Sample records for glucans

  1. Comparison of the potency of a variety of β-glucans to induce cytokine production in human whole blood

    PubMed Central

    Noss, Ilka; Doekes, Gert; Thorne, Peter S; Heederik, Dick J.J.; Wouters, Inge M.

    2014-01-01

    Beta-glucans are components of fungal cell walls and potent stimulants of innate immunity. The majority of research on biological activities of glucans has focused on β-(1,3)-glucans, which have been implicated in relation with fungal exposure-associated respiratory symptoms, and as important stimulatory agents in anti-fungal immune responses. Fungi - and bacteria and plants - produce a wide variety of glucans with vast differences in proportion and arrangement of their 1,3-, 1,4-, and 1,6-β-glycosidic linkages. Thus far the proinflammatory potential of different β-glucans has not been studied within the same experimental model. Therefore, we compared the potency of 13 different glucan preparations to induce in vitro production of IL1β, IL6, IL8 and TNF-α in human whole blood cultures. The strongest inducers of all cytokines were pustulan (β-(1,6)-glucan), lichenan (β-(1,3)-(1,4)-glucan), xyloglucan (β-(1,4)-glucan), and pullulan (α-(1,4)-(1,6)-glucan). Moderate to strong cytokine production was observed for curdlan (β-(1,3)-glucan), baker’s yeast glucan (β-(1,3)-(1,6)-glucan), and barley glucan (β-(1,3)-(1,4)-glucan), while all other glucan preparations induced only low or no detectable levels of cytokines. We therefore conclude that innate immunity reactions are not exclusively induced by β-(1,3)-glucans, but also by β-(1,6)- and β-(1,4)-structures. Thus, not only β-(1,3)-glucan, but also other β-glucans and particularly β-(1,6)-glucans should be considered in future research. PMID:22653750

  2. Soluble Glucan Is Internalized and Trafficked to the Golgi Apparatus in Macrophages via a Clathrin-Mediated, Lipid Raft-Regulated Mechanism

    PubMed Central

    Goldman, Matthew P.; Kalbfleisch, John H.; Williams, David L.

    2012-01-01

    Glucans are natural product carbohydrates that stimulate immunity. Glucans are internalized by the pattern recognition receptor, Dectin-1. Glucans were thought to be trafficked to phagolysosomes, but this is unproven. We examined the internalization and trafficking of soluble glucans in macrophages. Incubation of macrophages with glucan resulted in internalization of Dectin-1 and glucan. Inhibition of clathrin blocked internalization of the Dectin-1/glucan complex. Lipid raft depletion resulted in decreased Dectin levels and glucan uptake. Once internalized, glucans colocalized with early endosomes at 0 to 15 min, with the Golgi apparatus at 15 min to 24 h, and with Dectin-1 immediately (0 h) and again later (15 min-24 h). Glucans did not colocalize with lysosomes at any time interval examined. We conclude that the internalization of Dectin-1/glucan complexes in macrophages is mediated by clathrin and negatively regulated by lipid rafts and/or caveolin-1. Upon internalization, soluble glucans are trafficked via endosomes to the Golgi apparatus, not lysosomes. PMID:22700434

  3. A new colorimetric method to quantify β-1,3-1,6-glucans in comparison with total β-1,3-glucans in edible mushrooms.

    PubMed

    Nitschke, Jörg; Modick, Hendrik; Busch, Ekkehard; von Rekowski, Reimund Wantoch; Altenbach, Hans-Josef; Mölleken, Helga

    2011-07-15

    Mushroom β-glucans are known for their activity as biological response modifiers and anticarcinogenic agents. β-1,3-1,6 Branched glucans with a triple helix tertiary structure are recognised as the most potent ones. In the present work, a colorimetric method for β-1,3-1,6-glucan quantification based on the dye Congo red is introduced. This method is specific for β-glucans with a triple helix. The β-1,3-1,6-glucan content of mycelia and fruiting bodies from various mushrooms was determined and compared with the total β-1,3-glucan content, measured by a fluorimetric method. The results show equal amounts of β-1,3-1,6- and total β-1,3-glucans in the analysed species but obvious differences between mycelia and fruiting bodies. On the average, 3% of mycelia and 8% of fruiting body dry mass consist of β-1,3-1,6-glucans. The average percentage of β-1,3-1,6-glucans in the total β-1,3-glucan content differs between mycelia (46%) and fruiting bodies (87%). Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Screening of beta-glucan contents in commercially cultivated and wild growing mushrooms.

    PubMed

    Sari, Miriam; Prange, Alexander; Lelley, Jan I; Hambitzer, Reinhard

    2017-02-01

    Mushrooms have unique sensory properties and nutritional values as well as health benefits due to their bioactive compounds, especially beta-glucans. Well-known edible and medicinal mushroom species as well as uncommon or unknown species representing interesting sources of bioactive beta-glucans have been widely studied. Commercially cultivated and wild growing mushrooms were analysed for their beta-glucan contents. Enzymatic determinations of all glucans, alpha-glucans and beta-glucans in 39 mushrooms species were performed, leading to very remarkable results. Many wild growing species present high beta-glucan contents, especially Bracket fungi. The well-known cultivated species Agaricus bisporus, Lentinula edodes and Cantharellus cibarius as well as most screened wild growing species show higher glucan contents in their stipes than caps. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi.

    PubMed

    Yoshimi, Akira; Miyazawa, Ken; Abe, Keietsu

    2017-11-18

    Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.

  6. Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

    PubMed Central

    Avni, Sharon; Ezove, Nirit; Hanani, Hilla; Yadid, Itamar; Karpovsky, Michal; Hayby, Hilla; Gover, Ofer; Hadar, Yitzhak; Schwartz, Betty; Danay, Ofer

    2017-01-01

    Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe) of the fruit body contained higher glucan content then the caps (pileus). Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW) from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate. PMID:28718825

  7. Production of low-molecular weight soluble yeast β-glucan by an acid degradation method.

    PubMed

    Ishimoto, Yuina; Ishibashi, Ken-Ichi; Yamanaka, Daisuke; Adachi, Yoshiyuki; Kanzaki, Ken; Iwakura, Yoichiro; Ohno, Naohito

    2018-02-01

    β-glucan is widely distributed in nature as water soluble and insoluble forms. Both forms of β-glucan are utilized in several fields, especially for functional foods. Yeast β-glucan is a medically important insoluble particle. Solubilization of yeast β-glucan may be valuable for improving functional foods and in medicinal industries. In the present study, we applied an acid degradation method to solubilize yeast β-glucan and found that β-glucan was effectively solubilized to low-molecular weight β-glucans by 45% sulfuric acid treatment at 20°C. The acid-degraded soluble yeast β-glucan (ad-sBBG) was further fractionated into a higher-molecular weight fraction (ad-sBBG-high) and a lower-molecular weight fraction (ad-sBBG-low). Since ad-sBBG-high contained mannan, while ad-sBBG-low contained it only scarcely, it was possible to prepare low-molecular weight soluble β-glucan with higher purity. In addition, ad-sBBG-low bound to dectin-1, which is an innate immunity receptor of β-glucan, and showed antagonistic activity against reactive oxygen production and cytokine synthesis by macrophages. Thus, this acid degradation method is an important procedure for generating immune-modulating, low-molecular weight, soluble yeast β-glucan. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii.

    PubMed

    Avni, Sharon; Ezove, Nirit; Hanani, Hilla; Yadid, Itamar; Karpovsky, Michal; Hayby, Hilla; Gover, Ofer; Hadar, Yitzhak; Schwartz, Betty; Danay, Ofer

    2017-07-18

    Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe) of the fruit body contained higher glucan content then the caps (pileus). Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW) from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

  9. Extraction and characterization of beta-D-glucan from oat for industrial utilization.

    PubMed

    Ahmad, Asif; Anjum, Faqir Muhammad; Zahoor, Tahir; Nawaz, Haq; Ahmed, Zaheer

    2010-04-01

    Oat beta-D-glucan is a valuable functional ingredient having numerous industrial, nutritional and health benefits. Its extraction needs careful attention as extraction process may affect the physiochemical and functional properties of extracted beta-D-glucan. The present study aimed at analyzing the effect of extraction of beta-D-glucan gum pellets from oat cultivar followed by detailed chemical and functional analysis. Enzymatic extraction process resulted in highest yield and recovery. Chemical analysis revealed protein as a dominating impurity. The water binding capacity of the beta-D-glucan ranged between 3.14 and 4.52 g g(-1) of sample. beta-D-Glucan exhibited ideal foaming stability when appropriate extraction technique was used. The viscosity of beta-D-glucan gum ranged between 35.6 and 56.16 cp. The color analysis showed L* value of beta-D-glucan gum pellet ranged between 72.18 and 83.54. Phosphorus, potassium and calcium appeared as major minerals in beta-D-glucan gum whereas iron, manganese and copper appeared as minor minerals. FTIR spectroscopy also confirms the presence of beta-D-glucan, protein and other components in extracted beta-D-glucan gum pellets. Overall, extracted beta-D-glucan showed a good potential for industrial usage. Copyright 2010 Elsevier B.V. All rights reserved.

  10. β-(1,3)-Glucan Exposure Assessment by Passive Airborne Dust Sampling and New Sensitive Immunoassays▿

    PubMed Central

    Noss, Ilka; Wouters, Inge M.; Bezemer, Gillina; Metwali, Nervana; Sander, Ingrid; Raulf-Heimsoth, Monika; Heederik, Dick J. J.; Thorne, Peter S.; Doekes, Gert

    2010-01-01

    Associations between house dust-associated β-(1,3)-glucan exposure and airway inflammatory reactions have been reported, while such exposures in early childhood have been suggested to protect against asthma and wheezing. Most epidemiological studies have used reservoir dust samples and an inhibition enzyme immunoassay (EIA) for β-(1,3)-glucan exposure assessment. The objective of this study was to develop inexpensive but highly sensitive enzyme immunoassays to measure airborne β-(1,3)-glucans in low-exposure environments, like homes. Specificities of available anti-β-(1,3)-glucan antibodies were defined by direct and inhibition experiments. Three suitable antibody combinations were selected for sandwich EIAs. β-(1,3)-Glucans in passive airborne dust collected with an electrostatic dust fall collector (EDC) and floor dust from seven homes were measured with the three EIAs. Floor dust samples were additionally analyzed in the inhibition EIA. The sandwich EIAs were sensitive enough for airborne glucan measurement and showed different specificities for commercial glucans, while the β-(1,3)-glucan levels in house dust samples correlated strongly. The feasibility of measuring glucans in airborne dust with the recently introduced EDC method was further investigated by selecting the most suitable of the three EIAs to measure and compare β-(1,3)-glucan levels in the EDC and in floor and actively collected airborne dust samples of the previously performed EDC validation study. The EDC β-(1,3)-glucan levels correlated moderately with β-(1,3)-glucans in actively collected airborne dust and floor dust samples, while the glucan levels in the airborne dust and floor dust samples did not correlate. The combination of the newly developed β-(1,3)-glucan sandwich EIA with EDC sampling now allows assessment in large-scale population studies of exposure to airborne β-(1,3)-glucans in homes or other low-exposure environments. PMID:20038709

  11. Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

    NASA Astrophysics Data System (ADS)

    Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

    2009-07-01

    β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

  12. Mechanistic Insights into Glucan Phosphatase Activity against Polyglucan Substrates*

    PubMed Central

    Meekins, David A.; Raththagala, Madushi; Auger, Kyle D.; Turner, Benjamin D.; Santelia, Diana; Kötting, Oliver; Gentry, Matthew S.; Vander Kooi, Craig W.

    2015-01-01

    Glucan phosphatases are central to the regulation of starch and glycogen metabolism. Plants contain two known glucan phosphatases, Starch EXcess4 (SEX4) and Like Sex Four2 (LSF2), which dephosphorylate starch. Starch is water-insoluble and reversible phosphorylation solubilizes its outer surface allowing processive degradation. Vertebrates contain a single known glucan phosphatase, laforin, that dephosphorylates glycogen. In the absence of laforin, water-soluble glycogen becomes insoluble, leading to the neurodegenerative disorder Lafora Disease. Because of their essential role in starch and glycogen metabolism glucan phosphatases are of significant interest, yet a comparative analysis of their activities against diverse glucan substrates has not been established. We identify active site residues required for specific glucan dephosphorylation, defining a glucan phosphatase signature motif (CζAGΨGR) in the active site loop. We further explore the basis for phosphate position-specific activity of these enzymes and determine that their diverse phosphate position-specific activity is governed by the phosphatase domain. In addition, we find key differences in glucan phosphatase activity toward soluble and insoluble polyglucan substrates, resulting from the participation of ancillary glucan-binding domains. Together, these data provide fundamental insights into the specific activity of glucan phosphatases against diverse polyglucan substrates. PMID:26231210

  13. Structural Mechanisms of Plant Glucan Phosphatases in Starch Metabolism

    PubMed Central

    Meekins, David A.; Vander Kooi, Craig W.; Gentry, Matthew S.

    2016-01-01

    Glucan phosphatases are a recently discovered class of enzymes that dephosphorylate starch and glycogen, thereby regulating energy metabolism. Plant genomes encode for two glucan phosphatases called Starch EXcess4 (SEX4) and Like Sex Four2 (LSF2) that regulate starch metabolism by selectively dephosphorylating glucose moieties within starch glucan chains. Recently, the structures of both SEX4 and LSF2 were determined, with and without phosphoglucan products bound, revealing the mechanism for their unique activities. This review explores the structural and enzymatic features of the plant glucan phosphatases and outlines how they are uniquely adapted for carrying out their cellular functions. We outline the physical mechanisms employed by SEX4 and LSF2 to interact with starch glucans: SEX4 binds glucan chains via a continuous glucan binding platform comprised of its Dual Specificity Phosphatase (DSP) domain and Carbohydrate Binding Module (CBM) while LSF2 utilizes Surface Binding Sites (SBSs). SEX4 and LSF2 both contain a unique network of aromatic residues in their catalytic DSP domains that serve as glucan engagement platforms and are unique to the glucan phosphatases. We also discuss the phosphoglucan substrate specificities inherent to SEX4 and LSF2 and outline structural features within the active site that govern glucan orientation. This review defines the structural mechanism of the plant glucan phosphatases with respect to phosphatases, starch metabolism, and protein-glucan interaction; thereby providing a framework for their applications in both agricultural and industrial settings. PMID:26934589

  14. Novel structural features in Candida albicans hyphal glucan provide a basis for differential innate immune recognition of hyphae versus yeast.

    PubMed

    Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L

    2014-02-07

    The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.

  15. Novel Structural Features in Candida albicans Hyphal Glucan Provide a Basis for Differential Innate Immune Recognition of Hyphae Versus Yeast*

    PubMed Central

    Lowman, Douglas W.; Greene, Rachel R.; Bearden, Daniel W.; Kruppa, Michael D.; Pottier, Max; Monteiro, Mario A.; Soldatov, Dmitriy V.; Ensley, Harry E.; Cheng, Shih-Chin; Netea, Mihai G.; Williams, David L.

    2014-01-01

    The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. 1H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or “closed chain” structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae. PMID:24344127

  16. Beta-1-3-Glucan effect on sow antibody production and passive immunization of Progeny

    USDA-ARS?s Scientific Manuscript database

    Beta-glucans are glucose homopolymers known to modulate immunity. Here, the beta-glucan effect on sow antibody production and passive immunization of neonatal pigs was analyzed. Treatments included: 1) Corn-soy fed control group, 2) beta-glucan, 3) App vaccination, and 4) beta-glucan + App vaccinati...

  17. Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi

    PubMed Central

    Yoshimi, Akira; Miyazawa, Ken; Abe, Keietsu

    2017-01-01

    Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan. PMID:29371579

  18. Production of beta-glucan and related glucan-hydrolases by Botryosphaeria rhodina.

    PubMed

    Crognale, S; Bruno, M; Fidaleo, M; Moresi, M; Petruccioli, M

    2007-03-01

    Characterization of beta-glucan production from Botryosphaeria rhodina DABAC-P82 by detecting simultaneously glucan-hydrolytic enzymes and their localization, culture medium rheology and oxygen transfer. Mycelium growth, beta-glucan production, substrate consumption and glucan-hydrolytic enzymes were monitored both in shaken flasks and in a 3-l stirred-tank bioreactor. Glucan production (19.7 and 15.2 g l(-1), in flask and bioreactor, respectively) was accompanied by extra-cellular and cell-bound beta-glucanase and beta-glucosidase activities. In the bioreactor scale, in the time interval of 0-78 h the apparent viscosity of the culture broth exhibited a general increase; thereafter, it began to reduce, probably because of the above glucan-hydrolytic activities. Moreover, the culture media collected after 45 h behaved as solid-like materials at shear rates smaller than 0.001 s(-1), as pseudo-plastic liquids in the middle shear rate range and as Newtonian ones at shear rates greater than 1000 s(-1). The greatest beta-glucan accumulation in the bioreactor was found to be associated with nitrogen and dissolved oxygen concentrations smaller than 0.15 g l(-1) and 25%, respectively, and with the peak points of the glucan-degrading enzymes. A careful analysis of the critical factors (such as, culture broth rheology, oxygen mass transfer and glucan-hydrolytic enzymes) limiting the beta-glucan production by B. rhodina is a prerequisite to maximize beta-glucan yield and production, as well as to define the process flow sheet capable of maximizing biopolymer recovery, solvent re-utilization and glucose consumption.

  19. Effects of functional β-glucan on proliferation, differentiation, metabolism and its anti-fibrosis properties in muscle cells.

    PubMed

    Li, Yan; Fan, Yihui; Pan, Haiou; Qian, Haifeng; Qi, Xiguang; Wu, Gangcheng; Zhang, Hui; Xu, Meijuan; Rao, Zhiming; Wang, Li; Ying, Hao

    2018-05-26

    Skeletal muscles plays a crucial role in metabolism and exercise. Fuctional β-glucan is polysaccharide that is found in the cell walls of cereal, which is known to reduce cholesterol and lipid, prevent diabetes, cancer and cardiovascular diseases. In an attempt to identify β-glucan that could promote skeletal muscle function, we analyzed the proliferation, differentiation, metabolism and anti-fibrotic properties of β-glucan in C2C12 muscle cells. Treatment of β-glucan in C2C12 myoblasts led to increased proliferation and differentiation. Besides that, we found that C2C12 myotubes treated with β-glucan displayed a fast-to-slow muscle fiber conversion and improved oxidative metabolism. Further study revealed that β-glucan treatment could prevent myotubes from becoming myofibroblasts. Together, our study suggests that functional β-glucan might have a therapeutic potential to improve skeletal muscle function, which might contribute to the development of β-glucan. Copyright © 2018. Published by Elsevier B.V.

  20. Lipid oxidation induced oxidative degradation of cereal beta-glucan.

    PubMed

    Wang, Yu-Jie; Mäkelä, Noora; Maina, Ndegwa Henry; Lampi, Anna-Maija; Sontag-Strohm, Tuula

    2016-04-15

    In food systems, lipid oxidation can cause oxidation of other molecules. This research for the first time investigated oxidative degradation of β-glucan induced by lipid oxidation using an oil-in-water emulsion system which simulated a multi-phased aqueous food system containing oil and β-glucan. Lipid oxidation was monitored using peroxide value and hexanal production while β-glucan degradation was evaluated by viscosity and molecular weight measurements. The study showed that while lipid oxidation proceeded, β-glucan degradation occurred. Emulsions containing β-glucan, oil and ferrous ion showed significant viscosity and molecular weight decrease after 1 week of oxidation at room temperature. Elevated temperature (40°C) enhanced the oxidation reactions causing higher viscosity drop. In addition, the presence of β-glucan appeared to retard the hexanal production in lipid oxidation. The study revealed that lipid oxidation may induce the degradation of β-glucan in aqueous food systems where β-glucan and lipids co-exist. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Suppressing effects of glucan on micronuclei induced by Co60 in mice.

    PubMed

    Chorvatovicová, D

    1991-10-01

    The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P less than 0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy.

  2. Fibrinolytic, anti-inflammatory and anti-microbial properties of α-(1-3)-glucans produced from Streptococcus mutans (MTCC 497).

    PubMed

    Buddana, Sudheer Kumar; Varanasi, Yaswanth Venkata Naga; Shetty, Prakasham Reddy

    2015-01-22

    Streptococcus mutans (MTCC 497) cell associated α-(1-3)-glucans were isolated, characterized and evaluated for their bioactivity profile. Acid hydrolysis of α-(1-3)-glucans revealed presence of glucose moieties. Water insoluble α-(1-3)-glucans (WIG) were sulfated to convert them into water soluble glucans which were characterized by FT-IR spectral studies. The sulfation of WIG was confirmed by the presence of -O-SO3- and C-O-SO3- characteristic peaks at 1240 and 820 cm(-1). MALDI-TOF analysis of sulfated α-(1-3)-glucan revealed 1.2 to 9kDa fragmentation. Antibacterial profile studies revealed higher growth inhibitory activity against Gram negative than Gram positive bacterial strains by sulfated α-(1-3)-glucans. One-fold higher anti-inflammatory activity with IC50 value of 0.11mg/ml was observed with sulfated α-(1-3)-glucans over WIG. Time dependent fibrinolytic potential without requirement of tissue plasminogen activators was observed for sulfated α-(1-3)-glucans. This is the first report demonstrating the fibrinolytic and anti-inflammatory property for sulfated α-(1-3)-glucans. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Binding of Soluble Yeast β-Glucan to Human Neutrophils and Monocytes is Complement-Dependent

    PubMed Central

    Bose, Nandita; Chan, Anissa S. H.; Guerrero, Faimola; Maristany, Carolyn M.; Qiu, Xiaohong; Walsh, Richard M.; Ertelt, Kathleen E.; Jonas, Adria Bykowski; Gorden, Keith B.; Dudney, Christine M.; Wurst, Lindsay R.; Danielson, Michael E.; Elmasry, Natalie; Magee, Andrew S.; Patchen, Myra L.; Vasilakos, John P.

    2013-01-01

    The immunomodulatory properties of yeast β-1,3/1,6 glucans are mediated through their ability to be recognized by human innate immune cells. While several studies have investigated binding of opsonized and unopsonized particulate β-glucans to human immune cells mainly via complement receptor 3 (CR3) or Dectin-1, few have focused on understanding the binding characteristics of soluble β-glucans. Using a well-characterized, pharmaceutical-grade, soluble yeast β-glucan, this study evaluated and characterized the binding of soluble β-glucan to human neutrophils and monocytes. The results demonstrated that soluble β-glucan bound to both human neutrophils and monocytes in a concentration-dependent and receptor-specific manner. Antibodies blocking the CD11b and CD18 chains of CR3 significantly inhibited binding to both cell types, establishing CR3 as the key receptor recognizing the soluble β-glucan in these cells. Binding of soluble β-glucan to human neutrophils and monocytes required serum and was also dependent on incubation time and temperature, strongly suggesting that binding was complement-mediated. Indeed, binding was reduced in heat-inactivated serum, or in serum treated with methylamine or in serum reacted with the C3-specific inhibitor compstatin. Opsonization of soluble β-glucan was demonstrated by detection of iC3b, the complement opsonin on β-glucan-bound cells, as well as by the direct binding of iC3b to β-glucan in the absence of cells. Binding of β-glucan to cells was partially inhibited by blockade of the alternative pathway of complement, suggesting that the C3 activation amplification step mediated by this pathway also contributed to binding. PMID:23964276

  4. Reduced and high molecular weight barley beta-glucans decrease plasma total and non-HDL-cholesterol in hypercholesterolemic Syrian golden hamsters.

    PubMed

    Wilson, Thomas A; Nicolosi, Robert J; Delaney, Bryan; Chadwell, Kim; Moolchandani, Vikas; Kotyla, Timothy; Ponduru, Sridevi; Zheng, Guo-Hua; Hess, Richard; Knutson, Nathan; Curry, Leslie; Kolberg, Lore; Goulson, Melanie; Ostergren, Karen

    2004-10-01

    Consumption of concentrated barley beta-glucan lowers plasma cholesterol because of its soluble dietary fiber nature. The role of molecular weight (MW) in lowering serum cholesterol is not well established. Prior studies showed that enzymatic degradation of beta-glucan eliminates the cholesterol-lowering activity; however, these studies did not evaluate the MW of the beta-glucan. The current study was conducted to evaluate whether barley beta-glucan concentrates, partially hydrolyzed to reduce MW, possess cholesterol-lowering and antiatherogenic activities. The reduced MW fraction was compared with a high MW beta-glucan concentrate from the same barley flour. Concentrated beta-glucan preparations were evaluated in Syrian Golden F(1)B hamsters fed a hypercholesterolemic diet (HCD) with cholesterol, hydrogenated coconut oil, and cellulose. After 2 wk, hamsters were fed HCD or diets that contained high or reduced MW beta-glucan at a concentration of 8 g/100 g at the expense of cellulose. Decreases in plasma total cholesterol (TC) and non-HDL-cholesterol (non-HDL-C) concentrations occurred in the hamsters fed reduced MW and high MW beta-glucan diets. Plasma HDL-C concentrations did not differ. HCD-fed hamsters had higher plasma triglyceride concentrations. Liver TC, free cholesterol, and cholesterol ester concentrations did not differ. Aortic cholesterol ester concentrations were lower in the reduced MW beta-glucan-fed hamsters. Consumption of either high or reduced MW beta-glucan increased concentrations of fecal total neutral sterols and coprostanol, a cholesterol derivative. Fecal excretion of cholesterol was greater than in HCD-fed hamsters only in those fed the reduced MW beta-glucan. Study results demonstrate that the cholesterol-lowering activity of barley beta-glucan may occur at both lower and higher MW.

  5. The effects of β-glucan on human immune and cancer cells

    PubMed Central

    Chan, Godfrey Chi-Fung; Chan, Wing Keung; Sze, Daniel Man-Yuen

    2009-01-01

    Non-prescriptional use of medicinal herbs among cancer patients is common around the world. The alleged anti-cancer effects of most herbal extracts are mainly based on studies derived from in vitro or in vivo animal experiments. The current information suggests that these herbal extracts exert their biological effect either through cytotoxic or immunomodulatory mechanisms. One of the active compounds responsible for the immune effects of herbal products is in the form of complex polysaccharides known as β-glucans. β-glucans are ubiquitously found in both bacterial or fungal cell walls and have been implicated in the initiation of anti-microbial immune response. Based on in vitro studies, β-glucans act on several immune receptors including Dectin-1, complement receptor (CR3) and TLR-2/6 and trigger a group of immune cells including macrophages, neutrophils, monocytes, natural killer cells and dendritic cells. As a consequence, both innate and adaptive response can be modulated by β-glucans and they can also enhance opsonic and non-opsonic phagocytosis. In animal studies, after oral administration, the specific backbone 1→3 linear β-glycosidic chain of β-glucans cannot be digested. Most β-glucans enter the proximal small intestine and some are captured by the macrophages. They are internalized and fragmented within the cells, then transported by the macrophages to the marrow and endothelial reticular system. The small β-glucans fragments are eventually released by the macrophages and taken up by other immune cells leading to various immune responses. However, β-glucans of different sizes and branching patterns may have significantly variable immune potency. Careful selection of appropriate β-glucans is essential if we wish to investigate the effects of β-glucans clinically. So far, no good quality clinical trial data is available on assessing the effectiveness of purified β-glucans among cancer patients. Future effort should direct at performing well-designed clinical trials to verify the actual clinical efficacy of β-glucans or β-glucans containing compounds. PMID:19515245

  6. Preparation and evaluation of β-glucan hydrogel prepared by the radiation technique for drug carrier applications.

    PubMed

    Park, Jong-Seok; Lim, Youn-Mook; Baik, Jae; Jeong, Jin-Oh; An, Sung-Jun; Jeong, Sung-In; Gwon, Hui-Jeong; Khil, Myung-Seob

    2018-06-14

    β-Glucan can provide excellent environment to apply to drug carrier due to its immunological and anti-inflammatory effect. Minocycline hydrochloride (MH) has excellent oral bioavailability pharmacological properties. Specifically, MH is effectively absorbed into the gingiva for periodontal disease treatment. In this study, we attempt to develop MH loaded β-glucan hydrogel for periodontal disease treatment through radiation-crosslinking technique. In addition, MH loaded β-glucan hydrogels were tested for their cytotoxicity and antibacterial activity. Finally, we conducted an in vivo study to demonstrate the potential to prevent the invasion of bacteria to treat periodontal disease. The gel content and compressive strength of the β-glucan hydrogels increased as the β-glucan content and the absorbed dose (up to 7 kGy) increased. For a radiation dose of 7 kGy, the gelation and the compressive strength of a 6 wt% β-glucan hydrogel were approximately 92% and 270 kPa, respectively. As a drug, MH was consistently released from β-glucan hydrogels, reaching 80% at approximately 90 min. Furthermore, the MH loaded β-glucan hydrogels showed no cytotoxicity. The MH loaded β-glucan hydrogels exhibited good antibacterial activity against Porphyromonas gingivalis. In addition, MH loaded β-glucan hydrogel demonstrated the potential of a good capability to prevent the invasion of bacteria and to treat wounds. Copyright © 2017. Published by Elsevier B.V.

  7. Clinical and Physiological Perspectives of β-Glucans: The Past, Present, and Future

    PubMed Central

    Bashir, Khawaja Muhammad Imran; Choi, Jae-Suk

    2017-01-01

    β-Glucans are a group of biologically-active fibers or polysaccharides from natural sources with proven medical significance. β-Glucans are known to have antitumor, anti-inflammatory, anti-obesity, anti-allergic, anti-osteoporotic, and immunomodulating activities. β-Glucans are natural bioactive compounds and can be taken orally, as a food supplement, or as part of a daily diet, and are considered safe to use. The medical significance and efficiency of β-glucans are confirmed in vitro, as well as using animal- and human-based clinical studies. However, systematic study on the clinical and physiological significance of β-glucans is scarce. In this review, we not only discuss the clinical and physiological importance of β-glucans, we also compare their biological activities through the existing in vitro and animal-based in vivo studies. This review provides extensive data on the clinical study of β-glucans. PMID:28872611

  8. 6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.

    PubMed

    Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu

    2016-02-12

    With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.

  9. An Amylase-Like Protein, AmyD, Is the Major Negative Regulator for α-Glucan Synthesis in Aspergillus nidulans during the Asexual Life Cycle.

    PubMed

    He, Xiaoxiao; Li, Shengnan; Kaminskyj, Susan

    2017-03-27

    α-Glucan affects fungal cell-cell interactions and is important for the virulence of pathogenic fungi. Interfering with production of α-glucan could help to prevent fungal infection. In our previous study, we reported that an amylase-like protein, AmyD, could repress α-glucan accumulation in Aspergillus nidulans . However, the underlying molecular mechanism was not clear. Here, we examined the localization of AmyD and found it was a membrane-associated protein. We studied AmyD function in α-glucan degradation, as well as with other predicted amylase-like proteins and three annotated α-glucanases. AmyC and AmyE share a substantial sequence identity with AmyD, however, neither affects α-glucan synthesis. In contrast, AgnB and MutA (but not AgnE) are functional α-glucanases that also repress α-glucan accumulation. Nevertheless, the functions of AmyD and these glucanases were independent from each other. The dynamics of α-glucan accumulation showed different patterns between the AmyD overexpression strain and the α-glucanase overexpression strains, suggesting AmyD may not be involved in the α-glucan degradation process. These results suggest the function of AmyD is to directly suppress α-glucan synthesis, but not to facilitate its degradation.

  10. β-glucan extract from oat bran and its industrial importance

    NASA Astrophysics Data System (ADS)

    Ibrahim, M. N. G.; Selezneva, I. S.

    2017-09-01

    The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.

  11. Differential pathways regulating innate and adaptive antitumor immune responses by particulate and soluble yeast-derived β-glucans

    PubMed Central

    Qi, Chunjian; Cai, Yihua; Gunn, Lacey; Ding, Chuanlin; Li, Bing; Kloecker, Goetz; Qian, Keqing; Vasilakos, John; Saijo, Shinobu; Iwakura, Yoichiro; Yannelli, John R.

    2011-01-01

    β-glucans have been reported to function as a potent adjuvant to stimulate innate and adaptive immune responses. However, β-glucans from different sources are differential in their structure, conformation, and thus biologic activity. Different preparations of β-glucans, soluble versus particulate, further complicate their mechanism of action. Here we show that yeast-derived particulate β-glucan activated dendritic cells (DCs) and macrophages via a C-type lectin receptor dectin-1 pathway. Activated DCs by particulate β-glucan promoted Th1 and cytotoxic T-lymphocyte priming and differentiation in vitro. Treatment of orally administered yeast-derived particulate β-glucan elicited potent antitumor immune responses and drastically down-regulated immunosuppressive cells, leading to the delayed tumor progression. Deficiency of the dectin-1 receptor completely abrogated particulate β-glucan–mediated antitumor effects. In contrast, yeast-derived soluble β-glucan bound to DCs and macrophages independent of the dectin-1 receptor and did not activate DCs. Soluble β-glucan alone had no therapeutic effect but significantly augmented antitumor monoclonal antibody-mediated therapeutic efficacy via a complement activation pathway but independent of dectin-1 receptor. These findings reveal the importance of different preparations of β-glucans in the adjuvant therapy and allow for the rational design of immunotherapeutic protocols usable in clinical trials. PMID:21531981

  12. Distribution and Molecular Characterization of β-Glucans from Hull-Less Barley Bran, Shorts and Flour

    PubMed Central

    Zheng, Xueling; Li, Limin; Wang, Qi

    2011-01-01

    Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12–13.01%), followed by bran (6.15–7.58%) and flour (2.48–2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38–71.41% β-glucan, 10.81–17.26% arabinoxylan, 2.6–9.6% protein, 2.7–9.0% starch, and 5.23–9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91–95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw. PMID:21673907

  13. The Effects of Orally Administered Beta-Glucan on Innate Immune Responses in Humans, a Randomized Open-Label Intervention Pilot-Study

    PubMed Central

    Leentjens, Jenneke; Quintin, Jessica; Gerretsen, Jelle; Kox, Matthijs; Pickkers, Peter; Netea, Mihai G.

    2014-01-01

    Rationale To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use. Methods We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10) or the control group (n = 5). Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity. Results β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan. Conclusion The present study does not support the use of oral β-glucan to enhance innate immune responses in humans. Trial Registration ClinicalTrials.gov NCT01727895 PMID:25268806

  14. Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.

    PubMed

    Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij

    2015-07-20

    Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Nutraceutical, Anti-Inflammatory, and Immune Modulatory Effects of β-Glucan Isolated from Yeast

    PubMed Central

    Bacha, Umar; Iqbal, Sanaullah; Anjum, Aftab Ahmad

    2017-01-01

    β-Glucan is a dietary fibre, found in many natural sources, and controls chronic metabolic diseases effectively. However, β-glucan from the yeast has rarely been investigated. Objectively, conditions were optimized to isolate β-glucan from the yeast (max. 66% yield); those optimized conditions included 1.0 M NaOH, pH 7.0, and 90°C. The purity and identity of the isolated β-glucan were characterized through FT-IR, SEM, DSC, and physicofunctional properties. The obtained results from DSC revealed highly stable β-glucan (m.p., 125°C) with antioxidant activity (TAC value 0.240 ± 0.0021 µg/mg, H2O2 scavenging 38%), which has promising bile acid binding 40.463% and glucose control (in vitro). In line with these results, we evaluated the in vivo anti-inflammatory potential, that is, myeloperoxidase activity and reduction in MDA and NO; protective effect on proteins and keeping viscosity within normal range exhibited improvement. Also, the in vivo cholesterol binding and reduction in the skin thickness by β-glucan were highly encouraging. Finally, our results confirmed that yeast β-glucan is effective against some of the inflammatory and oxidative stress markers studied in this investigation. In general, the effect of 4%  β-glucan was more noticeable versus 2%  β-glucan. Therefore, our results support the utilization of β-glucan as a novel, economically cheap, and functional food ingredient. PMID:28913359

  16. Effective production of biologically active water-soluble β-1,3-glucan by a coupled system of Agrobacterium sp. and Trichoderma harzianum.

    PubMed

    Liang, Ying; Zhu, Li; Gao, Minjie; Wu, Jianrong; Zhan, Xiaobei

    2018-05-28

    Water-soluble β-1,3-glucan (w-glucan) prepared from curdlan is reported to possess various bioactive and medicinal properties. To develop an efficient and cost-effective microbial fermentation method for the direct production of w-glucan, a coupled fermentation system of Agrobacterium sp. and Trichoderma harzianum (CFS-AT) was established. The effects of Tween-80, glucose flow rate, and the use of a dissolved oxygen (DO) control strategy on w-glucan production were assessed. The addition of 10 g L -1 Tween-80 to the CFS-AT enhanced w-glucan production, presumably by loosening the curdlan ultrastructure and increasing the efficiency of curdlan hydrolysis. A two-stage glucose and DO control strategy was optimal for w-glucan production. At the T. harzianum cell growth stage, the optimal glucose flow rate and agitation speed were 2.0 g L -1 hr -1 and 600 rpm, respectively, and at the w-glucan production stage, they were 0.5 g L -1 hr -1 and 400 rpm, respectively. W-glucan production reached 17.31 g L -1 , with a degree of polymerization of 19-25. Furthermore, w-glucan at high concentrations exhibited anti-tumor activity against MCF-7, HepG2, and Hela cancer cells in vitro. This study provides a novel, cost-effective, eco-friendly, and efficient microbial fermentation method for the direct production of biologically active w-glucan.

  17. Immunostimulant effects and potential application of β-glucans derived from marine yeast Debaryomyces hansenii in goat peripheral blood leucocytes.

    PubMed

    Medina-Córdova, Noé; Reyes-Becerril, Martha; Ascencio, Felipe; Castellanos, Thelma; Campa-Córdova, Angel I; Angulo, Carlos

    2018-05-12

    Debaryomyces hansenii has been described to be effective probiotic and immunostimulatory marine yeast in fish. Nonetheless, to the best of our knowledge, it has been not assayed in ruminants. This study attempts to describe the immunostimulatory effects of its β-glucan content through in vitro assays using goat peripheral blood leukocytes at 24 h of stimulation. The structural characterization of yeast glucans by proton nuclear magnetic resonance indicated structures containing (1-6)-branched (1-3)-β-D-glucan. In vitro assays using peripheral blood leukocytes stimulated with β-glucans derived from three D. hansenii strains and zymosan revealed that β-glucans significantly increased cell immune parameters, such as phagocytic ability, reactive oxygen species production (respiratory burst), peroxidase activity and nitric oxide production. Antioxidant enzymes revealed an increase in superoxide dismutase and catalase activities in leukocytes stimulated with yeast β-glucans. This study revealed that yeast β-glucans were able to activate dectin-1 mRNA gene expression in leukocytes. The TLR4 gene expression was up-regulated in leukocytes after stimulation with yeast β-glucans. In conclusion, β-glucans were able to modulate the immune system by promoting cell viability, phagocytic activity, antioxidant immune response and immune-related gene expression in leukocytes. Therefore, β-glucans derived from Debaryomyces hansenii should be considered a potential immunostimulant for goat production systems. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. β-1,3-Glucan, Which Can Be Targeted by Drugs, Forms a Trabecular Scaffold in the Oocyst Walls of Toxoplasma and Eimeria

    PubMed Central

    Bushkin, G. Guy; Motari, Edwin; Magnelli, Paula; Gubbels, Marc-Jan; Dubey, Jitender P.; Miska, Katarzyna B.; Bullitt, Esther; Costello, Catherine E.; Robbins, Phillips W.; Samuelson, John

    2012-01-01

    ABSTRACT The walls of infectious pathogens, which are essential for transmission, pathogenesis, and diagnosis, contain sugar polymers that are defining structural features, e.g., β-1,3-glucan and chitin in fungi, chitin in Entamoeba cysts, β-1,3-GalNAc in Giardia cysts, and peptidoglycans in bacteria. The goal here was to determine in which of three walled forms of Toxoplasma gondii (oocyst, sporocyst, or tissue cyst) is β-1,3-glucan, the product of glucan synthases and glucan hydrolases predicted by whole-genome sequences of the parasite. The three most important discoveries were as follows. (i) β-1,3-glucan is present in oocyst walls of Toxoplasma and Eimeria (a chicken parasite that is a model for intestinal stages of Toxoplasma) but is absent from sporocyst and tissue cyst walls. (ii) Fibrils of β-1,3-glucan are part of a trabecular scaffold in the inner layer of the oocyst wall, which also includes a glucan hydrolase that has a novel glucan-binding domain. (iii) Echinocandins, which target the glucan synthase and kill fungi, arrest development of the Eimeria oocyst wall and prevent release of the parasites into the intestinal lumen. In summary, β-1,3-glucan, which can be targeted by drugs, is an important component of oocyst walls of Toxoplasma but is not a component of sporocyst and tissue cyst walls. PMID:23015739

  19. POLYSACCHARIDES FROM CELL WALLS OF AUREOBASIDIUM (PULLULARIA) PULLULANS. PART I. GLUCANS,

    DTIC Science & Technology

    The cell wall of Aureobasidium (Pullularia) pullulans contains three types of beta - glucan . One, extracted with dilute alkali, has a linear backbone...insoluble in dilute alkali contains a highly crystalline, essentially linear linked glucan and an amorphous glucan . (Author)

  20. Aureobasidium-Derived Soluble Branched (1,3-1,6) β-Glucan (Sophy β-glucan) Enhances Natural Killer Activity in Leishmania amazonensis-Infected Mice

    PubMed Central

    Yatawara, Lalani; Wickramasinghe, Susiji; Nagataki, Mitsuru; Takamoto, Misa; Nomura, Haruka; Ikeue, Yasunori; Watanabe, Yoshiya

    2009-01-01

    The β-glucans derived from yeast cell walls have been reported for having many immunomodulatory activities in vivo and in vitro. In this study, Aureobasidium-derived soluble branched (1,3-1,6) β-glucan (Sophy β-glucan) was checked for natural killer (NK) activity and for the production of IFN-γ and IL-4 in Leishmania amazonensis infection. The main experiment was performed with a group of female C57BL/6 and BALB/c mice, orally supplemented with 5% of Sophy β-glucan and infected with promastogotes of L. amazonensis (1 × 107) into the footpad. Increase in the footpad thickness with time was observed in BALB/c mice in spite of the oral Sophy β-glucan supplement, but it was less in C57BL/6 mice. The difference in overall mean footpad thickness between 'infection only' versus 'infection + glucan' groups was statistically significant (P < 0.001). High NK activity in C57BL/6 than BALB/c mice was observed in 'glucan only' group compared to the control group and also in 'infection + glucan' group compared to 'infection only' group. The difference in the NK activity among these groups was significant (P < 0.05). The IFN-γ level increased at weeks 7 and 8 post-infection in C57BL/6 mice and was significantly high in 'infection + glucan' group compared to the 'infection only' group (P < 0.05). IL-4 levels did not increase up to detectable levels throughout the study. The results led a conclusion that Sophy β-glucan enhances NK activity and cellular immunity in L. amazonensis-infected mice. PMID:19967081

  1. Elongated phytoglycogen chain length in transgenic rice endosperm expressing active starch synthase IIa affects the altered solubility and crystallinity of the storage α-glucan

    PubMed Central

    Fujita, Naoko; Toyosawa, Yoshiko; Utsumi, Yoshinori

    2012-01-01

    The relationship between the solubility, crystallinity, and length of the unit chains of plant storage α-glucan was investigated by manipulating the chain length of α-glucans accumulated in a rice mutant. Transgenic lines were produced by introducing a cDNA for starch synthase IIa (SSIIa) from an indica cultivar (SSIIa I, coding for active SSIIa) into an isoamylase1 (ISA1)-deficient mutant (isa1) that was derived from a japonica cultivar (bearing inactive SSIIa proteins). The water-soluble fraction accounted for >95% of the total α-glucan in the isa1 mutant, whereas it was only 35–70% in the transgenic SSIIa I /isa1 lines. Thus, the α-glucans from the SSIIa I /isa1 lines were fractionated into soluble and insoluble fractions prior to the following characterizations. X-ray diffraction analysis revealed a weak B-type crystallinity for the α-glucans of the insoluble fraction, while no crystallinity was confirmed for α-glucans in isa1. Concerning the degree of polymerization (DP) ≤30, the chain lengths of these α-glucans differed significantly in the order of SSIIa I /isa1 insoluble > SSIIa I /isa1 soluble > α-glucans in isa1. The amount of long chains with DP ≥33 was higher in the insoluble fraction α-glucans than in the other two α-glucans. No difference was observed in the chain length distributions of the β-amylase limit dextrins among these α-glucans. These results suggest that in the SSIIa I /isa1 transgenic lines, the unit chains of α-glucans were elongated by SSIIaI, whereas the expression of SSIIaI did not affect the branch positions. Thus, the observed insolubility and crystallinity of the insoluble fraction can be attributed to the elongated length of the outer chains due to SSIIaI. PMID:23048127

  2. Effect of β-glucan on MUC4 and MUC5B expression in human airway epithelial cells.

    PubMed

    Kim, Yong-Dae; Bae, Chang Hoon; Song, Si-Youn; Choi, Yoon Seok

    2015-08-01

    β-Glucan is found in the cell walls of fungi, bacteria, and some plant tissues, and is detected by the innate immune system. Furthermore, this recognition is known to worsen respiratory symptoms in patients with allergic and inflammatory airway diseases. However, the means by which β-glucan affects the secretion of major mucins by human airway epithelial cells has not been elucidated. Therefore, in this study, the effect and signaling pathway of β-glucan on mucins MUC4 and MUC5B were investigated in human airway epithelial cells. In NCI-H292 cells and human normal nasal epithelial cells, the effect and signaling pathway of β-glucan on MUC4 and MUC5B expression were investigated using reverse transcriptase-polymerase chain reaction (RT-PCR), real-time PCR, enzyme immunoassay, and immunoblot analysis with specific inhibitors and small interfering RNA (siRNA). β-Glucan increased MUC4 and MUC5B expression and activated the phosphorylation of p38 mitogen-activated protein kinase (MAPK) and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). SB203580 (a p38 MAPK inhibitor) and pyrrolidine dithiocarbamate (PDTC; a NF-κB inhibitor) inhibited β-glucan-induced MUC4 and MUC5B expression. In addition, siRNA knockdown of p38 MAPK blocked β-glucan-induced MUC4 and MUC5B mRNA expression and β-glucan-activated phosphorylation of NF-κB. Furthermore, Toll-like receptor 4 (TLR4) mRNA expression was increased by β-glucan, and siRNA knockdown of TLR4 blocked β-glucan-induced MUC4 and MUC5B mRNA expression and β-glucan-activated phosphorylation of p38 MAPK and NF-κB. These results demonstrate that in human airway epithelial cells β-glucan induces MUC4 and MUC5B expression via the TLR4-p38 MAPK-NF-κB signaling pathway. © 2015 ARS-AAOA, LLC.

  3. Effects of Purified Saccharomyces cerevisiae (1→3)-β-Glucan on Venous Ulcer Healing

    PubMed Central

    Medeiros, Sarah Dantas Viana; Cordeiro, Sara Lima; Cavalcanti, Jéssica Escorel Chaves; Melchuna, Karina Mendes; Lima, Aleida Maria da Silva; Filho, Irami Araújo; Medeiros, Aldo Cunha; Rocha, Keyla Borges Ferreira; Oliveira, Elizabeth Maia; Faria, Eduardo Dantas Baptista; Sassaki, Guilherme Lanzi; Rocha, Hugo Alexandre Oliveira; Sales, Valéria Soraya Farias

    2012-01-01

    Water-insoluble glucan was isolated from the baker’s yeast Saccharomyces cerevisiae. The yeast cells were treated with alkali and the residue then with acid. Chemical and NMR (1D and 2D) analyses showed that a linear (1→3)-β-glucan was purified that was not contaminated with other carbohydrates, proteins or phenolic compounds. The effects of the glucan on wound healing were assessed in human venous ulcers by histopathological analysis after 30 days of topical treatment. (1→3)-β-glucan enhanced ulcer healing and increased epithelial hyperplasia, as well as increased inflammatory cells, angiogenesis and fibroblast proliferation. In one patient who had an ulcer that would not heal for over 15 years, glucan treatment caused a 67.8% decrease in the area of the ulcer. This is the first study to investigate the effects of (1→3)-β-glucan on venous ulcer healing in humans; our findings suggest that this glucan is a potential natural biological response modifier in wound healing. PMID:22942695

  4. Potential of glucans as vaccine adjuvants: A review of the α-glucans case.

    PubMed

    Moreno-Mendieta, Silvia; Guillén, Daniel; Hernández-Pando, Rogelio; Sánchez, Sergio; Rodríguez-Sanoja, Romina

    2017-06-01

    α-Glucans are present in virtually all domains of life, and these glucose chains linked by α-1,4- and α-1,6-linked branches form the most important storage carbohydrates in cells. It is likely for this reason that α-glucans are not generally considered as bioactive molecules as β-glucans are. Nevertheless, it is known that depending on their source, many α-glucans play important roles as modulators of immune response. Recent efforts have attempted to elucidate the mechanisms through which α-glucans exert their immunostimulant effects; however, the main challenge is the accurate identification of the receptors of immune cells involved in their recognition. Here, we review the adjuvant properties reported for some polysaccharides and ultimately focus on α-glucans and how their structural characteristics, such as molecular weight, solubility and derivatization, influence their immunostimulatory properties. As a final point, we discuss the potential and associated challenges of using these polysaccharides as adjuvants, particularly in mucosal vaccination. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Physicochemical properties of beta-glucan in differently processed oat foods influence glycemic response.

    PubMed

    Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J

    2009-10-14

    To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.

  6. Immunomodulatory effects of beta-glucan on neutrophil function in fathead minnows (Pimephales promelas Rafinesque, 1820).

    PubMed

    Palić, Dusan; Andreasen, Claire B; Herolt, Dawn M; Menzel, Bruce W; Roth, James A

    2006-01-01

    Stimulatory effects of yeast beta-1,3-1,6-glucans on neutrophils have long been recognized, but effects of glucans on degranulation of primary granules in fish neutrophils have not been previously reported. Neutrophil function was monitored during in vitro and in vivo application of glucans to non- (NS), acute- (AS) and chronically stressed (CS) fish. beta-Glucan proved to be a strong and quick (80%, 2 min) stimulant of degranulation. Dietary glucan increased degranulation in NS fish, and prevented a decrease in AS fish. Degranulation in CS fish returned to NS levels 3 days after the glucan diet was fed. Fathead minnows appear to be a useful model to investigate neutrophil degranulation in fish exposed to different environmental conditions and immunomodulators. Use of beta-glucans in fish diets prior to AS and during chronic stress can enhance neutrophil function, potentially increasing disease resistance and survival rates after transportation or exposure to poor water quality.

  7. Effect of storage conditions on the solubility and viscosity of β-glucan extracted from bread under in vitro conditions.

    PubMed

    Moriartey, Stephanie; Temelli, Feral; Vasanthan, Thava

    2011-01-01

    The viscosity and solubility of β-glucan in muffins have been shown to be reduced by certain storage conditions, though the effect of storage on bread fortified with barley β-glucan concentrate has not been investigated. Therefore, this study investigated the effect of storage temperature and time (23 °C for 1, 4, and 7 d, 4 °C for 4, 7, and 14 d, and -20 °C for 1, 2, 4, and 8 wk) on the solubility and viscosity of β-glucan upon incorporation into bread at levels corresponding to 0 or 1.5 g β-glucan/serving, with or without vital gluten addition. The firmness and moisture content of bread following each storage treatment were also evaluated. The highest moisture and lowest firmness values were found in fresh bread, though these parameters were still maintained at appreciable levels upon room temperature storage of the 1.5 g β-glucan/serving bread with added gluten and at either room temperature or frozen storage for the 1.5 g β-glucan/serving bread for 4 d. If it is desirable to store bread for 7 d or more, frozen storage should be utilized in order to best maintain bread moisture and firmness levels. It is recommended that β-glucan-fortified bread be consumed fresh for greatest β-glucan solubility and viscosity, though β-glucan solubility of approximately 40% is still achievable upon frozen storage of the bread for up to 2 wk. It is still unclear, however, as to what extent of reductions in the solubility and viscosity of β-glucan would lower its physiological effectiveness. Previous research has demonstrated that solubility and thus viscosity of β-glucan, which is an important property associated with its health benefits can be impacted by different storage conditions applied to some bakery products, like muffins. This study demonstrates the extent of changes in the solubility and viscosity of β-glucan incorporated into bread. Therefore, storage time and temperature should be optimized to minimize changes in β-glucan for maintaining its efficacy for its health benefits.

  8. The structure of a β-(1→3)-d-glucan from yeast cell walls

    PubMed Central

    Manners, David J.; Masson, Alan J.; Patterson, James C.

    1973-01-01

    Yeast glucan as normally prepared by various treatments of yeast (Saccharomyces cerevisiae) cell walls to remove mannan and glycogen is still heterogeneous. The major component (about 85%) is a branched β-(1→3)-glucan of high molecular weight (about 240000) containing 3% of β-(1→6)-glucosidic interchain linkages. The minor component is a branched β-(1→6)-glucan. A comparison of our results with those of other workers suggests that different glucan preparations may differ in the degree of heterogeneity and that the major β-(1→3)-glucan component may vary considerably in degree of branching. PMID:4359920

  9. Histoplasma capsulatum α-(1,3)-glucan blocks innate immune recognition by the β-glucan receptor

    PubMed Central

    Rappleye, Chad A.; Eissenberg, Linda Groppe; Goldman, William E.

    2007-01-01

    Successful infection by fungal pathogens depends on subversion of host immune mechanisms that detect conserved cell wall components such as β-glucans. A less common polysaccharide, α-(1,3)-glucan, is a cell wall constituent of most fungal respiratory pathogens and has been correlated with pathogenicity or linked directly to virulence. However, the precise mechanism by which α-(1,3)-glucan promotes fungal virulence is unknown. Here, we show that α-(1,3)-glucan is present in the outermost layer of the Histoplasma capsulatum yeast cell wall and contributes to pathogenesis by concealing immunostimulatory β-glucans from detection by host phagocytic cells. Production of proinflammatory TNFα by phagocytes was suppressed either by the presence of the α-(1,3)-glucan layer on yeast cells or by RNA interference based depletion of the host β-glucan receptor dectin-1. Thus, we have functionally defined key molecular components influencing the initial host–pathogen interaction in histoplasmosis and have revealed an important mechanism by which H. capsulatum thwarts the host immune system. Furthermore, we propose that the degree of this evasion contributes to the difference in pathogenic potential between dimorphic fungal pathogens and opportunistic fungi. PMID:17227865

  10. Immune-modulatory effects of dietary Yeast Beta-1,3/1,6-D-glucan

    PubMed Central

    2014-01-01

    Beta-glucans are a heterogeneous group of natural polysaccharides mostly investigated for their immunological effects. Due to the low systemic availability of oral preparations, it has been thought that only parenterally applied beta-glucans can modulate the immune system. However, several in vivo and in vitro investigations have revealed that orally applied beta-glucans also exert such effects. Various receptor interactions, explaining possible mode of actions, have been detected. The effects mainly depend on the source and structure of the beta-glucans. In the meantime, several human clinical trials with dietary insoluble yeast beta-glucans have been performed. The results confirm the previous findings of in vivo studies. The results of all studies taken together clearly indicate that oral intake of insoluble yeast beta-glucans is safe and has an immune strengthening effect. PMID:24774968

  11. Immunomodulation of Fungal β-Glucan in Host Defense Signaling by Dectin-1

    PubMed Central

    Batbayar, Sainkhuu; Lee, Dong Hee; Kim, Ha Won

    2012-01-01

    During the course of evolution, animals encountered the harmful effects of fungi, which are strong pathogens. Therefore, they have developed powerful mechanisms to protect themselves against these fungal invaders. β-Glucans are glucose polymers of a linear β(1,3)-glucan backbone with β(1,6)-linked side chains. The immunostimulatory and antitumor activities of β-glucans have been reported; however, their mechanisms have only begun to be elucidated. Fungal and particulate β-glucans, despite their large size, can be taken up by the M cells of Peyer's patches, and interact with macrophages or dendritic cells (DCs) and activate systemic immune responses to overcome the fungal infection. The sampled β-glucans function as pathogen-associated molecular patterns (PAMPs) and are recognized by pattern recognition receptors (PRRs) on innate immune cells. Dectin-1 receptor systems have been incorporated as the PRRs of β-glucans in the innate immune cells of higher animal systems, which function on the front line against fungal infection, and have been exploited in cancer treatments to enhance systemic immune function. Dectin-1 on macrophages and DCs performs dual functions: internalization of β-glucan-containing particles and transmittance of its signals into the nucleus. This review will depict in detail how the physicochemical nature of β-glucan contributes to its immunostimulating effect in hosts and the potential uses of β-glucan by elucidating the dectin-1 signal transduction pathway. The elucidation of β-glucan and its signaling pathway will undoubtedly open a new research area on its potential therapeutic applications, including as immunostimulants for antifungal and anti-cancer regimens. PMID:24009832

  12. The Eng1 β-Glucanase Enhances Histoplasma Virulence by Reducing β-Glucan Exposure

    PubMed Central

    Garfoot, Andrew L.; Shen, Qian; Wüthrich, Marcel; Klein, Bruce S.

    2016-01-01

    ABSTRACT The fungal pathogen Histoplasma capsulatum parasitizes host phagocytes. To avoid antimicrobial immune responses, Histoplasma yeasts must minimize their detection by host receptors while simultaneously interacting with the phagocyte. Pathogenic Histoplasma yeast cells, but not avirulent mycelial cells, secrete the Eng1 protein, which is a member of the glycosylhydrolase 81 (GH81) family. We show that Histoplasma Eng1 is a glucanase that hydrolyzes β-(1,3)-glycosyl linkages but is not required for Histoplasma growth in vitro or for cell separation. However, Histoplasma yeasts lacking Eng1 function have attenuated virulence in vivo, particularly during the cell-mediated immunity stage. Histoplasma yeasts deficient for Eng1 show increased exposure of cell wall β-glucans, which results in enhanced binding to the Dectin-1 β-glucan receptor. Consistent with this, Eng1-deficient yeasts trigger increased tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6) cytokine production from macrophages and dendritic cells. While not responsible for large-scale cell wall structure and function, the secreted Eng1 reduces levels of exposed β-glucans at the yeast cell wall, thereby diminishing potential recognition by Dectin-1 and proinflammatory cytokine production by phagocytes. In α-glucan-producing Histoplasma strains, Eng1 acts in concert with α-glucan to minimize β-glucan exposure: α-glucan provides a masking function by covering the β-glucan-rich cell wall, while Eng1 removes any remaining exposed β-glucans. Thus, Histoplasma Eng1 has evolved a specialized pathogenesis function to remove exposed β-glucans, thereby enhancing the ability of yeasts to escape detection by host phagocytes. PMID:27094334

  13. [beta]-Glucan Synthesis in the Cotton Fiber (III. Identification of UDP-Glucose-Binding Subunits of [beta]-Glucan Synthases by Photoaffinity Labeling with [[beta]-32P]5[prime]-N3-UDP-Glucose.

