Beta-glucan-depleted, glycopeptide-rich extracts from Brewer's and Baker's yeast (Saccharomyces cerevisiae) lower interferon-gamma production by stimulated human blood cells in vitro.

PubMed

Williams, Roderick; Dias, Daniel A; Jayasinghe, Nirupama; Roessner, Ute; Bennett, Louise E

2016-04-15

Regulation of the human immune system requires controlled pro- and anti-inflammatory responses for host defence against infection and disease states. Yeasts (Saccharomyces cerevisiae), as used in brewing and baking, are mostly known for ability to stimulate the human immune-system predominantly reflecting the pro-inflammatory cell wall β-glucans. However, in this study, using food-compatible processing methods, glycopeptide-enriched and β-glucan-depleted products were each prepared from Brewer's and Baker's yeasts, which suppressed production of interferon-γ (IFN-γ) in human whole blood cell assay, signifying that anti-inflammatory factors are also present in yeast. Anti-inflammatory bioactivities of products prepared from Brewer's and Baker's yeast were compared with the commercial yeast product, Epicor®. While unfractionated Epicor was inactive, the C18 resin-binding fractions of Brewer's and Baker's yeast products and Epicor dose-dependently lowered IFN-γ, demonstrating that Epicor also contained both pro-inflammatory (β-glucans) and anti-inflammatory components. Anti-inflammatory activity was attributed to C18 resin-binding species glyco-peptides in Epicor and experimental yeast products. This study demonstrated that pro- and anti-inflammatory factors could be resolved and enriched in yeasts by suitable processing, with potential to improve specific activities. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

Re-engineering specificity in 1,3-1, 4-β-glucanase to accept branched xyloglucan substrates.

PubMed

Addington, Trevor; Calisto, Barbara; Alfonso-Prieto, Mercedes; Rovira, Carme; Fita, Ignasi; Planas, Antoni

2011-02-01

Family 16 carbohydrate active enzyme members Bacillus licheniformis 1,3-1,4-β-glucanase and Populus tremula x tremuloides xyloglucan endotransglycosylase (XET16-34) are highly structurally related but display different substrate specificities. Although the first binds linear gluco-oligosaccharides, the second binds branched xylogluco-oligosaccharides. Prior engineered nucleophile mutants of both enzymes are glycosynthases that catalyze the condensation between a glycosyl fluoride donor and a glycoside acceptor. With the aim of expanding the glycosynthase technology to produce designer oligosaccharides consisting of hybrids between branched xylogluco- and linear gluco-oligosaccharides, enzyme engineering on the negative subsites of 1,3-1,4-β-glucanase to accept branched substrates has been undertaken. Removal of the 1,3-1,4-β-glucanase major loop and replacement with that of XET16-34 to open the binding cleft resulted in a folded protein, which still maintained some β-glucan hydrolase activity, but the corresponding nucleophile mutant did not display glycosynthase activity with either linear or branched glycosyl donors. Next, point mutations of the 1,3-1,4-β-glucanase β-sheets forming the binding site cleft were mutated to resemble XET16-34 residues. The final chimeric protein acquired binding affinity for xyloglucan and did not bind β-glucan. Therefore, binding specificity has been re-engineered, but affinity was low and the nucleophile mutant of the chimeric enzyme did not show glycosynthase activity to produce the target hybrid oligosaccharides. Structural analysis by X-ray crystallography explains these results in terms of changes in the protein structure and highlights further engineering approaches toward introducing the desired activity. © 2010 Wiley-Liss, Inc.

Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192

PubMed Central

Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung

2017-01-01

ABSTRACT Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast (Saccharomyces cerevisiae) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter (malEFG1) and pullulanase (aapA) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable. Coupling classic forward genetics with next-generation sequencing, here we identified an ABC transporter ATP-binding protein (MalK) responsible for the import of insoluble yeast glucan breakdown products by B. breve JCM1192. We demonstrated the pleiotropic effects of the ABC transporter ATP-binding protein in maltose/maltooligosaccharide, raffinose, cellobiose, melibiose, and turanose transport. With the addition of transcriptional analysis, we propose that insoluble yeast glucans are broken down by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. PMID:28115383

Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192.

PubMed

Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan

2017-04-01

Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable. Coupling classic forward genetics with next-generation sequencing, here we identified an ABC transporter ATP-binding protein (MalK) responsible for the import of insoluble yeast glucan breakdown products by B. breve JCM1192. We demonstrated the pleiotropic effects of the ABC transporter ATP-binding protein in maltose/maltooligosaccharide, raffinose, cellobiose, melibiose, and turanose transport. With the addition of transcriptional analysis, we propose that insoluble yeast glucans are broken down by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. Copyright © 2017 American Society for Microbiology.

Vitronectin and fibronectin function as glucan binding proteins augmenting macrophage responses to Pneumocystis carinii.

PubMed

Vassallo, R; Kottom, T J; Standing, J E; Limper, A H

2001-08-01

beta-glucans represent major structural components of fungal cell walls. We recently reported that Pneumocystis carinii beta-glucans stimulate alveolar macrophages to release proinflammatory cytokines. Macrophage activation by beta-glucan is augmented by serum, implying the presence of circulating factors that interact with beta-glucans and enhance their ability to stimulate macrophages. Using beta-glucan-enriched cell wall fractions from P. carinii and Saccharomyces cerevisiae, two prominent proteins were precipitated from serum and demonstrated to be vitronectin (VN) and fibronectin (FN) by immune analysis. Preincubation of beta-glucan with VN or FN enhanced macrophage activation in response to this cell wall component. Because VN and FN accumulate in the lungs during P. carinii pneumonia, we further investigated hepatic and pulmonary expression of VN and FN messenger RNA during infection. P. carinii pneumonia in rodents is associated with increased hepatic expression of VN and FN as well as increased local expression of FN in the lung. Because interleukin (IL)-6 represents the major regulator of VN and FN expression during inflammatory conditions, we measured macrophage IL-6 release in response to stimulation with P. carinii beta-glucan. Stimulation of macrophages with P. carinii beta-glucan induced significant release of IL-6. Elevated concentrations of IL-6 were noted in the blood of infected animals compared with uninfected control animals. These studies indicate that VN and FN bind to beta-glucan components of P. carinii and augment macrophage inflammatory responses. P. carinii cell wall beta-glucan stimulates secretion of IL-6 by macrophages, thereby enhancing hepatic synthesis of both VN and FN, and lung synthesis of FN during pneumonia.

Contribution of AmyA, an extracellular α-glucan degrading enzyme, to group A streptococcal host-pathogen interaction

PubMed Central

Shelburne, Samuel A.; Keith, David B.; Davenport, Michael T.; Beres, Stephen B.; Carroll, Ronan K.; Musser, James M.

2010-01-01

α-glucans such as starch and glycogen are abundant in the human oropharynx, the main site of group A Streptococcus (GAS) infection. However, the role in pathogenesis of GAS extracellular α-glucan binding and degrading enzymes is unknown. The serotype M1 GAS genome encodes two extracellular proteins putatively involved in α-glucan binding and degradation; pulA encodes a cell-wall anchored pullulanase and amyA encodes a freely secreted putative cyclomaltodextrin α-glucanotransferase. Genetic inactivation of amyA, but not pulA, abolished GAS α-glucan degradation. The ΔamyA strain had a slower rate of translocation across human pharyngeal epithelial cells. Consistent with this finding, the ΔamyA strain was less virulent following mouse mucosal challenge. Recombinant AmyA degraded α-glucans into β-cyclomaltodextrins that reduced pharyngeal cell transepithelial resistance, providing a physiologic explanation for the observed transepithelial migration phenotype. Higher amyA transcript levels were present in serotype M1 GAS strains causing invasive infection compared to strains causing pharyngitis. GAS proliferation in a defined α-glucan-containing medium was dependent on the presence of human salivary α-amylase. These data delineate the molecular mechanisms by which α-glucan degradation contributes to GAS host-pathogen interaction including how GAS employs human salivary α-amylase for its own metabolic benefit. PMID:19735442

Structural basis for the glucan phosphatase activity of Starch Excess4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vander Kooi, Craig W.; Taylor, Adam O.; Pace, Rachel M.

Living organisms utilize carbohydrates as essential energy storage molecules. Starch is the predominant carbohydrate storage molecule in plants while glycogen is utilized in animals. Starch is a water-insoluble polymer that requires the concerted activity of kinases and phosphatases to solubilize the outer surface of the glucan and mediate starch catabolism. All known plant genomes encode the glucan phosphatase Starch Excess4 (SEX4). SEX4 can dephosphorylate both the starch granule surface and soluble phosphoglucans and is necessary for processive starch metabolism. The physical basis for the function of SEX4 as a glucan phosphatase is currently unclear. Herein, we report the crystal structuremore » of SEX4, containing phosphatase, carbohydrate-binding, and C-terminal domains. The three domains of SEX4 fold into a compact structure with extensive interdomain interactions. The C-terminal domain of SEX4 integrally folds into the core of the phosphatase domain and is essential for its stability. The phosphatase and carbohydrate-binding domains directly interact and position the phosphatase active site toward the carbohydrate-binding site in a single continuous pocket. Mutagenesis of the phosphatase domain residue F167, which forms the base of this pocket and bridges the two domains, selectively affects the ability of SEX4 to function as a glucan phosphatase. Together, these results reveal the unique tertiary architecture of SEX4 that provides the physical basis for its function as a glucan phosphatase.« less

Synthesis of New Hyperbranched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants.

PubMed

Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

2016-01-20

α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088, and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were targeted for mutagenesis both jointly and separately. Analysis of the mutational effects on enzyme function revealed that all D1085 and R1088 mutants catalyzed the synthesis of hyperbranched α-glucans with 15-22% branching (α1→3,6) linkages, compared to 13% in the wild-type GTF180. In addition, besides native (α1→6) and (α1→3) linkages, all of the mutations introduced a small amount of (α1→4) linkages (5% at most) in the polysaccharides produced. We conclude that α-helix 4 residues, especially D1085 and R1088, constituting part of the +2 acceptor binding subsite, are important determinants for the linkage specificity. The new hyperbranched α-glucans provide very interesting structural diversities and may find applications in the food industry.

Structural, thermal, functional, antioxidant & antimicrobial properties of β-d-glucan extracted from baker's yeast (Saccharomyces cereviseae)-Effect of γ-irradiation.

PubMed

Khan, Asma Ashraf; Gani, Adil; Masoodi, F A; Amin, Furheen; Wani, Idrees Ahmed; Khanday, Firdous Ahmad; Gani, Asir

2016-04-20

This study was carried out to evaluate the effect of γ-irradiation (0, 5, 10, 20, 30 & 50kGy) on the structural, functional, antioxidant and antimicrobial properties of yeast β-d-glucan. The samples were characterized by ATR-FTIR, gel permeation chromatography (GPC) and the thermal properties were studied using DSC. There was a decrease in the average molecular weight of β-d-glucan as the irradiation dose increased. The functional properties of irradiated yeast β-d-glucan were largely influenced by the action of gamma radiation like swelling power and viscosity decreases with increase in the irradiation dose while as fat binding capacity, emulsifying properties, foaming properties and bile acid binding capacity shows an increasing trend. All the antioxidant properties carried out using six different assays increased significantly (p≤0.05) in a dose dependent manner. The antibacterial activity of yeast β-d-glucan also showed an increasing trend with increase in the irradiation dose from 5 to 50kDa. Copyright © 2016 Elsevier Ltd. All rights reserved.

Yeast β-1,6-Glucan Is a Primary Target for the Saccharomyces cerevisiae K2 Toxin

PubMed Central

Lukša, Juliana; Podoliankaitė, Monika; Vepštaitė, Iglė; Strazdaitė-Žielienė, Živilė; Urbonavičius, Jaunius

2015-01-01

Certain Saccharomyces cerevisiae strains secrete different killer proteins of double-stranded-RNA origin. These proteins confer a growth advantage to their host by increasing its survival. K2 toxin affects the target cell by binding to the cell surface, disrupting the plasma membrane integrity, and inducing ion leakage. In this study, we determined that K2 toxin saturates the yeast cell surface receptors in 10 min. The apparent amount of K2 toxin, bound to a single cell of wild type yeast under saturating conditions, was estimated to be 435 to 460 molecules. It was found that an increased level of β-1,6-glucan directly correlates with the number of toxin molecules bound, thereby impacting the morphology and determining the fate of the yeast cell. We observed that the binding of K2 toxin to the yeast surface receptors proceeds in a similar manner as in case of the related K1 killer protein. It was demonstrated that the externally supplied pustulan, a poly-β-1,6-glucan, but not the glucans bearing other linkage types (such as laminarin, chitin, and pullulan) efficiently inhibits the K2 toxin killing activity. In addition, the analysis of toxin binding to the intact cells and spheroplasts confirmed that majority of K2 protein molecules attach to the β-1,6-glucan, rather than the plasma membrane-localized receptors. Taken together, our results reveal that β-1,6-glucan is a primary target of K2 toxin and is important for the execution of its killing property. PMID:25710965

Pattern Recognition Protein Binds to Lipopolysaccharide and β-1,3-Glucan and Activates Shrimp Prophenoloxidase System*

PubMed Central

Amparyup, Piti; Sutthangkul, Jantiwan; Charoensapsri, Walaiporn; Tassanakajon, Anchalee

2012-01-01

The prophenoloxidase (proPO) system is activated upon recognition of pathogens by pattern recognition proteins (PRPs), including a lipopolysaccharide- and β-1,3-glucan-binding protein (LGBP). However, shrimp LGBPs that are involved in the proPO system have yet to be clarified. Here, we focus on characterizing the role of a Penaeus monodon LGBP (PmLGBP) in the proPO system. We found that PmLGBP transcripts are expressed primarily in the hemocytes and are increased at 24 h after pathogenic bacterium Vibrio harveyi challenge. The binding studies carried out using ELISA indicated that recombinant (r)PmLGBP binds to β-1,3-glucan and LPS with a dissociation constant of 6.86 × 10−7 m and 3.55 × 10−7 m, respectively. Furthermore, we found that rPmLGBP could enhance the phenoloxidase (PO) activity of hemocyte suspensions in the presence of LPS or β-1,3-glucan. Using dsRNA interference-mediated gene silencing assay, we further demonstrated that knockdown of PmLGBP in shrimp in vivo significantly decreased the PmLGBP transcript level but had no effect on the expression of the other immune genes tested, including shrimp antimicrobial peptides (AMPs). However, suppression of proPO expression down-regulated PmLGBP, proPO-activating enzyme (PmPPAE2), and AMPs (penaeidin and crustin). Such PmLGBP down-regulated shrimp showed significantly decreased total PO activity. We conclude that PmLGBP functions as a pattern recognition protein for LPS and β-1,3-glucan in the shrimp proPO activating system. PMID:22235126

Interactions of liposome carriers with infectious fungal hyphae reveals the role of β-glucans.

PubMed

Chavan, Neelam L; Young, Joseph K; Drezek, Rebekah A; Lewis, Russell; Bikram, Malavosklish

2012-09-04

Relatively little is known about how liposomal formulations modulate drug delivery to fungal pathogens. We compared patterns of hyphal cell wall binding for empty rhodmine-labeled liposomes and the clinically available amphotericin B-containing liposomal formulation (AmBisome) in Aspergillus fumigatus and Candida albicans. Following 0.5 h of coincubation with A. fumigatus , empty liposomes concentrated primarily in fungal septae along at the surface of the cell wall, suggesting that liposome uptake is concentrated in areas of the cell wall where linear glucan is exposed on the cell surface, which was confirmed by aniline blue staining. Consistent with this hypothesis, pretreatment of liposomes with soluble linear glucan (laminarin) decreased liposome binding in both Aspergillus and Candida fungal hyphae, while growth of Aspergillus hyphae in the presence of an agent that increases fungal cell wall surface exposure of linear β-glucans without cell death (caspofungin) increased liposome uptake throughout the Aspergillus fungal cell wall. Increasing the polyethylene glycol (PEG) concentration in liposomes from 0 to 30% significantly increased fungal uptake of liposomes that was only modestly attenuated when fungal cells were incubated in serum concentrations ranging from 10 to 100%. The presence of β-glucans on the fungal hyphae cell walls of Aspergillus fumigatus is one of the factors responsible for mediating the binding of liposome carriers to the hyphae and could explain possible synergy reported between liposomal amphotericin B and echinocanins.

Extraction and characterization of beta-D-glucan from oat for industrial utilization.

PubMed

Ahmad, Asif; Anjum, Faqir Muhammad; Zahoor, Tahir; Nawaz, Haq; Ahmed, Zaheer

2010-04-01

Oat beta-D-glucan is a valuable functional ingredient having numerous industrial, nutritional and health benefits. Its extraction needs careful attention as extraction process may affect the physiochemical and functional properties of extracted beta-D-glucan. The present study aimed at analyzing the effect of extraction of beta-D-glucan gum pellets from oat cultivar followed by detailed chemical and functional analysis. Enzymatic extraction process resulted in highest yield and recovery. Chemical analysis revealed protein as a dominating impurity. The water binding capacity of the beta-D-glucan ranged between 3.14 and 4.52 g g(-1) of sample. beta-D-Glucan exhibited ideal foaming stability when appropriate extraction technique was used. The viscosity of beta-D-glucan gum ranged between 35.6 and 56.16 cp. The color analysis showed L* value of beta-D-glucan gum pellet ranged between 72.18 and 83.54. Phosphorus, potassium and calcium appeared as major minerals in beta-D-glucan gum whereas iron, manganese and copper appeared as minor minerals. FTIR spectroscopy also confirms the presence of beta-D-glucan, protein and other components in extracted beta-D-glucan gum pellets. Overall, extracted beta-D-glucan showed a good potential for industrial usage. Copyright 2010 Elsevier B.V. All rights reserved.

Homology modeling, molecular dynamics, and docking studies of pattern-recognition transmembrane protein-lipopolysaccharide and β-1,3 glucan-binding protein from Fenneropenaeus indicus.

PubMed

Sivakamavalli, Jeyachandran; Tripathi, Sunil Kumar; Singh, Sanjeev Kumar; Vaseeharan, Baskaralingam

2015-01-01

Lipopolysaccharide and β-1,3 glucan-binding protein (LGBP) is a family of pattern-recognition transmembrane proteins (PRPs) which plays a vital role in the immune mechanism of crustaceans in adverse conditions. Fenneropenaeus indicus LGBP-deduced amino acid has conserved potential recognition motif for β-1,3 linkages of polysaccharides and putative RGD (Arg-Gly-Asp) cell adhesion sites for the activation of innate defense mechanism. In order to understand the stimulating activity of β-1,3 glucan (β-glucan) and its interaction with LGBP, a 3D model of LGBP is generated. Molecular docking is performed with this model, and the results indicate Arg71 with strong hydrogen bond from RGD domain of LGBP. Moreover, from the docking studies, we also suggest that Arg34, Lys68, Val135, and Ala146 in LGBP are important amino acid residues in binding as they have strong bonding interaction in the active site of LGBP. In our in vitro studies, yeast agglutination results suggest that shrimp F. indicus LGBP possesses sugar binding and recognition sites in its structure, which is responsible for agglutination reaction. Our results were synchronized with the already reported evidence both in vivo and in vitro experiments. This investigation may be valuable for further experimental investigation in the synthesis of novel immunomodulator.

Yeast β-1,6-glucan is a primary target for the Saccharomyces cerevisiae K2 toxin.

PubMed

Lukša, Juliana; Podoliankaitė, Monika; Vepštaitė, Iglė; Strazdaitė-Žielienė, Živilė; Urbonavičius, Jaunius; Servienė, Elena

2015-04-01

Certain Saccharomyces cerevisiae strains secrete different killer proteins of double-stranded-RNA origin. These proteins confer a growth advantage to their host by increasing its survival. K2 toxin affects the target cell by binding to the cell surface, disrupting the plasma membrane integrity, and inducing ion leakage. In this study, we determined that K2 toxin saturates the yeast cell surface receptors in 10 min. The apparent amount of K2 toxin, bound to a single cell of wild type yeast under saturating conditions, was estimated to be 435 to 460 molecules. It was found that an increased level of β-1,6-glucan directly correlates with the number of toxin molecules bound, thereby impacting the morphology and determining the fate of the yeast cell. We observed that the binding of K2 toxin to the yeast surface receptors proceeds in a similar manner as in case of the related K1 killer protein. It was demonstrated that the externally supplied pustulan, a poly-β-1,6-glucan, but not the glucans bearing other linkage types (such as laminarin, chitin, and pullulan) efficiently inhibits the K2 toxin killing activity. In addition, the analysis of toxin binding to the intact cells and spheroplasts confirmed that majority of K2 protein molecules attach to the β-1,6-glucan, rather than the plasma membrane-localized receptors. Taken together, our results reveal that β-1,6-glucan is a primary target of K2 toxin and is important for the execution of its killing property. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Recognition of xyloglucan by the crystalline cellulose-binding site of a family 3a carbohydrate-binding module

PubMed Central

Hernandez-Gomez, Mercedes C.; Rydahl, Maja G.; Rogowski, Artur; Morland, Carl; Cartmell, Alan; Crouch, Lucy; Labourel, Aurore; Fontes, Carlos M. G. A.; Willats, William G. T.; Gilbert, Harry J; Knox, J. Paul

2018-01-01

Type A non-catalytic carbohydrate-binding modules (CBMs), exemplified by CtCBM3acipA, are widely believed to specifically target crystalline cellulose through entropic forces. Here we have tested the hypothesis that type A CBMs can also bind to xyloglucan, a soluble β-1,4-glucan containing α-1,6-xylose side chains. CtCBM3acipA bound to xyloglucan in cell walls and arrayed on solid surfaces. Xyloglucan and cellulose were shown to bind to the same planar surface on CBM3acipA. A range of type A CBMs from different families were shown to bind to xyloglucan in solution with ligand binding driven by enthalpic changes. The nature of CBM-polysaccharide interactions is discussed. PMID:26193423

Deletion of uncharacterized domain from α-1,3-glucanase of Bacillus circulans KA-304 enhances heterologous enzyme production in Escherichia coli.

PubMed

Yano, Shigekazu; Suyotha, Wasana; Zanma, Sumika; Konno, Hiroyuki; Cherdvorapong, Vipavee; Wakayama, Mamoru

2018-05-08

α-1,3-Glucanase (Agl-KA) of Bacillus circulans KA-304 consists of an N-terminal discoidin domain (DS1), a carbohydrate binding module family 6 (CBM6), threonine and proline repeats (TP), a second discoidin domain (DS2), an uncharacterized conserved domain (UCD), and a C-terminal catalytic domain. Previously, we reported that DS1, CBM6, and DS2 have α-1,3-glucan-binding activity and contribute to α-1,3-glucan hydrolysis. In this study, UCD deletion mutant (AglΔUCD) was constructed, and its properties were compared with those of Agl-KA. α-1,3-Glucan hydrolyzing, α-1,3-glucan binding, and protoplast-forming activities of AglΔUCD were almost the same as those of Agl-KA. k cat /K m values of AgΔUCD and Agl-KA were 11.4 and 11.1 s -1 mg -1 mL, respectively. AglΔUCD and Agl-KA exhibited similar characteristics, such as optimal pH, pH stability, optimal temperature, and thermostability. These results suggest that UCD is not α-1,3-glucan-binding and flexible linker domain, and that deletion of UCD does not affect the affinity of N-terminal binding domains and the catalytic action of the C-terminal domain. Subsequently, heterologous UCenzyme productivity of AglΔD in Escherichia coli was compared with that of Agl-KA. The productivity of AglΔUCD was about 4-fold larger than that of Agl-KA after an 8-h induction at 30°C. In the case of induction at 20°C, the productivity of AglΔUCD was also larger than that of Agl-KA. These findings indicate that deletion of only UCD enhances the enzyme productivity in E. coli.

An Extracellular Cell-Attached Pullulanase Confers Branched α-Glucan Utilization in Human Gut Lactobacillus acidophilus.

PubMed

Møller, Marie S; Goh, Yong Jun; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R; Svensson, Birte; Abou Hachem, Maher

2017-06-15

Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 ( La Pul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by La Pul13_14 and is abolished in a mutant strain lacking a functional La Pul13_14 gene. Hydrolysis kinetics of recombinant La Pul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest K m reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a metabolic resource for the gut microbiota. The role of health-beneficial lactobacilli prevalent in the human small intestine in starch metabolism remains unexplored in contrast to colonic bacterial residents. This study highlights the pivotal role of debranching enzymes in the breakdown of starchy branched α-glucan oligomers (α-limit dextrins) by human gut lactobacilli exemplified by Lactobacillus acidophilus NCFM, which is one of the best-characterized strains used as probiotics. Our data bring novel insight into the metabolic preference of L. acidophilus for α-glucans with short α-1,6-branches. The unprecedented affinity of the debranching enzyme that confers growth on these substrates reflects its adaptation to the nutrient-competitive gut ecological niche and constitutes a potential advantage in cross-feeding from human and bacterial dietary starch metabolism. Copyright © 2017 American Society for Microbiology.

An Extracellular Cell-Attached Pullulanase Confers Branched α-Glucan Utilization in Human Gut Lactobacillus acidophilus

PubMed Central

Møller, Marie S.; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R.; Svensson, Birte

2017-01-01

ABSTRACT Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 (LaPul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by LaPul13_14 and is abolished in a mutant strain lacking a functional LaPul13_14 gene. Hydrolysis kinetics of recombinant LaPul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest Km reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a metabolic resource for the gut microbiota. The role of health-beneficial lactobacilli prevalent in the human small intestine in starch metabolism remains unexplored in contrast to colonic bacterial residents. This study highlights the pivotal role of debranching enzymes in the breakdown of starchy branched α-glucan oligomers (α-limit dextrins) by human gut lactobacilli exemplified by Lactobacillus acidophilus NCFM, which is one of the best-characterized strains used as probiotics. Our data bring novel insight into the metabolic preference of L. acidophilus for α-glucans with short α-1,6-branches. The unprecedented affinity of the debranching enzyme that confers growth on these substrates reflects its adaptation to the nutrient-competitive gut ecological niche and constitutes a potential advantage in cross-feeding from human and bacterial dietary starch metabolism. PMID:28411221

Enhanced Release of Immunostimulating β-1,3- Glucan by Autodigestion of the Lingzhi Medicinal Mushroom, Ganoderma lingzhi (Agaricomycetes).

PubMed

Ishimoto, Yuina; Ishibashi, Ken-Ichi; Yamanaka, Daisuke; Adachi, Yoshiyuki; Ito, Hisatomi; Igami, Kentaro; Miyazaki, Toshitsugu; Ohno, Naohito

2017-01-01

Ganoderma lingzhi is a widely used medicinal mushroom that has antioxidative effects, ameliorates insulin resistance, and improves quality of life in patients with metabolic syndrome. Potentiation of immunity is also a major function of G. lingzhi, and this has been applied in patients with cancer. Supplementing G. lingzhi into foods reduced the metastasis of cancer cells. β-l,3-glucan is an important bioactive component of G. lingzhi. In this study we enhanced the solubilization ofimmunostimulating β-l,3-glucan by autodigestion of G. lingzhi. Fruiting bodies of G. lingzhi were disrupted and suspended in distilled water, then autodigested at 37°C for 24 hours. The resulting suspension was dried by spray drying. To assess the solubilization of β-l,3-glucan by autodigestion, cold and hot water extracts and sodium hydroxide extracts of G. lingzhi were prepared with and without autodigestion. Sodium hydroxide extracts were neutralized and dialyzed against distilled water. The resulting soluble and precipitated fractions were collected. Chemical, biochemical, and immunochemical characteristics of the extracts were compared. The yields of cold water extracts of autodigested and native G. lingzhi were significantly lower than the other extracts. Glucose was the major sugar component of the hot water extract, cold alkali extract (CAS), and the cold hydroxide extract insoluble in neutral aqueous condition (CASP) of the autodigested and native G. lingzhi. Nuclear magnetic resonance analysis revealed branched β-glucans in the hot water extract and CAS of the autodigested and native G. lingzhi. By contrast, the CASP of the autodigested and native G. lingzhi comprised mainly mixtures of linear α-l,3-glucans and linear β-l,3-glucans. Immunostimulation by β-l,3-glucan was examined by limulus factor G activation, dectin-1 binding, and anti-β-glucan antibody binding. Comparing relative activity, immunostimulating β-l,3-glucan was detected in the hot water extract, rather than the CAS, of autodigested and native G. lingzhi. Immunostimulating of β-glucan was also detected in the cold water extract of the autodigested G. lingzhi. These findings demonstrate that autodigestion is a useful processing protocol for enhancing the usefulness of G. lingzhi as a functional food.

Enhanced immunogenicity of a tricomponent mannan tetanus toxoid conjugate vaccine targeted to dendritic cells via Dectin-1 by incorporating β-glucan.

PubMed

Lipinski, Tomasz; Fitieh, Amira; St Pierre, Joëlle; Ostergaard, Hanne L; Bundle, David R; Touret, Nicolas

2013-04-15

In a previous attempt to generate a protective vaccine against Candida albicans, a β-mannan tetanus toxoid conjugate showed poor immunogenicity in mice. To improve the specific activation toward the fungal pathogen, we aimed to target Dectin-1, a pattern-recognition receptor expressed on monocytes, macrophages, and dendritic cells. Laminarin, a β-glucan ligand of Dectin-1, was incorporated into the original β-mannan tetanus toxoid conjugate providing a tricomponent conjugate vaccine. A macrophage cell line expressing Dectin-1 was employed to show binding and activation of Dectin-1 signal transduction pathway by the β-glucan-containing vaccine. Ligand binding to Dectin-1 resulted in the following: 1) activation of Src family kinases and Syk revealed by their recruitment and phosphorylation in the vicinity of bound conjugate and 2) translocation of NF-κB to the nucleus. Treatment of immature bone marrow-derived dendritic cells (BMDCs) with tricomponent or control vaccine confirmed that the β-glucan-containing vaccine exerted its enhanced activity by virtue of dendritic cell targeting and uptake. Immature primary cells stimulated by the tricomponent vaccine, but not the β-mannan tetanus toxoid vaccine, showed activation of BMDCs. Moreover, treated BMDCs secreted increased levels of several cytokines, including TGF-β and IL-6, which are known activators of Th17 cells. Immunization of mice with the novel type of vaccine resulted in improved immune response manifested by high titers of Ab recognizing C. albicans β-mannan Ag. Vaccine containing laminarin also affected distribution of IgG subclasses, showing that vaccine targeting to Dectin-1 receptor can benefit from augmentation and immunomodulation of the immune response.

Synthesis and evaluation of di- and trimeric hydroxylamine-based β-(1→3)-glucan mimetics.

PubMed

Ferry, Angélique; Malik, Gaëlle; Guinchard, Xavier; Vĕtvička, Václav; Crich, David

2014-10-22

Di- and trimeric hydroxylamine-based mimetics of β-(1→3)-glucans have been accessed by an asymmetric synthesis route featuring an iterative double ring-closing reductive amination reaction. These oligomeric hydroxylamines are demonstrated to inhibit the staining of human neutrophils and of mouse macrophages by fluorescent anti-CR3 and anti-dectin-1 antibodies, respectively, and to stimulate phagocytosis, all in a linkage-dependent manner suggestive of binding to the lectin domains of complement receptor 3 (CR3) and dectin-1. The ability of these relatively short mimetics to bind to CR3 and dectin-1, as compared to the greater degree of polymerization required in β-(1→3)-glucans, is discussed in terms of the increased hydrophobicity of the α-face on replacement of the glycosidic bond by the hydroxylamine linkage.

Human Common Salivary Protein 1 (CSP-1) Promotes Binding of Streptococcus mutans to Experimental Salivary Pellicle and Glucans Formed on Hydroxyapatite Surface

PubMed Central

Ambatipudi, Kiran S.; Hagen, Fred K.; Delahunty, Claire M.; Han, Xuemei; Shafi, Rubina; Hryhorenko, Jennifer; Gregoire, Stacy; Marquis, Robert E.; Melvin, James E.; Koo, Hyun; Yates, John R.

2010-01-01

Summary The saliva proteome includes host defense factors and specific bacterial-binding proteins that modulate microbial growth and colonization of tooth surface in the oral cavity. A multidimensional mass spectrometry approach identified the major host-derived salivary proteins which interacted with Streptococcus mutans (strain UA159), the primary microorganism associated with the pathogenesis of dental caries. Two abundant host proteins were found to tightly bind to S. mutans cells, common salivary protein-1 (CSP-1) and deleted in malignant brain tumor 1 (DMBT1, also known as salivary agglutinin or gp340). In contrast to gp340, limited functional information is available on CSP-1. The sequence of CSP-1 shares 38.1% similarity with rat CSP-1. Recombinant CSP-1 (rCSP-1) protein did not cause aggregation of S. mutans cells and was devoid of any significant biocidal activity (2.5 to 10 μg/ml). However, S. mutans cells exposed to rCSP-1 (10 μg/ml) in saliva displayed enhanced adherence to experimental salivary pellicle and to glucans in the pellicle formed on hydroxyapatite surfaces. Thus, our data demonstrate that the host salivary protein CSP-1 binds to S. mutans cells and may influence the initial colonization of this pathogenic bacterium onto tooth surface. PMID:20858015

The Dual Activity Responsible for the Elongation and Branching of β-(1,3)-Glucan in the Fungal Cell Wall.

PubMed

Aimanianda, Vishukumar; Simenel, Catherine; Garnaud, Cecile; Clavaud, Cecile; Tada, Rui; Barbin, Lise; Mouyna, Isabelle; Heddergott, Christoph; Popolo, Laura; Ohya, Yoshikazu; Delepierre, Muriel; Latge, Jean-Paul

2017-06-20

β-(1,3)-Glucan, the major fungal cell wall component, ramifies through β-(1,6)-glycosidic linkages, which facilitates its binding with other cell wall components contributing to proper cell wall assembly. Using Saccharomyces cerevisiae as a model, we developed a protocol to quantify β-(1,6)-branching on β-(1,3)-glucan. Permeabilized S. cerevisiae and radiolabeled substrate UDP-( 14 C)glucose allowed us to determine branching kinetics. A screening aimed at identifying deletion mutants with reduced branching among them revealed only two, the bgl2 Δ and gas1 Δ mutants, showing 15% and 70% reductions in the branching, respectively, compared to the wild-type strain. Interestingly, a recombinant Gas1p introduced β-(1,6)-branching on the β-(1,3)-oligomers following its β-(1,3)-elongase activity. Sequential elongation and branching activity of Gas1p occurred on linear β-(1,3)-oligomers as well as Bgl2p-catalyzed products [short β-(1,3)-oligomers linked by a linear β-(1,6)-linkage]. The double S. cerevisiae gas1 Δ bgl2 Δ mutant showed a drastically sick phenotype. An Sc Gas1p ortholog, Gel4p from Aspergillus fumigatus , also showed dual β-(1,3)-glucan elongating and branching activity. Both Sc Gas1p and A. fumigatus Gel4p sequences are endowed with a carbohydrate binding module (CBM), CBM43, which was required for the dual β-(1,3)-glucan elongating and branching activity. Our report unravels the β-(1,3)-glucan branching mechanism, a phenomenon occurring during construction of the cell wall which is essential for fungal life. IMPORTANCE The fungal cell wall is essential for growth, morphogenesis, protection, and survival. In spite of being essential, cell wall biogenesis, especially the core β-(1,3)-glucan ramification, is poorly understood; the ramified β-(1,3)-glucan interconnects other cell wall components. Once linear β-(1,3)-glucan is synthesized by plasma membrane-bound glucan synthase, the subsequent event is its branching event in the cell wall space. Using Saccharomyces cerevisiae as a model, we identified GH72 and GH17 family glycosyltransferases, Gas1p and Bgl2p, respectively, involved in the β-(1,3)-glucan branching. The sick phenotype of the double Scgas1 Δ bgl2 Δ mutant suggested that β-(1,3)-glucan branching is essential. In addition to Sc Gas1p, GH72 family Sc Gas2p and Aspergillus fumigatus Gel4p, having CBM43 in their sequences, showed dual β-(1,3)-glucan elongating and branching activity. Our report identifies the fungal cell wall β-(1,3)-glucan branching mechanism. The essentiality of β-(1,3)-glucan branching suggests that enzymes involved in the glucan branching could be exploited as antifungal targets. Copyright © 2017 Aimanianda et al.

β-1,3-Glucan, Which Can Be Targeted by Drugs, Forms a Trabecular Scaffold in the Oocyst Walls of Toxoplasma and Eimeria

PubMed Central

Bushkin, G. Guy; Motari, Edwin; Magnelli, Paula; Gubbels, Marc-Jan; Dubey, Jitender P.; Miska, Katarzyna B.; Bullitt, Esther; Costello, Catherine E.; Robbins, Phillips W.; Samuelson, John

2012-01-01

ABSTRACT The walls of infectious pathogens, which are essential for transmission, pathogenesis, and diagnosis, contain sugar polymers that are defining structural features, e.g., β-1,3-glucan and chitin in fungi, chitin in Entamoeba cysts, β-1,3-GalNAc in Giardia cysts, and peptidoglycans in bacteria. The goal here was to determine in which of three walled forms of Toxoplasma gondii (oocyst, sporocyst, or tissue cyst) is β-1,3-glucan, the product of glucan synthases and glucan hydrolases predicted by whole-genome sequences of the parasite. The three most important discoveries were as follows. (i) β-1,3-glucan is present in oocyst walls of Toxoplasma and Eimeria (a chicken parasite that is a model for intestinal stages of Toxoplasma) but is absent from sporocyst and tissue cyst walls. (ii) Fibrils of β-1,3-glucan are part of a trabecular scaffold in the inner layer of the oocyst wall, which also includes a glucan hydrolase that has a novel glucan-binding domain. (iii) Echinocandins, which target the glucan synthase and kill fungi, arrest development of the Eimeria oocyst wall and prevent release of the parasites into the intestinal lumen. In summary, β-1,3-glucan, which can be targeted by drugs, is an important component of oocyst walls of Toxoplasma but is not a component of sporocyst and tissue cyst walls. PMID:23015739

A Chitin-Like Component on Sclerotic Cells of Fonsecaea pedrosoi Inhibits Dectin-1-Mediated Murine Th17 Development by Masking β-Glucans

PubMed Central

Li, Ruoyu; Chen, Sharon C.-A.; Liu, Weihuang; Liu, Wei; Chen, Liuqing; Chen, Yao; Zhang, Xu; Tong, Zhongsheng; Xia, Yun; Xia, Ping; Wang, Yan; Duan, Yiqun

2014-01-01

Fonsecaea pedrosoi (F. pedrosoi), a major agent of chromoblastomycosis, has been shown to be recognized primarily by C-type lectin receptors (CLRs) in a murine model of chromoblastomycosis. Specifically, the β-glucan receptor, Dectin-1, mediates Th17 development and consequent recruitment of neutrophils, and is evidenced to have the capacity to bind to saprophytic hyphae of F. pedrosoi in vitro. However, when embedded in tissue, most etiological agents of chromoblastomycosis including F. pedrosoi will transform into the sclerotic cells, which are linked to the greatest survival of melanized fungi in tissue. In this study, using immunocompetent and athymic (nu/nu) murine models infected subcutaneously or intraperitoneally with F. pedrosoi, we demonstrated that T lymphocytes play an active role in the resolution of localized footpad infection, and there existed a significantly decreased expression of Th17-defining transcription factor Rorγt and inefficient recruitment of neutrophils in chronically infected spleen where the inoculated mycelium of F. pedrosoi transformed into the sclerotic cells. We also found that Dectin-1-expressing histocytes and neutrophils participated in the enclosure of transformed sclerotic cells in the infectious foci. Furthermore, we induced the formation of sclerotic cells in vitro, and evidenced a significantly decreased binding capacity of human or murine-derived Dectin-1 to the induced sclerotic cells in comparison with the saprophytic mycelial forms. Our analysis of β-glucans-masking components revealed that it is a chitin-like component, but not the mannose moiety on the sclerotic cells, that interferes with the binding of β-glucans by human or murine Dectin-1. Notably, we demonstrated that although Dectin-1 contributed to the development of IL-17A-producing CD3+CD4+ murine splenocytes upon in vitro-stimulation by saprophytic F. pedrosoi, the masking effect of chitin components partly inhibited Dectin-1-mediated Th17 development upon in vitro-stimulation by induced sclerotic cells. Therefore, these findings extend our understanding of the chronicity of chromoblastomycosis. PMID:25490199

6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.

PubMed

Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu

2016-02-12

With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.

Linkage specificity and role of properdin in activation of the alternative complement pathway by fungal glycans.

PubMed

Agarwal, Sarika; Specht, Charles A; Haibin, Huang; Ostroff, Gary R; Ram, Sanjay; Rice, Peter A; Levitz, Stuart M

2011-01-01

Fungal cell walls are predominantly composed of glucans, mannans, and chitin. Recognition of these glycans by the innate immune system is a critical component of host defenses against the mycoses. Complement, an important arm of innate immunity, plays a significant role in fungal pathogenesis, especially the alternative pathway (AP). Here we determine that the glycan monosaccharide composition and glycosidic linkages affect AP activation and C3 deposition. Furthermore, properdin, a positive regulator of the AP, contributes to these functions. AP activation by glycan particles that varied in composition and linkage was measured by C3a generation in serum treated with 10 mM EGTA and 10 mM Mg(2+) (Mg-EGTA-treated serum) (AP specific; properdin functional) or Mg-EGTA-treated serum that lacked functional properdin. Particles that contained either β1→3 or β1→6 glucans or both generated large and similar amounts of C3a when the AP was intact. Blocking properdin function resulted in 5- to 10-fold-less C3a production by particulate β1→3 glucans. However, particulate β1→6 glucans generated C3a via the AP only in the presence of intact properdin. Interestingly, zymosan and glucan-mannan particles (GMP), which contain both β-glucans and mannans, also required properdin to generate C3a. The β1→4 glycans chitin and chitosan minimally activated C3 even when properdin was functional. Finally, properdin binding to glucan particles (GP) and zymosan in serum required active C3. Properdin colocalized with bound C3, suggesting that in the presence of serum, properdin bound indirectly to glycans through C3 convertases. These findings provide a better understanding of how properdin facilitates AP activation by fungi through interaction with the cell wall components. Invasive fungal infections have increased in incidence with the widespread use of immunosuppressive therapy and invasive procedures. Activation of the complement system contributes to innate immunity against fungi by generating chemoattractants that recruit white blood cells and by coating the pathogen with complement fragments that "mark" them for phagocytosis. The fungal cell wall activates complement in an antibody-independent manner through the alternative pathway (AP). Properdin is a positive regulator of the AP. This study elucidates how the specificity of cell wall glycan linkages affects AP activation and the role properdin plays in this process. Particulate β1→3 glucans activated the AP even in the absence of properdin, while β1→6 glucans required properdin for AP activation. In contrast, the β1→4 glycans chitin and chitosan failed to activate the AP. These findings enhance our mechanistic understanding of how fungi activate complement and have implications for the use of glycans in biomedical applications.

A metagenome-derived thermostable β-glucanase with an unusual module architecture which defines the new glycoside hydrolase family GH148.

PubMed

Angelov, Angel; Pham, Vu Thuy Trang; Übelacker, Maria; Brady, Silja; Leis, Benedikt; Pill, Nicole; Brolle, Judith; Mechelke, Matthias; Moerch, Matthias; Henrissat, Bernard; Liebl, Wolfgang

2017-12-11

The discovery of novel and robust enzymes for the breakdown of plant biomass bears tremendous potential for the development of sustainable production processes in the rapidly evolving new bioeconomy. By functional screening of a metagenomic library from a volcano soil sample a novel thermostable endo-β-glucanase (EngU) which is unusual with regard to its module architecture and cleavage specificity was identified. Various recombinant EngU variants were characterized. Assignment of EngU to an existing glycoside hydrolase (GH) family was not possible. Two regions of EngU showed weak sequence similarity to proteins of the GH clan GH-A, and acidic residues crucial for catalytic activity of EngU were identified by mutation. Unusual, a carbohydrate-binding module (CBM4) which displayed binding affinity for β-glucan, lichenin and carboxymethyl-cellulose was found as an insertion between these two regions. EngU hydrolyzed β-1,4 linkages in carboxymethyl-cellulose, but displayed its highest activity with mixed linkage (β-1,3-/β-1,4-) glucans such as barley β-glucan and lichenin, where in contrast to characterized lichenases cleavage occurred predominantly at the β-1,3 linkages of C4-substituted glucose residues. EngU and numerous related enzymes with previously unknown function represent a new GH family of biomass-degrading enzymes within the GH-A clan. The name assigned to the new GH family is GH148.

Generation and characterization of β1,2-gluco-oligosaccharide probes from Brucella abortus cyclic β-glucan and their recognition by C-type lectins of the immune system

PubMed Central

Zhang, Hongtao; Palma, Angelina S; Zhang, Yibing; Childs, Robert A; Liu, Yan; Mitchell, Daniel A; Guidolin, Leticia S; Weigel, Wilfried; Mulloy, Barbara; Ciocchini, Andrés E; Feizi, Ten; Chai, Wengang

2016-01-01

The β1,2-glucans produced by bacteria are important in invasion, survival and immunomodulation in infected hosts be they mammals or plants. However, there has been a lack of information on proteins which recognize these molecules. This is partly due to the extremely limited availability of the sequence-defined oligosaccharides and derived probes for use in the study of their interactions. Here we have used the cyclic β1,2-glucan (CβG) of the bacterial pathogen Brucella abortus, after removal of succinyl side chains, to prepare linearized oligosaccharides which were used to generate microarrays. We describe optimized conditions for partial depolymerization of the cyclic glucan by acid hydrolysis and conversion of the β1,2-gluco-oligosaccharides, with degrees of polymerization 2–13, to neoglycolipids for the purpose of generating microarrays. By microarray analyses, we show that the C-type lectin receptor DC-SIGNR, like the closely related DC-SIGN we investigated earlier, binds to the β1,2-gluco-oligosaccharides, as does the soluble immune effector serum mannose-binding protein. Exploratory studies with DC-SIGN are suggestive of the recognition also of the intact CβG by this receptor. These findings open the way to unravelling mechanisms of immunomodulation mediated by β1,2-glucans in mammalian systems. PMID:27053576

Characterization of endo-1,3-1,4-β-glucanases in GH family 12 from Magnaporthe oryzae.

PubMed

Takeda, Takumi; Takahashi, Machiko; Nakanishi-Masuno, Tsugumi; Nakano, Yuki; Saitoh, Hiromasa; Hirabuchi, Akiko; Fujisawa, Shizuko; Terauchi, Ryohei

2010-11-01

We have cloned three putative endoglucanase cDNAs, designated MoCel12A, MoCel12B, and MoCel12C, from Magnaporthe oryzae. The deduced peptide sequences of both MoCel12A and MoCel12B contain secretion signal peptides and a catalytic core domain that classify them into GH subfamily 12-1. In contrast, the deduced peptide sequence of MoCel12C consists of a signal peptide, a catalytic core domain, and a fungal-type carbohydrate binding module belonging to GH subfamily 12-2. Although most GH family 12 endoglucanases hydrolyze β-1,4-glucans such as carboxymethylcellulose or phosphoric acid-swollen cellulose, MoCel12A that was prepared by overexpression in M. oryzae and Brevibacillus choshinensis hydrolyzed specifically 1,3-1,4-β-glucans, such as barley β-glucan and lichenan. The specific activity of MoCel12A overexpressed in M. oryzae was about 20 times higher than that prepared from B. choshinensis. Furthermore, MoCel12B prepared by overexpression in B. choshinensis also revealed preferential hydrolysis of endo-1,3-1,4-β-glucans with limited hydrolysis on carboxymethylcellulose. In comparison with MoCel12A, the activity of MoCel12B was more stable under alkaline conditions. Levels of mRNA encoding MoCel12A were constitutively high during infection and spore formation. The overexpression and disruption of the MoCel12A gene did not affect germination, appressorium formation, or invasion rate; however, M. oryzae overexpressing MoCel12A produced larger numbers of spores than the wild type or a mutant in which the MoCel12A gene was disrupted. These results suggest that MoCel12A functions in part to hydrolyze 1,3-1,4-β-glucan during infection and spore formation.

Glucan Binding Protein C of Streptococcus mutans Mediates both Sucrose-Independent and Sucrose-Dependent Adherence.

PubMed

Mieher, Joshua L; Larson, Matthew R; Schormann, Norbert; Purushotham, Sangeetha; Wu, Ren; Rajashankar, Kanagalaghatta R; Wu, Hui; Deivanayagam, Champion

2018-07-01

The high-resolution structure of glucan binding protein C (GbpC) at 1.14 Å, a sucrose-dependent virulence factor of the dental caries pathogen Streptococcus mutans , has been determined. GbpC shares not only structural similarities with the V regions of AgI/II and SspB but also functional adherence to salivary agglutinin (SAG) and its scavenger receptor cysteine-rich domains (SRCRs). This is not only a newly identified function for GbpC but also an additional fail-safe binding mechanism for S. mutans Despite the structural similarities with S. mutans antigen I/II (AgI/II) and SspB of Streptococcus gordonii , GbpC remains unique among these surface proteins in its propensity to adhere to dextran/glucans. The complex crystal structure of GbpC with dextrose (β-d-glucose; Protein Data Bank ligand BGC) highlights exclusive structural features that facilitate this interaction with dextran. Targeted deletion mutant studies on GbpC's divergent loop region in the vicinity of a highly conserved calcium binding site confirm its role in biofilm formation. Finally, we present a model for adherence to dextran. The structure of GbpC highlights how artfully microbes have engineered the lectin-like folds to broaden their functional adherence repertoire. Copyright © 2018 American Society for Microbiology.

Inhibition and Ultraviolet-Induced Chemical Modification of UDP-Glucose:(1,3)-β-Glucan (Callose) Synthase by Chlorpromazine 1

PubMed Central

Harriman, Robert W.; Shao, Ai-Ping; Wasserman, Bruce P.

1992-01-01

UDP-glucose:(1,3)-β-glucan (callose) synthase (CS) from storage tissue of red beet (Beta vulgaris L.) was strongly inhibited by the phenothiazine drug chlorpromazine (CPZ). In the absence of ultraviolet irradiation, CPZ was a noncompetitive inhibitor with 50% inhibitory concentration values for plasma membrane and solubilized CS of 100 and 90 μm, respectively. Both the Ca2+- and Mg2+- stimulated components of CS activity were affected. CPZ inhibition was partially alleviated at saturating levels of Ca2+, but not Mg2+, suggesting that CPZ interferes with the Ca2+-binding site of CS. Binding experiments with [14C]CPZ, however, showed strong non-specific partitioning of CPZ into the plasma membrane, providing evidence that perturbation of the membrane environment is probably the predominant mode of inhibition. Ultraviolet irradiation at 254 nm markedly enhanced CPZ inhibition, with complete activity loss following exposure to 4 μm CPZ for 2 min. Inhibition followed a pseudo-first order mechanism with at least three CPZ binding sites per CS complex. Under these conditions, [3H]CPZ was covalently incorporated into plasma membrane preparations by a free radical mechanism; however, polypeptide labeling profiles showed labeling to be largely nonspecific, with many polypeptides labeled even at [3H]CPZ levels as low as 1 μm, and with boiled membranes. Although CPZ is one of the most potent known inhibitors of CS, its use as a photolabel will require a homogeneous CS complex or establishment of conditions that protect against the interaction of CPZ with specific binding sites located on various polypeptide components of the CS complex. PMID:16653219

The Eng1 β-Glucanase Enhances Histoplasma Virulence by Reducing β-Glucan Exposure

PubMed Central

Garfoot, Andrew L.; Shen, Qian; Wüthrich, Marcel; Klein, Bruce S.

2016-01-01

ABSTRACT The fungal pathogen Histoplasma capsulatum parasitizes host phagocytes. To avoid antimicrobial immune responses, Histoplasma yeasts must minimize their detection by host receptors while simultaneously interacting with the phagocyte. Pathogenic Histoplasma yeast cells, but not avirulent mycelial cells, secrete the Eng1 protein, which is a member of the glycosylhydrolase 81 (GH81) family. We show that Histoplasma Eng1 is a glucanase that hydrolyzes β-(1,3)-glycosyl linkages but is not required for Histoplasma growth in vitro or for cell separation. However, Histoplasma yeasts lacking Eng1 function have attenuated virulence in vivo, particularly during the cell-mediated immunity stage. Histoplasma yeasts deficient for Eng1 show increased exposure of cell wall β-glucans, which results in enhanced binding to the Dectin-1 β-glucan receptor. Consistent with this, Eng1-deficient yeasts trigger increased tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6) cytokine production from macrophages and dendritic cells. While not responsible for large-scale cell wall structure and function, the secreted Eng1 reduces levels of exposed β-glucans at the yeast cell wall, thereby diminishing potential recognition by Dectin-1 and proinflammatory cytokine production by phagocytes. In α-glucan-producing Histoplasma strains, Eng1 acts in concert with α-glucan to minimize β-glucan exposure: α-glucan provides a masking function by covering the β-glucan-rich cell wall, while Eng1 removes any remaining exposed β-glucans. Thus, Histoplasma Eng1 has evolved a specialized pathogenesis function to remove exposed β-glucans, thereby enhancing the ability of yeasts to escape detection by host phagocytes. PMID:27094334

β-(1,3)-Glucan Unmasking in Some Candida albicans Mutants Correlates with Increases in Cell Wall Surface Roughness and Decreases in Cell Wall Elasticity

DOE PAGES

Hasim, Sahar; Allison, David P.; Retterer, Scott T.; ...

2016-11-14

Candida albicans is among the most common human fungal pathogens, causing a broad range of infections, including life-threatening systemic infections. The cell wall of C. albicans is the interface between the fungus and the innate immune system. The cell wall is composed of an outer layer enriched in mannosylated glycoproteins (mannan) and an inner layer enriched in β-(1,3)-glucan and chitin. Detection of C. albicans by Dectin-1, a C-type signaling lectin specific for β-(1,3)-glucan, is important for the innate immune system to recognize systemic fungal infections. Increased exposure of β-(1,3)-glucan to the immune system occurs when the mannan layer is alteredmore » or removed in a process called unmasking. Nanoscale changes to the cell wall during unmasking were explored in this paper in live cells with atomic force microscopy (AFM). Two mutants, the cho1Δ/Δ and kre5Δ/Δ mutants, were selected as representatives that exhibit modest and strong unmasking, respectively. Comparisons of the cho1Δ/Δ and kre5Δ/Δ mutants to the wild type reveal morphological changes in their cell walls that correlate with decreases in cell wall elasticity. In addition, AFM tips functionalized with Dectin-1 revealed that the forces of binding of Dectin-1 to all of the strains were similar, but the frequency of binding was highest for the kre5Δ/Δ mutant, decreased for the cho1Δ/Δ mutant, and rare for the wild type. These data show that nanoscale changes in surface topology are correlated with increased Dectin-1 adhesion and decreased cell wall elasticity. Finally, AFM, using tips functionalized with immunologically relevant molecules, can map epitopes of the cell wall and increase our understanding of pathogen recognition by the immune system.« less

β-(1,3)-Glucan Unmasking in Some Candida albicans Mutants Correlates with Increases in Cell Wall Surface Roughness and Decreases in Cell Wall Elasticity

PubMed Central

Hasim, Sahar; Allison, David P.; Retterer, Scott T.; Hopke, Alex; Wheeler, Robert T.; Doktycz, Mitchel J.

2016-01-01

ABSTRACT Candida albicans is among the most common human fungal pathogens, causing a broad range of infections, including life-threatening systemic infections. The cell wall of C. albicans is the interface between the fungus and the innate immune system. The cell wall is composed of an outer layer enriched in mannosylated glycoproteins (mannan) and an inner layer enriched in β-(1,3)-glucan and chitin. Detection of C. albicans by Dectin-1, a C-type signaling lectin specific for β-(1,3)-glucan, is important for the innate immune system to recognize systemic fungal infections. Increased exposure of β-(1,3)-glucan to the immune system occurs when the mannan layer is altered or removed in a process called unmasking. Nanoscale changes to the cell wall during unmasking were explored in live cells with atomic force microscopy (AFM). Two mutants, the cho1Δ/Δ and kre5Δ/Δ mutants, were selected as representatives that exhibit modest and strong unmasking, respectively. Comparisons of the cho1Δ/Δ and kre5Δ/Δ mutants to the wild type reveal morphological changes in their cell walls that correlate with decreases in cell wall elasticity. In addition, AFM tips functionalized with Dectin-1 revealed that the forces of binding of Dectin-1 to all of the strains were similar, but the frequency of binding was highest for the kre5Δ/Δ mutant, decreased for the cho1Δ/Δ mutant, and rare for the wild type. These data show that nanoscale changes in surface topology are correlated with increased Dectin-1 adhesion and decreased cell wall elasticity. AFM, using tips functionalized with immunologically relevant molecules, can map epitopes of the cell wall and increase our understanding of pathogen recognition by the immune system. PMID:27849179

β-(1,3)-Glucan Unmasking in Some Candida albicans Mutants Correlates with Increases in Cell Wall Surface Roughness and Decreases in Cell Wall Elasticity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hasim, Sahar; Allison, David P.; Retterer, Scott T.

Candida albicans is among the most common human fungal pathogens, causing a broad range of infections, including life-threatening systemic infections. The cell wall of C. albicans is the interface between the fungus and the innate immune system. The cell wall is composed of an outer layer enriched in mannosylated glycoproteins (mannan) and an inner layer enriched in β-(1,3)-glucan and chitin. Detection of C. albicans by Dectin-1, a C-type signaling lectin specific for β-(1,3)-glucan, is important for the innate immune system to recognize systemic fungal infections. Increased exposure of β-(1,3)-glucan to the immune system occurs when the mannan layer is alteredmore » or removed in a process called unmasking. Nanoscale changes to the cell wall during unmasking were explored in this paper in live cells with atomic force microscopy (AFM). Two mutants, the cho1Δ/Δ and kre5Δ/Δ mutants, were selected as representatives that exhibit modest and strong unmasking, respectively. Comparisons of the cho1Δ/Δ and kre5Δ/Δ mutants to the wild type reveal morphological changes in their cell walls that correlate with decreases in cell wall elasticity. In addition, AFM tips functionalized with Dectin-1 revealed that the forces of binding of Dectin-1 to all of the strains were similar, but the frequency of binding was highest for the kre5Δ/Δ mutant, decreased for the cho1Δ/Δ mutant, and rare for the wild type. These data show that nanoscale changes in surface topology are correlated with increased Dectin-1 adhesion and decreased cell wall elasticity. Finally, AFM, using tips functionalized with immunologically relevant molecules, can map epitopes of the cell wall and increase our understanding of pathogen recognition by the immune system.« less

Fungal β-glucan, a Dectin-1 ligand, promotes protection from Type 1 Diabetes by inducing regulatory innate immune response1

PubMed Central

Karumuthil-Melethil, Subha; Gudi, Radhika; Johnson, Benjamin M.; Perez, Nicolas; Vasu, Chenthamarakshan

2014-01-01

Beta-glucans (β-glucans) are naturally occurring polysaccharides in cereal grains, mushrooms, algae, or microbes including bacteria, fungi, and yeast. Immune cells recognize these β-glucans through a cell surface pathogen recognition receptor (PRR) called Dectin-1. Studies using β-glucans and other Dectin-1 binding components have demonstrated the potential of these agents in activating the immune cells for cancer treatment and controlling infections. Here, we show that the β-glucan from Saccharomyces cerevisiae induces the expression of immune regulatory cytokines (IL-10, TGF-β1 and IL-2) and a tolerogenic enzyme (Indoleamine 2, 3-dioxygenase; IDO) in bone marrow derived DCs (BM DCs) as well as spleen cells. These properties can be exploited to modulate autoimmunity in non-obese diabetic (NOD) mouse model of type 1 diabetes (T1D). Treatment of pre-diabetic NOD mice with low dose β-glucan resulted in a profound delay in hyperglycemia and this protection was associated with increase in the frequencies of Foxp3-, LAP-, and GARP-positive T cells. Upon antigen presentation, β-glucan-exposed DCs induced a significant increase in Foxp3− and LAP− positive T cells in in vitro cultures. Further, systemic co-administration of β-glucan plus pancreatic β-cell-Ag resulted in an enhanced protection of NOD mice from T1D as compared to treatment with β-glucan alone. These observations demonstrate that the innate immune response induced by low dose β-glucan is regulatory in nature and can be exploited to modulate T cell response to β-cell-Ag for inducing an effective protection from T1D. PMID:25143443

The structure of the catalytic domain of a plant cellulose synthase and its assembly into dimers

DOE PAGES

Olek, Anna T.; Rayon, Catherine; Makowski, Lee; ...

2014-07-10

Cellulose microfibrils are para-crystalline arrays of several dozen linear (1→4)-β-d-glucan chains synthesized at the surface of the cell membrane by large, multimeric complexes of synthase proteins. Recombinant catalytic domains of rice ( Oryza sativa) CesA8 cellulose synthase form dimers reversibly as the fundamental scaffold units of architecture in the synthase complex. Specificity of binding to UDP and UDP-Glc indicates a properly folded protein, and binding kinetics indicate that each monomer independently synthesizes single glucan chains of cellulose, i.e., two chains per dimer pair. In contrast to structure modeling predictions, solution x-ray scattering studies demonstrate that the monomer is a two-domain,more » elongated structure, with the smaller domain coupling two monomers into a dimer. The catalytic core of the monomer is accommodated only near its center, with the plant-specific sequences occupying the small domain and an extension distal to the catalytic domain. This configuration is in stark contrast to the domain organization obtained in predicted structures of plant CesA. As a result, the arrangement of the catalytic domain within the CesA monomer and dimer provides a foundation for constructing structural models of the synthase complex and defining the relationship between the rosette structure and the cellulose microfibrils they synthesize.« less

The structure of the catalytic domain of a plant cellulose synthase and its assembly into dimers.

PubMed

Olek, Anna T; Rayon, Catherine; Makowski, Lee; Kim, Hyung Rae; Ciesielski, Peter; Badger, John; Paul, Lake N; Ghosh, Subhangi; Kihara, Daisuke; Crowley, Michael; Himmel, Michael E; Bolin, Jeffrey T; Carpita, Nicholas C

2014-07-01

Cellulose microfibrils are para-crystalline arrays of several dozen linear (1→4)-β-d-glucan chains synthesized at the surface of the cell membrane by large, multimeric complexes of synthase proteins. Recombinant catalytic domains of rice (Oryza sativa) CesA8 cellulose synthase form dimers reversibly as the fundamental scaffold units of architecture in the synthase complex. Specificity of binding to UDP and UDP-Glc indicates a properly folded protein, and binding kinetics indicate that each monomer independently synthesizes single glucan chains of cellulose, i.e., two chains per dimer pair. In contrast to structure modeling predictions, solution x-ray scattering studies demonstrate that the monomer is a two-domain, elongated structure, with the smaller domain coupling two monomers into a dimer. The catalytic core of the monomer is accommodated only near its center, with the plant-specific sequences occupying the small domain and an extension distal to the catalytic domain. This configuration is in stark contrast to the domain organization obtained in predicted structures of plant CesA. The arrangement of the catalytic domain within the CesA monomer and dimer provides a foundation for constructing structural models of the synthase complex and defining the relationship between the rosette structure and the cellulose microfibrils they synthesize. © 2014 American Society of Plant Biologists. All rights reserved.

The growing world of expansins

NASA Technical Reports Server (NTRS)

Cosgrove, Daniel J.; Li, Lian Chao; Cho, Hyung-Taeg; Hoffmann-Benning, Susanne; Moore, Richard C.; Blecker, Douglas

2002-01-01

Expansins are cell wall proteins that induce pH-dependent wall extension and stress relaxation in a characteristic and unique manner. Two families of expansins are known, named alpha- and beta-expansins, and they comprise large multigene families whose members show diverse organ-, tissue- and cell-specific expression patterns. Other genes that bear distant sequence similarity to expansins are also represented in the sequence databases, but their biological and biochemical functions have not yet been uncovered. Expansin appears to weaken glucan-glucan binding, but its detailed mechanism of action is not well established. The biological roles of expansins are diverse, but can be related to the action of expansins to loosen cell walls, for example during cell enlargement, fruit softening, pollen tube and root hair growth, and abscission. Expansin-like proteins have also been identified in bacteria and fungi, where they may aid microbial invasion of the plant body.

Immune functions of insect βGRPs and their potential application.

PubMed

Rao, Xiang-Jun; Zhan, Ming-Yue; Pan, Yue-Min; Liu, Su; Yang, Pei-Jin; Yang, Li-Ling; Yu, Xiao-Qiang

2018-06-01

Insects rely completely on the innate immune system to sense the foreign bodies and to mount the immune responses. Germ-line encoded pattern recognition receptors play crucial roles in recognizing pathogen-associated molecular patterns. Among them, β-1,3-glucan recognition proteins (βGRPs) and gram-negative bacteria-binding proteins (GNBPs) belong to the same pattern recognition receptor family, which can recognize β-1,3-glucans. Typical insect βGRPs are comprised of a tandem carbohydrate-binding module in the N-terminal and a glucanase-like domain in the C-terminal. The former can recognize triple-helical β-1,3-glucans, whereas the latter, which normally lacks the enzymatic activity, can recruit adapter proteins to initiate the protease cascade. According to studies, insect βGRPs possess at least three types of functions. Firstly, some βGRPs cooperate with peptidoglycan recognition proteins to recognize the lysine-type peptidoglycans upstream of the Toll pathway. Secondly, some directly recognize fungal β-1,3-glucans to activate the Toll pathway and melanization. Thirdly, some form the 'attack complexes' with other immune effectors to promote the antifungal defenses. The current review will focus on the discovery of insect βGRPs, functions of some well-characterized members, structure-function studies and their potential application. Copyright © 2017 Elsevier Ltd. All rights reserved.

Brucella β 1,2 Cyclic Glucan Is an Activator of Human and Mouse Dendritic Cells

PubMed Central

Martirosyan, Anna; Pérez-Gutierrez, Camino; Banchereau, Romain; Dutartre, Hélène; Lecine, Patrick; Dullaers, Melissa; Mello, Marielle; Pinto Salcedo, Suzana; Muller, Alexandre; Leserman, Lee; Levy, Yves; Zurawski, Gerard; Zurawski, Sandy; Moreno, Edgardo; Moriyón, Ignacio; Klechevsky, Eynav; Banchereau, Jacques; Oh, SangKon; Gorvel, Jean-Pierre

2012-01-01

Bacterial cyclic glucans are glucose polymers that concentrate within the periplasm of alpha-proteobacteria. These molecules are necessary to maintain the homeostasis of the cell envelope by contributing to the osmolarity of Gram negative bacteria. Here, we demonstrate that Brucella β 1,2 cyclic glucans are potent activators of human and mouse dendritic cells. Dendritic cells activation by Brucella β 1,2 cyclic glucans requires TLR4, MyD88 and TRIF, but not CD14. The Brucella cyclic glucans showed neither toxicity nor immunogenicity compared to LPS and triggered antigen-specific CD8+ T cell responses in vivo. These cyclic glucans also enhanced antigen-specific CD4+ and CD8+ T cell responses including cross-presentation by different human DC subsets. Brucella β 1,2 cyclic glucans increased the memory CD4+ T cell responses of blood mononuclear cells exposed to recombinant fusion proteins composed of anti-CD40 antibody and antigens from both hepatitis C virus and Mycobacterium tuberculosis. Thus cyclic glucans represent a new class of adjuvants, which might contribute to the development of effective antimicrobial therapies. PMID:23166489

β-(1,3)-Glucan Exposure Assessment by Passive Airborne Dust Sampling and New Sensitive Immunoassays▿

PubMed Central

Noss, Ilka; Wouters, Inge M.; Bezemer, Gillina; Metwali, Nervana; Sander, Ingrid; Raulf-Heimsoth, Monika; Heederik, Dick J. J.; Thorne, Peter S.; Doekes, Gert

2010-01-01

Associations between house dust-associated β-(1,3)-glucan exposure and airway inflammatory reactions have been reported, while such exposures in early childhood have been suggested to protect against asthma and wheezing. Most epidemiological studies have used reservoir dust samples and an inhibition enzyme immunoassay (EIA) for β-(1,3)-glucan exposure assessment. The objective of this study was to develop inexpensive but highly sensitive enzyme immunoassays to measure airborne β-(1,3)-glucans in low-exposure environments, like homes. Specificities of available anti-β-(1,3)-glucan antibodies were defined by direct and inhibition experiments. Three suitable antibody combinations were selected for sandwich EIAs. β-(1,3)-Glucans in passive airborne dust collected with an electrostatic dust fall collector (EDC) and floor dust from seven homes were measured with the three EIAs. Floor dust samples were additionally analyzed in the inhibition EIA. The sandwich EIAs were sensitive enough for airborne glucan measurement and showed different specificities for commercial glucans, while the β-(1,3)-glucan levels in house dust samples correlated strongly. The feasibility of measuring glucans in airborne dust with the recently introduced EDC method was further investigated by selecting the most suitable of the three EIAs to measure and compare β-(1,3)-glucan levels in the EDC and in floor and actively collected airborne dust samples of the previously performed EDC validation study. The EDC β-(1,3)-glucan levels correlated moderately with β-(1,3)-glucans in actively collected airborne dust and floor dust samples, while the glucan levels in the airborne dust and floor dust samples did not correlate. The combination of the newly developed β-(1,3)-glucan sandwich EIA with EDC sampling now allows assessment in large-scale population studies of exposure to airborne β-(1,3)-glucans in homes or other low-exposure environments. PMID:20038709

Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide

PubMed Central

Choi, E. Y.; Lee, S. S.; Hyeon, J. Y.; Choe, S. H.; Keum, B. R.; Lim, J. M.; Park, D. C.; Choi, I. S.; Cho, K. K.

2016-01-01

This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS) of Escherichia. The incubated layer was used for a nitric oxide (NO) analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli) LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS)-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1) in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP). This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK) and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α) decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1) that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator. PMID:27488844

Impact of new ingredients obtained from brewer's spent yeast on bread characteristics.

PubMed

Martins, Z E; Pinho, O; Ferreira, I M P L V O

2018-05-01

The impact of bread fortification with β-glucans and with proteins/proteolytic enzymes from brewers' spent yeast on physical characteristics was evaluated. β-Glucans extraction from spent yeast cell wall was optimized and the extract was incorporated on bread to obtain 2.02 g β-glucans/100 g flour, in order to comply with the European Food Safety Authority guidelines. Protein/proteolytic enzymes extract from spent yeast was added to bread at 60 U proteolytic activity/100 g flour. Both β-glucans rich and proteins/proteolytic enzymes extracts favoured browning of bread crust. However, breads with proteins/proteolytic enzymes addition presented lower specific volume, whereas the incorporation of β-glucans in bread lead to uniform pores that was also noticeble in terms of higher specific volume. Overall, the improvement of nutritional/health promoting properties is highlighted with β-glucan rich extract, not only due to bread β-glucan content but also for total dietary fibre content (39% increase). The improvement was less noticeable for proteins/proteolytic enzymes extract. Only a 6% increase in bread protein content was noted with the addition of this extract and higher protein content would most likely accentuate the negative impact on bread specific volume that in turn could impair consumer acceptance. Therefore, only β-glucan rich extract is a promising bread ingredient.

Oligosaccharide Binding in Escherichia coli Glycogen Synthase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheng, Fang; Yep, Alejandra; Feng, Lei

2010-11-17

Glycogen/starch synthase elongates glucan chains and is the key enzyme in the synthesis of glycogen in bacteria and starch in plants. Cocrystallization of Escherichia coli wild-type glycogen synthase (GS) with substrate ADPGlc and the glucan acceptor mimic HEPPSO produced a closed form of GS and suggests that domain-domain closure accompanies glycogen synthesis. Cocrystallization of the inactive GS mutant E377A with substrate ADPGlc and oligosaccharide results in the first oligosaccharide-bound glycogen synthase structure. Four bound oligosaccharides are observed, one in the interdomain cleft (G6a) and three on the N-terminal domain surface (G6b, G6c, and G6d). Extending from the center of themore » enzyme to the interdomain cleft opening, G6a mostly interacts with the highly conserved N-terminal domain residues lining the cleft of GS. The surface-bound oligosaccharides G6c and G6d have less interaction with enzyme and exhibit a more curled, helixlike structural arrangement. The observation that oligosaccharides bind only to the N-terminal domain of GS suggests that glycogen in vivo probably binds to only one side of the enzyme to ensure unencumbered interdomain movement, which is required for efficient, continuous glucan-chain synthesis.« less

Identification and Structural Basis of Binding to Host Lung Glycogen by Streptococcal Virulence Factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lammerts van Bueren,A.; Higgins, M.; Wang, D.

2007-01-01

The ability of pathogenic bacteria to recognize host glycans is often essential to their virulence. Here we report structure-function studies of previously uncharacterized glycogen-binding modules in the surface-anchored pullulanases from Streptococcus pneumoniae (SpuA) and Streptococcus pyogenes (PulA). Multivalent binding to glycogen leads to a strong interaction with alveolar type II cells in mouse lung tissue. X-ray crystal structures of the binding modules reveal a novel fusion of tandem modules into single, bivalent functional domains. In addition to indicating a structural basis for multivalent attachment, the structure of the SpuA modules in complex with carbohydrate provides insight into the molecular basismore » for glycogen specificity. This report provides the first evidence that intracellular lung glycogen may be a novel target of pathogenic streptococci and thus provides a rationale for the identification of the streptococcal {alpha}-glucan-metabolizing machinery as virulence factors.« less

Redox-dependent interaction between thaumatin-like protein and β-glucan influences malting quality of barley.

PubMed

Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder

2017-07-18

Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.

EphA2 is an epithelial cell pattern recognition receptor for fungal β-glucans

PubMed Central

Swidergall, Marc; Solis, Norma V.; Lionakis, Michail S.; Filler, Scott G.

2017-01-01

Oral epithelial cells discriminate between pathogenic and non-pathogenic stimuli, and only induce an inflammatory response when they are exposed to high levels of a potentially harmful microorganism. The pattern recognition receptors (PRRs) in epithelial cells that mediate this differential response are poorly understood. Here, we demonstrate that the ephrin type-A receptor 2 (EphA2) is an oral epithelial cell PRR that binds to exposed β-glucans on the surface of the fungal pathogen Candida albicans. Binding of C. albicans to EphA2 on oral epithelial cells activates signal transducer and activator of transcription 3 (Stat3) and mitogen-activated protein kinase signaling in an inoculum-dependent manner, and is required for induction of a pro-inflammatory and antifungal response. EphA2−/− mice have impaired inflammatory responses and reduced IL-17 signaling during oropharyngeal candidiasis, resulting in more severe disease. Our study reveals that EphA2 functions as PRR for β-glucans that senses epithelial cell fungal burden and is required for the maximal mucosal inflammatory response to C. albicans. PMID:29133884

The Complexity of Fungal β-Glucan in Health and Disease: Effects on the Mononuclear Phagocyte System

PubMed Central

Camilli, Giorgio; Tabouret, Guillaume; Quintin, Jessica

2018-01-01

β-glucan, the most abundant fungal cell wall polysaccharide, has gained much attention from the scientific community in the last few decades for its fascinating but not yet fully understood immunobiology. Study of this molecule has been motivated by its importance as a pathogen-associated molecular pattern upon fungal infection as well as by its promising clinical utility as biological response modifier for the treatment of cancer and infectious diseases. Its immune effect is attributed to the ability to bind to different receptors expressed on the cell surface of phagocytic and cytotoxic innate immune cells, including monocytes, macrophages, neutrophils, and natural killer cells. The characteristics of the immune responses generated depend on the cell types and receptors involved. Size and biochemical composition of β-glucans isolated from different sources affect their immunomodulatory properties. The variety of studies using crude extracts of fungal cell wall rather than purified β-glucans renders data difficult to interpret. A better understanding of the mechanisms of purified fungal β-glucan recognition, downstream signaling pathways, and subsequent immune regulation activated, is, therefore, essential not only to develop new antifungal therapy but also to evaluate β-glucan as a putative anti-infective and antitumor mediator. Here, we briefly review the complexity of interactions between fungal β-glucans and mononuclear phagocytes during fungal infections. Furthermore, we discuss and present available studies suggesting how different fungal β-glucans exhibit antitumor and antimicrobial activities by modulating the biologic responses of mononuclear phagocytes, which make them potential candidates as therapeutic agents. PMID:29755450

The Complexity of Fungal β-Glucan in Health and Disease: Effects on the Mononuclear Phagocyte System.

PubMed

Camilli, Giorgio; Tabouret, Guillaume; Quintin, Jessica

2018-01-01

β-glucan, the most abundant fungal cell wall polysaccharide, has gained much attention from the scientific community in the last few decades for its fascinating but not yet fully understood immunobiology. Study of this molecule has been motivated by its importance as a pathogen-associated molecular pattern upon fungal infection as well as by its promising clinical utility as biological response modifier for the treatment of cancer and infectious diseases. Its immune effect is attributed to the ability to bind to different receptors expressed on the cell surface of phagocytic and cytotoxic innate immune cells, including monocytes, macrophages, neutrophils, and natural killer cells. The characteristics of the immune responses generated depend on the cell types and receptors involved. Size and biochemical composition of β-glucans isolated from different sources affect their immunomodulatory properties. The variety of studies using crude extracts of fungal cell wall rather than purified β-glucans renders data difficult to interpret. A better understanding of the mechanisms of purified fungal β-glucan recognition, downstream signaling pathways, and subsequent immune regulation activated, is, therefore, essential not only to develop new antifungal therapy but also to evaluate β-glucan as a putative anti-infective and antitumor mediator. Here, we briefly review the complexity of interactions between fungal β-glucans and mononuclear phagocytes during fungal infections. Furthermore, we discuss and present available studies suggesting how different fungal β-glucans exhibit antitumor and antimicrobial activities by modulating the biologic responses of mononuclear phagocytes, which make them potential candidates as therapeutic agents.

A new colorimetric method to quantify β-1,3-1,6-glucans in comparison with total β-1,3-glucans in edible mushrooms.

PubMed

Nitschke, Jörg; Modick, Hendrik; Busch, Ekkehard; von Rekowski, Reimund Wantoch; Altenbach, Hans-Josef; Mölleken, Helga

2011-07-15

Mushroom β-glucans are known for their activity as biological response modifiers and anticarcinogenic agents. β-1,3-1,6 Branched glucans with a triple helix tertiary structure are recognised as the most potent ones. In the present work, a colorimetric method for β-1,3-1,6-glucan quantification based on the dye Congo red is introduced. This method is specific for β-glucans with a triple helix. The β-1,3-1,6-glucan content of mycelia and fruiting bodies from various mushrooms was determined and compared with the total β-1,3-glucan content, measured by a fluorimetric method. The results show equal amounts of β-1,3-1,6- and total β-1,3-glucans in the analysed species but obvious differences between mycelia and fruiting bodies. On the average, 3% of mycelia and 8% of fruiting body dry mass consist of β-1,3-1,6-glucans. The average percentage of β-1,3-1,6-glucans in the total β-1,3-glucan content differs between mycelia (46%) and fruiting bodies (87%). Copyright © 2011 Elsevier Ltd. All rights reserved.

Expression, purification and characterization of soluble red rooster laforin as a fusion protein in Escherichia coli.

PubMed

Brewer, M Kathryn; Husodo, Satrio; Dukhande, Vikas V; Johnson, Mary Beth; Gentry, Matthew S

2014-04-02

The gene that encodes laforin, a dual-specificity phosphatase with a carbohydrate-binding module, is mutated in Lafora disease (LD). LD is an autosomal recessive, fatal progressive myoclonus epilepsy characterized by the intracellular buildup of insoluble, hyperphosphorylated glycogen-like particles, called Lafora bodies. Laforin dephosphorylates glycogen and other glucans in vitro, but the structural basis of its activity remains unknown. Recombinant human laforin when expressed in and purified from E. coli is largely insoluble and prone to aggregation and precipitation. Identification of a laforin ortholog that is more soluble and stable in vitro would circumvent this issue. In this study, we cloned multiple laforin orthologs, established a purification scheme for each, and tested their solubility and stability. Gallus gallus (Gg) laforin is more stable in vitro than human laforin, Gg-laforin is largely monomeric, and it possesses carbohydrate binding and phosphatase activity similar to human laforin. Gg-laforin is more soluble and stable than human laforin in vitro, and possesses similar activity as a glucan phosphatase. Therefore, it can be used to model human laforin in structure-function studies. We have established a protocol for purifying recombinant Gg-laforin in sufficient quantity for crystallographic and other biophysical analyses, in order to better understand the function of laforin and define the molecular mechanisms of Lafora disease.

Metabolism of the reserve polysaccharide of Streptococcus mitior (mitis): is there a second alpha-1,4-glucan phosphorylase?

PubMed Central

Pulkownik, A; Walker, G J

1976-01-01

The alpha-1,4-glucan phosphorylase (alpha-1,4-glucan: orthophosphate glucosyltransferase; EC 2.4.1.1) associated with the particulate cell fraction of Streptococcus mitior strain S3 was compared with the soluble maltodextrin phosphorylase that had been previously isolated from the same organism (Walker et al., 1969). The particulate enzyme was more sensitive to the glycogen content of the cell than the soluble euzyme; its activity was highest when the cells were grown under conditions favoring high glycogen storage. Substrate specificities of the two high activity towards endogenous glycogen, whereas low-molecular-weight maltodextrins were the preferred substrates for the soluble phosphorylase. The purification of the particulate phosphorylase included incubation of the particulate fraction in 160 mM sodium phosphate-10 mM sodium citrate-0.1% (wt/vol) Triton X-100 buffer (pH 6.7) and ion-exchange chromatography on diethylamino-ethyl- Sephadex A-50. The purified enzyme was fully soluble. The value for the purification factor was variable and depended on (i) the substrate used and (ii) whether the synthetic or the degradative reaction was being measured. The solubilization resulted in considerable changes in the properties of the phosphorylase: the pH optimum for activity was raised from 6.0 to 7.0-7.5 and the substrate specificity was altered. Consequently, the purified enzyme bore greater similarity to the soluble maltodextrin phosphorylase. The reported results are best explained in terms of a single phosphorylase, the specificity which is determind by its binding state in the cell. The enzyme acts as a glycogen phosphorylase in the particulate state and as a maltodextrin phosphorylase when soluble. The equilibrium between the two forms is related to the glycogen content of the cells. PMID:6434

Characteristics of β-glucan extracted from raw and germinated foxtail (Setaria italica) and kodo (Paspalum scrobiculatum) millets.

