of judgmental categories. All strategies that required a scanning of the whole face were basically equivalent but no better than natural strategy controls. The consistently worst groups were the ones that rated faces along preselected physical dimensions. This can be explained by subjects' lesser task involvement as revealed by manipulation checks.

Investigating the Role of RIO Protein Kinases in Caenorhabditis elegans

PubMed Central

Raymant, Greta; Bertram, Sonja E.; Esmaillie, Reza; Nadarajan, Saravanapriah; Breugelmans, Bert; Hofmann, Andreas; Gasser, Robin B.; Colaiácovo, Monica P.; Boag, Peter R.

2015-01-01

RIO protein kinases (RIOKs) are a relatively conserved family of enzymes implicated in cell cycle control and ribosomal RNA processing. Despite their functional importance, they remain a poorly understood group of kinases in multicellular organisms. Here, we show that the C. elegans genome contains one member of each of the three RIOK sub-families and that each of the genes coding for them has a unique tissue expression pattern. Our analysis showed that the gene encoding RIOK-1 (riok-1) was broadly and strongly expressed. Interestingly, the intestinal expression of riok-1 was dependent upon two putative binding sites for the oxidative and xenobiotic stress response transcription factor SKN-1. RNA interference (RNAi)-mediated knock down of riok-1 resulted in germline defects, including defects in germ line stem cell proliferation, oocyte maturation and the production of endomitotic oocytes. Taken together, our findings indicate new functions for RIOK-1 in post mitotic tissues and in reproduction. PMID:25688864

Episodic memory retrieval in adolescents with and without developmental language disorder (DLD).

PubMed

Lee, Joanna C

2018-03-01

Two reasons may explain the discrepant findings regarding declarative memory in developmental language disorder (DLD) in the literature. First, standardized tests are one of the primary tools used to assess declarative memory in previous studies. It is possible they are not sensitive enough to subtle memory impairment. Second, the system underlying declarative memory is complex, and thus results may vary depending on the types of encoding and retrieval processes measured (e.g., item specific or relational) and/or task demands (e.g., recall or recognition during memory retrieval). To adopt an experimental paradigm to examine episodic memory functioning in adolescents with and without DLD, with the focus on memory recognition of item-specific and relational information. Two groups of adolescents, one with DLD (n = 23; mean age = 16.73 years) and the other without (n = 23; mean age = 16.75 years), participated in the study. The Relational and Item-Specific Encoding (RISE) paradigm was used to assess the effect of different encoding processes on episodic memory retrieval in DLD. The advantage of using the RISE task is that both item-specific and relational encoding/retrieval can be examined within the same learning paradigm. Adolescents with DLD and those with typical language development showed comparable engagement during the encoding phase. The DLD group showed significantly poorer item recognition than the comparison group. Associative recognition was not significantly different between the two groups; however, there was a non-significant trend for to be poorer in the DLD group than in the comparison group, suggesting a possible impairment in associative recognition in individuals with DLD, but to a lesser magnitude. These results indicate that adolescents with DLD have difficulty with episodic memory retrieval when stimuli are encoded and retrieved without support from contextual information. Associative recognition is relatively less affected than item recognition in adolescents with DLD. © 2017 Royal College of Speech and Language Therapists.

A functional magnetic resonance imaging study of working memory abnormalities in schizophrenia.

PubMed

Johnson, Matthew R; Morris, Nicholas A; Astur, Robert S; Calhoun, Vince D; Mathalon, Daniel H; Kiehl, Kent A; Pearlson, Godfrey D

2006-07-01

Previous neuroimaging studies of working memory (WM) in schizophrenia, typically focusing on dorsolateral prefrontal cortex, yield conflicting results, possibly because of varied choice of tasks and analysis techniques. We examined neural function changes at several WM loads to derive a more complete picture of WM dysfunction in schizophrenia. We used a version of the Sternberg Item Recognition Paradigm to test WM function at five distinct loads. Eighteen schizophrenia patients and 18 matched healthy controls were scanned with functional magnetic resonance imaging at 3 Tesla. Patterns of both overactivation and underactivation in patients were observed depending on WM load. Patients' activation was generally less responsive to load changes than control subjects', and different patterns of between-group differences were observed for memory encoding and retrieval. In the specific case of successful retrieval, patients recruited additional neural circuits unused by control subjects. Behavioral effects were generally consistent with these imaging results. Differential findings of overactivation and underactivation may be attributable to patients' decreased ability to focus and allocate neural resources at task-appropriate levels. Additionally, differences between encoding and retrieval suggest that WM dysfunction may be manifested differently during the distinct phases of encoding, maintenance, and retrieval.

Log-Gabor Weber descriptor for face recognition

NASA Astrophysics Data System (ADS)

Li, Jing; Sang, Nong; Gao, Changxin

2015-09-01

The Log-Gabor transform, which is suitable for analyzing gradually changing data such as in iris and face images, has been widely used in image processing, pattern recognition, and computer vision. In most cases, only the magnitude or phase information of the Log-Gabor transform is considered. However, the complementary effect taken by combining magnitude and phase information simultaneously for an image-feature extraction problem has not been systematically explored in the existing works. We propose a local image descriptor for face recognition, called Log-Gabor Weber descriptor (LGWD). The novelty of our LGWD is twofold: (1) to fully utilize the information from the magnitude or phase feature of multiscale and orientation Log-Gabor transform, we apply the Weber local binary pattern operator to each transform response. (2) The encoded Log-Gabor magnitude and phase information are fused at the feature level by utilizing kernel canonical correlation analysis strategy, considering that feature level information fusion is effective when the modalities are correlated. Experimental results on the AR, Extended Yale B, and UMIST face databases, compared with those available from recent experiments reported in the literature, show that our descriptor yields a better performance than state-of-the art methods.

SpikeTemp: An Enhanced Rank-Order-Based Learning Approach for Spiking Neural Networks With Adaptive Structure.

PubMed

Wang, Jinling; Belatreche, Ammar; Maguire, Liam P; McGinnity, Thomas Martin

2017-01-01

This paper presents an enhanced rank-order-based learning algorithm, called SpikeTemp, for spiking neural networks (SNNs) with a dynamically adaptive structure. The trained feed-forward SNN consists of two layers of spiking neurons: 1) an encoding layer which temporally encodes real-valued features into spatio-temporal spike patterns and 2) an output layer of dynamically grown neurons which perform spatio-temporal classification. Both Gaussian receptive fields and square cosine population encoding schemes are employed to encode real-valued features into spatio-temporal spike patterns. Unlike the rank-order-based learning approach, SpikeTemp uses the precise times of the incoming spikes for adjusting the synaptic weights such that early spikes result in a large weight change and late spikes lead to a smaller weight change. This removes the need to rank all the incoming spikes and, thus, reduces the computational cost of SpikeTemp. The proposed SpikeTemp algorithm is demonstrated on several benchmark data sets and on an image recognition task. The results show that SpikeTemp can achieve better classification performance and is much faster than the existing rank-order-based learning approach. In addition, the number of output neurons is much smaller when the square cosine encoding scheme is employed. Furthermore, SpikeTemp is benchmarked against a selection of existing machine learning algorithms, and the results demonstrate the ability of SpikeTemp to classify different data sets after just one presentation of the training samples with comparable classification performance.

Instruction-specific brain activations during episodic encoding. a generalized level of processing effect.

PubMed

Petersson, Karl Magnus; Sandblom, Johan; Elfgren, Christina; Ingvar, Martin

2003-11-01

In a within-subject design we investigated the levels-of-processing (LOP) effect using visual material in a behavioral and a corresponding PET study. In the behavioral study we characterize a generalized LOP effect, using pleasantness and graphical quality judgments in the encoding situation, with two types of visual material, figurative and nonfigurative line drawings. In the PET study we investigate the related pattern of brain activations along these two dimensions. The behavioral results indicate that instruction and material contribute independently to the level of recognition performance. Therefore the LOP effect appears to stem both from the relative relevance of the stimuli (encoding opportunity) and an altered processing of stimuli brought about by the explicit instruction (encoding mode). In the PET study, encoding of visual material under the pleasantness (deep) instruction yielded left lateralized frontoparietal and anterior temporal activations while surface-based perceptually oriented processing (shallow instruction) yielded right lateralized frontoparietal, posterior temporal, and occipitotemporal activations. The result that deep encoding was related to the left prefrontal cortex while shallow encoding was related to the right prefrontal cortex, holding the material constant, is not consistent with the HERA model. In addition, we suggest that the anterior medial superior frontal region is related to aspects of self-referential semantic processing and that the inferior parts of the anterior cingulate as well as the medial orbitofrontal cortex is related to affective processing, in this case pleasantness evaluation of the stimuli regardless of explicit semantic content. Finally, the left medial temporal lobe appears more actively engaged by elaborate meaning-based processing and the complex response pattern observed in different subregions of the MTL lends support to the suggestion that this region is functionally segregated.

Recognition deficits in mice carrying mutations of genes encoding BLOC-1 subunits pallidin or dysbindin.

PubMed

Spiegel, S; Chiu, A; James, A S; Jentsch, J D; Karlsgodt, K H

2015-11-01

Numerous studies have implicated DTNBP1, the gene encoding dystrobrevin-binding protein or dysbindin, as a candidate risk gene for schizophrenia, though this relationship remains somewhat controversial. Variation in dysbindin, and its location on chromosome 6p, has been associated with cognitive processes, including those relying on a complex system of glutamatergic and dopaminergic interactions. Dysbindin is one of the seven protein subunits that comprise the biogenesis of lysosome-related organelles complex 1 (BLOC-1). Dysbindin protein levels are lower in mice with null mutations in pallidin, another gene in the BLOC-1, and pallidin levels are lower in mice with null mutations in the dysbindin gene, suggesting that multiple subunit proteins must be present to form a functional oligomeric complex. Furthermore, pallidin and dysbindin have similar distribution patterns in a mouse and human brain. Here, we investigated whether the apparent correspondence of pallid and dysbindin at the level of gene expression is also found at the level of behavior. Hypothesizing a mutation leading to underexpression of either of these proteins should show similar phenotypic effects, we studied recognition memory in both strains using the novel object recognition task (NORT) and social novelty recognition task (SNRT). We found that mice with a null mutation in either gene are impaired on SNRT and NORT when compared with wild-type controls. These results support the conclusion that deficits consistent with recognition memory impairment, a cognitive function that is impaired in schizophrenia, result from either pallidin or dysbindin mutations, possibly through degradation of BLOC-1 expression and/or function. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Remembering operations.

PubMed

Kolers, P A

1973-09-01

Two commonplace assumptions about encoding are that sentences are encoded and recognized on the basis of their semantic features primarily and that information regarding form features such as typography is typically ignored or discarded. These assumptions were tested m the present experiment where, within a signal-detection paradigm, S sorted sentences according to whether he had seen them before or not (old vs new) and, if they were old, whether their reappearance was in the same typography as on the first occurrence or a different one. Of the two typographies, one was familiar and the other unfamiliar. Results show that a considerable amount of information regarding surface features is stored for many minutes and that ease of initial encoding is inversely related to likelihood of subsequent recognition: sentences in the unfamiliar typography were remembered better. The results are probably not due to time spent encoding; control tests suggest that time spent encoding a difficult typography does not by itself increase recognition of the semantic content embodied in the typography. Other control tests show that pictorial features or images of the sentences play no significant role in their subsequent recognition. One interpretation of the results is that the analytic activities or cognitive operations that characterize initial acquisition play a significant role in subsequent recognition.

The role of semantically related distractors during encoding and retrieval of words in long-term memory.

PubMed

Meade, Melissa E; Fernandes, Myra A

2016-07-01

We examined the influence of divided attention (DA) on recognition of words when the concurrent task was semantically related or unrelated to the to-be-recognised target words. Participants were asked to either study or retrieve a target list of semantically related words while simultaneously making semantic decisions (i.e., size judgements) to another set of related or unrelated words heard concurrently. We manipulated semantic relatedness of distractor to target words, and whether DA occurred during the encoding or retrieval phase of memory. Recognition accuracy was significantly diminished relative to full attention, following DA conditions at encoding, regardless of relatedness of distractors to study words. However, response times (RTs) were slower with related compared to unrelated distractors. Similarly, under DA at retrieval, recognition RTs were slower when distractors were semantically related than unrelated to target words. Unlike the effect from DA at encoding, recognition accuracy was worse under DA at retrieval when the distractors were related compared to unrelated to the target words. Results suggest that availability of general attentional resources is critical for successful encoding, whereas successful retrieval is particularly reliant on access to a semantic code, making it sensitive to related distractors under DA conditions.

Encoding instructions and stimulus presentation in local environmental context-dependent memory studies.

PubMed

Markopoulos, G; Rutherford, A; Cairns, C; Green, J

2010-08-01

Murnane and Phelps (1993) recommend word pair presentations in local environmental context (EC) studies to prevent associations being formed between successively presented items and their ECs and a consequent reduction in the EC effect. Two experiments were conducted to assess the veracity of this assumption. In Experiment 1, participants memorised single words or word pairs, or categorised them as natural or man made. Their free recall protocols were examined to assess any associations established between successively presented items. Fewest associations were observed when the item-specific encoding task (i.e., natural or man made categorisation of word referents) was applied to single words. These findings were examined further in Experiment 2, where the influence of encoding instructions and stimulus presentation on local EC dependent recognition memory was examined. Consistent with recognition dual-process signal detection model predictions and findings (e.g., Macken, 2002; Parks & Yonelinas, 2008), recollection sensitivity, but not familiarity sensitivity, was found to be local EC dependent. However, local EC dependent recognition was observed only after item-specific encoding instructions, irrespective of stimulus presentation. These findings and the existing literature suggest that the use of single word presentations and item-specific encoding enhances local EC dependent recognition.

Spatial location in brief, free-viewing face encoding modulates contextual face recognition

PubMed Central

Felisberti, Fatima M.; McDermott, Mark R.

2013-01-01

The effect of the spatial location of faces in the visual field during brief, free-viewing encoding in subsequent face recognition is not known. This study addressed this question by tagging three groups of faces with cheating, cooperating or neutral behaviours and presenting them for encoding in two visual hemifields (upper vs. lower or left vs. right). Participants then had to indicate if a centrally presented face had been seen before or not. Head and eye movements were free in all phases. Findings showed that the overall recognition of cooperators was significantly better than cheaters, and it was better for faces encoded in the upper hemifield than in the lower hemifield, both in terms of a higher d′ and faster reaction time (RT). The d′ for any given behaviour in the left and right hemifields was similar. The RT in the left hemifield did not vary with tagged behaviour, whereas the RT in the right hemifield was longer for cheaters than for cooperators. The results showed that memory biases in contextual face recognition were modulated by the spatial location of briefly encoded faces and are discussed in terms of scanning reading habits, top-left bias in lighting preference and peripersonal space. PMID:24349694

Coordinated tissue-specific regulation of adjacent alternative 3′ splice sites in C. elegans

PubMed Central

Ragle, James Matthew; Katzman, Sol; Akers, Taylor F.; Barberan-Soler, Sergio; Zahler, Alan M.

2015-01-01

Adjacent alternative 3′ splice sites, those separated by ≤18 nucleotides, provide a unique problem in the study of alternative splicing regulation; there is overlap of the cis-elements that define the adjacent sites. Identification of the intron's 3′ end depends upon sequence elements that define the branchpoint, polypyrimidine tract, and terminal AG dinucleotide. Starting with RNA-seq data from germline-enriched and somatic cell-enriched Caenorhabditis elegans samples, we identify hundreds of introns with adjacent alternative 3′ splice sites. We identify 203 events that undergo tissue-specific alternative splicing. For these, the regulation is monodirectional, with somatic cells preferring to splice at the distal 3′ splice site (furthest from the 5′ end of the intron) and germline cells showing a distinct shift toward usage of the adjacent proximal 3′ splice site (closer to the 5′ end of the intron). Splicing patterns in somatic cells follow C. elegans consensus rules of 3′ splice site definition; a short stretch of pyrimidines preceding an AG dinucleotide. Splicing in germline cells occurs at proximal 3′ splice sites that lack a preceding polypyrimidine tract, and in three instances the germline-specific site lacks the AG dinucleotide. We provide evidence that use of germline-specific proximal 3′ splice sites is conserved across Caenorhabditis species. We propose that there are differences between germline and somatic cells in the way that the basal splicing machinery functions to determine the intron terminus. PMID:25922281

De novo mutations in the gene encoding the synaptic scaffolding protein SHANK3 in patients ascertained for schizophrenia

PubMed Central

Gauthier, Julie; Champagne, Nathalie; Lafrenière, Ronald G.; Xiong, Lan; Spiegelman, Dan; Brustein, Edna; Lapointe, Mathieu; Peng, Huashan; Côté, Mélanie; Noreau, Anne; Hamdan, Fadi F.; Addington, Anjené M.; Rapoport, Judith L.; DeLisi, Lynn E.; Krebs, Marie-Odile; Joober, Ridha; Fathalli, Ferid; Mouaffak, Fayçal; Haghighi, Ali P.; Néri, Christian; Dubé, Marie-Pierre; Samuels, Mark E.; Marineau, Claude; Stone, Eric A.; Awadalla, Philip; Barker, Philip A.; Carbonetto, Salvatore; Drapeau, Pierre; Rouleau, Guy A.

2010-01-01

Schizophrenia likely results from poorly understood genetic and environmental factors. We studied the gene encoding the synaptic protein SHANK3 in 285 controls and 185 schizophrenia patients with unaffected parents. Two de novo mutations (R1117X and R536W) were identified in two families, one being found in three affected brothers, suggesting germline mosaicism. Zebrafish and rat hippocampal neuron assays revealed behavior and differentiation defects resulting from the R1117X mutant. As mutations in SHANK3 were previously reported in autism, the occurrence of SHANK3 mutations in subjects with a schizophrenia phenotype suggests a molecular genetic link between these two neurodevelopmental disorders. PMID:20385823

Deep learning architecture for iris recognition based on optimal Gabor filters and deep belief network

NASA Astrophysics Data System (ADS)

He, Fei; Han, Ye; Wang, Han; Ji, Jinchao; Liu, Yuanning; Ma, Zhiqiang

2017-03-01

Gabor filters are widely utilized to detect iris texture information in several state-of-the-art iris recognition systems. However, the proper Gabor kernels and the generative pattern of iris Gabor features need to be predetermined in application. The traditional empirical Gabor filters and shallow iris encoding ways are incapable of dealing with such complex variations in iris imaging including illumination, aging, deformation, and device variations. Thereby, an adaptive Gabor filter selection strategy and deep learning architecture are presented. We first employ particle swarm optimization approach and its binary version to define a set of data-driven Gabor kernels for fitting the most informative filtering bands, and then capture complex pattern from the optimal Gabor filtered coefficients by a trained deep belief network. A succession of comparative experiments validate that our optimal Gabor filters may produce more distinctive Gabor coefficients and our iris deep representations be more robust and stable than traditional iris Gabor codes. Furthermore, the depth and scales of the deep learning architecture are also discussed.

Artificial Neural Networks for Processing Graphs with Application to Image Understanding: A Survey

NASA Astrophysics Data System (ADS)

Bianchini, Monica; Scarselli, Franco

In graphical pattern recognition, each data is represented as an arrangement of elements, that encodes both the properties of each element and the relations among them. Hence, patterns are modelled as labelled graphs where, in general, labels can be attached to both nodes and edges. Artificial neural networks able to process graphs are a powerful tool for addressing a great variety of real-world problems, where the information is naturally organized in entities and relationships among entities and, in fact, they have been widely used in computer vision, f.i. in logo recognition, in similarity retrieval, and for object detection. In this chapter, we propose a survey of neural network models able to process structured information, with a particular focus on those architectures tailored to address image understanding applications. Starting from the original recursive model (RNNs), we subsequently present different ways to represent images - by trees, forests of trees, multiresolution trees, directed acyclic graphs with labelled edges, general graphs - and, correspondingly, neural network architectures appropriate to process such structures.

The Neural Regions Sustaining Episodic Encoding and Recognition of Objects

ERIC Educational Resources Information Center

Hofer, Alex; Siedentopf, Christian M.; Ischebeck, Anja; Rettenbacher, Maria A.; Widschwendter, Christian G.; Verius, Michael; Golaszewski, Stefan M.; Koppelstaetter, Florian; Felber, Stephan; Wolfgang Fleischhacker, W.

2007-01-01

In this functional MRI experiment, encoding of objects was associated with activation in left ventrolateral prefrontal/insular and right dorsolateral prefrontal and fusiform regions as well as in the left putamen. By contrast, correct recognition of previously learned objects (R judgments) produced activation in left superior frontal, bilateral…

Learning Rotation-Invariant Local Binary Descriptor.

PubMed

Duan, Yueqi; Lu, Jiwen; Feng, Jianjiang; Zhou, Jie

2017-08-01

In this paper, we propose a rotation-invariant local binary descriptor (RI-LBD) learning method for visual recognition. Compared with hand-crafted local binary descriptors, such as local binary pattern and its variants, which require strong prior knowledge, local binary feature learning methods are more efficient and data-adaptive. Unlike existing learning-based local binary descriptors, such as compact binary face descriptor and simultaneous local binary feature learning and encoding, which are susceptible to rotations, our RI-LBD first categorizes each local patch into a rotational binary pattern (RBP), and then jointly learns the orientation for each pattern and the projection matrix to obtain RI-LBDs. As all the rotation variants of a patch belong to the same RBP, they are rotated into the same orientation and projected into the same binary descriptor. Then, we construct a codebook by a clustering method on the learned binary codes, and obtain a histogram feature for each image as the final representation. In order to exploit higher order statistical information, we extend our RI-LBD to the triple rotation-invariant co-occurrence local binary descriptor (TRICo-LBD) learning method, which learns a triple co-occurrence binary code for each local patch. Extensive experimental results on four different visual recognition tasks, including image patch matching, texture classification, face recognition, and scene classification, show that our RI-LBD and TRICo-LBD outperform most existing local descriptors.

The role of the thalamic nuclei in recognition memory accompanied by recall during encoding and retrieval: an fMRI study.

PubMed

Pergola, Giulio; Ranft, Alexander; Mathias, Klaus; Suchan, Boris

2013-07-01

The present functional imaging study aimed at investigating the contribution of the mediodorsal nucleus and the anterior nuclei of the thalamus with their related cortical networks to recognition memory and recall. Eighteen subjects performed associative picture encoding followed by a single item recognition test during the functional magnetic resonance imaging session. After scanning, subjects performed a cued recall test using the formerly recognized pictures as cues. This post-scanning test served to classify recognition trials according to subsequent recall performance. In general, single item recognition accompanied by successful recall of the associations elicited stronger activation in the mediodorsal nucleus of the thalamus and in the prefrontal cortices both during encoding and retrieval compared to recognition without recall. In contrast, the anterior nuclei of the thalamus were selectively active during the retrieval phase of recognition followed by recall. A correlational analysis showed that activation of the anterior thalamus during retrieval as assessed by measuring the percent signal changes predicted lower rates of recognition without recall. These findings show that the thalamus is critical for recognition accompanied by recall, and provide the first evidence of a functional segregation of the thalamic nuclei with respect to the memory retrieval phase. In particular, the mediodorsal thalamic-prefrontal cortical network is activated during successful encoding and retrieval of associations, which suggests a role of this system in recall and recollection. The activity of the anterior thalamic-temporal network selectively during retrieval predicts better memory performances across subjects and this confirms the paramount role of this network in recall and recollection. Copyright © 2013 Elsevier Inc. All rights reserved.

The effect of word concreteness on recognition memory.

PubMed

Fliessbach, K; Weis, S; Klaver, P; Elger, C E; Weber, B

2006-09-01

Concrete words that are readily imagined are better remembered than abstract words. Theoretical explanations for this effect either claim a dual coding of concrete words in the form of both a verbal and a sensory code (dual-coding theory), or a more accessible semantic network for concrete words than for abstract words (context-availability theory). However, the neural mechanisms of improved memory for concrete versus abstract words are poorly understood. Here, we investigated the processing of concrete and abstract words during encoding and retrieval in a recognition memory task using event-related functional magnetic resonance imaging (fMRI). As predicted, memory performance was significantly better for concrete words than for abstract words. Abstract words elicited stronger activations of the left inferior frontal cortex both during encoding and recognition than did concrete words. Stronger activation of this area was also associated with successful encoding for both abstract and concrete words. Concrete words elicited stronger activations bilaterally in the posterior inferior parietal lobe during recognition. The left parietal activation was associated with correct identification of old stimuli. The anterior precuneus, left cerebellar hemisphere and the posterior and anterior cingulate cortex showed activations both for successful recognition of concrete words and for online processing of concrete words during encoding. Additionally, we observed a correlation across subjects between brain activity in the left anterior fusiform gyrus and hippocampus during recognition of learned words and the strength of the concreteness effect. These findings support the idea of specific brain processes for concrete words, which are reactivated during successful recognition.

Memory strength and specificity revealed by pupillometry

PubMed Central

Papesh, Megan H.; Goldinger, Stephen D.; Hout, Michael C.

2011-01-01

Voice-specificity effects in recognition memory were investigated using both behavioral data and pupillometry. Volunteers initially heard spoken words and nonwords in two voices; they later provided confidence-based old/new classifications to items presented in their original voices, changed (but familiar) voices, or entirely new voices. Recognition was more accurate for old-voice items, replicating prior research. Pupillometry was used to gauge cognitive demand during both encoding and testing: Enlarged pupils revealed that participants devoted greater effort to encoding items that were subsequently recognized. Further, pupil responses were sensitive to the cue match between encoding and retrieval voices, as well as memory strength. Strong memories, and those with the closest encoding-retrieval voice matches, resulted in the highest peak pupil diameters. The results are discussed with respect to episodic memory models and Whittlesea’s (1997) SCAPE framework for recognition memory. PMID:22019480

Levels-Of-Processing Effect on Word Recognition in Schizophrenia

PubMed Central

Ragland, J. Daniel; Moelter, Stephen T.; McGrath, Claire; Hill, S. Kristian; Gur, Raquel E.; Bilker, Warren B.; Siegel, Steven J.; Gur, Ruben C.

2015-01-01

Background Individuals with schizophrenia have difficulty organizing words semantically to facilitate encoding. This is commonly attributed to organizational rather than semantic processing limitations. By requiring participants to classify and encode words on either a shallow (e.g., uppercase/lowercase) or deep level (e.g., concrete/abstract), the levels-of-processing paradigm eliminates the need to generate organizational strategies. Methods This paradigm was administered to 30 patients with schizophrenia and 30 healthy comparison subjects to test whether providing a strategy would improve patient performance. Results Word classification during shallow and deep encoding was slower and less accurate in patients. Patients also responded slowly during recognition testing and maintained a more conservative response bias following deep encoding; however, both groups showed a robust levels-of-processing effect on recognition accuracy, with unimpaired patient performance following both shallow and deep encoding. Conclusions This normal levels-of-processing effect in the patient sample suggests that semantic processing is sufficiently intact for patients to benefit from organizational cues. Memory remediation efforts may therefore be most successful if they focus on teaching patients to form organizational strategies during initial encoding. PMID:14643082

Levels-of-processing effect on word recognition in schizophrenia.

PubMed

Ragland, J Daniel; Moelter, Stephen T; McGrath, Claire; Hill, S Kristian; Gur, Raquel E; Bilker, Warren B; Siegel, Steven J; Gur, Ruben C

2003-12-01

Individuals with schizophrenia have difficulty organizing words semantically to facilitate encoding. This is commonly attributed to organizational rather than semantic processing limitations. By requiring participants to classify and encode words on either a shallow (e.g., uppercase/lowercase) or deep level (e.g., concrete/abstract), the levels-of-processing paradigm eliminates the need to generate organizational strategies. This paradigm was administered to 30 patients with schizophrenia and 30 healthy comparison subjects to test whether providing a strategy would improve patient performance. Word classification during shallow and deep encoding was slower and less accurate in patients. Patients also responded slowly during recognition testing and maintained a more conservative response bias following deep encoding; however, both groups showed a robust levels-of-processing effect on recognition accuracy, with unimpaired patient performance following both shallow and deep encoding. This normal levels-of-processing effect in the patient sample suggests that semantic processing is sufficiently intact for patients to benefit from organizational cues. Memory remediation efforts may therefore be most successful if they focus on teaching patients to form organizational strategies during initial encoding.

Genetic Dissection of Anopheles gambiae Gut Epithelial Responses to Serratia marcescens

PubMed Central

Stathopoulos, Stavros; Neafsey, Daniel E.; Lawniczak, Mara K. N.; Muskavitch, Marc A. T.; Christophides, George K.

2014-01-01

Genetic variation in the mosquito Anopheles gambiae profoundly influences its ability to transmit malaria. Mosquito gut bacteria are shown to influence the outcome of infections with Plasmodium parasites and are also thought to exert a strong drive on genetic variation through natural selection; however, a link between antibacterial effects and genetic variation is yet to emerge. Here, we combined SNP genotyping and expression profiling with phenotypic analyses of candidate genes by RNAi-mediated silencing and 454 pyrosequencing to investigate this intricate biological system. We identified 138 An. gambiae genes to be genetically associated with the outcome of Serratia marcescens infection, including the peptidoglycan recognition receptor PGRPLC that triggers activation of the antibacterial IMD/REL2 pathway and the epidermal growth factor receptor EGFR. Silencing of three genes encoding type III fibronectin domain proteins (FN3Ds) increased the Serratia load and altered the gut microbiota composition in favor of Enterobacteriaceae. These data suggest that natural genetic variation in immune-related genes can shape the bacterial population structure of the mosquito gut with high specificity. Importantly, FN3D2 encodes a homolog of the hypervariable pattern recognition receptor Dscam, suggesting that pathogen-specific recognition may involve a broader family of immune factors. Additionally, we showed that silencing the gene encoding the gustatory receptor Gr9 that is also associated with the Serratia infection phenotype drastically increased Serratia levels. The Gr9 antibacterial activity appears to be related to mosquito feeding behavior and to mostly rely on changes of neuropeptide F expression, together suggesting a behavioral immune response following Serratia infection. Our findings reveal that the mosquito response to oral Serratia infection comprises both an epithelial and a behavioral immune component. PMID:24603764

Recall and recognition of verbal paired associates in early Alzheimer's disease.

PubMed

Lowndes, G J; Saling, M M; Ames, D; Chiu, E; Gonzalez, L M; Savage, G R

2008-07-01

The primary impairment in early Alzheimer's disease (AD) is encoding/consolidation, resulting from medial temporal lobe (MTL) pathology. AD patients perform poorly on cued-recall paired associate learning (PAL) tasks, which assess the ability of the MTLs to encode relational memory. Since encoding and retrieval processes are confounded within performance indexes on cued-recall PAL, its specificity for AD is limited. Recognition paradigms tend to show good specificity for AD, and are well tolerated, but are typically less sensitive than recall tasks. Associate-recognition is a novel PAL task requiring a combination of recall and recognition processes. We administered a verbal associate-recognition test and cued-recall analogue to 22 early AD patients and 55 elderly controls to compare their ability to discriminate these groups. Both paradigms used eight arbitrarily related word pairs (e.g., pool-teeth) with varying degrees of imageability. Associate-recognition was equally effective as the cued-recall analogue in discriminating the groups, and logistic regression demonstrated classification rates by both tasks were equivalent. These preliminary findings provide support for the clinical value of this recognition tool. Conceptually it has potential for greater specificity in informing neuropsychological diagnosis of AD in clinical samples but this requires further empirical support.

Insulin-independent role of adiponectin receptor signaling in Drosophila germline stem cell maintenance.

PubMed

Laws, Kaitlin M; Sampson, Leesa L; Drummond-Barbosa, Daniela

2015-03-15

Adipocytes have key endocrine roles, mediated in large part by secreted protein hormones termed adipokines. The adipokine adiponectin is well known for its role in sensitizing peripheral tissues to insulin, and several lines of evidence suggest that adiponectin might also modulate stem cells/precursors. It remains unclear, however, how adiponectin signaling controls stem cells and whether this role is secondary to its insulin-sensitizing effects or distinct. Drosophila adipocytes also function as an endocrine organ and, although no obvious adiponectin homolog has been identified, Drosophila AdipoR encodes a well-conserved homolog of mammalian adiponectin receptors. Here, we generate a null AdipoR allele and use clonal analysis to demonstrate an intrinsic requirement for AdipoR in germline stem cell (GSC) maintenance in the Drosophila ovary. AdipoR null GSCs are not fully responsive to bone morphogenetic protein ligands from the niche and have a slight reduction in E-cadherin levels at the GSC-niche junction. Conversely, germline-specific overexpression of AdipoR inhibits natural GSC loss, suggesting that reduction in adiponectin signaling might contribute to the normal decline in GSC numbers observed over time in wild-type females. Surprisingly, AdipoR is not required for insulin sensitization of the germline, leading us to speculate that insulin sensitization is a more recently acquired function than stem cell regulation in the evolutionary history of adiponectin signaling. Our findings establish Drosophila female GSCs as a new system for future studies addressing the molecular mechanisms whereby adiponectin receptor signaling modulates stem cell fate. Copyright © 2015 Elsevier Inc. All rights reserved.

Face Memory: Implications for theories of binding items to context

PubMed Central

Reder, L. M.; Victoria, L. W.; Manelis, A.; Oates, J. M.; Dutcher, J. M.; Bates, J. T.; Cook, S.; Aizenstein, H. A.; Quinlan, J.; Gyulai, F.

2014-01-01

Two experiments tested the hypothesis that it is easier to bind a stimulus to context when the stimulus already has a stable (i.e., pre-existing) memory representation by comparing episodic memory of faces of celebrities vs. unknown individuals. Each face was superimposed on a picture of a well-known location (e.g., Eiffel Tower) during encoding and at a later unexpected recognition test but the background could change from encoding to test. Although recognition was to be based on the face, irrespective of background, performance was better when encoding context was reinstated. Further, a given background could be shown with many faces ("high fan") or only a few ("low fan") and this variable modulated the value added of context reinstatement. Importantly, manipulations of context only mattered for famous faces. As predicted, these effects were observed in recollection ("Remember") responses not in familiarity (“Know”) responses. Experiment 2 used the same design except that half of the subjects were administered midazolam, a drug that produces temporary anterograde amnesia, prior to encoding faces and backgrounds. Subjects injected with saline (control condition) showed the same pattern as Experiment 1; however subjects injected with midazolam showed a large decrease in the use of the "Remember" responses for famous faces and neither context reinstatement nor background fan affected performance. These results support the view that it is easier to bind stimuli to context when stimuli have a pre-existing, stable memory representation (e.g., faces of people whose identity we know) than when stimuli do not have pre-existing, stable memory representations. PMID:23395827

Phenotypic characterization of nevus and tumor patterns in MITF E318K mutation carrier melanoma patients.

PubMed

Sturm, Richard A; Fox, Carly; McClenahan, Phil; Jagirdar, Kasturee; Ibarrola-Villava, Maider; Banan, Parastoo; Abbott, Nicola C; Ribas, Gloria; Gabrielli, Brian; Duffy, David L; Peter Soyer, H

2014-01-01

A germline polymorphism of the microphthalmia transcription factor (MITF) gene encoding a SUMOylation-deficient E318K-mutated protein has recently been described as a medium-penetrance melanoma gene. In a clinical assessment of nevi from 301 volunteers taken from Queensland, we identified six individuals as MITF E318K mutation carriers. The phenotype for 5 of these individuals showed a commonality of fair skin, body freckling that varied over a wide range, and total nevus count between 46 and 430; in addition, all were multiple primary melanoma patients. The predominant dermoscopic signature pattern of nevi was reticular, and the frequency of globular nevi in carriers varied, which does not suggest that the MITF E318K mutation acts to force the continuous growth of nevi. Excised melanocytic lesions were available for four MITF E318K carrier patients and were compared with a matched range of wild-type (WT) melanocytic lesions. The MITF staining pattern showed a predominant nuclear signal in all sections, with no significant difference in the nuclear/cytoplasmic ratio between mutation-positive or -negative samples. A high incidence of amelanotic melanomas was found within the group, with three of the five melanomas from one patient suggesting a genetic interaction between the MITF E318K allele and an MC1R homozygous red hair color (RHC) variant genotype.

gone early, a Novel Germline Factor, Ensures the Proper Size of the Stem Cell Precursor Pool in the Drosophila Ovary

PubMed Central

Matsuoka, Shinya; Gupta, Swati; Suzuki, Emiko; Hiromi, Yasushi; Asaoka, Miho

2014-01-01

In order to sustain lifelong production of gametes, many animals have evolved a stem cell–based gametogenic program. In the Drosophila ovary, germline stem cells (GSCs) arise from a pool of primordial germ cells (PGCs) that remain undifferentiated even after gametogenesis has initiated. The decision of PGCs to differentiate or remain undifferentiated is regulated by somatic stromal cells: specifically, epidermal growth factor receptor (EGFR) signaling activated in the stromal cells determines the fraction of germ cells that remain undifferentiated by shaping a Decapentaplegic (Dpp) gradient that represses PGC differentiation. However, little is known about the contribution of germ cells to this process. Here we show that a novel germline factor, Gone early (Goe), limits the fraction of PGCs that initiate gametogenesis. goe encodes a non-peptidase homologue of the Neprilysin family metalloendopeptidases. At the onset of gametogenesis, Goe was localized on the germ cell membrane in the ovary, suggesting that it functions in a peptidase-independent manner in cell–cell communication at the cell surface. Overexpression of Goe in the germline decreased the number of PGCs that enter the gametogenic pathway, thereby increasing the proportion of undifferentiated PGCs. Inversely, depletion of Goe increased the number of PGCs initiating differentiation. Excess PGC differentiation in the goe mutant was augmented by halving the dose of argos, a somatically expressed inhibitor of EGFR signaling. This increase in PGC differentiation resulted in a massive decrease in the number of undifferentiated PGCs, and ultimately led to insufficient formation of GSCs. Thus, acting cooperatively with a somatic regulator of EGFR signaling, the germline factor goe plays a critical role in securing the proper size of the GSC precursor pool. Because goe can suppress EGFR signaling activity and is expressed in EGF-producing cells in various tissues, goe may function by attenuating EGFR signaling, and thereby affecting the stromal environment. PMID:25420147

Prestimulus default mode activity influences depth of processing and recognition in an emotional memory task.

PubMed

Soravia, Leila M; Witmer, Joëlle S; Schwab, Simon; Nakataki, Masahito; Dierks, Thomas; Wiest, Roland; Henke, Katharina; Federspiel, Andrea; Jann, Kay

2016-03-01

Low self-referential thoughts are associated with better concentration, which leads to deeper encoding and increases learning and subsequent retrieval. There is evidence that being engaged in externally rather than internally focused tasks is related to low neural activity in the default mode network (DMN) promoting open mind and the deep elaboration of new information. Thus, reduced DMN activity should lead to enhanced concentration, comprehensive stimulus evaluation including emotional categorization, deeper stimulus processing, and better long-term retention over one whole week. In this fMRI study, we investigated brain activation preceding and during incidental encoding of emotional pictures and on subsequent recognition performance. During fMRI, 24 subjects were exposed to 80 pictures of different emotional valence and subsequently asked to complete an online recognition task one week later. Results indicate that neural activity within the medial temporal lobes during encoding predicts subsequent memory performance. Moreover, a low activity of the default mode network preceding incidental encoding leads to slightly better recognition performance independent of the emotional perception of a picture. The findings indicate that the suppression of internally-oriented thoughts leads to a more comprehensive and thorough evaluation of a stimulus and its emotional valence. Reduced activation of the DMN prior to stimulus onset is associated with deeper encoding and enhanced consolidation and retrieval performance even one week later. Even small prestimulus lapses of attention influence consolidation and subsequent recognition performance. © 2015 Wiley Periodicals, Inc.

Enhanced tactile encoding and memory recognition in congenital blindness.

PubMed

D'Angiulli, Amedeo; Waraich, Paul

2002-06-01

Several behavioural studies have shown that early-blind persons possess superior tactile skills. Since neurophysiological data show that early-blind persons recruit visual as well as somatosensory cortex to carry out tactile processing (cross-modal plasticity), blind persons' sharper tactile skills may be related to cortical re-organisation resulting from loss of vision early in their life. To examine the nature of blind individuals' tactile superiority and its implications for cross-modal plasticity, we compared the tactile performance of congenitally totally blind, low-vision and sighted children on raised-line picture identification test and re-test, assessing effects of task familiarity, exploratory strategy and memory recognition. What distinguished the blind from the other children was higher memory recognition and higher tactile encoding associated with efficient exploration. These results suggest that enhanced perceptual encoding and recognition memory may be two cognitive correlates of cross-modal plasticity in congenital blindness.

The neural correlates of gist-based true and false recognition

PubMed Central

Gutchess, Angela H.; Schacter, Daniel L.

2012-01-01

When information is thematically related to previously studied information, gist-based processes contribute to false recognition. Using functional MRI, we examined the neural correlates of gist-based recognition as a function of increasing numbers of studied exemplars. Sixteen participants incidentally encoded small, medium, and large sets of pictures, and we compared the neural response at recognition using parametric modulation analyses. For hits, regions in middle occipital, middle temporal, and posterior parietal cortex linearly modulated their activity according to the number of related encoded items. For false alarms, visual, parietal, and hippocampal regions were modulated as a function of the encoded set size. The present results are consistent with prior work in that the neural regions supporting veridical memory also contribute to false memory for related information. The results also reveal that these regions respond to the degree of relatedness among similar items, and implicate perceptual and constructive processes in gist-based false memory. PMID:22155331

rahu is a mutant allele of Dnmt3c, encoding a DNA methyltransferase homolog required for meiosis and transposon repression in the mouse male germline

PubMed Central

Lange, Julian; Lailler, Nathalie

2017-01-01

Transcriptional silencing by heritable cytosine-5 methylation is an ancient strategy to repress transposable elements. It was previously thought that mammals possess four DNA methyltransferase paralogs—Dnmt1, Dnmt3a, Dnmt3b and Dnmt3l—that establish and maintain cytosine-5 methylation. Here we identify a fifth paralog, Dnmt3c, that is essential for retrotransposon methylation and repression in the mouse male germline. From a phenotype-based forward genetics screen, we isolated a mutant mouse called ‘rahu’, which displays severe defects in double-strand-break repair and homologous chromosome synapsis during male meiosis, resulting in sterility. rahu is an allele of a transcription unit (Gm14490, renamed Dnmt3c) that was previously mis-annotated as a Dnmt3-family pseudogene. Dnmt3c encodes a cytosine methyltransferase homolog, and Dnmt3crahu mutants harbor a non-synonymous mutation of a conserved residue within one of its cytosine methyltransferase motifs, similar to a mutation in human DNMT3B observed in patients with immunodeficiency, centromeric instability and facial anomalies syndrome. The rahu mutation lies at a potential dimerization interface and near the potential DNA binding interface, suggesting that it compromises protein-protein and/or protein-DNA interactions required for normal DNMT3C function. Dnmt3crahu mutant males fail to establish normal methylation within LINE and LTR retrotransposon sequences in the germline and accumulate higher levels of transposon-derived transcripts and proteins, particularly from distinct L1 and ERVK retrotransposon families. Phylogenetic analysis indicates that Dnmt3c arose during rodent evolution by tandem duplication of Dnmt3b, after the divergence of the Dipodoidea and Muroidea superfamilies. These findings provide insight into the evolutionary dynamics and functional specialization of the transposon suppression machinery critical for mammalian sexual reproduction and epigenetic regulation. PMID:28854222

Association of auditory-verbal and visual hallucinations with impaired and improved recognition of colored pictures.