    PubMed Central

    Li, L.; Drake, R. R.; Clement, S.; Brown, R. M.

    1993-01-01

    Using differential product entrapment and photolabeling under specifying conditions, we identifIed a 37-kD polypeptide as the best candidate among the UDP-glucose-binding polypeptides for the catalytic subunit of cotton (Gossypium hirsutum) cellulose synthase. This polypeptide is enriched by entrapment under conditions favoring [beta]-1,4-glucan synthesis, and it is magnesium dependent and sensitive to unlabeled UDP-glucose. A 52-kD polypeptide was identified as the most likely candidate for the catalytic subunit of [beta]-1,3-glucan synthase because this polypeptide is the most abundant protein in the entrapment fraction obtained under conditions favoring [beta]-1,3-glucan synthesis, is coincident with [beta]-1,3-glucan synthase activity, and is calcium dependent. The possible involvement of other polypeptides in the synthesis of [beta]-1,3-glucan is discussed. PMID:12231766

  14. Brucella β 1,2 Cyclic Glucan Is an Activator of Human and Mouse Dendritic Cells

    PubMed Central

    Martirosyan, Anna; Pérez-Gutierrez, Camino; Banchereau, Romain; Dutartre, Hélène; Lecine, Patrick; Dullaers, Melissa; Mello, Marielle; Pinto Salcedo, Suzana; Muller, Alexandre; Leserman, Lee; Levy, Yves; Zurawski, Gerard; Zurawski, Sandy; Moreno, Edgardo; Moriyón, Ignacio; Klechevsky, Eynav; Banchereau, Jacques; Oh, SangKon; Gorvel, Jean-Pierre

    2012-01-01

    Bacterial cyclic glucans are glucose polymers that concentrate within the periplasm of alpha-proteobacteria. These molecules are necessary to maintain the homeostasis of the cell envelope by contributing to the osmolarity of Gram negative bacteria. Here, we demonstrate that Brucella β 1,2 cyclic glucans are potent activators of human and mouse dendritic cells. Dendritic cells activation by Brucella β 1,2 cyclic glucans requires TLR4, MyD88 and TRIF, but not CD14. The Brucella cyclic glucans showed neither toxicity nor immunogenicity compared to LPS and triggered antigen-specific CD8+ T cell responses in vivo. These cyclic glucans also enhanced antigen-specific CD4+ and CD8+ T cell responses including cross-presentation by different human DC subsets. Brucella β 1,2 cyclic glucans increased the memory CD4+ T cell responses of blood mononuclear cells exposed to recombinant fusion proteins composed of anti-CD40 antibody and antigens from both hepatitis C virus and Mycobacterium tuberculosis. Thus cyclic glucans represent a new class of adjuvants, which might contribute to the development of effective antimicrobial therapies. PMID:23166489

  15. Re-examination of cellular cyclic beta-1,2-glucans of Rhizobiaceae: distribution of ring sizes and degrees of glycerol-1-phosphate substitution.

    PubMed

    Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H

    1990-04-01

    Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.

  16. Aureobasidium pullulans produced β-glucan is effective to enhance Kurosengoku soybean extract induced Thrombospondin-1 expression.

    PubMed

    Muramatsu, Daisuke; Okabe, Mitsuyasu; Takaoka, Akinori; Kida, Hiroshi; Iwai, Atsushi

    2017-06-06

    Black yeast, Aureobasidium pullulans is extracellularly produced β-(1,3), (1,6)-D-glucan (β-glucan) under certain conditions. In this study, using Glycine max cv. Kurosengoku (Kurosengoku soybeans), the production of β-glucan through fermentation of A. pullulans was evaluated, and the effects of A. pullulans cultured fluid (AP-CF) containing β-glucan made with Kurosengoku soybeans (kAP-CF) on a human monocyte derived cell line, Mono Mac 6 cells were investigated. Concentration of β-glucan in kAP-CF reached the same level as normal AP-CF. An anti-angiogenic protein, Thrombospondin-1 (THBS1) was effectively induced after the stimulation with kAP-CF for comparison with AP-CF. The THBS1 is also induced after stimulation with hot water extract of Kurosengoku soybeans (KS-E), while the combined stimulation of β-glucan with KS-E more effectively induced THBS1 than that with KS-E alone. These results suggest effects of A. pullulans-produced β-glucan on the enhancement of Kurosengoku soybean-induced THBS1 expression.

  17. Stimulated hemopoiesis and enhanced survival following glucan treatment in sublethally and lethally irradiated mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Patchen, M.L.; MacVittie, T.J.

    1985-01-01

    Hemopoietic effects of the reticuloendothelial agent glucan were assayed in normal mice and in mice hemopoietically depleted by exposure to /sup 60/Co radiation. In normal mice, glucan administration increased the content of bone marrow and splenic transplantable pluripotent hemopoietic stem cells (CFU-2), committed granulocyte-macrophage progenitor cells (GM-CFC), and pure macrophage progenitor cells (M-CFC). Erythroid progenitor cells (CFU-e) were increased only in the spleen. In sublethally irradiated mice (650 rads), glucan increased the number of endogeneous pluripotent hemopoietic stem cells (E-CFU) when administered either before or after irradiation. The most pronounced effects were observed when glucan was administered 1 day before,more » 1 h before, or 1 h after irradiation. In addition, the administration of glucan before lethal irradiation (900 rads) enhanced survival. The most significant results were seen when glucan was administered 1 day prior to irradiation. The possibility of using agents such as glucan to enhance hemopoietic reconstitution and prevent septicemia following chemotherapy and/or radiotherapy is discussed.« less

  18. Effect of γ-irradiation on structure and nutraceutical potential of β-D-glucan from barley (Hordeum vulgare).

    PubMed

    Shah, Asima; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Gani, Adil; Masoodi, Farooq Ahmad; Wani, Idrees Ahmed; Wani, Sajad Mohd; Gani, Asir

    2015-01-01

    This paper reports the characterization and potential antioxidant activity of β-D-glucan isolated from barley treated with γ-rays. The β-D-glucan was irradiated with 0, 2, 4 and 8 kGy by gamma ray. The samples were characterized by Fourier transform-infrared spectroscopy, gel permeation chromatography (GPC) and quantitative estimation by Megazyme β-D-glucan assay kit. The average molecular weight of non-irradiated β-D-glucan was 177 kDa that decreased to 79 kDa at 8 kGy. Antioxidant activity was evaluated by five complementary assays including DPPH, lipid peroxidation, reducing power, metal chelating ability and oxidative DNA damage assays. Further, the antiproliferative potential of irradiated β-D-glucan was tested against three human cancer cell lines including Colo-205, T47D and MCF7 using MTT assay. Irradiated β-D-glucan exhibited dose dependent cancer cell growth inhibition. In conclusion, the present study demonstrates that irradiation leads to the formation of low molecular weight β-D-glucan with enhanced antioxidant and antiproliferative activities. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. (1→6)- and (1→3)(1→6)-β-glucans from Lasiodiplodia theobromae MMBJ: Structural characterization and pro-inflammatory activity.

    PubMed

    Oliveira, Kassandra S M; Di Bastiani, Mirela; Cordeiro, Lucimara M C; Costa, Mírian F; Toledo, Karina A; Iacomini, Marcello; Babosa, Aneli M; Dekker, Robert F H; Nascimento, Valéria M G

    2015-11-20

    The chemical composition and structural characterization of exopolysaccharides from the fungus Lasiodiplodia theobromae MMBJ are described, and the immunomodulatory activity of a purified β-glucan was evaluated. L. theobromae MMBJ produced three different β-glucans. One, fraction PEPS, was a branched (1→3)(1→6)-β-glucan and was insoluble in cold water. The other two, fractions SEPS-005R and SEPS-10E, were characterized as linear (1→6)-β-glucans with molar mass of 1.8×10(6)Da and 7.0×10(3)Da, respectively. From a total of 2.2g/L of EPS produced by L. theobromae through submerged fermentation, 1.5g/L (67%) was of the branched (1→3)(1→6)-β-glucan, while 25% (w/w) were linear (1→6)-β-glucans. Tests conducted with macrophages showed that the high molar mass (1→6)-β-glucan fraction (SEPS-005R) induced a pro-inflammatory response pattern. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Evidence for Proinflammatory β-1,6 Glucans in the Pneumocystis carinii Cell Wall

    PubMed Central

    Kottom, Theodore J.; Hebrink, Deanne M.; Jenson, Paige E.; Gudmundsson, Gunnar

    2015-01-01

    Inflammation is a major cause of respiratory impairment during Pneumocystis pneumonia. Studies support a significant role for cell wall β-glucans in stimulating inflammatory responses. Fungal β-glucans are comprised of d-glucose homopolymers containing β-1,3-linked glucose backbones with β-1,6-linked glucose side chains. Prior studies in Pneumocystis carinii have characterized β-1,3 glucan components of the organism. However, recent investigations in other organisms support important roles for β-1,6 glucans, predominantly in mediating host cellular activation. Accordingly, we sought to characterize β-1,6 glucans in the cell wall of Pneumocystis and to establish their activity in lung cell inflammation. Immune staining revealed specific β-1,6 localization in P. carinii cyst walls. Homology-based cloning facilitated characterization of a functional P. carinii kre6 (Pckre6) β-1,6 glucan synthase in Pneumocystis that, when expressed in kre6-deficient Saccharomyces cerevisiae, restored cell wall stability. Recently synthesized β-1,6 glucan synthase inhibitors decreased the ability of isolated P. carinii preparations to generate β-1,6 carbohydrate. In addition, isolated β-1,6 glucan fractions from Pneumocystis elicited vigorous tumor necrosis factor alpha (TNF-α) responses from macrophages. These inflammatory responses were significantly dampened by inhibition of host cell plasma membrane microdomain function. Together, these studies indicate that β-1,6 glucans are present in the P. carinii cell wall and contribute to lung cell inflammatory activation during infection. PMID:25916991

  1. (1-->6)-beta-D-glucan as cell wall receptor for Pichia membranifaciens killer toxin.

    PubMed

    Santos, A; Marquina, D; Leal, J A; Peinado, J M

    2000-05-01

    The killer toxin from Pichia membranifaciens CYC 1106, a yeast isolated from fermenting olive brines, binds primarily to the (1-->6)-beta-D-glucan of the cell wall of a sensitive yeast (Candida boidinii IGC 3430). The (1-->6)-beta-D-glucan was purified from cell walls of C. boidinii by alkali and hot-acetic acid extraction, a procedure which solubilizes glucans. The major fraction of receptor activity remained with the alkali-insoluble (1-->6)-beta- and (1-->3)-beta-D-glucans. The chemical (gas-liquid chromatography) and structural (periodate oxidation, infrared spectroscopy, and (1)H nuclear magnetic resonance) analyses of the fractions obtained showed that (1-->6)-beta-D-glucan was a receptor. Adsorption of most of the killer toxin to the (1-->6)-beta-D-glucan was complete within 2 min. Killer toxin adsorption to the linear (1-->6)-beta-D-glucan, pustulan, and a glucan from Penicillium allahabadense was observed. Other polysaccharides with different linkages failed to bind the killer toxin. The specificity of the killer toxin for its primary receptor provides an effective means to purify the killer toxin, which may have industrial applications for fermentations in which salt is present as an adjunct, such as olive brines. This toxin shows its maximum killer activity in the presence of NaCl. This report is the first to identify the (1-->6)-beta-D-glucan as a receptor for this novel toxin.

  2. Macrophage Internalization of Fungal β-Glucans Is Not Necessary for Initiation of Related Inflammatory Responses

    PubMed Central

    McCann, Frances; Carmona, Eva; Puri, Vishwajeet; Pagano, Richard E.; Limper, Andrew H.

    2005-01-01

    Cell wall β-glucans are highly conserved structural components of fungi that potently trigger inflammatory responses in an infected host. Identification of molecular mechanisms responsible for internalization and signaling of fungal β-glucans should enhance our understanding of innate immune responses to fungi. In this study, we demonstrated that internalization of fungal β-glucan particles requires actin polymerization but not participation of components of caveolar uptake mechanisms. Using fluorescence microscopy, we observed that uptake of 5-([4,6-dichlorotriazin-2-yl] amino)-fluorescein hydrochloride-Celite complex-labeled Saccharomyces cerevisiae β-glucan by RAW macrophages was substantially reduced in the presence of cytochalasin D, which antagonizes actin-mediated internalization pathways, but not by treatment with nystatin, which blocks caveolar uptake. Interestingly, β-glucan-induced NF-κB translocation, which is necessary for inflammatory activation, and tumor necrosis factor alpha production were both normal in the presence of cytochalasin D, despite defective internalization of β-glucan particles following actin disruption. Dectin-1, a major β-glucan receptor on macrophages, colocalized to phagocytic cups on macrophages and exhibited tyrosine phosphorylation after challenge with β-glucan particles. Dectin-1 localization and other membrane markers were not affected by treatment with cytochalasin D. Furthermore, dectin-1 receptors rather than Toll-like receptor 2 receptors were shown to be necessary for both efficient internalization of β-glucan particles and cytokine release in response to the fungal cell wall component. PMID:16177305

  3. Effect of purified oat β-glucan on fermentation of set-style yogurt mix.

    PubMed

    Singh, Mukti; Kim, Sanghoon; Liu, Sean X

    2012-08-01

    Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.

  4. Amphiphilic polymeric micelles originating from 1,4-β-D-glucan-g-polyphenylene oxide as the carriers for delivery of docetaxel and the corresponding release behaviors.

    PubMed

    Yang, Fang; Xiao, Dan; Han, Huaxin; Chen, Yuhuan; Li, Gang

    2018-07-15

    A novel amphiphilic polymeric drug carrier was synthesized through grafting polymerization of water-soluble 1,4-β-D-glucan from cotton cellulose tailored and polypropylene oxide (PPO), and then use thereof to synthesize graft copolymer 1,4-β-D-glucan-PPO-docetaxel (DTX). The products were characterized by FTIR, 1 H NMR, and 13 C NMR. The physicochemical characteristics of 1,4-β-D-glucan-PPO and 1,4-β-D-glucan-PPO-DTX such as molecular weight distribution (MWD), micro-morphology, size, critical micelle concentration (CMC), aggregation number of micelle (N), in vitro stability and drug pharmacokinetic study in vivo were investigated. The results reveal that the degree of polymerization (DP) of the water-soluble 1,4-β-D-glucan from cotton cellulose tailored is equal to 7; the 1,4-β-D-glucan-PPO surfactant possesses good surface activity while the adduct number of propylene oxide reaches appropriately to 20; the DTX is completely dispersed in water medium with 1,4-β-D-glucan-PPO-DTX micelle and the drug conjugated percent is up to 40.3%; In vitro study confirms that 1,4-β-D-glucan-PPO-DTX has the capacity for sustained drug release; In plasma, 1,4-β-D-glucan-PPO-DTX exhibits a significantly enhanced C max , AUC (0-t) and T 1/2 compared with DTX. These results demonstrate that 1,4-β-D-glucan-PPO has the potential to be used as a novel biocompatible biomaterial for drug delivery. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Metabolic Network for the Biosynthesis of Intra- and Extracellular α-Glucans Required for Virulence of Mycobacterium tuberculosis

    PubMed Central

    van de Weerd, Robert; Chandra, Govind; Appelmelk, Ben; Alber, Marina; Ioerger, Thomas R.; Jacobs, William R.; Geurtsen, Jeroen; Bornemann, Stephen

    2016-01-01

    Mycobacterium tuberculosis synthesizes intra- and extracellular α-glucans that were believed to originate from separate pathways. The extracellular glucose polymer is the main constituent of the mycobacterial capsule that is thought to be involved in immune evasion and virulence. However, the role of the α-glucan capsule in pathogenesis has remained enigmatic due to an incomplete understanding of α-glucan biosynthetic pathways preventing the generation of capsule-deficient mutants. Three separate and potentially redundant pathways had been implicated in α-glucan biosynthesis in mycobacteria: the GlgC-GlgA, the Rv3032 and the TreS-Pep2-GlgE pathways. We now show that α-glucan in mycobacteria is exclusively assembled intracellularly utilizing the building block α-maltose-1-phosphate as the substrate for the maltosyltransferase GlgE, with subsequent branching of the polymer by the branching enzyme GlgB. Some α-glucan is exported to form the α-glucan capsule. There is an unexpected convergence of the TreS-Pep2 and GlgC-GlgA pathways that both generate α-maltose-1-phosphate. While the TreS-Pep2 route from trehalose was already known, we have now established that GlgA forms this phosphosugar from ADP-glucose and glucose 1-phosphate 1000-fold more efficiently than its hitherto described glycogen synthase activity. The two routes are connected by the common precursor ADP-glucose, allowing compensatory flux from one route to the other. Having elucidated this unexpected configuration of the metabolic pathways underlying α-glucan biosynthesis in mycobacteria, an M. tuberculosis double mutant devoid of α-glucan could be constructed, showing a direct link between the GlgE pathway, α-glucan biosynthesis and virulence in a mouse infection model. PMID:27513637

  6. Fungal β-glucan, a Dectin-1 ligand, promotes protection from Type 1 Diabetes by inducing regulatory innate immune response1

    PubMed Central

    Karumuthil-Melethil, Subha; Gudi, Radhika; Johnson, Benjamin M.; Perez, Nicolas; Vasu, Chenthamarakshan

    2014-01-01

    Beta-glucans (β-glucans) are naturally occurring polysaccharides in cereal grains, mushrooms, algae, or microbes including bacteria, fungi, and yeast. Immune cells recognize these β-glucans through a cell surface pathogen recognition receptor (PRR) called Dectin-1. Studies using β-glucans and other Dectin-1 binding components have demonstrated the potential of these agents in activating the immune cells for cancer treatment and controlling infections. Here, we show that the β-glucan from Saccharomyces cerevisiae induces the expression of immune regulatory cytokines (IL-10, TGF-β1 and IL-2) and a tolerogenic enzyme (Indoleamine 2, 3-dioxygenase; IDO) in bone marrow derived DCs (BM DCs) as well as spleen cells. These properties can be exploited to modulate autoimmunity in non-obese diabetic (NOD) mouse model of type 1 diabetes (T1D). Treatment of pre-diabetic NOD mice with low dose β-glucan resulted in a profound delay in hyperglycemia and this protection was associated with increase in the frequencies of Foxp3-, LAP-, and GARP-positive T cells. Upon antigen presentation, β-glucan-exposed DCs induced a significant increase in Foxp3− and LAP− positive T cells in in vitro cultures. Further, systemic co-administration of β-glucan plus pancreatic β-cell-Ag resulted in an enhanced protection of NOD mice from T1D as compared to treatment with β-glucan alone. These observations demonstrate that the innate immune response induced by low dose β-glucan is regulatory in nature and can be exploited to modulate T cell response to β-cell-Ag for inducing an effective protection from T1D. PMID:25143443

  7. β-Glucan from Saccharomyces cerevisiae Induces IFN-γ Production In Vivo in BALB/c Mice.

    PubMed

    Javmen, Artur; Nemeikaitė-Čėnienė, Aušra; Bratchikov, Maksim; Grigiškis, Saulius; Grigas, Fortūnatas; Jonauskienė, Irena; Zabulytė, Danguolė; Mauricas, Mykolas

    2015-01-01

    β-Glucan is one of the most abundant polymers in nature and has been established as an immunomodulator. This compound has notable physiological effects on mammalian immune systems, including anti-tumor and anti-infective activities and can activate the immune response. It is considered that the immune-stimulating activities of β-glucan can depend on physicochemical parameters, such as molecular size. Saccharomyces cerevisiae, also known as baker's yeast, is a frequently used source of β-glucan. The aim of the experiments was to investigate how different Saccharomyces cerevisiae β-glucan preparations with different molecular size affect interferon-gamma (IFN-γ) production in BALB/c mice. In vivo and in vitro BALB/c mouse models were used for the investigations. Different β-glucan preparations were orally administrated in the in vivo experiments. IFN-γ production in BALB/c mice was analyzed by enzyme-linked immunosorbent assay and measuring interferon-γ RNA concentration. The results showed that orally-administered β-glucan from S. cerevisiae enhanced IFN-γ production in BALB/c mice in the in vivo model, but not by mouse leukocytes in vitro. Moreover, water-soluble β-glucan enhanced IFN-γ production more effectively than did particulate β-glucan. IFN-γ plays an important role in immunity against viral and bacterial infections. Our experiments have shown that β-glucan preparations enhance IFN-γ production in BALB/c mice and can be potentially used for immune system stimulation in mammals. Current results may be used to develop soluble β-glucan nutritional supplements. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  8. Vitronectin and fibronectin function as glucan binding proteins augmenting macrophage responses to Pneumocystis carinii.

    PubMed

    Vassallo, R; Kottom, T J; Standing, J E; Limper, A H

    2001-08-01

    beta-glucans represent major structural components of fungal cell walls. We recently reported that Pneumocystis carinii beta-glucans stimulate alveolar macrophages to release proinflammatory cytokines. Macrophage activation by beta-glucan is augmented by serum, implying the presence of circulating factors that interact with beta-glucans and enhance their ability to stimulate macrophages. Using beta-glucan-enriched cell wall fractions from P. carinii and Saccharomyces cerevisiae, two prominent proteins were precipitated from serum and demonstrated to be vitronectin (VN) and fibronectin (FN) by immune analysis. Preincubation of beta-glucan with VN or FN enhanced macrophage activation in response to this cell wall component. Because VN and FN accumulate in the lungs during P. carinii pneumonia, we further investigated hepatic and pulmonary expression of VN and FN messenger RNA during infection. P. carinii pneumonia in rodents is associated with increased hepatic expression of VN and FN as well as increased local expression of FN in the lung. Because interleukin (IL)-6 represents the major regulator of VN and FN expression during inflammatory conditions, we measured macrophage IL-6 release in response to stimulation with P. carinii beta-glucan. Stimulation of macrophages with P. carinii beta-glucan induced significant release of IL-6. Elevated concentrations of IL-6 were noted in the blood of infected animals compared with uninfected control animals. These studies indicate that VN and FN bind to beta-glucan components of P. carinii and augment macrophage inflammatory responses. P. carinii cell wall beta-glucan stimulates secretion of IL-6 by macrophages, thereby enhancing hepatic synthesis of both VN and FN, and lung synthesis of FN during pneumonia.

  9. Simultaneous intake of beta-glucan and plant stanol esters affects lipid metabolism in slightly hypercholesterolemic subjects.

    PubMed

    Theuwissen, Elke; Mensink, Ronald P

    2007-03-01

    Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.

  10. High Molecular Weight Barley β-Glucan Alters Gut Microbiota Toward Reduced Cardiovascular Disease Risk

    PubMed Central

    Wang, Yanan; Ames, Nancy P.; Tun, Hein M.; Tosh, Susan M.; Jones, Peter J.; Khafipour, Ehsan

    2016-01-01

    The physiological cholesterol-lowering benefits of β-glucan have been well documented, however, whether modulation of gut microbiota by β-glucan is associated with these physiological effects remains unknown. The objectives of this study were therefore to determine the impact of β-glucan on the composition of gut microbiota in mildly hypercholesterolemic individuals and to identify if the altered microbiota are associated with bioactivity of β-glucan in improving risk factors of cardiovascular disease (CVD). Using a randomized, controlled crossover study design, individuals received for 5-week either a treatment breakfast containing 3 g high molecular weight (HMW), 3 g low molecular weight (LMW), 5 g LMW barley β-glucan, or wheat and rice. The American Heart Association (AHA) diet served as the background diet for all treatment groups. Phases were separated by 4-week washout periods. Fecal samples were collected at the end of each intervention phase and subjected to Illumina sequencing of 16S rRNA genes. Results revealed that at the phylum level, supplementation of 3 g/d HMW β-glucan increased Bacteroidetes and decreased Firmicutes abundances compared to control (P < 0.001). At the genus level, consumption of 3 g/d HMW β-glucan increased Bacteroides (P < 0.003), tended to increase Prevotella (P < 0.1) but decreased Dorea (P < 0.1), whereas diets containing 5 g LMW β-glucan and 3 g LMW β-glucan failed to alter the gut microbiota composition. Bacteroides, Prevotella, and Dorea composition correlated (P < 0.05) with shifts of CVD risk factors, including body mass index, waist circumference, blood pressure, as well as triglyceride levels. Our data suggest that consumption of HMW β-glucan favorably alters the composition of gut microbiota and this altered microbiota profile associates with a reduction of CVD risk markers. Together, our study suggests that β-glucan induced shifts in gut microbiota in a MW-dependent manner and that might be one of the underlying mechanisms responsible for the physiological benefits of β-glucan. PMID:26904005

  11. Binding of glucosyltransferase and glucan synthesis by Streptococcus mutans and other bacteria.

    PubMed

    Hamada, S; Tai, S; Slade, H D

    1978-07-01

    Lyophilized and heat-treated cells from the seven serotypes of Streptococcus mutans were examined for their ability to bind added insoluble-product glucosyl-transferase (GTase) and to synthesize cell-associated glucan from [(14)C]sucrose. Lyophilized cells of serotypes a and g did not synthesize any more additional glucan than did the controls after exposure to GTase. These cells, however, synthesized four- to eightfold-greater quantities of glucan than did the cells of the remaining serotypes. Lyophilized cells of serotypes b, c, d, e, and f synthesized two- to threefold-greater quantities of glucan after exposure to GTase than did the controls without added enzyme. Lyophilized cells of serotypes a and g synthesized 6- to 10-fold-greater quantities of glucan than did heat-treated cells of the same strain after binding of GTase. Lyophilized cells of the remaining serotypes synthesized only 1.6- to 3.3-fold-greater quantities of glucan than did the heat-treated cells. These results demonstrate that heat treatment to inactivate cell-associated GTase does not create additional GTase binding sites in S. mutans and that serotypes a and g are considerably more active in cell-associated glucan synthesis than cells of the other five serotypes. Ten species of gram-positive and gram-negative bacteria from five genera which do not produce in vitro plaque synthesized 10- to 100-fold-less glucan than did the S. mutans strains after exposure to GTase. Of these species, S. sanguis, Actinomyces viscosus, and A. naeslundii synthesized the largest quantities of glucan. Three mutant strains of S. mutans which possess a reduced ability for in vitro adherence but do agglutinate with glucan or dextran synthesized only one-third as much glucan after binding of GTase as the control. These results are discussed in relation to in vitro and in vivo plaque development and the agglutination of S. mutans. The results support earlier findings which indicate that the presence of bacterial species other than S. mutans in smooth-surface dental plaque is due in part to contact of the cells with glucan in the developing plaque and not to the binding of cell-free GTase and the in situ synthesis of glucan. The results obtained with these representative strains of the seven serotypes of S. mutans may not apply to the same extent to other strains within the serotypes.

  12. Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192

    PubMed Central

    Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung

    2017-01-01

    ABSTRACT Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast (Saccharomyces cerevisiae) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter (malEFG1) and pullulanase (aapA) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable. Coupling classic forward genetics with next-generation sequencing, here we identified an ABC transporter ATP-binding protein (MalK) responsible for the import of insoluble yeast glucan breakdown products by B. breve JCM1192. We demonstrated the pleiotropic effects of the ABC transporter ATP-binding protein in maltose/maltooligosaccharide, raffinose, cellobiose, melibiose, and turanose transport. With the addition of transcriptional analysis, we propose that insoluble yeast glucans are broken down by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. PMID:28115383

  13. Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192.

    PubMed

    Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan

    2017-04-01

    Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable. Coupling classic forward genetics with next-generation sequencing, here we identified an ABC transporter ATP-binding protein (MalK) responsible for the import of insoluble yeast glucan breakdown products by B. breve JCM1192. We demonstrated the pleiotropic effects of the ABC transporter ATP-binding protein in maltose/maltooligosaccharide, raffinose, cellobiose, melibiose, and turanose transport. With the addition of transcriptional analysis, we propose that insoluble yeast glucans are broken down by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. Copyright © 2017 American Society for Microbiology.

  14. Barley and Oat beta-Glucan content measured by Calcofluor fluorescence in a microplate assay

    USDA-ARS?s Scientific Manuscript database

    Beta-glucans, linear glucan polymers of mixed linkage, are important constituents of cereal cell walls. They have important health benefits in the human diet, but also can negatively affect the use of barley grain as an animal feed. High beta-glucans in barley malt can also cause problems in brewi...

  15. Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Gang; Xu, Zhenjiang; Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn

    β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceaemore » of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.« less

  16. Unravelling Glucan Recognition Systems by Glycome Microarrays Using the Designer Approach and Mass Spectrometry*

    PubMed Central

    Palma, Angelina S.; Liu, Yan; Zhang, Hongtao; Zhang, Yibing; McCleary, Barry V.; Yu, Guangli; Huang, Qilin; Guidolin, Leticia S.; Ciocchini, Andres E.; Torosantucci, Antonella; Wang, Denong; Carvalho, Ana Luísa; Fontes, Carlos M. G. A.; Mulloy, Barbara; Childs, Robert A.; Feizi, Ten; Chai, Wengang

    2015-01-01

    Glucans are polymers of d-glucose with differing linkages in linear or branched sequences. They are constituents of microbial and plant cell-walls and involved in important bio-recognition processes, including immunomodulation, anticancer activities, pathogen virulence, and plant cell-wall biodegradation. Translational possibilities for these activities in medicine and biotechnology are considerable. High-throughput micro-methods are needed to screen proteins for recognition of specific glucan sequences as a lead to structure–function studies and their exploitation. We describe construction of a “glucome” microarray, the first sequence-defined glycome-scale microarray, using a “designer” approach from targeted ligand-bearing glucans in conjunction with a novel high-sensitivity mass spectrometric sequencing method, as a screening tool to assign glucan recognition motifs. The glucome microarray comprises 153 oligosaccharide probes with high purity, representing major sequences in glucans. Negative-ion electrospray tandem mass spectrometry with collision-induced dissociation was used for complete linkage analysis of gluco-oligosaccharides in linear “homo” and “hetero” and branched sequences. The system is validated using antibodies and carbohydrate-binding modules known to target α- or β-glucans in different biological contexts, extending knowledge on their specificities, and applied to reveal new information on glucan recognition by two signaling molecules of the immune system against pathogens: Dectin-1 and DC-SIGN. The sequencing of the glucan oligosaccharides by the MS method and their interrogation on the microarrays provides detailed information on linkage, sequence and chain length requirements of glucan-recognizing proteins, and are a sensitive means of revealing unsuspected sequences in the polysaccharides. PMID:25670804

  17. Soluble β-1,3/1,6-glucan in seaweed from the southern hemisphere and its immunomodulatory effect.

    PubMed

    Bobadilla, Francisca; Rodriguez-Tirado, Carolina; Imarai, Mónica; Galotto, María José; Andersson, Roger

    2013-01-30

    Five types of macroalgae from the southern hemisphere were analysed for the presence of β-1,3/1,6-glucan and its immunostimulant properties. We were able to extract soluble β-1,3/1,6-D-glucan from Durvillaea antarctica (Chamisso) Hariot (DA). The morphology of the brown algae influenced extraction, and the highest percentage of β-glucan was found in the fronds. The content of β-glucan in the stipes and holdfast was on average 33% and <5%, respectively, of that in the fronds. A simple laboratory extraction process was developed. A highly pure water-soluble polysaccharide, mainly composed of glucose residues, was obtained with a dominant average molecular weight of 6.9 kDa. NMR spectroscopy confirmed the polysaccharide structure to be of β-1,3/1,6-glucan type, comprising a β-1,3-glucan backbone and 21% degree of branching of β-1,6-glucan side chains. Mouse cells were exposed to four DA extract concentrations in water (50, 100, 250 and 500 μg/mL) and no adverse effects on survival were noted. Remarkably, the β-glucan induced a 16.9% increase in activated CD19+ B lymphocytes compared with the control sample. The optimal concentration for maximum activity was 100 μg DA extract/mL. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. The hepta-beta-glucoside elicitor-binding proteins from legumes represent a putative receptor family.

    PubMed

    Mithöfer, A; Fliegmann, J; Neuhaus-Url, G; Schwarz, H; Ebel, J

    2000-08-01

    The ability of legumes to recognize and respond to beta-glucan elicitors by synthesizing phytoalexins is consistent with the existence of a membrane-bound beta-glucan-binding site. Related proteins of approximately 75 kDa and the corresponding mRNAs were detected in various species of legumes which respond to beta-glucans. The cDNAs for the beta-glucan-binding proteins of bean and soybean were cloned. The deduced 75-kDa proteins are predominantly hydrophilic and constitute a unique class of glucan-binding proteins with no currently recognizable functional domains. Heterologous expression of the soybean beta-glucan-binding protein in tomato cells resulted in the generation of a high-affinity binding site for the elicitor-active hepta-beta-glucoside conjugate (Kd = 4.5 nM). Ligand competition experiments with the recombinant binding sites demonstrated similar ligand specificities when compared with soybean. In both soybean and transgenic tomato, membrane-bound, active forms of the glucan-binding proteins coexist with immunologically detectable, soluble but inactive forms of the proteins. Reconstitution of a soluble protein fraction into lipid vesicles regained beta-glucoside-binding activity but with lower affinity (Kd = 130 nM). We conclude that the beta-glucan elicitor receptors of legumes are composed of the 75 kDa glucan-binding proteins as the critical components for ligand-recognition, and of an as yet unknown membrane anchor constituting the plasma membrane-associated receptor complex.

  19. Further Studies of the Role of Cyclic β-Glucans in Symbiosis. An ndvC Mutant of Bradyrhizobium japonicum Synthesizes Cyclodecakis-(1→3)-β-Glucosyl1

    PubMed Central

    Bhagwat, Arvind A.; Mithöfer, Axel; Pfeffer, Philip E.; Kraus, Christine; Spickers, Nicole; Hotchkiss, Arland; Ebel, Jürgen; Keister, Donald L.

    1999-01-01

    The cyclic β-(1→3),β-(1→6)-d-glucan synthesis locus of Bradyrhizobium japonicum is composed of at least two genes, ndvB and ndvC. Mutation in either gene affects glucan synthesis, as well as the ability of the bacterium to establish a successful symbiotic interaction with the legume host soybean (Glycine max). B. japonicum strain AB-14 (ndvB::Tn5) does not synthesize β-glucans, and strain AB-1 (ndvC::Tn5) synthesizes a cyclic β-glucan lacking β-(1→6)-glycosidic bonds. We determined that the structure of the glucan synthesized by strain AB-1 is cyclodecakis-(1→3)-β-d-glucosyl, a cyclic β-(1→3)-linked decasaccharide in which one of the residues is substituted in the 6 position with β-laminaribiose. Cyclodecakis-(1→3)-β-d-glucosyl did not suppress the fungal β-glucan-induced plant defense response in soybean cotyledons and had much lower affinity for the putative membrane receptor protein than cyclic β-(1→3),β-(1→6)-glucans produced by wild-type B. japonicum. This is consistent with the hypothesis presented previously that the wild-type cyclic β-glucans may function as suppressors of a host defense response. PMID:10069844

  20. Structure of the Arabidopsis Glucan Phosphatase LIKE SEX FOUR2 Reveals a Unique Mechanism for Starch Dephosphorylation[W

    PubMed Central

    Meekins, David A.; Guo, Hou-Fu; Husodo, Satrio; Paasch, Bradley C.; Bridges, Travis M.; Santelia, Diana; Kötting, Oliver; Vander Kooi, Craig W.; Gentry, Matthew S.

    2013-01-01

    Starch is a water-insoluble, Glc-based biopolymer that is used for energy storage and is synthesized and degraded in a diurnal manner in plant leaves. Reversible phosphorylation is the only known natural starch modification and is required for starch degradation in planta. Critical to starch energy release is the activity of glucan phosphatases; however, the structural basis of dephosphorylation by glucan phosphatases is unknown. Here, we describe the structure of the Arabidopsis thaliana starch glucan phosphatase LIKE SEX FOUR2 (LSF2) both with and without phospho-glucan product bound at 2.3Å and 1.65Å, respectively. LSF2 binds maltohexaose-phosphate using an aromatic channel within an extended phosphatase active site and positions maltohexaose in a C3-specific orientation, which we show is critical for the specific glucan phosphatase activity of LSF2 toward native Arabidopsis starch. However, unlike other starch binding enzymes, LSF2 does not possess a carbohydrate binding module domain. Instead we identify two additional glucan binding sites located within the core LSF2 phosphatase domain. This structure is the first of a glucan-bound glucan phosphatase and provides new insights into the molecular basis of this agriculturally and industrially relevant enzyme family as well as the unique mechanism of LSF2 catalysis, substrate specificity, and interaction with starch granules. PMID:23832589

  1. β-Glucans Are Masked but Contribute to Pulmonary Inflammation During Pneumocystis Pneumonia

    PubMed Central

    Kutty, Geetha; Davis, A. Sally; Ferreyra, Gabriela A.; Qiu, Ju; Huang, Da Wei; Sassi, Monica; Bishop, Lisa; Handley, Grace; Sherman, Brad; Lempicki, Richard; Kovacs, Joseph A.

    2016-01-01

    β-glucans, which can activate innate immune responses, are a major component in the cell wall of the cyst form of Pneumocystis. In the current study, we examined whether β-1,3-glucans are masked by surface proteins in Pneumocystis and what role β-glucans play in Pneumocystis-associated inflammation. For 3 species, including Pneumocystis jirovecii, which causes Pneumocystis pneumonia in humans, Pneumocystis carinii, and Pneumocystis murina, β-1,3-glucans were masked in most organisms, as demonstrated by increased exposure following trypsin treatment. Using quantitative polymerase chain reaction and microarray techniques, we demonstrated in a mouse model of Pneumocystis pneumonia that treatment with caspofungin, an inhibitor of β-1,3-glucan synthesis, for 21 days decreased expression of a broad panel of inflammatory markers, including interferon γ, tumor necrosis factor α, interleukin 1β, interleukin 6, and multiple chemokines/chemokine ligands. Thus, β-glucans in Pneumocystis cysts are largely masked, which likely decreases innate immune activation; this mechanism presumably was developed for interactions with immunocompetent hosts, in whom organism loads are substantially lower. In immunosuppressed hosts with a high organism burden, organism death and release of glucans appears to be an important contributor to deleterious host inflammatory responses. PMID:27324243

  2. Immunomodulatory effect of glucan on specific and nonspecific immunity after vaccination in puppies.

    PubMed

    Haladová, Eva; Mojžišová, Jana; Smrčo, Peter; Ondrejková, Anna; Vojtek, Boris; Prokeš, Marián; Petrovová, Eva

    2011-03-01

    The objective of the study was to determine the immunostimulatory effect of β-(1,3/1,6)-D-glucan in puppies. The effect exerted on the efficacy of vaccination, especially against canine parvovirus and rabies infection, was studied. The application of vaccine and glucan leads to significant increases in the nonspecific immunological parameters (phagocytic ability of leukocytes, blastogenic response of lymphocytes, metabolic and chemotactic activity of polymorphonuclear cells). The level of antibodies against canine parvovirus (Ab CPV) and rabies infection reached the most statistically significant values on the 28th day after the application of vaccine and a syrup containing β-(1,3/1,6)-D-glucan (Group GV) as compared to the control group (Group V, puppies receiving only vaccine). Dogs without glucan supplementation did not produce such significant levels of antibodies. We can conclude that glucan has relevant immunostimulatory effects in dogs with altered immunity. The glucan product tested in this study (PleraSAN V, PLEURAN, Bratislava, Slovakia) could be used in the small animal clinical practice.

  3. Isolation and characterization of periplasmic cyclic beta-glucans of Azorhizobium caulinodans.

    PubMed

    Komaniecka, Iwona; Choma, Adam

    2003-10-24

    Oligoglucose molecules isolated from Azorhizobium caulinodans were characterized by compositional analysis, Smith degradation, matrix-assisted laser desorption/ionization time of flight mass spectrometry, and (1)H and (13)C nuclear magnetic resonance analysis. A. caulinodans produced nonbranched and unsubstituted cyclic glucans composed solely of glucose, with the degree of polymerization ranging from 10 to 13. A major fraction of the periplasmic glucans contains 11 glucose residues within rings. The glucose residues are linked by beta-(1,3) and beta-(1,6) glycosidic bonds. These molecules seem to be quite similar to the periplasmic beta-(1,3);(1,6)-glucans synthesized by the Bradyrhizobium strain and are substantially different from the cyclic beta-(1,2)-glucans produced by Agrobacterium and Sinorhizobium species. Azorhizobial cyclic glucan synthesis is not osmoregulated. The response to the osmotic stress in Azorhizobium can be regulated similarly to Brucella spp. It is probable that the biosynthesis of beta-glucans is subject to the feedback control mechanism.

  4. Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.

    PubMed

    Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan

    2013-05-01

    The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. De facto molecular weight distributions of glucans by size-exclusion chromatography combined with mass/molar-detection of fluorescence labeled terminal hemiacetals.

    PubMed

    Praznik, Werner; Huber, Anton

    2005-09-25

    A major capability of polysaccharides in aqueous media is their tendency for aggregation and dynamic formation of supermolecular structures. Even extended dissolution processes will not eliminate these structures which dominate many analytical approaches, in particular absolute molecular weight determinations referring to light scattering data. An alternative approach for determination of de facto molecular weight for glucans with free terminal hemiacetal functionality (reducing end group) has been adjusted from carbohydrates for midrange and high-dp glucans: quantitative and stabilized labeling as aminopyridyl-derivatives (AP-glucans) and subsequent analysis of SEC-separated elution profiles based on simultaneously monitored mass and molar fractions by refractive index and fluorescence detection. SEC-DRI/FL of AP-glucans proved as an appropriate approach for determination of de facto molecular weight of constituting glucan molecules even in the presence of supermolecular structures for non-branched (pullulan), branched (dextran), narrow distributed and broad distributed and for mixes of compact and loose packed polymer coils (starch glucan hydrolizate).

  6. Cereal β-glucan quantification with calcofluor-application to cell culture supernatants.

    PubMed

    Rieder, Anne; Knutsen, Svein H; Ballance, Simon; Grimmer, Stine; Airado-Rodríguez, Diego

    2012-11-06

    The specific binding of the fluorescent dye calcofluor to cereal β-glucan results in increased fluorescence intensity of the formed complex and is in use for the quantification of β-glucan above a critical molecular weight (MW) by flow injection analysis. In this study, this method was applied in a fast and easy batch mode. In order to emphasize the spectral information of the emission spectra of the calcofluor/β-glucan complexes, derivative signals were calculated. A linear relationship was found between the amplitude of the second derivative signals and the β-glucan concentration between 0.1 and 0.4 μg/mL. The low detection limit of this new method (0.045 μg/mL) enabled its use to study the transport of cereal β-glucans over differentiated Caco-2 cell monolayers. Additionally, the method was applied to quantify β-glucan in arabinoxylan samples, which correlated well with data by an enzyme based method. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. The Dual Activity Responsible for the Elongation and Branching of β-(1,3)-Glucan in the Fungal Cell Wall.

    PubMed

    Aimanianda, Vishukumar; Simenel, Catherine; Garnaud, Cecile; Clavaud, Cecile; Tada, Rui; Barbin, Lise; Mouyna, Isabelle; Heddergott, Christoph; Popolo, Laura; Ohya, Yoshikazu; Delepierre, Muriel; Latge, Jean-Paul

    2017-06-20

    β-(1,3)-Glucan, the major fungal cell wall component, ramifies through β-(1,6)-glycosidic linkages, which facilitates its binding with other cell wall components contributing to proper cell wall assembly. Using Saccharomyces cerevisiae as a model, we developed a protocol to quantify β-(1,6)-branching on β-(1,3)-glucan. Permeabilized S. cerevisiae and radiolabeled substrate UDP-( 14 C)glucose allowed us to determine branching kinetics. A screening aimed at identifying deletion mutants with reduced branching among them revealed only two, the bgl2 Δ and gas1 Δ mutants, showing 15% and 70% reductions in the branching, respectively, compared to the wild-type strain. Interestingly, a recombinant Gas1p introduced β-(1,6)-branching on the β-(1,3)-oligomers following its β-(1,3)-elongase activity. Sequential elongation and branching activity of Gas1p occurred on linear β-(1,3)-oligomers as well as Bgl2p-catalyzed products [short β-(1,3)-oligomers linked by a linear β-(1,6)-linkage]. The double S. cerevisiae gas1 Δ bgl2 Δ mutant showed a drastically sick phenotype. An Sc Gas1p ortholog, Gel4p from Aspergillus fumigatus , also showed dual β-(1,3)-glucan elongating and branching activity. Both Sc Gas1p and A. fumigatus Gel4p sequences are endowed with a carbohydrate binding module (CBM), CBM43, which was required for the dual β-(1,3)-glucan elongating and branching activity. Our report unravels the β-(1,3)-glucan branching mechanism, a phenomenon occurring during construction of the cell wall which is essential for fungal life. IMPORTANCE The fungal cell wall is essential for growth, morphogenesis, protection, and survival. In spite of being essential, cell wall biogenesis, especially the core β-(1,3)-glucan ramification, is poorly understood; the ramified β-(1,3)-glucan interconnects other cell wall components. Once linear β-(1,3)-glucan is synthesized by plasma membrane-bound glucan synthase, the subsequent event is its branching event in the cell wall space. Using Saccharomyces cerevisiae as a model, we identified GH72 and GH17 family glycosyltransferases, Gas1p and Bgl2p, respectively, involved in the β-(1,3)-glucan branching. The sick phenotype of the double Scgas1 Δ bgl2 Δ mutant suggested that β-(1,3)-glucan branching is essential. In addition to Sc Gas1p, GH72 family Sc Gas2p and Aspergillus fumigatus Gel4p, having CBM43 in their sequences, showed dual β-(1,3)-glucan elongating and branching activity. Our report identifies the fungal cell wall β-(1,3)-glucan branching mechanism. The essentiality of β-(1,3)-glucan branching suggests that enzymes involved in the glucan branching could be exploited as antifungal targets. Copyright © 2017 Aimanianda et al.

  8. Warfighter Sustainability: Maximizing Human Performance in Hostile Environments

    DTIC Science & Technology

    2008-10-01

    Study 4: Effects of Beta Glucan on Symptoms of Upper Tract Infection in Wildland Firefighters. ix Approved for public release...Study 4: Effects of Beta Glucan on Symptoms of Upper Tract Infection in Wildland Firefighters. The use of a beta glucan supplement may decrease...reduce the required fluid intake during extended operations without compromising work output. In addition, the ingestion of a beta glucan supplement may

  9. Antiproliferative and pro-apoptotic effects of three fungal exocellular β-glucans in MCF-7 breast cancer cells is mediated by oxidative stress, AMP-activated protein kinase (AMPK) and the Forkhead transcription factor, FOXO3a.

    PubMed

    Queiroz, Eveline A I F; Fortes, Zuleica B; da Cunha, Mário A A; Barbosa, Aneli M; Khaper, Neelam; Dekker, Robert F H

    2015-10-01

    Fungal β-d-glucans of the (1→3)-type are known to exhibit direct antitumor effects, and can also indirectly decrease tumor proliferation through immunomodulatory responses. The underlying molecular mechanisms involved in decreasing tumor formation, however, are not well understood. In this study, we examined the antiproliferative role and mechanism of action of three different fungal exocellular β-glucans in MCF-7 breast cancer cells. The β-glucans were obtained from Botryosphaeria rhodina MAMB-05 [two botryosphaerans; (1→3)(1→6)-β-d-glucan; one produced on glucose, the other on fructose] and Lasiodiplodia theobromae MMPI [lasiodiplodan; (1→6)-β-d-glucan, produced on glucose]. Using the cell proliferation-MTT assay, we showed that the β-glucans exhibited a time- and concentration-dependent antiproliferative activity (IC50, 100μg/ml). Markers of cell cycle, apoptosis, necrosis and oxidative stress were analyzed using flow cytometry, RT-PCR and Western blotting. Exposure to β-glucans increased apoptosis, necrosis, oxidative stress, mRNA expression of p53, p27 and Bax; the activity of AMP-activated protein-kinase, Forkhead transcription factor FOXO3a, Bax and caspase-3; and decreased the activity of p70S6K in MCF-7 cells. In the presence of hydrogen peroxide, the fungal β-glucans increased oxidative stress, which was associated with reduced cell viability. We showed that these β-glucans exhibited an antiproliferative effect that was associated with apoptosis, necrosis and oxidative stress. This study demonstrated for the first time that the apoptosis induced by β-glucans was mediated by AMP-activated protein-kinase and Forkhead transcription factor, FOXO3a. Our findings provide novel mechanistic insights into their antiproliferative roles, and compelling evidence that these β-glucans possess a broad range of biomodulatory properties that may prove useful in cancer treatment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Effects of β-glucan extracted from Agaricus blazei on the expression of ERCC5, CASP9, and CYP1A1 genes and metabolic profile in HepG2 cells.

    PubMed

    da Silva, A F; Sartori, D; Macedo, F C; Ribeiro, L R; Fungaro, M H P; Mantovani, M S

    2013-06-01

    The polysaccharide β-glucan has biological properties that stimulate the immune system and can prevent chronic pathologies, including cancer. It has been shown to prevent damage to DNA caused by the chemical and physical agents to which humans are exposed. However, the mechanism of β-glucan remains poorly understood. The objective of the present study was to verify the protective effect of β-glucan on the expression of the genes ERCC5 (involved in excision repair of DNA damage), CASP9 (involved in apoptosis), and CYP1A1 (involved in the metabolism of xenobiotics) using real-time polymerase chain reaction and perform metabolic profile measurements on the HepG2 cells. Cells were exposed to only benzo[a]pyrene (B[a]P), β-glucan, or a combination of B[a]P with β-glucan. The results demonstrated that 50 µg/mL β-glucan significantly repressed the expression of the ERCC5 gene when compared with the untreated control cells in these conditions. No change was found in the CASP9 transcript level. However, the CYP1A1 gene expression was also induced by HepG2 cells exposed to B[a]P only or in association with β-glucan, showing its effective protector against damage caused by B[a]P, while HepG2 cells exposed to only β-glucan did not show CYP1A1 modulation. The metabolic profiles showed moderate bioenergetic metabolism with an increase in the metabolites involved in bioenergetic metabolism (alanine, glutamate, creatine and phosphocholine) in cells treated with β-glucan and to a lesser extent treated with B[a]P. Thus, these results demonstrate that the chemopreventive activity of β-glucan may modulate bioenergetic metabolism and gene expression.

  11. Analysis of bacterial community shifts in the gastrointestinal tract of pigs fed diets supplemented with β-glucan from Laminaria digitata, Laminaria hyperborea and Saccharomyces cerevisiae.

    PubMed

    Murphy, P; Dal Bello, F; O'Doherty, J; Arendt, E K; Sweeney, T; Coffey, A

    2013-07-01

    This study was designed to evaluate the effects of algal and yeast β-glucans on the porcine gastrointestinal microbiota, specifically the community of Lactobacillus, Bifidobacterium and coliforms. A total of 48 pigs were fed four diets over a 28-day period to determine the effect that each had on these communities. The control diet consisted of wheat and soya bean meal. The remaining three diets contained wheat and soya bean meal supplemented with β-glucan at 250 g/tonne from Laminaria digitata, Laminaria hyperborea or Saccharomyces cerevisiae. Faecal samples were collected from animals before feeding each diet and after the feeding period. The animals were slaughtered the following day and samples were collected from the stomach, ileum, caecum, proximal colon and distal colon. Alterations in Lactobacillus in the gastrointestinal tract (GIT) were analysed using denaturing gradient gel electrophoresis (DGGE) profiles generated by group-specific 16S rRNA gene PCR amplicons. Plate count analysis was also performed to quantify total coliforms. DGGE profiles indicated that all β-glucan diets provoked the emergence of a richer community of Lactobacillus. The richest community of lactobacilli emerged after feeding L. digitata (LD β-glucan). Plate count analysis revealed that the L. hyperborea (LH β-glucan) diet had a statistically significant effect on the coliform counts in the proximal colon in comparison with the control diet. β-glucan from L. digitata and S. cerevisiae also generally reduced coliforms but to a lesser extent. Nevertheless, the β-glucan diets did not significantly reduce levels of Lactobacillus or Bifidobacterium. DGGE analysis of GIT samples indicated that the three β-glucan diets generally promoted the establishment of a more varied range of Lactobacillus species in the caecum, proximal and distal colon. The LH β-glucan had the most profound reducing effect on coliform counts when compared with the control diet and diets supplemented with L. digitata and S. cerevisiae β-glucans.

  12. Association of Beta-Glucan Endogenous Production with Increased Stress Tolerance of Intestinal Lactobacilli▿

    PubMed Central

    Stack, Helena M.; Kearney, Niamh; Stanton, Catherine; Fitzgerald, Gerald F.; Ross, R. Paul

    2010-01-01

    The exopolysaccharide beta-glucan has been reported to be associated with many health-promoting and prebiotic properties. The membrane-associated glycosyltransferase enzyme (encoded by the gtf gene), responsible for microbial beta-glucan production, catalyzes the conversion of sugar nucleotides into beta-glucan. In this study, the gtf gene from Pediococcus parvulus 2.6 was heterologously expressed in Lactobacillus paracasei NFBC 338. When grown in the presence of glucose (7%, wt/vol), the recombinant strain (pNZ44-GTF+) displayed a “ropy” phenotype, while scanning electron microscopy (SEM) revealed strands of polysaccharide-linking neighboring cells. Beta-glucan biosynthesis was confirmed by agglutination tests carried out with Streptococcus pneumoniae type 37-specific antibodies, which specifically detect glucan-producing cells. Further analysis showed a ∼2-fold increase in viscosity in broth media for the beta-glucan-producing strain over 24 h compared to the control strain, which did not show any significant increase in viscosity. In addition, we analyzed the ability of beta-glucan-producing Lactobacillus paracasei NFBC 338 to survive both technological and gastrointestinal stresses. Heat stress assays revealed that production of the polysaccharide was associated with significantly increased protection during heat stress (60-fold), acid stress (20-fold), and simulated gastric juice stress (15-fold). Bile stress assays revealed a more modest but significant 5.5-fold increase in survival for the beta-glucan-producing strain compared to that of the control strain. These results suggest that production of a beta-glucan exopolysaccharide by strains destined for use as probiotics may afford them greater performance/protection during cultivation, processing, and ingestion. As such, expression of the gtf gene may prove to be a straightforward approach to improve strains that might otherwise prove sensitive in such applications. PMID:19933353

  13. Test performance of blood beta-glucan for Pneumocystis jirovecii pneumonia in patients with AIDS and respiratory symptoms.

    PubMed

    Wood, Brian R; Komarow, Lauren; Zolopa, Andrew R; Finkelman, Malcolm A; Powderly, William G; Sax, Paul E

    2013-03-27

    The objective of this study was to define the test characteristics of plasma beta-glucan for diagnosis of Pneumocystis jirovecii pneumonia (PCP) in AIDS patients with respiratory symptoms. Analysis of baseline blood samples in a randomized strategy study of patients with acute opportunistic infections, limited to participants with respiratory symptoms. Participants in the 282-person ACTG A5164 trial had baseline plasma samples assayed for beta-glucan testing. As part of A5164 trial, two study investigators independently adjudicated the diagnosis of PCP. Respiratory symptoms were identified by investigators from a list of all signs and symptoms with an onset or resolution in the 21 days prior to or 14 days following study entry. Beta-glucan was defined as positive if at least 80 pg/ml and negative if less than 80 pg/ml. Of 252 study participants with a beta-glucan result, 159 had at least one respiratory symptom, 139 of whom had a diagnosis of PCP. The sensitivity of beta-glucan for PCP in participants with respiratory symptoms was 92.8% [95% confidence interval (CI) 87.2-96.5], and specificity 75.0% (95% CI 50.9-91.3). Among 134 individuals with positive beta-glucan and respiratory symptoms, 129 had PCP, for a positive predictive value of 96.3% (95% CI 91.5-98.8). Fifteen of 25 patients with a normal beta-glucan did not have PCP, for a negative predictive value of 60% (95% CI 38.7-78.9). Elevated plasma beta-glucan has a high predictive value for diagnosis of PCP in AIDS patients with respiratory symptoms. We propose an algorithm for the use of beta-glucan as a diagnostic tool on the basis of the pretest probability of PCP in such patients.

  14. Characterization of β-Glucan Recognition Site on C-Type Lectin, Dectin 1

    PubMed Central

    Adachi, Yoshiyuki; Ishii, Takashi; Ikeda, Yoshihiko; Hoshino, Akiyoshi; Tamura, Hiroshi; Aketagawa, Jun; Tanaka, Shigenori; Ohno, Naohito

    2004-01-01

    Dectin 1 is a mammalian cell surface receptor for (1→3)-β-d-glucans. Since (1→3)-β-d-glucans are commonly present on fungal cell walls, it has been suggested that dectin 1 is important for recognizing fungal invasion. In this study we tried to deduce the amino acid residues in dectin 1 responsible for β-glucan recognition. HEK293 cells transfected with mouse dectin 1 cDNA could bind to a gel-forming (1→3)-β-d-glucan, schizophyllan (SPG). The binding of SPG to a dectin 1 transfectant was inhibited by pretreatment with other β-glucans having a (1→3)-β-d-glucosyl linkage but not by pretreatment with α-glucans. Dectin 1 has a carbohydrate recognition domain (CRD) consisting of six cysteine residues that are highly conserved in C-type lectins. We prepared 32 point mutants with mutations in the CRD and analyzed their binding to SPG. Mutations at Trp221 and His223 resulted in decreased binding to β-glucan. Monoclonal antibody 4B2, a dectin- 1 monoclonal antibody which had a blocking effect on the β-glucan interaction, completely failed to bind the dectin-1 mutant W221A. A mutant with mutations in Trp221 and His223 did not have a collaborative effect on Toll-like receptor 2-mediated cellular activation in response to zymosan. These amino acid residues are distinct from residues in other sugar-recognizing peptide sequences of typical C-type lectins. These results suggest that the amino acid sequence W221-I222-H223 is critical for formation of a β-glucan binding site in the CRD of dectin 1. PMID:15213161

  15. Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide

    PubMed Central

    Choi, E. Y.; Lee, S. S.; Hyeon, J. Y.; Choe, S. H.; Keum, B. R.; Lim, J. M.; Park, D. C.; Choi, I. S.; Cho, K. K.