PubMed

Sharma, Seema; Saxena, Dharmesh C; Riar, Charanjit S

2018-06-22

β-glucan extracted from raw and germinated foxtail and kodo millets were evaluated for its functional, rheological and in vitro antioxidant characteristics. The in vitro activity determined in terms of diphenyl-p-picryl hydrazy (DPPH) radical scavenging activity and Ferric reducing antioxidant power (FRAP) activity was found higher in germinated kodo millet (78.74%, 48.98%) compared to foxtail millet (34.96%, 38.67%), respectively. Water binding capacity and swelling power of β-glucan extract of foxtail millet increased from 2.88 g/g to 3.06 g/g and 1.32 g/g to 1.67 g/g and that of kodo millet from 3.45 to 3.99 g/g and 2.54 to 2.99 g/g, respectively, after germination. There was a significant improvement in foaming capacity and stability of β-glucan after germination. The 'n' values were less than unity indicated that β-glucan extracts behaved pseudo-plastic like material. The storage modus (G') of β-glucan extracts of germinated kodo millet was higher than foxtail millets, as well as overall higher than the loss modulus (G″) indicating a dominantly viscoelastic behaviour and stability. Peak tanδ was lower for germinated foxtail millet compared to kodo millet indicating more stable gel of the former. Therefore, improvements in the functional as well rheological properties of β-glucan could be exploited in food and pharmaceutical industries. Copyright © 2018. Published by Elsevier B.V.

Structural Analysis of a Family 81 Glycoside Hydrolase Implicates Its Recognition of β-1,3-Glucan Quaternary Structure.

PubMed

Pluvinage, Benjamin; Fillo, Alexander; Massel, Patricia; Boraston, Alisdair B

2017-09-05

Family 81 glycoside hydrolases (GHs), which are known to cleave β-1,3-glucans, are found in archaea, bacteria, eukaryotes, and viruses. Here we examine the structural and functional features of the GH81 catalytic module, BhGH81, from the Bacillus halodurans protein BH0236 to probe the molecular basis of β-1,3-glucan recognition and cleavage. BhGH81 displayed activity on laminarin, curdlan, and pachyman, but not scleroglucan; the enzyme also cleaved β-1,3-glucooligosaccharides as small as β-1,3-glucotriose. The crystal structures of BhGH81 in complex with various β-1,3-glucooligosaccharides revealed distorted sugars in the -1 catalytic subsite and an arrangement consistent with an inverting catalytic mechanism having a proposed conformational itinerary of 2 S 0 → 2,5 B ‡ → 5 S 1 . Notably, the architecture of the catalytic site, location of an adjacent ancillary β-1,3-glucan binding site, and the surface properties of the enzyme indicate the likely ability to recognize the double and/or triple-helical quaternary structures adopted by β-1,3-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.

One precursor, three apolipoproteins: the relationship between two crustacean lipoproteins, the large discoidal lipoprotein and the high density lipoprotein/β-glucan binding protein.

PubMed

Stieb, Stefanie; Roth, Ziv; Dal Magro, Christina; Fischer, Sabine; Butz, Eric; Sagi, Amir; Khalaila, Isam; Lieb, Bernhard; Schenk, Sven; Hoeger, Ulrich

2014-12-01

The novel discoidal lipoprotein (dLp) recently detected in the crayfish, differs from other crustacean lipoproteins in its large size, apoprotein composition and high lipid binding capacity, We identified the dLp sequence by transcriptome analyses of the hepatopancreas and mass spectrometry. Further de novo assembly of the NGS data followed by BLAST searches using the sequence of the high density lipoprotein/1-glucan binding protein (HDL-BGBP) of Astacus leptodactylus as query revealed a putative precursor molecule with an open reading frame of 14.7 kb and a deduced primary structure of 4889 amino acids. The presence of an N-terminal lipid bind- ing domain and a DUF 1943 domain suggests the relationship with the large lipid transfer proteins. Two-putative dibasic furin cleavage sites were identified bordering the sequence of the HDL-BGBP. When subjected to mass spectroscopic analyses, tryptic peptides of the large apoprotein of dLp matched the N-terminal part of the precursor, while the peptides obtained for its small apoprotein matched the C-terminal part. Repeating the analysis in the prawn Macrobrachium rosenbergii revealed a similar protein with identical domain architecture suggesting that our findings do not represent an isolated instance. Our results indicate that the above three apolipoproteins (i.e HDL-BGBP and both the large and the small subunit of dLp) are translated as a large precursor. Cleavage at the furin type sites releases two subunits forming a heterodimeric dLP particle, while the remaining part forms an HDL-BGBP whose relationship with other lipoproteins as well as specific functions are yet to be elucidated.

Association of Beta-Glucan Endogenous Production with Increased Stress Tolerance of Intestinal Lactobacilli▿

PubMed Central

Stack, Helena M.; Kearney, Niamh; Stanton, Catherine; Fitzgerald, Gerald F.; Ross, R. Paul

2010-01-01

The exopolysaccharide beta-glucan has been reported to be associated with many health-promoting and prebiotic properties. The membrane-associated glycosyltransferase enzyme (encoded by the gtf gene), responsible for microbial beta-glucan production, catalyzes the conversion of sugar nucleotides into beta-glucan. In this study, the gtf gene from Pediococcus parvulus 2.6 was heterologously expressed in Lactobacillus paracasei NFBC 338. When grown in the presence of glucose (7%, wt/vol), the recombinant strain (pNZ44-GTF+) displayed a “ropy” phenotype, while scanning electron microscopy (SEM) revealed strands of polysaccharide-linking neighboring cells. Beta-glucan biosynthesis was confirmed by agglutination tests carried out with Streptococcus pneumoniae type 37-specific antibodies, which specifically detect glucan-producing cells. Further analysis showed a ∼2-fold increase in viscosity in broth media for the beta-glucan-producing strain over 24 h compared to the control strain, which did not show any significant increase in viscosity. In addition, we analyzed the ability of beta-glucan-producing Lactobacillus paracasei NFBC 338 to survive both technological and gastrointestinal stresses. Heat stress assays revealed that production of the polysaccharide was associated with significantly increased protection during heat stress (60-fold), acid stress (20-fold), and simulated gastric juice stress (15-fold). Bile stress assays revealed a more modest but significant 5.5-fold increase in survival for the beta-glucan-producing strain compared to that of the control strain. These results suggest that production of a beta-glucan exopolysaccharide by strains destined for use as probiotics may afford them greater performance/protection during cultivation, processing, and ingestion. As such, expression of the gtf gene may prove to be a straightforward approach to improve strains that might otherwise prove sensitive in such applications. PMID:19933353

Oral Administration of β-1,3/1,6-Glucan to Dogs Temporally Changes Total and Antigen-Specific IgA and IgM▿

PubMed Central

Stuyven, E.; Verdonck, F.; Van Hoek, I.; Daminet, S.; Duchateau, L.; Remon, J. P.; Goddeeris, B. M.; Cox, E.

2010-01-01

The effect of oral administration of β-1,3/1,6-glucans from Saccharomyces cerevisiae on humoral immunity in domestic dogs is not known. In this study, 15 beagle dogs were orally given MacroGard tablets, which contain 150 mg of this β-glucan, daily for 4 weeks. At the end of this period, the total serum immunoglobulin A (IgA) level decreased significantly in the group treated with the glucan compared to that in the control group as well as compared to the concentrations before supplementation. In contrast, the total serum IgM level rose significantly, whereas no effect on the IgG level occurred. Similar changes were seen in Bordetella-specific IgA and IgM titers following vaccination during the supplementation period. The IgA concentration also became significantly lower in the saliva and tears of the glucan group than in the placebo group. The effects disappeared 1 week after the cessation of the supplementation. In conclusion, the results showed a temporary change in the isotype profile during glucan supplementation. PMID:20032218

The Arabidopsis COBRA Protein Facilitates Cellulose Crystallization at the Plasma Membrane*

PubMed Central

Sorek, Nadav; Sorek, Hagit; Kijac, Aleksandra; Szemenyei, Heidi J.; Bauer, Stefan; Hématy, Kian; Wemmer, David E.; Somerville, Chris R.

2014-01-01

Mutations in the Arabidopsis COBRA gene lead to defects in cellulose synthesis but the function of COBRA is unknown. Here we present evidence that COBRA localizes to discrete particles in the plasma membrane and is sensitive to inhibitors of cellulose synthesis, suggesting that COBRA and the cellulose synthase complex reside in close proximity on the plasma membrane. Live-cell imaging of cellulose synthesis indicated that, once initiated, cellulose synthesis appeared to proceed normally in the cobra mutant. Using isothermal calorimetry, COBRA was found to bind individual β1–4-linked glucan chains with a KD of 3.2 μm. Competition assays suggests that COBRA binds individual β1–4-linked glucan chains with higher affinity than crystalline cellulose. Solid-state nuclear magnetic resonance studies of the cell wall of the cobra mutant also indicated that, in addition to decreases in cellulose amount, the properties of the cellulose fibrils and other cell wall polymers differed from wild type by being less crystalline and having an increased number of reducing ends. We interpret the available evidence as suggesting that COBRA facilitates cellulose crystallization from the emerging β1–4-glucan chains by acting as a “polysaccharide chaperone.” PMID:25331944

Attenuation of PAMP-triggered immunity in maize requires down-regulation of the key β-1,6-glucan synthesis genes KRE5 and KRE6 in biotrophic hyphae of Colletotrichum graminicola.

PubMed

Oliveira-Garcia, Ely; Deising, Holger B

2016-08-01

In plants, pathogen defense is initiated by recognition of pathogen-associated molecular patterns (PAMPs) via plasma membrane-localized pattern-recognition receptors (PRRs). Fungal structural cell wall polymers such as branched β-glucans are essential for infection structure rigidity and pathogenicity, but at the same time represent PAMPs. Kre5 and Kre6 are key enzymes in β-1,6-glucan synthesis and formation of branch points of the β-glucan network. In spite of the importance of branched β-glucan for hyphal rigidity and plant-fungus interactions, neither the role of KRE5 and KRE6 in pathogenesis nor mechanisms allowing circumventing branched β-glucan-triggered immune responses are known. We functionally characterized KRE5 and KRE6 of the ascomycete Colletotrichum graminicola, a hemibiotroph that infects maize (Zea mays). After appressorial plant invasion, this fungus sequentially differentiates biotrophic and highly destructive necrotrophic hyphae. RNAi-mediated reduction of KRE5 and KRE6 transcript abundance caused appressoria to burst and swelling of necrotrophic hyphae, indicating that β-1,6-glucosidic bonds are essential in these cells. Live cell imaging employing KRE5:mCherry and KRE6:mCherry knock-in strains and probing of infection structures with a YFP-conjugated β-1,6-glucan-binding protein showed expression of these genes and exposure of β-1,6-glucan in conidia, appressoria and necrotrophic, but not in biotrophic hyphae. Overexpression of KRE5 and KRE6 in biotrophic hyphae led to activation of broad-spectrum plant defense responses, including papilla and H2 O2 formation, as well as transcriptional activation of several defense-related genes. Collectively, our results strongly suggest that down-regulation of synthesis and avoidance of exposure of branched β-1,3-β-1,6-glucan in biotrophic hyphae is required for attenuation of plant immune responses. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Glucan common to the microcyst walls of cyst-forming bacteria.

PubMed Central

Sutherland, I W; Mackenzie, C L

1977-01-01

Chemical analysis indicated that D-glucose is tha major neutral monosaccharide present in the microcysts of a range of gram-negative bacteria. Varying amounts of other neutral sugars were found. The glucose was mainly present as a glucan that could be extracted from microcysts of representative strains with alkali or mild acid treatment. The glucan could be identified as an alpha-1,3-linked polymer on the basis of (i) periodate resistance of the extracted polymer and the material present in microcysts; (ii) lectin agglutination of the microcysts; (iii) lectin precipitation of the extracted glucans; and (iv) susceptibility of the glucan either in the walls or after extraction to a specific alpha-1,3-glucanase from Aspergillus nidulans, yielding glucose as the sole hydrolysis product. The galactosamine found in microcysts of Myxococcus xanthus by other workers is clearly a component of another polymer, distinct from the glucan. The presence of an alpha 1,3-linked glucan, common to microcyst walls of various bacterial genera, probably contributes to the rigidity of the walls of these forms and, inter alia, to their resistance to ultrasonic treatment. Preliminary experiments indicate that the gulcan is discarded on germination of the microcysts rather than being broken down by specific enzymes. PMID:402353

The Response of Human Macrophages to β-Glucans Depends on the Inflammatory Milieu

PubMed Central

Montero, Olimpio; Hugo, Etzel; Rodríguez, Mario; Domingo, Esther; Alonso, Sara

2013-01-01

Background β-glucans are fungal cell wall components that bind to the C-type lectin-like receptor dectin-1. Polymorphisms of dectin-1 gene are associated with susceptibility to invasive fungal infection and medically refractory ulcerative colitis. The purpose of this study has been addressing the response of human macrophages to β-glucans under different conditions mimicking the composition of the inflammatory milieu in view of the wide plasticity and large range of phenotypical changes showed by these cells, and the relevant role of dectin-1 in several pathophysiological conditions. Principal Findings Serum-differentiated macrophages stimulated with β-glucans showed a low production of TNFα and IL-1β, a high production of IL-6 and IL-23, and a delayed induction of cyclooxygenase-2 and PGE2 biosynthesis that resembled the responses elicited by crystals and those produced when phagosomal degradation of the phagocytic cargo increases ligand access to intracellular pattern recognition receptors. Priming with a low concentration of LPS produced a rapid induction of cyclooxygenase-2 and a synergistic release of PGE2. When the differentiation of the macrophages was carried out in the presence of M-CSF, an increased expression of dectin-1 B isoform was observed. In addition, this treatment made the cells capable to release arachidonic acid in response to β-glucan. Conclusions These results indicate that the macrophage response to fungal β-glucans is strongly influenced by cytokines and microbial-derived factors that are usual components of the inflammatory milieu. These responses can be sorted into three main patterns i) an elementary response dependent on phagosomal processing of pathogen-associated molecular patterns and/or receptor-independent, direct membrane binding linked to the immunoreceptor tyrosine-based activation motif-bearing transmembrane adaptor DNAX-activating protein 12, ii) a response primed by TLR4-dependent signals, and iii) a response dependent on M-CSF and dectin-1 B isoform expression that mainly signals through the dectin-1 B/spleen tyrosine kinase/cytosolic phospholipase A2 route. PMID:23637950

Analysis of bacterial community shifts in the gastrointestinal tract of pigs fed diets supplemented with β-glucan from Laminaria digitata, Laminaria hyperborea and Saccharomyces cerevisiae.

PubMed

Murphy, P; Dal Bello, F; O'Doherty, J; Arendt, E K; Sweeney, T; Coffey, A

2013-07-01

This study was designed to evaluate the effects of algal and yeast β-glucans on the porcine gastrointestinal microbiota, specifically the community of Lactobacillus, Bifidobacterium and coliforms. A total of 48 pigs were fed four diets over a 28-day period to determine the effect that each had on these communities. The control diet consisted of wheat and soya bean meal. The remaining three diets contained wheat and soya bean meal supplemented with β-glucan at 250 g/tonne from Laminaria digitata, Laminaria hyperborea or Saccharomyces cerevisiae. Faecal samples were collected from animals before feeding each diet and after the feeding period. The animals were slaughtered the following day and samples were collected from the stomach, ileum, caecum, proximal colon and distal colon. Alterations in Lactobacillus in the gastrointestinal tract (GIT) were analysed using denaturing gradient gel electrophoresis (DGGE) profiles generated by group-specific 16S rRNA gene PCR amplicons. Plate count analysis was also performed to quantify total coliforms. DGGE profiles indicated that all β-glucan diets provoked the emergence of a richer community of Lactobacillus. The richest community of lactobacilli emerged after feeding L. digitata (LD β-glucan). Plate count analysis revealed that the L. hyperborea (LH β-glucan) diet had a statistically significant effect on the coliform counts in the proximal colon in comparison with the control diet. β-glucan from L. digitata and S. cerevisiae also generally reduced coliforms but to a lesser extent. Nevertheless, the β-glucan diets did not significantly reduce levels of Lactobacillus or Bifidobacterium. DGGE analysis of GIT samples indicated that the three β-glucan diets generally promoted the establishment of a more varied range of Lactobacillus species in the caecum, proximal and distal colon. The LH β-glucan had the most profound reducing effect on coliform counts when compared with the control diet and diets supplemented with L. digitata and S. cerevisiae β-glucans.

Crystal Structure of Glycoside Hydrolase Family 55 β-1,3-Glucanase from the Basidiomycete Phanerochaete chrysosporium*S⃞

PubMed Central

Ishida, Takuya; Fushinobu, Shinya; Kawai, Rie; Kitaoka, Motomitsu; Igarashi, Kiyohiko; Samejima, Masahiro

2009-01-01

Glycoside hydrolase family 55 consists of β-1,3-glucanases mainly from filamentous fungi. A β-1,3-glucanase (Lam55A) from the Basidiomycete Phanerochaete chrysosporium hydrolyzes β-1,3-glucans in the exo-mode with inversion of anomeric configuration and produces gentiobiose in addition to glucose from β-1,3/1,6-glucans. Here we report the crystal structure of Lam55A, establishing the three-dimensional structure of a member of glycoside hydrolase 55 for the first time. Lam55A has two β-helical domains in a single polypeptide chain. These two domains are separated by a long linker region but are positioned side by side, and the overall structure resembles a rib cage. In the complex, a gluconolactone molecule is bound at the bottom of a pocket between the two β-helical domains. Based on the position of the gluconolactone molecule, Glu-633 appears to be the catalytic acid, whereas the catalytic base residue could not be identified. The substrate binding pocket appears to be able to accept a gentiobiose unit near the cleavage site, and a long cleft runs from the pocket, in accordance with the activity of this enzyme toward various β-1,3-glucan oligosaccharides. In conclusion, we provide important features of the substrate-binding site at the interface of the two β-helical domains, demonstrating an unexpected variety of carbohydrate binding modes. PMID:19193645

Antimicrobial and Antitumor Activities of Novel Peptides Derived from the Lipopolysaccharide- and β-1,3-Glucan Binding Protein of the Pacific Abalone Haliotis discus hannai.

PubMed

Nam, Bo-Hye; Moon, Ji Young; Park, Eun Hee; Kong, Hee Jeong; Kim, Young-Ok; Kim, Dong-Gyun; Kim, Woo-Jin; An, Chul Min; Seo, Jung-Kil

2016-12-14

Antimicrobial peptides are a pivotal component of the invertebrate innate immune system. In this study, we identified a lipopolysaccharide- and β-1,3-glucan-binding protein (LGBP) gene from the pacific abalone Haliotis discus hannai (HDH), which is involved in the pattern recognition mechanism and plays avital role in the defense mechanism of invertebrates immune system. The HDH-LGBP cDNA consisted of a 1263-bp open reading frame (ORF) encoding a polypeptide of 420 amino acids, with a 20-amino-acid signal sequence. The molecular mass of the protein portion was 45.5 kDa, and the predicted isoelectric point of the mature protein was 4.93. Characteristic potential polysaccharide binding motif, glucanase motif, and β-glucan recognition motif were identified in the LGBP of HDH. We used its polysaccharide-binding motif sequence to design two novel antimicrobial peptide analogs (HDH-LGBP-A1 and HDH-LGBP-A2). By substituting a positively charged amino acid and amidation at the C -terminus, the pI and net charge of the HDH-LGBP increased, and the proteins formed an α-helical structure. The HDH-LGBP analogs exhibited antibacterial and antifungal activity, with minimal effective concentrations ranging from 0.008 to 2.2 μg/mL. Additionally, both were toxic against human cervix (HeLa), lung (A549), and colon (HCT 116) carcinoma cell lines but not much on human umbilical vein cell (HUVEC). Fluorescence-activated cell sorter (FACS) analysis showed that HDH-LGBP analogs disturb the cancer cell membrane and cause apoptotic cell death. These results suggest the use of HDH-LGBP analogs as multifunctional drugs.

Antimicrobial and Antitumor Activities of Novel Peptides Derived from the Lipopolysaccharide- and β-1,3-Glucan Binding Protein of the Pacific Abalone Haliotis discus hannai

PubMed Central

Nam, Bo-Hye; Moon, Ji Young; Park, Eun Hee; Kong, Hee Jeong; Kim, Young-Ok; Kim, Dong-Gyun; Kim, Woo-Jin; An, Chul Min; Seo, Jung-Kil

2016-01-01

Antimicrobial peptides are a pivotal component of the invertebrate innate immune system. In this study, we identified a lipopolysaccharide- and β-1,3-glucan-binding protein (LGBP) gene from the pacific abalone Haliotis discus hannai (HDH), which is involved in the pattern recognition mechanism and plays avital role in the defense mechanism of invertebrates immune system. The HDH-LGBP cDNA consisted of a 1263-bp open reading frame (ORF) encoding a polypeptide of 420 amino acids, with a 20-amino-acid signal sequence. The molecular mass of the protein portion was 45.5 kDa, and the predicted isoelectric point of the mature protein was 4.93. Characteristic potential polysaccharide binding motif, glucanase motif, and β-glucan recognition motif were identified in the LGBP of HDH. We used its polysaccharide-binding motif sequence to design two novel antimicrobial peptide analogs (HDH-LGBP-A1 and HDH-LGBP-A2). By substituting a positively charged amino acid and amidation at the C-terminus, the pI and net charge of the HDH-LGBP increased, and the proteins formed an α-helical structure. The HDH-LGBP analogs exhibited antibacterial and antifungal activity, with minimal effective concentrations ranging from 0.008 to 2.2 μg/mL. Additionally, both were toxic against human cervix (HeLa), lung (A549), and colon (HCT 116) carcinoma cell lines but not much on human umbilical vein cell (HUVEC). Fluorescence-activated cell sorter (FACS) analysis showed that HDH-LGBP analogs disturb the cancer cell membrane and cause apoptotic cell death. These results suggest the use of HDH-LGBP analogs as multifunctional drugs. PMID:27983632

Antibody to soluble 1,3/1,6-beta-D-glucan, SCG in sera of naive DBA/2 mice.

PubMed

Harada, Toshie; Nagi Miura, Noriko; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito

2003-08-01

A branched beta-glucan from Sparassis crispa (SCG) is a major 6-branched 1,3-beta-D-glucan showing antitumor activity. In the present study, we examined the anti-SCG antibody in naive mice by ELISA. Using SCG coated plate, sera of naive DBA/1 and DBA/2 mice contained significantly higher titers of antibody than other strains of mice. Anti-SCG Ab titers of each DBA/1 and DBA/2 mice were significantly varied. Using various polysaccharide-coated plate, sera of DBA/2 mice also reacted with a beta-glucan from Candida spp. (CSBG) having 1,3-beta and 1,6-beta-glucosidic linkages. The SCG specific immunoglobulin (Ig) M but G was detected in sera. The reactivity of sera to coated SCG was neutralized by adding soluble SCG and CSBG as competitor. These results suggested that DBA/1 and DBA/2 strains carry specific and unique immunological characteristics to branched 1,3-/1,6-beta-glucan.

Preparation and evaluation of β-glucan hydrogel prepared by the radiation technique for drug carrier applications.

PubMed

Park, Jong-Seok; Lim, Youn-Mook; Baik, Jae; Jeong, Jin-Oh; An, Sung-Jun; Jeong, Sung-In; Gwon, Hui-Jeong; Khil, Myung-Seob

2018-06-14

β-Glucan can provide excellent environment to apply to drug carrier due to its immunological and anti-inflammatory effect. Minocycline hydrochloride (MH) has excellent oral bioavailability pharmacological properties. Specifically, MH is effectively absorbed into the gingiva for periodontal disease treatment. In this study, we attempt to develop MH loaded β-glucan hydrogel for periodontal disease treatment through radiation-crosslinking technique. In addition, MH loaded β-glucan hydrogels were tested for their cytotoxicity and antibacterial activity. Finally, we conducted an in vivo study to demonstrate the potential to prevent the invasion of bacteria to treat periodontal disease. The gel content and compressive strength of the β-glucan hydrogels increased as the β-glucan content and the absorbed dose (up to 7 kGy) increased. For a radiation dose of 7 kGy, the gelation and the compressive strength of a 6 wt% β-glucan hydrogel were approximately 92% and 270 kPa, respectively. As a drug, MH was consistently released from β-glucan hydrogels, reaching 80% at approximately 90 min. Furthermore, the MH loaded β-glucan hydrogels showed no cytotoxicity. The MH loaded β-glucan hydrogels exhibited good antibacterial activity against Porphyromonas gingivalis. In addition, MH loaded β-glucan hydrogel demonstrated the potential of a good capability to prevent the invasion of bacteria and to treat wounds. Copyright © 2017. Published by Elsevier B.V.

Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.

PubMed

Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij

2015-07-20

Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.

Microbial cyclic β-(1→3),(1→6)-glucans as potential drug carriers: Interaction studies between cyclic β-glucans isolated from Bradyrhizobium japonicum and betulinic acid.

PubMed

Kambhampati, Naga Sai Visweswar; Kar, Swayamsiddha; Pinnepalli, Sai Siva Kumar; Chelli, Janardhana; Doble, Mukesh

2018-10-05

Betulinic acid (BA), a pentacyclic triterpenoid, is a very promising therapeutic drug with varied medicinal properties but it has low water solubility and consequentially low bioavailability. Cyclic β-(1→3),(1→6)-glucans (CBG), microbial cyclooligosaccharides produced by Bradyrhizobium japonicum ATCC 10324 having a cavity structure and good solubility in water have been tested for their ability to encapsulate betulinic acid and drug-binding interactions of CBG and BA were studied. First, in silico approach was employed to study the scope of any interaction between the CBG and BA. Then, the cyclic glucan-betulinic acid complexes were prepared in three compositions of 1:1, 1:2 and 1:3 CBG:BA. The complexes were analysed using UV-VIS spectroscopy, IR spectroscopy, powder XRD, differential scanning calorimetry (DSC) and thermogravimetric analysis (TGA) to confirm the computational results and consequently the encapsulation efficiency was found to be 9.53%. Copyright © 2017. Published by Elsevier B.V.

Immunomodulatory effect of glucan on specific and nonspecific immunity after vaccination in puppies.

PubMed

Haladová, Eva; Mojžišová, Jana; Smrčo, Peter; Ondrejková, Anna; Vojtek, Boris; Prokeš, Marián; Petrovová, Eva

2011-03-01

The objective of the study was to determine the immunostimulatory effect of β-(1,3/1,6)-D-glucan in puppies. The effect exerted on the efficacy of vaccination, especially against canine parvovirus and rabies infection, was studied. The application of vaccine and glucan leads to significant increases in the nonspecific immunological parameters (phagocytic ability of leukocytes, blastogenic response of lymphocytes, metabolic and chemotactic activity of polymorphonuclear cells). The level of antibodies against canine parvovirus (Ab CPV) and rabies infection reached the most statistically significant values on the 28th day after the application of vaccine and a syrup containing β-(1,3/1,6)-D-glucan (Group GV) as compared to the control group (Group V, puppies receiving only vaccine). Dogs without glucan supplementation did not produce such significant levels of antibodies. We can conclude that glucan has relevant immunostimulatory effects in dogs with altered immunity. The glucan product tested in this study (PleraSAN V, PLEURAN, Bratislava, Slovakia) could be used in the small animal clinical practice.

Enhanced Polysaccharide Binding and Activity on Linear β-Glucans through Addition of Carbohydrate-Binding Modules to Either Terminus of a Glucooligosaccharide Oxidase

PubMed Central

Foumani, Maryam; Vuong, Thu V.; MacCormick, Benjamin; Master, Emma R.

2015-01-01

The gluco-oligosaccharide oxidase from Sarocladium strictum CBS 346.70 (GOOX) is a single domain flavoenzyme that favourably oxidizes gluco- and xylo- oligosaccharides. In the present study, GOOX was shown to also oxidize plant polysaccharides, including cellulose, glucomannan, β-(1→3,1→4)-glucan, and xyloglucan, albeit to a lesser extent than oligomeric substrates. To improve GOOX activity on polymeric substrates, three carbohydrate binding modules (CBMs) from Clostridium thermocellum, namely CtCBM3 (type A), CtCBM11 (type B), and CtCBM44 (type B), were separately appended to the amino and carboxy termini of the enzyme, generating six fusion proteins. With the exception of GOOX-CtCBM3 and GOOX-CtCBM44, fusion of the selected CBMs increased the catalytic activity of the enzyme (kcat) on cellotetraose by up to 50%. All CBM fusions selectively enhanced GOOX binding to soluble and insoluble polysaccharides, and the immobilized enzyme on a solid cellulose surface remained stable and active. In addition, the CBM fusions increased the activity of GOOX on soluble glucomannan by up to 30 % and on insoluble crystalline as well as amorphous cellulose by over 50 %. PMID:25932926

Activation of the innate immune receptor Dectin-1 upon formation of a “phagocytic synapse”

PubMed Central

Goodridge, Helen S.; Reyes, Christopher N.; Becker, Courtney A.; Katsumoto, Tamiko R.; Ma, Jun; Wolf, Andrea J.; Bose, Nandita; Chan, Anissa S. H.; Magee, Andrew S.; Danielson, Michael E.; Weiss, Arthur; Vasilakos, John P.; Underhill, David M.

2011-01-01

Innate immune cells must be able to distinguish between direct binding to microbes and detection of components shed from the surface of microbes located at a distance. Dectin-1 is a pattern recognition receptor expressed by myeloid phagocytes (macrophages, dendritic cells and neutrophils) that detects β-glucans in fungal cell walls and triggers direct cellular anti-microbial activity, including phagocytosis and production of reactive oxygen species1, 2. In contrast to inflammatory responses stimulated upon detection of soluble ligands by other pattern recognition receptors, such as Toll-like receptors (TLRs), these responses are only useful when a cell comes into direct contact with a microbe and must not be spuriously activated by soluble stimuli. In this study we show that despite its ability to bind both soluble and particulate β-glucan polymers, Dectin-1 signalling is only activated by particulate β-glucans, which cluster the receptor in synapse-like structures from which regulatory tyrosine phosphatases CD45 and CD148 are excluded (Supplementary Figure 1). The “phagocytic synapse” now provides a model mechanism by which innate immune receptors can distinguish direct microbial contact from detection of microbes at a distance, thereby initiating direct cellular anti-microbial responses only when they are required. PMID:21525931

Observed mechanism for the breakup of small bundles of cellulose Iα and Iβ in ionic liquids from molecular dynamics simulations.

PubMed

Rabideau, Brooks D; Agarwal, Animesh; Ismail, Ahmed E

2013-04-04

Explicit, all-atom molecular dynamics simulations are used to study the breakup of small bundles of cellulose Iα and Iβ in the ionic liquids [BMIM]Cl, [EMIM]Ac, and [DMIM]DMP. In all cases, significant breakup of the bundles is observed with the initial breakup following a common underlying mechanism. Anions bind strongly to the hydroxyl groups of the exterior strands of the bundle, forming negatively charged complexes. Binding also weakens the intrastrand hydrogen bonds present in the cellulose strands, providing greater strand flexibility. Cations then intercalate between the individual strands, likely due to charge imbalances, providing the bulk to push the individual moieties apart and initiating the separation. The peeling of an individual strand from the main bundle is observed in [EMIM]Ac with an analysis of its hydrogen bonds with other strands showing that the chain detaches glucan by glucan from the main bundle in discrete, rapid events. Further analysis shows that the intrastrand hydrogen bonds of each glucan tend to break for a sustained period of time before the interstrand hydrogen bonds break and strand detachment occurs. Examination of similar nonpeeling strands shows that, without this intrastrand hydrogen bond breakage, the structural rigidity of the individual unit can hinder its peeling despite interstrand hydrogen bond breakage.

Control of Hepatic Glucose Metabolism by the Oral Hypoglycemic Sulfonylureas

DTIC Science & Technology

1984-05-11

another In vitro study, Vignerl, et al. (1982) were unable to detect any effect on Insulin binding to MCF-7 human breast cancer cells, IM-9 human cultured...according to the method of Huljlng (1970). Aspirgillus niger amyloglucosidase (1,4 a- glucan glucohy- drolase; E.C. 3.2.1.3), (0.5 U) and 0.38 U of porcine...pancreatic a-amylase (1,6 a- glucan glucohydrolase; E.C. 3.2.1.1), in 1.0 ml of 100 mM sodium acetate buffer (pH 4.8) were added to the glycogen 34

Chemical modification and pH dependence of kinetic parameters to identify functional groups in a glucosyltransferase from Strep. Mutans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bell, J.E.; Leone, A.; Bell, E.T.

1986-05-01

A glucosyltransferase, forming a predominantly al-6 linked glucan, was partially purified from the culture filtrate of S. mutans GS-5. The kinetic properties of the enzyme, assessed using the transfer of /sup 14/C glucose from sucrose into total glucan, were studied at pH values from pH 3.5 to 6.5. From the dependence of km on pH, a group with pKa = 5.5 must be protonated to maximize substrate binding. From plots of V/sub max/ vs pH two groups, with pKa's of 4.5 and 5.5 were indicated. The results suggest the involvement of either two carboxyl groups (one protonated, one unprotonated inmore » the native enzyme) or a carboxyl group (unprotonated) and some other protonated group such as histidine, cysteine. Chemical modification studies showed that Diethylyrocarbonate (histidine specific) had no effect on enzyme activity while modification with p-phydroxy-mercuribenzoate or iodoacetic acid (sulfhydryl reactive) and carbodimide reagents (carboxyl specific) resulted in almost complete inactivation. Activity loss was dependent upon time of incubation and reagent concentration. The disaccharide lylose, (shown to be an inhibitor of the enzyme with similar affinity to sucrose) offers no protection against modification by the sulfhydryl reactive reagents.« less

Candida albicans mannans mediate Streptococcus mutans exoenzyme GtfB binding to modulate cross-kingdom biofilm development in vivo.

PubMed

Hwang, Geelsu; Liu, Yuan; Kim, Dongyeop; Li, Yong; Krysan, Damian J; Koo, Hyun

2017-06-01

Candida albicans is frequently detected with heavy infection by Streptococcus mutans in plaque-biofilms from children with early-childhood caries (ECC). This cross-kingdom biofilm contains an extensive matrix of extracellular α-glucans that is produced by an exoenzyme (GtfB) secreted by S. mutans. Here, we report that mannans located on the outer surface of C. albicans cell-wall mediates GtfB binding, enhancing glucan-matrix production and modulating bacterial-fungal association within biofilms formed in vivo. Using single-molecule atomic force microscopy, we determined that GtfB binds with remarkable affinity to mannans and to the C. albicans surface, forming a highly stable and strong bond (1-2 nN). However, GtfB binding properties to C. albicans was compromised in strains defective in O-mannan (pmt4ΔΔ) or N-mannan outer chain (och1ΔΔ). In particular, the binding strength of GtfB on och1ΔΔ strain was severely disrupted (>3-fold reduction vs. parental strain). In turn, the GtfB amount on the fungal surface was significantly reduced, and the ability of C. albicans mutant strains to develop mixed-species biofilms with S. mutans was impaired. This phenotype was independent of hyphae or established fungal-biofilm regulators (EFG1, BCR1). Notably, the mechanical stability of the defective biofilms was weakened, resulting in near complete biomass removal by shear forces. In addition, these in vitro findings were confirmed in vivo using a rodent biofilm model. Specifically, we observed that C. albicans och1ΔΔ was unable to form cross-kingdom biofilms on the tooth surface of rats co-infected with S. mutans. Likewise, co-infection with S. mutans defective in GtfB was also incapable of forming mixed-species biofilms. Taken together, the data support a mechanism whereby S. mutans-secreted GtfB binds to the mannan layer of C. albicans to promote extracellular matrix formation and their co-existence within biofilms. Enhanced understanding of GtfB-Candida interactions may provide new perspectives for devising effective therapies to disrupt this cross-kingdom relationship associated with an important childhood oral disease.

Effect of natural flocculants on purity and properties of β-glucan extracted from barley and oat.

PubMed

Kurek, Marcin Andrzej; Karp, Sabina; Stelmasiak, Adrian; Pieczykolan, Ewelina; Juszczyk, Karolina; Rieder, Anne

2018-05-15

In this study, β-glucan was extracted from wholegrain oat and barley flours by a novel extraction and purification method employing natural flocculants (chitosan, guar gum and gelatin). The use of flocculants decreased the total amount of extracted gum, which was highest in control samples (9.07 and 7.9% for oat and barley, respectively). The β-glucan specific yield, however, increased with the use of chitosan and guar gum, which were able to remove protein and ash impurities resulting in gums with a higher purity.The highest concentration of chitosan (0.6 %) resulted in gums with the highest β-glucan content (82.0 ± 0.23 and 79.0 ± 0.19 for barley and oat, respectively) and highest β-glucan specific yield (96.9 and 93.3 % for oat and barley, respectively). Explanation is in R&D section. The use of gelatin was not successful. All gum samples had a high content of total dietary fiber (>74%) and a high water holding capacity (4.6-7.4 g/g), but differed in apparent viscosity, which was highest for the oat sample extracted with 0.6% chitosan. This sample also showed the highest β-glucan molecular weight among the oat samples, which were in general 10-fold higher than for the barley samples. Among the barley samples, β-glucan molecular weight was highest for the control. Copyright © 2018 Elsevier Ltd. All rights reserved.

Plant-derived antifungal agent poacic acid targets β-1,3-glucan

PubMed Central

Piotrowski, Jeff S.; Okada, Hiroki; Lu, Fachuang; Li, Sheena C.; Hinchman, Li; Ranjan, Ashish; Smith, Damon L.; Higbee, Alan J.; Ulbrich, Arne; Coon, Joshua J.; Deshpande, Raamesh; Bukhman, Yury V.; McIlwain, Sean; Ong, Irene M.; Myers, Chad L.; Boone, Charles; Landick, Robert; Ralph, John; Kabbage, Mehdi; Ohya, Yoshikazu

2015-01-01

A rise in resistance to current antifungals necessitates strategies to identify alternative sources of effective fungicides. We report the discovery of poacic acid, a potent antifungal compound found in lignocellulosic hydrolysates of grasses. Chemical genomics using Saccharomyces cerevisiae showed that loss of cell wall synthesis and maintenance genes conferred increased sensitivity to poacic acid. Morphological analysis revealed that cells treated with poacic acid behaved similarly to cells treated with other cell wall-targeting drugs and mutants with deletions in genes involved in processes related to cell wall biogenesis. Poacic acid causes rapid cell lysis and is synergistic with caspofungin and fluconazole. The cellular target was identified; poacic acid localized to the cell wall and inhibited β-1,3-glucan synthesis in vivo and in vitro, apparently by directly binding β-1,3-glucan. Through its activity on the glucan layer, poacic acid inhibits growth of the fungi Sclerotinia sclerotiorum and Alternaria solani as well as the oomycete Phytophthora sojae. A single application of poacic acid to leaves infected with the broad-range fungal pathogen S. sclerotiorum substantially reduced lesion development. The discovery of poacic acid as a natural antifungal agent targeting β-1,3-glucan highlights the potential side use of products generated in the processing of renewable biomass toward biofuels as a source of valuable bioactive compounds and further clarifies the nature and mechanism of fermentation inhibitors found in lignocellulosic hydrolysates. PMID:25775513

The effects of β-glucan on human immune and cancer cells

PubMed Central

Chan, Godfrey Chi-Fung; Chan, Wing Keung; Sze, Daniel Man-Yuen

2009-01-01

Non-prescriptional use of medicinal herbs among cancer patients is common around the world. The alleged anti-cancer effects of most herbal extracts are mainly based on studies derived from in vitro or in vivo animal experiments. The current information suggests that these herbal extracts exert their biological effect either through cytotoxic or immunomodulatory mechanisms. One of the active compounds responsible for the immune effects of herbal products is in the form of complex polysaccharides known as β-glucans. β-glucans are ubiquitously found in both bacterial or fungal cell walls and have been implicated in the initiation of anti-microbial immune response. Based on in vitro studies, β-glucans act on several immune receptors including Dectin-1, complement receptor (CR3) and TLR-2/6 and trigger a group of immune cells including macrophages, neutrophils, monocytes, natural killer cells and dendritic cells. As a consequence, both innate and adaptive response can be modulated by β-glucans and they can also enhance opsonic and non-opsonic phagocytosis. In animal studies, after oral administration, the specific backbone 1→3 linear β-glycosidic chain of β-glucans cannot be digested. Most β-glucans enter the proximal small intestine and some are captured by the macrophages. They are internalized and fragmented within the cells, then transported by the macrophages to the marrow and endothelial reticular system. The small β-glucans fragments are eventually released by the macrophages and taken up by other immune cells leading to various immune responses. However, β-glucans of different sizes and branching patterns may have significantly variable immune potency. Careful selection of appropriate β-glucans is essential if we wish to investigate the effects of β-glucans clinically. So far, no good quality clinical trial data is available on assessing the effectiveness of purified β-glucans among cancer patients. Future effort should direct at performing well-designed clinical trials to verify the actual clinical efficacy of β-glucans or β-glucans containing compounds. PMID:19515245

Characterization of an anti-glucosyltransferase serum specific for insoluble glucan synthesis by Streptococcus mutans.

PubMed

Linzer, R; Slade, H D

1976-02-01

An anti-glucosyltransferase serum, which synthesized 96% insoluble glucans, was prepared against a purified enzyme preparation from Streptococcus mutans strain HS6 (serotype a). This serum was examined for its effects on glucan synthesis by crude enzyme preparations from eight strains (four serotypes) of S. mutans and for the ability of these preparations to promote adherence of S. mutans to a smooth surface. Glucosyltransferase activity was assayed by measuring the incorporation of glucose from [14C]glucose-labeled sucrose into water-insoluble and water-soluble (ethanol-insoluble) glucans. Anti-glucosyltransferase serum inhibited insoluble glucan synthesis by crude enzyme preparations from cells of the four serotypes of S. mutans. Enzymes from strains of types a, b, and d were inhibited between 70 to 90%; enzymes from type c strains were inhibited from 45 to 60%. The adherence to a glass surface of heat-killed cells from these four serotypes was likewise inhibited. Soluble glucan synthesis was not inhibited by the serum, and in some cases its synthesis increased as insoluble glucan synthesis decreased.

Endotoxin and β-(1,3)-glucan levels in automobiles: a pilot study.

PubMed

Wu, Francis Fu-Sheng; Wu, Mei-Wen; Chang, Chin-Fu; Lai, Shu-Mei; Pierse, Nevil; Crane, Julian; Siebers, Rob

2010-01-01

Exposure to bacterial endotoxin and fungal β-(1,3)-glucan in the indoor environment can induce respiratory symptoms. Automobiles are an exposure source of allergens but it is not known if, and how much exposure there is to endotoxin and fungal β-(1,3)-glucan. The objective of the study was to determine whether automobiles are a potential source of exposure to these microbial products. Dust was sampled from the passenger seats of 40 automobiles. Specific Limulus amoebocyte kinetic assays were used to measure endotoxin and β-(1,3)-glucan, respectively. Endotoxin and β-(1,3)-glucan was detected in all samples ranging from 19.9-247.0 EU/mg and 1.6-59.8 μg/g, respectively. There were no significant differences in endotoxin levels between automobiles of smokers and non-smokers, but β-(1,3)-glucan levels were about two-fold higher in the automobiles of non-smokers. In conclusion, endotoxin and β-(1,3)-glucan exposure in automobiles at levels found in our study may be of importance for asthmatics.

Evidence for Proinflammatory β-1,6 Glucans in the Pneumocystis carinii Cell Wall

PubMed Central

Kottom, Theodore J.; Hebrink, Deanne M.; Jenson, Paige E.; Gudmundsson, Gunnar

2015-01-01

Inflammation is a major cause of respiratory impairment during Pneumocystis pneumonia. Studies support a significant role for cell wall β-glucans in stimulating inflammatory responses. Fungal β-glucans are comprised of d-glucose homopolymers containing β-1,3-linked glucose backbones with β-1,6-linked glucose side chains. Prior studies in Pneumocystis carinii have characterized β-1,3 glucan components of the organism. However, recent investigations in other organisms support important roles for β-1,6 glucans, predominantly in mediating host cellular activation. Accordingly, we sought to characterize β-1,6 glucans in the cell wall of Pneumocystis and to establish their activity in lung cell inflammation. Immune staining revealed specific β-1,6 localization in P. carinii cyst walls. Homology-based cloning facilitated characterization of a functional P. carinii kre6 (Pckre6) β-1,6 glucan synthase in Pneumocystis that, when expressed in kre6-deficient Saccharomyces cerevisiae, restored cell wall stability. Recently synthesized β-1,6 glucan synthase inhibitors decreased the ability of isolated P. carinii preparations to generate β-1,6 carbohydrate. In addition, isolated β-1,6 glucan fractions from Pneumocystis elicited vigorous tumor necrosis factor alpha (TNF-α) responses from macrophages. These inflammatory responses were significantly dampened by inhibition of host cell plasma membrane microdomain function. Together, these studies indicate that β-1,6 glucans are present in the P. carinii cell wall and contribute to lung cell inflammatory activation during infection. PMID:25916991

JPRS Report Science & Technology USSR: Life Sciences

DTIC Science & Technology

1990-06-18

water-soluble low-molecular-mass ß-l,3-ß-l,6- glucanes , suppressors present in the mycelium and zoospores of the fungus, and also in its excretions...This article studies the participation of the glucane suppressors of phytoph- thora infestans (Mont) de Bary in the suppression of various types of...potato immune response. The interac- tion of the glucanes with specific receptors on the plas- malemma of the potato cells prevents recognition by

The Phosphoglucan Phosphatase Like Sex Four2 Dephosphorylates Starch at the C3-Position in Arabidopsis[W][OA

PubMed Central

Santelia, Diana; Kötting, Oliver; Seung, David; Schubert, Mario; Thalmann, Matthias; Bischof, Sylvain; Meekins, David A.; Lutz, Andy; Patron, Nicola; Gentry, Matthew S.; Allain, Frédéric H.-T.; Zeeman, Samuel C.

2011-01-01

Starch contains phosphate covalently bound to the C6-position (70 to 80% of total bound phosphate) and the C3-position (20 to 30%) of the glucosyl residues of the amylopectin fraction. In plants, the transient phosphorylation of starch renders the granule surface more accessible to glucan hydrolyzing enzymes and is required for proper starch degradation. Phosphate also confers desired properties to starch-derived pastes for industrial applications. In Arabidopsis thaliana, the removal of phosphate by the glucan phosphatase Starch Excess4 (SEX4) is essential for starch breakdown. We identified a homolog of SEX4, LSF2 (Like Sex Four2), as a novel enzyme involved in starch metabolism in Arabidopsis chloroplasts. Unlike SEX4, LSF2 does not have a carbohydrate binding module. Nevertheless, it binds to starch and specifically hydrolyzes phosphate from the C3-position. As a consequence, lsf2 mutant starch has elevated levels of C3-bound phosphate. SEX4 can release phosphate from both the C6- and the C3-positions, resulting in partial functional overlap with LSF2. However, compared with sex4 single mutants, the lsf2 sex4 double mutants have a more severe starch-excess phenotype, impaired growth, and a further change in the proportion of C3- and C6-bound phosphate. These findings significantly advance our understanding of the metabolism of phosphate in starch and provide innovative options for tailoring novel starches with improved functionality for industry. PMID:22100529

The phosphoglucan phosphatase like sex Four2 dephosphorylates starch at the C3-position in Arabidopsis.

PubMed

Santelia, Diana; Kötting, Oliver; Seung, David; Schubert, Mario; Thalmann, Matthias; Bischof, Sylvain; Meekins, David A; Lutz, Andy; Patron, Nicola; Gentry, Matthew S; Allain, Frédéric H-T; Zeeman, Samuel C

2011-11-01

Starch contains phosphate covalently bound to the C6-position (70 to 80% of total bound phosphate) and the C3-position (20 to 30%) of the glucosyl residues of the amylopectin fraction. In plants, the transient phosphorylation of starch renders the granule surface more accessible to glucan hydrolyzing enzymes and is required for proper starch degradation. Phosphate also confers desired properties to starch-derived pastes for industrial applications. In Arabidopsis thaliana, the removal of phosphate by the glucan phosphatase Starch Excess4 (SEX4) is essential for starch breakdown. We identified a homolog of SEX4, LSF2 (Like Sex Four2), as a novel enzyme involved in starch metabolism in Arabidopsis chloroplasts. Unlike SEX4, LSF2 does not have a carbohydrate binding module. Nevertheless, it binds to starch and specifically hydrolyzes phosphate from the C3-position. As a consequence, lsf2 mutant starch has elevated levels of C3-bound phosphate. SEX4 can release phosphate from both the C6- and the C3-positions, resulting in partial functional overlap with LSF2. However, compared with sex4 single mutants, the lsf2 sex4 double mutants have a more severe starch-excess phenotype, impaired growth, and a further change in the proportion of C3- and C6-bound phosphate. These findings significantly advance our understanding of the metabolism of phosphate in starch and provide innovative options for tailoring novel starches with improved functionality for industry.

Antigen-specific response of murine immune system toward a yeast beta-glucan preparation, zymosan.

PubMed

Miura, T; Ohno, N; Miura, N N; Adachi, Y; Shimada, S; Yadomae, T

1999-06-01

Zymosan, a particulate beta-glucan preparation from Saccharomyces cerevisiae, shows various biological activities, including anti-tumor activity. We have previously shown that soluble beta-glucan initiated anti-tumor activity was long-lived and was effective even by prophylactic treatment at 1 month prior to tumor challenge. However, the activity by zymosan was relatively short-lived. Antigen-specific responses of mice to zymosan might be a causative mechanism. In this paper, mice were immunized with zymosan and antibody production and antigen-specific responses of lymphocytes to zymosan were analyzed. Sera of zymosan immune mice contained zymosan-specific IgG assessed by enzyme-linked immunosorbent assay and FACS. Spleen and bone marrow cells of zymosan-immune mice showed higher cytokine production in response to zymosan. Specificity of zymosan-specific responses were also analyzed using various derivatives prepared from zymosan. These facts strongly suggested that mice recognize zymosan as antigen in addition to non-specific immune stimulant.

Neurospora crassa 1,3-α-glucan synthase, AGS-1, is required for cell wall biosynthesis during macroconidia development

PubMed Central

Fu, Ci; Tanaka, Asuma

2014-01-01

The Neurospora crassa genome encodes two 1,3-α-glucan synthases. One of these 1,3-α-glucan synthase genes, ags-1, was shown to be required for the synthesis of 1,3-α-glucan in the aerial hyphae and macroconidia cell walls. 1,3-α-Glucan was found in the conidia cell wall, but was absent from the vegetative hyphae cell wall. Deletion of ags-1 affected conidial development. Δags-1 produced only 5 % as many conidia as the WT and most of the conidia produced by Δags-1 were not viable. The ags-1 upstream regulatory elements were shown to direct cell-type-specific expression of red fluorescent protein in conidia and aerial hyphae. A haemagglutinin-tagged AGS-1 was found to be expressed in aerial hyphae and conidia. The research showed that 1,3-α-glucan is an aerial hyphae and conidia cell wall component, and is required for normal conidial differentiation. PMID:24847001

Beta 1,3/1,6-glucan and vitamin C immunostimulate the non-specific immune response of white shrimp (Litopenaeus vannamei).

PubMed

Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua

2016-10-01

This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effect of β-glucan on MUC4 and MUC5B expression in human airway epithelial cells.

PubMed

Kim, Yong-Dae; Bae, Chang Hoon; Song, Si-Youn; Choi, Yoon Seok

2015-08-01

β-Glucan is found in the cell walls of fungi, bacteria, and some plant tissues, and is detected by the innate immune system. Furthermore, this recognition is known to worsen respiratory symptoms in patients with allergic and inflammatory airway diseases. However, the means by which β-glucan affects the secretion of major mucins by human airway epithelial cells has not been elucidated. Therefore, in this study, the effect and signaling pathway of β-glucan on mucins MUC4 and MUC5B were investigated in human airway epithelial cells. In NCI-H292 cells and human normal nasal epithelial cells, the effect and signaling pathway of β-glucan on MUC4 and MUC5B expression were investigated using reverse transcriptase-polymerase chain reaction (RT-PCR), real-time PCR, enzyme immunoassay, and immunoblot analysis with specific inhibitors and small interfering RNA (siRNA). β-Glucan increased MUC4 and MUC5B expression and activated the phosphorylation of p38 mitogen-activated protein kinase (MAPK) and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). SB203580 (a p38 MAPK inhibitor) and pyrrolidine dithiocarbamate (PDTC; a NF-κB inhibitor) inhibited β-glucan-induced MUC4 and MUC5B expression. In addition, siRNA knockdown of p38 MAPK blocked β-glucan-induced MUC4 and MUC5B mRNA expression and β-glucan-activated phosphorylation of NF-κB. Furthermore, Toll-like receptor 4 (TLR4) mRNA expression was increased by β-glucan, and siRNA knockdown of TLR4 blocked β-glucan-induced MUC4 and MUC5B mRNA expression and β-glucan-activated phosphorylation of p38 MAPK and NF-κB. These results demonstrate that in human airway epithelial cells β-glucan induces MUC4 and MUC5B expression via the TLR4-p38 MAPK-NF-κB signaling pathway. © 2015 ARS-AAOA, LLC.

Chemically engineered sulfated glucans from rice bran exert strong antiviral activity at the stage of viral entry.

PubMed

Ray, Bimalendu; Hutterer, Corina; Bandyopadhyay, Shruti S; Ghosh, Kanika; Chatterjee, Udipta R; Ray, Sayani; Zeitträger, Isabel; Wagner, Sabrina; Marschall, Manfred

2013-12-27

Attachment and entry of many viruses are mediated by their affinity for polysaccharides present on the surface of target cells. In this paper, we demonstrate that sulfated glucans isolated from rice (Oryza sativa) can be utilized as experimental drugs exerting strong antiviral activity. In particular, oleum-DMF-based extraction is described as a procedure for the generation of chemically engineered glucans from commercially available rice bran. The one-step procedure has the potential to provide a spectrum of related glucans with varying molecular masses and modifications, including sulfation. The sulfated glucans P444, P445, and P446 possess increased antiviral activity compared to a previously described glucan (S1G). P444, P445, and P446 were highly active against human cytomegalovirus (HCMV), moderately active against other members of the family Herpesviridae, while not active against unrelated viruses. Specific experimentation with HCMV-infected cells provided evidence that antiviral activity was based on inhibition of viral entry and that inhibition occurred in the absence of drug-induced cytotoxicity. These findings underline the high potential of sulfated glucans for antiviral research and drug development. In addition, the procedure described for the efficient transformation of glucan hydroxy groups to sulfate groups may be similarly beneficial for the chemical alteration of other natural products.

A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.

PubMed

Semedo, Magda C; Karmali, Amin; Fonseca, Luís

2015-02-01

Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.

Role of Glucosyltransferase B in Interactions of Candida albicans with Streptococcus mutans and with an Experimental Pellicle on Hydroxyapatite Surfaces ▿ †

PubMed Central

Gregoire, S.; Xiao, J.; Silva, B. B.; Gonzalez, I.; Agidi, P. S.; Klein, M. I.; Ambatipudi, K. S.; Rosalen, P. L.; Bauserman, R.; Waugh, R. E.; Koo, H.

2011-01-01

Candida albicans and mutans streptococci are frequently detected in dental plaque biofilms from toddlers afflicted with early childhood caries. Glucosyltransferases (Gtfs) secreted by Streptococcus mutans bind to saliva-coated apatite (sHA) and to bacterial surfaces, synthesizing exopolymers in situ, which promote cell clustering and adherence to tooth enamel. We investigated the potential role Gtfs may play in mediating the interactions between C. albicans SC5314 and S. mutans UA159, both with each other and with the sHA surface. GtfB adhered effectively to the C. albicans yeast cell surface in an enzymatically active form, as determined by scintillation spectroscopy and fluorescence imaging. The glucans formed on the yeast cell surface were more susceptible to dextranase than those synthesized in solution or on sHA and bacterial cell surfaces (P < 0.05), indicating an elevated α-1,6-linked glucose content. Fluorescence imaging revealed that larger numbers of S. mutans cells bound to C. albicans cells with glucans present on their surface than to yeast cells without surface glucans (uncoated). The glucans formed in situ also enhanced C. albicans interactions with sHA, as determined by a novel single-cell micromechanical method. Furthermore, the presence of glucan-coated yeast cells significantly increased the accumulation of S. mutans on the sHA surface (versus S. mutans incubated alone or mixed with uncoated C. albicans; P < 0.05). These data reveal a novel cross-kingdom interaction that is mediated by bacterial GtfB, which readily attaches to the yeast cell surface. Surface-bound GtfB promotes the formation of a glucan-rich matrix in situ and may enhance the accumulation of S. mutans on the tooth enamel surface, thereby modulating the development of virulent biofilms. PMID:21803906

Medicinal mushroom Lingzhi or Reishi, Ganoderma lucidum (W.Curt.:Fr.) P. Karst., beta-glucan induces Toll-like receptors and fails to induce inflammatory cytokines in NF-kappaB inhibitor-treated macrophages.

PubMed

Batbayar, Sainkhuu; Kim, Mi Jeong; Kim, Ha Won

2011-01-01

Beta-Glucan of medicinal Lingzhi or Reishi mushroom, Ganoderma lucidum (BGG), possesses immunostimulatory and anti-tumor activities. Innate immune cells are activated by the binding of beta-glucan to the dectin-1 receptor. The present study investigated the immunostimulating activities of BGG, including binding to dectin-1, secretion of cytokines and reactive oxygen species, and induction of Toll-like receptors (TLRs) in RAW264.7 mouse macrophages. Reverse transcription-polymerase chain reaction and flow cytometry were used for the cytokine and TLR analyses. A mouse inflammation antibody array was used for protein-level cytokine analysis. BGG bound to dectin-1 and induced RAW264.7 cell secretion of several cytokines, including granulocyte colony-stimulating factor, interleukin (IL)-6, regulated upon activation normal T cell expressed and secreted (RANTES), tissue inhibitor of metalloproteinase-1, and tumor necrosis factor-alpha. The secretion of these cytokines was further increased by the addition of lipopolysaccharide (LPS). BGG also induced both nitric oxide and inducible nitric oxide synthase (iNOS). Treatment with an inhibitor of nuclear factor-kappa B (NF-kappaB) reduced the induction of IL-1, IL-6, and iNOS in a concentration-dependent manner. Expressions of TLR2, TLR4, and TLR6 were increased by BGG treatment, and addition of LPS induced further induction of TLR4 and TLR6. Our result indicates that BGG induces macrophage secretion of inflammatory cytokines, which can be potentiated by the presence of LPS, likely by binding to dectin-1 and TLR-2/6 receptors, which activate NF-kappaB and prompt the secretion of cytokines.

Plant-derived antifungal agent poacic acid targets β-1,3-glucan

DOE PAGES

Piotrowski, Jeff S.; Okada, Hiroki; Lu, Fachuang; ...

2015-03-09

A rise in resistance to current antifungals necessitates strategies to identify alternative sources of effective fungicides. We report the discovery of poacic acid, a potent antifungal compound found in lignocellulosic hydrolysates of grasses. Chemical genomics using Saccharomyces cerevisiae showed that loss of cell wall synthesis and maintenance genes conferred increased sensitivity to poacic acid. Morphological analysis revealed that cells treated with poacic acid behaved similarly to cells treated with other cell wall-targeting drugs and mutants with deletions in genes involved in processes related to cell wall biogenesis. Poacic acid causes rapid cell lysis and is synergistic with caspofungin and fluconazole.more » The cellular target was identified; poacic acid localized to the cell wall and inhibited β-1,3-glucan synthesis in vivo and in vitro, apparently by directly binding β-1,3-glucan. Through its activity on the glucan layer, poacic acid inhibits growth of the fungi Sclerotinia sclerotiorum and Alternaria solani as well as the oomycete Phytophthora sojae. A single application of poacic acid to leaves infected with the broad-range fungal pathogen S. sclerotiorum substantially reduced lesion development. In conclusion, the discovery of poacic acid as a natural antifungal agent targeting β-1,3-glucan highlights the potential side use of products generated in the processing of renewable biomass toward biofuels as a source of valuable bioactive compounds and further clarifies the nature and mechanism of fermentation inhibitors found in lignocellulosic hydrolysates.« less

A Candida Biofilm-Induced Pathway for Matrix Glucan Delivery: Implications for Drug Resistance

PubMed Central

Taff, Heather T.; Nett, Jeniel E.; Zarnowski, Robert; Ross, Kelly M.; Sanchez, Hiram; Cain, Mike T.; Hamaker, Jessica; Mitchell, Aaron P.; Andes, David R.

2012-01-01

Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics. PMID:22876186

Accessibility and contribution to glucan masking of natural and genetically tagged versions of yeast wall protein 1 of Candida albicans

PubMed Central

2018-01-01

Yeast wall protein 1 (Ywp1) is an abundant glycoprotein of the cell wall of the yeast form of Candida albicans, the most prevalent fungal pathogen of humans. Antibodies that bind to the polypeptide backbone of isolated Ywp1 show little binding to intact yeast cells, presumably because the Ywp1 epitopes are masked by the polysaccharides of the mannoproteins that form the outer layer of the cell wall. Rare cells do exhibit much greater anti-Ywp1 binding, however, and one of these was isolated and characterized. No differences were seen in its Ywp1, but it exhibited greater adhesiveness, sensitivity to wall perturbing agents, and exposure of its underlying β-1,3-glucan layer to external antibodies. The molecular basis for this greater epitope accessibility has not been determined, but has facilitated exploration of how these properties change as a function of cell growth and morphology. In addition, previously engineered strains with reduced quantities of Ywp1 in their cell walls were also found to have greater β-1,3-glucan exposure, indicating that Ywp1 itself contributes to the masking of wall epitopes, which may be important for understanding the anti-adhesive effect of Ywp1. Ectopic production of Ywp1 by hyphae, which reduces the adhesivity of these filamentous forms of C. albicans, was similarly found to reduce exposure of the β-1,3-glucan in their walls. To monitor Ywp1 in the cell wall irrespective of its accessibility, green fluorescent protein (Gfp) was genetically inserted into wall-anchored Ywp1 using a bifunctional cassette that also allowed production from a single transfection of a soluble, anchor-free version. The wall-anchored Ywp1-Gfp-Ywp1 accumulated in the wall of the yeast forms but not hyphae, and appeared to have properties similar to native Ywp1, including its adhesion-inhibiting effect. Some pseudohyphal walls also detectably accumulated this probe. Strains of C. albicans with tandem hemagglutinin (HA) epitopes inserted into wall-anchored Ywp1 were previously created by others, and were further explored here. As above, rare cells with much greater accessibility of the HA epitopes were isolated, and also found to exhibit greater exposure of Ywp1 and β-1,3-glucan. The placement of the HA cassette inhibited the normal N-glycosylation and propeptide cleavage of Ywp1, but the wall-anchored Ywp1-HA-Ywp1 still accumulated in the cell wall of yeast forms. Bifunctional transformation cassettes were used to additionally tag these molecules with Gfp, generating soluble Ywp1-HA-Gfp and wall-anchored Ywp1-HA-Gfp-Ywp1 molecules. The former revealed unexpected electrophoretic properties caused by the HA insertion, while the latter further highlighted differences between the presence of a tagged Ywp1 molecule (as revealed by Gfp fluorescence) and its accessibility in the cell wall to externally applied antibodies specific for HA, Gfp and Ywp1, with accessibility being greatest in the rapidly expanding walls of budding daughter cells. These strains and results increase our understanding of cell wall properties and how C. albicans masks itself from recognition by the human immune system. PMID:29329339

Accessibility and contribution to glucan masking of natural and genetically tagged versions of yeast wall protein 1 of Candida albicans.

PubMed

Granger, Bruce L

2018-01-01

Yeast wall protein 1 (Ywp1) is an abundant glycoprotein of the cell wall of the yeast form of Candida albicans, the most prevalent fungal pathogen of humans. Antibodies that bind to the polypeptide backbone of isolated Ywp1 show little binding to intact yeast cells, presumably because the Ywp1 epitopes are masked by the polysaccharides of the mannoproteins that form the outer layer of the cell wall. Rare cells do exhibit much greater anti-Ywp1 binding, however, and one of these was isolated and characterized. No differences were seen in its Ywp1, but it exhibited greater adhesiveness, sensitivity to wall perturbing agents, and exposure of its underlying β-1,3-glucan layer to external antibodies. The molecular basis for this greater epitope accessibility has not been determined, but has facilitated exploration of how these properties change as a function of cell growth and morphology. In addition, previously engineered strains with reduced quantities of Ywp1 in their cell walls were also found to have greater β-1,3-glucan exposure, indicating that Ywp1 itself contributes to the masking of wall epitopes, which may be important for understanding the anti-adhesive effect of Ywp1. Ectopic production of Ywp1 by hyphae, which reduces the adhesivity of these filamentous forms of C. albicans, was similarly found to reduce exposure of the β-1,3-glucan in their walls. To monitor Ywp1 in the cell wall irrespective of its accessibility, green fluorescent protein (Gfp) was genetically inserted into wall-anchored Ywp1 using a bifunctional cassette that also allowed production from a single transfection of a soluble, anchor-free version. The wall-anchored Ywp1-Gfp-Ywp1 accumulated in the wall of the yeast forms but not hyphae, and appeared to have properties similar to native Ywp1, including its adhesion-inhibiting effect. Some pseudohyphal walls also detectably accumulated this probe. Strains of C. albicans with tandem hemagglutinin (HA) epitopes inserted into wall-anchored Ywp1 were previously created by others, and were further explored here. As above, rare cells with much greater accessibility of the HA epitopes were isolated, and also found to exhibit greater exposure of Ywp1 and β-1,3-glucan. The placement of the HA cassette inhibited the normal N-glycosylation and propeptide cleavage of Ywp1, but the wall-anchored Ywp1-HA-Ywp1 still accumulated in the cell wall of yeast forms. Bifunctional transformation cassettes were used to additionally tag these molecules with Gfp, generating soluble Ywp1-HA-Gfp and wall-anchored Ywp1-HA-Gfp-Ywp1 molecules. The former revealed unexpected electrophoretic properties caused by the HA insertion, while the latter further highlighted differences between the presence of a tagged Ywp1 molecule (as revealed by Gfp fluorescence) and its accessibility in the cell wall to externally applied antibodies specific for HA, Gfp and Ywp1, with accessibility being greatest in the rapidly expanding walls of budding daughter cells. These strains and results increase our understanding of cell wall properties and how C. albicans masks itself from recognition by the human immune system.

Psoriasin, a novel anti-Candida albicans adhesin.

PubMed

Brauner, Annelie; Alvendal, Cathrin; Chromek, Milan; Stopsack, Konrad H; Ehrström, Sophia; Schröder, Jens M; Bohm-Starke, Nina

2018-05-07

Candida albicans belongs to the normal microbial flora on epithelial surfaces of humans. However, under certain, still not fully understood conditions, it can become pathogenic and cause a spectrum of diseases, from local infections to life-threatening septicemia. We investigated a panel of antimicrobial proteins and peptides (AMPs), potentially involved in mucosal immunity against this pathogen. Out of six studied AMPs, psoriasin was most up-regulated during a mucosal infection, an acute episode of recurrent Candida vulvovaginitis, although candidacidal activity has not been demonstrated. We here show that psoriasin binds to β-glucan, a basic component of the C. albicans cell wall, and thereby inhibits adhesion of the pathogen to surfaces and increases IL-8 production by mucosal epithelial cells. In conclusion, we show a novel mechanism of action of psoriasin. By inhibiting C. albicans adhesion and by enhancing cytokine production, psoriasin contributes to the immune response against C. albicans. The antimicrobial peptide psoriasin is highly up-regulated during a local mucosal infection, Candida albicans vulvovaginitis. Psoriasin binds to β-glucan in the Candida albicans cell wall and thereby inhibits adhesion of the pathogen. Binding of psoriasin to Candida albicans induces an immune response by mucosal epithelial cells.

Interactions of grape tannins and wine polyphenols with a yeast protein extract, mannoproteins and β-glucan.

PubMed

Mekoue Nguela, J; Poncet-Legrand, C; Sieczkowski, N; Vernhet, A

2016-11-01

At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored by binding experiments, ITC and DLS. Depending on the tannin structure, a different affinity between the polyphenols and the YPE was observed, as well as differences in the stability of the aggregates. This was attributed to the mean degree of polymerization of tannins in the polyphenol fractions and to chemical changes that occur during winemaking. Much lower affinities were found between polyphenols and polysaccharides, with different behaviors between mannoproteins and β-glucans. Copyright © 2016 Elsevier Ltd. All rights reserved.

Characterization of the dextran-binding domain in the glucan-binding protein C of Streptococcus mutans.

PubMed

Takashima, Y; Fujita, K; Ardin, A C; Nagayama, K; Nomura, R; Nakano, K; Matsumoto-Nakano, M

2015-10-01

Streptococcus mutans produces multiple glucan-binding proteins (Gbps), among which GbpC encoded by the gbpC gene is known to be a cell-surface-associated protein involved in dextran-induced aggregation. The purpose of the present study was to characterize the dextran-binding domain of GbpC using bioinformatics analysis and molecular techniques. Bioinformatics analysis specified five possible regions containing molecular binding sites termed GB1 through GB5. Next, truncated recombinant GbpC (rGbpC) encoding each region was produced using a protein expression vector and five deletion mutant strains were generated, termed CDGB1 through CDGB5 respectively. The dextran-binding rates of truncated rGbpC that included the GB1, GB3, GB4 and GB5 regions in the upstream sequences were higher than that of the construct containing GB2 in the downstream region. In addition, the rates of dextran-binding for strains CDGB4 and CD1, which was entire gbpC deletion mutant, were significantly lower than for the other strains, while those of all other deletion mutants were quite similar to that of the parental strain MT8148. Biofilm structures formed by CDGB4 and CD1 were not as pronounced as that of MT8148, while those formed by other strains had greater density as compared to that of CD1. Our results suggest that the dextran-binding domain may be located in the GB4 region in the interior of the gbpC gene. Bioinformatics analysis is useful for determination of functional domains in many bacterial species. © 2015 The Society for Applied Microbiology.

Test performance of blood beta-glucan for Pneumocystis jirovecii pneumonia in patients with AIDS and respiratory symptoms.

PubMed

Wood, Brian R; Komarow, Lauren; Zolopa, Andrew R; Finkelman, Malcolm A; Powderly, William G; Sax, Paul E

2013-03-27

The objective of this study was to define the test characteristics of plasma beta-glucan for diagnosis of Pneumocystis jirovecii pneumonia (PCP) in AIDS patients with respiratory symptoms. Analysis of baseline blood samples in a randomized strategy study of patients with acute opportunistic infections, limited to participants with respiratory symptoms. Participants in the 282-person ACTG A5164 trial had baseline plasma samples assayed for beta-glucan testing. As part of A5164 trial, two study investigators independently adjudicated the diagnosis of PCP. Respiratory symptoms were identified by investigators from a list of all signs and symptoms with an onset or resolution in the 21 days prior to or 14 days following study entry. Beta-glucan was defined as positive if at least 80 pg/ml and negative if less than 80 pg/ml. Of 252 study participants with a beta-glucan result, 159 had at least one respiratory symptom, 139 of whom had a diagnosis of PCP. The sensitivity of beta-glucan for PCP in participants with respiratory symptoms was 92.8% [95% confidence interval (CI) 87.2-96.5], and specificity 75.0% (95% CI 50.9-91.3). Among 134 individuals with positive beta-glucan and respiratory symptoms, 129 had PCP, for a positive predictive value of 96.3% (95% CI 91.5-98.8). Fifteen of 25 patients with a normal beta-glucan did not have PCP, for a negative predictive value of 60% (95% CI 38.7-78.9). Elevated plasma beta-glucan has a high predictive value for diagnosis of PCP in AIDS patients with respiratory symptoms. We propose an algorithm for the use of beta-glucan as a diagnostic tool on the basis of the pretest probability of PCP in such patients.

Presence of a Large β(1-3)Glucan Linked to Chitin at the Saccharomyces cerevisiae Mother-Bud Neck Suggests Involvement in Localized Growth Control

PubMed Central

Blanco, Noelia; Arroyo, Javier

2012-01-01

Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan. PMID:22366124

Presence of a large β(1-3)glucan linked to chitin at the Saccharomyces cerevisiae mother-bud neck suggests involvement in localized growth control.

PubMed

Cabib, Enrico; Blanco, Noelia; Arroyo, Javier

2012-04-01

Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.

Infection Structure–Specific Expression of β-1,3-Glucan Synthase Is Essential for Pathogenicity of Colletotrichum graminicola and Evasion of β-Glucan–Triggered Immunity in Maize[W

PubMed Central

Oliveira-Garcia, Ely; Deising, Holger B.

2013-01-01

β-1,3-Glucan and chitin are the most prominent polysaccharides of the fungal cell wall. Covalently linked, these polymers form a scaffold that determines the form and properties of vegetative and pathogenic hyphae. While the role of chitin in plant infection is well understood, the role of β-1,3-glucan is unknown. We functionally characterized the β-1,3-glucan synthase gene GLS1 of the maize (Zea mays) pathogen Colletotrichum graminicola, employing RNA interference (RNAi), GLS1 overexpression, live-cell imaging, and aniline blue fluorochrome staining. This hemibiotroph sequentially differentiates a melanized appressorium on the cuticle and biotrophic and necrotrophic hyphae in its host. Massive β-1,3-glucan contents were detected in cell walls of appressoria and necrotrophic hyphae. Unexpectedly, GLS1 expression and β-1,3-glucan contents were drastically reduced during biotrophic development. In appressoria of RNAi strains, downregulation of β-1,3-glucan synthesis increased cell wall elasticity, and the appressoria exploded. While the shape of biotrophic hyphae was unaffected in RNAi strains, necrotrophic hyphae showed severe distortions. Constitutive expression of GLS1 led to exposure of β-1,3-glucan on biotrophic hyphae, massive induction of broad-spectrum defense responses, and significantly reduced disease symptom severity. Thus, while β-1,3-glucan synthesis is required for cell wall rigidity in appressoria and fast-growing necrotrophic hyphae, its rigorous downregulation during biotrophic development represents a strategy for evading β-glucan–triggered immunity. PMID:23898035

Molecular modeling and docking characterization of CzR1, a CC-NBS-LRR R-gene from Curcuma zedoaria Loeb. that confers resistance to Pythium aphanidermatum

PubMed Central

Joshi, Raj Kumar; Nanda, Satyabrata; Rout, Ellojita; Kar, Basudeba; Naik, Pradeep Kumar; Nayak, Sanghamitra

2013-01-01

Plant NBS-LRR R-genes recognizes several pathogen associated molecular patterns (PAMPs) and limit pathogen infection through a multifaceted defense response. CzR1, a coiled-coil-nucleotide-binding-site-leucine-rich repeat R-gene isolated from Curcuma zedoaria L exhibit constitutive resistance to different strains of P. aphanidermatum. Majority of the necrotrophic oomycetes are characterized by the presence of carbohydrate PAMPs β-glucans in their cell walls which intercat with R-genes. In the present study, we predicted the 3D (three dimensional) structure of CzR1 based on homology modeling using the homology module of Prime through the Maestro interface of Schrodinger package ver 2.5. The docking investigation of CzR1 with β-glucan using the Glide software suggests that six amino acid residues, Ser186, Glu187, Ser263, Asp264, Asp355 and Tyr425 act as catalytic residues and are involved in hydrogen bonding with ligand β-(1,3)-D-Glucan. The calculated distance between the carboxylic oxygen atoms of Glu187–Asp355 pair is well within the distance of 5Å suggesting a positive glucanase activity of CzR1. Elucidation of these molecular characteristics will help in in silico screening and understanding the structural basis of ligand binding to CzR1 protein and pave new ways towards a broad spectrum rhizome rot resistance development in the cultivated turmeric. PMID:23888096

Glucansucrases: three-dimensional structures, reactions, mechanism, α-glucan analysis and their implications in biotechnology and food applications.

PubMed

Leemhuis, Hans; Pijning, Tjaard; Dobruchowska, Justyna M; van Leeuwen, Sander S; Kralj, Slavko; Dijkstra, Bauke W; Dijkhuizen, Lubbert

2013-01-20

Glucansucrases are extracellular enzymes that synthesize a wide variety of α-glucan polymers and oligosaccharides, such as dextran. These carbohydrates have found numerous applications in food and health industries, and can be used as pure compounds or even be produced in situ by generally regarded as safe (GRAS) lactic acid bacteria in food applications. Research in the recent years has resulted in big steps forward in the understanding and exploitation of the biocatalytic potential of glucansucrases. This paper provides an overview of glucansucrase enzymes, their recently elucidated crystal structures, their reaction and product specificity, and the structural analysis and applications of α-glucan polymers. Furthermore, we discuss key developments in the understanding of α-glucan polymer formation based on the recently elucidated three-dimensional structures of glucansucrase proteins. Finally we discuss the (potential) applications of α-glucans produced by lactic acid bacteria in food and health related industries. Copyright © 2012 Elsevier B.V. All rights reserved.

β-Glucoside Activators of Mung Bean UDP-Glucose: β-Glucan Synthase 1

PubMed Central

Callaghan, Theresa; Ross, Peter; Weinberger-Ohana, Patricia; Benziman, Moshe

1988-01-01

n-Alkyl (C6-C12) β-d-monoglucopyranosides have been found to be highly potent activators of mung bean β-glucan synthase in vitro, increasing the Vmax of the enzyme as much as 60-fold and with Ka values as low as 10 micromolar. Activation is highly specific for the β-linked terminal glucose residue; other alkyl glycosides such as, octyl-α-glucoside, dodecyl β-maltoside, 6-lauryl sucrose, 6-lauryl glucose, which lack this structure, are ineffective as activators. Based on the similarities in their structure and effects on β-glucan synthesis under a variety of conditions, it is proposed that the alkyl β-glucosides are structural analogs of the native glucolipid activator of β-glucan synthase isolated from mung bean extracts. PMID:16666039

Optimizing Tumor Microenvironment for Cancer Immunotherapy: β-Glucan-Based Nanoparticles

PubMed Central

Zhang, Mei; Kim, Julian A.; Huang, Alex Yee-Chen

2018-01-01

Immunotherapy is revolutionizing cancer treatment. Recent clinical success with immune checkpoint inhibitors, chimeric antigen receptor T-cell therapy, and adoptive immune cellular therapies has generated excitement and new hopes for patients and investigators. However, clinically efficacious responses to cancer immunotherapy occur only in a minority of patients. One reason is the tumor microenvironment (TME), which potently inhibits the generation and delivery of optimal antitumor immune responses. As our understanding of TME continues to grow, strategies are being developed to change the TME toward one that augments the emergence of strong antitumor immunity. These strategies include eliminating tumor bulk to provoke the release of tumor antigens, using adjuvants to enhance antigen-presenting cell function, and employ agents that enhance immune cell effector activity. This article reviews the development of β-glucan and β-glucan-based nanoparticles as immune modulators of TME, as well as their potential benefit and future therapeutic applications. Cell-wall β-glucans from natural sources including plant, fungi, and bacteria are molecules that adopt pathogen-associated molecular pattern (PAMP) known to target specific receptors on immune cell subsets. Emerging data suggest that the TME can be actively manipulated by β-glucans and their related nanoparticles. In this review, we discuss the mechanisms of conditioning TME using β-glucan and β-glucan-based nanoparticles, and how this strategy enables future design of optimal combination cancer immunotherapies. PMID:29535722

Effect of Sasa veitchii extract on immunostimulating activity of β-glucan (SCG) from culinary-medicinal mushroom Sparassis crispa Wulf.:Fr. (higher Basidiomycetes).

PubMed

Yoshida, Mia; Hida, Toshie H; Takeshita, Kazuo; Tsuboi, Masamichi; Kanamori, Masato; Akachi, Natsuko; Miura, Noriko N; Adachi, Yoshiyuki; Ohno, Naohito

2012-01-01

Fungal β-glucan is a representative pathogen-associated microbial pattern (PAMP) from mushroom, yeast, and fungi, and stimulates innate as well as acquired immune systems. It is a widely used functional food to enhance immunity. Such plant extracts have been known as folk medicines and reported to show various biological activities beneficial to human health, such as anti-tumor, anti-allergic, and anti-inflammatory activities. In the present study, the cooperative effect of bamboo water-soluble methanol precipitation (BWMP), a macromolecular fraction of the hot-water extract of Sasa veitchii (Japanese folk medicine Kumazasa), and the β-glucan from the medicinal mushroom Sparassis crispa (SCG) was analyzed in vitro using DBA/2 mice. The splenocytes from male DBA/2 mice were cultured with BWMP in the presence of SCG, and the responses were assessed by measuring cytokines. BWMP suppressed IFN-γ and GM-CSF production by SCG, but not TNF-α production. To analyze the specificity of the reaction, similar experiments were conducted with BWMP in the presence of bacterial lipopolysaccharide (LPS); however, none of the cytokines were inhibited. Cytokine production of splenocytes by SCG was suggested to be largely dependent on the binding of lymphocytes with dendritic cells. Functions of BWMP were also analyzed by mixed lymphocyte reaction, and IFN-γ production was suppressed. These findings suggested that BWMP modulated the cell-to-cell contact induced by SCG and inhibited cytokine production. It is strongly suggested that the plant extracts modulate the immunostimulating effects of medicinal mushrooms. Cooperative effects of plants and mushrooms would be an important issue for functional foods.

Beta-1,3-1,6-glucan modulate the non-specific immune response to enhance the survival in the Vibrio alginolyticus infection of Taiwan abalone (Haliotis diversicolor supertexta).