PubMed

Brébion, Gildas; Stephan-Otto, Christian; Usall, Judith; Huerta-Ramos, Elena; Perez del Olmo, Mireia; Cuevas-Esteban, Jorge; Haro, Josep Maria; Ochoa, Susana

2015-09-01

A number of cognitive underpinnings of auditory hallucinations have been established in schizophrenia patients, but few have, as yet, been uncovered for visual hallucinations. In previous research, we unexpectedly observed that auditory hallucinations were associated with poor recognition of color, but not black-and-white (b/w), pictures. In this study, we attempted to replicate and explain this finding. Potential associations with visual hallucinations were explored. B/w and color pictures were presented to 50 schizophrenia patients and 45 healthy individuals under 2 conditions of visual context presentation corresponding to 2 levels of visual encoding complexity. Then, participants had to recognize the target pictures among distractors. Auditory-verbal hallucinations were inversely associated with the recognition of the color pictures presented under the most effortful encoding condition. This association was fully mediated by working-memory span. Visual hallucinations were associated with improved recognition of the color pictures presented under the less effortful condition. Patients suffering from visual hallucinations were not impaired, relative to the healthy participants, in the recognition of these pictures. Decreased working-memory span in patients with auditory-verbal hallucinations might impede the effortful encoding of stimuli. Visual hallucinations might be associated with facilitation in the visual encoding of natural scenes, or with enhanced color perception abilities. (c) 2015 APA, all rights reserved).

Distinct Patterns of Neural Activity during Memory Formation of Nonwords versus Words

PubMed Central

Otten, Leun J.; Sveen, Josefin; Quayle, Angela H.

2008-01-01

Research into the neural underpinnings of memory formation has focused on the encoding of familiar verbal information. Here, we address how the brain supports the encoding of novel information that does not have meaning. Electrical brain activity was recorded from the scalps of healthy young adults while they performed an incidental encoding task (syllable judgments) on separate series of words and ‘nonwords’ (nonsense letter strings that are orthographically legal and pronounceable). Memory for the items was then probed with a recognition memory test. For words as well as nonwords, event-related potentials differed depending on whether an item would subsequently be remembered or forgotten. However, the polarity and timing of the effect varied across item type. For words, subsequently remembered items showed the usually observed positive-going, frontally-distributed modulation from around 600 ms after word onset. For nonwords, by contrast, a negative-going, spatially widespread modulation predicted encoding success from 1000 ms onwards. Nonwords also showed a modulation shortly after item onset. These findings imply that the brain supports the encoding of familiar and unfamiliar letter strings in qualitatively different ways, including the engagement of distinct neural activity at different points in time. The processing of semantic attributes plays an important role in the encoding of words and the associated positive frontal modulation. PMID:17958481

Functional-anatomic study of episodic retrieval using fMRI. I. Retrieval effort versus retrieval success.

PubMed

Buckner, R L; Koutstaal, W; Schacter, D L; Wagner, A D; Rosen, B R

1998-04-01

A number of recent functional imaging studies have identified brain areas activated during tasks involving episodic memory retrieval. The identification of such areas provides a foundation for targeted hypotheses regarding the more specific contributions that these areas make to episodic retrieval. As a beginning effort toward such an endeavor, whole-brain functional magnetic resonance imaging (fMRI) was used to examine 14 subjects during episodic word recognition in a block-designed fMRI experiment. Study conditions were manipulated by presenting either shallow or deep encoding tasks. This manipulation yielded two recognition conditions that differed with regard to retrieval effort and retrieval success: shallow encoding yielded low levels of recognition success with high levels of retrieval effort, and deep encoding yielded high levels of recognition success with low levels of effort. Many brain areas were activated in common by these two recognition conditions compared to a low-level fixation condition, including left and right prefrontal regions often detected during PET episodic retrieval paradigms (e.g., R. L. Buckner et al., 1996, J. Neurosci. 16, 6219-6235) thereby generalizing these findings to fMRI. Characterization of the activated regions in relation to the separate recognition conditions showed (1) bilateral anterior insular regions and a left dorsal prefrontal region were more active after shallow encoding, when retrieval demanded greatest effort, and (2) right anterior prefrontal cortex, which has been implicated in episodic retrieval, was most active during successful retrieval after deep encoding. We discuss these findings in relation to component processes involved in episodic retrieval and in the context of a companion study using event-related fMRI.

Structural evolution of glycan recognition by a family of potent HIV antibodies.

PubMed

Garces, Fernando; Sok, Devin; Kong, Leopold; McBride, Ryan; Kim, Helen J; Saye-Francisco, Karen F; Julien, Jean-Philippe; Hua, Yuanzi; Cupo, Albert; Moore, John P; Paulson, James C; Ward, Andrew B; Burton, Dennis R; Wilson, Ian A

2014-09-25

The HIV envelope glycoprotein (Env) is densely covered with self-glycans that should help shield it from recognition by the human immune system. Here, we examine how a particularly potent family of broadly neutralizing antibodies (Abs) has evolved common and distinct structural features to counter the glycan shield and interact with both glycan and protein components of HIV Env. The inferred germline antibody already harbors potential binding pockets for a glycan and a short protein segment. Affinity maturation then leads to divergent evolutionary branches that either focus on a single glycan and protein segment (e.g., Ab PGT124) or engage multiple glycans (e.g., Abs PGT121-123). Furthermore, other surrounding glycans are avoided by selecting an appropriate initial antibody shape that prevents steric hindrance. Such molecular recognition lessons are important for engineering proteins that can recognize or accommodate glycans. Copyright © 2014 Elsevier Inc. All rights reserved.

Medial temporal lobe function during emotional memory in early Alzheimer’s disease, mild cognitive impairment and healthy ageing: an fMRI study

PubMed Central

2013-01-01

Background Relative to intentional memory encoding, which quickly declines in Mild Cognitive Impairment (MCI) and Alzheimer’s disease (AD), incidental memory for emotional stimuli appears to deteriorate more slowly. We hypothesised that tests of incidental emotional memory may inform on different aspects of cognitive decline in MCI and AD. Methods Patients with MCI, AD and Healthy Controls (HC) were asked to attend to emotional pictures (i.e., positive and neutral) sequentially presented during an fMRI session. Attention was monitored behaviourally. A surprise post-scan recognition test was then administered. Results The groups remained attentive within the scanner. The post-scan recognition pattern was in the form of (HC = MCI) > AD, with only the former group showing a clear benefit from emotional pictures. fMRI analysis of incidental encoding demonstrated clusters of activation in para-hippocampal regions and in the hippocampus in HC and MCI patients but not in AD patients. The pattern of activation observed in MCI patients tended to be greater than that found in HC. Conclusions The results suggest that incidental emotional memory might offer a suitable platform to investigate, using behavioural and fMRI measures, subtle changes in the process of developing AD. These changes seem to differ from those found using standard episodic memory tests. The underpinnings of such differences and the potential clinical use of this methodology are discussed in depth. PMID:23497150

Mutations in TMPRSS6 cause iron-refractory iron deficiency anemia (IRIDA)

PubMed Central

Finberg, Karin E; Heeney, Matthew M; Campagna, Dean R; Aydınok, Yeşim; Pearson, Howard A; Hartman, Kip R; Mayo, Mary M; Samuel, Stewart M; Strouse, John J; Markianos, Kyriacos; Andrews, Nancy C; Fleming, Mark D

2011-01-01

Iron deficiency is usually attributed to chronic blood loss or inadequate dietary intake. Here, we show that iron deficiency anemia refractory to oral iron therapy can be caused by germline mutations in TMPRSS6, which encodes a type II transmembrane serine protease produced by the liver that regulates the expression of the systemic iron regulatory hormone hepcidin. These findings demonstrate that TMPRSS6 is essential for normal systemic iron homeostasis in humans. PMID:18408718

Environmentally Induced Transgenerational Epigenetic Reprogramming of Primordial Germ Cells and the Subsequent Germ Line

PubMed Central

Skinner, Michael K.; Haque, Carlos Guerrero-Bosagna M.; Nilsson, Eric; Bhandari, Ramji; McCarrey, John R.

2013-01-01

A number of environmental factors (e.g. toxicants) have been shown to promote the epigenetic transgenerational inheritance of disease and phenotypic variation. Transgenerational inheritance requires the germline transmission of altered epigenetic information between generations in the absence of direct environmental exposures. The primary periods for epigenetic programming of the germ line are those associated with primordial germ cell development and subsequent fetal germline development. The current study examined the actions of an agricultural fungicide vinclozolin on gestating female (F0 generation) progeny in regards to the primordial germ cell (PGC) epigenetic reprogramming of the F3 generation (i.e. great-grandchildren). The F3 generation germline transcriptome and epigenome (DNA methylation) were altered transgenerationally. Interestingly, disruptions in DNA methylation patterns and altered transcriptomes were distinct between germ cells at the onset of gonadal sex determination at embryonic day 13 (E13) and after cord formation in the testis at embryonic day 16 (E16). A larger number of DNA methylation abnormalities (epimutations) and transcriptional alterations were observed in the E13 germ cells than in the E16 germ cells. These observations indicate that altered transgenerational epigenetic reprogramming and function of the male germline is a component of vinclozolin induced epigenetic transgenerational inheritance of disease. Insights into the molecular control of germline transmitted epigenetic inheritance are provided. PMID:23869203

Longevity and transposon defense, the case of termite reproductives

PubMed Central

Elsner, Daniel; Meusemann, Karen; Korb, Judith

2018-01-01

Social insects are promising new models in aging research. Within single colonies, longevity differences of several magnitudes exist that can be found elsewhere only between different species. Reproducing queens (and, in termites, also kings) can live for several decades, whereas sterile workers often have a lifespan of a few weeks only. We studied aging in the wild in a highly social insect, the termite Macrotermes bellicosus, which has one of the most pronounced longevity differences between reproductives and workers. We show that gene-expression patterns differed little between young and old reproductives, implying negligible aging. By contrast, old major workers had many genes up-regulated that are related to transposable elements (TEs), which can cause aging. Strikingly, genes from the PIWI-interacting RNA (piRNA) pathway, which are generally known to silence TEs in the germline of multicellular animals, were down-regulated only in old major workers but not in reproductives. Continued up-regulation of the piRNA defense commonly found in the germline of animals can explain the long life of termite reproductives, implying somatic cooption of germline defense during social evolution. This presents a striking germline/soma analogy as envisioned by the superorganism concept: the reproductives and workers of a colony reflect the germline and soma of multicellular animals, respectively. Our results provide support for the disposable soma theory of aging. PMID:29735660

Whole exome sequencing reveals recurrent mutations in BRCA2 and FAT genes in acinar cell carcinomas of the pancreas.

PubMed

Furukawa, Toru; Sakamoto, Hitomi; Takeuchi, Shoko; Ameri, Mitra; Kuboki, Yuko; Yamamoto, Toshiyuki; Hatori, Takashi; Yamamoto, Masakazu; Sugiyama, Masanori; Ohike, Nobuyuki; Yamaguchi, Hiroshi; Shimizu, Michio; Shibata, Noriyuki; Shimizu, Kyoko; Shiratori, Keiko

2015-03-06

Acinar cell carcinoma of the pancreas is a rare tumor with a poor prognosis. Compared to pancreatic ductal adenocarcinoma, its molecular features are poorly known. We studied a total of 11 acinar cell carcinomas, including 3 by exome and 4 by target sequencing. Exome sequencing revealed 65 nonsynonymous mutations and 22 indels with a mutation rate of 3.4 mutations/Mb per tumor, on average. By accounting for not only somatic but also germline mutations with loss of the wild-type allele, we identified recurrent mutations of BRCA2 and FAT genes. BRCA2 showed somatic or germline premature termination mutations, with loss of the wild-type allele in 3 of 7 tumors. FAT1, FAT3, and FAT4 showed somatic or germline missense mutations in 4 of 7 tumors. The germline FAT mutations were with loss of the wild-type allele. Loss of BRCA2 expression was observed in 5 of 11 tumors. One patient with a BRCA2-mutated tumor experienced complete remission of liver metastasis following cisplatinum chemotherapy. In conclusion, acinar cell carcinomas show a distinct mutation pattern and often harbor somatic or germline mutations of BRCA2 and FAT genes. This result may warrant assessment of BRCA2 abrogation in patients with the carcinoma to determine their sensitivity to chemotherapy.

Role of the Anterior Cingulate Cortex in the Retrieval of Novel Object Recognition Memory after a Long Delay

ERIC Educational Resources Information Center

Pezze, Marie A.; Marshall, Hayley J.; Fone, Kevin C. F.; Cassaday, Helen J.

2017-01-01

Previous in vivo electrophysiological studies suggest that the anterior cingulate cortex (ACgx) is an important substrate of novel object recognition (NOR) memory. However, intervention studies are needed to confirm this conclusion and permanent lesion studies cannot distinguish effects on encoding and retrieval. The interval between encoding and…

Stimulus Similarity and Encoding Time Influence Incidental Recognition Memory in Adult Monkeys with Selective Hippocampal Lesions

ERIC Educational Resources Information Center

Zeamer, Alyson; Meunier, Martine; Bachevalier, Jocelyne

2011-01-01

Recognition memory impairment after selective hippocampal lesions in monkeys is more profound when measured with visual paired-comparison (VPC) than with delayed nonmatching-to-sample (DNMS). To clarify this issue, we assessed the impact of stimuli similarity and encoding duration on the VPC performance in monkeys with hippocampal lesions and…

Negative words enhance recognition in nonclinical high dissociators: An fMRI study.

PubMed

de Ruiter, Michiel B; Veltman, Dick J; Phaf, R Hans; van Dyck, Richard

2007-08-01

Memory encoding and retrieval were studied in a nonclinical sample of participants that differed in the amount of reported dissociative experiences (trait dissociation). Behavioral as well as functional imaging (fMRI) indices were used as convergent measures of memory functioning. In a deep vs. shallow encoding paradigm, the influence of dissociative style on elaborative and avoidant encoding was studied, respectively. Furthermore, affectively neutral and negative words were presented, to test whether the effects of dissociative tendencies on memory functioning depended on the affective valence of the stimulus material. Results showed that (a) deep encoding of negative vs. neutral stimuli was associated with higher levels of semantic elaboration in high than in low dissociators, as indicated by increased levels of activity in hippocampus and prefrontal cortex during encoding and higher memory performance during recognition, (b) high dissociators were generally characterized by higher levels of conscious recollection as indicated by increased activity of the hippocampus and posterior parietal areas during recognition, (c) nonclinical high dissociators were not characterized by an avoidant encoding style. These results support the notion that trait dissociation in healthy individuals is associated with high levels of elaborative encoding, resulting in high levels of conscious recollection. These abilities, in addition, seem to depend on the salience of the presented stimulus material.

Examining the causes of memory strength variability: Recollection, attention failure, or encoding variability?

PubMed Central

Koen, Joshua D.; Aly, Mariam; Wang, Wei-Chun; Yonelinas, Andrew P.

2013-01-01

A prominent finding in recognition memory is that studied items are associated with more variability in memory strength than new items. Here, we test three competing theories for why this occurs - the encoding variability, attention failure, and recollection accounts. Distinguishing amongst these theories is critical because each provides a fundamentally different account of the processes underlying recognition memory. The encoding variability and attention failure accounts propose that old item variance will be unaffected by retrieval manipulations because the processes producing this effect are ascribed to encoding. The recollection account predicts that both encoding and retrieval manipulations that preferentially affect recollection will affect memory variability. These contrasting predictions were tested by examining the effect of response speeding (Experiment 1), dividing attention at retrieval (Experiment 2), context reinstatement (Experiment 3), and increased test delay (Experiment 4) on recognition performance. The results of all four experiments confirmed the predictions of the recollection account, and were inconsistent with the encoding variability account. The evidence supporting the attention failure account was mixed, with two of the four experiments confirming the account and two disconfirming the account. These results indicate that encoding variability and attention failure are insufficient accounts of memory variance, and provide support for the recollection account. Several alternative theoretical accounts of the results are also considered. PMID:23834057

Item-method directed forgetting: Effects at retrieval?

PubMed

Taylor, Tracy L; Cutmore, Laura; Pries, Lotta

2018-02-01

In an item-method directed forgetting paradigm, words are presented one at a time, each followed by an instruction to Remember or Forget; a directed forgetting effect is measured as better subsequent memory for Remember words than Forget words. The dominant view is that the directed forgetting effect arises during encoding due to selective rehearsal of Remember over Forget items. In three experiments we attempted to falsify a strong view that directed forgetting effects in recognition are due only to encoding mechanisms when an item method is used. Across 3 experiments we tested for retrieval-based processes by colour-coding the recognition test items. Black colour provided no information; green colour cued a potential Remember item; and, red colour cued a potential Forget item. Recognition cues were mixed within-blocks in Experiment 1 and between-blocks in Experiments 2 and 3; Experiment 3 added explicit feedback on the accuracy of the recognition decision. Although overall recognition improved with cuing when explicit test performance feedback was added in Experiment 3, in no case was the magnitude of the directed forgetting effect influenced by recognition cueing. Our results argue against a role for retrieval-based strategies that limit recognition of Forget items at test and posit a role for encoding intentions only. Copyright © 2017 Elsevier B.V. All rights reserved.

Evolutionary pattern of mutation in the factor IX genes of great apes: How does it compare to the pattern of recent germline mutation in patients with hemophilia B?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grouse, L.H.; Ketterling, R.P.; Sommer, S.S.

Most mutations causing hemophilia B have arisen within the past 150 years. By correcting for multiple biases, the underlying rates of spontaneous germline mutation have been estimated in the factor IX gene. From these rates, an underlying pattern of mutation has emerged. To determine if this pattern compares to a underlying pattern found in the great apes, sequence changes were determined in intronic regions of the factor IX gene. The following species were studied: Gorilla gorilla, Pan troglodytes (chimpanzee), Pongo pygmacus (orangutan) and Homo sapiens. Intronic sequences at least 200 bp from a splice junction were randomly chosen, amplified bymore » cross-species PCR, and sequenced. These regions are expected to be subject to little if any selective pressure. Early diverged species of Old World monkeys were also studied to help determine the direction of mutational changes. A total of 62 sequence changes were observed. Initial data suggest that the average pattern since evolution of the great apes has a paucity of transitions at CpG dinucleotides and an excess of microinsertions to microdeletions when compared to the pattern observed in humans during the past 150 years (p<.05). A larger study is in progress to confirm these results.« less

Schwannomatosis associated with multiple meningiomas due to a familial SMARCB1 mutation.

PubMed

Bacci, Costanza; Sestini, Roberta; Provenzano, Aldesia; Paganini, Irene; Mancini, Irene; Porfirio, Berardino; Vivarelli, Rossella; Genuardi, Maurizio; Papi, Laura

2010-02-01

Schwannomatosis (MIM 162091) is a condition predisposing to the development of central and peripheral schwannomas; most cases are sporadic without a clear family history but a few families with a clear autosomal dominant pattern of transmission have been described. Germline mutations in SMARCB1 are associated with schwannomatosis. We report a family with multiple schwannomas and meningiomas. A SMARCB1 germline mutation in exon 1 was identified. The mutation, c.92A>T (p.Glu31Val), occurs in a highly conserved amino acid in the SMARCB1 protein. In addition, in silico analysis demonstrated that the mutation disrupts the donor consensus sequence of exon 1. RNA studies verified the absence of mRNA transcribed by the mutant allele. This is the first report of a SMARCB1 germline mutation in a family with schwannomatosis characterized by the development of multiple meningiomas.

Local gradient Gabor pattern (LGGP) with applications in face recognition, cross-spectral matching, and soft biometrics

NASA Astrophysics Data System (ADS)

Chen, Cunjian; Ross, Arun

2013-05-01

Researchers in face recognition have been using Gabor filters for image representation due to their robustness to complex variations in expression and illumination. Numerous methods have been proposed to model the output of filter responses by employing either local or global descriptors. In this work, we propose a novel but simple approach for encoding Gradient information on Gabor-transformed images to represent the face, which can be used for identity, gender and ethnicity assessment. Extensive experiments on the standard face benchmark FERET (Visible versus Visible), as well as the heterogeneous face dataset HFB (Near-infrared versus Visible), suggest that the matching performance due to the proposed descriptor is comparable against state-of-the-art descriptor-based approaches in face recognition applications. Furthermore, the same feature set is used in the framework of a Collaborative Representation Classification (CRC) scheme for deducing soft biometric traits such as gender and ethnicity from face images in the AR, Morph and CAS-PEAL databases.

Promyelocytic leukaemia zinc finger maintains self-renewal of male germline stem cells (mGSCs) and its expression pattern in dairy goat testis.

PubMed

Song, W; Zhu, H; Li, M; Li, N; Wu, J; Mu, H; Yao, X; Han, W; Liu, W; Hua, J

2013-08-01

Previous studies have shown that promyelocytic leukaemia zinc finger (PLZF) is a spermatogonia-specific transcription factor in the testis, required to regulate self-renewal and maintenance of the spermatogonia stem cell. Up to now, expression and function of PLZF in the goat testis has not been known. The objectives of this study were to investigate PLZF expression pattern in the dairy goat and its effect on male goat germline stem cell (mGSC) self-renewal and differentiation. Testis development and expression patterns of PLZF in the dairy goat were analysed by haematoxylin and eosin staining, immunohistochemistry and reverse transcription-polymerase chain reaction (RT-PCR). Furthermore, effects of PLZF overexpression on mGSC self-renewal and differentiation were evaluated by quantitative RT-PCR (QRT-PCR), immunofluorescence and BrdU incorporation assay. Promyelocytic leukaemia zinc finger was essential for dairy goat testis development and expression of several proliferation and pluripotency-associated proteins including OCT4, C-MYC were upregulated by PLZF overexpression. The study demonstrated that PLZF played a key role in maintaining self-renewal of mGSCs and its overexpression enhanced expression of proliferation-associated genes. Promyelocytic leukaemia zinc finger could function in the dairy goat as well as in other species in maintaining self-renewal of germline stem cells and this study provides a model to study the mechanism on self-renewal and differentiation of mGSCs in livestock. © 2013 John Wiley & Sons Ltd.

Clinicopathologic Comparison of Lynch Syndrome-associated and "Lynch-like" Endometrial Carcinomas Identified on Universal Screening Using Mismatch Repair Protein Immunohistochemistry.

PubMed

Mills, Anne M; Sloan, Emily A; Thomas, Martha; Modesitt, Susan C; Stoler, Mark H; Atkins, Kristen A; Moskaluk, Christopher A

2016-02-01

Expanded testing for Lynch syndrome (LS) is increasingly recommended for patients with endometrial carcinomas, and immunohistochemistry (IHC) for tumor loss of mismatch-repair (MMR) protein expression is the most common primary screen. This has led to the recognition of MMR-IHC-deficient cases without identifiable mutations on directed germline sequencing. The clinical implications of such "Lynch-like" (LL) cancers are unclear. We here report the clinicopathologic features of putative familial endometrial carcinoma identified on universal MMR-IHC screening with attention to cases with discordant IHC and germline results. The files of the University of Virginia Pathology Department were retrospectively searched for all MMR-deficient endometrial carcinomas identified on screening. Cases were categorized as likely sporadic (MLH1/PMS2 loss, evidence of MLH1 promoter hypermethylation) or putative LS (PLS) (loss of MSH2/MSH6, MSH6, or PMS2). PLS cases were further subdivided into LS and LL groups on the basis of the presence or absence of a confirmatory mutation by germline testing, and the clinicopathologic features of these cases were compared. A deficiency of ≥1 MMR protein was observed in 31.4% (66/210) of endometrial carcinomas, including 26 PLS cases, 15 of which had germline testing. Directed germline sequencing confirmed LS in 46.7% (7/15); the remaining cases were classified as LL. High-grade and/or biphasic morphology was seen in 42.9% (3/7) of LS and 62.5% (5/8) of LL cases; the remaining cases showed low-grade, conventional endometrioid morphology. High level microsatellite instability was observed in 71.4% (5/7) of LL cases. The majority of cases from both groups (LS: 85.7% [6/7]; LL: 87.5% [7/8]) were low-stage (T1a/T1b). Endometrial carcinoma was the presenting malignancy in 85.7% (6/7) of LS patients and 87.5% (7/8) of LL patients. Family history was suggestive of LS in 28.5% (2/7) of LS patients and 12.5% (1/8) of LL patients. Screening algorithms based on age and cancer history would have failed to identify LS patients in 57.1% (4/7) of cases. Although universal MMR-IHC identifies endometrial carcinoma patients with LS who would have been missed using targeted screening algorithms, it also identifies cancers with discordant IHC and germline results for which the somatic versus germline origin of the MMR defect is unclear. Further study of this LL group is required before drawing definitive conclusions about their familial cancer risk.

Molecular Basis of 9G4 B Cell Autoreactivity in Human Systemic Lupus Erythematosus

PubMed Central

Richardson, Christopher; Chida, Asiya Seema; Adlowitz, Diana; Silver, Lin; Fox, Erin; Jenks, Scott A.; Palmer, Elise; Wang, Youliang; Heimburg-Molinaro, Jamie; Li, Quan-Zhen; Mohan, Chandra; Cummings, Richard; Tipton, Christopher

2013-01-01

9G4+ IgG Abs expand in systemic lupus erythematosus (SLE) in a disease-specific fashion and react with different lupus Ags including B cell Ags and apoptotic cells. Their shared use of VH4-34 represents a unique system to understand the molecular basis of lupus autoreactivity. In this study, a large panel of recombinant 9G4+ mAbs from single naive and memory cells was generated and tested against B cells, apoptotic cells, and other Ags. Mutagenesis eliminated the framework-1 hydrophobic patch (HP) responsible for the 9G4 idiotype. The expression of the HP in unselected VH4-34 cells was assessed by deep sequencing. We found that 9G4 Abs recognize several Ags following two distinct structural patterns. B cell binding is dependent on the HP, whereas anti-nuclear Abs, apoptotic cells, and dsDNA binding are HP independent and correlate with positively charged H chain third CDR. The majority of mutated VH4-34 memory cells retain the HP, thereby suggesting selection by Ags that require this germline structure. Our findings show that the germline-encoded HP is compulsory for the anti–B cell reactivity largely associated with 9G4 Abs in SLE but is not required for reactivity against apoptotic cells, dsDNA, chromatin, anti-nuclear Abs, or cardiolipin. Given that the lupus memory compartment contains a majority of HP+ VH4-34 cells but decreased B cell reactivity, additional HP-dependent Ags must participate in the selection of this compartment. This study represents the first analysis, to our knowledge, of VH-restricted autoreactive B cells specifically expanded in SLE and provides the foundation to understand the antigenic forces at play in this disease. PMID:24108696

Comprehensive identification of genes driven by ERV9-LTRs reveals TNFRSF10B as a re-activatable mediator of testicular cancer cell death

PubMed Central

Beyer, U; Krönung, S K; Leha, A; Walter, L; Dobbelstein, M

2016-01-01

The long terminal repeat (LTR) of human endogenous retrovirus type 9 (ERV9) acts as a germline-specific promoter that induces the expression of a proapoptotic isoform of the tumor suppressor homologue p63, GTAp63, in male germline cells. Testicular cancer cells silence this promoter, but inhibitors of histone deacetylases (HDACs) restore GTAp63 expression and give rise to apoptosis. We show here that numerous additional transcripts throughout the genome are driven by related ERV9-LTRs. 3' Rapid amplification of cDNA ends (3'RACE) was combined with next-generation sequencing to establish a large set of such mRNAs. HDAC inhibitors induce these ERV9-LTR-driven genes but not the LTRs from other ERVs. In particular, a transcript encoding the death receptor DR5 originates from an ERV9-LTR inserted upstream of the protein coding regions of the TNFRSF10B gene, and it shows an expression pattern similar to GTAp63. When treating testicular cancer cells with HDAC inhibitors as well as the death ligand TNF-related apoptosis-inducing ligand (TRAIL), rapid cell death was observed, which depended on TNFRSF10B expression. HDAC inhibitors also cooperate with cisplatin (cDDP) to promote apoptosis in testicular cancer cells. ERV9-LTRs not only drive a large set of human transcripts, but a subset of them acts in a proapoptotic manner. We propose that this avoids the survival of damaged germ cells. HDAC inhibition represents a strategy of restoring the expression of a class of ERV9-LTR-mediated genes in testicular cancer cells, thereby re-enabling tumor suppression. PMID:26024393

The functional characterization and comparison of two single CRD containing C-type lectins with novel and typical key motifs from Portunus trituberculatus.

PubMed

Huang, Mengmeng; Mu, Changkao; Wu, Yuehong; Ye, Fei; Wang, Dan; Sun, Cong; Lv, Zhengbing; Han, Bingnan; Wang, Chunlin; Xu, Xue-Wei

2017-11-01

C-type lectins are a superfamily of Ca 2+ -dependent carbohydrate-recognition proteins, which play crucial roles in innate immunity including nonself-recognition and pathogen elimination. In the present study, two single-CRD containing C-type lectins were identified from swimming crab Portunus trituberculatus (designated as PtCTL-2 and PtCTL-3). The open reading frame (ORF) of PtCTL-2 encoded polypeptides of 485 amino acids with a signal peptide and a single carbohydrate-recognition domain (CRD), while PtCTL-3's ORF encoded polypeptides of 241 amino acids with a coiled-coil region and a single-CRD. The key motifs determining carbohydrate binding specificity in PtCTL-2 and PtCTL-3 were EPR (Glu-Pro-Arg) and QPD (Gln-Pro-Asp). EPR is a motif being identified for the first time, whereas QPD is a typical motif in C-type lectins. Different PAMPs binding features of the two recombinant proteins - PtCTL-2 (rPtCTL-2) and PtCTL-3 (rPtCTL-3) have been observed in our experiments. rPtCTL-2 could bind three pathogen-associated molecular patterns (PAMPs) with relatively high affinity, including glucan, lipopolysaccharide (LPS) and peptidoglycan (PGN), while rPtCTL-3 could barely bind any of them. However, rPtCTL-2 could bind seven kinds of microbes and rPtCTL-3 could bind six kinds in microbe binding assay. Moreover, rPtCTL-2 and rPtCTL-3 exhibited similar agglutination activity against Gram-positive bacteria, Gram-negative bacteria and fungi in agglutination assay. All these results illustrated that PtCTL-2 and PtCTL-3 could function as important pattern-recognition receptors (PRR) with broad nonself-recognition spectrum involved in immune defense against invaders. In addition, the results of carbohydrate binding specificity showed that PtCTL-2 with novel key motif had broad carbohydrate binding specificity, while PtCTL-3 with typical key motif possessed different carbohydrate binding specificity from the classical binding rule. Furthermore, PtCTL-2 and PtCTL-3 could also function as opsonin to enhance encapsulation of hemocytes against Ni-NTA beads. Copyright © 2017 Elsevier Ltd. All rights reserved.

Leveling the playing field: attention mitigates the effects of intelligence on memory.

PubMed

Markant, Julie; Amso, Dima

2014-05-01

Effective attention and memory skills are fundamental to typical development and essential for achievement during the formal education years. It is critical to identify the specific mechanisms linking efficiency of attentional selection of an item and the quality of its memory retention. The present study capitalized on the spatial cueing paradigm to examine the role of selection via suppression in modulating children and adolescents' memory encoding. By varying a single parameter, the spatial cueing task can elicit either a simple orienting mechanism (i.e., facilitation) or one that involves both target selection and simultaneous suppression of competing information (i.e., IOR). We modified this paradigm to include images of common items in target locations. Participants were not instructed to learn the items and were not told they would be completing a memory test later. Following the cueing task, we imposed a 7-min delay and then asked participants to complete a recognition memory test. Results indicated that selection via suppression promoted recognition memory among 7-17year-olds. Moreover, individual differences in the extent of suppression during encoding predicted recognition memory accuracy. When basic cueing facilitated orienting to target items during encoding, IQ was the best predictor of recognition memory performance for the attended items. In contrast, engaging suppression (i.e., IOR) during encoding counteracted individual differences in intelligence, effectively improving recognition memory performance among children with lower IQs. This work demonstrates that engaging selection via suppression during learning and encoding improves memory retention and has broad implications for developing effective educational techniques. Copyright © 2014 Elsevier B.V. All rights reserved.

Leveling the playing field: Attention mitigates the effects of intelligence on memory

PubMed Central

Markant, Julie; Amso, Dima

2014-01-01

Effective attention and memory skills are fundamental to typical development and essential for achievement during the formal education years. It is critical to identify the specific mechanisms linking efficiency of attentional selection of an item and the quality of its memory retention. The present study capitalized on the spatial cueing paradigm to examine the role of selection via suppression in modulating children and adolescents’ memory encoding. By varying a single parameter, the spatial cueing task can elicit either a simple orienting mechanism (i.e., facilitation) or one that involves both target selection and simultaneous suppression of competing information (i.e., IOR). We modified this paradigm to include images of common items in target locations. Participants were not instructed to learn the items and were not told they would be completing a memory test later. Following the cueing task, we imposed a seven-minute delay and then asked participants to complete a recognition memory test. Results indicated that selection via suppression promoted recognition memory among 7-17 year-olds. Moreover, individual differences in the extent of suppression during encoding predicted recognition memory accuracy. When basic cueing facilitated orienting to target items during encoding, IQ was the best predictor of recognition memory performance for the attended items. In contrast, engaging suppression (i.e, IOR) during encoding counteracted individual differences in intelligence, effectively improving recognition memory performance among children with lower IQs. This work demonstrates that engaging selection via suppression during learning and encoding improves memory retention and has broad implications for developing effective educational techniques. PMID:24549142

Next generation mothers: Maternal control of germline development in zebrafish.

PubMed

Dosch, Roland

2015-01-01

In many animals, factors deposited by the mother into the egg control the earliest events in development of the zygote. These maternal RNAs and proteins play critical roles in oocyte development and the earliest steps of embryogenesis such as fertilization, cell division and embryonic patterning. Here, this article summarizes recent discoveries made on the maternal control of germline specification in zebrafish. Moreover, this review will discuss the major gaps remaining in our understanding of this process and highlight recent technical innovations in zebrafish, which allow tackling some of these questions in the near future.

Screening for germline phosphatase and tensin homolog-mutations in suspected Cowden syndrome and Cowden syndrome-like families among uterine cancer patients

PubMed Central

TZORTZATOS, GERASIMOS; ARAVIDIS, CHRISTOS; LINDBLOM, ANNIKA; MINTS, MIRIAM; THAM, EMMA

2015-01-01

Cowden syndrome (CS) is an autosomal dominant disorder characterized by multiple hamartomas in the breast, thyroid and endometrium, with a prevalence of 1 per 250,000. Females with CS have a 21–28% lifetime risk of developing uterine cancer. Germline mutations in the phosphatase and tensin homolog (PTEN) gene, a tumor suppressor gene, are responsible for 30–80% of CS cases. PTEN is a nine-exon gene, located on chromosome 10q23.3, which encodes the 403 amino acid PTEN protein. It negatively regulates the phosphoinositide 3-kinase/protein kinase B/mammalian target of rapamycin pathway, affecting various cellular processes and signaling pathways. The present study examined whether PTEN mutations are present in CS-like families with uterine cancer (UC). UC patients underwent surgery at Karolinska University Hospital, Stockholm, Sweden (2008–2012). Pedigrees were analyzed and 54 unrelated CS-like families were identified. CS-like families were defined as having at least one occurrence of uterine cancer and one of breast cancer, as well as at least one additional Cowden-associated tumor (uterine, breast, thyroid, colon or kidney cancer) in the same individual or in first-degree relatives. Genomic DNA was amplified using polymerase chain reaction, and DNA sequencing analysis of all nine exons of the PTEN gene was conducted. No germline PTEN mutations or polymorphisms were identified. Germline PTEN mutations are rare in CS-like families with uterine cancer, therefore, genetic screening must be restricted to patients that meet the strict National Comprehensive Cancer Network criteria. Gynecologists must be aware of the CS criteria and identify potential cases of CS in females where uterine cancer is the sentinel cancer. PMID:25789042

Genetic Basis for Developmental Homeostasis of Germline Stem Cell Niche Number: A Network of Tramtrack-Group Nuclear BTB Factors

PubMed Central

Chalvet, Fabienne; Netter, Sophie; Dos Santos, Nicolas; Poisot, Emilie; Paces-Fessy, Mélanie; Cumenal, Delphine; Peronnet, Frédérique; Pret, Anne-Marie; Théodore, Laurent

2012-01-01

The potential to produce new cells during adult life depends on the number of stem cell niches and the capacity of stem cells to divide, and is therefore under the control of programs ensuring developmental homeostasis. However, it remains generally unknown how the number of stem cell niches is controlled. In the insect ovary, each germline stem cell (GSC) niche is embedded in a functional unit called an ovariole. The number of ovarioles, and thus the number of GSC niches, varies widely among species. In Drosophila, morphogenesis of ovarioles starts in larvae with the formation of terminal filaments (TFs), each made of 8–10 cells that pile up and sort in stacks. TFs constitute organizers of individual germline stem cell niches during larval and early pupal development. In the Drosophila melanogaster subgroup, the number of ovarioles varies interspecifically from 8 to 20. Here we show that pipsqueak, Trithorax-like, batman and the bric-à-brac (bab) locus, all encoding nuclear BTB/POZ factors of the Tramtrack Group, are involved in limiting the number of ovarioles in D. melanogaster. At least two different processes are differentially perturbed by reducing the function of these genes. We found that when the bab dose is reduced, sorting of TF cells into TFs was affected such that each TF contains fewer cells and more TFs are formed. In contrast, psq mutants exhibited a greater number of TF cells per ovary, with a normal number of cells per TF, thereby leading to formation of more TFs per ovary than in the wild type. Our results indicate that two parallel genetic pathways under the control of a network of nuclear BTB factors are combined in order to negatively control the number of germline stem cell niches. PMID:23185495

Identification of two 14q32 deletions involving DICER1 associated with the development of DICER1-related tumors.

PubMed

Herriges, John C; Brown, Sara; Longhurst, Maria; Ozmore, Jillian; Moeschler, John B; Janze, Aura; Meck, Jeanne; South, Sarah T; Andersen, Erica F

2018-04-24

DICER1 encodes an RNase III endonuclease protein that regulates the production of small non-coding RNAs. Germline mutations in DICER1 are associated with an autosomal dominant hereditary cancer predisposition syndrome that confers an increased risk for the development of several rare childhood and adult-onset tumors, the most frequent of which include pleuropulmonary blastoma, ovarian sex cord-stromal tumors, cystic nephroma, and thyroid gland neoplasia. The majority of reported germline DICER1 mutations are truncating sequence-level alterations, suggesting that a loss-of-function type mechanism drives tumor formation in DICER1 syndrome. However, reports of patients with germline DICER1 whole gene deletions are limited, and thus far, only two have reported an association with tumor development. Here we report the clinical findings of three patients from two unrelated families with 14q32 deletions that encompass the DICER1 locus. The deletion identified in Family I is 1.4 Mb and was initially identified in a 6-year-old male referred for developmental delay, hypotonia, macrocephaly, obesity, and behavioral problems. Subsequent testing revealed that this deletion was inherited from his mother, who had a clinical history that included bilateral multinodular goiter and papillary thyroid carcinoma. The second deletion is 5.0 Mb and was identified in a 15-year-old female who presented with autism, coarse facial features, Sertoli-Leydig cell tumor, and Wilms' tumor. These findings provide additional supportive evidence that germline deletion of DICER1 confers an increased risk for DICER1-related tumor development, and provide new insight into the clinical significance of deletions involving the 14q32 region. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Successful adaptation to ketosis by mice with tissue-specific deficiency of ketone body oxidation

PubMed Central

Cotter, David G.; Schugar, Rebecca C.; Wentz, Anna E.; André d'Avignon, D.

2013-01-01

During states of low carbohydrate intake, mammalian ketone body metabolism transfers energy substrates originally derived from fatty acyl chains within the liver to extrahepatic organs. We previously demonstrated that the mitochondrial enzyme coenzyme A (CoA) transferase [succinyl-CoA:3-oxoacid CoA transferase (SCOT), encoded by nuclear Oxct1] is required for oxidation of ketone bodies and that germline SCOT-knockout (KO) mice die within 48 h of birth because of hyperketonemic hypoglycemia. Here, we use novel transgenic and tissue-specific SCOT-KO mice to demonstrate that ketone bodies do not serve an obligate energetic role within highly ketolytic tissues during the ketogenic neonatal period or during starvation in the adult. Although transgene-mediated restoration of myocardial CoA transferase in germline SCOT-KO mice is insufficient to prevent lethal hyperketonemic hypoglycemia in the neonatal period, mice lacking CoA transferase selectively within neurons, cardiomyocytes, or skeletal myocytes are all viable as neonates. Like germline SCOT-KO neonatal mice, neonatal mice with neuronal CoA transferase deficiency exhibit increased cerebral glycolysis and glucose oxidation, and, while these neonatal mice exhibit modest hyperketonemia, they do not develop hypoglycemia. As adults, tissue-specific SCOT-KO mice tolerate starvation, exhibiting only modestly increased hyperketonemia. Finally, metabolic analysis of adult germline Oxct1+/− mice demonstrates that global diminution of ketone body oxidation yields hyperketonemia, but hypoglycemia emerges only during a protracted state of low carbohydrate intake. Together, these data suggest that, at the tissue level, ketone bodies are not a required energy substrate in the newborn period or during starvation, but rather that integrated ketone body metabolism mediates adaptation to ketogenic nutrient states. PMID:23233542

Successful adaptation to ketosis by mice with tissue-specific deficiency of ketone body oxidation.

PubMed

Cotter, David G; Schugar, Rebecca C; Wentz, Anna E; d'Avignon, D André; Crawford, Peter A

2013-02-15

During states of low carbohydrate intake, mammalian ketone body metabolism transfers energy substrates originally derived from fatty acyl chains within the liver to extrahepatic organs. We previously demonstrated that the mitochondrial enzyme coenzyme A (CoA) transferase [succinyl-CoA:3-oxoacid CoA transferase (SCOT), encoded by nuclear Oxct1] is required for oxidation of ketone bodies and that germline SCOT-knockout (KO) mice die within 48 h of birth because of hyperketonemic hypoglycemia. Here, we use novel transgenic and tissue-specific SCOT-KO mice to demonstrate that ketone bodies do not serve an obligate energetic role within highly ketolytic tissues during the ketogenic neonatal period or during starvation in the adult. Although transgene-mediated restoration of myocardial CoA transferase in germline SCOT-KO mice is insufficient to prevent lethal hyperketonemic hypoglycemia in the neonatal period, mice lacking CoA transferase selectively within neurons, cardiomyocytes, or skeletal myocytes are all viable as neonates. Like germline SCOT-KO neonatal mice, neonatal mice with neuronal CoA transferase deficiency exhibit increased cerebral glycolysis and glucose oxidation, and, while these neonatal mice exhibit modest hyperketonemia, they do not develop hypoglycemia. As adults, tissue-specific SCOT-KO mice tolerate starvation, exhibiting only modestly increased hyperketonemia. Finally, metabolic analysis of adult germline Oxct1(+/-) mice demonstrates that global diminution of ketone body oxidation yields hyperketonemia, but hypoglycemia emerges only during a protracted state of low carbohydrate intake. Together, these data suggest that, at the tissue level, ketone bodies are not a required energy substrate in the newborn period or during starvation, but rather that integrated ketone body metabolism mediates adaptation to ketogenic nutrient states.

Genomic profiling of pelvic genital type leiomyosarcoma in a woman with a germline CHEK2:c.1100delC mutation and a concomitant diagnosis of metastatic invasive ductal breast carcinoma

PubMed Central

Reisle, Caralyn; Martin, Lee Ann; Alwelaie, Yazeed; Mungall, Karen L.; Ch'ng, Carolyn; Thomas, Ruth; Ng, Tony; Yip, Stephen; J. Lim, Howard; Sun, Sophie; Young, Sean S.; Karsan, Aly; Zhao, Yongjun; Mungall, Andrew J.; Moore, Richard A.; J. Renouf, Daniel; Gelmon, Karen; Ma, Yussanne P.; Hayes, Malcolm; Laskin, Janessa; Marra, Marco A.; Schrader, Kasmintan A.; Jones, Steven J. M.