    2016-01-01

    This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS) of Escherichia. The incubated layer was used for a nitric oxide (NO) analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli) LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS)-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1) in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP). This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK) and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α) decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1) that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator. PMID:27488844

  16. Development of downstream processing to minimize beta-glucan impurities in GMP-manufactured therapeutic antibodies.

    PubMed

    Vigor, Kim; Emerson, John; Scott, Robert; Cheek, Julia; Barton, Claire; Bax, Heather J; Josephs, Debra H; Karagiannis, Sophia N; Spicer, James F; Lentfer, Heike

    2016-11-01

    The presence of impurities or contaminants in biological products such as monoclonal antibodies (mAb) could affect efficacy or cause adverse reactions in patients. ICH guidelines (Q6A and Q6B) are in place to regulate the level of impurities within clinical drug products. An impurity less often reported and, therefore, lacking regulatory guideline is beta-glucan. Beta-glucans are polysaccharides of d-glucose monomers linked by (1-3) beta-glycosidic bonds, and are produced by prokaryotic and eukaryotic organisms, including plants. They may enter manufacturing processes via raw materials such as cellulose-based membrane filters or sucrose. Here we report the detection of beta-glucan contamination of a monoclonal IgE antibody (MOv18), manufactured in our facility for a first-in-human, first-in-class clinical trial in patients with cancer. Since beta-glucans have potential immunostimulatory properties and can cause symptomatic infusion reactions, it was of paramount importance to identify the source of beta-glucans in our product and to reduce the levels to clinically insignificant concentrations. We identified beta-glucans in sucrose within the formulation buffer and within the housing storage buffer of the virus removal filter. We also detected low level beta-glucan contamination in two of four commercially available antibodies used in oncology. Both formulation buffers contained sucrose. We managed to reduce levels of beta-glucan in our product 10-fold, by screening all sucrose raw material, filtering the sucrose by Posidyne® membrane filtration, and by incorporating extra wash steps when preparing the virus removal filter. The beta-glucan levels now lie within a range that is unlikely to cause clinically significant immunological effects. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1494-1502, 2016. © 2016 American Institute of Chemical Engineers.

  17. Presence of a Large β(1-3)Glucan Linked to Chitin at the Saccharomyces cerevisiae Mother-Bud Neck Suggests Involvement in Localized Growth Control

    PubMed Central

    Blanco, Noelia; Arroyo, Javier

    2012-01-01

    Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan. PMID:22366124

  18. Supplementation of a high-carbohydrate breakfast with barley beta-glucan improves postprandial glycaemic response for meals but not beverages.

    PubMed

    Poppitt, Sally D; van Drunen, Jenneke D E; McGill, Anne-Thea; Mulvey, Tom B; Leahy, Fiona E

    2007-01-01

    There is growing support for the protective role of soluble fibre in type II diabetes. Soluble fibre beta-glucan found in cereal products including oats and barley may be the active component. There is evidence of postprandial blunting of blood glucose and insulin responses to dietary carbohydrates when oat soluble fibre is supplemented into the diet but few trials have been carried out using natural barley or enriched barley beta-glucan products. The aim of this trial was to investigate the postprandial effect of a highly enriched barley beta -glucan product on blood glucose, insulin and lipids when given with a high-CHO food and a high-CHO drink. 18 lean, healthy men completed a 4 treatment intervention trial comprising (i) high-CHO(food control), (ii) high-CHO(food+fibre), (iii) high-CHO(drink control), (iv) high-CHO(drink+fibre) where a 10g dose of barley beta-glucan fibre supplement (Cerogen) containing 6.31g beta-glucan was added to food and drink controls. There was an increase of glucose and insulin following all 4 treatments. Addition of the beta -glucan supplement significantly blunted the glycaemic and insulinaemic responses on the food (p<0.05) but not drink (p>0.05) treatments when compared to controls. The high-CHO breakfasts decreased total, LDL- and HDL-cholesterol from baseline to 60 mins postprandially but there were no differential effects of beta-glucan treatment on circulating lipids. We conclude that a high dose barley beta-glucan supplement can improve glucose control when added to a high-CHO starchy food, probably due to increased gastro-intestinal viscosity, but not when added to a high-CHO beverage where rapid absorption combined with decreased beta-glucan concentration and viscosity may obviate this mechanism.

  19. Presence of a large β(1-3)glucan linked to chitin at the Saccharomyces cerevisiae mother-bud neck suggests involvement in localized growth control.

    PubMed

    Cabib, Enrico; Blanco, Noelia; Arroyo, Javier

    2012-04-01

    Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.

  20. Saccharomyces cerevisiae cell wall components as tools for ochratoxin a decontamination.

    PubMed

    Piotrowska, Małgorzata; Masek, Anna

    2015-04-02

    The aim of this study was to evaluate the usefulness of Saccharomyces cerevisiae cell wall preparations in the adsorption of ochratoxin A (OTA). The study involved the use of a brewer's yeast cell wall devoid of protein substances, glucans obtained by water and alkaline extraction, a glucan commercially available as a dietary supplement for animals and, additionally, dried brewer's yeast for comparison. Fourier Transform Infrared (FTIR) analysis of the obtained preparations showed bands characteristic for glucans in the resulting spectra. The yeast cell wall preparation, water-extracted glucan and the commercial glucan bound the highest amount of ochratoxin A, above 55% of the initial concentration, and the alkaline-extracted glucan adsorbed the lowest amount of this toxin. It has been shown that adsorption is most effective at a close-to-neutral pH, while being considerably limited in alkaline conditions.

  1. A Candida Biofilm-Induced Pathway for Matrix Glucan Delivery: Implications for Drug Resistance

    PubMed Central

    Taff, Heather T.; Nett, Jeniel E.; Zarnowski, Robert; Ross, Kelly M.; Sanchez, Hiram; Cain, Mike T.; Hamaker, Jessica; Mitchell, Aaron P.; Andes, David R.

    2012-01-01

    Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics. PMID:22876186

  2. α- and β-d-Glucans from the edible mushroom Pleurotus albidus differentially regulate lipid-induced inflammation and foam cell formation in human macrophage-like THP-1 cells.

    PubMed

    Castro-Alves, Victor Costa; Nascimento, João Roberto Oliveira do

    2018-05-01

    Macrophages play an essential role in lipid metabolism; however, the excessive uptake of modified lipids and cholesterol crystals (CC) leads to the formation of pro-inflammatory lipid-laden macrophages called foam cells. Since the α-1,6- and β-1,3-d-glucans from the basidiome and the mycelium of the edible mushroom Pleurotus albidus have previously been shown to regulate macrophage function, these glucans were tested in macrophage-like THP-1 cells previously exposed to acetylated low-density lipoproteins (acLDL) or CC. The glucans inhibited lipid-induced inflammation, but only the β-1,3-d-glucan regulated both the NLRP3 inflammasome activation and the expression of genes involved on lipid efflux in acLDL- or CC-pretreated cells, thereby reducing foam cell formation. In contrast, the two α-1,6-glucans tested inhibited foam cell formation only in acLDL-pretreated cells and had no effect on the expression of the peroxisome proliferator-activated receptor gamma and liver X receptor alpha genes, suggesting that these glucans regulate lipid influx rather than lipid efflux. Thus, α- and β-d-glucans differentially regulate lipid-induced inflammation and foam cell formation in macrophage-like cells. Furthermore, results emphasize that P. albidus has potential to be used as a functional food or as a source for the extraction of biologically-active glucans. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Integration of β-glucan fibre rich fractions from barley and mushrooms to form healthy extruded snacks.

    PubMed

    Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S

    2013-03-01

    β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P < 0.05). Product expansion increased with the introduction of both barley and mushroom fraction (P < 0.05) which in turn resulted in a reduction in product hardness (P < 0.05). In vitro digestion protocol illustrated that inclusion of barley and mushroom β-glucan rich fractions manipulated the starch digestibility profile and hence rate of glucose release during digestion compared to the control sample. This in turn resulted in a significant (P < 0.05) reduction in potential glycaemic response of the samples of between 20 and 25 % for barley β-glucan rich fractions and between 17 and 25 % for mushroom β-glucan rich fractions. We conclude that the inclusion of these fractions could be utilised by the food industry to manipulate the glycaemic response of extruded snack products.

  4. NMR spectroscopic structural characterization of a water-soluble β-(1→3, 1→6)-glucan from Aureobasidium pullulans.

    PubMed

    Kono, Hiroyuki; Kondo, Nobuhiro; Hirabayashi, Katsuki; Ogata, Makoto; Totani, Kazuhide; Ikematsu, Shinya; Osada, Mitsumasa

    2017-10-15

    An unambiguous structural characterization of the water-soluble Aureobasidium pullulans β-(1→3, 1→6)-glucan is yet to be achieved, although this β-(1→3, 1→6)-glucan is expected to exhibit excellent biofunctional properties. Thus, we herein report the elucidation of the primary structure of the A. pullulans β-(1→3, 1→6)-glucan using nuclear magnetic resonance spectroscopy, followed by comparison of the obtained structure with that of schizophyllan (SPG). Structural characterization of the A. pullulans β-(1→3, 1→6)-glucan revealed that the structural units are a β-(1→3)-d-glucan backbone with four β-(1→6)-d-glucosyl side branching units every six residues. In addition, circular dichroism spectroscopic analysis revealed that the β-(1→3, 1→6)-glucan interacted with polyadenylic acid (poly(A)) chains in DMSO solution to form a complex similar to that obtained in the complexation of SPG/poly(A). This finding indicates that β-(1→3, 1→6)-glucan forms a triple-helical conformation in aqueous solution but exhibits a random coil structure in DMSO solution, which is similar to the behavior of SPG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Chemically engineered sulfated glucans from rice bran exert strong antiviral activity at the stage of viral entry.

    PubMed

    Ray, Bimalendu; Hutterer, Corina; Bandyopadhyay, Shruti S; Ghosh, Kanika; Chatterjee, Udipta R; Ray, Sayani; Zeitträger, Isabel; Wagner, Sabrina; Marschall, Manfred

    2013-12-27

    Attachment and entry of many viruses are mediated by their affinity for polysaccharides present on the surface of target cells. In this paper, we demonstrate that sulfated glucans isolated from rice (Oryza sativa) can be utilized as experimental drugs exerting strong antiviral activity. In particular, oleum-DMF-based extraction is described as a procedure for the generation of chemically engineered glucans from commercially available rice bran. The one-step procedure has the potential to provide a spectrum of related glucans with varying molecular masses and modifications, including sulfation. The sulfated glucans P444, P445, and P446 possess increased antiviral activity compared to a previously described glucan (S1G). P444, P445, and P446 were highly active against human cytomegalovirus (HCMV), moderately active against other members of the family Herpesviridae, while not active against unrelated viruses. Specific experimentation with HCMV-infected cells provided evidence that antiviral activity was based on inhibition of viral entry and that inhibition occurred in the absence of drug-induced cytotoxicity. These findings underline the high potential of sulfated glucans for antiviral research and drug development. In addition, the procedure described for the efficient transformation of glucan hydroxy groups to sulfate groups may be similarly beneficial for the chemical alteration of other natural products.

  6. Optical Properties of Laminarin Using Terahertz Time-Domain Spectroscopy (abstract)

    NASA Astrophysics Data System (ADS)

    Shin, Hee Jun; Maeng, Inhee; Oh, Seung Jae; Kim, Sung In; Kim, Ha Won; Son, Joo-Hiuk

    2009-04-01

    Terahertz spectroscopy is important in the study of biomolecular structure because the vibration and rotation energy of large molecules such as DNA, proteins, and polysaccharides are laid in terahertz regions. Terahertz time-domain spectroscopy (THz-TDS), using terahertz pulses generated and detected by femto-second pulses laser, has been used in the study of biomolecular dynamics, as well as carrier dynamics of semiconductors. Laminarin is a polysaccharide of glucose in brown algae. It is made up of β(1-3)-glucan and β(1-6)-glucan. β-glucan is an anticancer material that activates the immune reaction of human cells and inhibits proliferation of cancer cells. β-glucan with a single-strand structure has been reported to activate the immune reaction to a greater extent than β-glucan with a triple-strand helix structure. We used THz-TDS to characterize the difference between single-strand and triple-strand β-glucan. We obtained single-strand β-glucan by chemical treatment of triple-strand β-glucan. We measured the frequency dependent optical constants of Laminarin using THz-TDS. Power absorption of the triple-strand helix is larger than the single-strand helix in terahertz regions. The refractive index of the triple-strand helix is also larger than that of the single-strand helix.

  7. Protective effect of β-(1,3 → 1,6)-D-glucan against irritant-induced gastric lesions.

    PubMed

    Tanaka, Ken-ichiro; Tanaka, Yuta; Suzuki, Toshio; Mizushima, Tohru

    2011-08-01

    β-(1,3)-D-Glucan with β-(1,6) branches has been reported to have various pharmacological activities, such as anti-tumour and anti-infection activities, which result from its immunomodulating effects. Gastric lesions result from an imbalance between aggressive and defensive factors. In the present study, we examined the effect of β-(1,3)-D-glucan with β-(1,6) branches isolated from Aureobasidium pullulans on the gastric ulcerogenic response in mice. Oral administration of β-glucan ameliorated gastric lesions induced by ethanol (EtOH) or HCl. This administration of β-glucan also suppressed EtOH-induced inflammatory responses, such as infiltration of neutrophils and expression of pro-inflammatory cytokines, chemokines and cell adhesion molecules (CAM) at the gastric mucosa. Of the various defensive factors, the levels of heat shock protein (HSP) 70 and mucin but not PGE(2) were increased by the administration of β-glucan. β-Glucan-dependent induction of the expression of HSP70 and mucin proteins and suppression of the expression of pro-inflammatory cytokines, chemokines and CAM were also observed in cultured cells in vitro. The results of the present study suggest that β-glucan protects the gastric mucosa from the formation of irritant-induced lesions by increasing the levels of defensive factors, such as HSP70 and mucin.

  8. Chemical Synthesis of Sulfated Yeast (Saccharomyces cerevisiae) Glucans and Their In Vivo Antioxidant Activity.

    PubMed

    Zhang, Hua; Zhang, Jing; Fan, Ziluan; Zhou, Xintao; Geng, Lin; Wang, Zhenyu; Regenstein, Joe M; Xia, Zhiqiang

    2017-07-28

    The effects of sulfation of yeast glucans was optimized using response surface methodology. The degree of sulfation was evaluated from 0.11 to 0.75 using ion-chromatography. The structural characteristics of SYG (sulfation of yeast glucans) with a DS = 0.75 were determined using high-performance liquid chromatography/gel-permeation chromatography and finally by Fourier transform infrared spectrometry. The SYG had lower viscosity and greater solubility than the native yeast glucans, suggesting that the conformation of the SYG had significantly changed. The results also showed that SYG had a significantly greater antioxidant activity in vivo compared to native yeast glucans.

  9. Characterization of an anti-glucosyltransferase serum specific for insoluble glucan synthesis by Streptococcus mutans.

    PubMed

    Linzer, R; Slade, H D

    1976-02-01

    An anti-glucosyltransferase serum, which synthesized 96% insoluble glucans, was prepared against a purified enzyme preparation from Streptococcus mutans strain HS6 (serotype a). This serum was examined for its effects on glucan synthesis by crude enzyme preparations from eight strains (four serotypes) of S. mutans and for the ability of these preparations to promote adherence of S. mutans to a smooth surface. Glucosyltransferase activity was assayed by measuring the incorporation of glucose from [14C]glucose-labeled sucrose into water-insoluble and water-soluble (ethanol-insoluble) glucans. Anti-glucosyltransferase serum inhibited insoluble glucan synthesis by crude enzyme preparations from cells of the four serotypes of S. mutans. Enzymes from strains of types a, b, and d were inhibited between 70 to 90%; enzymes from type c strains were inhibited from 45 to 60%. The adherence to a glass surface of heat-killed cells from these four serotypes was likewise inhibited. Soluble glucan synthesis was not inhibited by the serum, and in some cases its synthesis increased as insoluble glucan synthesis decreased.

  10. Combination Therapy with Glucan and Coenzyme Q10 in Murine Experimental Autoimmune Disease and Cancer.

    PubMed

    Vetvicka, Vaclav; Vetvickova, Jana

    2018-06-01

    Coenzyme Q 10 is a well-accepted anti-oxidant agent known to play a protective role in various physiological and disease processes. Recently, Coenzyme Q 10 is gaining attention as a substance with significant anti-inflammatory properties. β-Glucan is the most studied immunomodulator with significant synergetic effects with numerous bioactive molecules. We aimed to evaluate the possible synergistic effects of simultaneous use of coenzyme Q 10 with the well-established immune modulator, β-glucan, on immune reactions and cancer development. Coenzyme Q 10 and β-glucan were used, both in vivo and in vitro, and their effects were evaluated using phagocytosis and cytokine secretion. Our study confirmed the strong anti-inflammatory effects of coenzyme Q 10 and showed that these effects were further potentiated with the addition of β-glucan. The anticancer effects of coenzyme Q 10 were less pronounced, but stronger, with the addition of β-glucan. There is significant synergy between coenzyme Q 10 and β-glucan. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  11. Enhanced enzymatic hydrolysis of lignocellulose by optimizing enzyme complexes.

    PubMed

    Zhang, Mingjia; Su, Rongxin; Qi, Wei; He, Zhimin

    2010-03-01

    To enhance the conversion of the cellulose and hemicellulose, the corncob pretreated by aqueous ammonia soaking was hydrolyzed by enzyme complexes. The saturation limit for cellulase (Spezyme CP) was determined as 15 mg protein/g glucan (50 filter paper unit (FPU)/g glucan). The accessory enzymes (beta-glucosidase, xylanase, and pectinase) were supplemented to hydrolyze cellobiose (cellulase-inhibiting product), hemicellulose, and pectin (the component covering the fiber surfaces), respectively. It was found that beta-glucosidase (Novozyme 188) loading of 1.45 mg protein/g glucan [30 cellobiase units (CBU)/g glucan] was enough to eliminate the cellobiose inhibitor, and 2.9 mg protein/g glucan (60 CBU/g glucan) was the saturation limit. The supplementation of xylanase and pectinase can increase the conversion of cellulose and hemicellulose significantly. The yields of glucose and xylose enhanced with the increasing enzyme loading, but the increasing trend became low at high loading. Compared with xylanase, pectinase was more effective to promote the hydrolysis of cellulose and hemicellulose. The supplementation of pectinase with 0.12 mg protein/g glucan could increase the yields of glucose and xylose by 7.5% and 29.3%, respectively.

  12. Effects of barley β-glucan-enriched flour fractions on the glycaemic index of bread.

    PubMed

    Finocchiaro, Franca; Ferrari, Barbara; Gianinetti, Alberto; Scazzina, Francesca; Pellegrini, Nicoletta; Caramanico, Rosita; Salati, Claudia; Shirvanian, Vigen; Stanca, Antonio Michele

    2012-02-01

    The aim of this research was to evaluate β-glucan-enriched flours, obtained from barleys with either normal or waxy starch, for their effects on the glycaemic index (GI) and the quality of bread. Rheological results confirmed that when barley flour was included in the dough the overall quality of bread slightly worsened. However, positive consequences on glycaemia were obtained with the normal starch barley: the GI of all-wheat bread (82.8 ± 7.2) was significantly reduced (57.2 ± 7.9) when 40% of wheat flour was substituted with β-glucan-enriched barley flour (6.0% ± 0.1 β-glucan in the final flour blend). In contrast, this positive effect was significantly reduced (GI: 70.1 ± 9.1) when 40% of wheat flour was substituted with the β-glucan-enriched flour of a waxy barley (CDC Alamo; 6.6 ± 0.2 β-glucan in the final flour blend), suggesting that the ability of β-glucans to lower the GI was affected by the barley starch-type.

  13. Endotoxin and β-(1,3)-glucan levels in automobiles: a pilot study.

    PubMed

    Wu, Francis Fu-Sheng; Wu, Mei-Wen; Chang, Chin-Fu; Lai, Shu-Mei; Pierse, Nevil; Crane, Julian; Siebers, Rob

    2010-01-01

    Exposure to bacterial endotoxin and fungal β-(1,3)-glucan in the indoor environment can induce respiratory symptoms. Automobiles are an exposure source of allergens but it is not known if, and how much exposure there is to endotoxin and fungal β-(1,3)-glucan. The objective of the study was to determine whether automobiles are a potential source of exposure to these microbial products. Dust was sampled from the passenger seats of 40 automobiles. Specific Limulus amoebocyte kinetic assays were used to measure endotoxin and β-(1,3)-glucan, respectively. Endotoxin and β-(1,3)-glucan was detected in all samples ranging from 19.9-247.0 EU/mg and 1.6-59.8 μg/g, respectively. There were no significant differences in endotoxin levels between automobiles of smokers and non-smokers, but β-(1,3)-glucan levels were about two-fold higher in the automobiles of non-smokers. In conclusion, endotoxin and β-(1,3)-glucan exposure in automobiles at levels found in our study may be of importance for asthmatics.

  14. Free-radical scavenging properties and antioxidant activities of botryosphaeran and some other β-D-glucans.

    PubMed

    Giese, Ellen C; Gascon, Jacob; Anzelmo, Gianluca; Barbosa, Aneli M; da Cunha, Mário A Alves; Dekker, Robert F H

    2015-01-01

    β-D-Glucans are known to present antitumor, anticancer, and anti-inflammatory activities that are influenced by their own antioxidant capacity. The antioxidant activity of botryosphaeran, an exopolysaccharide of the (1 → 3;1 → 6)-β-D-glucan type produced by the Botryosphaeria rhodina MAMB-05 was evaluated and compared to some other β-D-glucans (lasiodiplodan an exocellular (1 → 6)-β-D-glucan from Lasiodiplodia theobromae, laminarin and curdlan), and oligosaccharides, disaccharides, and monosaccharides in a study of scavenging activities of free radicals in-vitro. Botryosphaeran displayed high total antioxidant activity (80%) as well as good scavenging activity against hydroxyl radical (90.6%), superoxide anion (37%), hydrogen peroxide (38%), and nitric oxide radical (90%). No reducing power, metal-chelating capacity or inhibition of lipid peroxidation was observed for these β-D-glucans. The results demonstrated that botryosphaeran exhibited effective antioxidant activity as supported by many different assays, suggesting that this β-D-glucan may serve as a source of a new bioactive compound with effective antioxidant activity. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Radioprotection by polysaccharides alone and in combination with aminothiols

    NASA Astrophysics Data System (ADS)

    Patchen, Myra L.; Macvittie, Thomas J.; Solberg, Brian D.; D'Alesandro, Michele M.; Brook, Itzhak

    We demonstrated that glucan, a beta-1,3 polysaccharide immunomodulator, enhances survival of mice when administered before radiation exposure. Glucan's prophylactic survival-enhancing effects are mediated by several mechanisms including (1) increasing macrophage-mediated resistance to potentially lethal postirradiation opportunistic infections, (2) increasing the Do of hematopoietic progenitor cells, and (3) accelerating hematopoietic reconstitution. In addition, even when administered shortly after some otherwise lethal doses of radiation, glucan increases survival. Glucan's therapeutic survival-enhancing effects are also mediated through its ability to enhance macrophage function and to accelerate hematopoietic reconstitution; glucan's therapeutic potential, however, is ultimately dependent on the survival of a critical number of hematopoietic stem cells capable of responding to glucan's stimulatory effects. Preirradiation administration of the traditional aminothiol radioprotectants WR-2721 and WR-3689 has been previously demonstrated to be an extremely effective means to increase hematopoietic stem cell survival. Therapeutic glucan treatment administered in combination with preirradiation WR-2721 or WR-3689 treatment synergistically increases both hematopoietic reconstitution and survival. Such combined modality treatments offer new promise in treating acute radiation injury.

  16. Evaluation of correlation between glucan conversion and degree of delignification depending on pretreatment strategies using Jabon Merah.

    PubMed

    Jang, Soo-Kyeong; Jeong, Hanseob; Kim, Ho-Yong; Choi, June-Ho; Kim, Jong-Hwa; Koo, Bon-Wook; Choi, In-Gyu

    2017-07-01

    The main purpose of this study was to investigate the glucan conversion rate after enzymatic hydrolysis depending on the treatment methods and conditions with changes in the chemical composition of treated solid fraction of Jabon Merah. The glucan conversion rate (17.4%) was not significantly improved after liquid hot water treatment (1st step) even though most of the hemicellulose was dissolved into liquid hydrolysate. Subsequently, dilute acid, organosolv, and peracetic acid treatment (2nd step) was conducted under various conditions to enhance glucan conversion. Among the 2nd step treatment, the glucan conversion rate of organosolv (max. 46.0%) and peracetic acid treatment (max. 65.9%) was increased remarkably through decomposition of acid-insoluble lignin (AIL). Finally, the glucan conversion rate and AIL content were highly correlated, which was revealed by the R-squared value (0.84), but inhibitory factors including cellulose crystallinity must be considered for advanced glucan conversion from highly recalcitrant biomasses, such as Jabon Merah. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. AFRRI Reports, Third Quarter 1993

    DTIC Science & Technology

    1993-10-01

    demonstrated that glucan , a beta -1,3- exerted its antibacterial activity either directly against or- polysaccharide immunomodulator, is capable of...h. Isolates were identified by standard criteria (16, La.). This glucan preparation was a soluble (1-3)- beta -D- 33). glucan isolated from the inner...particulate glucan . Int. J. pharmacol. IL407-425. Cancer 24-.773-779. 25. Patches, Mi. I, T. J. MacVklde, and W. E. Jackas". 1989. 5. Easas.., C. S. F

  18. Development of an Oral Barley Beta-Glucan Adjuvant That Augments the Tumoricidal Activity of Antibodies or Vaccines Used for the Immunotherapy of Breast Cancer

    DTIC Science & Technology

    2003-07-01

    These Data provided strong evidence for the efficacy of an oral beta - glucan adjuvant for use in combination with anti-tumor antibodies such as...oral beta - glucan . The data showing that antibodies must activate complement and deposit iC3b on tumors means that antibodies that do not to activate complement would not benefit from oral beta - glucan .

  19. Plants with elevated levels of glucan

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pauly, Markus; Kraemer, Florian J.; Hake, Sarah

    The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.

  20. Host-pathogen interactions. XV. Fungal glucans which elicit phytoalexin accumulation in soybean also elicit the accumulation of phytoalexins in other plants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cline, K.; Wade, M.; Albersheim, P.

    1978-01-01

    A ..beta..-glucan isolated from the mycelial walls of Phytophthora megasperma var. sojae and a glucan purified from yeast extract stimulate the accumulation of phytoalexins in red kidney bean, Phaseolus vulgaris, and stimulate the accumulation of the phytoalexin, rishitin, in potato tubers, Solanum tuberosum. Treatment of kidney bean cotyledons with the glucan elicitors resulted in the accumulation of at least five fungistatic compounds. These compounds migrate during thin layer chromatography identically to the fungistatic compounds which accumulate in kidney beans which have been inoculated with Colletotrichum lindemuthianum, a fungal pathogen of kidney beans. Potatoes accumulate as much as 29 micrograms ofmore » rishitin per gram fresh weight following exposure to the glucan from Phytophthora megasperma va. sojae and as much as 19.5 micrograms of rishitin per gram fresh weight following exposure to yeast glucan.« less

  1. Saccharomyces Cerevisiae Cell Wall Components as Tools for Ochratoxin A Decontamination

    PubMed Central

    Piotrowska, Małgorzata; Masek, Anna

    2015-01-01

    The aim of this study was to evaluate the usefulness of Saccharomyces cerevisiae cell wall preparations in the adsorption of ochratoxin A (OTA). The study involved the use of a brewer’s yeast cell wall devoid of protein substances, glucans obtained by water and alkaline extraction, a glucan commercially available as a dietary supplement for animals and, additionally, dried brewer’s yeast for comparison. Fourier Transform Infrared (FTIR) analysis of the obtained preparations showed bands characteristic for glucans in the resulting spectra. The yeast cell wall preparation, water-extracted glucan and the commercial glucan bound the highest amount of ochratoxin A, above 55% of the initial concentration, and the alkaline-extracted glucan adsorbed the lowest amount of this toxin. It has been shown that adsorption is most effective at a close-to-neutral pH, while being considerably limited in alkaline conditions. PMID:25848694

  2. Infection Structure–Specific Expression of β-1,3-Glucan Synthase Is Essential for Pathogenicity of Colletotrichum graminicola and Evasion of β-Glucan–Triggered Immunity in Maize[W

    PubMed Central

    Oliveira-Garcia, Ely; Deising, Holger B.

    2013-01-01

    β-1,3-Glucan and chitin are the most prominent polysaccharides of the fungal cell wall. Covalently linked, these polymers form a scaffold that determines the form and properties of vegetative and pathogenic hyphae. While the role of chitin in plant infection is well understood, the role of β-1,3-glucan is unknown. We functionally characterized the β-1,3-glucan synthase gene GLS1 of the maize (Zea mays) pathogen Colletotrichum graminicola, employing RNA interference (RNAi), GLS1 overexpression, live-cell imaging, and aniline blue fluorochrome staining. This hemibiotroph sequentially differentiates a melanized appressorium on the cuticle and biotrophic and necrotrophic hyphae in its host. Massive β-1,3-glucan contents were detected in cell walls of appressoria and necrotrophic hyphae. Unexpectedly, GLS1 expression and β-1,3-glucan contents were drastically reduced during biotrophic development. In appressoria of RNAi strains, downregulation of β-1,3-glucan synthesis increased cell wall elasticity, and the appressoria exploded. While the shape of biotrophic hyphae was unaffected in RNAi strains, necrotrophic hyphae showed severe distortions. Constitutive expression of GLS1 led to exposure of β-1,3-glucan on biotrophic hyphae, massive induction of broad-spectrum defense responses, and significantly reduced disease symptom severity. Thus, while β-1,3-glucan synthesis is required for cell wall rigidity in appressoria and fast-growing necrotrophic hyphae, its rigorous downregulation during biotrophic development represents a strategy for evading β-glucan–triggered immunity. PMID:23898035

  3. Lung cancer and β-glucans: review of potential therapeutic applications.

    PubMed

    Roudi, Raheleh; Mohammadi, Shahla Roudbar; Roudbary, Maryam; Mohsenzadegan, Monireh

    2017-08-01

    The potential of natural substances with immunotherapeutic properties has long been studied. β-glucans, a cell wall component of certain bacteria and fungi, potentiate the immune system against microbes and toxic substances. Moreover, β-glucans are known to exhibit direct anticancer effects and can suppress cancer proliferation through immunomodulatory pathways. Mortality of lung cancer has been alarmingly increasingly worldwide; therefore, treatment of lung cancer is an urgent necessity. Numerous researchers are now dedicated to using β-glucans as a therapy for lung cancer. In the present attempt, we have reviewed the studies addressing therapeutic effects of β-glucans in primary and metastatic lung cancer published in the time period of 1991-2016.

  4. Clinical Utility of Fungal Screening Assays in Adults with Severe Burns

    DTIC Science & Technology

    2013-01-01

    available test, FungitellTM Glucan Assay for (1,3) b D glucan (BG) in serum (Associates of Cape Cod Inc., East Falmouth, MA), is a qualitative...considered a positive test in the United States and was used as a positive value in this study. A positive test is reported with a b D glucan concentration... Glucan as a diagnostic adjunct for invasive fungal infections: validation, cutoff development, and performance in patients with acute myelogenous

  5. Contribution of AmyA, an extracellular α-glucan degrading enzyme, to group A streptococcal host-pathogen interaction

    PubMed Central

    Shelburne, Samuel A.; Keith, David B.; Davenport, Michael T.; Beres, Stephen B.; Carroll, Ronan K.; Musser, James M.

    2010-01-01

    α-glucans such as starch and glycogen are abundant in the human oropharynx, the main site of group A Streptococcus (GAS) infection. However, the role in pathogenesis of GAS extracellular α-glucan binding and degrading enzymes is unknown. The serotype M1 GAS genome encodes two extracellular proteins putatively involved in α-glucan binding and degradation; pulA encodes a cell-wall anchored pullulanase and amyA encodes a freely secreted putative cyclomaltodextrin α-glucanotransferase. Genetic inactivation of amyA, but not pulA, abolished GAS α-glucan degradation. The ΔamyA strain had a slower rate of translocation across human pharyngeal epithelial cells. Consistent with this finding, the ΔamyA strain was less virulent following mouse mucosal challenge. Recombinant AmyA degraded α-glucans into β-cyclomaltodextrins that reduced pharyngeal cell transepithelial resistance, providing a physiologic explanation for the observed transepithelial migration phenotype. Higher amyA transcript levels were present in serotype M1 GAS strains causing invasive infection compared to strains causing pharyngitis. GAS proliferation in a defined α-glucan-containing medium was dependent on the presence of human salivary α-amylase. These data delineate the molecular mechanisms by which α-glucan degradation contributes to GAS host-pathogen interaction including how GAS employs human salivary α-amylase for its own metabolic benefit. PMID:19735442

  6. Impact of new ingredients obtained from brewer's spent yeast on bread characteristics.

    PubMed

    Martins, Z E; Pinho, O; Ferreira, I M P L V O

    2018-05-01

    The impact of bread fortification with β-glucans and with proteins/proteolytic enzymes from brewers' spent yeast on physical characteristics was evaluated. β-Glucans extraction from spent yeast cell wall was optimized and the extract was incorporated on bread to obtain 2.02 g β-glucans/100 g flour, in order to comply with the European Food Safety Authority guidelines. Protein/proteolytic enzymes extract from spent yeast was added to bread at 60 U proteolytic activity/100 g flour. Both β-glucans rich and proteins/proteolytic enzymes extracts favoured browning of bread crust. However, breads with proteins/proteolytic enzymes addition presented lower specific volume, whereas the incorporation of β-glucans in bread lead to uniform pores that was also noticeble in terms of higher specific volume. Overall, the improvement of nutritional/health promoting properties is highlighted with β-glucan rich extract, not only due to bread β-glucan content but also for total dietary fibre content (39% increase). The improvement was less noticeable for proteins/proteolytic enzymes extract. Only a 6% increase in bread protein content was noted with the addition of this extract and higher protein content would most likely accentuate the negative impact on bread specific volume that in turn could impair consumer acceptance. Therefore, only β-glucan rich extract is a promising bread ingredient.

  7. Structural characterization and evaluation of antioxidant, anticancer and hypoglycemic activity of radiation degraded oat (Avena sativa) β- glucan

    NASA Astrophysics Data System (ADS)

    Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.

    2018-03-01

    Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.

  8. β-Glucans Are Masked but Contribute to Pulmonary Inflammation During Pneumocystis Pneumonia.

    PubMed

    Kutty, Geetha; Davis, A Sally; Ferreyra, Gabriela A; Qiu, Ju; Huang, Da Wei; Sassi, Monica; Bishop, Lisa; Handley, Grace; Sherman, Brad; Lempicki, Richard; Kovacs, Joseph A

    2016-09-01

    β-glucans, which can activate innate immune responses, are a major component in the cell wall of the cyst form of Pneumocystis In the current study, we examined whether β-1,3-glucans are masked by surface proteins in Pneumocystis and what role β-glucans play in Pneumocystis-associated inflammation. For 3 species, including Pneumocystis jirovecii, which causes Pneumocystis pneumonia in humans, Pneumocystis carinii, and Pneumocystis murina, β-1,3-glucans were masked in most organisms, as demonstrated by increased exposure following trypsin treatment. Using quantitative polymerase chain reaction and microarray techniques, we demonstrated in a mouse model of Pneumocystis pneumonia that treatment with caspofungin, an inhibitor of β-1,3-glucan synthesis, for 21 days decreased expression of a broad panel of inflammatory markers, including interferon γ, tumor necrosis factor α, interleukin 1β, interleukin 6, and multiple chemokines/chemokine ligands. Thus, β-glucans in Pneumocystis cysts are largely masked, which likely decreases innate immune activation; this mechanism presumably was developed for interactions with immunocompetent hosts, in whom organism loads are substantially lower. In immunosuppressed hosts with a high organism burden, organism death and release of glucans appears to be an important contributor to deleterious host inflammatory responses. Published by Oxford University Press for the Infectious Diseases Society of America 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  9. Enhanced Release of Immunostimulating β-1,3- Glucan by Autodigestion of the Lingzhi Medicinal Mushroom, Ganoderma lingzhi (Agaricomycetes).

    PubMed

    Ishimoto, Yuina; Ishibashi, Ken-Ichi; Yamanaka, Daisuke; Adachi, Yoshiyuki; Ito, Hisatomi; Igami, Kentaro; Miyazaki, Toshitsugu; Ohno, Naohito

    2017-01-01

    Ganoderma lingzhi is a widely used medicinal mushroom that has antioxidative effects, ameliorates insulin resistance, and improves quality of life in patients with metabolic syndrome. Potentiation of immunity is also a major function of G. lingzhi, and this has been applied in patients with cancer. Supplementing G. lingzhi into foods reduced the metastasis of cancer cells. β-l,3-glucan is an important bioactive component of G. lingzhi. In this study we enhanced the solubilization ofimmunostimulating β-l,3-glucan by autodigestion of G. lingzhi. Fruiting bodies of G. lingzhi were disrupted and suspended in distilled water, then autodigested at 37°C for 24 hours. The resulting suspension was dried by spray drying. To assess the solubilization of β-l,3-glucan by autodigestion, cold and hot water extracts and sodium hydroxide extracts of G. lingzhi were prepared with and without autodigestion. Sodium hydroxide extracts were neutralized and dialyzed against distilled water. The resulting soluble and precipitated fractions were collected. Chemical, biochemical, and immunochemical characteristics of the extracts were compared. The yields of cold water extracts of autodigested and native G. lingzhi were significantly lower than the other extracts. Glucose was the major sugar component of the hot water extract, cold alkali extract (CAS), and the cold hydroxide extract insoluble in neutral aqueous condition (CASP) of the autodigested and native G. lingzhi. Nuclear magnetic resonance analysis revealed branched β-glucans in the hot water extract and CAS of the autodigested and native G. lingzhi. By contrast, the CASP of the autodigested and native G. lingzhi comprised mainly mixtures of linear α-l,3-glucans and linear β-l,3-glucans. Immunostimulation by β-l,3-glucan was examined by limulus factor G activation, dectin-1 binding, and anti-β-glucan antibody binding. Comparing relative activity, immunostimulating β-l,3-glucan was detected in the hot water extract, rather than the CAS, of autodigested and native G. lingzhi. Immunostimulating of β-glucan was also detected in the cold water extract of the autodigested G. lingzhi. These findings demonstrate that autodigestion is a useful processing protocol for enhancing the usefulness of G. lingzhi as a functional food.

  10. Measuring (1,3)-β-D-glucan in tracheal aspirate, bronchoalveolar lavage fluid, and serum for detection of suspected Candida pneumonia in immunocompromised and critically ill patients: a prospective observational study.

    PubMed

    Su, Kang-Cheng; Chou, Kun-Ta; Hsiao, Yi-Han; Tseng, Ching-Min; Su, Vincent Yi-Fong; Lee, Yu-Chin; Perng, Diahn-Warng; Kou, Yu Ru

    2017-04-08

    While Candida pneumonia is life-threatening, biomarker measurements to early detect suspected Candida pneumonia are lacking. This study compared the diagnostic values of measuring levels of (1, 3)-β-D-glucan in endotracheal aspirate, bronchoalveolar lavage fluid, and serum to detect suspected Candida pneumonia in immunocompromised and critically ill patients. This prospective, observational study enrolled immunocompromised, critically ill, and ventilated patients with suspected fungal pneumonia in mixed intensive care units from November 2010 to October 2011. Patients with D-glucan confounding factors or other fungal infection were excluded. Endotracheal aspirate, bronchoalveolar lavage fluid and serum were collected from each patient to perform a fungal smear, culture, and D-glucan assay. After screening 166 patients, 31 patients completed the study and were categorized into non-Candida pneumonia/non-candidemia (n = 18), suspected Candida pneumonia (n = 9), and non-Candida pneumonia/candidemia groups (n = 4). D-glucan levels in endotracheal aspirate or bronchoalveolar lavage were highest in suspected Candida pneumonia, while the serum D-glucan level was highest in non-Candida pneumonia/candidemia. In all patients, the D-glucan value in endotracheal aspirate was positively correlated with that in bronchoalveolar lavage fluid. For the detection of suspected Candida pneumonia, the predictive performance (sensitivity/specificity/D-glucan cutoff [pg/ml]) of D-glucan in endotracheal aspirate and bronchoalveolar lavage fluid was 67%/82%/120 and 89%/86%/130, respectively, accounting for areas under the receiver operating characteristic curve of 0.833 and 0.939 (both P < 0.05), respectively. Measuring serum D-glucan was of no diagnostic value (area under curve =0.510, P = 0.931) for the detection of suspected Candida pneumonia in the absence of concurrent candidemia. D-glucan levels in both endotracheal aspirate and bronchoalveolar lavage, but not in serum, provide good diagnostic values to detect suspected Candida pneumonia and to serve as potential biomarkers for early detection in this patient population.

  11. Distinct Patterns of Dendritic Cell Cytokine Release Stimulated by Fungal β-Glucans and Toll-Like Receptor Agonists▿

    PubMed Central

    Huang, Haibin; Ostroff, Gary R.; Lee, Chrono K.; Wang, Jennifer P.; Specht, Charles A.; Levitz, Stuart M.

    2009-01-01

    β-Glucans derived from fungal cell walls have potential uses as immunomodulating agents and vaccine adjuvants. Yeast glucan particles (YGPs) are highly purified Saccharomyces cerevisiae cell walls composed of β1,6-branched β1,3-d-glucan and free of mannans. YGPs stimulated secretion of the proinflammatory cytokine tumor necrosis factor alpha (TNF-α) in wild-type murine bone marrow-derived myeloid dendritic cells (BMDCs) but did not stimulate interleukin-12p70 (IL-12p70) production. A purified soluble β1,6-branched β1,3-d-glucan, scleroglucan, also stimulated TNF-α in BMDCs. These two β-glucans failed to stimulate TNF-α in Dectin-1 (β-glucan receptor) knockout BMDCs. Costimulation of wild-type BMDCs with β-glucans and specific Toll-like receptor (TLR) ligands resulted in greatly enhanced TNF-α production but decreased IL-12p70 production compared with TLR agonists alone. The upregulation of TNF-α and downregulation of IL-12p70 required Dectin-1, but not IL-10. Gamma interferon (IFN-γ) priming did not overcome IL-12p70 reduction by β-glucans. Similar patterns of cytokine regulation were observed in human monocyte-derived dendritic cells (DCs) costimulated with YGPs and the TLR4 ligand lipopolysaccharide. Finally, costimulation of BMDCs with YGPs and either the TLR9 ligand, CpG, or the TLR2/1 ligand, Pam3CSK4, resulted in upregulated secretion of IL-1α and IL-10 and downregulated secretion of IL-1β, IL-6, and IFN-γ-inducible protein 10 but had no significant effects on IL-12p40, keratinocyte-derived chemokine, monocyte chemotactic protein 1, or macrophage inflammatory protein α, compared with the TLR ligand alone. Thus, β-glucans have distinct effects on cytokine responses following DC stimulation with different TLR agonists. These patterns of response might contribute to the skewing of immune responses during mycotic infections and have implications for the design of immunomodulators and vaccines containing β-glucans. PMID:19273561

  12. Quantitative evaluation of 1,3,1,6 β-D-glucan contents in wild-growing species of edible Polish mushrooms

    PubMed

    Mirończuk-Chodakowska, Iwona; Witkowska, Anna Maria; Zujko, Małgorzata Elżbieta; Terlikowska, Katarzyna Maria

    Macrofungal β-glucans are mainly represented by compounds with β-1,3- and β-1,6 glycosidic bonds. They have been shown to have immunomodulatory, anticancer, and antioxidant properties. Although there are many reports on the bioactivity and structure of fungal glucans, studies on the quantitative assessment of these compounds are sparse. The aim of the study was to determine total β-glucans and 1,3-1,6-β-D-glucan contents in selected species of wild-growing edible Polish mushrooms. Eight species of wild-growing edible mushrooms Boletus pinophilus, Hydnum repandum, Craterellus cornucopioides, Suillus variegatus, Suillus granulatus, Gyroporus cyanescens, Tricholomopsis rutilans, and Auricularia auricula-judae and one species of cultivated mushroom for comparison purposes Agaricus bisporus, were analyzed. Quantitative analysis of 1,3-1,6-β-D-glucans was done using a colorimetric method in accordance with Nitschke et al. Mean total β-glucan content varied from 13.5 g/100 g dry mass in A. bisporus (portobello variety) to 40.9 g/100 g dry mass in T. rutilans. Mean 1,3-1,6-β-D-glucan content in the analyzed fruiting bodies ranged from 3.9 g/100 g dry mass in Agaricus bisporus (cremini) to 16.8 g/100 g dry mass in Auricularia auricula-judae (wood ear). The following mushrooms demonstrated the greatest percentage of 1,3-1,6-β-D-glucan contents in relation to the total β-glucan content: Gyroporus cyanescens (54%), Suillus granulatus (49.8%), Auricularia auricula-judae (47.9%), and Suillus variegatus (40.6%). Among the analyzed species, wild-growing mushrooms had a generally higher average 1,3-1,6-β-Dglucan content compared with cultivated mushrooms such as A. bisporus. The highest average content of these polysaccharides was observed in medicinal mushroom Auricularia auricula-judae. Comparable 1,3-1,6-β-D-glucan content, in relation to this mushroom species, was found in Gyroporus cyanescens, Suillus granulatus and Suillus variegatus, which points to the possibility of the use of these species of mushrooms as medicinal foods.

  13. Barley β-glucan increases fecal bile acid excretion and short chain fatty acid levels in mildly hypercholesterolemic individuals.

    PubMed

    Thandapilly, Sijo J; Ndou, Saymore P; Wang, Yanan; Nyachoti, Charles M; Ames, Nancy P

    2018-06-20

    The cholesterol-lowering effect of barley β-glucan has been proposed to be the result of a pleiotropic effect, which involves several biological mechanisms such as gut fermentation, inhibition of intestinal cholesterol absorption and increased bile acid excretion and its synthesis. However, one of the recent studies from our laboratory indicated that increased bile acid excretion and subsequent increase in its synthesis, but not the inhibition of cholesterol absorption or synthesis might be responsible for the cholesterol-lowering effect of barley β-glucan. Accordingly, the primary objective of the present study was to investigate the concentration of bile acids (BA), neutral sterols (NS) and short chain fatty acids (SCFA) excreted through the feces by mildly hypercholesterolemic subjects who consumed diets containing barley β-glucan with varying molecular weights (MW) and concentrations. In a controlled, four phase, crossover trial, 30 mildly hypercholesterolemic but otherwise healthy subjects were randomly assigned to receive breakfast containing 3 g high MW (HMW), 5 g low MW (LMW), 3 g LMW barley β-glucan or a control diet for 5 weeks. The concentrations of BA, NS and SCFA in the feces were measured at the end of each treatment phase. Compared to the other treatment groups, 3 g day-1 HMW barley β-glucan consumption resulted in increased lithocholic acid (LCA) excretion (P < 0.001) but not LMW β-glucan, even at the high dose of 5 g day-1. Increased fermentability of fibre was also evident from a significant increase in fecal total SCFA concentrations in response to the 3 g HMW β-glucan diet compared to the 3 g LMW barley β-glucan and control diet (P = 0.0015). In summary, the current results validate our previous report on the role of fecal bile acid excretion in cholesterol lowering through the consumption of barley β-glucan. In addition, increased SCFA concentrations indicate that an increase in β-glucan molecular weight promotes hindgut fermentation, which might also be playing a role in attenuating cholesterol levels.

  14. β-D-glucan inhibits endocrine-resistant breast cancer cell proliferation and alters gene expression

    PubMed Central

    JAFAAR, ZAINAB M.T.; LITCHFIELD, LACEY M.; IVANOVA, MARGARITA M.; RADDE, BRANDIE N.; AL-RAYYAN, NUMAN; KLINGE, CAROLYN M.

    2014-01-01

    Endocrine therapies have been successfully used for breast cancer patients with estrogen receptor α (ERα) positive tumors, but ∼40% of patients relapse due to endocrine resistance. β-glucans are components of plant cell walls that have immunomodulatory and anticancer activity. The objective of this study was to examine the activity of β-D-glucan, purified from barley, in endocrine-sensitive MCF-7 versus endocrine-resistant LCC9 and LY2 breast cancer cells. β-D-glucan dissolved in DMSO but not water inhibited MCF-7 cell proliferation in a concentration-dependent manner as measured by BrdU incorporation with an IC50 of ∼164±12 μg/ml. β-D-glucan dissolved in DMSO inhibited tamoxifen/endocrine-resistant LCC9 and LY2 cell proliferation with IC50 values of 4.6±0.3 and 24.2±1.4 μg/ml, respectively. MCF-10A normal breast epithelial cells showed a higher IC50 ∼464 μg/ml and the proliferation of MDA-MB-231 triple negative breast cancer cells was not inhibited by β-D-glucan. Concentration-dependent increases in the BAX/BCL2 ratio and cell death with β-D-glucan were observed in MCF-7 and LCC9 cells. PCR array analysis revealed changes in gene expression in response to 24-h treatment with 10 or 50 μg/ml β-D-glucan that were different between MCF-7 and LCC9 cells as well as differences in basal gene expression between the two cell lines. Select results were confirmed by quantitative real-time PCR demonstrating that β-D-glucan increased RASSF1 expression in MCF-7 cells and IGFBP3, CTNNB1 and ERβ transcript expression in LCC9 cells. Our data indicate that β-D-glucan regulates breast cancer-relevant gene expression and may be useful for inhibiting endocrine-resistant breast cancer cell proliferation. PMID:24534923

  15. Gamma-irradiated β-glucan modulates signaling molecular targets of hepatocellular carcinoma in rats.

    PubMed

    Elsonbaty, Sawsan M; Zahran, Walid E; Moawed, Fatma Sm

    2017-08-01

    β-glucans are one of the most abundant forms of polysaccharides known as biological response modifiers which influence host's biological response and stimulate immune system. Accordingly, this study was initiated to evaluate irradiated β-glucan as a modulator for cellular signaling growth factors involved in the pathogenesis of hepatocellular carcinoma in rats. Hepatocellular carcinoma was induced with 20 mg diethylnitrosamine/kg BW. Rats received daily by gastric gavage 65 mg irradiated β-glucan/kg BW. It was found that treatment of rats with diethylnitrosamine induced hepatic injury and caused significant increase in liver injury markers with a concomitant significant increase in both hepatic oxidative and inflammatory indices: alpha-fetoprotein, interferon gamma, and interleukin 6 in comparison with normal and irradiated β-glucan-treated groups. Western immunoblotting showed a significant increase in the signaling growth factors: extracellular signal-regulated kinase 1 and phosphoinositide 3-kinase proteins in a diethylnitrosamine-treated group while both preventive and therapeutic irradiated β-glucan treatments recorded significant improvement versus diethylnitrosamine group via the modulation of growth factors that encounters hepatic toxicity. The transcript levels of vascular endothelial growth factor A and inducible nitric oxide synthase genes were significantly higher in the diethylnitrosamine-treated group in comparison with controls. Preventive and therapeutic treatments with irradiated β-glucan demonstrated that the transcript level of these genes was significantly decreased which demonstrates the protective effect of β-glucan. Histological investigations revealed that diethylnitrosamine treatment affects the hepatic architecture throughout the significant severe appearance of inflammatory cell infiltration in the portal area and congestion in the portal vein in association with severe degeneration and dysplasia in hepatocytes all over hepatic parenchyma. The severity of hepatic architecture changes was significantly decreased with both β-glucan therapeutic and preventive treatments. In conclusion, irradiated β-glucan modulated signal growth factors, vascular endothelial growth factor A, extracellular signal-regulated kinase 1, and phosphatidylinositol-3-kinase, which contributed to experimental hepatocarcinogenesis.

  16. Structural Insights of Glucan Phosphatase Dynamics using Amide Hydrogen/Deuterium Exchange Mass Spectrometry

    PubMed Central

    Hsu, Simon; Kim, Youngjun; Li, Sheng; Durrant, Eric S.; Pace, Rachel M.; Woods, Virgil L.; Gentry, Matthew S.

    2009-01-01

    Laforin and Starch Excess 4 (SEX4) are founding members of a class of phosphatases that dephosphorylate phosphoglucans. Each protein contains a carbohydrate binding module (CBM) and a dual specificity phosphatase (DSP) domain. The gene encoding laforin is mutated in a fatal neurodegenerative disease called Lafora disease (LD). In the absence of laforin function, insoluble glucans accumulate that are hyperphosphorylated and exhibit sparse branching. It is hypothesized that these accumulations trigger the neurodegeneration and premature death of LD patients. We recently demonstrated that laforin removes phosphate from phosphoglucans and hypothesized that this function inhibits insoluble glucan accumulation. Loss of SEX4 function in plants yields a similar cellular phenotype; cells accumulate an excess amount of insoluble, hyperphosphorylated glucans. While multiple groups have shown that these phosphatases dephosphorylate phosphoglucans, there is no structure of a glucan phosphatase and little is known about the mechanism whereby they perform this action. We utilized hydrogen-deuterium exchange mass spectrometry (DXMS) and structural modeling to probe the conformational and structural dynamics of the glucan phosphatase SEX4. We found that the enzyme does not undergo a global conformational change upon glucan binding, but instead undergoes minimal rearrangement upon binding. The CBM undergoes increased protection from deuteration when bound to glucans, confirming its role in glucan binding. More interestingly, we identified structural components of the DSP that also undergo increased protection from deuteration upon glucan addition. To determine the position of these regions, we generated a homology model of the SEX4 DSP. The homology model shows that all of these regions are adjacent the DSP active site. Therefore, our results suggest that these regions of the DSP participate in presenting the phosphoglucan to the active site and provide the first structural analysis and mode of action of this unique class of phosphatases. PMID:19754155

  17. Cost-effectiveness of Maintaining Daily Intake of Oat β-Glucan for Coronary Heart Disease Primary Prevention.

    PubMed

    Earnshaw, Stephanie R; McDade, Cheryl L; Chu, YiFang; Fleige, Lisa E; Sievenpiper, John L

    2017-04-01

    Oat β-glucan reduces cholesterol levels and thus reduces the risk for coronary heart disease (CHD). However, its economic impact has not been well studied. We examined the economic impact of daily intake of ≥3 g of oat β-glucan in primary prevention of CHD in patients receiving statins or no pharmacologic treatment. A decision model was developed to compare costs and outcomes associated with lowering cholesterol levels with no pharmacologic treatment and normal diet, no pharmacologic treatment plus ≥3 g/d of oat β-glucan, and statin therapy plus ≥3 g/d of oat β-glucan. The population comprised men 45, 55, or 65 years of age with no history of cardiovascular disease and a 10-year risk for CHD of 5%, 7.5%, or 10%. Clinical efficacy data were gathered from meta-analyses; safety data, costs, and utilities were gathered from published literature. Cost per quality-adjusted life years and number of first events were reported. Maintaining ≥3 g/d of β-glucan may be cost-effective in men aged 45, 55, and 65 years with 10-year CHD risks of 5.0%, 7.5%, and 10.0% taking no pharmacologic treatment or on statins. It may also reduce first events of myocardial infarction and CHD death. Results are sensitive to oat β-glucan cost but insensitive to changes in other parameters. Maintaining ≥3 g of oat β-glucan daily remains cost-effective within plausible range of values. β-glucan may be cost-effective for preventing CHD events in middle-aged men with no history of cardiovascular events whose 10-year CHD risk is ≥5%. Maintaining daily β-glucan intake may have considerable impact on first events. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  18. β-Glucans (Saccharomyces cereviseae) Reduce Glucose Levels and Attenuate Alveolar Bone Loss in Diabetic Rats with Periodontal Disease

    PubMed Central

    2015-01-01

    The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p < 0.05). β-glucans reduced blood glucose, cholesterol and triacylglycerol levels in diabetic animals, both with and without periodontal disease (p < 0.05). Furthermore, treatment with β-glucans reduced the expression of cyclooxygenase-2 and receptor activator of nuclear factor kappa-B ligand and increased osteoprotegerin expression in animals with diabetes and periodontal disease (p < 0.05). It was concluded that treatment with β-glucans has beneficial metabolic and periodontal effects in diabetic rats with periodontal disease. PMID:26291983

  19. Substantial decrease in cell wall α-1,3-glucan caused by disruption of the kexB gene encoding a subtilisin-like processing protease in Aspergillus oryzae.

    PubMed

    Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu

    2016-09-01

    Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.

  20. Pulmonary α-1,3-Glucan-Specific IgA-Secreting B Cells Suppress the Development of Cockroach Allergy1

    PubMed Central

    Patel, Preeyam S.; King, R. Glenn; Kearney, John F.