PubMed

Wu, Yu-Sheng; Tseng, Tzu-Yu; Nan, Fan-Hua

2016-07-01

This research aims to investigate the non-specific immune response of Taiwan abalone (Haliotis diversicolor supertexta) which was treated with the beta-1,3-1,6-glucan to be observed in the survival impact after the Vibrio alginolyticus infection. The non-specific immune and physiological response of superoxide anion radical (O2(-)), phenoloxidase (PO), phagocytic index (PI), phagocytic rate (PR) and lucigenin-chemiluminescence for reactive oxygen intermediates (ROIs) were enhanced via in-vitro experiment. In the in-vivo experiment, the observed data presented that the haemolymph lysate supernatant (HLS), superoxide dismutase (SOD), glutamate oxalacetate transaminase (GOT) and glutamate pyruvate transaminase (GPT) were not significant enhanced, but the total haemocyte count (THC), O2(-), PO, phagocytic index (PI), phagocytic ratio (PR) and other parameters of immune were significantly promoted after treated with beta-1,3-1,6-glucan. In the challenge experiment, the survival rates of abalone in the 40 and 80 μl/ml groups of beta-1,3-1,6-glucan were observed from 6.67% up to 33.33% and 36.67% after injection with Vibrio alginolyticus, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effect of oat's soluble fibre (β-glucan) as a fat replacer on physical, chemical, microbiological and sensory properties of low-fat beef patties.

PubMed

Piñero, M P; Parra, K; Huerta-Leidenz, N; Arenas de Moreno, L; Ferrer, M; Araujo, S; Barboza, Y

2008-11-01

This study evaluated the effect of adding oat fibre source of β-glucan (13.45%) on physical, chemical, microbiological and sensory traits of low-fat (<10%) beef patties as compared to 20% fat control patties. Significant (p<0.05) improvements in cooking yield (74.19%), and retentions of fat (79.74%) and moisture (48.41%) of low-fat patties were attributed to the water binding ability of β-glucan. Because of larger water retentions moisture contents of raw and cooked low-fat patties were higher (p<0.05) than those of the control patties. Cholesterol content was similar across formulations. Low-fat and control beef patties remained stable in microbiological quality during 60days frozen storage. Low-fat patties were found to be of lower degree of likeness in the taste but juicer than control (p<0.05). Besides appearance, tenderness and colour were not affected by the addition of oat's soluble fibre. Oat fibre can be used successfully as a fat substitute in low-fat beef patties.

Chitinase-like1/pom-pom1 and its homolog CTL2 are glucan-interacting proteins important for cellulose biosynthesis in Arabidopsis.

PubMed

Sánchez-Rodríguez, Clara; Bauer, Stefan; Hématy, Kian; Saxe, Friederike; Ibáñez, Ana Belén; Vodermaier, Vera; Konlechner, Cornelia; Sampathkumar, Arun; Rüggeberg, Markus; Aichinger, Ernst; Neumetzler, Lutz; Burgert, Ingo; Somerville, Chris; Hauser, Marie-Theres; Persson, Staffan

2012-02-01

Plant cells are encased by a cellulose-containing wall that is essential for plant morphogenesis. Cellulose consists of β-1,4-linked glucan chains assembled into paracrystalline microfibrils that are synthesized by plasma membrane-located cellulose synthase (CESA) complexes. Associations with hemicelluloses are important for microfibril spacing and for maintaining cell wall tensile strength. Several components associated with cellulose synthesis have been identified; however, the biological functions for many of them remain elusive. We show that the chitinase-like (CTL) proteins, CTL1/POM1 and CTL2, are functionally equivalent, affect cellulose biosynthesis, and are likely to play a key role in establishing interactions between cellulose microfibrils and hemicelluloses. CTL1/POM1 coincided with CESAs in the endomembrane system and was secreted to the apoplast. The movement of CESAs was compromised in ctl1/pom1 mutant seedlings, and the cellulose content and xyloglucan structures were altered. X-ray analysis revealed reduced crystalline cellulose content in ctl1 ctl2 double mutants, suggesting that the CTLs cooperatively affect assembly of the glucan chains, which may affect interactions between hemicelluloses and cellulose. Consistent with this hypothesis, both CTLs bound glucan-based polymers in vitro. We propose that the apoplastic CTLs regulate cellulose assembly and interaction with hemicelluloses via binding to emerging cellulose microfibrils.

CHITINASE-LIKE1/POM-POM1 and Its Homolog CTL2 Are Glucan-Interacting Proteins Important for Cellulose Biosynthesis in Arabidopsis[W][OA

PubMed Central

Sánchez-Rodríguez, Clara; Bauer, Stefan; Hématy, Kian; Saxe, Friederike; Ibáñez, Ana Belén; Vodermaier, Vera; Konlechner, Cornelia; Sampathkumar, Arun; Rüggeberg, Markus; Aichinger, Ernst; Neumetzler, Lutz; Burgert, Ingo; Somerville, Chris; Hauser, Marie-Theres; Persson, Staffan

2012-01-01

Plant cells are encased by a cellulose-containing wall that is essential for plant morphogenesis. Cellulose consists of β-1,4-linked glucan chains assembled into paracrystalline microfibrils that are synthesized by plasma membrane–located cellulose synthase (CESA) complexes. Associations with hemicelluloses are important for microfibril spacing and for maintaining cell wall tensile strength. Several components associated with cellulose synthesis have been identified; however, the biological functions for many of them remain elusive. We show that the chitinase-like (CTL) proteins, CTL1/POM1 and CTL2, are functionally equivalent, affect cellulose biosynthesis, and are likely to play a key role in establishing interactions between cellulose microfibrils and hemicelluloses. CTL1/POM1 coincided with CESAs in the endomembrane system and was secreted to the apoplast. The movement of CESAs was compromised in ctl1/pom1 mutant seedlings, and the cellulose content and xyloglucan structures were altered. X-ray analysis revealed reduced crystalline cellulose content in ctl1 ctl2 double mutants, suggesting that the CTLs cooperatively affect assembly of the glucan chains, which may affect interactions between hemicelluloses and cellulose. Consistent with this hypothesis, both CTLs bound glucan-based polymers in vitro. We propose that the apoplastic CTLs regulate cellulose assembly and interaction with hemicelluloses via binding to emerging cellulose microfibrils. PMID:22327741

Measuring (1,3)-β-D-glucan in tracheal aspirate, bronchoalveolar lavage fluid, and serum for detection of suspected Candida pneumonia in immunocompromised and critically ill patients: a prospective observational study.

PubMed

Su, Kang-Cheng; Chou, Kun-Ta; Hsiao, Yi-Han; Tseng, Ching-Min; Su, Vincent Yi-Fong; Lee, Yu-Chin; Perng, Diahn-Warng; Kou, Yu Ru

2017-04-08

While Candida pneumonia is life-threatening, biomarker measurements to early detect suspected Candida pneumonia are lacking. This study compared the diagnostic values of measuring levels of (1, 3)-β-D-glucan in endotracheal aspirate, bronchoalveolar lavage fluid, and serum to detect suspected Candida pneumonia in immunocompromised and critically ill patients. This prospective, observational study enrolled immunocompromised, critically ill, and ventilated patients with suspected fungal pneumonia in mixed intensive care units from November 2010 to October 2011. Patients with D-glucan confounding factors or other fungal infection were excluded. Endotracheal aspirate, bronchoalveolar lavage fluid and serum were collected from each patient to perform a fungal smear, culture, and D-glucan assay. After screening 166 patients, 31 patients completed the study and were categorized into non-Candida pneumonia/non-candidemia (n = 18), suspected Candida pneumonia (n = 9), and non-Candida pneumonia/candidemia groups (n = 4). D-glucan levels in endotracheal aspirate or bronchoalveolar lavage were highest in suspected Candida pneumonia, while the serum D-glucan level was highest in non-Candida pneumonia/candidemia. In all patients, the D-glucan value in endotracheal aspirate was positively correlated with that in bronchoalveolar lavage fluid. For the detection of suspected Candida pneumonia, the predictive performance (sensitivity/specificity/D-glucan cutoff [pg/ml]) of D-glucan in endotracheal aspirate and bronchoalveolar lavage fluid was 67%/82%/120 and 89%/86%/130, respectively, accounting for areas under the receiver operating characteristic curve of 0.833 and 0.939 (both P < 0.05), respectively. Measuring serum D-glucan was of no diagnostic value (area under curve =0.510, P = 0.931) for the detection of suspected Candida pneumonia in the absence of concurrent candidemia. D-glucan levels in both endotracheal aspirate and bronchoalveolar lavage, but not in serum, provide good diagnostic values to detect suspected Candida pneumonia and to serve as potential biomarkers for early detection in this patient population.

Distinct Patterns of Dendritic Cell Cytokine Release Stimulated by Fungal β-Glucans and Toll-Like Receptor Agonists▿

PubMed Central

Huang, Haibin; Ostroff, Gary R.; Lee, Chrono K.; Wang, Jennifer P.; Specht, Charles A.; Levitz, Stuart M.

2009-01-01

β-Glucans derived from fungal cell walls have potential uses as immunomodulating agents and vaccine adjuvants. Yeast glucan particles (YGPs) are highly purified Saccharomyces cerevisiae cell walls composed of β1,6-branched β1,3-d-glucan and free of mannans. YGPs stimulated secretion of the proinflammatory cytokine tumor necrosis factor alpha (TNF-α) in wild-type murine bone marrow-derived myeloid dendritic cells (BMDCs) but did not stimulate interleukin-12p70 (IL-12p70) production. A purified soluble β1,6-branched β1,3-d-glucan, scleroglucan, also stimulated TNF-α in BMDCs. These two β-glucans failed to stimulate TNF-α in Dectin-1 (β-glucan receptor) knockout BMDCs. Costimulation of wild-type BMDCs with β-glucans and specific Toll-like receptor (TLR) ligands resulted in greatly enhanced TNF-α production but decreased IL-12p70 production compared with TLR agonists alone. The upregulation of TNF-α and downregulation of IL-12p70 required Dectin-1, but not IL-10. Gamma interferon (IFN-γ) priming did not overcome IL-12p70 reduction by β-glucans. Similar patterns of cytokine regulation were observed in human monocyte-derived dendritic cells (DCs) costimulated with YGPs and the TLR4 ligand lipopolysaccharide. Finally, costimulation of BMDCs with YGPs and either the TLR9 ligand, CpG, or the TLR2/1 ligand, Pam3CSK4, resulted in upregulated secretion of IL-1α and IL-10 and downregulated secretion of IL-1β, IL-6, and IFN-γ-inducible protein 10 but had no significant effects on IL-12p40, keratinocyte-derived chemokine, monocyte chemotactic protein 1, or macrophage inflammatory protein α, compared with the TLR ligand alone. Thus, β-glucans have distinct effects on cytokine responses following DC stimulation with different TLR agonists. These patterns of response might contribute to the skewing of immune responses during mycotic infections and have implications for the design of immunomodulators and vaccines containing β-glucans. PMID:19273561

Use of (1-3)-β-D-glucan Concentrations in Dust as a Surrogate Method for Estimating Specific Mold Exposures

EPA Science Inventory

Indoor exposure to fungi has been associated with respiratory symptoms, often attributed to their major cell wall component, (1-3)-β-D-glucan (DG). This and the ease and low cost of performing DG analysis rather than cultivation or microscopic counting of mold spores, has prompte...

Comparison of (1->3)-β-D-glucan, mannan/anti-mannan antibodies, and Cand-Tec Candida antigen as serum biomarkers for candidemia.

PubMed

Held, Jürgen; Kohlberger, Isabelle; Rappold, Elfriede; Busse Grawitz, Andrea; Häcker, Georg

2013-04-01

We conducted a case-control study using the Fungitell assay, the novel Platelia Candida Antigen (Ag) Plus and Candida Antibody (Ab) Plus assays, and the Cand-Tec latex agglutination test to evaluate the usefulness of (1→3)-β-D-glucan (BDG), mannan antigen with/without anti-mannan antibody, and Cand-Tec Candida antigen measurement for the diagnosis of candidemia. A total of 56 patients fulfilled the inclusion criteria and were enrolled. One hundred patients with bacteremia and 100 patients with sterile blood cultures served as negative controls. In the candidemia group, median (1→3)-β-D-glucan, mannan antigen, and anti-mannan antibody levels were 427 pg/ml, 190 pg/ml, and 18.6 antibody units (AU)/ml, respectively. All three parameters were significantly elevated in patients with candidemia. The sensitivity and specificity were, respectively, 87.5% and 85.5% for (1→3)-β-D-glucan, 58.9% and 97.5% for mannan antigen, 62.5% and 65.0% for anti-mannan antibody, 89.3% and 63.0% for mannan antigen plus anti-mannan antibody, 89.3% and 85.0% for BDG plus mannan antigen, and 13.0% and 93.9% for Cand-Tec Candida antigen. The low mannan antigen sensitivity was in part caused by Candida parapsilosis and Candida guilliermondii fungemias, which were not detected by the Platelia Candida Ag Plus assay. When the cutoff was lowered from 125 pg/ml to 50 pg/ml, mannan antigen sensitivity increased to 69.6% without severely affecting the specificity (93.5%). Contrary to recently published data, superficial candidiasis was not associated with elevated mannan antigen levels, not even after the cutoff was lowered. Combining procalcitonin (PCT) with (1→3)-β-D-glucan to increase specificity provided a limited advantage because the benefit of the combination did not outweigh the loss of sensitivity. Our results demonstrate that the Cand-Tec Candida antigen and the mannan antigen plus anti-mannan antibody measurements have unacceptably low sensitivity or specificity. Of the four tests compared, (1→3)-β-D-glucan and mannan antigen are the superior biomarkers, depending on whether a sensitivity-driven or specificity-driven approach is used.

Comparison of (1→3)-β-d-Glucan, Mannan/Anti-Mannan Antibodies, and Cand-Tec Candida Antigen as Serum Biomarkers for Candidemia

PubMed Central

Kohlberger, Isabelle; Rappold, Elfriede; Busse Grawitz, Andrea; Häcker, Georg

2013-01-01

We conducted a case-control study using the Fungitell assay, the novel Platelia Candida Antigen (Ag) Plus and Candida Antibody (Ab) Plus assays, and the Cand-Tec latex agglutination test to evaluate the usefulness of (1→3)-β-d-glucan (BDG), mannan antigen with/without anti-mannan antibody, and Cand-Tec Candida antigen measurement for the diagnosis of candidemia. A total of 56 patients fulfilled the inclusion criteria and were enrolled. One hundred patients with bacteremia and 100 patients with sterile blood cultures served as negative controls. In the candidemia group, median (1→3)-β-d-glucan, mannan antigen, and anti-mannan antibody levels were 427 pg/ml, 190 pg/ml, and 18.6 antibody units (AU)/ml, respectively. All three parameters were significantly elevated in patients with candidemia. The sensitivity and specificity were, respectively, 87.5% and 85.5% for (1→3)-β-d-glucan, 58.9% and 97.5% for mannan antigen, 62.5% and 65.0% for anti-mannan antibody, 89.3% and 63.0% for mannan antigen plus anti-mannan antibody, 89.3% and 85.0% for BDG plus mannan antigen, and 13.0% and 93.9% for Cand-Tec Candida antigen. The low mannan antigen sensitivity was in part caused by Candida parapsilosis and Candida guilliermondii fungemias, which were not detected by the Platelia Candida Ag Plus assay. When the cutoff was lowered from 125 pg/ml to 50 pg/ml, mannan antigen sensitivity increased to 69.6% without severely affecting the specificity (93.5%). Contrary to recently published data, superficial candidiasis was not associated with elevated mannan antigen levels, not even after the cutoff was lowered. Combining procalcitonin (PCT) with (1→3)-β-d-glucan to increase specificity provided a limited advantage because the benefit of the combination did not outweigh the loss of sensitivity. Our results demonstrate that the Cand-Tec Candida antigen and the mannan antigen plus anti-mannan antibody measurements have unacceptably low sensitivity or specificity. Of the four tests compared, (1→3)-β-d-glucan and mannan antigen are the superior biomarkers, depending on whether a sensitivity-driven or specificity-driven approach is used. PMID:23363830

Identification and analysis of OsttaDSP, a phosphoglucan phosphatase from Ostreococcus tauri

PubMed Central

Carrillo, Julieta B.; Gomez-Casati, Diego F.; Martín, Mariana

2018-01-01

Ostreococcus tauri, the smallest free-living (non-symbiotic) eukaryote yet described, is a unicellular green alga of the Prasinophyceae family. It has a very simple cellular organization and presents a unique starch granule and chloroplast. However, its starch metabolism exhibits a complexity comparable to higher plants, with multiple enzyme forms for each metabolic reaction. Glucan phosphatases, a family of enzymes functionally conserved in animals and plants, are essential for normal starch or glycogen degradation in plants and mammals, respectively. Despite the importance of O. tauri microalgae in evolution, there is no information available concerning the enzymes involved in reversible phosphorylation of starch. Here, we report the molecular cloning and heterologous expression of the gene coding for a dual specific phosphatase from O. tauri (OsttaDSP), homologous to Arabidopsis thaliana LSF2. The recombinant enzyme was purified to electrophoretic homogeneity to characterize its oligomeric and kinetic properties accurately. OsttaDSP is a homodimer of 54.5 kDa that binds and dephosphorylates amylopectin. Also, we also determined that residue C162 is involved in catalysis and possibly also in structural stability of the enzyme. Our results could contribute to better understand the role of glucan phosphatases in the metabolism of starch in green algae. PMID:29360855

CovR Regulates Streptococcus mutans Susceptibility To Complement Immunity and Survival in Blood

PubMed Central

Alves, Lívia A.; Nomura, Ryota; Mariano, Flávia S.; Harth-Chu, Erika N.; Stipp, Rafael N.; Nakano, Kazuhiko

2016-01-01

Streptococcus mutans, a major pathogen of dental caries, may promote systemic infections after accessing the bloodstream from oral niches. In this study, we investigate pathways of complement immunity against S. mutans and show that the orphan regulator CovR (CovRSm) modulates susceptibility to complement opsonization and survival in blood. S. mutans blood isolates showed reduced susceptibility to C3b deposition compared to oral isolates. Reduced expression of covRSm in blood strains was associated with increased transcription of CovRSm-repressed genes required for S. mutans interactions with glucans (gbpC, gbpB, and epsC), sucrose-derived exopolysaccharides (EPS). Consistently, blood strains showed an increased capacity to bind glucan in vitro. Deletion of covRSm in strain UA159 (UAcov) impaired C3b deposition and binding to serum IgG and C-reactive protein (CRP) as well as phagocytosis through C3b/iC3b receptors and killing by neutrophils. Opposite effects were observed in mutants of gbpC, epsC, or gtfBCD (required for glucan synthesis). C3b deposition on UA159 was abolished in C1q-depleted serum, implying that the classical pathway is essential for complement activation on S. mutans. Growth in sucrose-containing medium impaired the binding of C3b and IgG to UA159, UAcov, and blood isolates but had absent or reduced effects on C3b deposition in gtfBCD, gbpC, and epsC mutants. UAcov further showed increased ex vivo survival in human blood in an EPS-dependent way. Consistently, reduced survival was observed for the gbpC and epsC mutants. Finally, UAcov showed an increased ability to cause bacteremia in a rat model. These results reveal that CovRSm modulates systemic virulence by regulating functions affecting S. mutans susceptibility to complement opsonization. PMID:27572331

The Lipopolysaccharide and β-1,3-Glucan Binding Protein Gene Is Upregulated in White Spot Virus-Infected Shrimp (Penaeus stylirostris)

PubMed Central

Roux, Michelle M.; Pain, Arnab; Klimpel, Kurt R.; Dhar, Arun K.

2002-01-01

Pattern recognition proteins such as lipopolysaccharide and β-1,3-glucan binding protein (LGBP) play an important role in the innate immune response of crustaceans and insects. Random sequencing of cDNA clones from a hepatopancreas cDNA library of white spot virus (WSV)-infected shrimp provided a partial cDNA (PsEST-289) that showed similarity to the LGBP gene of crayfish and insects. Subsequently full-length cDNA was cloned by the 5′-RACE (rapid amplification of cDNA ends) technique and sequenced. The shrimp LGBP gene is 1,352 bases in length and is capable of encoding a polypeptide of 376 amino acids that showed significant similarity to homologous genes from crayfish, insects, earthworms, and sea urchins. Analysis of the shrimp LGBP deduced amino acid sequence identified conserved features of this gene family including a potential recognition motif for β-(1→3) linkage of polysaccharides and putative RGD cell adhesion sites. It is known that LGBP gene expression is upregulated in bacterial and fungal infection and that the binding of lipopolysaccharide and β-1,3-glucan to LGBP activates the prophenoloxidase (proPO) cascade. The temporal expression of LGBP and proPO genes in healthy and WSV-challenged Penaeus stylirostris shrimp was measured by real-time quantitative reverse transcription-PCR, and we showed that LGBP gene expression in shrimp was upregulated as the WSV infection progressed. Interestingly, the proPO expression was upregulated initially after infection followed by a downregulation as the viral infection progressed. The downward trend in the expression of proPO coincided with the detection of WSV in the infected shrimp. Our data suggest that shrimp LGBP is an inducible acute-phase protein that may play a critical role in shrimp-WSV interaction and that the WSV infection regulates the activation and/or activity of the proPO cascade in a novel way. PMID:12072514

An initial event in the insect innate immune response: structural and biological studies of interactions between β-1,3-glucan and the N-terminal domain of β-1,3-glucan recognition protein.

PubMed

Dai, Huaien; Hiromasa, Yasuaki; Takahashi, Daisuke; VanderVelde, David; Fabrick, Jeffrey A; Kanost, Michael R; Krishnamoorthi, Ramaswamy

2013-01-08

In response to invading microorganisms, insect β-1,3-glucan recognition protein (βGRP), a soluble receptor in the hemolymph, binds to the surfaces of bacteria and fungi and activates serine protease cascades that promote destruction of pathogens by means of melanization or expression of antimicrobial peptides. Here we report on the nuclear magnetic resonance (NMR) solution structure of the N-terminal domain of βGRP (N-βGRP) from Indian meal moth (Plodia interpunctella), which is sufficient to activate the prophenoloxidase (proPO) pathway resulting in melanin formation. NMR and isothermal calorimetric titrations of N-βGRP with laminarihexaose, a glucose hexamer containing β-1,3 links, suggest a weak binding of the ligand. However, addition of laminarin, a glucose polysaccharide (~6 kDa) containing β-1,3 and β-1,6 links that activates the proPO pathway, to N-βGRP results in the loss of NMR cross-peaks from the backbone (15)N-(1)H groups of the protein, suggesting the formation of a large complex. Analytical ultracentrifugation (AUC) studies of formation of the N-βGRP-laminarin complex show that ligand binding induces self-association of the protein-carbohydrate complex into a macro structure, likely containing six protein and three laminarin molecules (~102 kDa). The macro complex is quite stable, as it does not undergo dissociation upon dilution to submicromolar concentrations. The structural model thus derived from this study for the N-βGRP-laminarin complex in solution differs from the one in which a single N-βGRP molecule has been proposed to bind to a triple-helical form of laminarin on the basis of an X-ray crystallographic structure of the N-βGRP-laminarihexaose complex [Kanagawa, M., Satoh, T., Ikeda, A., Adachi, Y., Ohno, N., and Yamaguchi, Y. (2011) J. Biol. Chem. 286, 29158-29165]. AUC studies and phenoloxidase activation measurements conducted with the designed mutants of N-βGRP indicate that electrostatic interactions involving Asp45, Arg54, and Asp68 between the ligand-bound protein molecules contribute in part to the stability of the N-βGRP-laminarin macro complex and that a decreased stability is accompanied by a reduced level of activation of the proPO pathway. An increased level of β-1,6 branching in laminarin also results in destabilization of the macro complex. These novel findings suggest that ligand-induced self-association of the βGRP-β-1,3-glucan complex may form a platform on a microbial surface for recruitment of downstream proteases, as a means of amplification of the initial signal of pathogen recognition for the activation of the proPO pathway.

The functional characterization and comparison of two single CRD containing C-type lectins with novel and typical key motifs from Portunus trituberculatus.

PubMed

Huang, Mengmeng; Mu, Changkao; Wu, Yuehong; Ye, Fei; Wang, Dan; Sun, Cong; Lv, Zhengbing; Han, Bingnan; Wang, Chunlin; Xu, Xue-Wei

2017-11-01

C-type lectins are a superfamily of Ca 2+ -dependent carbohydrate-recognition proteins, which play crucial roles in innate immunity including nonself-recognition and pathogen elimination. In the present study, two single-CRD containing C-type lectins were identified from swimming crab Portunus trituberculatus (designated as PtCTL-2 and PtCTL-3). The open reading frame (ORF) of PtCTL-2 encoded polypeptides of 485 amino acids with a signal peptide and a single carbohydrate-recognition domain (CRD), while PtCTL-3's ORF encoded polypeptides of 241 amino acids with a coiled-coil region and a single-CRD. The key motifs determining carbohydrate binding specificity in PtCTL-2 and PtCTL-3 were EPR (Glu-Pro-Arg) and QPD (Gln-Pro-Asp). EPR is a motif being identified for the first time, whereas QPD is a typical motif in C-type lectins. Different PAMPs binding features of the two recombinant proteins - PtCTL-2 (rPtCTL-2) and PtCTL-3 (rPtCTL-3) have been observed in our experiments. rPtCTL-2 could bind three pathogen-associated molecular patterns (PAMPs) with relatively high affinity, including glucan, lipopolysaccharide (LPS) and peptidoglycan (PGN), while rPtCTL-3 could barely bind any of them. However, rPtCTL-2 could bind seven kinds of microbes and rPtCTL-3 could bind six kinds in microbe binding assay. Moreover, rPtCTL-2 and rPtCTL-3 exhibited similar agglutination activity against Gram-positive bacteria, Gram-negative bacteria and fungi in agglutination assay. All these results illustrated that PtCTL-2 and PtCTL-3 could function as important pattern-recognition receptors (PRR) with broad nonself-recognition spectrum involved in immune defense against invaders. In addition, the results of carbohydrate binding specificity showed that PtCTL-2 with novel key motif had broad carbohydrate binding specificity, while PtCTL-3 with typical key motif possessed different carbohydrate binding specificity from the classical binding rule. Furthermore, PtCTL-2 and PtCTL-3 could also function as opsonin to enhance encapsulation of hemocytes against Ni-NTA beads. Copyright © 2017 Elsevier Ltd. All rights reserved.

The mechanism of synthesis of a mixed-linkage (1-->3), (1-->4)beta-D-glucan in maize. Evidence for multiple sites of glucosyl transfer in the synthase complex

PubMed

Buckeridge; Vergara; Carpita

1999-08-01

We examined the mechanism of synthesis in vitro of (1-->3), (1-->4)beta-D-glucan (beta-glucan), a growth-specific cell wall polysaccharide found in grasses and cereals. beta-Glucan is composed primarily of cellotriosyl and cellotetraosyl units linked by single (1-->3)beta-linkages. The ratio of cellotriosyl and cellotetraosyl units in the native polymer is strictly controlled at between 2 and 3 in all grasses, whereas the ratios of these units in beta-glucan formed in vitro vary from 1.5 with 5 &mgr;M UDP-glucose (Glc) to over 11 with 30 mM substrate. These results support a model in which three sites of glycosyl transfer occur within the synthase complex to produce the cellobiosyl-(1-->3)-D-glucosyl units. We propose that failure to fill one of the sites results in the iterative addition of one or more cellobiosyl units to produce the longer cellodextrin units in the polymer. Variations in the UDP-Glc concentration in excised maize (Zea mays) coleoptiles did not result in wide variations in the ratios of cellotriosyl and cellotetraosyl units in beta-glucan synthesized in vivo, indicating that other factors control delivery of UDP-Glc to the synthase. In maize sucrose synthase is enriched in Golgi membranes and plasma membranes and may be involved in the control of substrate delivery to beta-glucan synthase and cellulose synthase.

Specifically targeted delivery of protein to phagocytic macrophages

PubMed Central

Yu, Min; Chen, Zeming; Guo, Wenjun; Wang, Jin; Feng, Yupeng; Kong, Xiuqi; Hong, Zhangyong

2015-01-01

Macrophages play important roles in the pathogenesis of various diseases, and are important potential therapeutic targets. Furthermore, macrophages are key antigen-presenting cells and important in vaccine design. In this study, we report on the novel formulation (bovine serum albumin [BSA]-loaded glucan particles [GMP-BSA]) based on β-glucan particles from cell walls of baker’s yeast for the targeted delivery of protein to macrophages. Using this formulation, chitosan, tripolyphosphate, and alginate were used to fabricate colloidal particles with the model protein BSA via electrostatic interactions, which were caged and incorporated BSA very tightly within the β-glucan particle shells. The prepared GMP-BSA exhibited good protein-release behavior and avoided protein leakage. The particles were also highly specific to phagocytic macrophages, such as Raw 264.7 cells, primary bone marrow-derived macrophages, and peritoneal exudate macrophages, whereas the particles were not taken up by nonphagocytic cells, including NIH3T3, AD293, HeLa, and Caco-2. We hypothesize that these tightly encapsulated protein-loaded glucan particles deliver various types of proteins to macrophages with notably high selectivity, and may have broad applications in targeted drug delivery or vaccine design against macrophages. PMID:25784802

Purification and characterization of a novel alkaline β-1,3-1,4-glucanase (lichenase) from thermophilic fungus Malbranchea cinnamomea.

PubMed

Yang, Shaoqing; Xiong, Hao; Yan, Qiaojuan; Yang, Hongye; Jiang, Zhengqiang

2014-10-01

A novel alkaline β-1,3-1,4-glucanase (McLic1) from a thermophilic fungus, Malbranchea cinnamomea, was purified and biochemically characterized. McLic1 was purified to homogeneity with a purification fold of 3.1 and a recovery yield of 3.7 %. The purified enzyme was most active at pH 10.0 and 55 °C, and exhibited a wide range of pH stability (pH 4.0-10.0). McLic1 displayed strict substrate specificity for barley β-glucan, oat β-glucan and lichenan, but did not show activity towards other tested polysaccharides and synthetic p-nitrophenyl derivates, suggesting that it is a specific β-1,3-1,4-glucanase. The K m values for barley β-glucan, oat β-glucan and lichenan were determined to be 0.69, 1.11 and 0.63 mg mL(-1), respectively. Moreover, the enzyme was stable in various non ionic surfactants, oxidizing agents and several commercial detergents. Thus, the alkaline β-1,3-1,4-glucanase may have potential in industrial applications, such as detergent, paper and pulp industries.

Down-regulation of the CSLF6 gene results in decreased (1,3;1,4)-beta-D-glucan in endosperm of wheat.

PubMed

Nemeth, Csilla; Freeman, Jackie; Jones, Huw D; Sparks, Caroline; Pellny, Till K; Wilkinson, Mark D; Dunwell, Jim; Andersson, Annica A M; Aman, Per; Guillon, Fabienne; Saulnier, Luc; Mitchell, Rowan A C; Shewry, Peter R

2010-03-01

(1,3;1,4)-beta-d-Glucan (beta-glucan) accounts for 20% of the total cell walls in the starchy endosperm of wheat (Triticum aestivum) and is an important source of dietary fiber for human nutrition with potential health benefits. Bioinformatic and array analyses of gene expression profiles in developing caryopses identified the CELLULOSE SYNTHASE-LIKE F6 (CSLF6) gene as encoding a putative beta-glucan synthase. RNA interference constructs were therefore designed to down-regulate CSLF6 gene expression and expressed in transgenic wheat under the control of a starchy endosperm-specific HMW subunit gene promoter. Analysis of wholemeal flours using an enzyme-based kit and by high-performance anion-exchange chromatography after digestion with lichenase showed decreases in total beta-glucan of between 30% and 52% and between 36% and 53%, respectively, in five transgenic lines compared to three control lines. The content of water-extractable beta-glucan was also reduced by about 50% in the transgenic lines, and the M(r) distribution of the fraction was decreased from an average of 79 to 85 x 10(4) g/mol in the controls and 36 to 57 x 10(4) g/mol in the transgenics. Immunolocalization of beta-glucan in semithin sections of mature and developing grains confirmed that the impact of the transgene was confined to the starchy endosperm with little or no effect on the aleurone or outer layers of the grain. The results confirm that the CSLF6 gene of wheat encodes a beta-glucan synthase and indicate that transgenic manipulation can be used to enhance the health benefits of wheat products.

Immunostimulatory properties and antitumor activities of glucans

PubMed Central

VANNUCCI, LUCA; KRIZAN, JIRI; SIMA, PETR; STAKHEEV, DMITRY; CAJA, FABIAN; RAJSIGLOVA, LENKA; HORAK, VRATISLAV; SAIEH, MUSTAFA

2013-01-01

New foods and natural biological modulators have recently become of scientific interest in the investigation of the value of traditional medical therapeutics. Glucans have an important part in this renewed interest. These fungal wall components are claimed to be useful for various medical purposes and they are obtained from medicinal mushrooms commonly used in traditional Oriental medicine. The immunotherapeutic properties of fungi extracts have been reported, including the enhancement of anticancer immunity responses. These properties are principally related to the stimulation of cells of the innate immune system. The discovery of specific receptors for glucans on dendritic cells (dectin-1), as well as interactions with other receptors, mainly expressed by innate immune cells (e.g., Toll-like receptors, complement receptor-3), have raised new attention toward these products as suitable therapeutic agents. We briefly review the characteristics of the glucans from mycelial walls as modulators of the immunity and their possible use as antitumor treatments. PMID:23739801

Genetics and physiology of cell wall polysaccharides in the model C4 grass, Setaria viridis spp.

PubMed

Ermawar, Riksfardini A; Collins, Helen M; Byrt, Caitlin S; Henderson, Marilyn; O'Donovan, Lisa A; Shirley, Neil J; Schwerdt, Julian G; Lahnstein, Jelle; Fincher, Geoffrey B; Burton, Rachel A

2015-10-02

Setaria viridis has emerged as a model species for the larger C4 grasses. Here the cellulose synthase (CesA) superfamily has been defined, with an emphasis on the amounts and distribution of (1,3;1,4)-β-glucan, a cell wall polysaccharide that is characteristic of the grasses and is of considerable value for human health. Orthologous relationship of the CesA and Poales-specific cellulose synthase-like (Csl) genes among Setaria italica (Si), Sorghum bicolor (Sb), Oryza sativa (Os), Brachypodium distachyon (Bradi) and Hordeum vulgare (Hv) were compared using bioinformatics analysis. Transcription profiling of Csl gene families, which are involved in (1,3;1,4)-β-glucan synthesis, was performed using real-time quantitative PCR (Q-PCR). The amount of (1,3;1,4)-β-glucan was measured using a modified Megazyme assay. The fine structures of the (1,3;1,4)-β-glucan, as denoted by the ratio of cellotriosyl to cellotetraosyl residues (DP3:DP4 ratio) was assessed by chromatography (HPLC and HPAEC-PAD). The distribution and deposition of the MLG was examined using the specific antibody BG-1 and captured using fluorescence and transmission electron microscopy (TEM). The cellulose synthase gene superfamily contains 13 CesA and 35 Csl genes in Setaria. Transcript profiling of CslF, CslH and CslJ gene families across a vegetative tissue series indicated that SvCslF6 transcripts were the most abundant relative to all other Csl transcripts. The amounts of (1,3;1,4)-β-glucan in Setaria vegetative tissues ranged from 0.2% to 2.9% w/w with much smaller amounts in developing grain (0.003% to 0.013% w/w). In general, the amount of (1,3;1,4)-β-glucan was greater in younger than in older tissues. The DP3:DP4 ratios varied between tissue types and across developmental stages, and ranged from 2.4 to 3.0:1. The DP3:DP4 ratios in developing grain ranged from 2.5 to 2.8:1. Micrographs revealing the distribution of (1,3;1,4)-β-glucan in walls of different cell types and the data were consistent with the quantitative (1,3;1,4)-β-glucan assays. The characteristics of the cellulose synthase gene superfamily and the accumulation and distribution of (1,3;1,4)-β-glucans in Setaria are similar to those in other C4 grasses, including sorghum. This suggests that Setaria is a suitable model plant for cell wall polysaccharide biology in C4 grasses.

Promotion of beta-glucan synthase activity in corn microsomal membranes by calcium and protein phosphorylation

NASA Technical Reports Server (NTRS)

Paliyath, G.; Poovaiah, B. W.

1988-01-01

Regulation of the activity of beta-glucan synthase was studied using microsomal preparations from corn coleoptiles. The specific activity as measured by the incorporation of glucose from uridine diphospho-D-[U-14C]glucose varied between 5 to 15 pmol (mg protein)-1 min-1. Calcium promoted beta-glucan synthase activity and the promotion was observed at free calcium concentrations as low as 1 micromole. Kinetic analysis of substrate-velocity curve showed an apparent Km of 1.92 x 10(-4) M for UDPG. Calcium increased the Vmax from 5.88 x 10(-7) mol liter-1 min-1 in the absence of calcium to 9.52 x 10(-7) mol liter-1 min-1 and 1.66 x 10(-6) mol liter-1 min-1 in the presence of 0.5 mM and 1 mM calcium, respectively. The Km values remained the same under these conditions. Addition of ATP further increased the activity above the calcium-promoted level. Sodium fluoride, a phosphoprotein phosphatase inhibitor, promoted glucan synthase activity indicating that phosphorylation and dephosphorylation are involved in the regulation of the enzyme activity. Increasing the concentration of sodium fluoride from 0.25 mM to 10 mM increased glucan synthase activity five-fold over the + calcium + ATP control. Phosphorylation of membrane proteins also showed a similar increase under these conditions. Calmodulin, in the presence of calcium and ATP stimulated glucan synthase activity substantially, indicating that calmodulin could be involved in the calcium-dependent phosphorylation and promotion of beta-glucan synthase activity. The role of calcium in mediating auxin action is discussed.

A role for fungal β-glucans and their receptor Dectin-1 in the induction of autoimmune arthritis in genetically susceptible mice

PubMed Central

Yoshitomi, Hiroyuki; Sakaguchi, Noriko; Kobayashi, Katsuya; Brown, Gordon D.; Tagami, Tomoyuki; Sakihama, Toshiko; Hirota, Keiji; Tanaka, Satoshi; Nomura, Takashi; Miki, Ichiro; Gordon, Siamon; Akira, Shizuo; Nakamura, Takashi; Sakaguchi, Shimon

2005-01-01

A combination of genetic and environmental factors can cause autoimmune disease in animals. SKG mice, which are genetically prone to develop autoimmune arthritis, fail to develop the disease under a microbially clean condition, despite active thymic production of arthritogenic autoimmune T cells and their persistence in the periphery. However, in the clean environment, a single intraperitoneal injection of zymosan, a crude fungal β-glucan, or purified β-glucans such as curdlan and laminarin can trigger severe chronic arthritis in SKG mice, but only transient arthritis in normal mice. Blockade of Dectin-1, a major β-glucan receptor, can prevent SKG arthritis triggered by β-glucans, which strongly activate dendritic cells in vitro in a Dectin-1–dependent but Toll-like receptor-independent manner. Furthermore, antibiotic treatment against fungi can prevent SKG arthritis in an arthritis-prone microbial environment. Multiple injections of polyinosinic-polycytidylic acid double-stranded RNA also elicit mild arthritis in SKG mice. Thus, specific microbes, including fungi and viruses, may evoke autoimmune arthritis such as rheumatoid arthritis by stimulating innate immunity in individuals who harbor potentially arthritogenic autoimmune T cells as a result of genetic anomalies or variations. PMID:15781585

Function of the family-9 and family-22 carbohydrate-binding modules in a modular beta-1,3-1,4-glucanase/xylanase derived from Clostridium stercorarium Xyn10B.

PubMed

Zhao, Guangshan; Ali, Ehsan; Araki, Rie; Sakka, Makiko; Kimura, Tetsuya; Sakka, Kazuo

2005-08-01

Clostridium stercorarium Xyn10B having hydrolytic activities on xylan and beta-1,3-1,4-glucan is a modular enzyme composed of two family-22 carbohydrate-binding modules (CBMs), a family-10 catalytic module of the glycoside hydrolases, a family-9 CBM, and two S-layer homologous modules, consecutively from the N-terminus. We investigated the function of family-9 and family-22 CBMs in a modular enzyme by comparing the enzymatic properties of a truncated enzyme composed of two family-22 CBMs and the catalytic module (rCBM22-CM), an enzyme composed of the catalytic module and family-9 CBM (rCM-CBM9), an enzyme composed of two family-22 CBMs, the catalytic module, and family-9 CBM (rCBM22-CM-CBM9), and the catalytic module polypeptide (rCM). Although the addition of family-9 CBM to rCM and rCBM22-CM did not significantly change catalytic activity toward xylan and beta-1,3-1,4-glucan, the addition of family-22 CBM to rCM and rCM-CBM9 drastically enhanced catalytic activity toward xylan and especially beta-1,3-1,4-glucan. Furthermore, the addition of family-22 CBM to rCM and rCM-CBM9 shifted the optimum temperature from 65 degrees C to 75 degrees C, but that of family-9 CBM to rCM and rCBM22-CM did not affect the optimum temperature. These facts suggest that the enzyme properties of Xyn10B were mainly dependent on the presence of the family-22 CBMs but not family-9 CBM.

Polysaccharide-inducible endoglucanases from Lentinula edodes exhibit a preferential hydrolysis of 1,3-1,4-β-glucan and xyloglucan.

PubMed

Takeda, Takumi; Nakano, Yuki; Takahashi, Machiko; Sakamoto, Yuichi; Konno, Naotake

2013-08-07

Three genes encoding glycoside hydrolase family 12 (GH12) enzymes from Lentinula edodes, namely Lecel12A, Lecel12B, and Lecel12C, were newly cloned by PCR using highly conserved sequence primers. To investigate enzymatic properties, recombinant enzymes encoded by L. edodes DNAs and GH12 genes from Postia placenta (PpCel12A and PpCel12B) and Schizophyllum commune (ScCel12A) were prepared in Brevibacillus choshinensis. Recombinant LeCel12A, PpCel12A, and PpCel12B, which were grouped in GH12 subfamily 1, preferentially hydrolyzed 1,3-1,4-β-glucan. By contrast, LeCel12B, LeCel12C, and ScCel12A, members of the subfamily 2, exhibited specific hydrolysis of xyloglucan. These results suggest that two subfamilies of GH12 are separated based on the substrate specificity. Transcript levels of L. edodes genes increased 72 h after growth of L. edodes mycelia cells in the presence of plant cell wall polymers such as xyloglucan, 1,3-1,4-β-glucan, and cellulose. These results suggest that L. edodes GH12 enzymes have evolved to hydrolyze 1,3-1,4-β-glucan and xyloglucan, which might enhance hyphal extension and nutrient acquisition.

Comparison of the potency of a variety of β-glucans to induce cytokine production in human whole blood

PubMed Central

Noss, Ilka; Doekes, Gert; Thorne, Peter S; Heederik, Dick J.J.; Wouters, Inge M.

2014-01-01

Beta-glucans are components of fungal cell walls and potent stimulants of innate immunity. The majority of research on biological activities of glucans has focused on β-(1,3)-glucans, which have been implicated in relation with fungal exposure-associated respiratory symptoms, and as important stimulatory agents in anti-fungal immune responses. Fungi - and bacteria and plants - produce a wide variety of glucans with vast differences in proportion and arrangement of their 1,3-, 1,4-, and 1,6-β-glycosidic linkages. Thus far the proinflammatory potential of different β-glucans has not been studied within the same experimental model. Therefore, we compared the potency of 13 different glucan preparations to induce in vitro production of IL1β, IL6, IL8 and TNF-α in human whole blood cultures. The strongest inducers of all cytokines were pustulan (β-(1,6)-glucan), lichenan (β-(1,3)-(1,4)-glucan), xyloglucan (β-(1,4)-glucan), and pullulan (α-(1,4)-(1,6)-glucan). Moderate to strong cytokine production was observed for curdlan (β-(1,3)-glucan), baker’s yeast glucan (β-(1,3)-(1,6)-glucan), and barley glucan (β-(1,3)-(1,4)-glucan), while all other glucan preparations induced only low or no detectable levels of cytokines. We therefore conclude that innate immunity reactions are not exclusively induced by β-(1,3)-glucans, but also by β-(1,6)- and β-(1,4)-structures. Thus, not only β-(1,3)-glucan, but also other β-glucans and particularly β-(1,6)-glucans should be considered in future research. PMID:22653750

Sterigmatomyces halophilus β-glucan improves the immune response and bacterial resistance in Pacific red snapper (Lutjanus peru) peripheral blood leucocytes: In vitro study.

PubMed

Reyes-Becerril, Martha; Guardiola, Francisco A; Sanchez, Veronica; Maldonado, Minerva; Angulo, Carlos

2018-04-21

β-Glucans are naturally occurring polysaccharides that are produced by bacteria, fungi and yeast. They are considered immunostimulants in fish acting on non-specific defense mechanism. Yeast-derived glucans from cell wall (Sterigmatomyces halophilus, β-Gluc/Sh) have been used for this purpose in this study. Therefore, an in vitro assay using peripheral blood leucocytes (PBLs) from Pacific red snapper was performed to evaluate the stimulant effects of β-Gluc/Sh and zymosan A (positive control) for 12 and 24 h and after bacterial challenge with Aeromonas hydrophila at 24 h. In addition, structural characterization of this marine yeast glucan was performed by proton nuclear magnetic resonance (NMR) revealing structures containing (1-6)-branched (1-3)-β-D-glucan. PBLs responded positively to β-Gluc/Sh where cell viability was higher than 80%. After challenge, β-Gluc/Sh was able to inhibit cytotoxicity caused by A. hydrophila, highlighting that the PBLs incubated with β-Gluc/Sh significantly increased the non-specific immune response, such as phagocytic activity, respiratory burst, nitric oxide and peroxidase activities followed by an increase in superoxide dismutase and catalase activities after 12 and 24 h post-stimulation and after challenge with the pathogen. Regarding induction of antioxidant gene expression, it was more pronounced in stimulated β-Gluc/Sh leucocytes compared to other groups at all experimental times of the trial and after bacterial challenge. Indeed, our results clearly showed the ability of leucocytes to strongly react to β-Gluc/Sh with an increase in cytokine gene expression, particularly the IL-1β, IL-10 and IL-17 genes. These results confirm that S. halophilus yeast-derived β-glucan, isolated from an extreme marine environment, is beneficial for increasing innate immune response and enhancing resistance against A. hydrophila in vitro. Copyright © 2018. Published by Elsevier Ltd.

Label-free Chemical Imaging of Fungal Spore Walls by Raman Microscopy and Multivariate Curve Resolution Analysis

PubMed Central

Noothalapati, Hemanth; Sasaki, Takahiro; Kaino, Tomohiro; Kawamukai, Makoto; Ando, Masahiro; Hamaguchi, Hiro-o; Yamamoto, Tatsuyuki

2016-01-01

Fungal cell walls are medically important since they represent a drug target site for antifungal medication. So far there is no method to directly visualize structurally similar cell wall components such as α-glucan, β-glucan and mannan with high specificity, especially in a label-free manner. In this study, we have developed a Raman spectroscopy based molecular imaging method and combined multivariate curve resolution analysis to enable detection and visualization of multiple polysaccharide components simultaneously at the single cell level. Our results show that vegetative cell and ascus walls are made up of both α- and β-glucans while spore wall is exclusively made of α-glucan. Co-localization studies reveal the absence of mannans in ascus wall but are distributed primarily in spores. Such detailed picture is believed to further enhance our understanding of the dynamic spore wall architecture, eventually leading to advancements in drug discovery and development in the near future. PMID:27278218

Anti-Inflammatory Effects of a Mytilus coruscus α-d-Glucan (MP-A) in Activated Macrophage Cells via TLR4/NF-κB/MAPK Pathway Inhibition

PubMed Central

Liu, Fuyan; Zhang, Xiaofeng; Li, Yuqiu; Chen, Qixin; Liu, Fei; Zhu, Xiqiang; Mei, Li; Song, Xinlei; Liu, Xia; Song, Zhigang; Zhang, Jinhua; Zhang, Wen; Ling, Peixue

2017-01-01

The hard-shelled mussel (Mytilus coruscus) has been used as Chinese traditional medicine for thousands of years; however, to date the ingredients responsible for the various beneficial health outcomes attributed to Mytilus coruscus are still unclear. An α-d-Glucan, called MP-A, was isolated from Mytilus coruscus, and observed to exert anti-inflammatory activity in THP-1 human macrophage cells. Specifically, we showed that MP-A treatment inhibited the production of inflammatory markers, including TNF-α, NO, and PGE2, inducible NOS (iNOS), and cyclooxygenase-2 (COX-2), in LPS-activated THP-1 cells. It was also shown to enhance phagocytosis in the analyzed cells, but to severely inhibit the phosphorylation of mitogen-activated protein kinases (MAPKs) and the nuclear translocation of NF-κB P65. Finally, MP-A was found to exhibit a high binding affinity for the cell surface receptor TLR4, but a low affinity for TLR2 and dectin-1, via surface plasmon resonance (SPR) analysis. The study indicates that MP-A suppresses LPS-induced TNF-α, NO and PEG2 production via TLR4/NF-κB/MAPK pathway inhibition, and suggests that MP-A may be a promising therapeutic candidate for diseases associated with TNF-α, NO, and/or PEG2 overproduction. PMID:28930149

Anti-Inflammatory Effects of a Mytilus coruscus α-d-Glucan (MP-A) in Activated Macrophage Cells via TLR4/NF-κB/MAPK Pathway Inhibition.

PubMed

Liu, Fuyan; Zhang, Xiaofeng; Li, Yuqiu; Chen, Qixin; Liu, Fei; Zhu, Xiqiang; Mei, Li; Song, Xinlei; Liu, Xia; Song, Zhigang; Zhang, Jinhua; Zhang, Wen; Ling, Peixue; Wang, Fengshan

2017-09-20

The hard-shelled mussel ( Mytilus coruscus ) has been used as Chinese traditional medicine for thousands of years; however, to date the ingredients responsible for the various beneficial health outcomes attributed to Mytilus coruscus are still unclear. An α-d-Glucan, called MP-A, was isolated from Mytilus coruscus , and observed to exert anti-inflammatory activity in THP-1 human macrophage cells. Specifically, we showed that MP-A treatment inhibited the production of inflammatory markers, including TNF-α, NO, and PGE2, inducible NOS (iNOS), and cyclooxygenase-2 (COX-2), in LPS-activated THP-1 cells. It was also shown to enhance phagocytosis in the analyzed cells, but to severely inhibit the phosphorylation of mitogen-activated protein kinases (MAPKs) and the nuclear translocation of NF-κB P65. Finally, MP-A was found to exhibit a high binding affinity for the cell surface receptor TLR4, but a low affinity for TLR2 and dectin-1, via surface plasmon resonance (SPR) analysis. The study indicates that MP-A suppresses LPS-induced TNF-α, NO and PEG2 production via TLR4/NF-κB/MAPK pathway inhibition, and suggests that MP-A may be a promising therapeutic candidate for diseases associated with TNF-α, NO, and/or PEG2 overproduction.

Blood (1→3)-β-D-Glucan as a Diagnostic Test for HIV-Related Pneumocystis jirovecii Pneumonia

PubMed Central

Komarow, Lauren; Finkelman, Malcolm A.; Grant, Philip M.; Andersen, Janet; Scully, Eileen; Powderly, William G.; Zolopa, Andrew R.

2011-01-01

(See the editorial commentary by Morris and Masur, on pages 203–204.) Background. Improved noninvasive diagnostic tests for Pneumocystis jirovecii pneumonia (PCP) are needed. We evaluated the test characteristics of plasma (1→3)-β-D-glucan (β-glucan) for HIV-related PCP among a large group of patients presenting with diverse opportunistic infections (OIs). Methods. The study population included all 282 participants in AIDS Clinical Trials Group A5164, a study of early versus deferred antiretroviral therapy in conjunction with initial therapy of acute OIs. Baseline plasma samples were assayed for β-glucan, with standard assay reference values defining ≥80 pg/mL as positive. Before this analysis, diagnosis of PCP was independently adjudicated by 2 study investigators after reviewing reports from study sites. Results. A total of 252 persons had a β-glucan result that could be analyzed, 173 (69%) of whom had received a diagnosis of PCP. Median β-glucan with PCP was 408 pg/mL (interquartile range [IQR], 209–500 pg/mL), compared with 37 pg/mL (IQR, 31–235 pg/mL) without PCP (P < .001). The sensitivity of β-glucan dichotomized at 80 pg/mL for the diagnosis of PCP was 92% (95% confidence interval [CI], 87%–96%), and the specificity was 65% (95% CI, 53%–75%); positive and negative predictive values were 85% (95% CI, 79%–90%) and 80% (95% CI, 68%–89%) respectively, based on the study prevalence of 69% of patients with PCP. Rates of abnormal lactate dehyrogenase levels did not differ significantly between those with and without PCP. Conclusions. Blood (1→3)-β-D-glucan is strongly correlated with HIV-related PCP. In some clinical centers, this may be a more sensitive test than the induced sputum examination and could reduce the need for both bronchoscopy and empirical therapy of PCP. PMID:21690628

In Situ β-Glucan Fortification of Cereal-Based Matrices by Pediococcus parvulus 2.6: Technological Aspects and Prebiotic Potential

PubMed Central

Mohedano, María Luz; Spano, Giuseppe; Fiocco, Daniela; Russo, Pasquale; Capozzi, Vittorio

2017-01-01

Bacterial exopolysaccharides produced by lactic acid bacteria are of increasing interest in the food industry, since they might enhance the technological and functional properties of some edible matrices. In this work, Pediococcus parvulus 2.6, which produces an O2-substituted (1,3)-β-d-glucan exopolysaccharide only synthesised by bacteria, was proposed as a starter culture for the production of three cereal-based fermented foods. The obtained fermented matrices were naturally bio-fortified in microbial β-glucans, and used to investigate the prebiotic potential of the bacterial exopolysaccharide by analysing the impact on the survival of a probiotic Lactobacillus plantarum strain under starvation and gastrointestinal simulated conditions. All of the assays were performed by using as control of the P. parvulus 2.6’s performance, the isogenic β-glucan non-producing 2.6NR strain. Our results showed a differential capability of P. parvulus to ferment the cereal flours. During the fermentation step, the β-glucans produced were specifically quantified and their concentration correlated with an increased viscosity of the products. The survival of the model probiotic L. plantarum WCFS1 was improved by the presence of the bacterial β-glucans in oat and rice fermented foods under starvation conditions. The probiotic bacteria showed a significantly higher viability when submitted to a simulated intestinal stress in the oat matrix fermented by the 2.6 strain. Therefore, the cereal flours were a suitable substrate for in situ bio-fortification with the bacterial β-glucan, and these matrices could be used as carriers to enhance the beneficial properties of probiotic bacteria. PMID:28754020

Characterisation and functional comparison of single-CRD and multidomain containing galectins CgGal-2 and CgGal-3 from oyster Crassostrea gigas.

PubMed

Huang, Mengmeng; Zhou, Tao; Wu, Yuehong; Fei, Hui; Wang, Gaoyang; Li, Zhi; Lei, Yutong; Liu, Qian; Sun, Cong; Lv, Zhengbing; Xu, Xue-Wei

2018-04-18

Galectins are β-galactoside binding lectins that play crucial roles in innate immunity in vertebrates and invertebrates through their conserved carbohydrate-recognition domains (CRDs). In the present study, single- and four-CRD-containing galectins were identified in oyster Crassostrea gigas (designated CgGal-2 and CgGal-3). The open reading frames (ORFs) of CgGal-2 and CgGal-3 encode polypeptides of 200 and 555 amino acids, respectively. All CRDs of CgGal-3 include two consensus motifs essential for ligand-binding, and a novel motif is present in CgGal-2. Pathogen-associated molecular pattern (PAMP) profiles were determined for recombinant rCgGal-2 and rCgGal-3, and rCgGal-2 displayed low binding affinity for PAMPs, while rCgGal-3 bound various PAMPs including glucan, lipopolysaccharide (LPS), and peptidoglycan (PGN) with relatively high affinity. Furthermore, rCgGal-2 and rCgGal-3 exhibited different microbe binding profiles; rCgGal-2 bound to Gram-negative bacteria (Escherichia coli and Vibrio vulnificus) and fungi (Saccharomyces cerevisiae and Pichia pastoris), while rCgGal-3 bound to these microbes but also to Gram-positive bacteria (Micrococcus luteus). In addition, rCgGal-3 possessed microbial agglutinating activity and coagulation activity against fungi and erythrocytes, respectively, but rCgGal-2 lacked any agglutinating activity. Carbohydrate binding specificity analysis showed that rCgGal-3 specifically bound D-galactose. Furthermore, rCgGal-2 and rCgGal-3 functioned as opsonin participating in the clearance against invaders in C. gigas. Thus, CgGal-2 with one CRD and CgGal-3 with four CRDs are new members of the galectin family involved in immune responses against bacterial infection. Differences in the organisation and amino acid sequences of CRDs may affect their specificity and affinity for nonself substances. Copyright © 2018 Elsevier Ltd. All rights reserved.

Effects of extrusion variables on the properties of waxy hulless barley extrudates.

PubMed

Köksel, Hamit; Ryu, Gy-Hyung; Başman, Arzu; Demiralp, Hande; Ng, Perry K W

2004-02-01

The objective of this research was to investigate the extrudability of waxy hulless barley flour under various extrusion conditions. Waxy hulless barley flour was processed in a laboratory-scale corotating twin-screw extruder with different levels of feed moisture content (22.3, 26.8, and 30.7%) and die temperature (130, 150, and 170 degrees C) to develop a snack food with high beta-glucan content. The effects of extrusion condition variables (screw configuration, moisture, and temperature) on the system variables (pressure and specific mechanical energy), the extrudate physical properties (sectional expansion index, bulk density), starch gelatinization, pasting properties (cold peak viscosity, trough viscosity, and final viscosity), and beta-glucan contents were determined. Results were evaluated by using response surface methodology. Increased extrusion temperature and feed moisture content resulted in decreases in exit die pressure and specific mechanical energy values. For extrudates extruded under low shear screw configuration (LS), increased barrel temperature decreased sectional expansion index (SEI) values at both low and high moisture contents. The feed moisture seems to have an inverse relationship with SEI over the range studied. Bulk density was higher at higher moisture contents, for both low and high barrel temperatures, for samples extruded under high shear screw configuration (HS) and LS. Cold peak viscosities (CV) were observed in all samples. The CV increased with the increase in extrusion temperature and feed moisture content. Although beta-glucan contents of the LS extrudates were comparable to that of barley flour sample, HS samples had generally lower beta-glucan contents. The extrusion cooking technique seems to be promising for the production of snack foods with high beta-glucan content, especially using LS conditions.

Diagnostic value of (1 → 3)-β-D-glucan in bronchoalveolar lavage fluid for invasive fungal disease: A meta-analysis.

PubMed

Shi, Xin-Yu; Liu, Yao; Gu, Xian-Min; Hao, Sheng-Yu; Wang, Yu-Hong; Yan, Di; Jiang, Shu-Juang

2016-08-01

The serum (1 → 3)-β-D-glucan (BG) assay has been approved for diagnosing invasive fungal diseases (IFDs). However, the performance of (1 → 3)-β-D-glucan assay in bronchoalveolar lavage (BAL) fluid is various among studies. The present study aimed to assess the accuracy of (1 → 3)-β-D-glucan assay in bronchoalveolar lavage fluid for the diagnosis of invasive fungal diseases by means of meta-analysis and systematic review of relevant studies. The sensitivity, specificity, positive likelihood ratio (PLR), negative likelihood ratio (NLR), diagnostic odds ratio (OR) and a summary receiver-operating characteristic curve of BAL-BG for diagnosing invasive fungal diseases were pooled using meta-analysis. We also performed meta-regression analysis. A total of 838 patients (138 with proven or probable invasive fungal diseases), included in 6 studies, were analyzed. The pooled sensitivity, specificity, PLR, NLR and diagnostic odds ratio were 0.52 (95%CI, 0.38-0.53), 0.58 (95%CI, 0.55-0.61), 1.34 (95%CI, 1.08-1.66), 0.82 (95% CI, 0.63-1.07) and 1.71 (95%CI, 1.01-2.92) respectively. The area under the summary receiver operating characteristic curve, with 95% confidence intervals was 0.61 (95%CI, 0.67-0.55). The accuracy of (1 → 3)-β-D-glucan test in bronchoalveolar lavage fluid is marginal, so that the results should not be interpreted alone but can be used as a part of full assessment with clinical features, image findings and other laboratory results for the diagnosis of invasive fungal diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.

Soluble Glucan Is Internalized and Trafficked to the Golgi Apparatus in Macrophages via a Clathrin-Mediated, Lipid Raft-Regulated Mechanism

PubMed Central

Goldman, Matthew P.; Kalbfleisch, John H.; Williams, David L.

2012-01-01

Glucans are natural product carbohydrates that stimulate immunity. Glucans are internalized by the pattern recognition receptor, Dectin-1. Glucans were thought to be trafficked to phagolysosomes, but this is unproven. We examined the internalization and trafficking of soluble glucans in macrophages. Incubation of macrophages with glucan resulted in internalization of Dectin-1 and glucan. Inhibition of clathrin blocked internalization of the Dectin-1/glucan complex. Lipid raft depletion resulted in decreased Dectin levels and glucan uptake. Once internalized, glucans colocalized with early endosomes at 0 to 15 min, with the Golgi apparatus at 15 min to 24 h, and with Dectin-1 immediately (0 h) and again later (15 min-24 h). Glucans did not colocalize with lysosomes at any time interval examined. We conclude that the internalization of Dectin-1/glucan complexes in macrophages is mediated by clathrin and negatively regulated by lipid rafts and/or caveolin-1. Upon internalization, soluble glucans are trafficked via endosomes to the Golgi apparatus, not lysosomes. PMID:22700434

Cell Wall Architecture of the Elongating Maize Coleoptile1

PubMed Central

Carpita, Nicholas C.; Defernez, Marianne; Findlay, Kim; Wells, Brian; Shoue, Douglas A.; Catchpole, Gareth; Wilson, Reginald H.; McCann, Maureen C.

2001-01-01

The primary walls of grasses are composed of cellulose microfibrils, glucuronoarabinoxylans (GAXs), and mixed-linkage β-glucans, together with smaller amounts of xyloglucans, glucomannans, pectins, and a network of polyphenolic substances. Chemical imaging by Fourier transform infrared microspectroscopy revealed large differences in the distributions of many chemical species between different tissues of the maize (Zea mays) coleoptile. This was confirmed by chemical analyses of isolated outer epidermal tissues compared with mesophyll-enriched preparations. Glucomannans and esterified uronic acids were more abundant in the epidermis, whereas β-glucans were more abundant in the mesophyll cells. The localization of β-glucan was confirmed by immunocytochemistry in the electron microscope and quantitative biochemical assays. We used field emission scanning electron microscopy, infrared microspectroscopy, and biochemical characterization of sequentially extracted polymers to further characterize the cell wall architecture of the epidermis. Oxidation of the phenolic network followed by dilute NaOH extraction widened the pores of the wall substantially and permitted observation by scanning electron microscopy of up to six distinct microfibrillar lamellae. Sequential chemical extraction of specific polysaccharides together with enzymic digestion of β-glucans allowed us to distinguish two distinct domains in the grass primary wall. First, a β-glucan-enriched domain, coextensive with GAXs of low degrees of arabinosyl substitution and glucomannans, is tightly associated around microfibrils. Second, a GAX that is more highly substituted with arabinosyl residues and additional glucomannan provides an interstitial domain that interconnects the β-glucan-coated microfibrils. Implications for current models that attempt to explain the biochemical and biophysical mechanism of wall loosening during cell growth are discussed. PMID:11598229

Isolation of prawn ( Exopalaemon carinicauda) lipopolysaccharide and β-1, 3-glucan binding protein gene and its expression in responding to bacterial and viral infections

NASA Astrophysics Data System (ADS)

Ge, Qianqian; Li, Jian; Duan, Yafei; Li, Jitao; Sun, Ming; Zhao, Fazhen

2016-04-01

The pattern recognition proteins (PRPs) play a major role in immune response of crustacean to resist pathogens. In the present study, as one of PRPs, lipopolysaccharide and β-1, 3-glucan binding protein (LGBP) gene in the ridge tail white prawn ( Exopalaemon carinicauda) ( EcLGBP) was isolated. The full-length cDNA of EcLGBP was 1338 bp, encoding a polypeptide of 366 amino acid residules. The deduced amino acid sequence of EcLGBP shared high similarities with LGBP and BGBP from other crustaceans. Some conservative domains were predicted in EcLGBP sequence. EcLGBP constitutively expressed in most tissues at different levels, and the highest expression was observed in hepatopancreas. With infection time, the cumulative mortality increased gradually followed by the proliferation of Vibrio parahaemolyticus and white spot syndrome virus (WSSV). The expression of EcLGBP in response to V. parahaemolyticus infection was up-regulated in hemocytes and hepatopancreas, and the up-regulation in hepatopancreas was earlier than that in hemocytes. EcLGBP expression after WSSV infection increased at 3 h, then significantly decreased in both hemocytes and hepatopancreas. The results indicated that EcLGBP was involved in the immune defense against bacterial and viral infections.

Adhesion of glucosyltransferase phase variants to Streptococcus gordonii bacterium-glucan substrata may involve lipoteichoic acid.

PubMed

Vickerman, M M; Jones, G W

1992-10-01

Growing Streptococcus gordonii Spp+ phase variants, which have normal levels of glucosyltransferase (GTF) activity, use sucrose to promote their accumulation on surfaces by forming a cohesive bacterium-insoluble glucan polymer mass (BPM). Spp- phase variants, which have lower levels of GTF activity, do not form BPMs and do not remain in BPMs formed by Spp+ cells when grown in mixed cultures. To test the hypothesis that segregation of attached Spp+ and unattached Spp- cells was due to differences in adhesiveness, adhesion between washed, [3H]thymidine-labeled cells and preformed BPM substrata was measured. Unexpectedly, the results showed that cells of both phenotypes, as well as GTF-negative cells, attached equally well to preformed BPMs, indicating that attachment to BPMs was independent of cell surface GTF activity. Initial characterization of this binding interaction suggested that a protease-sensitive component on the washed cells may be binding to lipoteichoic acids sequestered in the BPM, since exogenous lipoteichoic acid inhibited adhesion. Surprisingly, the adhesion of both Spp+ and Spp- cells was markedly inhibited in the presence of sucrose, which also released lipoteichoic acid from the BPM. These in vitro findings suggest that, in vivo, sucrose and lipoteichoic acid may modify dental plaque development by enhancing or inhibiting the attachment of additional bacteria.

Adhesion of glucosyltransferase phase variants to Streptococcus gordonii bacterium-glucan substrata may involve lipoteichoic acid.

PubMed Central

Vickerman, M M; Jones, G W

1992-01-01

Growing Streptococcus gordonii Spp+ phase variants, which have normal levels of glucosyltransferase (GTF) activity, use sucrose to promote their accumulation on surfaces by forming a cohesive bacterium-insoluble glucan polymer mass (BPM). Spp- phase variants, which have lower levels of GTF activity, do not form BPMs and do not remain in BPMs formed by Spp+ cells when grown in mixed cultures. To test the hypothesis that segregation of attached Spp+ and unattached Spp- cells was due to differences in adhesiveness, adhesion between washed, [3H]thymidine-labeled cells and preformed BPM substrata was measured. Unexpectedly, the results showed that cells of both phenotypes, as well as GTF-negative cells, attached equally well to preformed BPMs, indicating that attachment to BPMs was independent of cell surface GTF activity. Initial characterization of this binding interaction suggested that a protease-sensitive component on the washed cells may be binding to lipoteichoic acids sequestered in the BPM, since exogenous lipoteichoic acid inhibited adhesion. Surprisingly, the adhesion of both Spp+ and Spp- cells was markedly inhibited in the presence of sucrose, which also released lipoteichoic acid from the BPM. These in vitro findings suggest that, in vivo, sucrose and lipoteichoic acid may modify dental plaque development by enhancing or inhibiting the attachment of additional bacteria. PMID:1398940

Fungal Allergen β-Glucans Trigger p38 Mitogen-Activated Protein Kinase–Mediated IL-6 Translation in Lung Epithelial Cells

PubMed Central

Neveu, Wendy A.; Bernardo, Edgar; Allard, Jenna L.; Nagaleekar, Viswas; Wargo, Matthew J.; Davis, Roger J.; Iwakura, Yoichiro; Whittaker, Laurie A.

2011-01-01

In addition to immune cells, airway epithelial cells can contribute to and shape the immune response in the lung by secreting specific cytokines. IL-6 is a key factor in determining the effector fate of CD4+ T cells. Here we show that under basal conditions, the IL-6 gene is already highly expressed in lung epithelial cells, but not in immune cells resident in the lung. However, upon exposure of the lungs to fungal allergens, the direct contact of β-glucans present in the fungus cell wall with lung epithelial cells is sufficient to trigger the rapid synthesis and secretion of IL-6 protein. This posttranscriptional regulation of IL-6 in response to fungal extracts is mediated by the p38 mitogen-activated protein kinase pathway. The inhalation of β-glucans with a nonallergenic antigen is sufficient to provide an adjuvant effect that leads to mucous hyperplasia in the airways. Thus, β-glucans may constitute a common determinant of the fungal and plant-derived allergens responsible for some of the pathological features in allergic asthma. PMID:21642586

D-glucans from edible mushrooms: a review on the extraction, purification and chemical characterization approaches.

PubMed

Ruthes, Andrea Caroline; Smiderle, Fhernanda Ribeiro; Iacomini, Marcello

2015-03-06

D-Glucans from edible mushrooms present diversified chemical structures. The most common type consists of a backbone of β-D-glucose (1→3)-linked frequently branched at O-6 by β-D-glucose residues as side chains. However it is possible to distinguish α-, β- and mixed D-glucans. Further discrimination could be made on the basis of glycosidic bond position in a pyranoid ring, distribution of specific glycosidic bonds along the chain, branching and molecular weight. The present manuscript reviews the processes of extraction, purification and chemical characterization of D-glucans, such as NMR studies, methylation analysis, Smith degradation, and some other methodologies employed in carbohydrate chemistry characterization. In addition, these polysaccharides are important because they can provide many therapeutic benefits related to their biological activity in animals and humans, either immunostimulatory activity, inhibiting tumor growth, as well as exerting antinociceptive and anti-inflammatory action, among others, which are usually attached to their structure, molecular weight and degree of branching. Copyright © 2014 Elsevier Ltd. All rights reserved.

Biochemical Characterization of Paracoccidioides brasiliensis α-1,3-Glucanase Agn1p, and Its Functionality by Heterologous Expression in Schizosaccharomyces pombe

PubMed Central

Villalobos-Duno, Héctor; San-Blas, Gioconda; Paulinkevicius, Maryan; Sánchez-Martín, Yolanda; Nino-Vega, Gustavo

2013-01-01

α-1,3-Glucan is present as the outermost layer of the cell wall in the pathogenic yeastlike (Y) form of Paracoccidioides brasiliensis. Based on experimental evidence, this polysaccharide has been proposed as a fungal virulence factor. To degrade α-1,3-glucan and allow remodeling of the cell wall, α-1,3-glucanase is required. Therefore, the study of this enzyme, its encoding gene, and regulatory mechanisms, might be of interest to understand the morphogenesis and virulence process in this fungus. A single gene, orthologous to other fungal α-1,3-glucanase genes, was identified in the Paracoccidioides genome, and labeled AGN1. Transcriptional levels of AGN1 and AGS1 (α-1,3-glucan synthase-encoding gene) increased sharply when the pathogenic Y phase was cultured in the presence of 5% horse serum, a reported booster for cell wall α-1,3-glucan synthesis in this fungus. To study the biochemical properties of P. brasiliensis Agn1p, the enzyme was heterologously overexpressed, purified, and its activity profile determined by means of the degradation of carboxymethyl α-1,3-glucan (SCMG, chemically modified from P. brasiliensis α-1,3-glucan), used as a soluble substrate for the enzymatic reaction. Inhibition assays, thin layer chromatography and enzymatic reactions with alternative substrates (dextran, starch, chitin, laminarin and cellulose), showed that Agn1p displays an endolytic cut pattern and high specificity for SCMG. Complementation of a Schizosaccharomyces pombe agn1Δ strain with the P. brasiliensis AGN1 gene restored the wild type phenotype, indicating functionality of the gene, suggesting a possible role of Agn1p in the remodeling of P. brasiliensis Y phase cell wall. Based on amino acid sequence, P. brasiliensis Agn1p, groups within the family 71 of fungal glycoside hydrolases (GH-71), showing similar biochemical characteristics to other members of this family. Also based on amino acid sequence alignments, we propose a subdivision of fungal GH-71 into at least five groups, for which specific conserved sequences can be identified. PMID:23825576

A Single-Nucleotide Polymorphism in an Endo-1,4-β-Glucanase Gene Controls Seed Coat Permeability in Soybean

PubMed Central

Jang, Seong-Jin; Sato, Masako; Sato, Kei; Jitsuyama, Yutaka; Fujino, Kaien; Mori, Haruhide; Takahashi, Ryoji; Benitez, Eduardo R.; Liu, Baohui; Yamada, Tetsuya; Abe, Jun

2015-01-01

Physical dormancy, a structural feature of the seed coat known as hard seededness, is an important characteristic for adaptation of plants against unstable and unpredictable environments. To dissect the molecular basis of qHS1, a quantitative trait locus for hard seededness in soybean (Glycine max (L) Merr.), we developed a near-isogenic line (NIL) of a permeable (soft-seeded) cultivar, Tachinagaha, containing a hard-seed allele from wild soybean (G. soja) introduced by successive backcrossings. The hard-seed allele made the seed coat of Tachinagaha more rigid by increasing the amount of β-1,4-glucans in the outer layer of palisade cells of the seed coat on the dorsal side of seeds, known to be a point of entrance of water. Fine-mapping and subsequent expression and sequencing analyses revealed that qHS1 encodes an endo-1,4-β-glucanase. A single-nucleotide polymorphism (SNP) introduced an amino acid substitution in a substrate-binding cleft of the enzyme, possibly reducing or eliminating its affinity for substrates in permeable cultivars. Introduction of the genomic region of qHS1 from the impermeable (hard-seeded) NIL into the permeable cultivar Kariyutaka resulted in accumulation of β-1,4-glucan in the outer layer of palisade cells and production of hard seeds. The SNP allele found in the NIL was further associated with the occurrence of hard seeds in soybean cultivars of various origins. The findings of this and previous studies may indicate that qHS1 is involved in the accumulation of β-1,4-glucan derivatives such as xyloglucan and/or β-(1,3)(1,4)-glucan that reinforce the impermeability of seed coats in soybean. PMID:26039079

Proteolytic Cascade for the Activation of the Insect Toll Pathway Induced by the Fungal Cell Wall Component

PubMed Central

Roh, Kyung-Baeg; Kim, Chan-Hee; Lee, Hanna; Kwon, Hyun-Mi; Park, Ji-Won; Ryu, Ji-Hwan; Kurokawa, Kenji; Ha, Nam-Chul; Lee, Won-Jae; Lemaitre, Bruno; Söderhäll, Kenneth; Lee, Bok-Luel

2009-01-01

The insect Toll signaling pathway is activated upon recognition of Gram-positive bacteria and fungi, resulting in the expression of antimicrobial peptides via NF-κB-like transcription factor. This activation is mediated by a serine protease cascade leading to the processing of Spätzle, which generates the functional ligand of the Toll receptor. Recently, we identified three serine proteases mediating Toll pathway activation induced by lysine-type peptidoglycan of Gram-positive bacteria. However, the identities of the downstream serine protease components of Gram-negative-binding protein 3 (GNBP3), a receptor for a major cell wall component β-1,3-glucan of fungi, and their order of activation have not been characterized yet. Here, we identified three serine proteases that are required for Toll activation by β-1,3-glucan in the larvae of a large beetle, Tenebrio molitor. The first one is a modular serine protease functioning immediately downstream of GNBP3 that proteolytically activates the second one, a Spätzle-processing enzyme-activating enzyme that in turn activates the third serine protease, a Spätzle-processing enzyme. The active form of Spätzle-processing enzyme then cleaves Spätzle into the processed Spätzle as Toll ligand. In addition, we show that injection of β-1,3-glucan into Tenebrio larvae induces production of two antimicrobial peptides, Tenecin 1 and Tenecin 2, which are also inducible by injection of the active form of Spätzle-processing enzyme-activating enzyme or processed Spätzle. These results demonstrate a three-step proteolytic cascade essential for the Toll pathway activation by fungal β-1,3-glucan in Tenebrio larvae, which is shared with lysine-type peptidoglycan-induced Toll pathway activation. PMID:19473968

Screening of beta-glucan contents in commercially cultivated and wild growing mushrooms.

PubMed

Sari, Miriam; Prange, Alexander; Lelley, Jan I; Hambitzer, Reinhard

2017-02-01

Mushrooms have unique sensory properties and nutritional values as well as health benefits due to their bioactive compounds, especially beta-glucans. Well-known edible and medicinal mushroom species as well as uncommon or unknown species representing interesting sources of bioactive beta-glucans have been widely studied. Commercially cultivated and wild growing mushrooms were analysed for their beta-glucan contents. Enzymatic determinations of all glucans, alpha-glucans and beta-glucans in 39 mushrooms species were performed, leading to very remarkable results. Many wild growing species present high beta-glucan contents, especially Bracket fungi. The well-known cultivated species Agaricus bisporus, Lentinula edodes and Cantharellus cibarius as well as most screened wild growing species show higher glucan contents in their stipes than caps. Copyright © 2016 Elsevier Ltd. All rights reserved.

Respiratory Tract Infections and the Role of Biologically Active Polysaccharides in Their Management and Prevention.

PubMed

Jesenak, Milos; Urbancikova, Ingrid; Banovcin, Peter

2017-07-20

Respiratory tract infections (RTIs) are the most common form of infections in every age category. Recurrent respiratory tract infections (RRTIs), a specific form of RTIs, represent a typical and common problem associated with early childhood, causing high indirect and direct costs on the healthcare system. They are usually the consequence of immature immunity in children and high exposure to various respiratory pathogens. Their rational management should aim at excluding other severe chronic diseases associated with increased morbidity (e.g., primary immunodeficiency syndromes, cystic fibrosis, and ciliary dyskinesia) and at supporting maturity of the mucosal immune system. However, RRTIs can also be observed in adults (e.g., during exhausting and stressful periods, chronic inflammatory diseases, secondary immunodeficiencies, or in elite athletes) and require greater attention. Biologically active polysaccharides (e.g., β-glucans) are one of the most studied natural immunomodulators with a pluripotent mode of action and biological activity. According to many studies, they possess immunomodulatory, anti-inflammatory, and anti-infectious activities and therefore could be suggested as an effective part of treating and preventing RTIs. Based on published studies, the application of β-glucans was proven as a possible therapeutic and preventive approach in managing and preventing recurrent respiratory tract infections in children (especially β-glucans from Pleurotus ostreatus ), adults (mostly the studies with yeast-derived β-glucans), and in elite athletes (studies with β-glucans from Pleurotus ostreatus or yeast).

Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi.

PubMed

Yoshimi, Akira; Miyazawa, Ken; Abe, Keietsu

2017-11-18

Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.

Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

PubMed Central

Avni, Sharon; Ezove, Nirit; Hanani, Hilla; Yadid, Itamar; Karpovsky, Michal; Hayby, Hilla; Gover, Ofer; Hadar, Yitzhak; Schwartz, Betty; Danay, Ofer

2017-01-01

Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe) of the fruit body contained higher glucan content then the caps (pileus). Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW) from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate. PMID:28718825

Production of low-molecular weight soluble yeast β-glucan by an acid degradation method.

PubMed

Ishimoto, Yuina; Ishibashi, Ken-Ichi; Yamanaka, Daisuke; Adachi, Yoshiyuki; Kanzaki, Ken; Iwakura, Yoichiro; Ohno, Naohito

2018-02-01

β-glucan is widely distributed in nature as water soluble and insoluble forms. Both forms of β-glucan are utilized in several fields, especially for functional foods. Yeast β-glucan is a medically important insoluble particle. Solubilization of yeast β-glucan may be valuable for improving functional foods and in medicinal industries. In the present study, we applied an acid degradation method to solubilize yeast β-glucan and found that β-glucan was effectively solubilized to low-molecular weight β-glucans by 45% sulfuric acid treatment at 20°C. The acid-degraded soluble yeast β-glucan (ad-sBBG) was further fractionated into a higher-molecular weight fraction (ad-sBBG-high) and a lower-molecular weight fraction (ad-sBBG-low). Since ad-sBBG-high contained mannan, while ad-sBBG-low contained it only scarcely, it was possible to prepare low-molecular weight soluble β-glucan with higher purity. In addition, ad-sBBG-low bound to dectin-1, which is an innate immunity receptor of β-glucan, and showed antagonistic activity against reactive oxygen production and cytokine synthesis by macrophages. Thus, this acid degradation method is an important procedure for generating immune-modulating, low-molecular weight, soluble yeast β-glucan. Copyright © 2017 Elsevier B.V. All rights reserved.

Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii.

PubMed

Avni, Sharon; Ezove, Nirit; Hanani, Hilla; Yadid, Itamar; Karpovsky, Michal; Hayby, Hilla; Gover, Ofer; Hadar, Yitzhak; Schwartz, Betty; Danay, Ofer

2017-07-18

Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe) of the fruit body contained higher glucan content then the caps (pileus). Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW) from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

Cloning, Sequencing, and Characterization of the cgmB Gene of Sinorhizobium meliloti Involved in Cyclic β-Glucan Biosynthesis

PubMed Central

Wang, Ping; Ingram-Smith, Cheryl; Hadley, Jill A.; Miller, Karen J.