2017-01-01

We describe a woman with the known pathogenic germline variant CHEK2:c.1100delC and synchronous diagnoses of both pelvic genital type leiomyosarcoma (LMS) and metastatic invasive ductal breast carcinoma. CHEK2 (checkpoint kinase 2) is a tumor-suppressor gene encoding a serine/threonine-protein kinase (CHEK2) involved in double-strand DNA break repair and cell cycle arrest. The CHEK2:c.1100delC variant is a moderate penetrance allele resulting in an approximately twofold increase in breast cancer risk. Whole-genome and whole-transcriptome sequencing were performed on the leiomyosarcoma and matched blood-derived DNA. Despite the presence of several genomic hits within the double-strand DNA damage pathway (CHEK2 germline variant and multiple RAD51B somatic structural variants), tumor profiling did not show an obvious DNA repair deficiency signature. However, even though the LMS displayed clear malignant features, its genomic profiling revealed several characteristics classically associated with leiomyomas including a translocation, t(12;14), with one breakpoint disrupting RAD51B and the other breakpoint upstream of HMGA2 with very high expression of HMGA2 and PLAG1. This is the first report of LMS genomic profiling in a patient with the germline CHEK2:c.1100delC variant and an additional diagnosis of metastatic invasive ductal breast carcinoma. We also describe a possible mechanistic relationship between leiomyoma and LMS based on genomic and transcriptome data. Our findings suggest that RAD51B translocation and HMGA2 overexpression may play an important role in LMS oncogenesis. PMID:28514723

Genomic profiling of pelvic genital type leiomyosarcoma in a woman with a germline CHEK2:c.1100delC mutation and a concomitant diagnosis of metastatic invasive ductal breast carcinoma.

PubMed

Thibodeau, My Linh; Reisle, Caralyn; Zhao, Eric; Martin, Lee Ann; Alwelaie, Yazeed; Mungall, Karen L; Ch'ng, Carolyn; Thomas, Ruth; Ng, Tony; Yip, Stephen; J Lim, Howard; Sun, Sophie; Young, Sean S; Karsan, Aly; Zhao, Yongjun; Mungall, Andrew J; Moore, Richard A; J Renouf, Daniel; Gelmon, Karen; Ma, Yussanne P; Hayes, Malcolm; Laskin, Janessa; Marra, Marco A; Schrader, Kasmintan A; Jones, Steven J M

2017-09-01

We describe a woman with the known pathogenic germline variant CHEK2 :c.1100delC and synchronous diagnoses of both pelvic genital type leiomyosarcoma (LMS) and metastatic invasive ductal breast carcinoma. CHEK2 (checkpoint kinase 2) is a tumor-suppressor gene encoding a serine/threonine-protein kinase (CHEK2) involved in double-strand DNA break repair and cell cycle arrest. The CHEK2 :c.1100delC variant is a moderate penetrance allele resulting in an approximately twofold increase in breast cancer risk. Whole-genome and whole-transcriptome sequencing were performed on the leiomyosarcoma and matched blood-derived DNA. Despite the presence of several genomic hits within the double-strand DNA damage pathway ( CHEK2 germline variant and multiple RAD51B somatic structural variants), tumor profiling did not show an obvious DNA repair deficiency signature. However, even though the LMS displayed clear malignant features, its genomic profiling revealed several characteristics classically associated with leiomyomas including a translocation, t(12;14), with one breakpoint disrupting RAD51B and the other breakpoint upstream of HMGA2 with very high expression of HMGA2 and PLAG1 This is the first report of LMS genomic profiling in a patient with the germline CHEK2 :c.1100delC variant and an additional diagnosis of metastatic invasive ductal breast carcinoma. We also describe a possible mechanistic relationship between leiomyoma and LMS based on genomic and transcriptome data. Our findings suggest that RAD51B translocation and HMGA2 overexpression may play an important role in LMS oncogenesis. © 2017 Thibodeau et al.; Published by Cold Spring Harbor Laboratory Press.

cdc-25.2, a C. elegans ortholog of cdc25, is required to promote oocyte maturation.

PubMed

Kim, Jiyoung; Kawasaki, Ichiro; Shim, Yhong-Hee

2010-03-15

Cdc25 is an evolutionarily conserved protein phosphatase that promotes progression through the cell cycle. Some metazoans have multiple isoforms of Cdc25, which have distinct functions and different expression patterns during development. C. elegans has four cdc-25 genes. cdc-25.1 is required for germline mitotic proliferation. To determine if the other members of the cdc-25 family also contribute to regulation of cell division in the germ line, we examined phenotypes of loss-of-function mutants of the other cdc-25 family genes. We found that cdc-25.2 is also essential for germline development. cdc-25.2 homozygous mutant hermaphrodites exhibited sterility as a result of defects in oogenesis: mutant oocytes were arrested as endomitotic oocytes that were not fertilized successfully. Spermatogenesis and male germline development were not affected. Through genetic interaction studies, we found that CDC-25.2 functions upstream of maturation-promoting factor containing CDK-1 and CYB-3 to promote oocyte maturation by counteracting function of WEE-1.3. We propose that cdc-25 family members function as distinct but related cell cycle regulators to control diverse cell cycles in C. elegans germline development.

Primordial germ cell-mediated transgenesis and genome editing in birds.

PubMed

Han, Jae Yong; Park, Young Hyun

2018-01-01

Transgenesis and genome editing in birds are based on a unique germline transmission system using primordial germ cells (PGCs), which is quite different from the mammalian transgenic and genome editing system. PGCs are progenitor cells of gametes that can deliver genetic information to the next generation. Since avian PGCs were first discovered in nineteenth century, there have been numerous efforts to reveal their origin, specification, and unique migration pattern, and to improve germline transmission efficiency. Recent advances in the isolation and in vitro culture of avian PGCs with genetic manipulation and genome editing tools enable the development of valuable avian models that were unavailable before. However, many challenges remain in the production of transgenic and genome-edited birds, including the precise control of germline transmission, introduction of exogenous genes, and genome editing in PGCs. Therefore, establishing reliable germline-competent PGCs and applying precise genome editing systems are critical current issues in the production of avian models. Here, we introduce a historical overview of avian PGCs and their application, including improved techniques and methodologies in the production of transgenic and genome-edited birds, and we discuss the future potential applications of transgenic and genome-edited birds to provide opportunities and benefits for humans.

Orienting to face expression during encoding improves men's recognition of own gender faces.

PubMed

Fulton, Erika K; Bulluck, Megan; Hertzog, Christopher

2015-10-01

It is unclear why women have superior episodic memory of faces, but the benefit may be partially the result of women engaging in superior processing of facial expressions. Therefore, we hypothesized that orienting instructions to attend to facial expression at encoding would significantly improve men's memory of faces and possibly reduce gender differences. We directed 203 college students (122 women) to study 120 faces under instructions to orient to either the person's gender or their emotional expression. They later took a recognition test of these faces by either judging whether they had previously studied the same person or that person with the exact same expression; the latter test evaluated recollection of specific facial details. Orienting to facial expressions during encoding significantly improved men's recognition of own-gender faces and eliminated the advantage that women had for male faces under gender orienting instructions. Although gender differences in spontaneous strategy use when orienting to faces cannot fully account for gender differences in face recognition, orienting men to facial expression during encoding is one way to significantly improve their episodic memory for male faces. Copyright © 2015 Elsevier B.V. All rights reserved.

Levels-of-processing effect on frontotemporal function in schizophrenia during word encoding and recognition.

PubMed

Ragland, J Daniel; Gur, Ruben C; Valdez, Jeffrey N; Loughead, James; Elliott, Mark; Kohler, Christian; Kanes, Stephen; Siegel, Steven J; Moelter, Stephen T; Gur, Raquel E

2005-10-01

Patients with schizophrenia improve episodic memory accuracy when given organizational strategies through levels-of-processing paradigms. This study tested if improvement is accompanied by normalized frontotemporal function. Event-related blood-oxygen-level-dependent functional magnetic resonance imaging (fMRI) was used to measure activation during shallow (perceptual) and deep (semantic) word encoding and recognition in 14 patients with schizophrenia and 14 healthy comparison subjects. Despite slower and less accurate overall word classification, the patients showed normal levels-of-processing effects, with faster and more accurate recognition of deeply processed words. These effects were accompanied by left ventrolateral prefrontal activation during encoding in both groups, although the thalamus, hippocampus, and lingual gyrus were overactivated in the patients. During word recognition, the patients showed overactivation in the left frontal pole and had a less robust right prefrontal response. Evidence of normal levels-of-processing effects and left prefrontal activation suggests that patients with schizophrenia can form and maintain semantic representations when they are provided with organizational cues and can improve their word encoding and retrieval. Areas of overactivation suggest residual inefficiencies. Nevertheless, the effect of teaching organizational strategies on episodic memory and brain function is a worthwhile topic for future interventional studies.

Multiple endocrine neoplasia type 2 syndromes (MEN 2): results from the ItaMEN network analysis on the prevalence of different genotypes and phenotypes.

PubMed

Romei, Cristina; Mariotti, Stefano; Fugazzola, Laura; Taccaliti, Augusto; Pacini, Furio; Opocher, Giuseppe; Mian, Caterina; Castellano, Maurizio; degli Uberti, Ettore; Ceccherini, Isabella; Cremonini, Nadia; Seregni, Ettore; Orlandi, Fabio; Ferolla, Piero; Puxeddu, Efisio; Giorgino, Francesco; Colao, Annamaria; Loli, Paola; Bondi, Fabio; Cosci, Barbara; Bottici, Valeria; Cappai, Antonello; Pinna, Giovanni; Persani, Luca; Verga, Uberta; Uberta, Verga; Boscaro, Marco; Castagna, Maria Grazia; Cappelli, Carlo; Zatelli, Maria Chiara; Faggiano, Antongiulio; Francia, Giuseppe; Brandi, Maria Luisa; Falchetti, Alberto; Pinchera, Aldo; Elisei, Rossella

2010-08-01

Multiple endocrine neoplasia type 2 (MEN 2) is a genetic disease characterized by medullary thyroid carcinoma (MTC) associated (MEN 2A and 2B) or not familial MTC (FMTC) with other endocrine neoplasia due to germline RET gene mutations. The prevalence of these rare genetic diseases and their corresponding RET mutations are unknown due to the small size of the study population. We collected data on germline RET mutations of 250 families with hereditary MTC followed in 20 different Italian centres. The most frequent RET amino acid substitution was Val804Met (19.6%) followed by Cys634Arg (13.6%). A total of 40 different germline RET mutations were present. Six families (2.4%) were negative for germline RET mutations. The comparison of the prevalence of RET germline mutations in the present study with those published by other European studies showed a higher prevalence of Val804Met and Ser891Ala mutations and a lower prevalence of Leu790Phe and Tyr791Phe (P<0.0001). A statistically significant higher prevalence of mutations affecting non-cysteine codons was also found (P<0.0001). Furthermore, the phenotype data collection showed an unexpected higher prevalence of FMTC (57.6%) with respect to other MEN 2 syndromes (34% MEN 2A and 6.8% of MEN 2B). In conclusion, we observed a statistically significant different pattern of RET mutations in Italian MEN 2 families with respect to other European studies and a higher prevalence of FMTC phenotype. The different ethnic origins of the patients and the particular attention given to analysing apparently sporadic MTC for RET germline mutations may explain these findings.

The effect of mild acute stress during memory consolidation on emotional recognition memory.

PubMed

Corbett, Brittany; Weinberg, Lisa; Duarte, Audrey

2017-11-01

Stress during consolidation improves recognition memory performance. Generally, this memory benefit is greater for emotionally arousing stimuli than neutral stimuli. The strength of the stressor also plays a role in memory performance, with memory performance improving up to a moderate level of stress and thereafter worsening. As our daily stressors are generally minimal in strength, we chose to induce mild acute stress to determine its effect on memory performance. In the current study, we investigated if mild acute stress during consolidation improves memory performance for emotionally arousing images. To investigate this, we had participants encode highly arousing negative, minimally arousing negative, and neutral images. We induced stress using the Montreal Imaging Stress Task (MIST) in half of the participants and a control task to the other half of the participants directly after encoding (i.e. during consolidation) and tested recognition 48h later. We found no difference in memory performance between the stress and control group. We found a graded pattern among confidence, with responders in the stress group having the least amount of confidence in their hits and controls having the most. Across groups, we found highly arousing negative images were better remembered than minimally arousing negative or neutral images. Although stress did not affect memory accuracy, responders, as defined by cortisol reactivity, were less confident in their decisions. Our results suggest that the daily stressors humans experience, regardless of their emotional affect, do not have adverse effects on memory. Copyright © 2017 Elsevier Inc. All rights reserved.

Comparing visual representations across human fMRI and computational vision

PubMed Central

Leeds, Daniel D.; Seibert, Darren A.; Pyles, John A.; Tarr, Michael J.

2013-01-01

Feedforward visual object perception recruits a cortical network that is assumed to be hierarchical, progressing from basic visual features to complete object representations. However, the nature of the intermediate features related to this transformation remains poorly understood. Here, we explore how well different computer vision recognition models account for neural object encoding across the human cortical visual pathway as measured using fMRI. These neural data, collected during the viewing of 60 images of real-world objects, were analyzed with a searchlight procedure as in Kriegeskorte, Goebel, and Bandettini (2006): Within each searchlight sphere, the obtained patterns of neural activity for all 60 objects were compared to model responses for each computer recognition algorithm using representational dissimilarity analysis (Kriegeskorte et al., 2008). Although each of the computer vision methods significantly accounted for some of the neural data, among the different models, the scale invariant feature transform (Lowe, 2004), encoding local visual properties gathered from “interest points,” was best able to accurately and consistently account for stimulus representations within the ventral pathway. More generally, when present, significance was observed in regions of the ventral-temporal cortex associated with intermediate-level object perception. Differences in model effectiveness and the neural location of significant matches may be attributable to the fact that each model implements a different featural basis for representing objects (e.g., more holistic or more parts-based). Overall, we conclude that well-known computer vision recognition systems may serve as viable proxies for theories of intermediate visual object representation. PMID:24273227

Structural requirements for recognition of the HLA-Dw14 class II epitope: A key HLA determinant associated with rheumatoid arthritis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hiraiwa, Akikazu; Yamanaka, Katsuo; Kwok, W.W.

Although HLA genes have been shown to be associated with certain diseases, the basis for this association is unknown. Recent studies, however, have documented patterns of nucleotide sequence variation among some HLA genes associated with a particular disease. For rheumatoid arthritis, HLA genes in most patients have a shared nucleotide sequence encoding a key structural element of an HLA class II polypeptide; this sequence element is critical for the interaction of the HLA molecule with antigenic peptides and with responding T cells, suggestive of a direct role for this sequence element in disease susceptibility. The authors describe the serological andmore » cellular immunologic characteristics encoded by this rheumatoid arthritis-associated sequence element. Site-directed mutagenesis of the DRB1 gene was used to define amino acids critical for antibody and T-cell recognition of this structural element, focusing on residues that distinguish the rheumatoid arthritis-associated alleles Dw4 and Dw14 from a closely related allele, Dw10, not associated with disease. Both the gain and loss of rheumatoid arthritis-associated epitopes were highly dependent on three residues within a discrete domain of the HLA-DR molecule. Recognition was most strongly influenced by the following amino acids (in order): 70 > 71 > 67. Some alloreactive T-cell clones were also influenced by amino acid variation in portions of the DR molecule lying outside the shared sequence element.« less

Restricted VH gene usage and generation of antibody diversity in rabbit.

PubMed

Knight, K L

1992-01-01

The presence of VHa allotypic specificities on nearly all rabbit Ig molecules has perplexed immunologists for many years. How could these allotypic specificities be inherited as if controlled by alleles if the germline has hundreds of VHa allotype-encoding genes and if most of these genes are used in VDJ gene rearrangements. I review recent data indicating that the allelic inheritance of the VHa allotypes can be explained by preferential utilization of the D-proximal VH gene VH1 in VDJ gene rearrangements. The preferential usage of one VH gene, however, limits the contribution of combinatorial joining of multiple VH, D and JH gene segments to the generation of antibody diversity. The roles of somatic gene conversion and somatic mutation in generating antibody diversity are discussed. Further, the limited usage of germline VH genes in normal, allotype-suppressed and the mutant Alicia rabbit as well as the molecular basis of latent allotypes and VH/CH recombinants is reviewed.

Sex, stem cells and tumors in the Drosophila ovary.

PubMed

Salz, Helen K

2013-01-01

The Drosophila Sex-lethal (Sxl) gene encodes a female-specific RNA binding protein that in somatic cells globally regulates all aspects of female-specific development and behavior. Sxl also has a critical, but less well understood, role in female germ cells. Germ cells without Sxl protein can adopt a stem cell fate when housed in a normal ovary, but fail to successfully execute the self-renewal differentiation fate switch. The failure to differentiate is accompanied by the inappropriate expression of a set of male specific markers, continued proliferation, and formation of a tumor. The findings in Chau et al., (2012) identify the germline stem cell maintenance factor nanos as one of its target genes, and suggest that Sxl enables the switch from germline stem cell to committed daughter cell by posttranscriptional downregulation of nanos expression. These studies provide the basis for a new model in which Sxl directly couples sexual identity with the self-renewal differentiation decision and raises several interesting questions about the genesis of the tumor phenotype.

Aubergine Controls Germline Stem Cell Self-Renewal and Progeny Differentiation via Distinct Mechanisms.

PubMed

Ma, Xing; Zhu, Xiujuan; Han, Yingying; Story, Benjamin; Do, Trieu; Song, Xiaoqing; Wang, Su; Zhang, Ying; Blanchette, Marco; Gogol, Madelaine; Hall, Kate; Peak, Allison; Anoja, Perera; Xie, Ting

2017-04-24

Piwi family protein Aubergine (Aub) maintains genome integrity in late germ cells of the Drosophila ovary through Piwi-associated RNA-mediated repression of transposon activities. Although it is highly expressed in germline stem cells (GSCs) and early progeny, it remains unclear whether it plays any roles in early GSC lineage development. Here we report that Aub promotes GSC self-renewal and GSC progeny differentiation. RNA-iCLIP results show that Aub binds the mRNAs encoding self-renewal and differentiation factors in cultured GSCs. Aub controls GSC self-renewal by preventing DNA-damage-induced Chk2 activation and by translationally controlling the expression of self-renewal factors. It promotes GSC progeny differentiation by translationally controlling the expression of differentiation factors, including Bam. Therefore, this study reveals a function of Aub in GSCs and their progeny, which promotes translation of self-renewal and differentiation factors by directly binding to its target mRNAs and interacting with translational initiation factors. Copyright © 2017 Elsevier Inc. All rights reserved.

Rare splicing defects of FAS underly severe recessive autoimmune lymphoproliferative syndrome.

PubMed

Agrebi, N; Ben-Mustapha, I; Matoussi, N; Dhouib, N; Ben-Ali, M; Mekki, N; Ben-Ahmed, M; Larguèche, B; Ben Becher, S; Béjaoui, M; Barbouche, M R

2017-10-01

Autoimmune lymphoproliferative syndrome (ALPS) is a prototypic disorder of impaired apoptosis characterized by autoimmune features and lymphoproliferation. Heterozygous germline or somatic FAS mutations associated with preserved protein expression have been described. Very rare cases of homozygous germline FAS mutations causing severe autosomal recessive form of ALPS with a complete defect of Fas expression have been reported. We report two unrelated patients from highly inbred North African population showing a severe ALPS phenotype and an undetectable Fas surface expression. Two novel homozygous mutations have been identified underlying rare splicing defects mechanisms. The first mutation breaks a branch point sequence and the second alters a regulatory exonic splicing site. These splicing defects induce the skipping of exon 6 encoding the transmembrane domain of CD95. Our findings highlight the requirement of tight regulation of FAS exon 6 splicing for balanced alternative splicing and illustrate the importance of such studies in highly consanguineous populations. Copyright © 2017 Elsevier Inc. All rights reserved.

The heparin-binding site in tetranectin is located in the N-terminal region and binding does not involve the carbohydrate recognition domain.

PubMed Central

Lorentsen, R H; Graversen, J H; Caterer, N R; Thogersen, H C; Etzerodt, M

2000-01-01

Tetranectin is a homotrimeric plasma and extracellular-matrix protein that binds plasminogen and complex sulphated polysaccharides including heparin. In terms of primary and tertiary structure, tetranectin is related to the collectin family of Ca(2+)-binding C-type lectins. Tetranectin is encoded in three exons. Exon 3 encodes the carbohydrate recognition domain, which binds to kringle 4 in plasminogen at low levels of Ca(2+). Exon 2 encodes an alpha-helix, which is necessary and sufficient to govern the trimerization of tetranectin by assembling into a triple-helical coiled-coil structural element. Here we show that the heparin-binding site in tetranectin resides not in the carbohydrate recognition domain but within the N-terminal region, comprising the 16 amino acid residues encoded by exon 1. In particular, the lysine residues in the decapeptide segment KPKKIVNAKK (tetranectin residues 6-15) are shown to be of primary importance in heparin binding. PMID:10727405

The heparin-binding site in tetranectin is located in the N-terminal region and binding does not involve the carbohydrate recognition domain.

PubMed

Lorentsen, R H; Graversen, J H; Caterer, N R; Thogersen, H C; Etzerodt, M

2000-04-01

Tetranectin is a homotrimeric plasma and extracellular-matrix protein that binds plasminogen and complex sulphated polysaccharides including heparin. In terms of primary and tertiary structure, tetranectin is related to the collectin family of Ca(2+)-binding C-type lectins. Tetranectin is encoded in three exons. Exon 3 encodes the carbohydrate recognition domain, which binds to kringle 4 in plasminogen at low levels of Ca(2+). Exon 2 encodes an alpha-helix, which is necessary and sufficient to govern the trimerization of tetranectin by assembling into a triple-helical coiled-coil structural element. Here we show that the heparin-binding site in tetranectin resides not in the carbohydrate recognition domain but within the N-terminal region, comprising the 16 amino acid residues encoded by exon 1. In particular, the lysine residues in the decapeptide segment KPKKIVNAKK (tetranectin residues 6-15) are shown to be of primary importance in heparin binding.

The effects of divided attention at study and test on false recognition: a comparison of DRM and categorized lists.

PubMed

Knott, Lauren M; Dewhurst, Stephen A

2007-12-01

Three experiments investigated the effects of divided attention at encoding and retrieval on false recognition. In Experiment 1, participants studied word lists in either full or divided attention (random number generation) conditions and then took part in a recognition test with full attention. In Experiment 2, after studying word lists with full attention, participants carried out a recognition test with either full or divided attention. Experiment 3 manipulated attention at both study and test. We also compared Deese/Roediger-McDermott (DRM) and categorized lists, due to recent claims regarding the locus of false memories produced by such lists (Smith, Gerkens, Pierce, & Choi, 2002). With both list types, false "remember" responses were reduced by divided attention at encoding and increased by divided attention at retrieval. The findings suggest that the production of false memories occurs as a result of the generation of associates at encoding and failures of source monitoring retrieval. Crucially, this is true for both DRM and categorized lists.

Examining the causes of memory strength variability: recollection, attention failure, or encoding variability?

PubMed

Koen, Joshua D; Aly, Mariam; Wang, Wei-Chun; Yonelinas, Andrew P

2013-11-01

A prominent finding in recognition memory is that studied items are associated with more variability in memory strength than new items. Here, we test 3 competing theories for why this occurs-the encoding variability, attention failure, and recollection accounts. Distinguishing among these theories is critical because each provides a fundamentally different account of the processes underlying recognition memory. The encoding variability and attention failure accounts propose that old item variance will be unaffected by retrieval manipulations because the processes producing this effect are ascribed to encoding. The recollection account predicts that both encoding and retrieval manipulations that preferentially affect recollection will affect memory variability. These contrasting predictions were tested by examining the effect of response speeding (Experiment 1), dividing attention at retrieval (Experiment 2), context reinstatement (Experiment 3), and increased test delay (Experiment 4) on recognition performance. The results of all 4 experiments confirm the predictions of the recollection account and are inconsistent with the encoding variability account. The evidence supporting the attention failure account is mixed, with 2 of the 4 experiments confirming the account and 2 disconfirming the account. These results indicate that encoding variability and attention failure are insufficient accounts of memory variance and provide support for the recollection account. Several alternative theoretical accounts of the results are also considered. PsycINFO Database Record (c) 2013 APA, all rights reserved.

Analyses of chicken immunoglobulin light chain cDNA clones indicate a few germline V lambda genes and allotypes of the C lambda locus.

PubMed

Parvari, R; Ziv, E; Lentner, F; Tel-Or, S; Burstein, Y; Schechter, I

1987-01-01

cDNA libraries of chicken spleen and Harder gland (a gland enriched with immunocytes) constructed in pBR322 were screened by differential hybridization and by mRNA hybrid-selected translation. Eleven L-chain cDNA clones were identified from which VL probes were prepared and each was annealed with kidney DNA restriction digests. All VL probes revealed the same set of bands, corresponding to about 15 germline VL genes of one subgroup. The nucleotide sequences of six VL clones showed greater than or equal to 85% homology, and the predicted amino acid sequences were identical or nearly identical to the major N-terminal sequence of L-chains in chicken serum. These findings, and the fact that the VL clones were randomly selected from normal lymphoid tissues, strongly indicate that the bulk of chicken L-chains is encoded by a few germline VL genes, probably much less than 15 since many of the VL genes are known to be pseudogenes. Therefore, it is likely that somatic mechanisms operating prior to specific triggering by antigen play a major role in the generation of antibody diversity in chicken. Analysis of the constant region locus (sequencing of CL gene and cDNAs) demonstrate a single CL isotype and suggest the presence of CL allotypes.

Inversion and contrast polarity reversal affect both encoding and recognition processes of unfamiliar faces: a repetition study using ERPs.

PubMed

Itier, Roxane J; Taylor, Margot J

2002-02-01

Using ERPs in a face recognition task, we investigated whether inversion and contrast reversal, which seem to disrupt different aspects of face configuration, differentially affected encoding and memory for faces. Upright, inverted, and negative (contrast-reversed) unknown faces were either immediately repeated (0-lag) or repeated after 1 intervening face (1-lag). The encoding condition (new) consisted of the first presentation of items correctly recognized in the two repeated conditions. 0-lag faces were recognized better and faster than 1-lag faces. Inverted and negative pictures elicited longer reaction times, lower hit rates, and higher false alarm rates than upright faces. ERP analyses revealed that negative and inverted faces affected both early (encoding) and late (recognition) stages of face processing. Early components (N170, VPP) were delayed and enhanced by both inversion and contrast reversal which also affected P1 and P2 components. Amplitudes were higher for inverted faces at frontal and parietal sites from 350 to 600 ms. Priming effects were seen at encoding stages, revealed by shorter latencies and smaller amplitudes of N170 for repeated stimuli, which did not differ depending on face type. Repeated faces yielded more positive amplitudes than new faces from 250 to 450 ms frontally and from 400 to 600 ms parietally. However, ERP differences revealed that the magnitude of this repetition effect was smaller for negative and inverted than upright faces at 0-lag but not at 1-lag condition. Thus, face encoding and recognition processes were affected by inversion and contrast-reversal differently.

The genetics of phaeochromocytoma: using clinical features to guide genetic testing.

PubMed

Jafri, Mariam; Maher, Eamonn R

2012-02-01

Phaeochromocytoma is a rare, usually benign, tumour predominantly managed by endocrinologists. Over the last decade, major advances have been made in understanding the molecular genetic basis of adrenal and extra-adrenal phaeochromocytoma (also referred to as adrenal phaeochromocytoma (aPCA) and extra-adrenal functional paraganglioma (eFPGL)). In contrast to the previously held belief that only 10% of cases had a genetic component, currently about one-third of all aPCA/eFPGL cases are thought to be attributable to germline mutations in at least nine genes (NF1, RET, SDHA, SDHB, SDHC, SDHD, TMEM127, MAX and VHL). Recognition of inherited cases of aPCA/eFPGL is critical for optimal patient management. Thus, the identification of a germline mutation can predict risks of malignancy, recurrent disease, associated non-chromaffin tumours and risks to other family members. Mutation carriers should be offered specific surveillance programmes (according to the relevant gene). In this review, we will describe the genetics of aPCA/eFPGL and strategies for genetic testing.

Mutant glucocerebrosidase in Gaucher disease recruits Hsp27 to the Hsp90 chaperone complex for proteasomal degradation

PubMed Central

Yang, Chunzhang; Wang, Herui; Zhu, Dongwang; Hong, Christopher S.; Dmitriev, Pauline; Zhang, Chao; Li, Yan; Ikejiri, Barbara; Brady, Roscoe O.; Zhuang, Zhengping

2015-01-01

Gaucher disease is caused by mutations of the GBA1 gene, which encodes the lysosomal anchored gluococerebrosidase (GCase). GBA1 mutations commonly result in protein misfolding, abnormal chaperone recognition, and premature degradation, but are less likely to affect catalytic activity. In the present study, we demonstrate that the Hsp90/HOP/Cdc37 complex recruits Hsp27 after recognition of GCase mutants with subsequent targeting of GCase mutant peptides to degradation mechanisms such as VCP and the 26S proteasome. Inhibition of Hsp27 not only increased the quantity of enzyme but also enhanced GCase activity in fibroblasts derived from patients with Gaucher disease. These findings provide insight into a possible therapeutic strategy for protein misfolding diseases by correcting chaperone binding and altering subsequent downstream patterns of protein degradation. PMID:25583479

Mutant glucocerebrosidase in Gaucher disease recruits Hsp27 to the Hsp90 chaperone complex for proteasomal degradation.

PubMed

Yang, Chunzhang; Wang, Herui; Zhu, Dongwang; Hong, Christopher S; Dmitriev, Pauline; Zhang, Chao; Li, Yan; Ikejiri, Barbara; Brady, Roscoe O; Zhuang, Zhengping

2015-01-27

Gaucher disease is caused by mutations of the GBA1 gene, which encodes the lysosomal anchored gluococerebrosidase (GCase). GBA1 mutations commonly result in protein misfolding, abnormal chaperone recognition, and premature degradation, but are less likely to affect catalytic activity. In the present study, we demonstrate that the Hsp90/HOP/Cdc37 complex recruits Hsp27 after recognition of GCase mutants with subsequent targeting of GCase mutant peptides to degradation mechanisms such as VCP and the 26S proteasome. Inhibition of Hsp27 not only increased the quantity of enzyme but also enhanced GCase activity in fibroblasts derived from patients with Gaucher disease. These findings provide insight into a possible therapeutic strategy for protein misfolding diseases by correcting chaperone binding and altering subsequent downstream patterns of protein degradation.

Levels-of-processing effect on internal source monitoring in schizophrenia

PubMed Central

RAGLAND, J. DANIEL; McCARTHY, ERIN; BILKER, WARREN B.; RENSINGER, COLLEEN M. B; VALDEZ, JEFFREY; KOHLER, CHRISTIAN; GUR, RAQUEL E.; GUR, RUBEN C.

2015-01-01

Background Recognition can be normalized in schizophrenia by providing patients with semantic organizational strategies through a levels-of-processing (LOP) framework. However, patients may rely primarily on familiarity effects, making recognition less sensitive than source monitoring to the strength of the episodic memory trace. The current study investigates whether providing semantic organizational strategies can also normalize patients’ internal source-monitoring performance. Method Sixteen clinically stable medicated patients with schizophrenia and 15 demographically matched healthy controls were asked to identify the source of remembered words following an LOP-encoding paradigm in which they alternated between processing words on a ‘shallow’ perceptual versus a ‘deep’ semantic level. A multinomial analysis provided orthogonal measures of item recognition and source discrimination, and bootstrapping generated variance to allow for parametric analyses. LOP and group effects were tested by contrasting recognition and source-monitoring parameters for words that had been encoded during deep versus shallow processing conditions. Results As in a previous study there were no group differences in LOP effects on recognition performance, with patients and controls benefiting equally from deep versus shallow processing. Although there were no group differences in internal source monitoring, only controls had significantly better performance for words processed during the deep encoding condition. Patient performance did not correlate with clinical symptoms or medication dose. Conclusions Providing a deep processing semantic encoding strategy significantly improved patients’ recognition performance only. The lack of a significant LOP effect on internal source monitoring in patients may reffect subtle problems in the relational binding of semantic information that are independent of strategic memory processes. PMID:16608558

Levels-of-processing effect on internal source monitoring in schizophrenia.

PubMed

Ragland, J Daniel; McCarthy, Erin; Bilker, Warren B; Brensinger, Colleen M; Valdez, Jeffrey; Kohler, Christian; Gur, Raquel E; Gur, Ruben C

2006-05-01

Recognition can be normalized in schizophrenia by providing patients with semantic organizational strategies through a levels-of-processing (LOP) framework. However, patients may rely primarily on familiarity effects, making recognition less sensitive than source monitoring to the strength of the episodic memory trace. The current study investigates whether providing semantic organizational strategies can also normalize patients' internal source-monitoring performance. Sixteen clinically stable medicated patients with schizophrenia and 15 demographically matched healthy controls were asked to identify the source of remembered words following an LOP-encoding paradigm in which they alternated between processing words on a 'shallow' perceptual versus a 'deep' semantic level. A multinomial analysis provided orthogonal measures of item recognition and source discrimination, and bootstrapping generated variance to allow for parametric analyses. LOP and group effects were tested by contrasting recognition and source-monitoring parameters for words that had been encoded during deep versus shallow processing conditions. As in a previous study there were no group differences in LOP effects on recognition performance, with patients and controls benefiting equally from deep versus shallow processing. Although there were no group differences in internal source monitoring, only controls had significantly better performance for words processed during the deep encoding condition. Patient performance did not correlate with clinical symptoms or medication dose. Providing a deep processing semantic encoding strategy significantly improved patients' recognition performance only. The lack of a significant LOP effect on internal source monitoring in patients may reflect subtle problems in the relational binding of semantic information that are independent of strategic memory processes.

Sex influence on face recognition memory moderated by presentation duration and reencoding.

PubMed

Weirich, Sebastian; Hoffmann, Ferdinand; Meissner, Lucia; Heinz, Andreas; Bengner, Thomas

2011-11-01

It has been suggested that women have a better face recognition memory than men. Here we analyzed whether this advantage depends on a better encoding or consolidation of information and if the advantage is visible during short-term memory (STM), only, or whether it also remains evident in long-term memory (LTM). We tested short- and long-term face recognition memory in 36 nonclinical participants (19 women). We varied the duration of item presentation (1, 5, and 10 s), the time of testing (immediately after the study phase, 1 hr, and 24 hr later), and the possibility to reencode items (none, immediately after the study phase, after 1 hr). Women showed better overall face recognition memory than men (ηp² = .15, p < .05). We found this advantage, however, only with a longer duration of item presentation (interaction effect Sex × ηp² = .16, p < .05). Women's advantage in face recognition was visible mainly if participants had the possibility to reencode faces during former test trials. Our results suggest women do not have a better face recognition memory than men per se, but may profit more than men from longer durations of presentation during encoding or the possibility for reencoding. Future research on sex differences in face recognition memory should explicate possible causes for the better encoding of face information in women.

Effects of emotion and reward motivation on neural correlates of episodic memory encoding: a PET study.

PubMed

Shigemune, Yayoi; Abe, Nobuhito; Suzuki, Maki; Ueno, Aya; Mori, Etsuro; Tashiro, Manabu; Itoh, Masatoshi; Fujii, Toshikatsu

2010-05-01

It is known that emotion and reward motivation promote long-term memory formation. It remains unclear, however, how and where emotion and reward are integrated during episodic memory encoding. In the present study, subjects were engaged in intentional encoding of photographs under four different conditions that were made by combining two factors (emotional valence, negative or neutral; and monetary reward value, high or low for subsequent successful recognition) during H2 15O positron emission tomography (PET) scanning. As for recognition performance, we found significant main effects of emotional valence (negative>neutral) and reward value (high value>low value), without an interaction between the two factors. Imaging data showed that the left amygdala was activated during the encoding conditions of negative pictures relative to neutral pictures, and the left orbitofrontal cortex was activated during the encoding conditions of high reward pictures relative to low reward pictures. In addition, conjunction analysis of these two main effects detected right hippocampal activation. Although we could not find correlations between recognition performance and activity of these three regions, we speculate that the right hippocampus may integrate the effects of emotion (processed in the amygdala) and monetary reward (processed in the orbitofrontal cortex) on episodic memory encoding. 2010 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.

Is having similar eye movement patterns during face learning and recognition beneficial for recognition performance? Evidence from hidden Markov modeling.

PubMed

Chuk, Tim; Chan, Antoni B; Hsiao, Janet H

2017-12-01

The hidden Markov model (HMM)-based approach for eye movement analysis is able to reflect individual differences in both spatial and temporal aspects of eye movements. Here we used this approach to understand the relationship between eye movements during face learning and recognition, and its association with recognition performance. We discovered holistic (i.e., mainly looking at the face center) and analytic (i.e., specifically looking at the two eyes in addition to the face center) patterns during both learning and recognition. Although for both learning and recognition, participants who adopted analytic patterns had better recognition performance than those with holistic patterns, a significant positive correlation between the likelihood of participants' patterns being classified as analytic and their recognition performance was only observed during recognition. Significantly more participants adopted holistic patterns during learning than recognition. Interestingly, about 40% of the participants used different patterns between learning and recognition, and among them 90% switched their patterns from holistic at learning to analytic at recognition. In contrast to the scan path theory, which posits that eye movements during learning have to be recapitulated during recognition for the recognition to be successful, participants who used the same or different patterns during learning and recognition did not differ in recognition performance. The similarity between their learning and recognition eye movement patterns also did not correlate with their recognition performance. These findings suggested that perceptuomotor memory elicited by eye movement patterns during learning does not play an important role in recognition. In contrast, the retrieval of diagnostic information for recognition, such as the eyes for face recognition, is a better predictor for recognition performance. Copyright © 2017 Elsevier Ltd. All rights reserved.

Rehabilitation of face-processing skills in an adolescent with prosopagnosia: Evaluation of an online perceptual training programme.

PubMed

Bate, Sarah; Bennetts, Rachel; Mole, Joseph A; Ainge, James A; Gregory, Nicola J; Bobak, Anna K; Bussunt, Amanda

2015-01-01

In this paper we describe the case of EM, a female adolescent who acquired prosopagnosia following encephalitis at the age of eight. Initial neuropsychological and eye-movement investigations indicated that EM had profound difficulties in face perception as well as face recognition. EM underwent 14 weeks of perceptual training in an online programme that attempted to improve her ability to make fine-grained discriminations between faces. Following training, EM's face perception skills had improved, and the effect generalised to untrained faces. Eye-movement analyses also indicated that EM spent more time viewing the inner facial features post-training. Examination of EM's face recognition skills revealed an improvement in her recognition of personally-known faces when presented in a laboratory-based test, although the same gains were not noted in her everyday experiences with these faces. In addition, EM did not improve on a test assessing the recognition of newly encoded faces. One month after training, EM had maintained the improvement on the eye-tracking test, and to a lesser extent, her performance on the familiar faces test. This pattern of findings is interpreted as promising evidence that the programme can improve face perception skills, and with some adjustments, may at least partially improve face recognition skills.

Iris Matching Based on Personalized Weight Map.

PubMed

Dong, Wenbo; Sun, Zhenan; Tan, Tieniu

2011-09-01

Iris recognition typically involves three steps, namely, iris image preprocessing, feature extraction, and feature matching. The first two steps of iris recognition have been well studied, but the last step is less addressed. Each human iris has its unique visual pattern and local image features also vary from region to region, which leads to significant differences in robustness and distinctiveness among the feature codes derived from different iris regions. However, most state-of-the-art iris recognition methods use a uniform matching strategy, where features extracted from different regions of the same person or the same region for different individuals are considered to be equally important. This paper proposes a personalized iris matching strategy using a class-specific weight map learned from the training images of the same iris class. The weight map can be updated online during the iris recognition procedure when the successfully recognized iris images are regarded as the new training data. The weight map reflects the robustness of an encoding algorithm on different iris regions by assigning an appropriate weight to each feature code for iris matching. Such a weight map trained by sufficient iris templates is convergent and robust against various noise. Extensive and comprehensive experiments demonstrate that the proposed personalized iris matching strategy achieves much better iris recognition performance than uniform strategies, especially for poor quality iris images.

Permutation coding technique for image recognition systems.

PubMed

Kussul, Ernst M; Baidyk, Tatiana N; Wunsch, Donald C; Makeyev, Oleksandr; Martín, Anabel

2006-11-01

A feature extractor and neural classifier for image recognition systems are proposed. The proposed feature extractor is based on the concept of random local descriptors (RLDs). It is followed by the encoder that is based on the permutation coding technique that allows to take into account not only detected features but also the position of each feature on the image and to make the recognition process invariant to small displacements. The combination of RLDs and permutation coding permits us to obtain a sufficiently general description of the image to be recognized. The code generated by the encoder is used as an input data for the neural classifier. Different types of images were used to test the proposed image recognition system. It was tested in the handwritten digit recognition problem, the face recognition problem, and the microobject shape recognition problem. The results of testing are very promising. The error rate for the Modified National Institute of Standards and Technology (MNIST) database is 0.44% and for the Olivetti Research Laboratory (ORL) database it is 0.1%.

Incidental Memory Encoding Assessed with Signal Detection Theory and Functional Magnetic Resonance Imaging (fMRI).

PubMed

Clemens, Benjamin; Regenbogen, Christina; Koch, Kathrin; Backes, Volker; Romanczuk-Seiferth, Nina; Pauly, Katharina; Shah, N Jon; Schneider, Frank; Habel, Ute; Kellermann, Thilo

2015-01-01

In functional magnetic resonance imaging (fMRI) studies that apply a "subsequent memory" approach, successful encoding is indicated by increased fMRI activity during the encoding phase for hits vs. misses, in areas underlying memory encoding such as the hippocampal formation. Signal-detection theory (SDT) can be used to analyze memory-related fMRI activity as a function of the participant's memory trace strength (d(')). The goal of the present study was to use SDT to examine the relationship between fMRI activity during incidental encoding and participants' recognition performance. To implement a new approach, post-experimental group assignment into High- or Low Performers (HP or LP) was based on 29 healthy participants' recognition performance, assessed with SDT. The analyses focused on the interaction between the factors group (HP vs. LP) and recognition performance (hits vs. misses). A whole-brain analysis revealed increased activation for HP vs. LP during incidental encoding for remembered vs. forgotten items (hits > misses) in the insula/temporo-parietal junction (TPJ) and the fusiform gyrus (FFG). Parameter estimates in these regions exhibited a significant positive correlation with d('). As these brain regions are highly relevant for salience detection (insula), stimulus-driven attention (TPJ), and content-specific processing of mnemonic stimuli (FFG), we suggest that HPs' elevated memory performance was associated with enhanced attentional and content-specific sensory processing during the encoding phase. We provide first correlative evidence that encoding-related activity in content-specific sensory areas and content-independent attention and salience detection areas influences memory performance in a task with incidental encoding of facial stimuli. Based on our findings, we discuss whether the aforementioned group differences in brain activity during incidental encoding might constitute the basis of general differences in memory performance between HP and LP.

Transcriptomic analysis reveals tomato genes whose expression is induced specifically during effector-triggered immunity and identifies the Epk1 protein kinase which is required for the host response to three bacterial effector proteins.