    2016-01-01

    There is a higher incidence of allergic conditions among children living in industrialized countries than those in developing regions. One explanation for this is reduced neonatal exposure to microbes and the consequent lack of immune stimulation. Sensitivity to cockroach allergen is highly correlated with the development of severe asthma. In this study, we determined that an antibody to microbial α-1,3-glucan binds an Enterobacter species and cockroach allergen. Neonatal, but not adult, mice immunized with this α-1,3-glucan-bearing Enterobacter (MK7) are protected against cockroach allergy. Following exposure to cockroach allergen, α-1,3-glucan-specific IgA-secreting cells are present in the lungs of mice immunized with MK7 as neonates, but not in the lungs of those immunized as adults. Mice that are unable to generate anti-α-1,3-glucan IgA antibodies were immunized with MK7 as neonates and were no longer protected against cockroach allergy. Thus, neonatal, but not adult, exposure to α-1,3-glucan results in suppressed development of cockroach allergy via pulmonary α-1,3-glucan-specific IgA-secreting cells. PMID:27581173

  1. Interactions between meat proteins and barley (Hordeum spp.) β-glucan within a reduced-fat breakfast sausage system.

    PubMed

    Morin, L A; Temelli, F; McMullen, L

    2004-11-01

    Barley β-glucan, a soluble fibre component with health benefits, has the potential to be used as a fat replacer in meat systems. Interactions between meat proteins and β-glucan gum were examined in reduced-fat (12%, w/w) sausages formulated with β-glucan at 0.3% (w/w) (0.3β-gl) and 0.8% (w/w) (0.8β-gl) levels, as well as high- and reduced-fat controls. Cooking loss results indicated that β-glucan gum held more water in cooked sausages than control gum (carboxymethyl cellulose), due to its ability to form a tighter network within the protein matrix, as shown by scanning electron microscopy. In a raw system, β-glucan gum was not as effective at retaining moisture as a stable protein network, formed by heating. Differential scanning calorimetry results showed that sausages with a higher gum to protein ratio required additional energy for protein denaturation to occur. Findings indicate that β-glucan gum increases the amount of moisture held in a cooked meat protein system, due to the physical entrapment of water, when compared to the high-fat control, but is similar to the reduced-fat formulation with added water.

  2. AFRRI (Armed Forces Radiobiology Research Institute) Reports, October, January-March 1989

    DTIC Science & Technology

    1989-01-01

    and/or enhance recovery from radiation injury. 2. GLUCAN : BACKGROUND AND GENERAL IMMUNOLOGIC AND HEMOPOIETIC EFFECTS Glucan (Fig. 1) is a beta -l.3...and particulate glucan . Int. J Cancer 24, 773-779(1979). 18 J. Smtit’t z. P. R. ALMOND. J. R. Ct.NNINGHIAM, J. G. HoL r, R. LOEVINGIER. N...L., MacVittie, T. J., and Jackson, W. E. 4_ostirradia- tion glucan administration enhances the radioprotective effects of WR-27U1 SR89-11: Rabin, B

  3. Revisiting the structure of the anti-neoplastic glucans of Mycobacterium bovis Bacille Calmette-Guerin. Structural analysis of the extracellular and boiling water extract-derived glucans of the vaccine substrains.

    PubMed

    Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou

    2004-03-26

    The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.

  4. Beta-Glucan Activated Human B-Lymphocytes Participate in Innate Immune Responses by Releasing Pro-inflammatory Cytokines and Stimulating Neutrophil Chemotaxis

    PubMed Central

    Ali, Mohamed F.; Driscoll, Christopher B.; Walters, Paula R.; Limper, Andrew H.; Carmona, Eva M.

    2015-01-01

    B-lymphocytes play an essential regulatory role in the adaptive immune response through antibody production during infection. A less known function of B-lymphocytes is their ability to respond directly to infectious antigens through stimulation of pattern recognition receptors expressed on their surfaces. β-glucans are carbohydrates present in the cell wall of many pathogenic fungi that can be detected in the peripheral blood of patients during infection. They have been shown to participate in the innate inflammatory response as they can directly activate peripheral macrophages and dendritic cells. However, their effect as direct stimulators of B-lymphocytes has not been yet fully elucidated. The aim of this study was to examine the molecular mechanisms and cytokine profiles generated following β-glucan stimulation of B-lymphocytes, compared with the well-established TLR-9 agonist CpG-oligodeoxynucleotide (CpG) and study the participation of β-glucan stimulated B-cells in the innate immune response. Herein, we demonstrate that β-glucan activated B-lymphocytes upregulate pro-inflammatory cytokines (TNFα, IL-6 and IL-8). Interestingly, β-glucan, unlike CpG, had no effect on B-lymphocyte proliferation or IgM production. When compared with CpG (TLR9 agonist), β-glucan-activated cells secreted significantly higher levels of IL-8. Furthermore, IL-8 secretion was partially mediated by Dectin-1 and required SYK, MAPKs and the transcription factors NF-κB and AP-1. Moreover, we observed that conditioned media from β-glucan stimulated B-lymphocytes elicited neutrophil chemotaxis. These studies suggest that β-glucan activated B-lymphocytes have an important and novel role in fungal innate immune responses. PMID:26519534

  5. Immunomodulatory Activity of Dietary Fiber: Arabinoxylan and Mixed-Linked Beta-Glucan Isolated from Barley Show Modest Activities in Vitro

    PubMed Central

    Samuelsen, Anne Berit; Rieder, Anne; Grimmer, Stine; Michaelsen, Terje E.; Knutsen, Svein H.

    2011-01-01

    High intake of dietary fiber is claimed to protect against development of colorectal cancer. Barley is a rich source of dietary fiber, and possible immunomodulatory effects of barley polysaccharides might explain a potential protective effect. Dietary fiber was isolated by extraction and enzyme treatment. A mixed-linked β-glucan (WSM-TPX, 96.5% β-glucan, Mw 886 kDa), an arabinoxylan (WUM-BS-LA, 96.4% arabinoxylan, Mw 156 kDa), a mixed-linked β-glucan rich fraction containing 10% arabinoxylan (WSM-TP) and an arabinoxylan rich fraction containing 30% mixed-linked β-glucan (WUM-BS) showed no significant effect on IL-8 secretion and proliferation of two intestinal epithelial cell lines, Caco-2 and HT-29, and had no significant effect on the NF-κB activity in the monocytic cell line U937-3κB-LUC. Further enriched arabinoxylan fractions (WUM-BS-LA) from different barley varieties (Tyra, NK96300, SB94897 and CDCGainer) were less active than the mixed-linked β-glucan rich fractions (WSM-TP and WSM-TPX) in the complement-fixing test. The mixed-linked β-glucan rich fraction from NK96300 and CDCGainer showed similar activities as the positive control while mixed-linked β-glucan rich fractions from Tyra and SB94897 were less active. From these results it is concluded that the isolated high molecular weight mixed-linked β-glucans and arabinoxylans from barley show low immunological responses in selected in vitro test systems and thus possible anti-colon cancer effects of barley dietary fiber cannot be explained by our observations. PMID:21340001

  6. Aspergillus fumigatus Cell Wall α-(1,3)-Glucan Stimulates Regulatory T-Cell Polarization by Inducing PD-L1 Expression on Human Dendritic Cells.

    PubMed

    Stephen-Victor, Emmanuel; Karnam, Anupama; Fontaine, Thierry; Beauvais, Anne; Das, Mrinmoy; Hegde, Pushpa; Prakhar, Praveen; Holla, Sahana; Balaji, Kithiganahalli N; Kaveri, Srini V; Latgé, Jean-Paul; Aimanianda, Vishukumar; Bayry, Jagadeesh

    2017-12-05

    Human dendritic cell (DC) response to α-(1,3)-glucan polysaccharide of Aspergillus fumigatus and ensuing CD4+ T-cell polarization are poorly characterized. α-(1,3)-Glucan was isolated from A. fumigatus conidia and mycelia cell wall. For the analysis of polarization, DCs and autologous naive CD4+ T cells were cocultured. Phenotype of immune cells was analyzed by flow cytometry, and cytokines by enzyme-linked immunosorbent assay (ELISA). Blocking antibodies were used to dissect the role of Toll-like receptor 2 (TLR2) and programmed death-ligand 1 (PD-L1) in regulating α-(1,3)-glucan-mediated DC activation and T-cell responses. DCs from TLR2-deficient mice were additionally used to consolidate the findings. α-(1,3)-Glucan induced the maturation of DCs and was dependent in part on TLR2. "α-(1,3)-Glucan-educated" DCs stimulated the activation of naive T cells and polarized a subset of these cells into CD4+CD25+FoxP3+ regulatory T cells (Tregs). Mechanistically, Treg stimulation by α-(1,3)-glucan was dependent on the PD-L1 pathway that negatively regulated interferon-gamma (IFN-γ) secretion. Short α-(1,3)-oligosaccharides lacked the capacity to induce maturation of DCs but significantly blocked α-(1,3)-glucan-induced Treg polarization. PD-L1 dictates the balance between Treg and IFN-γ responses induced by α-(1,3)-glucan. Our data provide a rationale for the exploitation of immunotherapeutic approaches that target PD-1-PD-L1 to enhance protective immune responses to A. fumigatus infections. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  7. Viability of bifidobacteria strains in yogurt with added oat beta-glucan and corn starch during cold storage.

    PubMed

    Rosburg, Valerie; Boylston, Terri; White, Pamela

    2010-06-01

    Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.

  8. Overview of β-Glucans from Laminaria spp.: Immunomodulation Properties and Applications on Biologic Models

    PubMed Central

    Bonfim-Mendonça, Patrícia de Souza; Capoci, Isis Regina Grenier; Tobaldini-Valerio, Flávia Kelly; Negri, Melyssa; Svidzinski, Terezinha Inez Estivalet

    2017-01-01

    Glucans are a group of glucose polymers that are found in bacteria, algae, fungi, and plants. While their properties are well known, their biochemical and solubility characteristics vary considerably, and glucans obtained from different sources can have different applications. Research has described the bioactivity of β-glucans extracted from the algae of the Laminaria genus, including in vivo and in vitro studies assessing pro- and anti-inflammatory cytokines, vaccine production, inhibition of cell proliferation, and anti- and pro-oxidant activity. Thus, the objective of this article was to review the potential application of β-glucans from Laminaria spp. in terms of their immunomodulatory properties, microorganism host interaction, anti-cancer activity and vaccine development. PMID:28878139

  9. The influences of sugars and plant growth regulators on β-glucan synthesis of G. lucidum mycelium in submerged culture

    NASA Astrophysics Data System (ADS)

    Thao, Cao Phuong; Tien, Le Thi Thuy

    2017-09-01

    β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.

  10. Beta Glucan: Health Benefits in Obesity and Metabolic Syndrome

    PubMed Central

    El Khoury, D.; Cuda, C.; Luhovyy, B. L.; Anderson, G. H.

    2012-01-01

    Despite the lack of international agreement regarding the definition and classification of fiber, there is established evidence on the role of dietary fibers in obesity and metabolic syndrome. Beta glucan (β-glucan) is a soluble fiber readily available from oat and barley grains that has been gaining interest due to its multiple functional and bioactive properties. Its beneficial role in insulin resistance, dyslipidemia, hypertension, and obesity is being continuously documented. The fermentability of β-glucans and their ability to form highly viscous solutions in the human gut may constitute the basis of their health benefits. Consequently, the applicability of β-glucan as a food ingredient is being widely considered with the dual purposes of increasing the fiber content of food products and enhancing their health properties. Therefore, this paper explores the role of β-glucans in the prevention and treatment of characteristics of the metabolic syndrome, their underlying mechanisms of action, and their potential in food applications. PMID:22187640

  11. Isolation and characterization of beta-glucan synthase: A potential biochemical regulator of gravistimulated differential cell wall loosening

    NASA Technical Reports Server (NTRS)

    Kuzmanoff, K. M.

    1984-01-01

    In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.

  12. β-Glucan Synthase Gene Overexpression and β-Glucans Overproduction in Pleurotus ostreatus Using Promoter Swapping

    PubMed Central

    Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou

    2013-01-01

    Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi. PMID:23637884

  13. Neurospora crassa 1,3-α-glucan synthase, AGS-1, is required for cell wall biosynthesis during macroconidia development

    PubMed Central

    Fu, Ci; Tanaka, Asuma

    2014-01-01

    The Neurospora crassa genome encodes two 1,3-α-glucan synthases. One of these 1,3-α-glucan synthase genes, ags-1, was shown to be required for the synthesis of 1,3-α-glucan in the aerial hyphae and macroconidia cell walls. 1,3-α-Glucan was found in the conidia cell wall, but was absent from the vegetative hyphae cell wall. Deletion of ags-1 affected conidial development. Δags-1 produced only 5 % as many conidia as the WT and most of the conidia produced by Δags-1 were not viable. The ags-1 upstream regulatory elements were shown to direct cell-type-specific expression of red fluorescent protein in conidia and aerial hyphae. A haemagglutinin-tagged AGS-1 was found to be expressed in aerial hyphae and conidia. The research showed that 1,3-α-glucan is an aerial hyphae and conidia cell wall component, and is required for normal conidial differentiation. PMID:24847001

  14. Membrane pore architecture of the CslF6 protein controls (1-3,1-4)-β-glucan structure.

    PubMed

    Jobling, Stephen A

    2015-06-01

    The cereal cell wall polysaccharide (1-3,1-4)-β-glucan is a linear polymer of glucose containing both β1-3 and β1-4 bonds. The structure of (1-3,1-4)-β-glucan varies between different cereals and during plant growth and development, but little is known about how this is controlled. The cellulose synthase-like CslF6 protein is an integral membrane protein and a major component of the (1-3,1-4)-β-glucan synthase. I show that a single amino acid within the predicted transmembrane pore domain of CslF6 controls (1-3,1-4)-β-glucan structure. A new mechanism for the control of the polysaccharide structure is proposed where membrane pore architecture and the translocation of the growing polysaccharide across the membrane control how the acceptor glucan is coordinated at the active site and thus the proportion of β1-3 and β1-4 bonds within the polysaccharide.

  15. Beta 1,3/1,6-glucan and vitamin C immunostimulate the non-specific immune response of white shrimp (Litopenaeus vannamei).

    PubMed

    Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua

    2016-10-01

    This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.

    PubMed

    Das, Deeplina; Baruah, Rwivoo; Goyal, Arun

    2014-08-01

    An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Response of the intestinal mucosal barrier of carp (Cyprinus carpio) to a bacterial challenge by Aeromonas hydrophila intubation after feeding with β-1,3/1,6-glucan.

    PubMed

    Jung-Schroers, V; Adamek, M; Harris, S; Syakuri, H; Jung, A; Irnazarow, I; Steinhagen, D

    2018-03-15

    The effect of dietary β-glucan on the bacterial community in the gut of common carp (Cyprinus carpio) was examined after oral application of Aeromonas hydrophila. Carp received either feed supplemented with 1% MacroGard ® , a β-1,3/1,6-glucan, or a β-glucan-free diet. Fourteen days after feeding, half of the carp from each group were intubated with 10 9 colony-forming units (CFU) of a pathogenic strain of A. hydrophila. Gut samples were taken 12 hr to 7 days after application and analysed using microbiological and molecular biological techniques (NGS, RT-PCR-DGGE). The reaction of the mucosa and the microbiota to an A. hydrophila intubation differed in carp fed with β-glucan compared to carp from the control group. In β-glucan fed carp, the total bacterial amount was lower but the number of bacterial species was higher. Bacterial composition was different for carp from both treatment groups. The number of mucin filled goblet cells was reduced in carp fed the β-glucan diet. Mucus was obviously released from the goblet cells and was probably washed out of the gut together with high numbers of bacteria. This might be protective against pathogenic bacteria and, therefore, feeding with β-glucan may provide protection against infections of the gut in carp. © 2018 John Wiley & Sons Ltd.

  18. Effects of β-Glucans Ingestion on Alveolar Bone Loss, Intestinal Morphology, Systemic Inflammatory Profile, and Pancreatic β-Cell Function in Rats with Periodontitis and Diabetes

    PubMed Central

    Silva, Viviam de O.; Lobato, Raquel V.; Orlando, Débora R.; Borges, Bruno D.B.; de Sousa, Raimundo V.

    2017-01-01

    This study aimed to evaluate the effects of β-glucan ingestion (Saccharomyces cerevisiae) on the plasmatic levels of tumor necrosis factor-α (TNF-α) and interleukin-10 (IL-10), alveolar bone loss, and pancreatic β-cell function (HOMA-BF) in diabetic rats with periodontal disease (PD). Besides, intestinal morphology was determined by the villus/crypt ratio. A total of 48 Wistar rats weighing 203 ± 18 g were used. Diabetes was induced by the intraperitoneal injection of streptozotocin (80 mg/kg) and periodontal inflammation, by ligature. The design was completely randomized in a factorial scheme 2 × 2 × 2 (diabetic or not, with or without periodontitis, and ingesting β-glucan or not). The animals received β-glucan by gavage for 28 days. Alveolar bone loss was determined by scanning electron microscopy (distance between the cementoenamel junction and alveolar bone crest) and histometric analysis (bone area between tooth roots). β-glucan reduced plasmatic levels of TNF-α in diabetic animals with PD and of IL-10 in animals with PD (p < 0.05). β-glucan reduced bone loss in animals with PD (p < 0.05). In diabetic animals, β-glucan improved β-cell function (p < 0.05). Diabetic animals had a higher villus/crypt ratio (p < 0.05). In conclusion, β-glucan ingestion reduced the systemic inflammatory profile, prevented alveolar bone loss, and improved β-cell function in diabetic animals with PD. PMID:28906456

  19. Varying Effects of Different β-Glucans on the Maturation of Porcine Monocyte-Derived Dendritic Cells ▿

    PubMed Central

    Sonck, Eva; Devriendt, Bert; Goddeeris, Bruno; Cox, Eric

    2011-01-01

    β-Glucans are well known for their immunomodulatory capacities in humans and mice. For this reason, together with the European ban on growth-promoting antibiotics, β-glucans are intensively used in pig feed. However, as shown in the present study, there is much variation in the stimulatory capacities of β-glucans from different sources. Since dendritic cells (DCs) are the first cells that are encountered after an antigen is taken up by the intestinal epithelial cell barrier, we decided to investigate the effect of two concentrations (5 and 10 μg/ml) of five commercial β-glucan preparations, differing in structure and source, on porcine monocyte-derived dendritic cells (MoDCs). Although all β-glucans gave rise to a significant reduction of the phagocytic activity of DCs, only Macrogard induced a significant phenotypic maturation. In addition to Macrogard, zymosan, another β-glucan derived from Saccharomyces cerevisiae, and curdlan also significantly improved the T-cell-stimulatory capacity of MoDCs. Most interesting, however, is the cytokine secretion profile of curdlan-stimulated MoDCs, since only curdlan induced significant higher expression levels of interleukin-1β (IL-1β), IL-6, IL-10, and IL-12/IL-23p40. Since the cytokine profile of DCs influences the outcome of the ensuing immune response and thus may prove valuable in intestinal immunity, a careful choice is necessary when β-glucans are used as dietary supplement. PMID:21752950

  20. β-Glucans inhibit intracellular growth of Mycobacterium bovis BCG but not virulent Mycobacterium tuberculosis in human macrophages

    PubMed Central

    Morris, Jessica D.; Rajaram, Murugesan V.S.; Schlesinger, Larry S.

    2014-01-01

    The yeast polysaccharide, β-glucan, has been shown to promote both anti-microbial and anti-tumor activities through its interaction with macrophages. Here we analyzed the effects of an insoluble whole glucan particle (WGP), a 1,3/1,6-β-glucan from Saccharomyces cerevisiae, and a soluble poly-1-6-β-d-glucopyranosyl-1-3-β-d-glucopyranose (PGG), a hydrolytic product of WGP, on the anti-microbial response of human macrophages against mycobacterial infection. Treatment of macrophages with WGP and PGG significantly decreased cell association and intracellular growth of Mycobacterium bovis BCG, but not Mycobacterium tuberculosis (M.tb) when compared to untreated controls. We characterized the influence of β-glucans on the generation of macrophage oxidative products and pro-inflammatory cytokines, two important anti-microbial defense mechanisms. WGP but not PGG treatment enhanced the oxidative response of macrophages as determined by the 2′,7′-dichlorofluorescin (DCF) assay. WGP treatment also induced macrophages to produce pro-inflammatory cytokines. The β-glucan receptor, Dectin-1, was found to be involved in the WGP-induced macrophage oxidative burst and intracellular growth inhibition of M. bovis BCG. This report indicates that although some forms of β-glucan are able to stimulate the respiratory burst and cytokine production in human macrophages, and exhibit antimicrobial properties against M. bovis BCG, the β-glucans tested here did not inhibit growth of M.tb within human macrophages. PMID:21762773

  1. Chitosan-guar gum-silver nanoparticles hybrid matrix with immobilized enzymes for fabrication of beta-glucan and glucose sensing photometric flow injection system.

    PubMed

    Bagal-Kestwal, Dipali R; Kestwal, Rakesh Mohan; Hsieh, Wen-Ting; Chiang, Been-Huang

    2014-01-01

    Simple and fast photometric flow injection analysis system was developed for sensing of β-1,3-glucan from medicinal mushroom Ganoderma lucidum during fermentation. For this purpose, the chitosan-guar gum-silver nanoparticle-beta glucanase (Ch-GG-AgNPs-βG) beads and Ch-GG-AgNPs-GOD (glucose oxidase) beads were prepared. The bead packed mini-columns were then used to assemble a flow injection analysis (FIA) system for the detection of β-(1→3)-d-glucan biomarker or glucose. This colorimetric flow system can detect glucose and glucan with detection limits as low as 50ngmL(-1) and 100ngmL(-1) (S/N=3), respectively. The analysis time of this FIA was approximately 40s, which is faster than the previously reported glucan sensors. The glucose and glucan calibration curves were obtained in the range of 0.25-1.25μgmL(-1) (R(2)=0.988) and 0.2-1.0μgmL(-1)(R(2)=0.979), respectively. The applicability of the nano-bio-composite FIA sensor system for spiked and real β-(1→3)-d-glucan samples were tested, and the accuracy of the results were greater than 95%. Thus, the designed FIA provides a simple, interference free and rapid tool for monitoring glucose and β-glucan content, which can be used for various food samples with a little modification. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Production of insoluble glucans using modified recombinant glycosyltransferase from Leuconostoc mesenteroides

    USDA-ARS?s Scientific Manuscript database

    Glucansucrases catalyze the transfer of D-glucopyranosyl units from sucrose to form a-glucan chains. Glucansucrases are capable of catalyzing the synthesis of several different a-glucosidic linkages that affect molecular mass, branching, and solubility of the polysaccharide. In general, a-glucans co...

  3. Barley and oat beta-glucan content measured by calcofluor fluorescence in a microplate assay

    USDA-ARS?s Scientific Manuscript database

    Beta-glucan levels in grains, particularly barley and oats, are receiving increased interest in part due to their recognized benefits to human health. While a number of methods to determine grain beta-glucan levels are available, each suffers from significant drawbacks for routine implementation. ...

  4. 21 CFR 866.3050 - Beta-glucan serological assays.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Beta-glucan serological assays. 866.3050 Section 866.3050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3050 Beta-glucan...

  5. 21 CFR 866.3050 - Beta-glucan serological assays.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Beta-glucan serological assays. 866.3050 Section 866.3050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3050 Beta-glucan...

  6. 21 CFR 866.3050 - Beta-glucan serological assays.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Beta-glucan serological assays. 866.3050 Section 866.3050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3050 Beta-glucan...

  7. 21 CFR 866.3050 - Beta-glucan serological assays.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Beta-glucan serological assays. 866.3050 Section 866.3050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3050 Beta-glucan...

  8. 21 CFR 866.3050 - Beta-glucan serological assays.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Beta-glucan serological assays. 866.3050 Section 866.3050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3050 Beta-glucan...

  9. Custom-tailored water-insoluble glucans from sucrose via glucansucrases

    USDA-ARS?s Scientific Manuscript database

    Dextrans and related glucans produced from sucrose by lactic acid bacteria have been studied for many years and are used in numerous commercial applications and products. Most of these glucans are water-soluble, except for a few notable exceptions from cariogenic Streptococcus spp. and a very small ...

  10. Water-insoluble glucans from sucrose via glucansucrases. Factors influencing structures and yields

    USDA-ARS?s Scientific Manuscript database

    Dextrans and related glucans produced from sucrose by lactic acid bacteria have been studied for many years and are used in numerous commercial applications and products. Most of these glucans are water-soluble, except for a few notable exceptions from cariogenic Streptococcus spp. and a very small ...

  11. Identification of amino acid residues in Streptococcus mutans glucosyltransferases influencing the structure of the glucan product.

    PubMed Central

    Shimamura, A; Nakano, Y J; Mukasa, H; Kuramitsu, H K

    1994-01-01

    The glucosyltransferases (GTFs) of mutans streptococci are important virulence factors in the sucrose-dependent colonization of tooth surfaces by these organisms. To investigate the structure-function relationship of the GTFs, an approach was initiated to identify amino acid residues of the GTFs which affect the incorporation of glucose residues into the glucan polymer. Conserved amino acid residues were identified in the GTF-S and GTF-I enzymes of the mutans streptococci and were selected for site-directed mutagenesis in the corresponding enzymes from Streptococcus mutans GS5. Conversion of six amino acid residues of the GTF-I enzyme to those present at the corresponding positions in GTF-S, either singly or in multiple combinations, resulted in enzymes synthesizing increased levels of soluble glucans. The enzyme containing six alterations synthesized 73% water-soluble glucan in the absence of acceptor dextran T10, while parental enzyme GTF-I synthesized no such glucan product. Conversely, when residue 589 of the GTF-S enzyme was converted from Thr to either Asp or Glu, the resulting enzyme synthesized primarily water-insoluble glucan in the absence of the acceptor. Therefore, this approach has identified several amino acid positions which influence the nature of the glucan product synthesized by GTFs. PMID:8050997

  12. Dectin-1 Activation by a Natural Product β-Glucan Converts Immunosuppressive Macrophages into an M1-like Phenotype

    PubMed Central

    Liu, Min; Luo, Fengling; Ding, Chuanlin; Albeituni, Sabrin; Hu, Xiaoling; Ma, Yunfeng; Cai, Yihua; McNally, Lacey; Sanders, Mary Ann; Jain, Dharamvir; Kloecker, Goetz; Bousamra, Michael; Zhang, Huang-ge; Higashi, Richard M.; Lane, Andrew N.; Fan, Teresa W-M.; Yan, Jun

    2015-01-01

    Tumor-associated macrophages (TAM) with an M2-like phenotype have been linked to tumor-elicited inflammation, immunosuppression, and resistance to chemotherapies in cancer, thus representing an attractive target for an effective cancer immunotherapy. Here, we demonstrate that particulate yeast-derived β-glucan, a natural polysaccharide compound, converts polarized M2 macrophages or immunosuppressive TAM into an M1-like phenotype with potent immuno-stimulating activity. This process is associated with macrophage metabolic reprograming with enhanced glycolysis, krebs cycle and glutamine utilization. In addition, particulate β-glucan converts immunosuppressive TAM via the C-type lectin receptor dectin-1-induced Syk-Card9-Erk pathway. Further in vivo studies show that oral particulate β-glucan treatment significantly delays tumor growth, which is associated with in vivo TAM phenotype conversion and enhanced effector T cell activation. Mice injected with particulate β-glucan-treated TAM mixed with tumor cells have significantly reduced tumor burden with less blood vascular vessels compared to those with TAM plus tumor cell injection. In addition, macrophage depletion significantly reduced the therapeutic efficacy of particulate β-glucan in tumor-bearing mice. These findings have established a new paradigm for macrophage polarization and immunosuppressive TAM conversion and shed the light on the action mode of β-glucan treatment in cancer. PMID:26453753

  13. In vivo evaluation of the antimutagenic and antigenotoxic effects of β-glucan extracted from Saccharomyces cerevisiae in acute treatment with multiple doses.

    PubMed

    Oliveira, Rodrigo Juliano; Salles, Maria José Sparça; da Silva, Ariane Fernanda; Kanno, Tatiane Yumi Nakamura; Lourenço, Ana Carolina Dos Santos; Leite, Véssia da Silva; Matiazi, Hevenilton José; Pesarini, João Renato; Ribeiro, Lúcia Regina; Mantovani, Mário Sérgio

    2013-09-01

    Ample evidence suggests that cancer is triggered by mutagenic damage and diets or supplements capable of reducing such incidences can be related to the prevention of neoplasy development or to an improvement in life quality of patients who undergo chemotherapy. This research aimed to evaluate the antimutagenic and antigenotoxic activity of β-glucan. We set up 8 experimental groups: control (Group 1), cyclophosphamide (Group 2), Groups 3-5 to assess the effect of β-glucan administration, and Groups 6-8 to evaluate the association between cyclophosphamide and β-glucan. The intraperitonial concentrations of β-glucan used were 100, 150 and 200 mg/kg. Micronucleus and comet assays showed that within the first week of treatment β-glucan presented a damage reduction rate between 100-62.04% and 94.34-59.52% for mutagenic and genotoxic damages, respectively. This activity decreased as the treatment was extended. During the sixth week of treatment antimutagenicity rates were reduced to 59.51-39.83% and antigenotoxicity was not effective. This leads to the conclusion that the efficacy of β-glucan in preventing DNA damage is limited when treatment is extended, and that its use as a chemotherapeutic adjuvant need to be better clarified.

  14. Unique carbohydrate binding platforms employed by the glucan phosphatases

    PubMed Central

    MEEKINS, David A.; GENTRY, Matthew S.

    2016-01-01

    Glucan phosphatases are a family of enzymes that are functionally conserved at the enzymatic level in animals and plants. These enzymes bind and dephosphorylate glycogen in animals and starch in plants. While the enzymatic function is conserved, the glucan phosphatases employ distinct mechanisms to bind and dephosphorylate glycogen or starch. The founding member of the family is a bimodular human protein called laforin that is comprised of a carbohydrate binding module 20 (CBM20) followed by a dual specificity phosphatase domain. Plants contain two glucan phosphatases: Starch EXcess4 (SEX4) and Like Sex Four2 (LSF2). SEX4 contains a chloroplast targeting peptide, dual specificity phosphatase (DSP) domain, a CBM45, and a carboxy-terminal motif. LSF2 is comprised of simply a chloroplast targeting peptide, DSP domain, and carboxy-terminal motif. SEX4 employs an integrated DSP-CBM glucan-binding platform to engage and dephosphorylate starch. LSF2 lacks a CBM and instead utilizes two surface binding sites to bind and dephosphorylate starch. Laforin is a dimeric protein in solution and it utilizes a tetramodular architecture and cooperativity to bind and dephosphorylate glycogen. This chapter describes the biological role of glucan phosphatases in glycogen and starch metabolism and compares and contrasts their ability to bind and dephosphorylate glucans. PMID:27147465

  15. Beta-glucan enhances the response to SVCV infection in zebrafish.

    PubMed

    M Medina-Gali, Regla; Ortega-Villaizan, María Del Mar; Mercado, Luis; Novoa, Beatriz; Coll, Julio; Perez, Luis

    2018-07-01

    The antiviral effects of beta-glucan, an immunostimulatory agent were studied in zebrafish both in vitro and in vivo. Here we show that zebrafish ZF4 cells as well as whole fish primed with yeast β-glucan zymosan exhibited increased cytokine expression and elevated response to spring viremia of carp virus (SVCV) infection. In vitro, previous treatment of β-glucan enhanced ZF4 cell viability against SVCV infection which is associated to the activation of interferon signaling pathway and inflammatory cytokines gene expression. In vivo, the SVCV-infected fish primed with β-glucan had a higher survival rate (≈73%) than the control SVCV-infected group (≈33%). Additionally, up-regulation of the expression of a set of genes involved in innate immune response was detected in zebrafish intraperitoneally injected of β-glucan: il1b, il6, il8, il10 and tnfa transcripts showed increased expression that appear to be rapid (2 days) but not long-lived (less than 2 weeks). The present study is, to our knowledge, the first to combine cell culture and in vivo approaches to describe host response to β-glucan stimulation and viral infection in zebrafish. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Glucan common to the microcyst walls of cyst-forming bacteria.

    PubMed Central

    Sutherland, I W; Mackenzie, C L

    1977-01-01

    Chemical analysis indicated that D-glucose is tha major neutral monosaccharide present in the microcysts of a range of gram-negative bacteria. Varying amounts of other neutral sugars were found. The glucose was mainly present as a glucan that could be extracted from microcysts of representative strains with alkali or mild acid treatment. The glucan could be identified as an alpha-1,3-linked polymer on the basis of (i) periodate resistance of the extracted polymer and the material present in microcysts; (ii) lectin agglutination of the microcysts; (iii) lectin precipitation of the extracted glucans; and (iv) susceptibility of the glucan either in the walls or after extraction to a specific alpha-1,3-glucanase from Aspergillus nidulans, yielding glucose as the sole hydrolysis product. The galactosamine found in microcysts of Myxococcus xanthus by other workers is clearly a component of another polymer, distinct from the glucan. The presence of an alpha 1,3-linked glucan, common to microcyst walls of various bacterial genera, probably contributes to the rigidity of the walls of these forms and, inter alia, to their resistance to ultrasonic treatment. Preliminary experiments indicate that the gulcan is discarded on germination of the microcysts rather than being broken down by specific enzymes. PMID:402353

  17. Functional characterization of barley betaglucanless mutants demonstrates a unique role for CslF6 in (1,3;1,4)-β-D-glucan biosynthesis

    PubMed Central

    Taketa, Shin; Yuo, Takahisa; Tonooka, Takuji; Tsumuraya, Yoichi; Inagaki, Yoshiaki; Haruyama, Naoto; Larroque, Oscar; Jobling, Stephen A.

    2012-01-01

    (1,3;1,4)-β-D-glucans (mixed-linkage glucans) are found in tissues of members of the Poaceae (grasses), and are particularly high in barley (Hordeum vulgare) grains. The present study describes the isolation of three independent (1,3;1,4)-β-D-glucanless (betaglucanless; bgl) mutants of barley which completely lack (1,3;1,4)-β-D-glucan in all the tissues tested. The bgl phenotype cosegregates with the cellulose synthase like HvCslF6 gene on chromosome arm 7HL. Each of the bgl mutants has a single nucleotide substitution in the coding region of the HvCslF6 gene resulting in a change of a highly conserved amino acid residue of the HvCslF6 protein. Microsomal membranes isolated from developing endosperm of the bgl mutants lack detectable (1,3;1,4)-β-D-glucan synthase activity indicating that the HvCslF6 protein is inactive. This was confirmed by transient expression of the HvCslF6 cDNAs in Nicotiana benthamiana leaves. The wild-type HvCslF6 gene directed the synthesis of high levels of (1,3;1,4)-β-D-glucans, whereas the mutant HvCslF6 proteins completely lack the ability to synthesize (1,3;1,4)-β-D-glucans. The fine structure of the (1,3;1,4)-β-D-glucan produced in the tobacco leaf was also very different from that found in cereals having an extremely low DP3/DP4 ratio. These results demonstrate that, among the seven CslF and one CslH genes present in the barley genome, HvCslF6 has a unique role and is the key determinant controlling the biosynthesis of (1,3;1,4)-β-D-glucans. Natural allelic variation in the HvCslF6 gene was found predominantly within introns among 29 barley accessions studied. Genetic manipulation of the HvCslF6 gene could enable control of (1,3;1,4)-β-D-glucans in accordance with the purposes of use. PMID:21940720

  18. The Complexity of Fungal β-Glucan in Health and Disease: Effects on the Mononuclear Phagocyte System

    PubMed Central

    Camilli, Giorgio; Tabouret, Guillaume; Quintin, Jessica

    2018-01-01

    β-glucan, the most abundant fungal cell wall polysaccharide, has gained much attention from the scientific community in the last few decades for its fascinating but not yet fully understood immunobiology. Study of this molecule has been motivated by its importance as a pathogen-associated molecular pattern upon fungal infection as well as by its promising clinical utility as biological response modifier for the treatment of cancer and infectious diseases. Its immune effect is attributed to the ability to bind to different receptors expressed on the cell surface of phagocytic and cytotoxic innate immune cells, including monocytes, macrophages, neutrophils, and natural killer cells. The characteristics of the immune responses generated depend on the cell types and receptors involved. Size and biochemical composition of β-glucans isolated from different sources affect their immunomodulatory properties. The variety of studies using crude extracts of fungal cell wall rather than purified β-glucans renders data difficult to interpret. A better understanding of the mechanisms of purified fungal β-glucan recognition, downstream signaling pathways, and subsequent immune regulation activated, is, therefore, essential not only to develop new antifungal therapy but also to evaluate β-glucan as a putative anti-infective and antitumor mediator. Here, we briefly review the complexity of interactions between fungal β-glucans and mononuclear phagocytes during fungal infections. Furthermore, we discuss and present available studies suggesting how different fungal β-glucans exhibit antitumor and antimicrobial activities by modulating the biologic responses of mononuclear phagocytes, which make them potential candidates as therapeutic agents. PMID:29755450

  19. Genetic Diversity and Genome Wide Association Study of β-Glucan Content in Tetraploid Wheat Grains

    PubMed Central

    Marcotuli, Ilaria; Houston, Kelly; Schwerdt, Julian G.; Waugh, Robbie; Fincher, Geoffrey B.; Burton, Rachel A.; Blanco, Antonio; Gadaleta, Agata

    2016-01-01

    Non-starch polysaccharides (NSPs) have many health benefits, including immunomodulatory activity, lowering serum cholesterol, a faecal bulking effect, enhanced absorption of certain minerals, prebiotic effects and the amelioration of type II diabetes. The principal components of the NSP in cereal grains are (1,3;1,4)-β-glucans and arabinoxylans. Although (1,3;1,4)-β-glucan (hereafter called β-glucan) is not the most representative component of wheat cell walls, it is one of the most important types of soluble fibre in terms of its proven beneficial effects on human health. In the present work we explored the genetic variability of β-glucan content in grains from a tetraploid wheat collection that had been genotyped with a 90k-iSelect array, and combined this data to carry out an association analysis. The β-glucan content, expressed as a percentage w/w of grain dry weight, ranged from 0.18% to 0.89% across the collection. Our analysis identified seven genomic regions associated with β-glucan, located on chromosomes 1A, 2A (two), 2B, 5B and 7A (two), confirming the quantitative nature of this trait. Analysis of marker trait associations (MTAs) in syntenic regions of several grass species revealed putative candidate genes that might influence β-glucan levels in the endosperm, possibly via their participation in carbon partitioning. These include the glycosyl hydrolases endo-β-(1,4)-glucanase (cellulase), β-amylase, (1,4)-β-xylan endohydrolase, xylanase inhibitor protein I, isoamylase and the glycosyl transferase starch synthase II. PMID:27045166

  20. The Complexity of Fungal β-Glucan in Health and Disease: Effects on the Mononuclear Phagocyte System.

    PubMed

    Camilli, Giorgio; Tabouret, Guillaume; Quintin, Jessica

    2018-01-01

    β-glucan, the most abundant fungal cell wall polysaccharide, has gained much attention from the scientific community in the last few decades for its fascinating but not yet fully understood immunobiology. Study of this molecule has been motivated by its importance as a pathogen-associated molecular pattern upon fungal infection as well as by its promising clinical utility as biological response modifier for the treatment of cancer and infectious diseases. Its immune effect is attributed to the ability to bind to different receptors expressed on the cell surface of phagocytic and cytotoxic innate immune cells, including monocytes, macrophages, neutrophils, and natural killer cells. The characteristics of the immune responses generated depend on the cell types and receptors involved. Size and biochemical composition of β-glucans isolated from different sources affect their immunomodulatory properties. The variety of studies using crude extracts of fungal cell wall rather than purified β-glucans renders data difficult to interpret. A better understanding of the mechanisms of purified fungal β-glucan recognition, downstream signaling pathways, and subsequent immune regulation activated, is, therefore, essential not only to develop new antifungal therapy but also to evaluate β-glucan as a putative anti-infective and antitumor mediator. Here, we briefly review the complexity of interactions between fungal β-glucans and mononuclear phagocytes during fungal infections. Furthermore, we discuss and present available studies suggesting how different fungal β-glucans exhibit antitumor and antimicrobial activities by modulating the biologic responses of mononuclear phagocytes, which make them potential candidates as therapeutic agents.

  1. Fluorescence microplate readers as an alternative to flow injection analysis for determination of wort beta-glucan

    USDA-ARS?s Scientific Manuscript database

    Wort beta-glucan concentration is a critical malting quality parameter used to identify and avoid potential brewhouse filtration problems. ASBC method Wort-18 is widely used in malt analysis laboratories and brewhouses to measure wort beta-glucan levels. However, the chemistry underlying the method...

  2. Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction.

    PubMed

    Muñoz, Javier; Cortés, Juan Carlos G; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M Belén; Martins, Ivone M; Pérez, Pilar; Ribas, Juan Carlos

    2013-10-28

    Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells.

  3. Oral Administration of β-1,3/1,6-Glucan to Dogs Temporally Changes Total and Antigen-Specific IgA and IgM▿

    PubMed Central

    Stuyven, E.; Verdonck, F.; Van Hoek, I.; Daminet, S.; Duchateau, L.; Remon, J. P.; Goddeeris, B. M.; Cox, E.

    2010-01-01

    The effect of oral administration of β-1,3/1,6-glucans from Saccharomyces cerevisiae on humoral immunity in domestic dogs is not known. In this study, 15 beagle dogs were orally given MacroGard tablets, which contain 150 mg of this β-glucan, daily for 4 weeks. At the end of this period, the total serum immunoglobulin A (IgA) level decreased significantly in the group treated with the glucan compared to that in the control group as well as compared to the concentrations before supplementation. In contrast, the total serum IgM level rose significantly, whereas no effect on the IgG level occurred. Similar changes were seen in Bordetella-specific IgA and IgM titers following vaccination during the supplementation period. The IgA concentration also became significantly lower in the saliva and tears of the glucan group than in the placebo group. The effects disappeared 1 week after the cessation of the supplementation. In conclusion, the results showed a temporary change in the isotype profile during glucan supplementation. PMID:20032218

  4. Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil

    NASA Astrophysics Data System (ADS)

    Chang, I.; Cho, G.

    2012-12-01

    Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.

  5. Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction

    PubMed Central

    Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar

    2013-01-01

    Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938

  6. Impact of flavouring substances on the aggregation behaviour of dissolved barley β-glucans in a model beer.

    PubMed

    Kupetz, M; Sacher, B; Becker, T

    2016-06-05

    Structural polymers such as cereal β-glucan may cause various processing problems in beverage industry depending on concentration, molar size distribution and agglomeration behaviour. In this context, influences of the beer volatiles dodecanoic acid, octyl butanoate, ethyl decanoate and decyl acetate on molar mass and radii of barley β-glucan were investigated in ethanolic (4% w/w) model solution. After addition of 100mg/l ethyl decanoate and decyl acetate to the β-glucan solution, a wider-ranging molar mass distribution could be observed by means of asymmetric field-flow-fractionation. Due to agglomeration, average molar mass of β-glucan standard (MW=6.8×10(6)g/mol) increased by 2×10(6)g/mol (P<0.05) in solution containing decyl acetate. Furthermore, a significant growth (P<0.05) from 86 to 102 nm in gyration radius was measured. The obtained results elucidate the importance of fatty acid derived flavouring substance composition in beer regarding the aggregation behaviour of β-glucan. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Beta-glucans in the treatment of diabetes and associated cardiovascular risks

    PubMed Central

    Chen, Jiezhong; Raymond, Kenneth

    2008-01-01

    Diabetes mellitus is characterized by high blood glucose level with typical manifestations of thirst, polyuria, polydipsia, and weight loss. It is caused by defects in insulin-mediated signal pathways, resulting in decreased glucose transportation from blood into muscle and fat cells. The major risk is vascular injury leading to heart disease, which is accelerated by increased lipid levels and hypertension. Management of diabetes includes: control of blood glucose level and lipids; and reduction of hypertension. Dietary intake of beta-glucans has been shown to reduce all these risk factors to benefit the treatment of diabetes and associated complications. In addition, beta-glucans also promote wound healing and alleviate ischemic heart injury. However, the mechanisms behind the effect of beta-glucans on diabetes and associated complications need to be further studied using pure beta-glucan. PMID:19337540

  8. Attenuation of PAMP-triggered immunity in maize requires down-regulation of the key β-1,6-glucan synthesis genes KRE5 and KRE6 in biotrophic hyphae of Colletotrichum graminicola.

    PubMed

    Oliveira-Garcia, Ely; Deising, Holger B

    2016-08-01

    In plants, pathogen defense is initiated by recognition of pathogen-associated molecular patterns (PAMPs) via plasma membrane-localized pattern-recognition receptors (PRRs). Fungal structural cell wall polymers such as branched β-glucans are essential for infection structure rigidity and pathogenicity, but at the same time represent PAMPs. Kre5 and Kre6 are key enzymes in β-1,6-glucan synthesis and formation of branch points of the β-glucan network. In spite of the importance of branched β-glucan for hyphal rigidity and plant-fungus interactions, neither the role of KRE5 and KRE6 in pathogenesis nor mechanisms allowing circumventing branched β-glucan-triggered immune responses are known. We functionally characterized KRE5 and KRE6 of the ascomycete Colletotrichum graminicola, a hemibiotroph that infects maize (Zea mays). After appressorial plant invasion, this fungus sequentially differentiates biotrophic and highly destructive necrotrophic hyphae. RNAi-mediated reduction of KRE5 and KRE6 transcript abundance caused appressoria to burst and swelling of necrotrophic hyphae, indicating that β-1,6-glucosidic bonds are essential in these cells. Live cell imaging employing KRE5:mCherry and KRE6:mCherry knock-in strains and probing of infection structures with a YFP-conjugated β-1,6-glucan-binding protein showed expression of these genes and exposure of β-1,6-glucan in conidia, appressoria and necrotrophic, but not in biotrophic hyphae. Overexpression of KRE5 and KRE6 in biotrophic hyphae led to activation of broad-spectrum plant defense responses, including papilla and H2 O2 formation, as well as transcriptional activation of several defense-related genes. Collectively, our results strongly suggest that down-regulation of synthesis and avoidance of exposure of branched β-1,3-β-1,6-glucan in biotrophic hyphae is required for attenuation of plant immune responses. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  9. Radioprotection by Biological Response Modifiers Alone and in Combination with WR-2721

    DTIC Science & Technology

    1989-01-01

    reasons related to cancer therapy rather 247 CH2 OH CH 2OH CH 2 0H H H H OH H OH H OH H OH FI(; . Chemical structure of glucan . a polgl~can consisting...2. GLUCAN : BACKGROUND AND GENERAL IMMUNOLOGIC AND HEMOPOIETIC EFFECTS Glucan (Fig. 1) is a beta -l,3-polyglucose isolated from the inner cell wall of...Adju’an, Therapy. pp. 183- 194. CH iiGOS. M. A led ) Ra%.en Press. New York Ciop. J. K. and AtSTiN. K. F 11985) A beta - glucan inhibitable receptor on human

  10. Characterization of a beta-glucanase produced by Rhizopus microsporus var. microsporus, and its potential for application in the brewing industry.

    PubMed

    Celestino, Klecius R Silveira; Cunha, Ricardo B; Felix, Carlos R

    2006-12-05

    In the barley malting process, partial hydrolysis of beta-glucans begins with seed germination. However, the endogenous 1,3-1,4-beta-glucanases are heat inactivated, and the remaining high molecular weight beta-glucans may cause severe problems such as increased brewer mash viscosity and turbidity. Increased viscosity impairs pumping and filtration, resulting in lower efficiency, reduced yields of extracts, and lower filtration rates, as well as the appearance of gelatinous precipitates in the finished beer. Therefore, the use of exogenous beta-glucanases to reduce the beta-glucans already present in the malt barley is highly desirable. The zygomycete microfungus Rhizopus microsporus var. microsporus secreted substantial amounts of beta-glucanase in liquid culture medium containing 0.5% chitin. An active protein was isolated by gel filtration and ion exchange chromatographies of the beta-glucanase activity-containing culture supernatant. This isolated protein hydrolyzed 1,3-1,4-beta-glucan (barley beta-glucan), but showed only residual activity against 1,3-beta-glucan (laminarin), or no activity at all against 1,4-beta-glucan (cellulose), indicating that the R. microsporus var. microsporus enzyme is a member of the EC 3.2.1.73 category. The purified protein had a molecular mass of 33.7 kDa, as determined by mass spectrometry. The optimal pH and temperature for hydrolysis of 1,3-1,4-beta-glucan were in the ranges of 4-5, and 50-60 degrees C, respectively. The Km and Vmax values for hydrolysis of beta-glucan at pH 5.0 and 50 degrees C were 22.39 mg.mL-1 and 16.46 mg.min-1, respectively. The purified enzyme was highly sensitive to Cu+2, but showed less or no sensitivity to other divalent ions, and was able to reduce both the viscosity and the filtration time of a sample of brewer mash. In comparison to the values determined for the mash treated with two commercial glucanases, the relative viscosity value for the mash treated with the 1,3-1,4-beta-glucanase produced by R. microsporus var. microsporus. was determined to be consistently lower. The zygomycete microfungus R. microsporus var. microsporus produced a 1,3-1,4-beta-D-glucan 4-glucanhydrolase (EC 3.2.1.73) which is able to hydrolyze beta-D-glucan that contains both the 1,3- and 1,4-bonds (barley beta-glucans). Its molecular mass was 33.7 kDa. Maximum activity was detected at pH values in the range of 4-5, and temperatures in the range of 50-60 degrees C. The enzyme was able to reduce both the viscosity of the brewer mash and the filtration time, indicating its potential value for the brewing industry.

  11. pH recycling aqueous two-phase systems applied in extraction of Maitake β-Glucan and mechanism analysis using low-field nuclear magnetic resonance.

    PubMed

    Hou, Huiyun; Cao, Xuejun

    2015-07-31

    In this paper, a recycling aqueous two-phase systems (ATPS) based on two pH-response copolymers PADB and PMDM were used in purification of β-Glucan from Grifola frondosa. The main parameters, such as polymer concentration, type and concentration of salt, extraction temperature and pH, were investigated to optimize partition conditions. The results demonstrated that β-Glucan was extracted into PADB-rich phase, while impurities were extracted into PMDM-rich phase. In this 2.5% PADB/2.5% PMDM ATPS, 7.489 partition coefficient and 96.92% extraction recovery for β-Glucan were obtained in the presence of 30mmol/L KBr, at pH 8.20, 30°C. The phase-forming copolymers could be recycled by adjusting pH, with recoveries of over 96.0%. Furthermore, the partition mechanism of Maitake β-Glucan in PADB/PMDM aqueous two-phase systems was studied. Fourier transform infrared spectra, ForteBio Octet system and low-field nuclear magnetic resonance (LF-NMR) were introduced for elucidating the partition mechanism of β-Glucan. Especially, LF-NMR was firstly used in the mechanism analysis in partition of aqueous two-phase systems. The change of transverse relaxation time (T2) in ATPS could reflect the interaction between polymers and β-Glucan. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Optimizing Tumor Microenvironment for Cancer Immunotherapy: β-Glucan-Based Nanoparticles

    PubMed Central

    Zhang, Mei; Kim, Julian A.; Huang, Alex Yee-Chen

    2018-01-01

    Immunotherapy is revolutionizing cancer treatment. Recent clinical success with immune checkpoint inhibitors, chimeric antigen receptor T-cell therapy, and adoptive immune cellular therapies has generated excitement and new hopes for patients and investigators. However, clinically efficacious responses to cancer immunotherapy occur only in a minority of patients. One reason is the tumor microenvironment (TME), which potently inhibits the generation and delivery of optimal antitumor immune responses. As our understanding of TME continues to grow, strategies are being developed to change the TME toward one that augments the emergence of strong antitumor immunity. These strategies include eliminating tumor bulk to provoke the release of tumor antigens, using adjuvants to enhance antigen-presenting cell function, and employ agents that enhance immune cell effector activity. This article reviews the development of β-glucan and β-glucan-based nanoparticles as immune modulators of TME, as well as their potential benefit and future therapeutic applications. Cell-wall β-glucans from natural sources including plant, fungi, and bacteria are molecules that adopt pathogen-associated molecular pattern (PAMP) known to target specific receptors on immune cell subsets. Emerging data suggest that the TME can be actively manipulated by β-glucans and their related nanoparticles. In this review, we discuss the mechanisms of conditioning TME using β-glucan and β-glucan-based nanoparticles, and how this strategy enables future design of optimal combination cancer immunotherapies. PMID:29535722

  13. Exercise and Beta-Glucan Consumption (Saccharomyces cerevisiae) Improve the Metabolic Profile and Reduce the Atherogenic Index in Type 2 Diabetic Rats (HFD/STZ)

    PubMed Central

    Andrade, Eric Francelino; Lima, Andressa Ribeiro Veiga; Nunes, Ingrid Edwiges; Orlando, Débora Ribeiro; Gondim, Paula Novato; Zangeronimo, Márcio Gilberto; Alves, Fernando Henrique Ferrari; Pereira, Luciano José

    2016-01-01

    Physical activity and the ingestion of dietary fiber are non-drug alternatives commonly used as adjuvants to glycemic control in diabetic individuals. Among these fibers, we can highlight beta-glucans. However, few studies have compared isolated and synergic effects of physical exercise and beta-glucan ingestion, especially in type 2 diabetic rats. Therefore, we evaluated the effects beta-glucan (Saccharomyces cerevisiae) consumption, associated or not to exercise, on metabolic parameters of diabetic Wistar rats. The diabetes mellitus (DM) was induced by high-fat diet (HFD) associated with a low dose of streptozotocin (STZ—35 mg/kg). Trained groups were submitted to eight weeks of exercise in aquatic environment. In the last 28 days of experiment, animals received 30 mg/kg/day of beta-glucan by gavage. Isolated use of beta-glucan decreased glucose levels in fasting, Glycated hemoglobin (HbA1c), triglycerides (TAG), total cholesterol (TC), low-density lipoprotein (LDL-C), the atherogenic index of plasma. Exercise alone also decreased blood glucose levels, HbA1c, and renal lesions. An additive effect for reducing the atherogenic index of plasma and renal lesions was observed when both treatments were combined. It was concluded that both beta-glucan and exercise improved metabolic parameters in type 2 (HFD/STZ) diabetic rats. PMID:27999319

  14. Effect of a single point mutation on the interaction of glucans with a glucansucrase from Leuconostoc mesenteroides NRRL B-1118

    USDA-ARS?s Scientific Manuscript database

    Our previous work showed that substitution of an amino acid that is coupled with the +2 subsite adjacent to the transition stabilizer of a glucansucrase, which produces a water-insoluble glucan, resulted in significant changes in the structures and yields of the water-insoluble glucans produced. We ...

  15. Investigations of the relationship betw een disease and airborne (1→3)-β-D-glucan in buildings

    PubMed Central

    Rylander, Ragnar

    1997-01-01

    Studies on the relationship between symptoms in indoor air and the amount of airborne (1→3)-β-D-glucan were reviewed. Relationships were found for symptoms and objective tests of airways inflammation. The data suggest that (1→3)-β-D-glucan could be a causative agent. PMID:18472858

  16. Micro-heterogeneity and micro-rheological properties of high-viscosity barley beta-glucan solutions studied by diffusion wave spectroscopy (DWS)

    USDA-ARS?s Scientific Manuscript database

    Soluble fiber ß-glucan is one of the key dietary materials in healthy food products known for reducing serum cholesterol levels. The micro-structural heterogeneity and micro-rheology of high-viscosity barley ß-glucan solutions were investigated by the diffusing wave spectroscopy (DWS) technology. By...

  17. Down-regulation of the CSLF6 gene results in decreased (1,3;1,4)-beta-D-glucan in endosperm of wheat.

    PubMed

    Nemeth, Csilla; Freeman, Jackie; Jones, Huw D; Sparks, Caroline; Pellny, Till K; Wilkinson, Mark D; Dunwell, Jim; Andersson, Annica A M; Aman, Per; Guillon, Fabienne; Saulnier, Luc; Mitchell, Rowan A C; Shewry, Peter R

    2010-03-01

    (1,3;1,4)-beta-d-Glucan (beta-glucan) accounts for 20% of the total cell walls in the starchy endosperm of wheat (Triticum aestivum) and is an important source of dietary fiber for human nutrition with potential health benefits. Bioinformatic and array analyses of gene expression profiles in developing caryopses identified the CELLULOSE SYNTHASE-LIKE F6 (CSLF6) gene as encoding a putative beta-glucan synthase. RNA interference constructs were therefore designed to down-regulate CSLF6 gene expression and expressed in transgenic wheat under the control of a starchy endosperm-specific HMW subunit gene promoter. Analysis of wholemeal flours using an enzyme-based kit and by high-performance anion-exchange chromatography after digestion with lichenase showed decreases in total beta-glucan of between 30% and 52% and between 36% and 53%, respectively, in five transgenic lines compared to three control lines. The content of water-extractable beta-glucan was also reduced by about 50% in the transgenic lines, and the M(r) distribution of the fraction was decreased from an average of 79 to 85 x 10(4) g/mol in the controls and 36 to 57 x 10(4) g/mol in the transgenics. Immunolocalization of beta-glucan in semithin sections of mature and developing grains confirmed that the impact of the transgene was confined to the starchy endosperm with little or no effect on the aleurone or outer layers of the grain. The results confirm that the CSLF6 gene of wheat encodes a beta-glucan synthase and indicate that transgenic manipulation can be used to enhance the health benefits of wheat products.

  18. Caspase-8 modulates Dectin-1 and CR3 driven IL-1β production in response to β-glucans and the fungal pathogen, Candida albicans1

    PubMed Central

    Ganesan, Sandhya; Rathinam, Vijay A. K.; Bossaller, Lukas; Army, Kelly; Kaiser, William J.; Mocarski, Edward S.; Dillon, Christopher P.; Green, Douglas R.; Mayadas, Tanya N.; Levitz, Stuart M.; Hise, Amy G.