1999-01-01

Periplasmic cyclic β-glucans of Rhizobium species provide important functions during plant infection and hypo-osmotic adaptation. In Sinorhizobium meliloti (also known as Rhizobium meliloti), these molecules are highly modified with phosphoglycerol and succinyl substituents. We have previously identified an S. meliloti Tn5 insertion mutant, S9, which is specifically impaired in its ability to transfer phosphoglycerol substituents to the cyclic β-glucan backbone (M. W. Breedveld, J. A. Hadley, and K. J. Miller, J. Bacteriol. 177:6346–6351, 1995). In the present study, we have cloned, sequenced, and characterized this mutation at the molecular level. By using the Tn5 flanking sequences (amplified by inverse PCR) as a probe, an S. meliloti genomic library was screened, and two overlapping cosmid clones which functionally complement S9 were isolated. A 3.1-kb HindIII-EcoRI fragment found in both cosmids was shown to fully complement mutant S9. Furthermore, when a plasmid containing this 3.1-kb fragment was used to transform Rhizobium leguminosarum bv. trifolii TA-1JH, a strain which normally synthesizes only neutral cyclic β-glucans, anionic glucans containing phosphoglycerol substituents were produced, consistent with the functional expression of an S. meliloti phosphoglycerol transferase gene. Sequence analysis revealed the presence of two major, overlapping open reading frames within the 3.1-kb fragment. Primer extension analysis revealed that one of these open reading frames, ORF1, was transcribed and its transcription was osmotically regulated. This novel locus of S. meliloti is designated the cgm (cyclic glucan modification) locus, and the product encoded by ORF1 is referred to as CgmB. PMID:10419956

Effects of dietary β-glucan and glycyrrhizin on non-specific immunity and disease resistance of the sea cucumber ( Apostichopus japonicus Selenka) challenged with Vibrio splendidus

NASA Astrophysics Data System (ADS)

Chang, Jie; Zhang, Wenbing; Mai, Kangsen; Ma, Hongming; Xu, Wei

2010-12-01

Sea cucumbers, Apostichopus japonicus Selenka, were fed diets containing non-immunostimulant (basal diet), 0.2% β-glucan and 0.02% glycyrrhizin in a recirculatory water system for 45 days, and subsequently challenged with Vibrio splendidus by injection at 1.0×108 cfu / sea cucumber for 15 days. Phagocytic capacity (PC), intracellular superoxide anion production (ISAP), lysozyme (LSZ) activity and superoxide dismutase (SOD) activity in the coelomic fluid were analyzed on the 0th, 5th, 10th and 15th days after injection. Results showed that after the 45-day feeding period, PC, ISAP, LSZ activity and SOD activity in sea cucumbers fed with dietary β-glucan or glycyrrhizin were significantly higher than in those fed with the basal diet. On the 5th day after infection, all the immune parameters examined in the sea cucumbers injected with V. splendidus decreased in value significantly. On the 15th day, PC, ISAP and LSZ activity returned to levels similar to those on the 0th day. For the sea cucumbers injected with saline, there were no significant differences in all the immune parameters examined and in the cumulative morbidity during the 15-day challenging trial. After injecting with V. splendidus, the cumulative morbidity of sea cucumbers fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin when challenged with V. splendidus challenged sea cucumber fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin. There was no significant difference in cumulative morbidity between the dietary β-glucan and glycyrrhizin treatments over time.

Enzymology and structure of the GH13_31 glucan 1,6-α-glucosidase that confers isomaltooligosaccharide utilization in the probiotic Lactobacillus acidophilus NCFM.

PubMed

Møller, Marie S; Fredslund, Folmer; Majumder, Avishek; Nakai, Hiroyuki; Poulsen, Jens-Christian N; Lo Leggio, Leila; Svensson, Birte; Abou Hachem, Maher

2012-08-01

Isomaltooligosaccharides (IMO) have been suggested as promising prebiotics that stimulate the growth of probiotic bacteria. Genomes of probiotic lactobacilli from the acidophilus group, as represented by Lactobacillus acidophilus NCFM, encode α-1,6 glucosidases of the family GH13_31 (glycoside hydrolase family 13 subfamily 31) that confer degradation of IMO. These genes reside frequently within maltooligosaccharide utilization operons, which include an ATP-binding cassette transporter and α-glucan active enzymes, e.g., maltogenic amylases and maltose phosphorylases, and they also occur separated from any carbohydrate transport or catabolism genes on the genomes of some acidophilus complex members, as in L. acidophilus NCFM. Besides the isolated locus encoding a GH13_31 enzyme, the ABC transporter and another GH13 in the maltooligosaccharide operon were induced in response to IMO or maltotetraose, as determined by reverse transcription-PCR (RT-PCR) transcriptional analysis, suggesting coregulation of α-1,6- and α-1,4-glucooligosaccharide utilization loci in L. acidophilus NCFM. The L. acidophilus NCFM GH13_31 (LaGH13_31) was produced recombinantly and shown to be a glucan 1,6-α-glucosidase active on IMO and dextran and product-inhibited by glucose. The catalytic efficiency of LaGH13_31 on dextran and the dextran/panose (trisaccharide) efficiency ratio were the highest reported for this class of enzymes, suggesting higher affinity at distal substrate binding sites. The crystal structure of LaGH13_31 was determined to a resolution of 2.05 Å and revealed additional substrate contacts at the +2 subsite in LaGH13_31 compared to the GH13_31 from Streptococcus mutans (SmGH13_31), providing a possible structural rationale to the relatively high affinity for dextran. A comprehensive phylogenetic and activity motif analysis mapped IMO utilization enzymes from gut microbiota to rationalize preferential utilization of IMO by gut residents.

Enzymology and Structure of the GH13_31 Glucan 1,6-α-Glucosidase That Confers Isomaltooligosaccharide Utilization in the Probiotic Lactobacillus acidophilus NCFM

PubMed Central

Møller, Marie S.; Fredslund, Folmer; Majumder, Avishek; Nakai, Hiroyuki; Poulsen, Jens-Christian N.; Lo Leggio, Leila; Svensson, Birte

2012-01-01

Isomaltooligosaccharides (IMO) have been suggested as promising prebiotics that stimulate the growth of probiotic bacteria. Genomes of probiotic lactobacilli from the acidophilus group, as represented by Lactobacillus acidophilus NCFM, encode α-1,6 glucosidases of the family GH13_31 (glycoside hydrolase family 13 subfamily 31) that confer degradation of IMO. These genes reside frequently within maltooligosaccharide utilization operons, which include an ATP-binding cassette transporter and α-glucan active enzymes, e.g., maltogenic amylases and maltose phosphorylases, and they also occur separated from any carbohydrate transport or catabolism genes on the genomes of some acidophilus complex members, as in L. acidophilus NCFM. Besides the isolated locus encoding a GH13_31 enzyme, the ABC transporter and another GH13 in the maltooligosaccharide operon were induced in response to IMO or maltotetraose, as determined by reverse transcription-PCR (RT-PCR) transcriptional analysis, suggesting coregulation of α-1,6- and α-1,4-glucooligosaccharide utilization loci in L. acidophilus NCFM. The L. acidophilus NCFM GH13_31 (LaGH13_31) was produced recombinantly and shown to be a glucan 1,6-α-glucosidase active on IMO and dextran and product-inhibited by glucose. The catalytic efficiency of LaGH13_31 on dextran and the dextran/panose (trisaccharide) efficiency ratio were the highest reported for this class of enzymes, suggesting higher affinity at distal substrate binding sites. The crystal structure of LaGH13_31 was determined to a resolution of 2.05 Å and revealed additional substrate contacts at the +2 subsite in LaGH13_31 compared to the GH13_31 from Streptococcus mutans (SmGH13_31), providing a possible structural rationale to the relatively high affinity for dextran. A comprehensive phylogenetic and activity motif analysis mapped IMO utilization enzymes from gut microbiota to rationalize preferential utilization of IMO by gut residents. PMID:22685275

Streptococcus mutans Protein Synthesis during Mixed-Species Biofilm Development by High-Throughput Quantitative Proteomics

PubMed Central

Klein, Marlise I.; Xiao, Jin; Lu, Bingwen; Delahunty, Claire M.; Yates, John R.; Koo, Hyun

2012-01-01

Biofilms formed on tooth surfaces are comprised of mixed microbiota enmeshed in an extracellular matrix. Oral biofilms are constantly exposed to environmental changes, which influence the microbial composition, matrix formation and expression of virulence. Streptococcus mutans and sucrose are key modulators associated with the evolution of virulent-cariogenic biofilms. In this study, we used a high-throughput quantitative proteomics approach to examine how S. mutans produces relevant proteins that facilitate its establishment and optimal survival during mixed-species biofilms development induced by sucrose. Biofilms of S. mutans, alone or mixed with Actinomyces naeslundii and Streptococcus oralis, were initially formed onto saliva-coated hydroxyapatite surface under carbohydrate-limiting condition. Sucrose (1%, w/v) was then introduced to cause environmental changes, and to induce biofilm accumulation. Multidimensional protein identification technology (MudPIT) approach detected up to 60% of proteins encoded by S. mutans within biofilms. Specific proteins associated with exopolysaccharide matrix assembly, metabolic and stress adaptation processes were highly abundant as the biofilm transit from earlier to later developmental stages following sucrose introduction. Our results indicate that S. mutans within a mixed-species biofilm community increases the expression of specific genes associated with glucan synthesis and remodeling (gtfBC, dexA) and glucan-binding (gbpB) during this transition (P<0.05). Furthermore, S. mutans up-regulates specific adaptation mechanisms to cope with acidic environments (F1F0-ATPase system, fatty acid biosynthesis, branched chain amino acids metabolism), and molecular chaperones (GroEL). Interestingly, the protein levels and gene expression are in general augmented when S. mutans form mixed-species biofilms (vs. single-species biofilms) demonstrating fundamental differences in the matrix assembly, survival and biofilm maintenance in the presence of other organisms. Our data provide insights about how S. mutans optimizes its metabolism and adapts/survives within the mixed-species community in response to a dynamically changing environment. This reflects the intricate physiological processes linked to expression of virulence by this bacterium within complex biofilms. PMID:23049864

Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

NASA Astrophysics Data System (ADS)

Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

2009-07-01

β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

Bioengineering T cells to target carbohydrate to treat opportunistic fungal infection

PubMed Central

Kumaresan, Pappanaicken R.; Manuri, Pallavi R.; Albert, Nathaniel D.; Maiti, Sourindra; Singh, Harjeet; Mi, Tiejuan; Roszik, Jason; Rabinovich, Brian; Olivares, Simon; Krishnamurthy, Janani; Zhang, Ling; Najjar, Amer M.; Huls, M. Helen; Lee, Dean A.; Champlin, Richard E.; Kontoyiannis, Dimitrios P.; Cooper, Laurence J. N.

2014-01-01

Clinical-grade T cells are genetically modified ex vivo to express chimeric antigen receptors (CARs) to redirect their specificity to target tumor-associated antigens in vivo. We now have developed this molecular strategy to render cytotoxic T cells specific for fungi. We adapted the pattern-recognition receptor Dectin-1 to activate T cells via chimeric CD28 and CD3-ζ (designated “D-CAR”) upon binding with carbohydrate in the cell wall of Aspergillus germlings. T cells genetically modified with the Sleeping Beauty system to express D-CAR stably were propagated selectively on artificial activating and propagating cells using an approach similar to that approved by the Food and Drug Administration for manufacturing CD19-specific CAR+ T cells for clinical trials. The D-CAR+ T cells exhibited specificity for β-glucan which led to damage and inhibition of hyphal growth of Aspergillus in vitro and in vivo. Treatment of D-CAR+ T cells with steroids did not compromise antifungal activity significantly. These data support the targeting of carbohydrate antigens by CAR+ T cells and provide a clinically appealing strategy to enhance immunity for opportunistic fungal infections using T-cell gene therapy. PMID:25002471

Novel structural features in Candida albicans hyphal glucan provide a basis for differential innate immune recognition of hyphae versus yeast.

PubMed

Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L

2014-02-07

The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.

Novel Structural Features in Candida albicans Hyphal Glucan Provide a Basis for Differential Innate Immune Recognition of Hyphae Versus Yeast*

PubMed Central

Lowman, Douglas W.; Greene, Rachel R.; Bearden, Daniel W.; Kruppa, Michael D.; Pottier, Max; Monteiro, Mario A.; Soldatov, Dmitriy V.; Ensley, Harry E.; Cheng, Shih-Chin; Netea, Mihai G.; Williams, David L.

2014-01-01

The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. 1H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or “closed chain” structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae. PMID:24344127

The structure of amylosucrase from Deinococcus radiodurans has an unusual open active-site topology.

PubMed

Skov, Lars K; Pizzut-Serin, Sandra; Remaud-Simeon, Magali; Ernst, Heidi A; Gajhede, Michael; Mirza, Osman

2013-09-01

Amylosucrases (ASes) catalyze the formation of an α-1,4-glucosidic linkage by transferring a glucosyl unit from sucrose onto an acceptor α-1,4-glucan. To date, several ligand-bound crystal structures of wild-type and mutant ASes from Neisseria polysaccharea and Deinococcus geothermalis have been solved. These structures all display a very similar overall conformation with a deep pocket leading to the site for transglucosylation, subsite -1. This has led to speculation on how sucrose enters the active site during glucan elongation. In contrast to previous studies, the AS structure from D. radiodurans presented here has a completely empty -1 subsite. This structure is strikingly different from other AS structures, as an active-site-lining loop comprising residues Leu214-Asn225 is found in a previously unobserved conformation. In addition, a large loop harbouring the conserved active-site residues Asp133 and Tyr136 is disordered. The result of the changed loop conformations is that the active-site topology is radically changed, leaving subsite -1 exposed and partially dismantled. This structure provides novel insights into the dynamics of ASes and comprises the first structural support for an elongation mechanism that involves considerable conformational changes to modulate accessibility to the sucrose-binding site and thereby allows successive cycles of glucosyl-moiety transfer to a growing glucan chain.

Beta-1-3-Glucan effect on sow antibody production and passive immunization of Progeny

USDA-ARS?s Scientific Manuscript database

Beta-glucans are glucose homopolymers known to modulate immunity. Here, the beta-glucan effect on sow antibody production and passive immunization of neonatal pigs was analyzed. Treatments included: 1) Corn-soy fed control group, 2) beta-glucan, 3) App vaccination, and 4) beta-glucan + App vaccinati...

Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi

PubMed Central

Yoshimi, Akira; Miyazawa, Ken; Abe, Keietsu

2017-01-01

Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan. PMID:29371579

Carbohydrate-binding module 74 is a novel starch-binding domain associated with large and multidomain α-amylase enzymes.

PubMed

Valk, Vincent; Lammerts van Bueren, Alicia; van der Kaaij, Rachel M; Dijkhuizen, Lubbert

2016-06-01

Microbacterium aurum B8.A is a bacterium that originates from a potato starch-processing plant and employs a GH13 α-amylase (MaAmyA) enzyme that forms pores in potato starch granules. MaAmyA is a large and multi-modular protein that contains a novel domain at its C terminus (Domain 2). Deletion of Domain 2 from MaAmyA did not affect its ability to degrade starch granules but resulted in a strong reduction in granular pore size. Here, we separately expressed and purified this Domain 2 in Escherichia coli and determined its likely function in starch pore formation. Domain 2 independently binds amylose, amylopectin, and granular starch but does not have any detectable catalytic (hydrolytic or oxidizing) activity on α-glucan substrates. Therefore, we propose that this novel starch-binding domain is a new carbohydrate-binding module (CBM), the first representative of family CBM74 that assists MaAmyA in efficient pore formation in starch granules. Protein sequence-based BLAST searches revealed that CBM74 occurs widespread, but in bacteria only, and is often associated with large and multi-domain α-amylases containing family CBM25 or CBM26 domains. CBM74 may specifically function in binding to granular starches to enhance the capability of α-amylase enzymes to degrade resistant starches (RSs). Interestingly, the majority of family CBM74 representatives are found in α-amylases originating from human gut-associated Bifidobacteria, where they may assist in resistant starch degradation. The CBM74 domain thus may have a strong impact on the efficiency of RS digestion in the mammalian gastrointestinal tract. © 2016 The Authors. The FEBS Journal published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

Diagnostic potential of nested PCR, galactomannan EIA, and beta-D-glucan for invasive aspergillosis in pediatric patients.

PubMed

Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa

2012-04-13

Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen  (Platelia Aspergillus), nested  PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp.  The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders. 

Pichia anomala DBVPG 3003 Secretes a Ubiquitin-Like Protein That Has Antimicrobial Activity▿

PubMed Central

De Ingeniis, Jessica; Raffaelli, Nadia; Ciani, Maurizio; Mannazzu, Ilaria

2009-01-01

The yeast strain Pichia anomala DBVPG 3003 secretes a killer toxin (Pikt) that has antifungal activity against Brettanomyces/Dekkera sp. yeasts. Pikt interacts with β-1,6-glucan, consistent with binding to the cell wall of sensitive targets. In contrast to that of toxin K1, secreted by Saccharomyces cerevisiae, Pikt killer activity is not mediated by an increase in membrane permeability. Purification of the toxin yielded a homogeneous protein of about 8 kDa, which showed a marked similarity to ubiquitin in terms of molecular mass and N-terminal sequences. Pikt is also specifically recognized by anti-bovine ubiquitin antibodies and, similar to ubiquitin-like peptides, is not absorbed by DEAE-cellulose. However, Pikt differs from ubiquitin in its sensitivity to proteolytic enzymes. Therefore, Pikt appears to be a novel ubiquitin-like peptide that has killer activity. PMID:19114528

Production of beta-glucan and related glucan-hydrolases by Botryosphaeria rhodina.

PubMed

Crognale, S; Bruno, M; Fidaleo, M; Moresi, M; Petruccioli, M

2007-03-01

Characterization of beta-glucan production from Botryosphaeria rhodina DABAC-P82 by detecting simultaneously glucan-hydrolytic enzymes and their localization, culture medium rheology and oxygen transfer. Mycelium growth, beta-glucan production, substrate consumption and glucan-hydrolytic enzymes were monitored both in shaken flasks and in a 3-l stirred-tank bioreactor. Glucan production (19.7 and 15.2 g l(-1), in flask and bioreactor, respectively) was accompanied by extra-cellular and cell-bound beta-glucanase and beta-glucosidase activities. In the bioreactor scale, in the time interval of 0-78 h the apparent viscosity of the culture broth exhibited a general increase; thereafter, it began to reduce, probably because of the above glucan-hydrolytic activities. Moreover, the culture media collected after 45 h behaved as solid-like materials at shear rates smaller than 0.001 s(-1), as pseudo-plastic liquids in the middle shear rate range and as Newtonian ones at shear rates greater than 1000 s(-1). The greatest beta-glucan accumulation in the bioreactor was found to be associated with nitrogen and dissolved oxygen concentrations smaller than 0.15 g l(-1) and 25%, respectively, and with the peak points of the glucan-degrading enzymes. A careful analysis of the critical factors (such as, culture broth rheology, oxygen mass transfer and glucan-hydrolytic enzymes) limiting the beta-glucan production by B. rhodina is a prerequisite to maximize beta-glucan yield and production, as well as to define the process flow sheet capable of maximizing biopolymer recovery, solvent re-utilization and glucose consumption.

Fiber and nonstarch polysaccharide content and variation in common crops used in broiler diets.

PubMed

Knudsen, Knud Erik Bach

2014-09-01

The current paper reviews content and variation in fiber and nonstarch polysaccharides (NSP) of common crops used in broiler diets. The cereal grain is a complex structure, and its cell walls (CW) differ in their composition and hence properties. Arabinoxylan (AX), mixed linkage (1→3; 1→4)-β-glucan (β-glucan), cellulose, and the noncarbohydrate component lignin are the predominant polymers in cereals. They occur in different proportions depending on the species and tissue type. Rye, triticale, wheat, corn, and sorghum are all rich in AX, whereas barley and oats contain a high level of β-glucan. The AX from rye, wheat, and triticale and β-glucan from barley and oats are to a large extent soluble, whereas the solubility of AX found in corn and sorghum is lower than the other cereals. The ratio of arabinose to xylose gives a crude indication of the AX structure, which varies between the endosperm, the aleurone and the outer grain layers as well as between the same tissues from different grains. Varietal differences in AX structure of the endosperm are also identified. From the analysis of the released oligomers after hydrolysis with a specific (1→3,1→4)-β-d-glucan hydrolase, it is found that the ratio of trisaccharides (degree of polymerization 3) and tetrasaccharides (degree of polymerization 4) varies depending on the source, being higher in barley than in oats but lower than in wheat. The molecular weight of β-glucan is higher than that of AX, and both polymers contribute to the viscosity of the extract. However, because AX molecules are more resistant to degradation than β-glucan, the use of AX rich grains in broiler diets is usually more problematic than those containing high concentrations of β-glucan. The cereal coproducts (brans and hulls) are concentrated sources of cellulose, lignin, and insoluble AX, but β-glucan can also be present mainly in rye and wheat brans. The CW composition of seeds and grains of protein crops and feedstuffs are different from that of cereals. The main CW polymers are pectic substances (homogalacturonan, rhamnogalacturonan type I and II, xylogalacturonan, and arabinogalactans type I and II), xyloglucans, and cellulose, but there are significant differences in the composition of the parenchymatous (cotyledon) tissues and that of the hulls. In the hulls, cellulose is the predominant polysaccharide, followed by acidic xylans and pectic substances. The implications of the heterogeneous CW for the action of exogenous enzymes are discussed. © 2014 Poultry Science Association Inc.

Structure-function relationships of family GH70 glucansucrase and 4,6-α-glucanotransferase enzymes, and their evolutionary relationships with family GH13 enzymes.

PubMed

Meng, Xiangfeng; Gangoiti, Joana; Bai, Yuxiang; Pijning, Tjaard; Van Leeuwen, Sander S; Dijkhuizen, Lubbert

2016-07-01

Lactic acid bacteria (LAB) are known to produce large amounts of α-glucan exopolysaccharides. Family GH70 glucansucrase (GS) enzymes catalyze the synthesis of these α-glucans from sucrose. The elucidation of the crystal structures of representative GS enzymes has advanced our understanding of their reaction mechanism, especially structural features determining their linkage specificity. In addition, with the increase of genome sequencing, more and more GS enzymes are identified and characterized. Together, such knowledge may promote the synthesis of α-glucans with desired structures and properties from sucrose. In the meantime, two new GH70 subfamilies (GTFB- and GTFC-like) have been identified as 4,6-α-glucanotransferases (4,6-α-GTs) that represent novel evolutionary intermediates between the family GH13 and "classical GH70 enzymes". These enzymes are not active on sucrose; instead, they use (α1 → 4) glucans (i.e. malto-oligosaccharides and starch) as substrates to synthesize novel α-glucans by introducing linear chains of (α1 → 6) linkages. All these GH70 enzymes are very interesting biocatalysts and hold strong potential for applications in the food, medicine and cosmetic industries. In this review, we summarize the microbiological distribution and the structure-function relationships of family GH70 enzymes, introduce the two newly identified GH70 subfamilies, and discuss evolutionary relationships between family GH70 and GH13 enzymes.

Respiratory Tract Infections and the Role of Biologically Active Polysaccharides in Their Management and Prevention

PubMed Central

Jesenak, Milos; Urbancikova, Ingrid; Banovcin, Peter

2017-01-01

Respiratory tract infections (RTIs) are the most common form of infections in every age category. Recurrent respiratory tract infections (RRTIs), a specific form of RTIs, represent a typical and common problem associated with early childhood, causing high indirect and direct costs on the healthcare system. They are usually the consequence of immature immunity in children and high exposure to various respiratory pathogens. Their rational management should aim at excluding other severe chronic diseases associated with increased morbidity (e.g., primary immunodeficiency syndromes, cystic fibrosis, and ciliary dyskinesia) and at supporting maturity of the mucosal immune system. However, RRTIs can also be observed in adults (e.g., during exhausting and stressful periods, chronic inflammatory diseases, secondary immunodeficiencies, or in elite athletes) and require greater attention. Biologically active polysaccharides (e.g., β-glucans) are one of the most studied natural immunomodulators with a pluripotent mode of action and biological activity. According to many studies, they possess immunomodulatory, anti-inflammatory, and anti-infectious activities and therefore could be suggested as an effective part of treating and preventing RTIs. Based on published studies, the application of β-glucans was proven as a possible therapeutic and preventive approach in managing and preventing recurrent respiratory tract infections in children (especially β-glucans from Pleurotus ostreatus), adults (mostly the studies with yeast-derived β-glucans), and in elite athletes (studies with β-glucans from Pleurotus ostreatus or yeast). PMID:28726737

Comprehensive functional characterization of the Glycoside Hydrolase Family 3 enzymes from Cellvibrio japonicus reveals unique metabolic roles in biomass saccharification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nelson, Cassandra E.; Attia, Mohamed A.; Rogowski, Artur

Here, lignocellulose degradation is central to the carbon cycle and renewable biotechnologies. The xyloglucan (XyG), β(1!3)/β(1!4) mixed-linkage glucan (MLG), and β(1!3) glucan components of lignocellulose represent significant carbohydrate energy sources for saprophytic microorganisms. The bacterium Cellvibrio japonicus has a robust capacity for plant polysaccharide degradation, due to a genome encoding a large contingent of Carbohydrate-Active Enzymes (CAZymes), many of whose specific functions remain unknown. Using a comprehensive genetic and biochemical approach we have delineated the physiological roles of the four C. japonicus Glycoside Hydrolase Family 3 (GH3) members on diverse β-glucans. Despite high protein sequence similarity and partially overlapping activitymore » profiles on disaccharides, these β-glucosidases are not functionally equivalent. Bgl3A has a major role in MLG and sophorose utilization, and supports β(1!3) glucan utilization, while Bgl3B underpins cellulose utilization and supports MLG utilization. Bgl3C drives β(1!3) glucan utilization. Finally, Bgl3D is the crucial β-glucosidase for XyG utilization. This study not only sheds the light on the metabolic machinery of C. japonicus, but also expands the repertoire of characterized CAZymes for future deployment in biotechnological applications. In particular, the precise functional analysis provided here serves as a reference for informed bioinformatics on the genomes of other Cellvibrio and related species.« less

Comprehensive functional characterization of the Glycoside Hydrolase Family 3 enzymes from Cellvibrio japonicus reveals unique metabolic roles in biomass saccharification

DOE PAGES

Nelson, Cassandra E.; Attia, Mohamed A.; Rogowski, Artur; ...

2017-10-20

Here, lignocellulose degradation is central to the carbon cycle and renewable biotechnologies. The xyloglucan (XyG), β(1!3)/β(1!4) mixed-linkage glucan (MLG), and β(1!3) glucan components of lignocellulose represent significant carbohydrate energy sources for saprophytic microorganisms. The bacterium Cellvibrio japonicus has a robust capacity for plant polysaccharide degradation, due to a genome encoding a large contingent of Carbohydrate-Active Enzymes (CAZymes), many of whose specific functions remain unknown. Using a comprehensive genetic and biochemical approach we have delineated the physiological roles of the four C. japonicus Glycoside Hydrolase Family 3 (GH3) members on diverse β-glucans. Despite high protein sequence similarity and partially overlapping activitymore » profiles on disaccharides, these β-glucosidases are not functionally equivalent. Bgl3A has a major role in MLG and sophorose utilization, and supports β(1!3) glucan utilization, while Bgl3B underpins cellulose utilization and supports MLG utilization. Bgl3C drives β(1!3) glucan utilization. Finally, Bgl3D is the crucial β-glucosidase for XyG utilization. This study not only sheds the light on the metabolic machinery of C. japonicus, but also expands the repertoire of characterized CAZymes for future deployment in biotechnological applications. In particular, the precise functional analysis provided here serves as a reference for informed bioinformatics on the genomes of other Cellvibrio and related species.« less

Comprehensive functional characterization of the glycoside hydrolase family 3 enzymes from Cellvibrio japonicus reveals unique metabolic roles in biomass saccharification.

PubMed

Nelson, Cassandra E; Attia, Mohamed A; Rogowski, Artur; Morland, Carl; Brumer, Harry; Gardner, Jeffrey G

2017-12-01

Lignocellulose degradation is central to the carbon cycle and renewable biotechnologies. The xyloglucan (XyG), β(1→3)/β(1→4) mixed-linkage glucan (MLG) and β(1→3) glucan components of lignocellulose represent significant carbohydrate energy sources for saprophytic microorganisms. The bacterium Cellvibrio japonicus has a robust capacity for plant polysaccharide degradation, due to a genome encoding a large contingent of Carbohydrate-Active enZymes (CAZymes), many of whose specific functions remain unknown. Using a comprehensive genetic and biochemical approach, we have delineated the physiological roles of the four C. japonicus glycoside hydrolase family 3 (GH3) members on diverse β-glucans. Despite high protein sequence similarity and partially overlapping activity profiles on disaccharides, these β-glucosidases are not functionally equivalent. Bgl3A has a major role in MLG and sophorose utilization, and supports β(1→3) glucan utilization, while Bgl3B underpins cellulose utilization and supports MLG utilization. Bgl3C drives β(1→3) glucan utilization. Finally, Bgl3D is the crucial β-glucosidase for XyG utilization. This study not only sheds the light on the metabolic machinery of C. japonicus, but also expands the repertoire of characterized CAZymes for future deployment in biotechnological applications. In particular, the precise functional analysis provided here serves as a reference for informed bioinformatics on the genomes of other Cellvibrio and related species. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Method for hull-less barley transformation and manipulation of grain mixed-linkage beta-glucan.

PubMed

Lim, Wai Li; Collins, Helen M; Singh, Rohan R; Kibble, Natalie A J; Yap, Kuok; Taylor, Jillian; Fincher, Geoffrey B; Burton, Rachel A

2018-05-01

Hull-less barley is increasingly offering scope for breeding grains with improved characteristics for human nutrition; however, recalcitrance of hull-less cultivars to transformation has limited the use of these varieties. To overcome this limitation, we sought to develop an effective transformation system for hull-less barley using the cultivar Torrens. Torrens yielded a transformation efficiency of 1.8%, using a modified Agrobacterium transformation method. This method was used to over-express genes encoding synthases for the important dietary fiber component, (1,3;1,4)-β-glucan (mixed-linkage glucan), primarily present in starchy endosperm cell walls. Over-expression of the HvCslF6 gene, driven by an endosperm-specific promoter, produced lines where mixed-linkage glucan content increased on average by 45%, peaking at 70% in some lines, with smaller increases in transgenic HvCslH1 grain. Transgenic HvCslF6 lines displayed alterations where grain had a darker color, were more easily crushed than wild type and were smaller. This was associated with an enlarged cavity in the central endosperm and changes in cell morphology, including aleurone and sub-aleurone cells. This work provides proof-of-concept evidence that mixed-linkage glucan content in hull-less barley grain can be increased by over-expression of the HvCslF6 gene, but also indicates that hull-less cultivars may be more sensitive to attempts to modify cell wall composition. © 2017 Institute of Botany, Chinese Academy of Sciences.

Effects of functional β-glucan on proliferation, differentiation, metabolism and its anti-fibrosis properties in muscle cells.

PubMed

Li, Yan; Fan, Yihui; Pan, Haiou; Qian, Haifeng; Qi, Xiguang; Wu, Gangcheng; Zhang, Hui; Xu, Meijuan; Rao, Zhiming; Wang, Li; Ying, Hao

2018-05-26

Skeletal muscles plays a crucial role in metabolism and exercise. Fuctional β-glucan is polysaccharide that is found in the cell walls of cereal, which is known to reduce cholesterol and lipid, prevent diabetes, cancer and cardiovascular diseases. In an attempt to identify β-glucan that could promote skeletal muscle function, we analyzed the proliferation, differentiation, metabolism and anti-fibrotic properties of β-glucan in C2C12 muscle cells. Treatment of β-glucan in C2C12 myoblasts led to increased proliferation and differentiation. Besides that, we found that C2C12 myotubes treated with β-glucan displayed a fast-to-slow muscle fiber conversion and improved oxidative metabolism. Further study revealed that β-glucan treatment could prevent myotubes from becoming myofibroblasts. Together, our study suggests that functional β-glucan might have a therapeutic potential to improve skeletal muscle function, which might contribute to the development of β-glucan. Copyright © 2018. Published by Elsevier B.V.

Lipid oxidation induced oxidative degradation of cereal beta-glucan.

PubMed

Wang, Yu-Jie; Mäkelä, Noora; Maina, Ndegwa Henry; Lampi, Anna-Maija; Sontag-Strohm, Tuula

2016-04-15

In food systems, lipid oxidation can cause oxidation of other molecules. This research for the first time investigated oxidative degradation of β-glucan induced by lipid oxidation using an oil-in-water emulsion system which simulated a multi-phased aqueous food system containing oil and β-glucan. Lipid oxidation was monitored using peroxide value and hexanal production while β-glucan degradation was evaluated by viscosity and molecular weight measurements. The study showed that while lipid oxidation proceeded, β-glucan degradation occurred. Emulsions containing β-glucan, oil and ferrous ion showed significant viscosity and molecular weight decrease after 1 week of oxidation at room temperature. Elevated temperature (40°C) enhanced the oxidation reactions causing higher viscosity drop. In addition, the presence of β-glucan appeared to retard the hexanal production in lipid oxidation. The study revealed that lipid oxidation may induce the degradation of β-glucan in aqueous food systems where β-glucan and lipids co-exist. Copyright © 2015 Elsevier Ltd. All rights reserved.

Suppressing effects of glucan on micronuclei induced by Co60 in mice.

PubMed

Chorvatovicová, D

1991-10-01

The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P less than 0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy.

Fibrinolytic, anti-inflammatory and anti-microbial properties of α-(1-3)-glucans produced from Streptococcus mutans (MTCC 497).

PubMed

Buddana, Sudheer Kumar; Varanasi, Yaswanth Venkata Naga; Shetty, Prakasham Reddy

2015-01-22

Streptococcus mutans (MTCC 497) cell associated α-(1-3)-glucans were isolated, characterized and evaluated for their bioactivity profile. Acid hydrolysis of α-(1-3)-glucans revealed presence of glucose moieties. Water insoluble α-(1-3)-glucans (WIG) were sulfated to convert them into water soluble glucans which were characterized by FT-IR spectral studies. The sulfation of WIG was confirmed by the presence of -O-SO3- and C-O-SO3- characteristic peaks at 1240 and 820 cm(-1). MALDI-TOF analysis of sulfated α-(1-3)-glucan revealed 1.2 to 9kDa fragmentation. Antibacterial profile studies revealed higher growth inhibitory activity against Gram negative than Gram positive bacterial strains by sulfated α-(1-3)-glucans. One-fold higher anti-inflammatory activity with IC50 value of 0.11mg/ml was observed with sulfated α-(1-3)-glucans over WIG. Time dependent fibrinolytic potential without requirement of tissue plasminogen activators was observed for sulfated α-(1-3)-glucans. This is the first report demonstrating the fibrinolytic and anti-inflammatory property for sulfated α-(1-3)-glucans. Copyright © 2014 Elsevier Ltd. All rights reserved.

Reduced and high molecular weight barley beta-glucans decrease plasma total and non-HDL-cholesterol in hypercholesterolemic Syrian golden hamsters.

PubMed

Wilson, Thomas A; Nicolosi, Robert J; Delaney, Bryan; Chadwell, Kim; Moolchandani, Vikas; Kotyla, Timothy; Ponduru, Sridevi; Zheng, Guo-Hua; Hess, Richard; Knutson, Nathan; Curry, Leslie; Kolberg, Lore; Goulson, Melanie; Ostergren, Karen

2004-10-01

Consumption of concentrated barley beta-glucan lowers plasma cholesterol because of its soluble dietary fiber nature. The role of molecular weight (MW) in lowering serum cholesterol is not well established. Prior studies showed that enzymatic degradation of beta-glucan eliminates the cholesterol-lowering activity; however, these studies did not evaluate the MW of the beta-glucan. The current study was conducted to evaluate whether barley beta-glucan concentrates, partially hydrolyzed to reduce MW, possess cholesterol-lowering and antiatherogenic activities. The reduced MW fraction was compared with a high MW beta-glucan concentrate from the same barley flour. Concentrated beta-glucan preparations were evaluated in Syrian Golden F(1)B hamsters fed a hypercholesterolemic diet (HCD) with cholesterol, hydrogenated coconut oil, and cellulose. After 2 wk, hamsters were fed HCD or diets that contained high or reduced MW beta-glucan at a concentration of 8 g/100 g at the expense of cellulose. Decreases in plasma total cholesterol (TC) and non-HDL-cholesterol (non-HDL-C) concentrations occurred in the hamsters fed reduced MW and high MW beta-glucan diets. Plasma HDL-C concentrations did not differ. HCD-fed hamsters had higher plasma triglyceride concentrations. Liver TC, free cholesterol, and cholesterol ester concentrations did not differ. Aortic cholesterol ester concentrations were lower in the reduced MW beta-glucan-fed hamsters. Consumption of either high or reduced MW beta-glucan increased concentrations of fecal total neutral sterols and coprostanol, a cholesterol derivative. Fecal excretion of cholesterol was greater than in HCD-fed hamsters only in those fed the reduced MW beta-glucan. Study results demonstrate that the cholesterol-lowering activity of barley beta-glucan may occur at both lower and higher MW.

Clinical and Physiological Perspectives of β-Glucans: The Past, Present, and Future

PubMed Central

Bashir, Khawaja Muhammad Imran; Choi, Jae-Suk

2017-01-01

β-Glucans are a group of biologically-active fibers or polysaccharides from natural sources with proven medical significance. β-Glucans are known to have antitumor, anti-inflammatory, anti-obesity, anti-allergic, anti-osteoporotic, and immunomodulating activities. β-Glucans are natural bioactive compounds and can be taken orally, as a food supplement, or as part of a daily diet, and are considered safe to use. The medical significance and efficiency of β-glucans are confirmed in vitro, as well as using animal- and human-based clinical studies. However, systematic study on the clinical and physiological significance of β-glucans is scarce. In this review, we not only discuss the clinical and physiological importance of β-glucans, we also compare their biological activities through the existing in vitro and animal-based in vivo studies. This review provides extensive data on the clinical study of β-glucans. PMID:28872611

Beta-1,4-glucanase-like protein from the cyanobacterium Synechocystis PCC6803 is a beta-1,3-1,4-glucanase and functions in salt stress tolerance.

PubMed

Tamoi, Masahiro; Kurotaki, Hideki; Fukamizo, Tamo

2007-07-01

In the present study, we characterized the gene (Cyanobase accession number slr0897) designated Ssglc encoding a beta-1,4-glucanase-like protein (SsGlc) from Synechocystis PCC6803. The deduced amino acid sequence for Ssglc showed a high degree of similarity to sequences of GH (glycoside hydrolase) family 9 beta-1,4-glucanases (cellulases) from various sources. Surprisingly, the recombinant protein obtained from the Escherichia coli expression system was able to hydrolyse barley beta-glucan and lichenan (beta-1,3-1,4-glucan), but not cellulose (beta-1,4-glucan), curdlan (beta-1,3-glucan), or laminarin (beta-1,3-1,6-glucan). A 1H-NMR analysis of the enzymatic products revealed that the enzyme hydrolyses the beta-1,4-glycosidic linkage of barley beta-glucan through an inverting mechanism. The data indicated that SsGlc was a novel type of GH9 glucanase which could specifically hydrolyse the beta-1,3-1,4-linkage of glucan. The growth of mutant Synechocystis cells in which the Ssglc gene was disrupted by a kanamycin-resistance cartridge gene was almost the same as that of the wild-type cells under continuous light (40 micromol of photons/m2 per s), a 12 h light (40 micromol of photons/m2 per s)/12 h dark cycle, cold stress (4 degrees C), and high light stress (200 micromol of photons/m2 per s). However, under salt stress (300-450 mM NaCl), growth of the Ssglc-disrupted mutant cells was significantly inhibited as compared with that of the wild-type cells. The Ssglc-disrupted mutant cells showed a decreased rate of O2 consumption and NaHCO3-dependent O2 evolution as compared with the wild-type cells under salt stress. Under osmotic stress (100-400 mM sorbitol), there was no difference in growth between the wild-type and the Ssglc-disrupted mutant cells. These results suggest that SsGlc functions in salt stress tolerance in Synechocystis PCC6803.

An Amylase-Like Protein, AmyD, Is the Major Negative Regulator for α-Glucan Synthesis in Aspergillus nidulans during the Asexual Life Cycle.

PubMed

He, Xiaoxiao; Li, Shengnan; Kaminskyj, Susan

2017-03-27

α-Glucan affects fungal cell-cell interactions and is important for the virulence of pathogenic fungi. Interfering with production of α-glucan could help to prevent fungal infection. In our previous study, we reported that an amylase-like protein, AmyD, could repress α-glucan accumulation in Aspergillus nidulans . However, the underlying molecular mechanism was not clear. Here, we examined the localization of AmyD and found it was a membrane-associated protein. We studied AmyD function in α-glucan degradation, as well as with other predicted amylase-like proteins and three annotated α-glucanases. AmyC and AmyE share a substantial sequence identity with AmyD, however, neither affects α-glucan synthesis. In contrast, AgnB and MutA (but not AgnE) are functional α-glucanases that also repress α-glucan accumulation. Nevertheless, the functions of AmyD and these glucanases were independent from each other. The dynamics of α-glucan accumulation showed different patterns between the AmyD overexpression strain and the α-glucanase overexpression strains, suggesting AmyD may not be involved in the α-glucan degradation process. These results suggest the function of AmyD is to directly suppress α-glucan synthesis, but not to facilitate its degradation.

β-glucan extract from oat bran and its industrial importance

NASA Astrophysics Data System (ADS)

Ibrahim, M. N. G.; Selezneva, I. S.

2017-09-01

The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.

Differential pathways regulating innate and adaptive antitumor immune responses by particulate and soluble yeast-derived β-glucans

PubMed Central

Qi, Chunjian; Cai, Yihua; Gunn, Lacey; Ding, Chuanlin; Li, Bing; Kloecker, Goetz; Qian, Keqing; Vasilakos, John; Saijo, Shinobu; Iwakura, Yoichiro; Yannelli, John R.

2011-01-01

β-glucans have been reported to function as a potent adjuvant to stimulate innate and adaptive immune responses. However, β-glucans from different sources are differential in their structure, conformation, and thus biologic activity. Different preparations of β-glucans, soluble versus particulate, further complicate their mechanism of action. Here we show that yeast-derived particulate β-glucan activated dendritic cells (DCs) and macrophages via a C-type lectin receptor dectin-1 pathway. Activated DCs by particulate β-glucan promoted Th1 and cytotoxic T-lymphocyte priming and differentiation in vitro. Treatment of orally administered yeast-derived particulate β-glucan elicited potent antitumor immune responses and drastically down-regulated immunosuppressive cells, leading to the delayed tumor progression. Deficiency of the dectin-1 receptor completely abrogated particulate β-glucan–mediated antitumor effects. In contrast, yeast-derived soluble β-glucan bound to DCs and macrophages independent of the dectin-1 receptor and did not activate DCs. Soluble β-glucan alone had no therapeutic effect but significantly augmented antitumor monoclonal antibody-mediated therapeutic efficacy via a complement activation pathway but independent of dectin-1 receptor. These findings reveal the importance of different preparations of β-glucans in the adjuvant therapy and allow for the rational design of immunotherapeutic protocols usable in clinical trials. PMID:21531981

Distribution and Molecular Characterization of β-Glucans from Hull-Less Barley Bran, Shorts and Flour

PubMed Central

Zheng, Xueling; Li, Limin; Wang, Qi

2011-01-01

Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12–13.01%), followed by bran (6.15–7.58%) and flour (2.48–2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38–71.41% β-glucan, 10.81–17.26% arabinoxylan, 2.6–9.6% protein, 2.7–9.0% starch, and 5.23–9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91–95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw. PMID:21673907

The Effects of Orally Administered Beta-Glucan on Innate Immune Responses in Humans, a Randomized Open-Label Intervention Pilot-Study

PubMed Central

Leentjens, Jenneke; Quintin, Jessica; Gerretsen, Jelle; Kox, Matthijs; Pickkers, Peter; Netea, Mihai G.

2014-01-01

Rationale To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use. Methods We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10) or the control group (n = 5). Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity. Results β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan. Conclusion The present study does not support the use of oral β-glucan to enhance innate immune responses in humans. Trial Registration ClinicalTrials.gov NCT01727895 PMID:25268806

Identification of a crustacean β-1,3-glucanase related protein as a pattern recognition protein in antibacterial response.

PubMed

Chai, Lian-Qin; Meng, Jing-Hui; Gao, Jie; Xu, Yi-Hui; Wang, Xian-Wei

2018-06-02

Prophenoloxidase (proPO) activating system is an important immune response for arthropods. β-1, 3-glucanase related protein (previously named as lipopolysaccharide and β-1, 3-glucan binding protein (LGBP) in crustaceans) is a typical pattern recognition receptor family involved in the proPO activation by recognizing the invading microbes. In this study, we pay special attention to a bacteria-induced β-1,3-glucanase related protein from red swamp crayfish Procambarus clarkii, an important aquaculture specie in China. This protein, designated PcBGRP, was found a typical member of crustacean BGRP family with the glucanase-related domain and the characteristic motifs. PcBGRP was expressed in hemcoyes and hepatopancreas, and its expression could be induced by the carbohydrate and bacteria stimulants. The induction by lipopolysaccharide (LPS) and β-1,3-glucan (βG) was more significant than by peptidoglycan (PG). The response of PcBGRP to the native Gram-negative bacterial pathogen Aeromonas hydrophila was more obvious than to Gram-positive bacteria. Using RNA interference and recombinant protein, PcBGRP was found to protect crayfish from A. hydrophila infection revealed by the survival test and morphological analysis. A mechanism study found PcBGRP could bind LPS and βG in a dose-dependent manner, and the LPS recognizing ability determined the Gram-negative bacterium binding activity of PcBGRP. PcBGRP was found to enhance the PO activation both in vitro and in vivo, and the protective role was related to the PO activating ability of PcBGRP. This study emphasized the role of BGRP family in crustacean immune response, and provided new insight to the immunity of red swamp crayfish which suffered serious disease during the aquaculture in China. Copyright © 2018 Elsevier Ltd. All rights reserved.

Effective production of biologically active water-soluble β-1,3-glucan by a coupled system of Agrobacterium sp. and Trichoderma harzianum.

PubMed

Liang, Ying; Zhu, Li; Gao, Minjie; Wu, Jianrong; Zhan, Xiaobei

2018-05-28

Water-soluble β-1,3-glucan (w-glucan) prepared from curdlan is reported to possess various bioactive and medicinal properties. To develop an efficient and cost-effective microbial fermentation method for the direct production of w-glucan, a coupled fermentation system of Agrobacterium sp. and Trichoderma harzianum (CFS-AT) was established. The effects of Tween-80, glucose flow rate, and the use of a dissolved oxygen (DO) control strategy on w-glucan production were assessed. The addition of 10 g L -1 Tween-80 to the CFS-AT enhanced w-glucan production, presumably by loosening the curdlan ultrastructure and increasing the efficiency of curdlan hydrolysis. A two-stage glucose and DO control strategy was optimal for w-glucan production. At the T. harzianum cell growth stage, the optimal glucose flow rate and agitation speed were 2.0 g L -1 hr -1 and 600 rpm, respectively, and at the w-glucan production stage, they were 0.5 g L -1 hr -1 and 400 rpm, respectively. W-glucan production reached 17.31 g L -1 , with a degree of polymerization of 19-25. Furthermore, w-glucan at high concentrations exhibited anti-tumor activity against MCF-7, HepG2, and Hela cancer cells in vitro. This study provides a novel, cost-effective, eco-friendly, and efficient microbial fermentation method for the direct production of biologically active w-glucan.

Immunostimulant effects and potential application of β-glucans derived from marine yeast Debaryomyces hansenii in goat peripheral blood leucocytes.

PubMed

Medina-Córdova, Noé; Reyes-Becerril, Martha; Ascencio, Felipe; Castellanos, Thelma; Campa-Córdova, Angel I; Angulo, Carlos

2018-05-12

Debaryomyces hansenii has been described to be effective probiotic and immunostimulatory marine yeast in fish. Nonetheless, to the best of our knowledge, it has been not assayed in ruminants. This study attempts to describe the immunostimulatory effects of its β-glucan content through in vitro assays using goat peripheral blood leukocytes at 24 h of stimulation. The structural characterization of yeast glucans by proton nuclear magnetic resonance indicated structures containing (1-6)-branched (1-3)-β-D-glucan. In vitro assays using peripheral blood leukocytes stimulated with β-glucans derived from three D. hansenii strains and zymosan revealed that β-glucans significantly increased cell immune parameters, such as phagocytic ability, reactive oxygen species production (respiratory burst), peroxidase activity and nitric oxide production. Antioxidant enzymes revealed an increase in superoxide dismutase and catalase activities in leukocytes stimulated with yeast β-glucans. This study revealed that yeast β-glucans were able to activate dectin-1 mRNA gene expression in leukocytes. The TLR4 gene expression was up-regulated in leukocytes after stimulation with yeast β-glucans. In conclusion, β-glucans were able to modulate the immune system by promoting cell viability, phagocytic activity, antioxidant immune response and immune-related gene expression in leukocytes. Therefore, β-glucans derived from Debaryomyces hansenii should be considered a potential immunostimulant for goat production systems. Copyright © 2018 Elsevier B.V. All rights reserved.

POLYSACCHARIDES FROM CELL WALLS OF AUREOBASIDIUM (PULLULARIA) PULLULANS. PART I. GLUCANS,

DTIC Science & Technology

The cell wall of Aureobasidium (Pullularia) pullulans contains three types of beta - glucan . One, extracted with dilute alkali, has a linear backbone...insoluble in dilute alkali contains a highly crystalline, essentially linear linked glucan and an amorphous glucan . (Author)

Aureobasidium-Derived Soluble Branched (1,3-1,6) β-Glucan (Sophy β-glucan) Enhances Natural Killer Activity in Leishmania amazonensis-Infected Mice

PubMed Central

Yatawara, Lalani; Wickramasinghe, Susiji; Nagataki, Mitsuru; Takamoto, Misa; Nomura, Haruka; Ikeue, Yasunori; Watanabe, Yoshiya

2009-01-01

The β-glucans derived from yeast cell walls have been reported for having many immunomodulatory activities in vivo and in vitro. In this study, Aureobasidium-derived soluble branched (1,3-1,6) β-glucan (Sophy β-glucan) was checked for natural killer (NK) activity and for the production of IFN-γ and IL-4 in Leishmania amazonensis infection. The main experiment was performed with a group of female C57BL/6 and BALB/c mice, orally supplemented with 5% of Sophy β-glucan and infected with promastogotes of L. amazonensis (1 × 107) into the footpad. Increase in the footpad thickness with time was observed in BALB/c mice in spite of the oral Sophy β-glucan supplement, but it was less in C57BL/6 mice. The difference in overall mean footpad thickness between 'infection only' versus 'infection + glucan' groups was statistically significant (P < 0.001). High NK activity in C57BL/6 than BALB/c mice was observed in 'glucan only' group compared to the control group and also in 'infection + glucan' group compared to 'infection only' group. The difference in the NK activity among these groups was significant (P < 0.05). The IFN-γ level increased at weeks 7 and 8 post-infection in C57BL/6 mice and was significantly high in 'infection + glucan' group compared to the 'infection only' group (P < 0.05). IL-4 levels did not increase up to detectable levels throughout the study. The results led a conclusion that Sophy β-glucan enhances NK activity and cellular immunity in L. amazonensis-infected mice. PMID:19967081

Synthesis of O- and C-glycosides derived from β-(1,3)-D-glucans.

PubMed

Marca, Eduardo; Valero-Gonzalez, Jessika; Delso, Ignacio; Tejero, Tomás; Hurtado-Guerrero, Ramon; Merino, Pedro

2013-12-15

A series of β-(1,3)-d-glucans have been synthesized incorporating structural variations specifically on the reducing end of the oligomers. Both O- and C-glucosides derived from di- and trisaccharides have been obtained in good overall yields and with complete selectivity. Whereas the O-glycosides were obtained via a classical Koenigs-Knorr glycosylation, the corresponding C-glycosides were obtained through allylation of the anomeric carbon and further cross-metathesis reaction. Finally, the compounds were evaluated against two glycosidases and two endo-glucanases and no inhibitory activity was observed. Copyright © 2013 Elsevier Ltd. All rights reserved.

Elongated phytoglycogen chain length in transgenic rice endosperm expressing active starch synthase IIa affects the altered solubility and crystallinity of the storage α-glucan

PubMed Central

Fujita, Naoko; Toyosawa, Yoshiko; Utsumi, Yoshinori

2012-01-01

The relationship between the solubility, crystallinity, and length of the unit chains of plant storage α-glucan was investigated by manipulating the chain length of α-glucans accumulated in a rice mutant. Transgenic lines were produced by introducing a cDNA for starch synthase IIa (SSIIa) from an indica cultivar (SSIIa I, coding for active SSIIa) into an isoamylase1 (ISA1)-deficient mutant (isa1) that was derived from a japonica cultivar (bearing inactive SSIIa proteins). The water-soluble fraction accounted for >95% of the total α-glucan in the isa1 mutant, whereas it was only 35–70% in the transgenic SSIIa I /isa1 lines. Thus, the α-glucans from the SSIIa I /isa1 lines were fractionated into soluble and insoluble fractions prior to the following characterizations. X-ray diffraction analysis revealed a weak B-type crystallinity for the α-glucans of the insoluble fraction, while no crystallinity was confirmed for α-glucans in isa1. Concerning the degree of polymerization (DP) ≤30, the chain lengths of these α-glucans differed significantly in the order of SSIIa I /isa1 insoluble > SSIIa I /isa1 soluble > α-glucans in isa1. The amount of long chains with DP ≥33 was higher in the insoluble fraction α-glucans than in the other two α-glucans. No difference was observed in the chain length distributions of the β-amylase limit dextrins among these α-glucans. These results suggest that in the SSIIa I /isa1 transgenic lines, the unit chains of α-glucans were elongated by SSIIaI, whereas the expression of SSIIaI did not affect the branch positions. Thus, the observed insolubility and crystallinity of the insoluble fraction can be attributed to the elongated length of the outer chains due to SSIIaI. PMID:23048127

Oral Administration of N-Acetyl-D Glucosamine Polymer Particles Down-Regulates Airway Allergic Responses

DTIC Science & Technology

2005-03-01

detection with flow cytometry. Cancer . 85:2359-67. 18. Justice JP, Shibata Y, Sur S, Mustafa J, Fan M, Van Scott MR. 2001. IL-10 gene knockout attenuates...primed donors. Regional Immunol., 2, 169-175. 7. Druker, B. J., Wepsic, H. T. (1983) BCG-induced macrophages as suppressor cells. Cancer Investig. 1:151...however, have significantly lower binding affinities to de-acetylated glucosamine sugar residues (31). Dectin-1/[3- glucan CLR, on the other hand

Effects of Purified Saccharomyces cerevisiae (1→3)-β-Glucan on Venous Ulcer Healing

PubMed Central

Medeiros, Sarah Dantas Viana; Cordeiro, Sara Lima; Cavalcanti, Jéssica Escorel Chaves; Melchuna, Karina Mendes; Lima, Aleida Maria da Silva; Filho, Irami Araújo; Medeiros, Aldo Cunha; Rocha, Keyla Borges Ferreira; Oliveira, Elizabeth Maia; Faria, Eduardo Dantas Baptista; Sassaki, Guilherme Lanzi; Rocha, Hugo Alexandre Oliveira; Sales, Valéria Soraya Farias

2012-01-01

Water-insoluble glucan was isolated from the baker’s yeast Saccharomyces cerevisiae. The yeast cells were treated with alkali and the residue then with acid. Chemical and NMR (1D and 2D) analyses showed that a linear (1→3)-β-glucan was purified that was not contaminated with other carbohydrates, proteins or phenolic compounds. The effects of the glucan on wound healing were assessed in human venous ulcers by histopathological analysis after 30 days of topical treatment. (1→3)-β-glucan enhanced ulcer healing and increased epithelial hyperplasia, as well as increased inflammatory cells, angiogenesis and fibroblast proliferation. In one patient who had an ulcer that would not heal for over 15 years, glucan treatment caused a 67.8% decrease in the area of the ulcer. This is the first study to investigate the effects of (1→3)-β-glucan on venous ulcer healing in humans; our findings suggest that this glucan is a potential natural biological response modifier in wound healing. PMID:22942695

Potential of glucans as vaccine adjuvants: A review of the α-glucans case.

PubMed

Moreno-Mendieta, Silvia; Guillén, Daniel; Hernández-Pando, Rogelio; Sánchez, Sergio; Rodríguez-Sanoja, Romina

2017-06-01

α-Glucans are present in virtually all domains of life, and these glucose chains linked by α-1,4- and α-1,6-linked branches form the most important storage carbohydrates in cells. It is likely for this reason that α-glucans are not generally considered as bioactive molecules as β-glucans are. Nevertheless, it is known that depending on their source, many α-glucans play important roles as modulators of immune response. Recent efforts have attempted to elucidate the mechanisms through which α-glucans exert their immunostimulant effects; however, the main challenge is the accurate identification of the receptors of immune cells involved in their recognition. Here, we review the adjuvant properties reported for some polysaccharides and ultimately focus on α-glucans and how their structural characteristics, such as molecular weight, solubility and derivatization, influence their immunostimulatory properties. As a final point, we discuss the potential and associated challenges of using these polysaccharides as adjuvants, particularly in mucosal vaccination. Copyright © 2017 Elsevier Ltd. All rights reserved.

Physicochemical properties of beta-glucan in differently processed oat foods influence glycemic response.

PubMed

Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J

2009-10-14

To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.

Immunomodulatory effects of beta-glucan on neutrophil function in fathead minnows (Pimephales promelas Rafinesque, 1820).

PubMed

Palić, Dusan; Andreasen, Claire B; Herolt, Dawn M; Menzel, Bruce W; Roth, James A

2006-01-01

Stimulatory effects of yeast beta-1,3-1,6-glucans on neutrophils have long been recognized, but effects of glucans on degranulation of primary granules in fish neutrophils have not been previously reported. Neutrophil function was monitored during in vitro and in vivo application of glucans to non- (NS), acute- (AS) and chronically stressed (CS) fish. beta-Glucan proved to be a strong and quick (80%, 2 min) stimulant of degranulation. Dietary glucan increased degranulation in NS fish, and prevented a decrease in AS fish. Degranulation in CS fish returned to NS levels 3 days after the glucan diet was fed. Fathead minnows appear to be a useful model to investigate neutrophil degranulation in fish exposed to different environmental conditions and immunomodulators. Use of beta-glucans in fish diets prior to AS and during chronic stress can enhance neutrophil function, potentially increasing disease resistance and survival rates after transportation or exposure to poor water quality.

The dynamics of cereal cyst nematode infection differ between susceptible and resistant barley cultivars and lead to changes in (1,3;1,4)-β-glucan levels and HvCslF gene transcript abundance.

PubMed

Aditya, Jessika; Lewis, John; Shirley, Neil J; Tan, Hwei-Ting; Henderson, Marilyn; Fincher, Geoffrey B; Burton, Rachel A; Mather, Diane E; Tucker, Matthew R

2015-07-01

Heterodera avenae (cereal cyst nematode, CCN) infects the roots of barley (Hordeum vulgare) forming syncytial feeding sites. In resistant host plants, relatively few females develop to maturity. Little is known about the physiological and biochemical changes induced during CCN infection. Responses to CCN infection were investigated in resistant (Rha2) and susceptible barley cultivars through histological, compositional and transcriptional analysis. Two phases were identified that influence CCN viability, including feeding site establishment and subsequent cyst maturation. Syncytial development progressed faster in the resistant cultivar Chebec than in the susceptible cultivar Skiff, and was accompanied by changes in cell wall polysaccharide abundance, particularly (1,3;1,4)-β-glucan. Transcriptional profiling identified several glycosyl transferase genes, including CELLULOSE SYNTHASE-LIKE F10 (HvCslF10), which may contribute to differences in polysaccharide abundance between resistant and susceptible cultivars. In barley, Rha2-mediated CCN resistance drives rapid deterioration of CCN feeding sites, specific changes in cell wall-related transcript abundance and changes in cell wall composition. During H. avenae infection, (1,3;1,4)-β-glucan may influence CCN feeding site development by limiting solute flow, similar to (1,3)-β-glucan during dicot cyst nematode infections. Dynamic transcriptional changes in uncharacterized HvCslF genes, possibly involved in (1,3;1,4)-β-glucan synthesis, suggest a role for these genes in the CCN infection process. © 2015 The University of Adelaide. New Phytologist © 2015 New Phytologist Trust.

Effect of storage conditions on the solubility and viscosity of β-glucan extracted from bread under in vitro conditions.

PubMed

Moriartey, Stephanie; Temelli, Feral; Vasanthan, Thava

2011-01-01

The viscosity and solubility of β-glucan in muffins have been shown to be reduced by certain storage conditions, though the effect of storage on bread fortified with barley β-glucan concentrate has not been investigated. Therefore, this study investigated the effect of storage temperature and time (23 °C for 1, 4, and 7 d, 4 °C for 4, 7, and 14 d, and -20 °C for 1, 2, 4, and 8 wk) on the solubility and viscosity of β-glucan upon incorporation into bread at levels corresponding to 0 or 1.5 g β-glucan/serving, with or without vital gluten addition. The firmness and moisture content of bread following each storage treatment were also evaluated. The highest moisture and lowest firmness values were found in fresh bread, though these parameters were still maintained at appreciable levels upon room temperature storage of the 1.5 g β-glucan/serving bread with added gluten and at either room temperature or frozen storage for the 1.5 g β-glucan/serving bread for 4 d. If it is desirable to store bread for 7 d or more, frozen storage should be utilized in order to best maintain bread moisture and firmness levels. It is recommended that β-glucan-fortified bread be consumed fresh for greatest β-glucan solubility and viscosity, though β-glucan solubility of approximately 40% is still achievable upon frozen storage of the bread for up to 2 wk. It is still unclear, however, as to what extent of reductions in the solubility and viscosity of β-glucan would lower its physiological effectiveness. Previous research has demonstrated that solubility and thus viscosity of β-glucan, which is an important property associated with its health benefits can be impacted by different storage conditions applied to some bakery products, like muffins. This study demonstrates the extent of changes in the solubility and viscosity of β-glucan incorporated into bread. Therefore, storage time and temperature should be optimized to minimize changes in β-glucan for maintaining its efficacy for its health benefits.

Dendritic Cell Activation by Glucan Isolated from Umbilicaria Esculenta

PubMed Central

Kim, Hyung Sook; Kim, Jee Youn; Lee, Hong Kyung; Kim, Moo Sung; Lee, Sang Rin; Kang, Jong Soon; Kim, Hwan Mook; Lee, Kyung-Ae; Hong, Jin Tae; Kim, Youngsoo

2010-01-01

Background Lichen-derived glucans have been known to stimulate the functions of immune cells. However, immunostimulatory activity of glucan obtained from edible lichen, Umbilicaria esculenta, has not been reported. Thus we evaluated the phenotype and functional maturation of dendritic cells (DCs) following treatment of extracted glucan (PUE). Methods The phenotypic and functional maturation of PUE-treated DCs was assessed by flow cytometric analysis and cytokine production, respectively. PUE-treated DCs was also used for mixed leukocyte reaction to evaluate T cell-priming capacity. Finally we detected the activation of MAPK and NF-κB by immunoblot. Results Phenotypic maturation of DCs was shown by the elevated expressions of CD40, CD80, CD86, and MHC class I/II molecules. Functional activation of DCs was proved by increased cytokine production of IL-12, IL-1β, TNF-α, and IFN-α/β, decreased endocytosis, and enhanced proliferation of allogenic T cells. Polymyxin B, specific inhibitor of lipopolysaccharide (LPS), did not affect PUE activity, which suggested that PUE was free of LPS contamination. As a mechanism of action, PUE increased phosphorylation of ERK, JNK, and p38 MAPKs, and enhanced nuclear translocation of NF-κB p50/p65 in DCs. Conclusion These results indicate that PUE induced DC maturation via MAPK and NF-κB signaling pathways. PMID:21286379

The structure of a β-(1→3)-d-glucan from yeast cell walls

PubMed Central

Manners, David J.; Masson, Alan J.; Patterson, James C.

1973-01-01

Yeast glucan as normally prepared by various treatments of yeast (Saccharomyces cerevisiae) cell walls to remove mannan and glycogen is still heterogeneous. The major component (about 85%) is a branched β-(1→3)-glucan of high molecular weight (about 240000) containing 3% of β-(1→6)-glucosidic interchain linkages. The minor component is a branched β-(1→6)-glucan. A comparison of our results with those of other workers suggests that different glucan preparations may differ in the degree of heterogeneity and that the major β-(1→3)-glucan component may vary considerably in degree of branching. PMID:4359920

Histoplasma capsulatum α-(1,3)-glucan blocks innate immune recognition by the β-glucan receptor

PubMed Central

Rappleye, Chad A.; Eissenberg, Linda Groppe; Goldman, William E.

2007-01-01

Successful infection by fungal pathogens depends on subversion of host immune mechanisms that detect conserved cell wall components such as β-glucans. A less common polysaccharide, α-(1,3)-glucan, is a cell wall constituent of most fungal respiratory pathogens and has been correlated with pathogenicity or linked directly to virulence. However, the precise mechanism by which α-(1,3)-glucan promotes fungal virulence is unknown. Here, we show that α-(1,3)-glucan is present in the outermost layer of the Histoplasma capsulatum yeast cell wall and contributes to pathogenesis by concealing immunostimulatory β-glucans from detection by host phagocytic cells. Production of proinflammatory TNFα by phagocytes was suppressed either by the presence of the α-(1,3)-glucan layer on yeast cells or by RNA interference based depletion of the host β-glucan receptor dectin-1. Thus, we have functionally defined key molecular components influencing the initial host–pathogen interaction in histoplasmosis and have revealed an important mechanism by which H. capsulatum thwarts the host immune system. Furthermore, we propose that the degree of this evasion contributes to the difference in pathogenic potential between dimorphic fungal pathogens and opportunistic fungi. PMID:17227865

The β‐1,3‐glucanosyltransferases (Gels) affect the structure of the rice blast fungal cell wall during appressorium‐mediated plant infection

PubMed Central

Samalova, Marketa; Mélida, Hugo; Vilaplana, Francisco; Bulone, Vincent; Soanes, Darren M.; Talbot, Nicholas J.

2016-01-01

Abstract The fungal wall is pivotal for cell shape and function, and in interfacial protection during host infection and environmental challenge. Here, we provide the first description of the carbohydrate composition and structure of the cell wall of the rice blast fungus Magnaporthe oryzae. We focus on the family of glucan elongation proteins (Gels) and characterize five putative β‐1,3‐glucan glucanosyltransferases that each carry the Glycoside Hydrolase 72 signature. We generated targeted deletion mutants of all Gel isoforms, that is, the GH72+, which carry a putative carbohydrate‐binding module, and the GH72− Gels, without this motif. We reveal that M. oryzae GH72 + GELs are expressed in spores and during both infective and vegetative growth, but each individual Gel enzymes are dispensable for pathogenicity. Further, we demonstrated that a Δgel1Δgel3Δgel4 null mutant has a modified cell wall in which 1,3‐glucans have a higher degree of polymerization and are less branched than the wild‐type strain. The mutant showed significant differences in global patterns of gene expression, a hyper‐branching phenotype and no sporulation, and thus was unable to cause rice blast lesions (except via wounded tissues). We conclude that Gel proteins play significant roles in structural modification of the fungal cell wall during appressorium‐mediated plant infection. PMID:27568483

Immune-modulatory effects of dietary Yeast Beta-1,3/1,6-D-glucan

PubMed Central

2014-01-01

Beta-glucans are a heterogeneous group of natural polysaccharides mostly investigated for their immunological effects. Due to the low systemic availability of oral preparations, it has been thought that only parenterally applied beta-glucans can modulate the immune system. However, several in vivo and in vitro investigations have revealed that orally applied beta-glucans also exert such effects. Various receptor interactions, explaining possible mode of actions, have been detected. The effects mainly depend on the source and structure of the beta-glucans. In the meantime, several human clinical trials with dietary insoluble yeast beta-glucans have been performed. The results confirm the previous findings of in vivo studies. The results of all studies taken together clearly indicate that oral intake of insoluble yeast beta-glucans is safe and has an immune strengthening effect. PMID:24774968

Immunomodulation of Fungal β-Glucan in Host Defense Signaling by Dectin-1

PubMed Central

Batbayar, Sainkhuu; Lee, Dong Hee; Kim, Ha Won

2012-01-01

During the course of evolution, animals encountered the harmful effects of fungi, which are strong pathogens. Therefore, they have developed powerful mechanisms to protect themselves against these fungal invaders. β-Glucans are glucose polymers of a linear β(1,3)-glucan backbone with β(1,6)-linked side chains. The immunostimulatory and antitumor activities of β-glucans have been reported; however, their mechanisms have only begun to be elucidated. Fungal and particulate β-glucans, despite their large size, can be taken up by the M cells of Peyer's patches, and interact with macrophages or dendritic cells (DCs) and activate systemic immune responses to overcome the fungal infection. The sampled β-glucans function as pathogen-associated molecular patterns (PAMPs) and are recognized by pattern recognition receptors (PRRs) on innate immune cells. Dectin-1 receptor systems have been incorporated as the PRRs of β-glucans in the innate immune cells of higher animal systems, which function on the front line against fungal infection, and have been exploited in cancer treatments to enhance systemic immune function. Dectin-1 on macrophages and DCs performs dual functions: internalization of β-glucan-containing particles and transmittance of its signals into the nucleus. This review will depict in detail how the physicochemical nature of β-glucan contributes to its immunostimulating effect in hosts and the potential uses of β-glucan by elucidating the dectin-1 signal transduction pathway. The elucidation of β-glucan and its signaling pathway will undoubtedly open a new research area on its potential therapeutic applications, including as immunostimulants for antifungal and anti-cancer regimens. PMID:24009832

Translational Development and Application of (1→3)-β-d-Glucan for Diagnosis and Therapeutic Monitoring of Invasive Mycoses

PubMed Central

McCarthy, Matthew W.; Petraitiene, Ruta; Walsh, Thomas J.

2017-01-01

Early diagnosis and prompt initiation of appropriate antimicrobial therapy are crucial steps in the management of patients with invasive fungal infections. However, the diagnosis of invasive mycoses remains a major challenge in clinical practice, because presenting symptoms may be subtle and non-invasive diagnostic assays often lack sensitivity and specificity. Diagnosis is often expressed on a scale of probability (proven, probable and possible) based on a constellation of imaging findings, microbiological tools and histopathology, as there is no stand-alone assay for diagnosis. Recent data suggest that the carbohydrate biomarker (1→3)-β-d-glucan may be useful in both the diagnosis and therapeutic monitoring of invasive fungal infections due to some yeasts, molds, and dimorphic fungi. In this paper, we review recent advances in the use of (1→3)-β-d-glucan to monitor clinical response to antifungal therapy and explore how this assay may be used in the future. PMID:28538702

Re-examination of cellular cyclic beta-1,2-glucans of Rhizobiaceae: distribution of ring sizes and degrees of glycerol-1-phosphate substitution.

PubMed

Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H

1990-04-01

Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.

Aureobasidium pullulans produced β-glucan is effective to enhance Kurosengoku soybean extract induced Thrombospondin-1 expression.

PubMed

Muramatsu, Daisuke; Okabe, Mitsuyasu; Takaoka, Akinori; Kida, Hiroshi; Iwai, Atsushi

2017-06-06

Black yeast, Aureobasidium pullulans is extracellularly produced β-(1,3), (1,6)-D-glucan (β-glucan) under certain conditions. In this study, using Glycine max cv. Kurosengoku (Kurosengoku soybeans), the production of β-glucan through fermentation of A. pullulans was evaluated, and the effects of A. pullulans cultured fluid (AP-CF) containing β-glucan made with Kurosengoku soybeans (kAP-CF) on a human monocyte derived cell line, Mono Mac 6 cells were investigated. Concentration of β-glucan in kAP-CF reached the same level as normal AP-CF. An anti-angiogenic protein, Thrombospondin-1 (THBS1) was effectively induced after the stimulation with kAP-CF for comparison with AP-CF. The THBS1 is also induced after stimulation with hot water extract of Kurosengoku soybeans (KS-E), while the combined stimulation of β-glucan with KS-E more effectively induced THBS1 than that with KS-E alone. These results suggest effects of A. pullulans-produced β-glucan on the enhancement of Kurosengoku soybean-induced THBS1 expression.

Stimulated hemopoiesis and enhanced survival following glucan treatment in sublethally and lethally irradiated mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patchen, M.L.; MacVittie, T.J.

1985-01-01

Hemopoietic effects of the reticuloendothelial agent glucan were assayed in normal mice and in mice hemopoietically depleted by exposure to /sup 60/Co radiation. In normal mice, glucan administration increased the content of bone marrow and splenic transplantable pluripotent hemopoietic stem cells (CFU-2), committed granulocyte-macrophage progenitor cells (GM-CFC), and pure macrophage progenitor cells (M-CFC). Erythroid progenitor cells (CFU-e) were increased only in the spleen. In sublethally irradiated mice (650 rads), glucan increased the number of endogeneous pluripotent hemopoietic stem cells (E-CFU) when administered either before or after irradiation. The most pronounced effects were observed when glucan was administered 1 day before,more » 1 h before, or 1 h after irradiation. In addition, the administration of glucan before lethal irradiation (900 rads) enhanced survival. The most significant results were seen when glucan was administered 1 day prior to irradiation. The possibility of using agents such as glucan to enhance hemopoietic reconstitution and prevent septicemia following chemotherapy and/or radiotherapy is discussed.« less

Effect of γ-irradiation on structure and nutraceutical potential of β-D-glucan from barley (Hordeum vulgare).

PubMed

Shah, Asima; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Gani, Adil; Masoodi, Farooq Ahmad; Wani, Idrees Ahmed; Wani, Sajad Mohd; Gani, Asir

2015-01-01

This paper reports the characterization and potential antioxidant activity of β-D-glucan isolated from barley treated with γ-rays. The β-D-glucan was irradiated with 0, 2, 4 and 8 kGy by gamma ray. The samples were characterized by Fourier transform-infrared spectroscopy, gel permeation chromatography (GPC) and quantitative estimation by Megazyme β-D-glucan assay kit. The average molecular weight of non-irradiated β-D-glucan was 177 kDa that decreased to 79 kDa at 8 kGy. Antioxidant activity was evaluated by five complementary assays including DPPH, lipid peroxidation, reducing power, metal chelating ability and oxidative DNA damage assays. Further, the antiproliferative potential of irradiated β-D-glucan was tested against three human cancer cell lines including Colo-205, T47D and MCF7 using MTT assay. Irradiated β-D-glucan exhibited dose dependent cancer cell growth inhibition. In conclusion, the present study demonstrates that irradiation leads to the formation of low molecular weight β-D-glucan with enhanced antioxidant and antiproliferative activities. Copyright © 2014 Elsevier B.V. All rights reserved.

(1→6)- and (1→3)(1→6)-β-glucans from Lasiodiplodia theobromae MMBJ: Structural characterization and pro-inflammatory activity.

PubMed

Oliveira, Kassandra S M; Di Bastiani, Mirela; Cordeiro, Lucimara M C; Costa, Mírian F; Toledo, Karina A; Iacomini, Marcello; Babosa, Aneli M; Dekker, Robert F H; Nascimento, Valéria M G

2015-11-20

The chemical composition and structural characterization of exopolysaccharides from the fungus Lasiodiplodia theobromae MMBJ are described, and the immunomodulatory activity of a purified β-glucan was evaluated. L. theobromae MMBJ produced three different β-glucans. One, fraction PEPS, was a branched (1→3)(1→6)-β-glucan and was insoluble in cold water. The other two, fractions SEPS-005R and SEPS-10E, were characterized as linear (1→6)-β-glucans with molar mass of 1.8×10(6)Da and 7.0×10(3)Da, respectively. From a total of 2.2g/L of EPS produced by L. theobromae through submerged fermentation, 1.5g/L (67%) was of the branched (1→3)(1→6)-β-glucan, while 25% (w/w) were linear (1→6)-β-glucans. Tests conducted with macrophages showed that the high molar mass (1→6)-β-glucan fraction (SEPS-005R) induced a pro-inflammatory response pattern. Copyright © 2015 Elsevier Ltd. All rights reserved.

Macrophage Internalization of Fungal β-Glucans Is Not Necessary for Initiation of Related Inflammatory Responses

PubMed Central

McCann, Frances; Carmona, Eva; Puri, Vishwajeet; Pagano, Richard E.; Limper, Andrew H.

2005-01-01

Cell wall β-glucans are highly conserved structural components of fungi that potently trigger inflammatory responses in an infected host. Identification of molecular mechanisms responsible for internalization and signaling of fungal β-glucans should enhance our understanding of innate immune responses to fungi. In this study, we demonstrated that internalization of fungal β-glucan particles requires actin polymerization but not participation of components of caveolar uptake mechanisms. Using fluorescence microscopy, we observed that uptake of 5-([4,6-dichlorotriazin-2-yl] amino)-fluorescein hydrochloride-Celite complex-labeled Saccharomyces cerevisiae β-glucan by RAW macrophages was substantially reduced in the presence of cytochalasin D, which antagonizes actin-mediated internalization pathways, but not by treatment with nystatin, which blocks caveolar uptake. Interestingly, β-glucan-induced NF-κB translocation, which is necessary for inflammatory activation, and tumor necrosis factor alpha production were both normal in the presence of cytochalasin D, despite defective internalization of β-glucan particles following actin disruption. Dectin-1, a major β-glucan receptor on macrophages, colocalized to phagocytic cups on macrophages and exhibited tyrosine phosphorylation after challenge with β-glucan particles. Dectin-1 localization and other membrane markers were not affected by treatment with cytochalasin D. Furthermore, dectin-1 receptors rather than Toll-like receptor 2 receptors were shown to be necessary for both efficient internalization of β-glucan particles and cytokine release in response to the fungal cell wall component. PMID:16177305

Effect of purified oat β-glucan on fermentation of set-style yogurt mix.

PubMed

Singh, Mukti; Kim, Sanghoon; Liu, Sean X

2012-08-01

Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.

Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing

PubMed Central

White, P. Lewis; Wingard, John R.; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F.; Slavin, Monica A.; Barnes, Rosemary A.; Pappas, Peter G.; Donnelly, J. Peter

2015-01-01

Background. Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. Methods. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. Results. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%–88.0% and 75.0%–94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. Conclusions. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. PMID:26113653

Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing.

PubMed

White, P Lewis; Wingard, John R; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F; Slavin, Monica A; Barnes, Rosemary A; Pappas, Peter G; Donnelly, J Peter

2015-10-15

Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%-88.0% and 75.0%-94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

Amphiphilic polymeric micelles originating from 1,4-β-D-glucan-g-polyphenylene oxide as the carriers for delivery of docetaxel and the corresponding release behaviors.

PubMed

Yang, Fang; Xiao, Dan; Han, Huaxin; Chen, Yuhuan; Li, Gang

2018-07-15

A novel amphiphilic polymeric drug carrier was synthesized through grafting polymerization of water-soluble 1,4-β-D-glucan from cotton cellulose tailored and polypropylene oxide (PPO), and then use thereof to synthesize graft copolymer 1,4-β-D-glucan-PPO-docetaxel (DTX). The products were characterized by FTIR, 1 H NMR, and 13 C NMR. The physicochemical characteristics of 1,4-β-D-glucan-PPO and 1,4-β-D-glucan-PPO-DTX such as molecular weight distribution (MWD), micro-morphology, size, critical micelle concentration (CMC), aggregation number of micelle (N), in vitro stability and drug pharmacokinetic study in vivo were investigated. The results reveal that the degree of polymerization (DP) of the water-soluble 1,4-β-D-glucan from cotton cellulose tailored is equal to 7; the 1,4-β-D-glucan-PPO surfactant possesses good surface activity while the adduct number of propylene oxide reaches appropriately to 20; the DTX is completely dispersed in water medium with 1,4-β-D-glucan-PPO-DTX micelle and the drug conjugated percent is up to 40.3%; In vitro study confirms that 1,4-β-D-glucan-PPO-DTX has the capacity for sustained drug release; In plasma, 1,4-β-D-glucan-PPO-DTX exhibits a significantly enhanced C max , AUC (0-t) and T 1/2 compared with DTX. These results demonstrate that 1,4-β-D-glucan-PPO has the potential to be used as a novel biocompatible biomaterial for drug delivery. Copyright © 2018 Elsevier B.V. All rights reserved.

Metabolic Network for the Biosynthesis of Intra- and Extracellular α-Glucans Required for Virulence of Mycobacterium tuberculosis

PubMed Central

van de Weerd, Robert; Chandra, Govind; Appelmelk, Ben; Alber, Marina; Ioerger, Thomas R.; Jacobs, William R.; Geurtsen, Jeroen; Bornemann, Stephen

2016-01-01

Mycobacterium tuberculosis synthesizes intra- and extracellular α-glucans that were believed to originate from separate pathways. The extracellular glucose polymer is the main constituent of the mycobacterial capsule that is thought to be involved in immune evasion and virulence. However, the role of the α-glucan capsule in pathogenesis has remained enigmatic due to an incomplete understanding of α-glucan biosynthetic pathways preventing the generation of capsule-deficient mutants. Three separate and potentially redundant pathways had been implicated in α-glucan biosynthesis in mycobacteria: the GlgC-GlgA, the Rv3032 and the TreS-Pep2-GlgE pathways. We now show that α-glucan in mycobacteria is exclusively assembled intracellularly utilizing the building block α-maltose-1-phosphate as the substrate for the maltosyltransferase GlgE, with subsequent branching of the polymer by the branching enzyme GlgB. Some α-glucan is exported to form the α-glucan capsule. There is an unexpected convergence of the TreS-Pep2 and GlgC-GlgA pathways that both generate α-maltose-1-phosphate. While the TreS-Pep2 route from trehalose was already known, we have now established that GlgA forms this phosphosugar from ADP-glucose and glucose 1-phosphate 1000-fold more efficiently than its hitherto described glycogen synthase activity. The two routes are connected by the common precursor ADP-glucose, allowing compensatory flux from one route to the other. Having elucidated this unexpected configuration of the metabolic pathways underlying α-glucan biosynthesis in mycobacteria, an M. tuberculosis double mutant devoid of α-glucan could be constructed, showing a direct link between the GlgE pathway, α-glucan biosynthesis and virulence in a mouse infection model. PMID:27513637

β-Glucan from Saccharomyces cerevisiae Induces IFN-γ Production In Vivo in BALB/c Mice.