PubMed

Pombo, Marina A; Zheng, Yi; Fernandez-Pozo, Noe; Dunham, Diane M; Fei, Zhangjun; Martin, Gregory B

2014-01-01

Plants have two related immune systems to defend themselves against pathogen attack. Initially,pattern-triggered immunity is activated upon recognition of microbe-associated molecular patterns by pattern recognition receptors. Pathogenic bacteria deliver effector proteins into the plant cell that interfere with this immune response and promote disease. However, some plants express resistance proteins that detect the presence of specific effectors leading to a robust defense response referred to as effector-triggered immunity. The interaction of tomato with Pseudomonas syringae pv. tomato is an established model system for understanding the molecular basis of these plant immune responses. We apply high-throughput RNA sequencing to this pathosystem to identify genes whose expression changes specifically during pattern-triggered or effector-triggered immunity. We then develop reporter genes for each of these responses that will enable characterization of the host response to the large collection of P. s. pv. tomato strains that express different combinations of effectors. Virus-induced gene silencing of 30 of the effector-triggered immunity-specific genes identifies Epk1 which encodes a predicted protein kinase from a family previously unknown to be involved in immunity. Knocked-down expression of Epk1 compromises effector-triggered immunity triggered by three bacterial effectors but not by effectors from non-bacterial pathogens. Epistasis experiments indicate that Epk1 acts upstream of effector-triggered immunity-associated MAP kinase signaling. Using RNA-seq technology we identify genes involved in specific immune responses. A functional genomics screen led to the discovery of Epk1, a novel predicted protein kinase required for plant defense activation upon recognition of three different bacterial effectors.

An orphan G-protein-coupled receptor causes human gigantism and/or acromegaly: Molecular biology and clinical correlations.

PubMed

Trivellin, Giampaolo; Hernández-Ramírez, Laura C; Swan, Jeremy; Stratakis, Constantine A

2018-04-01

X-linked acrogigantism (X-LAG) is a recently described form of familial or sporadic pituitary gigantism characterized by very early onset GH and IGF-1 excess, accelerated growth velocity, gigantism and/or acromegaloid features. Germline or somatic microduplications of the Xq26.3 chromosomal region, invariably involving the GPR101 gene, constitute the genetic defect leading to X-LAG. GPR101 encodes a class A G protein-coupled receptor that activates the 3',5'-cyclic adenosine monophosphate signaling pathway. Highly expressed in the central nervous system, the main physiological function and ligand of GPR101 remain unknown, but it seems to play a role in the normal development of the GHRH-GH axis. Early recognition of X-LAG cases is imperative because these patients require clinical management that differs from that of other patients with acromegaly or gigantism. Medical treatment with pegvisomant seems to be the best approach, since X-LAG tumors are resistant to the treatment with somatostatin analogues and dopamine agonists; surgical cure requires near-total hypophysectomy. Currently, the efforts of our research focus on the identification of GPR101 ligands; in addition, the long-term follow-up of X-LAG patients is of extreme interest as this is expected to lead to better understanding of GPR101 effects on human pathophysiology. Copyright © 2018. Published by Elsevier Ltd.

Mandarin Chinese Tone Identification in Cochlear Implants: Predictions from Acoustic Models

PubMed Central

Morton, Kenneth D.; Torrione, Peter A.; Throckmorton, Chandra S.; Collins, Leslie M.

2015-01-01

It has been established that current cochlear implants do not supply adequate spectral information for perception of tonal languages. Comprehension of a tonal language, such as Mandarin Chinese, requires recognition of lexical tones. New strategies of cochlear stimulation such as variable stimulation rate and current steering may provide the means of delivering more spectral information and thus may provide the auditory fine structure required for tone recognition. Several cochlear implant signal processing strategies are examined in this study, the continuous interleaved sampling (CIS) algorithm, the frequency amplitude modulation encoding (FAME) algorithm, and the multiple carrier frequency algorithm (MCFA). These strategies provide different types and amounts of spectral information. Pattern recognition techniques can be applied to data from Mandarin Chinese tone recognition tasks using acoustic models as a means of testing the abilities of these algorithms to transmit the changes in fundamental frequency indicative of the four lexical tones. The ability of processed Mandarin Chinese tones to be correctly classified may predict trends in the effectiveness of different signal processing algorithms in cochlear implants. The proposed techniques can predict trends in performance of the signal processing techniques in quiet conditions but fail to do so in noise. PMID:18706497

That's a good one! Belief in efficacy of mnemonic strategies contributes to age-related increase in associative memory.

PubMed

Daugherty, Ana M; Ofen, Noa

2015-08-01

The development of associative memory during childhood may be influenced by metacognitive factors. Here, one aspect of metamemory function--belief in strategy efficacy-was tested for a role in the effective use of encoding strategies. A sample of 61 children and adults (8-25 years of age) completed an associative recognition memory test and were assessed on belief in the efficacy of encoding strategies. Independent of age, belief ratings identified two factors: "deep" and "shallow" encoding strategies. Although the strategy factor structure was stable across age, adolescents and adults were more likely to prefer using a deep encoding strategy, whereas children were equally likely to prefer a shallow strategy. Belief ratings of deep encoding strategies increased with age and, critically, accounted for better associative recognition. Copyright © 2015 Elsevier Inc. All rights reserved.

A Prosthetic Hand Body Area Controller Based on Efficient Pattern Recognition Control Strategies.

PubMed

Benatti, Simone; Milosevic, Bojan; Farella, Elisabetta; Gruppioni, Emanuele; Benini, Luca

2017-04-15

Poliarticulated prosthetic hands represent a powerful tool to restore functionality and improve quality of life for upper limb amputees. Such devices offer, on the same wearable node, sensing and actuation capabilities, which are not equally supported by natural interaction and control strategies. The control in state-of-the-art solutions is still performed mainly through complex encoding of gestures in bursts of contractions of the residual forearm muscles, resulting in a non-intuitive Human-Machine Interface (HMI). Recent research efforts explore the use of myoelectric gesture recognition for innovative interaction solutions, however there persists a considerable gap between research evaluation and implementation into successful complete systems. In this paper, we present the design of a wearable prosthetic hand controller, based on intuitive gesture recognition and a custom control strategy. The wearable node directly actuates a poliarticulated hand and wirelessly interacts with a personal gateway (i.e., a smartphone) for the training and personalization of the recognition algorithm. Through the whole system development, we address the challenge of integrating an efficient embedded gesture classifier with a control strategy tailored for an intuitive interaction between the user and the prosthesis. We demonstrate that this combined approach outperforms systems based on mere pattern recognition, since they target the accuracy of a classification algorithm rather than the control of a gesture. The system was fully implemented, tested on healthy and amputee subjects and compared against benchmark repositories. The proposed approach achieves an error rate of 1.6% in the end-to-end real time control of commonly used hand gestures, while complying with the power and performance budget of a low-cost microcontroller.

A Prosthetic Hand Body Area Controller Based on Efficient Pattern Recognition Control Strategies

PubMed Central

Benatti, Simone; Milosevic, Bojan; Farella, Elisabetta; Gruppioni, Emanuele; Benini, Luca

2017-01-01

Poliarticulated prosthetic hands represent a powerful tool to restore functionality and improve quality of life for upper limb amputees. Such devices offer, on the same wearable node, sensing and actuation capabilities, which are not equally supported by natural interaction and control strategies. The control in state-of-the-art solutions is still performed mainly through complex encoding of gestures in bursts of contractions of the residual forearm muscles, resulting in a non-intuitive Human-Machine Interface (HMI). Recent research efforts explore the use of myoelectric gesture recognition for innovative interaction solutions, however there persists a considerable gap between research evaluation and implementation into successful complete systems. In this paper, we present the design of a wearable prosthetic hand controller, based on intuitive gesture recognition and a custom control strategy. The wearable node directly actuates a poliarticulated hand and wirelessly interacts with a personal gateway (i.e., a smartphone) for the training and personalization of the recognition algorithm. Through the whole system development, we address the challenge of integrating an efficient embedded gesture classifier with a control strategy tailored for an intuitive interaction between the user and the prosthesis. We demonstrate that this combined approach outperforms systems based on mere pattern recognition, since they target the accuracy of a classification algorithm rather than the control of a gesture. The system was fully implemented, tested on healthy and amputee subjects and compared against benchmark repositories. The proposed approach achieves an error rate of 1.6% in the end-to-end real time control of commonly used hand gestures, while complying with the power and performance budget of a low-cost microcontroller. PMID:28420135

Involvement of hippocampal NMDA receptors in encoding and consolidation, but not retrieval, processes of spontaneous object location memory in rats.

PubMed

Yamada, Kazuo; Arai, Misaki; Suenaga, Toshiko; Ichitani, Yukio

2017-07-28

The hippocampus is thought to be involved in object location recognition memory, yet the contribution of hippocampal NMDA receptors to the memory processes, such as encoding, retention and retrieval, is unknown. First, we confirmed that hippocampal infusion of a competitive NMDA receptor antagonist, AP5 (2-amino-5-phosphonopentanoic acid, 20-40nmol), impaired performance of spontaneous object location recognition test but not that of novel object recognition test in Wistar rats. Next, the effects of hippocampal AP5 treatment on each process of object location recognition memory were examined with three different injection times using a 120min delay-interposed test: 15min before the sample phase (Time I), immediately after the sample phase (Time II), and 15min before the test phase (Time III). The blockade of hippocampal NMDA receptors before and immediately after the sample phase, but not before the test phase, markedly impaired performance of object location recognition test, suggesting that hippocampal NMDA receptors play an important role in encoding and consolidation/retention, but not retrieval, of spontaneous object location memory. Copyright © 2017 Elsevier B.V. All rights reserved.

Precise-spike-driven synaptic plasticity: learning hetero-association of spatiotemporal spike patterns.

PubMed

Yu, Qiang; Tang, Huajin; Tan, Kay Chen; Li, Haizhou

2013-01-01

A new learning rule (Precise-Spike-Driven (PSD) Synaptic Plasticity) is proposed for processing and memorizing spatiotemporal patterns. PSD is a supervised learning rule that is analytically derived from the traditional Widrow-Hoff rule and can be used to train neurons to associate an input spatiotemporal spike pattern with a desired spike train. Synaptic adaptation is driven by the error between the desired and the actual output spikes, with positive errors causing long-term potentiation and negative errors causing long-term depression. The amount of modification is proportional to an eligibility trace that is triggered by afferent spikes. The PSD rule is both computationally efficient and biologically plausible. The properties of this learning rule are investigated extensively through experimental simulations, including its learning performance, its generality to different neuron models, its robustness against noisy conditions, its memory capacity, and the effects of its learning parameters. Experimental results show that the PSD rule is capable of spatiotemporal pattern classification, and can even outperform a well studied benchmark algorithm with the proposed relative confidence criterion. The PSD rule is further validated on a practical example of an optical character recognition problem. The results again show that it can achieve a good recognition performance with a proper encoding. Finally, a detailed discussion is provided about the PSD rule and several related algorithms including tempotron, SPAN, Chronotron and ReSuMe.

Precise-Spike-Driven Synaptic Plasticity: Learning Hetero-Association of Spatiotemporal Spike Patterns

PubMed Central

Yu, Qiang; Tang, Huajin; Tan, Kay Chen; Li, Haizhou

2013-01-01

A new learning rule (Precise-Spike-Driven (PSD) Synaptic Plasticity) is proposed for processing and memorizing spatiotemporal patterns. PSD is a supervised learning rule that is analytically derived from the traditional Widrow-Hoff rule and can be used to train neurons to associate an input spatiotemporal spike pattern with a desired spike train. Synaptic adaptation is driven by the error between the desired and the actual output spikes, with positive errors causing long-term potentiation and negative errors causing long-term depression. The amount of modification is proportional to an eligibility trace that is triggered by afferent spikes. The PSD rule is both computationally efficient and biologically plausible. The properties of this learning rule are investigated extensively through experimental simulations, including its learning performance, its generality to different neuron models, its robustness against noisy conditions, its memory capacity, and the effects of its learning parameters. Experimental results show that the PSD rule is capable of spatiotemporal pattern classification, and can even outperform a well studied benchmark algorithm with the proposed relative confidence criterion. The PSD rule is further validated on a practical example of an optical character recognition problem. The results again show that it can achieve a good recognition performance with a proper encoding. Finally, a detailed discussion is provided about the PSD rule and several related algorithms including tempotron, SPAN, Chronotron and ReSuMe. PMID:24223789

Evaluation of germline sequence variants of GFRA1, GFRA2, and GFRA3 genes in a cohort of Spanish patients with sporadic medullary thyroid cancer.

PubMed

Borrego, Salud; Fernández, Raquel M; Dziema, Heather; Japón, Miguel A; Marcos, Irene; Eng, Charis; Antiñolo, Guillermo

2002-11-01

The etiology of sporadic medullary thyroid carcinoma (sMTC) remains elusive. While germline gain-of-function mutations in the RET proto-oncogene cause hereditary MTC, somatic RET mutations have been described in a variable number of sMTC. So far, S836S of RET, is the only variant whose association with sMTC has been found in several European cohorts. Because RET variants seem to be associated with MTC, it is plausible that variants in genes encoding for RET coreceptors may play a role in the pathogenesis of sMTC. Recently, we described two possible low penetrance susceptibility alleles in the gene encoding RET coreceptor GFRalpha1, -193C > G and 537T > C, in a German series of sMTC. In this study, we have genotyped nine polymorphisms within GFRA1-3 genes for 51 Spanish sMTC, and 100 normal controls. Our results show that no statistical signification was found when Spanish sMTC patients were compared to controls. Taken together with the observations in the German sMTC series, the present findings suggest that GFRA1-193C > G and 537T > C could be in linkage disequilibrium with other loci responsible for the disease with a founder effect in Germany. Alternatively, the combined observations might also suggest that, if indeed the polymorphisms are functional, the effect is small.

Covalent Binding Antibodies Suppress Advanced Glycation: On the Innate Tier of Adaptive Immunity

PubMed Central

Shcheglova, T.; Makker, S. P.

2009-01-01

Non-enzymatic protein glycation is a source of metabolic stress that contributes to cytotoxicity and tissue damage. Hyperglycemia has been linked to elevation of advanced glycation endproducts, which mediate much of the vascular pathology leading to diabetic complications. Enhanced glycation of immunoglobulins and their accelerated vascular clearance is proposed as a natural mechanism to intercept alternative advanced glycation endproducts, thereby mitigating microvascular disease. We reported that antibodies against the glycoprotein KLH have elevated reactivity for glycopeptides from diabetic serum. These reactions are mediated by covalent binding between antibody light chains and carbonyl groups of glycated peptides. Diabetic animals that were immunized to induce reactive antibodies had attenuated diabetic nephropathy, which correlated with reduced levels of circulating and kidney-bound glycation products. Molecular analysis of antibody glycation revealed the preferential modification of light chains bearing germline-encoded lambda V regions. We previously noted that antibody fragments carrying V regions in the germline configuration are selected from a human Fv library by covalent binding to a reactive organophosphorus ester. These Fv fragments were specifically modified at light chain V region residues, which map to the combining site at the interface between light and heavy chains. These findings suggest that covalent binding is an innate property of antibodies, which may be encoded in the genome for specific physiological purposes. This hypothesis is discussed in context with current knowledge of the natural antibodies that recognize altered self molecules and the catalytic autoantibodies found in autoimmune disease. PMID:22649604

Levels-of-Processing Effect on Frontotemporal Function in Schizophrenia During Word Encoding and Recognition

PubMed Central

Ragland, J. Daniel; Gur, Ruben C.; Valdez, Jeffrey N.; Loughead, James; Elliott, Mark; Kohler, Christian; Kanes, Stephen; Siegel, Steven J.; Moelter, Stephen T.; Gur, Raquel E.

2015-01-01

Objective Patients with schizophrenia improve episodic memory accuracy when given organizational strategies through levels-of-processing paradigms. This study tested if improvement is accompanied by normalized frontotemporal function. Method Event-related blood-oxygen-level-dependent functional magnetic resonance imaging (fMRI) was used to measure activation during shallow (perceptual) and deep (semantic) word encoding and recognition in 14 patients with schizophrenia and 14 healthy comparison subjects. Results Despite slower and less accurate overall word classification, the patients showed normal levels-of-processing effects, with faster and more accurate recognition of deeply processed words. These effects were accompanied by left ventrolateral prefrontal activation during encoding in both groups, although the thalamus, hippocampus, and lingual gyrus were overactivated in the patients. During word recognition, the patients showed overactivation in the left frontal pole and had a less robust right prefrontal response. Conclusions Evidence of normal levels-of-processing effects and left prefrontal activation suggests that patients with schizophrenia can form and maintain semantic representations when they are provided with organizational cues and can improve their word encoding and retrieval. Areas of overactivation suggest residual inefficiencies. Nevertheless, the effect of teaching organizational strategies on episodic memory and brain function is a worthwhile topic for future interventional studies. PMID:16199830

Memory in pregnancy and post-partum: Item specific and relational encoding processes in recall and recognition.

PubMed

Spataro, Pietro; Saraulli, Daniele; Oriolo, Debora; Costanzi, Marco; Zanetti, Humberto; Cestari, Vincenzo; Rossi-Arnaud, Clelia

2016-08-01

It has been recently proposed that pregnant women would perform memory tasks by focusing more on item-specific processes and less on relational processing, compared to post-partum women (Mickes, Wixted, Shapiro & Scarff, ). The present cross-sectional study tested this hypothesis by directly manipulating the type of encoding employed in the study phase. Pregnant, post-partum and control women either rated the pleasantness of word meaning (which induced item-specific elaboration) or named the semantic category to which they belonged (which induced relational elaboration). Memory for the encoded words was later tested in free recall (which emphasizes relational processing) and in recognition (which emphasizes item-specific processing). In line with Mickes et al.'s () conclusions, pregnant women in the item-specific condition performed worse than post-partum women in the relational condition in free recall, but not in recognition. However, compared to the other two groups, pregnant women also exhibited lower recognition accuracy in the item-specific condition. Overall, these results confirm that pregnant women rely on relational encoding less than post-partum women, but additionally suggest that the former group might use item-specific processes less efficiently than post-partum and control women. © 2016 Scandinavian Psychological Associations and John Wiley & Sons Ltd.

Divided attention enhances the recognition of emotional stimuli: evidence from the attentional boost effect.

PubMed

Rossi-Arnaud, Clelia; Spataro, Pietro; Costanzi, Marco; Saraulli, Daniele; Cestari, Vincenzo

2018-01-01

The present study examined predictions of the early-phase-elevated-attention hypothesis of the attentional boost effect (ABE), which suggests that transient increases in attention at encoding, as instantiated in the ABE paradigm, should enhance the recognition of neutral and positive items (whose encoding is mostly based on controlled processes), while having small or null effects on the recognition of negative items (whose encoding is primarily based on automatic processes). Participants were presented a sequence of negative, neutral and positive stimuli (pictures in Experiment 1, words in Experiment 2) associated to target (red) squares, distractor (green) squares or no squares (baseline condition). They were told to attend to the pictures/words and simultaneously press the spacebar of the computer when a red square appeared. In a later recognition task, stimuli associated to target squares were recognised better than stimuli associated to distractor squares, replicating the standard ABE. More importantly, we also found that: (a) the memory enhancement following target detection occurred with all types of stimuli (neutral, negative and positive) and (b) the advantage of negative stimuli over neutral stimuli was intact in the DA condition. These findings suggest that the encoding of negative stimuli depends on both controlled (attention-dependent) and automatic (attention-independent) processes.

Optical Pattern Recognition

NASA Astrophysics Data System (ADS)

Yu, Francis T. S.; Jutamulia, Suganda

2008-10-01

Contributors; Preface; 1. Pattern recognition with optics Francis T. S. Yu and Don A. Gregory; 2. Hybrid neural networks for nonlinear pattern recognition Taiwei Lu; 3. Wavelets, optics, and pattern recognition Yao Li and Yunglong Sheng; 4. Applications of the fractional Fourier transform to optical pattern recognition David Mendlovic, Zeev Zalesky and Haldum M. Oxaktas; 5. Optical implementation of mathematical morphology Tien-Hsin Chao; 6. Nonlinear optical correlators with improved discrimination capability for object location and recognition Leonid P. Yaroslavsky; 7. Distortion-invariant quadratic filters Gregory Gheen; 8. Composite filter synthesis as applied to pattern recognition Shizhou Yin and Guowen Lu; 9. Iterative procedures in electro-optical pattern recognition Joseph Shamir; 10. Optoelectronic hybrid system for three-dimensional object pattern recognition Guoguang Mu, Mingzhe Lu and Ying Sun; 11. Applications of photrefractive devices in optical pattern recognition Ziangyang Yang; 12. Optical pattern recognition with microlasers Eung-Gi Paek; 13. Optical properties and applications of bacteriorhodopsin Q. Wang Song and Yu-He Zhang; 14. Liquid-crystal spatial light modulators Aris Tanone and Suganda Jutamulia; 15. Representations of fully complex functions on real-time spatial light modulators Robert W. Cohn and Laurence G. Hassbrook; Index.

Remembrance of things past retrieved from the Paramecium genome.

PubMed

Sperling, Linda

2011-01-01

Paramecium and other ciliates are the only unicellular eukaryotes that separate germinal and somatic functions. A germline micronucleus transmits the genetic information to sexual progeny, while a somatic macronucleus expresses the genetic information during vegetative growth to determine the phenotype. At each sexual generation, a new macronucleus develops from the zygotic nucleus through programmed rearrangements of the germline genome. Paramecium tetraurelia somatic genome sequencing, reviewed here, has provided insight into the organization and evolution of the genome. A series of at least 3 whole genome duplications was detected in the Paramecium lineage and selective pressures that determine the fate of the gene duplicates analyzed. Variability in the somatic DNA was characterized and could be attributed to the genome rearrangement processes. Since, in Paramecium, alternative genome rearrangement patterns can be inherited across sexual generations by homology-dependent epigenetic mechanisms and can affect phenotype, I discuss the possibility that ciliate nuclear dimorphism buffers genetic variation hidden in the germline. Copyright © 2011 Institut Pasteur. Published by Elsevier SAS. All rights reserved.

Cingulo-opercular activity affects incidental memory encoding for speech in noise.

PubMed

Vaden, Kenneth I; Teubner-Rhodes, Susan; Ahlstrom, Jayne B; Dubno, Judy R; Eckert, Mark A

2017-08-15

Correctly understood speech in difficult listening conditions is often difficult to remember. A long-standing hypothesis for this observation is that the engagement of cognitive resources to aid speech understanding can limit resources available for memory encoding. This hypothesis is consistent with evidence that speech presented in difficult conditions typically elicits greater activity throughout cingulo-opercular regions of frontal cortex that are proposed to optimize task performance through adaptive control of behavior and tonic attention. However, successful memory encoding of items for delayed recognition memory tasks is consistently associated with increased cingulo-opercular activity when perceptual difficulty is minimized. The current study used a delayed recognition memory task to test competing predictions that memory encoding for words is enhanced or limited by the engagement of cingulo-opercular activity during challenging listening conditions. An fMRI experiment was conducted with twenty healthy adult participants who performed a word identification in noise task that was immediately followed by a delayed recognition memory task. Consistent with previous findings, word identification trials in the poorer signal-to-noise ratio condition were associated with increased cingulo-opercular activity and poorer recognition memory scores on average. However, cingulo-opercular activity decreased for correctly identified words in noise that were not recognized in the delayed memory test. These results suggest that memory encoding in difficult listening conditions is poorer when elevated cingulo-opercular activity is not sustained. Although increased attention to speech when presented in difficult conditions may detract from more active forms of memory maintenance (e.g., sub-vocal rehearsal), we conclude that task performance monitoring and/or elevated tonic attention supports incidental memory encoding in challenging listening conditions. Copyright © 2017 Elsevier Inc. All rights reserved.

The effect of scene context on episodic object recognition: parahippocampal cortex mediates memory encoding and retrieval success.

PubMed

Hayes, Scott M; Nadel, Lynn; Ryan, Lee

2007-01-01

Previous research has investigated intentional retrieval of contextual information and contextual influences on object identification and word recognition, yet few studies have investigated context effects in episodic memory for objects. To address this issue, unique objects embedded in a visually rich scene or on a white background were presented to participants. At test, objects were presented either in the original scene or on a white background. A series of behavioral studies with young adults demonstrated a context shift decrement (CSD)-decreased recognition performance when context is changed between encoding and retrieval. The CSD was not attenuated by encoding or retrieval manipulations, suggesting that binding of object and context may be automatic. A final experiment explored the neural correlates of the CSD, using functional Magnetic Resonance Imaging. Parahippocampal cortex (PHC) activation (right greater than left) during incidental encoding was associated with subsequent memory of objects in the context shift condition. Greater activity in right PHC was also observed during successful recognition of objects previously presented in a scene. Finally, a subset of regions activated during scene encoding, such as bilateral PHC, was reactivated when the object was presented on a white background at retrieval. Although participants were not required to intentionally retrieve contextual information, the results suggest that PHC may reinstate visual context to mediate successful episodic memory retrieval. The CSD is attributed to automatic and obligatory binding of object and context. The results suggest that PHC is important not only for processing of scene information, but also plays a role in successful episodic memory encoding and retrieval. These findings are consistent with the view that spatial information is stored in the hippocampal complex, one of the central tenets of Multiple Trace Theory. (c) 2007 Wiley-Liss, Inc.

The Fanconi anemia DNA damage repair pathway in the spotlight for germline predisposition to colorectal cancer.

PubMed

Esteban-Jurado, Clara; Franch-Expósito, Sebastià; Muñoz, Jenifer; Ocaña, Teresa; Carballal, Sabela; López-Cerón, Maria; Cuatrecasas, Miriam; Vila-Casadesús, Maria; Lozano, Juan José; Serra, Enric; Beltran, Sergi; Brea-Fernández, Alejandro; Ruiz-Ponte, Clara; Castells, Antoni; Bujanda, Luis; Garre, Pilar; Caldés, Trinidad; Cubiella, Joaquín; Balaguer, Francesc; Castellví-Bel, Sergi

2016-10-01

Colorectal cancer (CRC) is one of the most common neoplasms in the world. Fanconi anemia (FA) is a very rare genetic disease causing bone marrow failure, congenital growth abnormalities and cancer predisposition. The comprehensive FA DNA damage repair pathway requires the collaboration of 53 proteins and it is necessary to restore genome integrity by efficiently repairing damaged DNA. A link between FA genes in breast and ovarian cancer germline predisposition has been previously suggested. We selected 74 CRC patients from 40 unrelated Spanish families with strong CRC aggregation compatible with an autosomal dominant pattern of inheritance and without mutations in known hereditary CRC genes and performed germline DNA whole-exome sequencing with the aim of finding new candidate germline predisposition variants. After sequencing and data analysis, variant prioritization selected only those very rare alterations, producing a putative loss of function and located in genes with a role compatible with cancer. We detected an enrichment for variants in FA DNA damage repair pathway genes in our familial CRC cohort as 6 families carried heterozygous, rare, potentially pathogenic variants located in BRCA2/FANCD1, BRIP1/FANCJ, FANCC, FANCE and REV3L/POLZ. In conclusion, the FA DNA damage repair pathway may play an important role in the inherited predisposition to CRC.

SMARCB1 involvement in the development of leiomyoma in a patient with schwannomatosis.

PubMed

Hulsebos, Theo J M; Kenter, Susan; Siebers-Renelt, Ulrike; Hans, Volkmar; Wesseling, Pieter; Flucke, Uta

2014-03-01

Germline SMARCB1 mutations predispose in schwannomatosis patients to the development of multiple benign schwannomas and, in some cases, meningiomas. Here, we report on a 34-year-old female patient who developed multiple schwannomas at various locations and in addition a leiomyoma of the cervix uteri. She carried a c.362+1G>A mutation that inactivates the donor splice site of exon 3. This mutation caused the schwannomatosis phenotype in this patient and was also demonstrated to be present in her affected mother. The leiomyoma displayed the genetic features that are characteristic for germline SMARCB1 mutation-associated tumors. The mutant allele retained in the tumor, whereas the wild-type allele was lost by loss of heterozygosity. Furthermore, the loss of heterozygosity involved net loss of chromosome 22. An NF2 mutation was not found. However, quantitative polymerase chain reaction suggested that both NF2 copies were lost in the tumor. Immunostaining with a SMARCB1 antibody revealed the mosaic expression pattern that is typical for schwannomatosis-associated tumors. To our knowledge, this is the first reported case of leiomyoma associated with a germline SMARCB1 mutation. As such, it widens the spectrum of benign tumors associated with a germline SMARCB1 mutation.

Contribution of familiarity and recollection to associative recognition memory: insights from event-related potentials.

PubMed

Opitz, Bertram; Cornell, Sonia

2006-09-01

Within the dual-process perspective of recognition memory, it has been claimed that familiarity is sufficient to support recognition of single items, but recollection is necessary for associative recognition of item pairs. However, there are some reports suggesting that familiarity might support associative recognition judgments when the items form an easy to access bound representation. In contrast, recollection seems to be required for the recognition of bindings that might be flexibly rearranged in novel situations. We investigated whether both forms of binding are mediated by different mechanisms as reflected by a qualitatively different spatiotemporal eventrelated potential (ERP) pattern. In a recognition memory experiment, subjects gave old/new judgments to words learned by focusing either on interitem associations or on size relation of word triplets. Results revealed higher hit rates in the relational condition as compared to the associative condition. In addition, the proportion of triplets from which all three items were remembered was significantly larger in the relational condition suggesting that memory retrieval in this condition relies primarily on bound representations of word triplets. The ERP revealed a late parietal old/new effect for both conditions, with relational processing resulting in a greater effect. In contrast, an early frontal old/new effect was solely present in the associative condition. Taken together, these data provide evidence that familiarity might support associative recognition if the associated components are coherently encoded into a bound representation. Recollection might foster the recognition of relational bindings among items. This indicates that the contribution of familiarity and recollection to associative recognition depends on the kind of binding operations performed on the items rather than on the single versus multiple item distinction.

The mate recognition protein gene mediates reproductive isolation and speciation in the Brachionus plicatilis cryptic species complex.

PubMed

Gribble, Kristin E; Mark Welch, David B

2012-08-01

Chemically mediated prezygotic barriers to reproduction likely play an important role in speciation. In facultatively sexual monogonont rotifers from the Brachionus plicatilis cryptic species complex, mate recognition of females by males is mediated by the Mate Recognition Protein (MRP), a globular glycoprotein on the surface of females, encoded by the mmr-b gene family. In this study, we sequenced mmr-b copies from 27 isolates representing 11 phylotypes of the B. plicatilis species complex, examined the mode of evolution and selection of mmr-b, and determined the relationship between mmr-b genetic distance and mate recognition among isolates. Isolates of the B. plicatilis species complex have 1-4 copies of mmr-b, each composed of 2-9 nearly identical tandem repeats. The repeats within a gene copy are generally more similar than are gene copies among phylotypes, suggesting concerted evolution. Compared to housekeeping genes from the same isolates, mmr-b has accumulated only half as many synonymous differences but twice as many non-synonymous differences. Most of the amino acid differences between repeats appear to occur on the outer face of the protein, and these often result in changes in predicted patterns of phosphorylation. However, we found no evidence of positive selection driving these differences. Isolates with the most divergent copies were unable to mate with other isolates and rarely self-crossed. Overall the degree of mate recognition was significantly correlated with the genetic distance of mmr-b. Discrimination of compatible mates in the B. plicatilis species complex is determined by proteins encoded by closely related copies of a single gene, mmr-b. While concerted evolution of the tandem repeats in mmr-b may function to maintain identity, it can also lead to the rapid spread of a mutation through all copies in the genome and thus to reproductive isolation. The mmr-b gene is evolving rapidly, and novel alleles may be maintained and increase in frequency via asexual reproduction. Our analyses indicate that mate recognition, controlled by MMR-B, may drive reproductive isolation and allow saltational sympatric speciation within the B. plicatilis cryptic species complex, and that this process may be largely neutral.

Depth of word processing in Alzheimer patients and normal controls: a magnetoencephalographic (MEG) study.

PubMed

Walla, P; Püregger, E; Lehrner, J; Mayer, D; Deecke, L; Dal Bianco, P

2005-05-01

Effects related to depth of verbal information processing were investigated in probable Alzheimer's disease patients (AD) and age matched controls. During word encoding sessions 10 patients and 10 controls had either to decide whether the letter "s" appeared in visually presented words (alphabetical decision, shallow encoding), or whether the meaning of each presented word was animate or inanimate (lexical decision, deep encoding). These encoding sessions were followed by test sessions during which all previously encoded words were presented again together with the same number of new words. The task was then to discriminate between repeated and new words. Magnetic field changes related to brain activity were recorded with a whole cortex MEG.5 probable AD patients showed recognition performances above chance level related to both depths of information processing. Those patients and 5 age matched controls were then further analysed. Recognition performance was poorer in probable AD patients compared to controls for both levels of processing. However, in both groups deep encoding led to a higher recognition performance than shallow encoding. We therefore conclude that the performance reduction in the patient group was independent of depth of processing. Reaction times related to false alarms differed between patients and controls after deep encoding which perhaps could already be used for supporting an early diagnosis. The analysis of the physiological data revealed significant differences between correctly recognised repetitions and correctly classified new words (old/new-effect) in the control group which were missing in the patient group after deep encoding. The lack of such an effect in the patient group is interpreted as being due to the respective neuropathology related to probable AD. The present results demonstrate that magnetic field recordings represent a useful tool to physiologically distinguish between probable AD and age matched controls.

Orientation Encoding and Viewpoint Invariance in Face Recognition: Inferring Neural Properties from Large-Scale Signals.

PubMed

Ramírez, Fernando M

2018-05-01

Viewpoint-invariant face recognition is thought to be subserved by a distributed network of occipitotemporal face-selective areas that, except for the human anterior temporal lobe, have been shown to also contain face-orientation information. This review begins by highlighting the importance of bilateral symmetry for viewpoint-invariant recognition and face-orientation perception. Then, monkey electrophysiological evidence is surveyed describing key tuning properties of face-selective neurons-including neurons bimodally tuned to mirror-symmetric face-views-followed by studies combining functional magnetic resonance imaging (fMRI) and multivariate pattern analyses to probe the representation of face-orientation and identity information in humans. Altogether, neuroimaging studies suggest that face-identity is gradually disentangled from face-orientation information along the ventral visual processing stream. The evidence seems to diverge, however, regarding the prevalent form of tuning of neural populations in human face-selective areas. In this context, caveats possibly leading to erroneous inferences regarding mirror-symmetric coding are exposed, including the need to distinguish angular from Euclidean distances when interpreting multivariate pattern analyses. On this basis, this review argues that evidence from the fusiform face area is best explained by a view-sensitive code reflecting head angular disparity, consistent with a role of this area in face-orientation perception. Finally, the importance is stressed of explicit models relating neural properties to large-scale signals.

The parietal memory network activates similarly for true and associative false recognition elicited via the DRM procedure.

PubMed

McDermott, Kathleen B; Gilmore, Adrian W; Nelson, Steven M; Watson, Jason M; Ojemann, Jeffrey G

2017-02-01

Neuroimaging investigations of human memory encoding and retrieval have revealed that multiple regions of parietal cortex contribute to memory. Recently, a sparse network of regions within parietal cortex has been identified using resting state functional connectivity (MRI techniques). The regions within this network exhibit consistent task-related responses during memory formation and retrieval, leading to its being called the parietal memory network (PMN). Among its signature patterns are: deactivation during initial experience with an item (e.g., encoding); activation during subsequent repetitions (e.g., at retrieval); greater activation for successfully retrieved familiar words than novel words (e.g., hits relative to correctly-rejected lures). The question of interest here is whether novel words that are subjectively experienced as having been recently studied would elicit PMN activation similar to that of hits. That is, we compared old items correctly recognized to two types of novel items on a recognition test: those correctly identified as new and those incorrectly labeled as old due to their strong associative relation to the studied words (in the DRM false memory protocol). Subjective oldness plays a strong role in driving activation, as hits and false alarms activated similarly (and greater than correctly-rejected lures). Copyright © 2016 Elsevier Ltd. All rights reserved.

Propofol and midazolam inhibit conscious memory processes very soon after encoding: an event-related potential study of familiarity and recollection in volunteers.

PubMed

Veselis, Robert A; Pryor, Kane O; Reinsel, Ruth A; Li, Yuelin; Mehta, Meghana; Johnson, Ray

2009-02-01

Intravenous drugs active via gamma-aminobutyric acid receptors to produce memory impairment during conscious sedation. Memory function was assessed using event-related potentials (ERPs) while drug was present. The continuous recognition task measured recognition of photographs from working (6 s) and long-term (27 s) memory while ERPs were recorded from Cz (familiarity recognition) and Pz electrodes (recollection recognition). Volunteer participants received sequential doses of one of placebo (n = 11), 0.45 and 0.9 microg/ml propofol (n = 10), 20 and 40 ng/ml midazolam (n = 12), 1.5 and 3 microg/ml thiopental (n = 11), or 0.25 and 0.4 ng/ml dexmedetomidine (n = 11). End-of-day yes/no recognition 225 min after the end of drug infusion tested memory retention of pictures encoded on the continuous recognition tasks. Active drugs increased reaction times and impaired memory on the continuous recognition task equally, except for a greater effect of midazolam (P < 0.04). Forgetting from continuous recognition tasks to end of day was similar for all drugs (P = 0.40), greater than placebo (P < 0.001). Propofol and midazolam decreased the area between first presentation (new) and recognized (old, 27 s later) ERP waveforms from long-term memory for familiarity (P = 0.03) and possibly for recollection processes (P = 0.12). Propofol shifted ERP amplitudes to smaller voltages (P < 0.002). Dexmedetomidine may have impaired familiarity more than recollection processes (P = 0.10). Thiopental had no effect on ERPs. Propofol and midazolam impaired recognition ERPs from long-term memory but not working memory. ERP measures of memory revealed different pathways to end-of-day memory loss as early as 27 s after encoding.

Short theta burst stimulation to left frontal cortex prior to encoding enhances subsequent recognition memory

PubMed Central

Demeter, Elise; Mirdamadi, Jasmine L.; Meehan, Sean K.; Taylor, Stephan F.

2016-01-01

Deep semantic encoding of verbal stimuli can aid in later successful retrieval of those stimuli from long-term episodic memory. Evidence from numerous neuropsychological and neuroimaging experiments demonstrate regions in left prefrontal cortex, including left dorsolateral prefrontal cortex (DLPFC), are important for processes related to encoding. Here, we investigated the relationship between left DLPFC activity during encoding and successful subsequent memory with transcranial magnetic stimulation (TMS). In a pair of experiments using a 2-session within-subjects design, we stimulated either left DLPFC or a control region (Vertex) with a single 2-s train of short theta burst stimulation (sTBS) during a semantic encoding task and then gave participants a recognition memory test. We found that subsequent memory was enhanced on the day left DLPFC was stimulated, relative to the day Vertex was stimulated, and that DLPFC stimulation also increased participants’ confidence in their decisions during the recognition task. We also explored the time course of how long the effects of sTBS persisted. Our data suggest 2 s of sTBS to left DLPFC is capable of enhancing subsequent memory for items encoded up to 15 s following stimulation. Collectively, these data demonstrate sTBS is capable of enhancing long-term memory and provide evidence that TBS protocols are a potentially powerful tool for modulating cognitive function. PMID:27098772

Insights from child development on the relationship between episodic and semantic memory.

PubMed

Robertson, Erin K; Köhler, Stefan

2007-11-05

The present study was motivated by a recent controversy in the neuropsychological literature on semantic dementia as to whether episodic encoding requires semantic processing or whether it can proceed solely based on perceptual processing. We addressed this issue by examining the effect of age-related limitations in semantic competency on episodic memory in 4-6-year-old children (n=67). We administered three different forced-choice recognition memory tests for pictures previously encountered in a single study episode. The tests varied in the degree to which access to semantically encoded information was required at retrieval. Semantic competency predicted recognition performance regardless of whether access to semantic information was required. A direct relation between picture naming at encoding and subsequent recognition was also found for all tests. Our findings emphasize the importance of semantic encoding processes even in retrieval situations that purportedly do not require access to semantic information. They also highlight the importance of testing neuropsychological models of memory in different populations, healthy and brain damaged, at both ends of the developmental continuum.

Get the gist? The effects of processing depth on false recognition in short-term and long-term memory.

PubMed

Flegal, Kristin E; Reuter-Lorenz, Patricia A

2014-07-01

Gist-based processing has been proposed to account for robust false memories in the converging-associates task. The deep-encoding processes known to enhance verbatim memory also strengthen gist memory and increase distortions of long-term memory (LTM). Recent research has demonstrated that compelling false memory illusions are relatively delay-invariant, also occurring under canonical short-term memory (STM) conditions. To investigate the contributions of gist to false memory at short and long delays, processing depth was manipulated as participants encoded lists of four semantically related words and were probed immediately, following a filled 3- to 4-s retention interval, or approximately 20 min later, in a surprise recognition test. In two experiments, the encoding manipulation dissociated STM and LTM on the frequency, but not the phenomenology, of false memory. Deep encoding at STM increases false recognition rates at LTM, but confidence ratings and remember/know judgments are similar across delays and do not differ as a function of processing depth. These results suggest that some shared and some unique processes underlie false memory illusions at short and long delays.

Pervasive polymorphic imprinted methylation in the human placenta

PubMed Central

Hanna, Courtney W.; Peñaherrera, Maria S.; Saadeh, Heba; Andrews, Simon; McFadden, Deborah E.; Kelsey, Gavin; Robinson, Wendy P.

2016-01-01

The maternal and paternal copies of the genome are both required for mammalian development, and this is primarily due to imprinted genes, those that are monoallelically expressed based on parent-of-origin. Typically, this pattern of expression is regulated by differentially methylated regions (DMRs) that are established in the germline and maintained after fertilization. There are a large number of germline DMRs that have not yet been associated with imprinting, and their function in development is unknown. In this study, we developed a genome-wide approach to identify novel imprinted DMRs in the human placenta and investigated the dynamics of these imprinted DMRs during development in somatic and extraembryonic tissues. DNA methylation was evaluated using the Illumina HumanMethylation450 array in 134 human tissue samples, publicly available reduced representation bisulfite sequencing in the human embryo and germ cells, and targeted bisulfite sequencing in term placentas. Forty-three known and 101 novel imprinted DMRs were identified in the human placenta by comparing methylation between diandric and digynic triploid conceptions in addition to female and male gametes. Seventy-two novel DMRs showed a pattern consistent with placental-specific imprinting, and this monoallelic methylation was entirely maternal in origin. Strikingly, these DMRs exhibited polymorphic imprinted methylation between placental samples. These data suggest that imprinting in human development is far more extensive and dynamic than previously reported and that the placenta preferentially maintains maternal germline-derived DNA methylation. PMID:26769960

Germline DNA methylation in reef corals: patterns and potential roles in response to environmental change.

PubMed

Dimond, James L; Roberts, Steven B

2016-04-01

DNA methylation is an epigenetic mark that plays an inadequately understood role in gene regulation, particularly in nonmodel species. Because it can be influenced by the environment, DNA methylation may contribute to the ability of organisms to acclimatize and adapt to environmental change. We evaluated the distribution of gene body methylation in reef-building corals, a group of organisms facing significant environmental threats. Gene body methylation in six species of corals was inferred from in silico transcriptome analysis of CpG O/E, an estimate of germline DNA methylation that is highly correlated with patterns of methylation enrichment. Consistent with what has been documented in most other invertebrates, all corals exhibited bimodal distributions of germline methylation suggestive of distinct fractions of genes with high and low levels of methylation. The hypermethylated fractions were enriched with genes with housekeeping functions, while genes with inducible functions were highly represented in the hypomethylated fractions. High transcript abundance was associated with intermediate levels of methylation. In three of the coral species, we found that genes differentially expressed in response to thermal stress and ocean acidification exhibited significantly lower levels of methylation. These results support a link between gene body hypomethylation and transcriptional plasticity that may point to a role of DNA methylation in the response of corals to environmental change. © 2015 John Wiley & Sons Ltd.