    2014-01-01

    Inflammasomes are central mediators of host defense to a wide range of microbial pathogens. The NLRP3 inflammasome plays a key role in triggering caspase-1 dependent IL-1β maturation and resistance to fungal dissemination in Candida albicans infection. β-glucans are major components of fungal cell walls that trigger IL-1β secretion in both murine and human immune cells. In this study, we sought to determine the contribution of β-glucans to C. albicans-induced inflammasome responses in mouse dendritic cells. We show that the NLRP3-ASC-caspase-1 inflammasome is absolutely critical for IL-1β production in response to β-glucans. Interestingly, we also found that both Complement Receptor 3 (CR3/Mac-1) and dectin-1 play a crucial role in coordinating β-glucan-induced IL-1β processing as well as a cell death response. In addition to the essential role of caspase-1, we identify an important role for the pro-apoptotic protease caspase-8 in promoting β-glucan-induced cell death and NLRP3 inflammasome-dependent IL-1β maturation. A strong requirement for Complement Receptor 3 and caspase-8 was also found for NLRP3 dependent IL-1β production in response to heat killed Candida albicans. Together, these results define the importance of dectin-1, CR3 and caspase-8, in addition to the canonical NLRP3 inflammasome, in mediating β-glucan and C. albicans induced innate responses in dendritic cells. Collectively, these findings establish a novel link between β-glucan recognition receptors and the inflammatory proteases caspase-8 and caspase-1 in coordinating cytokine secretion and cell death in response to immunostimulatory fungal components. PMID:25063877

  19. Interleukin-1 and Interferon-γ Orchestrate β-Glucan-Activated Human Dendritic Cell Programming via IκB-ζ Modulation

    PubMed Central

    Cardone, Marco; Dzutsev, Amiran K.; Li, Hongchuan; Riteau, Nicolas; Gerosa, Franca; Shenderov, Kevin; Winkler-Pickett, Robin; Provezza, Lisa; Riboldi, Elena; Leighty, Robert M.; Orr, Selinda J.; Steinhagen, Folkert; Wewers, Mark D.; Sher, Alan; Anderson, Stephen K.; Goldszmid, Romina; McVicar, Daniel W.

    2014-01-01

    Recognition of microbial components via innate receptors including the C-type lectin receptor Dectin-1, together with the inflammatory environment, programs dendritic cells (DCs) to orchestrate the magnitude and type of adaptive immune responses. The exposure to β-glucan, a known Dectin-1 agonist and component of fungi, yeasts, and certain immune support supplements, activates DCs to induce T helper (Th)17 cells that are essential against fungal pathogens and extracellular bacteria but may trigger inflammatory pathology or autoimmune diseases. However, the exact mechanisms of DC programming by β-glucan have not yet been fully elucidated. Using a gene expression/perturbation approach, we demonstrate that in human DCs β-glucan transcriptionally activates via an interleukin (IL)-1- and inflammasome-mediated positive feedback late-induced genes that bridge innate and adaptive immunity. We report that in addition to its known ability to directly prime T cells toward the Th17 lineage, IL-1 by promoting the transcriptional cofactor inhibitor of κB-ζ (IκB-ζ) also programs β-glucan-exposed DCs to express cell adhesion and migration mediators, antimicrobial molecules, and Th17-polarizing factors. Interferon (IFN)-γ interferes with the IL-1/IκB-ζ axis in β-glucan-activated DCs and promotes T cell-mediated immune responses with increased release of IFN-γ and IL-22, and diminished production of IL-17. Thus, our results identify IL-1 and IFN-γ as regulators of DC programming by β-glucan. These molecular networks provide new insights into the regulation of the Th17 response as well as new targets for the modulation of immune responses to β-glucan-containing microorganisms. PMID:25474109

  20. Identification and Deletion of Tft1, a Predicted Glycosyltransferase Necessary for Cell Wall β-1,3;1,4-Glucan Synthesis in Aspergillus fumigatus

    PubMed Central

    Samar, Danial; Kieler, Joshua B.; Klutts, J. Stacey

    2015-01-01

    Aspergillus fumigatus is an environmental mold that causes severe, often fatal invasive infections in immunocompromised patients. The search for new antifungal drug targets is critical, and the synthesis of the cell wall represents a potential area to find such a target. Embedded within the main β-1,3-glucan core of the A. fumigatus cell wall is a mixed linkage, β-D-(1,3;1,4)-glucan. The role of this molecule or how it is synthesized is unknown, though it comprises 10% of the glucans within the wall. While this is not a well-studied molecule in fungi, it has been studied in plants. Using the sequences of two plant mixed linkage glucan synthases, a single ortholog was identified in A. fumigatus (Tft1). A strain lacking this enzyme (tft1Δ) was generated along with revertant strains containing the native gene under the control of either the native or a strongly expressing promoter. Immunofluorescence staining with an antibody against β-(1,3;1,4)-glucan and biochemical quantification of this polysaccharide in the tft1Δ strain demonstrated complete loss of this molecule. Reintroduction of the gene into the knockout strain yielded reappearance in amounts that correlated with expected expression of the gene. The loss of Tft1 and mixed linkage glucan yielded no in vitro growth phenotype. However, there was a modest increase in virulence for the tft1Δ strain in a wax worm model. While the precise roles for β-(1,3;1,4)-glucan within A. fumigatus cell wall are still uncertain, it is clear that Tft1 plays a pivotal role in the biosynthesis of this cell wall polysaccharide. PMID:25723175

  1. Protective effects of β-glucan against oxidative injury induced by 2.45-GHz electromagnetic radiation in the skin tissue of rats.

    PubMed

    Ceyhan, Ali Murat; Akkaya, Vahide Baysal; Güleçol, Şeyma Celik; Ceyhan, Betül Mermi; Özgüner, Fehmi; Chen, WenChieh

    2012-09-01

    In recent times, there is widespread use of 2.45-GHz irradiation-emitting devices in industrial, medical, military and domestic application. The aim of the present study was to investigate the effect of 2.45-GHz electromagnetic radiation (EMR) on the oxidant and antioxidant status of skin and to examine the possible protective effects of β-glucans against the oxidative injury. Thirty-two male Wistar albino rats were randomly divided into four equal groups: control; sham exposed; EMR; and EMR + β-glucan. A 2.45-GHz EMR emitted device from the experimental exposure was applied to the EMR group and EMR + β-glucan group for 60 min daily, respectively, for 4 weeks. β-glucan was administered via gavage at a dose of 50 mg/kg/day before each exposure to radiation in the treatment group. The activities of antioxidant enzymes, superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) and catalase (CAT), as well as the concentration of malondialdehyde (MDA) were measured in tissue homogenates of the skin. Exposure to 2.45-GHz EMR caused a significant increase in MDA levels and CAT activity, while the activities of SOD and GSH-Px decreased in skin tissues. Systemic β-glucan significantly reversed the elevation of MDA levels and the reduction of SOD activities. β-glucan treatment also slightly enhanced the activity of CAT and prevented the depletion of GSH-Px activity caused by EMR, but not statistically significantly. The present study demonstrated the role of oxidative mechanisms in EMR-induced skin tissue damages and that β-glucan could ameliorate oxidative skin injury via its antioxidant properties.

  2. The well-coordinated linkage between acidogenicity and aciduricity via insoluble glucans on the surface of Streptococcus mutans

    PubMed Central

    Guo, Lihong; McLean, Jeffrey S.; Lux, Renate; He, Xuesong; Shi, Wenyuan

    2015-01-01

    Streptococcus mutans is considered the principal cariogenic bacterium for dental caries. Despite the recognition of their importance for cariogenesis, the possible coordination among S. mutans’ main virulence factors, including glucan production, acidogenicity and aciduricity, has been less well studied. In the present study, using S. mutans strains with surface-displayed pH-sensitive pHluorin, we revealed sucrose availability- and Gtf functionality-dependent proton accumulation on S. mutans surface. Consistent with this, using a pH-sensitive dye, we demonstrated that both in vivo cell-produced and in vitro enzymatically synthesized insoluble glucans displayed proton-concentrating ability. Global transcriptomics revealed proton accumulation triggers the up-regulation of genes encoding functions involved in acid tolerance response in a glucan-dependent manner. Our data suggested that this proton enrichment around S. mutans could pre-condition the bacterium for acid-stress. Consistent with this hypothesis, we found S. mutans strains defective in glucan production were more acid sensitive. Our study revealed for the first time that insoluble glucans is likely an essential factor linking acidogenicity with aciduricity. The coordination of these key virulence factors could provide new insights on how S. mutans may have become a major cariogenic pathogen. PMID:26657939

  3. In vitro synthesis of linear α-1,3-glucan and chemical modification to ester derivatives exhibiting outstanding thermal properties

    PubMed Central

    Puanglek, Sakarin; Kimura, Satoshi; Enomoto-Rogers, Yukiko; Kabe, Taizo; Yoshida, Makoto; Wada, Masahisa; Iwata, Tadahisa

    2016-01-01

    Bio-based polymer is considered as one of potentially renewable materials to reduce the consumption of petroleum resources. We report herein on the one-pot synthesis and development of unnatural-type bio-based polysaccharide, α-1,3-glucan. The synthesis can be achieved by in vitro enzymatic polymerization with GtfJ enzyme, one type of glucosyltransferase, cloned from Streptococcus salivarius ATCC 25975 utilizing sucrose, a renewable feedstock, as a glucose monomer source, via environmentally friendly one-pot water-based reaction. The structure of α-1,3-glucan is completely linear without branches with weight-average molecular weight (Mw) of 700 kDa. Furthermore, acetate and propionate esters of α-1,3-glucan were synthesized and characterized. Interestingly, α-1,3-glucan acetate showed a comparatively high melting temperature at 339 °C, higher than that of commercially available thermoplastics such as PET (265 °C) and Nylon 6 (220 °C). Thus, the discovery of crystalline α-1,3-glucan esters without branches with high thermal stability and melting temperature opens the gate for further researches in the application of thermoplastic materials. PMID:27469976

  4. A Drug-Sensitive Genetic Network Masks Fungi from the Immune System

    PubMed Central

    Wheeler, Robert T; Fink, Gerald R

    2006-01-01

    Fungal pathogens can be recognized by the immune system via their β-glucan, a potent proinflammatory molecule that is present at high levels but is predominantly buried beneath a mannoprotein coat and invisible to the host. To investigate the nature and significance of “masking” this molecule, we characterized the mechanism of masking and consequences of unmasking for immune recognition. We found that the underlying β-glucan in the cell wall of Candida albicans is unmasked by subinhibitory doses of the antifungal drug caspofungin, causing the exposed fungi to elicit a stronger immune response. Using a library of bakers' yeast (Saccharomyces cerevisiae) mutants, we uncovered a conserved genetic network that is required for concealing β-glucan from the immune system and limiting the host response. Perturbation of parts of this network in the pathogen C. albicans caused unmasking of its β-glucan, leading to increased β-glucan receptor-dependent elicitation of key proinflammatory cytokines from primary mouse macrophages. By creating an anti-inflammatory barrier to mask β-glucan, opportunistic fungi may promote commensal colonization and have an increased propensity for causing disease. Targeting the widely conserved gene network required for creating and maintaining this barrier may lead to novel broad-spectrum antimycotics. PMID:16652171

  5. In vitro synthesis of linear α-1,3-glucan and chemical modification to ester derivatives exhibiting outstanding thermal properties

    NASA Astrophysics Data System (ADS)

    Puanglek, Sakarin; Kimura, Satoshi; Enomoto-Rogers, Yukiko; Kabe, Taizo; Yoshida, Makoto; Wada, Masahisa; Iwata, Tadahisa

    2016-07-01

    Bio-based polymer is considered as one of potentially renewable materials to reduce the consumption of petroleum resources. We report herein on the one-pot synthesis and development of unnatural-type bio-based polysaccharide, α-1,3-glucan. The synthesis can be achieved by in vitro enzymatic polymerization with GtfJ enzyme, one type of glucosyltransferase, cloned from Streptococcus salivarius ATCC 25975 utilizing sucrose, a renewable feedstock, as a glucose monomer source, via environmentally friendly one-pot water-based reaction. The structure of α-1,3-glucan is completely linear without branches with weight-average molecular weight (Mw) of 700 kDa. Furthermore, acetate and propionate esters of α-1,3-glucan were synthesized and characterized. Interestingly, α-1,3-glucan acetate showed a comparatively high melting temperature at 339 °C, higher than that of commercially available thermoplastics such as PET (265 °C) and Nylon 6 (220 °C). Thus, the discovery of crystalline α-1,3-glucan esters without branches with high thermal stability and melting temperature opens the gate for further researches in the application of thermoplastic materials.

  6. Preparation, characterization, and biological properties of β-glucans

    PubMed Central

    Rahar, Sandeep; Swami, Gaurav; Nagpal, Navneet; Nagpal, Manisha A.; Singh, Gagan Shah

    2011-01-01

    β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast), and Agaricus blazei murell (mushroom). Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC) analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa) being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa) to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine. PMID:22171300

  7. Monitoring total endotoxin and (1 --> 3)-beta-D-glucan at the air exhaust of concentrated animal feeding operations.

    PubMed

    Yang, Xufei; Wang, Xinlei; Zhang, Yuanhui; Lee, Jongmin; Su, Jingwei; Gates, Richard S

    2013-10-01

    Mitigation of bioaerosol emissions from concentrated animal feeding operations (CAFOs) demands knowledge of bioaerosol concentrations feeding into an end-of-pipe air treatment process. The aim of this preliminary study was to measure total endotoxin and (1 --> 3)-beta-glucan concentrations at the air exhaust of 18 commercial CAFOs and to examine their variability with animal operation type (swine farrowing, swine gestation, swine weaning, swine finishing, manure belt laying hen, and tom turkey) and season (cold, mild, and hot). The measured airborne concentrations of total endotoxin ranged from 98 to 23,157 endotoxin units (EU)/m3, and the airborne concentrations of total (1 --> 3)-beta-D-glucan ranged from 2.4 to 537.9 ng/m3. Animal operation type in this study had a significant effect on airborne concentrations of total endotoxin and (1 --> 3)-beta-D-glucan but no significant effect on their concentrations in total suspended particulate (TSP). Both endotoxin and (1 --> 3)-beta-D-glucan attained their highest airborne concentrations in visited tom turkey buildings. Comparatively, season had no significant effect on airborne concentrations of total endotoxin or (1 --> 3)-beta-D-glucan. Endotoxin and (1 --> 3)-beta-glucan concentrations in TSP dust appeared to increase as the weather became warmer, and this seasonal effect was significant in swine buildings. Elevated indoor temperatures in the hot season were considered to facilitate the growth and propagation of bacteria and fungi, thus leading to higher biocomponent concentrations in TSP.

  8. Protective effect of β-D-glucan and glutamine on the genomic instability induced by Cytarabine/Ara-C in BALB/c mice.

    PubMed

    de Souza Silva, Priscilla Mirian; de Sousa, Raimundo Vicente; Simão, Anderson Assaid; Cesar, Pedro Henrique Souza; Trento, Marcus Vinicius Cardoso; Marcussi, Silvana

    2018-05-28

    Prophylactic antibiotics and growth promoters have been substituted, mainly for livestock, by immunomodulators and intestinal health promoters - such as β-D-glucans and glutamine. The aim of this study was to verify the beneficial effects of β-D-glucans and glutamine against Cytarabine/Ara-C, evaluating the DNA damage in leukocytes, the leukogram, and the mitotic index of intestinal crypts cells. Balb/C mice received treatment with β-D-glucan (80 mg/Kg), glutamine (150 mg/Kg), or both, for 21 days. On the last two days of this period, Ara-C was administered (1.8 mg/animal) by intraperitoneal injection every 12 h. The animals submitted to the treatment with Ara-C presented the highest genotoxic index, a significant leukopenia, and a decrease in the mitotic index of the intestinal crypts cells. Treatment with β-D-glucan protected the leukocytes against DNA fragmentation induced by Ara-C. Glutamine alone promoted maintenance of the mitotic index and, in association with β-Dglucan, reduced leukopenia. Thus, the use of β-D-glucan and glutamine proved to be beneficial to intestinal tropism. This can happen once the damage to the genetic material, prevented by the treatments with β-D-glucan and glutamine, can result in genotoxicity. Not only this, but it might be capable of turning into a mutagenesis, with consequential physiopathological alterations. Copyright © 2018. Published by Elsevier B.V.

  9. Characteristics of β-glucan extracted from raw and germinated foxtail (Setaria italica) and kodo (Paspalum scrobiculatum) millets.

    PubMed

    Sharma, Seema; Saxena, Dharmesh C; Riar, Charanjit S

    2018-06-22

    β-glucan extracted from raw and germinated foxtail and kodo millets were evaluated for its functional, rheological and in vitro antioxidant characteristics. The in vitro activity determined in terms of diphenyl-p-picryl hydrazy (DPPH) radical scavenging activity and Ferric reducing antioxidant power (FRAP) activity was found higher in germinated kodo millet (78.74%, 48.98%) compared to foxtail millet (34.96%, 38.67%), respectively. Water binding capacity and swelling power of β-glucan extract of foxtail millet increased from 2.88 g/g to 3.06 g/g and 1.32 g/g to 1.67 g/g and that of kodo millet from 3.45 to 3.99 g/g and 2.54 to 2.99 g/g, respectively, after germination. There was a significant improvement in foaming capacity and stability of β-glucan after germination. The 'n' values were less than unity indicated that β-glucan extracts behaved pseudo-plastic like material. The storage modus (G') of β-glucan extracts of germinated kodo millet was higher than foxtail millets, as well as overall higher than the loss modulus (G″) indicating a dominantly viscoelastic behaviour and stability. Peak tanδ was lower for germinated foxtail millet compared to kodo millet indicating more stable gel of the former. Therefore, improvements in the functional as well rheological properties of β-glucan could be exploited in food and pharmaceutical industries. Copyright © 2018. Published by Elsevier B.V.

  10. Soluble β-(1,3)-glucans enhance LPS-induced response in the monocyte activation test, but inhibit LPS-mediated febrile response in rabbits: Implications for pyrogenicity tests.

    PubMed

    Pardo-Ruiz, Zenia; Menéndez-Sardiñas, Dalia E; Pacios-Michelena, Anabel; Gabilondo-Ramírez, Tatiana; Montero-Alejo, Vivian; Perdomo-Morales, Rolando

    2016-01-01

    In the present study, we aimed to determine the influence of β-(1,3)-d-glucans on the LPS-induced pro-inflammatory cytokine response in the Monocyte Activation Test (MAT) for pyrogens, and on the LPS-induced febrile response in the Rabbit Pyrogen Test (RPT), thus evaluating the resulting effect in the outcome of each test. It was found that β-(1,3)-d-glucans elicited the production of pro-inflammatory cytokines IL-1β, IL-6 and TNF-α, also known as endogenous pyrogens, but not enough to classify them as pyrogenic according to MAT. The same β-(1,3)-d-glucans samples were non-pyrogenic by RPT. However, β-(1,3)-d-glucans significantly enhanced the LPS-induced pro-inflammatory cytokines response in MAT, insomuch that samples containing non-pyrogenic concentrations of LPS become pyrogenic. On the other hand, β-(1,3)-d-glucans had no effect on sub-pyrogenic LPS doses in the RPT, but surprisingly, inhibited the LPS-induced febrile response of pyrogenic LPS concentrations. Thus, while β-(1,3)-d-glucans could mask the LPS pyrogenic activity in the RPT, they exerted an overstimulation of pro-inflammatory cytokines in the MAT. Hence, MAT provides higher safety since it evidences an unwanted biological response, which is not completely controlled and is overlooked by the RPT. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. The mechanism of synthesis of a mixed-linkage (1-->3), (1-->4)beta-D-glucan in maize. Evidence for multiple sites of glucosyl transfer in the synthase complex

    PubMed

    Buckeridge; Vergara; Carpita

    1999-08-01

    We examined the mechanism of synthesis in vitro of (1-->3), (1-->4)beta-D-glucan (beta-glucan), a growth-specific cell wall polysaccharide found in grasses and cereals. beta-Glucan is composed primarily of cellotriosyl and cellotetraosyl units linked by single (1-->3)beta-linkages. The ratio of cellotriosyl and cellotetraosyl units in the native polymer is strictly controlled at between 2 and 3 in all grasses, whereas the ratios of these units in beta-glucan formed in vitro vary from 1.5 with 5 &mgr;M UDP-glucose (Glc) to over 11 with 30 mM substrate. These results support a model in which three sites of glycosyl transfer occur within the synthase complex to produce the cellobiosyl-(1-->3)-D-glucosyl units. We propose that failure to fill one of the sites results in the iterative addition of one or more cellobiosyl units to produce the longer cellodextrin units in the polymer. Variations in the UDP-Glc concentration in excised maize (Zea mays) coleoptiles did not result in wide variations in the ratios of cellotriosyl and cellotetraosyl units in beta-glucan synthesized in vivo, indicating that other factors control delivery of UDP-Glc to the synthase. In maize sucrose synthase is enriched in Golgi membranes and plasma membranes and may be involved in the control of substrate delivery to beta-glucan synthase and cellulose synthase.

  12. Effect of natural flocculants on purity and properties of β-glucan extracted from barley and oat.

    PubMed

    Kurek, Marcin Andrzej; Karp, Sabina; Stelmasiak, Adrian; Pieczykolan, Ewelina; Juszczyk, Karolina; Rieder, Anne

    2018-05-15

    In this study, β-glucan was extracted from wholegrain oat and barley flours by a novel extraction and purification method employing natural flocculants (chitosan, guar gum and gelatin). The use of flocculants decreased the total amount of extracted gum, which was highest in control samples (9.07 and 7.9% for oat and barley, respectively). The β-glucan specific yield, however, increased with the use of chitosan and guar gum, which were able to remove protein and ash impurities resulting in gums with a higher purity.The highest concentration of chitosan (0.6 %) resulted in gums with the highest β-glucan content (82.0 ± 0.23 and 79.0 ± 0.19 for barley and oat, respectively) and highest β-glucan specific yield (96.9 and 93.3 % for oat and barley, respectively). Explanation is in R&D section. The use of gelatin was not successful. All gum samples had a high content of total dietary fiber (>74%) and a high water holding capacity (4.6-7.4 g/g), but differed in apparent viscosity, which was highest for the oat sample extracted with 0.6% chitosan. This sample also showed the highest β-glucan molecular weight among the oat samples, which were in general 10-fold higher than for the barley samples. Among the barley samples, β-glucan molecular weight was highest for the control. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Effect of purified oat ß-glucan on fermentation of set-style yogurt mix

    USDA-ARS?s Scientific Manuscript database

    Effect of ß-glucan on the fermentation of set-style yogurt was investigated by incorporating 0, 0.1, 0.2, 0.3, 0.4, and 0.5% of ß-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of ß-gluca...

  14. Barley β-glucan reduces blood cholesterol levels via interrupting bile acid metabolism.

    PubMed

    Wang, Yanan; Harding, Scott V; Thandapilly, Sijo J; Tosh, Susan M; Jones, Peter J H; Ames, Nancy P

    2017-11-01

    Underlying mechanisms responsible for the cholesterol-lowering effect of β-glucan have been proposed, yet have not been fully demonstrated. The primary aim of this study was to determine whether the consumption of barley β-glucan lowers cholesterol by affecting the cholesterol absorption, cholesterol synthesis or bile acid synthesis. In addition, this study was aimed to assess whether the underlying mechanisms are related to cholesterol 7α hydroxylase (CYP7A1) SNP rs3808607 as proposed by us earlier. In a controlled, randomised, cross-over study, participants with mild hypercholesterolaemia (n 30) were randomly assigned to receive breakfast containing 3 g high-molecular weight (HMW), 5 g low-molecular weight (LMW), 3 g LMW barley β-glucan or a control diet, each for 5 weeks. Cholesterol absorption was determined by assessing the enrichment of circulating 13C-cholesterol over 96 h following oral administration; fractional rate of synthesis for cholesterol was assessed by measuring the incorporation rate of 2H derived from deuterium oxide within the body water pool into the erythrocyte cholesterol pool over 24 h; bile acid synthesis was determined by measuring serum 7α-hydroxy-4-cholesten-3-one concentrations. Consumption of 3 g HMW β-glucan decreased total cholesterol (TC) levels (P=0·029), but did not affect cholesterol absorption (P=0·25) or cholesterol synthesis (P=0·14). Increased bile acid synthesis after consumption of 3 g HMW β-glucan was observed in all participants (P=0·049), and more pronounced in individuals carrying homozygous G of rs3808607 (P=0·033). In addition, a linear relationship between log (viscosity) of β-glucan and serum 7α-HC concentration was observed in homozygous G allele carriers. Results indicate that increased bile acid synthesis rather than inhibition of cholesterol absorption or synthesis may be responsible for the cholesterol-lowering effect of barley β-glucan. The pronounced TC reduction in G allele carriers of rs3808607 observed in the previous study may be due to enhanced bile acid synthesis in response to high-viscosity β-glucan consumption in those individuals.

  15. Analysis of the levels of endotoxin and β-d-glucan in the synovial fluid of hemodialysis patients.

    PubMed

    Shiota, E; Maekawa, M; Kono, T

    2001-12-01

    Abstract We analyzed the levels of endotoxin and β-d-glucan, which possibly induce cytokine production, in the synovial fluid of patients on long-term hemodialysis and compared the results to those in patients with osteoarthritis and rheumatoid arthritis. We studied 42 knees in 42 hemodialysis patients, 21 in 21 osteoarthritis patients, and 26 in 26 rheumatoid arthritis patients. The mean ages were 60.7, 63.2, and 59.7 years, respectively. The duration of hemodialysis in the long-term hemodialysis group averaged 14.0 years. The concentrations of endotoxin and β-d-glucan in the synovial fluid of these three groups were measured. The concentration of endotoxin was the same in the three groups. However, the concentration of β-d-glucan was significantly higher in long-term hemodialysis patients. This finding suggests that β-d-glucan may have some relation to the pathogenesis of the synovitis which exists in the hydrarthrosis of long-term hemodialysis patients.

  16. Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria

    PubMed Central

    Arena, Mattia P.; Caggianiello, Graziano; Fiocco, Daniela; Russo, Pasquale; Torelli, Michele; Spano, Giuseppe; Capozzi, Vittorio

    2014-01-01

    Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed. PMID:24562330

  17. Glucansucrases: three-dimensional structures, reactions, mechanism, α-glucan analysis and their implications in biotechnology and food applications.

    PubMed

    Leemhuis, Hans; Pijning, Tjaard; Dobruchowska, Justyna M; van Leeuwen, Sander S; Kralj, Slavko; Dijkstra, Bauke W; Dijkhuizen, Lubbert

    2013-01-20

    Glucansucrases are extracellular enzymes that synthesize a wide variety of α-glucan polymers and oligosaccharides, such as dextran. These carbohydrates have found numerous applications in food and health industries, and can be used as pure compounds or even be produced in situ by generally regarded as safe (GRAS) lactic acid bacteria in food applications. Research in the recent years has resulted in big steps forward in the understanding and exploitation of the biocatalytic potential of glucansucrases. This paper provides an overview of glucansucrase enzymes, their recently elucidated crystal structures, their reaction and product specificity, and the structural analysis and applications of α-glucan polymers. Furthermore, we discuss key developments in the understanding of α-glucan polymer formation based on the recently elucidated three-dimensional structures of glucansucrase proteins. Finally we discuss the (potential) applications of α-glucans produced by lactic acid bacteria in food and health related industries. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Structural characterization of the cell wall D-glucans isolated from the mycelium of Botryosphaeria rhodina MAMB-05.

    PubMed

    de Lourdes Corradi da Silva, Maria; Fukuda, Eliane K; Vasconcelos, Ana Flora D; Dekker, Robert F H; Matias, Andreza C; Monteiro, Nilson K; Cardoso, Marilsa S; Barbosa, Aneli M; Silveira, Joana L M; Sassaki, Guilherme L; Carbonero, Elaine R

    2008-03-17

    Three D-glucans were isolated from the mycelium of the fungus Botryosphaeria rhodina MAMB-05 by sequential extraction with hot-water and hot aqueous KOH (2% w/v) followed by ethanol precipitation. Following their purification by gel permeation chromatography on Sepharose CL-4B, the structural characteristics of the D-glucans were determined by FT-IR and 13C NMR spectroscopy and, after methylation, by GC-MS. The hot-water extract produced a fraction designated Q1A that was a beta-(1-->6)-D-glucan with the following structure: [Formula: see text] The alkaline extract, when subjected to repeated freeze-thawing, yielded two fractions: K1P (insoluble) that comprised a beta-(1-->3)-D-glucan with beta-D-glucose branches at C-6 with the structure: [Formula: see text] and K1SA (soluble) consisting of a backbone chain of alpha-(1-->4)-linked D-glucopyranosyl residues substituted at O-6 with alpha-D-glucopyranosyl residues: [Formula: see text

  19. Self-Assembled Polysaccharide Nanotubes Generated from β-1,3-Glucan Polysaccharides

    NASA Astrophysics Data System (ADS)

    Numata, Munenori; Shinkai, Seiji

    β-1,3-Glucans act as unique natural nanotubes, the features of which are greatly different from other natural or synthetic helical polymers. The origin mostly stems from their strong helix-forming nature and reversible interconversion between single-strand random coil and triple-strand helix. During this interconversion process, they can accept functional polymers, molecular assemblies and nanoparticles in an induced-fit manner to create water-soluble one-dimensional nanocomposites, where individual conjugated polymers or molecular assemblies can be incorporated into the one-dimensional hollow constructed by the helical superstructure of β-1,3-glucans. The advantageous point of the β-1,3-glucan hosting system is that the selective modification of β-1,3-glucans leads to the creation of various functional one-dimensional nanocomposites in a supramolecular manner, being applicable toward fundamental nanomaterials such as sensors or circuits. Furthermore, the composites with functional surfaces can act as one-dimensional building blocks toward further hierarchical self-assemblies, leading to the creation of two- or three-dimensional nanoarchitectures.

  20. Antibody to soluble 1,3/1,6-beta-D-glucan, SCG in sera of naive DBA/2 mice.

    PubMed

    Harada, Toshie; Nagi Miura, Noriko; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito

    2003-08-01

    A branched beta-glucan from Sparassis crispa (SCG) is a major 6-branched 1,3-beta-D-glucan showing antitumor activity. In the present study, we examined the anti-SCG antibody in naive mice by ELISA. Using SCG coated plate, sera of naive DBA/1 and DBA/2 mice contained significantly higher titers of antibody than other strains of mice. Anti-SCG Ab titers of each DBA/1 and DBA/2 mice were significantly varied. Using various polysaccharide-coated plate, sera of DBA/2 mice also reacted with a beta-glucan from Candida spp. (CSBG) having 1,3-beta and 1,6-beta-glucosidic linkages. The SCG specific immunoglobulin (Ig) M but G was detected in sera. The reactivity of sera to coated SCG was neutralized by adding soluble SCG and CSBG as competitor. These results suggested that DBA/1 and DBA/2 strains carry specific and unique immunological characteristics to branched 1,3-/1,6-beta-glucan.

  1. The effect of ß-1,3-glucan derived from Euglena gracilis (Algamune™) on the innate immunological responses of Nile tilapia (Oreochromis niloticus L.)

    USDA-ARS?s Scientific Manuscript database

    Algamune™ is a commercial feed additive derived from Euglena gracilis, providing a rich source of the ß-1,3-glucan paramylon. Isolated kidney phagocytes of Nile tilapia were incubated with graded doses (0, 8, 16, 32, 64, and 128 µg mL-1) of Algamune™ and purified ß-1,3-glucan paramylon to gauge the...

  2. Studies of Altered Response to Infection Induced by Severe Injury.

    DTIC Science & Technology

    1991-10-01

    indomethacin, lypoxygenase inhibitors, synthetic glucans and interleukin-4, as possible inmunomcdulators post-trauma. Indo, as described above, was... glucans would decrease post-trauma MO PGE2 levels and TNF levels, but had no effect on MO IL-6 production, indicating they might be useful in post... glucans and interleukin-4, as possible immunomodulators post-trauma. Indo, as described above, was effective in PGE, downregulation, but massively

  3. Glucan-Induced Enhancement of Host Resistance to Selected Infectious Diseases

    DTIC Science & Technology

    1980-10-01

    infectious foci. J. Exp. Med. 133:1090-1104. to bacterial endotoxin and Sabmnoiefa emteridu ia bfc 2. Burgaleta, C., and D. W. Golde. 1977. The effect of...aerosol with Pseudomonas pseudomalei, whereas intravenous glucan pretreatment did not increase survival. Mice given glucan combined with a marginally...Its effects can be catego- , responses been recognized (14). Apparently, rized as macrophage-mediated immunotimula- macrophages not only are capable

  4. Oral administration of soluble β-glucan preparation from the cauliflower mushroom, Sparassis crispa (Higher Basidiomycetes) modulated cytokine production in mice.

    PubMed

    Hida, Toshie H; Kawaminami, Hiromi; Ishibashi, Ken-Ichi; Miura, Noriko N; Adachi, Yoshiyuki; Ohno, Naohito

    2013-01-01

    Soluble β-glucan preparation from the cold NaOH extract of Sparassis crispa (SCG) is a six-branched 1,3-β-D-glucan that is a major cell-wall structural component in fungi. Leukocytes from DBA/2 mice are highly sensitive to SCG, producing cytokines in vitro. We previously reported that the intraperitoneal (i.p.) administration of β-glucan decreased cytokine induction by SCG in vitro in DBA/2 mice. In this study, we examined the effects of the oral (p.o.) administration of polysaccharide fractions extracted from S. crispa, using hot water (SCHWE), a β-glucan from S. crispa, to DBA/2 mice on cytokine induction by SCG in the spleen in vitro. The level of induction of IFN-γ and GM-CSF by SCG was significantly increased in SCHWE-treated mice. This activity was more clearly observed when chlorpromazine was administered as a pretreatment in SCHWE-treated mice. The production of GM-CSF, IFN-γ, and IL-6 by immune cells in Peyer's patches was higher in SCHWE-treated mice than in control mice. These results suggest that orally administered β-glucan may modulate cytokine induction by SCG in the spleen through the activation of Peyer's patches.

  5. Effects of β-glucan and Vitamin D Supplementation on Inflammatory Parameters in Patients with Diabetic Retinopathy.

    PubMed

    Richter, Josef; Závorková, Martina; Vetvicka, Vaclav; Liehneová, Ivana; Kral, Vlastimil; Rajnohova Dobiasova, Lucie

    2018-06-19

    The objective of this article is to evaluate the potential effects of beta-glucan and vitamin D supplementation in patients with diabetic retinopathy. We evaluated the levels of several parameters of inflammatory reactions (C-reactive protein [CRP], serum amyloid A [SAA], and interleukin- [IL-] 6), leptin, and vitamin D. Using a 3-month interval, we divided the patients into three groups: (1) supplemented with beta-glucan and vitamin D, (2) supplemented with vitamin D and placebo, and (3) supplemented with vitamin D alone. By this division, we aim not only to observe whether beta-glucan can increase the effects of vitamin D, but also to eliminate the potential effects of placebo. The doses of vitamin D corresponded to phototype, weight, age, and sex of the individual. Fifty-two diabetic retinopathy patients were selected for our study. We found significant vitamin D deficits in all cases, even after three months of supplementation with vitamin D. Significant changes in levels of CRP were observed in the beta-glucan-supplemented group; levels of SAA and IL-6 were not changed. Leptin levels were significantly lowered in the beta-glucan-supplemented group and increased in the other groups. More detailed studies and/or longer supplementation is necessary.

  6. Streptococcus mutans dextransucrase: stimulation by phospholipids from human sera and oral fluids.

    PubMed Central

    Schachtele, C F; Harlander, S K; Bracke, J W; Ostrum, L C; Maltais, J A; Billings, R J

    1978-01-01

    Serum, gingival crevicular fluid, and parotid, submandibular, and labial minor gland saliva from four individuals stimulated glucan formation from sucrose by the Streptococcus mutans strain 6715 dextransucrase (EC 2.4.1.5). At final dilutions of 1:10 all of the fluids stimulated crude enzyme preparations approximately 1.8-fold. The fluids stimulated the purified water-insoluble glucan-synthesizing form of the dextransucrase approximately 3.2-fold and the water-soluble glucan-producing form of the enzyme approximately 2.4-fold. The fluids all contained concentrations of stimulatory material that could be reduced to undetectable levels only after dilutions of greater than 1:1,000. The increased rates of glucan formation caused by the fluids and dextran were additive, indicating that stimulation by the fluids was primarily due to interactions with entities other than glucan primer molecules. In contrast, the elevated levels of glucan formation in the presence of the fluids was not further enhanced by the addition of lysophosphatidylcholine. Lysophosphatidylcholine purified from parotid and submandibular saliva by solvent extraction and thin-layer chromatography stimulated the dextransucrase as effectively as egg yolk lysophosphatidylcholine. Thus, phospholipids normally found in human oral fluids can enhance the activity of an enzyme believed to be directly associated with the cariogenic potential of S. mutans. PMID:365766

  7. A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.

    PubMed

    Semedo, Magda C; Karmali, Amin; Fonseca, Luís

    2015-02-01

    Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Serum (1 → 3) β-D-glucan assay for discrimination between Pneumocystis jirovecii pneumonia and colonization.

    PubMed

    Tasaka, Sadatomo; Kobayashi, Seiki; Yagi, Kazuma; Asami, Takahiro; Namkoong, Ho; Yamasawa, Wakako; Ishii, Makoto; Hasegawa, Naoki; Betsuyaku, Tomoko

    2014-11-01

    Polymerase chain reaction (PCR) technique is being increasingly used for the microbiological diagnosis of Pneumocystis pneumonia (PCP). As PCR is highly sensitive, it can be positive even in a patient with Pneumocystis colonization. In this study, we evaluated whether the β-d-glucan assay could be used to differentiate between PCP and Pneumocystis jirovecii colonization in immunocompromised patients with pulmonary infiltrates. We retrospectively evaluated data from 166 consecutive patients who underwent bronchoalveolar lavage for the diagnosis of PCP. Serum levels of β-d-glucan in the negative, colonization, probable PCP, and definite PCP groups were 20.2 ± 6.3, 48.8 ± 15.9, 89.9 ± 20.2, 224.9 ± 25.9 pg/mL, respectively. The β-D-glucan levels in the definite PCP group were significantly higher than those in the other 3 groups (p < 0.001). Serum β-d-glucan levels in patients with either definite or probable PCP (173.1 ± 18.8 pg/mL) were significantly greater than those in patients with colonization who had positive PCR results but improved without anti-PCP treatment (p < 0.002). The cut-off level for discrimination was estimated to be 33.5 pg/mL, with which the positive predictive value was 0.925. These results indicate that β-D-glucan is a useful marker to differentiate between PCP and Pneumocystis colonization. A positive β-D-glucan assay result might be a good indication to begin anti-PCP treatment. Copyright © 2014. Published by Elsevier Ltd.

  9. Promotion of beta-glucan synthase activity in corn microsomal membranes by calcium and protein phosphorylation

    NASA Technical Reports Server (NTRS)

    Paliyath, G.; Poovaiah, B. W.

    1988-01-01

    Regulation of the activity of beta-glucan synthase was studied using microsomal preparations from corn coleoptiles. The specific activity as measured by the incorporation of glucose from uridine diphospho-D-[U-14C]glucose varied between 5 to 15 pmol (mg protein)-1 min-1. Calcium promoted beta-glucan synthase activity and the promotion was observed at free calcium concentrations as low as 1 micromole. Kinetic analysis of substrate-velocity curve showed an apparent Km of 1.92 x 10(-4) M for UDPG. Calcium increased the Vmax from 5.88 x 10(-7) mol liter-1 min-1 in the absence of calcium to 9.52 x 10(-7) mol liter-1 min-1 and 1.66 x 10(-6) mol liter-1 min-1 in the presence of 0.5 mM and 1 mM calcium, respectively. The Km values remained the same under these conditions. Addition of ATP further increased the activity above the calcium-promoted level. Sodium fluoride, a phosphoprotein phosphatase inhibitor, promoted glucan synthase activity indicating that phosphorylation and dephosphorylation are involved in the regulation of the enzyme activity. Increasing the concentration of sodium fluoride from 0.25 mM to 10 mM increased glucan synthase activity five-fold over the + calcium + ATP control. Phosphorylation of membrane proteins also showed a similar increase under these conditions. Calmodulin, in the presence of calcium and ATP stimulated glucan synthase activity substantially, indicating that calmodulin could be involved in the calcium-dependent phosphorylation and promotion of beta-glucan synthase activity. The role of calcium in mediating auxin action is discussed.

  10. Hypoglycemic activity of polysaccharide fractions containing beta-glucans from extracts of Rhynchelytrum repens (Willd.) C.E. Hubb., Poaceae.

    PubMed

    De Paula, A C C F F; Sousa, R V; Figueiredo-Ribeiro, R C L; Buckeridge, M S

    2005-06-01

    Beta-glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of beta-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of beta-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-beta-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa) being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa) to that of maize coleoptile beta-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure beta-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of beta-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

  11. Fungi, β-glucan, and bacteria in nasal lavage of greenhouse workers and their relation to occupational exposure.

    PubMed

    Madsen, Anne Mette; Tendal, Kira; Thilsing, Trine; Frederiksen, Margit W; Baelum, Jesper; Hansen, Jørgen V

    2013-10-01

    The nose and mouth are the first regions of the respiratory tract in contact with airborne microorganisms. Occupational exposures to airborne microorganisms are associated with inflammation and different symptoms of the airways. The purpose of this study is to investigate the relation between occupational exposure to fungi, β-glucan, and bacteria and contents of fungi, β-glucan, and bacteria in nasal lavage (NAL) of greenhouse workers. We also studied whether contents of microorganisms in NAL were related to gender, time of the work week, and runny nose. NAL samples (n = 135) were taken Monday morning and Thursday at noon and personal exposure to inhalable bioaerosols was measured during a working day. The content of fungi and β-glucan in NAL of men was affected by their exposure to fungi and β-glucan. The content of fungi, β-glucan, and bacteria in NAL was higher Thursday at noon than Monday morning. The ratios of fungi in NAL between Thursday at noon and Monday morning were 14 (median value) for men and 3.5 for women. Gender had no effect on the exposure level but had a significant effect on the content of fungi, β-glucan, and bacteria in NAL, with the highest contents in NAL of men. On Thursdays, the median content of fungi in NAL samples of men without runny noses was 9408 cfu per NAL sample, whereas the same content for women was 595 cfu per NAL sample. Workers with runny noses had fewer fungi in NAL than workers without runny noses. A higher content of β-glucan per fungal spore was found in NAL than in the air. This indicates that mainly the larger fungal spores or pollen grains deposit in the nose. The difference between genders and the fact that the content of fungi in NAL was significantly affected by the exposure indicate that the two genders are affected by the same exposure level differently.

  12. Blood (1→3)-β-D-Glucan as a Diagnostic Test for HIV-Related Pneumocystis jirovecii Pneumonia

    PubMed Central

    Komarow, Lauren; Finkelman, Malcolm A.; Grant, Philip M.; Andersen, Janet; Scully, Eileen; Powderly, William G.; Zolopa, Andrew R.

    2011-01-01

    (See the editorial commentary by Morris and Masur, on pages 203–204.) Background. Improved noninvasive diagnostic tests for Pneumocystis jirovecii pneumonia (PCP) are needed. We evaluated the test characteristics of plasma (1→3)-β-D-glucan (β-glucan) for HIV-related PCP among a large group of patients presenting with diverse opportunistic infections (OIs). Methods. The study population included all 282 participants in AIDS Clinical Trials Group A5164, a study of early versus deferred antiretroviral therapy in conjunction with initial therapy of acute OIs. Baseline plasma samples were assayed for β-glucan, with standard assay reference values defining ≥80 pg/mL as positive. Before this analysis, diagnosis of PCP was independently adjudicated by 2 study investigators after reviewing reports from study sites. Results. A total of 252 persons had a β-glucan result that could be analyzed, 173 (69%) of whom had received a diagnosis of PCP. Median β-glucan with PCP was 408 pg/mL (interquartile range [IQR], 209–500 pg/mL), compared with 37 pg/mL (IQR, 31–235 pg/mL) without PCP (P < .001). The sensitivity of β-glucan dichotomized at 80 pg/mL for the diagnosis of PCP was 92% (95% confidence interval [CI], 87%–96%), and the specificity was 65% (95% CI, 53%–75%); positive and negative predictive values were 85% (95% CI, 79%–90%) and 80% (95% CI, 68%–89%) respectively, based on the study prevalence of 69% of patients with PCP. Rates of abnormal lactate dehyrogenase levels did not differ significantly between those with and without PCP. Conclusions. Blood (1→3)-β-D-glucan is strongly correlated with HIV-related PCP. In some clinical centers, this may be a more sensitive test than the induced sputum examination and could reduce the need for both bronchoscopy and empirical therapy of PCP. PMID:21690628

  13. T(reg) cells may regulate interlukin-17 production by modulating TH1 responses in 1,3-β-glucan-induced lung inflammation in mice.

    PubMed

    Chen, Ying; Liu, Fangwei; Weng, Dong; Song, Laiyu; Li, Cuiying; Tang, Wen; Yu, Ye; Dai, Wujing; Chen, Jie

    2013-01-01

    1,3-β-glucan is considered a fungal biomarker and exposure to this agent can induce lung inflammation. Complement activation plays an important role in early immune responses to β-glucan. Previous studies showed that T-regulatory cells (Tregs) regulated 1,3-β-glucan-induced lung inflammation by modulating the maintenance of immune homeostasis in the lung. Both interleukin (IL)-17 and TH17 cells play pivotal roles in inflammation associated with lung disease and share reciprocal developmental pathways with Tregs. However, the effect of Tregs on IL-17 and TH17 responses in 1,3-β-glucan-induced lung inflammation remains unclear. In this study, mice were exposed to 1,3-β-glucan by intratracheal instillation. To investigate the effects of Tregs on IL-17 and TH17 cells in the induced lung inflammation, a Treg-depleted mice model was generated by administration of anti-CD25 mAb. The results indicated that Treg-depleted mice showed more severe pathological inflammatory changes in lung tissues. Tregs depletion reduced IL-17 expression in these tissues, and increased those of TH1 cytokines. The expression of IL-17 increased at the early phase of the inflammation response. There were no significant effects of the Tregs on expression of RORγt and IL-6 or the amount of CD4(+)IL-17(+) cells in the lungs. When taken together, the late phase of the 1,3-β-glucan-induced inflammatory response in the mice was primarily mediated by TH1 cytokines rather than IL-17. In contrast, the early phase of the inflammatory response might be mediated in part by IL-17 along with activated complement. Tregs might be required for IL-17 expression during the late phase inflammatory response in mice. The increased IL-17 mRNA observed during the 1,3-β-glucan induced inflammatory response were attributed to cells other than TH17 cells.

  14. Pneumocystis polymerase chain reaction and blood (1→3)-β-D-glucan assays to predict survival with suspected Pneumocystis jirovecii pneumonia.

    PubMed

    Matsumura, Yasufumi; Ito, Yutaka; Yamamoto, Masaki; Matsushima, Aki; Nagao, Miki; Takakura, Shunji; Iinuma, Yoshitsugu; Ichiyama, Satoshi

    2014-02-01

    Pneumocystis polymerase chain reaction (PCR) and blood (1→3)-β-D-glucan assays are known to be useful for the diagnosis of Pneumocystis pneumonia (PCP). However, their impact on the outcome of clinically suspected PCP patients has not yet been elucidated. Between January 2008 and July 2011, we prospectively observed 190 immunocompromised patients who had ground-glass opacity on chest computed tomography scans and were suspected to have PCP. The blood β-D-glucan levels of these patients were measured, and PCR was used to detect Pneumocystis jirovecii in the respiratory samples. The 30-day mortality rates and related factors were assessed. The 30-day mortality rate of all included patients was 21.6%. Both β-D-glucan-positive (10.1%) and PCR-positive patients (15.0%) had significantly lower mortality rates than β-D-glucan-negative (28.1%) or PCR-negative patients (30.1%). All of the 13 definite PCP patients had positive PCR and β-D-glucan results, received anti-PCP treatments, and survived. Among the 72 patients who were negative for microscopic detection of P. jirovecii but received anti-PCP treatments, positive PCR results (odds ratio [OR], 0.14; 95% confidence interval [CI], 0.02-0.74), a high Sequential Organ Failure Assessment score (OR, 1.42; CI, 1.08-1.88), and positive β-D-glucan levels (OR 0.25, CI 0.06-1.02) were associated with mortality rates using stepwise logistic regression analyses. A positive Pneumocystis PCR or β-D-glucan test was a candidate predictor of survival in patients who were suspected of having PCP, even though negative for visual detection by microscopy. Copyright © 2013 Japanese Society of Chemotherapy and the Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  15. Modulators of Fish Immune Responses. Volume 1. Models for Environmental Toxicology/Biomarkers Immunostimulators

    DTIC Science & Technology

    1994-01-01

    Immunity in Invertebrates. (M. Breh~lin, editor). Springer-Verlag, Berlin, Heidelberg. pp 112-124. Smith, V.J. and K. Soderhall. (1983). Beta -1-3- glucan ...resistance of carp Cyprinus carpio to experimental Edwardsiella tarda infection, by some beta - 1, 3- glucan . Nippon Suisan Gakkaishi 55:1815-1819. Yoshida...inhibitory and anti-bacterial activity of soluble and particulate glucan . Intl. J. Cancer 24: 773-779. Ellsaesser, C.F. (1989). Identification and

  16. JPRS Report Science & Technology USSR: Life Sciences

    DTIC Science & Technology

    1990-06-18

    water-soluble low-molecular-mass ß-l,3-ß-l,6- glucanes , suppressors present in the mycelium and zoospores of the fungus, and also in its excretions...This article studies the participation of the glucane suppressors of phytoph- thora infestans (Mont) de Bary in the suppression of various types of...potato immune response. The interac- tion of the glucanes with specific receptors on the plas- malemma of the potato cells prevents recognition by

  17. Dectin-1 is required for β-glucan recognition and control of fungal infection

    PubMed Central

    Taylor, Philip R; Tsoni, S Vicky; Willment, Janet A; Dennehy, Kevin M; Rosas, Marcela; Findon, Helen; Haynes, Ken; Steele, Chad; Botto, Marina; Gordon, Siamon; Brown, Gordon D

    2007-01-01

    β-Glucan is one of the most abundant polysaccharides in fungal pathogens, yet its importance in antifungal immunity is unclear. Here we show that deficiency of dectin-1, the myeloid receptor for β-glucan, rendered mice susceptible to infection with Candida albicans. Dectin-1-deficient leukocytes demonstrated significantly impaired responses to fungi even in the presence of opsonins. Impaired leukocyte responses were manifested in vivo by reduced inflammatory cell recruitment after fungal infection, resulting in substantially increased fungal burdens and enhanced fungal dissemination. Our results establish a fundamental function for β-glucan recognition by dectin-1 in antifungal immunity and demonstrate a signaling non–Toll-like pattern-recognition receptor required for the induction of protective immune responses. PMID:17159984

  18. Targeted Delivery of Glucan Particle Encapsulated Gallium Nanoparticles Inhibits HIV Growth in Human Macrophages

    PubMed Central

    Soto, Ernesto R.; O'Connell, Olivia; Dikengil, Fusun; Peters, Paul J.; Clapham, Paul R.

    2016-01-01

    Glucan particles (GPs) are hollow, porous 3–5 μm microspheres derived from the cell walls of Baker's yeast (Saccharomyces cerevisiae). The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of a wide range of payloads (DNA, siRNA, protein, small molecules, and nanoparticles) encapsulated inside the hollow GPs or bound to the surface of chemically derivatized GPs. Gallium nanoparticles have been proposed as an inhibitory agent against HIV infection. Here, macrophage targeting of gallium using GPs provides for more efficient delivery of gallium and inhibition of HIV infection in macrophages compared to free gallium nanoparticles. PMID:27965897

  19. Wholegrain barley β-glucan fermentation does not improve glucose tolerance in rats fed a high-fat diet.

    PubMed

    Belobrajdic, Damien P; Jobling, Stephen A; Morell, Matthew K; Taketa, Shin; Bird, Anthony R

    2015-02-01

    Fermentation of oat and barley β-glucans is believed to mediate in part their metabolic health benefits, but the exact mechanisms remain unclear. In this study, we sought to test the hypothesis that barley β-glucan fermentation raises circulating incretin hormone levels and improves glucose control, independent of other grain components. Male Sprague-Dawley rats (n = 30) were fed a high-fat diet for 6 weeks and then randomly allocated to 1 of 3 dietary treatments for 2 weeks. The low- (LBG, 0% β-glucan) and high- (HBG, 3% β-glucan) β-glucan diets contained 25% wholegrain barley and similar levels of insoluble dietary fiber, available carbohydrate, and energy. A low-fiber diet (basal) was included for comparison. Immediately prior to the dietary intervention, gastric emptying rate (using the (13)C-octanoic breath test) and postprandial glycemic response of each diet were determined. At the end of the study, circulating gut hormone levels were determined; and a glucose tolerance test was performed. The rats were then killed, and indices of cecal fermentation were assessed. Diet did not affect live weight; however, the HBG diet, compared to basal and LBG, reduced food intake, tended to slow gastric emptying, increased cecal digesta mass and individual and total short-chain fatty acid pools, and lowered digesta pH. In contrast, circulating levels of glucose, insulin, gastric-inhibitory peptide, and glucagon-like peptide-1, and glucose tolerance were unaffected by diet. In conclusion, wholegrain barley β-glucan suppressed feed intake and increased cecal fermentation but did not improve postprandial glucose control or insulin sensitivity. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

  20. Molecular Cloning and Characterization of cgs, the Brucella abortus Cyclic β(1-2) Glucan Synthetase Gene: Genetic Complementation of Rhizobium meliloti ndvB and Agrobacterium tumefaciens chvB Mutants

    PubMed Central

    Iñón de Iannino, Nora; Briones, Gabriel; Tolmasky, Marcelo; Ugalde, Rodolfo A.

    1998-01-01

    The animal pathogen Brucella abortus contains a gene, cgs, that complemented a Rhizobium meliloti nodule development (ndvB) mutant and an Agrobacterium tumefaciens chromosomal virulence (chvB) mutant. The complemented strains recovered the synthesis of cyclic β(1-2) glucan, motility, virulence in A. tumefaciens, and nitrogen fixation in R. meliloti; all traits were strictly associated with the presence of an active cyclic β(1-2) glucan synthetase protein in the membranes. Nucleotide sequencing revealed the presence in B. abortus of an 8.49-kb open reading frame coding for a predicted membrane protein of 2,831 amino acids (316.2 kDa) and with 51% identity to R. meliloti NdvB. Four regions of the B. abortus protein spanning amino acids 520 to 800, 1025 to 1124, 1284 to 1526, and 2400 to 2660 displayed similarities of higher than 80% with R. meliloti NdvB. Tn3-HoHo1 mutagenesis showed that the C-terminal 825 amino acids of the Brucella protein, although highly conserved in Rhizobium, are not necessary for cyclic β(1-2) glucan synthesis. Confirmation of the identity of this protein as B. abortus cyclic β(1-2) glucan synthetase was done by the construction of a B. abortus Tn3-HoHo1 insertion mutant that does not form cyclic β(1-2) glucan and lacks the 316.2-kDa membrane protein. The recovery of this mutant from the spleens of inoculated mice was decreased by 3 orders of magnitude compared with that of the parental strain; this result suggests that cyclic β(1-2) glucan may be a virulence factor in Brucella infection. PMID:9721274

  1. Aerosolization of Particulate (1→3)-β-d-Glucan from Moldy Materials▿

    PubMed Central

    Seo, Sung-Chul; Reponen, Tiina; Levin, Linda; Borchelt, Tiffany; Grinshpun, Sergey A.

    2008-01-01

    Mold-damaged building materials may contain biologically active agents, such as (1→3)-β-d-glucan, allergens, and mycotoxins, which have been associated with adverse health effects. The release of these components from contaminated surfaces into the air is not well understood. The purpose of this study was to characterize the release of particulate (1→3)-β-d-glucan from the surface of artificially mold-contaminated materials. Aspergillus versicolor and Stachybotrys chartarum were grown on malt extract agar (MEA), white ceiling tiles, and a wall-papered gypsum board for 1 and 6 months. The (1→3)-β-d-glucan on the surfaces of moldy materials and in air samples collected from these materials was analyzed by the Limulus amebocyte lysate assay. The aerosolization ratio was defined as the amount of (1→3)-β-d-glucan in the air divided by the amount on the surface. The results showed that the aerosolization of particulate (1→3)-β-d-glucan was influenced mainly by the type of material and the fungal species. For A. versicolor, the aerosolization ratios of particulate (1→3)-β-d-glucan released from the three types of material were not significantly different. However, the ratios for S. chartarum released from ceiling tiles and gypsum board were significantly higher than the ratios for this organism released from MEA (P < 0.001) and were comparable to those for A. versicolor. These findings indicate that the use of MEA in aerosolization experiments is likely to underestimate the release of S. chartarum particles from building materials. These results provide important background information for design of future laboratory or animal experiments, as well as for interpretation of field measurement data. PMID:18065630

  2. Review of human studies investigating the post-prandial blood-glucose lowering ability of oat and barley food products.

    PubMed

    Tosh, S M

    2013-04-01

    Oat and barley foods have been shown to reduce human glycaemic response, compared to similar wheat foods or a glucose control. The strength of the evidence supporting the hypothesis that the soluble fibre, mixed linkage β-glucan, reduces glycaemic response was evaluated. A search of the literature was conducted to find clinical trials with acute glycaemic response as an end point using oat or barley products. Of the 76 human studies identified, 34 met the inclusion and exclusion criteria. Dose response and ratio of β-glucan to available carbohydrate as predictors of glycaemic response were assessed. Meals provided 0.3-12.1 g oat or barley β-glucan, and reduced glycaemic response by an average of 48 ± 33 mmol · min/l compared to a suitable control. Regression analysis on 119 treatments indicated that change in glycaemic response (expressed as incremental area under the post-prandial blood-glucose curve) was greater for intact grains than for processed foods. For processed foods, glycaemic response was more strongly related to the β-glucan dose alone (r(2)=0.48, P<0.0001) than to the ratio of β-glucan to the available carbohydrate (r(2)=0.25, P<0.0001). For processed foods containing 4 g of β-glucan, the linear model predicted a decrease in glycaemic response of 27 ± 3 mmol · min/l, and 76% of treatments significantly reduced glycaemic response. Thus, intact grains as well as a variety of processed oat and barley foods containing at least 4 g of β-glucan and 30-80 g available carbohydrate can significantly reduce post-prandial blood glucose.

  3. Oral microbe-host interactions: influence of β-glucans on gene expression of inflammatory cytokines and metabolome profile.