PubMed

Javmen, Artur; Nemeikaitė-Čėnienė, Aušra; Bratchikov, Maksim; Grigiškis, Saulius; Grigas, Fortūnatas; Jonauskienė, Irena; Zabulytė, Danguolė; Mauricas, Mykolas

2015-01-01

β-Glucan is one of the most abundant polymers in nature and has been established as an immunomodulator. This compound has notable physiological effects on mammalian immune systems, including anti-tumor and anti-infective activities and can activate the immune response. It is considered that the immune-stimulating activities of β-glucan can depend on physicochemical parameters, such as molecular size. Saccharomyces cerevisiae, also known as baker's yeast, is a frequently used source of β-glucan. The aim of the experiments was to investigate how different Saccharomyces cerevisiae β-glucan preparations with different molecular size affect interferon-gamma (IFN-γ) production in BALB/c mice. In vivo and in vitro BALB/c mouse models were used for the investigations. Different β-glucan preparations were orally administrated in the in vivo experiments. IFN-γ production in BALB/c mice was analyzed by enzyme-linked immunosorbent assay and measuring interferon-γ RNA concentration. The results showed that orally-administered β-glucan from S. cerevisiae enhanced IFN-γ production in BALB/c mice in the in vivo model, but not by mouse leukocytes in vitro. Moreover, water-soluble β-glucan enhanced IFN-γ production more effectively than did particulate β-glucan. IFN-γ plays an important role in immunity against viral and bacterial infections. Our experiments have shown that β-glucan preparations enhance IFN-γ production in BALB/c mice and can be potentially used for immune system stimulation in mammals. Current results may be used to develop soluble β-glucan nutritional supplements. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Simultaneous intake of beta-glucan and plant stanol esters affects lipid metabolism in slightly hypercholesterolemic subjects.

PubMed

Theuwissen, Elke; Mensink, Ronald P

2007-03-01

Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.

High Molecular Weight Barley β-Glucan Alters Gut Microbiota Toward Reduced Cardiovascular Disease Risk

PubMed Central

Wang, Yanan; Ames, Nancy P.; Tun, Hein M.; Tosh, Susan M.; Jones, Peter J.; Khafipour, Ehsan

2016-01-01

The physiological cholesterol-lowering benefits of β-glucan have been well documented, however, whether modulation of gut microbiota by β-glucan is associated with these physiological effects remains unknown. The objectives of this study were therefore to determine the impact of β-glucan on the composition of gut microbiota in mildly hypercholesterolemic individuals and to identify if the altered microbiota are associated with bioactivity of β-glucan in improving risk factors of cardiovascular disease (CVD). Using a randomized, controlled crossover study design, individuals received for 5-week either a treatment breakfast containing 3 g high molecular weight (HMW), 3 g low molecular weight (LMW), 5 g LMW barley β-glucan, or wheat and rice. The American Heart Association (AHA) diet served as the background diet for all treatment groups. Phases were separated by 4-week washout periods. Fecal samples were collected at the end of each intervention phase and subjected to Illumina sequencing of 16S rRNA genes. Results revealed that at the phylum level, supplementation of 3 g/d HMW β-glucan increased Bacteroidetes and decreased Firmicutes abundances compared to control (P < 0.001). At the genus level, consumption of 3 g/d HMW β-glucan increased Bacteroides (P < 0.003), tended to increase Prevotella (P < 0.1) but decreased Dorea (P < 0.1), whereas diets containing 5 g LMW β-glucan and 3 g LMW β-glucan failed to alter the gut microbiota composition. Bacteroides, Prevotella, and Dorea composition correlated (P < 0.05) with shifts of CVD risk factors, including body mass index, waist circumference, blood pressure, as well as triglyceride levels. Our data suggest that consumption of HMW β-glucan favorably alters the composition of gut microbiota and this altered microbiota profile associates with a reduction of CVD risk markers. Together, our study suggests that β-glucan induced shifts in gut microbiota in a MW-dependent manner and that might be one of the underlying mechanisms responsible for the physiological benefits of β-glucan. PMID:26904005

Passive Immunization with Milk Produced from an Immunized Cow Prevents Oral Recolonization by Streptococcus mutans

PubMed Central

Shimazaki, Yoshihiro; Mitoma, Morihide; Oho, Takahiko; Nakano, Yoshio; Yamashita, Yoshihisa; Okano, Kaoru; Nakano, Yutaka; Fukuyama, Masataka; Fujihara, Noboru; Nada, Youichi; Koga, Toshihiko

2001-01-01

Cell surface protein antigen (PAc) and water-insoluble glucan-synthesizing enzyme (GTF-I) produced by cariogenic Streptococcus mutans are two major factors implicated in the colonization of the human oral cavity by this bacterium. We examined the effect of bovine milk, produced after immunization with a fusion protein of functional domains of these proteins, on the recolonization of S. mutans. To prepare immune milk, a pregnant Holstein cow was immunized with the fusion protein PAcA-GB, a fusion of the saliva-binding alanine-rich region (PAcA) of PAc and the glucan-binding (GB) domain of GTF-I. After eight adult subjects received cetylpyridinium chloride (CPC) treatment, one subgroup (n = 4) rinsed their mouths with immune milk and a control group (n = 4) rinsed with nonimmune milk. S. mutans levels in saliva and dental plaque decreased after CPC treatment in both groups. Mouth rinsing with immune milk significantly inhibited recolonization of S. mutans in saliva and plaque. On the other hand, the numbers of S. mutans cells in saliva and plaque in the control group increased immediately after the CPC treatment and surpassed the baseline level 42 and 28 days, respectively, after the CPC treatment. The ratios of S. mutans to total streptococci in saliva and plaque in the group that received immune milk were lower than those in the control group. These results suggest that milk produced from immunized cow may be useful for controlling S. mutans in the human oral cavity. PMID:11687453

Overlapping functions of the starch synthases SSII and SSIII in amylopectin biosynthesis in Arabidopsis

PubMed Central

Zhang, Xiaoli; Szydlowski, Nicolas; Delvallé, David; D'Hulst, Christophe; James, Martha G; Myers, Alan M

2008-01-01

Background The biochemical mechanisms that determine the molecular architecture of amylopectin are central in plant biology because they allow long-term storage of reduced carbon. Amylopectin structure imparts the ability to form semi-crystalline starch granules, which in turn provides its glucose storage function. The enzymatic steps of amylopectin biosynthesis resemble those of the soluble polymer glycogen, however, the reasons for amylopectin's architectural distinctions are not clearly understood. The multiplicity of starch biosynthetic enzymes conserved in plants likely is involved. For example, amylopectin chain elongation in plants involves five conserved classes of starch synthase (SS), whereas glycogen biosynthesis typically requires only one class of glycogen synthase. Results Null mutations were characterized in AtSS2, which codes for SSII, and mutant lines were compared to lines lacking SSIII and to an Atss2, Atss3 double mutant. Loss of SSII did not affect growth rate or starch quantity, but caused increased amylose/amylopectin ratio, increased total amylose, and deficiency in amylopectin chains with degree of polymerization (DP) 12 to DP28. In contrast, loss of both SSII and SSIII caused slower plant growth and dramatically reduced starch content. Extreme deficiency in DP12 to DP28 chains occurred in the double mutant, far more severe than the summed changes in SSII- or SSIII-deficient plants lacking only one of the two enzymes. Conclusion SSII and SSIII have partially redundant functions in determination of amylopectin structure, and these roles cannot be substituted by any other conserved SS, specifically SSI, GBSSI, or SSIV. Even though SSIII is not required for the normal abundance of glucan chains of DP12 to DP18, the enzyme clearly is capable of functioning in production such chains. The role of SSIII in producing these chains cannot be detected simply by analysis of an individual mutation. Competition between different SSs for binding to substrate could in part explain the specific distribution of glucan chains within amylopectin. PMID:18811962

Barley and Oat beta-Glucan content measured by Calcofluor fluorescence in a microplate assay

USDA-ARS?s Scientific Manuscript database

Beta-glucans, linear glucan polymers of mixed linkage, are important constituents of cereal cell walls. They have important health benefits in the human diet, but also can negatively affect the use of barley grain as an animal feed. High beta-glucans in barley malt can also cause problems in brewi...

Insight into multi-site mechanisms of glycosyl transfer in (1-->4)beta-D-glycans provided by the cereal mixed-linkage (1-->3),(1-->4)beta-D-glucan synthase.

PubMed

Buckeridge, M S; Vergara, C E; Carpita, N C

2001-08-01

Synthases of cellulose, chitin, hyaluronan, and all other polymers containing (1-->4)beta-linked glucosyl, mannosyl and xylosyl units have overcome a substrate orientation problem in catalysis because the (1-->4)beta-linkage requires that each of these sugar units be inverted nearly 180 degrees with respect to its neighbors. We and others have proposed that this problem is solved by two modes of glycosyl transfer within a single catalytic subunit to generate disaccharide units, which, when linked processively, maintain the proper orientation without rotation or re-orientation of the synthetic machinery in 3-dimensional space. A variant of the strict (1-->4)beta-D-linkage structure is the mixed-linkage (1-->3),(1-->4)beta-D-glucan, a growth-specific cell wall polysaccharide found in grasses and cereals. beta-Glucan is composed primarily of cellotriosyl and cellotetraosyl units linked by single (1-->3)beta-D-linkages. In reactions in vitro at high substrate concentration, a polymer composed of almost entirely cellotriosyl and cellopentosyl units is made. These results support a model in which three modes of glycosyl transfer occur within the synthase complex instead of just two. The generation of odd numbered units demands that they are connected by (1-->3)beta-linkages and not (1-->4)beta-. In this short review of beta-glucan synthesis in maize, we show how such a model not only provides simple mechanisms of synthesis for all (1-->4)beta-D-glycans but also explains how the synthesis of callose, or strictly (1-->3)beta-D-glucans, occurs upon loss of the multiple modes of glycosyl transfer to a single one.

β-1,4-Glucanase-like protein from the cyanobacterium Synechocystis PCC6803 is a β-1,3-1,4-glucanase and functions in salt stress tolerance

PubMed Central

Tamoi, Masahiro; Kurotaki, Hideki; Fukamizo, Tamo

2007-01-01

In the present study, we characterized the gene (Cyanobase accession number slr0897) designated Ssglc encoding a β-1,4-glucanase-like protein (SsGlc) from Synechocystis PCC6803. The deduced amino acid sequence for Ssglc showed a high degree of similarity to sequences of GH (glycoside hydrolase) family 9 β-1,4-glucanases (cellulases) from various sources. Surprisingly, the recombinant protein obtained from the Escherichia coli expression system was able to hydrolyse barley β-glucan and lichenan (β-1,3-1,4-glucan), but not cellulose (β-1,4-glucan), curdlan (β-1,3-glucan), or laminarin (β-1,3-1,6-glucan). A 1H-NMR analysis of the enzymatic products revealed that the enzyme hydrolyses the β-1,4-glycosidic linkage of barley β-glucan through an inverting mechanism. The data indicated that SsGlc was a novel type of GH9 glucanase which could specifically hydrolyse the β-1,3-1,4-linkage of glucan. The growth of mutant Synechocystis cells in which the Ssglc gene was disrupted by a kanamycin-resistance cartridge gene was almost the same as that of the wild-type cells under continuous light (40 μmol of photons/m2 per s), a 12 h light (40 μmol of photons/m2 per s)/12 h dark cycle, cold stress (4 °C), and high light stress (200 μmol of photons/m2 per s). However, under salt stress (300–450 mM NaCl), growth of the Ssglc-disrupted mutant cells was significantly inhibited as compared with that of the wild-type cells. The Ssglc-disrupted mutant cells showed a decreased rate of O2 consumption and NaHCO3-dependent O2 evolution as compared with the wild-type cells under salt stress. Under osmotic stress (100–400 mM sorbitol), there was no difference in growth between the wild-type and the Ssglc-disrupted mutant cells. These results suggest that SsGlc functions in salt stress tolerance in Synechocystis PCC6803. PMID:17331074

Dietary fibers from mushroom sclerotia: 1. Preparation and physicochemical and functional properties.

PubMed

Wong, Ka-Hing; Cheung, Peter C K

2005-11-30

Preparation of three novel dietary fibers (DFs) from mushroom sclerotia, namely, Pleurotus tuberregium, Polyporous rhinocerus, and Wolfiporia cocos, by a scale-up modified AOAC procedure using industrial enzymes was investigated. A remarkably high level of total dietary fiber (TDF) ranging from 81.7 to 96.3% sample dry matter (DM), in which a content of nonstarch polysaccharide (NSP) ranging from 86.6 to 94.3% sclerotial TDF DM, was obtained from the three sclerotia. All sclerotial DFs were rich in beta-glucan (the glucose residue ranged from 89.7 to 94.5% NSP DM) with a very low level of resistant glycogen (ranged from 3.77 to 3.94% sclerotial TDF DM). All three novel sclerotial DFs also exhibited similar, if not better, physicochemical and functional properties (pH, color, water binding capacity, oil holding capacity, and emulsifying properties) as those of barely DF control and commercial DF-rich ingredients. The potential use of the three mushroom sclerotial DFs as a new beta-glucan type DF-rich ingredient in the food industry was discussed.

Dirhamnolipids secreted from Pseudomonas aeruginosa modify anjpegungal susceptibility of Aspergillus fumigatus by inhibiting β1,3 glucan synthase activity

PubMed Central

Briard, Benoit; Rasoldier, Vero; Bomme, Perrine; ElAouad, Noureddine; Guerreiro, Catherine; Chassagne, Pierre; Muszkieta, Laetitia; Latgé, Jean-Paul; Mulard, Laurence; Beauvais, Anne

2017-01-01

Pseudomonas aeruginosa and Aspergillus fumigatus are the two microorganisms responsible for most of the chronic infections in cystic fibrosis patients. P. aeruginosa is known to produce quorum-sensing controlled rhamnolipids during chronic infections. Here we show that the dirhamnolipids secreted from P. aeruginosa (i) induce A. fumigatus to produce an extracellular matrix, rich in galactosaminogalactan, 1,8-dihydroxynaphthalene (DHN)- and pyo-melanin, surrounding their hyphae, which facilitates P. aeruginosa binding and (ii) inhibit A. fumigatus growth by blocking β1,3 glucan synthase (GS) activity, thus altering the cell wall architecture. A. fumigatus in the presence of diRhls resulted in a growth phenotype similar to that upon its treatment with anjpegungal echinocandins, showing multibranched hyphae and thicker cell wall rich in chitin. The diRhl structure containing two rhamnose moieties attached to fatty acyl chain is essential for the interaction with β1,3 GS; however, the site of action of diRhls on GS is different from that of echinocandins, and showed synergistic anjpegungal effect with azoles. PMID:28338676

Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Gang; Xu, Zhenjiang; Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn

β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceaemore » of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.« less

Soluble β-1,3/1,6-glucan in seaweed from the southern hemisphere and its immunomodulatory effect.

PubMed

Bobadilla, Francisca; Rodriguez-Tirado, Carolina; Imarai, Mónica; Galotto, María José; Andersson, Roger

2013-01-30

Five types of macroalgae from the southern hemisphere were analysed for the presence of β-1,3/1,6-glucan and its immunostimulant properties. We were able to extract soluble β-1,3/1,6-D-glucan from Durvillaea antarctica (Chamisso) Hariot (DA). The morphology of the brown algae influenced extraction, and the highest percentage of β-glucan was found in the fronds. The content of β-glucan in the stipes and holdfast was on average 33% and <5%, respectively, of that in the fronds. A simple laboratory extraction process was developed. A highly pure water-soluble polysaccharide, mainly composed of glucose residues, was obtained with a dominant average molecular weight of 6.9 kDa. NMR spectroscopy confirmed the polysaccharide structure to be of β-1,3/1,6-glucan type, comprising a β-1,3-glucan backbone and 21% degree of branching of β-1,6-glucan side chains. Mouse cells were exposed to four DA extract concentrations in water (50, 100, 250 and 500 μg/mL) and no adverse effects on survival were noted. Remarkably, the β-glucan induced a 16.9% increase in activated CD19+ B lymphocytes compared with the control sample. The optimal concentration for maximum activity was 100 μg DA extract/mL. Copyright © 2012 Elsevier Ltd. All rights reserved.

Further Studies of the Role of Cyclic β-Glucans in Symbiosis. An ndvC Mutant of Bradyrhizobium japonicum Synthesizes Cyclodecakis-(1→3)-β-Glucosyl1

PubMed Central

Bhagwat, Arvind A.; Mithöfer, Axel; Pfeffer, Philip E.; Kraus, Christine; Spickers, Nicole; Hotchkiss, Arland; Ebel, Jürgen; Keister, Donald L.

1999-01-01

The cyclic β-(1→3),β-(1→6)-d-glucan synthesis locus of Bradyrhizobium japonicum is composed of at least two genes, ndvB and ndvC. Mutation in either gene affects glucan synthesis, as well as the ability of the bacterium to establish a successful symbiotic interaction with the legume host soybean (Glycine max). B. japonicum strain AB-14 (ndvB::Tn5) does not synthesize β-glucans, and strain AB-1 (ndvC::Tn5) synthesizes a cyclic β-glucan lacking β-(1→6)-glycosidic bonds. We determined that the structure of the glucan synthesized by strain AB-1 is cyclodecakis-(1→3)-β-d-glucosyl, a cyclic β-(1→3)-linked decasaccharide in which one of the residues is substituted in the 6 position with β-laminaribiose. Cyclodecakis-(1→3)-β-d-glucosyl did not suppress the fungal β-glucan-induced plant defense response in soybean cotyledons and had much lower affinity for the putative membrane receptor protein than cyclic β-(1→3),β-(1→6)-glucans produced by wild-type B. japonicum. This is consistent with the hypothesis presented previously that the wild-type cyclic β-glucans may function as suppressors of a host defense response. PMID:10069844

β-Glucans Are Masked but Contribute to Pulmonary Inflammation During Pneumocystis Pneumonia

PubMed Central

Kutty, Geetha; Davis, A. Sally; Ferreyra, Gabriela A.; Qiu, Ju; Huang, Da Wei; Sassi, Monica; Bishop, Lisa; Handley, Grace; Sherman, Brad; Lempicki, Richard; Kovacs, Joseph A.

2016-01-01

β-glucans, which can activate innate immune responses, are a major component in the cell wall of the cyst form of Pneumocystis. In the current study, we examined whether β-1,3-glucans are masked by surface proteins in Pneumocystis and what role β-glucans play in Pneumocystis-associated inflammation. For 3 species, including Pneumocystis jirovecii, which causes Pneumocystis pneumonia in humans, Pneumocystis carinii, and Pneumocystis murina, β-1,3-glucans were masked in most organisms, as demonstrated by increased exposure following trypsin treatment. Using quantitative polymerase chain reaction and microarray techniques, we demonstrated in a mouse model of Pneumocystis pneumonia that treatment with caspofungin, an inhibitor of β-1,3-glucan synthesis, for 21 days decreased expression of a broad panel of inflammatory markers, including interferon γ, tumor necrosis factor α, interleukin 1β, interleukin 6, and multiple chemokines/chemokine ligands. Thus, β-glucans in Pneumocystis cysts are largely masked, which likely decreases innate immune activation; this mechanism presumably was developed for interactions with immunocompetent hosts, in whom organism loads are substantially lower. In immunosuppressed hosts with a high organism burden, organism death and release of glucans appears to be an important contributor to deleterious host inflammatory responses. PMID:27324243

Isolation and characterization of periplasmic cyclic beta-glucans of Azorhizobium caulinodans.

PubMed

Komaniecka, Iwona; Choma, Adam

2003-10-24

Oligoglucose molecules isolated from Azorhizobium caulinodans were characterized by compositional analysis, Smith degradation, matrix-assisted laser desorption/ionization time of flight mass spectrometry, and (1)H and (13)C nuclear magnetic resonance analysis. A. caulinodans produced nonbranched and unsubstituted cyclic glucans composed solely of glucose, with the degree of polymerization ranging from 10 to 13. A major fraction of the periplasmic glucans contains 11 glucose residues within rings. The glucose residues are linked by beta-(1,3) and beta-(1,6) glycosidic bonds. These molecules seem to be quite similar to the periplasmic beta-(1,3);(1,6)-glucans synthesized by the Bradyrhizobium strain and are substantially different from the cyclic beta-(1,2)-glucans produced by Agrobacterium and Sinorhizobium species. Azorhizobial cyclic glucan synthesis is not osmoregulated. The response to the osmotic stress in Azorhizobium can be regulated similarly to Brucella spp. It is probable that the biosynthesis of beta-glucans is subject to the feedback control mechanism.

Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.

PubMed

Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan

2013-05-01

The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.

De facto molecular weight distributions of glucans by size-exclusion chromatography combined with mass/molar-detection of fluorescence labeled terminal hemiacetals.

PubMed

Praznik, Werner; Huber, Anton

2005-09-25

A major capability of polysaccharides in aqueous media is their tendency for aggregation and dynamic formation of supermolecular structures. Even extended dissolution processes will not eliminate these structures which dominate many analytical approaches, in particular absolute molecular weight determinations referring to light scattering data. An alternative approach for determination of de facto molecular weight for glucans with free terminal hemiacetal functionality (reducing end group) has been adjusted from carbohydrates for midrange and high-dp glucans: quantitative and stabilized labeling as aminopyridyl-derivatives (AP-glucans) and subsequent analysis of SEC-separated elution profiles based on simultaneously monitored mass and molar fractions by refractive index and fluorescence detection. SEC-DRI/FL of AP-glucans proved as an appropriate approach for determination of de facto molecular weight of constituting glucan molecules even in the presence of supermolecular structures for non-branched (pullulan), branched (dextran), narrow distributed and broad distributed and for mixes of compact and loose packed polymer coils (starch glucan hydrolizate).

Characterization of β-glucan formation by Lactobacillus brevis TMW 1.2112 isolated from slimy spoiled beer.

PubMed

Fraunhofer, Marion E; Geissler, Andreas J; Wefers, Daniel; Bunzel, Mirko; Jakob, Frank; Vogel, Rudi F

2018-02-01

Despite several hurdles, which hinder bacterial growth in beer, certain bacteria are still able to spoil beer. One type of spoilage is characterized by an increased viscosity and slimy texture caused by exopolysaccharide (EPS) formation of lactic acid bacteria (LAB). In this study, we characterize for the first time EPS production in a beer-spoiling strain (TMW 1.2112) of Lactobacillus brevis, a species commonly involved in beer spoilage. The strain's growth dynamics were assessed and we found an increased viscosity or ropiness in liquid or on solid media, respectively. Capsular polysaccharides (CPS) and released EPS from the cells or supernatant, respectively, were analyzed via NMR spectroscopy and methylation analysis. Both are identical β-(1→3)-glucans, which are ramified with β-glucose residues at position O2. Therefore, we assume that this EPS is mainly produced as CPS and partially released into the surrounding medium, causing viscosity of e.g. beer. CPS formation was confirmed via an agglutination test. A plasmid-located glycosyltransferase-2 was found as responsible for excess β-glucan formation, chromosomal glucanases were proposed for its degradation. The glycosyltransferase-2 gene could also be specifically identified in beer-spoiling, slime-producing Lactobacillus rossiae and Lactobacillus parabuchneri strains, suggesting it as promising marker gene for the early detection of β-glucan-producing Lactobacilli in breweries. Copyright © 2017 Elsevier B.V. All rights reserved.

A Multifunctional Bread Rich in Beta Glucans and Low in Starch Improves Metabolic Control in Type 2 Diabetes: A Controlled Trial

PubMed Central

Tessari, Paolo; Lante, Anna

2017-01-01

Design: Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed ‘functional’ bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods: Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Results: Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values (p = 0.028), and by ~0.6% vs. the control group (p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. Conclusions: A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes. PMID:28304350

β-Glucans in food modify colonic microflora by inducing antimicrobial protein, calprotectin, in a Dectin-1-induced-IL-17F-dependent manner.

PubMed

Kamiya, T; Tang, C; Kadoki, M; Oshima, K; Hattori, M; Saijo, S; Adachi, Y; Ohno, N; Iwakura, Y

2018-05-01

Dectin-1 (gene symbol: Clec7a) is a receptor for β-glucans that play an important role for the host defense against fungi. Recently, we showed that Clec7a -/- mice are resistant against dextran sodium sulfate (DSS)-induced colitis because of regulatory T-cell population expansion in the colon. The regulatory T-cell expansion is caused by expansion of commensal Lactobacillus murinus whose growth is suppressed by an antimicrobial protein, calprotectin S100A8/A9. In this report, we showed that S100A8 was mainly produced by mouse colonic epithelial cells. S100A8 was not induced directly by Dectin-1 but by Dectin-1-induced cytokines, especially interleukin-17F (IL-17F), that were produced by several types of innate immune cells including CD11c + /CD11b + myeloid cells in colonic lamina propria. S100A8/A9 heterodimer preferentially suppressed the growth of L. murinus that was increased in both Clec7a -/- and Il17f -/- mice. Furthermore, similar expansion of L. murinus and DSS-colitis resistance were observed in mice fed with β-glucan-free food. These observations suggest that food-derived β-glucans control the specific commensal microbiota via the Dectin-1-IL-17F-calprotectin axis to maintain the intestinal homeostasis.

Warfighter Sustainability: Maximizing Human Performance in Hostile Environments

DTIC Science & Technology

2008-10-01

Study 4: Effects of Beta Glucan on Symptoms of Upper Tract Infection in Wildland Firefighters. ix Approved for public release...Study 4: Effects of Beta Glucan on Symptoms of Upper Tract Infection in Wildland Firefighters. The use of a beta glucan supplement may decrease...reduce the required fluid intake during extended operations without compromising work output. In addition, the ingestion of a beta glucan supplement may

Antiproliferative and pro-apoptotic effects of three fungal exocellular β-glucans in MCF-7 breast cancer cells is mediated by oxidative stress, AMP-activated protein kinase (AMPK) and the Forkhead transcription factor, FOXO3a.

PubMed

Queiroz, Eveline A I F; Fortes, Zuleica B; da Cunha, Mário A A; Barbosa, Aneli M; Khaper, Neelam; Dekker, Robert F H

2015-10-01

Fungal β-d-glucans of the (1→3)-type are known to exhibit direct antitumor effects, and can also indirectly decrease tumor proliferation through immunomodulatory responses. The underlying molecular mechanisms involved in decreasing tumor formation, however, are not well understood. In this study, we examined the antiproliferative role and mechanism of action of three different fungal exocellular β-glucans in MCF-7 breast cancer cells. The β-glucans were obtained from Botryosphaeria rhodina MAMB-05 [two botryosphaerans; (1→3)(1→6)-β-d-glucan; one produced on glucose, the other on fructose] and Lasiodiplodia theobromae MMPI [lasiodiplodan; (1→6)-β-d-glucan, produced on glucose]. Using the cell proliferation-MTT assay, we showed that the β-glucans exhibited a time- and concentration-dependent antiproliferative activity (IC50, 100μg/ml). Markers of cell cycle, apoptosis, necrosis and oxidative stress were analyzed using flow cytometry, RT-PCR and Western blotting. Exposure to β-glucans increased apoptosis, necrosis, oxidative stress, mRNA expression of p53, p27 and Bax; the activity of AMP-activated protein-kinase, Forkhead transcription factor FOXO3a, Bax and caspase-3; and decreased the activity of p70S6K in MCF-7 cells. In the presence of hydrogen peroxide, the fungal β-glucans increased oxidative stress, which was associated with reduced cell viability. We showed that these β-glucans exhibited an antiproliferative effect that was associated with apoptosis, necrosis and oxidative stress. This study demonstrated for the first time that the apoptosis induced by β-glucans was mediated by AMP-activated protein-kinase and Forkhead transcription factor, FOXO3a. Our findings provide novel mechanistic insights into their antiproliferative roles, and compelling evidence that these β-glucans possess a broad range of biomodulatory properties that may prove useful in cancer treatment. Copyright © 2015 Elsevier Ltd. All rights reserved.

Peptides derived from tryptic hydrolysate of Bacillus subtilis culture suppress fungal spoilage of table grapes.

PubMed

Zhang, Bo; Wang, Jingnan; Ning, Shuqing; Yuan, Quan; Chen, Xiangning; Zhang, Yanyan; Fan, Junfeng

2018-01-15

This study confirmed the anti-fungal effect of trypsin-treated Bacillus subtilis culture (BC) (tryptic hydrolysate, TH) on mold growth on Kyoho grapes. We examined the anti-fungal activity of TH by identifying TH peptides and performing a computational docking analysis. TH was more potent than untreated BC in suppressing fungal growth on grapes. Specifically, TH maintained grape freshness by inhibiting respiration and rachis browning, maintaining firmness, and preventing weight loss. Thirty-six inhibitory peptides against β-1,3-glucan synthase (GS) were screened from 126 TH peptides identified through proteomic analysis. Among them, 13 peptides bound tightly to GS active pockets with lower binding energies than that of GppNHp. The most potent peptides, LFEIDEELNEK and FATSDLNDLYR, were synthesized, and further experiments showed that these peptides had a highly suppressive effect on GS activity and Aspergillus niger and Penicillium chrysogenum growth. Our results confirm that tryptic treatment is effective for improving the anti-fungal activity of BC. Copyright © 2017 Elsevier Ltd. All rights reserved.

Structural modeling of glucanase-substrate complexes suggests a conserved tyrosine is involved in carbohydrate recognition in plant 1,3-1,4-β- d-glucanases

NASA Astrophysics Data System (ADS)

Tsai, Li-Chu; Chen, Yi-Ning; Shyur, Lie-Fen

2008-12-01

Glycosyl hydrolase family 16 (GHF16) truncated Fibrobacter succinogenes (TFs) and GHF17 barley 1,3-1,4-β- d-glucanases (β-glucanases) possess different structural folds, β-jellyroll and (β/α)8, although they both catalyze the specific hydrolysis of β-1,4 glycosidic bonds adjacent to β-1,3 linkages in mixed β-1,3 and β-1,4 β- d-glucans or lichenan. Differences in the active site region residues of TFs β-glucanase and barley β-glucanase create binding site topographies that require different substrate conformations. In contrast to barley β-glucanase, TFs β-glucanase possesses a unique and compact active site. The structural analysis results suggest that the tyrosine residue, which is conserved in all known 1,3-1,4-β- d-glucanases, is involved in the recognition of mixed β-1,3 and β-1,4 linked polysaccharide.

Effects of β-glucan extracted from Agaricus blazei on the expression of ERCC5, CASP9, and CYP1A1 genes and metabolic profile in HepG2 cells.

PubMed

da Silva, A F; Sartori, D; Macedo, F C; Ribeiro, L R; Fungaro, M H P; Mantovani, M S

2013-06-01

The polysaccharide β-glucan has biological properties that stimulate the immune system and can prevent chronic pathologies, including cancer. It has been shown to prevent damage to DNA caused by the chemical and physical agents to which humans are exposed. However, the mechanism of β-glucan remains poorly understood. The objective of the present study was to verify the protective effect of β-glucan on the expression of the genes ERCC5 (involved in excision repair of DNA damage), CASP9 (involved in apoptosis), and CYP1A1 (involved in the metabolism of xenobiotics) using real-time polymerase chain reaction and perform metabolic profile measurements on the HepG2 cells. Cells were exposed to only benzo[a]pyrene (B[a]P), β-glucan, or a combination of B[a]P with β-glucan. The results demonstrated that 50 µg/mL β-glucan significantly repressed the expression of the ERCC5 gene when compared with the untreated control cells in these conditions. No change was found in the CASP9 transcript level. However, the CYP1A1 gene expression was also induced by HepG2 cells exposed to B[a]P only or in association with β-glucan, showing its effective protector against damage caused by B[a]P, while HepG2 cells exposed to only β-glucan did not show CYP1A1 modulation. The metabolic profiles showed moderate bioenergetic metabolism with an increase in the metabolites involved in bioenergetic metabolism (alanine, glutamate, creatine and phosphocholine) in cells treated with β-glucan and to a lesser extent treated with B[a]P. Thus, these results demonstrate that the chemopreventive activity of β-glucan may modulate bioenergetic metabolism and gene expression.

Development of downstream processing to minimize beta-glucan impurities in GMP-manufactured therapeutic antibodies.

PubMed

Vigor, Kim; Emerson, John; Scott, Robert; Cheek, Julia; Barton, Claire; Bax, Heather J; Josephs, Debra H; Karagiannis, Sophia N; Spicer, James F; Lentfer, Heike

2016-11-01

The presence of impurities or contaminants in biological products such as monoclonal antibodies (mAb) could affect efficacy or cause adverse reactions in patients. ICH guidelines (Q6A and Q6B) are in place to regulate the level of impurities within clinical drug products. An impurity less often reported and, therefore, lacking regulatory guideline is beta-glucan. Beta-glucans are polysaccharides of d-glucose monomers linked by (1-3) beta-glycosidic bonds, and are produced by prokaryotic and eukaryotic organisms, including plants. They may enter manufacturing processes via raw materials such as cellulose-based membrane filters or sucrose. Here we report the detection of beta-glucan contamination of a monoclonal IgE antibody (MOv18), manufactured in our facility for a first-in-human, first-in-class clinical trial in patients with cancer. Since beta-glucans have potential immunostimulatory properties and can cause symptomatic infusion reactions, it was of paramount importance to identify the source of beta-glucans in our product and to reduce the levels to clinically insignificant concentrations. We identified beta-glucans in sucrose within the formulation buffer and within the housing storage buffer of the virus removal filter. We also detected low level beta-glucan contamination in two of four commercially available antibodies used in oncology. Both formulation buffers contained sucrose. We managed to reduce levels of beta-glucan in our product 10-fold, by screening all sucrose raw material, filtering the sucrose by Posidyne® membrane filtration, and by incorporating extra wash steps when preparing the virus removal filter. The beta-glucan levels now lie within a range that is unlikely to cause clinically significant immunological effects. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1494-1502, 2016. © 2016 American Institute of Chemical Engineers.

Supplementation of a high-carbohydrate breakfast with barley beta-glucan improves postprandial glycaemic response for meals but not beverages.

PubMed

Poppitt, Sally D; van Drunen, Jenneke D E; McGill, Anne-Thea; Mulvey, Tom B; Leahy, Fiona E

2007-01-01

There is growing support for the protective role of soluble fibre in type II diabetes. Soluble fibre beta-glucan found in cereal products including oats and barley may be the active component. There is evidence of postprandial blunting of blood glucose and insulin responses to dietary carbohydrates when oat soluble fibre is supplemented into the diet but few trials have been carried out using natural barley or enriched barley beta-glucan products. The aim of this trial was to investigate the postprandial effect of a highly enriched barley beta -glucan product on blood glucose, insulin and lipids when given with a high-CHO food and a high-CHO drink. 18 lean, healthy men completed a 4 treatment intervention trial comprising (i) high-CHO(food control), (ii) high-CHO(food+fibre), (iii) high-CHO(drink control), (iv) high-CHO(drink+fibre) where a 10g dose of barley beta-glucan fibre supplement (Cerogen) containing 6.31g beta-glucan was added to food and drink controls. There was an increase of glucose and insulin following all 4 treatments. Addition of the beta -glucan supplement significantly blunted the glycaemic and insulinaemic responses on the food (p<0.05) but not drink (p>0.05) treatments when compared to controls. The high-CHO breakfasts decreased total, LDL- and HDL-cholesterol from baseline to 60 mins postprandially but there were no differential effects of beta-glucan treatment on circulating lipids. We conclude that a high dose barley beta-glucan supplement can improve glucose control when added to a high-CHO starchy food, probably due to increased gastro-intestinal viscosity, but not when added to a high-CHO beverage where rapid absorption combined with decreased beta-glucan concentration and viscosity may obviate this mechanism.

Saccharomyces cerevisiae cell wall components as tools for ochratoxin a decontamination.

PubMed

Piotrowska, Małgorzata; Masek, Anna

2015-04-02

The aim of this study was to evaluate the usefulness of Saccharomyces cerevisiae cell wall preparations in the adsorption of ochratoxin A (OTA). The study involved the use of a brewer's yeast cell wall devoid of protein substances, glucans obtained by water and alkaline extraction, a glucan commercially available as a dietary supplement for animals and, additionally, dried brewer's yeast for comparison. Fourier Transform Infrared (FTIR) analysis of the obtained preparations showed bands characteristic for glucans in the resulting spectra. The yeast cell wall preparation, water-extracted glucan and the commercial glucan bound the highest amount of ochratoxin A, above 55% of the initial concentration, and the alkaline-extracted glucan adsorbed the lowest amount of this toxin. It has been shown that adsorption is most effective at a close-to-neutral pH, while being considerably limited in alkaline conditions.

α- and β-d-Glucans from the edible mushroom Pleurotus albidus differentially regulate lipid-induced inflammation and foam cell formation in human macrophage-like THP-1 cells.

PubMed

Castro-Alves, Victor Costa; Nascimento, João Roberto Oliveira do

2018-05-01

Macrophages play an essential role in lipid metabolism; however, the excessive uptake of modified lipids and cholesterol crystals (CC) leads to the formation of pro-inflammatory lipid-laden macrophages called foam cells. Since the α-1,6- and β-1,3-d-glucans from the basidiome and the mycelium of the edible mushroom Pleurotus albidus have previously been shown to regulate macrophage function, these glucans were tested in macrophage-like THP-1 cells previously exposed to acetylated low-density lipoproteins (acLDL) or CC. The glucans inhibited lipid-induced inflammation, but only the β-1,3-d-glucan regulated both the NLRP3 inflammasome activation and the expression of genes involved on lipid efflux in acLDL- or CC-pretreated cells, thereby reducing foam cell formation. In contrast, the two α-1,6-glucans tested inhibited foam cell formation only in acLDL-pretreated cells and had no effect on the expression of the peroxisome proliferator-activated receptor gamma and liver X receptor alpha genes, suggesting that these glucans regulate lipid influx rather than lipid efflux. Thus, α- and β-d-glucans differentially regulate lipid-induced inflammation and foam cell formation in macrophage-like cells. Furthermore, results emphasize that P. albidus has potential to be used as a functional food or as a source for the extraction of biologically-active glucans. Copyright © 2018 Elsevier B.V. All rights reserved.

Integration of β-glucan fibre rich fractions from barley and mushrooms to form healthy extruded snacks.

PubMed

Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S

2013-03-01

β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P < 0.05). Product expansion increased with the introduction of both barley and mushroom fraction (P < 0.05) which in turn resulted in a reduction in product hardness (P < 0.05). In vitro digestion protocol illustrated that inclusion of barley and mushroom β-glucan rich fractions manipulated the starch digestibility profile and hence rate of glucose release during digestion compared to the control sample. This in turn resulted in a significant (P < 0.05) reduction in potential glycaemic response of the samples of between 20 and 25 % for barley β-glucan rich fractions and between 17 and 25 % for mushroom β-glucan rich fractions. We conclude that the inclusion of these fractions could be utilised by the food industry to manipulate the glycaemic response of extruded snack products.

NMR spectroscopic structural characterization of a water-soluble β-(1→3, 1→6)-glucan from Aureobasidium pullulans.

PubMed

Kono, Hiroyuki; Kondo, Nobuhiro; Hirabayashi, Katsuki; Ogata, Makoto; Totani, Kazuhide; Ikematsu, Shinya; Osada, Mitsumasa

2017-10-15

An unambiguous structural characterization of the water-soluble Aureobasidium pullulans β-(1→3, 1→6)-glucan is yet to be achieved, although this β-(1→3, 1→6)-glucan is expected to exhibit excellent biofunctional properties. Thus, we herein report the elucidation of the primary structure of the A. pullulans β-(1→3, 1→6)-glucan using nuclear magnetic resonance spectroscopy, followed by comparison of the obtained structure with that of schizophyllan (SPG). Structural characterization of the A. pullulans β-(1→3, 1→6)-glucan revealed that the structural units are a β-(1→3)-d-glucan backbone with four β-(1→6)-d-glucosyl side branching units every six residues. In addition, circular dichroism spectroscopic analysis revealed that the β-(1→3, 1→6)-glucan interacted with polyadenylic acid (poly(A)) chains in DMSO solution to form a complex similar to that obtained in the complexation of SPG/poly(A). This finding indicates that β-(1→3, 1→6)-glucan forms a triple-helical conformation in aqueous solution but exhibits a random coil structure in DMSO solution, which is similar to the behavior of SPG. Copyright © 2017 Elsevier Ltd. All rights reserved.

Optical Properties of Laminarin Using Terahertz Time-Domain Spectroscopy (abstract)

NASA Astrophysics Data System (ADS)

Shin, Hee Jun; Maeng, Inhee; Oh, Seung Jae; Kim, Sung In; Kim, Ha Won; Son, Joo-Hiuk

2009-04-01

Terahertz spectroscopy is important in the study of biomolecular structure because the vibration and rotation energy of large molecules such as DNA, proteins, and polysaccharides are laid in terahertz regions. Terahertz time-domain spectroscopy (THz-TDS), using terahertz pulses generated and detected by femto-second pulses laser, has been used in the study of biomolecular dynamics, as well as carrier dynamics of semiconductors. Laminarin is a polysaccharide of glucose in brown algae. It is made up of β(1-3)-glucan and β(1-6)-glucan. β-glucan is an anticancer material that activates the immune reaction of human cells and inhibits proliferation of cancer cells. β-glucan with a single-strand structure has been reported to activate the immune reaction to a greater extent than β-glucan with a triple-strand helix structure. We used THz-TDS to characterize the difference between single-strand and triple-strand β-glucan. We obtained single-strand β-glucan by chemical treatment of triple-strand β-glucan. We measured the frequency dependent optical constants of Laminarin using THz-TDS. Power absorption of the triple-strand helix is larger than the single-strand helix in terahertz regions. The refractive index of the triple-strand helix is also larger than that of the single-strand helix.

Protective effect of β-(1,3 → 1,6)-D-glucan against irritant-induced gastric lesions.

PubMed

Tanaka, Ken-ichiro; Tanaka, Yuta; Suzuki, Toshio; Mizushima, Tohru

2011-08-01

β-(1,3)-D-Glucan with β-(1,6) branches has been reported to have various pharmacological activities, such as anti-tumour and anti-infection activities, which result from its immunomodulating effects. Gastric lesions result from an imbalance between aggressive and defensive factors. In the present study, we examined the effect of β-(1,3)-D-glucan with β-(1,6) branches isolated from Aureobasidium pullulans on the gastric ulcerogenic response in mice. Oral administration of β-glucan ameliorated gastric lesions induced by ethanol (EtOH) or HCl. This administration of β-glucan also suppressed EtOH-induced inflammatory responses, such as infiltration of neutrophils and expression of pro-inflammatory cytokines, chemokines and cell adhesion molecules (CAM) at the gastric mucosa. Of the various defensive factors, the levels of heat shock protein (HSP) 70 and mucin but not PGE(2) were increased by the administration of β-glucan. β-Glucan-dependent induction of the expression of HSP70 and mucin proteins and suppression of the expression of pro-inflammatory cytokines, chemokines and CAM were also observed in cultured cells in vitro. The results of the present study suggest that β-glucan protects the gastric mucosa from the formation of irritant-induced lesions by increasing the levels of defensive factors, such as HSP70 and mucin.

Effects of dietary β-1,3-glucan, chitosan or raffinose on the growth, innate immunity and resistance of koi (Cyprinus carpio koi).

PubMed

Lin, Shimei; Pan, Yu; Luo, Lin; Luo, Li

2011-12-01

This study was performed to determine the efficacy of three immunomodulators viz., β-1,3 glucan, chitosan and raffinose on the innate immune response of koi, Cyprinus carpio koi. Kois were divided into 4 groups and each group was fed with diets supplemented with or without immunostimulant for 56 days. Total leukocyte counts (WBC), the non-specific humoral (lysozyme, alternative complement pathway and superoxide dismutase) and cellular (phagocytic capacity and respiratory burst activity) responses were determined and compared with controls (no supplement) after 7, 14, 21 and 56 days of feeding. The results of 8 weeks feeding trial showed that β-1,3 glucan supplementation significantly enhanced koi growth, whereas other immunostimulants did not. Variation in the levels of responses was evident among different supplements. Compared with chitosan or raffinose, β-1,3 glucan could maintain the immunity of kois at a higher level during the experimental period. However, continuously applying β-1,3 glucan, chitosan or raffinose into the diet caused immunity fatigue in koi. No significant change in alternative complement pathway (ACP) activity was observed for any of the three supplements over the four different periods. After feeding for 14 days, the total leukocyte count (WBC), respiratory burst activity and superoxide dismutase (SOD) activity of the kois fed with chitosan or raffinose continuously remained relatively unchanged, subsequently decreased on the 56th day, but SOD did not. Meanwhile, lysozyme activity was no longer significantly higher on the 7th day, and for phagocytic capacity on the 14th day. After 56 days, these three immunostimulants groups also exhibited a decrease in the cumulative symptom rates compared to the controls when challenged with Aeromonas veronii. These results indicated that dietary intake containing immunostimulants could enhance the immune responses of koi and improve its resistance to infection by A.veronii. Especially supplementation with β-1,3 glucan to the kois for 56 days showed considerable improvement in the growth, survival and immune response of the kois. Copyright © 2011 Elsevier Ltd. All rights reserved.

Endotoxin and β-1,3-d-Glucan in Concentrated Ambient Particles Induce Rapid Increase in Blood Pressure in Controlled Human Exposures.

PubMed

Zhong, Jia; Urch, Bruce; Speck, Mary; Coull, Brent A; Koutrakis, Petros; Thorne, Peter S; Scott, James; Liu, Ling; Brook, Robert D; Behbod, Behrooz; Gibson, Heike; Silverman, Frances; Mittleman, Murray A; Baccarelli, Andrea A; Gold, Diane R

2015-09-01

Short-term exposure to particulate matter (PM) is associated with increased blood pressure (BP) in epidemiological studies. Understanding the impact of specific PM components on BP is essential in developing effective risk-reduction strategies. We investigated the association between endotoxin and β-1,3-d-Glucan-two major biological PM components-and BP. We also examined whether vascular endothelial growth factor, a vasodilatory inflammatory marker, modified these associations. We conducted a single-blind, randomized, crossover trial of controlled human exposure to concentrated ambient particles with 50 healthy adults. Particle-associated-endotoxin and β-1,3-d-Glucan were sampled using polycarbonate-membrane-filters. Supine resting systolic BP and diastolic BP were measured pre-, 0.5-hour post-, and 20-hour postexposure. Urine vascular endothelial growth factor concentration was determined using enzyme-linked immunosorbant assay and creatinine-corrected. Exposures to endotoxin and β-1,3-d-Glucan for 130 minutes were associated with increases in BPs: at 0.5-hour postexposure, every doubling in endotoxin concentration was associated with 1.73 mm Hg higher systolic BP (95% confidence interval, 0.28, 3.18; P=0.02) and 2.07 mm Hg higher diastolic BP (95% confidence interval, 0.74, 3.39; P=0.003); every doubling in β-1,3-d-Glucan concentration was associated with 0.80 mm Hg higher systolic BP (95% confidence interval, -0.07, 1.67; P=0.07) and 0.88 mm Hg higher diastolic BP (95% confidence interval, 0.09, 1.66; P=0.03). Vascular endothelial growth factor rose after concentrated ambient particle endotoxin exposure and attenuated the association between endotoxin and 0.5-hour postexposure diastolic BP (Pinteraction=0.02). In healthy adults, short-term endotoxin and β-1,3-d-Glucan exposures were associated with increased BP. Our findings suggest that the biological PM components contribute to PM-related cardiovascular outcomes, and postexposure vascular endothelial growth factor elevation might be an adaptive response that attenuates these effects. © 2015 American Heart Association, Inc.

Conservation and Divergence in the Candida Species Biofilm Matrix Mannan-Glucan Complex Structure, Function, and Genetic Control.

PubMed

Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R

2018-04-03

Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which contributes to sequestration of antifungal drug, shielding the fungus from this external assault. Synthesis of a common polysaccharide backbone appears conserved. However, subtle structural differences in the branching side chains likely rely upon unique modification enzymes, which are species specific. Our findings identify MGCx backbone synthesis as a potential pan- Candida biofilm therapeutic target. Copyright © 2018 Dominguez et al.

Chemical Synthesis of Sulfated Yeast (Saccharomyces cerevisiae) Glucans and Their In Vivo Antioxidant Activity.

PubMed

Zhang, Hua; Zhang, Jing; Fan, Ziluan; Zhou, Xintao; Geng, Lin; Wang, Zhenyu; Regenstein, Joe M; Xia, Zhiqiang

2017-07-28

The effects of sulfation of yeast glucans was optimized using response surface methodology. The degree of sulfation was evaluated from 0.11 to 0.75 using ion-chromatography. The structural characteristics of SYG (sulfation of yeast glucans) with a DS = 0.75 were determined using high-performance liquid chromatography/gel-permeation chromatography and finally by Fourier transform infrared spectrometry. The SYG had lower viscosity and greater solubility than the native yeast glucans, suggesting that the conformation of the SYG had significantly changed. The results also showed that SYG had a significantly greater antioxidant activity in vivo compared to native yeast glucans.

Combination Therapy with Glucan and Coenzyme Q10 in Murine Experimental Autoimmune Disease and Cancer.

PubMed

Vetvicka, Vaclav; Vetvickova, Jana

2018-06-01

Coenzyme Q 10 is a well-accepted anti-oxidant agent known to play a protective role in various physiological and disease processes. Recently, Coenzyme Q 10 is gaining attention as a substance with significant anti-inflammatory properties. β-Glucan is the most studied immunomodulator with significant synergetic effects with numerous bioactive molecules. We aimed to evaluate the possible synergistic effects of simultaneous use of coenzyme Q 10 with the well-established immune modulator, β-glucan, on immune reactions and cancer development. Coenzyme Q 10 and β-glucan were used, both in vivo and in vitro, and their effects were evaluated using phagocytosis and cytokine secretion. Our study confirmed the strong anti-inflammatory effects of coenzyme Q 10 and showed that these effects were further potentiated with the addition of β-glucan. The anticancer effects of coenzyme Q 10 were less pronounced, but stronger, with the addition of β-glucan. There is significant synergy between coenzyme Q 10 and β-glucan. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Enhanced enzymatic hydrolysis of lignocellulose by optimizing enzyme complexes.

PubMed

Zhang, Mingjia; Su, Rongxin; Qi, Wei; He, Zhimin

2010-03-01

To enhance the conversion of the cellulose and hemicellulose, the corncob pretreated by aqueous ammonia soaking was hydrolyzed by enzyme complexes. The saturation limit for cellulase (Spezyme CP) was determined as 15 mg protein/g glucan (50 filter paper unit (FPU)/g glucan). The accessory enzymes (beta-glucosidase, xylanase, and pectinase) were supplemented to hydrolyze cellobiose (cellulase-inhibiting product), hemicellulose, and pectin (the component covering the fiber surfaces), respectively. It was found that beta-glucosidase (Novozyme 188) loading of 1.45 mg protein/g glucan [30 cellobiase units (CBU)/g glucan] was enough to eliminate the cellobiose inhibitor, and 2.9 mg protein/g glucan (60 CBU/g glucan) was the saturation limit. The supplementation of xylanase and pectinase can increase the conversion of cellulose and hemicellulose significantly. The yields of glucose and xylose enhanced with the increasing enzyme loading, but the increasing trend became low at high loading. Compared with xylanase, pectinase was more effective to promote the hydrolysis of cellulose and hemicellulose. The supplementation of pectinase with 0.12 mg protein/g glucan could increase the yields of glucose and xylose by 7.5% and 29.3%, respectively.

Effects of barley β-glucan-enriched flour fractions on the glycaemic index of bread.

PubMed

Finocchiaro, Franca; Ferrari, Barbara; Gianinetti, Alberto; Scazzina, Francesca; Pellegrini, Nicoletta; Caramanico, Rosita; Salati, Claudia; Shirvanian, Vigen; Stanca, Antonio Michele

2012-02-01

The aim of this research was to evaluate β-glucan-enriched flours, obtained from barleys with either normal or waxy starch, for their effects on the glycaemic index (GI) and the quality of bread. Rheological results confirmed that when barley flour was included in the dough the overall quality of bread slightly worsened. However, positive consequences on glycaemia were obtained with the normal starch barley: the GI of all-wheat bread (82.8 ± 7.2) was significantly reduced (57.2 ± 7.9) when 40% of wheat flour was substituted with β-glucan-enriched barley flour (6.0% ± 0.1 β-glucan in the final flour blend). In contrast, this positive effect was significantly reduced (GI: 70.1 ± 9.1) when 40% of wheat flour was substituted with the β-glucan-enriched flour of a waxy barley (CDC Alamo; 6.6 ± 0.2 β-glucan in the final flour blend), suggesting that the ability of β-glucans to lower the GI was affected by the barley starch-type.

Free-radical scavenging properties and antioxidant activities of botryosphaeran and some other β-D-glucans.

PubMed

Giese, Ellen C; Gascon, Jacob; Anzelmo, Gianluca; Barbosa, Aneli M; da Cunha, Mário A Alves; Dekker, Robert F H

2015-01-01

β-D-Glucans are known to present antitumor, anticancer, and anti-inflammatory activities that are influenced by their own antioxidant capacity. The antioxidant activity of botryosphaeran, an exopolysaccharide of the (1 → 3;1 → 6)-β-D-glucan type produced by the Botryosphaeria rhodina MAMB-05 was evaluated and compared to some other β-D-glucans (lasiodiplodan an exocellular (1 → 6)-β-D-glucan from Lasiodiplodia theobromae, laminarin and curdlan), and oligosaccharides, disaccharides, and monosaccharides in a study of scavenging activities of free radicals in-vitro. Botryosphaeran displayed high total antioxidant activity (80%) as well as good scavenging activity against hydroxyl radical (90.6%), superoxide anion (37%), hydrogen peroxide (38%), and nitric oxide radical (90%). No reducing power, metal-chelating capacity or inhibition of lipid peroxidation was observed for these β-D-glucans. The results demonstrated that botryosphaeran exhibited effective antioxidant activity as supported by many different assays, suggesting that this β-D-glucan may serve as a source of a new bioactive compound with effective antioxidant activity. Copyright © 2014 Elsevier B.V. All rights reserved.

Radioprotection by polysaccharides alone and in combination with aminothiols

NASA Astrophysics Data System (ADS)

Patchen, Myra L.; Macvittie, Thomas J.; Solberg, Brian D.; D'Alesandro, Michele M.; Brook, Itzhak

We demonstrated that glucan, a beta-1,3 polysaccharide immunomodulator, enhances survival of mice when administered before radiation exposure. Glucan's prophylactic survival-enhancing effects are mediated by several mechanisms including (1) increasing macrophage-mediated resistance to potentially lethal postirradiation opportunistic infections, (2) increasing the Do of hematopoietic progenitor cells, and (3) accelerating hematopoietic reconstitution. In addition, even when administered shortly after some otherwise lethal doses of radiation, glucan increases survival. Glucan's therapeutic survival-enhancing effects are also mediated through its ability to enhance macrophage function and to accelerate hematopoietic reconstitution; glucan's therapeutic potential, however, is ultimately dependent on the survival of a critical number of hematopoietic stem cells capable of responding to glucan's stimulatory effects. Preirradiation administration of the traditional aminothiol radioprotectants WR-2721 and WR-3689 has been previously demonstrated to be an extremely effective means to increase hematopoietic stem cell survival. Therapeutic glucan treatment administered in combination with preirradiation WR-2721 or WR-3689 treatment synergistically increases both hematopoietic reconstitution and survival. Such combined modality treatments offer new promise in treating acute radiation injury.

Evaluation of correlation between glucan conversion and degree of delignification depending on pretreatment strategies using Jabon Merah.

PubMed

Jang, Soo-Kyeong; Jeong, Hanseob; Kim, Ho-Yong; Choi, June-Ho; Kim, Jong-Hwa; Koo, Bon-Wook; Choi, In-Gyu

2017-07-01

The main purpose of this study was to investigate the glucan conversion rate after enzymatic hydrolysis depending on the treatment methods and conditions with changes in the chemical composition of treated solid fraction of Jabon Merah. The glucan conversion rate (17.4%) was not significantly improved after liquid hot water treatment (1st step) even though most of the hemicellulose was dissolved into liquid hydrolysate. Subsequently, dilute acid, organosolv, and peracetic acid treatment (2nd step) was conducted under various conditions to enhance glucan conversion. Among the 2nd step treatment, the glucan conversion rate of organosolv (max. 46.0%) and peracetic acid treatment (max. 65.9%) was increased remarkably through decomposition of acid-insoluble lignin (AIL). Finally, the glucan conversion rate and AIL content were highly correlated, which was revealed by the R-squared value (0.84), but inhibitory factors including cellulose crystallinity must be considered for advanced glucan conversion from highly recalcitrant biomasses, such as Jabon Merah. Copyright © 2017 Elsevier Ltd. All rights reserved.

Molecular Dissection of Xyloglucan Recognition in a Prominent Human Gut Symbiont

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tauzin, Alexandra S.; Kwiatkowski, Kurt J.; Orlovsky, Nicole I.

Polysaccharide utilization loci (PUL) within the genomes of resident human gutBacteroidetesare central to the metabolism of the otherwise indigestible complex carbohydrates known as “dietary fiber.” However, functional characterization of PUL lags significantly behind sequencing efforts, which limits physiological understanding of the human-bacterial symbiosis. In particular, the molecular basis of complex polysaccharide recognition, an essential prerequisite to hydrolysis by cell surface glycosidases and subsequent metabolism, is generally poorly understood. Here, we present the biochemical, structural, and reverse genetic characterization of two unique cell surface glycan-binding proteins (SGBPs) encoded by a xyloglucan utilization locus (XyGUL) fromBacteroides ovatus, which are integral to growthmore » on this key dietary vegetable polysaccharide. Biochemical analysis reveals that these outer membrane-anchored proteins are in fact exquisitely specific for the highly branched xyloglucan (XyG) polysaccharide. The crystal structure of SGBP-A, a SusD homolog, with a bound XyG tetradecasaccharide reveals an extended carbohydrate-binding platform that primarily relies on recognition of the β-glucan backbone. The unique, tetra-modular structure of SGBP-B is comprised of tandem Ig-like folds, with XyG binding mediated at the distal C-terminal domain. Despite displaying similar affinities for XyG, reverse-genetic analysis reveals that SGBP-B is only required for the efficient capture of smaller oligosaccharides, whereas the presence of SGBP-A is more critical than its carbohydrate-binding ability for growth on XyG. Finally, together, these data demonstrate that SGBP-A and SGBP-B play complementary, specialized roles in carbohydrate capture byB. ovatusand elaborate a model of how vegetable xyloglucans are accessed by theBacteroidetes.« less

Molecular Dissection of Xyloglucan Recognition in a Prominent Human Gut Symbiont

DOE PAGES

Tauzin, Alexandra S.; Kwiatkowski, Kurt J.; Orlovsky, Nicole I.; ...

2016-04-26

Polysaccharide utilization loci (PUL) within the genomes of resident human gutBacteroidetesare central to the metabolism of the otherwise indigestible complex carbohydrates known as “dietary fiber.” However, functional characterization of PUL lags significantly behind sequencing efforts, which limits physiological understanding of the human-bacterial symbiosis. In particular, the molecular basis of complex polysaccharide recognition, an essential prerequisite to hydrolysis by cell surface glycosidases and subsequent metabolism, is generally poorly understood. Here, we present the biochemical, structural, and reverse genetic characterization of two unique cell surface glycan-binding proteins (SGBPs) encoded by a xyloglucan utilization locus (XyGUL) fromBacteroides ovatus, which are integral to growthmore » on this key dietary vegetable polysaccharide. Biochemical analysis reveals that these outer membrane-anchored proteins are in fact exquisitely specific for the highly branched xyloglucan (XyG) polysaccharide. The crystal structure of SGBP-A, a SusD homolog, with a bound XyG tetradecasaccharide reveals an extended carbohydrate-binding platform that primarily relies on recognition of the β-glucan backbone. The unique, tetra-modular structure of SGBP-B is comprised of tandem Ig-like folds, with XyG binding mediated at the distal C-terminal domain. Despite displaying similar affinities for XyG, reverse-genetic analysis reveals that SGBP-B is only required for the efficient capture of smaller oligosaccharides, whereas the presence of SGBP-A is more critical than its carbohydrate-binding ability for growth on XyG. Finally, together, these data demonstrate that SGBP-A and SGBP-B play complementary, specialized roles in carbohydrate capture byB. ovatusand elaborate a model of how vegetable xyloglucans are accessed by theBacteroidetes.« less

Molecular Dissection of Xyloglucan Recognition in a Prominent Human Gut Symbiont

PubMed Central

Tauzin, Alexandra S.; Kwiatkowski, Kurt J.; Orlovsky, Nicole I.; Smith, Christopher J.; Creagh, A. Louise; Haynes, Charles A.; Wawrzak, Zdzislaw

2016-01-01

ABSTRACT Polysaccharide utilization loci (PUL) within the genomes of resident human gut Bacteroidetes are central to the metabolism of the otherwise indigestible complex carbohydrates known as “dietary fiber.” However, functional characterization of PUL lags significantly behind sequencing efforts, which limits physiological understanding of the human-bacterial symbiosis. In particular, the molecular basis of complex polysaccharide recognition, an essential prerequisite to hydrolysis by cell surface glycosidases and subsequent metabolism, is generally poorly understood. Here, we present the biochemical, structural, and reverse genetic characterization of two unique cell surface glycan-binding proteins (SGBPs) encoded by a xyloglucan utilization locus (XyGUL) from Bacteroides ovatus, which are integral to growth on this key dietary vegetable polysaccharide. Biochemical analysis reveals that these outer membrane-anchored proteins are in fact exquisitely specific for the highly branched xyloglucan (XyG) polysaccharide. The crystal structure of SGBP-A, a SusD homolog, with a bound XyG tetradecasaccharide reveals an extended carbohydrate-binding platform that primarily relies on recognition of the β-glucan backbone. The unique, tetra-modular structure of SGBP-B is comprised of tandem Ig-like folds, with XyG binding mediated at the distal C-terminal domain. Despite displaying similar affinities for XyG, reverse-genetic analysis reveals that SGBP-B is only required for the efficient capture of smaller oligosaccharides, whereas the presence of SGBP-A is more critical than its carbohydrate-binding ability for growth on XyG. Together, these data demonstrate that SGBP-A and SGBP-B play complementary, specialized roles in carbohydrate capture by B. ovatus and elaborate a model of how vegetable xyloglucans are accessed by the Bacteroidetes. PMID:27118585

Exploiting fungal cell wall components in vaccines.

PubMed

Levitz, Stuart M; Huang, Haibin; Ostroff, Gary R; Specht, Charles A

2015-03-01

Innate recognition of fungi leads to strong adaptive immunity. Investigators are trying to exploit this observation in vaccine development by combining antigens with evolutionarily conserved fungal cell wall carbohydrates to induce protective responses. Best studied is β-1,3-glucan, a glycan that activates complement and is recognized by dectin-1. Administration of antigens in association with β-1,3-glucan, either by direct conjugation or complexed in glucan particles, results in robust humoral and cellular immune responses. While the host has a host of mannose receptors, responses to fungal mannoproteins generally are amplified if cells are cooperatively stimulated with an additional danger signal such as a toll-like receptor agonist. Chitosan, a polycationic homopolymer of glucosamine manufactured by the deacetylation of chitin, is being studied as an adjuvant in DNA and protein-based vaccines. It appears particularly promising in mucosal vaccines. Finally, universal and organism-specific fungal vaccines have been formulated by conjugating fungal cell wall glycans to carrier proteins. A major challenge will be to advance these experimental findings so that at risk patients can be protected.

Exploiting fungal cell wall components in vaccines

PubMed Central

Levitz, Stuart M.; Huang, Haibin; Ostroff, Gary R.; Specht, Charles A.

2014-01-01

Innate recognition of fungi leads to strong adaptive immunity. Investigators are trying to exploit this observation in vaccine development by combining antigens with evolutionarily conserved fungal cell wall carbohydrates to induce protective responses. Best studied is β-1,3-glucan, a glycan that activates complement and is recognized by Dectin-1. Administration of antigens in association with β-1,3-glucan, either by direct conjugation or complexed in glucan particles, results in robust humoral and cellular immune responses. While the host has a host of mannose receptors, responses to fungal mannoproteins generally are amplified if cells are cooperatively stimulated with an additional danger signal such as a toll-like receptor agonist. Chitosan, a polycationic homopolymer of glucosamine manufactured by the deacetylation of chitin, is being studied as an adjuvant in DNA and protein-based vaccines. It appears particularly promising in mucosal vaccines. Finally, universal and organism-specific fungal vaccines have been formulated by conjugating fungal cell wall glycans to carrier proteins. A major challenge will be to advance these experimental findings so that at risk patients can be protected. PMID:25404118

Interaction between chitosan and its related enzymes: A review.

PubMed

Shinya, Shoko; Fukamizo, Tamo

2017-11-01

Chitosan-related enzymes including chitosanases, exo-β-glucosaminidases, and enzymes having chitosan-binding modules recognize ligands through electrostatic interactions between the acidic amino acids in proteins and amino groups of chitosan polysaccharides. However, in GH8 chitosanases, several aromatic residues are also involved in substrate recognition through stacking interactions, and these enzymes consequently hydrolyze β-1,4-glucan as well as chitosan. The binding grooves of these chitosanases are extended and opened at both ends of the grooves, so that the enzymes can clamp a long chitosan polysaccharide. The association/dissociation of positively charged glucosamine residues to/from the binding pocket of a GH2 exo-β-glucosaminidase controls the p K a of the catalytic acid, thereby maintaining the high catalytic potency of the enzyme. In contrast to chitosanases, chitosan-binding modules only accommodate a couple of glucosamine residues, predominantly recognizing the non-reducing end glucosamine residue of chitosan by electrostatic interactions and a hydrogen-bonding network. These structural findings on chitosan-related enzymes may contribute to future applications for the efficient conversion of the chitin/chitosan biomass. Copyright © 2017 Elsevier B.V. All rights reserved.

AFRRI Reports, Third Quarter 1993

DTIC Science & Technology

1993-10-01

demonstrated that glucan , a beta -1,3- exerted its antibacterial activity either directly against or- polysaccharide immunomodulator, is capable of...h. Isolates were identified by standard criteria (16, La.). This glucan preparation was a soluble (1-3)- beta -D- 33). glucan isolated from the inner...particulate glucan . Int. J. pharmacol. IL407-425. Cancer 24-.773-779. 25. Patches, Mi. I, T. J. MacVklde, and W. E. Jackas". 1989. 5. Easas.., C. S. F

Development of an Oral Barley Beta-Glucan Adjuvant That Augments the Tumoricidal Activity of Antibodies or Vaccines Used for the Immunotherapy of Breast Cancer

DTIC Science & Technology

2003-07-01

These Data provided strong evidence for the efficacy of an oral beta - glucan adjuvant for use in combination with anti-tumor antibodies such as...oral beta - glucan . The data showing that antibodies must activate complement and deposit iC3b on tumors means that antibodies that do not to activate complement would not benefit from oral beta - glucan .

Plants with elevated levels of glucan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pauly, Markus; Kraemer, Florian J.; Hake, Sarah

The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.

Host-pathogen interactions. XV. Fungal glucans which elicit phytoalexin accumulation in soybean also elicit the accumulation of phytoalexins in other plants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cline, K.; Wade, M.; Albersheim, P.

1978-01-01

A ..beta..-glucan isolated from the mycelial walls of Phytophthora megasperma var. sojae and a glucan purified from yeast extract stimulate the accumulation of phytoalexins in red kidney bean, Phaseolus vulgaris, and stimulate the accumulation of the phytoalexin, rishitin, in potato tubers, Solanum tuberosum. Treatment of kidney bean cotyledons with the glucan elicitors resulted in the accumulation of at least five fungistatic compounds. These compounds migrate during thin layer chromatography identically to the fungistatic compounds which accumulate in kidney beans which have been inoculated with Colletotrichum lindemuthianum, a fungal pathogen of kidney beans. Potatoes accumulate as much as 29 micrograms ofmore » rishitin per gram fresh weight following exposure to the glucan from Phytophthora megasperma va. sojae and as much as 19.5 micrograms of rishitin per gram fresh weight following exposure to yeast glucan.« less

Saccharomyces Cerevisiae Cell Wall Components as Tools for Ochratoxin A Decontamination

PubMed Central

Piotrowska, Małgorzata; Masek, Anna

2015-01-01

The aim of this study was to evaluate the usefulness of Saccharomyces cerevisiae cell wall preparations in the adsorption of ochratoxin A (OTA). The study involved the use of a brewer’s yeast cell wall devoid of protein substances, glucans obtained by water and alkaline extraction, a glucan commercially available as a dietary supplement for animals and, additionally, dried brewer’s yeast for comparison. Fourier Transform Infrared (FTIR) analysis of the obtained preparations showed bands characteristic for glucans in the resulting spectra. The yeast cell wall preparation, water-extracted glucan and the commercial glucan bound the highest amount of ochratoxin A, above 55% of the initial concentration, and the alkaline-extracted glucan adsorbed the lowest amount of this toxin. It has been shown that adsorption is most effective at a close-to-neutral pH, while being considerably limited in alkaline conditions. PMID:25848694

Lung cancer and β-glucans: review of potential therapeutic applications.

PubMed

Roudi, Raheleh; Mohammadi, Shahla Roudbar; Roudbary, Maryam; Mohsenzadegan, Monireh

2017-08-01

The potential of natural substances with immunotherapeutic properties has long been studied. β-glucans, a cell wall component of certain bacteria and fungi, potentiate the immune system against microbes and toxic substances. Moreover, β-glucans are known to exhibit direct anticancer effects and can suppress cancer proliferation through immunomodulatory pathways. Mortality of lung cancer has been alarmingly increasingly worldwide; therefore, treatment of lung cancer is an urgent necessity. Numerous researchers are now dedicated to using β-glucans as a therapy for lung cancer. In the present attempt, we have reviewed the studies addressing therapeutic effects of β-glucans in primary and metastatic lung cancer published in the time period of 1991-2016.

Crystal structures of Mycobacterium tuberculosis GlgE and complexes with non-covalent inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindenberger, Jared J.; Kumar Veleti, Sri; Wilson, Brittney N.

GlgE is a bacterial maltosyltransferase that catalyzes the elongation of a cytosolic, branched α-glucan. In Mycobacterium tuberculosis (M. tb), inactivation of GlgE (Mtb GlgE) results in the rapid death of the organism due to a toxic accumulation of the maltosyl donor, maltose-1-phosphate (M1P), suggesting that GlgE is an intriguing target for inhibitor design. In this study, the crystal structures of the Mtb GlgE in a binary complex with maltose and a ternary complex with maltose and a maltosyl-acceptor molecule, maltohexaose, were solved to 3.3 Å and 4.0 Å, respectively. The maltohexaose structure reveals a dominant site for α-glucan binding. Tomore » obtain more detailed interactions between first generation, non-covalent inhibitors and GlgE, a variant Streptomyces coelicolor GlgEI (Sco GlgEI-V279S) was made to better emulate the Mtb GlgE M1P binding site. The structure of Sco GlgEI-V279S complexed with α-maltose-C-phosphonate (MCP), a non-hydrolyzable substrate analogue, was solved to 1.9 Å resolution, and the structure of Sco GlgEI-V279S complexed with 2,5-dideoxy-3-O-α-D-glucopyranosyl-2,5-imino-D-mannitol (DDGIM), an oxocarbenium mimic, was solved to 2.5 Å resolution. These structures detail important interactions that contribute to the inhibitory activity of these compounds, and provide information on future designs that may be exploited to improve upon these first generation GlgE inhibitors.« less

Chilling of Dormant Buds Hyperinduces FLOWERING LOCUS T and Recruits GA-Inducible 1,3-β-Glucanases to Reopen Signal Conduits and Release Dormancy in Populus[W][OA

PubMed Central

Rinne, Päivi L.H.; Welling, Annikki; Vahala, Jorma; Ripel, Linda; Ruonala, Raili; Kangasjärvi, Jaakko; van der Schoot, Christiaan

2011-01-01

In trees, production of intercellular signals and accessibility of signal conduits jointly govern dormancy cycling at the shoot apex. We identified 10 putative cell wall 1,3-β-glucanase genes (glucan hydrolase family 17 [GH17]) in Populus that could turn over 1,3-β-glucan (callose) at pores and plasmodesmata (PD) and investigated their regulation in relation to FT and CENL1 expression. The 10 genes encode orthologs of Arabidopsis thaliana BG_ppap, a PD-associated glycosylphosphatidylinositol (GPI) lipid-anchored protein, the Arabidopsis PD callose binding protein PDCB, and a birch (Betula pendula) putative lipid body (LB) protein. We found that these genes were differentially regulated by photoperiod, by chilling (5°C), and by feeding of gibberellins GA3 and GA4. GA3 feeding upregulated all LB-associated GH17s, whereas GA4 upregulated most GH17s with a GPI anchor and/or callose binding motif, but only GA4 induced true bud burst. Chilling upregulated a number of GA biosynthesis and signaling genes as well as FT, but not CENL1, while the reverse was true for both GA3 and GA4. Collectively, the results suggest a model for dormancy release in which chilling induces FT and both GPI lipid-anchored and GA3-inducible GH17s to reopen signaling conduits in the embryonic shoot. When temperatures rise, the reopened conduits enable movement of FT and CENL1 to their targets, where they drive bud burst, shoot elongation, and morphogenesis. PMID:21282527

Clinical Utility of Fungal Screening Assays in Adults with Severe Burns

DTIC Science & Technology

2013-01-01

available test, FungitellTM Glucan Assay for (1,3) b D glucan (BG) in serum (Associates of Cape Cod Inc., East Falmouth, MA), is a qualitative...considered a positive test in the United States and was used as a positive value in this study. A positive test is reported with a b D glucan concentration... Glucan as a diagnostic adjunct for invasive fungal infections: validation, cutoff development, and performance in patients with acute myelogenous

Structural characterization and evaluation of antioxidant, anticancer and hypoglycemic activity of radiation degraded oat (Avena sativa) β- glucan

NASA Astrophysics Data System (ADS)

Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.

2018-03-01

Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.

β-Glucans Are Masked but Contribute to Pulmonary Inflammation During Pneumocystis Pneumonia.

PubMed

Kutty, Geetha; Davis, A Sally; Ferreyra, Gabriela A; Qiu, Ju; Huang, Da Wei; Sassi, Monica; Bishop, Lisa; Handley, Grace; Sherman, Brad; Lempicki, Richard; Kovacs, Joseph A

2016-09-01

β-glucans, which can activate innate immune responses, are a major component in the cell wall of the cyst form of Pneumocystis In the current study, we examined whether β-1,3-glucans are masked by surface proteins in Pneumocystis and what role β-glucans play in Pneumocystis-associated inflammation. For 3 species, including Pneumocystis jirovecii, which causes Pneumocystis pneumonia in humans, Pneumocystis carinii, and Pneumocystis murina, β-1,3-glucans were masked in most organisms, as demonstrated by increased exposure following trypsin treatment. Using quantitative polymerase chain reaction and microarray techniques, we demonstrated in a mouse model of Pneumocystis pneumonia that treatment with caspofungin, an inhibitor of β-1,3-glucan synthesis, for 21 days decreased expression of a broad panel of inflammatory markers, including interferon γ, tumor necrosis factor α, interleukin 1β, interleukin 6, and multiple chemokines/chemokine ligands. Thus, β-glucans in Pneumocystis cysts are largely masked, which likely decreases innate immune activation; this mechanism presumably was developed for interactions with immunocompetent hosts, in whom organism loads are substantially lower. In immunosuppressed hosts with a high organism burden, organism death and release of glucans appears to be an important contributor to deleterious host inflammatory responses. Published by Oxford University Press for the Infectious Diseases Society of America 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Quantitative evaluation of 1,3,1,6 β-D-glucan contents in wild-growing species of edible Polish mushrooms

PubMed

Mirończuk-Chodakowska, Iwona; Witkowska, Anna Maria; Zujko, Małgorzata Elżbieta; Terlikowska, Katarzyna Maria

Macrofungal β-glucans are mainly represented by compounds with β-1,3- and β-1,6 glycosidic bonds. They have been shown to have immunomodulatory, anticancer, and antioxidant properties. Although there are many reports on the bioactivity and structure of fungal glucans, studies on the quantitative assessment of these compounds are sparse. The aim of the study was to determine total β-glucans and 1,3-1,6-β-D-glucan contents in selected species of wild-growing edible Polish mushrooms. Eight species of wild-growing edible mushrooms Boletus pinophilus, Hydnum repandum, Craterellus cornucopioides, Suillus variegatus, Suillus granulatus, Gyroporus cyanescens, Tricholomopsis rutilans, and Auricularia auricula-judae and one species of cultivated mushroom for comparison purposes Agaricus bisporus, were analyzed. Quantitative analysis of 1,3-1,6-β-D-glucans was done using a colorimetric method in accordance with Nitschke et al. Mean total β-glucan content varied from 13.5 g/100 g dry mass in A. bisporus (portobello variety) to 40.9 g/100 g dry mass in T. rutilans. Mean 1,3-1,6-β-D-glucan content in the analyzed fruiting bodies ranged from 3.9 g/100 g dry mass in Agaricus bisporus (cremini) to 16.8 g/100 g dry mass in Auricularia auricula-judae (wood ear). The following mushrooms demonstrated the greatest percentage of 1,3-1,6-β-D-glucan contents in relation to the total β-glucan content: Gyroporus cyanescens (54%), Suillus granulatus (49.8%), Auricularia auricula-judae (47.9%), and Suillus variegatus (40.6%). Among the analyzed species, wild-growing mushrooms had a generally higher average 1,3-1,6-β-Dglucan content compared with cultivated mushrooms such as A. bisporus. The highest average content of these polysaccharides was observed in medicinal mushroom Auricularia auricula-judae. Comparable 1,3-1,6-β-D-glucan content, in relation to this mushroom species, was found in Gyroporus cyanescens, Suillus granulatus and Suillus variegatus, which points to the possibility of the use of these species of mushrooms as medicinal foods.

Barley β-glucan increases fecal bile acid excretion and short chain fatty acid levels in mildly hypercholesterolemic individuals.

PubMed

Thandapilly, Sijo J; Ndou, Saymore P; Wang, Yanan; Nyachoti, Charles M; Ames, Nancy P

2018-06-20

The cholesterol-lowering effect of barley β-glucan has been proposed to be the result of a pleiotropic effect, which involves several biological mechanisms such as gut fermentation, inhibition of intestinal cholesterol absorption and increased bile acid excretion and its synthesis. However, one of the recent studies from our laboratory indicated that increased bile acid excretion and subsequent increase in its synthesis, but not the inhibition of cholesterol absorption or synthesis might be responsible for the cholesterol-lowering effect of barley β-glucan. Accordingly, the primary objective of the present study was to investigate the concentration of bile acids (BA), neutral sterols (NS) and short chain fatty acids (SCFA) excreted through the feces by mildly hypercholesterolemic subjects who consumed diets containing barley β-glucan with varying molecular weights (MW) and concentrations. In a controlled, four phase, crossover trial, 30 mildly hypercholesterolemic but otherwise healthy subjects were randomly assigned to receive breakfast containing 3 g high MW (HMW), 5 g low MW (LMW), 3 g LMW barley β-glucan or a control diet for 5 weeks. The concentrations of BA, NS and SCFA in the feces were measured at the end of each treatment phase. Compared to the other treatment groups, 3 g day-1 HMW barley β-glucan consumption resulted in increased lithocholic acid (LCA) excretion (P < 0.001) but not LMW β-glucan, even at the high dose of 5 g day-1. Increased fermentability of fibre was also evident from a significant increase in fecal total SCFA concentrations in response to the 3 g HMW β-glucan diet compared to the 3 g LMW barley β-glucan and control diet (P = 0.0015). In summary, the current results validate our previous report on the role of fecal bile acid excretion in cholesterol lowering through the consumption of barley β-glucan. In addition, increased SCFA concentrations indicate that an increase in β-glucan molecular weight promotes hindgut fermentation, which might also be playing a role in attenuating cholesterol levels.

Design of a potentially prebiotic and responsive encapsulation material for probiotic bacteria based on chitosan and sulfated β-glucan.

PubMed

Yucel Falco, Cigdem; Sotres, Javier; Rascón, Ana; Risbo, Jens; Cárdenas, Marité

2017-02-01

Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured by changes in the bacterial suspension zeta potential. Viability of coated cells was shown using plate counting method. The coatings on solid surfaces were examined after exposure to mimics of gastrointestinal fluids and a commercially available β-glucanase. Successful build-up of multilayers was confirmed with QCM-D and SE. Zeta potential values proved the coating of cells. There was 2 log CFU/mL decrease after coating cells with four alternating layers of chitosan and sulfated β-glucan when compared to viability of uncoated cells. The coatings were partially degraded after exposure to simulated intestinal fluid and restructured as a result of β-glucanase treatment, mimicking enzymes present in the microflora of the human gut, but seemed to resist acidic gastric conditions. Therefore, coatings of chitosan and sulfated β-glucan can potentially be exploited as carriers for probiotics and delicate nutraceuticals. Copyright © 2016 Elsevier Inc. All rights reserved.

Complementary Sample Preparation Strategies for Analysis of Cereal β-Glucan Oxidation Products by UPLC-MS/MS.

PubMed

Boulos, Samy; Nyström, Laura

2017-01-01

The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO • ) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO • -attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO • -attack on glucose units irrespective of glycosidic linkage and neighborhood. The method was demonstrated to be (1) sufficiently sensitive to allow for the analysis of oxidation products also from a mild ascorbate-driven Fenton reaction, and (2) to be specific for cereal β-glucan even in the presence of other co-oxidized polysaccharides. This opens doors to applications in food processing to assess potential oxidations and provides the detailed structural basis to understand the effect oxidized functional groups have on β-glucan's health promoting and technological properties.

Complementary Sample Preparation Strategies for Analysis of Cereal β-Glucan Oxidation Products by UPLC-MS/MS

PubMed Central

Boulos, Samy; Nyström, Laura

2017-01-01

The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO•-attack on glucose units irrespective of glycosidic linkage and neighborhood. The method was demonstrated to be (1) sufficiently sensitive to allow for the analysis of oxidation products also from a mild ascorbate-driven Fenton reaction, and (2) to be specific for cereal β-glucan even in the presence of other co-oxidized polysaccharides. This opens doors to applications in food processing to assess potential oxidations and provides the detailed structural basis to understand the effect oxidized functional groups have on β-glucan's health promoting and technological properties. PMID:29164106

Non-branched β-1,3-glucan oligosaccharides trigger immune responses in Arabidopsis.