No effect of stress on false recognition.

PubMed

Beato, María Soledad; Cadavid, Sara; Pulido, Ramón F; Pinho, María Salomé

2013-02-01

The present study aimed to analyze the effect of acute stress on false recognition in the Deese/Roediger-McDermott (DRM) paradigm. In this paradigm, lists of words associated with a non-presented critical lure are studied and, in a subsequent memory test, critical lures are often falsely remembered. In two experiments, participants were randomly assigned to either the stress group (Trier Social Stress Test) or the no-stress control group. Because we sought to control the level-of-processing at encoding, in Experiment 1, participants created a visual mental image for each presented word (deep encoding). In Experiment 2, participants performed a shallow encoding (to respond whether each word contained the letter "o"). The results indicated that, in both experiments, as predicted, heart rate and STAI-S scores increased only in the stress group. However, false recognition did not differ across stress and no-stress groups. Results suggest that, although psychosocial stress was successfully induced, it does not enhance the vulnerability of individuals with acute stress to DRM false recognition, regardless of the level of processing.

Item-specific processing reduces false memories.

PubMed

McCabe, David P; Presmanes, Alison G; Robertson, Chuck L; Smith, Anderson D

2004-12-01

We examined the effect of item-specific and relational encoding instructions on false recognition in two experiments in which the DRM paradigm was used (Deese, 1959; Roediger & McDermott, 1995). Type of encoding (item-specific or relational) was manipulated between subjects in Experiment 1 and within subjects in Experiment 2. Decision-based explanations (e.g., the distinctiveness heuristic) predict reductions in false recognition in between-subjects designs, but not in within-subjects designs, because they are conceptualized as global shifts in decision criteria. Memory-based explanations predict reductions in false recognition in both designs, resulting from enhanced recollection of item-specific details. False recognition was reduced following item-specific encoding instructions in both experiments, favoring a memory-based explanation. These results suggest that providing unique cues for the retrieval of individual studied items results in enhanced discrimination between those studied items and critical lures. Conversely, enhancing the similarity of studied items results in poor discrimination among items within a particular list theme. These results are discussed in terms of the item-specific/ relational framework (Hunt & McDaniel, 1993).

A novel C-type lectin with two CRD domains from Chinese shrimp Fenneropenaeus chinensis functions as a pattern recognition protein.

PubMed

Zhang, Xiao-Wen; Xu, Wen-Teng; Wang, Xian-Wei; Mu, Yi; Zhao, Xiao-Fan; Yu, Xiao-Qiang; Wang, Jin-Xing

2009-05-01

Lectins are regarded as potential immune recognition proteins. In this study, a novel C-type lectin (Fc-Lec2) was cloned from the hepatopancreas of Chinese shrimp, Fenneropenaeus chinensis. The cDNA of Fc-Lec2 is 1219 bp with an open reading frame (ORF) of 1002 bp that encodes a protein of 333 amino acids. Fc-Lec2 contains a signal peptide and two different carbohydrate recognition domains (CRDs) arranged in tandem. The first CRD contains a QPD (Gln-Pro-Asp) motif that has a predicted binding specificity for galactose and the second CRD contains a EPN (Glu-Pro-Asn) motif for mannose. Fc-Lec2 was constitutively expressed in the hepatopancreas of normal shrimp, and its expression was up-regulated in the hepatopancreas of shrimp challenged with bacteria or viruses. Recombinant mature Fc-Lec2 and its two individual CRDs (CRD1 and 2) did not have hemagglutinating activity against animal red blood cells, but agglutinated some gram-positive and gram-negative bacteria in a calcium-dependent manner. The three recombinant proteins also bound to bacteria in the absence of calcium. Fc-Lec2 seems to have broader specificity and higher affinity for bacteria and polysaccharides (peptidoglycan, lipoteichoic acid and lipopolysaccharide) than each of the two individual CRDs. These data suggest that the two CRDs have synergistic effect, and the intact lectin may be more effective in response to bacterial infection, the Fc-Lec2 performs its pattern recognition function by binding to polysaccharides of pathogen cells.

Dissociative effects of orthographic distinctiveness in pure and mixed lists: an item-order account.

PubMed

McDaniel, Mark A; Cahill, Michael; Bugg, Julie M; Meadow, Nathaniel G

2011-10-01

We apply the item-order theory of list composition effects in free recall to the orthographic distinctiveness effect. The item-order account assumes that orthographically distinct items advantage item-specific encoding in both mixed and pure lists, but at the expense of exploiting relational information present in the list. Experiment 1 replicated the typical free recall advantage of orthographically distinct items in mixed lists and the elimination of that advantage in pure lists. Supporting the item-order account, recognition performances indicated that orthographically distinct items received greater item-specific encoding than did orthographically common items in mixed and pure lists (Experiments 1 and 2). Furthermore, order memory (input-output correspondence and sequential contiguity effects) was evident in recall of pure unstructured common lists, but not in recall of unstructured distinct lists (Experiment 1). These combined patterns, although not anticipated by prevailing views, are consistent with an item-order account.

Characterisation of major histocompatibility complex class I transcripts in an Australian dragon lizard.

PubMed

Hacking, Jessica; Bertozzi, Terry; Moussalli, Adnan; Bradford, Tessa; Gardner, Michael

2018-07-01

Characterisation of squamate major histocompatibility complex (MHC) genes has lagged behind other taxonomic groups. MHC genes encode cell-surface glycoproteins that present self- and pathogen-derived peptides to T cells and play a critical role in pathogen recognition. Here we characterise MHC class I transcripts for an agamid lizard (Ctenophorus decresii) and investigate the evolution of MHC class I in Iguanian lizards. An iterative assembly strategy was used to identify six full-length C. decresii MHC class I transcripts, which were validated as likely to encode classical class I MHC molecules. Evidence for exon shuffling recombination was uncovered for C. decresii transcripts and Bayesian phylogenetic analysis of Iguanian MHC class I sequences revealed a pattern expected under a birth-and-death mode of evolution. This work provides a stepping stone towards further research on the agamid MHC class I region. Copyright © 2018 Elsevier Ltd. All rights reserved.

The role of attention during encoding in implicit and explicit memory.

PubMed

Mulligan, N W

1998-01-01

In 5 experiments, participants read study words under conditions of divided or full attention. Dividing attention reduced performance on the general knowledge test, a conceptual implicit test of memory. Likewise, dividing attention reduced conceptual priming on the word--association task, as well as on a matched explicit test, associate-cued recall. In contrast, even very strong division of attention did not reduce perceptual priming on word-fragment completion, although it did reduce recall on the matched explicit test of word-fragment-cued recall. Finally, dividing attention reduced recall on the perceptual explicit tests of graphemic-cued recall and graphemic recognition. The results indicate that perceptual implicit tests rely minimally on attention-demanding encoding processes relative to other types of memory tests. The obtained pattern of dissociations is not readily accommodated by the transfer-appropriate-processing (TAP) account of implicit and explicit memory. Potential extensions of the TAP view are discussed.

Learning Category-Specific Dictionary and Shared Dictionary for Fine-Grained Image Categorization.

PubMed

Gao, Shenghua; Tsang, Ivor Wai-Hung; Ma, Yi

2014-02-01

This paper targets fine-grained image categorization by learning a category-specific dictionary for each category and a shared dictionary for all the categories. Such category-specific dictionaries encode subtle visual differences among different categories, while the shared dictionary encodes common visual patterns among all the categories. To this end, we impose incoherence constraints among the different dictionaries in the objective of feature coding. In addition, to make the learnt dictionary stable, we also impose the constraint that each dictionary should be self-incoherent. Our proposed dictionary learning formulation not only applies to fine-grained classification, but also improves conventional basic-level object categorization and other tasks such as event recognition. Experimental results on five data sets show that our method can outperform the state-of-the-art fine-grained image categorization frameworks as well as sparse coding based dictionary learning frameworks. All these results demonstrate the effectiveness of our method.

Retrieval Failure Contributes to Gist-Based False Recognition

PubMed Central

Guerin, Scott A.; Robbins, Clifford A.; Gilmore, Adrian W.; Schacter, Daniel L.

2011-01-01

People often falsely recognize items that are similar to previously encountered items. This robust memory error is referred to as gist-based false recognition. A widely held view is that this error occurs because the details fade rapidly from our memory. Contrary to this view, an initial experiment revealed that, following the same encoding conditions that produce high rates of gist-based false recognition, participants overwhelmingly chose the correct target rather than its related foil when given the option to do so. A second experiment showed that this result is due to increased access to stored details provided by reinstatement of the originally encoded photograph, rather than to increased attention to the details. Collectively, these results suggest that details needed for accurate recognition are, to a large extent, still stored in memory and that a critical factor determining whether false recognition will occur is whether these details can be accessed during retrieval. PMID:22125357

The Effects of a Distracting N-Back Task on Recognition Memory Are Reduced by Negative Emotional Intensity

PubMed Central

Buratto, Luciano G.; Pottage, Claire L.; Brown, Charity; Morrison, Catriona M.; Schaefer, Alexandre

2014-01-01

Memory performance is usually impaired when participants have to encode information while performing a concurrent task. Recent studies using recall tasks have found that emotional items are more resistant to such cognitive depletion effects than non-emotional items. However, when recognition tasks are used, the same effect is more elusive as recent recognition studies have obtained contradictory results. In two experiments, we provide evidence that negative emotional content can reliably reduce the effects of cognitive depletion on recognition memory only if stimuli with high levels of emotional intensity are used. In particular, we found that recognition performance for realistic pictures was impaired by a secondary 3-back working memory task during encoding if stimuli were emotionally neutral or had moderate levels of negative emotionality. In contrast, when negative pictures with high levels of emotional intensity were used, the detrimental effects of the secondary task were significantly attenuated. PMID:25330251

The effects of a distracting N-back task on recognition memory are reduced by negative emotional intensity.

PubMed

Buratto, Luciano G; Pottage, Claire L; Brown, Charity; Morrison, Catriona M; Schaefer, Alexandre

2014-01-01

Memory performance is usually impaired when participants have to encode information while performing a concurrent task. Recent studies using recall tasks have found that emotional items are more resistant to such cognitive depletion effects than non-emotional items. However, when recognition tasks are used, the same effect is more elusive as recent recognition studies have obtained contradictory results. In two experiments, we provide evidence that negative emotional content can reliably reduce the effects of cognitive depletion on recognition memory only if stimuli with high levels of emotional intensity are used. In particular, we found that recognition performance for realistic pictures was impaired by a secondary 3-back working memory task during encoding if stimuli were emotionally neutral or had moderate levels of negative emotionality. In contrast, when negative pictures with high levels of emotional intensity were used, the detrimental effects of the secondary task were significantly attenuated.

Source misattributions and false recognition errors: examining the role of perceptual resemblance and imagery generation processes.

PubMed

Foley, Mary Ann; Bays, Rebecca Brooke; Foy, Jeffrey; Woodfield, Mila

2015-01-01

In three experiments, we examine the extent to which participants' memory errors are affected by the perceptual features of an encoding series and imagery generation processes. Perceptual features were examined by manipulating the features associated with individual items as well as the relationships among items. An encoding instruction manipulation was included to examine the effects of explicit requests to generate images. In all three experiments, participants falsely claimed to have seen pictures of items presented as words, committing picture misattribution errors. These misattribution errors were exaggerated when the perceptual resemblance between pictures and images was relatively high (Experiment 1) and when explicit requests to generate images were omitted from encoding instructions (Experiments 1 and 2). When perceptual cues made the thematic relationships among items salient, the level and pattern of misattribution errors were also affected (Experiments 2 and 3). Results address alternative views about the nature of internal representations resulting in misattribution errors and refute the idea that these errors reflect only participants' general impressions or beliefs about what was seen.

Exploring the effects of ownership and choice on self-memory biases.

PubMed

Cunningham, Sheila J; Brady-Van den Bos, Mirjam; Turk, David J

2011-07-01

Objects encoded in the context of temporary ownership by self enjoy a memorial advantage over objects owned by other people. This memory effect has been linked to self-referential encoding processes. The current inquiry explored the extent to which the effects of ownership are influenced by the degree of personal choice involved in assigning ownership. In three experiments pairs of participants chose objects to keep for ownership by self, and rejected objects that were given to the other participant to own. Recognition memory for the objects was then assessed. Experiment 1 showed that participants recognised more items encoded as "self-owned" than "other-owned", but only when they had been chosen by self. Experiment 2 replicated this pattern when participants' sense of choice was illusory. A source memory test in Experiment 3 showed that self-chosen items were most likely to be correctly attributed to ownership by self. These findings are discussed with reference to the link between owned objects and the self, and the routes through which self-referential operations can impact on cognition.

Collaborative encoding and memory accuracy: examining the effects of interactive components of co-construction processes.

PubMed

Foley, Mary Ann; Fried, Adina Rachel; Cowan, Emily; Bays, Rebecca Brooke

2014-01-01

In 2 experiments, the effect of collaborative encoding on memory was examined by testing 2 interactive components of co-construction processes. One component focused on the nature of the interactive exchange between collaborators: As the partners worked together to create descriptions about ways to interact with familiar objects, constraints were imposed on the interactions by requiring them to take turns (Experiment 1) or to interact without constraints (Experiment 2). The nature of the relationship between partners was manipulated as well by including 2 pair types, friends or unfamiliar peers (Experiments 1 and 2). Interactive component effects were found to influence spontaneous activations through content analyses of participants' descriptions, the patterns of false recognition errors, and the relationship between content and errors. The findings highlight the value of examining the content of participants' collaborative efforts when assessing the effects of collaborative encoding on memory and point to mechanisms mediating collaboration's effects. Because the interactions occurred within the context of an imagery generation task, the findings are also intriguing because of their implications for the use of guided imagery techniques that incorporate co-construction processes.

Are affective events richly recollected or simply familiar? The experience and process of recognizing feelings past.

PubMed

Ochsner, K N

2000-06-01

The author used the remember/know paradigm and the dual process recognition model of A. P. Yonelinas, N. E. A. Kroll, I. Dobbins, M. Lazzara, and R. T. Knight (1998) to study the states of awareness accompanying recognition of affective images and the processes of recollection and familiarity that may underlie them. Results from all experiments showed that (a) negative stimuli tended to be remembered, whereas positive stimuli tended to be known; (b) recollection, but not familiarity, was boosted for negative or highly arousing and, to a lesser extent, positive stimuli; and (c) across experiments, variations in depth of encoding did not influence these patterns. These data suggest that greater recollection for affective events leads them to be more richly experienced in memory, and they are consistent with the idea that the states of remembering and knowing are experientially exclusive, whereas the processes underlying them are functionally independent.

Music causes deterioration of source memory: evidence from normal ageing.

PubMed

El Haj, Mohamad; Omigie, Diana; Clément, Sylvain

2014-01-01

Previous research has shown that music exposure can impair a wide variety of cognitive and behavioural performance. We investigated whether this is the case for source memory. Forty-one younger adults and 35 healthy elderly were required to retain the location in which pictures of coloured objects were displayed. On a subsequent recognition test they were required to decide whether the objects were displayed in the same location as before or not. Encoding took place (a) in silence, (b) while listening to street noise, or (c) while listening to Vivaldi's "Four Seasons". Recognition always took place during silence. A significant reduction in source memory was observed following music exposure, a reduction that was more pronounced for older adults than for younger adults. This pattern was significantly correlated with performance on an executive binding task. The exposure to music appeared to interfere with binding in working memory, worsening source recall.

Rehearsal strategies can enlarge or diminish the spacing effect: pure versus mixed lists and encoding strategy.

PubMed

Delaney, Peter F; Verkoeijen, Peter P J L

2009-09-01

Using 5 experiments, the authors explored the dependency of spacing effects on rehearsal patterns. Encouraging rehearsal borrowing produced opposing effects on mixed lists (containing both spaced and massed repetitions) and pure lists (containing only one or the other), magnifying spacing effects on mixed lists but diminishing spacing effects on pure lists. Rehearsing with borrowing produced large spacing effects on mixed lists but not on pure lists for both free recall (Experiment 1) and recognition (Experiment 2). In contrast, rehearsing only the currently visible item produced spacing effects on both mixed lists and pure lists in free recall (Experiment 3) and recognition (Experiment 4). Experiment 5 demonstrated these effects using a fully within-subjects design. Rehearse-aloud protocols showed that rehearsal borrowing redistributed study from massed to spaced items on mixed lists, especially during massed presentations. (c) 2009 APA, all rights reserved.

Genetic Diversity of Toll-Like Receptors and Immunity to M. leprae Infection

PubMed Central

Hart, Bryan E.; Tapping, Richard I.

2012-01-01

Genetic association studies of leprosy cohorts across the world have identified numerous polymorphisms which alter susceptibility and outcome to infection with Mycobacterium leprae. As expected, many of the polymorphisms reside within genes that encode components of the innate and adaptive immune system. Despite the preponderance of these studies, our understanding of the mechanisms that underlie these genetic associations remains sparse. Toll-like receptors (TLRs) have emerged as an essential family of innate immune pattern recognition receptors which play a pivotal role in host defense against microbes, including pathogenic strains of mycobacteria. This paper will highlight studies which have uncovered the association of specific TLR gene polymorphisms with leprosy or tuberculosis: two important diseases resulting from mycobacterial infection. This analysis will focus on the potential influence these polymorphic variants have on TLR expression and function and how altered TLR recognition or signaling may contribute to successful antimycobacterial immunity. PMID:22529866

Older adults encode--but do not always use--perceptual details: intentional versus unintentional effects of detail on memory judgments.

PubMed

Koutstaal, Wilma

2003-03-01

Investigations of memory deficits in older individuals have concentrated on their increased likelihood of forgetting events or details of events that were actually encountered (errors of omission). However, mounting evidence demonstrates that normal cognitive aging also is associated with an increased propensity for errors of commission--shown in false alarms or false recognition. The present study examined the origins of this age difference. Older and younger adults each performed three types of memory tasks in which details of encountered items might influence performance. Although older adults showed greater false recognition of related lures on a standard (identical) old/new episodic recognition task, older and younger adults showed parallel effects of detail on repetition priming and meaning-based episodic recognition (decreased priming and decreased meaning-based recognition for different relative to same exemplars). The results suggest that the older adults encoded details but used them less effectively than the younger adults in the recognition context requiring their deliberate, controlled use.

A shared representation of order between encoding and recognition in visual short-term memory.

PubMed

Kalm, Kristjan; Norris, Dennis

2017-07-15

Many complex tasks require people to bind individual events into a sequence that can be held in short term memory (STM). For this purpose information about the order of the individual events in the sequence needs to be maintained in an active and accessible form in STM over a period of few seconds. Here we investigated how the temporal order information is shared between the presentation and response phases of an STM task. We trained a classification algorithm on the fMRI activity patterns from the presentation phase of the STM task to predict the order of the items during the subsequent recognition phase. While voxels in a number of brain regions represented positional information during either presentation and recognition phases, only voxels in the lateral prefrontal cortex (PFC) and the anterior temporal lobe (ATL) represented position consistently across task phases. A shared positional code in the ATL might reflect verbal recoding of visual sequences to facilitate the maintenance of order information over several seconds. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Gradient language dominance affects talker learning.

PubMed

Bregman, Micah R; Creel, Sarah C

2014-01-01

Traditional conceptions of spoken language assume that speech recognition and talker identification are computed separately. Neuropsychological and neuroimaging studies imply some separation between the two faculties, but recent perceptual studies suggest better talker recognition in familiar languages than unfamiliar languages. A familiar-language benefit in talker recognition potentially implies strong ties between the two domains. However, little is known about the nature of this language familiarity effect. The current study investigated the relationship between speech and talker processing by assessing bilingual and monolingual listeners' ability to learn voices as a function of language familiarity and age of acquisition. Two effects emerged. First, bilinguals learned to recognize talkers in their first language (Korean) more rapidly than they learned to recognize talkers in their second language (English), while English-speaking participants showed the opposite pattern (learning English talkers faster than Korean talkers). Second, bilinguals' learning rate for talkers in their second language (English) correlated with age of English acquisition. Taken together, these results suggest that language background materially affects talker encoding, implying a tight relationship between speech and talker representations. Copyright © 2013 Elsevier B.V. All rights reserved.

Adaptive error correction codes for face identification

NASA Astrophysics Data System (ADS)

Hussein, Wafaa R.; Sellahewa, Harin; Jassim, Sabah A.

2012-06-01

Face recognition in uncontrolled environments is greatly affected by fuzziness of face feature vectors as a result of extreme variation in recording conditions (e.g. illumination, poses or expressions) in different sessions. Many techniques have been developed to deal with these variations, resulting in improved performances. This paper aims to model template fuzziness as errors and investigate the use of error detection/correction techniques for face recognition in uncontrolled environments. Error correction codes (ECC) have recently been used for biometric key generation but not on biometric templates. We have investigated error patterns in binary face feature vectors extracted from different image windows of differing sizes and for different recording conditions. By estimating statistical parameters for the intra-class and inter-class distributions of Hamming distances in each window, we encode with appropriate ECC's. The proposed approached is tested for binarised wavelet templates using two face databases: Extended Yale-B and Yale. We shall demonstrate that using different combinations of BCH-based ECC's for different blocks and different recording conditions leads to in different accuracy rates, and that using ECC's results in significantly improved recognition results.

Deep neural network features for horses identity recognition using multiview horses' face pattern

NASA Astrophysics Data System (ADS)

Jarraya, Islem; Ouarda, Wael; Alimi, Adel M.

2017-03-01

To control the state of horses in the born, breeders needs a monitoring system with a surveillance camera that can identify and distinguish between horses. We proposed in [5] a method of horse's identification at a distance using the frontal facial biometric modality. Due to the change of views, the face recognition becomes more difficult. In this paper, the number of images used in our THoDBRL'2015 database (Tunisian Horses DataBase of Regim Lab) is augmented by adding other images of other views. Thus, we used front, right and left profile face's view. Moreover, we suggested an approach for multiview face recognition. First, we proposed to use the Gabor filter for face characterization. Next, due to the augmentation of the number of images, and the large number of Gabor features, we proposed to test the Deep Neural Network with the auto-encoder to obtain the more pertinent features and to reduce the size of features vector. Finally, we performed the proposed approach on our THoDBRL'2015 database and we used the linear SVM for classification.

Time in the eye of the beholder: Gaze position reveals spatial-temporal associations during encoding and memory retrieval of future and past.

PubMed

Martarelli, Corinna S; Mast, Fred W; Hartmann, Matthias

2017-01-01

Time is grounded in various ways, and previous studies point to a "mental time line" with past associated with the left, and future with the right side. In this study, we investigated whether spontaneous eye movements on a blank screen would follow a mental timeline during encoding, free recall, and recognition of past and future items. In all three stages of processing, gaze position was more rightward during future items compared to past items. Moreover, horizontal gaze position during encoding predicted horizontal gaze position during free recall and recognition. We conclude that mental time line and the stored gaze position during encoding assist memory retrieval of past versus future items. Our findings highlight the spatial nature of temporal representations.

Time and timing in the acoustic recognition system of crickets

PubMed Central

Hennig, R. Matthias; Heller, Klaus-Gerhard; Clemens, Jan

2014-01-01

The songs of many insects exhibit precise timing as the result of repetitive and stereotyped subunits on several time scales. As these signals encode the identity of a species, time and timing are important for the recognition system that analyzes these signals. Crickets are a prominent example as their songs are built from sound pulses that are broadcast in a long trill or as a chirped song. This pattern appears to be analyzed on two timescales, short and long. Recent evidence suggests that song recognition in crickets relies on two computations with respect to time; a short linear-nonlinear (LN) model that operates as a filter for pulse rate and a longer integration time window for monitoring song energy over time. Therefore, there is a twofold role for timing. A filter for pulse rate shows differentiating properties for which the specific timing of excitation and inhibition is important. For an integrator, however, the duration of the time window is more important than the precise timing of events. Here, we first review evidence for the role of LN-models and integration time windows for song recognition in crickets. We then parameterize the filter part by Gabor functions and explore the effects of duration, frequency, phase, and offset as these will correspond to differently timed patterns of excitation and inhibition. These filter properties were compared with known preference functions of crickets and katydids. In a comparative approach, the power for song discrimination by LN-models was tested with the songs of over 100 cricket species. It is demonstrated how the acoustic signals of crickets occupy a simple 2-dimensional space for song recognition that arises from timing, described by a Gabor function, and time, the integration window. Finally, we discuss the evolution of recognition systems in insects based on simple sensory computations. PMID:25161622

Gene expression analysis of parthenogenetic embryonic development of the pea aphid, Acyrthosiphon pisum, suggests that aphid parthenogenesis evolved from meiotic oogenesis.

PubMed

Srinivasan, Dayalan G; Abdelhady, Ahmed; Stern, David L

2014-01-01

Aphids exhibit a form of phenotypic plasticity, called polyphenism, in which genetically identical females reproduce sexually during one part of the life cycle and asexually (via parthenogenesis) during the remainder of the life cycle. The molecular basis for aphid parthenogenesis is unknown. Cytological observations of aphid parthenogenesis suggest that asexual oogenesis evolved either through a modification of meiosis or from a mitotic process. As a test of these alternatives, we assessed the expression levels and expression patterns of canonical meiotic recombination and germline genes in the sexual and asexual ovaries of the pea aphid, Acyrthosiphon pisum. We observed expression of all meiosis genes in similar patterns in asexual and sexual ovaries, with the exception that some genes encoding Argonaute-family members were not expressed in sexual ovaries. In addition, we observed that asexual aphid tissues accumulated unspliced transcripts of Spo11, whereas sexual aphid tissues accumulated primarily spliced transcripts. In situ hybridization revealed Spo11 transcript in sexual germ cells and undetectable levels of Spo11 transcript in asexual germ cells. We also found that an obligately asexual strain of pea aphid produced little spliced Spo11 transcript. Together, these results suggest that parthenogenetic oogenesis evolved from a meiosis-like, and not a mitosis-like, process and that the aphid reproductive polyphenism may involve a modification of Spo11 gene activity.

Gene Expression Analysis of Parthenogenetic Embryonic Development of the Pea Aphid, Acyrthosiphon pisum, Suggests That Aphid Parthenogenesis Evolved from Meiotic Oogenesis

PubMed Central

Srinivasan, Dayalan G.; Abdelhady, Ahmed; Stern, David L.

2014-01-01

Aphids exhibit a form of phenotypic plasticity, called polyphenism, in which genetically identical females reproduce sexually during one part of the life cycle and asexually (via parthenogenesis) during the remainder of the life cycle. The molecular basis for aphid parthenogenesis is unknown. Cytological observations of aphid parthenogenesis suggest that asexual oogenesis evolved either through a modification of meiosis or from a mitotic process. As a test of these alternatives, we assessed the expression levels and expression patterns of canonical meiotic recombination and germline genes in the sexual and asexual ovaries of the pea aphid, Acyrthosiphon pisum. We observed expression of all meiosis genes in similar patterns in asexual and sexual ovaries, with the exception that some genes encoding Argonaute-family members were not expressed in sexual ovaries. In addition, we observed that asexual aphid tissues accumulated unspliced transcripts of Spo11, whereas sexual aphid tissues accumulated primarily spliced transcripts. In situ hybridization revealed Spo11 transcript in sexual germ cells and undetectable levels of Spo11 transcript in asexual germ cells. We also found that an obligately asexual strain of pea aphid produced little spliced Spo11 transcript. Together, these results suggest that parthenogenetic oogenesis evolved from a meiosis-like, and not a mitosis-like, process and that the aphid reproductive polyphenism may involve a modification of Spo11 gene activity. PMID:25501006

Evidence for a differential contribution of early perceptual and late cognitive processes during encoding to episodic memory impairment in schizophrenia.

PubMed

Green, Amity E; Fitzgerald, Paul B; Johnston, Patrick J; Nathan, Pradeep J; Kulkarni, Jayashri; Croft, Rodney J

2017-08-01

Schizophrenia is characterised by significant episodic memory impairment that is thought to be related to problems with encoding, however the neuro-functional mechanisms underlying these deficits are not well understood. The present study used a subsequent recognition memory paradigm and event-related potentials (ERPs) to investigate temporal aspects of episodic memory encoding deficits in schizophrenia. Electroencephalographic data was recorded in 24 patients and 19 healthy controls whilst participants categorised single words as pleasant/unpleasant. ERPs were generated to subsequently recognised versus unrecognised words on the basis of a forced-choice recognition memory task. Subsequent memory effects were examined with the late positive component (LPP). Group differences in N1, P2, N400 and LPP were examined for words correctly recognised. Patients performed more poorly than controls on the recognition task. During encoding patients had significantly reduced N400 and LPP amplitudes than controls. LPP amplitude correlated with task performance however amplitudes did not differ between patients and controls as a function of subsequent memory. No significant differences in N1 or P2 amplitude or latency were observed. The present results indicate that early sensory processes are intact and dysfunctional higher order cognitive processes during encoding are contributing to episodic memory impairments in schizophrenia.

Aerobic fitness and executive control of relational memory in preadolescent children.

PubMed

Chaddock, Laura; Hillman, Charles H; Buck, Sarah M; Cohen, Neal J

2011-02-01

the neurocognitive benefits of an active lifestyle in childhood have public health and educational implications, especially as children in today's technological society are becoming increasingly overweight, unhealthy, and unfit. Human and animal studies show that aerobic exercise affects both prefrontal executive control and hippocampal function. This investigation attempts to bridge these research threads by using a cognitive task to examine the relationship between aerobic fitness and executive control of relational memory in preadolescent 9- and 10-yr-old children. higher-fit and lower-fit children studied faces and houses under individual item (i.e., nonrelational) and relational encoding conditions, and the children were subsequently tested with recognition memory trials consisting of previously studied pairs and pairs of completely new items. With each subject participating in both item and relational encoding conditions, and with recognition test trials amenable to the use of both item and relational memory cues, this task afforded a challenge to the flexible use of memory, specifically in the use of appropriate encoding and retrieval strategies. Hence, the task provided a test of both executive control and memory processes. lower-fit children showed poorer recognition memory performance than higher-fit children, selectively in the relational encoding condition. No association between aerobic fitness and recognition performance was found for faces and houses studied as individual items (i.e., nonrelationally). the findings implicate childhood aerobic fitness as a factor in the ability to use effective encoding and retrieval executive control processes for relational memory material and, possibly, in the strategic engagement of prefrontal- and hippocampal-dependent systems.

Use of Biometrics within Sub-Saharan Refugee Communities

DTIC Science & Technology

2013-12-01

fingerprint patterns, iris pattern recognition, and facial recognition as a means of establishing an individual’s identity. Biometrics creates and...Biometrics typically comprises fingerprint patterns, iris pattern recognition, and facial recognition as a means of establishing an individual’s identity...authentication because it identifies an individual based on mathematical analysis of the random pattern visible within the iris. Facial recognition is

The influence of encoding strategy on episodic memory and cortical activity in schizophrenia.

PubMed

Bonner-Jackson, Aaron; Haut, Kristen; Csernansky, John G; Barch, Deanna M

2005-07-01

Recent work suggests that episodic memory deficits in schizophrenia may be related to disturbances of encoding or retrieval. Schizophrenia patients appear to benefit from instruction in episodic memory strategies. We tested the hypothesis that providing effective encoding strategies to schizophrenia patients enhances encoding-related brain activity and recognition performance. Seventeen schizophrenia patients and 26 healthy comparison subjects underwent functional magnetic resonance imaging scans while performing incidental encoding tasks of words and faces. Subjects were required to make either deep (abstract/concrete) or shallow (alphabetization) judgments for words and deep (gender) judgments for faces, followed by subsequent recognition tests. Schizophrenia and comparison subjects recognized significantly more words encoded deeply than shallowly, activated regions in inferior frontal cortex (Brodmann area 45/47) typically associated with deep and successful encoding of words, and showed greater left frontal activation for the processing of words compared with faces. However, during deep encoding and material-specific processing (words vs. faces), participants with schizophrenia activated regions not activated by control subjects, including several in prefrontal cortex. Our findings suggest that a deficit in use of effective strategies influences episodic memory performance in schizophrenia and that abnormalities in functional brain activation persist even when such strategies are applied.

Elevated basal serum tryptase identifies a multisystem disorder associated with increased TPSAB1 copy number.

PubMed

Lyons, Jonathan J; Yu, Xiaomin; Hughes, Jason D; Le, Quang T; Jamil, Ali; Bai, Yun; Ho, Nancy; Zhao, Ming; Liu, Yihui; O'Connell, Michael P; Trivedi, Neil N; Nelson, Celeste; DiMaggio, Thomas; Jones, Nina; Matthews, Helen; Lewis, Katie L; Oler, Andrew J; Carlson, Ryan J; Arkwright, Peter D; Hong, Celine; Agama, Sherene; Wilson, Todd M; Tucker, Sofie; Zhang, Yu; McElwee, Joshua J; Pao, Maryland; Glover, Sarah C; Rothenberg, Marc E; Hohman, Robert J; Stone, Kelly D; Caughey, George H; Heller, Theo; Metcalfe, Dean D; Biesecker, Leslie G; Schwartz, Lawrence B; Milner, Joshua D

2016-12-01

Elevated basal serum tryptase levels are present in 4-6% of the general population, but the cause and relevance of such increases are unknown. Previously, we described subjects with dominantly inherited elevated basal serum tryptase levels associated with multisystem complaints including cutaneous flushing and pruritus, dysautonomia, functional gastrointestinal symptoms, chronic pain, and connective tissue abnormalities, including joint hypermobility. Here we report the identification of germline duplications and triplications in the TPSAB1 gene encoding α-tryptase that segregate with inherited increases in basal serum tryptase levels in 35 families presenting with associated multisystem complaints. Individuals harboring alleles encoding three copies of α-tryptase had higher basal serum levels of tryptase and were more symptomatic than those with alleles encoding two copies, suggesting a gene-dose effect. Further, we found in two additional cohorts (172 individuals) that elevated basal serum tryptase levels were exclusively associated with duplication of α-tryptase-encoding sequence in TPSAB1, and affected individuals reported symptom complexes seen in our initial familial cohort. Thus, our findings link duplications in TPSAB1 with irritable bowel syndrome, cutaneous complaints, connective tissue abnormalities, and dysautonomia.

Rotation-invariant neural pattern recognition system with application to coin recognition.

PubMed

Fukumi, M; Omatu, S; Takeda, F; Kosaka, T

1992-01-01

In pattern recognition, it is often necessary to deal with problems to classify a transformed pattern. A neural pattern recognition system which is insensitive to rotation of input pattern by various degrees is proposed. The system consists of a fixed invariance network with many slabs and a trainable multilayered network. The system was used in a rotation-invariant coin recognition problem to distinguish between a 500 yen coin and a 500 won coin. The results show that the approach works well for variable rotation pattern recognition.

Content-Specific Source Encoding in the Human Medial Temporal Lobe

ERIC Educational Resources Information Center

Awipi, T.; Davachi, L.

2008-01-01

Although the medial temporal lobe (MTL) is known to be essential for episodic encoding, the contributions of individual MTL subregions remain unclear. Data from recognition memory studies have provided evidence that the hippocampus supports relational encoding important for later episodic recollection, whereas the perirhinal cortex has been linked…

Worldwide Practice Patterns in Lynch Syndrome Diagnosis and Management, Based on Data From the International Mismatch Repair Consortium.

PubMed

Pan, Jennifer Y; Haile, Robert W; Templeton, Allyson; Macrae, Finlay; Qin, FeiFei; Sundaram, Vandana; Ladabaum, Uri

2018-04-24

Families with a history of Lynch syndrome often do not adhere to guidelines for genetic testing and screening. We investigated practice patterns related to Lynch syndrome worldwide, to ascertain potential targets for research and public policy efforts. We collected data from the International Mismatch Repair Consortium (IMRC), which comprises major research and clinical groups engaged in the care of families with Lynch syndrome worldwide. IMRC institutions were invited to complete a questionnaire to characterize diagnoses of Lynch syndrome and management practice patterns. Fifty-five providers, representing 63 of 128 member institutions (49%) in 21 countries, completed the questionnaire. For case finding, 55% of respondents reported participating in routine widespread population tumor testing among persons with newly diagnosed Lynch syndrome-associated cancers, whereas 27% reported relying on clinical criteria with selective tumor and/or germline analyses. Most respondents (64%) reported using multigene panels for germline analysis, and only 28% reported testing tumors for biallelic mutations for cases in which suspected pathogenic mutations were not confirmed by germline analysis. Respondents reported relying on passive dissemination of information to at-risk family members, and there was variation in follow through of genetic testing recommendations. Reported risk management practices varied-nearly all programs (98%) recommended colonoscopy every 1 to 2 years, but only 35% recommended chemoprevention with aspirin. There is widespread heterogeneity in management practices for Lynch syndrome worldwide among IMRC member institutions. This may reflect the rapid pace of emerging technology, regional differences in resources, and the lack of definitive data for many clinical questions. Future efforts should focus on the large numbers of high-risk patients without access to state-of-the-art Lynch syndrome management. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.

Development of Encoding and Decision Processes in Visual Recognition.

ERIC Educational Resources Information Center

Newcombe, Nora; MacKenzie, Doris L.

This experiment examined two processes which might account for developmental increases in accuracy in visual recognition tasks: age-related increases in efficiency of scanning during inspection, and age-related increases in the ability to make decisions systematically during test. Critical details necessary for recognition were highlighted as…

Noise-robust speech recognition through auditory feature detection and spike sequence decoding.

PubMed

Schafer, Phillip B; Jin, Dezhe Z

2014-03-01

Speech recognition in noisy conditions is a major challenge for computer systems, but the human brain performs it routinely and accurately. Automatic speech recognition (ASR) systems that are inspired by neuroscience can potentially bridge the performance gap between humans and machines. We present a system for noise-robust isolated word recognition that works by decoding sequences of spikes from a population of simulated auditory feature-detecting neurons. Each neuron is trained to respond selectively to a brief spectrotemporal pattern, or feature, drawn from the simulated auditory nerve response to speech. The neural population conveys the time-dependent structure of a sound by its sequence of spikes. We compare two methods for decoding the spike sequences--one using a hidden Markov model-based recognizer, the other using a novel template-based recognition scheme. In the latter case, words are recognized by comparing their spike sequences to template sequences obtained from clean training data, using a similarity measure based on the length of the longest common sub-sequence. Using isolated spoken digits from the AURORA-2 database, we show that our combined system outperforms a state-of-the-art robust speech recognizer at low signal-to-noise ratios. Both the spike-based encoding scheme and the template-based decoding offer gains in noise robustness over traditional speech recognition methods. Our system highlights potential advantages of spike-based acoustic coding and provides a biologically motivated framework for robust ASR development.

Two are not better than one: Combining unitization and relational encoding strategies.

PubMed

Tu, Hsiao-Wei; Diana, Rachel A

2016-01-01

In recognition memory, recollection is defined as retrieval of the context associated with an event, whereas familiarity is defined as retrieval based on item strength alone. Recent studies have shown that conventional recollection-based tasks, in which context details are manipulated for source memory assessment at test, can also rely on familiarity when context information is "unitized" with the relevant item information at encoding. Unlike naturalistic episodic memories that include many context details encoded in different ways simultaneously, previous studies have focused on unitization and its effect on the recognition of a single context detail. To further understand how various encoding strategies operate on item and context representations, we independently assigned unitization and relational association to 2 context details (size and color) of each item and tested the contribution of recollection and familiarity to source recognition of each detail. The influence of familiarity on retrieval of each context detail was compared as a function of the encoding strategy used for each detail. Receiver operating characteristic curves suggested that the unitization effect was not additive and that similar levels of familiarity occurred for 1 or multiple details when unitization was the only strategy applied during encoding. On the other hand, a detrimental effect was found when relational encoding and unitization were simultaneously applied to 1 item such that a salient nonunitized context detail interfered with the effortful processing required to unitize an accompanying context detail. However, this detrimental effect was not reciprocal and possibly dependent on the nature of individual context details. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

A Cross-Correlated Delay Shift Supervised Learning Method for Spiking Neurons with Application to Interictal Spike Detection in Epilepsy.

PubMed

Guo, Lilin; Wang, Zhenzhong; Cabrerizo, Mercedes; Adjouadi, Malek

2017-05-01

This study introduces a novel learning algorithm for spiking neurons, called CCDS, which is able to learn and reproduce arbitrary spike patterns in a supervised fashion allowing the processing of spatiotemporal information encoded in the precise timing of spikes. Unlike the Remote Supervised Method (ReSuMe), synapse delays and axonal delays in CCDS are variants which are modulated together with weights during learning. The CCDS rule is both biologically plausible and computationally efficient. The properties of this learning rule are investigated extensively through experimental evaluations in terms of reliability, adaptive learning performance, generality to different neuron models, learning in the presence of noise, effects of its learning parameters and classification performance. Results presented show that the CCDS learning method achieves learning accuracy and learning speed comparable with ReSuMe, but improves classification accuracy when compared to both the Spike Pattern Association Neuron (SPAN) learning rule and the Tempotron learning rule. The merit of CCDS rule is further validated on a practical example involving the automated detection of interictal spikes in EEG records of patients with epilepsy. Results again show that with proper encoding, the CCDS rule achieves good recognition performance.

Functional MRI study of diencephalic amnesia in Wernicke-Korsakoff syndrome.

PubMed

Caulo, M; Van Hecke, J; Toma, L; Ferretti, A; Tartaro, A; Colosimo, C; Romani, G L; Uncini, A

2005-07-01

Anterograde amnesia in Wernicke-Korsakoff syndrome is associated with diencephalic lesions, mainly in the anterior thalamic nuclei. Whether diencephalic and temporal lobe amnesias are distinct entities is still not clear. We investigated episodic memory for faces using functional MRI (fMRI) in eight controls and in a 34-year-old man with Wernicke-Korsakoff syndrome and diencephalic lesions but without medial temporal lobe (MTL) involvement at MRI. fMRI was performed with a 1.5 tesla unit. Three dual-choice tasks were employed: (i) face encoding (18 faces were randomly presented three times and subjects were asked to memorize the faces); (ii) face perception (subjects indicated which of two faces matched a third face); and (iii) face recognition (subjects indicated which of two faces belonged to the group they had been asked to memorize during encoding). All activation was greater in the right hemisphere. In controls both the encoding and recognition tasks activated two hippocampal regions (anterior and posterior). The anterior hippocampal region was more activated during recognition. Activation in the prefrontal cortex was greater during recognition. In the subject with Wernicke-Korsakoff syndrome, fMRI did not show hippocampal activation during either encoding or recognition. During recognition, although behavioural data showed defective retrieval, the prefrontal regions were activated as in controls, except for the ventrolateral prefrontal cortex. fMRI activation of the visual cortices and the behavioural score on the perception task indicated that the subject with Wernicke-Korsakoff syndrome perceived the faces, paid attention to the task and demonstrated accurate judgement. In the subject with Wernicke-Korsakoff syndrome, although the anatomical damage does not involve the MTL, the hippocampal memory encoding has been lost, possibly as a consequence of the hippocampal-anterior thalamic axis involvement. Anterograde amnesia could therefore be the expression of damage to an extended hippocampal system, and the distinction between temporal lobe and diencephalic amnesia has limited value. In the subject with Wernicke-Korsakoff syndrome, the preserved dorsolateral prefrontal cortex activation during incorrect recognition suggests that this region is more involved in either the orientation or attention at retrieval than in retrieval. The lack of activation of the prefrontal ventrolateral cortex confirms the role of this area in episodic memory formation.