    PubMed

    Silva, Viviam de Oliveira; Pereira, Luciano José; Murata, Ramiro Mendonça

    2017-03-07

    The aim of this study was to evaluate the effects of β-glucan on the expression of inflammatory mediators and metabolomic profile of oral cells [keratinocytes (OBA-9) and fibroblasts (HGF-1) in a dual-chamber model] infected by Aggregatibacter actinomycetemcomitans. The periodontopathogen was applied and allowed to cross the top layer of cells (OBA-9) to reach the bottom layer of cells (HGF-1) and induce the synthesis of immune factors and cytokines in the host cells. β-glucan (10 μg/mL or 20 μg/mL) were added, and the transcriptional factors and metabolites produced were quantified in the remaining cell layers and supernatant. The relative expression of interleukin (IL)-1-α and IL-18 genes in HGF-1 decreased with 10 μg/mL or 20 μg/mL of β-glucan, where as the expression of PTGS-2 decreased only with 10 μg/mL. The expression of IL-1-α increased with 20 μg/mL and that of IL-18 increased with 10 μg/mL in OBA-9; the expression of BCL 2, EP 300, and PTGS-2 decreased with the higher dose of β-glucan. The production of the metabolite 4-aminobutyric acid presented lower concentrations under 20 μg/mL, whereas the concentrations of 2-deoxytetronic acid NIST and oxalic acid decreased at both concentrations used. Acetophenone, benzoic acid, and pinitol presented reduced concentrations only when treated with 10 μg/mL of β-glucan. Treatment with β-glucans positively modulated the immune response and production of metabolites.

  4. In Situ β-Glucan Fortification of Cereal-Based Matrices by Pediococcus parvulus 2.6: Technological Aspects and Prebiotic Potential

    PubMed Central

    Mohedano, María Luz; Spano, Giuseppe; Fiocco, Daniela; Russo, Pasquale; Capozzi, Vittorio

    2017-01-01

    Bacterial exopolysaccharides produced by lactic acid bacteria are of increasing interest in the food industry, since they might enhance the technological and functional properties of some edible matrices. In this work, Pediococcus parvulus 2.6, which produces an O2-substituted (1,3)-β-d-glucan exopolysaccharide only synthesised by bacteria, was proposed as a starter culture for the production of three cereal-based fermented foods. The obtained fermented matrices were naturally bio-fortified in microbial β-glucans, and used to investigate the prebiotic potential of the bacterial exopolysaccharide by analysing the impact on the survival of a probiotic Lactobacillus plantarum strain under starvation and gastrointestinal simulated conditions. All of the assays were performed by using as control of the P. parvulus 2.6’s performance, the isogenic β-glucan non-producing 2.6NR strain. Our results showed a differential capability of P. parvulus to ferment the cereal flours. During the fermentation step, the β-glucans produced were specifically quantified and their concentration correlated with an increased viscosity of the products. The survival of the model probiotic L. plantarum WCFS1 was improved by the presence of the bacterial β-glucans in oat and rice fermented foods under starvation conditions. The probiotic bacteria showed a significantly higher viability when submitted to a simulated intestinal stress in the oat matrix fermented by the 2.6 strain. Therefore, the cereal flours were a suitable substrate for in situ bio-fortification with the bacterial β-glucan, and these matrices could be used as carriers to enhance the beneficial properties of probiotic bacteria. PMID:28754020

  5. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  6. Effects of oat β-glucan consumption at breakfast on ad libitum eating, appetite, glycemia, insulinemia and GLP-1 concentrations in healthy subjects.

    PubMed

    Zaremba, Suzanne M M; Gow, Iain F; Drummond, Sandra; McCluskey, Jane T; Steinert, Robert E

    2018-06-18

    There is evidence that oat β-glucan lowers appetite and ad libitum eating; however, not all studies are consistent, and the underpinning mechanisms are not entirely understood. We investigated the effects of 4 g high molecular weight (MW) oat β-glucan on ad libitum eating, subjective appetite, glycemia, insulinemia and plasma GLP-1 responses in 33 normal-weight subjects (22 female/11 male, mean age (y): 26.9 ± 1.0, BMI (kg/m 2 ): 23.5 ± 0.4). The study followed a randomised double-blind, cross-over design with subjects fed two test breakfasts with and without oat β-glucan followed by an ad libitum test meal on two different days. Blood samples and ratings for subjective appetite were collected postprandially at regular time intervals. Oat β-glucan increased feelings of fullness (p = 0.048) and satiety (p = 0.034), but did not affect energy and amount eaten at the ad libitum test meal. There was a treatment by time interaction for plasma GLP-1, plasma insulin and blood glucose. GLP-1 was significantly reduced at 90 min (p = 0.021), blood glucose at 30 min (p = 0.008) and plasma insulin at 30 and 60 min (p = 0.002 and 0.017, respectively) following the oat β-glucan breakfast when compared with the control breakfast. Four grams of high MW oat β-glucan lowers appetite but not ad libitum eating and beneficially modulates postprandial glycaemia, it does however, not increase plasma GLP-1 secretion. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Family 46 Carbohydrate-binding Modules Contribute to the Enzymatic Hydrolysis of Xyloglucan and β-1,3-1,4-Glucans through Distinct Mechanisms.

    PubMed

    Venditto, Immacolata; Najmudin, Shabir; Luís, Ana S; Ferreira, Luís M A; Sakka, Kazuo; Knox, J Paul; Gilbert, Harry J; Fontes, Carlos M G A

    2015-04-24

    Structural carbohydrates comprise an extraordinary source of energy that remains poorly utilized by the biofuel sector as enzymes have restricted access to their substrates within the intricacy of plant cell walls. Carbohydrate active enzymes (CAZYmes) that target recalcitrant polysaccharides are modular enzymes containing noncatalytic carbohydrate-binding modules (CBMs) that direct enzymes to their cognate substrate, thus potentiating catalysis. In general, CBMs are functionally and structurally autonomous from their associated catalytic domains from which they are separated through flexible linker sequences. Here, we show that a C-terminal CBM46 derived from BhCel5B, a Bacillus halodurans endoglucanase, does not interact with β-glucans independently but, uniquely, acts cooperatively with the catalytic domain of the enzyme in substrate recognition. The structure of BhCBM46 revealed a β-sandwich fold that abuts onto the region of the substrate binding cleft upstream of the active site. BhCBM46 as a discrete entity is unable to bind to β-glucans. Removal of BhCBM46 from BhCel5B, however, abrogates binding to β-1,3-1,4-glucans while substantially decreasing the affinity for decorated β-1,4-glucan homopolymers such as xyloglucan. The CBM46 was shown to contribute to xyloglucan hydrolysis only in the context of intact plant cell walls, but it potentiates enzymatic activity against purified β-1,3-1,4-glucans in solution or within the cell wall. This report reveals the mechanism by which a CBM can promote enzyme activity through direct interaction with the substrate or by targeting regions of the plant cell wall where the target glucan is abundant. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Summaries of Research, Fiscal Year 1980.

    DTIC Science & Technology

    1980-10-01

    separated from its subunits. The 1, 3- glucanse did not exhibit any dextranase or amylase activity when induced on a "limit- glucan " substrate. The greatest...by Surface Active Compounds." SHKLAIR, I. L. presented " Glucan Synthesis of S. mutans from Caries-Active and Caries-Free Naval Recruits." WIRTHLIN, M...I. L. presented "Relationship of Glucan Formation by S. mutans and Dental Caries Activity." WALTER, R. G. presented "Streptococcus mutans in Caries

  9. Chemical Organization of the Cell Wall Polysaccharide Core of Malassezia restricta

    PubMed Central

    Stalhberger, Thomas; Simenel, Catherine; Clavaud, Cécile; Eijsink, Vincent G. H.; Jourdain, Roland; Delepierre, Muriel; Latgé, Jean-Paul; Breton, Lionel; Fontaine, Thierry

    2014-01-01

    Malassezia species are ubiquitous residents of human skin and are associated with several diseases such as seborrheic dermatitis, tinea versicolor, folliculitis, atopic dermatitis, and scalp conditions such as dandruff. Host-Malassezia interactions and mechanisms to evade local immune responses remain largely unknown. Malassezia restricta is one of the most predominant yeasts of the healthy human skin, its cell wall has been investigated in this paper. Polysaccharides in the M. restricta cell wall are almost exclusively alkali-insoluble, showing that they play an essential role in the organization and rigidity of the M. restricta cell wall. Fractionation of cell wall polymers and carbohydrate analyses showed that the polysaccharide core of the cell wall of M. restricta contained an average of 5% chitin, 20% chitosan, 5% β-(1,3)-glucan, and 70% β-(1,6)-glucan. In contrast to other yeasts, chitin and chitosan are relatively abundant, and β-(1,3)-glucans constitute a minor cell wall component. The most abundant polymer is β-(1,6)-glucans, which are large molecules composed of a linear β-(1,6)-glucan chains with β-(1,3)-glucosyl side chain with an average of 1 branch point every 3.8 glucose unit. Both β-glucans are cross-linked, forming a huge alkali-insoluble complex with chitin and chitosan polymers. Data presented here show that M. restricta has a polysaccharide organization very different of all fungal species analyzed to date. PMID:24627479

  10. Chemical organization of the cell wall polysaccharide core of Malassezia restricta.

    PubMed

    Stalhberger, Thomas; Simenel, Catherine; Clavaud, Cécile; Eijsink, Vincent G H; Jourdain, Roland; Delepierre, Muriel; Latgé, Jean-Paul; Breton, Lionel; Fontaine, Thierry

    2014-05-02

    Malassezia species are ubiquitous residents of human skin and are associated with several diseases such as seborrheic dermatitis, tinea versicolor, folliculitis, atopic dermatitis, and scalp conditions such as dandruff. Host-Malassezia interactions and mechanisms to evade local immune responses remain largely unknown. Malassezia restricta is one of the most predominant yeasts of the healthy human skin, its cell wall has been investigated in this paper. Polysaccharides in the M. restricta cell wall are almost exclusively alkali-insoluble, showing that they play an essential role in the organization and rigidity of the M. restricta cell wall. Fractionation of cell wall polymers and carbohydrate analyses showed that the polysaccharide core of the cell wall of M. restricta contained an average of 5% chitin, 20% chitosan, 5% β-(1,3)-glucan, and 70% β-(1,6)-glucan. In contrast to other yeasts, chitin and chitosan are relatively abundant, and β-(1,3)-glucans constitute a minor cell wall component. The most abundant polymer is β-(1,6)-glucans, which are large molecules composed of a linear β-(1,6)-glucan chains with β-(1,3)-glucosyl side chain with an average of 1 branch point every 3.8 glucose unit. Both β-glucans are cross-linked, forming a huge alkali-insoluble complex with chitin and chitosan polymers. Data presented here show that M. restricta has a polysaccharide organization very different of all fungal species analyzed to date.

  11. (1-3)(1-6)-β-glucan-enriched materials from Lentinus edodes mushroom as a high-fibre and low-calorie flour substitute for baked foods.

    PubMed

    Kim, Juyoung; Lee, Seung Mi; Bae, In Young; Park, Hyuk-Gu; Gyu Lee, Hyeon; Lee, Suyong

    2011-08-15

    Extensive physiological and biological emphasis has been placed on pharmaceutical and medicinal uses of mushrooms containing β-glucans, but their incorporation into processed functional foods is quite limited. Thus, low-grade Lentinus edodes mushrooms were utilised to produce β-glucan-enriched materials (BGEMs), which were evaluated as a high-fibre and low-calorie substitute for wheat flour. The fractions obtained from Lentinus edodes mushrooms contained 514 g kg⁻¹ of (1-3)-β-glucans with (1-6)-β-linked side chains and the chemical structure was confirmed by ¹³C NMR and FTIR spectroscopy. Replacement of a portion of the wheat flour with BGEMs resulted in the solutions with lower values of pasting parameters and also caused significant changes in starch gelatinisation. When BGEMs were incorporated into cake formulations, batter viscosity increased with more shear-thinning behaviours and elastic properties improved. Overall, the cakes containing more BGEMs showed decreased volume and increased hardness while no significant differences were observed between the control and BGEM cakes containing 1 g of β-glucan per serving. As a wheat flour substitute, the BGEMs that were prepared from low-grade Lentinus edodes mushrooms, could be successfully used to produce cakes containing 1 g of β-glucan per serving with quality attributes similar to those of the control. Copyright © 2011 Society of Chemical Industry.

  12. (1→3)-β-D-Glucan Assay in Monitoring Response to Anti-Fungal Therapy in Fungal Endocarditis.

    PubMed

    Slim, Jihad; Saling, Christopher; Szabela, Maria; Brown, Melinda; Johnson, Tamara; Goldfarb, Irvin

    2017-03-01

    A case is reported of Candida glabrata infective endocarditis (IE) treated without surgical intervention. The study aim was to: (i) briefly discuss the outcomes of other documented cases of fungal IE managed medically with fluconazole; (ii) discuss the (1→3)-β-D-glucan assay and its previously studied role in the diagnosis of invasive fungal infections; and (iii) examine a possible application of the (1→3)-β-D-glucan assay to monitor response to antifungal treatment in patients with Candida endocarditis. The serum Fungitell assay was used to trend (1→3)-β-D-glucan in a patient with Candida endocarditis to determine treatment effectiveness with fluconazole, to provide an appropriate end date for antifungal therapy, and to survey infection suppression while off treatment. The (1→03)-β-D-glucan assay began trending downwards at 197 days into treatment with oral fluconazole. After 16 months of therapy, fluconazole was stopped due to transaminitis. (1→3)-β-Dglucan levels were checked six weeks after the discontinuation of treatment and were negative. The patient has now been off therapy for 21 weeks with no signs of clinical disease, and values remain negative. The present case indicates that a trending (1→3)-β-D-glucan assay may have valuable application in monitoring treatment response and infection suppression for Candida endocarditis.

  13. Action of an endo-β-1,3(4)-glucanase on cellobiosyl unit structure in barley β-1,3:1,4-glucan

    PubMed Central

    Kuge, Takao; Nagoya, Hiroki; Tryfona, Theodora; Kurokawa, Tsunemi; Yoshimi, Yoshihisa; Dohmae, Naoshi; Tsubaki, Kazufumi; Dupree, Paul; Tsumuraya, Yoichi; Kotake, Toshihisa

    2015-01-01

    β-1,3:1,4-Glucan is a major cell wall component accumulating in endosperm and young tissues in grasses. The mixed linkage glucan is a linear polysaccharide mainly consisting of cellotriosyl and cellotetraosyl units linked through single β-1,3-glucosidic linkages, but it also contains minor structures such as cellobiosyl units. In this study, we examined the action of an endo-β-1,3(4)-glucanase from Trichoderma sp. on a minor structure in barley β-1,3:1,4-glucan. To find the minor structure on which the endo-β-1,3(4)-glucanase acts, we prepared oligosaccharides from barley β-1,3:1,4-glucan by endo-β-1,4-glucanase digestion followed by purification by gel permeation and paper chromatography. The endo-β-1,3(4)-glucanase appeared to hydrolyze an oligosaccharide with degree of polymerization 5, designated C5-b. Based on matrix-assisted laser desorption/ionization (MALDI) time-of-flight (ToF)/ToF-mass spectrometry (MS)/MS analysis, C5-b was identified as β-Glc-1,3-β-Glc-1,4-β-Glc-1,3-β-Glc-1,4-Glc including a cellobiosyl unit. The results indicate that a type of endo-β-1,3(4)-glucanase acts on the cellobiosyl units of barley β-1,3:1,4-glucan in an endo-manner. PMID:26027730

  14. Investigation of the Effects of Inulin and β-Glucan on the Physical and Sensory Properties of Low-Fat Beef Burgers Containing Vegetable Oils: Optimisation of the Formulation Using D-Optimal Mixture Design

    PubMed Central

    Afshari, Roya; Khaksar, Ramin; Mohammadifar, Mohammad Amin; Amiri, Zohre; Komeili, Rozita; Khaneghah, Amin Mousavi

    2015-01-01

    Summary In this study, the D-optimal mixture design methodology was applied to determine the optimised proportions of inulin, β-glucan and breadcrumbs in formulation of low-fat beef burgers containing pre-emulsified canola and olive oil blend. Also, the effect of each of the ingredients individually as well as their interactions on cooking characteristics, texture, colour and sensory properties of low-fat beef burgers were investigated. The results of this study revealed that the increase of inulin content in the formulations of burgers led to lower cooking yield, moisture retention and increased lightness, overall acceptability, mouldability and desired textural parameters. In contrast, incorporation of β-glucan increased the cooking yield, moisture retention and decreased lightness, overall acceptability, mouldability and desired textural parameters of burger patties. The interaction between inulin and β-glucan improved the cooking characteristics of the burgers without significantly negative effect on the colour or sensory properties. The results of the study clearly stated that the optimum mixture for the burger formulation consisted of (in g per 100 g): inulin 3.1, β-glucan 2.2 and breadcrumbs 2.7. The texture parameters and cooking characteristics were improved by using the mixture of inulin, β-glucan and breadcrumbs, without any negative effects on the sensory properties of the burgers. PMID:27904378

  15. Structural characterization and immunostimulatory activity of a novel linear α-(1→6)-D-glucan isolated from Panax ginseng C. A. Meyer.

    PubMed

    Sun, Lin; Peng, Xiaoxia; Sun, Pan; Shi, Jiahong; Yuan, Xiaowen; Zhu, Jingjing; Tai, Guihua; Zhou, Yifa

    2012-08-01

    Panax ginseng C. A. Meyer is a well-known plant medicine in the world. Ginseng polysaccharides mainly contain starch-like glucan and pectin. In this paper, a novel glucan WGPA-UH-N1 was purified from ginseng pectin by the treatment of de-esterification and endo-polygalacturonase, followed by the chromatographies on DEAE-Sepharose Fast Flow and Sephadex G-50 column. WGPA-UH-N1 has molecular weight about 17 kDa. WGPA-UH-N1 was determined to be a linear α-(1→6)-D-glucan without side chains by FT-IR, (13)C-NMR, (1)H-NMR, HMQC and HMBC spectra. It is the first time to isolate a linear α-(1→6)-D-glucan from Panax ginseng C. A. Meyer. Immunological activity assays showed that WGPA-UH-N1, although not effective on the phagocytosis of macrophage, could significantly induce lymphocyte proliferation without mitogenic stimuli at 1.0 mg/mL or with LPS at 0.5 mg/mL, also significantly increase NO production at the range of 0.1-1.0 mg/mL in a dose-dependent manner. The immunological activities of WGPA-UH-N1 are different from those of the β-(1→6)-D-glucan (BIWP2) isolated from the fruit bodies of Bulgaria Inquinans (Fries).

  16. Simultaneous saccharification and fermentation of Eastern redcedar heartwood and sapwood using a novel size reduction technique.

    PubMed

    Ramachandriya, Karthikeyan D; Wilkins, Mark; Pardo-Planas, Oscar; Atiyeh, Hasan K; Dunford, Nurhan T; Hiziroglu, Salim

    2014-06-01

    This study investigated the effect of two wood zones (sapwood versus heartwood) and size reduction techniques [Crumbles® (Crumbles® is a registered trademark of Forest Concepts, LLC, Auburn, WA, USA) particles versus ground particles] on wood glucan-to-ethanol yield after acid bisulfite pretreatment and simultaneous saccharification and fermentation (SSF) of Eastern redcedar. SSFs were conducted at 8% solids loading (w/w dry basis) using Accellerase® 1500 at a loading of 46FPU/g glucan and Saccharomyces cerevisiae D5A for ethanol fermentation. The size reduction technique had no effect on ethanol yield. However, sapwood glucan-to-ethanol yields were significantly greater than heartwood yields. The highest wood glucan-to-ethanol yield of 187L/dryMg (95% of theoretical) was achieved with sapwood crumbled particles in 240h. Ground sapwood, crumbled heartwood and ground heartwood achieved ethanol yields of 89%, 81% and 80% of theoretical in 240h, respectively. Preliminary mass balances showed 100% glucan recovery with crumbled sapwood and extensive (72%) delignification. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. New developments and prospective applications for beta (1,3) glucans.

    PubMed

    Laroche, Celine; Michaud, Philippe

    2007-01-01

    Publications and patents relative to newly observed functions of beta-(1,3)-D-glucans have notably increased in the last few years with the exploitation of their biological activities. The term beta-(1,3)-D-glucans includes a very large number of polysaccharides from bacterial, fungal and vegetable sources. Their structures have a common backbone of beta-(1,3) linked glucopyranosyl residues but the polysaccharidic chain can be beta-(1,6) branched with glucose or integrate some beta-(1,4) linked glucopyranosyl residues in the main chain. Except for the curdlan, a bacterial linear beta-(1,3)-D-glucans, and for the scleroglucan produced by Sclerotium rolfsii, the main drawback limiting the development of these polysaccharides is the lack of efficient processes for their extraction and purification and their cost. However new applications in agronomy, foods, cosmetic and therapeutic could in a next future accentuate the effort of research for their development. So this review focuses on these beta-(1,3)-D-glucans with the objective to detail the strategies employed for their extraction and the relation structure-functions identified when they induce biological activities.

  18. Fission yeast Ags1 confers the essential septum strength needed for safe gradual cell abscission

    PubMed Central

    Sato, Mamiko; Muñoz, Javier; Moreno, M. Belén; Clemente-Ramos, Jose Angel; Ramos, Mariona; Okada, Hitoshi; Osumi, Masako; Durán, Angel; Ribas, Juan Carlos

    2012-01-01

    Fungal cytokinesis requires the assembly of a dividing septum wall. In yeast, the septum has to be selectively digested during the critical cell separation process. Fission yeast cell wall α(1-3)glucan is essential, but nothing is known about its localization and function in the cell wall or about cooperation between the α- and β(1-3)glucan synthases Ags1 and Bgs for cell wall and septum assembly. Here, we generate a physiological Ags1-GFP variant and demonstrate a tight colocalization with Bgs1, suggesting a cooperation in the important early steps of septum construction. Moreover, we define the essential functions of α(1-3)glucan in septation and cell separation. We show that α(1-3)glucan is essential for both secondary septum formation and the primary septum structural strength needed to support the physical forces of the cell turgor pressure during cell separation. Consequently, the absence of Ags1 and therefore α(1-3)glucan generates a special and unique side-explosive cell separation due to an instantaneous primary septum tearing caused by the turgor pressure. PMID:22891259

  19. Structural, thermal, functional, antioxidant & antimicrobial properties of β-d-glucan extracted from baker's yeast (Saccharomyces cereviseae)-Effect of γ-irradiation.

    PubMed

    Khan, Asma Ashraf; Gani, Adil; Masoodi, F A; Amin, Furheen; Wani, Idrees Ahmed; Khanday, Firdous Ahmad; Gani, Asir

    2016-04-20

    This study was carried out to evaluate the effect of γ-irradiation (0, 5, 10, 20, 30 & 50kGy) on the structural, functional, antioxidant and antimicrobial properties of yeast β-d-glucan. The samples were characterized by ATR-FTIR, gel permeation chromatography (GPC) and the thermal properties were studied using DSC. There was a decrease in the average molecular weight of β-d-glucan as the irradiation dose increased. The functional properties of irradiated yeast β-d-glucan were largely influenced by the action of gamma radiation like swelling power and viscosity decreases with increase in the irradiation dose while as fat binding capacity, emulsifying properties, foaming properties and bile acid binding capacity shows an increasing trend. All the antioxidant properties carried out using six different assays increased significantly (p≤0.05) in a dose dependent manner. The antibacterial activity of yeast β-d-glucan also showed an increasing trend with increase in the irradiation dose from 5 to 50kDa. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Validation of a high-performance size-exclusion chromatography method to determine and characterize β-glucans in beer wort using a triple-detector array.

    PubMed

    Tomasi, Ivan; Marconi, Ombretta; Sileoni, Valeria; Perretti, Giuseppe

    2017-01-01

    Beer wort β-glucans are high-molecular-weight non-starch polysaccharides of that are great interest to the brewing industries. Because glucans can increase the viscosity of the solutions and form gels, hazes, and precipitates, they are often related to poor lautering performance and beer filtration problems. In this work, a simple and suitable method was developed to determine and characterize β-glucans in beer wort using size exclusion chromatography coupled with a triple-detector array, which is composed of a light scatterer, a viscometer, and a refractive-index detector. The method performances are comparable to the commercial reference method as result from the statistical validation and enable one to obtain interesting parameters of β-glucan in beer wort, such as the molecular weight averages, fraction description, hydrodynamic radius, intrinsic viscosity, polydispersity and Mark-Houwink parameters. This characterization can be useful in brewing science to understand filtration problems, which are not always explained through conventional analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. β-Glucoside Activators of Mung Bean UDP-Glucose: β-Glucan Synthase 1

    PubMed Central

    Callaghan, Theresa; Ross, Peter; Weinberger-Ohana, Patricia; Benziman, Moshe

    1988-01-01

    n-Alkyl (C6-C12) β-d-monoglucopyranosides have been found to be highly potent activators of mung bean β-glucan synthase in vitro, increasing the Vmax of the enzyme as much as 60-fold and with Ka values as low as 10 micromolar. Activation is highly specific for the β-linked terminal glucose residue; other alkyl glycosides such as, octyl-α-glucoside, dodecyl β-maltoside, 6-lauryl sucrose, 6-lauryl glucose, which lack this structure, are ineffective as activators. Based on the similarities in their structure and effects on β-glucan synthesis under a variety of conditions, it is proposed that the alkyl β-glucosides are structural analogs of the native glucolipid activator of β-glucan synthase isolated from mung bean extracts. PMID:16666039

  2. Two-dimensional NMR data of a water-soluble β-(1→3, 1→6)-glucan from Aureobasidium pullulans and schizophyllan from Schizophyllum commune.

    PubMed

    Kono, Hiroyuki; Kondo, Nobuhiro; Hirabayashi, Katsuki; Ogata, Makoto; Totani, Kazuhide; Ikematsu, Shinya; Osada, Mitsumasa

    2017-12-01

    This article contains two-dimensional (2D) NMR experimental data, obtained by the Bruker BioSpin 500 MHz NMR spectrometer (Germany) which can used for the determination of primary structures of schizophyllan from Schizophyllum commune (SPG) and a water-soluble β-(1→3, 1→6)-glucan from Aureobasidium pullulans . Data include analyzed the 2D NMR spectra of these β-glucans, which are related to the subject of an article in Carbohydrate Polymers , entitled "NMR spectroscopic structural characterization of a water-soluble β-(1→3, 1→6)-glucan from A. pullulans " (Kono et al., 2017) [1]. Data can help to assign the 1 H and 13 C chemical shifts of the structurally complex polysaccharides.

  3. Effects of β-glucans from Coriolus versicolor on macrophage phagocytosis are related to the Akt and CK2/Ikaros.

    PubMed

    Kang, Se Chan; Koo, Hyun Jung; Park, Sulkyung; Lim, Jung Dae; Kim, Ye-Jin; Kim, Taeseong; Namkoong, Seung; Jang, Ki-Hyo; Pyo, Suhkneung; Jang, Seon-A; Sohn, Eun-Hwa

    2013-06-01

    Coriolus versicolor has been known to be an immune stimulator effects. For further understanding of the phagocytic activity and the intracellular mechanisms of β-glucan from C. versicolor (CVG), we examined the phagocytic activity, phosphorylation of Akt and CK2, nucleus translocation of p65 and Ikaros activity in β-glucan-treated macrophages using RT-PCR, western blotting, and IP assay. The role of Ikaros in regulating phagocytic effects of CVG was also determined using Ikaros dominant negative isoform cells. This study suggests that CK2/Ikaros are positive regulators and novel signaling pathway involved in phagocytosis and contributes to elucidating the mechanism underlying phagocytic activity induced by β-glucan. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Oats

    MedlinePlus

    ... saturated fat. For each gram of soluble fiber (beta-glucan) consumed, total cholesterol decreases by about 1.42 ... total cholesterol than foods containing oat bran plus beta-glucan soluble fiber. The FDA recommends that approximately 3 ...

  5. The Center for Advanced Food Technology: Food Related Studies.

    DTIC Science & Technology

    1992-11-16

    Glucan (Callose) Synthase from Beta Vulgaris L. by Product-Entrapment," Entrapment Mechanisms and Polypeptide Characterization. Elant MU g. 97:684...Na3HGe7O16 xH20, xaO 0-6. 1," Chemiatr of Materials, 4:388. FRost, D.L, Drake, R.R., and B.P. Wasserman (1992) ’(1,3)-- glucan Synthase from Saccbaro...Wu, A., and R.W. Harriman (1992) "Probing the Molecular Architecture of (1,3-- Glucan (Callose) Synthase: Polypeptide Depletion Studies," Biochemical

  6. β-1,3 glucan derived from Euglena gracilis and Algamune™ enhances innate immune responses of red drum (Sciaenops ocellatus L.).

    PubMed

    Yamamoto, Fernando Y; Yin, Fei; Rossi, Waldemar; Hume, Michael; Gatlin, Delbert M

    2018-06-01

    To reduce susceptibility to stressors and diseases, immune-modulators such as β-glucans have been proven effective tools to enhance the innate immune responses of fish. Consequently, commercial sources of this polysaccharide are becoming increasingly more available. Algamune™ is a commercial additive produced from Euglena gracilis, as a source of linear β-1,3-glucan. In order to evaluate the immunomodulatory effects of this β-glucan product, the present study assessed the innate immune parameters of red drum (Sciaenops ocellatus) exposed to Algamune™ ex vivo and in vivo. Isolated kidney phagocytes were incubated with graded concentrations (0, 0.2, 0.4, 0.8, 1.6 and 3.2 mg L -1 ) of dried Euglena gracilis (Algamune™) as well as purified Paramylon (linear β-1,3 glucan). Increased bactericidal activity against Streptococcus iniae, and production of intracellular O 2 - anion superoxide were stimulated by both β-glucan sources. A reduced activity of extracellular anion superoxide was observed by the phagocytes incubated with Algamune ™. After corroborating the effectiveness of the glucan source ex vivo, a feeding trial was conducted using red drum juveniles (∼26.6 g initial weight). Fish were fed diets with graded levels of Algamune™ (0, 100, 200, 400 and 800 mg kg -1 ) twice daily for 21 days. No significant differences were detected regarding production performance parameters. At the end of the feeding trial, blood, intestinal content, and kidney were sampled. Intestinal microbiota from fecal material was analyzed through denaturing gradient gel electrophoresis (DGGE) and found to be similar among all treatments. No significant differences were detected for oxidative radical production from whole blood, and isolated phagocytes, and plasma lysozyme activity. However, the total hemolytic activity of red drum plasma was increased in fish fed 100 and 200 mg kg -1 of dietary Algamune™ when compared to fish fed the basal diet. Based on results from both ex vivo and in vivo trials, β-glucan from Algamune™ was demonstrated to have a moderate immunostimulatory effects on red drum. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Production of Ginkgo leaf-shaped basidiocarps of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes), containing high levels of α- and β-D-glucan and ganoderic acid A.

    PubMed

    Yajima, Yuka; Miyazaki, Minoru; Okita, Noriyasu; Hoshino, Tamotsu

    2013-01-01

    Ganoderic acid A and α- and β-D-glucan content were compared among morphologically different basidiocarps of the medicinal mushroom Ganoderma lucidum. Ginkgo leaf-shaped basidiocarps gradually hardened from the base to the pileus and accumulated a higher amount of bioactive components than normal (kidney-shaped) and antler/deer horn-shaped basidiocarps. In the normal G. lucidum stipe, the outer context contained the highest amount of α- and β-D-glucan (approximately 55%) and the highest amount of ganoderic acid A (approximately 0.3%). Ginkgo leaf-shaped G. lucidum had a large area of outer layer and stout outer context, which contributed to their high α- and β-D-glucan and ganoderic acid A content.

  8. In vitro fermentation of oat flours from typical and high beta-glucan oat lines.

    PubMed

    Kim, Hyun Jung; White, Pamela J

    2009-08-26

    Two publicly available oat (Avena sativa) lines, "Jim" and "Paul" (5.17 and 5.31% beta-glucan, respectively), and one experimental oat line "N979" (7.70% beta-glucan), were used to study the effect of beta-glucan levels in oat flours during simulated in vitro digestion and fermentation with human fecal flora obtained from different individuals. The oat flours were digested by using human digestion enzymes and fermented by batch fermentation under anaerobic conditions for 24 h. The fermentation progress was monitored by measuring pH, total gas, and short-chain fatty acid (SCFA) production. Significant effects of beta-glucan on the formation of gas and total SCFA were observed compared to the blank without substrate (P < 0.05); however, there were no differences in pH changes, total gas, and total SCFA production among oat lines (P > 0.05). Acetate, propionate, and butyrate were the main SCFA produced from digested oat flours during fermentation. More propionate and less acetate were produced from digested oat flours compared to lactulose. Different human fecal floras obtained from three healthy individuals had similar patterns in the change of pH and the production of gas during fermentation. Total SCFA after 24 h of fermentation were not different, but the formation rates of total SCFA differed between individuals. In vitro fermentation of digested oat flours with beta-glucan could provide favorable environmental conditions for the colon and these findings, thus, will help in developing oat-based food products with desirable health benefits.

  9. Structural basis for the glucan phosphatase activity of Starch Excess4

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vander Kooi, Craig W.; Taylor, Adam O.; Pace, Rachel M.

    Living organisms utilize carbohydrates as essential energy storage molecules. Starch is the predominant carbohydrate storage molecule in plants while glycogen is utilized in animals. Starch is a water-insoluble polymer that requires the concerted activity of kinases and phosphatases to solubilize the outer surface of the glucan and mediate starch catabolism. All known plant genomes encode the glucan phosphatase Starch Excess4 (SEX4). SEX4 can dephosphorylate both the starch granule surface and soluble phosphoglucans and is necessary for processive starch metabolism. The physical basis for the function of SEX4 as a glucan phosphatase is currently unclear. Herein, we report the crystal structuremore » of SEX4, containing phosphatase, carbohydrate-binding, and C-terminal domains. The three domains of SEX4 fold into a compact structure with extensive interdomain interactions. The C-terminal domain of SEX4 integrally folds into the core of the phosphatase domain and is essential for its stability. The phosphatase and carbohydrate-binding domains directly interact and position the phosphatase active site toward the carbohydrate-binding site in a single continuous pocket. Mutagenesis of the phosphatase domain residue F167, which forms the base of this pocket and bridges the two domains, selectively affects the ability of SEX4 to function as a glucan phosphatase. Together, these results reveal the unique tertiary architecture of SEX4 that provides the physical basis for its function as a glucan phosphatase.« less

  10. Dietary β-glucans differentially modulate immune and stress-related gene expression in lymphoid organs from healthy and Aeromonas hydrophila-infected rainbow trout (Oncorhynchus mykiss).

    PubMed

    Douxfils, Jessica; Fierro-Castro, Camino; Mandiki, S N M; Emile, Wakson; Tort, Lluis; Kestemont, Patrick

    2017-04-01

    Although β-glucans stimulating effects have already been demonstrated on the immune system of numerous animal species, available data remain relatively variable and more research should be done regarding the complexity of underlying mechanisms. In this context, the present study aimed to evaluate the stress and immune-related effects of dietary β-glucans (i.e. Macrogard ® ) by considering a number of influencing factors such as the dose (0, 0.1, 0.2 and 0.5% in food), feeding duration (15 versus 30 days), tissue (blood, kidney, spleen, gills) and infection status (healthy or infected). Blood parameters (lysozyme, ACH50 activities, leucocyte populations) and mRNA expression level of several immune- and stress-related genes (TFN-α1, IL-1β, IL10, COX-2, TGF-β, MC2R, HSP70) were measured. Our results suggest that spleen may be a highly responsive organ to dietary β-glucans both in healthy or infected fish, and that this organ may therefore significantly contribute to the immune reinforcement induced by such immunostimulatory diet. Our study further reveals that overdoses of β-glucans and/or prolonged medication can lead to a non-reactive physiological status and, consequently, to a poor immune response. All in all, the current data emphasizes the need for further extensive research in the field of dietary β-glucans as a preventive method for farmed fish protection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Case series of topical and orally administered β-glucan for the treatment of diabetic wounds: clinical study.

    PubMed

    Karaaslan, Onder; Kankaya, Yuksel; Sungur, Nezih; Kocer, Ugur; Sedat Cuzdan, Suat; Sahin, Belma; Uysal, Afsin

    2012-01-01

    Chronic, nonhealing wounds, foot ulcers, and lower extremity amputations are among the most problematic complications associated with diabetes mellitus. Standard care for diabetes-related chronic ulcers has included treatment of infection, weight off-loading, aggressive surgical débridement, and maintenance of a moist wound environment with frequent dressing changes. Yeast glucan is a particular high-molecular-weight polymer of β-(1,3)-glycosidic linkages of glycopyranose. We report our observations about the effectiveness of topically and orally administrated β-(1,3)-glucan for the treatment of chronic diabetic wounds and compare them to the literature results previously reported for similar wounds. Twenty-two patients with nonhealing ulcers associated with diabetes were included in this study. β-Glucan was given both orally and topically for the treatment of nonhealing ulcers. Macroscopic changes and surface areas of diabetic ulcers were recorded, and complete healing times were noted for each patient. A rapid decrease in size and healthy granulation were significantly observed in most patients. The duration of complete healing averaged 10.8 weeks (range 6-20 weeks). No adverse events were observed in the treatment period. The complete healing time was shorter than the results previously reported in the literature. Our observations support the view that application of glucan hastens epithelialization and wound closure, so topically and orally administered β-(1,3)-glucan therapy can help reverse some of the deficits in impaired healing diseases such as diabetes mellitus.

  12. Glucan-MOS® improved growth and innate immunity in pacu stressed and experimentally infected with Aeromonas hydrophila.

    PubMed

    Soares, Michelly Pereira; Oliveira, Fulvia Cristina; Cardoso, Israel Luz; Urbinati, Elisabeth Criscuolo; Meldau de Campos, Cristiane; Hisano, Hamilton

    2018-02-01

    We tested the efficacy of a commercial product (Glucan-MOS ® ) derived from yeast Saccharomyces cerevisiae, containing two combined products, β-1,3-1,6 glucans and mannans on the growth, feed efficiency, stress and innate immune responses of juvenile pacu (Piaractus mesopotamicus) after a stressful handling and bacterial inoculation. For this, we evaluated the serum cortisol and plasma glucose levels, the respiratory activity of leukocytes, the serum lysozyme levels, as well as the number of circulating erythrocytes and leukocytes of fish fed during 30 days with diets containing increased levels of Glucan-MOS (0.0, 0.1, 0.2, 0.4 and 0.8%). The supplementation of 0.1% improved weight gain, feed conversion and the protein efficiency ratio compared to a control diet. The 0.2 and 0.4% Glucan-MOS ® diets were sufficient to increase the respiratory burst of leukocytes and lysozyme activity, the number of thrombocytes, neutrophils and monocytes in the blood after a stressful handling and bacterial challenge, and minimized stress response as shown by decreased cortisol and glucose levels when compared to the control. The results of this work reinforce the benefits of the adoption of feeding strategies including combination of both β-1,3-1,6 glucans and mannans as a dietary supplement in periods prior to intensive management. The 30-day period was sufficient to stimulate growth performance, improve nutrient utilization, minimize stress response and modulate innate immunity responses. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Fiber and nonstarch polysaccharide content and variation in common crops used in broiler diets.

    PubMed

    Knudsen, Knud Erik Bach

    2014-09-01

    The current paper reviews content and variation in fiber and nonstarch polysaccharides (NSP) of common crops used in broiler diets. The cereal grain is a complex structure, and its cell walls (CW) differ in their composition and hence properties. Arabinoxylan (AX), mixed linkage (1→3; 1→4)-β-glucan (β-glucan), cellulose, and the noncarbohydrate component lignin are the predominant polymers in cereals. They occur in different proportions depending on the species and tissue type. Rye, triticale, wheat, corn, and sorghum are all rich in AX, whereas barley and oats contain a high level of β-glucan. The AX from rye, wheat, and triticale and β-glucan from barley and oats are to a large extent soluble, whereas the solubility of AX found in corn and sorghum is lower than the other cereals. The ratio of arabinose to xylose gives a crude indication of the AX structure, which varies between the endosperm, the aleurone and the outer grain layers as well as between the same tissues from different grains. Varietal differences in AX structure of the endosperm are also identified. From the analysis of the released oligomers after hydrolysis with a specific (1→3,1→4)-β-d-glucan hydrolase, it is found that the ratio of trisaccharides (degree of polymerization 3) and tetrasaccharides (degree of polymerization 4) varies depending on the source, being higher in barley than in oats but lower than in wheat. The molecular weight of β-glucan is higher than that of AX, and both polymers contribute to the viscosity of the extract. However, because AX molecules are more resistant to degradation than β-glucan, the use of AX rich grains in broiler diets is usually more problematic than those containing high concentrations of β-glucan. The cereal coproducts (brans and hulls) are concentrated sources of cellulose, lignin, and insoluble AX, but β-glucan can also be present mainly in rye and wheat brans. The CW composition of seeds and grains of protein crops and feedstuffs are different from that of cereals. The main CW polymers are pectic substances (homogalacturonan, rhamnogalacturonan type I and II, xylogalacturonan, and arabinogalactans type I and II), xyloglucans, and cellulose, but there are significant differences in the composition of the parenchymatous (cotyledon) tissues and that of the hulls. In the hulls, cellulose is the predominant polysaccharide, followed by acidic xylans and pectic substances. The implications of the heterogeneous CW for the action of exogenous enzymes are discussed. © 2014 Poultry Science Association Inc.

  14. Genetics and physiology of cell wall polysaccharides in the model C4 grass, Setaria viridis spp.

    PubMed

    Ermawar, Riksfardini A; Collins, Helen M; Byrt, Caitlin S; Henderson, Marilyn; O'Donovan, Lisa A; Shirley, Neil J; Schwerdt, Julian G; Lahnstein, Jelle; Fincher, Geoffrey B; Burton, Rachel A

    2015-10-02

    Setaria viridis has emerged as a model species for the larger C4 grasses. Here the cellulose synthase (CesA) superfamily has been defined, with an emphasis on the amounts and distribution of (1,3;1,4)-β-glucan, a cell wall polysaccharide that is characteristic of the grasses and is of considerable value for human health. Orthologous relationship of the CesA and Poales-specific cellulose synthase-like (Csl) genes among Setaria italica (Si), Sorghum bicolor (Sb), Oryza sativa (Os), Brachypodium distachyon (Bradi) and Hordeum vulgare (Hv) were compared using bioinformatics analysis. Transcription profiling of Csl gene families, which are involved in (1,3;1,4)-β-glucan synthesis, was performed using real-time quantitative PCR (Q-PCR). The amount of (1,3;1,4)-β-glucan was measured using a modified Megazyme assay. The fine structures of the (1,3;1,4)-β-glucan, as denoted by the ratio of cellotriosyl to cellotetraosyl residues (DP3:DP4 ratio) was assessed by chromatography (HPLC and HPAEC-PAD). The distribution and deposition of the MLG was examined using the specific antibody BG-1 and captured using fluorescence and transmission electron microscopy (TEM). The cellulose synthase gene superfamily contains 13 CesA and 35 Csl genes in Setaria. Transcript profiling of CslF, CslH and CslJ gene families across a vegetative tissue series indicated that SvCslF6 transcripts were the most abundant relative to all other Csl transcripts. The amounts of (1,3;1,4)-β-glucan in Setaria vegetative tissues ranged from 0.2% to 2.9% w/w with much smaller amounts in developing grain (0.003% to 0.013% w/w). In general, the amount of (1,3;1,4)-β-glucan was greater in younger than in older tissues. The DP3:DP4 ratios varied between tissue types and across developmental stages, and ranged from 2.4 to 3.0:1. The DP3:DP4 ratios in developing grain ranged from 2.5 to 2.8:1. Micrographs revealing the distribution of (1,3;1,4)-β-glucan in walls of different cell types and the data were consistent with the quantitative (1,3;1,4)-β-glucan assays. The characteristics of the cellulose synthase gene superfamily and the accumulation and distribution of (1,3;1,4)-β-glucans in Setaria are similar to those in other C4 grasses, including sorghum. This suggests that Setaria is a suitable model plant for cell wall polysaccharide biology in C4 grasses.

  15. Preferential induction of Th17 cells in vitro and in vivo by Fucogalactan from Ganoderma lucidum (Reishi).

    PubMed

    Yoshida, Hideyuki; Suzuki, Mayu; Sakaguchi, Ryota; Tani, Ito; Kotani, Hitoshi; Shudo, Norimasa; Yoshimura, Akihiko

    2012-05-25

    The mushroom known as Reishi (Ganoderma lucidum) has been used as an herbal medicine for tumor treatment and immune system activation. Because its effects on the differentiation of effector T helper cells have not yet been fully understood, we investigated the effects of Reishi and those of its principal ingredient, β-glucan, on the activation of dendritic cells and the differentiation of Th17 cells. Reishi extracts as well as purified β-glucan (Curdran) activated DCs and caused them to produce large amounts of IL-23. β-glucan also enhanced and sustained the transcription of IL-23p19. The MEK-ERK signaling pathway positively regulates IL-23p19 transcription in β-glucan-stimulated DCs. In a mixed leukocyte reaction, Reishi-stimulated DCs preferentially induced Th17 cells. Furthermore, orally-administrated Reishi increased the percentages of Th17 cells and the transcription levels of antimicrobial peptides. Our results show that Reishi and β-glucan activate DCs to produce large amounts of IL-23, which induces Th17 differentiation both in vitro and in vivo. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Quantification of 1,3-β-D-glucan from yeast added as a functional ingredient to bread.

    PubMed

    Rieder, Anne; Ballance, Simon; Böcker, Ulrike; Knutsen, Svein

    2018-02-01

    Due to their immunomodulatory effect, 1,3-β-G from yeast are used as functional ingredients, but reliable methods for their detection in foods are lacking. We have adapted a method based on fluorescence detection with aniline blue to quantify the amount of five commercial yeast β-glucan preparations added to crisp or yeast-leavened bread. This assay detected yeast β-glucan preparations added to different breads with an average recovery of 90, 96, 99 and 105%, while one of the preparations was overestimated, with an average recovery of 157%. The presence of cereal 1,3-1,4-β- D- glucans did not interfere with assay performance. The addition of 1,3-β-G at 0.2 and 0.5 g/100g is low compared to the recommended dose of 1,3-β-G per serving demonstrating assay sensitivity. However, more research is needed to fully understand the effect of 1,3-β-G conformation/structure on aniline blue interaction as well as the effect of baking on structure and dissolution properties of yeast β-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Mechanisms of antimelanoma effect of oat β-glucan supported by electroporation.

    PubMed

    Choromanska, Anna; Lubinska, Sandra; Szewczyk, Anna; Saczko, Jolanta; Kulbacka, Julita

    2018-06-06

    There are still not specified mechanisms how beta-glucan molecules are transported into cells. Supposing, beta-glucan toxicity against tumor cells may be related to the overexpression of the transporter responsible for the transport of glucose molecules in the cells. In this case, glucans - polymers composed of glucose units are much more up-taken by tumor than normal cells. Increased GLUT1 (Glucose Transporter Type 1) expression has been demonstrated earlier in malignant melanomas. GLUT1 expression promotes glucose uptake and cell growth in that cells. Also, in human melanoma tissues a significant correlation between GLUT1 expression and mitotic activity was found. The aim of the study was to verify if oat β-glucan (OβG) is delivered into cells by GLUT-1 membrane protein. To check it out we blocked GLUT1 transporters by an inhibitor WZB117 and then we investigated cells viability with and without reversible electroporation (EP). The obtained results bring us to elucidate the mechanism of transport of the OβG into the cells is GLUT-1 dependent and moreover can be supported by EP method. Copyright © 2018. Published by Elsevier B.V.

  18. Direct ethanol production from barley beta-glucan by sake yeast displaying Aspergillus oryzae beta-glucosidase and endoglucanase.

    PubMed

    Kotaka, Atsushi; Bando, Hiroki; Kaya, Masahiko; Kato-Murai, Michiko; Kuroda, Kouichi; Sahara, Hiroshi; Hata, Yoji; Kondo, Akihiko; Ueda, Mitsuyoshi

    2008-06-01

    Three beta-glucosidase- and two endoglucanase-encoding genes were cloned from Aspergillus oryzae, and their gene products were displayed on the cell surface of the sake yeast, Saccharomyces cerevisiae GRI-117-UK. GRI-117-UK/pUDB7 displaying beta-glucosidase AO090009000356 showed the highest activity against various substrates and efficiently produced ethanol from cellobiose. On the other hand, GRI-117-UK/pUDCB displaying endoglucanase AO090010000314 efficiently degraded barley beta-glucan to glucose and smaller cellooligosaccharides. GRI-117-UK/pUDB7CB codisplaying both beta-glucosidase AO090009000356 and endoglucanase AO090010000314 was constructed. When direct ethanol fermentation from 20 g/l barley beta-glucan as a model substrate was performed with the codisplaying strain, the ethanol concentration reached 7.94 g/l after 24 h of fermentation. The conversion ratio of ethanol from beta-glucan was 69.6% of the theoretical ethanol concentration produced from 20 g/l barley beta-glucan. These results showed that sake yeast displaying A. oryzae cellulolytic enzymes can be used to produce ethanol from cellulosic materials. Our constructs have higher ethanol production potential than the laboratory constructs previously reported.

  19. Mechanochemical Phosphorylation and Solubilisation of β-D-Glucan from Yeast Saccharomyces cerevisiae and Its Biological Activities

    PubMed Central

    Shi, Feng; Shi, Jikui; Li, Yongfu

    2014-01-01

    To obtain a water-soluble β-D-glucan derivative cleanly and conveniently, a highly efficient mechanochemical method, planetary ball milling, was used to phosphorylate β-D-glucan isolated from yeast Saccharomyces cerevisiae in solid state. Soluble β-D-glucan phosphate (GP) with a high degree of substitution (0.77–2.09) and an apparent PEAK molecular weight of 6.6–10.0 kDa was produced when β-D-glucan was co-milled with sodium hexametaphosphate at 139.5–186.0 rad/s for 12–20 min. The energy transferred was 3.03–11.98 KJ/g. The phosphorylation of GPs was demonstrated by Fourier transform infrared spectroscopy and 13C and 31P Nuclear magnetic resonance spectroscopy. Three GP products with different degree of substitution (DS) and degree of polymerisation (DP) were able to upregulate the functional events mediated by activated murine macrophage RAW264.7 cells, among which GP-2 with a DS of 1.24 and DP of 30.5 exerted the highest immunostimulating activity. Our results indicate that mechanochemical processing is an efficient method for preparing water-soluble and biologically active GP with high DS. PMID:25075740

  20. Structural Analysis of a Family 81 Glycoside Hydrolase Implicates Its Recognition of β-1,3-Glucan Quaternary Structure.

    PubMed

    Pluvinage, Benjamin; Fillo, Alexander; Massel, Patricia; Boraston, Alisdair B

    2017-09-05

    Family 81 glycoside hydrolases (GHs), which are known to cleave β-1,3-glucans, are found in archaea, bacteria, eukaryotes, and viruses. Here we examine the structural and functional features of the GH81 catalytic module, BhGH81, from the Bacillus halodurans protein BH0236 to probe the molecular basis of β-1,3-glucan recognition and cleavage. BhGH81 displayed activity on laminarin, curdlan, and pachyman, but not scleroglucan; the enzyme also cleaved β-1,3-glucooligosaccharides as small as β-1,3-glucotriose. The crystal structures of BhGH81 in complex with various β-1,3-glucooligosaccharides revealed distorted sugars in the -1 catalytic subsite and an arrangement consistent with an inverting catalytic mechanism having a proposed conformational itinerary of 2 S 0 → 2,5 B ‡ → 5 S 1 . Notably, the architecture of the catalytic site, location of an adjacent ancillary β-1,3-glucan binding site, and the surface properties of the enzyme indicate the likely ability to recognize the double and/or triple-helical quaternary structures adopted by β-1,3-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. A role for fungal β-glucans and their receptor Dectin-1 in the induction of autoimmune arthritis in genetically susceptible mice

    PubMed Central

    Yoshitomi, Hiroyuki; Sakaguchi, Noriko; Kobayashi, Katsuya; Brown, Gordon D.; Tagami, Tomoyuki; Sakihama, Toshiko; Hirota, Keiji; Tanaka, Satoshi; Nomura, Takashi; Miki, Ichiro; Gordon, Siamon; Akira, Shizuo; Nakamura, Takashi; Sakaguchi, Shimon

    2005-01-01

    A combination of genetic and environmental factors can cause autoimmune disease in animals. SKG mice, which are genetically prone to develop autoimmune arthritis, fail to develop the disease under a microbially clean condition, despite active thymic production of arthritogenic autoimmune T cells and their persistence in the periphery. However, in the clean environment, a single intraperitoneal injection of zymosan, a crude fungal β-glucan, or purified β-glucans such as curdlan and laminarin can trigger severe chronic arthritis in SKG mice, but only transient arthritis in normal mice. Blockade of Dectin-1, a major β-glucan receptor, can prevent SKG arthritis triggered by β-glucans, which strongly activate dendritic cells in vitro in a Dectin-1–dependent but Toll-like receptor-independent manner. Furthermore, antibiotic treatment against fungi can prevent SKG arthritis in an arthritis-prone microbial environment. Multiple injections of polyinosinic-polycytidylic acid double-stranded RNA also elicit mild arthritis in SKG mice. Thus, specific microbes, including fungi and viruses, may evoke autoimmune arthritis such as rheumatoid arthritis by stimulating innate immunity in individuals who harbor potentially arthritogenic autoimmune T cells as a result of genetic anomalies or variations. PMID:15781585

  2. Linkage Analyses of Extracellular Glucans from Streptococcus sanguis and Streptococcus mitior

    PubMed Central

    Freedman, M.; Birkhed, D.; Coykendall, A.; Rizzo, D.