PubMed

Mélida, Hugo; Sopeña-Torres, Sara; Bacete, Laura; Garrido-Arandia, María; Jordá, Lucía; López, Gemma; Muñoz-Barrios, Antonio; Pacios, Luis F; Molina, Antonio

2018-01-01

Fungal cell walls, which are essential for environmental adaptation and host colonization by the fungus, have been evolutionarily selected by plants and animals as a source of microbe-associated molecular patterns (MAMPs) that, upon recognition by host pattern recognition receptors (PRRs), trigger immune responses conferring disease resistance. Chito-oligosaccharides [β-1,4-N-acetylglucosamine oligomers, (GlcNAc) n ] are the only glycosidic structures from fungal walls that have been well-demonstrated to function as MAMPs in plants. Perception of (GlcNAc) 4-8 by Arabidopsis involves CERK1, LYK4 and LYK5, three of the eight members of the LysM PRR family. We found that a glucan-enriched wall fraction from the pathogenic fungus Plectosphaerella cucumerina which was devoid of GlcNAc activated immune responses in Arabidopsis wild-type plants but not in the cerk1 mutant. Using this differential response, we identified the non-branched 1,3-β-d-(Glc) hexasaccharide as a major fungal MAMP. Recognition of 1,3-β-d-(Glc) 6 was impaired in cerk1 but not in mutants defective in either each of the LysM PRR family members or in the PRR-co-receptor BAK1. Transcriptomic analyses of Arabidopsis plants treated with 1,3-β-d-(Glc) 6 further demonstrated that this fungal MAMP triggers the expression of immunity-associated genes. In silico docking analyses with molecular mechanics and solvation energy calculations corroborated that CERK1 can bind 1,3-β-d-(Glc) 6 at effective concentrations similar to those of (GlcNAc) 4 . These data support that plants, like animals, have selected as MAMPs the linear 1,3-β-d-glucans present in the walls of fungi and oomycetes. Our data also suggest that CERK1 functions as an immune co-receptor for linear 1,3-β-d-glucans in a similar way to its proposed function in the recognition of fungal chito-oligosaccharides and bacterial peptidoglycan MAMPs. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

β-D-glucan inhibits endocrine-resistant breast cancer cell proliferation and alters gene expression

PubMed Central

JAFAAR, ZAINAB M.T.; LITCHFIELD, LACEY M.; IVANOVA, MARGARITA M.; RADDE, BRANDIE N.; AL-RAYYAN, NUMAN; KLINGE, CAROLYN M.

2014-01-01

Endocrine therapies have been successfully used for breast cancer patients with estrogen receptor α (ERα) positive tumors, but ∼40% of patients relapse due to endocrine resistance. β-glucans are components of plant cell walls that have immunomodulatory and anticancer activity. The objective of this study was to examine the activity of β-D-glucan, purified from barley, in endocrine-sensitive MCF-7 versus endocrine-resistant LCC9 and LY2 breast cancer cells. β-D-glucan dissolved in DMSO but not water inhibited MCF-7 cell proliferation in a concentration-dependent manner as measured by BrdU incorporation with an IC50 of ∼164±12 μg/ml. β-D-glucan dissolved in DMSO inhibited tamoxifen/endocrine-resistant LCC9 and LY2 cell proliferation with IC50 values of 4.6±0.3 and 24.2±1.4 μg/ml, respectively. MCF-10A normal breast epithelial cells showed a higher IC50 ∼464 μg/ml and the proliferation of MDA-MB-231 triple negative breast cancer cells was not inhibited by β-D-glucan. Concentration-dependent increases in the BAX/BCL2 ratio and cell death with β-D-glucan were observed in MCF-7 and LCC9 cells. PCR array analysis revealed changes in gene expression in response to 24-h treatment with 10 or 50 μg/ml β-D-glucan that were different between MCF-7 and LCC9 cells as well as differences in basal gene expression between the two cell lines. Select results were confirmed by quantitative real-time PCR demonstrating that β-D-glucan increased RASSF1 expression in MCF-7 cells and IGFBP3, CTNNB1 and ERβ transcript expression in LCC9 cells. Our data indicate that β-D-glucan regulates breast cancer-relevant gene expression and may be useful for inhibiting endocrine-resistant breast cancer cell proliferation. PMID:24534923

Gamma-irradiated β-glucan modulates signaling molecular targets of hepatocellular carcinoma in rats.

PubMed

Elsonbaty, Sawsan M; Zahran, Walid E; Moawed, Fatma Sm

2017-08-01

β-glucans are one of the most abundant forms of polysaccharides known as biological response modifiers which influence host's biological response and stimulate immune system. Accordingly, this study was initiated to evaluate irradiated β-glucan as a modulator for cellular signaling growth factors involved in the pathogenesis of hepatocellular carcinoma in rats. Hepatocellular carcinoma was induced with 20 mg diethylnitrosamine/kg BW. Rats received daily by gastric gavage 65 mg irradiated β-glucan/kg BW. It was found that treatment of rats with diethylnitrosamine induced hepatic injury and caused significant increase in liver injury markers with a concomitant significant increase in both hepatic oxidative and inflammatory indices: alpha-fetoprotein, interferon gamma, and interleukin 6 in comparison with normal and irradiated β-glucan-treated groups. Western immunoblotting showed a significant increase in the signaling growth factors: extracellular signal-regulated kinase 1 and phosphoinositide 3-kinase proteins in a diethylnitrosamine-treated group while both preventive and therapeutic irradiated β-glucan treatments recorded significant improvement versus diethylnitrosamine group via the modulation of growth factors that encounters hepatic toxicity. The transcript levels of vascular endothelial growth factor A and inducible nitric oxide synthase genes were significantly higher in the diethylnitrosamine-treated group in comparison with controls. Preventive and therapeutic treatments with irradiated β-glucan demonstrated that the transcript level of these genes was significantly decreased which demonstrates the protective effect of β-glucan. Histological investigations revealed that diethylnitrosamine treatment affects the hepatic architecture throughout the significant severe appearance of inflammatory cell infiltration in the portal area and congestion in the portal vein in association with severe degeneration and dysplasia in hepatocytes all over hepatic parenchyma. The severity of hepatic architecture changes was significantly decreased with both β-glucan therapeutic and preventive treatments. In conclusion, irradiated β-glucan modulated signal growth factors, vascular endothelial growth factor A, extracellular signal-regulated kinase 1, and phosphatidylinositol-3-kinase, which contributed to experimental hepatocarcinogenesis.

Cost-effectiveness of Maintaining Daily Intake of Oat β-Glucan for Coronary Heart Disease Primary Prevention.

PubMed

Earnshaw, Stephanie R; McDade, Cheryl L; Chu, YiFang; Fleige, Lisa E; Sievenpiper, John L

2017-04-01

Oat β-glucan reduces cholesterol levels and thus reduces the risk for coronary heart disease (CHD). However, its economic impact has not been well studied. We examined the economic impact of daily intake of ≥3 g of oat β-glucan in primary prevention of CHD in patients receiving statins or no pharmacologic treatment. A decision model was developed to compare costs and outcomes associated with lowering cholesterol levels with no pharmacologic treatment and normal diet, no pharmacologic treatment plus ≥3 g/d of oat β-glucan, and statin therapy plus ≥3 g/d of oat β-glucan. The population comprised men 45, 55, or 65 years of age with no history of cardiovascular disease and a 10-year risk for CHD of 5%, 7.5%, or 10%. Clinical efficacy data were gathered from meta-analyses; safety data, costs, and utilities were gathered from published literature. Cost per quality-adjusted life years and number of first events were reported. Maintaining ≥3 g/d of β-glucan may be cost-effective in men aged 45, 55, and 65 years with 10-year CHD risks of 5.0%, 7.5%, and 10.0% taking no pharmacologic treatment or on statins. It may also reduce first events of myocardial infarction and CHD death. Results are sensitive to oat β-glucan cost but insensitive to changes in other parameters. Maintaining ≥3 g of oat β-glucan daily remains cost-effective within plausible range of values. β-glucan may be cost-effective for preventing CHD events in middle-aged men with no history of cardiovascular events whose 10-year CHD risk is ≥5%. Maintaining daily β-glucan intake may have considerable impact on first events. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

β-Glucans (Saccharomyces cereviseae) Reduce Glucose Levels and Attenuate Alveolar Bone Loss in Diabetic Rats with Periodontal Disease

PubMed Central

2015-01-01

The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p < 0.05). β-glucans reduced blood glucose, cholesterol and triacylglycerol levels in diabetic animals, both with and without periodontal disease (p < 0.05). Furthermore, treatment with β-glucans reduced the expression of cyclooxygenase-2 and receptor activator of nuclear factor kappa-B ligand and increased osteoprotegerin expression in animals with diabetes and periodontal disease (p < 0.05). It was concluded that treatment with β-glucans has beneficial metabolic and periodontal effects in diabetic rats with periodontal disease. PMID:26291983

Substantial decrease in cell wall α-1,3-glucan caused by disruption of the kexB gene encoding a subtilisin-like processing protease in Aspergillus oryzae.

PubMed

Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu

2016-09-01

Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.

Interactions between meat proteins and barley (Hordeum spp.) β-glucan within a reduced-fat breakfast sausage system.

PubMed

Morin, L A; Temelli, F; McMullen, L

2004-11-01

Barley β-glucan, a soluble fibre component with health benefits, has the potential to be used as a fat replacer in meat systems. Interactions between meat proteins and β-glucan gum were examined in reduced-fat (12%, w/w) sausages formulated with β-glucan at 0.3% (w/w) (0.3β-gl) and 0.8% (w/w) (0.8β-gl) levels, as well as high- and reduced-fat controls. Cooking loss results indicated that β-glucan gum held more water in cooked sausages than control gum (carboxymethyl cellulose), due to its ability to form a tighter network within the protein matrix, as shown by scanning electron microscopy. In a raw system, β-glucan gum was not as effective at retaining moisture as a stable protein network, formed by heating. Differential scanning calorimetry results showed that sausages with a higher gum to protein ratio required additional energy for protein denaturation to occur. Findings indicate that β-glucan gum increases the amount of moisture held in a cooked meat protein system, due to the physical entrapment of water, when compared to the high-fat control, but is similar to the reduced-fat formulation with added water.

AFRRI (Armed Forces Radiobiology Research Institute) Reports, October, January-March 1989

DTIC Science & Technology

1989-01-01

and/or enhance recovery from radiation injury. 2. GLUCAN : BACKGROUND AND GENERAL IMMUNOLOGIC AND HEMOPOIETIC EFFECTS Glucan (Fig. 1) is a beta -l.3...and particulate glucan . Int. J Cancer 24, 773-779(1979). 18 J. Smtit’t z. P. R. ALMOND. J. R. Ct.NNINGHIAM, J. G. HoL r, R. LOEVINGIER. N...L., MacVittie, T. J., and Jackson, W. E. 4_ostirradia- tion glucan administration enhances the radioprotective effects of WR-27U1 SR89-11: Rabin, B

Revisiting the structure of the anti-neoplastic glucans of Mycobacterium bovis Bacille Calmette-Guerin. Structural analysis of the extracellular and boiling water extract-derived glucans of the vaccine substrains.

PubMed

Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou

2004-03-26

The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.

Beta-Glucan Activated Human B-Lymphocytes Participate in Innate Immune Responses by Releasing Pro-inflammatory Cytokines and Stimulating Neutrophil Chemotaxis

PubMed Central

Ali, Mohamed F.; Driscoll, Christopher B.; Walters, Paula R.; Limper, Andrew H.; Carmona, Eva M.

2015-01-01

B-lymphocytes play an essential regulatory role in the adaptive immune response through antibody production during infection. A less known function of B-lymphocytes is their ability to respond directly to infectious antigens through stimulation of pattern recognition receptors expressed on their surfaces. β-glucans are carbohydrates present in the cell wall of many pathogenic fungi that can be detected in the peripheral blood of patients during infection. They have been shown to participate in the innate inflammatory response as they can directly activate peripheral macrophages and dendritic cells. However, their effect as direct stimulators of B-lymphocytes has not been yet fully elucidated. The aim of this study was to examine the molecular mechanisms and cytokine profiles generated following β-glucan stimulation of B-lymphocytes, compared with the well-established TLR-9 agonist CpG-oligodeoxynucleotide (CpG) and study the participation of β-glucan stimulated B-cells in the innate immune response. Herein, we demonstrate that β-glucan activated B-lymphocytes upregulate pro-inflammatory cytokines (TNFα, IL-6 and IL-8). Interestingly, β-glucan, unlike CpG, had no effect on B-lymphocyte proliferation or IgM production. When compared with CpG (TLR9 agonist), β-glucan-activated cells secreted significantly higher levels of IL-8. Furthermore, IL-8 secretion was partially mediated by Dectin-1 and required SYK, MAPKs and the transcription factors NF-κB and AP-1. Moreover, we observed that conditioned media from β-glucan stimulated B-lymphocytes elicited neutrophil chemotaxis. These studies suggest that β-glucan activated B-lymphocytes have an important and novel role in fungal innate immune responses. PMID:26519534

Immunomodulatory Activity of Dietary Fiber: Arabinoxylan and Mixed-Linked Beta-Glucan Isolated from Barley Show Modest Activities in Vitro

PubMed Central

Samuelsen, Anne Berit; Rieder, Anne; Grimmer, Stine; Michaelsen, Terje E.; Knutsen, Svein H.

2011-01-01

High intake of dietary fiber is claimed to protect against development of colorectal cancer. Barley is a rich source of dietary fiber, and possible immunomodulatory effects of barley polysaccharides might explain a potential protective effect. Dietary fiber was isolated by extraction and enzyme treatment. A mixed-linked β-glucan (WSM-TPX, 96.5% β-glucan, Mw 886 kDa), an arabinoxylan (WUM-BS-LA, 96.4% arabinoxylan, Mw 156 kDa), a mixed-linked β-glucan rich fraction containing 10% arabinoxylan (WSM-TP) and an arabinoxylan rich fraction containing 30% mixed-linked β-glucan (WUM-BS) showed no significant effect on IL-8 secretion and proliferation of two intestinal epithelial cell lines, Caco-2 and HT-29, and had no significant effect on the NF-κB activity in the monocytic cell line U937-3κB-LUC. Further enriched arabinoxylan fractions (WUM-BS-LA) from different barley varieties (Tyra, NK96300, SB94897 and CDCGainer) were less active than the mixed-linked β-glucan rich fractions (WSM-TP and WSM-TPX) in the complement-fixing test. The mixed-linked β-glucan rich fraction from NK96300 and CDCGainer showed similar activities as the positive control while mixed-linked β-glucan rich fractions from Tyra and SB94897 were less active. From these results it is concluded that the isolated high molecular weight mixed-linked β-glucans and arabinoxylans from barley show low immunological responses in selected in vitro test systems and thus possible anti-colon cancer effects of barley dietary fiber cannot be explained by our observations. PMID:21340001

Aspergillus fumigatus Cell Wall α-(1,3)-Glucan Stimulates Regulatory T-Cell Polarization by Inducing PD-L1 Expression on Human Dendritic Cells.

PubMed

Stephen-Victor, Emmanuel; Karnam, Anupama; Fontaine, Thierry; Beauvais, Anne; Das, Mrinmoy; Hegde, Pushpa; Prakhar, Praveen; Holla, Sahana; Balaji, Kithiganahalli N; Kaveri, Srini V; Latgé, Jean-Paul; Aimanianda, Vishukumar; Bayry, Jagadeesh

2017-12-05

Human dendritic cell (DC) response to α-(1,3)-glucan polysaccharide of Aspergillus fumigatus and ensuing CD4+ T-cell polarization are poorly characterized. α-(1,3)-Glucan was isolated from A. fumigatus conidia and mycelia cell wall. For the analysis of polarization, DCs and autologous naive CD4+ T cells were cocultured. Phenotype of immune cells was analyzed by flow cytometry, and cytokines by enzyme-linked immunosorbent assay (ELISA). Blocking antibodies were used to dissect the role of Toll-like receptor 2 (TLR2) and programmed death-ligand 1 (PD-L1) in regulating α-(1,3)-glucan-mediated DC activation and T-cell responses. DCs from TLR2-deficient mice were additionally used to consolidate the findings. α-(1,3)-Glucan induced the maturation of DCs and was dependent in part on TLR2. "α-(1,3)-Glucan-educated" DCs stimulated the activation of naive T cells and polarized a subset of these cells into CD4+CD25+FoxP3+ regulatory T cells (Tregs). Mechanistically, Treg stimulation by α-(1,3)-glucan was dependent on the PD-L1 pathway that negatively regulated interferon-gamma (IFN-γ) secretion. Short α-(1,3)-oligosaccharides lacked the capacity to induce maturation of DCs but significantly blocked α-(1,3)-glucan-induced Treg polarization. PD-L1 dictates the balance between Treg and IFN-γ responses induced by α-(1,3)-glucan. Our data provide a rationale for the exploitation of immunotherapeutic approaches that target PD-1-PD-L1 to enhance protective immune responses to A. fumigatus infections. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Viability of bifidobacteria strains in yogurt with added oat beta-glucan and corn starch during cold storage.

PubMed

Rosburg, Valerie; Boylston, Terri; White, Pamela

2010-06-01

Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.

Overview of β-Glucans from Laminaria spp.: Immunomodulation Properties and Applications on Biologic Models

PubMed Central

Bonfim-Mendonça, Patrícia de Souza; Capoci, Isis Regina Grenier; Tobaldini-Valerio, Flávia Kelly; Negri, Melyssa; Svidzinski, Terezinha Inez Estivalet

2017-01-01

Glucans are a group of glucose polymers that are found in bacteria, algae, fungi, and plants. While their properties are well known, their biochemical and solubility characteristics vary considerably, and glucans obtained from different sources can have different applications. Research has described the bioactivity of β-glucans extracted from the algae of the Laminaria genus, including in vivo and in vitro studies assessing pro- and anti-inflammatory cytokines, vaccine production, inhibition of cell proliferation, and anti- and pro-oxidant activity. Thus, the objective of this article was to review the potential application of β-glucans from Laminaria spp. in terms of their immunomodulatory properties, microorganism host interaction, anti-cancer activity and vaccine development. PMID:28878139

The influences of sugars and plant growth regulators on β-glucan synthesis of G. lucidum mycelium in submerged culture

NASA Astrophysics Data System (ADS)

Thao, Cao Phuong; Tien, Le Thi Thuy

2017-09-01

β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.

Beta Glucan: Health Benefits in Obesity and Metabolic Syndrome

PubMed Central

El Khoury, D.; Cuda, C.; Luhovyy, B. L.; Anderson, G. H.

2012-01-01

Despite the lack of international agreement regarding the definition and classification of fiber, there is established evidence on the role of dietary fibers in obesity and metabolic syndrome. Beta glucan (β-glucan) is a soluble fiber readily available from oat and barley grains that has been gaining interest due to its multiple functional and bioactive properties. Its beneficial role in insulin resistance, dyslipidemia, hypertension, and obesity is being continuously documented. The fermentability of β-glucans and their ability to form highly viscous solutions in the human gut may constitute the basis of their health benefits. Consequently, the applicability of β-glucan as a food ingredient is being widely considered with the dual purposes of increasing the fiber content of food products and enhancing their health properties. Therefore, this paper explores the role of β-glucans in the prevention and treatment of characteristics of the metabolic syndrome, their underlying mechanisms of action, and their potential in food applications. PMID:22187640

Isolation and characterization of beta-glucan synthase: A potential biochemical regulator of gravistimulated differential cell wall loosening

NASA Technical Reports Server (NTRS)

Kuzmanoff, K. M.

1984-01-01

In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.

β-Glucan Synthase Gene Overexpression and β-Glucans Overproduction in Pleurotus ostreatus Using Promoter Swapping

PubMed Central

Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou

2013-01-01

Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi. PMID:23637884

Membrane pore architecture of the CslF6 protein controls (1-3,1-4)-β-glucan structure.

PubMed

Jobling, Stephen A

2015-06-01

The cereal cell wall polysaccharide (1-3,1-4)-β-glucan is a linear polymer of glucose containing both β1-3 and β1-4 bonds. The structure of (1-3,1-4)-β-glucan varies between different cereals and during plant growth and development, but little is known about how this is controlled. The cellulose synthase-like CslF6 protein is an integral membrane protein and a major component of the (1-3,1-4)-β-glucan synthase. I show that a single amino acid within the predicted transmembrane pore domain of CslF6 controls (1-3,1-4)-β-glucan structure. A new mechanism for the control of the polysaccharide structure is proposed where membrane pore architecture and the translocation of the growing polysaccharide across the membrane control how the acceptor glucan is coordinated at the active site and thus the proportion of β1-3 and β1-4 bonds within the polysaccharide.

A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.

PubMed

Das, Deeplina; Baruah, Rwivoo; Goyal, Arun

2014-08-01

An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.

Response of the intestinal mucosal barrier of carp (Cyprinus carpio) to a bacterial challenge by Aeromonas hydrophila intubation after feeding with β-1,3/1,6-glucan.

PubMed

Jung-Schroers, V; Adamek, M; Harris, S; Syakuri, H; Jung, A; Irnazarow, I; Steinhagen, D

2018-03-15

The effect of dietary β-glucan on the bacterial community in the gut of common carp (Cyprinus carpio) was examined after oral application of Aeromonas hydrophila. Carp received either feed supplemented with 1% MacroGard ® , a β-1,3/1,6-glucan, or a β-glucan-free diet. Fourteen days after feeding, half of the carp from each group were intubated with 10 9 colony-forming units (CFU) of a pathogenic strain of A. hydrophila. Gut samples were taken 12 hr to 7 days after application and analysed using microbiological and molecular biological techniques (NGS, RT-PCR-DGGE). The reaction of the mucosa and the microbiota to an A. hydrophila intubation differed in carp fed with β-glucan compared to carp from the control group. In β-glucan fed carp, the total bacterial amount was lower but the number of bacterial species was higher. Bacterial composition was different for carp from both treatment groups. The number of mucin filled goblet cells was reduced in carp fed the β-glucan diet. Mucus was obviously released from the goblet cells and was probably washed out of the gut together with high numbers of bacteria. This might be protective against pathogenic bacteria and, therefore, feeding with β-glucan may provide protection against infections of the gut in carp. © 2018 John Wiley & Sons Ltd.

Effects of β-Glucans Ingestion on Alveolar Bone Loss, Intestinal Morphology, Systemic Inflammatory Profile, and Pancreatic β-Cell Function in Rats with Periodontitis and Diabetes

PubMed Central

Silva, Viviam de O.; Lobato, Raquel V.; Orlando, Débora R.; Borges, Bruno D.B.; de Sousa, Raimundo V.

2017-01-01

This study aimed to evaluate the effects of β-glucan ingestion (Saccharomyces cerevisiae) on the plasmatic levels of tumor necrosis factor-α (TNF-α) and interleukin-10 (IL-10), alveolar bone loss, and pancreatic β-cell function (HOMA-BF) in diabetic rats with periodontal disease (PD). Besides, intestinal morphology was determined by the villus/crypt ratio. A total of 48 Wistar rats weighing 203 ± 18 g were used. Diabetes was induced by the intraperitoneal injection of streptozotocin (80 mg/kg) and periodontal inflammation, by ligature. The design was completely randomized in a factorial scheme 2 × 2 × 2 (diabetic or not, with or without periodontitis, and ingesting β-glucan or not). The animals received β-glucan by gavage for 28 days. Alveolar bone loss was determined by scanning electron microscopy (distance between the cementoenamel junction and alveolar bone crest) and histometric analysis (bone area between tooth roots). β-glucan reduced plasmatic levels of TNF-α in diabetic animals with PD and of IL-10 in animals with PD (p < 0.05). β-glucan reduced bone loss in animals with PD (p < 0.05). In diabetic animals, β-glucan improved β-cell function (p < 0.05). Diabetic animals had a higher villus/crypt ratio (p < 0.05). In conclusion, β-glucan ingestion reduced the systemic inflammatory profile, prevented alveolar bone loss, and improved β-cell function in diabetic animals with PD. PMID:28906456

Varying Effects of Different β-Glucans on the Maturation of Porcine Monocyte-Derived Dendritic Cells ▿

PubMed Central

Sonck, Eva; Devriendt, Bert; Goddeeris, Bruno; Cox, Eric

2011-01-01

β-Glucans are well known for their immunomodulatory capacities in humans and mice. For this reason, together with the European ban on growth-promoting antibiotics, β-glucans are intensively used in pig feed. However, as shown in the present study, there is much variation in the stimulatory capacities of β-glucans from different sources. Since dendritic cells (DCs) are the first cells that are encountered after an antigen is taken up by the intestinal epithelial cell barrier, we decided to investigate the effect of two concentrations (5 and 10 μg/ml) of five commercial β-glucan preparations, differing in structure and source, on porcine monocyte-derived dendritic cells (MoDCs). Although all β-glucans gave rise to a significant reduction of the phagocytic activity of DCs, only Macrogard induced a significant phenotypic maturation. In addition to Macrogard, zymosan, another β-glucan derived from Saccharomyces cerevisiae, and curdlan also significantly improved the T-cell-stimulatory capacity of MoDCs. Most interesting, however, is the cytokine secretion profile of curdlan-stimulated MoDCs, since only curdlan induced significant higher expression levels of interleukin-1β (IL-1β), IL-6, IL-10, and IL-12/IL-23p40. Since the cytokine profile of DCs influences the outcome of the ensuing immune response and thus may prove valuable in intestinal immunity, a careful choice is necessary when β-glucans are used as dietary supplement. PMID:21752950

β-Glucans inhibit intracellular growth of Mycobacterium bovis BCG but not virulent Mycobacterium tuberculosis in human macrophages

PubMed Central

Morris, Jessica D.; Rajaram, Murugesan V.S.; Schlesinger, Larry S.

2014-01-01

The yeast polysaccharide, β-glucan, has been shown to promote both anti-microbial and anti-tumor activities through its interaction with macrophages. Here we analyzed the effects of an insoluble whole glucan particle (WGP), a 1,3/1,6-β-glucan from Saccharomyces cerevisiae, and a soluble poly-1-6-β-d-glucopyranosyl-1-3-β-d-glucopyranose (PGG), a hydrolytic product of WGP, on the anti-microbial response of human macrophages against mycobacterial infection. Treatment of macrophages with WGP and PGG significantly decreased cell association and intracellular growth of Mycobacterium bovis BCG, but not Mycobacterium tuberculosis (M.tb) when compared to untreated controls. We characterized the influence of β-glucans on the generation of macrophage oxidative products and pro-inflammatory cytokines, two important anti-microbial defense mechanisms. WGP but not PGG treatment enhanced the oxidative response of macrophages as determined by the 2′,7′-dichlorofluorescin (DCF) assay. WGP treatment also induced macrophages to produce pro-inflammatory cytokines. The β-glucan receptor, Dectin-1, was found to be involved in the WGP-induced macrophage oxidative burst and intracellular growth inhibition of M. bovis BCG. This report indicates that although some forms of β-glucan are able to stimulate the respiratory burst and cytokine production in human macrophages, and exhibit antimicrobial properties against M. bovis BCG, the β-glucans tested here did not inhibit growth of M.tb within human macrophages. PMID:21762773

Chitosan-guar gum-silver nanoparticles hybrid matrix with immobilized enzymes for fabrication of beta-glucan and glucose sensing photometric flow injection system.

PubMed

Bagal-Kestwal, Dipali R; Kestwal, Rakesh Mohan; Hsieh, Wen-Ting; Chiang, Been-Huang

2014-01-01

Simple and fast photometric flow injection analysis system was developed for sensing of β-1,3-glucan from medicinal mushroom Ganoderma lucidum during fermentation. For this purpose, the chitosan-guar gum-silver nanoparticle-beta glucanase (Ch-GG-AgNPs-βG) beads and Ch-GG-AgNPs-GOD (glucose oxidase) beads were prepared. The bead packed mini-columns were then used to assemble a flow injection analysis (FIA) system for the detection of β-(1→3)-d-glucan biomarker or glucose. This colorimetric flow system can detect glucose and glucan with detection limits as low as 50ngmL(-1) and 100ngmL(-1) (S/N=3), respectively. The analysis time of this FIA was approximately 40s, which is faster than the previously reported glucan sensors. The glucose and glucan calibration curves were obtained in the range of 0.25-1.25μgmL(-1) (R(2)=0.988) and 0.2-1.0μgmL(-1)(R(2)=0.979), respectively. The applicability of the nano-bio-composite FIA sensor system for spiked and real β-(1→3)-d-glucan samples were tested, and the accuracy of the results were greater than 95%. Thus, the designed FIA provides a simple, interference free and rapid tool for monitoring glucose and β-glucan content, which can be used for various food samples with a little modification. Copyright © 2013 Elsevier B.V. All rights reserved.

Immunomodulatory dietary polysaccharides: a systematic review of the literature

PubMed Central

2010-01-01

Background A large body of literature suggests that certain polysaccharides affect immune system function. Much of this literature, however, consists of in vitro studies or studies in which polysaccharides were injected. Their immunologic effects following oral administration is less clear. The purpose of this systematic review was to consolidate and evaluate the available data regarding the specific immunologic effects of dietary polysaccharides. Methods Studies were identified by conducting PubMed and Google Scholar electronic searches and through reviews of polysaccharide article bibliographies. Only articles published in English were included in this review. Two researchers reviewed data on study design, control, sample size, results, and nature of outcome measures. Subsequent searches were conducted to gather information about polysaccharide safety, structure and composition, and disposition. Results We found 62 publications reporting statistically significant effects of orally ingested glucans, pectins, heteroglycans, glucomannans, fucoidans, galactomannans, arabinogalactans and mixed polysaccharide products in rodents. Fifteen controlled human studies reported that oral glucans, arabinogalactans, heteroglycans, and fucoidans exerted significant effects. Although some studies investigated anti-inflammatory effects, most studies investigated the ability of oral polysaccharides to stimulate the immune system. These studies, as well as safety and toxicity studies, suggest that these polysaccharide products appear to be largely well-tolerated. Conclusions Taken as a whole, the oral polysaccharide literature is highly heterogenous and is not sufficient to support broad product structure/function generalizations. Numerous dietary polysaccharides, particularly glucans, appear to elicit diverse immunomodulatory effects in numerous animal tissues, including the blood, GI tract and spleen. Glucan extracts from the Trametes versicolor mushroom improved survival and immune function in human RCTs of cancer patients; glucans, arabinogalactans and fucoidans elicited immunomodulatory effects in controlled studies of healthy adults and patients with canker sores and seasonal allergies. This review provides a foundation that can serve to guide future research on immune modulation by well-characterized polysaccharide compounds. PMID:21087484

The association between endotoxin and beta-(1 → 3)-D-glucan in house dust with asthma severity among schoolchildren.

PubMed

Oluwole, Oluwafemi; Rennie, Donna C; Senthilselvan, Ambikaipakan; Dyck, Roland; Afanasieva, Anna; Kirychuk, Shelley; Katselis, George; Lawson, Joshua A

2018-05-01

Asthma severity can be affected by microbial exposures. However, less is known about the specific indoor agents aggravating the disease in children. We examined the associations between indoor endotoxin and beta-(1 → 3)-D-glucan exposures and asthma severity in children with asthma. A clinical cross-sectional study of schoolchildren (aged 7-17 years) was conducted in the province of Saskatchewan, Canada. Children with asthma (n = 116) were identified from 335 participants using a combination of survey responses and objective clinical assessments. We then ascertained asthma severity based on recommended guidelines (continuous daytime asthma symptoms, frequent nighttime asthma symptoms, and ≤ 60% predicted FEV 1 ). Levels of indoor endotoxin and beta-(1 → 3)-D-glucan were measured in dust samples obtained from play area floors and child's mattresses. The study population of 116 children with asthma was comprised of 75.9% mild asthma and 24.1% moderate/severe asthma. Higher mattress endotoxin concentration was associated with increased odds of moderate/severe asthma [adjusted odds ratio (aOR) = 11.40, 95% confidence interval (CI): 1.45-89.43] while higher beta-(1 → 3)-D-glucan concentration (aOR = 0.16, 95% CI: 0.03-0.89) and load (aOR = 0.10, 95% CI: 0.02-0.72) in play areas were inversely associated with moderate/severe asthma. Furthermore, higher mattress endotoxin concentration was associated with lower FVC (p = 0.01) and FEV 1 (p = 0.03). These associations were not seen for beta-(1 → 3)-D-glucan. Our results showed differential effects of microbial exposures on childhood asthma severity and further highlight domestic endotoxin exposure effects on respiratory health outcomes in children with asthma. Copyright © 2018 Elsevier Ltd. All rights reserved.

Effects of two whole-grain barley varieties on caecal SCFA, gut microbiota and plasma inflammatory markers in rats consuming low- and high-fat diets.

PubMed

Zhong, Yadong; Marungruang, Nittaya; Fåk, Frida; Nyman, Margareta

2015-05-28

Mixed-linkage β-glucans are fermented by the colon microbiota that give rise to SCFA. Propionic and butyric acids have been found to play an important role in colonic health, as well as they may have extraintestinal metabolic effects. The aim of the present study was to investigate how two whole-grain barley varieties differing in dietary fibre and β-glucan content affected caecal SCFA, gut microbiota and some plasma inflammatory markers in rats consuming low-fat (LF) or high-fat (HF) diets. Barley increased the caecal pool of SCFA in rats fed the LF and HF diets compared with those fed the control diet, and the effect was generally dependent on fibre content, an exception was butyric acid in the LF setting. Furthermore, whole-grain barley reduced plasma lipopolysaccharide-binding protein and monocyte chemoattractant protein-1, increased the caecal abundance of Lactobacillus and decreased the Bacteroides fragilis group, but increased the number of Bifidobacterium only when dietary fat was consumed at a low level. Fat content influenced the effects of barley: rats fed the HF diets had a higher caecal pool of acetic and propionic acids, higher concentrations of amino acids and higher amounts of lipids in the portal plasma and liver than rats fed the LF diets; however, less amounts of butyric acid were generally formed. Interestingly, there was an increase in the caecal abundance of Akkermansia and the caecal pool of succinic acid, and a decrease in the proportion of Bifidobacterium and the Clostridium leptum group. In summary, whole-grain barley decreased HF diet-induced inflammation, which was possibly related to the formation of SCFA and changes in microbiota composition. High β-glucan content in the diet was associated with reduced plasma cholesterol levels.

Antifungal Activity of Salvia miltiorrhiza Against Candida albicans Is Associated with the Alteration of Membrane Permeability and (1,3)-β-D-Glucan Synthase Activity.

PubMed

Lee, Heung-Shick; Kim, Younhee

2016-03-01

Candidiasis has posed a serious health risk to immunocompromised patients owing to the increase in resistant yeasts, and Candida albicans is the prominent pathogen of fungal infections. Therefore, there is a critical need for the discovery and characterization of novel antifungals to treat infections caused by C. albicans. In the present study, we report on the antifungal activity of the ethanol extract from Salvia miltiorrhiza against C. albicans and the possible mode of action against C. albicans. The increase in the membrane permeability was evidenced by changes in diphenylhexatriene binding and release of both 260-nm-absorbing intracellular materials and protein. In addition, inhibition of cell wall synthesis was demonstrated by the enhanced minimal inhibitory concentration in the presence of sorbitol and reduced (1,3)-β-D-glucan synthase activity. The above evidence supports the notion that S. miltiorrhiza has antifungal activity against C. albicans by the synergistic activity of targeting the cell membrane and cell wall. These findings indicate that S. miltiorrhiza displays effective activity against C. albicans in vitro and merits further investigation to treat C. albicans-associated infections.

Production of insoluble glucans using modified recombinant glycosyltransferase from Leuconostoc mesenteroides

USDA-ARS?s Scientific Manuscript database

Glucansucrases catalyze the transfer of D-glucopyranosyl units from sucrose to form a-glucan chains. Glucansucrases are capable of catalyzing the synthesis of several different a-glucosidic linkages that affect molecular mass, branching, and solubility of the polysaccharide. In general, a-glucans co...

Barley and oat beta-glucan content measured by calcofluor fluorescence in a microplate assay

USDA-ARS?s Scientific Manuscript database

Beta-glucan levels in grains, particularly barley and oats, are receiving increased interest in part due to their recognized benefits to human health. While a number of methods to determine grain beta-glucan levels are available, each suffers from significant drawbacks for routine implementation. ...

21 CFR 866.3050 - Beta-glucan serological assays.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Beta-glucan serological assays. 866.3050 Section 866.3050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3050 Beta-glucan...

21 CFR 866.3050 - Beta-glucan serological assays.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Beta-glucan serological assays. 866.3050 Section 866.3050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3050 Beta-glucan...

21 CFR 866.3050 - Beta-glucan serological assays.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Beta-glucan serological assays. 866.3050 Section 866.3050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3050 Beta-glucan...

21 CFR 866.3050 - Beta-glucan serological assays.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Beta-glucan serological assays. 866.3050 Section 866.3050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3050 Beta-glucan...

21 CFR 866.3050 - Beta-glucan serological assays.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Beta-glucan serological assays. 866.3050 Section 866.3050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3050 Beta-glucan...

Custom-tailored water-insoluble glucans from sucrose via glucansucrases

USDA-ARS?s Scientific Manuscript database

Dextrans and related glucans produced from sucrose by lactic acid bacteria have been studied for many years and are used in numerous commercial applications and products. Most of these glucans are water-soluble, except for a few notable exceptions from cariogenic Streptococcus spp. and a very small ...

Water-insoluble glucans from sucrose via glucansucrases. Factors influencing structures and yields

USDA-ARS?s Scientific Manuscript database

Dextrans and related glucans produced from sucrose by lactic acid bacteria have been studied for many years and are used in numerous commercial applications and products. Most of these glucans are water-soluble, except for a few notable exceptions from cariogenic Streptococcus spp. and a very small ...

Identification of amino acid residues in Streptococcus mutans glucosyltransferases influencing the structure of the glucan product.

PubMed Central

Shimamura, A; Nakano, Y J; Mukasa, H; Kuramitsu, H K

1994-01-01

The glucosyltransferases (GTFs) of mutans streptococci are important virulence factors in the sucrose-dependent colonization of tooth surfaces by these organisms. To investigate the structure-function relationship of the GTFs, an approach was initiated to identify amino acid residues of the GTFs which affect the incorporation of glucose residues into the glucan polymer. Conserved amino acid residues were identified in the GTF-S and GTF-I enzymes of the mutans streptococci and were selected for site-directed mutagenesis in the corresponding enzymes from Streptococcus mutans GS5. Conversion of six amino acid residues of the GTF-I enzyme to those present at the corresponding positions in GTF-S, either singly or in multiple combinations, resulted in enzymes synthesizing increased levels of soluble glucans. The enzyme containing six alterations synthesized 73% water-soluble glucan in the absence of acceptor dextran T10, while parental enzyme GTF-I synthesized no such glucan product. Conversely, when residue 589 of the GTF-S enzyme was converted from Thr to either Asp or Glu, the resulting enzyme synthesized primarily water-insoluble glucan in the absence of the acceptor. Therefore, this approach has identified several amino acid positions which influence the nature of the glucan product synthesized by GTFs. PMID:8050997

Dectin-1 Activation by a Natural Product β-Glucan Converts Immunosuppressive Macrophages into an M1-like Phenotype

PubMed Central

Liu, Min; Luo, Fengling; Ding, Chuanlin; Albeituni, Sabrin; Hu, Xiaoling; Ma, Yunfeng; Cai, Yihua; McNally, Lacey; Sanders, Mary Ann; Jain, Dharamvir; Kloecker, Goetz; Bousamra, Michael; Zhang, Huang-ge; Higashi, Richard M.; Lane, Andrew N.; Fan, Teresa W-M.; Yan, Jun

2015-01-01

Tumor-associated macrophages (TAM) with an M2-like phenotype have been linked to tumor-elicited inflammation, immunosuppression, and resistance to chemotherapies in cancer, thus representing an attractive target for an effective cancer immunotherapy. Here, we demonstrate that particulate yeast-derived β-glucan, a natural polysaccharide compound, converts polarized M2 macrophages or immunosuppressive TAM into an M1-like phenotype with potent immuno-stimulating activity. This process is associated with macrophage metabolic reprograming with enhanced glycolysis, krebs cycle and glutamine utilization. In addition, particulate β-glucan converts immunosuppressive TAM via the C-type lectin receptor dectin-1-induced Syk-Card9-Erk pathway. Further in vivo studies show that oral particulate β-glucan treatment significantly delays tumor growth, which is associated with in vivo TAM phenotype conversion and enhanced effector T cell activation. Mice injected with particulate β-glucan-treated TAM mixed with tumor cells have significantly reduced tumor burden with less blood vascular vessels compared to those with TAM plus tumor cell injection. In addition, macrophage depletion significantly reduced the therapeutic efficacy of particulate β-glucan in tumor-bearing mice. These findings have established a new paradigm for macrophage polarization and immunosuppressive TAM conversion and shed the light on the action mode of β-glucan treatment in cancer. PMID:26453753

In vivo evaluation of the antimutagenic and antigenotoxic effects of β-glucan extracted from Saccharomyces cerevisiae in acute treatment with multiple doses.

PubMed

Oliveira, Rodrigo Juliano; Salles, Maria José Sparça; da Silva, Ariane Fernanda; Kanno, Tatiane Yumi Nakamura; Lourenço, Ana Carolina Dos Santos; Leite, Véssia da Silva; Matiazi, Hevenilton José; Pesarini, João Renato; Ribeiro, Lúcia Regina; Mantovani, Mário Sérgio

2013-09-01

Ample evidence suggests that cancer is triggered by mutagenic damage and diets or supplements capable of reducing such incidences can be related to the prevention of neoplasy development or to an improvement in life quality of patients who undergo chemotherapy. This research aimed to evaluate the antimutagenic and antigenotoxic activity of β-glucan. We set up 8 experimental groups: control (Group 1), cyclophosphamide (Group 2), Groups 3-5 to assess the effect of β-glucan administration, and Groups 6-8 to evaluate the association between cyclophosphamide and β-glucan. The intraperitonial concentrations of β-glucan used were 100, 150 and 200 mg/kg. Micronucleus and comet assays showed that within the first week of treatment β-glucan presented a damage reduction rate between 100-62.04% and 94.34-59.52% for mutagenic and genotoxic damages, respectively. This activity decreased as the treatment was extended. During the sixth week of treatment antimutagenicity rates were reduced to 59.51-39.83% and antigenotoxicity was not effective. This leads to the conclusion that the efficacy of β-glucan in preventing DNA damage is limited when treatment is extended, and that its use as a chemotherapeutic adjuvant need to be better clarified.

Beta-glucan enhances the response to SVCV infection in zebrafish.

PubMed

M Medina-Gali, Regla; Ortega-Villaizan, María Del Mar; Mercado, Luis; Novoa, Beatriz; Coll, Julio; Perez, Luis

2018-07-01

The antiviral effects of beta-glucan, an immunostimulatory agent were studied in zebrafish both in vitro and in vivo. Here we show that zebrafish ZF4 cells as well as whole fish primed with yeast β-glucan zymosan exhibited increased cytokine expression and elevated response to spring viremia of carp virus (SVCV) infection. In vitro, previous treatment of β-glucan enhanced ZF4 cell viability against SVCV infection which is associated to the activation of interferon signaling pathway and inflammatory cytokines gene expression. In vivo, the SVCV-infected fish primed with β-glucan had a higher survival rate (≈73%) than the control SVCV-infected group (≈33%). Additionally, up-regulation of the expression of a set of genes involved in innate immune response was detected in zebrafish intraperitoneally injected of β-glucan: il1b, il6, il8, il10 and tnfa transcripts showed increased expression that appear to be rapid (2 days) but not long-lived (less than 2 weeks). The present study is, to our knowledge, the first to combine cell culture and in vivo approaches to describe host response to β-glucan stimulation and viral infection in zebrafish. Copyright © 2018 Elsevier Ltd. All rights reserved.

Mixed-Linkage Glucan Oligosaccharides Produced by Automated Glycan Assembly Serve as Tools To Determine the Substrate Specificity of Lichenase.

PubMed

Dallabernardina, Pietro; Schuhmacher, Frank; Seeberger, Peter H; Pfrengle, Fabian

2017-03-02

The mixed-linkage (1→3),(1→4)-d-glucan (MLG) specific glycosyl hydrolase lichenase is an important biochemical tool for the structural characterization of MLGs. It holds potential for application in the brewery, animal feed, and biofuel industries. Several defined MLG oligosaccharides obtained by automated glycan assembly are used to analyze the substrate specificities of Bacillus subtilis lichenase. Two glucose building blocks (BBs), equipped with a temporary fluorenylmethyloxycarbonyl chloride (Fmoc) protecting group in the C-3 or C-4 position, served to assemble different oligosaccharides by using an automated oligosaccharide synthesizer. Light-induced cleavage of the glycan products from the solid support followed by global deprotection provided seven MLG oligosaccharides of different length and connectivity. After incubation of the MLG oligosaccharides with lichenase, the digestion products were analyzed by HPLC-MS. These digestion experiments provided insights into the enzyme's active site that is in line with other recent evidence suggesting that the substrate specificity of lichenases has to be reconsidered. These results demonstrate that synthetic MLG oligosaccharides are useful tools to analyze mixed-linkage β-glucanases. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Quaternary Structure of a Glycoside Hydrolase Dictates Specificity toward β-Glucans*

PubMed Central

Lafond, Mickael; Sulzenbacher, Gerlind; Freyd, Thibaud; Henrissat, Bernard; Berrin, Jean-Guy; Garron, Marie-Line

2016-01-01

In the Carbohydrate-Active Enzyme (CAZy) database, glycoside hydrolase family 5 (GH5) is a large family with more than 6,000 sequences. Among the 51 described GH5 subfamilies, subfamily GH5_26 contains members that display either endo-β(1,4)-glucanase or β(1,3;1,4)-glucanase activities. In this study, we focused on the GH5_26 enzyme from Saccharophagus degradans (SdGluc5_26A), a marine bacterium known for its capacity to degrade a wide diversity of complex polysaccharides. SdGluc5_26A displays lichenase activity toward β(1,3;1,4)-glucans with a side cellobiohydrolase activity toward β(1,4)-glucans. The three-dimensional structure of SdGluc5_26A adopts a stable trimeric quaternary structure also observable in solution. The N-terminal region of SdGluc5_26A protrudes into the active site of an adjacent monomer. To understand whether this occupation of the active site could influence its activity, we conducted a comprehensive enzymatic characterization of SdGluc5_26A and of a mutant truncated at the N terminus. Ligand complex structures and kinetic analyses reveal that the N terminus governs the substrate specificity of SdGluc5_26A. Its deletion opens the enzyme cleft at the −3 subsite and turns the enzyme into an endo-β(1,4)-glucanase. This study demonstrates that experimental approaches can reveal structure-function relationships out of reach of current bioinformatic predictions. PMID:26755730

Peptide- and Amine-Modified Glucan Particles for the Delivery of Therapeutic siRNA

PubMed Central

Aouadi, Myriam; Vangala, Pranitha; Tencerova, Michaela; Amano, Shinya U.; Nicoloro, Sarah M.; Yawe, Joseph C.; Czech, Michael P.

2016-01-01

Translation of siRNA technology into the clinic is limited by the need for improved delivery systems that target specific cell types. Macrophages are particularly attractive targets for RNAi therapy because they promote pathogenic inflammatory responses in a number of important human diseases. We previously demonstrated that a multi-component formulation of β-1,3-D-glucan-encapsulated siRNA particles (GeRPs) can specifically and potently silence genes in mouse macrophages. A major advance would be to simplify the GeRP system by reducing the number of delivery components, thus enabling more facile manufacturing and future commercialization. Here we report the synthesis and evaluation of a simplified glucan-based particle (GP) capable of delivering siRNA in vivo to selectively silence macrophage genes. Covalent attachment of small-molecule amines and short peptides containing weak bases to GPs facilitated electrostatic interaction of the particles with siRNA and aided in the endosomal release of siRNA by the proton-sponge effect. Modified GPs were non-toxic and were efficiently internalized by macrophages in vitro. When injected intraperitoneally (i.p.), several of the new peptide-modified GPs were found to efficiently deliver siRNA to peritoneal macrophages in lean, healthy mice. In an animal model of obesity-induced inflammation, i.p. administration of one of the peptide-modified GPs (GP-EP14) bound to siRNA selectively reduced the expression of target inflammatory cytokines in the visceral adipose tissue macrophages. Decreasing adipose tissue inflammation resulted in an improvement of glucose metabolism in these metabolically challenged animals. Thus, modified GPs represent a promising new simplified system for the efficient delivery of therapeutic siRNAs specifically to phagocytic cells in vivo for modulation of inflammation responses. PMID:26815386

alpha-1,4-Glucan lyase, a new class of starch/glycogen degrading enzyme. III. Substrate specificity, mode of action, and cleavage mechanism.

PubMed

Yu, S; Ahmad, T; Kenne, L; Pedersén, M

1995-05-11

The alpha-1,4-glucan lyase (EC 4.2.2.-), purified from the red alga Gracilariopsis lemaneiformis, is a single polypeptide with a molecular mass of 116,654 Da as determined by matrix-assisted laser-desorption mass spectrometry. It degraded maltose, maltosaccharides, amylose, amylopectin and glycogen, forming 1,5-anhydro-D-fructose from the non-reducing end groups. The substrate specificity, mode of action, and cleavage mechanism of the enzyme were studied by using various naturally occurring and synthesized substrates. This enzyme was highly specific for the alpha-1,4-D-glucosidic bond. When a linear alpha-1,4-glucan was used as substrate, the enzyme split the substrate from the non-reducing end and released 1,5-anhydro-D-fructose successively until only one glucose unit was left. When a branched pentasaccharide of 6(2)-alpha-maltosylmaltotriose, obtained from glycogen by alpha-amylase limitation, was used as substrate, the glucose group in the 4-position of the 4,6-branched residue was not cleaved off. Using maltoheptaose as substrate and following the reaction with HPLC and 1H-NMR spectroscopy, it was found that the action mode of the lyase followed a multichain attack mechanism. 1H- and 13C-NMR spectroscopic studies on unlabelled and labelled amylose (1-2H, 2-2H, 1-13C) as substrates indicated that the lyase cleaved the C-(1')-O(4) bond forming a double bond between C-1' and C-2', thus forming the enol form of 1,5-anhydro-D-fructose. It also indicated that the catalytic process of the lyase involved proton exchanges among C-1, C-2, C-3 and the solvent.

Functional characterization of barley betaglucanless mutants demonstrates a unique role for CslF6 in (1,3;1,4)-β-D-glucan biosynthesis

PubMed Central

Taketa, Shin; Yuo, Takahisa; Tonooka, Takuji; Tsumuraya, Yoichi; Inagaki, Yoshiaki; Haruyama, Naoto; Larroque, Oscar; Jobling, Stephen A.

2012-01-01

(1,3;1,4)-β-D-glucans (mixed-linkage glucans) are found in tissues of members of the Poaceae (grasses), and are particularly high in barley (Hordeum vulgare) grains. The present study describes the isolation of three independent (1,3;1,4)-β-D-glucanless (betaglucanless; bgl) mutants of barley which completely lack (1,3;1,4)-β-D-glucan in all the tissues tested. The bgl phenotype cosegregates with the cellulose synthase like HvCslF6 gene on chromosome arm 7HL. Each of the bgl mutants has a single nucleotide substitution in the coding region of the HvCslF6 gene resulting in a change of a highly conserved amino acid residue of the HvCslF6 protein. Microsomal membranes isolated from developing endosperm of the bgl mutants lack detectable (1,3;1,4)-β-D-glucan synthase activity indicating that the HvCslF6 protein is inactive. This was confirmed by transient expression of the HvCslF6 cDNAs in Nicotiana benthamiana leaves. The wild-type HvCslF6 gene directed the synthesis of high levels of (1,3;1,4)-β-D-glucans, whereas the mutant HvCslF6 proteins completely lack the ability to synthesize (1,3;1,4)-β-D-glucans. The fine structure of the (1,3;1,4)-β-D-glucan produced in the tobacco leaf was also very different from that found in cereals having an extremely low DP3/DP4 ratio. These results demonstrate that, among the seven CslF and one CslH genes present in the barley genome, HvCslF6 has a unique role and is the key determinant controlling the biosynthesis of (1,3;1,4)-β-D-glucans. Natural allelic variation in the HvCslF6 gene was found predominantly within introns among 29 barley accessions studied. Genetic manipulation of the HvCslF6 gene could enable control of (1,3;1,4)-β-D-glucans in accordance with the purposes of use. PMID:21940720

Genetic Diversity and Genome Wide Association Study of β-Glucan Content in Tetraploid Wheat Grains

PubMed Central

Marcotuli, Ilaria; Houston, Kelly; Schwerdt, Julian G.; Waugh, Robbie; Fincher, Geoffrey B.; Burton, Rachel A.; Blanco, Antonio; Gadaleta, Agata

2016-01-01

Non-starch polysaccharides (NSPs) have many health benefits, including immunomodulatory activity, lowering serum cholesterol, a faecal bulking effect, enhanced absorption of certain minerals, prebiotic effects and the amelioration of type II diabetes. The principal components of the NSP in cereal grains are (1,3;1,4)-β-glucans and arabinoxylans. Although (1,3;1,4)-β-glucan (hereafter called β-glucan) is not the most representative component of wheat cell walls, it is one of the most important types of soluble fibre in terms of its proven beneficial effects on human health. In the present work we explored the genetic variability of β-glucan content in grains from a tetraploid wheat collection that had been genotyped with a 90k-iSelect array, and combined this data to carry out an association analysis. The β-glucan content, expressed as a percentage w/w of grain dry weight, ranged from 0.18% to 0.89% across the collection. Our analysis identified seven genomic regions associated with β-glucan, located on chromosomes 1A, 2A (two), 2B, 5B and 7A (two), confirming the quantitative nature of this trait. Analysis of marker trait associations (MTAs) in syntenic regions of several grass species revealed putative candidate genes that might influence β-glucan levels in the endosperm, possibly via their participation in carbon partitioning. These include the glycosyl hydrolases endo-β-(1,4)-glucanase (cellulase), β-amylase, (1,4)-β-xylan endohydrolase, xylanase inhibitor protein I, isoamylase and the glycosyl transferase starch synthase II. PMID:27045166

Granulocyte-macrophage colony-stimulating factor (GM-CSF) regulates cytokine induction by 1,3-beta-D-glucan SCG in DBA/2 mice in vitro.

PubMed

Harada, Toshie; Miura, Noriko N; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito

2004-08-01

Sparassis crispa Fr. is an edible/medicinal mushroom that recently became cultivable in Japan. SCG is a major 6-branched 1,3-beta-D-glucan in S. crispa showing antitumor activity. We recently found that the splenocytes from naive DBA/1 and DBA/2 mice strongly react with SCG to produce interferon-gamma (IFN-gamma). In this study, cytokines induced by SCG were screened and found to be IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), granulocyte-macrophage colony-stimulating factor (GM-CSF), and interleukin-12 (IL-12p70). The addition of recombinant murine GM-CSF (rMuGM-CSF) to spleen cell cultures from various strains of mice synergistically enhanced IFN-gamma, TNF-alpha and IL-12p70 in the presence of SCG. In contrast, neutralizing GM-CSF using anti-GM-CSF monoclonal antibody (mAb) significantly inhibited IFN-gamma, TNF-alpha, and IL-12p70 elicited by SCG. We conclude that GM-CSF is a key molecule for cytokine induction by beta-glucan, and GM-CSF induction by SCG is the specific step in DBA/2 mice in vitro.

Fluorescence microplate readers as an alternative to flow injection analysis for determination of wort beta-glucan

USDA-ARS?s Scientific Manuscript database

Wort beta-glucan concentration is a critical malting quality parameter used to identify and avoid potential brewhouse filtration problems. ASBC method Wort-18 is widely used in malt analysis laboratories and brewhouses to measure wort beta-glucan levels. However, the chemistry underlying the method...

Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction.

PubMed

Muñoz, Javier; Cortés, Juan Carlos G; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M Belén; Martins, Ivone M; Pérez, Pilar; Ribas, Juan Carlos

2013-10-28

Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells.

Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil

NASA Astrophysics Data System (ADS)

Chang, I.; Cho, G.

2012-12-01

Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.

Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction

PubMed Central

Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar

2013-01-01

Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938

Impact of flavouring substances on the aggregation behaviour of dissolved barley β-glucans in a model beer.

PubMed

Kupetz, M; Sacher, B; Becker, T

2016-06-05

Structural polymers such as cereal β-glucan may cause various processing problems in beverage industry depending on concentration, molar size distribution and agglomeration behaviour. In this context, influences of the beer volatiles dodecanoic acid, octyl butanoate, ethyl decanoate and decyl acetate on molar mass and radii of barley β-glucan were investigated in ethanolic (4% w/w) model solution. After addition of 100mg/l ethyl decanoate and decyl acetate to the β-glucan solution, a wider-ranging molar mass distribution could be observed by means of asymmetric field-flow-fractionation. Due to agglomeration, average molar mass of β-glucan standard (MW=6.8×10(6)g/mol) increased by 2×10(6)g/mol (P<0.05) in solution containing decyl acetate. Furthermore, a significant growth (P<0.05) from 86 to 102 nm in gyration radius was measured. The obtained results elucidate the importance of fatty acid derived flavouring substance composition in beer regarding the aggregation behaviour of β-glucan. Copyright © 2016 Elsevier Ltd. All rights reserved.

β-Glucans and Resistant Starch Alter the Fermentation of Recalcitrant Fibers in Growing Pigs.

PubMed

de Vries, Sonja; Gerrits, Walter J J; Kabel, Mirjam A; Vasanthan, Thava; Zijlstra, Ruurd T

2016-01-01

Interactions among dietary ingredients are often assumed non-existent when evaluating the nutritive value and health effects of dietary fiber. Specific fibers can distinctly affect digestive processes; therefore, digestibility and fermentability of the complete diet may depend on fiber types present. This study aimed to evaluate the effects of readily fermentable fibers (β-glucans and resistant starch) on the degradation of feed ingredients containing more persistent, recalcitrant, fibers. Six semi-synthetic diets with recalcitrant fibers from rapeseed meal (pectic polysaccharides, xyloglucans, and cellulose) or corn distillers dried grain with solubles (DDGS; (glucurono)arabinoxylans and cellulose) with or without inclusion of β-glucans (6%) or retrograded tapioca (40%) substituted for corn starch were formulated. Six ileal-cannulated pigs (BW 28±1.4 kg) were assigned to the diets according to a 6×6 Latin square. β-glucan-extract increased apparent total tract digestibility (ATTD) of non-glucosyl polysaccharides (accounting for ~40% of the fiber-fraction) from rapeseed meal (6%-units, P<0.001), but did not affect non-glucosyl polysaccharides from DDGS. Retrograded tapioca reduced ATTD of non-glucosyl polysaccharides from rapeseed meal and DDGS (>10%-units, P<0.001), indicating that the large amount of resistant starch entering the hindgut was preferentially degraded over recalcitrant fibers from rapeseed meal and DDGS, possibly related to reduced hindgut-retention time following the increased intestinal bulk. Fermentation of fiber sources was not only dependent on fiber characteristics, but also on the presence of other fibers in the diet. Hence, interactions in the gastrointestinal tract among fibrous feed ingredients should be considered when evaluating their nutritive value.

A Neutral Thermostable β-1,4-Glucanase from Humicola insolens Y1 with Potential for Applications in Various Industries

PubMed Central

Zhang, Wei; Huang, Huoqing; Shi, Pengjun; Luo, Huiying; Liu, Bo; Zhang, Yuhong; Zhang, Zhifang; Fan, Yunliu; Yao, Bin

2015-01-01

We cloned a new glycoside hydrolase family 6 gene, Hicel6C, from the thermophilic fungus Humicola insolens Y1 and expressed it in Pichia pastoris. Using barley β-glucan as a substrate, recombinant HiCel6C protein exhibited neutral pH (6.5) and high temperature (70°C) optima. Distinct from most reported acidic fungal endo-β-1,4-glucanases, HiCel6C was alkali-tolerant, retaining greater than 98.0, 61.2, and 27.6% of peak activity at pH 8.0, 9.0, and 10.0, respectively, and exhibited good stability over a wide pH range (pH 5.0−11.0) and at temperatures up to 60°C. The K m and V max values of HiCel6C for barley β-glucan were 1.29 mg/mL and 752 μmol/min·mg, respectively. HiCel6C was strictly specific for the β-1,4-glucoside linkage exhibiting activity toward barley β-glucan, lichenan, and carboxy methylcellulose sodium salt (CMC-Na), but not toward laminarin (1,3-β-glucan). HiCel6C cleaved the internal glycosidic linkages of cellooligosaccharides randomly and thus represents an endo-cleaving enzyme. The predominant product of polysaccharide hydrolysis by HiCel6C was cellobiose, suggesting that it functions by an endo-processive mechanism. The favorable properties of HiCel6C make it a good candidate for basic research and for applications in the textile and brewing industries. PMID:25909505

Characterization and Structural Analysis of a Novel exo-Type Enzyme Acting on β-1,2-Glucooligosaccharides from Parabacteroides distasonis.

PubMed

Shimizu, Hisaka; Nakajima, Masahiro; Miyanaga, Akimasa; Takahashi, Yuta; Tanaka, Nobukiyo; Kobayashi, Kaito; Sugimoto, Naohisa; Nakai, Hiroyuki; Taguchi, Hayao

2018-05-25

β-1,2-Glucan is a polysaccharide produced mainly by some Gram-negative bacteria as a symbiosis and infectious factor. We recently identified endo-β-1,2-glucanase from Chitinophaga pinensis ( CpSGL) as an enzyme comprising a new family. Here, we report the characteristics and crystal structure of a CpSGL homologue from Parabacteroides distasonis, an intestinal bacterium (BDI_3064 protein), which exhibits distinctive properties of known β-1,2-glucan-degrading enzymes. BDI_3064 hydrolyzed linear β-1,2-glucan and β-1,2-glucooligosaccharides with degrees of polymerization (DPs) of ≥4 to produce sophorose specifically but did not hydrolyze cyclic β-1,2-glucan. This result indicates that BDI_3064 is a new exo-type enzyme. BDI_3064 also produced sophorose from β-1,2-glucooligosaccharide analogues that have a modified reducing end, indicating that BDI_3064 acts on its substrates from the nonreducing end. The crystal structure showed that BDI_3064 possesses additional N-terminal domains 1 and 2, unlike CpSGL. Superimposition of BDI_3064 and CpSGL complexed with ligands showed that R93 in domain 1 overlapped subsite -3 in CpSGL. Docking analysis involving a β-1,2-glucooligosaccharide with DP4 showed that R93 completely blocks the nonreducing end of the docked β-1,2-glucooligosaccharide. This indicates that BDI_3064 employs a distinct mechanism of recognition at the nonreducing end of substrates to act as an exo-type enzyme. Thus, we propose 2-β-d-glucooligosaccharide sophorohydrolase (nonreducing end) as a systematic name for BDI_3064.

Beta-glucans in the treatment of diabetes and associated cardiovascular risks

PubMed Central

Chen, Jiezhong; Raymond, Kenneth

2008-01-01

Diabetes mellitus is characterized by high blood glucose level with typical manifestations of thirst, polyuria, polydipsia, and weight loss. It is caused by defects in insulin-mediated signal pathways, resulting in decreased glucose transportation from blood into muscle and fat cells. The major risk is vascular injury leading to heart disease, which is accelerated by increased lipid levels and hypertension. Management of diabetes includes: control of blood glucose level and lipids; and reduction of hypertension. Dietary intake of beta-glucans has been shown to reduce all these risk factors to benefit the treatment of diabetes and associated complications. In addition, beta-glucans also promote wound healing and alleviate ischemic heart injury. However, the mechanisms behind the effect of beta-glucans on diabetes and associated complications need to be further studied using pure beta-glucan. PMID:19337540

Radioprotection by Biological Response Modifiers Alone and in Combination with WR-2721

DTIC Science & Technology

1989-01-01

reasons related to cancer therapy rather 247 CH2 OH CH 2OH CH 2 0H H H H OH H OH H OH H OH FI(; . Chemical structure of glucan . a polgl~can consisting...2. GLUCAN : BACKGROUND AND GENERAL IMMUNOLOGIC AND HEMOPOIETIC EFFECTS Glucan (Fig. 1) is a beta -l,3-polyglucose isolated from the inner cell wall of...Adju’an, Therapy. pp. 183- 194. CH iiGOS. M. A led ) Ra%.en Press. New York Ciop. J. K. and AtSTiN. K. F 11985) A beta - glucan inhibitable receptor on human

Characterization of a beta-glucanase produced by Rhizopus microsporus var. microsporus, and its potential for application in the brewing industry.

PubMed

Celestino, Klecius R Silveira; Cunha, Ricardo B; Felix, Carlos R

2006-12-05

In the barley malting process, partial hydrolysis of beta-glucans begins with seed germination. However, the endogenous 1,3-1,4-beta-glucanases are heat inactivated, and the remaining high molecular weight beta-glucans may cause severe problems such as increased brewer mash viscosity and turbidity. Increased viscosity impairs pumping and filtration, resulting in lower efficiency, reduced yields of extracts, and lower filtration rates, as well as the appearance of gelatinous precipitates in the finished beer. Therefore, the use of exogenous beta-glucanases to reduce the beta-glucans already present in the malt barley is highly desirable. The zygomycete microfungus Rhizopus microsporus var. microsporus secreted substantial amounts of beta-glucanase in liquid culture medium containing 0.5% chitin. An active protein was isolated by gel filtration and ion exchange chromatographies of the beta-glucanase activity-containing culture supernatant. This isolated protein hydrolyzed 1,3-1,4-beta-glucan (barley beta-glucan), but showed only residual activity against 1,3-beta-glucan (laminarin), or no activity at all against 1,4-beta-glucan (cellulose), indicating that the R. microsporus var. microsporus enzyme is a member of the EC 3.2.1.73 category. The purified protein had a molecular mass of 33.7 kDa, as determined by mass spectrometry. The optimal pH and temperature for hydrolysis of 1,3-1,4-beta-glucan were in the ranges of 4-5, and 50-60 degrees C, respectively. The Km and Vmax values for hydrolysis of beta-glucan at pH 5.0 and 50 degrees C were 22.39 mg.mL-1 and 16.46 mg.min-1, respectively. The purified enzyme was highly sensitive to Cu+2, but showed less or no sensitivity to other divalent ions, and was able to reduce both the viscosity and the filtration time of a sample of brewer mash. In comparison to the values determined for the mash treated with two commercial glucanases, the relative viscosity value for the mash treated with the 1,3-1,4-beta-glucanase produced by R. microsporus var. microsporus. was determined to be consistently lower. The zygomycete microfungus R. microsporus var. microsporus produced a 1,3-1,4-beta-D-glucan 4-glucanhydrolase (EC 3.2.1.73) which is able to hydrolyze beta-D-glucan that contains both the 1,3- and 1,4-bonds (barley beta-glucans). Its molecular mass was 33.7 kDa. Maximum activity was detected at pH values in the range of 4-5, and temperatures in the range of 50-60 degrees C. The enzyme was able to reduce both the viscosity of the brewer mash and the filtration time, indicating its potential value for the brewing industry.

The diversity and specificity of the extracellular proteome in the cellulolytic bacterium Caldicellulosiruptor bescii is driven by the nature of the cellulosic growth substrate

DOE PAGES

Poudel, Suresh; Giannone, Richard J.; Basen, Mirko; ...

2018-03-23

Background: Caldicellulosiruptor bescii is a thermophilic cellulolytic bacterium that efficiently deconstructs lignocellulosic biomass into sugars, which subsequently can be fermented into alcohols, such as ethanol, and other products. Deconstruction of complex substrates by C. bescii involves a myriad of highly abundant, substrate-specific extracellular solute binding proteins (ESBPs) and carbohydrate-active enzymes (CAZymes) containing carbohydrate-binding modules (CBMs). Mass spectrometry-based proteomics was employed to investigate how these substrate recognition proteins and enzymes vary as a function of lignocellulosic substrates.Results:Proteomic analysis revealed several key extracellular proteins that respond specifically to either C5 or C6 mono- and polysaccharides. These include proteins of unknown functions (PUFs),more » ESBPs, and CAZymes. ESBPs that were previously shown to interact more efficiently with hemicellulose and pectin were detected in high abundance during growth on complex C5 substrates, such as switchgrass and xylan. Some proteins, such as Athe_0614 and Athe_2368, whose functions are not well defined were predicted to be involved in xylan utilization and ABC transport and were significantly more abundant in complex and C5 substrates, respectively. The proteins encoded by the entire glucan degradation locus (GDL; Athe_1857, 1859, 1860, 1865, 1867, and 1866) were highly abundant under all growth conditions, particularly when C. bescii was grown on cellobiose, switchgrass, or xylan. In contrast, the glycoside hydrolases Athe_0609 (Pullulanase) and 0610, which both possess CBM20 and a starch binding domain, appear preferential to C5/complex substrate deconstruction. Some PUFs, such as Athe_2463 and 2464, were detected as highly abundant when grown on C5 substrates (xylan and xylose), also suggesting C5-substrate specificity. In conclusion, this study reveals the protein membership of the C. bescii secretome and demonstrates its plasticity based on the complexity (mono-/disaccharides vs. polysaccharides) and type of carbon (C5 vs. C6) available to the microorganism. The presence or increased abundance of extracellular proteins as a response to specific substrates helps to further elucidate C. bescii’s utilization and conversion of lignocellulosic biomass to biofuel and other valuable products. This includes improved characterization of extracellular proteins that lack discrete functional roles and are poorly/not annotated.« less

The diversity and specificity of the extracellular proteome in the cellulolytic bacterium Caldicellulosiruptor bescii is driven by the nature of the cellulosic growth substrate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poudel, Suresh; Giannone, Richard J.; Basen, Mirko

Background: Caldicellulosiruptor bescii is a thermophilic cellulolytic bacterium that efficiently deconstructs lignocellulosic biomass into sugars, which subsequently can be fermented into alcohols, such as ethanol, and other products. Deconstruction of complex substrates by C. bescii involves a myriad of highly abundant, substrate-specific extracellular solute binding proteins (ESBPs) and carbohydrate-active enzymes (CAZymes) containing carbohydrate-binding modules (CBMs). Mass spectrometry-based proteomics was employed to investigate how these substrate recognition proteins and enzymes vary as a function of lignocellulosic substrates.Results:Proteomic analysis revealed several key extracellular proteins that respond specifically to either C5 or C6 mono- and polysaccharides. These include proteins of unknown functions (PUFs),more » ESBPs, and CAZymes. ESBPs that were previously shown to interact more efficiently with hemicellulose and pectin were detected in high abundance during growth on complex C5 substrates, such as switchgrass and xylan. Some proteins, such as Athe_0614 and Athe_2368, whose functions are not well defined were predicted to be involved in xylan utilization and ABC transport and were significantly more abundant in complex and C5 substrates, respectively. The proteins encoded by the entire glucan degradation locus (GDL; Athe_1857, 1859, 1860, 1865, 1867, and 1866) were highly abundant under all growth conditions, particularly when C. bescii was grown on cellobiose, switchgrass, or xylan. In contrast, the glycoside hydrolases Athe_0609 (Pullulanase) and 0610, which both possess CBM20 and a starch binding domain, appear preferential to C5/complex substrate deconstruction. Some PUFs, such as Athe_2463 and 2464, were detected as highly abundant when grown on C5 substrates (xylan and xylose), also suggesting C5-substrate specificity. In conclusion, this study reveals the protein membership of the C. bescii secretome and demonstrates its plasticity based on the complexity (mono-/disaccharides vs. polysaccharides) and type of carbon (C5 vs. C6) available to the microorganism. The presence or increased abundance of extracellular proteins as a response to specific substrates helps to further elucidate C. bescii’s utilization and conversion of lignocellulosic biomass to biofuel and other valuable products. This includes improved characterization of extracellular proteins that lack discrete functional roles and are poorly/not annotated.« less

The diversity and specificity of the extracellular proteome in the cellulolytic bacterium Caldicellulosiruptor bescii is driven by the nature of the cellulosic growth substrate.

PubMed

Poudel, Suresh; Giannone, Richard J; Basen, Mirko; Nookaew, Intawat; Poole, Farris L; Kelly, Robert M; Adams, Michael W W; Hettich, Robert L

2018-01-01

Caldicellulosiruptor bescii is a thermophilic cellulolytic bacterium that efficiently deconstructs lignocellulosic biomass into sugars, which subsequently can be fermented into alcohols, such as ethanol, and other products. Deconstruction of complex substrates by C. bescii involves a myriad of highly abundant, substrate-specific extracellular solute binding proteins (ESBPs) and carbohydrate-active enzymes (CAZymes) containing carbohydrate-binding modules (CBMs). Mass spectrometry-based proteomics was employed to investigate how these substrate recognition proteins and enzymes vary as a function of lignocellulosic substrates. Proteomic analysis revealed several key extracellular proteins that respond specifically to either C5 or C6 mono- and polysaccharides. These include proteins of unknown functions (PUFs), ESBPs, and CAZymes. ESBPs that were previously shown to interact more efficiently with hemicellulose and pectin were detected in high abundance during growth on complex C5 substrates, such as switchgrass and xylan. Some proteins, such as Athe_0614 and Athe_2368, whose functions are not well defined were predicted to be involved in xylan utilization and ABC transport and were significantly more abundant in complex and C5 substrates, respectively. The proteins encoded by the entire glucan degradation locus (GDL; Athe_1857, 1859, 1860, 1865, 1867, and 1866) were highly abundant under all growth conditions, particularly when C. bescii was grown on cellobiose, switchgrass, or xylan. In contrast, the glycoside hydrolases Athe_0609 (Pullulanase) and 0610, which both possess CBM20 and a starch binding domain, appear preferential to C5/complex substrate deconstruction. Some PUFs, such as Athe_2463 and 2464, were detected as highly abundant when grown on C5 substrates (xylan and xylose), also suggesting C5-substrate specificity. This study reveals the protein membership of the C. bescii secretome and demonstrates its plasticity based on the complexity (mono-/disaccharides vs. polysaccharides) and type of carbon (C5 vs. C6) available to the microorganism. The presence or increased abundance of extracellular proteins as a response to specific substrates helps to further elucidate C. bescii 's utilization and conversion of lignocellulosic biomass to biofuel and other valuable products. This includes improved characterization of extracellular proteins that lack discrete functional roles and are poorly/not annotated.

Synthesis, (1-->3)-beta-D-glucanase-binding ability, and phytoalexin-elicitor activity of a mixture of 3,4-epoxybutyl (1-->3)-beta-D-oligoglucosides.

PubMed

Huang, Gang-Liang; Liu, Man-Xi; Mei, Xin-Ya

2004-06-01

We describe a approach for the synthesis of a mixture of 3,4-epoxybutyl (1-->3)-beta-D-oligoglucosides. The particular (1-->3)-beta-D-glucan isolated from the cell walls of Saccharomyces cerevisiae was recovered from the aqueous medium as water-insoluble particles by the spray drying (GS) method, and it was characterized by FTIR spectroscopy. The acid-solubilized (1-->3)-beta-D-oligoglucosides were prepared by partial acid hydrolysis of glucan particles, which were qualitatively analyzed by fluorophore-assisted carbohydrate electrophoresis (FACE). The peracetylated 3-butenyl (1-->3)-beta-D-oligoglucosides were synthesized by treating peracetylated (1-->3)-beta-D-oligoglucosides with the 3-butenyl alcohols and a Lewis acid (SnCl4) catalyst. Epoxidation of the peracetylated 3-butenyl oligoglucosides took place with m-chloroperoxybenzoic acid (m-CPBA). NaOMe in dry methanol was used for the deacetylation of the blocked derivatives, to give the 3,4-epoxybutyl (1-->3)-beta-D-oligoglucoside mixture in an overall yield of 21%. The sample was analyzed by positive-ion electrospray ionization mass spectrometry (ESIMS). In a 3,4-epoxybutyl (1-->3)-beta-D-oligoglucoside-binding (1-->3)-beta-D-glucanase assay, we found that the (1-->3)-beta-D-glucanase was obviously inactivated by the 3,4-epoxybutyl (1-->3)-beta-D-oligoglucosides. At the same time, we found the 3,4-epoxybutyl (1-->3)-beta-D-oligoglucoside mixture was more active as compared to the underivatized oligoglucoside mixture in eliciting phytoalexin accumulation in tobacco cotyledon tissue. Furthermore, it could be kept for a longer time than a (1-->3)-beta-D-oligoglucoside mixture, which indicated it is much more stable than (1-->3)-beta-D-oligoglucosides. Copyright 2004 Elsevier Ltd.

Strategies To Discover the Structural Components of Cyst and Oocyst Walls

PubMed Central

Bushkin, G. Guy; Chatterjee, Aparajita; Robbins, Phillips W.

2013-01-01

Cysts of Giardia lamblia and Entamoeba histolytica and oocysts of Toxoplasma gondii and Cryptosporidium parvum are the infectious and sometimes diagnostic forms of these parasites. To discover the structural components of cyst and oocyst walls, we have developed strategies based upon a few simple assumptions. Briefly, the most abundant wall proteins are identified by monoclonal antibodies or mass spectrometry. Structural components include a sugar polysaccharide (chitin for Entamoeba, β-1,3-linked glucose for Toxoplasma, and β-1,3-linked GalNAc for Giardia) and/or acid-fast lipids (Toxoplasma and Cryptosporidium). Because Entamoeba cysts and Toxoplasma oocysts are difficult to obtain, studies of walls of nonhuman pathogens (E. invadens and Eimeria, respectively) accelerate discovery. Biochemical methods to dissect fungal walls work well for cyst and oocyst walls, although the results are often unexpected. For example, echinocandins, which inhibit glucan synthases and kill fungi, arrest the development of oocyst walls and block their release into the intestinal lumen. Candida walls are coated with mannans, while Entamoeba cysts are coated in a dextran-like glucose polymer. Models for cyst and oocyst walls derive from their structural components and organization within the wall. Cyst walls are composed of chitin fibrils and lectins that bind chitin (Entamoeba) or fibrils of the β-1,3-GalNAc polymer and lectins that bind the polymer (Giardia). Oocyst walls of Toxoplasma have two distinct layers that resemble those of fungi (β-1,3-glucan in the inner layer) or mycobacteria (acid-fast lipids in the outer layer). Oocyst walls of Cryptosporidium have a rigid bilayer of acid-fast lipids and inner layer of oocyst wall proteins. PMID:24096907

Ole e 13 is the unique food allergen in olive: Structure-functional, substrates docking, and molecular allergenicity comparative analysis.

PubMed

Jimenez-Lopez, J C; Robles-Bolivar, P; Lopez-Valverde, F J; Lima-Cabello, E; Kotchoni, S O; Alché, J D

2016-05-01

Thaumatin-like proteins (TLPs) are enzymes with important functions in pathogens defense and in the response to biotic and abiotic stresses. Last identified olive allergen (Ole e 13) is a TLP, which may also importantly contribute to food allergy and cross-allergenicity to pollen allergen proteins. The goals of this study are the characterization of the structural-functionality of Ole e 13 with a focus in its catalytic mechanism, and its molecular allergenicity by extensive analysis using different molecular computer-aided approaches covering a) functional-regulatory motifs, b) comparative study of linear sequence, 2-D and 3D structural homology modeling, c) molecular docking with two different β-D-glucans, d) conservational and evolutionary analysis, e) catalytic mechanism modeling, and f) IgE-binding, B- and T-cell epitopes identification and comparison to other allergenic TLPs. Sequence comparison, structure-based features, and phylogenetic analysis identified Ole e 13 as a thaumatin-like protein. 3D structural characterization revealed a conserved overall folding among plants TLPs, with mayor differences in the acidic (catalytic) cleft. Molecular docking analysis using two β-(1,3)-glucans allowed to identify fundamental residues involved in the endo-1,3-β-glucanase activity, and defining E84 as one of the conserved residues of the TLPs responsible of the nucleophilic attack to initiate the enzymatic reaction and D107 as proton donor, thus proposing a catalytic mechanism for Ole e 13. Identification of IgE-binding, B- and T-cell epitopes may help designing strategies to improve diagnosis and immunotherapy to food allergy and cross-allergenic pollen TLPs. Copyright © 2016 Elsevier Inc. All rights reserved.

pH recycling aqueous two-phase systems applied in extraction of Maitake β-Glucan and mechanism analysis using low-field nuclear magnetic resonance.

PubMed

Hou, Huiyun; Cao, Xuejun

2015-07-31

In this paper, a recycling aqueous two-phase systems (ATPS) based on two pH-response copolymers PADB and PMDM were used in purification of β-Glucan from Grifola frondosa. The main parameters, such as polymer concentration, type and concentration of salt, extraction temperature and pH, were investigated to optimize partition conditions. The results demonstrated that β-Glucan was extracted into PADB-rich phase, while impurities were extracted into PMDM-rich phase. In this 2.5% PADB/2.5% PMDM ATPS, 7.489 partition coefficient and 96.92% extraction recovery for β-Glucan were obtained in the presence of 30mmol/L KBr, at pH 8.20, 30°C. The phase-forming copolymers could be recycled by adjusting pH, with recoveries of over 96.0%. Furthermore, the partition mechanism of Maitake β-Glucan in PADB/PMDM aqueous two-phase systems was studied. Fourier transform infrared spectra, ForteBio Octet system and low-field nuclear magnetic resonance (LF-NMR) were introduced for elucidating the partition mechanism of β-Glucan. Especially, LF-NMR was firstly used in the mechanism analysis in partition of aqueous two-phase systems. The change of transverse relaxation time (T2) in ATPS could reflect the interaction between polymers and β-Glucan. Copyright © 2015 Elsevier B.V. All rights reserved.