The CCR4 Deadenylase Acts with Nanos and Pumilio in the Fine-Tuning of Mei-P26 Expression to Promote Germline Stem Cell Self-Renewal

PubMed Central

Joly, Willy; Chartier, Aymeric; Rojas-Rios, Patricia; Busseau, Isabelle; Simonelig, Martine

2013-01-01

Summary Translational regulation plays an essential role in Drosophila ovarian germline stem cell (GSC) biology. GSC self-renewal requires two translational repressors, Nanos (Nos) and Pumilio (Pum), which repress the expression of differentiation factors in the stem cells. The molecular mechanisms underlying this translational repression remain unknown. Here, we show that the CCR4 deadenylase is required for GSC self-renewal and that Nos and Pum act through its recruitment onto specific mRNAs. We identify mei-P26 mRNA as a direct and major target of Nos/Pum/CCR4 translational repression in the GSCs. mei-P26 encodes a protein of the Trim-NHL tumor suppressor family that has conserved functions in stem cell lineages. We show that fine-tuning Mei-P26 expression by CCR4 plays a key role in GSC self-renewal. These results identify the molecular mechanism of Nos/Pum function in GSC self-renewal and reveal the role of CCR4-NOT-mediated deadenylation in regulating the balance between GSC self-renewal and differentiation. PMID:24286029

The CCR4 deadenylase acts with Nanos and Pumilio in the fine-tuning of Mei-P26 expression to promote germline stem cell self-renewal.

PubMed

Joly, Willy; Chartier, Aymeric; Rojas-Rios, Patricia; Busseau, Isabelle; Simonelig, Martine

2013-01-01

Translational regulation plays an essential role in Drosophila ovarian germline stem cell (GSC) biology. GSC self-renewal requires two translational repressors, Nanos (Nos) and Pumilio (Pum), which repress the expression of differentiation factors in the stem cells. The molecular mechanisms underlying this translational repression remain unknown. Here, we show that the CCR4 deadenylase is required for GSC self-renewal and that Nos and Pum act through its recruitment onto specific mRNAs. We identify mei-P26 mRNA as a direct and major target of Nos/Pum/CCR4 translational repression in the GSCs. mei-P26 encodes a protein of the Trim-NHL tumor suppressor family that has conserved functions in stem cell lineages. We show that fine-tuning Mei-P26 expression by CCR4 plays a key role in GSC self-renewal. These results identify the molecular mechanism of Nos/Pum function in GSC self-renewal and reveal the role of CCR4-NOT-mediated deadenylation in regulating the balance between GSC self-renewal and differentiation.

A team of heterochromatin factors collaborates with small RNA pathways to combat repetitive elements and germline stress

PubMed Central

McMurchy, Alicia N; Stempor, Przemyslaw; Gaarenstroom, Tessa; Wysolmerski, Brian; Dong, Yan; Aussianikava, Darya; Appert, Alex; Huang, Ni; Kolasinska-Zwierz, Paulina; Sapetschnig, Alexandra; Miska, Eric A; Ahringer, Julie

2017-01-01

Repetitive sequences derived from transposons make up a large fraction of eukaryotic genomes and must be silenced to protect genome integrity. Repetitive elements are often found in heterochromatin; however, the roles and interactions of heterochromatin proteins in repeat regulation are poorly understood. Here we show that a diverse set of C. elegans heterochromatin proteins act together with the piRNA and nuclear RNAi pathways to silence repetitive elements and prevent genotoxic stress in the germ line. Mutants in genes encoding HPL-2/HP1, LIN-13, LIN-61, LET-418/Mi-2, and H3K9me2 histone methyltransferase MET-2/SETDB1 also show functionally redundant sterility, increased germline apoptosis, DNA repair defects, and interactions with small RNA pathways. Remarkably, fertility of heterochromatin mutants could be partially restored by inhibiting cep-1/p53, endogenous meiotic double strand breaks, or the expression of MIRAGE1 DNA transposons. Functional redundancy among factors and pathways underlies the importance of safeguarding the genome through multiple means. DOI: http://dx.doi.org/10.7554/eLife.21666.001 PMID:28294943

Insights into wild-type and mutant p53 functions provided by genetically engineered mice.

PubMed

Donehower, Lawrence A

2014-06-01

Recent whole-exome sequencing studies of numerous human cancers have now conclusively shown that the TP53 tumor-suppressor gene is the most frequently mutated gene in human cancers. Despite extensive studies of the TP53 gene and its encoded protein (p53), our understanding of how TP53 mutations contribute to cancer initiation and progression remain incomplete. Genetically engineered mice with germline or inducible Trp53 somatic mutations have provided important insights into the mechanisms by which different types of p53 mutation influence cancer development. Trp53 germline mutations that alter specific p53 structural domains or posttranslation modification sites have benefitted our understanding of wild-type p53 functions in a whole organism context. Moreover, genetic approaches to reestablish functional wild-type p53 to p53-deficient tissues and tumors have increased our understanding of the therapeutic potential of restoring functional p53 signaling to cancers. This review outlines many of the key insights provided by the various categories of Trp53 mutant mice that have been generated by multiple genetic engineering approaches. © 2014 WILEY PERIODICALS, INC.

Mouse mutants from chemically mutagenized embryonic stem cells

PubMed Central

Munroe, Robert J.; Bergstrom, Rebecca A.; Zheng, Qing Yin; Libby, Brian; Smith, Richard; John, Simon W.M.; Schimenti, Kerry J.; Browning, Victoria L.; Schimenti, John C.

2010-01-01

The drive to characterize functions of human genes on a global scale has stimulated interest in large-scale generation of mouse mutants. Conventional germ-cell mutagenesis with N-ethyl-N-nitrosourea (ENU) is compromised by an inability to monitor mutation efficiency, strain1 and interlocus2 variation in mutation induction, and extensive husbandry requirements. To overcome these obstacles and develop new methods for generating mouse mutants, we devised protocols to generate germline chi-maeric mice from embryonic stem (ES) cells heavily mutagenized with ethylmethanesulphonate (EMS). Germline chimaeras were derived from cultures that underwent a mutation rate of up to 1 in 1,200 at the Hprt locus (encoding hypoxanthine guanine phosphoribosyl transferase). The spectrum of mutations induced by EMS and the frameshift mutagen ICR191 was consistent with that observed in other mammalian cells. Chimaeras derived from ES cells treated with EMS transmitted mutations affecting several processes, including limb development, hair growth, hearing and gametogenesis. This technology affords several advantages over traditional mutagenesis, including the ability to conduct shortened breeding schemes and to screen for mutant phenotypes directly in ES cells or their differentiated derivatives. PMID:10700192

A Recurrent Mutation in PARK2 Is Associated with Familial Lung Cancer

PubMed Central

Xiong, Donghai; Wang, Yian; Kupert, Elena; Simpson, Claire; Pinney, Susan M.; Gaba, Colette R.; Mandal, Diptasri; Schwartz, Ann G.; Yang, Ping; de Andrade, Mariza; Pikielny, Claudio; Byun, Jinyoung; Li, Yafang; Stambolian, Dwight; Spitz, Margaret R.; Liu, Yanhong; Amos, Christopher I.; Bailey-Wilson, Joan E.; Anderson, Marshall; You, Ming

2015-01-01

PARK2, a gene associated with Parkinson disease, is a tumor suppressor in human malignancies. Here, we show that c.823C>T (p.Arg275Trp), a germline mutation in PARK2, is present in a family with eight cases of lung cancer. The resulting amino acid change, p.Arg275Trp, is located in the highly conserved RING finger 1 domain of PARK2, which encodes an E3 ubiquitin ligase. Upon further analysis, the c.823C>T mutation was detected in three additional families affected by lung cancer. The effect size for PARK2 c.823C>T (odds ratio = 5.24) in white individuals was larger than those reported for variants from lung cancer genome-wide association studies. These data implicate this PARK2 germline mutation as a genetic susceptibility factor for lung cancer. Our results provide a rationale for further investigations of this specific mutation and gene for evaluation of the possibility of developing targeted therapies against lung cancer in individuals with PARK2 variants by compensating for the loss-of-function effect caused by the associated variation. PMID:25640678

Local binary pattern variants-based adaptive texture features analysis for posed and nonposed facial expression recognition

NASA Astrophysics Data System (ADS)

Sultana, Maryam; Bhatti, Naeem; Javed, Sajid; Jung, Soon Ki

2017-09-01

Facial expression recognition (FER) is an important task for various computer vision applications. The task becomes challenging when it requires the detection and encoding of macro- and micropatterns of facial expressions. We present a two-stage texture feature extraction framework based on the local binary pattern (LBP) variants and evaluate its significance in recognizing posed and nonposed facial expressions. We focus on the parametric limitations of the LBP variants and investigate their effects for optimal FER. The size of the local neighborhood is an important parameter of the LBP technique for its extraction in images. To make the LBP adaptive, we exploit the granulometric information of the facial images to find the local neighborhood size for the extraction of center-symmetric LBP (CS-LBP) features. Our two-stage texture representations consist of an LBP variant and the adaptive CS-LBP features. Among the presented two-stage texture feature extractions, the binarized statistical image features and adaptive CS-LBP features were found showing high FER rates. Evaluation of the adaptive texture features shows competitive and higher performance than the nonadaptive features and other state-of-the-art approaches, respectively.

Cellulose and hemicellulose-degrading enzymes in Fusarium commune transcriptome and functional characterization of three identified xylanases.

PubMed

Huang, Yuhong; Busk, Peter Kamp; Lange, Lene

2015-06-01

Specific enzymes from plant-pathogenic microbes demonstrate high effectiveness for natural lignocellulosic biomass degradation and utilization. The secreted lignocellulolytic enzymes of Fusarium species have not been investigated comprehensively, however. In this study we compared cellulose and hemicellulose-degrading enzymes of classical fungal enzyme producers with those of Fusarium species. The results indicated that Fusarium species are robust cellulose and hemicellulose degraders. Wheat bran, carboxymethylcellulose and xylan-based growth media induced a broad spectrum of lignocellulolytic enzymes in Fusarium commune. Prediction of the cellulose and hemicellulose-degrading enzymes in the F. commune transcriptome using peptide pattern recognition revealed 147 genes encoding glycoside hydrolases and six genes encoding lytic polysaccharide monooxygenases (AA9 and AA11), including all relevant cellulose decomposing enzymes (GH3, GH5, GH6, GH7, GH9, GH45 and AA9), and abundant hemicellulases. We further applied peptide pattern recognition to reveal nine and seven subfamilies of GH10 and GH11 family enzymes, respectively. The uncharacterized XYL10A, XYL10B and XYL11 enzymes of F. commune were classified, respectively, into GH10 subfamily 1, subfamily 3 and GH11 subfamily 1. These xylanases were successfully expressed in the PichiaPink™ system with the following properties: the purified recombinant XYL10A had interesting high specific activity; XYL10B was active at alkaline conditions with both endo-1,4-β-d-xylanase and β-xylosidase activities; and XYL11 was a true xylanase characterized by high substrate specificity. These results indicate that F. commune with genetic modification is a promising source of enzymes for the decomposition of lignocellulosic biomass. Copyright © 2015 Elsevier Inc. All rights reserved.

AluY-mediated germline deletion, duplication and somatic stem cell reversion in UBE2T defines a new subtype of Fanconi anemia.

PubMed

Virts, Elizabeth L; Jankowska, Anna; Mackay, Craig; Glaas, Marcel F; Wiek, Constanze; Kelich, Stephanie L; Lottmann, Nadine; Kennedy, Felicia M; Marchal, Christophe; Lehnert, Erik; Scharf, Rüdiger E; Dufour, Carlo; Lanciotti, Marina; Farruggia, Piero; Santoro, Alessandra; Savasan, Süreyya; Scheckenbach, Kathrin; Schipper, Jörg; Wagenmann, Martin; Lewis, Todd; Leffak, Michael; Farlow, Janice L; Foroud, Tatiana M; Honisch, Ellen; Niederacher, Dieter; Chakraborty, Sujata C; Vance, Gail H; Pruss, Dmitry; Timms, Kirsten M; Lanchbury, Jerry S; Alpi, Arno F; Hanenberg, Helmut

2015-09-15

Fanconi anemia (FA) is a rare inherited disorder clinically characterized by congenital malformations, progressive bone marrow failure and cancer susceptibility. At the cellular level, FA is associated with hypersensitivity to DNA-crosslinking genotoxins. Eight of 17 known FA genes assemble the FA E3 ligase complex, which catalyzes monoubiquitination of FANCD2 and is essential for replicative DNA crosslink repair. Here, we identify the first FA patient with biallelic germline mutations in the ubiquitin E2 conjugase UBE2T. Both mutations were aluY-mediated: a paternal deletion and maternal duplication of exons 2-6. These loss-of-function mutations in UBE2T induced a cellular phenotype similar to biallelic defects in early FA genes with the absence of FANCD2 monoubiquitination. The maternal duplication produced a mutant mRNA that could encode a functional protein but was degraded by nonsense-mediated mRNA decay. In the patient's hematopoietic stem cells, the maternal allele with the duplication of exons 2-6 spontaneously reverted to a wild-type allele by monoallelic recombination at the duplicated aluY repeat, thereby preventing bone marrow failure. Analysis of germline DNA of 814 normal individuals and 850 breast cancer patients for deletion or duplication of UBE2T exons 2-6 identified the deletion in only two controls, suggesting aluY-mediated recombinations within the UBE2T locus are rare and not associated with an increased breast cancer risk. Finally, a loss-of-function germline mutation in UBE2T was detected in a high-risk breast cancer patient with wild-type BRCA1/2. Cumulatively, we identified UBE2T as a bona fide FA gene (FANCT) that also may be a rare cancer susceptibility gene. © The Author 2015. Published by Oxford University Press.

The homeobox gene mirror links EGF signalling to embryonic dorso-ventral axis formation through notch activation.

PubMed

Jordan, K C; Clegg, N J; Blasi, J A; Morimoto, A M; Sen, J; Stein, D; McNeill, H; Deng, W M; Tworoger, M; Ruohola-Baker, H

2000-04-01

Recent studies in vertebrates and Drosophila melanogaster have revealed that Fringe-mediated activation of the Notch pathway has a role in patterning cell layers during organogenesis. In these processes, a homeobox-containing transcription factor is responsible for spatially regulating fringe (fng) expression and thus directing activation of the Notch pathway along the fng expression border. Here we show that this may be a general mechanism for patterning epithelial cell layers. At three stages in Drosophila oogenesis, mirror (mirr) and fng have complementary expression patterns in the follicle-cell epithelial layer, and at all three stages loss of mirr enlarges, and ectopic expression of mirr restricts, fng expression, with consequences for follicle-cell patterning. These morphological changes are similar to those caused by Notch mutations. Ectopic expression of mirr in the posterior follicle cells induces a stripe of rhomboid (rho) expression and represses pipe (pip), a gene with a role in the establishment of the dorsal-ventral axis, at a distance. Ectopic Notch activation has a similar long-range effect on pip. Our results suggest that Mirror and Notch induce secretion of diffusible morphogens and we have identified TGF-beta (encoded by dpp) as such a molecule in germarium. We also found that mirr expression in dorsal follicle cells is induced by the EGF-receptor (EGFR) pathway and that mirr then represses pip expression in all but the ventral follicle cells, connecting EGFR activation in the dorsal follicle cells to repression of pip in the dorsal and lateral follicle cells. Our results suggest that the differentiation of ventral follicle cells is not a direct consequence of germline signalling, but depends on long-range signals from dorsal follicle cells, and provide a link between early and late events in Drosophila embryonic dorsal-ventral axis formation.

Audiovisual semantic congruency during encoding enhances memory performance.

PubMed

Heikkilä, Jenni; Alho, Kimmo; Hyvönen, Heidi; Tiippana, Kaisa

2015-01-01

Studies of memory and learning have usually focused on a single sensory modality, although human perception is multisensory in nature. In the present study, we investigated the effects of audiovisual encoding on later unisensory recognition memory performance. The participants were to memorize auditory or visual stimuli (sounds, pictures, spoken words, or written words), each of which co-occurred with either a semantically congruent stimulus, incongruent stimulus, or a neutral (non-semantic noise) stimulus in the other modality during encoding. Subsequent memory performance was overall better when the stimulus to be memorized was initially accompanied by a semantically congruent stimulus in the other modality than when it was accompanied by a neutral stimulus. These results suggest that semantically congruent multisensory experiences enhance encoding of both nonverbal and verbal materials, resulting in an improvement in their later recognition memory.

Study of the Gray Scale, Polychromatic, Distortion Invariant Neural Networks Using the Ipa Model.

NASA Astrophysics Data System (ADS)

Uang, Chii-Maw

Research in the optical neural network field is primarily motivated by the fact that humans recognize objects better than the conventional digital computers and the massively parallel inherent nature of optics. This research represents a continuous effort during the past several years in the exploitation of using neurocomputing for pattern recognition. Based on the interpattern association (IPA) model and Hamming net model, many new systems and applications are introduced. A gray level discrete associative memory that is based on object decomposition/composition is proposed for recognizing gray-level patterns. This technique extends the processing ability from the binary mode to gray-level mode, and thus the information capacity is increased. Two polychromatic optical neural networks using color liquid crystal television (LCTV) panels for color pattern recognition are introduced. By introducing a color encoding technique in conjunction with the interpattern associative algorithm, a color associative memory was realized. Based on the color decomposition and composition technique, a color exemplar-based Hamming net was built for color image classification. A shift-invariant neural network is presented through use of the translation invariant property of the modulus of the Fourier transformation and the hetero-associative interpattern association (IPA) memory. To extract the main features, a quadrantal sampling method is used to sampled data and then replace the training patterns. Using the concept of hetero-associative memory to recall the distorted object. A shift and rotation invariant neural network using an interpattern hetero-association (IHA) model is presented. To preserve the shift and rotation invariant properties, a set of binarized-encoded circular harmonic expansion (CHE) functions at the Fourier domain is used as the training set. We use the shift and symmetric properties of the modulus of the Fourier spectrum to avoid the problem of centering the CHE functions. Almost all neural networks have the positive and negative weights, which increases the difficulty of optical implementation. A method to construct a unipolar IPA IWM is discussed. By searching the redundant interconnection links, an effective way that removes all negative links is discussed.

NLRP7 affects trophoblast lineage differentiation, binds to overexpressed YY1 and alters CpG methylation

USDA-ARS?s Scientific Manuscript database

Maternal-effect mutations in NLRP7 cause rare biparentally inherited hydatidiform moles (BiHMs), abnormal pregnancies containing hypertrophic vesicular trophoblast but no embryo. BiHM trophoblasts display abnormal DNA methylation patterns affecting maternally methylated germline differentially methy...

Asymmetric effects of emotion on mnemonic interference

PubMed Central

Leal, Stephanie L.; Tighe, Sarah K.; Yassa, Michael A.

2014-01-01

Emotional experiences can strengthen memories so that they can be used to guide future behavior. Emotional arousal, mediated by the amygdala, is thought to modulate storage by the hippocampus, which may encode unique episodic memories via pattern separation – the process by which similar memories are stored using non-overlapping representations. While prior work has examined mnemonic interference due to similarity and emotional modulation of memory independently, examining the mechanisms by which emotion influences mnemonic interference has not been previously accomplished in humans. To this end, we developed an emotional memory task where emotional content and stimulus similarity were varied to examine the effect of emotion on fine mnemonic discrimination (a putative behavioral correlate of hippocampal pattern separation). When tested immediately after encoding, discrimination was reduced for similar emotional items compared to similar neutral items, consistent with a reduced bias towards pattern separation. After 24 h, recognition of emotional target items was preserved compared to neutral items, whereas similar emotional item discrimination was further diminished. This suggests a potential mechanism for the emotional modulation of memory with a selective remembering of gist, as well as a selective forgetting of detail, indicating an emotion-induced reduction in pattern separation. This can potentially increase the effective signal-to-noise ratio in any given situation to promote survival. Furthermore, we found that individuals with depressive symptoms hyper-discriminate negative items, which correlated with their symptom severity. This suggests that utilizing mnemonic discrimination paradigms allows us to tease apart the nuances of disorders with aberrant emotional mnemonic processing. PMID:24607286

Navon letters affect face learning and face retrieval.

PubMed

Lewis, Michael B; Mills, Claire; Hills, Peter J; Weston, Nicola

2009-01-01

Identifying the local letters of a Navon letter (a large letter made up of smaller different letters) prior to recognition causes impairment in accuracy, while identifying the global letters of a Navon letter causes an enhancement in recognition accuracy (Macrae & Lewis, 2002). This effect may result from a transfer-inappropriate processing shift (TIPS) (Schooler, 2002). The present experiment extends research on the underlying mechanism of this effect by exploring this Navon effect on face learning as well as face recognition. The results of the two experiments revealed that when the Navon task used at retrieval was the same as that used at encoding then the performance accuracy is enhanced, whereas when the processing operations mismatch at retrieval and at encoding, this impairs recognition accuracy. These results provide support for the TIPS explanation of the Navon effect.

Innexin2 gap junctions in somatic support cells are required for cyst formation and for egg chamber formation in Drosophila.

PubMed

Mukai, Masanori; Kato, Hirotaka; Hira, Seiji; Nakamura, Katsuhiro; Kita, Hiroaki; Kobayashi, Satoru

2011-01-01

Germ cells require intimate associations with surrounding somatic cells during gametogenesis. During oogenesis, gap junctions mediate communication between germ cells and somatic support cells. However, the molecular mechanisms by which gap junctions regulate the developmental processes during oogenesis are poorly understood. We have identified a female sterile allele of innexin2 (inx2), which encodes a gap junction protein in Drosophila. In females bearing this inx2 allele, cyst formation and egg chamber formation are impaired. In wild-type germaria, Inx2 is strongly expressed in escort cells and follicle cells, both of which make close contact with germline cells. We show that inx2 function in germarial somatic cells is required for the survival of early germ cells and promotes cyst formation, probably downstream of EGFR pathway, and that inx2 function in follicle cells promotes egg chamber formation through the regulation of DE-cadherin and Bazooka (Baz) at the boundary between germ cells and follicle cells. Furthermore, genetic experiments demonstrate that inx2 interacts with the zero population growth (zpg) gene, which encodes a germline-specific gap junction protein. These results indicate a multifunctional role for Inx2 gap junctions in somatic support cells in the regulation of early germ cell survival, cyst formation and egg chamber formation. Inx2 gap junctions may mediate the transfer of nutrients and signal molecules between germ cells and somatic support cells, as well as play a role in the regulation of cell adhesion. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Rated Measures of Narrative Structure for Written Smoking-Cessation Texts

PubMed Central

Sanders-Jackson, Ashley

2014-01-01

This article describes the effect of a series of rated measures of narrative structure on recognition memory, agreement on story-relevant beliefs, and intention to engage in a health-related behavior—in this case smoking cessation. Using short smoking-cessation stories as stimuli, data were collected in a nationally representative sample of adult smokers (n = 1,312). Results suggested that messages rated as more sequential improved encoding and messages rated as containing more context decreased encoding. Messages rated high in transportation were associated with increased recognition, agreement with story-relevant beliefs, and intention to quit. Both positive and negative emotion were positively associated with intention to quit, but were negatively associated with recognition memory. PMID:24447036

Biased Immunoglobulin Light Chain Gene Usage in the Shark.

PubMed

Iacoangeli, Anna; Lui, Anita; Naik, Ushma; Ohta, Yuko; Flajnik, Martin; Hsu, Ellen

2015-10-15

This study of a large family of κ L chain clusters in nurse shark completes the characterization of its classical Ig gene content (two H chain isotypes, μ and ω, and four L chain isotypes, κ, λ, σ, and σ-2). The shark κ clusters are minigenes consisting of a simple VL-JL-CL array, where V to J recombination occurs over an ~500-bp interval, and functional clusters are widely separated by at least 100 kb. Six out of ~39 κ clusters are prerearranged in the germline (germline joined). Unlike the complex gene organization and multistep assembly process of Ig in mammals, each shark Ig rearrangement, somatic or in the germline, appears to be an independent event localized to the minigene. This study examined the expression of functional, nonproductive, and sterile transcripts of the κ clusters compared with the other three L chain isotypes. κ cluster usage was investigated in young sharks, and a skewed pattern of split gene expression was observed, one similar in functional and nonproductive rearrangements. These results show that the individual activation of the spatially distant κ clusters is nonrandom. Although both split and germline-joined κ genes are expressed, the latter are prominent in young animals and wane with age. We speculate that, in the shark, the differential activation of the multiple isotypes can be advantageously used in receptor editing. Copyright © 2015 by The American Association of Immunologists, Inc.

Sex chromosome-specific regulation in the Drosophila male germline but little evidence for chromosomal dosage compensation or meiotic inactivation.

PubMed

Meiklejohn, Colin D; Landeen, Emily L; Cook, Jodi M; Kingan, Sarah B; Presgraves, Daven C

2011-08-01

The evolution of heteromorphic sex chromosomes (e.g., XY in males or ZW in females) has repeatedly elicited the evolution of two kinds of chromosome-specific regulation: dosage compensation--the equalization of X chromosome gene expression in males and females--and meiotic sex chromosome inactivation (MSCI)--the transcriptional silencing and heterochromatinization of the X during meiosis in the male (or Z in the female) germline. How the X chromosome is regulated in the Drosophila melanogaster male germline is unclear. Here we report three new findings concerning gene expression from the X in Drosophila testes. First, X chromosome-wide dosage compensation appears to be absent from most of the Drosophila male germline. Second, microarray analysis provides no evidence for X chromosome-specific inactivation during meiosis. Third, we confirm the previous discovery that the expression of transgene reporters driven by autosomal spermatogenesis-specific promoters is strongly reduced when inserted on the X chromosome versus the autosomes; but we show that this chromosomal difference in expression is established in premeiotic cells and persists in meiotic cells. The magnitude of the X-autosome difference in transgene expression cannot be explained by the absence of dosage compensation, suggesting that a previously unrecognized mechanism limits expression from the X during spermatogenesis in Drosophila. These findings help to resolve several previously conflicting reports and have implications for patterns of genome evolution and speciation in Drosophila.

Encoding Strategies in Primary School Children: Insights from an Eye-Tracking Approach and the Role of Individual Differences in Attentional Control

ERIC Educational Resources Information Center

Roebers, Claudia M.; Schmid, Corinne; Roderer, Thomas

2010-01-01

The authors explored different aspects of encoding strategy use in primary school children by including (a) an encoding strategy task in which children's encoding strategy use was recorded through a remote eye-tracking device and, later, free recall and recognition for target items was assessed; and (b) tasks measuring resistance to interference…

BRCA Mutation Frequency and Patterns of Treatment Response in BRCA Mutation–Positive Women With Ovarian Cancer: A Report From the Australian Ovarian Cancer Study Group

PubMed Central

Alsop, Kathryn; Fereday, Sian; Meldrum, Cliff; deFazio, Anna; Emmanuel, Catherine; George, Joshy; Dobrovic, Alexander; Birrer, Michael J.; Webb, Penelope M.; Stewart, Colin; Friedlander, Michael; Fox, Stephen; Bowtell, David; Mitchell, Gillian

2012-01-01

Purpose The frequency of BRCA1 and BRCA2 germ-line mutations in women with ovarian cancer is unclear; reports vary from 3% to 27%. The impact of germ-line mutation on response requires further investigation to understand its impact on treatment planning and clinical trial design. Patients and Methods Women with nonmucinous ovarian carcinoma (n = 1,001) enrolled onto a population-based, case-control study were screened for point mutations and large deletions in both genes. Survival outcomes and responses to multiple lines of chemotherapy were assessed. Results Germ-line mutations were found in 14.1% of patients overall, including 16.6% of serous cancer patients (high-grade serous, 22.6%); 44% had no reported family history of breast or ovarian cancer. Patients carrying germ-line mutations had improved rates of progression-free and overall survival. In the relapse setting, patients carrying mutations more frequently responded to both platin- and nonplatin-based regimens than mutation-negative patients, even in patients with early relapse after primary treatment. Mutation-negative patients who responded to multiple cycles of platin-based treatment were more likely to carry somatic BRCA1/2 mutations. Conclusion BRCA mutation status has a major influence on survival in ovarian cancer patients and should be an additional stratification factor in clinical trials. Treatment outcomes in BRCA1/2 carriers challenge conventional definitions of platin resistance, and mutation status may be able to contribute to decision making and systemic therapy selection in the relapse setting. Our data, together with the advent of poly(ADP-ribose) polymerase inhibitor trials, supports the recommendation that germ-line BRCA1/2 testing should be offered to all women diagnosed with nonmucinous, ovarian carcinoma, regardless of family history. PMID:22711857

Medial prefrontal cortex supports source memory accuracy for self-referenced items.

PubMed

Leshikar, Eric D; Duarte, Audrey

2012-01-01

Previous behavioral work suggests that processing information in relation to the self enhances subsequent item recognition. Neuroimaging evidence further suggests that regions along the cortical midline, particularly those of the medial prefrontal cortex (PFC), underlie this benefit. There has been little work to date, however, on the effects of self-referential encoding on source memory accuracy or whether the medial PFC might contribute to source memory for self-referenced materials. In the current study, we used fMRI to measure neural activity while participants studied and subsequently retrieved pictures of common objects superimposed on one of two background scenes (sources) under either self-reference or self-external encoding instructions. Both item recognition and source recognition were better for objects encoded self-referentially than self-externally. Neural activity predictive of source accuracy was observed in the medial PFC (Brodmann area 10) at the time of study for self-referentially but not self-externally encoded objects. The results of this experiment suggest that processing information in relation to the self leads to a mnemonic benefit for source level features, and that activity in the medial PFC contributes to this source memory benefit. This evidence expands the purported role that the medial PFC plays in self-referencing.

The Role of Executive Control of Attention and Selective Encoding for Preschoolers' Learning

ERIC Educational Resources Information Center

Roderer, Thomas; Krebs, Saskia; Schmid, Corinne; Roebers, Claudia M.

2012-01-01

Selectivity in encoding, aspects of attentional control and their contribution to learning performance were explored in a sample of preschoolers. While the children are performing a learning task, their encoding of relevant and attention towards irrelevant information was recorded through an eye-tracking device. Recognition of target items was…

Speech perception as an active cognitive process

PubMed Central

Heald, Shannon L. M.; Nusbaum, Howard C.

2014-01-01

One view of speech perception is that acoustic signals are transformed into representations for pattern matching to determine linguistic structure. This process can be taken as a statistical pattern-matching problem, assuming realtively stable linguistic categories are characterized by neural representations related to auditory properties of speech that can be compared to speech input. This kind of pattern matching can be termed a passive process which implies rigidity of processing with few demands on cognitive processing. An alternative view is that speech recognition, even in early stages, is an active process in which speech analysis is attentionally guided. Note that this does not mean consciously guided but that information-contingent changes in early auditory encoding can occur as a function of context and experience. Active processing assumes that attention, plasticity, and listening goals are important in considering how listeners cope with adverse circumstances that impair hearing by masking noise in the environment or hearing loss. Although theories of speech perception have begun to incorporate some active processing, they seldom treat early speech encoding as plastic and attentionally guided. Recent research has suggested that speech perception is the product of both feedforward and feedback interactions between a number of brain regions that include descending projections perhaps as far downstream as the cochlea. It is important to understand how the ambiguity of the speech signal and constraints of context dynamically determine cognitive resources recruited during perception including focused attention, learning, and working memory. Theories of speech perception need to go beyond the current corticocentric approach in order to account for the intrinsic dynamics of the auditory encoding of speech. In doing so, this may provide new insights into ways in which hearing disorders and loss may be treated either through augementation or therapy. PMID:24672438

A galectin from Eriocheir sinensis functions as pattern recognition receptor enhancing microbe agglutination and haemocytes encapsulation.

PubMed

Wang, Mengqiang; Wang, Lingling; Huang, Mengmeng; Yi, Qilin; Guo, Ying; Gai, Yunchao; Wang, Hao; Zhang, Huan; Song, Linsheng

2016-08-01

Galectins are a family of β-galactoside binding lectins that function as pattern recognition receptors (PRRs) in innate immune system of both vertebrates and invertebrates. The cDNA of Chinese mitten crab Eriocheir sinensis galectin (designated as EsGal) was cloned via rapid amplification of cDNA ends (RACE) technique based on expressed sequence tags (ESTs) analysis. The full-length cDNA of EsGal was 999 bp. Its open reading frame encoded a polypeptide of 218 amino acids containing a GLECT/Gal-bind_lectin domain and a proline/glycine rich low complexity region. The deduced amino acid sequence and domain organization of EsGal were highly similar to those of crustacean galectins. The mRNA transcripts of EsGal were found to be constitutively expressed in a wide range of tissues and mainly in hepatopancreas, gill and haemocytes. The mRNA expression level of EsGal increased rapidly and significantly after crabs were stimulated by different microbes. The recombinant EsGal (rEsGal) could bind various pathogen-associated molecular patterns (PAMPs), including lipopolysaccharide (LPS), peptidoglycan (PGN) and glucan (GLU), and exhibited strong activity to agglutinate Escherichia coli, Vibrio anguillarum, Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus and Pichia pastoris, and such agglutinating activity could be inhibited by both d-galactose and α-lactose. The in vitro encapsulation assay revealed that rEsGal could enhance the encapsulation of haemocytes towards agarose beads. These results collectively suggested that EsGal played crucial roles in the immune recognition and elimination of pathogens and contributed to the innate immune response against various microbes in crabs. Copyright © 2016 Elsevier Ltd. All rights reserved.

Modelling Odor Decoding in the Antennal Lobe by Combining Sequential Firing Rate Models with Bayesian Inference

PubMed Central

Cuevas Rivera, Dario; Bitzer, Sebastian; Kiebel, Stefan J.

2015-01-01

The olfactory information that is received by the insect brain is encoded in the form of spatiotemporal patterns in the projection neurons of the antennal lobe. These dense and overlapping patterns are transformed into a sparse code in Kenyon cells in the mushroom body. Although it is clear that this sparse code is the basis for rapid categorization of odors, it is yet unclear how the sparse code in Kenyon cells is computed and what information it represents. Here we show that this computation can be modeled by sequential firing rate patterns using Lotka-Volterra equations and Bayesian online inference. This new model can be understood as an ‘intelligent coincidence detector’, which robustly and dynamically encodes the presence of specific odor features. We found that the model is able to qualitatively reproduce experimentally observed activity in both the projection neurons and the Kenyon cells. In particular, the model explains mechanistically how sparse activity in the Kenyon cells arises from the dense code in the projection neurons. The odor classification performance of the model proved to be robust against noise and time jitter in the observed input sequences. As in recent experimental results, we found that recognition of an odor happened very early during stimulus presentation in the model. Critically, by using the model, we found surprising but simple computational explanations for several experimental phenomena. PMID:26451888

Genetics Home Reference: Meier-Gorlin syndrome

MedlinePlus

... ORC1, encoding the largest subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin ... M, Skidmore DL, Samuels ME. Mutations in origin recognition complex gene ORC4 cause Meier-Gorlin syndrome. Nat ...

The role of hippocampus dysfunction in deficient memory encoding and positive symptoms in schizophrenia.

PubMed

Zierhut, Kathrin; Bogerts, Bernhard; Schott, Björn; Fenker, Daniela; Walter, Martin; Albrecht, Dominik; Steiner, Johann; Schütze, Hartmut; Northoff, Georg; Düzel, Emrah; Schiltz, Kolja

2010-09-30

Declarative memory disturbances, known to substantially contribute to cognitive impairment in schizophrenia, have previously been attributed to prefrontal as well as hippocampal dysfunction. To characterize the role of prefrontal and mesolimbic/hippocampal dysfunction during memory encoding in schizophrenia. Neuronal activation in schizophrenia patients and controls was assessed using functional magnetic resonance imaging (fMRI) during encoding of words in a deep (semantic judgement) and shallow (case judgment) task. A free recall (no delay) and a recognition task (24h delay) were performed. Free recall, but not recognition performance was reduced in patients. Reduced performance was correlated with positive symptoms which in turn were related to increased left hippocampal activity during successful encoding. Furthermore, schizophrenia patients displayed a hippocampal hyperactivity during deep encoding irrespective of encoding success along with a reduced anterior cingulate cortex (ACC) and dorsomedial prefrontal cortex (DMPFC) activity in successful encoding but an intact left inferior frontal cortex (LIFC) activity. This study provides the first evidence directly linking positive symptoms and memory deficits to dysfunctional hippocampal hyperactivity. It thereby underscores the pivotal pathophysiological role of a hyperdopaminergic mesolimbic state in schizophrenia. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Role of temporal processing stages by inferior temporal neurons in facial recognition.

PubMed

Sugase-Miyamoto, Yasuko; Matsumoto, Narihisa; Kawano, Kenji

2011-01-01

In this review, we focus on the role of temporal stages of encoded facial information in the visual system, which might enable the efficient determination of species, identity, and expression. Facial recognition is an important function of our brain and is known to be processed in the ventral visual pathway, where visual signals are processed through areas V1, V2, V4, and the inferior temporal (IT) cortex. In the IT cortex, neurons show selective responses to complex visual images such as faces, and at each stage along the pathway the stimulus selectivity of the neural responses becomes sharper, particularly in the later portion of the responses. In the IT cortex of the monkey, facial information is represented by different temporal stages of neural responses, as shown in our previous study: the initial transient response of face-responsive neurons represents information about global categories, i.e., human vs. monkey vs. simple shapes, whilst the later portion of these responses represents information about detailed facial categories, i.e., expression and/or identity. This suggests that the temporal stages of the neuronal firing pattern play an important role in the coding of visual stimuli, including faces. This type of coding may be a plausible mechanism underlying the temporal dynamics of recognition, including the process of detection/categorization followed by the identification of objects. Recent single-unit studies in monkeys have also provided evidence consistent with the important role of the temporal stages of encoded facial information. For example, view-invariant facial identity information is represented in the response at a later period within a region of face-selective neurons. Consistent with these findings, temporally modulated neural activity has also been observed in human studies. These results suggest a close correlation between the temporal processing stages of facial information by IT neurons and the temporal dynamics of face recognition.

Role of Temporal Processing Stages by Inferior Temporal Neurons in Facial Recognition

PubMed Central

Sugase-Miyamoto, Yasuko; Matsumoto, Narihisa; Kawano, Kenji

2011-01-01

In this review, we focus on the role of temporal stages of encoded facial information in the visual system, which might enable the efficient determination of species, identity, and expression. Facial recognition is an important function of our brain and is known to be processed in the ventral visual pathway, where visual signals are processed through areas V1, V2, V4, and the inferior temporal (IT) cortex. In the IT cortex, neurons show selective responses to complex visual images such as faces, and at each stage along the pathway the stimulus selectivity of the neural responses becomes sharper, particularly in the later portion of the responses. In the IT cortex of the monkey, facial information is represented by different temporal stages of neural responses, as shown in our previous study: the initial transient response of face-responsive neurons represents information about global categories, i.e., human vs. monkey vs. simple shapes, whilst the later portion of these responses represents information about detailed facial categories, i.e., expression and/or identity. This suggests that the temporal stages of the neuronal firing pattern play an important role in the coding of visual stimuli, including faces. This type of coding may be a plausible mechanism underlying the temporal dynamics of recognition, including the process of detection/categorization followed by the identification of objects. Recent single-unit studies in monkeys have also provided evidence consistent with the important role of the temporal stages of encoded facial information. For example, view-invariant facial identity information is represented in the response at a later period within a region of face-selective neurons. Consistent with these findings, temporally modulated neural activity has also been observed in human studies. These results suggest a close correlation between the temporal processing stages of facial information by IT neurons and the temporal dynamics of face recognition. PMID:21734904

Music as a memory enhancer in patients with Alzheimer's disease.

PubMed

Simmons-Stern, Nicholas R; Budson, Andrew E; Ally, Brandon A

2010-08-01

Musical mnemonics have a long and diverse history of popular use. In addition, music processing in general is often considered spared by the neurodegenerative effects of Alzheimer's disease (AD). Research examining these two phenomena is limited, and no work to our knowledge has explored the effectiveness of musical mnemonics in AD. The present study sought to investigate the effect of music at encoding on the subsequent recognition of associated verbal information. Lyrics of unfamiliar children's songs were presented bimodally at encoding, and visual stimuli were accompanied by either a sung or a spoken recording. Patients with AD demonstrated better recognition accuracy for the sung lyrics than the spoken lyrics, while healthy older adults showed no significant difference between the two conditions. We propose two possible explanations for these findings: first, that the brain areas subserving music processing may be preferentially spared by AD, allowing a more holistic encoding that facilitates recognition, and second, that music heightens arousal in patients with AD, allowing better attention and improved memory. Published by Elsevier Ltd.

Sad people are more accurate at expression identification with a smaller own-ethnicity bias than happy people.

PubMed

Hills, Peter J; Hill, Dominic M

2017-07-12

Sad individuals perform more accurately at face identity recognition (Hills, Werno, & Lewis, 2011), possibly because they scan more of the face during encoding. During expression identification tasks, sad individuals do not fixate on the eyes as much as happier individuals (Wu, Pu, Allen, & Pauli, 2012). Fixating on features other than the eyes leads to a reduced own-ethnicity bias (Hills & Lewis, 2006). This background indicates that sad individuals would not view the eyes as much as happy individuals and this would result in improved expression recognition and a reduced own-ethnicity bias. This prediction was tested using an expression identification task, with eye tracking. We demonstrate that sad-induced participants show enhanced expression recognition and a reduced own-ethnicity bias than happy-induced participants due to scanning more facial features. We conclude that mood affects eye movements and face encoding by causing a wider sampling strategy and deeper encoding of facial features diagnostic for expression identification.

Recognition of visual stimuli and memory for spatial context in schizophrenic patients and healthy volunteers.

PubMed

Brébion, Gildas; David, Anthony S; Pilowsky, Lyn S; Jones, Hugh

2004-11-01

Verbal and visual recognition tasks were administered to 40 patients with schizophrenia and 40 healthy comparison subjects. The verbal recognition task consisted of discriminating between 16 target words and 16 new words. The visual recognition task consisted of discriminating between 16 target pictures (8 black-and-white and 8 color) and 16 new pictures (8 black-and-white and 8 color). Visual recognition was followed by a spatial context discrimination task in which subjects were required to remember the spatial location of the target pictures at encoding. Results showed that recognition deficit in patients was similar for verbal and visual material. In both schizophrenic and healthy groups, men, but not women, obtained better recognition scores for the colored than for the black-and-white pictures. However, men and women similarly benefited from color to reduce spatial context discrimination errors. Patients showed a significant deficit in remembering the spatial location of the pictures, independently of accuracy in remembering the pictures themselves. These data suggest that patients are impaired in the amount of visual information that they can encode. With regards to the perceptual attributes of the stimuli, memory for spatial information appears to be affected, but not processing of color information.

The memory that’s right and the memory that’s left: Event-related potentials reveal hemispheric asymmetries in the encoding and retention of verbal information

PubMed Central

Evans, Karen M.; Federmeier, Kara D.