    1979-01-01

    Similar α-(1→6) linkage-rich, soluble, extracellular glucans have been isolated from six strains of two genetically distinct groups of Streptococcus sanguis and three strains of Streptococcus mitior. PMID:457265

  3. Beta-Glucans Supplementation Associates with Reduction in P-Cresyl Sulfate Levels and Improved Endothelial Vascular Reactivity in Healthy Individuals

    PubMed Central

    De Angelis, Maria; Rocchetti, Maria Teresa; Montemurno, Eustacchio; Maranzano, Valentina; Dalfino, Giuseppe; Manno, Carlo; Zito, Annapaola; Gesualdo, Michele; Ciccone, Marco Matteo; Gobbetti, Marco; Gesualdo, Loreto

    2017-01-01

    Background Oat and barley beta-glucans are prebiotic fibers known for their cholesterol-lowering activity, but their action on the human gut microbiota metabolism is still under research. Although the induction of short-chain fatty acids (SCFA) following their ingestion has previously been reported, no study has investigated their effects on proteolytic uremic toxins p-cresyl sulfate (pCS) and indoxyl sulfate (IS) levels, while others have failed to demonstrate an effect on the endothelial function measured through flow-mediated dilation (FMD). Objective The aim of our study was to evaluate whether a nutritional intervention with a functional pasta enriched with beta-glucans could promote a saccharolytic shift on the gut microbial metabolism and improve FMD. Methods We carried out a pilot study on 26 healthy volunteers who underwent a 2-month dietary treatment including a daily administration of Granoro “Cuore Mio” pasta enriched with barley beta-glucans (3g/100g). Blood and urine routine parameters, serum pCS/IS and FMD were evaluated before and after the dietary treatment. Results The nutritional treatment significantly reduced LDL and total cholesterol, as expected. Moreover, following beta-glucans supplementation we observed a reduction of serum pCS levels and an increase of FMD, while IS serum levels remained unchanged. Conclusions We demonstrated that a beta-glucans dietary intervention in healthy volunteers correlates with a saccharolytic shift on the gut microbiota metabolism, as suggested by the decrease of pCS and the increase of SCFA, and associates with an improved endothelial reactivity. Our pilot study suggests, in addition to cholesterol, novel pCS-lowering properties of beta-glucans, worthy to be confirmed in large-scale trials and particularly in contexts where the reduction of the microbial-derived uremic toxin pCS is of critical importance, such as in chronic kidney disease. PMID:28107445

  4. Modulation of Intestinal Inflammation by Yeasts and Cell Wall Extracts: Strain Dependence and Unexpected Anti-Inflammatory Role of Glucan Fractions

    PubMed Central

    Jawhara, Samir; Habib, Khalid; Maggiotto, François; Pignede, Georges; Vandekerckove, Pascal; Maes, Emmanuel; Dubuquoy, Laurent; Fontaine, Thierry; Guerardel, Yann; Poulain, Daniel

    2012-01-01

    Yeasts and their glycan components can have a beneficial or adverse effect on intestinal inflammation. Previous research has shown that the presence of Saccharomyces cerevisiae var. boulardii (Sb) reduces intestinal inflammation and colonization by Candida albicans. The aim of this study was to identify dietary yeasts, which have comparable effects to the anti-C. albicans and anti-inflammatory properties of Sb and to assess the capabilities of yeast cell wall components to modulate intestinal inflammation. Mice received a single oral challenge of C. albicans and were then given 1.5% dextran-sulphate-sodium (DSS) for 2 weeks followed by a 3-day restitution period. S. cerevisiae strains (Sb, Sc1 to Sc4), as well as mannoprotein (MP) and β-glucan crude fractions prepared from Sc2 and highly purified β-glucans prepared from C. albicans were used in this curative model, starting 3 days after C. albicans challenge. Mice were assessed for the clinical, histological and inflammatory responses related to DSS administration. Strain Sc1-1 gave the same level of protection against C. albicans as Sb when assessed by mortality, clinical scores, colonization levels, reduction of TNFα and increase in IL-10 transcription. When Sc1-1 was compared with the other S. cerevisiae strains, the preparation process had a strong influence on biological activity. Interestingly, some S. cerevisiae strains dramatically increased mortality and clinical scores. Strain Sc4 and MP fraction favoured C. albicans colonization and inflammation, whereas β-glucan fraction was protective against both. Surprisingly, purified β-glucans from C. albicans had the same protective effect. Thus, some yeasts appear to be strong modulators of intestinal inflammation. These effects are dependent on the strain, species, preparation process and cell wall fraction. It was striking that β-glucan fractions or pure β-glucans from C. albicans displayed the most potent anti-inflammatory effect in the DSS model. PMID:22848391

  5. Functional Analysis of the α-1,3-Glucan Synthase Genes agsA and agsB in Aspergillus nidulans: AgsB Is the Major α-1,3-Glucan Synthase in This Fungus

    PubMed Central

    Yoshimi, Akira; Sano, Motoaki; Inaba, Azusa; Kokubun, Yuko; Fujioka, Tomonori; Mizutani, Osamu; Hagiwara, Daisuke; Fujikawa, Takashi; Nishimura, Marie; Yano, Shigekazu; Kasahara, Shin; Shimizu, Kiminori; Yamaguchi, Masashi; Kawakami, Kazuyoshi; Abe, Keietsu

    2013-01-01

    Although α-1,3-glucan is one of the major cell wall polysaccharides in filamentous fungi, the physiological roles of α-1,3-glucan remain unclear. The model fungus Aspergillus nidulans possesses two α-1,3-glucan synthase (AGS) genes, agsA and agsB. For functional analysis of these genes, we constructed several mutant strains in A. nidulans: agsA disruption, agsB disruption, and double-disruption strains. We also constructed several CagsB strains in which agsB expression was controlled by the inducible alcA promoter, with or without the agsA-disrupting mutation. The agsA disruption strains did not show markedly different phenotypes from those of the wild-type strain. The agsB disruption strains formed dispersed hyphal cells under liquid culture conditions, regardless of the agsA genetic background. Dispersed hyphal cells were also observed in liquid culture of the CagsB strains when agsB expression was repressed, whereas these strains grew normally in plate culture even under the agsB-repressed conditions. Fractionation of the cell wall based on the alkali solubility of its components, quantification of sugars, and 13C-NMR spectroscopic analysis revealed that α-1,3-glucan was the main component of the alkali-soluble fraction in the wild-type and agsA disruption strains, but almost no α-1,3-glucan was found in the alkali-soluble fraction derived from either the agsB disruption strain or the CagsB strain under the agsB-repressed conditions, regardless of the agsA genetic background. Taken together, our data demonstrate that the two AGS genes are dispensable in A. nidulans, but that AgsB is required for normal growth characteristics under liquid culture conditions and is the major AGS in this species. PMID:23365684

  6. Immunostimulatory properties and antitumor activities of glucans

    PubMed Central

    VANNUCCI, LUCA; KRIZAN, JIRI; SIMA, PETR; STAKHEEV, DMITRY; CAJA, FABIAN; RAJSIGLOVA, LENKA; HORAK, VRATISLAV; SAIEH, MUSTAFA

    2013-01-01

    New foods and natural biological modulators have recently become of scientific interest in the investigation of the value of traditional medical therapeutics. Glucans have an important part in this renewed interest. These fungal wall components are claimed to be useful for various medical purposes and they are obtained from medicinal mushrooms commonly used in traditional Oriental medicine. The immunotherapeutic properties of fungi extracts have been reported, including the enhancement of anticancer immunity responses. These properties are principally related to the stimulation of cells of the innate immune system. The discovery of specific receptors for glucans on dendritic cells (dectin-1), as well as interactions with other receptors, mainly expressed by innate immune cells (e.g., Toll-like receptors, complement receptor-3), have raised new attention toward these products as suitable therapeutic agents. We briefly review the characteristics of the glucans from mycelial walls as modulators of the immunity and their possible use as antitumor treatments. PMID:23739801

  7. β-glucans and cholesterol (Review)

    PubMed Central

    Sima, Petr; Vetvicka, Vaclav

    2018-01-01

    Hypercholesterolemia is one of primary risk factors of cardiovascular disease, together with metabolic syndrome, hypertension and diabetes. Although progress has been made, the search for novel methods of preventing and treating dyslipidemia is ongoing and current therapies for cardiovascular disease induce various side effects. β-glucans are linear unbranched polysaccharides found in various natural sources, such as mushrooms. Due to their structure they are able to interact with innate immunity receptors, however they also act as dietary fibers in the digestive tract. As there are two forms of β-glucans, insoluble and soluble forms, they are able to interact with lipids and biliary salts in the bowel and consequently reduce cholesterol levels. Therefore, they may be developed as a suitable therapeutic option to treat patients with dyslipidemia, as they are natural molecules that do not induce any significant side effects. The current review discusses the evidence supporting the effects of β-glucans on cholesterol levels. PMID:29393350

  8. Prophylactic effects of humic acid-glucan combination against experimental liver injury

    PubMed Central

    Vetvicka, Vaclav; Garcia-Mina, Jose Maria; Yvin, Jean-Claude

    2015-01-01

    Aim: Despite intensive research, liver diseases represent a significant health problem and current medicine does not offer a substance able to significantly inhibit the hepatotoxicity leading to various stages of liver disease. Based on our previously published studies showing the protective effects of a glucan-humic acid (HA) combination, we focused on the hypothesis that the combination of these two natural molecules can offer prophylactic protection against experimentally induced hepatotoxicity. Materials and Methods: Lipopolysaccharide, carbon tetrachloride, and ethanol were used to experimentally damage the liver. Levels of aspartate aminotransferase, alanine transaminase, alkaline phosphatase, glutathione, superoxide dismutase, and malondialdehyde, known to correspond to the liver damage, were assayed. Results: Using three different hepatotoxins, we found that in all cases, some samples of HA and most of all the glucan-HA combination, offer strong protection against liver damage. Conclusion: Glucan-HA combination is a promising agent for use in liver protection. PMID:26401416

  9. Yeast β-1,6-Glucan Is a Primary Target for the Saccharomyces cerevisiae K2 Toxin

    PubMed Central

    Lukša, Juliana; Podoliankaitė, Monika; Vepštaitė, Iglė; Strazdaitė-Žielienė, Živilė; Urbonavičius, Jaunius

    2015-01-01

    Certain Saccharomyces cerevisiae strains secrete different killer proteins of double-stranded-RNA origin. These proteins confer a growth advantage to their host by increasing its survival. K2 toxin affects the target cell by binding to the cell surface, disrupting the plasma membrane integrity, and inducing ion leakage. In this study, we determined that K2 toxin saturates the yeast cell surface receptors in 10 min. The apparent amount of K2 toxin, bound to a single cell of wild type yeast under saturating conditions, was estimated to be 435 to 460 molecules. It was found that an increased level of β-1,6-glucan directly correlates with the number of toxin molecules bound, thereby impacting the morphology and determining the fate of the yeast cell. We observed that the binding of K2 toxin to the yeast surface receptors proceeds in a similar manner as in case of the related K1 killer protein. It was demonstrated that the externally supplied pustulan, a poly-β-1,6-glucan, but not the glucans bearing other linkage types (such as laminarin, chitin, and pullulan) efficiently inhibits the K2 toxin killing activity. In addition, the analysis of toxin binding to the intact cells and spheroplasts confirmed that majority of K2 protein molecules attach to the β-1,6-glucan, rather than the plasma membrane-localized receptors. Taken together, our results reveal that β-1,6-glucan is a primary target of K2 toxin and is important for the execution of its killing property. PMID:25710965

  10. Cell Wall Architecture of the Elongating Maize Coleoptile1

    PubMed Central

    Carpita, Nicholas C.; Defernez, Marianne; Findlay, Kim; Wells, Brian; Shoue, Douglas A.; Catchpole, Gareth; Wilson, Reginald H.; McCann, Maureen C.

    2001-01-01

    The primary walls of grasses are composed of cellulose microfibrils, glucuronoarabinoxylans (GAXs), and mixed-linkage β-glucans, together with smaller amounts of xyloglucans, glucomannans, pectins, and a network of polyphenolic substances. Chemical imaging by Fourier transform infrared microspectroscopy revealed large differences in the distributions of many chemical species between different tissues of the maize (Zea mays) coleoptile. This was confirmed by chemical analyses of isolated outer epidermal tissues compared with mesophyll-enriched preparations. Glucomannans and esterified uronic acids were more abundant in the epidermis, whereas β-glucans were more abundant in the mesophyll cells. The localization of β-glucan was confirmed by immunocytochemistry in the electron microscope and quantitative biochemical assays. We used field emission scanning electron microscopy, infrared microspectroscopy, and biochemical characterization of sequentially extracted polymers to further characterize the cell wall architecture of the epidermis. Oxidation of the phenolic network followed by dilute NaOH extraction widened the pores of the wall substantially and permitted observation by scanning electron microscopy of up to six distinct microfibrillar lamellae. Sequential chemical extraction of specific polysaccharides together with enzymic digestion of β-glucans allowed us to distinguish two distinct domains in the grass primary wall. First, a β-glucan-enriched domain, coextensive with GAXs of low degrees of arabinosyl substitution and glucomannans, is tightly associated around microfibrils. Second, a GAX that is more highly substituted with arabinosyl residues and additional glucomannan provides an interstitial domain that interconnects the β-glucan-coated microfibrils. Implications for current models that attempt to explain the biochemical and biophysical mechanism of wall loosening during cell growth are discussed. PMID:11598229

  11. The Barley Genome Sequence Assembly Reveals Three Additional Members of the CslF (1,3;1,4)-β-Glucan Synthase Gene Family

    PubMed Central

    Schreiber, Miriam; Wright, Frank; MacKenzie, Katrin; Hedley, Pete E.; Schwerdt, Julian G.; Little, Alan; Burton, Rachel A.; Fincher, Geoffrey B.; Marshall, David; Waugh, Robbie; Halpin, Claire

    2014-01-01

    An important component of barley cell walls, particularly in the endosperm, is (1,3;1,4)-β- glucan, a polymer that has proven health benefits in humans and that influences processability in the brewing industry. Genes of the cellulose synthase-like (Csl) F gene family have been shown to be involved in (1,3;1,4)-β-glucan synthesis but many aspects of the biosynthesis are still unclear. Examination of the sequence assembly of the barley genome has revealed the presence of an additional three HvCslF genes (HvCslF11, HvCslF12 and HvCslF13) which may be involved in (1,3;1,4)-β-glucan synthesis. Transcripts of HvCslF11 and HvCslF12 mRNA were found in roots and young leaves, respectively. Transient expression of these genes in Nicotiana benthamiana resulted in phenotypic changes in the infiltrated leaves, although no authentic (1,3;1,4)-β-glucan was detected. Comparisons of the CslF gene families in cereals revealed evidence of intergenic recombination, gene duplications and translocation events. This significant divergence within the gene family might be related to multiple functions of (1,3;1,4)-β-glucans in the Poaceae. Emerging genomic and global expression data for barley and other cereals is a powerful resource for characterising the evolution and dynamics of complete gene families. In the case of the CslF gene family, the results will contribute to a more thorough understanding of carbohydrate metabolism in grass cell walls. PMID:24595438

  12. Isolation and chemical characterization of dissolved and particulate polysaccharides in Mikawa Bay

    NASA Astrophysics Data System (ADS)

    Sakugawa, Hiroshi; Handa, Nobuhiko

    1985-05-01

    Isolation and chemical elucidation of dissolved and particulate polysaccharides in seawater were conducted. The water samples were collected in Mikawa Bay, Japan during a red tide bloom of the dinoflagellate, Prorocentrum minimum. Dissolved polysaccharides were concentrated from 5-101 of seawater with dialysis followed by separation by gel flitration, and isolation by ethanol precipitation. A heteropolysaccharide consisting of glucose, galactose, mannose, xylose, arabinose, fucose and rhamnose and a glucan were isolated from the polysaccharide component having a molecular weight more than 4,000 Dalton and were characterized by several chemical analyses. The heteropolysaccharide is a mucilaginous polysaccharide having a highly branched structure and a molecular weight of 10 4-5 × 10 6 Daltons and probably contains a sulfate half ester: the glucan is a polysaccharide with β-1,3- and 1,6-linkages (chrysolaminaran type). Concentrations of these were respectively ca. 20 and 67 μg l -1 at 1 m, and 2 and 26 μg l -1 at 6 m. A similar heteropolysaccharide was found in the boiling water extract of the particulate matter, while β-glucan was isolated in a much less purified form than the seawater β-glucan. In addition, a large amount of β-1,4 glucan was found in the strong alkali extract of the particulate matter, indicating that this glucan must be a cell wall polysaccharide derived from phytoplankton. These results strongly suggest that the heteropolysaccharide and chrysolaminaran type polysaccharide dissolved in seawater were derived from water soluble carbohydrates of phytoplankton through extracellular release or cell lysis.

  13. Effects of black yeast-derived β-1,3-1,6-glucan on serum cytokine and microRNA expression in transplanted sarcoma in mice.

    PubMed

    Li, Wei; Zhang, Yaru; Cong, Fengsong

    2013-01-01

    β-1,3-1,6-glucans are the most abundant glucose polymers in the cell walls of fungi. Previous studies have shown that β-1,3-1,6-glucans derived from fungi possess immunomodulating activitivies. Antitumor effects of these compounds have also been reported in animal models. Current studies mainly focus on the direct effects of β-1,3-1,6-glucans on immune systems, but no data are available to address the underlying molecular events in tumor cells. β-1,3-1,6-glucan purified from black yeast at 5 mg/100 g body weight (study group) or saline (control group) was intragastrically administered on a daily basis to subcutaneously-injected mice with mouse S180 sarcoma cells. Tumor sizes, tumor weights, serum concentrations of cytokines and levels of microRNAs (miRNAs) in transplanted tumors were compared between the treated and control groups. The volumes and weights of transplanted tumors were significantly lower in the treatment groups compared to the control groups by ∼150% and 70%, respectively. The treated mice demonstrated significantly higher levels of cytokines, including IL-2, IL-4, IL-6, IL-8, IL-10 and IL-12, compared to the control mice. Notably, the expression of several miRNAs in transplanted tumor tissues also markedly changed. These data suggest that black yeast-derived β-1,3-1,6-glucan, not only stimulates cytokine release from immune cells, but also changes the expression profiles of miRNAs in transplanted tumors.

  14. Effects of black yeast-derived β-1,3-1,6-glucan on serum cytokine and microRNA expression in transplanted sarcoma in mice

    PubMed Central

    LI, WEI; ZHANG, YARU; CONG, FENGSONG

    2013-01-01

    β-1,3-1,6-glucans are the most abundant glucose polymers in the cell walls of fungi. Previous studies have shown that β-1,3-1,6-glucans derived from fungi possess immunomodulating activitivies. Antitumor effects of these compounds have also been reported in animal models. Current studies mainly focus on the direct effects of β-1,3-1,6-glucans on immune systems, but no data are available to address the underlying molecular events in tumor cells. β-1,3-1,6-glucan purified from black yeast at 5 mg/100 g body weight (study group) or saline (control group) was intragastrically administered on a daily basis to subcutaneously-injected mice with mouse S180 sarcoma cells. Tumor sizes, tumor weights, serum concentrations of cytokines and levels of microRNAs (miRNAs) in transplanted tumors were compared between the treated and control groups. The volumes and weights of transplanted tumors were significantly lower in the treatment groups compared to the control groups by ∼150% and 70%, respectively. The treated mice demonstrated significantly higher levels of cytokines, including IL-2, IL-4, IL-6, IL-8, IL-10 and IL-12, compared to the control mice. Notably, the expression of several miRNAs in transplanted tumor tissues also markedly changed. These data suggest that black yeast-derived β-1,3-1,6-glucan, not only stimulates cytokine release from immune cells, but also changes the expression profiles of miRNAs in transplanted tumors. PMID:24648910

  15. Host-Pathogen Interactions : XXXII. A Fungal Glucan Preparation Protects Nicotianae against Infection by Viruses.

    PubMed

    Kopp, M; Rouster, J; Fritig, B; Darvill, A; Albersheim, P

    1989-05-01

    A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described.

  16. β-1,6-glucan synthesis-associated genes are required for proper spore wall formation in Saccharomyces cerevisiae.

    PubMed

    Pan, Hua-Ping; Wang, Ning; Tachikawa, Hiroyuki; Nakanishi, Hideki; Gao, Xiao-Dong

    2017-11-01

    The yeast spore wall is an excellent model to study the assembly of an extracellular macromolecule structure. In the present study, mutants defective in β-1,6-glucan synthesis, including kre1∆, kre6∆, kre9∆ and big1∆, were sporulated to analyse the effect of β-1,6-glucan defects on the spore wall. Except for kre6∆, these mutant spores were sensitive to treatment with ether, suggesting that the mutations perturb the integrity of the spore wall. Morphologically, the mutant spores were indistinguishable from wild-type spores. They lacked significant sporulation defects partly because the chitosan layer, which covers the glucan layer, compensated for the damage. The proof for this model was obtained from the effect of the additional deletion of CHS3 that resulted in the absence of the chitosan layer. Among the double mutants, the most severe spore wall deficiency was observed in big1∆ spores. The majority of the big1∆chs3∆ mutants failed to form visible spores at a higher temperature. Given that the big1∆ mutation caused a failure to attach a GPI-anchored reporter, Cwp2-GFP, to the spore wall, β-1,6-glucan is involved in tethering of GPI-anchored proteins in the spore wall as well as in the vegetative cell wall. Thus, β-1,6-glucan is required for proper organization of the spore wall. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  17. The α-Glucan Phosphorylase MalP of Corynebacterium glutamicum Is Subject to Transcriptional Regulation and Competitive Inhibition by ADP-Glucose

    PubMed Central

    Clermont, Lina; Macha, Arthur; Müller, Laura M.; Derya, Sami M.; von Zaluskowski, Philipp; Eck, Alexander; Eikmanns, Bernhard J.

    2015-01-01

    ABSTRACT α-Glucan phosphorylases contribute to degradation of glycogen and maltodextrins formed in the course of maltose metabolism in bacteria. Accordingly, bacterial α-glucan phosphorylases are classified as either glycogen or maltodextrin phosphorylase, GlgP or MalP, respectively. GlgP and MalP enzymes follow the same catalytic mechanism, and thus their substrate spectra overlap; however, they differ in their regulation: GlgP genes are constitutively expressed and the enzymes are controlled on the activity level, whereas expression of MalP genes are transcriptionally controlled in response to the carbon source used for cultivation. We characterize here the modes of control of the α-glucan phosphorylase MalP of the Gram-positive Corynebacterium glutamicum. In accordance to the proposed function of the malP gene product as MalP, we found transcription of malP to be regulated in response to the carbon source. Moreover, malP transcription is shown to depend on the growth phase and to occur independently of the cell glycogen content. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. Since the latter is considered a typical feature of GlgPs, we propose that C. glutamicum MalP acts as both maltodextrin and glycogen phosphorylase and, based on these findings, we question the current system for classification of bacterial α-glucan phosphorylases. IMPORTANCE Bacterial α-glucan phosphorylases have been classified conferring to their purpose as either glycogen or maltodextrin phosphorylases. We found transcription of malP in C. glutamicum to be regulated in response to the carbon source, which is recognized as typical for maltodextrin phosphorylases. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. The latter is considered a typical feature of GlgPs. These findings, taken together, suggest that C. glutamicum MalP is the first α-glucan phosphorylase that does not fit into the current system for classification of bacterial α-glucan phosphorylases and exemplifies the complex mechanisms underlying the control of glycogen content and maltose metabolism in this model organism. PMID:25666133

  18. The difference between oats and beta-glucan extract intake in the management of HbA1c, fasting glucose and insulin sensitivity: a meta-analysis of randomized controlled trials.

    PubMed

    He, Li-xia; Zhao, Jian; Huang, Yuan-sheng; Li, Yong

    2016-03-01

    Increasing oats and beta-glucan extract intake has been associated with improved glycemic control, which is associated with the reduction in the development of diabetes. This study aims to assess the different effects between oat (whole and bran) and beta-glucan extract intake on glycemic control and insulin sensitivity. PubMed, Embase, Medline, The Cochrane Library, CINAHL and Web of Science were searched up to February 2014. We included randomized controlled trials with interventions that lasted at least four weeks that compared oats and beta-glucan (extracted from oats or other sources) intake with a control. A total of 1351 articles were screened for eligibility, and relevant data were extracted from 18 studies (n = 1024). Oat product dose ranged from 20 g d(-1) to 136 g d(-1), and beta-glucan extract dose ranged from 3 g d(-1) to 10 g d(-1). Compared with the control, oat intake resulted in a greater decrease in fasting glucose and insulin of subjects (P < 0.05), but beta-glucan extract intake did not. Furthermore, oat intake resulted in a greater decrease in glycosylated hemoglobin (HbA1c) (P < 0.001, I(2) = 0%) and fasting glucose (P < 0.001, I(2) = 68%) after removing one study using a concentrate and a different design and fasting insulin of type 2 diabetes (T2D) (P < 0.001, I(2) = 0%). The intake of oats and beta-glucan extracted from oats were effective in decreasing fasting glucose (P = 0.007, I(2) = 91%) and fasting insulin of T2D (P < 0.001, I(2) = 0%) and tented to lower HbA1c (P = 0.09, I(2) = 92%). Higher consumption of whole oats and oat bran, but not oat or barley beta-glucan extracts, are associated with lower HbA1c, fasting glucose and fasting insulin of T2D, hyperlipidaemic and overweight subjects, especially people with T2D, which supports the need for clinical trials to evaluate the potential role of oats in approaching to the management of glycemic control and insulin sensitivity of diabetes or metabolic syndrome subjects.

  19. β-1,3/1,6-Glucan alleviated intestinal mucosal barrier impairment of broiler chickens challenged with Salmonella enterica serovar Typhimurium.

    PubMed

    Shao, Yujing; Guo, Yuming; Wang, Zhong

    2013-07-01

    This study investigated the protective effect of β-1,3/1,6-glucan on gut morphology, intestinal epithelial tight junctions, and bacterial translocation of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Ninety Salmonella-free Arbor Acre male broiler chickens were randomly divided into 3 groups: negative control group (NC), Salmonella Typhimurium-infected positive group (PC), and the Salmonella Typhimurium-infected group with dietary 100 mg/kg of β-1,3/1,6-glucan supplementation (T) to determine the effect of β-1,3/1,6-glucan on intestinal barrier function. Salmonella Typhimurium challenge alone significantly decreased villus height (P < 0.001), villus height/crypt depth ratio (P < 0.05), and the number of goblet cells (P < 0.001) in the jejunum at 14 d postinfection (dpi), but significantly increased the number of intestinal secretory IgA (sIgA)-expressing cells at 14 dpi (P < 0.01) and total sIgA levels in the jejunum at 7 (P < 0.05) and 14 dpi (P < 0.01) compared with the unchallenged birds (NC). Dietary β-1,3/1,6-glucan supplementation not only significantly increased villus height, villus height/crypt depth ratio, and the number of goblet cells (P < 0.01), but also increased the number of sIgA-expressing cells (P < 0.05) and sIgA content in the jejunum at 14 dpi (P < 0.01) in birds challenged with Salmonella Typhimurium in comparison with Salmonella Typhimurium challenge alone. β-1,3/1,6-Glucan addition had significant inhibitory effects (P < 0.05) on cecal Salmonella colonization levels and liver Salmonella invasion of the Salmonella Typhimurium-infected birds compared with the PC group. Intestinal tight junction proteins claudin-1, claudin-4, and occludin mRNA expression in the jejunum at 14 dpi was significantly decreased by Salmonella Typhimurium challenge alone (P < 0.01) compared with that of the NC group, whereas β-1,3/1,6-glucan supplementation significantly increased claudin-1 and occludin mRNA expression (P < 0.01) at 14 dpi in the jejunum of the Salmonella Typhimurium-infected birds in comparison with the PC group. Our results indicate that dietary β-1,3/1,6-glucan can alleviate intestinal mucosal barrier impairment in broiler chickens challenged with Salmonella Typhimurium.

  20. Effects of β-glucan polysaccharide revealed by the dominant lethal assay and micronucleus assays, and reproductive performance of male mice exposed to cyclophosphamide

    PubMed Central

    Oliveira, Rodrigo Juliano; Pesarini, João Renato; Sparça Salles, Maria José; Nakamura Kanno, Tatiane Yumi; dos Santos Lourenço, Ana Carolina; da Silva Leite, Véssia; da Silva, Ariane Fernanda; Matiazi, Hevenilton José; Ribeiro, Lúcia Regina; Mantovani, Mário Sérgio

    2014-01-01

    β-glucan is a well-known polysaccharide for its chemopreventive effect. This study aimed to evaluate the chemopreventive ability of β-glucan in somatic and germ cells through the dominant lethal and micronucleus assays, and its influence on the reproductive performance of male mice exposed to cyclophosphamide. The results indicate that β-glucan is capable of preventing changes in DNA in both germ cells and somatic ones. Changes in germ cells were evaluated by the dominant lethal assay and showed damage reduction percentages of 46.46% and 43.79% for the doses of 100 and 150 mg/kg. For the somatic changes, evaluated by micronucleus assay in peripheral blood cells in the first week of treatment, damage reduction percentages from 80.63–116.32% were found. In the fifth and sixth weeks, the percentage ranged from 10.20–52.54% and −0.95–62.35%, respectively. Besides the chemopreventive efficiency it appears that the β-glucan, when combined with cyclophosphamide, is able to improve the reproductive performance of males verified by the significant reduction in rates of post-implantation losses and reabsorption in the mating of nulliparous females with males treated with cyclophosphamide. PMID:24688298

  1. Effects of β-glucan polysaccharide revealed by the dominant lethal assay and micronucleus assays, and reproductive performance of male mice exposed to cyclophosphamide.

    PubMed

    Oliveira, Rodrigo Juliano; Pesarini, João Renato; Sparça Salles, Maria José; Nakamura Kanno, Tatiane Yumi; Dos Santos Lourenço, Ana Carolina; da Silva Leite, Véssia; da Silva, Ariane Fernanda; Matiazi, Hevenilton José; Ribeiro, Lúcia Regina; Mantovani, Mário Sérgio

    2014-03-01

    β-glucan is a well-known polysaccharide for its chemopreventive effect. This study aimed to evaluate the chemopreventive ability of β-glucan in somatic and germ cells through the dominant lethal and micronucleus assays, and its influence on the reproductive performance of male mice exposed to cyclophosphamide. The results indicate that β-glucan is capable of preventing changes in DNA in both germ cells and somatic ones. Changes in germ cells were evaluated by the dominant lethal assay and showed damage reduction percentages of 46.46% and 43.79% for the doses of 100 and 150 mg/kg. For the somatic changes, evaluated by micronucleus assay in peripheral blood cells in the first week of treatment, damage reduction percentages from 80.63-116.32% were found. In the fifth and sixth weeks, the percentage ranged from 10.20-52.54% and -0.95-62.35%, respectively. Besides the chemopreventive efficiency it appears that the β-glucan, when combined with cyclophosphamide, is able to improve the reproductive performance of males verified by the significant reduction in rates of post-implantation losses and reabsorption in the mating of nulliparous females with males treated with cyclophosphamide.

  2. Determination of Lovastatin, β-glucan, Total Polyphenols, and Antioxidant Activity in Raw and Processed Oyster Culinary-Medicinal Mushroom, Pleurotus ostreatus (Higher Basidiomycetes).

    PubMed

    Lam, Yu Shan; Okello, Edward J

    2015-01-01

    The objective of this study was to quantify a number of bioactive compounds and antioxidant activity of the oyster mushroom, Pleurotus. Ostreatus, and characterize the effects of processing, such as blanching, on these outcomes. Dry matter content was 8%. Lovastatin was not detected in this study. β-glucan content of 23.9% and total polyphenol content of 487.12 mg gallic acid equivalent/100 g of dry matter were obtained in raw P. ostreatus. Antioxidant activities as evaluated by 1,1-diphenyl-2-picrylhydrazyl, Trolox equivalent antioxidant capacity, and ferric reducing antioxidant power assays in raw P. ostreatus were 14.46, 16.51, and 11.21 µmol/g, respectively. Blanching did not significantly affect β-glucan content but caused significant decrease in dry matter content, polyphenol content, and antioxidant activities. Mushroom rolls produced from blanched mushrooms and blanching water contained significantly higher amounts of β-glucan, total polyphenol content, and FRAP antioxidant activity compared to blanched mushrooms. In conclusion, P. ostreatus is a good source for β-glucan, dietary polyphenols, and antioxidants. Although the blanching process could affect these properties, re-addition of the blanching water during the production process of mushroom rolls could potentially recover these properties and is therefore recommended.

  3. The use of (1-3) β-glucan along with itraconazole against canine refractory sporotrichosis.

    PubMed

    Guterres, Karina Affeldt; de Matos, Caroline Bohnen; Osório, Luiza Da Gama; Schuch, Isabel Duarte; Cleff, Marlete Brum

    2014-04-01

    Sporotrichosis, caused by the Sporothrix schenckii fungal complex, is a zoonotic mycosis distributed worldwide. Itraconazole is the treatment of choice for domestic animals although some fungal isolates have shown resistance to this drug. The objective of this study was to report, for the first time, the use of (1-3) β-glucan along with itraconazole in the treatment of a canine with sporotrichosis caused by Sporothrix brasiliensis. The animal had ulcerated and crusted lesions, especially on the nasal planum. Clinical samples were collected for a complete blood count, cytological analysis of the lesion, and fungal culture. Based on the results of the laboratory examination, and after the fungal culture, antibiotic therapy and treatment with itraconazole were initiated. Two additional fungal cultures were performed, which were positive. After 7 months of the animal treatment with itraconazole, the S. brasiliensis culture was still positive, so that the itraconazole was associated with (1-3) β-glucan. After four weekly applications of glucan, the complete elimination of the fungus was observed based on the fungal culture negative results. The results show, therefore, that (1-3) β-glucan with itraconazole promoted the case resolution, and it may be considered a promising alternative for the treatment of sporotrichosis in cases of resistance to conventional therapy.

  4. The role of viscous soluble fiber in the metabolic control of diabetes. A review with special emphasis on cereals rich in beta-glucan.

    PubMed

    Würsch, P; Pi-Sunyer, F X

    1997-11-01

    Recent recommendations for the dietary management of diabetes mellitus state that diet needs to be individualized so that there is improved glucose and lipid control in the patient. In a majority of individuals with diabetes, this is best done with a diet that is low in fat and high in carbohydrate, particularly that of cereal origin. However, symptoms of hyper- and hypoglycemia must be averted. Most cereal products, however, tend to have a high glycemic index Cereals such as Prowashonupana barley or fractions of oat bran are particularly high in the soluble fiber beta-glucan, which when taken with a meal increases the viscosity of the meal bolus once it has reached the small intestine, where the absorption of nutrients occurs. This high viscosity delays absorption. A 50% reduction in glycemic peak can be achieved with a concentration of 10% beta-glucan in a cereal food. A significant lowering of plasma LDL cholesterol concentrations can also be anticipated with the daily consumption of > or = 3 g of beta-glucan. Diabetic individuals can benefit from diets that are high in beta-glucan, which, as a component of oats and barley, can be incorporated into breakfast cereals and other products.

  5. An Extracellular Cell-Attached Pullulanase Confers Branched α-Glucan Utilization in Human Gut Lactobacillus acidophilus.

    PubMed

    Møller, Marie S; Goh, Yong Jun; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R; Svensson, Birte; Abou Hachem, Maher

    2017-06-15

    Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 ( La Pul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by La Pul13_14 and is abolished in a mutant strain lacking a functional La Pul13_14 gene. Hydrolysis kinetics of recombinant La Pul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest K m reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a metabolic resource for the gut microbiota. The role of health-beneficial lactobacilli prevalent in the human small intestine in starch metabolism remains unexplored in contrast to colonic bacterial residents. This study highlights the pivotal role of debranching enzymes in the breakdown of starchy branched α-glucan oligomers (α-limit dextrins) by human gut lactobacilli exemplified by Lactobacillus acidophilus NCFM, which is one of the best-characterized strains used as probiotics. Our data bring novel insight into the metabolic preference of L. acidophilus for α-glucans with short α-1,6-branches. The unprecedented affinity of the debranching enzyme that confers growth on these substrates reflects its adaptation to the nutrient-competitive gut ecological niche and constitutes a potential advantage in cross-feeding from human and bacterial dietary starch metabolism. Copyright © 2017 American Society for Microbiology.

  6. An Extracellular Cell-Attached Pullulanase Confers Branched α-Glucan Utilization in Human Gut Lactobacillus acidophilus

    PubMed Central

    Møller, Marie S.; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R.; Svensson, Birte

    2017-01-01

    ABSTRACT Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 (LaPul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by LaPul13_14 and is abolished in a mutant strain lacking a functional LaPul13_14 gene. Hydrolysis kinetics of recombinant LaPul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest Km reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a metabolic resource for the gut microbiota. The role of health-beneficial lactobacilli prevalent in the human small intestine in starch metabolism remains unexplored in contrast to colonic bacterial residents. This study highlights the pivotal role of debranching enzymes in the breakdown of starchy branched α-glucan oligomers (α-limit dextrins) by human gut lactobacilli exemplified by Lactobacillus acidophilus NCFM, which is one of the best-characterized strains used as probiotics. Our data bring novel insight into the metabolic preference of L. acidophilus for α-glucans with short α-1,6-branches. The unprecedented affinity of the debranching enzyme that confers growth on these substrates reflects its adaptation to the nutrient-competitive gut ecological niche and constitutes a potential advantage in cross-feeding from human and bacterial dietary starch metabolism. PMID:28411221

  7. Cell Wall and Membrane-Associated Exo-β-d-Glucanases from Developing Maize Seedlings1

    PubMed Central

    Kim, Jong-Bum; Olek, Anna T.; Carpita, Nicholas C.

    2000-01-01

    A β-d-glucan exohydrolase was purified from the cell walls of developing maize (Zea mays L.) shoots. The cell wall enzyme preferentially hydrolyzes the non-reducing terminal glucosyl residue from (1→3)-β-d-glucans, but also hydrolyzes (1→2)-, (1→6)-, and (1→4)-β-d-glucosyl units in decreasing order of activity. Polyclonal antisera raised against the purified exo-β-d-glucanase (ExGase) were used to select partial-length cDNA clones, and the complete sequence of 622 amino acid residues was deduced from the nucleotide sequences of the cDNA and a full-length genomic clone. Northern gel-blot analysis revealed what appeared to be a single transcript, but three distinct polypeptides were detected in immunogel-blot analyses of the ExGases extracted from growing coleoptiles. Two polypeptides appear in the cell wall, where one polypeptide is constitutive, and the second appears at the time of the maximum rate of elongation and reaches peak activity after elongation has ceased. The appearance of the second polypeptide coincides with the disappearance of the mixed-linkage (1→3),(1→4)-β-d-glucan, whose accumulation is associated with cell elongation in grasses. The third polypeptide of the ExGase is an extrinsic protein associated with the exterior surface of the plasma membrane. Although the activity of the membrane-associated ExGase is highest against (1→3)-β-d-glucans, the activity against (1→4)-β-d-glucan linkages is severely attenuated and, therefore, the enzyme is unlikely to be involved with turnover of the (1→3),(1→4)-β-d-glucan. We propose three potential functions for this novel ExGase at the membrane-wall interface. PMID:10859178

  8. Yeast β-1,6-glucan is a primary target for the Saccharomyces cerevisiae K2 toxin.

    PubMed

    Lukša, Juliana; Podoliankaitė, Monika; Vepštaitė, Iglė; Strazdaitė-Žielienė, Živilė; Urbonavičius, Jaunius; Servienė, Elena

    2015-04-01

    Certain Saccharomyces cerevisiae strains secrete different killer proteins of double-stranded-RNA origin. These proteins confer a growth advantage to their host by increasing its survival. K2 toxin affects the target cell by binding to the cell surface, disrupting the plasma membrane integrity, and inducing ion leakage. In this study, we determined that K2 toxin saturates the yeast cell surface receptors in 10 min. The apparent amount of K2 toxin, bound to a single cell of wild type yeast under saturating conditions, was estimated to be 435 to 460 molecules. It was found that an increased level of β-1,6-glucan directly correlates with the number of toxin molecules bound, thereby impacting the morphology and determining the fate of the yeast cell. We observed that the binding of K2 toxin to the yeast surface receptors proceeds in a similar manner as in case of the related K1 killer protein. It was demonstrated that the externally supplied pustulan, a poly-β-1,6-glucan, but not the glucans bearing other linkage types (such as laminarin, chitin, and pullulan) efficiently inhibits the K2 toxin killing activity. In addition, the analysis of toxin binding to the intact cells and spheroplasts confirmed that majority of K2 protein molecules attach to the β-1,6-glucan, rather than the plasma membrane-localized receptors. Taken together, our results reveal that β-1,6-glucan is a primary target of K2 toxin and is important for the execution of its killing property. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  9. Fungal exposure, atopy, and asthma exacerbations in Puerto Rican children.

    PubMed

    Blatter, Joshua; Forno, Erick; Brehm, John; Acosta-Pérez, Edna; Alvarez, María; Colón-Semidey, Angel; Thorne, Peter S; Metwali, Nervana; Canino, Glorisa; Celedón, Juan C

    2014-07-01

    Glucan is a component of the fungal cell wall that is used as a marker of fungal exposure. Little is known about indoor glucan, atopy, and asthma exacerbations among children living in tropical environments such as Puerto Rico. Our objective was to examine whether glucan exposure is associated with degree of atopy or visits to the emergency department (ED)/urgent care for asthma in Puerto Rican children. This was a cross-sectional study of 317 children aged 6 to 14 years with (cases, n = 160) and without (control subjects, n = 157) asthma in San Juan, Puerto Rico. Our primary outcomes were the number of positive skin tests to allergens (range, 0-15) and (in cases only) having had at least one visit to the ED/urgent care for asthma in the prior year. Levels of glucan, endotoxin, peptidoglycan, and five allergens (Der p 1, Bla g 2, Fel d 1, Can f 1, and Mus m 1) were measured in samples of house dust. Linear or logistic regression was used for the multivariate analysis. In a multivariate analysis adjusting for case-control status, mouse allergen, and other covariates, children exposed to glucan levels in the second and third quartiles had approximately two more positive skin tests than those in the lowest quartile (P < 0.01 in both instances). Among children with asthma, exposure to the highest quartile of glucan was associated with nearly ninefold greater odds of one or more visits to the ED/urgent care for asthma (95% confidence interval for adjusted odds ratio, 2.7-28.4; P < 0.001). Our results suggest that indoor fungal exposure leads to an increased degree of atopy and visits to the ED/urgent care for asthma in Puerto Rican children.

  10. Fungal Exposure, Atopy, and Asthma Exacerbations in Puerto Rican Children

    PubMed Central

    Blatter, Joshua; Forno, Erick; Brehm, John; Acosta-Pérez, Edna; Alvarez, María; Colón-Semidey, Angel; Thorne, Peter S.; Metwali, Nervana; Canino, Glorisa

    2014-01-01

    Background: Glucan is a component of the fungal cell wall that is used as a marker of fungal exposure. Little is known about indoor glucan, atopy, and asthma exacerbations among children living in tropical environments such as Puerto Rico. Our objective was to examine whether glucan exposure is associated with degree of atopy or visits to the emergency department (ED)/urgent care for asthma in Puerto Rican children. Methods: This was a cross-sectional study of 317 children aged 6 to 14 years with (cases, n = 160) and without (control subjects, n = 157) asthma in San Juan, Puerto Rico. Our primary outcomes were the number of positive skin tests to allergens (range, 0–15) and (in cases only) having had at least one visit to the ED/urgent care for asthma in the prior year. Levels of glucan, endotoxin, peptidoglycan, and five allergens (Der p 1, Bla g 2, Fel d 1, Can f 1, and Mus m 1) were measured in samples of house dust. Linear or logistic regression was used for the multivariate analysis. Measurements and Main Results: In a multivariate analysis adjusting for case-control status, mouse allergen, and other covariates, children exposed to glucan levels in the second and third quartiles had approximately two more positive skin tests than those in the lowest quartile (P < 0.01 in both instances). Among children with asthma, exposure to the highest quartile of glucan was associated with nearly ninefold greater odds of one or more visits to the ED/urgent care for asthma (95% confidence interval for adjusted odds ratio, 2.7–28.4; P < 0.001). Conclusions: Our results suggest that indoor fungal exposure leads to an increased degree of atopy and visits to the ED/urgent care for asthma in Puerto Rican children. PMID:24915164

  11. Prospecting for Energy-Rich Renewable Raw Materials: Sorghum Stem Case Study.

    PubMed

    Byrt, Caitlin S; Betts, Natalie S; Tan, Hwei-Ting; Lim, Wai Li; Ermawar, Riksfardini A; Nguyen, Hai Yen; Shirley, Neil J; Lahnstein, Jelle; Corbin, Kendall; Fincher, Geoffrey B; Knauf, Vic; Burton, Rachel A

    2016-01-01

    Sorghum vegetative tissues are becoming increasingly important for biofuel production. The composition of sorghum stem tissues is influenced by genotype, environment and photoperiod sensitivity, and varies widely between varieties and also between different stem tissues (outer rind vs inner pith). Here, the amount of cellulose, (1,3;1,4)-β-glucan, arabinose and xylose in the stems of twelve diverse sorghum varieties, including four photoperiod-sensitive varieties, was measured. At maturity, most photoperiod-insensitive lines had 1% w/w (1,3;1,4)-β-glucan in stem pith tissue whilst photoperiod-sensitive varieties remained in a vegetative stage and accumulated up to 6% w/w (1,3;1,4)-β-glucan in the same tissue. Three sorghum lines were chosen for further study: a cultivated grain variety (Sorghum bicolor BTx623), a sweet variety (S. bicolor Rio) and a photoperiod-sensitive wild line (S. bicolor ssp. verticilliflorum Arun). The Arun line accumulated 5.5% w/w (1,3;1,4)-β-glucan and had higher SbCslF6 and SbCslH3 transcript levels in pith tissues than did photoperiod-insensitive varieties Rio and BTx623 (<1% w/w pith (1,3;1,4)-β-glucan). To assess the digestibility of the three varieties, stem tissue was treated with either hydrolytic enzymes or dilute acid and the release of fermentable glucose was determined. Despite having the highest lignin content, Arun yielded significantly more glucose than the other varieties, and theoretical calculation of ethanol yields was 10 344 L ha-1 from this sorghum stem tissue. These data indicate that sorghum stem (1,3;1,4)-β-glucan content may have a significant effect on digestibility and bioethanol yields. This information opens new avenues of research to generate sorghum lines optimised for biofuel production.

  12. Consumption of both resistant starch and beta-glucan improves postprandial plasma glucose and insulin in women.

    PubMed

    Behall, Kay M; Scholfield, Daniel J; Hallfrisch, Judith G; Liljeberg-Elmståhl, Helena G M

    2006-05-01

    Consumption of a meal high in resistant starch or soluble fiber (beta-glucan) decreases peak insulin and glucose concentrations and areas under the curve (AUCs). The objective was to determine whether the effects of soluble fiber and resistant starch on glycemic variables are additive. Ten normal-weight (43.5 years of age, BMI 22.0 kg/m2) and 10 overweight women (43.3 years of age, BMI 30.4 kg/m2) consumed 10 tolerance meals in a Latin square design. Meals (1 g carbohydrate/kg body wt) were glucose alone or muffins made with different levels of soluble fiber (0.26, 0.68, or 2.3 g beta-glucan/100 g muffin) and three levels of resistant starch (0.71, 2.57, or 5.06 g/100 g muffin). Overweight subjects had plasma insulin concentrations higher than those of normal-weight subjects but maintained similar plasma glucose levels. Compared with low beta-glucan-low resistant starch muffins, glucose and insulin AUC decreased when beta-glucan (17 and 33%, respectively) or resistant starch (24 and 38%, respectively) content was increased. The greatest AUC reduction occurred after meals containing both high beta-glucan-high resistant starch (33 and 59% lower AUC for glucose and insulin, respectively). Overweight women were somewhat more insulin resistant than control women. Soluble fiber appears to have a greater effect on postprandial insulin response while glucose reduction is greater after resistant starch from high-amylose cornstarch. The reduction in glycemic response was enhanced by combining resistant starch and soluble fiber. Consumption of foods containing moderate amounts of these fibers may improve glucose metabolism in both normal and overweight women.

  13. Role of Glucosyltransferase B in Interactions of Candida albicans with Streptococcus mutans and with an Experimental Pellicle on Hydroxyapatite Surfaces ▿ †

    PubMed Central

    Gregoire, S.; Xiao, J.; Silva, B. B.; Gonzalez, I.; Agidi, P. S.; Klein, M. I.; Ambatipudi, K. S.; Rosalen, P. L.; Bauserman, R.; Waugh, R. E.; Koo, H.

    2011-01-01

    Candida albicans and mutans streptococci are frequently detected in dental plaque biofilms from toddlers afflicted with early childhood caries. Glucosyltransferases (Gtfs) secreted by Streptococcus mutans bind to saliva-coated apatite (sHA) and to bacterial surfaces, synthesizing exopolymers in situ, which promote cell clustering and adherence to tooth enamel. We investigated the potential role Gtfs may play in mediating the interactions between C. albicans SC5314 and S. mutans UA159, both with each other and with the sHA surface. GtfB adhered effectively to the C. albicans yeast cell surface in an enzymatically active form, as determined by scintillation spectroscopy and fluorescence imaging. The glucans formed on the yeast cell surface were more susceptible to dextranase than those synthesized in solution or on sHA and bacterial cell surfaces (P < 0.05), indicating an elevated α-1,6-linked glucose content. Fluorescence imaging revealed that larger numbers of S. mutans cells bound to C. albicans cells with glucans present on their surface than to yeast cells without surface glucans (uncoated). The glucans formed in situ also enhanced C. albicans interactions with sHA, as determined by a novel single-cell micromechanical method. Furthermore, the presence of glucan-coated yeast cells significantly increased the accumulation of S. mutans on the sHA surface (versus S. mutans incubated alone or mixed with uncoated C. albicans; P < 0.05). These data reveal a novel cross-kingdom interaction that is mediated by bacterial GtfB, which readily attaches to the yeast cell surface. Surface-bound GtfB promotes the formation of a glucan-rich matrix in situ and may enhance the accumulation of S. mutans on the tooth enamel surface, thereby modulating the development of virulent biofilms. PMID:21803906

  14. Xylan extraction from pretreated sugarcane bagasse using alkaline and enzymatic approaches.

    PubMed

    Sporck, Daniele; Reinoso, Felipe A M; Rencoret, Jorge; Gutiérrez, Ana; Del Rio, José C; Ferraz, André; Milagres, Adriane M F

    2017-01-01

    New biorefinery concepts are necessary to drive industrial use of lignocellulose biomass components. Xylan recovery before enzymatic hydrolysis of the glucan component is a way to add value to the hemicellulose fraction, which can be used in papermaking, pharmaceutical, and food industries. Hemicellulose removal can also facilitate subsequent cellulolytic glucan hydrolysis. Sugarcane bagasse was pretreated with an alkaline-sulfite chemithermomechanical process to facilitate subsequent extraction of xylan by enzymatic or alkaline procedures. Alkaline extraction methods yielded 53% (w/w) xylan recovery. The enzymatic approach provided a limited yield of 22% (w/w) but produced the xylan with the lowest contamination with lignin and glucan components. All extracted xylans presented arabinosyl side groups and absence of acetylation. 2D-NMR data suggested the presence of O -methyl-glucuronic acid and p -coumarates only in enzymatically extracted xylan. Xylans isolated using the enzymatic approach resulted in products with molecular weights (Mw) lower than 6 kDa. Higher Mw values were detected in the alkali-isolated xylans. Alkaline extraction of xylan provided a glucan-enriched solid readily hydrolysable with low cellulase loads, generating hydrolysates with a high glucose/xylose ratio. Hemicellulose removal before enzymatic hydrolysis of the cellulosic fraction proved to be an efficient manner to add value to sugarcane bagasse biorefining. Xylans with varied yield, purity, and structure can be obtained according to the extraction method. Enzymatic extraction procedures produce high-purity xylans at low yield, whereas alkaline extraction methods provided higher xylan yields with more lignin and glucan contamination. When xylan extraction is performed with alkaline methods, the residual glucan-enriched solid seems suitable for glucose production employing low cellulase loadings.

  15. Cell wall α-1,3-glucan prevents α-amylase adsorption onto fungal cell in submerged culture of Aspergillus oryzae.

    PubMed

    Zhang, Silai; Sato, Hiroki; Ichinose, Sakurako; Tanaka, Mizuki; Miyazawa, Ken; Yoshimi, Akira; Abe, Keietsu; Shintani, Takahiro; Gomi, Katsuya

    2017-07-01

    We have previously reported that α-amylase (Taka-amylase A, TAA) activity disappears in the later stage of submerged Aspergillus oryzae culture as a result of TAA adsorption onto the cell wall. Chitin, one of the major components of the cell wall, was identified as a potential factor that facilitates TAA adsorption. However, TAA adsorption only occurred in the later stage of cultivation, although chitin was assumed to be sufficiently abundant in the cell wall regardless of the submerged culture period. This suggested the presence a factor that inhibits TAA adsorption to the cell wall in the early stage of cultivation. In the current study, we identified α-1,3-glucan as a potential inhibiting factor for TAA adsorption. We constructed single, double, and triple disruption mutants of three α-1,3-glucan synthase genes (agsA, agsB, and agsC) in A. oryzae. Growth characteristics and cell wall component analysis of these disruption strains showed that AgsB plays a major role in α-1,3-glucan synthesis. In the ΔagsB mutant, TAA was adsorbed onto the mycelium in all stages of cultivation (early and later), and the ΔagsB mutant cell walls had a significantly high capacity for TAA adsorption. Moreover, the α-1,3-glucan content of the cell wall prepared from the wild-type strain in the later stage of cultivation was markedly reduced compared with that in the early stage. These results suggest that α-1,3-glucan is a potential inhibiting factor for TAA adsorption onto the cell wall component, chitin, in the early stage of submerged culture in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  16. Cloning, Sequencing, and Characterization of the cgmB Gene of Sinorhizobium meliloti Involved in Cyclic β-Glucan Biosynthesis

    PubMed Central

    Wang, Ping; Ingram-Smith, Cheryl; Hadley, Jill A.; Miller, Karen J.

    1999-01-01

    Periplasmic cyclic β-glucans of Rhizobium species provide important functions during plant infection and hypo-osmotic adaptation. In Sinorhizobium meliloti (also known as Rhizobium meliloti), these molecules are highly modified with phosphoglycerol and succinyl substituents. We have previously identified an S. meliloti Tn5 insertion mutant, S9, which is specifically impaired in its ability to transfer phosphoglycerol substituents to the cyclic β-glucan backbone (M. W. Breedveld, J. A. Hadley, and K. J. Miller, J. Bacteriol. 177:6346–6351, 1995). In the present study, we have cloned, sequenced, and characterized this mutation at the molecular level. By using the Tn5 flanking sequences (amplified by inverse PCR) as a probe, an S. meliloti genomic library was screened, and two overlapping cosmid clones which functionally complement S9 were isolated. A 3.1-kb HindIII-EcoRI fragment found in both cosmids was shown to fully complement mutant S9. Furthermore, when a plasmid containing this 3.1-kb fragment was used to transform Rhizobium leguminosarum bv. trifolii TA-1JH, a strain which normally synthesizes only neutral cyclic β-glucans, anionic glucans containing phosphoglycerol substituents were produced, consistent with the functional expression of an S. meliloti phosphoglycerol transferase gene. Sequence analysis revealed the presence of two major, overlapping open reading frames within the 3.1-kb fragment. Primer extension analysis revealed that one of these open reading frames, ORF1, was transcribed and its transcription was osmotically regulated. This novel locus of S. meliloti is designated the cgm (cyclic glucan modification) locus, and the product encoded by ORF1 is referred to as CgmB. PMID:10419956

  17. Effect of barley β-glucan addition as a fat replacer on muffin quality.

    PubMed

    Onacik-Gür, Sylwia; Żbikowska, Anna; Kapler, Ewa; Kowalska, Hanna

    2016-01-01

    The aim of this study was to perform the partial replacement of bakery fat with barley β-glucan in muffins and to determine its effect on the physical properties of products. Most shortenings used in the industry are solid fats rich in saturated fatty acids and often trans fatty isomers, which are nutritionally unfavorable. Dough and baked muffins were used as the research material. Five muffin recipes were prepared: control (K0%) with 16% fat content in the total dough weight, with fat content decreased by 10% (PG10%), 15% (PG15%), 20% (PG20%) and 25% (PG25%). β-glucan was used as a fat replacer in the 1:4 ratio. The parameters determining the physical characteristics and sensory attributes were measured, compared and statistically analyzed using a principal component analysis (PCA) method. Although the partial replacement of shortening with barley β-glucan is possible, it may negatively influence the physical properties of dough (aeration) and baked products (volume, density). It has been observed that increasing the content of this fat replacer enlarges the pores of the crumb. The textural properties of muffins with a fat content decreased by 20% are most similar to the control. Moreover, it has been shown that the overall sensory quality goes down when the amount of fat replacer in the muffin recipe is increased. However, adding β-glucan to products in which fat content was decreased by 10% did not influence significantly the typical taste. Despite the adverse effect of β-glucan on the physical and sensorial properties, it was found to be reasonable to use it even in small amounts (up to 10%) to increase the nutritional value of products.

  18. Effects of dietary β-glucan and glycyrrhizin on non-specific immunity and disease resistance of the sea cucumber ( Apostichopus japonicus Selenka) challenged with Vibrio splendidus

    NASA Astrophysics Data System (ADS)

    Chang, Jie; Zhang, Wenbing; Mai, Kangsen; Ma, Hongming; Xu, Wei

    2010-12-01

    Sea cucumbers, Apostichopus japonicus Selenka, were fed diets containing non-immunostimulant (basal diet), 0.2% β-glucan and 0.02% glycyrrhizin in a recirculatory water system for 45 days, and subsequently challenged with Vibrio splendidus by injection at 1.0×108 cfu / sea cucumber for 15 days. Phagocytic capacity (PC), intracellular superoxide anion production (ISAP), lysozyme (LSZ) activity and superoxide dismutase (SOD) activity in the coelomic fluid were analyzed on the 0th, 5th, 10th and 15th days after injection. Results showed that after the 45-day feeding period, PC, ISAP, LSZ activity and SOD activity in sea cucumbers fed with dietary β-glucan or glycyrrhizin were significantly higher than in those fed with the basal diet. On the 5th day after infection, all the immune parameters examined in the sea cucumbers injected with V. splendidus decreased in value significantly. On the 15th day, PC, ISAP and LSZ activity returned to levels similar to those on the 0th day. For the sea cucumbers injected with saline, there were no significant differences in all the immune parameters examined and in the cumulative morbidity during the 15-day challenging trial. After injecting with V. splendidus, the cumulative morbidity of sea cucumbers fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin when challenged with V. splendidus challenged sea cucumber fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin. There was no significant difference in cumulative morbidity between the dietary β-glucan and glycyrrhizin treatments over time.

  19. Biofilm formation by strains of Leuconostoc citreum and L. mesenteroides

    USDA-ARS?s Scientific Manuscript database

    Aims: To compare for the first time biofilm formation among strains of Leuconostoc citreum and L. mesenteroides that produce varying types of extracellular glucans. Methods and Results: Twelve strains of Leuconostoc sp. that produce extracellular glucans were compared for their capacity to produ...

  20. Osmoregulated periplasmic glucans synthesis gene family of Shigella flexneri

    USDA-ARS?s Scientific Manuscript database

    Osmoregulated periplasmic glucans (OPGs) of foodborne enteropathogen Shigella flexneri were characterized. OPGs were composed of 100 percent glucose with 2-linked glucose as the most abundant residue with terminal glucose, 2-linked and 2,6-linked glucose also present in high quantities. Most dominan...

  1. Lactate signalling regulates fungal β-glucan masking and immune evasion

    PubMed Central

    Ballou, Elizabeth R.; Avelar, Gabriela M.; Childers, Delma S.; Mackie, Joanna; Bain, Judith M.; Wagener, Jeanette; Kastora, Stavroula L.; Panea, Mirela D.; Hardison, Sarah E.; Walker, Louise A.; Erwig, Lars P.; Munro, Carol A.; Gow, Neil A.R.; Brown, Gordon D.; MacCallum, Donna M.; Brown, Alistair J.P.

    2017-01-01

    Summary Paragraph As they proliferate, fungi expose antigens at their cell surface that are potent stimulators of the innate immune response, and yet the commensal fungus Candida albicans is able to colonize immuno-competent individuals. We show that C. albicans may evade immune detection by presenting a moving immunological target. We report that the exposure of β-glucan, a key Pathogen Associated Molecular Pattern (PAMP) located at the cell surface of C. albicans and other pathogenic Candida species, is modulated in response to changes in carbon source. Exposure to lactate induces β-glucan masking in C. albicans via a signaling pathway that has recruited an evolutionarily conserved receptor (Gpr1) and transcriptional factor (Crz1) from other well-characterized pathways. In response to lactate, these regulators control the expression of cell wall related genes that contribute to β-glucan masking. This represents the first description of active PAMP masking by a Candida species, a process that reduces the visibility of the fungus to the immune system. PMID:27941860

  2. Label-free Chemical Imaging of Fungal Spore Walls by Raman Microscopy and Multivariate Curve Resolution Analysis

    PubMed Central

    Noothalapati, Hemanth; Sasaki, Takahiro; Kaino, Tomohiro; Kawamukai, Makoto; Ando, Masahiro; Hamaguchi, Hiro-o; Yamamoto, Tatsuyuki

    2016-01-01

    Fungal cell walls are medically important since they represent a drug target site for antifungal medication. So far there is no method to directly visualize structurally similar cell wall components such as α-glucan, β-glucan and mannan with high specificity, especially in a label-free manner. In this study, we have developed a Raman spectroscopy based molecular imaging method and combined multivariate curve resolution analysis to enable detection and visualization of multiple polysaccharide components simultaneously at the single cell level. Our results show that vegetative cell and ascus walls are made up of both α- and β-glucans while spore wall is exclusively made of α-glucan. Co-localization studies reveal the absence of mannans in ascus wall but are distributed primarily in spores. Such detailed picture is believed to further enhance our understanding of the dynamic spore wall architecture, eventually leading to advancements in drug discovery and development in the near future. PMID:27278218

  3. Applications of β-limit dextrin as a matrix forming excipient for fast disintegrating buccal dosage formats.

    PubMed

    Qi, Xin; Tester, Richard; Liu, Yu; Mullin, Margaret

    2012-01-01

    To compare the properties of buccal delivery matrices (wafers) made with dextrin, β-limit dextrin and pre-gelatinised starch. The constituent α-glucans were tested for their mucoadhesive properties in solution plus their content of crystalline material (differential scanning calorimetry, DSC). Wafers were made by lyophilisation of aqueous solutions/dispersions of the α-glucans. Physical properties of the wafers were evaluated using texture analysis, dissolution coupled to photography and scanning electron microscopy (SEM). The results highlighted how the β-limit dextrins chemical and physical properties were ideally suited for the production of buccal delivery wafers. Dissolution testing confirmed the excellent hydration profile of the β-limit dextrin (within wafers) with time. Using SEM it was evident that the homogeneous "bee-hive" like structure of the β-limit dextrin wafers, unlike the other α-glucans, provided a rapidly hydratable strong porous matrix. The β-limit dextrin α-glucan makes a superb (lyophilised) mucoadhesive delivery structure for the delivery of active agents to the buccal mucosa.