Exercise and Beta-Glucan Consumption (Saccharomyces cerevisiae) Improve the Metabolic Profile and Reduce the Atherogenic Index in Type 2 Diabetic Rats (HFD/STZ)

PubMed Central

Andrade, Eric Francelino; Lima, Andressa Ribeiro Veiga; Nunes, Ingrid Edwiges; Orlando, Débora Ribeiro; Gondim, Paula Novato; Zangeronimo, Márcio Gilberto; Alves, Fernando Henrique Ferrari; Pereira, Luciano José

2016-01-01

Physical activity and the ingestion of dietary fiber are non-drug alternatives commonly used as adjuvants to glycemic control in diabetic individuals. Among these fibers, we can highlight beta-glucans. However, few studies have compared isolated and synergic effects of physical exercise and beta-glucan ingestion, especially in type 2 diabetic rats. Therefore, we evaluated the effects beta-glucan (Saccharomyces cerevisiae) consumption, associated or not to exercise, on metabolic parameters of diabetic Wistar rats. The diabetes mellitus (DM) was induced by high-fat diet (HFD) associated with a low dose of streptozotocin (STZ—35 mg/kg). Trained groups were submitted to eight weeks of exercise in aquatic environment. In the last 28 days of experiment, animals received 30 mg/kg/day of beta-glucan by gavage. Isolated use of beta-glucan decreased glucose levels in fasting, Glycated hemoglobin (HbA1c), triglycerides (TAG), total cholesterol (TC), low-density lipoprotein (LDL-C), the atherogenic index of plasma. Exercise alone also decreased blood glucose levels, HbA1c, and renal lesions. An additive effect for reducing the atherogenic index of plasma and renal lesions was observed when both treatments were combined. It was concluded that both beta-glucan and exercise improved metabolic parameters in type 2 (HFD/STZ) diabetic rats. PMID:27999319

Effect of a single point mutation on the interaction of glucans with a glucansucrase from Leuconostoc mesenteroides NRRL B-1118

USDA-ARS?s Scientific Manuscript database

Our previous work showed that substitution of an amino acid that is coupled with the +2 subsite adjacent to the transition stabilizer of a glucansucrase, which produces a water-insoluble glucan, resulted in significant changes in the structures and yields of the water-insoluble glucans produced. We ...

Investigations of the relationship betw een disease and airborne (1→3)-β-D-glucan in buildings

PubMed Central

Rylander, Ragnar

1997-01-01

Studies on the relationship between symptoms in indoor air and the amount of airborne (1→3)-β-D-glucan were reviewed. Relationships were found for symptoms and objective tests of airways inflammation. The data suggest that (1→3)-β-D-glucan could be a causative agent. PMID:18472858

Micro-heterogeneity and micro-rheological properties of high-viscosity barley beta-glucan solutions studied by diffusion wave spectroscopy (DWS)

USDA-ARS?s Scientific Manuscript database

Soluble fiber ß-glucan is one of the key dietary materials in healthy food products known for reducing serum cholesterol levels. The micro-structural heterogeneity and micro-rheology of high-viscosity barley ß-glucan solutions were investigated by the diffusing wave spectroscopy (DWS) technology. By...

Characterization of the glucansucrase GTF180 W1065 mutant enzymes producing polysaccharides and oligosaccharides with altered linkage composition.

PubMed

Meng, Xiangfeng; Pijning, Tjaard; Tietema, Martin; Dobruchowska, Justyna M; Yin, Huifang; Gerwig, Gerrit J; Kralj, Slavko; Dijkhuizen, Lubbert

2017-02-15

Exopolysaccharides produced by lactic acid bacteria are extensively used for food applications. Glucansucrase enzymes of lactic acid bacteria use sucrose to catalyze the synthesis of α-glucans with different linkage compositions, size and physico-chemical properties. Crystallographic studies of GTF180-ΔN show that at the acceptor binding sites +1 and +2, residue W1065 provides stacking interactions to the glucosyl moiety. However, the detailed functional roles of W1065 have not been elucidated. We performed random mutagenesis targeting residue W1065 of GTF180-ΔN, resulting in the generation of 10 mutant enzymes that were characterized regarding activity and product specificity. Characterization of mutant enzymes showed that residue W1065 is critical for the activity of GTF180-ΔN. Using sucrose, and sucrose (donor) plus maltose (acceptor) as substrates, the mutant enzymes synthesized polysaccharides and oligosaccharides with changed linkage composition. The stacking interaction of an aromatic residue at position 1065 is essential for polysaccharide synthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

In vitro antioxidant capacity and anti-inflammatory activity of seven common oats

USDA-ARS?s Scientific Manuscript database

Oats have received increased scientific and public interest for their purported antioxidant-associated health benefits, however most reported studies have concentrated on oat extracts or specific oat phytochemicals, such as beta-glucans, tocols (vitamin E) or avenanthramides. Studies on whole oat gr...

Caspase-8 modulates Dectin-1 and CR3 driven IL-1β production in response to β-glucans and the fungal pathogen, Candida albicans1

PubMed Central

Ganesan, Sandhya; Rathinam, Vijay A. K.; Bossaller, Lukas; Army, Kelly; Kaiser, William J.; Mocarski, Edward S.; Dillon, Christopher P.; Green, Douglas R.; Mayadas, Tanya N.; Levitz, Stuart M.; Hise, Amy G.

2014-01-01

Inflammasomes are central mediators of host defense to a wide range of microbial pathogens. The NLRP3 inflammasome plays a key role in triggering caspase-1 dependent IL-1β maturation and resistance to fungal dissemination in Candida albicans infection. β-glucans are major components of fungal cell walls that trigger IL-1β secretion in both murine and human immune cells. In this study, we sought to determine the contribution of β-glucans to C. albicans-induced inflammasome responses in mouse dendritic cells. We show that the NLRP3-ASC-caspase-1 inflammasome is absolutely critical for IL-1β production in response to β-glucans. Interestingly, we also found that both Complement Receptor 3 (CR3/Mac-1) and dectin-1 play a crucial role in coordinating β-glucan-induced IL-1β processing as well as a cell death response. In addition to the essential role of caspase-1, we identify an important role for the pro-apoptotic protease caspase-8 in promoting β-glucan-induced cell death and NLRP3 inflammasome-dependent IL-1β maturation. A strong requirement for Complement Receptor 3 and caspase-8 was also found for NLRP3 dependent IL-1β production in response to heat killed Candida albicans. Together, these results define the importance of dectin-1, CR3 and caspase-8, in addition to the canonical NLRP3 inflammasome, in mediating β-glucan and C. albicans induced innate responses in dendritic cells. Collectively, these findings establish a novel link between β-glucan recognition receptors and the inflammatory proteases caspase-8 and caspase-1 in coordinating cytokine secretion and cell death in response to immunostimulatory fungal components. PMID:25063877

Interleukin-1 and Interferon-γ Orchestrate β-Glucan-Activated Human Dendritic Cell Programming via IκB-ζ Modulation

PubMed Central

Cardone, Marco; Dzutsev, Amiran K.; Li, Hongchuan; Riteau, Nicolas; Gerosa, Franca; Shenderov, Kevin; Winkler-Pickett, Robin; Provezza, Lisa; Riboldi, Elena; Leighty, Robert M.; Orr, Selinda J.; Steinhagen, Folkert; Wewers, Mark D.; Sher, Alan; Anderson, Stephen K.; Goldszmid, Romina; McVicar, Daniel W.

2014-01-01

Recognition of microbial components via innate receptors including the C-type lectin receptor Dectin-1, together with the inflammatory environment, programs dendritic cells (DCs) to orchestrate the magnitude and type of adaptive immune responses. The exposure to β-glucan, a known Dectin-1 agonist and component of fungi, yeasts, and certain immune support supplements, activates DCs to induce T helper (Th)17 cells that are essential against fungal pathogens and extracellular bacteria but may trigger inflammatory pathology or autoimmune diseases. However, the exact mechanisms of DC programming by β-glucan have not yet been fully elucidated. Using a gene expression/perturbation approach, we demonstrate that in human DCs β-glucan transcriptionally activates via an interleukin (IL)-1- and inflammasome-mediated positive feedback late-induced genes that bridge innate and adaptive immunity. We report that in addition to its known ability to directly prime T cells toward the Th17 lineage, IL-1 by promoting the transcriptional cofactor inhibitor of κB-ζ (IκB-ζ) also programs β-glucan-exposed DCs to express cell adhesion and migration mediators, antimicrobial molecules, and Th17-polarizing factors. Interferon (IFN)-γ interferes with the IL-1/IκB-ζ axis in β-glucan-activated DCs and promotes T cell-mediated immune responses with increased release of IFN-γ and IL-22, and diminished production of IL-17. Thus, our results identify IL-1 and IFN-γ as regulators of DC programming by β-glucan. These molecular networks provide new insights into the regulation of the Th17 response as well as new targets for the modulation of immune responses to β-glucan-containing microorganisms. PMID:25474109

Identification and Deletion of Tft1, a Predicted Glycosyltransferase Necessary for Cell Wall β-1,3;1,4-Glucan Synthesis in Aspergillus fumigatus

PubMed Central

Samar, Danial; Kieler, Joshua B.; Klutts, J. Stacey

2015-01-01

Aspergillus fumigatus is an environmental mold that causes severe, often fatal invasive infections in immunocompromised patients. The search for new antifungal drug targets is critical, and the synthesis of the cell wall represents a potential area to find such a target. Embedded within the main β-1,3-glucan core of the A. fumigatus cell wall is a mixed linkage, β-D-(1,3;1,4)-glucan. The role of this molecule or how it is synthesized is unknown, though it comprises 10% of the glucans within the wall. While this is not a well-studied molecule in fungi, it has been studied in plants. Using the sequences of two plant mixed linkage glucan synthases, a single ortholog was identified in A. fumigatus (Tft1). A strain lacking this enzyme (tft1Δ) was generated along with revertant strains containing the native gene under the control of either the native or a strongly expressing promoter. Immunofluorescence staining with an antibody against β-(1,3;1,4)-glucan and biochemical quantification of this polysaccharide in the tft1Δ strain demonstrated complete loss of this molecule. Reintroduction of the gene into the knockout strain yielded reappearance in amounts that correlated with expected expression of the gene. The loss of Tft1 and mixed linkage glucan yielded no in vitro growth phenotype. However, there was a modest increase in virulence for the tft1Δ strain in a wax worm model. While the precise roles for β-(1,3;1,4)-glucan within A. fumigatus cell wall are still uncertain, it is clear that Tft1 plays a pivotal role in the biosynthesis of this cell wall polysaccharide. PMID:25723175

Protective effects of β-glucan against oxidative injury induced by 2.45-GHz electromagnetic radiation in the skin tissue of rats.

PubMed

Ceyhan, Ali Murat; Akkaya, Vahide Baysal; Güleçol, Şeyma Celik; Ceyhan, Betül Mermi; Özgüner, Fehmi; Chen, WenChieh

2012-09-01

In recent times, there is widespread use of 2.45-GHz irradiation-emitting devices in industrial, medical, military and domestic application. The aim of the present study was to investigate the effect of 2.45-GHz electromagnetic radiation (EMR) on the oxidant and antioxidant status of skin and to examine the possible protective effects of β-glucans against the oxidative injury. Thirty-two male Wistar albino rats were randomly divided into four equal groups: control; sham exposed; EMR; and EMR + β-glucan. A 2.45-GHz EMR emitted device from the experimental exposure was applied to the EMR group and EMR + β-glucan group for 60 min daily, respectively, for 4 weeks. β-glucan was administered via gavage at a dose of 50 mg/kg/day before each exposure to radiation in the treatment group. The activities of antioxidant enzymes, superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) and catalase (CAT), as well as the concentration of malondialdehyde (MDA) were measured in tissue homogenates of the skin. Exposure to 2.45-GHz EMR caused a significant increase in MDA levels and CAT activity, while the activities of SOD and GSH-Px decreased in skin tissues. Systemic β-glucan significantly reversed the elevation of MDA levels and the reduction of SOD activities. β-glucan treatment also slightly enhanced the activity of CAT and prevented the depletion of GSH-Px activity caused by EMR, but not statistically significantly. The present study demonstrated the role of oxidative mechanisms in EMR-induced skin tissue damages and that β-glucan could ameliorate oxidative skin injury via its antioxidant properties.

The well-coordinated linkage between acidogenicity and aciduricity via insoluble glucans on the surface of Streptococcus mutans

PubMed Central

Guo, Lihong; McLean, Jeffrey S.; Lux, Renate; He, Xuesong; Shi, Wenyuan

2015-01-01

Streptococcus mutans is considered the principal cariogenic bacterium for dental caries. Despite the recognition of their importance for cariogenesis, the possible coordination among S. mutans’ main virulence factors, including glucan production, acidogenicity and aciduricity, has been less well studied. In the present study, using S. mutans strains with surface-displayed pH-sensitive pHluorin, we revealed sucrose availability- and Gtf functionality-dependent proton accumulation on S. mutans surface. Consistent with this, using a pH-sensitive dye, we demonstrated that both in vivo cell-produced and in vitro enzymatically synthesized insoluble glucans displayed proton-concentrating ability. Global transcriptomics revealed proton accumulation triggers the up-regulation of genes encoding functions involved in acid tolerance response in a glucan-dependent manner. Our data suggested that this proton enrichment around S. mutans could pre-condition the bacterium for acid-stress. Consistent with this hypothesis, we found S. mutans strains defective in glucan production were more acid sensitive. Our study revealed for the first time that insoluble glucans is likely an essential factor linking acidogenicity with aciduricity. The coordination of these key virulence factors could provide new insights on how S. mutans may have become a major cariogenic pathogen. PMID:26657939

In vitro synthesis of linear α-1,3-glucan and chemical modification to ester derivatives exhibiting outstanding thermal properties

PubMed Central

Puanglek, Sakarin; Kimura, Satoshi; Enomoto-Rogers, Yukiko; Kabe, Taizo; Yoshida, Makoto; Wada, Masahisa; Iwata, Tadahisa

2016-01-01

Bio-based polymer is considered as one of potentially renewable materials to reduce the consumption of petroleum resources. We report herein on the one-pot synthesis and development of unnatural-type bio-based polysaccharide, α-1,3-glucan. The synthesis can be achieved by in vitro enzymatic polymerization with GtfJ enzyme, one type of glucosyltransferase, cloned from Streptococcus salivarius ATCC 25975 utilizing sucrose, a renewable feedstock, as a glucose monomer source, via environmentally friendly one-pot water-based reaction. The structure of α-1,3-glucan is completely linear without branches with weight-average molecular weight (Mw) of 700 kDa. Furthermore, acetate and propionate esters of α-1,3-glucan were synthesized and characterized. Interestingly, α-1,3-glucan acetate showed a comparatively high melting temperature at 339 °C, higher than that of commercially available thermoplastics such as PET (265 °C) and Nylon 6 (220 °C). Thus, the discovery of crystalline α-1,3-glucan esters without branches with high thermal stability and melting temperature opens the gate for further researches in the application of thermoplastic materials. PMID:27469976

A Drug-Sensitive Genetic Network Masks Fungi from the Immune System

PubMed Central

Wheeler, Robert T; Fink, Gerald R

2006-01-01

Fungal pathogens can be recognized by the immune system via their β-glucan, a potent proinflammatory molecule that is present at high levels but is predominantly buried beneath a mannoprotein coat and invisible to the host. To investigate the nature and significance of “masking” this molecule, we characterized the mechanism of masking and consequences of unmasking for immune recognition. We found that the underlying β-glucan in the cell wall of Candida albicans is unmasked by subinhibitory doses of the antifungal drug caspofungin, causing the exposed fungi to elicit a stronger immune response. Using a library of bakers' yeast (Saccharomyces cerevisiae) mutants, we uncovered a conserved genetic network that is required for concealing β-glucan from the immune system and limiting the host response. Perturbation of parts of this network in the pathogen C. albicans caused unmasking of its β-glucan, leading to increased β-glucan receptor-dependent elicitation of key proinflammatory cytokines from primary mouse macrophages. By creating an anti-inflammatory barrier to mask β-glucan, opportunistic fungi may promote commensal colonization and have an increased propensity for causing disease. Targeting the widely conserved gene network required for creating and maintaining this barrier may lead to novel broad-spectrum antimycotics. PMID:16652171

In vitro synthesis of linear α-1,3-glucan and chemical modification to ester derivatives exhibiting outstanding thermal properties

NASA Astrophysics Data System (ADS)

Puanglek, Sakarin; Kimura, Satoshi; Enomoto-Rogers, Yukiko; Kabe, Taizo; Yoshida, Makoto; Wada, Masahisa; Iwata, Tadahisa

2016-07-01

Bio-based polymer is considered as one of potentially renewable materials to reduce the consumption of petroleum resources. We report herein on the one-pot synthesis and development of unnatural-type bio-based polysaccharide, α-1,3-glucan. The synthesis can be achieved by in vitro enzymatic polymerization with GtfJ enzyme, one type of glucosyltransferase, cloned from Streptococcus salivarius ATCC 25975 utilizing sucrose, a renewable feedstock, as a glucose monomer source, via environmentally friendly one-pot water-based reaction. The structure of α-1,3-glucan is completely linear without branches with weight-average molecular weight (Mw) of 700 kDa. Furthermore, acetate and propionate esters of α-1,3-glucan were synthesized and characterized. Interestingly, α-1,3-glucan acetate showed a comparatively high melting temperature at 339 °C, higher than that of commercially available thermoplastics such as PET (265 °C) and Nylon 6 (220 °C). Thus, the discovery of crystalline α-1,3-glucan esters without branches with high thermal stability and melting temperature opens the gate for further researches in the application of thermoplastic materials.

LESSONS LEARNED REGARDING THE USE OF AN IMPINGER FOR COLLECTING AIRBORNE BACTERIA DURING A BIOSOLIDS APPLICATION FIELD STUDY

EPA Science Inventory

The National Risk Management Research Laboratory (NRMRL) of the USEPA has performed laboratory wind tunnel studies as well as large field studies to evaluate specific bioaerosol components (bacteria, fungi, endotoxin, β-d glucan) that may be associated with various practices for ...

Development of a Novel Targeted RNAi Delivery Technology in Therapies for Metabolic Diseases

DTIC Science & Technology

2016-10-01

Kupffer cells and macrophages as demonstrated in our earlier studies, for targeted delivery of the sdRNA to these phagocytes in liver as originally...conjugation to glucan shell while preserving targeting specificity to phagocytic cells observed with our existing GeRP formulations. Small

Preparation, characterization, and biological properties of β-glucans

PubMed Central

Rahar, Sandeep; Swami, Gaurav; Nagpal, Navneet; Nagpal, Manisha A.; Singh, Gagan Shah

2011-01-01

β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast), and Agaricus blazei murell (mushroom). Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC) analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa) being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa) to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine. PMID:22171300

Monitoring total endotoxin and (1 --> 3)-beta-D-glucan at the air exhaust of concentrated animal feeding operations.

PubMed

Yang, Xufei; Wang, Xinlei; Zhang, Yuanhui; Lee, Jongmin; Su, Jingwei; Gates, Richard S

2013-10-01

Mitigation of bioaerosol emissions from concentrated animal feeding operations (CAFOs) demands knowledge of bioaerosol concentrations feeding into an end-of-pipe air treatment process. The aim of this preliminary study was to measure total endotoxin and (1 --> 3)-beta-glucan concentrations at the air exhaust of 18 commercial CAFOs and to examine their variability with animal operation type (swine farrowing, swine gestation, swine weaning, swine finishing, manure belt laying hen, and tom turkey) and season (cold, mild, and hot). The measured airborne concentrations of total endotoxin ranged from 98 to 23,157 endotoxin units (EU)/m3, and the airborne concentrations of total (1 --> 3)-beta-D-glucan ranged from 2.4 to 537.9 ng/m3. Animal operation type in this study had a significant effect on airborne concentrations of total endotoxin and (1 --> 3)-beta-D-glucan but no significant effect on their concentrations in total suspended particulate (TSP). Both endotoxin and (1 --> 3)-beta-D-glucan attained their highest airborne concentrations in visited tom turkey buildings. Comparatively, season had no significant effect on airborne concentrations of total endotoxin or (1 --> 3)-beta-D-glucan. Endotoxin and (1 --> 3)-beta-glucan concentrations in TSP dust appeared to increase as the weather became warmer, and this seasonal effect was significant in swine buildings. Elevated indoor temperatures in the hot season were considered to facilitate the growth and propagation of bacteria and fungi, thus leading to higher biocomponent concentrations in TSP.

Protective effect of β-D-glucan and glutamine on the genomic instability induced by Cytarabine/Ara-C in BALB/c mice.

PubMed

de Souza Silva, Priscilla Mirian; de Sousa, Raimundo Vicente; Simão, Anderson Assaid; Cesar, Pedro Henrique Souza; Trento, Marcus Vinicius Cardoso; Marcussi, Silvana

2018-05-28

Prophylactic antibiotics and growth promoters have been substituted, mainly for livestock, by immunomodulators and intestinal health promoters - such as β-D-glucans and glutamine. The aim of this study was to verify the beneficial effects of β-D-glucans and glutamine against Cytarabine/Ara-C, evaluating the DNA damage in leukocytes, the leukogram, and the mitotic index of intestinal crypts cells. Balb/C mice received treatment with β-D-glucan (80 mg/Kg), glutamine (150 mg/Kg), or both, for 21 days. On the last two days of this period, Ara-C was administered (1.8 mg/animal) by intraperitoneal injection every 12 h. The animals submitted to the treatment with Ara-C presented the highest genotoxic index, a significant leukopenia, and a decrease in the mitotic index of the intestinal crypts cells. Treatment with β-D-glucan protected the leukocytes against DNA fragmentation induced by Ara-C. Glutamine alone promoted maintenance of the mitotic index and, in association with β-Dglucan, reduced leukopenia. Thus, the use of β-D-glucan and glutamine proved to be beneficial to intestinal tropism. This can happen once the damage to the genetic material, prevented by the treatments with β-D-glucan and glutamine, can result in genotoxicity. Not only this, but it might be capable of turning into a mutagenesis, with consequential physiopathological alterations. Copyright © 2018. Published by Elsevier B.V.

Soluble β-(1,3)-glucans enhance LPS-induced response in the monocyte activation test, but inhibit LPS-mediated febrile response in rabbits: Implications for pyrogenicity tests.

PubMed

Pardo-Ruiz, Zenia; Menéndez-Sardiñas, Dalia E; Pacios-Michelena, Anabel; Gabilondo-Ramírez, Tatiana; Montero-Alejo, Vivian; Perdomo-Morales, Rolando

2016-01-01

In the present study, we aimed to determine the influence of β-(1,3)-d-glucans on the LPS-induced pro-inflammatory cytokine response in the Monocyte Activation Test (MAT) for pyrogens, and on the LPS-induced febrile response in the Rabbit Pyrogen Test (RPT), thus evaluating the resulting effect in the outcome of each test. It was found that β-(1,3)-d-glucans elicited the production of pro-inflammatory cytokines IL-1β, IL-6 and TNF-α, also known as endogenous pyrogens, but not enough to classify them as pyrogenic according to MAT. The same β-(1,3)-d-glucans samples were non-pyrogenic by RPT. However, β-(1,3)-d-glucans significantly enhanced the LPS-induced pro-inflammatory cytokines response in MAT, insomuch that samples containing non-pyrogenic concentrations of LPS become pyrogenic. On the other hand, β-(1,3)-d-glucans had no effect on sub-pyrogenic LPS doses in the RPT, but surprisingly, inhibited the LPS-induced febrile response of pyrogenic LPS concentrations. Thus, while β-(1,3)-d-glucans could mask the LPS pyrogenic activity in the RPT, they exerted an overstimulation of pro-inflammatory cytokines in the MAT. Hence, MAT provides higher safety since it evidences an unwanted biological response, which is not completely controlled and is overlooked by the RPT. Copyright © 2015 Elsevier B.V. All rights reserved.

Purification and Properties of Mesophyll and Bundle Sheath Cell α-Glucan Phosphorylases from Zea mays L. 1

PubMed Central

Mateyka, Christian; Schnarrenberger, Claus

1988-01-01

Two major α-glucan phosphorylases (I and II) from leaves of the C4 plant corn (Zea mays L.) were previously shown to be compartmented in mesophyll and bundle sheath cells, respectively (C Mateyka, C Schnarrenberger 1984 Plant Sci Lett 36: 119-123). The two enzymes were separated by chromatography on DEAE-cellulose and purified to homogeneity by affinity chromatography on immobilized starch, according to published procedures, as developed for the cytosol and chloroplast phosphorylase from the C3 plant spinach. The two α-glucan phosphorylases have their pH optimum at pH 7. The specificity for polyglucans was similar for soluble starch and amylopectin, however, differed for glycogen (Km = 16 micrograms per milliliter for the mesophyll cell and 250 micrograms per milliliter for the bundle sheath cell phosphorylase). Maltose, maltotriose, and maltotetraose were not cleaved by either phosphorylase. If maltopentaose was used as substrate, the rate was about twice as high with the bundle sheath cell phosphorylase, than with the mesophyll cell phosphorylase. The phosphorylase I showed a molecular mass of 174 kilodaltons and the phosphorylase II of 195 kilodaltons for the native enzyme and of 87 and of 53 kilodaltons for the SDS-treated proteins, respectively. Specific antisera raised against mesophyll cell phosphorylase from corn leaves and against chloroplast phosphorylase from spinach leaves implied high similarity for the cytosol phosphorylase of the C3 plant spinach with mesophyll cell phosphorylase of the C4 plant corn and of chloroplast phosphorylase of spinach with the bundle sheath cell phosphorylase of corn. Images Fig. 2 Fig. 7 PMID:16665923

Catalytic properties of the Gas family β-(1,3)-glucanosyltransferases active in fungal cell-wall biogenesis as determined by a novel fluorescent assay.

PubMed

Mazáň, Marián; Ragni, Enrico; Popolo, Laura; Farkaš, Vladimír

2011-09-01

BGTs [β-(1,3)-glucanosyltransglycosylases; EC 2.4.1.-] of the GH72 (family 72 of glycosylhydrolases) are GPI (glycosylphosphatidylinositol)-anchored proteins that play an important role in the biogenesis of fungal cell walls. They randomly cleave glycosidic linkages in β-(1,3)-glucan chains and ligate the polysaccharide portions containing newly formed reducing ends to C(3)(OH) at non-reducing ends of other β-(1,3)-glucan molecules. We have developed a sensitive fluorescence-based method for the assay of transglycosylating activity of GH72 enzymes. In the new assay, laminarin [β-(1,3)-glucan] is used as the glucanosyl donor and LamOS (laminarioligosaccharides) fluorescently labelled with SR (sulforhodamine) serve as the acceptors. The new fluorescent assay was employed for partial biochemical characterization of the heterologously expressed Gas family proteins from the yeast Saccharomyces cerevisiae. All the Gas enzymes specifically used laminarin as the glucanosyl donor and a SR-LamOS of DP (degree of polymerization) ≥5 as the acceptors. Gas proteins expressed in distinct stages of the yeast life cycle showed differences in their pH optima. Gas1p and Gas5p, which are expressed during vegetative growth, had the highest activity at pH 4.5 and 3.5 respectively, whereas the sporulation-specific Gas2p and Gas4p were most active between pH 5 and 6. The novel fluorescent assay provides a suitable tool for the screening of potential glucanosyltransferases or their inhibitors.

Effect of purified oat ß-glucan on fermentation of set-style yogurt mix

USDA-ARS?s Scientific Manuscript database

Effect of ß-glucan on the fermentation of set-style yogurt was investigated by incorporating 0, 0.1, 0.2, 0.3, 0.4, and 0.5% of ß-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of ß-gluca...

Barley β-glucan reduces blood cholesterol levels via interrupting bile acid metabolism.

PubMed

Wang, Yanan; Harding, Scott V; Thandapilly, Sijo J; Tosh, Susan M; Jones, Peter J H; Ames, Nancy P

2017-11-01

Underlying mechanisms responsible for the cholesterol-lowering effect of β-glucan have been proposed, yet have not been fully demonstrated. The primary aim of this study was to determine whether the consumption of barley β-glucan lowers cholesterol by affecting the cholesterol absorption, cholesterol synthesis or bile acid synthesis. In addition, this study was aimed to assess whether the underlying mechanisms are related to cholesterol 7α hydroxylase (CYP7A1) SNP rs3808607 as proposed by us earlier. In a controlled, randomised, cross-over study, participants with mild hypercholesterolaemia (n 30) were randomly assigned to receive breakfast containing 3 g high-molecular weight (HMW), 5 g low-molecular weight (LMW), 3 g LMW barley β-glucan or a control diet, each for 5 weeks. Cholesterol absorption was determined by assessing the enrichment of circulating 13C-cholesterol over 96 h following oral administration; fractional rate of synthesis for cholesterol was assessed by measuring the incorporation rate of 2H derived from deuterium oxide within the body water pool into the erythrocyte cholesterol pool over 24 h; bile acid synthesis was determined by measuring serum 7α-hydroxy-4-cholesten-3-one concentrations. Consumption of 3 g HMW β-glucan decreased total cholesterol (TC) levels (P=0·029), but did not affect cholesterol absorption (P=0·25) or cholesterol synthesis (P=0·14). Increased bile acid synthesis after consumption of 3 g HMW β-glucan was observed in all participants (P=0·049), and more pronounced in individuals carrying homozygous G of rs3808607 (P=0·033). In addition, a linear relationship between log (viscosity) of β-glucan and serum 7α-HC concentration was observed in homozygous G allele carriers. Results indicate that increased bile acid synthesis rather than inhibition of cholesterol absorption or synthesis may be responsible for the cholesterol-lowering effect of barley β-glucan. The pronounced TC reduction in G allele carriers of rs3808607 observed in the previous study may be due to enhanced bile acid synthesis in response to high-viscosity β-glucan consumption in those individuals.

Invasive Candidiasis in Various Patient Populations: Incorporating Non-Culture Diagnostic Tests into Rational Management Strategies

PubMed Central

Clancy, Cornelius J.; Shields, Ryan K.; Nguyen, M. Hong

2016-01-01

Mortality rates due to invasive candidiasis remain unacceptably high, in part because the poor sensitivity and slow turn-around time of cultures delay the initiation of antifungal treatment. β-d-glucan (Fungitell) and polymerase chain reaction (PCR)-based (T2Candida) assays are FDA-approved adjuncts to cultures for diagnosing invasive candidiasis, but their clinical roles are unclear. We propose a Bayesian framework for interpreting non-culture test results and developing rational patient management strategies, which considers test performance and types of invasive candidiasis that are most common in various patient populations. β-d-glucan sensitivity/specificity for candidemia and intra-abdominal candidiasis is ~80%/80% and ~60%/75%, respectively. In settings with 1%–10% likelihood of candidemia, anticipated β-d-glucan positive and negative predictive values are ~4%–31% and ≥97%, respectively. Corresponding values in settings with 3%–30% likelihood of intra-abdominal candidiasis are ~7%–51% and ~78%–98%. β-d-glucan is predicted to be useful in guiding antifungal treatment for wide ranges of populations at-risk for candidemia (incidence ~5%–40%) or intra-abdominal candidiasis (~7%–20%). Validated PCR-based assays should broaden windows to include populations at lower-risk for candidemia (incidence ≥~2%) and higher-risk for intra-abdominal candidiasis (up to ~40%). In the management of individual patients, non-culture tests may also have value outside of these windows. The proposals we put forth are not definitive treatment guidelines, but rather represent starting points for clinical trial design and debate by the infectious diseases community. The principles presented here will be applicable to other assays as they enter the clinic, and to existing assays as more data become available from different populations. PMID:29376927

Linear β-1,3 Glucans Are Elicitors of Defense Responses in Tobacco

PubMed Central

Klarzynski, Olivier; Plesse, Bertrand; Joubert, Jean-Marie; Yvin, Jean-Claude; Kopp, Marguerite; Kloareg, Bernard; Fritig, Bernard

2000-01-01

Laminarin, a linear β-1,3 glucan (mean degree of polymerization of 33) was extracted and purified from the brown alga Laminaria digitata. Its elicitor activity on tobacco (Nicotiana tabacum) was compared to that of oligogalacturonides with a mean degree of polymerization of 10. The two oligosaccharides were perceived by suspension-cultured cells as distinct chemical stimuli but triggered a similar and broad spectrum of defense responses. A dose of 200 μg mL−1 laminarin or oligogalacturonides induced within a few minutes a 1.9-pH-units alkalinization of the extracellular medium and a transient release of H2O2. After a few hours, a strong stimulation of Phe ammonia-lyase, caffeic acid O-methyltransferase, and lipoxygenase activities occurred, as well as accumulation of salicylic acid. Neither of the two oligosaccharides induced tissue damage or cell death nor did they induce accumulation of the typical tobacco phytoalexin capsidiol, in contrast with the effects of the proteinaceous elicitor β-megaspermin. Structure activity studies with laminarin, laminarin oligomers, high molecular weight β-1,3–1,6 glucans from fungal cell walls, and the β-1,6–1,3 heptaglucan showed that the elicitor effects observed in tobacco with β-glucans are specific to linear β-1,3 linkages, with laminaripentaose being the smallest elicitor-active structure. In accordance with its strong stimulating effect on defense responses in tobacco cells, infiltration of 200 μg mL−1 laminarin in tobacco leaves triggered accumulation within 48 h of the four families of antimicrobial pathogenesis-related proteins investigated. Challenge of the laminarin-infiltrated leaves 5 d after treatment with the soft rot pathogen Erwinia carotovora subsp. carotovora resulted in a strong reduction of the infection when compared with water-treated leaves. PMID:11080280

β-Glucans and Resistant Starch Alter the Fermentation of Recalcitrant Fibers in Growing Pigs

PubMed Central

Gerrits, Walter J. J.; Kabel, Mirjam A.; Vasanthan, Thava; Zijlstra, Ruurd T.

2016-01-01

Interactions among dietary ingredients are often assumed non-existent when evaluating the nutritive value and health effects of dietary fiber. Specific fibers can distinctly affect digestive processes; therefore, digestibility and fermentability of the complete diet may depend on fiber types present. This study aimed to evaluate the effects of readily fermentable fibers (β-glucans and resistant starch) on the degradation of feed ingredients containing more persistent, recalcitrant, fibers. Six semi-synthetic diets with recalcitrant fibers from rapeseed meal (pectic polysaccharides, xyloglucans, and cellulose) or corn distillers dried grain with solubles (DDGS; (glucurono)arabinoxylans and cellulose) with or without inclusion of β-glucans (6%) or retrograded tapioca (40%) substituted for corn starch were formulated. Six ileal-cannulated pigs (BW 28±1.4 kg) were assigned to the diets according to a 6×6 Latin square. β-glucan-extract increased apparent total tract digestibility (ATTD) of non-glucosyl polysaccharides (accounting for ~40% of the fiber-fraction) from rapeseed meal (6%-units, P<0.001), but did not affect non-glucosyl polysaccharides from DDGS. Retrograded tapioca reduced ATTD of non-glucosyl polysaccharides from rapeseed meal and DDGS (>10%-units, P<0.001), indicating that the large amount of resistant starch entering the hindgut was preferentially degraded over recalcitrant fibers from rapeseed meal and DDGS, possibly related to reduced hindgut-retention time following the increased intestinal bulk. Fermentation of fiber sources was not only dependent on fiber characteristics, but also on the presence of other fibers in the diet. Hence, interactions in the gastrointestinal tract among fibrous feed ingredients should be considered when evaluating their nutritive value. PMID:27911928

β(1,3)-Glucanosyl-Transferase Activity Is Essential for Cell Wall Integrity and Viability of Schizosaccharomyces pombe

PubMed Central

de Medina-Redondo, María; Arnáiz-Pita, Yolanda; Clavaud, Cécile; Fontaine, Thierry; del Rey, Francisco; Latgé, Jean Paul; Vázquez de Aldana, Carlos R.

2010-01-01

Background The formation of the cell wall in Schizosaccharomyces pombe requires the coordinated activity of enzymes involved in the biosynthesis and modification of β-glucans. The β(1,3)-glucan synthase complex synthesizes linear β(1,3)-glucans, which remain unorganized until they are cross-linked to other β(1,3)-glucans and other cell wall components. Transferases of the GH72 family play important roles in cell wall assembly and its rearrangement in Saccharomyces cerevisiae and Aspergillus fumigatus. Four genes encoding β(1,3)-glucanosyl-transferases -gas1+, gas2+, gas4+ and gas5+- are present in S. pombe, although their function has not been analyzed. Methodology/Principal Findings Here, we report the characterization of the catalytic activity of gas1p, gas2p and gas5p together with studies directed to understand their function during vegetative growth. From the functional point of view, gas1p is essential for cell integrity and viability during vegetative growth, since gas1Δ mutants can only grow in osmotically supported media, while gas2p and gas5p play a minor role in cell wall construction. From the biochemical point of view, all of them display β(1,3)-glucanosyl-transferase activity, although they differ in their specificity for substrate length, cleavage point and product size. In light of all the above, together with the differences in expression profiles during the life cycle, the S. pombe GH72 proteins may accomplish complementary, non-overlapping functions in fission yeast. Conclusions/Significance We conclude that β(1,3)-glucanosyl-transferase activity is essential for viability in fission yeast, being required to maintain cell integrity during vegetative growth. PMID:21124977

Inhibitory Role of Greatwall-Like Protein Kinase Rim15p in Alcoholic Fermentation via Upregulating the UDP-Glucose Synthesis Pathway in Saccharomyces cerevisiae

PubMed Central

Watanabe, Daisuke; Zhou, Yan; Hirata, Aiko; Sugimoto, Yukiko; Takagi, Kenichi; Akao, Takeshi; Ohya, Yoshikazu; Takagi, Hiroshi

2015-01-01

The high fermentation rate of Saccharomyces cerevisiae sake yeast strains is attributable to a loss-of-function mutation in the RIM15 gene, which encodes a Greatwall-family protein kinase that is conserved among eukaryotes. In the present study, we performed intracellular metabolic profiling analysis and revealed that deletion of the RIM15 gene in a laboratory strain impaired glucose-anabolic pathways through the synthesis of UDP-glucose (UDPG). Although Rim15p is required for the synthesis of trehalose and glycogen from UDPG upon entry of cells into the quiescent state, we found that Rim15p is also essential for the accumulation of cell wall β-glucans, which are also anabolic products of UDPG. Furthermore, the impairment of UDPG or 1,3-β-glucan synthesis contributed to an increase in the fermentation rate. Transcriptional induction of PGM2 (phosphoglucomutase) and UGP1 (UDPG pyrophosphorylase) was impaired in Rim15p-deficient cells in the early stage of fermentation. These findings demonstrate that the decreased anabolism of glucose into UDPG and 1,3-β-glucan triggered by a defect in the Rim15p-mediated upregulation of PGM2 and UGP1 redirects the glucose flux into glycolysis. Consistent with this, sake yeast strains with defective Rim15p exhibited impaired expression of PGM2 and UGP1 and decreased levels of β-glucans, trehalose, and glycogen during sake fermentation. We also identified a sake yeast-specific mutation in the glycogen synthesis-associated glycogenin gene GLG2, supporting the conclusion that the glucose-anabolic pathway is impaired in sake yeast. These findings demonstrate that downregulation of the UDPG synthesis pathway is a key mechanism accelerating alcoholic fermentation in industrially utilized S. cerevisiae sake strains. PMID:26497456

A Novel Glycoside Hydrolase Family 5 β-1,3-1,6-Endoglucanase from Saccharophagus degradans 2-40T and Its Transglycosylase Activity

PubMed Central

Wang, Damao; Kim, Do Hyoung; Seo, Nari; Yun, Eun Ju; An, Hyun Joo; Kim, Jae-Han

2016-01-01

ABSTRACT In this study, we characterized Gly5M, originating from a marine bacterium, as a novel β-1,3-1,6-endoglucanase in glycoside hydrolase family 5 (GH5) in the Carbohydrate-Active enZyme database. The gly5M gene encodes Gly5M, a newly characterized enzyme from GH5 subfamily 47 (GH5_47) in Saccharophagus degradans 2-40T. The gly5M gene was cloned and overexpressed in Escherichia coli. Through analysis of the enzymatic reaction products by thin-layer chromatography, high-performance liquid chromatography, and matrix-assisted laser desorption ionization–tandem time of flight mass spectrometry, Gly5M was identified as a novel β-1,3-endoglucanase (EC 3.2.1.39) and bacterial β-1,6-glucanase (EC 3.2.1.75) in GH5. The β-1,3-endoglucanase and β-1,6-endoglucanase activities were detected by using laminarin (a β-1,3-glucan with β-1,6-glycosidic linkages derived from brown macroalgae) and pustulan (a β-1,6-glucan derived from fungal cell walls) as the substrates, respectively. This enzyme also showed transglycosylase activity toward β-1,3-oligosaccharides when laminarioligosaccharides were used as the substrates. Since laminarin is the major form of glucan storage in brown macroalgae, Gly5M could be used to produce glucose and laminarioligosaccharides, using brown macroalgae, for industrial purposes. IMPORTANCE In this study, we have discovered a novel β-1,3-1,6-endoglucanase with a unique transglycosylase activity, namely, Gly5M, from a marine bacterium, Saccharophagus degradans 2-40T. Gly5M was identified as the newly found β-1,3-endoglucanase and bacterial β-1,6-glucanase in GH5. Gly5M is capable of cleaving glycosidic linkages of both β-1,3-glucans and β-1,6-glucans. Gly5M also possesses a transglycosylase activity toward β-1,3-oligosacchrides. Due to the broad specificity of Gly5M, this enzyme can be used to produce glucose or high-value β-1,3- and/or β-1,6-oligosaccharides. PMID:27208098

A Novel Glycoside Hydrolase Family 5 β-1,3-1,6-Endoglucanase from Saccharophagus degradans 2-40T and Its Transglycosylase Activity.

PubMed

Wang, Damao; Kim, Do Hyoung; Seo, Nari; Yun, Eun Ju; An, Hyun Joo; Kim, Jae-Han; Kim, Kyoung Heon

2016-07-15

In this study, we characterized Gly5M, originating from a marine bacterium, as a novel β-1,3-1,6-endoglucanase in glycoside hydrolase family 5 (GH5) in the Carbohydrate-Active enZyme database. The gly5M gene encodes Gly5M, a newly characterized enzyme from GH5 subfamily 47 (GH5_47) in Saccharophagus degradans 2-40(T) The gly5M gene was cloned and overexpressed in Escherichia coli Through analysis of the enzymatic reaction products by thin-layer chromatography, high-performance liquid chromatography, and matrix-assisted laser desorption ionization-tandem time of flight mass spectrometry, Gly5M was identified as a novel β-1,3-endoglucanase (EC 3.2.1.39) and bacterial β-1,6-glucanase (EC 3.2.1.75) in GH5. The β-1,3-endoglucanase and β-1,6-endoglucanase activities were detected by using laminarin (a β-1,3-glucan with β-1,6-glycosidic linkages derived from brown macroalgae) and pustulan (a β-1,6-glucan derived from fungal cell walls) as the substrates, respectively. This enzyme also showed transglycosylase activity toward β-1,3-oligosaccharides when laminarioligosaccharides were used as the substrates. Since laminarin is the major form of glucan storage in brown macroalgae, Gly5M could be used to produce glucose and laminarioligosaccharides, using brown macroalgae, for industrial purposes. In this study, we have discovered a novel β-1,3-1,6-endoglucanase with a unique transglycosylase activity, namely, Gly5M, from a marine bacterium, Saccharophagus degradans 2-40(T) Gly5M was identified as the newly found β-1,3-endoglucanase and bacterial β-1,6-glucanase in GH5. Gly5M is capable of cleaving glycosidic linkages of both β-1,3-glucans and β-1,6-glucans. Gly5M also possesses a transglycosylase activity toward β-1,3-oligosacchrides. Due to the broad specificity of Gly5M, this enzyme can be used to produce glucose or high-value β-1,3- and/or β-1,6-oligosaccharides. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Aluminum hydroxide colloid vaccine encapsulated in yeast shells with enhanced humoral and cellular immune responses.

PubMed

Liu, Hui; Jia, Zhenghu; Yang, Chengmao; Song, Mei; Jing, Zhe; Zhao, Yapu; Wu, Zhenzhou; Zhao, Liqing; Wei, Dongsheng; Yin, Zhinan; Hong, Zhangyong

2018-06-01

Aluminum salt (Alum) is one of the most important immune adjuvants approved for use in humans, however it is not suitable for vaccination against various chronic infectious diseases and cancers for not being able to induce cell-mediated (Th1) immunity. Here, we encapsulated an Alum colloid inside β-glucan particles (GPs), which are a type of natural particles derived from the yeast glucan shells, to prepare hybrid GP-Alum (GP-Al) adjuvant particles with a very uniform size of 2-4 μm. These hybrid particles can be used to load antigen proteins through a simple mixing procedure, and can be highly specifically targeted to antigen-presenting cells (APCs) and strongly activate dendritic cells (DCs) maturation and cytokine secretion. In an animal model, they elicit a strong Th1-biased immune response and extremely high antibody titer, and cause marked prophylactic and therapeutic effects against tumors. As Alum has been proven to be a safe adjuvant to induce strong humoral responses and β-glucans are safe for human use, this very uniform hybrid Alum particulate system could have important application as a vaccine carrier to stimulate humoral and cellular immune responses at the same time. Copyright © 2018 Elsevier Ltd. All rights reserved.

Determining the Subcellular Location of Synthesis and Assembly of the Cell Wall Polysaccharide (1,3; 1,4)-β-d-Glucan in Grasses[OPEN

PubMed Central

Wilson, Sarah M.; Ho, Yin Ying; Lampugnani, Edwin R.; Van de Meene, Allison M.L.; Bain, Melissa P.; Bacic, Antony; Doblin, Monika S.

2015-01-01

The current dogma for cell wall polysaccharide biosynthesis is that cellulose (and callose) is synthesized at the plasma membrane (PM), whereas matrix phase polysaccharides are assembled in the Golgi apparatus. We provide evidence that (1,3;1,4)-β-d-glucan (mixed-linkage glucan [MLG]) does not conform to this paradigm. We show in various grass (Poaceae) species that MLG-specific antibody labeling is present in the wall but absent over Golgi, suggesting it is assembled at the PM. Antibodies to the MLG synthases, cellulose synthase-like F6 (CSLF6) and CSLH1, located CSLF6 to the endoplasmic reticulum, Golgi, secretory vesicles, and the PM and CSLH1 to the same locations apart from the PM. This pattern was recreated upon expression of VENUS-tagged barley (Hordeum vulgare) CSLF6 and CSLH1 in Nicotiana benthamiana leaves and, consistent with our biochemical analyses of native grass tissues, shown to be catalytically active with CSLF6 and CSLH1 in PM-enriched and PM-depleted membrane fractions, respectively. These data support a PM location for the synthesis of MLG by CSLF6, the predominant enzymatically active isoform. A model is proposed to guide future experimental approaches to dissect the molecular mechanism(s) of MLG assembly. PMID:25770111

Structural diversity requires individual optimization of ethanol concentration in polysaccharide precipitation.

PubMed

Xu, Jun; Yue, Rui-Qi; Liu, Jing; Ho, Hing-Man; Yi, Tao; Chen, Hu-Biao; Han, Quan-Bin

2014-06-01

Ethanol precipitation is one of the most widely used methods for preparing natural polysaccharides, in which ethanol concentration significantly affects the precipitate yield, however, is usually set at 70-80%. Whether the standardization of ethanol concentration is appropriate has not been investigated. In the present study, the precipitation yields produced in varied ethanol concentrations (10-90%) were qualitatively and quantitatively evaluated by HPGPC (high-performance gel-permeation chromatography), using two series of standard glucans, namely dextrans and pullulans, as reference samples, and then eight natural samples. The results indicated that the response of a polysaccharide's chemical structure, with diversity in structural features and molecular sizes, to ethanol concentration is the decisive factor in precipitation of these glucans. Polysaccharides with different structural features, even though they have similar molecular weights, exhibit significantly different precipitation behaviors. For a specific glucan, the lower its molecular size, the higher the ethanol concentration needed for complete precipitation. The precipitate yield varied from 10% to 100% in 80% ethanol as the molecular size increased from 1kDa to 270kDa. This paper aims to draw scientists' attention to the fact that, in extracting natural polysaccharides by ethanol precipitation, the ethanol concentration must be individually optimized for each type of material. Copyright © 2014 Elsevier B.V. All rights reserved.

Complementary sample preparation strategies for analysis of cereal β-glucan oxidation products by UPLC-MS/MS

NASA Astrophysics Data System (ADS)

Boulos, Samy; Nyström, Laura

2017-11-01

The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO•-attack on glucose units irrespective of glycosidic linkage and neighborhood. The method was demonstrated to be 1) sufficiently sensitive to allow for the analysis of oxidation products also from a mild ascorbate-driven Fenton reaction, and 2) to be specific for cereal β-glucan even in the presence of other co-oxidized polysaccharides. This opens doors to applications in food processing to assess potential oxidations and provides the detailed structural basis to understand the effect oxidized functional groups have on β-glucan’s health promoting and technological properties.

Analysis of the levels of endotoxin and β-d-glucan in the synovial fluid of hemodialysis patients.

PubMed

Shiota, E; Maekawa, M; Kono, T

2001-12-01

Abstract We analyzed the levels of endotoxin and β-d-glucan, which possibly induce cytokine production, in the synovial fluid of patients on long-term hemodialysis and compared the results to those in patients with osteoarthritis and rheumatoid arthritis. We studied 42 knees in 42 hemodialysis patients, 21 in 21 osteoarthritis patients, and 26 in 26 rheumatoid arthritis patients. The mean ages were 60.7, 63.2, and 59.7 years, respectively. The duration of hemodialysis in the long-term hemodialysis group averaged 14.0 years. The concentrations of endotoxin and β-d-glucan in the synovial fluid of these three groups were measured. The concentration of endotoxin was the same in the three groups. However, the concentration of β-d-glucan was significantly higher in long-term hemodialysis patients. This finding suggests that β-d-glucan may have some relation to the pathogenesis of the synovitis which exists in the hydrarthrosis of long-term hemodialysis patients.

Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria

PubMed Central

Arena, Mattia P.; Caggianiello, Graziano; Fiocco, Daniela; Russo, Pasquale; Torelli, Michele; Spano, Giuseppe; Capozzi, Vittorio

2014-01-01

Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed. PMID:24562330

Structural characterization of the cell wall D-glucans isolated from the mycelium of Botryosphaeria rhodina MAMB-05.

PubMed

de Lourdes Corradi da Silva, Maria; Fukuda, Eliane K; Vasconcelos, Ana Flora D; Dekker, Robert F H; Matias, Andreza C; Monteiro, Nilson K; Cardoso, Marilsa S; Barbosa, Aneli M; Silveira, Joana L M; Sassaki, Guilherme L; Carbonero, Elaine R

2008-03-17

Three D-glucans were isolated from the mycelium of the fungus Botryosphaeria rhodina MAMB-05 by sequential extraction with hot-water and hot aqueous KOH (2% w/v) followed by ethanol precipitation. Following their purification by gel permeation chromatography on Sepharose CL-4B, the structural characteristics of the D-glucans were determined by FT-IR and 13C NMR spectroscopy and, after methylation, by GC-MS. The hot-water extract produced a fraction designated Q1A that was a beta-(1-->6)-D-glucan with the following structure: [Formula: see text] The alkaline extract, when subjected to repeated freeze-thawing, yielded two fractions: K1P (insoluble) that comprised a beta-(1-->3)-D-glucan with beta-D-glucose branches at C-6 with the structure: [Formula: see text] and K1SA (soluble) consisting of a backbone chain of alpha-(1-->4)-linked D-glucopyranosyl residues substituted at O-6 with alpha-D-glucopyranosyl residues: [Formula: see text

Self-Assembled Polysaccharide Nanotubes Generated from β-1,3-Glucan Polysaccharides

NASA Astrophysics Data System (ADS)

Numata, Munenori; Shinkai, Seiji

β-1,3-Glucans act as unique natural nanotubes, the features of which are greatly different from other natural or synthetic helical polymers. The origin mostly stems from their strong helix-forming nature and reversible interconversion between single-strand random coil and triple-strand helix. During this interconversion process, they can accept functional polymers, molecular assemblies and nanoparticles in an induced-fit manner to create water-soluble one-dimensional nanocomposites, where individual conjugated polymers or molecular assemblies can be incorporated into the one-dimensional hollow constructed by the helical superstructure of β-1,3-glucans. The advantageous point of the β-1,3-glucan hosting system is that the selective modification of β-1,3-glucans leads to the creation of various functional one-dimensional nanocomposites in a supramolecular manner, being applicable toward fundamental nanomaterials such as sensors or circuits. Furthermore, the composites with functional surfaces can act as one-dimensional building blocks toward further hierarchical self-assemblies, leading to the creation of two- or three-dimensional nanoarchitectures.

The effect of ß-1,3-glucan derived from Euglena gracilis (Algamune™) on the innate immunological responses of Nile tilapia (Oreochromis niloticus L.)

USDA-ARS?s Scientific Manuscript database

Algamune™ is a commercial feed additive derived from Euglena gracilis, providing a rich source of the ß-1,3-glucan paramylon. Isolated kidney phagocytes of Nile tilapia were incubated with graded doses (0, 8, 16, 32, 64, and 128 µg mL-1) of Algamune™ and purified ß-1,3-glucan paramylon to gauge the...

Studies of Altered Response to Infection Induced by Severe Injury.

DTIC Science & Technology

1991-10-01

indomethacin, lypoxygenase inhibitors, synthetic glucans and interleukin-4, as possible inmunomcdulators post-trauma. Indo, as described above, was... glucans would decrease post-trauma MO PGE2 levels and TNF levels, but had no effect on MO IL-6 production, indicating they might be useful in post... glucans and interleukin-4, as possible immunomodulators post-trauma. Indo, as described above, was effective in PGE, downregulation, but massively

Glucan-Induced Enhancement of Host Resistance to Selected Infectious Diseases

DTIC Science & Technology

1980-10-01

infectious foci. J. Exp. Med. 133:1090-1104. to bacterial endotoxin and Sabmnoiefa emteridu ia bfc 2. Burgaleta, C., and D. W. Golde. 1977. The effect of...aerosol with Pseudomonas pseudomalei, whereas intravenous glucan pretreatment did not increase survival. Mice given glucan combined with a marginally...Its effects can be catego- , responses been recognized (14). Apparently, rized as macrophage-mediated immunotimula- macrophages not only are capable

Oral administration of soluble β-glucan preparation from the cauliflower mushroom, Sparassis crispa (Higher Basidiomycetes) modulated cytokine production in mice.

PubMed

Hida, Toshie H; Kawaminami, Hiromi; Ishibashi, Ken-Ichi; Miura, Noriko N; Adachi, Yoshiyuki; Ohno, Naohito

2013-01-01

Soluble β-glucan preparation from the cold NaOH extract of Sparassis crispa (SCG) is a six-branched 1,3-β-D-glucan that is a major cell-wall structural component in fungi. Leukocytes from DBA/2 mice are highly sensitive to SCG, producing cytokines in vitro. We previously reported that the intraperitoneal (i.p.) administration of β-glucan decreased cytokine induction by SCG in vitro in DBA/2 mice. In this study, we examined the effects of the oral (p.o.) administration of polysaccharide fractions extracted from S. crispa, using hot water (SCHWE), a β-glucan from S. crispa, to DBA/2 mice on cytokine induction by SCG in the spleen in vitro. The level of induction of IFN-γ and GM-CSF by SCG was significantly increased in SCHWE-treated mice. This activity was more clearly observed when chlorpromazine was administered as a pretreatment in SCHWE-treated mice. The production of GM-CSF, IFN-γ, and IL-6 by immune cells in Peyer's patches was higher in SCHWE-treated mice than in control mice. These results suggest that orally administered β-glucan may modulate cytokine induction by SCG in the spleen through the activation of Peyer's patches.

Effects of β-glucan and Vitamin D Supplementation on Inflammatory Parameters in Patients with Diabetic Retinopathy.

PubMed

Richter, Josef; Závorková, Martina; Vetvicka, Vaclav; Liehneová, Ivana; Kral, Vlastimil; Rajnohova Dobiasova, Lucie

2018-06-19

The objective of this article is to evaluate the potential effects of beta-glucan and vitamin D supplementation in patients with diabetic retinopathy. We evaluated the levels of several parameters of inflammatory reactions (C-reactive protein [CRP], serum amyloid A [SAA], and interleukin- [IL-] 6), leptin, and vitamin D. Using a 3-month interval, we divided the patients into three groups: (1) supplemented with beta-glucan and vitamin D, (2) supplemented with vitamin D and placebo, and (3) supplemented with vitamin D alone. By this division, we aim not only to observe whether beta-glucan can increase the effects of vitamin D, but also to eliminate the potential effects of placebo. The doses of vitamin D corresponded to phototype, weight, age, and sex of the individual. Fifty-two diabetic retinopathy patients were selected for our study. We found significant vitamin D deficits in all cases, even after three months of supplementation with vitamin D. Significant changes in levels of CRP were observed in the beta-glucan-supplemented group; levels of SAA and IL-6 were not changed. Leptin levels were significantly lowered in the beta-glucan-supplemented group and increased in the other groups. More detailed studies and/or longer supplementation is necessary.

Streptococcus mutans dextransucrase: stimulation by phospholipids from human sera and oral fluids.

PubMed Central

Schachtele, C F; Harlander, S K; Bracke, J W; Ostrum, L C; Maltais, J A; Billings, R J

1978-01-01

Serum, gingival crevicular fluid, and parotid, submandibular, and labial minor gland saliva from four individuals stimulated glucan formation from sucrose by the Streptococcus mutans strain 6715 dextransucrase (EC 2.4.1.5). At final dilutions of 1:10 all of the fluids stimulated crude enzyme preparations approximately 1.8-fold. The fluids stimulated the purified water-insoluble glucan-synthesizing form of the dextransucrase approximately 3.2-fold and the water-soluble glucan-producing form of the enzyme approximately 2.4-fold. The fluids all contained concentrations of stimulatory material that could be reduced to undetectable levels only after dilutions of greater than 1:1,000. The increased rates of glucan formation caused by the fluids and dextran were additive, indicating that stimulation by the fluids was primarily due to interactions with entities other than glucan primer molecules. In contrast, the elevated levels of glucan formation in the presence of the fluids was not further enhanced by the addition of lysophosphatidylcholine. Lysophosphatidylcholine purified from parotid and submandibular saliva by solvent extraction and thin-layer chromatography stimulated the dextransucrase as effectively as egg yolk lysophosphatidylcholine. Thus, phospholipids normally found in human oral fluids can enhance the activity of an enzyme believed to be directly associated with the cariogenic potential of S. mutans. PMID:365766

Structure of a novel α-glucan substitute with the rare 6-deoxy-D-altrose from Lactarius lividatus (mushroom).

PubMed

Tako, Masakuni; Dobashi, Yahiko; Shimabukuro, Junpei; Yogi, Takuya; Uechi, Keiko; Tamaki, Yukihiro; Konishi, Teruko

2013-02-15

A novel α-glucan substituted rare 6-deoxy-D-altropyranose was isolated from edible fruiting bodies of a mushroom (Lactarius lividatus) grown in Okinawa, Japan. The polysaccharide consists of D-glucose, D-galactose and 6-deoxy-D-altrose in a molar ratio of 3.0:1.0:1.0. The specific rotation [α](589) was estimated as +64.3° (0.2% in water) at 25 °C. Based on results of IR, NMR ((1)H, (13)C, 2D-COSY, 2D-HMQC, 2D-ROESY and 2D-HMBC), and methylation analyses, the structure of the polysaccharide was determined as [formula, see text] This work is the first demonstration of rare 6-deoxy-D-altropyranose moiety on polysaccharides. Copyright © 2012 Elsevier Ltd. All rights reserved.

Serum (1 → 3) β-D-glucan assay for discrimination between Pneumocystis jirovecii pneumonia and colonization.

PubMed

Tasaka, Sadatomo; Kobayashi, Seiki; Yagi, Kazuma; Asami, Takahiro; Namkoong, Ho; Yamasawa, Wakako; Ishii, Makoto; Hasegawa, Naoki; Betsuyaku, Tomoko

2014-11-01

Polymerase chain reaction (PCR) technique is being increasingly used for the microbiological diagnosis of Pneumocystis pneumonia (PCP). As PCR is highly sensitive, it can be positive even in a patient with Pneumocystis colonization. In this study, we evaluated whether the β-d-glucan assay could be used to differentiate between PCP and Pneumocystis jirovecii colonization in immunocompromised patients with pulmonary infiltrates. We retrospectively evaluated data from 166 consecutive patients who underwent bronchoalveolar lavage for the diagnosis of PCP. Serum levels of β-d-glucan in the negative, colonization, probable PCP, and definite PCP groups were 20.2 ± 6.3, 48.8 ± 15.9, 89.9 ± 20.2, 224.9 ± 25.9 pg/mL, respectively. The β-D-glucan levels in the definite PCP group were significantly higher than those in the other 3 groups (p < 0.001). Serum β-d-glucan levels in patients with either definite or probable PCP (173.1 ± 18.8 pg/mL) were significantly greater than those in patients with colonization who had positive PCR results but improved without anti-PCP treatment (p < 0.002). The cut-off level for discrimination was estimated to be 33.5 pg/mL, with which the positive predictive value was 0.925. These results indicate that β-D-glucan is a useful marker to differentiate between PCP and Pneumocystis colonization. A positive β-D-glucan assay result might be a good indication to begin anti-PCP treatment. Copyright © 2014. Published by Elsevier Ltd.

Hypoglycemic activity of polysaccharide fractions containing beta-glucans from extracts of Rhynchelytrum repens (Willd.) C.E. Hubb., Poaceae.

PubMed

De Paula, A C C F F; Sousa, R V; Figueiredo-Ribeiro, R C L; Buckeridge, M S

2005-06-01

Beta-glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of beta-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of beta-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-beta-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa) being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa) to that of maize coleoptile beta-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure beta-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of beta-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

Fungi, β-glucan, and bacteria in nasal lavage of greenhouse workers and their relation to occupational exposure.

PubMed

Madsen, Anne Mette; Tendal, Kira; Thilsing, Trine; Frederiksen, Margit W; Baelum, Jesper; Hansen, Jørgen V

2013-10-01

The nose and mouth are the first regions of the respiratory tract in contact with airborne microorganisms. Occupational exposures to airborne microorganisms are associated with inflammation and different symptoms of the airways. The purpose of this study is to investigate the relation between occupational exposure to fungi, β-glucan, and bacteria and contents of fungi, β-glucan, and bacteria in nasal lavage (NAL) of greenhouse workers. We also studied whether contents of microorganisms in NAL were related to gender, time of the work week, and runny nose. NAL samples (n = 135) were taken Monday morning and Thursday at noon and personal exposure to inhalable bioaerosols was measured during a working day. The content of fungi and β-glucan in NAL of men was affected by their exposure to fungi and β-glucan. The content of fungi, β-glucan, and bacteria in NAL was higher Thursday at noon than Monday morning. The ratios of fungi in NAL between Thursday at noon and Monday morning were 14 (median value) for men and 3.5 for women. Gender had no effect on the exposure level but had a significant effect on the content of fungi, β-glucan, and bacteria in NAL, with the highest contents in NAL of men. On Thursdays, the median content of fungi in NAL samples of men without runny noses was 9408 cfu per NAL sample, whereas the same content for women was 595 cfu per NAL sample. Workers with runny noses had fewer fungi in NAL than workers without runny noses. A higher content of β-glucan per fungal spore was found in NAL than in the air. This indicates that mainly the larger fungal spores or pollen grains deposit in the nose. The difference between genders and the fact that the content of fungi in NAL was significantly affected by the exposure indicate that the two genders are affected by the same exposure level differently.

T(reg) cells may regulate interlukin-17 production by modulating TH1 responses in 1,3-β-glucan-induced lung inflammation in mice.

PubMed

Chen, Ying; Liu, Fangwei; Weng, Dong; Song, Laiyu; Li, Cuiying; Tang, Wen; Yu, Ye; Dai, Wujing; Chen, Jie

2013-01-01

1,3-β-glucan is considered a fungal biomarker and exposure to this agent can induce lung inflammation. Complement activation plays an important role in early immune responses to β-glucan. Previous studies showed that T-regulatory cells (Tregs) regulated 1,3-β-glucan-induced lung inflammation by modulating the maintenance of immune homeostasis in the lung. Both interleukin (IL)-17 and TH17 cells play pivotal roles in inflammation associated with lung disease and share reciprocal developmental pathways with Tregs. However, the effect of Tregs on IL-17 and TH17 responses in 1,3-β-glucan-induced lung inflammation remains unclear. In this study, mice were exposed to 1,3-β-glucan by intratracheal instillation. To investigate the effects of Tregs on IL-17 and TH17 cells in the induced lung inflammation, a Treg-depleted mice model was generated by administration of anti-CD25 mAb. The results indicated that Treg-depleted mice showed more severe pathological inflammatory changes in lung tissues. Tregs depletion reduced IL-17 expression in these tissues, and increased those of TH1 cytokines. The expression of IL-17 increased at the early phase of the inflammation response. There were no significant effects of the Tregs on expression of RORγt and IL-6 or the amount of CD4(+)IL-17(+) cells in the lungs. When taken together, the late phase of the 1,3-β-glucan-induced inflammatory response in the mice was primarily mediated by TH1 cytokines rather than IL-17. In contrast, the early phase of the inflammatory response might be mediated in part by IL-17 along with activated complement. Tregs might be required for IL-17 expression during the late phase inflammatory response in mice. The increased IL-17 mRNA observed during the 1,3-β-glucan induced inflammatory response were attributed to cells other than TH17 cells.

Pneumocystis polymerase chain reaction and blood (1→3)-β-D-glucan assays to predict survival with suspected Pneumocystis jirovecii pneumonia.

PubMed

Matsumura, Yasufumi; Ito, Yutaka; Yamamoto, Masaki; Matsushima, Aki; Nagao, Miki; Takakura, Shunji; Iinuma, Yoshitsugu; Ichiyama, Satoshi

2014-02-01

Pneumocystis polymerase chain reaction (PCR) and blood (1→3)-β-D-glucan assays are known to be useful for the diagnosis of Pneumocystis pneumonia (PCP). However, their impact on the outcome of clinically suspected PCP patients has not yet been elucidated. Between January 2008 and July 2011, we prospectively observed 190 immunocompromised patients who had ground-glass opacity on chest computed tomography scans and were suspected to have PCP. The blood β-D-glucan levels of these patients were measured, and PCR was used to detect Pneumocystis jirovecii in the respiratory samples. The 30-day mortality rates and related factors were assessed. The 30-day mortality rate of all included patients was 21.6%. Both β-D-glucan-positive (10.1%) and PCR-positive patients (15.0%) had significantly lower mortality rates than β-D-glucan-negative (28.1%) or PCR-negative patients (30.1%). All of the 13 definite PCP patients had positive PCR and β-D-glucan results, received anti-PCP treatments, and survived. Among the 72 patients who were negative for microscopic detection of P. jirovecii but received anti-PCP treatments, positive PCR results (odds ratio [OR], 0.14; 95% confidence interval [CI], 0.02-0.74), a high Sequential Organ Failure Assessment score (OR, 1.42; CI, 1.08-1.88), and positive β-D-glucan levels (OR 0.25, CI 0.06-1.02) were associated with mortality rates using stepwise logistic regression analyses. A positive Pneumocystis PCR or β-D-glucan test was a candidate predictor of survival in patients who were suspected of having PCP, even though negative for visual detection by microscopy. Copyright © 2013 Japanese Society of Chemotherapy and the Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

The effect of oyster mushroom β-1.3/1.6-D-glucan and oxytetracycline antibiotic on biometrical, haematological, biochemical, and immunological indices, and histopathological changes in common carp (Cyprinus carpio L.).

PubMed

Dobšíková, Radka; Blahová, Jana; Mikulíková, Ivana; Modrá, Helena; Prášková, Eva; Svobodová, Zdeňka; Skorič, Mišo; Jarkovský, Jiří; Siwicki, Andrzej-Krzysztof

2013-12-01

The aim of the study was to evaluate the effect of micronized β-1.3/1.6-D-glucan (BG) derived from the oyster mushroom Pleurotus ostreatus Hiratake and tetracycline antibiotic oxytetracycline (OTC) on biometrical, haematological, biochemical, and immunological indices, and histopathological changes in tissues of one- to two-year-old common carp (Cyprinus carpio L.). The fish tested were divided into five experimental groups and one control. Carp in the control group were fed commercial carp feed pellets. Fish in the five experimental groups were fed the same pellets supplemented with either OTC, a combination of OTC and BG, or BG as follows: 75 mg oxytetracycline kg(-1) bw (OTC group), 75 mg oxytetracycline kg(-1) bw and 0.5% β-glucan (OTC + 0.5% BG group), 75 mg oxytetracycline kg(-1) bw and 2.0% β-glucan (OTC + 2.0% BG group), 0.5% β-glucan (0.5% BG group), and 2.0% β-glucan (2.0% BG group). OTC- and BG-supplemented diets and the control diet were administered to experimental and control carp for 50 days (i.e. samplings 1-3, the exposure period); for the following 14 days, fish were fed only control feed pellets with no OTC or BG supplementation (i.e. sampling 4, the recovery period). Blood and tissue samples were collected both during, and at the end of the study. No significant changes in biometrical indices (i.e. total length, standard length, total weight, hepatosomatic and spleen somatic index, and Fulton's condition factor) were found in experimental carp compared to control in any sampling. In haematological indices, significant changes were found only in sampling 2, in which shifts in PCV (P < 0.01), Hb (P < 0.01), and WBC (P < 0.01), and in the counts of lymphocytes (P < 0.01), monocytes (P < 0.01), and neutrophil granulocytes-segments (P < 0.05) were revealed. As for biochemical profiling, plasma concentrations of glucose, albumins, cholesterol, natrium, and chlorides (all P < 0.01), and total proteins, lactate, phosphorus, and potassium (all P < 0.05) as well as the catalytic activity of ALP (P < 0.05) were altered in common carp. A significant change in induced (opsonizedzymosan particles, OZP) chemiluminescence (P < 0.05) in sampling 3 and no shifts in serum immunoglobulins concentration were found in the immunological analysis. Histopathological examination of skin, gills, liver, spleen, and cranial and caudal kidneys revealed no obvious specific changes in any tissue analysed. The use of β-glucans in clinically healthy aquaculture remains an issue. Nevertheless, their use in breeding endangered by stress stimuli, infectious disease, or adverse environmental factors is defensible. Copyright © 2013 Elsevier Ltd. All rights reserved.

Effect of β-1, 3 glucan binding protein based zinc oxide nanoparticles supplemented diet on immune response and disease resistance in Oreochromis mossambicus against Aeromonas hydrophila.

PubMed

Anjugam, Mahalingam; Vaseeharan, Baskaralingam; Iswarya, Arokiadhas; Gobi, Narayanan; Divya, Mani; Thangaraj, Merlin P; Elumalai, Preetham

2018-05-01

Recently, several immunostimulants such as β-glucan, microbial and plant products have been used as dietary supplements to combat disease outbreaks in aquaculture. The present study investigates the potential of Portunus pelagicus β-1, 3 glucan binding protein based zinc oxide nanoparticles (Ppβ-GBP-ZnO NPs) supplemented diet on growth, immune response and disease resistance in Mozambique tilapia, Oreochromis mossambicus. The immune-related protein β-GBP was purified from the haemolymph of P. pelagicus using Sephadex G-100 affinity column chromatography. Ppβ-GBP-ZnO NPs was physico- chemically characterized and experimental feed was formulated. Fish were separately fed with commercial diet (control-group I) and Ppβ-GBP (group II, III, IV), Ppβ-GBP-ZnO NPs (group V, VI, VII), chem-ZnO NPs (VIII, IX, X) mixed diet at the concentration of 0.001%, 0.002% and 0.004% respectively. Triplicate groups of O. mossambicus were fed with experimental diets twice a day for 30 days. Fish receiving Ppβ-GBP-ZnO NPs supplemented diet showed a significant increase (P < 0.05) in growth performance. Cellular immune responses (myeloperoxidase activity, lysozyme activity and reactive oxygen species activity) and humoral immune responses (complement activity, antiprotease activity and alkaline phosphatase activity) were evaluated at an interval of 15 days during the feeding trial. Results demonstrate that both cellular and humoral immune responses were substantially increased (P < 0.05) in fish fed with 0.004% of Ppβ-GBP-ZnO NPs supplemented diet than others. Antibiofilm potential of Ppβ-GBP-ZnO NPs against Aeromonas hydrophila was visualized through confocal laser scanning microscopy (CLSM), which reveals reduction in the preformed biofilm thickness to 10 μm  at the concentration of 50 μg/ml. Furthermore, after 30 days of feeding trial, fish were challenged with aquatic fish pathogen A. hydrophila (1 × 10 7  cells ml -1 ) through intraperitoneal injection. Challenge study displayed a reduced mortality rate in fish fed with diet containing Ppβ-GBP-ZnO NPs. Thus our study suggests that dietary supplementation of Ppβ-GBP-ZnO NPs at 0.004% may have a potential effect to enhance the immune system and survival of O. mossambicus. Copyright © 2018 Elsevier Ltd. All rights reserved.

Modulators of Fish Immune Responses. Volume 1. Models for Environmental Toxicology/Biomarkers Immunostimulators

DTIC Science & Technology

1994-01-01

Immunity in Invertebrates. (M. Breh~lin, editor). Springer-Verlag, Berlin, Heidelberg. pp 112-124. Smith, V.J. and K. Soderhall. (1983). Beta -1-3- glucan ...resistance of carp Cyprinus carpio to experimental Edwardsiella tarda infection, by some beta - 1, 3- glucan . Nippon Suisan Gakkaishi 55:1815-1819. Yoshida...inhibitory and anti-bacterial activity of soluble and particulate glucan . Intl. J. Cancer 24: 773-779. Ellsaesser, C.F. (1989). Identification and

Dectin-1 is required for β-glucan recognition and control of fungal infection

PubMed Central

Taylor, Philip R; Tsoni, S Vicky; Willment, Janet A; Dennehy, Kevin M; Rosas, Marcela; Findon, Helen; Haynes, Ken; Steele, Chad; Botto, Marina; Gordon, Siamon; Brown, Gordon D

2007-01-01

β-Glucan is one of the most abundant polysaccharides in fungal pathogens, yet its importance in antifungal immunity is unclear. Here we show that deficiency of dectin-1, the myeloid receptor for β-glucan, rendered mice susceptible to infection with Candida albicans. Dectin-1-deficient leukocytes demonstrated significantly impaired responses to fungi even in the presence of opsonins. Impaired leukocyte responses were manifested in vivo by reduced inflammatory cell recruitment after fungal infection, resulting in substantially increased fungal burdens and enhanced fungal dissemination. Our results establish a fundamental function for β-glucan recognition by dectin-1 in antifungal immunity and demonstrate a signaling non–Toll-like pattern-recognition receptor required for the induction of protective immune responses. PMID:17159984

Targeted Delivery of Glucan Particle Encapsulated Gallium Nanoparticles Inhibits HIV Growth in Human Macrophages

PubMed Central

Soto, Ernesto R.; O'Connell, Olivia; Dikengil, Fusun; Peters, Paul J.; Clapham, Paul R.

2016-01-01

Glucan particles (GPs) are hollow, porous 3–5 μm microspheres derived from the cell walls of Baker's yeast (Saccharomyces cerevisiae). The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of a wide range of payloads (DNA, siRNA, protein, small molecules, and nanoparticles) encapsulated inside the hollow GPs or bound to the surface of chemically derivatized GPs. Gallium nanoparticles have been proposed as an inhibitory agent against HIV infection. Here, macrophage targeting of gallium using GPs provides for more efficient delivery of gallium and inhibition of HIV infection in macrophages compared to free gallium nanoparticles. PMID:27965897

Wholegrain barley β-glucan fermentation does not improve glucose tolerance in rats fed a high-fat diet.

PubMed

Belobrajdic, Damien P; Jobling, Stephen A; Morell, Matthew K; Taketa, Shin; Bird, Anthony R

2015-02-01

Fermentation of oat and barley β-glucans is believed to mediate in part their metabolic health benefits, but the exact mechanisms remain unclear. In this study, we sought to test the hypothesis that barley β-glucan fermentation raises circulating incretin hormone levels and improves glucose control, independent of other grain components. Male Sprague-Dawley rats (n = 30) were fed a high-fat diet for 6 weeks and then randomly allocated to 1 of 3 dietary treatments for 2 weeks. The low- (LBG, 0% β-glucan) and high- (HBG, 3% β-glucan) β-glucan diets contained 25% wholegrain barley and similar levels of insoluble dietary fiber, available carbohydrate, and energy. A low-fiber diet (basal) was included for comparison. Immediately prior to the dietary intervention, gastric emptying rate (using the (13)C-octanoic breath test) and postprandial glycemic response of each diet were determined. At the end of the study, circulating gut hormone levels were determined; and a glucose tolerance test was performed. The rats were then killed, and indices of cecal fermentation were assessed. Diet did not affect live weight; however, the HBG diet, compared to basal and LBG, reduced food intake, tended to slow gastric emptying, increased cecal digesta mass and individual and total short-chain fatty acid pools, and lowered digesta pH. In contrast, circulating levels of glucose, insulin, gastric-inhibitory peptide, and glucagon-like peptide-1, and glucose tolerance were unaffected by diet. In conclusion, wholegrain barley β-glucan suppressed feed intake and increased cecal fermentation but did not improve postprandial glucose control or insulin sensitivity. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

Molecular Cloning and Characterization of cgs, the Brucella abortus Cyclic β(1-2) Glucan Synthetase Gene: Genetic Complementation of Rhizobium meliloti ndvB and Agrobacterium tumefaciens chvB Mutants

PubMed Central

Iñón de Iannino, Nora; Briones, Gabriel; Tolmasky, Marcelo; Ugalde, Rodolfo A.

1998-01-01

The animal pathogen Brucella abortus contains a gene, cgs, that complemented a Rhizobium meliloti nodule development (ndvB) mutant and an Agrobacterium tumefaciens chromosomal virulence (chvB) mutant. The complemented strains recovered the synthesis of cyclic β(1-2) glucan, motility, virulence in A. tumefaciens, and nitrogen fixation in R. meliloti; all traits were strictly associated with the presence of an active cyclic β(1-2) glucan synthetase protein in the membranes. Nucleotide sequencing revealed the presence in B. abortus of an 8.49-kb open reading frame coding for a predicted membrane protein of 2,831 amino acids (316.2 kDa) and with 51% identity to R. meliloti NdvB. Four regions of the B. abortus protein spanning amino acids 520 to 800, 1025 to 1124, 1284 to 1526, and 2400 to 2660 displayed similarities of higher than 80% with R. meliloti NdvB. Tn3-HoHo1 mutagenesis showed that the C-terminal 825 amino acids of the Brucella protein, although highly conserved in Rhizobium, are not necessary for cyclic β(1-2) glucan synthesis. Confirmation of the identity of this protein as B. abortus cyclic β(1-2) glucan synthetase was done by the construction of a B. abortus Tn3-HoHo1 insertion mutant that does not form cyclic β(1-2) glucan and lacks the 316.2-kDa membrane protein. The recovery of this mutant from the spleens of inoculated mice was decreased by 3 orders of magnitude compared with that of the parental strain; this result suggests that cyclic β(1-2) glucan may be a virulence factor in Brucella infection. PMID:9721274

Aerosolization of Particulate (1→3)-β-d-Glucan from Moldy Materials▿

PubMed Central

Seo, Sung-Chul; Reponen, Tiina; Levin, Linda; Borchelt, Tiffany; Grinshpun, Sergey A.

2008-01-01

Mold-damaged building materials may contain biologically active agents, such as (1→3)-β-d-glucan, allergens, and mycotoxins, which have been associated with adverse health effects. The release of these components from contaminated surfaces into the air is not well understood. The purpose of this study was to characterize the release of particulate (1→3)-β-d-glucan from the surface of artificially mold-contaminated materials. Aspergillus versicolor and Stachybotrys chartarum were grown on malt extract agar (MEA), white ceiling tiles, and a wall-papered gypsum board for 1 and 6 months. The (1→3)-β-d-glucan on the surfaces of moldy materials and in air samples collected from these materials was analyzed by the Limulus amebocyte lysate assay. The aerosolization ratio was defined as the amount of (1→3)-β-d-glucan in the air divided by the amount on the surface. The results showed that the aerosolization of particulate (1→3)-β-d-glucan was influenced mainly by the type of material and the fungal species. For A. versicolor, the aerosolization ratios of particulate (1→3)-β-d-glucan released from the three types of material were not significantly different. However, the ratios for S. chartarum released from ceiling tiles and gypsum board were significantly higher than the ratios for this organism released from MEA (P < 0.001) and were comparable to those for A. versicolor. These findings indicate that the use of MEA in aerosolization experiments is likely to underestimate the release of S. chartarum particles from building materials. These results provide important background information for design of future laboratory or animal experiments, as well as for interpretation of field measurement data. PMID:18065630

Review of human studies investigating the post-prandial blood-glucose lowering ability of oat and barley food products.

PubMed

Tosh, S M

2013-04-01

Oat and barley foods have been shown to reduce human glycaemic response, compared to similar wheat foods or a glucose control. The strength of the evidence supporting the hypothesis that the soluble fibre, mixed linkage β-glucan, reduces glycaemic response was evaluated. A search of the literature was conducted to find clinical trials with acute glycaemic response as an end point using oat or barley products. Of the 76 human studies identified, 34 met the inclusion and exclusion criteria. Dose response and ratio of β-glucan to available carbohydrate as predictors of glycaemic response were assessed. Meals provided 0.3-12.1 g oat or barley β-glucan, and reduced glycaemic response by an average of 48 ± 33 mmol · min/l compared to a suitable control. Regression analysis on 119 treatments indicated that change in glycaemic response (expressed as incremental area under the post-prandial blood-glucose curve) was greater for intact grains than for processed foods. For processed foods, glycaemic response was more strongly related to the β-glucan dose alone (r(2)=0.48, P<0.0001) than to the ratio of β-glucan to the available carbohydrate (r(2)=0.25, P<0.0001). For processed foods containing 4 g of β-glucan, the linear model predicted a decrease in glycaemic response of 27 ± 3 mmol · min/l, and 76% of treatments significantly reduced glycaemic response. Thus, intact grains as well as a variety of processed oat and barley foods containing at least 4 g of β-glucan and 30-80 g available carbohydrate can significantly reduce post-prandial blood glucose.

Oral microbe-host interactions: influence of β-glucans on gene expression of inflammatory cytokines and metabolome profile.