2009-01-01

We examined the nature and timecourse of hemispheric asymmetries in verbal memory by recording event-related potentials (ERPs) in a continuous recognition task. Participants made overt recognition judgments to test words presented in central vision that were either novel (new words) or had been previously presented in the left or right visual field (old words). An ERP memory effect linked to explicit retrieval revealed no asymmetries for words repeated at short and medium retention intervals, but at longer repetition lags (20–50 intervening words) this ‘old/new effect’ was more pronounced for words whose study presentation had been biased to the right hemisphere (RH). Additionally, a repetition effect linked to more implicit recognition processes (P2 amplitude changes) was observed at all lags for words preferentially encoded by the RH but was not observed for left hemisphere (LH)-encoded words. These results are consistent with theories that the RH encodes verbal stimuli more veridically whereas the LH encodes in a more abstract manner. The current findings provide a critical link between prior work on memory asymmetries, which has emphasized general LH advantages for verbal material, and on language comprehension, which has pointed to an important role for the RH in language processes that require the retention and integration of verbal information over long time spans. PMID:17291547

The impact of threat of shock-induced anxiety on memory encoding and retrieval

PubMed Central

Bolton, Sorcha

2017-01-01

Anxiety disorders are the most common mental health disorders, and daily transient feelings of anxiety (or “stress”) are ubiquitous. However, the precise impact of both transient and pathological anxiety on higher-order cognitive functions, including short- and long-term memory, is poorly understood. A clearer understanding of the anxiety–memory relationship is important as one of the core symptoms of anxiety, most prominently in post-traumatic stress disorder (PTSD), is intrusive reexperiencing of traumatic events in the form of vivid memories. This study therefore aimed to examine the impact of induced anxiety (threat of shock) on memory encoding and retrieval. Eighty-six healthy participants completed tasks assessing: visuospatial working memory, verbal recognition, face recognition, and associative memory. Critically, anxiety was manipulated within-subjects: information was both encoded and retrieved under threat of shock and safe (no shock) conditions. Results revealed that visuospatial working memory was enhanced when information was encoded and subsequently retrieved under threat, and that threat impaired the encoding of faces regardless of the condition in which it was retrieved. Episodic memory and verbal short-term recognition were, however, unimpaired. These findings indicate that transient anxiety in healthy individuals has domain-specific, rather than domain-general, impacts on memory. Future studies would benefit from expanding these findings into anxiety disorder patients to delineate the differences between adaptive and maladaptive responding. PMID:28916628

Behavioral and Single-Neuron Sensitivity to Millisecond Variations in Temporally Patterned Communication Signals

PubMed Central

Baker, Christa A.; Ma, Lisa; Casareale, Chelsea R.

2016-01-01

In many sensory pathways, central neurons serve as temporal filters for timing patterns in communication signals. However, how a population of neurons with diverse temporal filtering properties codes for natural variation in communication signals is unknown. Here we addressed this question in the weakly electric fish Brienomyrus brachyistius, which varies the time intervals between successive electric organ discharges to communicate. These fish produce an individually stereotyped signal called a scallop, which consists of a distinctive temporal pattern of ∼8–12 electric pulses. We manipulated the temporal structure of natural scallops during behavioral playback and in vivo electrophysiology experiments to probe the temporal sensitivity of scallop encoding and recognition. We found that presenting time-reversed, randomized, or jittered scallops increased behavioral response thresholds, demonstrating that fish's electric signaling behavior was sensitive to the precise temporal structure of scallops. Next, using in vivo intracellular recordings and discriminant function analysis, we found that the responses of interval-selective midbrain neurons were also sensitive to the precise temporal structure of scallops. Subthreshold changes in membrane potential recorded from single neurons discriminated natural scallops from time-reversed, randomized, and jittered sequences. Pooling the responses of multiple neurons improved the discriminability of natural sequences from temporally manipulated sequences. Finally, we found that single-neuron responses were sensitive to interindividual variation in scallop sequences, raising the question of whether fish may analyze scallop structure to gain information about the sender. Collectively, these results demonstrate that a population of interval-selective neurons can encode behaviorally relevant temporal patterns with millisecond precision. SIGNIFICANCE STATEMENT The timing patterns of action potentials, or spikes, play important roles in representing information in the nervous system. However, how these temporal patterns are recognized by downstream neurons is not well understood. Here we use the electrosensory system of mormyrid weakly electric fish to investigate how a population of neurons with diverse temporal filtering properties encodes behaviorally relevant input timing patterns, and how this relates to behavioral sensitivity. We show that fish are behaviorally sensitive to millisecond variations in natural, temporally patterned communication signals, and that the responses of individual midbrain neurons are also sensitive to variation in these patterns. In fact, the output of single neurons contains enough information to discriminate stereotyped communication signals produced by different individuals. PMID:27559179

Behavioral and Single-Neuron Sensitivity to Millisecond Variations in Temporally Patterned Communication Signals.

PubMed

Baker, Christa A; Ma, Lisa; Casareale, Chelsea R; Carlson, Bruce A

2016-08-24

In many sensory pathways, central neurons serve as temporal filters for timing patterns in communication signals. However, how a population of neurons with diverse temporal filtering properties codes for natural variation in communication signals is unknown. Here we addressed this question in the weakly electric fish Brienomyrus brachyistius, which varies the time intervals between successive electric organ discharges to communicate. These fish produce an individually stereotyped signal called a scallop, which consists of a distinctive temporal pattern of ∼8-12 electric pulses. We manipulated the temporal structure of natural scallops during behavioral playback and in vivo electrophysiology experiments to probe the temporal sensitivity of scallop encoding and recognition. We found that presenting time-reversed, randomized, or jittered scallops increased behavioral response thresholds, demonstrating that fish's electric signaling behavior was sensitive to the precise temporal structure of scallops. Next, using in vivo intracellular recordings and discriminant function analysis, we found that the responses of interval-selective midbrain neurons were also sensitive to the precise temporal structure of scallops. Subthreshold changes in membrane potential recorded from single neurons discriminated natural scallops from time-reversed, randomized, and jittered sequences. Pooling the responses of multiple neurons improved the discriminability of natural sequences from temporally manipulated sequences. Finally, we found that single-neuron responses were sensitive to interindividual variation in scallop sequences, raising the question of whether fish may analyze scallop structure to gain information about the sender. Collectively, these results demonstrate that a population of interval-selective neurons can encode behaviorally relevant temporal patterns with millisecond precision. The timing patterns of action potentials, or spikes, play important roles in representing information in the nervous system. However, how these temporal patterns are recognized by downstream neurons is not well understood. Here we use the electrosensory system of mormyrid weakly electric fish to investigate how a population of neurons with diverse temporal filtering properties encodes behaviorally relevant input timing patterns, and how this relates to behavioral sensitivity. We show that fish are behaviorally sensitive to millisecond variations in natural, temporally patterned communication signals, and that the responses of individual midbrain neurons are also sensitive to variation in these patterns. In fact, the output of single neurons contains enough information to discriminate stereotyped communication signals produced by different individuals. Copyright © 2016 the authors 0270-6474/16/368985-16$15.00/0.

Double sex and mab-3 related transcription factor 1 regulates differentiation and proliferation in dairy goat male germline stem cells.

PubMed

Wei, Yudong; Cai, Shufang; Ma, Fanglin; Zhang, Ying; Zhou, Zhe; Xu, Shuanshuan; Zhang, Mengfei; Peng, Sha; Hua, Jinlian

2018-03-01

The protein encoded by double sex and mab-3 related transcription factor 1 (Dmrt1) gene contains a double sex/mab-3 domain, which was considered as one of the most conservative structures in sex determination. However, its effect on spermatogenesis of dairy goat spermatogonial stem cells (SSCs) remains to be clarified. For the first time, the roles of Dmrt1 in spermatogenesis of livestock are highlighted. Here, we investigated the expression pattern of Dmrt1 in the testes of dairy goats. Dmrt1 primarily located in undifferentiated SSCs. Moreover, Dmrt1 enhanced differentiation and proliferation of mGSCs. On the contrary, the level of meiosis was down-regulated, as Dmrt1 determines whether SSCs undergo mitosis and spermatogonial differentiation or meiosis. In the busulfan-treated mice testes, Dmrt1 repair germ cell damage was emphasized as well. Our results exposed that Dmrt1 maintenance mGSCs in two ways: facilitating proliferation and self-renewal of SSCs; and reducing the inflammatory response caused by reproductive injury. These findings identify a central role for Dmrt1 in controlling population stability and injury restoring of SSCs. © 2017 Wiley Periodicals, Inc.

An Extreme Learning Machine-Based Neuromorphic Tactile Sensing System for Texture Recognition.

PubMed

Rasouli, Mahdi; Chen, Yi; Basu, Arindam; Kukreja, Sunil L; Thakor, Nitish V

2018-04-01

Despite significant advances in computational algorithms and development of tactile sensors, artificial tactile sensing is strikingly less efficient and capable than the human tactile perception. Inspired by efficiency of biological systems, we aim to develop a neuromorphic system for tactile pattern recognition. We particularly target texture recognition as it is one of the most necessary and challenging tasks for artificial sensory systems. Our system consists of a piezoresistive fabric material as the sensor to emulate skin, an interface that produces spike patterns to mimic neural signals from mechanoreceptors, and an extreme learning machine (ELM) chip to analyze spiking activity. Benefiting from intrinsic advantages of biologically inspired event-driven systems and massively parallel and energy-efficient processing capabilities of the ELM chip, the proposed architecture offers a fast and energy-efficient alternative for processing tactile information. Moreover, it provides the opportunity for the development of low-cost tactile modules for large-area applications by integration of sensors and processing circuits. We demonstrate the recognition capability of our system in a texture discrimination task, where it achieves a classification accuracy of 92% for categorization of ten graded textures. Our results confirm that there exists a tradeoff between response time and classification accuracy (and information transfer rate). A faster decision can be achieved at early time steps or by using a shorter time window. This, however, results in deterioration of the classification accuracy and information transfer rate. We further observe that there exists a tradeoff between the classification accuracy and the input spike rate (and thus energy consumption). Our work substantiates the importance of development of efficient sparse codes for encoding sensory data to improve the energy efficiency. These results have a significance for a wide range of wearable, robotic, prosthetic, and industrial applications.

Molecular characterization and expression profiles of four transformer-2 isoforms in the Chinese mitten crab Eriocheir sinensis

NASA Astrophysics Data System (ADS)

Luo, Danli; Liu, Yuan; Hui, Min; Song, Chengwen; Liu, Hourong; Cui, Zhaoxia

2017-07-01

The transformer-2 ( tra-2) gene plays a key role in the regulatory hierarchy of sexual differentiation in somatic tissues and in the germline of Drosophila melanogaster. In this study, sequences and expression profiles of tra-2 in the Chinese mitten crab Eriocheir sinensis were characterized. Four tra-2 isoforms, designated as Estra-2a, Estra-2b, Estra-2c, and Estra-2d, were isolated. They all contained an RNA-recognition motif (RRM) and a linker region, which shared high similarity with other reported tra-2s. Sequence analysis revealed that Estra-2a, Estra-2b and Estra-2c are encoded by the same genomic locus and are generated by alternative splicing of the pre-mRNA. Compared with the other three isoforms, Estra-2d lacks the RS2 domain. Quantitative real-time PCR showed that all four isoforms were highly expressed in the fertilized egg, and in the 2-4 cell and blastula stages compared with larval stages ( P≤0.01), suggesting their maternal origin in early embryonic developmental stages. Notably, Estra-2a was highly expressed in male somatic tissues, while Estra-2c was significantly highly expressed in the ovary. These results suggest that Estra-2c is involved in sexual differentiation of the Chinese mitten crab. Our findings provide basic information for further functional studies of the tra-2 gene/protein in this species.

The Influence of Encoding Strategy on Episodic Memory and Cortical Activity in Schizophrenia

PubMed Central

Haut, Kristen; Csernansky, John G.; Barch, Deanna M.

2005-01-01

Background: Recent work suggests that episodic memory deficits in schizophrenia may be related to disturbances of encoding or retrieval. Schizophrenia patients appear to benefit from instruction in episodic memory strategies. We tested the hypothesis that providing effective encoding strategies to schizophrenia patients enhances encoding-related brain activity and recognition performance. Methods: Seventeen schizophrenia patients and 26 healthy comparison subjects underwent functional magnetic resonance imaging scans while performing incidental encoding tasks of words and faces. Subjects were required to make either deep (abstract/concrete) or shallow (alphabetization) judgments for words and deep (gender) judgments for faces, followed by subsequent recognition tests. Results: Schizophrenia and comparison subjects recognized significantly more words encoded deeply than shallowly, activated regions in inferior frontal cortex (Brodmann area 45/47) typically associated with deep and successful encoding of words, and showed greater left frontal activation for the processing of words compared with faces. However, during deep encoding and material-specific processing (words vs. faces), participants with schizophrenia activated regions not activated by control subjects, including several in prefrontal cortex. Conclusions: Our findings suggest that a deficit in use of effective strategies influences episodic memory performance in schizophrenia and that abnormalities in functional brain activation persist even when such strategies are applied. PMID:15992522

Levels-of-processing effects in first-degree relatives of individuals with schizophrenia.

PubMed

Bonner-Jackson, Aaron; Csernansky, John G; Barch, Deanna M

2007-05-15

First-degree relatives of individuals with schizophrenia show cognitive impairments that are similar to but less severe than their ill relatives. We have shown that memory impairments can be improved and prefrontal cortical (PFC) activity increased in individuals with schizophrenia by providing beneficial encoding strategies. The current study used a similar paradigm to determine whether siblings of individuals with schizophrenia (SIBs) also show increases in brain activity when presented with beneficial encoding strategies. Twenty-one SIBs and 38 siblings of healthy comparison subjects underwent functional magnetic resonance imaging scans while engaged in deep (abstract/concrete judgments) and shallow (orthographic judgments) encoding. Subjects were then given a recognition memory test. The groups did not differ on encoding or recognition accuracy, and the SIBs benefited from deep encoding to a similar degree as control subjects. The SIBs showed deep encoding-related activity in a number of PFC regions typically activated during semantic processing. However, SIBs showed more activity than control subjects in three subregions of PFC (left BA 44 & BA 47 bilaterally). Siblings of individuals with schizophrenia benefit from supportive verbal encoding conditions. Like individuals with schizophrenia, SIBs also show increased task-related activity in a larger number of PFC subregions than control subjects during deep verbal encoding.

The first does the work, but the third time's the charm: the effects of massed repetition on episodic encoding of multimodal face-name associations.

PubMed

Mangels, Jennifer A; Manzi, Alberto; Summerfield, Christopher

2010-03-01

In social interactions, it is often necessary to rapidly encode the association between visually presented faces and auditorily presented names. The present study used event-related potentials to examine the neural correlates of associative encoding for multimodal face-name pairs. We assessed study-phase processes leading to high-confidence recognition of correct pairs (and consistent rejection of recombined foils) as compared to lower-confidence recognition of correct pairs (with inconsistent rejection of recombined foils) and recognition failures (misses). Both high- and low-confidence retrieval of face-name pairs were associated with study-phase activity suggestive of item-specific processing of the face (posterior inferior temporal negativity) and name (fronto-central negativity). However, only those pairs later retrieved with high confidence recruited a sustained centro-parietal positivity that an ancillary localizer task suggested may index an association-unique process. Additionally, we examined how these processes were influenced by massed repetition, a mnemonic strategy commonly employed in everyday situations to improve face-name memory. Differences in subsequent memory effects across repetitions suggested that associative encoding was strongest at the initial presentation, and thus, that the initial presentation has the greatest impact on memory formation. Yet, exploratory analyses suggested that the third presentation may have benefited later memory by providing an opportunity for extended processing of the name. Thus, although encoding of the initial presentation was critical for establishing a strong association, the extent to which processing was sustained across subsequent immediate (massed) presentations may provide additional encoding support that serves to differentiate face-name pairs from similar (recombined) pairs by providing additional encoding opportunities for the less dominant stimulus dimension (i.e., name).

Developmentally programmed DNA splicing in Paramecium reveals short-distance crosstalk between DNA cleavage sites

PubMed Central

Gratias, Ariane; Lepère, Gersende; Garnier, Olivier; Rosa, Sarah; Duharcourt, Sandra; Malinsky, Sophie; Meyer, Eric; Bétermier, Mireille

2008-01-01

Somatic genome assembly in the ciliate Paramecium involves the precise excision of thousands of short internal eliminated sequences (IESs) that are scattered throughout the germline genome and often interrupt open reading frames. Excision is initiated by double-strand breaks centered on the TA dinucleotides that are conserved at each IES boundary, but the factors that drive cleavage site recognition remain unknown. A degenerate consensus was identified previously at IES ends and genetic analyses confirmed the participation of their nucleotide sequence in efficient excision. Even for wild-type IESs, however, variant excision patterns (excised or nonexcised) may be inherited maternally through sexual events, in a homology-dependent manner. We show here that this maternal epigenetic control interferes with the targeting of DNA breaks at IES ends. Furthermore, we demonstrate that a mutation in the TA at one end of an IES impairs DNA cleavage not only at the mutant end but also at the wild-type end. We conclude that crosstalk between both ends takes place prior to their cleavage and propose that the ability of an IES to adopt an excision-prone conformation depends on the combination of its nucleotide sequence and of additional determinants. PMID:18420657

School-aged children can benefit from audiovisual semantic congruency during memory encoding.

PubMed

Heikkilä, Jenni; Tiippana, Kaisa

2016-05-01

Although we live in a multisensory world, children's memory has been usually studied concentrating on only one sensory modality at a time. In this study, we investigated how audiovisual encoding affects recognition memory. Children (n = 114) from three age groups (8, 10 and 12 years) memorized auditory or visual stimuli presented with a semantically congruent, incongruent or non-semantic stimulus in the other modality during encoding. Subsequent recognition memory performance was better for auditory or visual stimuli initially presented together with a semantically congruent stimulus in the other modality than for stimuli accompanied by a non-semantic stimulus in the other modality. This congruency effect was observed for pictures presented with sounds, for sounds presented with pictures, for spoken words presented with pictures and for written words presented with spoken words. The present results show that semantically congruent multisensory experiences during encoding can improve memory performance in school-aged children.

Age-related differences in agenda-driven monitoring of format and task information

PubMed Central

Mitchell, Karen J.; Ankudowich, Elizabeth; Durbin, Kelly A.; Greene, Erich J.; Johnson, Marcia K.

2013-01-01

Age-related source memory deficits may arise, in part, from changes in the agenda-driven processes that control what features of events are relevant during remembering. Using fMRI, we compared young and older adults on tests assessing source memory for format (picture, word) or encoding task (self-, other-referential), as well as on old-new recognition. Behaviorally, relative to old-new recognition, older adults showed disproportionate and equivalent deficits on both source tests compared to young adults. At encoding, both age groups showed expected activation associated with format in posterior visual processing areas, and with task in medial prefrontal cortex. At test, the groups showed similar selective, agenda-related activity in these representational areas. There were, however, marked age differences in the activity of control regions in lateral and medial prefrontal cortex and lateral parietal cortex. Results of correlation analyses were consistent with the idea that young adults had greater trial-by-trial agenda-driven modulation of activity (i.e., greater selectivity) than did older adults in representational regions. Thus, under selective remembering conditions where older adults showed clear differential regional activity in representational areas depending on type of test, they also showed evidence of disrupted frontal and parietal function and reduced item-by-item modulation of test-appropriate features. This pattern of results is consistent with an age-related deficit in the engagement of selective reflective attention. PMID:23357375

Non-accidental properties, metric invariance, and encoding by neurons in a model of ventral stream visual object recognition, VisNet.

PubMed

Rolls, Edmund T; Mills, W Patrick C

2018-05-01

When objects transform into different views, some properties are maintained, such as whether the edges are convex or concave, and these non-accidental properties are likely to be important in view-invariant object recognition. The metric properties, such as the degree of curvature, may change with different views, and are less likely to be useful in object recognition. It is shown that in a model of invariant visual object recognition in the ventral visual stream, VisNet, non-accidental properties are encoded much more than metric properties by neurons. Moreover, it is shown how with the temporal trace rule training in VisNet, non-accidental properties of objects become encoded by neurons, and how metric properties are treated invariantly. We also show how VisNet can generalize between different objects if they have the same non-accidental property, because the metric properties are likely to overlap. VisNet is a 4-layer unsupervised model of visual object recognition trained by competitive learning that utilizes a temporal trace learning rule to implement the learning of invariance using views that occur close together in time. A second crucial property of this model of object recognition is, when neurons in the level corresponding to the inferior temporal visual cortex respond selectively to objects, whether neurons in the intermediate layers can respond to combinations of features that may be parts of two or more objects. In an investigation using the four sides of a square presented in every possible combination, it was shown that even though different layer 4 neurons are tuned to encode each feature or feature combination orthogonally, neurons in the intermediate layers can respond to features or feature combinations present is several objects. This property is an important part of the way in which high capacity can be achieved in the four-layer ventral visual cortical pathway. These findings concerning non-accidental properties and the use of neurons in intermediate layers of the hierarchy help to emphasise fundamental underlying principles of the computations that may be implemented in the ventral cortical visual stream used in object recognition. Copyright © 2018 Elsevier Inc. All rights reserved.

Mother-to-child transmission of HIV-1: strong association with certain maternal HLA-B alleles independent of viral load implicates innate immune mechanisms.

PubMed

Winchester, Robert; Pitt, Jane; Charurat, Manhattan; Magder, Laurence S; Göring, Harald H H; Landay, Alan; Read, Jennifer S; Shearer, William; Handelsman, Edward; Luzuriaga, Katherine; Hillyer, George V; Blattner, William

2004-06-01

The transmission of HIV-1 from mother to child during pregnancy is unlike other types of HIV-1 transmission because the child shares major histocompatibility complex (MHC) genes with the mother during a time while the mother is induced to tolerate the paternally derived fetal MHC molecules, in part through natural killer (NK) recognition of MHC polymorphisms. The relevance of these immune mechanisms to HIV-1 transmission was assessed by determining the HLA-B alleles of mother and infant. Almost half (48%) of mothers who transmitted with low viral loads had HLA-B*1302, B*3501, B*3503, B*4402, or B*5001 alleles, compared with 8% of nontransmitting mothers (P=0.001). Conversely, 25% of mothers who did not transmit despite high viral loads had B*4901 and B*5301, vs. 5% of transmitting mothers (P=0.003), a pattern of allelic involvement distinct from that influencing HIV-1 infection outcome. The infant's HLA-B alleles did not appear associated with transmission risk. The HLA-B*4901 and B*5301 alleles that were protective in the mother both differed respectively from the otherwise identical susceptibility alleles, B*5001 and B*3501, by 5 amino acids encoding the ligand for the KIR3DL1 NK receptor. These results suggest that the probable molecular basis of the observed association involves definition of the maternal NK recognition repertoire by engagement of NK receptors with polymorphic ligands encoded by maternal HLA-B alleles, and that the placenta is the likely site of the effect that appears to protect against transmission of maternal HIV-1 through interrelating adaptive and innate immune recognition.

Semantic congruence affects hippocampal response to repetition of visual associations.

PubMed

McAndrews, Mary Pat; Girard, Todd A; Wilkins, Leanne K; McCormick, Cornelia

2016-09-01

Recent research has shown complementary engagement of the hippocampus and medial prefrontal cortex (mPFC) in encoding and retrieving associations based on pre-existing or experimentally-induced schemas, such that the latter supports schema-congruent information whereas the former is more engaged for incongruent or novel associations. Here, we attempted to explore some of the boundary conditions in the relative involvement of those structures in short-term memory for visual associations. The current literature is based primarily on intentional evaluation of schema-target congruence and on study-test paradigms with relatively long delays between learning and retrieval. We used a continuous recognition paradigm to investigate hippocampal and mPFC activation to first and second presentations of scene-object pairs as a function of semantic congruence between the elements (e.g., beach-seashell versus schoolyard-lamp). All items were identical at first and second presentation and the context scene, which was presented 500ms prior to the appearance of the target object, was incidental to the task which required a recognition response to the central target only. Very short lags 2-8 intervening stimuli occurred between presentations. Encoding the targets with congruent contexts was associated with increased activation in visual cortical regions at initial presentation and faster response time at repetition, but we did not find enhanced activation in mPFC relative to incongruent stimuli at either presentation. We did observe enhanced activation in the right anterior hippocampus, as well as regions in visual and lateral temporal and frontal cortical regions, for the repetition of incongruent scene-object pairs. This pattern demonstrates rapid and incidental effects of schema processing in hippocampal, but not mPFC, engagement during continuous recognition. Copyright © 2016 Elsevier Ltd. All rights reserved.

Premature termination of SMARCB1 translation may be followed by reinitiation in schwannomatosis-associated schwannomas, but results in absence of SMARCB1 expression in rhabdoid tumors.

PubMed

Hulsebos, Theo J M; Kenter, Susan; Verhagen, Wim I M; Baas, Frank; Flucke, Uta; Wesseling, Pieter

2014-09-01

In schwannomatosis, germline SMARCB1 mutations predispose to the development of multiple schwannomas, but not vestibular schwannomas. Many of these are missense or splice-site mutations or in-frame deletions, which are presumed to result in the synthesis of altered SMARCB1 proteins. However, also nonsense and frameshift mutations, which are characteristic for rhabdoid tumors and are predicted to result in the absence of SMARCB1 protein via nonsense-mediated mRNA decay, have been reported in schwannomatosis patients. We investigated the consequences of four of the latter mutations, i.e. c.30delC, c.34C>T, c.38delA, and c.46A>T, all in SMARCB1-exon 1. We could demonstrate for the c.30delC and c.34C>T mutations that the respective mRNAs were still present in the schwannomas of the patients. We hypothesized that these were prevented from degradation by translation reinitiation at the AUG codon encoding methionine at position 27 of the SMARCB1 protein. To test this, we expressed the mutations in MON cells, rhabdoid cells without endogenous SMARCB1 protein, and found that all four resulted in synthesis of the N-terminally truncated protein. Mutation of the reinitiation methionine codon into a valine codon prevented synthesis of the truncated protein, thereby confirming its identity. Immunohistochemistry with a SMARCB1 antibody revealed a mosaic staining pattern in schwannomas of the patients with the c.30delC and c.34C>T mutations. Our findings support the concept that, in contrast to the complete absence of SMARCB1 expression in rhabdoid tumors, altered SMARCB1 proteins with modified activity and reduced (mosaic) expression are formed in the schwannomas of schwannomatosis patients with a germline SMARCB1 mutation.

Bilingual recognition memory: stronger performance but weaker levels-of-processing effects in the less fluent language.

PubMed

Francis, Wendy S; Gutiérrez, Marisela

2012-04-01

The effects of bilingual proficiency on recognition memory were examined in an experiment with Spanish-English bilinguals. Participants learned lists of words in English and Spanish under shallow- and deep-encoding conditions. Overall, hit rates were higher, discrimination greater, and response times shorter in the nondominant language, consistent with effects previously observed for lower frequency words. Levels-of-processing effects in hit rates, discrimination, and response time were stronger in the dominant language. Specifically, with shallow encoding, the advantage for the nondominant language was larger than with deep encoding. The results support the idea that memory performance in the nondominant language is impacted by both the greater demand for cognitive resources and the lower familiarity of the words.

In the eye of the beholder? Universality and cultural specificity in the expression and perception of emotion.

PubMed

Scherer, Klaus R; Clark-Polner, Elizabeth; Mortillaro, Marcello

2011-12-01

Do members of different cultures express (or "encode") emotions in the same fashion? How well can members of distinct cultures recognize (or "decode") each other's emotion expressions? The question of cultural universality versus specificity in emotional expression has been a hot topic of debate for more than half a century, but, despite a sizeable amount of empirical research produced to date, no convincing answers have emerged. We suggest that this unsatisfactory state of affairs is due largely to a lack of concern with the precise mechanisms involved in emotion expression and perception, and propose to use a modified Brunswikian lens model as an appropriate framework for research in this area. On this basis we provide a comprehensive review of the existing literature and point to research paradigms that are likely to provide the evidence required to resolve the debate on universality vs. cultural specificity of emotional expression. Applying this fresh perspective, our analysis reveals that, given the paucity of pertinent data, no firm conclusions can be drawn on actual expression (encoding) patterns across cultures (although there appear to be more similarities than differences), but that there is compelling evidence for intercultural continuity in decoding, or recognition, ability. We also note a growing body of research on the notion of ingroup advantage due to expression "dialects," above and beyond the general encoding or decoding patterns. We furthermore suggest that these empirical patterns could be explained by both universality in the underlying mechanisms and cultural specificity in the input to, and the regulation of, these expression and perception mechanisms. Overall, more evidence is needed, both to further elucidate these mechanisms and to inventory the patterns of cultural effects. We strongly recommend using more solid conceptual and theoretical perspectives, as well as more ecologically valid approaches, in designing future studies in emotion expression and perception research.

The Low-Frequency Encoding Disadvantage: Word Frequency Affects Processing Demands

ERIC Educational Resources Information Center

Diana, Rachel A.; Reder, Lynne M.

2006-01-01

Low-frequency words produce more hits and fewer false alarms than high-frequency words in a recognition task. The low-frequency hit rate advantage has sometimes been attributed to processes that operate during the recognition test (e.g., L. M. Reder et al., 2000). When tasks other than recognition, such as recall, cued recall, or associative…

Neural Mechanisms of Context Effects on Face Recognition: Automatic Binding and Context Shift Decrements

PubMed Central

Hayes, Scott M.; Baena, Elsa; Truong, Trong-Kha; Cabeza, Roberto

2011-01-01

Although people do not normally try to remember associations between faces and physical contexts, these associations are established automatically, as indicated by the difficulty of recognizing familiar faces in different contexts (“butcher-on-the-bus” phenomenon). The present functional MRI (fMRI) study investigated the automatic binding of faces and scenes. In the Face-Face (F-F) condition, faces were presented alone during both encoding and retrieval, whereas in the Face/Scene-Face (FS-F) condition, they were presented overlaid on scenes during encoding but alone during retrieval (context change). Although participants were instructed to focus only on the faces during both encoding and retrieval, recognition performance was worse in the FS-F than the F-F condition (“context shift decrement”—CSD), confirming automatic face-scene binding during encoding. This binding was mediated by the hippocampus as indicated by greater subsequent memory effects (remembered > forgotten) in this region for the FS-F than the F-F condition. Scene memory was mediated by the right parahippocampal cortex, which was reactivated during successful retrieval when the faces were associated with a scene during encoding (FS-F condition). Analyses using the CSD as a regressor yielded a clear hemispheric asymmetry in medial temporal lobe activity during encoding: left hippocampal and parahippocampal activity was associated with a smaller CSD, indicating more flexible memory representations immune to context changes, whereas right hippocampal/rhinal activity was associated with a larger CSD, indicating less flexible representations sensitive to context change. Taken together, the results clarify the neural mechanisms of context effects on face recognition. PMID:19925208

Heterozygous Germline Mutations in the CBL Tumor-Suppressor Gene Cause a Noonan Syndrome-like Phenotype

PubMed Central

Martinelli, Simone; De Luca, Alessandro; Stellacci, Emilia; Rossi, Cesare; Checquolo, Saula; Lepri, Francesca; Caputo, Viviana; Silvano, Marianna; Buscherini, Francesco; Consoli, Federica; Ferrara, Grazia; Digilio, Maria C.; Cavaliere, Maria L.; van Hagen, Johanna M.; Zampino, Giuseppe; van der Burgt, Ineke; Ferrero, Giovanni B.; Mazzanti, Laura; Screpanti, Isabella; Yntema, Helger G.; Nillesen, Willy M.; Savarirayan, Ravi; Zenker, Martin; Dallapiccola, Bruno; Gelb, Bruce D.; Tartaglia, Marco

2010-01-01

RAS signaling plays a key role in controlling appropriate cell responses to extracellular stimuli and participates in early and late developmental processes. Although enhanced flow through this pathway has been established as a major contributor to oncogenesis, recent discoveries have revealed that aberrant RAS activation causes a group of clinically related developmental disorders characterized by facial dysmorphism, a wide spectrum of cardiac disease, reduced growth, variable cognitive deficits, ectodermal and musculoskeletal anomalies, and increased risk for certain malignancies. Here, we report that heterozygous germline mutations in CBL, a tumor-suppressor gene that is mutated in myeloid malignancies and encodes a multivalent adaptor protein with E3 ubiquitin ligase activity, can underlie a phenotype with clinical features fitting or partially overlapping Noonan syndrome (NS), the most common condition of this disease family. Independent CBL mutations were identified in two sporadic cases and two families from among 365 unrelated subjects who had NS or suggestive features and were negative for mutations in previously identified disease genes. Phenotypic heterogeneity and variable expressivity were documented. Mutations were missense changes altering evolutionarily conserved residues located in the RING finger domain or the linker connecting this domain to the N-terminal tyrosine kinase binding domain, a known mutational hot spot in myeloid malignancies. Mutations were shown to affect CBL-mediated receptor ubiquitylation and dysregulate signal flow through RAS. These findings document that germline mutations in CBL alter development to cause a clinically variable condition that resembles NS and that possibly predisposes to malignancies. PMID:20619386

Gigantism: X-linked acrogigantism and GPR101 mutations.

PubMed

Iacovazzo, Donato; Korbonits, Márta

X-linked acrogigantism (XLAG) is a recently identified condition of early-onset GH excess resulting from the germline or somatic duplication of the GPR101 gene on chromosome Xq26.3. Thirty patients have been formally reported so far. The disease affects mostly females, occurs usually sporadically, and is characterised by early onset and marked overgrowth. Most patients present with concomitant hyperprolactinaemia. Histopathology shows pituitary hyperplasia or pituitary adenoma with or without associated hyperplasia. XLAG-related pituitary adenomas present peculiar histopathological features that should contribute to raise the suspicion of this rare condition. Treatment is frequently challenging and multi-modal. While females present with germline mutations, the sporadic male patients reported so far were somatic mosaics with variable levels of mosaicism, although no differences in the clinical phenotype were observed between patients with germline or somatic duplication. The GPR101 gene encodes an orphan G protein-coupled receptor normally expressed in the central nervous system, and at particularly high levels in the hypothalamus. While the physiological function and the endogenous ligand of GPR101 are unknown, the high expression of GPR101 in the arcuate nucleus and the occurrence of increased circulating GHRH levels in some patients with XLAG, suggest that increased hypothalamic GHRH secretion could play a role in the pathogenesis of this condition. In this review, we summarise the published evidence on XLAG and GPR101 and discuss the results of recent studies that have investigated the potential role of GPR101 variants in the pathogenesis of pituitary adenomas. Copyright © 2016 Elsevier Ltd. All rights reserved.

Developing a hippocampal neural prosthetic to facilitate human memory encoding and recall.

PubMed

Hampson, Robert E; Song, Dong; Robinson, Brian S; Fetterhoff, Dustin; Dakos, Alexander S; Roeder, Brent M; She, Xiwei; Wicks, Robert T; Witcher, Mark R; Couture, Daniel E; Laxton, Adrian W; Munger-Clary, Heidi; Popli, Gautam; Sollman, Myriam J; Whitlow, Christopher T; Marmarelis, Vasilis Z; Berger, Theodore W; Deadwyler, Sam A

2018-06-01

We demonstrate here the first successful implementation in humans of a proof-of-concept system for restoring and improving memory function via facilitation of memory encoding using the patient's own hippocampal spatiotemporal neural codes for memory. Memory in humans is subject to disruption by drugs, disease and brain injury, yet previous attempts to restore or rescue memory function in humans typically involved only nonspecific, modulation of brain areas and neural systems related to memory retrieval. We have constructed a model of processes by which the hippocampus encodes memory items via spatiotemporal firing of neural ensembles that underlie the successful encoding of short-term memory. A nonlinear multi-input, multi-output (MIMO) model of hippocampal CA3 and CA1 neural firing is computed that predicts activation patterns of CA1 neurons during the encoding (sample) phase of a delayed match-to-sample (DMS) human short-term memory task. MIMO model-derived electrical stimulation delivered to the same CA1 locations during the sample phase of DMS trials facilitated short-term/working memory by 37% during the task. Longer term memory retention was also tested in the same human subjects with a delayed recognition (DR) task that utilized images from the DMS task, along with images that were not from the task. Across the subjects, the stimulated trials exhibited significant improvement (35%) in both short-term and long-term retention of visual information. These results demonstrate the facilitation of memory encoding which is an important feature for the construction of an implantable neural prosthetic to improve human memory.

Developing a hippocampal neural prosthetic to facilitate human memory encoding and recall

NASA Astrophysics Data System (ADS)

Hampson, Robert E.; Song, Dong; Robinson, Brian S.; Fetterhoff, Dustin; Dakos, Alexander S.; Roeder, Brent M.; She, Xiwei; Wicks, Robert T.; Witcher, Mark R.; Couture, Daniel E.; Laxton, Adrian W.; Munger-Clary, Heidi; Popli, Gautam; Sollman, Myriam J.; Whitlow, Christopher T.; Marmarelis, Vasilis Z.; Berger, Theodore W.; Deadwyler, Sam A.

2018-06-01

Objective. We demonstrate here the first successful implementation in humans of a proof-of-concept system for restoring and improving memory function via facilitation of memory encoding using the patient’s own hippocampal spatiotemporal neural codes for memory. Memory in humans is subject to disruption by drugs, disease and brain injury, yet previous attempts to restore or rescue memory function in humans typically involved only nonspecific, modulation of brain areas and neural systems related to memory retrieval. Approach. We have constructed a model of processes by which the hippocampus encodes memory items via spatiotemporal firing of neural ensembles that underlie the successful encoding of short-term memory. A nonlinear multi-input, multi-output (MIMO) model of hippocampal CA3 and CA1 neural firing is computed that predicts activation patterns of CA1 neurons during the encoding (sample) phase of a delayed match-to-sample (DMS) human short-term memory task. Main results. MIMO model-derived electrical stimulation delivered to the same CA1 locations during the sample phase of DMS trials facilitated short-term/working memory by 37% during the task. Longer term memory retention was also tested in the same human subjects with a delayed recognition (DR) task that utilized images from the DMS task, along with images that were not from the task. Across the subjects, the stimulated trials exhibited significant improvement (35%) in both short-term and long-term retention of visual information. Significance. These results demonstrate the facilitation of memory encoding which is an important feature for the construction of an implantable neural prosthetic to improve human memory.

The mate recognition protein gene mediates reproductive isolation and speciation in the Brachionus plicatilis cryptic species complex

PubMed Central

2012-01-01

Background Chemically mediated prezygotic barriers to reproduction likely play an important role in speciation. In facultatively sexual monogonont rotifers from the Brachionus plicatilis cryptic species complex, mate recognition of females by males is mediated by the Mate Recognition Protein (MRP), a globular glycoprotein on the surface of females, encoded by the mmr-b gene family. In this study, we sequenced mmr-b copies from 27 isolates representing 11 phylotypes of the B. plicatilis species complex, examined the mode of evolution and selection of mmr-b, and determined the relationship between mmr-b genetic distance and mate recognition among isolates. Results Isolates of the B. plicatilis species complex have 1–4 copies of mmr-b, each composed of 2–9 nearly identical tandem repeats. The repeats within a gene copy are generally more similar than are gene copies among phylotypes, suggesting concerted evolution. Compared to housekeeping genes from the same isolates, mmr-b has accumulated only half as many synonymous differences but twice as many non-synonymous differences. Most of the amino acid differences between repeats appear to occur on the outer face of the protein, and these often result in changes in predicted patterns of phosphorylation. However, we found no evidence of positive selection driving these differences. Isolates with the most divergent copies were unable to mate with other isolates and rarely self-crossed. Overall the degree of mate recognition was significantly correlated with the genetic distance of mmr-b. Conclusions Discrimination of compatible mates in the B. plicatilis species complex is determined by proteins encoded by closely related copies of a single gene, mmr-b. While concerted evolution of the tandem repeats in mmr-b may function to maintain identity, it can also lead to the rapid spread of a mutation through all copies in the genome and thus to reproductive isolation. The mmr-b gene is evolving rapidly, and novel alleles may be maintained and increase in frequency via asexual reproduction. Our analyses indicate that mate recognition, controlled by MMR-B, may drive reproductive isolation and allow saltational sympatric speciation within the B. plicatilis cryptic species complex, and that this process may be largely neutral. PMID:22852831

Peptidoglycan Recognition Protein S2 From Silkworm Integument: Characterization, Microbe-Induced Expression, and Involvement in the Immune-Deficiency Pathway

PubMed Central

Yang, Jie; Wang, Xiaonan; Tang, Shunming; Shen, Zhongyuan; Wu, Jinmei

2015-01-01

Peptidoglycan recognition protein (PGRP) binds specifically to peptidoglycan and plays an important role as a pattern recognition receptor in the innate immunity of insects. The cDNA of a short-type PGRP, an open reading frame of 588 bp encoding a polypeptide of 196 amino acids, was cloned from Bombyx mori. A phylogenetic tree was constructed, and the results showed that BmPGRP-S2 was most similar to Drosophila melanogaster PGRP (DmPGRP-SA). The induced expression profile of BmPGRP-S2 in healthy Escherichia coli- and Bacillus subtilis-challenged B. mori was measured using semiquantitative reverse transcriptase polymerase chain reaction analysis. The expression of BmPGRP-S2 was upregulated at 24 h by E. coli and Ba. subtilis challenge. In addition, in the integument of B. mori, RNAi knockdown of BmPGRP-S2 caused an obvious reduction in the transcription expression of the transcription factor Relish and in antibacterial effector genes Attacin, Gloverin, and Moricin. The results indicated that BmPGRP-S2 participates in the signal transduction pathway of B. mori. PMID:25797797

Ball-scale based hierarchical multi-object recognition in 3D medical images

NASA Astrophysics Data System (ADS)

Bağci, Ulas; Udupa, Jayaram K.; Chen, Xinjian

2010-03-01

This paper investigates, using prior shape models and the concept of ball scale (b-scale), ways of automatically recognizing objects in 3D images without performing elaborate searches or optimization. That is, the goal is to place the model in a single shot close to the right pose (position, orientation, and scale) in a given image so that the model boundaries fall in the close vicinity of object boundaries in the image. This is achieved via the following set of key ideas: (a) A semi-automatic way of constructing a multi-object shape model assembly. (b) A novel strategy of encoding, via b-scale, the pose relationship between objects in the training images and their intensity patterns captured in b-scale images. (c) A hierarchical mechanism of positioning the model, in a one-shot way, in a given image from a knowledge of the learnt pose relationship and the b-scale image of the given image to be segmented. The evaluation results on a set of 20 routine clinical abdominal female and male CT data sets indicate the following: (1) Incorporating a large number of objects improves the recognition accuracy dramatically. (2) The recognition algorithm can be thought as a hierarchical framework such that quick replacement of the model assembly is defined as coarse recognition and delineation itself is known as finest recognition. (3) Scale yields useful information about the relationship between the model assembly and any given image such that the recognition results in a placement of the model close to the actual pose without doing any elaborate searches or optimization. (4) Effective object recognition can make delineation most accurate.

Pattern reverberation in networks of excitable systems with connection delays

NASA Astrophysics Data System (ADS)

Lücken, Leonhard; Rosin, David P.; Worlitzer, Vasco M.; Yanchuk, Serhiy

2017-01-01

We consider the recurrent pulse-coupled networks of excitable elements with delayed connections, which are inspired by the biological neural networks. If the delays are tuned appropriately, the network can either stay in the steady resting state, or alternatively, exhibit a desired spiking pattern. It is shown that such a network can be used as a pattern-recognition system. More specifically, the application of the correct pattern as an external input to the network leads to a self-sustained reverberation of the encoded pattern. In terms of the coupling structure, the tolerance and the refractory time of the individual systems, we determine the conditions for the uniqueness of the sustained activity, i.e., for the functionality of the network as an unambiguous pattern detector. We point out the relation of the considered systems with cyclic polychronous groups and show how the assumed delay configurations may arise in a self-organized manner when a spike-time dependent plasticity of the connection delays is assumed. As excitable elements, we employ the simplistic coincidence detector models as well as the Hodgkin-Huxley neuron models. Moreover, the system is implemented experimentally on a Field-Programmable Gate Array.

How chemical information processing interferes with face processing: a magnetoencephalographic study.