PubMed

Silva, Viviam de Oliveira; Pereira, Luciano José; Murata, Ramiro Mendonça

2017-03-07

The aim of this study was to evaluate the effects of β-glucan on the expression of inflammatory mediators and metabolomic profile of oral cells [keratinocytes (OBA-9) and fibroblasts (HGF-1) in a dual-chamber model] infected by Aggregatibacter actinomycetemcomitans. The periodontopathogen was applied and allowed to cross the top layer of cells (OBA-9) to reach the bottom layer of cells (HGF-1) and induce the synthesis of immune factors and cytokines in the host cells. β-glucan (10 μg/mL or 20 μg/mL) were added, and the transcriptional factors and metabolites produced were quantified in the remaining cell layers and supernatant. The relative expression of interleukin (IL)-1-α and IL-18 genes in HGF-1 decreased with 10 μg/mL or 20 μg/mL of β-glucan, where as the expression of PTGS-2 decreased only with 10 μg/mL. The expression of IL-1-α increased with 20 μg/mL and that of IL-18 increased with 10 μg/mL in OBA-9; the expression of BCL 2, EP 300, and PTGS-2 decreased with the higher dose of β-glucan. The production of the metabolite 4-aminobutyric acid presented lower concentrations under 20 μg/mL, whereas the concentrations of 2-deoxytetronic acid NIST and oxalic acid decreased at both concentrations used. Acetophenone, benzoic acid, and pinitol presented reduced concentrations only when treated with 10 μg/mL of β-glucan. Treatment with β-glucans positively modulated the immune response and production of metabolites.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

NASA Astrophysics Data System (ADS)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Effects of oat β-glucan consumption at breakfast on ad libitum eating, appetite, glycemia, insulinemia and GLP-1 concentrations in healthy subjects.

PubMed

Zaremba, Suzanne M M; Gow, Iain F; Drummond, Sandra; McCluskey, Jane T; Steinert, Robert E

2018-06-18

There is evidence that oat β-glucan lowers appetite and ad libitum eating; however, not all studies are consistent, and the underpinning mechanisms are not entirely understood. We investigated the effects of 4 g high molecular weight (MW) oat β-glucan on ad libitum eating, subjective appetite, glycemia, insulinemia and plasma GLP-1 responses in 33 normal-weight subjects (22 female/11 male, mean age (y): 26.9 ± 1.0, BMI (kg/m 2 ): 23.5 ± 0.4). The study followed a randomised double-blind, cross-over design with subjects fed two test breakfasts with and without oat β-glucan followed by an ad libitum test meal on two different days. Blood samples and ratings for subjective appetite were collected postprandially at regular time intervals. Oat β-glucan increased feelings of fullness (p = 0.048) and satiety (p = 0.034), but did not affect energy and amount eaten at the ad libitum test meal. There was a treatment by time interaction for plasma GLP-1, plasma insulin and blood glucose. GLP-1 was significantly reduced at 90 min (p = 0.021), blood glucose at 30 min (p = 0.008) and plasma insulin at 30 and 60 min (p = 0.002 and 0.017, respectively) following the oat β-glucan breakfast when compared with the control breakfast. Four grams of high MW oat β-glucan lowers appetite but not ad libitum eating and beneficially modulates postprandial glycaemia, it does however, not increase plasma GLP-1 secretion. Copyright © 2018 Elsevier Ltd. All rights reserved.

Summaries of Research, Fiscal Year 1980.

DTIC Science & Technology

1980-10-01

separated from its subunits. The 1, 3- glucanse did not exhibit any dextranase or amylase activity when induced on a "limit- glucan " substrate. The greatest...by Surface Active Compounds." SHKLAIR, I. L. presented " Glucan Synthesis of S. mutans from Caries-Active and Caries-Free Naval Recruits." WIRTHLIN, M...I. L. presented "Relationship of Glucan Formation by S. mutans and Dental Caries Activity." WALTER, R. G. presented "Streptococcus mutans in Caries

Chemical Organization of the Cell Wall Polysaccharide Core of Malassezia restricta

PubMed Central

Stalhberger, Thomas; Simenel, Catherine; Clavaud, Cécile; Eijsink, Vincent G. H.; Jourdain, Roland; Delepierre, Muriel; Latgé, Jean-Paul; Breton, Lionel; Fontaine, Thierry

2014-01-01

Malassezia species are ubiquitous residents of human skin and are associated with several diseases such as seborrheic dermatitis, tinea versicolor, folliculitis, atopic dermatitis, and scalp conditions such as dandruff. Host-Malassezia interactions and mechanisms to evade local immune responses remain largely unknown. Malassezia restricta is one of the most predominant yeasts of the healthy human skin, its cell wall has been investigated in this paper. Polysaccharides in the M. restricta cell wall are almost exclusively alkali-insoluble, showing that they play an essential role in the organization and rigidity of the M. restricta cell wall. Fractionation of cell wall polymers and carbohydrate analyses showed that the polysaccharide core of the cell wall of M. restricta contained an average of 5% chitin, 20% chitosan, 5% β-(1,3)-glucan, and 70% β-(1,6)-glucan. In contrast to other yeasts, chitin and chitosan are relatively abundant, and β-(1,3)-glucans constitute a minor cell wall component. The most abundant polymer is β-(1,6)-glucans, which are large molecules composed of a linear β-(1,6)-glucan chains with β-(1,3)-glucosyl side chain with an average of 1 branch point every 3.8 glucose unit. Both β-glucans are cross-linked, forming a huge alkali-insoluble complex with chitin and chitosan polymers. Data presented here show that M. restricta has a polysaccharide organization very different of all fungal species analyzed to date. PMID:24627479

Chemical organization of the cell wall polysaccharide core of Malassezia restricta.

PubMed

Stalhberger, Thomas; Simenel, Catherine; Clavaud, Cécile; Eijsink, Vincent G H; Jourdain, Roland; Delepierre, Muriel; Latgé, Jean-Paul; Breton, Lionel; Fontaine, Thierry

2014-05-02

Malassezia species are ubiquitous residents of human skin and are associated with several diseases such as seborrheic dermatitis, tinea versicolor, folliculitis, atopic dermatitis, and scalp conditions such as dandruff. Host-Malassezia interactions and mechanisms to evade local immune responses remain largely unknown. Malassezia restricta is one of the most predominant yeasts of the healthy human skin, its cell wall has been investigated in this paper. Polysaccharides in the M. restricta cell wall are almost exclusively alkali-insoluble, showing that they play an essential role in the organization and rigidity of the M. restricta cell wall. Fractionation of cell wall polymers and carbohydrate analyses showed that the polysaccharide core of the cell wall of M. restricta contained an average of 5% chitin, 20% chitosan, 5% β-(1,3)-glucan, and 70% β-(1,6)-glucan. In contrast to other yeasts, chitin and chitosan are relatively abundant, and β-(1,3)-glucans constitute a minor cell wall component. The most abundant polymer is β-(1,6)-glucans, which are large molecules composed of a linear β-(1,6)-glucan chains with β-(1,3)-glucosyl side chain with an average of 1 branch point every 3.8 glucose unit. Both β-glucans are cross-linked, forming a huge alkali-insoluble complex with chitin and chitosan polymers. Data presented here show that M. restricta has a polysaccharide organization very different of all fungal species analyzed to date.

(1-3)(1-6)-β-glucan-enriched materials from Lentinus edodes mushroom as a high-fibre and low-calorie flour substitute for baked foods.

PubMed

Kim, Juyoung; Lee, Seung Mi; Bae, In Young; Park, Hyuk-Gu; Gyu Lee, Hyeon; Lee, Suyong

2011-08-15

Extensive physiological and biological emphasis has been placed on pharmaceutical and medicinal uses of mushrooms containing β-glucans, but their incorporation into processed functional foods is quite limited. Thus, low-grade Lentinus edodes mushrooms were utilised to produce β-glucan-enriched materials (BGEMs), which were evaluated as a high-fibre and low-calorie substitute for wheat flour. The fractions obtained from Lentinus edodes mushrooms contained 514 g kg⁻¹ of (1-3)-β-glucans with (1-6)-β-linked side chains and the chemical structure was confirmed by ¹³C NMR and FTIR spectroscopy. Replacement of a portion of the wheat flour with BGEMs resulted in the solutions with lower values of pasting parameters and also caused significant changes in starch gelatinisation. When BGEMs were incorporated into cake formulations, batter viscosity increased with more shear-thinning behaviours and elastic properties improved. Overall, the cakes containing more BGEMs showed decreased volume and increased hardness while no significant differences were observed between the control and BGEM cakes containing 1 g of β-glucan per serving. As a wheat flour substitute, the BGEMs that were prepared from low-grade Lentinus edodes mushrooms, could be successfully used to produce cakes containing 1 g of β-glucan per serving with quality attributes similar to those of the control. Copyright © 2011 Society of Chemical Industry.

(1→3)-β-D-Glucan Assay in Monitoring Response to Anti-Fungal Therapy in Fungal Endocarditis.

PubMed

Slim, Jihad; Saling, Christopher; Szabela, Maria; Brown, Melinda; Johnson, Tamara; Goldfarb, Irvin

2017-03-01

A case is reported of Candida glabrata infective endocarditis (IE) treated without surgical intervention. The study aim was to: (i) briefly discuss the outcomes of other documented cases of fungal IE managed medically with fluconazole; (ii) discuss the (1→3)-β-D-glucan assay and its previously studied role in the diagnosis of invasive fungal infections; and (iii) examine a possible application of the (1→3)-β-D-glucan assay to monitor response to antifungal treatment in patients with Candida endocarditis. The serum Fungitell assay was used to trend (1→3)-β-D-glucan in a patient with Candida endocarditis to determine treatment effectiveness with fluconazole, to provide an appropriate end date for antifungal therapy, and to survey infection suppression while off treatment. The (1→03)-β-D-glucan assay began trending downwards at 197 days into treatment with oral fluconazole. After 16 months of therapy, fluconazole was stopped due to transaminitis. (1→3)-β-Dglucan levels were checked six weeks after the discontinuation of treatment and were negative. The patient has now been off therapy for 21 weeks with no signs of clinical disease, and values remain negative. The present case indicates that a trending (1→3)-β-D-glucan assay may have valuable application in monitoring treatment response and infection suppression for Candida endocarditis.

Action of an endo-β-1,3(4)-glucanase on cellobiosyl unit structure in barley β-1,3:1,4-glucan

PubMed Central

Kuge, Takao; Nagoya, Hiroki; Tryfona, Theodora; Kurokawa, Tsunemi; Yoshimi, Yoshihisa; Dohmae, Naoshi; Tsubaki, Kazufumi; Dupree, Paul; Tsumuraya, Yoichi; Kotake, Toshihisa

2015-01-01

β-1,3:1,4-Glucan is a major cell wall component accumulating in endosperm and young tissues in grasses. The mixed linkage glucan is a linear polysaccharide mainly consisting of cellotriosyl and cellotetraosyl units linked through single β-1,3-glucosidic linkages, but it also contains minor structures such as cellobiosyl units. In this study, we examined the action of an endo-β-1,3(4)-glucanase from Trichoderma sp. on a minor structure in barley β-1,3:1,4-glucan. To find the minor structure on which the endo-β-1,3(4)-glucanase acts, we prepared oligosaccharides from barley β-1,3:1,4-glucan by endo-β-1,4-glucanase digestion followed by purification by gel permeation and paper chromatography. The endo-β-1,3(4)-glucanase appeared to hydrolyze an oligosaccharide with degree of polymerization 5, designated C5-b. Based on matrix-assisted laser desorption/ionization (MALDI) time-of-flight (ToF)/ToF-mass spectrometry (MS)/MS analysis, C5-b was identified as β-Glc-1,3-β-Glc-1,4-β-Glc-1,3-β-Glc-1,4-Glc including a cellobiosyl unit. The results indicate that a type of endo-β-1,3(4)-glucanase acts on the cellobiosyl units of barley β-1,3:1,4-glucan in an endo-manner. PMID:26027730

Investigation of the Effects of Inulin and β-Glucan on the Physical and Sensory Properties of Low-Fat Beef Burgers Containing Vegetable Oils: Optimisation of the Formulation Using D-Optimal Mixture Design

PubMed Central

Afshari, Roya; Khaksar, Ramin; Mohammadifar, Mohammad Amin; Amiri, Zohre; Komeili, Rozita; Khaneghah, Amin Mousavi

2015-01-01

Summary In this study, the D-optimal mixture design methodology was applied to determine the optimised proportions of inulin, β-glucan and breadcrumbs in formulation of low-fat beef burgers containing pre-emulsified canola and olive oil blend. Also, the effect of each of the ingredients individually as well as their interactions on cooking characteristics, texture, colour and sensory properties of low-fat beef burgers were investigated. The results of this study revealed that the increase of inulin content in the formulations of burgers led to lower cooking yield, moisture retention and increased lightness, overall acceptability, mouldability and desired textural parameters. In contrast, incorporation of β-glucan increased the cooking yield, moisture retention and decreased lightness, overall acceptability, mouldability and desired textural parameters of burger patties. The interaction between inulin and β-glucan improved the cooking characteristics of the burgers without significantly negative effect on the colour or sensory properties. The results of the study clearly stated that the optimum mixture for the burger formulation consisted of (in g per 100 g): inulin 3.1, β-glucan 2.2 and breadcrumbs 2.7. The texture parameters and cooking characteristics were improved by using the mixture of inulin, β-glucan and breadcrumbs, without any negative effects on the sensory properties of the burgers. PMID:27904378

Structural characterization and immunostimulatory activity of a novel linear α-(1→6)-D-glucan isolated from Panax ginseng C. A. Meyer.

PubMed

Sun, Lin; Peng, Xiaoxia; Sun, Pan; Shi, Jiahong; Yuan, Xiaowen; Zhu, Jingjing; Tai, Guihua; Zhou, Yifa

2012-08-01

Panax ginseng C. A. Meyer is a well-known plant medicine in the world. Ginseng polysaccharides mainly contain starch-like glucan and pectin. In this paper, a novel glucan WGPA-UH-N1 was purified from ginseng pectin by the treatment of de-esterification and endo-polygalacturonase, followed by the chromatographies on DEAE-Sepharose Fast Flow and Sephadex G-50 column. WGPA-UH-N1 has molecular weight about 17 kDa. WGPA-UH-N1 was determined to be a linear α-(1→6)-D-glucan without side chains by FT-IR, (13)C-NMR, (1)H-NMR, HMQC and HMBC spectra. It is the first time to isolate a linear α-(1→6)-D-glucan from Panax ginseng C. A. Meyer. Immunological activity assays showed that WGPA-UH-N1, although not effective on the phagocytosis of macrophage, could significantly induce lymphocyte proliferation without mitogenic stimuli at 1.0 mg/mL or with LPS at 0.5 mg/mL, also significantly increase NO production at the range of 0.1-1.0 mg/mL in a dose-dependent manner. The immunological activities of WGPA-UH-N1 are different from those of the β-(1→6)-D-glucan (BIWP2) isolated from the fruit bodies of Bulgaria Inquinans (Fries).

Simultaneous saccharification and fermentation of Eastern redcedar heartwood and sapwood using a novel size reduction technique.

PubMed

Ramachandriya, Karthikeyan D; Wilkins, Mark; Pardo-Planas, Oscar; Atiyeh, Hasan K; Dunford, Nurhan T; Hiziroglu, Salim

2014-06-01

This study investigated the effect of two wood zones (sapwood versus heartwood) and size reduction techniques [Crumbles® (Crumbles® is a registered trademark of Forest Concepts, LLC, Auburn, WA, USA) particles versus ground particles] on wood glucan-to-ethanol yield after acid bisulfite pretreatment and simultaneous saccharification and fermentation (SSF) of Eastern redcedar. SSFs were conducted at 8% solids loading (w/w dry basis) using Accellerase® 1500 at a loading of 46FPU/g glucan and Saccharomyces cerevisiae D5A for ethanol fermentation. The size reduction technique had no effect on ethanol yield. However, sapwood glucan-to-ethanol yields were significantly greater than heartwood yields. The highest wood glucan-to-ethanol yield of 187L/dryMg (95% of theoretical) was achieved with sapwood crumbled particles in 240h. Ground sapwood, crumbled heartwood and ground heartwood achieved ethanol yields of 89%, 81% and 80% of theoretical in 240h, respectively. Preliminary mass balances showed 100% glucan recovery with crumbled sapwood and extensive (72%) delignification. Copyright © 2014 Elsevier Ltd. All rights reserved.

New developments and prospective applications for beta (1,3) glucans.

PubMed

Laroche, Celine; Michaud, Philippe

2007-01-01

Publications and patents relative to newly observed functions of beta-(1,3)-D-glucans have notably increased in the last few years with the exploitation of their biological activities. The term beta-(1,3)-D-glucans includes a very large number of polysaccharides from bacterial, fungal and vegetable sources. Their structures have a common backbone of beta-(1,3) linked glucopyranosyl residues but the polysaccharidic chain can be beta-(1,6) branched with glucose or integrate some beta-(1,4) linked glucopyranosyl residues in the main chain. Except for the curdlan, a bacterial linear beta-(1,3)-D-glucans, and for the scleroglucan produced by Sclerotium rolfsii, the main drawback limiting the development of these polysaccharides is the lack of efficient processes for their extraction and purification and their cost. However new applications in agronomy, foods, cosmetic and therapeutic could in a next future accentuate the effort of research for their development. So this review focuses on these beta-(1,3)-D-glucans with the objective to detail the strategies employed for their extraction and the relation structure-functions identified when they induce biological activities.

Fission yeast Ags1 confers the essential septum strength needed for safe gradual cell abscission

PubMed Central

Sato, Mamiko; Muñoz, Javier; Moreno, M. Belén; Clemente-Ramos, Jose Angel; Ramos, Mariona; Okada, Hitoshi; Osumi, Masako; Durán, Angel; Ribas, Juan Carlos

2012-01-01

Fungal cytokinesis requires the assembly of a dividing septum wall. In yeast, the septum has to be selectively digested during the critical cell separation process. Fission yeast cell wall α(1-3)glucan is essential, but nothing is known about its localization and function in the cell wall or about cooperation between the α- and β(1-3)glucan synthases Ags1 and Bgs for cell wall and septum assembly. Here, we generate a physiological Ags1-GFP variant and demonstrate a tight colocalization with Bgs1, suggesting a cooperation in the important early steps of septum construction. Moreover, we define the essential functions of α(1-3)glucan in septation and cell separation. We show that α(1-3)glucan is essential for both secondary septum formation and the primary septum structural strength needed to support the physical forces of the cell turgor pressure during cell separation. Consequently, the absence of Ags1 and therefore α(1-3)glucan generates a special and unique side-explosive cell separation due to an instantaneous primary septum tearing caused by the turgor pressure. PMID:22891259

Validation of a high-performance size-exclusion chromatography method to determine and characterize β-glucans in beer wort using a triple-detector array.

PubMed

Tomasi, Ivan; Marconi, Ombretta; Sileoni, Valeria; Perretti, Giuseppe

2017-01-01

Beer wort β-glucans are high-molecular-weight non-starch polysaccharides of that are great interest to the brewing industries. Because glucans can increase the viscosity of the solutions and form gels, hazes, and precipitates, they are often related to poor lautering performance and beer filtration problems. In this work, a simple and suitable method was developed to determine and characterize β-glucans in beer wort using size exclusion chromatography coupled with a triple-detector array, which is composed of a light scatterer, a viscometer, and a refractive-index detector. The method performances are comparable to the commercial reference method as result from the statistical validation and enable one to obtain interesting parameters of β-glucan in beer wort, such as the molecular weight averages, fraction description, hydrodynamic radius, intrinsic viscosity, polydispersity and Mark-Houwink parameters. This characterization can be useful in brewing science to understand filtration problems, which are not always explained through conventional analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Two-dimensional NMR data of a water-soluble β-(1→3, 1→6)-glucan from Aureobasidium pullulans and schizophyllan from Schizophyllum commune.

PubMed

Kono, Hiroyuki; Kondo, Nobuhiro; Hirabayashi, Katsuki; Ogata, Makoto; Totani, Kazuhide; Ikematsu, Shinya; Osada, Mitsumasa

2017-12-01

This article contains two-dimensional (2D) NMR experimental data, obtained by the Bruker BioSpin 500 MHz NMR spectrometer (Germany) which can used for the determination of primary structures of schizophyllan from Schizophyllum commune (SPG) and a water-soluble β-(1→3, 1→6)-glucan from Aureobasidium pullulans . Data include analyzed the 2D NMR spectra of these β-glucans, which are related to the subject of an article in Carbohydrate Polymers , entitled "NMR spectroscopic structural characterization of a water-soluble β-(1→3, 1→6)-glucan from A. pullulans " (Kono et al., 2017) [1]. Data can help to assign the 1 H and 13 C chemical shifts of the structurally complex polysaccharides.

Effects of β-glucans from Coriolus versicolor on macrophage phagocytosis are related to the Akt and CK2/Ikaros.

PubMed

Kang, Se Chan; Koo, Hyun Jung; Park, Sulkyung; Lim, Jung Dae; Kim, Ye-Jin; Kim, Taeseong; Namkoong, Seung; Jang, Ki-Hyo; Pyo, Suhkneung; Jang, Seon-A; Sohn, Eun-Hwa

2013-06-01

Coriolus versicolor has been known to be an immune stimulator effects. For further understanding of the phagocytic activity and the intracellular mechanisms of β-glucan from C. versicolor (CVG), we examined the phagocytic activity, phosphorylation of Akt and CK2, nucleus translocation of p65 and Ikaros activity in β-glucan-treated macrophages using RT-PCR, western blotting, and IP assay. The role of Ikaros in regulating phagocytic effects of CVG was also determined using Ikaros dominant negative isoform cells. This study suggests that CK2/Ikaros are positive regulators and novel signaling pathway involved in phagocytosis and contributes to elucidating the mechanism underlying phagocytic activity induced by β-glucan. Copyright © 2013 Elsevier B.V. All rights reserved.

Studies on the Mechanism of Action of Dinitramine

PubMed Central

Travis, Robert L.; Woods, William G.

1977-01-01

The effect of dinitramine, a selective herbicide, on the plasma membrane of the soybean (Glycine max L.) root was studied. Used as marker systems to observe the herbicide effect were two plasma-membrane-specific enzymes, pH 6.5 ATPase and glucan synthetase. The activity of pH 6.5 ATPase decreased significantly in membrane vesicles prepared from roots harvested 15 minutes after treatment with dinitramine. Maximum inhibition occurred in roots harvested 2 hours after treatment. Glucan synthetase activity decreased similarly within 2 hours of treatment. Membrane permeability to 86Rb was rapidly increased by dinitramine. The activity of pH 6.5 ATPase returned to the control level within 8 hours of treatment with dinitramine. These results show dinitramine's initial site of action to be the plasma membrane, producing an over-all reduction in membrane function through inactivation of membrane-associated proteins. PMID:16660043

Strategies for the production of high concentrations of bioethanol from seaweeds

PubMed Central

Yanagisawa, Mitsunori; Kawai, Shigeyuki; Murata, Kousaku

2013-01-01

Bioethanol has attracted attention as an alternative to petroleum-derived fuel. Seaweeds have been proposed as some of the most promising raw materials for bioethanol production because they have several advantages over lignocellulosic biomass. However, because seaweeds contain low contents of glucans, i.e., polysaccharides composed of glucose, the conversion of only the glucans from seaweed is not sufficient to produce high concentrations of ethanol. Therefore, it is also necessary to produce ethanol from other specific carbohydrate components of seaweeds, including sulfated polysaccharides, mannitol, alginate, agar and carrageenan. This review summarizes the current state of research on the production of ethanol from seaweed carbohydrates for which the conversion of carbohydrates to sugars is a key step and makes comparisons with the production of ethanol from lignocellulosic biomass. This review provides valuable information necessary for the production of high concentrations of ethanol from seaweeds. PMID:23314751

Strategies for the production of high concentrations of bioethanol from seaweeds: production of high concentrations of bioethanol from seaweeds.

PubMed

Yanagisawa, Mitsunori; Kawai, Shigeyuki; Murata, Kousaku

2013-01-01

Bioethanol has attracted attention as an alternative to petroleum-derived fuel. Seaweeds have been proposed as some of the most promising raw materials for bioethanol production because they have several advantages over lignocellulosic biomass. However, because seaweeds contain low contents of glucans, i.e., polysaccharides composed of glucose, the conversion of only the glucans from seaweed is not sufficient to produce high concentrations of ethanol. Therefore, it is also necessary to produce ethanol from other specific carbohydrate components of seaweeds, including sulfated polysaccharides, mannitol, alginate, agar and carrageenan. This review summarizes the current state of research on the production of ethanol from seaweed carbohydrates for which the conversion of carbohydrates to sugars is a key step and makes comparisons with the production of ethanol from lignocellulosic biomass. This review provides valuable information necessary for the production of high concentrations of ethanol from seaweeds.

Oats

MedlinePlus

... saturated fat. For each gram of soluble fiber (beta-glucan) consumed, total cholesterol decreases by about 1.42 ... total cholesterol than foods containing oat bran plus beta-glucan soluble fiber. The FDA recommends that approximately 3 ...

The Center for Advanced Food Technology: Food Related Studies.

DTIC Science & Technology

1992-11-16

Glucan (Callose) Synthase from Beta Vulgaris L. by Product-Entrapment," Entrapment Mechanisms and Polypeptide Characterization. Elant MU g. 97:684...Na3HGe7O16 xH20, xaO 0-6. 1," Chemiatr of Materials, 4:388. FRost, D.L, Drake, R.R., and B.P. Wasserman (1992) ’(1,3)-- glucan Synthase from Saccbaro...Wu, A., and R.W. Harriman (1992) "Probing the Molecular Architecture of (1,3-- Glucan (Callose) Synthase: Polypeptide Depletion Studies," Biochemical

Immunogenicity and prediction of epitopic region of antigen Ag I/II and glucosyltransferase from Streptococcus mutans.

PubMed

Cao, Xi-Xi; Fan, Jian; Chen, Jiang; Li, Yu-Hong; Fan, Ming-Wen

2016-06-01

The levels of Streptococcus (S.) mutans infections in saliva were evaluated and a comparison for specific antibody levels among children with different levels of S. mutans infection was made. The promising epitopic regions of antigen AgI/II (PAc) and glucosyltransferase (GTF) for potential vaccine targets related to S. mutans adherence were screened. A total of 94 children aged 3-4 years were randomly selected, including 53 caries-negative and 41 caries-positive children. The values of S. mutans and those of salivary total secretory immunoglobulin A (sIgA), anti-PAc and anti-Glucan binding domain (anti-GLU) were compared to determine the correlation among them. It was found the level of s-IgA against specific antigens did not increase with increasing severity of S. mutans infection, and the complete amino acid sequence of PAc and GTFB was analyzed using the DNAStar Protean system for developing specific anti-caries vaccines related to S. mutans adherence. A significantly positive correlation between the amount of S. mutans and children decayed, missing, and filled teeth index was observed. No significant difference was detected in specific sIgA against PAc or GLU between any two groups. No significant correlation was found between such specific sIgA and caries index. A total of 16 peptides from PAc as well as 13 peptides from GTFB were chosen for further investigation. S. mutans colonization contributed to early children caries as an important etiological factor. The level of sIgA against specific antigens did not increase with increasing severity of S. mutans infection in children. The epitopes of PAc and GTF have been screened to develop the peptide-based or protein-based anti-caries vaccines.

β-1,3 glucan derived from Euglena gracilis and Algamune™ enhances innate immune responses of red drum (Sciaenops ocellatus L.).

PubMed

Yamamoto, Fernando Y; Yin, Fei; Rossi, Waldemar; Hume, Michael; Gatlin, Delbert M

2018-06-01

To reduce susceptibility to stressors and diseases, immune-modulators such as β-glucans have been proven effective tools to enhance the innate immune responses of fish. Consequently, commercial sources of this polysaccharide are becoming increasingly more available. Algamune™ is a commercial additive produced from Euglena gracilis, as a source of linear β-1,3-glucan. In order to evaluate the immunomodulatory effects of this β-glucan product, the present study assessed the innate immune parameters of red drum (Sciaenops ocellatus) exposed to Algamune™ ex vivo and in vivo. Isolated kidney phagocytes were incubated with graded concentrations (0, 0.2, 0.4, 0.8, 1.6 and 3.2 mg L -1 ) of dried Euglena gracilis (Algamune™) as well as purified Paramylon (linear β-1,3 glucan). Increased bactericidal activity against Streptococcus iniae, and production of intracellular O 2 - anion superoxide were stimulated by both β-glucan sources. A reduced activity of extracellular anion superoxide was observed by the phagocytes incubated with Algamune ™. After corroborating the effectiveness of the glucan source ex vivo, a feeding trial was conducted using red drum juveniles (∼26.6 g initial weight). Fish were fed diets with graded levels of Algamune™ (0, 100, 200, 400 and 800 mg kg -1 ) twice daily for 21 days. No significant differences were detected regarding production performance parameters. At the end of the feeding trial, blood, intestinal content, and kidney were sampled. Intestinal microbiota from fecal material was analyzed through denaturing gradient gel electrophoresis (DGGE) and found to be similar among all treatments. No significant differences were detected for oxidative radical production from whole blood, and isolated phagocytes, and plasma lysozyme activity. However, the total hemolytic activity of red drum plasma was increased in fish fed 100 and 200 mg kg -1 of dietary Algamune™ when compared to fish fed the basal diet. Based on results from both ex vivo and in vivo trials, β-glucan from Algamune™ was demonstrated to have a moderate immunostimulatory effects on red drum. Copyright © 2018 Elsevier Ltd. All rights reserved.

Allelic variants of the amylose extender mutation of maize demonstrate phenotypic variation in starch structure resulting from modified protein–protein interactions

PubMed Central

Liu, Fushan; Ahmed, Zaheer; Lee, Elizabeth A.; Donner, Elizabeth; Liu, Qiang; Ahmed, Regina; Morell, Matthew K.; Emes, Michael J.; Tetlow, Ian J.

2012-01-01

amylose extender (ae−) starches characteristically have modified starch granule morphology resulting from amylopectin with reduced branch frequency and longer glucan chains in clusters, caused by the loss of activity of the major starch branching enzyme (SBE), which in maize endosperm is SBEIIb. A recent study with ae− maize lacking the SBEIIb protein (termed ae1.1 herein) showed that novel protein–protein interactions between enzymes of starch biosynthesis in the amyloplast could explain the starch phenotype of the ae1.1 mutant. The present study examined an allelic variant of the ae− mutation, ae1.2, which expresses a catalytically inactive form of SBEIIb. The catalytically inactive SBEIIb in ae1.2 lacks a 28 amino acid peptide (Val272–Pro299) and is unable to bind to amylopectin. Analysis of starch from ae1.2 revealed altered granule morphology and physicochemical characteristics distinct from those of the ae1.1 mutant as well as the wild-type, including altered apparent amylose content and gelatinization properties. Starch from ae1.2 had fewer intermediate length glucan chains (degree of polymerization 16–20) than ae1.1. Biochemical analysis of ae1.2 showed that there were differences in the organization and assembly of protein complexes of starch biosynthetic enzymes in comparison with ae1.1 (and wild-type) amyloplasts, which were also reflected in the composition of starch granule-bound proteins. The formation of stromal protein complexes in the wild-type and ae1.2 was strongly enhanced by ATP, and broken by phosphatase treatment, indicating a role for protein phosphorylation in their assembly. Labelling experiments with [γ-32P]ATP showed that the inactive form of SBEIIb in ae1.2 was phosphorylated, both in the monomeric form and in association with starch synthase isoforms. Although the inactive SBEIIb was unable to bind starch directly, it was strongly associated with the starch granule, reinforcing the conclusion that its presence in the granules is a result of physical association with other enzymes of starch synthesis. In addition, an Mn2+-based affinity ligand, specific for phosphoproteins, was used to show that the granule-bound forms of SBEIIb in the wild-type and ae1.2 were phosphorylated, as was the granule-bound form of SBEI found in ae1.2 starch. The data strongly support the hypothesis that the complement of heteromeric complexes of proteins involved in amylopectin synthesis contributes to the fine structure and architecture of the starch granule. PMID:22121198

Outer membrane proteins related to SusC and SusD are not required for Cytophaga hutchinsonii cellulose utilization.

PubMed

Zhu, Yongtao; Kwiatkowski, Kurt J; Yang, Tengteng; Kharade, Sampada S; Bahr, Constance M; Koropatkin, Nicole M; Liu, Weifeng; McBride, Mark J

2015-08-01

Cytophaga hutchinsonii, a member of the phylum Bacteroidetes, employs a novel collection of cell-associated proteins to digest crystalline cellulose. Other Bacteroidetes rely on cell surface proteins related to the starch utilization system (Sus) proteins SusC and SusD to bind oligosaccharides and import them across the outer membrane for further digestion. These bacteria typically produce dozens of SusC-like porins and SusD-like oligosaccharide-binding proteins to facilitate utilization of diverse polysaccharides. C. hutchinsonii specializes in cellulose digestion and its genome has only two susC-like genes and two susD-like genes. Single and multiple gene deletions were constructed to determine if the susC-like and susD-like genes have roles in cellulose utilization. A mutant lacking all susC-like and all susD-like genes digested cellulose and grew on cellulose as well as wild-type cells. Further, recombinantly expressed SusD-like proteins CHU_0547 and CHU_0554 failed to bind cellulose or β-glucan hemicellulosic polysaccharides. The results suggest that the Bacteroidetes Sus paradigm for polysaccharide utilization may not apply to the cellulolytic bacterium C. hutchinsonii.

Dendritic cells pulsed with Pythium insidiosum (1,3)(1,6)-β-glucan, Heat-inactivated zoospores and immunotherapy prime naïve T cells to Th1 differentiation in vitro.

PubMed

Ledur, Pauline C; Tondolo, Juliana S M; Jesus, Francielli P K; Verdi, Camila M; Loreto, Érico S; Alves, Sydney H; Santurio, Janio M

2018-03-01

Pythiosis is a life-threatening disease caused by the fungus-like microorganism Pythium insidiosum that can lead to death if not treated. Since P. insidiosum has particular cell wall characteristics, pythiosis is difficult to treat, as it does not respond well to traditional antifungal drugs. In our study, we investigated a new immunotherapeutic approach with potential use in treatment and in the acquisition of immunity against pythiosis. Dendritic cells from both human and mouse, pulsed with P. insidiosum heat-inactivated zoospore, (1,3)(1,6)-β-glucan and the immunotherapeutic PitiumVac ® efficiently induced naïve T cell differentiation in a Th1 phenotype by the activation of specific Th1 cytokine production in vitro. Heat-inactivated zoospores showed the greatest Th1 response among the tested groups, with a significant increase in IL-6 and IFN-γ production in human cells. In mice cells, we also observed a Th17 pathway induction, with an increase on the IL-17A levels in lymphocytes cultured with β-glucan pulsed DCs. These results suggest a potential use of DCs pulsed with P. insidiosum antigens as a new therapeutic strategy in the treatment and acquisition of immunity against pythiosis. Copyright © 2017 Elsevier GmbH. All rights reserved.

Antibodies against glucan, chitin, and Saccharomyces cerevisiae mannan as new biomarkers of Candida albicans infection that complement tests based on C. albicans mannan.

PubMed

Sendid, B; Dotan, N; Nseir, S; Savaux, C; Vandewalle, P; Standaert, A; Zerimech, F; Guery, B P; Dukler, A; Colombel, J F; Poulain, D

2008-12-01

Antibodies against Saccharomyces cerevisiae mannan (ASCA) and antibodies against synthetic disaccharide fragments of glucans (ALCA) and chitin (ACCA) are biomarkers of Crohn's disease (CD). We previously showed that Candida albicans infection generates ASCA. Here, we explored ALCA and ACCA as possible biomarkers of invasive C. albicans infection (ICI). ASCA, ALCA, ACCA, and Candida mannan antigen and antibody detection tests were performed on 69 sera obtained sequentially from 18 patients with ICIs proven by blood culture, 59 sera from CD patients, 47 sera from hospitalized subjects colonized by Candida species (CZ), and 131 sera from healthy controls (HC). ASCA, ALCA, and ACCA levels in CD and ICI patients were significantly different from those in CZ and HC subjects (P<0.0001). In ICI patients, these levels increased as infection developed. Using ASCA, ALCA, ACCA, and Platelia Candida tests, 100% of ICIs were detected, with the kinetics of the antibody response depending on the patient during the time course of infection. A large number of sera presented with more than three positive tests. This is the first evidence that the detection of antibodies against chitin and glucans has diagnostic value in fungal infections and that these tests can complement more specific tests. Future trials are necessary to assess the value of these tests in multiparametric analysis, as well as their pathophysiological relevance.

Crystal Structure of 4,6-α-Glucanotransferase Supports Diet-Driven Evolution of GH70 Enzymes from α-Amylases in Oral Bacteria.

PubMed

Bai, Yuxiang; Gangoiti, Joana; Dijkstra, Bauke W; Dijkhuizen, Lubbert; Pijning, Tjaard

2017-02-07

Food processing and refining has dramatically changed the human diet, but little is known about whether this affected the evolution of enzymes in human microbiota. We present evidence that glycoside hydrolase family 70 (GH70) glucansucrases from lactobacilli, synthesizing α-glucan-type extracellular polysaccharides from sucrose, likely evolved from GH13 starch-acting α-amylases, via GH70 4,6-α-glucanotransferases. The crystal structure of a 4,6-α-glucanotransferase explains the mode of action and unique product specificity of these enzymes. While the α-amylase substrate-binding scaffold is retained, active-site loops adapted to favor transglycosylation over hydrolysis; the structure also gives clues as to how 4,6-α-glucanotransferases may have evolved further toward sucrose utilization instead of starch. Further supported by genomic, phylogenetic, and in vivo studies, we propose that dietary changes involving starch (and starch derivatives) and sucrose intake were critical factors during the evolution of 4,6-α-GTs and glucansucrases from α-amylases, allowing oral bacteria to produce extracellular polymers that contribute to biofilm formation from different substrates. Copyright © 2017 Elsevier Ltd. All rights reserved.

Production of Ginkgo leaf-shaped basidiocarps of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes), containing high levels of α- and β-D-glucan and ganoderic acid A.

PubMed

Yajima, Yuka; Miyazaki, Minoru; Okita, Noriyasu; Hoshino, Tamotsu

2013-01-01

Ganoderic acid A and α- and β-D-glucan content were compared among morphologically different basidiocarps of the medicinal mushroom Ganoderma lucidum. Ginkgo leaf-shaped basidiocarps gradually hardened from the base to the pileus and accumulated a higher amount of bioactive components than normal (kidney-shaped) and antler/deer horn-shaped basidiocarps. In the normal G. lucidum stipe, the outer context contained the highest amount of α- and β-D-glucan (approximately 55%) and the highest amount of ganoderic acid A (approximately 0.3%). Ginkgo leaf-shaped G. lucidum had a large area of outer layer and stout outer context, which contributed to their high α- and β-D-glucan and ganoderic acid A content.

In vitro fermentation of oat flours from typical and high beta-glucan oat lines.

PubMed

Kim, Hyun Jung; White, Pamela J

2009-08-26

Two publicly available oat (Avena sativa) lines, "Jim" and "Paul" (5.17 and 5.31% beta-glucan, respectively), and one experimental oat line "N979" (7.70% beta-glucan), were used to study the effect of beta-glucan levels in oat flours during simulated in vitro digestion and fermentation with human fecal flora obtained from different individuals. The oat flours were digested by using human digestion enzymes and fermented by batch fermentation under anaerobic conditions for 24 h. The fermentation progress was monitored by measuring pH, total gas, and short-chain fatty acid (SCFA) production. Significant effects of beta-glucan on the formation of gas and total SCFA were observed compared to the blank without substrate (P < 0.05); however, there were no differences in pH changes, total gas, and total SCFA production among oat lines (P > 0.05). Acetate, propionate, and butyrate were the main SCFA produced from digested oat flours during fermentation. More propionate and less acetate were produced from digested oat flours compared to lactulose. Different human fecal floras obtained from three healthy individuals had similar patterns in the change of pH and the production of gas during fermentation. Total SCFA after 24 h of fermentation were not different, but the formation rates of total SCFA differed between individuals. In vitro fermentation of digested oat flours with beta-glucan could provide favorable environmental conditions for the colon and these findings, thus, will help in developing oat-based food products with desirable health benefits.

Dietary β-glucans differentially modulate immune and stress-related gene expression in lymphoid organs from healthy and Aeromonas hydrophila-infected rainbow trout (Oncorhynchus mykiss).

PubMed

Douxfils, Jessica; Fierro-Castro, Camino; Mandiki, S N M; Emile, Wakson; Tort, Lluis; Kestemont, Patrick

2017-04-01

Although β-glucans stimulating effects have already been demonstrated on the immune system of numerous animal species, available data remain relatively variable and more research should be done regarding the complexity of underlying mechanisms. In this context, the present study aimed to evaluate the stress and immune-related effects of dietary β-glucans (i.e. Macrogard ® ) by considering a number of influencing factors such as the dose (0, 0.1, 0.2 and 0.5% in food), feeding duration (15 versus 30 days), tissue (blood, kidney, spleen, gills) and infection status (healthy or infected). Blood parameters (lysozyme, ACH50 activities, leucocyte populations) and mRNA expression level of several immune- and stress-related genes (TFN-α1, IL-1β, IL10, COX-2, TGF-β, MC2R, HSP70) were measured. Our results suggest that spleen may be a highly responsive organ to dietary β-glucans both in healthy or infected fish, and that this organ may therefore significantly contribute to the immune reinforcement induced by such immunostimulatory diet. Our study further reveals that overdoses of β-glucans and/or prolonged medication can lead to a non-reactive physiological status and, consequently, to a poor immune response. All in all, the current data emphasizes the need for further extensive research in the field of dietary β-glucans as a preventive method for farmed fish protection. Copyright © 2017 Elsevier Ltd. All rights reserved.

Case series of topical and orally administered β-glucan for the treatment of diabetic wounds: clinical study.

PubMed

Karaaslan, Onder; Kankaya, Yuksel; Sungur, Nezih; Kocer, Ugur; Sedat Cuzdan, Suat; Sahin, Belma; Uysal, Afsin

2012-01-01

Chronic, nonhealing wounds, foot ulcers, and lower extremity amputations are among the most problematic complications associated with diabetes mellitus. Standard care for diabetes-related chronic ulcers has included treatment of infection, weight off-loading, aggressive surgical débridement, and maintenance of a moist wound environment with frequent dressing changes. Yeast glucan is a particular high-molecular-weight polymer of β-(1,3)-glycosidic linkages of glycopyranose. We report our observations about the effectiveness of topically and orally administrated β-(1,3)-glucan for the treatment of chronic diabetic wounds and compare them to the literature results previously reported for similar wounds. Twenty-two patients with nonhealing ulcers associated with diabetes were included in this study. β-Glucan was given both orally and topically for the treatment of nonhealing ulcers. Macroscopic changes and surface areas of diabetic ulcers were recorded, and complete healing times were noted for each patient. A rapid decrease in size and healthy granulation were significantly observed in most patients. The duration of complete healing averaged 10.8 weeks (range 6-20 weeks). No adverse events were observed in the treatment period. The complete healing time was shorter than the results previously reported in the literature. Our observations support the view that application of glucan hastens epithelialization and wound closure, so topically and orally administered β-(1,3)-glucan therapy can help reverse some of the deficits in impaired healing diseases such as diabetes mellitus.

Glucan-MOS® improved growth and innate immunity in pacu stressed and experimentally infected with Aeromonas hydrophila.

PubMed

Soares, Michelly Pereira; Oliveira, Fulvia Cristina; Cardoso, Israel Luz; Urbinati, Elisabeth Criscuolo; Meldau de Campos, Cristiane; Hisano, Hamilton

2018-02-01

We tested the efficacy of a commercial product (Glucan-MOS ® ) derived from yeast Saccharomyces cerevisiae, containing two combined products, β-1,3-1,6 glucans and mannans on the growth, feed efficiency, stress and innate immune responses of juvenile pacu (Piaractus mesopotamicus) after a stressful handling and bacterial inoculation. For this, we evaluated the serum cortisol and plasma glucose levels, the respiratory activity of leukocytes, the serum lysozyme levels, as well as the number of circulating erythrocytes and leukocytes of fish fed during 30 days with diets containing increased levels of Glucan-MOS (0.0, 0.1, 0.2, 0.4 and 0.8%). The supplementation of 0.1% improved weight gain, feed conversion and the protein efficiency ratio compared to a control diet. The 0.2 and 0.4% Glucan-MOS ® diets were sufficient to increase the respiratory burst of leukocytes and lysozyme activity, the number of thrombocytes, neutrophils and monocytes in the blood after a stressful handling and bacterial challenge, and minimized stress response as shown by decreased cortisol and glucose levels when compared to the control. The results of this work reinforce the benefits of the adoption of feeding strategies including combination of both β-1,3-1,6 glucans and mannans as a dietary supplement in periods prior to intensive management. The 30-day period was sufficient to stimulate growth performance, improve nutrient utilization, minimize stress response and modulate innate immunity responses. Copyright © 2017 Elsevier Ltd. All rights reserved.

Diagnostic performance of the (1-3)-β-D-glucan assay in patients with Pneumocystis jirovecii compared with those with candidiasis, aspergillosis, mucormycosis, and tuberculosis, and healthy volunteers.

PubMed

Son, Hyo-Ju; Sung, Heungsup; Park, Se Yoon; Kim, Taeeun; Lee, Hyun Jeong; Kim, Sun-Mi; Chong, Yong Pil; Lee, Sang-Oh; Choi, Sang-Ho; Kim, Yang Soo; Woo, Jun Hee; Kim, Sung-Han

2017-01-01

Diagnosis of pneumocystis pneumonia (PCP) relies on microscopic visualization of P. jirovecii, or detection of Pneumocystis DNA in respiratory specimens, which involves invasive procedures such as bronchoalveolar lavage. The (1-3)-β-D-glucan (BG) assay has been proposed as a less invasive and less expensive diagnostic test to rule out PCP. We therefore compared blood levels of BG in patients with PCP with those of patients with candidemia, chronic disseminated candidiasis (CDC), invasive aspergillosis, mucormycosis, and tuberculosis and those of healthy volunteers. Adult patients who were diagnosed with PCP, candidemia, CDC, invasive aspergillosis, mucormycosis, and tuberculosis whose blood samples were available, and healthy volunteers were enrolled in a tertiary hospital in Seoul, South Korea, during a 21-month period. The blood samples were assayed with the Goldstream Fungus (1-3)-β-D-glucan test (Gold Mountain River Tech Development, Beijing, China). A total of 136 individuals including 50 patients P. jirovecii,15 candidemia, 6 CDC, 15 invasive aspergillosis, 10 mucormycosis, and 40 controls (20 TB and 20 healthy volunteers) were included. The mean±SD of the concentration of 1-3-β-D-glucan in the patients with PCP (290.08 pg/mL±199.98) were similar to those of patients with candidemia (314.14 pg/mL±205.60, p = 0.90 at an α = 0.005) and CDC (129.74 pg/mL±182.79, p = 0.03 at an α = 0.005), but higher than those of patients with invasive aspergillosis (131.62 pg/mL±161.67, p = 0.002 at an α = 0.005), mucormycosis (95.08 pg/mL±146.80, p<0.001 at an α = 0.005), and tuberculosis (103.31 pg/mL±140.81, p<0.001 at an α = 0.005) as well as healthy volunteers (101.18 pg/mL±197.52, p<0.001 at an α = 0.005). At a cut-off value > 31.25 pg/mL, which is highly sensitive for PCP versus tuberculosis plus healthy volunteers at the expense of specificity, the BG assay had a sensitivity of 92% (95% CI 81%-98%) and a specificity of 55% (95% CI 39%-71%). The BG assay appears to be a useful adjunct test for PCP.

Inorganic Phosphate Limitation Modulates Capsular Polysaccharide Composition in Mycobacteria.

PubMed

van de Weerd, Robert; Boot, Maikel; Maaskant, Janneke; Sparrius, Marion; Verboom, Theo; van Leeuwen, Lisanne M; Burggraaf, Maroeska J; Paauw, Nanne J; Dainese, Elisa; Manganelli, Riccardo; Bitter, Wilbert; Appelmelk, Ben J; Geurtsen, Jeroen

2016-05-27

Mycobacterium tuberculosis is protected by an unusual and highly impermeable cell envelope that is critically important for the successful colonization of the host. The outermost surface of this cell envelope is formed by capsular polysaccharides that play an important role in modulating the initial interactions once the bacillus enters the body. Although the bioenzymatic steps involved in the production of the capsular polysaccharides are emerging, information regarding the ability of the bacterium to modulate the composition of the capsule is still unknown. Here, we study the mechanisms involved in regulation of mycobacterial capsule biosynthesis using a high throughput screen for gene products involved in capsular α-glucan production. Utilizing this approach we identified a group of mutants that all carried mutations in the ATP-binding cassette phosphate transport locus pst These mutants collectively exhibited a strong overproduction of capsular polysaccharides, including α-glucan and arabinomannan, suggestive of a role for inorganic phosphate (Pi) metabolism in modulating capsular polysaccharide production. These findings were corroborated by the observation that growth under low Pi conditions as well as chemical activation of the stringent response induces capsule production in a number of mycobacterial species. This induction is, in part, dependent on σ factor E. Finally, we show that Mycobacterium marinum, a model organism for M. tuberculosis, encounters Pi stress during infection, which shows the relevance of our findings in vivo. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Influence of fat replacers on chemical composition, proteolysis, texture profiles, meltability and sensory properties of low-fat Kashar cheese.

PubMed

Sahan, Nuray; Yasar, Kurban; Hayaloglu, Ali A; Karaca, Oya B; Kaya, Ahmet

2008-02-01

Changes in chemical composition, proteolysis, lipolysis, texture, melting and sensory properties of low-fat Kashar cheese made with three different fat replacers (Simplesse D-100, Avicel Plus CM 2159 or beta-glucan) were investigated throughout ripening. The low-fat cheeses made with fat replacers were compared with full- and low-fat counterparts as controls. Reduction of fat caused increases in moisture and protein contents and decreases in moisture-in-non fat substance and yield values in low-fat cheeses. The use of fat replacers in the manufacture of low-fat Kashar cheese increased water binding capacity and improved overall quality of the cheeses. Use of fat replacer in low-fat cheese making has enhanced cheese proteolysis. All samples underwent lipolysis during ripening and low-fat cheeses with fat replacers had higher level of total free fatty acid than full- or low-fat control cheeses. Texture attributes and meltability significantly increased with addition of fat replacers. Sensory scores showed that the full-fat cheese was awarded best in all stages of ripening and low-fat variant of Kashar cheeses have inferior quality. However, fat replacers except beta-glucan improved the appearance, texture and flavour attributes of low-fat cheeses. When the fat replacers are compared, the low-fat cheese with Avicel Plus CM 2159 was highly acceptable and had sensory attributes closest to full-fat Kashar cheese.

Structure, function and regulation of the enzymes in the starch biosynthetic pathway.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geiger, Jim

Starch is the major reserve polysaccharide in nature and accounts for the majority of the caloric intact of humans. It is also gaining importance as a renewable and biodegradable industrial material. There is burgeoning interest in increasing the amount and altering the properties of the plant starches by plant genetic modification. A rational approach to this effort will require a detailed, atomic-level understanding of the enzymatic processes that produce the starch granule. The starch granule is a complex particle made up of alternating layers of crystalline and amorphous lamellae. It consists of two types of polymer, amylose, a polymer ofmore » relatively long chains of α-1,4-linked glucans that contain virtually no branches, and amylopectin, which is highly branched and contains much shorter chains. This complex structure is synthesized by the coordinate activities of the starch synthases (SS), which elongate the polysaccharide chain by addition of glucose units via α-1,4 linkages using ADP- glucose as a donor, and branching enzymes (BE), which branch the polysaccharide chain by cleavage of α₋1,4 linkages and subsequent re-attachment via α₋1,6 linkages. Several isoforms of both starch synthase (SS) and branching enzyme (BE) are found in plants, including SSI, SSII, SSIII and granule- bound SS (GBSS), and SBEI, SBEIIa and SBEIIb. These isoforms have different activities and substrate and product specificities and play different roles in creating the granule and determining the properties of the resulting starch. The overarching goal of this proposal is to begin to understand the regulation and specificities of these enzymes at the atomic level. High-resolution X-ray structures of these enzymes bound to substrates and products will be determined to visualize the molecular interactions responsible for the properties of the enzymes. Hypotheses regarding these issues will then be tested using mutagenesis and enzyme assays. To date, we have determined the structure of ADP- Glucose pyrophosphorylase from potato in its inhibited conformation, and bound to both ATP and ADP-glucose. In addition, we have determined the first structure of glycogen synthase in its "closed", catalytically active conformation bound to ADP-glucose. We also determined the structure of glycogen synthase bound to malto-oligosaccharides, showing for the first time that an enzyme in the starch biosynthetic pathway recognizes glucans not just in its active site but on binding sites on the surface of the enzyme ten’s of Angstroms from the active site. In addition our structure of a glycogen branching enzyme bound to malto-oligosaccharides identified seven distinct binding sites distributed about the surface of the enzyme. We will now determine the function of these sites to get a molecular-level picture of exactly how these enzymes interact with their polymeric substrates and confer specificity leading to the complex structure of the starch granule. We will extend our studies to other isoforms of the enzymes, to understand how their structures give rise to their distinct function. Our goal is to understand what accounts for the various functional differences between SS and SBE isoforms at a molecular level.« less

Preferential induction of Th17 cells in vitro and in vivo by Fucogalactan from Ganoderma lucidum (Reishi).

PubMed

Yoshida, Hideyuki; Suzuki, Mayu; Sakaguchi, Ryota; Tani, Ito; Kotani, Hitoshi; Shudo, Norimasa; Yoshimura, Akihiko

2012-05-25

The mushroom known as Reishi (Ganoderma lucidum) has been used as an herbal medicine for tumor treatment and immune system activation. Because its effects on the differentiation of effector T helper cells have not yet been fully understood, we investigated the effects of Reishi and those of its principal ingredient, β-glucan, on the activation of dendritic cells and the differentiation of Th17 cells. Reishi extracts as well as purified β-glucan (Curdran) activated DCs and caused them to produce large amounts of IL-23. β-glucan also enhanced and sustained the transcription of IL-23p19. The MEK-ERK signaling pathway positively regulates IL-23p19 transcription in β-glucan-stimulated DCs. In a mixed leukocyte reaction, Reishi-stimulated DCs preferentially induced Th17 cells. Furthermore, orally-administrated Reishi increased the percentages of Th17 cells and the transcription levels of antimicrobial peptides. Our results show that Reishi and β-glucan activate DCs to produce large amounts of IL-23, which induces Th17 differentiation both in vitro and in vivo. Copyright © 2012 Elsevier Inc. All rights reserved.

Quantification of 1,3-β-D-glucan from yeast added as a functional ingredient to bread.

PubMed

Rieder, Anne; Ballance, Simon; Böcker, Ulrike; Knutsen, Svein

2018-02-01

Due to their immunomodulatory effect, 1,3-β-G from yeast are used as functional ingredients, but reliable methods for their detection in foods are lacking. We have adapted a method based on fluorescence detection with aniline blue to quantify the amount of five commercial yeast β-glucan preparations added to crisp or yeast-leavened bread. This assay detected yeast β-glucan preparations added to different breads with an average recovery of 90, 96, 99 and 105%, while one of the preparations was overestimated, with an average recovery of 157%. The presence of cereal 1,3-1,4-β- D- glucans did not interfere with assay performance. The addition of 1,3-β-G at 0.2 and 0.5 g/100g is low compared to the recommended dose of 1,3-β-G per serving demonstrating assay sensitivity. However, more research is needed to fully understand the effect of 1,3-β-G conformation/structure on aniline blue interaction as well as the effect of baking on structure and dissolution properties of yeast β-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mechanisms of antimelanoma effect of oat β-glucan supported by electroporation.

PubMed

Choromanska, Anna; Lubinska, Sandra; Szewczyk, Anna; Saczko, Jolanta; Kulbacka, Julita

2018-06-06

There are still not specified mechanisms how beta-glucan molecules are transported into cells. Supposing, beta-glucan toxicity against tumor cells may be related to the overexpression of the transporter responsible for the transport of glucose molecules in the cells. In this case, glucans - polymers composed of glucose units are much more up-taken by tumor than normal cells. Increased GLUT1 (Glucose Transporter Type 1) expression has been demonstrated earlier in malignant melanomas. GLUT1 expression promotes glucose uptake and cell growth in that cells. Also, in human melanoma tissues a significant correlation between GLUT1 expression and mitotic activity was found. The aim of the study was to verify if oat β-glucan (OβG) is delivered into cells by GLUT-1 membrane protein. To check it out we blocked GLUT1 transporters by an inhibitor WZB117 and then we investigated cells viability with and without reversible electroporation (EP). The obtained results bring us to elucidate the mechanism of transport of the OβG into the cells is GLUT-1 dependent and moreover can be supported by EP method. Copyright © 2018. Published by Elsevier B.V.

Direct ethanol production from barley beta-glucan by sake yeast displaying Aspergillus oryzae beta-glucosidase and endoglucanase.

PubMed

Kotaka, Atsushi; Bando, Hiroki; Kaya, Masahiko; Kato-Murai, Michiko; Kuroda, Kouichi; Sahara, Hiroshi; Hata, Yoji; Kondo, Akihiko; Ueda, Mitsuyoshi

2008-06-01

Three beta-glucosidase- and two endoglucanase-encoding genes were cloned from Aspergillus oryzae, and their gene products were displayed on the cell surface of the sake yeast, Saccharomyces cerevisiae GRI-117-UK. GRI-117-UK/pUDB7 displaying beta-glucosidase AO090009000356 showed the highest activity against various substrates and efficiently produced ethanol from cellobiose. On the other hand, GRI-117-UK/pUDCB displaying endoglucanase AO090010000314 efficiently degraded barley beta-glucan to glucose and smaller cellooligosaccharides. GRI-117-UK/pUDB7CB codisplaying both beta-glucosidase AO090009000356 and endoglucanase AO090010000314 was constructed. When direct ethanol fermentation from 20 g/l barley beta-glucan as a model substrate was performed with the codisplaying strain, the ethanol concentration reached 7.94 g/l after 24 h of fermentation. The conversion ratio of ethanol from beta-glucan was 69.6% of the theoretical ethanol concentration produced from 20 g/l barley beta-glucan. These results showed that sake yeast displaying A. oryzae cellulolytic enzymes can be used to produce ethanol from cellulosic materials. Our constructs have higher ethanol production potential than the laboratory constructs previously reported.

Mechanochemical Phosphorylation and Solubilisation of β-D-Glucan from Yeast Saccharomyces cerevisiae and Its Biological Activities

PubMed Central

Shi, Feng; Shi, Jikui; Li, Yongfu

2014-01-01

To obtain a water-soluble β-D-glucan derivative cleanly and conveniently, a highly efficient mechanochemical method, planetary ball milling, was used to phosphorylate β-D-glucan isolated from yeast Saccharomyces cerevisiae in solid state. Soluble β-D-glucan phosphate (GP) with a high degree of substitution (0.77–2.09) and an apparent PEAK molecular weight of 6.6–10.0 kDa was produced when β-D-glucan was co-milled with sodium hexametaphosphate at 139.5–186.0 rad/s for 12–20 min. The energy transferred was 3.03–11.98 KJ/g. The phosphorylation of GPs was demonstrated by Fourier transform infrared spectroscopy and 13C and 31P Nuclear magnetic resonance spectroscopy. Three GP products with different degree of substitution (DS) and degree of polymerisation (DP) were able to upregulate the functional events mediated by activated murine macrophage RAW264.7 cells, among which GP-2 with a DS of 1.24 and DP of 30.5 exerted the highest immunostimulating activity. Our results indicate that mechanochemical processing is an efficient method for preparing water-soluble and biologically active GP with high DS. PMID:25075740

Linkage Analyses of Extracellular Glucans from Streptococcus sanguis and Streptococcus mitior

PubMed Central

Freedman, M.; Birkhed, D.; Coykendall, A.; Rizzo, D.

1979-01-01

Similar α-(1→6) linkage-rich, soluble, extracellular glucans have been isolated from six strains of two genetically distinct groups of Streptococcus sanguis and three strains of Streptococcus mitior. PMID:457265

Inhibitory Role of Greatwall-Like Protein Kinase Rim15p in Alcoholic Fermentation via Upregulating the UDP-Glucose Synthesis Pathway in Saccharomyces cerevisiae.

PubMed

Watanabe, Daisuke; Zhou, Yan; Hirata, Aiko; Sugimoto, Yukiko; Takagi, Kenichi; Akao, Takeshi; Ohya, Yoshikazu; Takagi, Hiroshi; Shimoi, Hitoshi

2016-01-01

The high fermentation rate of Saccharomyces cerevisiae sake yeast strains is attributable to a loss-of-function mutation in the RIM15 gene, which encodes a Greatwall-family protein kinase that is conserved among eukaryotes. In the present study, we performed intracellular metabolic profiling analysis and revealed that deletion of the RIM15 gene in a laboratory strain impaired glucose-anabolic pathways through the synthesis of UDP-glucose (UDPG). Although Rim15p is required for the synthesis of trehalose and glycogen from UDPG upon entry of cells into the quiescent state, we found that Rim15p is also essential for the accumulation of cell wall β-glucans, which are also anabolic products of UDPG. Furthermore, the impairment of UDPG or 1,3-β-glucan synthesis contributed to an increase in the fermentation rate. Transcriptional induction of PGM2 (phosphoglucomutase) and UGP1 (UDPG pyrophosphorylase) was impaired in Rim15p-deficient cells in the early stage of fermentation. These findings demonstrate that the decreased anabolism of glucose into UDPG and 1,3-β-glucan triggered by a defect in the Rim15p-mediated upregulation of PGM2 and UGP1 redirects the glucose flux into glycolysis. Consistent with this, sake yeast strains with defective Rim15p exhibited impaired expression of PGM2 and UGP1 and decreased levels of β-glucans, trehalose, and glycogen during sake fermentation. We also identified a sake yeast-specific mutation in the glycogen synthesis-associated glycogenin gene GLG2, supporting the conclusion that the glucose-anabolic pathway is impaired in sake yeast. These findings demonstrate that downregulation of the UDPG synthesis pathway is a key mechanism accelerating alcoholic fermentation in industrially utilized S. cerevisiae sake strains. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Beta-Glucans Supplementation Associates with Reduction in P-Cresyl Sulfate Levels and Improved Endothelial Vascular Reactivity in Healthy Individuals

PubMed Central

De Angelis, Maria; Rocchetti, Maria Teresa; Montemurno, Eustacchio; Maranzano, Valentina; Dalfino, Giuseppe; Manno, Carlo; Zito, Annapaola; Gesualdo, Michele; Ciccone, Marco Matteo; Gobbetti, Marco; Gesualdo, Loreto

2017-01-01

Background Oat and barley beta-glucans are prebiotic fibers known for their cholesterol-lowering activity, but their action on the human gut microbiota metabolism is still under research. Although the induction of short-chain fatty acids (SCFA) following their ingestion has previously been reported, no study has investigated their effects on proteolytic uremic toxins p-cresyl sulfate (pCS) and indoxyl sulfate (IS) levels, while others have failed to demonstrate an effect on the endothelial function measured through flow-mediated dilation (FMD). Objective The aim of our study was to evaluate whether a nutritional intervention with a functional pasta enriched with beta-glucans could promote a saccharolytic shift on the gut microbial metabolism and improve FMD. Methods We carried out a pilot study on 26 healthy volunteers who underwent a 2-month dietary treatment including a daily administration of Granoro “Cuore Mio” pasta enriched with barley beta-glucans (3g/100g). Blood and urine routine parameters, serum pCS/IS and FMD were evaluated before and after the dietary treatment. Results The nutritional treatment significantly reduced LDL and total cholesterol, as expected. Moreover, following beta-glucans supplementation we observed a reduction of serum pCS levels and an increase of FMD, while IS serum levels remained unchanged. Conclusions We demonstrated that a beta-glucans dietary intervention in healthy volunteers correlates with a saccharolytic shift on the gut microbiota metabolism, as suggested by the decrease of pCS and the increase of SCFA, and associates with an improved endothelial reactivity. Our pilot study suggests, in addition to cholesterol, novel pCS-lowering properties of beta-glucans, worthy to be confirmed in large-scale trials and particularly in contexts where the reduction of the microbial-derived uremic toxin pCS is of critical importance, such as in chronic kidney disease. PMID:28107445

Modulation of Intestinal Inflammation by Yeasts and Cell Wall Extracts: Strain Dependence and Unexpected Anti-Inflammatory Role of Glucan Fractions

PubMed Central

Jawhara, Samir; Habib, Khalid; Maggiotto, François; Pignede, Georges; Vandekerckove, Pascal; Maes, Emmanuel; Dubuquoy, Laurent; Fontaine, Thierry; Guerardel, Yann; Poulain, Daniel

2012-01-01

Yeasts and their glycan components can have a beneficial or adverse effect on intestinal inflammation. Previous research has shown that the presence of Saccharomyces cerevisiae var. boulardii (Sb) reduces intestinal inflammation and colonization by Candida albicans. The aim of this study was to identify dietary yeasts, which have comparable effects to the anti-C. albicans and anti-inflammatory properties of Sb and to assess the capabilities of yeast cell wall components to modulate intestinal inflammation. Mice received a single oral challenge of C. albicans and were then given 1.5% dextran-sulphate-sodium (DSS) for 2 weeks followed by a 3-day restitution period. S. cerevisiae strains (Sb, Sc1 to Sc4), as well as mannoprotein (MP) and β-glucan crude fractions prepared from Sc2 and highly purified β-glucans prepared from C. albicans were used in this curative model, starting 3 days after C. albicans challenge. Mice were assessed for the clinical, histological and inflammatory responses related to DSS administration. Strain Sc1-1 gave the same level of protection against C. albicans as Sb when assessed by mortality, clinical scores, colonization levels, reduction of TNFα and increase in IL-10 transcription. When Sc1-1 was compared with the other S. cerevisiae strains, the preparation process had a strong influence on biological activity. Interestingly, some S. cerevisiae strains dramatically increased mortality and clinical scores. Strain Sc4 and MP fraction favoured C. albicans colonization and inflammation, whereas β-glucan fraction was protective against both. Surprisingly, purified β-glucans from C. albicans had the same protective effect. Thus, some yeasts appear to be strong modulators of intestinal inflammation. These effects are dependent on the strain, species, preparation process and cell wall fraction. It was striking that β-glucan fractions or pure β-glucans from C. albicans displayed the most potent anti-inflammatory effect in the DSS model. PMID:22848391

Functional Analysis of the α-1,3-Glucan Synthase Genes agsA and agsB in Aspergillus nidulans: AgsB Is the Major α-1,3-Glucan Synthase in This Fungus

PubMed Central

Yoshimi, Akira; Sano, Motoaki; Inaba, Azusa; Kokubun, Yuko; Fujioka, Tomonori; Mizutani, Osamu; Hagiwara, Daisuke; Fujikawa, Takashi; Nishimura, Marie; Yano, Shigekazu; Kasahara, Shin; Shimizu, Kiminori; Yamaguchi, Masashi; Kawakami, Kazuyoshi; Abe, Keietsu

2013-01-01

Although α-1,3-glucan is one of the major cell wall polysaccharides in filamentous fungi, the physiological roles of α-1,3-glucan remain unclear. The model fungus Aspergillus nidulans possesses two α-1,3-glucan synthase (AGS) genes, agsA and agsB. For functional analysis of these genes, we constructed several mutant strains in A. nidulans: agsA disruption, agsB disruption, and double-disruption strains. We also constructed several CagsB strains in which agsB expression was controlled by the inducible alcA promoter, with or without the agsA-disrupting mutation. The agsA disruption strains did not show markedly different phenotypes from those of the wild-type strain. The agsB disruption strains formed dispersed hyphal cells under liquid culture conditions, regardless of the agsA genetic background. Dispersed hyphal cells were also observed in liquid culture of the CagsB strains when agsB expression was repressed, whereas these strains grew normally in plate culture even under the agsB-repressed conditions. Fractionation of the cell wall based on the alkali solubility of its components, quantification of sugars, and 13C-NMR spectroscopic analysis revealed that α-1,3-glucan was the main component of the alkali-soluble fraction in the wild-type and agsA disruption strains, but almost no α-1,3-glucan was found in the alkali-soluble fraction derived from either the agsB disruption strain or the CagsB strain under the agsB-repressed conditions, regardless of the agsA genetic background. Taken together, our data demonstrate that the two AGS genes are dispensable in A. nidulans, but that AgsB is required for normal growth characteristics under liquid culture conditions and is the major AGS in this species. PMID:23365684

Maize variety and method of production

DOEpatents

Pauly, Markus; Hake, Sarah; Kraemer, Florian J

2014-05-27

The disclosure relates to a maize plant, seed, variety, and hybrid. More specifically, the disclosure relates to a maize plant containing a Cal-1 allele, whose expression results in increased cell wall-derived glucan content in the maize plant. The disclosure also relates to crossing inbreds, varieties, and hybrids containing the Cal-1 allele to produce novel types and varieties of maize plants.

β-glucans and cholesterol (Review)

PubMed Central

Sima, Petr; Vetvicka, Vaclav

2018-01-01

Hypercholesterolemia is one of primary risk factors of cardiovascular disease, together with metabolic syndrome, hypertension and diabetes. Although progress has been made, the search for novel methods of preventing and treating dyslipidemia is ongoing and current therapies for cardiovascular disease induce various side effects. β-glucans are linear unbranched polysaccharides found in various natural sources, such as mushrooms. Due to their structure they are able to interact with innate immunity receptors, however they also act as dietary fibers in the digestive tract. As there are two forms of β-glucans, insoluble and soluble forms, they are able to interact with lipids and biliary salts in the bowel and consequently reduce cholesterol levels. Therefore, they may be developed as a suitable therapeutic option to treat patients with dyslipidemia, as they are natural molecules that do not induce any significant side effects. The current review discusses the evidence supporting the effects of β-glucans on cholesterol levels. PMID:29393350

Prophylactic effects of humic acid-glucan combination against experimental liver injury

PubMed Central

Vetvicka, Vaclav; Garcia-Mina, Jose Maria; Yvin, Jean-Claude

2015-01-01

Aim: Despite intensive research, liver diseases represent a significant health problem and current medicine does not offer a substance able to significantly inhibit the hepatotoxicity leading to various stages of liver disease. Based on our previously published studies showing the protective effects of a glucan-humic acid (HA) combination, we focused on the hypothesis that the combination of these two natural molecules can offer prophylactic protection against experimentally induced hepatotoxicity. Materials and Methods: Lipopolysaccharide, carbon tetrachloride, and ethanol were used to experimentally damage the liver. Levels of aspartate aminotransferase, alanine transaminase, alkaline phosphatase, glutathione, superoxide dismutase, and malondialdehyde, known to correspond to the liver damage, were assayed. Results: Using three different hepatotoxins, we found that in all cases, some samples of HA and most of all the glucan-HA combination, offer strong protection against liver damage. Conclusion: Glucan-HA combination is a promising agent for use in liver protection. PMID:26401416

The Barley Genome Sequence Assembly Reveals Three Additional Members of the CslF (1,3;1,4)-β-Glucan Synthase Gene Family

PubMed Central

Schreiber, Miriam; Wright, Frank; MacKenzie, Katrin; Hedley, Pete E.; Schwerdt, Julian G.; Little, Alan; Burton, Rachel A.; Fincher, Geoffrey B.; Marshall, David; Waugh, Robbie; Halpin, Claire

2014-01-01

An important component of barley cell walls, particularly in the endosperm, is (1,3;1,4)-β- glucan, a polymer that has proven health benefits in humans and that influences processability in the brewing industry. Genes of the cellulose synthase-like (Csl) F gene family have been shown to be involved in (1,3;1,4)-β-glucan synthesis but many aspects of the biosynthesis are still unclear. Examination of the sequence assembly of the barley genome has revealed the presence of an additional three HvCslF genes (HvCslF11, HvCslF12 and HvCslF13) which may be involved in (1,3;1,4)-β-glucan synthesis. Transcripts of HvCslF11 and HvCslF12 mRNA were found in roots and young leaves, respectively. Transient expression of these genes in Nicotiana benthamiana resulted in phenotypic changes in the infiltrated leaves, although no authentic (1,3;1,4)-β-glucan was detected. Comparisons of the CslF gene families in cereals revealed evidence of intergenic recombination, gene duplications and translocation events. This significant divergence within the gene family might be related to multiple functions of (1,3;1,4)-β-glucans in the Poaceae. Emerging genomic and global expression data for barley and other cereals is a powerful resource for characterising the evolution and dynamics of complete gene families. In the case of the CslF gene family, the results will contribute to a more thorough understanding of carbohydrate metabolism in grass cell walls. PMID:24595438

Isolation and chemical characterization of dissolved and particulate polysaccharides in Mikawa Bay

NASA Astrophysics Data System (ADS)

Sakugawa, Hiroshi; Handa, Nobuhiko

1985-05-01

Isolation and chemical elucidation of dissolved and particulate polysaccharides in seawater were conducted. The water samples were collected in Mikawa Bay, Japan during a red tide bloom of the dinoflagellate, Prorocentrum minimum. Dissolved polysaccharides were concentrated from 5-101 of seawater with dialysis followed by separation by gel flitration, and isolation by ethanol precipitation. A heteropolysaccharide consisting of glucose, galactose, mannose, xylose, arabinose, fucose and rhamnose and a glucan were isolated from the polysaccharide component having a molecular weight more than 4,000 Dalton and were characterized by several chemical analyses. The heteropolysaccharide is a mucilaginous polysaccharide having a highly branched structure and a molecular weight of 10 4-5 × 10 6 Daltons and probably contains a sulfate half ester: the glucan is a polysaccharide with β-1,3- and 1,6-linkages (chrysolaminaran type). Concentrations of these were respectively ca. 20 and 67 μg l -1 at 1 m, and 2 and 26 μg l -1 at 6 m. A similar heteropolysaccharide was found in the boiling water extract of the particulate matter, while β-glucan was isolated in a much less purified form than the seawater β-glucan. In addition, a large amount of β-1,4 glucan was found in the strong alkali extract of the particulate matter, indicating that this glucan must be a cell wall polysaccharide derived from phytoplankton. These results strongly suggest that the heteropolysaccharide and chrysolaminaran type polysaccharide dissolved in seawater were derived from water soluble carbohydrates of phytoplankton through extracellular release or cell lysis.

Effects of black yeast-derived β-1,3-1,6-glucan on serum cytokine and microRNA expression in transplanted sarcoma in mice.

PubMed

Li, Wei; Zhang, Yaru; Cong, Fengsong

2013-01-01

β-1,3-1,6-glucans are the most abundant glucose polymers in the cell walls of fungi. Previous studies have shown that β-1,3-1,6-glucans derived from fungi possess immunomodulating activitivies. Antitumor effects of these compounds have also been reported in animal models. Current studies mainly focus on the direct effects of β-1,3-1,6-glucans on immune systems, but no data are available to address the underlying molecular events in tumor cells. β-1,3-1,6-glucan purified from black yeast at 5 mg/100 g body weight (study group) or saline (control group) was intragastrically administered on a daily basis to subcutaneously-injected mice with mouse S180 sarcoma cells. Tumor sizes, tumor weights, serum concentrations of cytokines and levels of microRNAs (miRNAs) in transplanted tumors were compared between the treated and control groups. The volumes and weights of transplanted tumors were significantly lower in the treatment groups compared to the control groups by ∼150% and 70%, respectively. The treated mice demonstrated significantly higher levels of cytokines, including IL-2, IL-4, IL-6, IL-8, IL-10 and IL-12, compared to the control mice. Notably, the expression of several miRNAs in transplanted tumor tissues also markedly changed. These data suggest that black yeast-derived β-1,3-1,6-glucan, not only stimulates cytokine release from immune cells, but also changes the expression profiles of miRNAs in transplanted tumors.

Effects of black yeast-derived β-1,3-1,6-glucan on serum cytokine and microRNA expression in transplanted sarcoma in mice

PubMed Central

LI, WEI; ZHANG, YARU; CONG, FENGSONG

2013-01-01

β-1,3-1,6-glucans are the most abundant glucose polymers in the cell walls of fungi. Previous studies have shown that β-1,3-1,6-glucans derived from fungi possess immunomodulating activitivies. Antitumor effects of these compounds have also been reported in animal models. Current studies mainly focus on the direct effects of β-1,3-1,6-glucans on immune systems, but no data are available to address the underlying molecular events in tumor cells. β-1,3-1,6-glucan purified from black yeast at 5 mg/100 g body weight (study group) or saline (control group) was intragastrically administered on a daily basis to subcutaneously-injected mice with mouse S180 sarcoma cells. Tumor sizes, tumor weights, serum concentrations of cytokines and levels of microRNAs (miRNAs) in transplanted tumors were compared between the treated and control groups. The volumes and weights of transplanted tumors were significantly lower in the treatment groups compared to the control groups by ∼150% and 70%, respectively. The treated mice demonstrated significantly higher levels of cytokines, including IL-2, IL-4, IL-6, IL-8, IL-10 and IL-12, compared to the control mice. Notably, the expression of several miRNAs in transplanted tumor tissues also markedly changed. These data suggest that black yeast-derived β-1,3-1,6-glucan, not only stimulates cytokine release from immune cells, but also changes the expression profiles of miRNAs in transplanted tumors. PMID:24648910

Host-Pathogen Interactions : XXXII. A Fungal Glucan Preparation Protects Nicotianae against Infection by Viruses.

PubMed

Kopp, M; Rouster, J; Fritig, B; Darvill, A; Albersheim, P

1989-05-01

A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described.

β-1,6-glucan synthesis-associated genes are required for proper spore wall formation in Saccharomyces cerevisiae.

PubMed

Pan, Hua-Ping; Wang, Ning; Tachikawa, Hiroyuki; Nakanishi, Hideki; Gao, Xiao-Dong

2017-11-01

The yeast spore wall is an excellent model to study the assembly of an extracellular macromolecule structure. In the present study, mutants defective in β-1,6-glucan synthesis, including kre1∆, kre6∆, kre9∆ and big1∆, were sporulated to analyse the effect of β-1,6-glucan defects on the spore wall. Except for kre6∆, these mutant spores were sensitive to treatment with ether, suggesting that the mutations perturb the integrity of the spore wall. Morphologically, the mutant spores were indistinguishable from wild-type spores. They lacked significant sporulation defects partly because the chitosan layer, which covers the glucan layer, compensated for the damage. The proof for this model was obtained from the effect of the additional deletion of CHS3 that resulted in the absence of the chitosan layer. Among the double mutants, the most severe spore wall deficiency was observed in big1∆ spores. The majority of the big1∆chs3∆ mutants failed to form visible spores at a higher temperature. Given that the big1∆ mutation caused a failure to attach a GPI-anchored reporter, Cwp2-GFP, to the spore wall, β-1,6-glucan is involved in tethering of GPI-anchored proteins in the spore wall as well as in the vegetative cell wall. Thus, β-1,6-glucan is required for proper organization of the spore wall. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Active-site copper reduction promotes substrate binding of fungal lytic polysaccharide monooxygenase and reduces stability.

PubMed

Kracher, Daniel; Andlar, Martina; Furtmüller, Paul G; Ludwig, Roland

2018-02-02

Lytic polysaccharide monooxygenases (LPMOs) are a class of copper-containing enzymes that oxidatively degrade insoluble plant polysaccharides and soluble oligosaccharides. Upon reductive activation, they cleave the substrate and promote biomass degradation by hydrolytic enzymes. In this study, we employed LPMO9C from Neurospora crassa , which is active toward cellulose and soluble β-glucans, to study the enzyme-substrate interaction and thermal stability. Binding studies showed that the reduction of the mononuclear active-site copper by ascorbic acid increased the affinity and the maximum binding capacity of LPMO for cellulose. The reduced redox state of the active-site copper and not the subsequent formation of the activated oxygen species increased the affinity toward cellulose. The lower affinity of oxidized LPMO could support its desorption after catalysis and allow hydrolases to access the cleavage site. It also suggests that the copper reduction is not necessarily performed in the substrate-bound state of LPMO. Differential scanning fluorimetry showed a stabilizing effect of the substrates cellulose and xyloglucan on the apparent transition midpoint temperature of the reduced, catalytically active enzyme. Oxidative auto-inactivation and destabilization were observed in the absence of a suitable substrate. Our data reveal the determinants of LPMO stability under turnover and non-turnover conditions and indicate that the reduction of the active-site copper initiates substrate binding. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

The α-Glucan Phosphorylase MalP of Corynebacterium glutamicum Is Subject to Transcriptional Regulation and Competitive Inhibition by ADP-Glucose

PubMed Central

Clermont, Lina; Macha, Arthur; Müller, Laura M.; Derya, Sami M.; von Zaluskowski, Philipp; Eck, Alexander; Eikmanns, Bernhard J.

2015-01-01

ABSTRACT α-Glucan phosphorylases contribute to degradation of glycogen and maltodextrins formed in the course of maltose metabolism in bacteria. Accordingly, bacterial α-glucan phosphorylases are classified as either glycogen or maltodextrin phosphorylase, GlgP or MalP, respectively. GlgP and MalP enzymes follow the same catalytic mechanism, and thus their substrate spectra overlap; however, they differ in their regulation: GlgP genes are constitutively expressed and the enzymes are controlled on the activity level, whereas expression of MalP genes are transcriptionally controlled in response to the carbon source used for cultivation. We characterize here the modes of control of the α-glucan phosphorylase MalP of the Gram-positive Corynebacterium glutamicum. In accordance to the proposed function of the malP gene product as MalP, we found transcription of malP to be regulated in response to the carbon source. Moreover, malP transcription is shown to depend on the growth phase and to occur independently of the cell glycogen content. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. Since the latter is considered a typical feature of GlgPs, we propose that C. glutamicum MalP acts as both maltodextrin and glycogen phosphorylase and, based on these findings, we question the current system for classification of bacterial α-glucan phosphorylases. IMPORTANCE Bacterial α-glucan phosphorylases have been classified conferring to their purpose as either glycogen or maltodextrin phosphorylases. We found transcription of malP in C. glutamicum to be regulated in response to the carbon source, which is recognized as typical for maltodextrin phosphorylases. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. The latter is considered a typical feature of GlgPs. These findings, taken together, suggest that C. glutamicum MalP is the first α-glucan phosphorylase that does not fit into the current system for classification of bacterial α-glucan phosphorylases and exemplifies the complex mechanisms underlying the control of glycogen content and maltose metabolism in this model organism. PMID:25666133