PubMed

Walla, Peter; Mayer, Dagmar; Deecke, Lüder; Lang, Wilfried

2005-01-01

Magnetic field changes related to face encoding were recorded in 20 healthy young participants. Faces had to be deeply encoded under four kinds of simultaneous nasal chemical stimulation. Neutral room air, phenyl ethyl alcohol (PEA, rose flavor), carbon dioxide (CO2, pain), and hydrogen sulfide (H2S, rotten eggs flavor) were used as chemical stimuli. PEA and H2S represented odor stimuli, whereas CO2 was used for trigeminal stimulation (pain sensation). After the encoding of faces, the respective recognition performances were tested focusing on recognition effects related to specific chemical stimulation during encoding. The number of correctly recognized faces (hits) varied between chemical conditions. PEA stimulation during face encoding significantly increased the number of hits compared to the control condition. H2S also led to an increased mean number of hits, whereas simultaneous CO2 administration during face encoding resulted in a reduction. Analysis of the physiological data revealed two latency regions of interest. Compared to the control condition, both olfactory stimulus conditions resulted in reduced activity components peaking at about 260 ms after stimulus onset, whereas CO2 produced a strongly pronounced enhanced activity component peaking at about 700 ms after stimulus onset. Both olfactory conditions elicited only weak enhanced activities at about 700 ms, and CO2 did not show any difference activity at 260 ms after stimulus onset compared to the control condition. It is concluded that the early activity differences represent subconscious olfactory information processing leading to enhanced memory performances irrespective of the hedonic value, at least if they are only subconsciously processed. The later activity is suggested to reflect conscious CO2 perception negatively affecting face encoding and therefore leading to reduced subsequent face recognition. We interpret that conscious processing of nasal chemical stimulation competes with deep face encoding with respect to cortical resources, whereas subconscious processing of nasal chemical stimulation does not.

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton.

PubMed

Gopal, Sandeep; Pocock, Roger

2018-04-19

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and chromosome dynamics. While the germline is an excellent model, the analysis is often two dimensional due to the time and labor required for three-dimensional analysis. Major readouts in such studies are the number/position of nuclei and protein distribution within the germline. Here, we present a method to perform automated analysis of the germline using confocal microscopy and computational approaches to determine the number and position of nuclei in each region of the germline. Our method also analyzes germline protein distribution that enables the three-dimensional examination of protein expression in different genetic backgrounds. Further, our study shows variations in cytoskeletal architecture in distinct regions of the germline that may accommodate specific spatial developmental requirements. Finally, our method enables automated counting of the sperm in the spermatheca of each germline. Taken together, our method enables rapid and reproducible phenotypic analysis of the C. elegans germline.

Germline-Specific MATH-BTB Substrate Adaptor MAB1 Regulates Spindle Length and Nuclei Identity in Maize[W

PubMed Central

Juranić, Martina; Srilunchang, Kanok-orn; Krohn, Nádia Graciele; Leljak-Levanić, Dunja; Sprunck, Stefanie; Dresselhaus, Thomas

2012-01-01

Germline and early embryo development constitute ideal model systems to study the establishment of polarity, cell identity, and asymmetric cell divisions (ACDs) in plants. We describe here the function of the MATH-BTB domain protein MAB1 that is exclusively expressed in the germ lineages and the zygote of maize (Zea mays). mab1 (RNA interference [RNAi]) mutant plants display chromosome segregation defects and short spindles during meiosis that cause insufficient separation and migration of nuclei. After the meiosis-to-mitosis transition, two attached nuclei of similar identity are formed in mab1 (RNAi) mutants leading to an arrest of further germline development. Transient expression studies of MAB1 in tobacco (Nicotiana tabacum) Bright Yellow-2 cells revealed a cell cycle–dependent nuclear localization pattern but no direct colocalization with the spindle apparatus. MAB1 is able to form homodimers and interacts with the E3 ubiquitin ligase component Cullin 3a (CUL3a) in the cytoplasm, likely as a substrate-specific adapter protein. The microtubule-severing subunit p60 of katanin was identified as a candidate substrate for MAB1, suggesting that MAB1 resembles the animal key ACD regulator Maternal Effect Lethal 26 (MEL-26). In summary, our findings provide further evidence for the importance of posttranslational regulation for asymmetric divisions and germline progression in plants and identified an unstable key protein that seems to be involved in regulating the stability of a spindle apparatus regulator(s). PMID:23250449

Cell surface fucosylation does not affect development of colon tumors in mice with germline Smad3 mutation

PubMed Central

Domino, Steven E.; Karnak, David M.; Hurd, Elizabeth A.

2006-01-01

Background/Aims: Neoplasia-related alterations in cell surface α(1,2)fucosylated glycans have been reported in multiple tumors including colon, pancreas, endometrium, cervix, bladder, lung, and choriocarcinoma. Spontaneous colorectal tumors from mice with a germline null mutation of transforming growth factor-β signaling gene Smad3 (Madh3) were tested for α(1,2)fucosylated glycan expression. Methods: Ulex Europaeus Agglutinin-I lectin staining, fucosyltransferase gene northern blot analysis, and a cross of mutant mice with Fut2 and Smad3 germline mutations were performed. Results: Spontaneous colorectal tumors from Smad3 (-/-) homozygous null mice were found to express α(1,2)fucosylated glycans in an abnormal pattern compared to adjacent nonneoplastic colon. Northern blot analysis of α(1,2)fucosyltransferase genes Fut1 and Fut2 revealed that Fut2, but not Fut1, steady-state mRNA levels were significantly increased in tumors relative to adjacent normal colonic mucosa. Mutant mice with a Fut2-inactivating germline mutation were crossed with Smad3 targeted mice. In Smad3 (-/-)/Fut2 (-/-) double knock-out mice, UEA-I lectin staining was eliminated from colon and colon tumors, however, the number and size of tumors present by 24 weeks of age did not vary regardless of the Fut2 genotype. Conclusions: In this model of colorectal cancer, cell surface α(1,2)fucosylation does not affect development of colon tumors. PMID:17264540

Genomic characterization of biliary tract cancers identifies driver genes and predisposing mutations.

PubMed

Wardell, Christopher P; Fujita, Masashi; Yamada, Toru; Simbolo, Michele; Fassan, Matteo; Karlic, Rosa; Polak, Paz; Kim, Jaegil; Hatanaka, Yutaka; Maejima, Kazuhiro; Lawlor, Rita T; Nakanishi, Yoshitsugu; Mitsuhashi, Tomoko; Fujimoto, Akihiro; Furuta, Mayuko; Ruzzenente, Andrea; Conci, Simone; Oosawa, Ayako; Sasaki-Oku, Aya; Nakano, Kaoru; Tanaka, Hiroko; Yamamoto, Yujiro; Michiaki, Kubo; Kawakami, Yoshiiku; Aikata, Hiroshi; Ueno, Masaki; Hayami, Shinya; Gotoh, Kunihito; Ariizumi, Shun-Ichi; Yamamoto, Masakazu; Yamaue, Hiroki; Chayama, Kazuaki; Miyano, Satoru; Getz, Gad; Scarpa, Aldo; Hirano, Satoshi; Nakamura, Toru; Nakagawa, Hidewaki

2018-05-01

Biliary tract cancers (BTCs) are clinically and pathologically heterogeneous and respond poorly to treatment. Genomic profiling can offer a clearer understanding of their carcinogenesis, classification and treatment strategy. We performed large-scale genome sequencing analyses on BTCs to investigate their somatic and germline driver events and characterize their genomic landscape. We analyzed 412 BTC samples from Japanese and Italian populations, 107 by whole-exome sequencing (WES), 39 by whole-genome sequencing (WGS), and a further 266 samples by targeted sequencing. The subtypes were 136 intrahepatic cholangiocarcinomas (ICCs), 101 distal cholangiocarcinomas (DCCs), 109 peri-hilar type cholangiocarcinomas (PHCs), and 66 gallbladder or cystic duct cancers (GBCs/CDCs). We identified somatic alterations and searched for driver genes in BTCs, finding pathogenic germline variants of cancer-predisposing genes. We predicted cell-of-origin for BTCs by combining somatic mutation patterns and epigenetic features. We identified 32 significantly and commonly mutated genes including TP53, KRAS, SMAD4, NF1, ARID1A, PBRM1, and ATR, some of which negatively affected patient prognosis. A novel deletion of MUC17 at 7q22.1 affected patient prognosis. Cell-of-origin predictions using WGS and epigenetic features suggest hepatocyte-origin of hepatitis-related ICCs. Deleterious germline mutations of cancer-predisposing genes such as BRCA1, BRCA2, RAD51D, MLH1, or MSH2 were detected in 11% (16/146) of BTC patients. BTCs have distinct genetic features including somatic events and germline predisposition. These findings could be useful to establish treatment and diagnostic strategies for BTCs based on genetic information. We here analyzed genomic features of 412 BTC samples from Japanese and Italian populations. A total of 32 significantly and commonly mutated genes were identified, some of which negatively affected patient prognosis, including a novel deletion of MUC17 at 7q22.1. Cell-of-origin predictions using WGS and epigenetic features suggest hepatocyte-origin of hepatitis-related ICCs. Deleterious germline mutations of cancer-predisposing genes were detected in 11% of patients with BTC. BTCs have distinct genetic features including somatic events and germline predisposition. Copyright © 2018 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Local inhibition modulates learning-dependent song encoding in the songbird auditory cortex

PubMed Central

Thompson, Jason V.; Jeanne, James M.

2013-01-01

Changes in inhibition during development are well documented, but the role of inhibition in adult learning-related plasticity is not understood. In songbirds, vocal recognition learning alters the neural representation of songs across the auditory forebrain, including the caudomedial nidopallium (NCM), a region analogous to mammalian secondary auditory cortices. Here, we block local inhibition with the iontophoretic application of gabazine, while simultaneously measuring song-evoked spiking activity in NCM of European starlings trained to recognize sets of conspecific songs. We find that local inhibition differentially suppresses the responses to learned and unfamiliar songs and enhances spike-rate differences between learned categories of songs. These learning-dependent response patterns emerge, in part, through inhibitory modulation of selectivity for song components and the masking of responses to specific acoustic features without altering spectrotemporal tuning. The results describe a novel form of inhibitory modulation of the encoding of learned categories and demonstrate that inhibition plays a central role in shaping the responses of neurons to learned, natural signals. PMID:23155175

Cardiovascular reactivity of younger and older adults to positive-, negative-, and mixed-emotion cognitive challenge.

PubMed

Hogan, Michael J; James, Jack E; McCabe, Tadhg R; Kilmartin, Liam; Howard, Siobhán; Noone, Chris

2012-03-01

Although aging is associated with progressive increases in blood pressure level, previous research has been inconsistent as to whether older adults show greater or lesser cardiovascular reactivity (CVR) to emotion than do younger adults. There is reason to believe that these inconsistencies could be clarified by examining age-related differences in hemodynamic profile revealed by measuring the pattern of cardiac output and total peripheral resistance associated with changes in blood pressure reactivity. Accordingly, the present study examined the performance, CVR, and hemodynamic profile of younger and older adults during encoding and recognition of word pairs involving four valence types: positive, negative, mixed (positive/negative), and neutral word pairs. Results revealed higher baseline blood pressure, increased CVR characterized by a vascular hemodynamic profile, and more rapid recovery (especially during encoding) for older than for younger participants. Results are discussed in light of research and theory on the relationship between aging and cardiovascular health. Copyright © 2012 Elsevier B.V. All rights reserved.

Preferential V beta gene usage and lack of junctional sequence conservation among human T cell receptors specific for a tetanus toxin- derived peptide: evidence for a dominant role of a germline-encoded V region in antigen/major histocompatibility complex recognition

PubMed Central

1992-01-01

To investigate the structural and genetic basis of the T cell response to defined peptide/major histocompatibility (MHC) class II complexes in humans, we established a large panel of T cell clones (61) from donors of different HLA-DR haplotypes and reactive with a tetanus toxin- derived peptide (tt830-844) recognized in association with most DR molecules (universal peptide). By using a bacterial enterotoxin-based proliferation assay and cDNA sequencing, we found preferential use of a particular V beta region gene segment, V beta 2.1, in three of the individuals studied (64%, n = 58), irrespective of whether the peptide was presented by the DR6wcI, DR4w4, or DRw11.1 and DRw11.2 alleles, demonstrating that shared MHC class II antigens are not required for shared V beta gene use by T cell receptors (TCRs) specific for this peptide. V alpha gene use was more heterogeneous, with at least seven different V alpha segments derived from five distinct families encoding alpha chains able to pair with V beta 2.1 chains to form a tt830-844/DR- specific binding site. Several cases were found of clones restricted to different DR alleles that expressed identical V beta and (or very closely related) V alpha gene segments and that differed only in their junctional sequences. Thus, changes in the putative complementary determining region 3 (CDR3) of the TCR may, in certain cases, alter MHC specificity and maintain peptide reactivity. Finally, in contrast to what has been observed in other defined peptide/MHC systems, a striking heterogeneity was found in the junctional regions of both alpha and beta chains, even for TCRs with identical V alpha and/or V beta gene segments and the same restriction. Among 14 anti-tt830-844 clones using the V beta 2.1 gene segment, 14 unique V beta-D-J beta junctions were found, with no evident conservation in length and/or amino acid composition. One interpretation for this apparent lack of coselection of specific junctional sequences in the context of a common V element, V beta 2.1, is that this V region plays a dominant role in the recognition of the tt830-844/DR complex. PMID:1371303

Transcranial direct current stimulation of dorsolateral prefrontal cortex during encoding improves recall but not recognition memory

DOE PAGES

Leshikar, Eric D.; Leach, Ryan C.; McCurdy, Matthew P.; ...

2017-10-19

Prior work demonstrates that application of transcranial direct current stimulation (tDCS) improves memory. In this study, we investigated tDCS effects on face-name associative memory using both recall and recognition tests. Participants encoded face-name pairs under either active (1.5 mA) or sham (.1 mA) stimulation applied to the scalp adjacent to the left dorsolateral prefrontal cortex (dlPFC), an area known to support associative memory. Participants’ memory was then tested after study (day one) and then again after a 24-h delay (day two), to assess both immediate and delayed stimulation effects on memory. Results indicated that active relative to sham stimulation ledmore » to substantially improved recall (more than 50%) at both day one and day two. Recognition memory performance did not differ between stimulation groups at either time point. These results suggest that stimulation at encoding improves memory performance by enhancing memory for details that enable a rich recollective experience, but that these improvements are evident only under some testing conditions, especially those that rely on recollection. Altogether, stimulation of the dlPFC could have led to recall improvement through enhanced encoding from stimulation or from carryover effects of stimulation that influenced retrieval processes, or both.« less

Transcranial direct current stimulation of dorsolateral prefrontal cortex during encoding improves recall but not recognition memory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leshikar, Eric D.; Leach, Ryan C.; McCurdy, Matthew P.

Prior work demonstrates that application of transcranial direct current stimulation (tDCS) improves memory. In this study, we investigated tDCS effects on face-name associative memory using both recall and recognition tests. Participants encoded face-name pairs under either active (1.5 mA) or sham (.1 mA) stimulation applied to the scalp adjacent to the left dorsolateral prefrontal cortex (dlPFC), an area known to support associative memory. Participants’ memory was then tested after study (day one) and then again after a 24-h delay (day two), to assess both immediate and delayed stimulation effects on memory. Results indicated that active relative to sham stimulation ledmore » to substantially improved recall (more than 50%) at both day one and day two. Recognition memory performance did not differ between stimulation groups at either time point. These results suggest that stimulation at encoding improves memory performance by enhancing memory for details that enable a rich recollective experience, but that these improvements are evident only under some testing conditions, especially those that rely on recollection. Altogether, stimulation of the dlPFC could have led to recall improvement through enhanced encoding from stimulation or from carryover effects of stimulation that influenced retrieval processes, or both.« less

Medial prefrontal cortex supports source memory accuracy for self-referenced items

PubMed Central

Leshikar, Eric D.; Duarte, Audrey

2013-01-01

Previous behavioral work suggests that processing information in relation to the self enhances subsequent item recognition. Neuroimaging evidence further suggests that regions along the cortical midline, particularly those of the medial prefrontal cortex, underlie this benefit. There has been little work to date, however, on the effects of self-referential encoding on source memory accuracy or whether the medial prefrontal cortex might contribute to source memory for self-referenced materials. In the current study, we used fMRI to measure neural activity while participants studied and subsequently retrieved pictures of common objects superimposed on one of two background scenes (sources) under either self-reference or self-external encoding instructions. Both item recognition and source recognition were better for objects encoded self-referentially than self-externally. Neural activity predictive of source accuracy was observed in the medial prefrontal cortex (BA 10) at the time of study for self-referentially but not self-externally encoded objects. The results of this experiment suggest that processing information in relation to the self leads to a mnemonic benefit for source level features, and that activity in the medial prefrontal cortex contributes to this source memory benefit. This evidence expands the purported role that the medial prefrontal cortex plays in self-referencing. PMID:21936739

Encoding deficit during face processing within the right fusiform face area in schizophrenia.

PubMed

Walther, Sebastian; Federspiel, Andrea; Horn, Helge; Bianchi, Piero; Wiest, Roland; Wirth, Miranka; Strik, Werner; Müller, Thomas Jörg

2009-06-30

Face processing is crucial to social interaction, but is impaired in schizophrenia patients, who experience delays in face recognition, difficulties identifying others, and misperceptions of affective content. The right fusiform face area plays an important role in the early stages of human face processing and thus may be affected in schizophrenia. The aim of the study was therefore to investigate whether face processing deficits are related to dysfunctions of the right fusiform face area in schizophrenia patients compared with controls. In a rapid, event-related functional magnetic resonance imaging (fMRI) design, we investigated the encoding of new faces, as well as the recognition of newly learned, famous, and unfamiliar faces, in 13 schizophrenia patients and 21 healthy controls. We applied region of interest analysis to each individual's right fusiform face area and tested for group differences. Controls displayed higher blood oxygenation level dependent (BOLD) activation during the memorization of faces that were later successfully recognized. In schizophrenia patients, this effect was not observed. During the recognition task, schizophrenia patients exhibited lower BOLD responses, less accuracy, and longer reaction times to famous and unfamiliar faces. Our results support the hypothesis that impaired face processing in schizophrenia is related to early-stage deficits during the encoding and recognition of faces.

Co-factors Required for TLR7- and TLR9- dependent Innate Immune Responses

PubMed Central

Chiang, Chih-yuan; Engel, Alex; Opaluch, Amanda M.; Ramos, Irene; Maestre, Ana M.; Secundino, Ismael; De Jesus, Paul D.; Nguyen, Quy T.; Welch, Genevieve; Bonamy, Ghislain M.C.; Miraglia, Loren J.; Orth, Anthony P.; Nizet, Victor; Fernandez-Sesma, Ana; Zhou, Yingyao; Barton, Gregory M.; Chanda, Sumit K.

2012-01-01

SUMMARY Pathogens commonly utilize endocytic pathways to gain cellular access. The endosomal pattern recognition receptors TLR7 and TLR9 detect pathogen-encoded nucleic acids to initiate MyD88-dependent pro-inflammatory responses to microbial infection. Using genome-wide RNAi screening and integrative systems-based analysis we identify 190 co-factors required for TLR7- and TLR9-directed signaling responses. A set of co-factors were cross-profiled for their activities downstream of several immunoreceptors, and then functionally mapped based on the known architecture of NF-κB signaling pathways. Protein complexes and pathways involved in ubiquitin-protein ligase activities, sphingolipid metabolism, chromatin modifications, and ancient stress responses were found to modulate innate recognition of endosomal nucleic acids. Additionally, hepatocyte growth factor-regulated tyrosine kinase substrate (HRS) was characterized as necessary for ubiquitin-dependent TLR9 targeting to the endolysosome. Proteins and pathways identified here should prove useful in delineating strategies to manipulate innate responses for treatment of autoimmune disorders and microbial infection. PMID:22423970

When Does Memory Monitoring Succeed versus Fail? Comparing Item-Specific and Relational Encoding in the DRM Paradigm

ERIC Educational Resources Information Center

Huff, Mark J.; Bodner, Glen E.

2013-01-01

We compared the effects of item-specific versus relational encoding on recognition memory in the Deese-Roediger-McDermott paradigm. In Experiment 1, we directly compared item-specific and relational encoding instructions, whereas in Experiments 2 and 3 we biased pleasantness and generation tasks, respectively, toward one or the other type of…

Emotional Encoding Context Leads to Memory Bias in Individuals with High Anxiety

PubMed Central

Fernandes, Myra A.

2017-01-01

We investigated whether anxious individuals, who adopt an inherently negative mindset, demonstrate a particularly salient memory bias for words tainted by negative contexts. To this end, sequentially presented target words, overlayed onto negative or neutral pictures, were studied in separate blocks (within-subjects) using a deep or shallow encoding instruction (between-subjects). Following study, in Test 1, participants completed separate recognition test blocks for the words overlayed onto the negative and the neutral contexts. Following this, in Test 2, participants completed a recognition test for the foils from each Test 1 block. We found a significant three-way interaction on Test 2, such that individuals with high anxiety who initially studied target words using a shallow encoding instruction, demonstrated significantly elevated memory for foils that were contained within the negative Test 1 block. Results show that during retrieval (Test 1), participants re-entered the mode of processing (negative or neutral) engaged at encoding, tainting the encoding of foils with that same mode of processing. The findings suggest that individuals with high relative to low anxiety, adopt a particularly salient negative retrieval mode, and this creates a downstream bias in encoding and subsequent retrieval of otherwise neutral information. PMID:29280957

Magnetoencephalographic--features related to mild cognitive impairment.

PubMed

Püregger, E; Walla, P; Deecke, L; Dal-Bianco, P

2003-12-01

We recorded changes of brain activity from 10 MCI patients and 10 controls related to shallow (nonsemantic) and deep (semantic) word encoding using a whole-head MEG. During the following recognition tasks, all participants had to recognize the previously encoded words, which were presented again together with new words. In both groups recognition performance significantly varied as a function of depth of processing. No significant differences were found between the groups. Reaction times related to correctly classified new words (correct rejections) and incorrectly classified repetitions (misses) of MCI patients showed a strong tendency toward prolongation compared to controls, although no statistically significant differences occurred. Strikingly, in patients the neurophysiological data associated with nonsemantic and semantic word encoding differed significantly between 250 and 450 ms after stimulus onset mainly over left frontal and left temporal sensors. They showed higher electrophysiological activation during shallow encoding as compared to deep encoding. No such significant differences were found in controls. The present results might reflect a dysfunction with respect to shallow encoding of visually presented verbal information. It is interpreted that additional neural activation is needed to compensate for neurodegeneration. This finding is suggested to be an additional tool for MCI diagnosis.

Emotional Encoding Context Leads to Memory Bias in Individuals with High Anxiety.

PubMed

Lee, Christopher; Fernandes, Myra A

2017-12-27

We investigated whether anxious individuals, who adopt an inherently negative mindset, demonstrate a particularly salient memory bias for words tainted by negative contexts. To this end, sequentially presented target words, overlayed onto negative or neutral pictures, were studied in separate blocks (within-subjects) using a deep or shallow encoding instruction (between-subjects). Following study, in Test 1, participants completed separate recognition test blocks for the words overlayed onto the negative and the neutral contexts. Following this, in Test 2, participants completed a recognition test for the foils from each Test 1 block. We found a significant three-way interaction on Test 2, such that individuals with high anxiety who initially studied target words using a shallow encoding instruction, demonstrated significantly elevated memory for foils that were contained within the negative Test 1 block. Results show that during retrieval (Test 1), participants re-entered the mode of processing (negative or neutral) engaged at encoding, tainting the encoding of foils with that same mode of processing. The findings suggest that individuals with high relative to low anxiety, adopt a particularly salient negative retrieval mode, and this creates a downstream bias in encoding and subsequent retrieval of otherwise neutral information.

False recognition depends on depth of prior word processing: a magnetoencephalographic (MEG) study.

PubMed

Walla, P; Hufnagl, B; Lindinger, G; Deecke, L; Imhof, H; Lang, W

2001-04-01

Brain activity was measured with a whole head magnetoencephalograph (MEG) during the test phases of word recognition experiments. Healthy young subjects had to discriminate between previously presented and new words. During prior study phases two different levels of word processing were provided according to two different kinds of instructions (shallow and deep encoding). Event-related fields (ERFs) associated with falsely recognized words (false alarms) were found to depend on the depth of processing during the prior study phase. False alarms elicited higher brain activity (as reflected by dipole strength) in case of prior deep encoding as compared to shallow encoding between 300 and 500 ms after stimulus onset at temporal brain areas. Between 500 and 700 ms we found evidence for differences in the involvement of neural structures related to both conditions of false alarms. Furthermore, the number of false alarms was found to depend on depth of processing. Shallow encoding led to a higher number of false alarms than deep encoding. All data are discussed as strong support for the ideas that a certain level of word processing is performed by a distinct set of neural systems and that the same neural systems which encode information are reactivated during the retrieval.

Semantic attributes are encoded in human electrocorticographic signals during visual object recognition.

PubMed

Rupp, Kyle; Roos, Matthew; Milsap, Griffin; Caceres, Carlos; Ratto, Christopher; Chevillet, Mark; Crone, Nathan E; Wolmetz, Michael

2017-03-01

Non-invasive neuroimaging studies have shown that semantic category and attribute information are encoded in neural population activity. Electrocorticography (ECoG) offers several advantages over non-invasive approaches, but the degree to which semantic attribute information is encoded in ECoG responses is not known. We recorded ECoG while patients named objects from 12 semantic categories and then trained high-dimensional encoding models to map semantic attributes to spectral-temporal features of the task-related neural responses. Using these semantic attribute encoding models, untrained objects were decoded with accuracies comparable to whole-brain functional Magnetic Resonance Imaging (fMRI), and we observed that high-gamma activity (70-110Hz) at basal occipitotemporal electrodes was associated with specific semantic dimensions (manmade-animate, canonically large-small, and places-tools). Individual patient results were in close agreement with reports from other imaging modalities on the time course and functional organization of semantic processing along the ventral visual pathway during object recognition. The semantic attribute encoding model approach is critical for decoding objects absent from a training set, as well as for studying complex semantic encodings without artificially restricting stimuli to a small number of semantic categories. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Reading Faces: From Features to Recognition.

PubMed

Guntupalli, J Swaroop; Gobbini, M Ida

2017-12-01

Chang and Tsao recently reported that the monkey face patch system encodes facial identity in a space of facial features as opposed to exemplars. Here, we discuss how such coding might contribute to face recognition, emphasizing the critical role of learning and interactions with other brain areas for optimizing the recognition of familiar faces. Copyright © 2017 Elsevier Ltd. All rights reserved.

Bag-of-visual-phrases and hierarchical deep models for traffic sign detection and recognition in mobile laser scanning data

NASA Astrophysics Data System (ADS)

Yu, Yongtao; Li, Jonathan; Wen, Chenglu; Guan, Haiyan; Luo, Huan; Wang, Cheng

2016-03-01

This paper presents a novel algorithm for detection and recognition of traffic signs in mobile laser scanning (MLS) data for intelligent transportation-related applications. The traffic sign detection task is accomplished based on 3-D point clouds by using bag-of-visual-phrases representations; whereas the recognition task is achieved based on 2-D images by using a Gaussian-Bernoulli deep Boltzmann machine-based hierarchical classifier. To exploit high-order feature encodings of feature regions, a deep Boltzmann machine-based feature encoder is constructed. For detecting traffic signs in 3-D point clouds, the proposed algorithm achieves an average recall, precision, quality, and F-score of 0.956, 0.946, 0.907, and 0.951, respectively, on the four selected MLS datasets. For on-image traffic sign recognition, a recognition accuracy of 97.54% is achieved by using the proposed hierarchical classifier. Comparative studies with the existing traffic sign detection and recognition methods demonstrate that our algorithm obtains promising, reliable, and high performance in both detecting traffic signs in 3-D point clouds and recognizing traffic signs on 2-D images.

Variation in genome-wide mutation rates within and between human families.

PubMed

Conrad, Donald F; Keebler, Jonathan E M; DePristo, Mark A; Lindsay, Sarah J; Zhang, Yujun; Casals, Ferran; Idaghdour, Youssef; Hartl, Chris L; Torroja, Carlos; Garimella, Kiran V; Zilversmit, Martine; Cartwright, Reed; Rouleau, Guy A; Daly, Mark; Stone, Eric A; Hurles, Matthew E; Awadalla, Philip

2011-06-12

J.B.S. Haldane proposed in 1947 that the male germline may be more mutagenic than the female germline. Diverse studies have supported Haldane's contention of a higher average mutation rate in the male germline in a variety of mammals, including humans. Here we present, to our knowledge, the first direct comparative analysis of male and female germline mutation rates from the complete genome sequences of two parent-offspring trios. Through extensive validation, we identified 49 and 35 germline de novo mutations (DNMs) in two trio offspring, as well as 1,586 non-germline DNMs arising either somatically or in the cell lines from which the DNA was derived. Most strikingly, in one family, we observed that 92% of germline DNMs were from the paternal germline, whereas, in contrast, in the other family, 64% of DNMs were from the maternal germline. These observations suggest considerable variation in mutation rates within and between families.

Spontaneous generation of germline characteristics in mouse fibrosarcoma cells

NASA Astrophysics Data System (ADS)

Ma, Zhan; Hu, Yao; Jiang, Guoying; Hou, Jun; Liu, Ruilai; Lu, Yuan; Liu, Chunfang

2012-10-01

Germline/embryonic-specific genes have been found to be activated in somatic tumors. In this study, we further showed that cells functioning as germline could be present in mouse fibrosarcoma cells (L929 cell line). Early germline-like cells spontaneously appeared in L929 cells and further differentiated into oocyte-like cells. These germline-like cells can, in turn, develop into blastocyst-like structures in vitro and cause teratocarcinomas in vivo, which is consistent with natural germ cells in function. Generation of germline-like cells from somatic tumors might provide a novel way to understand why somatic cancer cells have strong features of embryonic/germline development. It is thought that the germline traits of tumors are associated with the central characteristics of malignancy, such as immortalization, invasion, migration and immune evasion. Therefore, germline-like cells in tumors might provide potential targets to tumor biology, diagnosis and therapy.

Brain regions and functional interactions supporting early word recognition in the face of input variability.

PubMed

Benavides-Varela, Silvia; Siugzdaite, Roma; Gómez, David Maximiliano; Macagno, Francesco; Cattarossi, Luigi; Mehler, Jacques

2017-07-18

Perception and cognition in infants have been traditionally investigated using habituation paradigms, assuming that babies' memories in laboratory contexts are best constructed after numerous repetitions of the very same stimulus in the absence of interference. A crucial, yet open, question regards how babies deal with stimuli experienced in a fashion similar to everyday learning situations-namely, in the presence of interfering stimuli. To address this question, we used functional near-infrared spectroscopy to test 40 healthy newborns on their ability to encode words presented in concomitance with other words. The results evidenced a habituation-like hemodynamic response during encoding in the left-frontal region, which was associated with a progressive decrement of the functional connections between this region and the left-temporal, right-temporal, and right-parietal regions. In a recognition test phase, a characteristic neural signature of recognition recruited first the right-frontal region and subsequently the right-parietal ones. Connections originating from the right-temporal regions to these areas emerged when newborns listened to the familiar word in the test phase. These findings suggest a neural specialization at birth characterized by the lateralization of memory functions: the interplay between temporal and left-frontal regions during encoding and between temporo-parietal and right-frontal regions during recognition of speech sounds. Most critically, the results show that newborns are capable of retaining the sound of specific words despite hearing other stimuli during encoding. Thus, habituation designs that include various items may be as effective for studying early memory as repeated presentation of a single word.

56. The Role of Prefrontal Cortex in Self-Referential Memory Retrieval in Schizophrenia

PubMed Central

Jimenez, Amy; Lee, Junghee; Wynn, Jonathan K.; Horan, William; Iglesias, Julio; Hoy, Jennifer; Green, Michael F.

2017-01-01

Abstract Background: Enhanced memory for self-oriented information is known as the self-referential memory (SRM) effect. fMRI studies of the SRM effect have largely focused on encoding, revealing selective engagement of medial prefrontal cortex (mPFC) during “self” relative to other semantic processing conditions. Other areas typically activated during self-processing include the ventrolateral prefrontal cortex (vlPFC) and temporo-parietal junction (TPJ). Previous imaging work by our group indicated that patients with schizophrenia activate regions similar to controls during encoding of self-referential information. However, little is known about activation patterns during retrieval, or how activation during encoding relates to retrieval behaviorally. The current study utilized an SRM task to examine: (1) the neural correlates of the retrieval of previously encoded self-oriented information, and (2) the relationship between behavioral data from the retrieval phase and fMRI data at encoding. Methods: 20 clinically stable schizophrenia outpatients and 16 demographically matched healthy controls completed an SRM task modified for event-related fMRI. During the encoding phase, trait adjectives were judged in terms of structural features (“case” condition), social desirability (“other” condition), or as self-referential (“self” condition). Following a 12-minute delay comprised of distractor tasks, memory for trait adjectives was tested during an unexpected yes–no recognition test (retrieval phase). Voxel-wise whole-brain BOLD signal analysis of retrieval phase data was used to examine contrasts of interest with a cluster-threshold of Z = 2.3, P < .05, corrected for multiple comparisons. Results: During retrieval, both groups demonstrated better recognition discriminability (d-prime) for adjectives from the “self” and “other” conditions compared to the “case” condition; d-prime scores were greater for the “self” condition compared to the “other” condition at the trend level. During retrieval, controls showed greater activation than patients in several areas of lateral prefrontal cortex including inferior frontal gyrus (Brodmann Area, BA, 44/45) and middle frontal gyrus (BA 9) for words from the “self” condition. Further, level of activation of mPFC (BA 10) during encoding was positively correlated with d-prime for the “self” condition in controls, but not patients. Conclusion: Although the groups demonstrated comparable behavioral performance during the retrieval phase of an SRM task, regional BOLD activation of prefrontal regions discriminated patients from controls during the retrieval of self-oriented information. The current findings add to a growing body of literature highlighting the critical role of disrupted mPFC activity in self-oriented processing in schizophrenia.

Recalled Aspects of Original Encoding Strategies Influence Episodic Feeling of Knowing

PubMed Central

Hertzog, Christopher; Fulton, Erika K.; Sinclair, Starlette M.; Dunlosky, John

2013-01-01

We tested the hypothesis that feeling of knowing (FOK) after a failed recall attempt is influenced by recalling aspects of the original encoding strategy. Individuals were instructed to use interactive imagery to encode unrelated word pairs. We manipulated item concreteness (abstract versus concrete) and item repetition at study (1 versus 3). Participants orally described the mediator produced immediately after studying each item, if any. After a delay they were given cued recall, made FOK ratings, and attempted to recall their original mediator. Concreteness and item repetition enhanced strategy recall, which had a large effect on FOKs. Controlling on strategy recall reduced the predictive validity of FOKs for recognition memory, indicating that access to original aspects of encoding influenced FOK accuracy. Confidence judgments (CJs) for correctly recognized items covaried with FOKs, but FOKs did not fully track strategy recall associations with CJs, suggesting emergent effects of strategy cues elicited by recognition tests not accessed at the time of the FOK judgment. In summary, cue-generated access to aspects of the original encoding strategy strongly influenced episodic FOK, although other influences are also implicated. PMID:23835601

Quantum-dots-encoded-microbeads based molecularly imprinted polymer.

PubMed

Liu, Yixi; Liu, Le; He, Yonghong; He, Qinghua; Ma, Hui

2016-03-15

Quantum dots encoded microbeads have various advantages such as large surface area, superb optical properties and the ability of multiplexing. Molecularly imprinted polymer that can mimic the natural recognition entities has high affinity and selectivity for the specific analyte. Here, the concept of utilizing the quantum dots encoded microbeads as the supporting material and the polydopamine as the functional monomer to form the core-shell molecular imprinted polymer was proposed for the first time. The resulted imprinted polymer can provide various merits: polymerization can complete in aqueous environment; fabrication procedure is facile and universal; the obvious economic advantage; the thickness of the imprinting layer is highly controllable; polydopamine coating can improve the biocompatibility of the quantum dot encoded microbeads. The rabbit IgG binding and flow cytometer experiment result showed the distinct advantages of this strategy: cost-saving, facile and fast preparation procedure. Most importantly, the ability for the multichannel detection, which makes the imprinted polydopamine modified encoded-beads very attractive in protein pre-concentration, recognition, separation and biosensing. Copyright © 2015 Elsevier B.V. All rights reserved.

Recalled aspects of original encoding strategies influence episodic feelings of knowing.

PubMed

Hertzog, Christopher; Fulton, Erika K; Sinclair, Starlette M; Dunlosky, John

2014-01-01

We tested the hypothesis that the feeling of knowing (FOK) after a failed recall attempt is influenced by recalling aspects of the original encoding strategy. Individuals were instructed to use interactive imagery to encode unrelated word pairs. We manipulated item concreteness (abstract vs. concrete) and item repetitions at study (one vs. three). Participants orally described the mediator produced immediately after studying each item, if any. After a delay, they were given cued recall, made FOK ratings, and attempted to recall their original mediator. Concreteness and item repetition enhanced strategy recall, which had a large effect on FOKs. Controlling on strategy recall reduced the predictive validity of FOKs for recognition memory, indicating that access to the original aspects of encoding influenced FOK accuracy. Confidence judgments (CJs) for correctly recognized items covaried with FOKs, but FOKs did not fully track the strategy recall associations with CJs, suggesting emergent effects of strategy cues that were elicited by recognition tests but not accessed at the time of the FOK judgment. In summary, cue-generated access to aspects of the original encoding strategy strongly influenced episodic FOKs, although other influences were also implicated.

Odor Memory and Discrimination Covary as a Function of Delay between Encoding and Recall in Rats.

PubMed

Hackett, Chelsea; Choi, Christina; O'Brien, Brenna; Shin, Philip; Linster, Christiane

2015-06-01

Nonassociative odor learning paradigms are often used to assess memory, social recognition and neuromodulation of olfactory pathways. We here use a modified object recognition paradigm to investigate how an important task parameter, delay between encoding and recall trials, affects the properties of this memory. We show that both memory for a previously investigated odorant and discrimination of a novel odorant decay with delay time and that rats can remember an odorant for up to 45min after a single trial encoding event. The number of odorants that can be encoded, as well as the specificity of the encoded memory, decrease with increased delay and also depend on stimulus concentration. Memory for an odorant and discrimination of a novel odorant decay at approximately the same rate, whereas the specificity of the formed memory decays faster than the memory itself. These results have important implications for the interpretation of behavioral data obtained with this paradigm. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Effects of distinctive encoding on source-based false recognition: further examination of recall-to-reject processes in aging and Alzheimer disease.

PubMed

Pierce, Benton H; Waring, Jill D; Schacter, Daniel L; Budson, Andrew E

2008-09-01

To examine the use of distinctive materials at encoding on recall-to-reject monitoring processes in aging and Alzheimer disease (AD). AD patients, and to a lesser extent older adults, have shown an impaired ability to use recollection-based monitoring processes (eg, recall-to-reject) to avoid various types of false memories, such as source-based false recognition. Younger adults, healthy older adults, and AD patients engaged in an incidental learning task, in which critical category exemplars were either accompanied by a distinctive picture or were presented as only words. Later, participants studied a series of categorized lists in which several typical exemplars were omitted and were then given a source memory test. Both older and younger adults made more accurate source attributions after picture encoding compared with word-only encoding, whereas AD patients did not exhibit this distinctiveness effect. These results extend those of previous studies showing that monitoring in older adults can be enhanced with distinctive encoding, and suggest that such monitoring processes in AD patients many be insensitive to distinctiveness.

Role of the anterior cingulate cortex in the retrieval of novel object recognition memory after a long delay

PubMed Central

Pezze, Marie A.; Marshall, Hayley J.; Fone, Kevin CF.; Cassaday, Helen J.

2017-01-01

Previous in vivo electrophysiological studies suggest that the anterior cingulate cortex (ACgx) is an important substrate of novel object recognition (NOR) memory. However, intervention studies are needed to confirm this conclusion and permanent lesion studies cannot distinguish effects on encoding and retrieval. The interval between encoding and retrieval tests may also be a critical determinant of the role of the ACgx. The current series of experiments used micro-infusion of the GABAA receptor agonist, muscimol, into ACgx to reversibly inactivate the area and distinguish its role in encoding and retrieval. ACgx infusions of muscimol, before encoding did not alter NOR assessed after a delay of 20 min or 24 h. However, when infused into the ACgx before retrieval muscimol impaired NOR assessed after a delay of 24 h, but not after a 20-min retention test. Together these findings suggest that the ACgx plays a time-dependent role in the retrieval, but not the encoding, of NOR memory, neuronal activation being required for the retrieval of remote (24 h old), but not recent (20 min old) visual memory. PMID:28620078

Role of sleep for encoding of emotional memory.

PubMed

Kaida, Kosuke; Niki, Kazuhisa; Born, Jan

2015-05-01

Total sleep deprivation (TSD) has been consistently found to impair encoding of information during ensuing wakefulness, probably through suppressing NonREM (non-rapid eye movement) sleep. However, a possible contribution of missing REM sleep to this encoding impairment after TSD has so far not been systematically examined in humans, although such contribution might be suspected in particular for emotional information. Here, in two separate experiments in young healthy men, we compared effects of TSD and of selective REM sleep deprivation (REMD), relative to respective control conditions of undisturbed sleep, on the subsequent encoding of neutral and emotional pictures. The pictures were presented in conjunction with colored frames to also assess related source memory. REMD was achieved by tones presented contingently upon initial signs of REM sleep. Encoding capabilities were examined in the evening (18:00h) after the experimental nights, by a picture recognition test right after encoding. TSD significantly decreased both the rate of correctly recognized pictures and of recalled frames associated with the pictures. The TSD effect was robust and translated into an impaired long term memory formation, as it was likewise observed on a second recognition testing one week after the encoding phase. Contrary to our expectation, REMD did not affect encoding in general, or particularly of emotional pictures. Also, REMD did not affect valence ratings of the encoded pictures. However, like TSD, REMD distinctly impaired vigilance at the time of encoding. Altogether, these findings indicate an importance of NonREM rather than REM sleep for the encoding of information that is independent of the emotionality of the materials. Copyright © 2015 Elsevier Inc. All rights reserved.

Character recognition from trajectory by recurrent spiking neural networks.

PubMed

Jiangrong Shen; Kang Lin; Yueming Wang; Gang Pan

2017-07-01

Spiking neural networks are biologically plausible and power-efficient on neuromorphic hardware, while recurrent neural networks have been proven to be efficient on time series data. However, how to use the recurrent property to improve the performance of spiking neural networks is still a problem. This paper proposes a recurrent spiking neural network for character recognition using trajectories. In the network, a new encoding method is designed, in which varying time ranges of input streams are used in different recurrent layers. This is able to improve the generalization ability of our model compared with general encoding methods. The experiments are conducted on four groups of the character data set from University of Edinburgh. The results show that our method can achieve a higher average recognition accuracy than existing methods.

Neural dynamics based on the recognition of neural fingerprints

PubMed Central

Carrillo-Medina, José Luis; Latorre, Roberto

2015-01-01

Experimental evidence has revealed the existence of characteristic spiking features in different neural signals, e.g., individual neural signatures identifying the emitter or functional signatures characterizing specific tasks. These neural fingerprints may play a critical role in neural information processing, since they allow receptors to discriminate or contextualize incoming stimuli. This could be a powerful strategy for neural systems that greatly enhances the encoding and processing capacity of these networks. Nevertheless, the study of information processing based on the identification of specific neural fingerprints has attracted little attention. In this work, we study (i) the emerging collective dynamics of a network of neurons that communicate with each other by exchange of neural fingerprints and (ii) the influence of the network topology on the self-organizing properties within the network. Complex collective dynamics emerge in the network in the presence of stimuli. Predefined inputs, i.e., specific neural fingerprints, are detected and encoded into coexisting patterns of activity that propagate throughout the network with different spatial organization. The patterns evoked by a stimulus can survive after the stimulation is over, which provides memory mechanisms to the network. The results presented in this paper suggest that neural information processing based on neural fingerprints can be a plausible, flexible, and powerful strategy. PMID:25852531