  4. Structure and function of α-glucan debranching enzymes.

    PubMed

    Møller, Marie Sofie; Henriksen, Anette; Svensson, Birte

    2016-07-01

    α-Glucan debranching enzymes hydrolyse α-1,6-linkages in starch/glycogen, thereby, playing a central role in energy metabolism in all living organisms. They belong to glycoside hydrolase families GH13 and GH57 and several of these enzymes are industrially important. Nine GH13 subfamilies include α-glucan debranching enzymes; isoamylase and glycogen debranching enzymes (GH13_11); pullulanase type I/limit dextrinase (GH13_12-14); pullulan hydrolase (GH13_20); bifunctional glycogen debranching enzyme (GH13_25); oligo-1 and glucan-1,6-α-glucosidases (GH13_31); pullulanase type II (GH13_39); and α-amylase domains (GH13_41) in two-domain amylase-pullulanases. GH57 harbours type II pullulanases. Specificity differences, domain organisation, carbohydrate binding modules, sequence motifs, three-dimensional structures and specificity determinants are discussed. The phylogenetic analysis indicated that GH13_39 enzymes could represent a "missing link" between the strictly α-1,6-specific debranching enzymes and the enzymes with dual specificity and α-1,4-linkage preference.

  5. Deproteinization of water-soluble ß-glucan during acid extraction from fruiting bodies of Pleurotus ostreatus mushrooms.

    PubMed

    Szwengiel, Artur; Stachowiak, Barbara

    2016-08-01

    Some ß-glucans can be easily extracted from Basidiomycete mushrooms but commonly used extraction procedures are not satisfactory. A simultaneous method for acid extraction and deproteinization in the case of Pleurotus ostreatus was developed using response surface methodology. The optimized extraction conditions proposed here (30°C, 3.8% HCl, 300min, stirring) allow for the simultaneous extraction and deproteinization of polysaccharides. Additionally, the acid extraction yield was 7 times greater than that of hot water extraction. The combined enzymatic digestion with lyticase, ß-glucanase, exo-1,3-ß-d-glucanase, and ß-glucosidase results elucidated that an extract containing ß-1,3-ß-1,6-ß-1,4-glucan. The gel permeation chromatography (GPC) results showed that the two glucan fractions obtained do not contain linked proteins. The weight average molecular weight of the first fraction (Mw=1137kDa) was 60 times higher than that of the second fraction (Mw=19kDa). Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Deletion of the α-(1,3)-Glucan Synthase Genes Induces a Restructuring of the Conidial Cell Wall Responsible for the Avirulence of Aspergillus fumigatus

    PubMed Central

    Beauvais, Anne; Bozza, Silvia; Kniemeyer, Olaf; Formosa, Céline; Balloy, Viviane; Henry, Christine; Roberson, Robert W.; Dague, Etienne; Chignard, Michel; Brakhage, Axel A.; Romani, Luigina; Latgé, Jean-Paul

    2013-01-01

    α-(1,3)-Glucan is a major component of the cell wall of Aspergillus fumigatus, an opportunistic human fungal pathogen. There are three genes (AGS1, AGS2 and AGS3) controlling the biosynthesis of α-(1,3)-glucan in this fungal species. Deletion of all the three AGS genes resulted in a triple mutant that was devoid of α-(1,3)-glucan in its cell wall; however, its growth and germination was identical to that of the parental strain in vitro. In the experimental murine aspergillosis model, this mutant was less pathogenic than the parental strain. The AGS deletion resulted in an extensive structural modification of the conidial cell wall, especially conidial surface where the rodlet layer was covered by an amorphous glycoprotein matrix. This surface modification was responsible for viability reduction of conidia in vivo, which explains decrease in the virulence of triple agsΔ mutant. PMID:24244155

  7. Heat treatment of curdlan enhances the enzymatic production of biologically active β-(1,3)-glucan oligosaccharides.

    PubMed

    Kumagai, Yuya; Okuyama, Masayuki; Kimura, Atsuo

    2016-08-01

    Biologically active β-(1,3)-glucan oligosaccharides were prepared from curdlan using GH64 enzyme (KfGH64). KfGH64 showed low activity toward native curdlan; thereby pretreatment conditions of curdlan were evaluated. KfGH64 showed the highest activity toward curdlan with heat treatment. The most efficient pretreatment (90°C for 0.5h) converted approximately 60% of curdlan into soluble saccharides under the optimized enzyme reaction conditions (pH 5.5, 37°C, 100rpm mixing speed, 24h, and 10μg of KfGH64/1g of curdlan). The resulting products were predominantly laminaripentaose and a small amount of β-(1,3)-glucans with an average degree of polymerization (DP) of 13 and 130. The products did not contain small oligosaccharides (DP<5), indicating that the hydrolysis of heat-treated curdlan by KfGH64 is a suitable method for the production of biologically active β-(1,3)-glucan oligosaccharides. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Protection against Experimental Cryptococcosis following Vaccination with Glucan Particles Containing Cryptococcus Alkaline Extracts.

    PubMed

    Specht, Charles A; Lee, Chrono K; Huang, Haibin; Tipper, Donald J; Shen, Zu T; Lodge, Jennifer K; Leszyk, John; Ostroff, Gary R; Levitz, Stuart M

    2015-12-22

    A vaccine capable of protecting at-risk persons against infections due to Cryptococcus neoformans and Cryptococcus gattii could reduce the substantial global burden of human cryptococcosis. Vaccine development has been hampered though, by lack of knowledge as to which antigens are immunoprotective and the need for an effective vaccine delivery system. We made alkaline extracts from mutant cryptococcal strains that lacked capsule or chitosan. The extracts were then packaged into glucan particles (GPs), which are purified Saccharomyces cerevisiae cell walls composed primarily of β-1,3-glucans. Subcutaneous vaccination with the GP-based vaccines provided significant protection against subsequent pulmonary infection with highly virulent strains of C. neoformans and C. gattii. The alkaline extract derived from the acapsular strain was analyzed by liquid chromatography tandem mass spectrometry (LC-MS/MS), and the most abundant proteins were identified. Separation of the alkaline extract by size exclusion chromatography revealed fractions that conferred protection when loaded in GP-based vaccines. Robust Th1- and Th17-biased CD4(+) T cell recall responses were observed in the lungs of vaccinated and infected mice. Thus, our preclinical studies have indicated promising cryptococcal vaccine candidates in alkaline extracts delivered in GPs. Ongoing studies are directed at identifying the individual components of the extracts that confer protection and thus would be promising candidates for a human vaccine. The encapsulated yeast Cryptococcus neoformans and its closely related sister species, Cryptococcus gattii, are major causes of morbidity and mortality, particularly in immunocompromised persons. This study reports on the preclinical development of vaccines to protect at-risk populations from cryptococcosis. Antigens were extracted from Cryptococcus by treatment with an alkaline solution. The extracted antigens were then packaged into glucan particles, which are hollow yeast cell walls composed mainly of β-glucans. The glucan particle-based vaccines elicited robust T cell immune responses and protected mice from otherwise-lethal challenge with virulent strains of C. neoformans and C. gattii. The technology used for antigen extraction and subsequent loading into the glucan particle delivery system is relatively simple and can be applied to vaccine development against other pathogens. Copyright © 2015 Specht et al.

  9. Analysis of adrenocortical secretory responses during acute an prolonged immune stimulation in inflammation-susceptible and -resistant rat strains.

    PubMed

    Andersson, I M; Lorentzen, J C; Ericsson-Dahlstrand, A

    2000-11-01

    Endogenous corticosterone secreted during immune challenge restricts the inflammatory process and genetic variations in this neuroendocrine-immune dialogue have been suggested to influence an individuals sensitivity to develop chronic inflammatory disorders. We have tested inflammation-susceptible Dark Agouti (DA) rats and resistant, MHC-identical, PVG.1AV1 rats for their abilities to secrete corticosterone in response to acute challenge with bacterial lipopolysaccharide (LPS) or a prolonged activation of the nonspecific immune system with arthritogenic yeast beta-glucan. Intravenous injection of LPS triggered equipotent secretion of corticosterone in both rat strains. Interestingly, peak concentrations of corticosterone did not differ significantly between the strains. Intradermal injection of beta-glucan caused severe, monophasic, polyarthritis in DA rats while PVG.1AV1 responded with significantly milder joint inflammation. Importantly, serial sampling of plasma from glucan-injected DA and PVG.1AV1 rats did not reveal elevated concentrations of plasma corticosterone at any time from days 1-30 postinjection compared to preinjection values, in spite of the ongoing inflammatory process. Interestingly, adrenalectomized, beta-glucan-challenged DA rats responded with an aggravated arthritic process, indicating an anti-inflammatory role for the basal levels of corticosterone that were detected in intact DA rats challenged with beta-glucan. Moreover, substitution with subcutaneous corticosterone-secreting pellets, yielding moderate stress-levels, significantly attenuated the arthritic response. In contrast, adrenalectomized and glucan-challenged PVG.1AV1 rats did not respond with an elevated arthritic response, suggesting that these rats contain the arthritic process via corticosterone-independent mechanisms. In conclusion, the hypothalamic-pituitary-adrenal axis in both rat strains exhibited strong activation after challenge with LPS. This contrasted to the basal corticosterone levels observed strains during a prolonged arthritic process. No correlation between ability to secrete corticosterone and susceptibility to inflammation could be demonstrated. Basal levels of endogenous corticosterone appeared to restrain inflammation in beta-glucan-challenged DA rats whereas resistance to inflammation in PVG.1AV1 rats may be mediated via corticosterone-independent mechanisms.

  10. Beta-1,4-glucanase-like protein from the cyanobacterium Synechocystis PCC6803 is a beta-1,3-1,4-glucanase and functions in salt stress tolerance.

    PubMed

    Tamoi, Masahiro; Kurotaki, Hideki; Fukamizo, Tamo

    2007-07-01

    In the present study, we characterized the gene (Cyanobase accession number slr0897) designated Ssglc encoding a beta-1,4-glucanase-like protein (SsGlc) from Synechocystis PCC6803. The deduced amino acid sequence for Ssglc showed a high degree of similarity to sequences of GH (glycoside hydrolase) family 9 beta-1,4-glucanases (cellulases) from various sources. Surprisingly, the recombinant protein obtained from the Escherichia coli expression system was able to hydrolyse barley beta-glucan and lichenan (beta-1,3-1,4-glucan), but not cellulose (beta-1,4-glucan), curdlan (beta-1,3-glucan), or laminarin (beta-1,3-1,6-glucan). A 1H-NMR analysis of the enzymatic products revealed that the enzyme hydrolyses the beta-1,4-glycosidic linkage of barley beta-glucan through an inverting mechanism. The data indicated that SsGlc was a novel type of GH9 glucanase which could specifically hydrolyse the beta-1,3-1,4-linkage of glucan. The growth of mutant Synechocystis cells in which the Ssglc gene was disrupted by a kanamycin-resistance cartridge gene was almost the same as that of the wild-type cells under continuous light (40 micromol of photons/m2 per s), a 12 h light (40 micromol of photons/m2 per s)/12 h dark cycle, cold stress (4 degrees C), and high light stress (200 micromol of photons/m2 per s). However, under salt stress (300-450 mM NaCl), growth of the Ssglc-disrupted mutant cells was significantly inhibited as compared with that of the wild-type cells. The Ssglc-disrupted mutant cells showed a decreased rate of O2 consumption and NaHCO3-dependent O2 evolution as compared with the wild-type cells under salt stress. Under osmotic stress (100-400 mM sorbitol), there was no difference in growth between the wild-type and the Ssglc-disrupted mutant cells. These results suggest that SsGlc functions in salt stress tolerance in Synechocystis PCC6803.

  11. Stereochemical course and structure of the products of the enzymic action of endo-1,3-1,4-beta-D-glucan 4-glucanohydrolase from Bacillus licheniformis.

    PubMed Central

    Malet, C; Jiménez-Barbero, J; Bernabé, M; Brosa, C; Planas, A

    1993-01-01

    The stereochemical course of the reaction catalysed by endo-1,3-1,4-beta-D-glucan 4-glucanohydrolase (EC 3.2.1.73) has been determined by 1H n.m.r. The enzyme-catalysed hydrolysis of barley beta-glucan proceeds with overall retention of the anomeric configuration, indicating that the enzyme operates through a double-displacement mechanism. The structures of the final oligosaccharide products, 3-beta-O-cellobiosyl D-glucopyranoside and 3-beta-O-cellotriosyl D-glucopyranoside, have been completely assigned by 1H- and 13C-n.m.r. spectroscopy. PMID:8280073

  12. Protection of groundnut plants from rust disease by application of glucan isolated from a biocontrol agent Acremonium obclavatum.

    PubMed

    Sathiyabama, M; Balasubramanian, R

    2018-05-01

    Prior treatment of groundnut leaves with glucan isolated from a biocontrol agent, Acremonium obclavatum, protected against the rust disease. Glucan treated leaves showed increased levels of chitinase and β-1,3-glucanase in the apoplastic fluid. An increase in endogenous levels of salicylic acid also was observed in treated leaves. Treated leaves also showed a significant reduction in rust disease development in groundnut leaves. Enhanced activities of glucanohydrolases of treated groundnut leaves might have affected the biotrophic rust pathogen, which is known to colonize in the apoplastic spaces. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Role of anionic charges of periplasmic glucans of Shigella flexneri in overcoming detergent stress

    USDA-ARS?s Scientific Manuscript database

    Osmoregulated periplasmic glucans (OPGs) are synthesized by the members of the family Enterobacteriaceae when grown under low osmotic growth conditions. Enteropathogens such as Shigella flexneri spend considerable time outside the host environment such as irrigation waters where low nutrient low os...

  14. Biochemical conversion of sugar to novel renewable products and materials

    USDA-ARS?s Scientific Manuscript database

    Dextrans and related glucan polysaccharides are synthesized from sucrose by enzymes, called glucansucrases, which are produced by lactic acid bacteria. These water-soluble glucans have been studied for many years and are used in numerous commercial applications and products. A small number of Leucon...

  15. Oyster hemocyte mobilization and increased adhesion activity after beta glucan administration

    USDA-ARS?s Scientific Manuscript database

    In the eastern oyster (Crassostrea virginica) hemocytes are important effector cells for maintenance of defense against pathogenic microorganisms. Various forms of ß-glucans have been suggested for use in shrimp and fish aquaculture because of their potential to enhance disease resistance via hemoc...

  16. Conservation and Divergence in the Candida Species Biofilm Matrix Mannan-Glucan Complex Structure, Function, and Genetic Control

    PubMed Central

    Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S.; Westler, William M.; Azadi, Parastoo; Nett, Jeniel

    2018-01-01

    ABSTRACT Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non-albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan-Candida species biofilm therapy. PMID:29615504

  17. Interactions of liposome carriers with infectious fungal hyphae reveals the role of β-glucans.

    PubMed

    Chavan, Neelam L; Young, Joseph K; Drezek, Rebekah A; Lewis, Russell; Bikram, Malavosklish

    2012-09-04

    Relatively little is known about how liposomal formulations modulate drug delivery to fungal pathogens. We compared patterns of hyphal cell wall binding for empty rhodmine-labeled liposomes and the clinically available amphotericin B-containing liposomal formulation (AmBisome) in Aspergillus fumigatus and Candida albicans. Following 0.5 h of coincubation with A. fumigatus , empty liposomes concentrated primarily in fungal septae along at the surface of the cell wall, suggesting that liposome uptake is concentrated in areas of the cell wall where linear glucan is exposed on the cell surface, which was confirmed by aniline blue staining. Consistent with this hypothesis, pretreatment of liposomes with soluble linear glucan (laminarin) decreased liposome binding in both Aspergillus and Candida fungal hyphae, while growth of Aspergillus hyphae in the presence of an agent that increases fungal cell wall surface exposure of linear β-glucans without cell death (caspofungin) increased liposome uptake throughout the Aspergillus fungal cell wall. Increasing the polyethylene glycol (PEG) concentration in liposomes from 0 to 30% significantly increased fungal uptake of liposomes that was only modestly attenuated when fungal cells were incubated in serum concentrations ranging from 10 to 100%. The presence of β-glucans on the fungal hyphae cell walls of Aspergillus fumigatus is one of the factors responsible for mediating the binding of liposome carriers to the hyphae and could explain possible synergy reported between liposomal amphotericin B and echinocanins.

  18. Immunological relationships between glucosyltransferases from Streptococcus mutans serotypes.

    PubMed

    Kuramitsu, H; Ingersoll, L

    1976-09-01

    Partially purified glycosyltransferase enzymes for Streptococcus mutans GS-5 (serotype c) have been utilized to prepare antibodies directed against the soluble glucan-synthesizing activity, GTF-B, and the insoluble-soluble glucan synthetic activity, GTF-A. Anti-GTF-A inhibited insoluble glucan formation catalyzed by the extracellular enzymes from strains GS-5 and FA-1 (serotype b) to a much greater extent than that of strains HS-6 (serotype a) or OMZ-176 (serotype d). This antibody fraction also inhibited both the cell-associated glucosyltransferase activities as well as the sucrose-mediated adherence of cells to glass surfaces by strains GS-5 and FA-1 but not that of strains HS-6 and OMZ-176. Anti-GTF-B inhibited soluble glucan formation catalyzed by the extracellular enzymes of strains GS-5 but not that of strain HS-6, FA-1, or OMZ-176. However, this antibody fraction did not strongly inhibit either the cell-associated glycosyltransferase activity or cellular adherence of any of the four strains. These results with body antibody fractions were also correlated with the ability of the antibodies to agglutinate the cells and form precipitin bands after immunodiffusion with the extracellular enzymes. Antibody prepared against the homogeneous soluble glucan-synthesizing enzyme demonstrated similar effects to the anti-GTF-B fraction. These results are discussed in terms of the antigenic relationships existing between the glucosyltransferases from different serotypes of S. mutans.

  19. Plant-derived antifungal agent poacic acid targets β-1,3-glucan

    PubMed Central

    Piotrowski, Jeff S.; Okada, Hiroki; Lu, Fachuang; Li, Sheena C.; Hinchman, Li; Ranjan, Ashish; Smith, Damon L.; Higbee, Alan J.; Ulbrich, Arne; Coon, Joshua J.; Deshpande, Raamesh; Bukhman, Yury V.; McIlwain, Sean; Ong, Irene M.; Myers, Chad L.; Boone, Charles; Landick, Robert; Ralph, John; Kabbage, Mehdi; Ohya, Yoshikazu

    2015-01-01

    A rise in resistance to current antifungals necessitates strategies to identify alternative sources of effective fungicides. We report the discovery of poacic acid, a potent antifungal compound found in lignocellulosic hydrolysates of grasses. Chemical genomics using Saccharomyces cerevisiae showed that loss of cell wall synthesis and maintenance genes conferred increased sensitivity to poacic acid. Morphological analysis revealed that cells treated with poacic acid behaved similarly to cells treated with other cell wall-targeting drugs and mutants with deletions in genes involved in processes related to cell wall biogenesis. Poacic acid causes rapid cell lysis and is synergistic with caspofungin and fluconazole. The cellular target was identified; poacic acid localized to the cell wall and inhibited β-1,3-glucan synthesis in vivo and in vitro, apparently by directly binding β-1,3-glucan. Through its activity on the glucan layer, poacic acid inhibits growth of the fungi Sclerotinia sclerotiorum and Alternaria solani as well as the oomycete Phytophthora sojae. A single application of poacic acid to leaves infected with the broad-range fungal pathogen S. sclerotiorum substantially reduced lesion development. The discovery of poacic acid as a natural antifungal agent targeting β-1,3-glucan highlights the potential side use of products generated in the processing of renewable biomass toward biofuels as a source of valuable bioactive compounds and further clarifies the nature and mechanism of fermentation inhibitors found in lignocellulosic hydrolysates. PMID:25775513

  20. Distinct roles of cell wall biogenesis in yeast morphogenesis as revealed by multivariate analysis of high-dimensional morphometric data

    PubMed Central

    Okada, Hiroki; Ohnuki, Shinsuke; Roncero, Cesar; Konopka, James B.; Ohya, Yoshikazu

    2014-01-01

    The cell wall of budding yeast is a rigid structure composed of multiple components. To thoroughly understand its involvement in morphogenesis, we used the image analysis software CalMorph to quantitatively analyze cell morphology after treatment with drugs that inhibit different processes during cell wall synthesis. Cells treated with cell wall–affecting drugs exhibited broader necks and increased morphological variation. Tunicamycin, which inhibits the initial step of N-glycosylation of cell wall mannoproteins, induced morphologies similar to those of strains defective in α-mannosylation. The chitin synthase inhibitor nikkomycin Z induced morphological changes similar to those of mutants defective in chitin transglycosylase, possibly due to the critical role of chitin in anchoring the β-glucan network. To define the mode of action of echinocandin B, a 1,3-β-glucan synthase inhibitor, we compared the morphology it induced with mutants of Fks1 that contains the catalytic domain for 1,3-β-glucan synthesis. Echinocandin B exerted morphological effects similar to those observed in some fks1 mutants, with defects in cell polarity and reduced glucan synthesis activity, suggesting that echinocandin B affects not only 1,3-β-glucan synthesis, but also another functional domain. Thus our multivariate analyses reveal discrete functions of cell wall components and increase our understanding of the pharmacology of antifungal drugs. PMID:24258022

  1. Generation and characterization of β1,2-gluco-oligosaccharide probes from Brucella abortus cyclic β-glucan and their recognition by C-type lectins of the immune system

    PubMed Central

    Zhang, Hongtao; Palma, Angelina S; Zhang, Yibing; Childs, Robert A; Liu, Yan; Mitchell, Daniel A; Guidolin, Leticia S; Weigel, Wilfried; Mulloy, Barbara; Ciocchini, Andrés E; Feizi, Ten; Chai, Wengang

    2016-01-01

    The β1,2-glucans produced by bacteria are important in invasion, survival and immunomodulation in infected hosts be they mammals or plants. However, there has been a lack of information on proteins which recognize these molecules. This is partly due to the extremely limited availability of the sequence-defined oligosaccharides and derived probes for use in the study of their interactions. Here we have used the cyclic β1,2-glucan (CβG) of the bacterial pathogen Brucella abortus, after removal of succinyl side chains, to prepare linearized oligosaccharides which were used to generate microarrays. We describe optimized conditions for partial depolymerization of the cyclic glucan by acid hydrolysis and conversion of the β1,2-gluco-oligosaccharides, with degrees of polymerization 2–13, to neoglycolipids for the purpose of generating microarrays. By microarray analyses, we show that the C-type lectin receptor DC-SIGNR, like the closely related DC-SIGN we investigated earlier, binds to the β1,2-gluco-oligosaccharides, as does the soluble immune effector serum mannose-binding protein. Exploratory studies with DC-SIGN are suggestive of the recognition also of the intact CβG by this receptor. These findings open the way to unravelling mechanisms of immunomodulation mediated by β1,2-glucans in mammalian systems. PMID:27053576

  2. Respiratory Tract Infections and the Role of Biologically Active Polysaccharides in Their Management and Prevention.

    PubMed

    Jesenak, Milos; Urbancikova, Ingrid; Banovcin, Peter

    2017-07-20

    Respiratory tract infections (RTIs) are the most common form of infections in every age category. Recurrent respiratory tract infections (RRTIs), a specific form of RTIs, represent a typical and common problem associated with early childhood, causing high indirect and direct costs on the healthcare system. They are usually the consequence of immature immunity in children and high exposure to various respiratory pathogens. Their rational management should aim at excluding other severe chronic diseases associated with increased morbidity (e.g., primary immunodeficiency syndromes, cystic fibrosis, and ciliary dyskinesia) and at supporting maturity of the mucosal immune system. However, RRTIs can also be observed in adults (e.g., during exhausting and stressful periods, chronic inflammatory diseases, secondary immunodeficiencies, or in elite athletes) and require greater attention. Biologically active polysaccharides (e.g., β-glucans) are one of the most studied natural immunomodulators with a pluripotent mode of action and biological activity. According to many studies, they possess immunomodulatory, anti-inflammatory, and anti-infectious activities and therefore could be suggested as an effective part of treating and preventing RTIs. Based on published studies, the application of β-glucans was proven as a possible therapeutic and preventive approach in managing and preventing recurrent respiratory tract infections in children (especially β-glucans from Pleurotus ostreatus ), adults (mostly the studies with yeast-derived β-glucans), and in elite athletes (studies with β-glucans from Pleurotus ostreatus or yeast).

  3. β-1,3-Glucans are components of brown seaweed (Phaeophyceae) cell walls.

    PubMed

    Raimundo, Sandra Cristina; Pattathil, Sivakumar; Eberhard, Stefan; Hahn, Michael G; Popper, Zoë A

    2017-03-01

    LAMP is a cell wall-directed monoclonal antibody (mAb) that recognizes a β-(1,3)-glucan epitope. It has primarily been used in the immunolocalization of callose in vascular plant cell wall research. It was generated against a brown seaweed storage polysaccharide, laminarin, although it has not often been applied in algal research. We conducted in vitro (glycome profiling of cell wall extracts) and in situ (immunolabeling of sections) studies on the brown seaweeds Fucus vesiculosus (Fucales) and Laminaria digitata (Laminariales). Although glycome profiling did not give a positive signal with the LAMP mAb, this antibody clearly detected the presence of the β-(1,3)-glucan in situ, showing that this epitope is a constituent of these brown algal cell walls. In F. vesiculosus, the β-(1,3)-glucan epitope was present throughout the cell walls in all thallus parts; in L. digitata, the epitope was restricted to the sieve plates of the conductive elements. The sieve plate walls also stained with aniline blue, a fluorochrome used as a probe for callose. Enzymatic digestion with an endo-β-(1,3)-glucanase removed the ability of the LAMP mAb to label the cell walls. Thus, β-(1,3)-glucans are structural polysaccharides of F. vesiculosus cell walls and are integral components of the sieve plates in these brown seaweeds, reminiscent of plant callose.

  4. Linkage specificity and role of properdin in activation of the alternative complement pathway by fungal glycans.

    PubMed

    Agarwal, Sarika; Specht, Charles A; Haibin, Huang; Ostroff, Gary R; Ram, Sanjay; Rice, Peter A; Levitz, Stuart M

    2011-01-01

    Fungal cell walls are predominantly composed of glucans, mannans, and chitin. Recognition of these glycans by the innate immune system is a critical component of host defenses against the mycoses. Complement, an important arm of innate immunity, plays a significant role in fungal pathogenesis, especially the alternative pathway (AP). Here we determine that the glycan monosaccharide composition and glycosidic linkages affect AP activation and C3 deposition. Furthermore, properdin, a positive regulator of the AP, contributes to these functions. AP activation by glycan particles that varied in composition and linkage was measured by C3a generation in serum treated with 10 mM EGTA and 10 mM Mg(2+) (Mg-EGTA-treated serum) (AP specific; properdin functional) or Mg-EGTA-treated serum that lacked functional properdin. Particles that contained either β1→3 or β1→6 glucans or both generated large and similar amounts of C3a when the AP was intact. Blocking properdin function resulted in 5- to 10-fold-less C3a production by particulate β1→3 glucans. However, particulate β1→6 glucans generated C3a via the AP only in the presence of intact properdin. Interestingly, zymosan and glucan-mannan particles (GMP), which contain both β-glucans and mannans, also required properdin to generate C3a. The β1→4 glycans chitin and chitosan minimally activated C3 even when properdin was functional. Finally, properdin binding to glucan particles (GP) and zymosan in serum required active C3. Properdin colocalized with bound C3, suggesting that in the presence of serum, properdin bound indirectly to glycans through C3 convertases. These findings provide a better understanding of how properdin facilitates AP activation by fungi through interaction with the cell wall components. Invasive fungal infections have increased in incidence with the widespread use of immunosuppressive therapy and invasive procedures. Activation of the complement system contributes to innate immunity against fungi by generating chemoattractants that recruit white blood cells and by coating the pathogen with complement fragments that "mark" them for phagocytosis. The fungal cell wall activates complement in an antibody-independent manner through the alternative pathway (AP). Properdin is a positive regulator of the AP. This study elucidates how the specificity of cell wall glycan linkages affects AP activation and the role properdin plays in this process. Particulate β1→3 glucans activated the AP even in the absence of properdin, while β1→6 glucans required properdin for AP activation. In contrast, the β1→4 glycans chitin and chitosan failed to activate the AP. These findings enhance our mechanistic understanding of how fungi activate complement and have implications for the use of glycans in biomedical applications.

  5. Fractionation of oats into products enriched with protein, beta-glucan, starch, or other carbohydrates

    USDA-ARS?s Scientific Manuscript database

    A modified wet method was developed to fractionate ground oat groats into 4 fractions enriched with beta-glucan (BG), protein, starch, and other carbohydrates (CHO), respectively. Effects of defatting oats and centrifuge force for separation were also investigated. Results show that, depending on ...

  6. Secreted expression of Leuconostoc mesenteroides glucansucrase in Lactococcus lactis for the production of insoluble glucans

    USDA-ARS?s Scientific Manuscript database

    We expressed a glucansucrase, DsrI, from Leuconostoc mesenteroides that catalyzes formation of water-insoluble glucans from sucrose in Lactococcus lactis using a nisin-controlled gene expression system. Production of DsrI was optimized using several different background vectors, signal peptides, str...

  7. Wet processing barley grains into concentrates with protein, beta-glucan, and starch

    USDA-ARS?s Scientific Manuscript database

    An improved wet method was developed to process barley into fractions concentrated in protein, (1-3)(1-4)-b-D-glucan (BG), starch, or other carbohydrates (CHO). Alkaline concentration, solvent to barley flour ratio (SFR), and extraction temperature were evaluated for their effects on concentration a...

  8. Pasting and rheological properties of chia composites containing barley flour

    USDA-ARS?s Scientific Manuscript database

    The chia containing omega-3 polyunsaturated fatty acids (omega-3 PUFAs) was composited with barley flour having high ß-glucan content. Both omega-3 PUFAs and ß-glucan are well known for lowering blood cholesterol and preventing coronary heart disease. Barley flour was dry blended with ground chia ...

  9. Multiple-particle tracking study of the microheterogeneity of beta-glucan-rich hydrocolloidal extractive suspensions

    USDA-ARS?s Scientific Manuscript database

    Nutrim-10 is a newly developed food product containing the dietary of soluble fiber ß-glucan. The micro-structural heterogeneities of Nutrim-10 suspensions were investigated by monitoring the thermally driven displacements of well-dispersed microspheres via video fluorescence microscopy. By comparin...

  10. Viscoelastic properties of oat ß-glucan-rich aqueous dispersions

    USDA-ARS?s Scientific Manuscript database

    C-trim is a healthy food product containing the dietary of soluble fiber ß-glucan. The suspension of C-trim in water is a hydrocolloid biopolymer. The linear and non-linear rheological properties for suspensions of C-trim biopolymers were investigated. The linear viscoelastic behaviors for C-trim...

  11. Glucansucrases from lactic acid bacteria which produce water-insoluble polysaccharides from sucrose

    USDA-ARS?s Scientific Manuscript database

    Dextrans and related glucans produced from sucrose by lactic acid bacteria have been studied for many years and are used in numerous commercial applications and products. Most of these glucans are water-soluble, except for a few notable exceptions from cariogenic Streptococcus spp. and a very small ...

  12. Role of anionic charges of osmoregulated periplasmic glucans of Salmonella enterica Serovar Typhimurium SL1344 in mice virulence

    USDA-ARS?s Scientific Manuscript database

    Osmoregulated periplasmic glucans (OPGs) are important periplasmic constituents of Salmonella spp. and are required for optimal growth in hypoosmotic environments such as irrigation and vegetable wash waters as well as for mice virulence. opgB gene of Salmonella enterica serovar Typhimurium was ide...

  13. Swarm and swim motilities of Salmonella enterica serovar Typhimurium and role of osmoregulated periplasmic glucans

    USDA-ARS?s Scientific Manuscript database

    Background: Salmonella enterica serovar Typhimurium strains synthesize osmoregulated periplasmic glucans (OPGs) under low osmolarity conditions (< 70 mos mol l-1). OPG synthesis is not observed when cells are grown in iso- or hyper-osmotic media (> 400 mos mol l-1). Mutation in OPG structural gene...

  14. Effects of mutations on the insoluble glucan synthesized by Leuconostoc mesenteroides NRRL B-1118 glucansucrase

    USDA-ARS?s Scientific Manuscript database

    Twelve different amino acids were each substituted for Threonine-654 in a cloned glucansucrase from Leuconostoc mesenteroides NRRL B-1118 (DSR-I). The native enzyme produces a water-insoluble glucan containing approximately 44 mol% 1,3-disubstituted a-D-glucopyranosyl units and 29 mol% 1,6-disubstit...

  15. ß-1,3 glucan derived from Euglena gracilis and Algamune enhances innate immune responses of red drum (Sciaenops ocellatus L.)

    USDA-ARS?s Scientific Manuscript database

    To reduce susceptibility to stressors and diseases, immune-modulators such as ß-glucans have been proven effective tools to enhance the innate immune responses of fish. Consequently, commercial sources of this polysaccharide are becoming increasingly more available. AlgamuneTM is a commercial addi...

  16. Genetic dissection of grain beta-glucan and amylose content in barley (Hordeum vulgare L.)

    USDA-ARS?s Scientific Manuscript database

    High beta glucan (BG) barleys (Hordeum vulgare L.) have major potential as food ingredients due to the well know health benefits. Quantitative trait loci (QTLs) associated with BG have been reported in hulled barley, however no QTL studies have been reported in hulless barley. In this study, QTL an...

  17. Isolation of Hybridomas for Golgi-associated Proteins and a Plant Calmodulin

    NASA Technical Reports Server (NTRS)

    Kuzmanoff, K. M.; Ray, P. M.

    1985-01-01

    The demonstration of a role for calcium in the mechanism of the gravitropic response indicates a role for calmodulin. Localization studies indicate that plant cell walls have a high content of calmodulin which suggests a regulatory role for CaM in both gravitropic curvature and auxin-induced growth. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the ctivity of Golgi-localized B-1,4-glucan synthase (GS), an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. In order to determine whether auxin stimulates GS activity either by modulation of existing enzyme or induces de novo formation of Golgi glucan synthase, a study was undertaken to isolate and quantitate glucan synthase. This enzyme appears to be an integral protein of the Golgi membrane and has resisted isolation with retention of activity. The production of monoclonal antibody for glucan synthase was undertaken due to the inability to isolate GS by standard detergent/liposome techniques.

  18. Enhancement of enzymatic hydrolysis and Klason lignin removal of corn stover using photocatalyst-assisted ammonia pretreatment.

    PubMed

    Yoo, Chang Geun; Wang, Chao; Yu, Chenxu; Kim, Tae Hyun

    2013-03-01

    Photocatalyst-assisted ammonia pretreatment was explored to improve lignin removal of the lignocellulosic biomass for effective sugar conversion. Corn stover was treated with 5.0-12.5 wt.% ammonium hydroxide, two different photocatalysts (TiO(2) and ZnO) in the presence of molecular oxygen in a batch reactor at 60 °C. Various solid-to-liquid ratios (1:20-1:50) were also tested. Ammonia pretreatment assisted by TiO(2)-catalyzed photo-degradation removed 70 % of Klason lignin under the optimum condition (12.5 % ammonium hydroxide, 60 °C, 24 h, solid/liquid=1:20, photocatalyst/biomass=1:10 with oxygen atmosphere). The enzymatic digestibilities of pretreated corn stover were 85 % for glucan and 75 % for xylan with NH(3)-TiO(2)-treated solid and 82 % for glucan and 77 % for xylan with NH(3)-ZnO-treated solid with 15 filter paper units/g-glucan of cellulase and 30 cellobiase units/g-glucan of β-glucosidase, a 2-13 % improvement over ammonia pretreatment alone.

  19. Fungal Allergen β-Glucans Trigger p38 Mitogen-Activated Protein Kinase–Mediated IL-6 Translation in Lung Epithelial Cells

    PubMed Central

    Neveu, Wendy A.; Bernardo, Edgar; Allard, Jenna L.; Nagaleekar, Viswas; Wargo, Matthew J.; Davis, Roger J.; Iwakura, Yoichiro; Whittaker, Laurie A.

    2011-01-01

    In addition to immune cells, airway epithelial cells can contribute to and shape the immune response in the lung by secreting specific cytokines. IL-6 is a key factor in determining the effector fate of CD4+ T cells. Here we show that under basal conditions, the IL-6 gene is already highly expressed in lung epithelial cells, but not in immune cells resident in the lung. However, upon exposure of the lungs to fungal allergens, the direct contact of β-glucans present in the fungus cell wall with lung epithelial cells is sufficient to trigger the rapid synthesis and secretion of IL-6 protein. This posttranscriptional regulation of IL-6 in response to fungal extracts is mediated by the p38 mitogen-activated protein kinase pathway. The inhalation of β-glucans with a nonallergenic antigen is sufficient to provide an adjuvant effect that leads to mucous hyperplasia in the airways. Thus, β-glucans may constitute a common determinant of the fungal and plant-derived allergens responsible for some of the pathological features in allergic asthma. PMID:21642586

  20. Microbial cyclic β-(1→3),(1→6)-glucans as potential drug carriers: Interaction studies between cyclic β-glucans isolated from Bradyrhizobium japonicum and betulinic acid.

    PubMed

    Kambhampati, Naga Sai Visweswar; Kar, Swayamsiddha; Pinnepalli, Sai Siva Kumar; Chelli, Janardhana; Doble, Mukesh

    2018-10-05

    Betulinic acid (BA), a pentacyclic triterpenoid, is a very promising therapeutic drug with varied medicinal properties but it has low water solubility and consequentially low bioavailability. Cyclic β-(1→3),(1→6)-glucans (CBG), microbial cyclooligosaccharides produced by Bradyrhizobium japonicum ATCC 10324 having a cavity structure and good solubility in water have been tested for their ability to encapsulate betulinic acid and drug-binding interactions of CBG and BA were studied. First, in silico approach was employed to study the scope of any interaction between the CBG and BA. Then, the cyclic glucan-betulinic acid complexes were prepared in three compositions of 1:1, 1:2 and 1:3 CBG:BA. The complexes were analysed using UV-VIS spectroscopy, IR spectroscopy, powder XRD, differential scanning calorimetry (DSC) and thermogravimetric analysis (TGA) to confirm the computational results and consequently the encapsulation efficiency was found to be 9.53%. Copyright © 2017. Published by Elsevier B.V.

  1. Synthesis of New Hyperbranched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants.

    PubMed

    Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

    2016-01-20

    α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088, and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were targeted for mutagenesis both jointly and separately. Analysis of the mutational effects on enzyme function revealed that all D1085 and R1088 mutants catalyzed the synthesis of hyperbranched α-glucans with 15-22% branching (α1→3,6) linkages, compared to 13% in the wild-type GTF180. In addition, besides native (α1→6) and (α1→3) linkages, all of the mutations introduced a small amount of (α1→4) linkages (5% at most) in the polysaccharides produced. We conclude that α-helix 4 residues, especially D1085 and R1088, constituting part of the +2 acceptor binding subsite, are important determinants for the linkage specificity. The new hyperbranched α-glucans provide very interesting structural diversities and may find applications in the food industry.

  2. β-glucans and eicosapolyenoic acids as MAMPs in plant–oomycete interactions: past and present

    PubMed Central

    Robinson, Sara M.; Bostock, Richard M.

    2015-01-01

    Branched β-1,3-glucans and the eicosapolyenoic acids (EP) are among the best characterized oomycete elicitors that trigger innate immune responses in plants. These elicitors were identified over three decades ago, and they were useful in the study of the sequence of physiological, biochemical and molecular events that induce resistance in plants. However, in spite of the cross-kingdom parallels where these molecules are well-characterized as immune system modulators in animals, their perception and modes of action in plants remains obscure. Oomycetes are among the most important plant pathogens, responsible for diseases that devastate crops, ornamentals, and tree species worldwide. With the recent interest and advances in our understanding of innate immunity in plants, and the redefining of many of the classical elicitors as microbe-associated molecular patterns (MAMPs), it seems timely and important to reexamine β-glucans and EP using contemporary approaches. In this review, we highlight early studies of β-glucans and EP, discuss their roles as evolutionarily conserved signals, and consider their action in relation to current models of MAMP-triggered immunity. PMID:25628639

  3. Ultrasonically extracted β-d-glucan from artificially cultivated mushroom, characteristic properties and antioxidant activity.

    PubMed

    Alzorqi, Ibrahim; Sudheer, Surya; Lu, Ting-Jang; Manickam, Sivakumar

    2017-03-01

    Ganoderma mushroom cultivated recently in Malaysia to produce chemically different nutritional fibers has attracted the attention of the local market. The extraction methods, molecular weight and degree of branching of (1-3; 1-6)-β-d-glucan polysaccharides is of prime importance to determine its antioxidant bioactivity. Therefore three extraction methods i.e. hot water extraction (HWE), soxhlet extraction (SE) and ultrasound assisted extraction (US) were employed to study the total content of (1-3; 1-6)-β-d-glucans, degree of branching, structural characteristics, monosaccharides composition, as well as the total yield of polysaccharides that could be obtained from the artificially cultivated Ganoderma. The physical characteristics by HPAEC-PAD, HPGPC and FTIR, as well as the antioxidant in vitro assays of DPPH scavenging activity and ferric reducing power (FRAP) indicated that (1-3; 1-6)-β-d-glucans of Malaysian mushroom have better antioxidant activity, higher molecular weight and optimal degree of branching when extracted by US in comparison with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Conformational properties of two exopolysaccharides produced by Inquilinus limosus, a cystic fibrosis lung pathogen.

    PubMed

    Kuttel, Michelle; Ravenscroft, Neil; Foschiatti, Michela; Cescutti, Paola; Rizzo, Roberto

    2012-03-01

    Inquilinus limosus is a multi-resistant bacterium found in the respiratory tract of patients with cystic fibrosis. This bacterium produces two unique fully pyruvylated exopolysaccharides in similar quantities: an α-(1→2)-linked mannan and a β-(1→3)-linked glucan. We employed molecular modelling methods to probe the characteristic conformations and dynamics of these polysaccharides, with corroboration from potentiometric titrations and circular dichroism experiments. Our calculations reveal different structural motifs for the mannan and glucan polysaccharides: the glucan forms primarily right-handed helices with a wide range of extensions, while the mannan forms only left-handed helices. This finding is supported by our circular dichroism experiments. Our calculations also show that the (1→3)-β-d-Glcp linkage is more dynamically flexible than the (1→2)-α-d-Manp: the glucan characteristically forms a range of wide helices with large central cavities. In contrast, the mannan forms rigid regular 'bottlebrush' helices with a minimal central cavity. The widely different character of these two polymers suggests a possible differentiation of biological roles. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Effects of spaceflight on polysaccharides of Saccharomyces cerevisiae cell wall.

    PubMed

    Liu, Hong-Zhi; Wang, Qiang; Liu, Xiao-Yong; Tan, Sze-Sze

    2008-12-01

    Freeze-dried samples of four Saccharomyces cerevisiae strains, namely, FL01, FL03, 2.0016, and 2.1424, were subjected to spaceflight. After the satellite's landing on Earth, the samples were recovered and changes in yeast cell wall were analyzed. Spaceflight strains of all S. cerevisiae strains showed significant changes in cell wall thickness (P < 0.05). One mutant of S. cerevisiae 2.0016 with increased biomass, cell wall thickness, and cell wall glucan was isolated (P < 0.05). The spaceflight mutant of S. cerevisiae 2.0016 showed 46.7%, 62.6%, and 146.0% increment in biomass, cell wall thickness and beta-glucan content, respectively, when compared to the ground strain. Moreover, growth curve analysis showed spaceflight S. cerevisiae 2.0016 had a faster growth rate, shorter lag phase periods, higher final biomass, and higher content of beta-glucan. Genetic stability analysis showed that prolonged subculturing of spaceflight strain S. cerevisiae 2.0016 did not lead to the appearance of variants, indicating that the genetic stability of S. cerevisiae 2.0016 mutant could be sufficient for its exploitation of beta-glucan production.

  6. D-glucans from edible mushrooms: a review on the extraction, purification and chemical characterization approaches.

    PubMed

    Ruthes, Andrea Caroline; Smiderle, Fhernanda Ribeiro; Iacomini, Marcello

    2015-03-06

    D-Glucans from edible mushrooms present diversified chemical structures. The most common type consists of a backbone of β-D-glucose (1→3)-linked frequently branched at O-6 by β-D-glucose residues as side chains. However it is possible to distinguish α-, β- and mixed D-glucans. Further discrimination could be made on the basis of glycosidic bond position in a pyranoid ring, distribution of specific glycosidic bonds along the chain, branching and molecular weight. The present manuscript reviews the processes of extraction, purification and chemical characterization of D-glucans, such as NMR studies, methylation analysis, Smith degradation, and some other methodologies employed in carbohydrate chemistry characterization. In addition, these polysaccharides are important because they can provide many therapeutic benefits related to their biological activity in animals and humans, either immunostimulatory activity, inhibiting tumor growth, as well as exerting antinociceptive and anti-inflammatory action, among others, which are usually attached to their structure, molecular weight and degree of branching. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Xylose production from corn stover biomass by steam explosion combined with enzymatic digestibility.

    PubMed

    Liu, Zhi-Hua; Chen, Hong-Zhang

    2015-10-01

    A novel conversion process using steam explosion combined with enzymatic digestibility was exploited to increase sugar yield. Results showed that glucan and xylan recovery decreased with the increase of holding temperature and residence time in SE, respectively, while glucan and xylan conversion exhibited an opposite trend. The optimal conditions of steam explosion were 160 °C and 48 min, under which glucan and xylan recovery was 93.4% and 71.6%, respectively. Glucan and xylan conversion at 18% solid loading by periodic peristalsis increased by 3.4-5.8% and 4.5-6.2%, respectively, compared with that by water baths shaker. In the whole process, glucose, xylose and total sugar yield reached to 77.3%, 62.8% and 72.3%, respectively. The yield of hydroxymethyl furfural, furfural and lignin-derived products was 6.3 × 10(-2), 7.5 × 10(-2) and less than 3.7 × 10(-2) g/100 g feedstock, respectively. This novel conversion process increased sugar recovery, reduced degradation products formation, improved digestibility efficiency, and hence increased sugar yield. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. How Does the Preparation of Rye Porridge Affect Molecular Weight Distribution of Extractable Dietary Fibers?

    PubMed Central

    Rakha, Allah; Åman, Per; Andersson, Roger

    2011-01-01

    Extractable dietary fiber (DF) plays an important role in nutrition. This study on porridge making with whole grain rye investigated the effect of rest time of flour slurries at room temperature before cooking and amount of flour and salt in the recipe on the content of DF components and molecular weight distribution of extractable fructan, mixed linkage (1→3)(1→4)-β-d-glucan (β-glucan) and arabinoxylan (AX) in the porridge. The content of total DF was increased (from about 20% to 23% of dry matter) during porridge making due to formation of insoluble resistant starch. A small but significant increase in the extractability of β-glucan (P = 0.016) and AX (P = 0.002) due to rest time was also noted. The molecular weight of extractable fructan and AX remained stable during porridge making. However, incubation of the rye flour slurries at increased temperature resulted in a significant decrease in extractable AX molecular weight. The molecular weight of extractable β-glucan decreased greatly during a rest time before cooking, most likely by the action of endogenous enzymes. The amount of salt and flour used in the recipe had small but significant effects on the molecular weight of β-glucan. These results show that whole grain rye porridge made without a rest time before cooking contains extractable DF components maintaining high molecular weights. High molecular weight is most likely of nutritional importance. PMID:21686191

  9. How does the preparation of rye porridge affect molecular weight distribution of extractable dietary fibers?

    PubMed

    Rakha, Allah; Aman, Per; Andersson, Roger

    2011-01-01

    Extractable dietary fiber (DF) plays an important role in nutrition. This study on porridge making with whole grain rye investigated the effect of rest time of flour slurries at room temperature before cooking and amount of flour and salt in the recipe on the content of DF components and molecular weight distribution of extractable fructan, mixed linkage (1→3)(1→4)-β-d-glucan (β-glucan) and arabinoxylan (AX) in the porridge. The content of total DF was increased (from about 20% to 23% of dry matter) during porridge making due to formation of insoluble resistant starch. A small but significant increase in the extractability of β-glucan (P = 0.016) and AX (P = 0.002) due to rest time was also noted. The molecular weight of extractable fructan and AX remained stable during porridge making. However, incubation of the rye flour slurries at increased temperature resulted in a significant decrease in extractable AX molecular weight. The molecular weight of extractable β-glucan decreased greatly during a rest time before cooking, most likely by the action of endogenous enzymes. The amount of salt and flour used in the recipe had small but significant effects on the molecular weight of β-glucan. These results show that whole grain rye porridge made without a rest time before cooking contains extractable DF components maintaining high molecular weights. High molecular weight is most likely of nutritional importance.

  10. Plant-derived antifungal agent poacic acid targets β-1,3-glucan

    DOE PAGES

    Piotrowski, Jeff S.; Okada, Hiroki; Lu, Fachuang; ...

    2015-03-09

    A rise in resistance to current antifungals necessitates strategies to identify alternative sources of effective fungicides. We report the discovery of poacic acid, a potent antifungal compound found in lignocellulosic hydrolysates of grasses. Chemical genomics using Saccharomyces cerevisiae showed that loss of cell wall synthesis and maintenance genes conferred increased sensitivity to poacic acid. Morphological analysis revealed that cells treated with poacic acid behaved similarly to cells treated with other cell wall-targeting drugs and mutants with deletions in genes involved in processes related to cell wall biogenesis. Poacic acid causes rapid cell lysis and is synergistic with caspofungin and fluconazole.more » The cellular target was identified; poacic acid localized to the cell wall and inhibited β-1,3-glucan synthesis in vivo and in vitro, apparently by directly binding β-1,3-glucan. Through its activity on the glucan layer, poacic acid inhibits growth of the fungi Sclerotinia sclerotiorum and Alternaria solani as well as the oomycete Phytophthora sojae. A single application of poacic acid to leaves infected with the broad-range fungal pathogen S. sclerotiorum substantially reduced lesion development. In conclusion, the discovery of poacic acid as a natural antifungal agent targeting β-1,3-glucan highlights the potential side use of products generated in the processing of renewable biomass toward biofuels as a source of valuable bioactive compounds and further clarifies the nature and mechanism of fermentation inhibitors found in lignocellulosic hydrolysates.« less

  11. Structure-function relationships of family GH70 glucansucrase and 4,6-α-glucanotransferase enzymes, and their evolutionary relationships with family GH13 enzymes.

    PubMed

    Meng, Xiangfeng; Gangoiti, Joana; Bai, Yuxiang; Pijning, Tjaard; Van Leeuwen, Sander S; Dijkhuizen, Lubbert

    2016-07-01

    Lactic acid bacteria (LAB) are known to produce large amounts of α-glucan exopolysaccharides. Family GH70 glucansucrase (GS) enzymes catalyze the synthesis of these α-glucans from sucrose. The elucidation of the crystal structures of representative GS enzymes has advanced our understanding of their reaction mechanism, especially structural features determining their linkage specificity. In addition, with the increase of genome sequencing, more and more GS enzymes are identified and characterized. Together, such knowledge may promote the synthesis of α-glucans with desired structures and properties from sucrose. In the meantime, two new GH70 subfamilies (GTFB- and GTFC-like) have been identified as 4,6-α-glucanotransferases (4,6-α-GTs) that represent novel evolutionary intermediates between the family GH13 and "classical GH70 enzymes". These enzymes are not active on sucrose; instead, they use (α1 → 4) glucans (i.e. malto-oligosaccharides and starch) as substrates to synthesize novel α-glucans by introducing linear chains of (α1 → 6) linkages. All these GH70 enzymes are very interesting biocatalysts and hold strong potential for applications in the food, medicine and cosmetic industries. In this review, we summarize the microbiological distribution and the structure-function relationships of family GH70 enzymes, introduce the two newly identified GH70 subfamilies, and discuss evolutionary relationships between family GH70 and GH13 enzymes.

  12. Respiratory Tract Infections and the Role of Biologically Active Polysaccharides in Their Management and Prevention

    PubMed Central

    Jesenak, Milos; Urbancikova, Ingrid; Banovcin, Peter

    2017-01-01

    Respiratory tract infections (RTIs) are the most common form of infections in every age category. Recurrent respiratory tract infections (RRTIs), a specific form of RTIs, represent a typical and common problem associated with early childhood, causing high indirect and direct costs on the healthcare system. They are usually the consequence of immature immunity in children and high exposure to various respiratory pathogens. Their rational management should aim at excluding other severe chronic diseases associated with increased morbidity (e.g., primary immunodeficiency syndromes, cystic fibrosis, and ciliary dyskinesia) and at supporting maturity of the mucosal immune system. However, RRTIs can also be observed in adults (e.g., during exhausting and stressful periods, chronic inflammatory diseases, secondary immunodeficiencies, or in elite athletes) and require greater attention. Biologically active polysaccharides (e.g., β-glucans) are one of the most studied natural immunomodulators with a pluripotent mode of action and biological activity. According to many studies, they possess immunomodulatory, anti-inflammatory, and anti-infectious activities and therefore could be suggested as an effective part of treating and preventing RTIs. Based on published studies, the application of β-glucans was proven as a possible therapeutic and preventive approach in managing and preventing recurrent respiratory tract infections in children (especially β-glucans from Pleurotus ostreatus), adults (mostly the studies with yeast-derived β-glucans), and in elite athletes (studies with β-glucans from Pleurotus ostreatus or yeast). PMID:28726737

  13. Seasonality in airborne bacterial, fungal, and (1→3)-β-D-glucan concentrations in two indoor laboratory animal rooms.

    PubMed

    Hwang, Sungho; Ko, Yeji; Park, Donguk; Yoon, Chungsik

    2018-01-01

    The purpose of this study was to assess the temporal changes in the concentrations of bioaerosols in a laboratory mouse room (LMR) and laboratory rabbit room (LRR), and to determine environmental factors associated with the culturable bacteria, fungi and (1→3)-β-D-glucan concentrations. The concentrations of culturable airborne bacteria, fungi and (1→3)-β-D-glucan in the LMR and LRR were sampled once a month from March 2011 to February 2012. A single-stage viable cascade impactor was used to sample bacteria and fungi, while a two-stage cyclone bioaerosol sampler was used to collect airborne (1→3)-β-D-glucan. The culturable bacterial concentrations in the LMR showed a gradual increase during the summer. The culturable fungal concentrations showed similar seasonal patterns of change in the LMR and LRR with a noticeable increase during the summer. The (1→3)-β-D-glucan concentrations were highest during the warmer spring and summer months. Relative humidity (RH) was the environmental factor most associated with the concentrations of culturable bacteria and fungi. The overall airborne microbe concentrations were significantly higher in the LRR than in the LMR. Airborne microbe concentrations in the LMR and LRR varied greatly depending on season, and these changes were affected by environmental factors. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  14. Comprehensive functional characterization of the Glycoside Hydrolase Family 3 enzymes from Cellvibrio japonicus reveals unique metabolic roles in biomass saccharification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nelson, Cassandra E.; Attia, Mohamed A.; Rogowski, Artur

    Here, lignocellulose degradation is central to the carbon cycle and renewable biotechnologies. The xyloglucan (XyG), β(1!3)/β(1!4) mixed-linkage glucan (MLG), and β(1!3) glucan components of lignocellulose represent significant carbohydrate energy sources for saprophytic microorganisms. The bacterium Cellvibrio japonicus has a robust capacity for plant polysaccharide degradation, due to a genome encoding a large contingent of Carbohydrate-Active Enzymes (CAZymes), many of whose specific functions remain unknown. Using a comprehensive genetic and biochemical approach we have delineated the physiological roles of the four C. japonicus Glycoside Hydrolase Family 3 (GH3) members on diverse β-glucans. Despite high protein sequence similarity and partially overlapping activitymore » profiles on disaccharides, these β-glucosidases are not functionally equivalent. Bgl3A has a major role in MLG and sophorose utilization, and supports β(1!3) glucan utilization, while Bgl3B underpins cellulose utilization and supports MLG utilization. Bgl3C drives β(1!3) glucan utilization. Finally, Bgl3D is the crucial β-glucosidase for XyG utilization. This study not only sheds the light on the metabolic machinery of C. japonicus, but also expands the repertoire of characterized CAZymes for future deployment in biotechnological applications. In particular, the precise functional analysis provided here serves as a reference for informed bioinformatics on the genomes of other Cellvibrio and related species.« less

  15. Comprehensive functional characterization of the Glycoside Hydrolase Family 3 enzymes from Cellvibrio japonicus reveals unique metabolic roles in biomass saccharification

    DOE PAGES

    Nelson, Cassandra E.; Attia, Mohamed A.; Rogowski, Artur; ...

    2017-10-20

    Here, lignocellulose degradation is central to the carbon cycle and renewable biotechnologies. The xyloglucan (XyG), β(1!3)/β(1!4) mixed-linkage glucan (MLG), and β(1!3) glucan components of lignocellulose represent significant carbohydrate energy sources for saprophytic microorganisms. The bacterium Cellvibrio japonicus has a robust capacity for plant polysaccharide degradation, due to a genome encoding a large contingent of Carbohydrate-Active Enzymes (CAZymes), many of whose specific functions remain unknown. Using a comprehensive genetic and biochemical approach we have delineated the physiological roles of the four C. japonicus Glycoside Hydrolase Family 3 (GH3) members on diverse β-glucans. Despite high protein sequence similarity and partially overlapping activitymore » profiles on disaccharides, these β-glucosidases are not functionally equivalent. Bgl3A has a major role in MLG and sophorose utilization, and supports β(1!3) glucan utilization, while Bgl3B underpins cellulose utilization and supports MLG utilization. Bgl3C drives β(1!3) glucan utilization. Finally, Bgl3D is the crucial β-glucosidase for XyG utilization. This study not only sheds the light on the metabolic machinery of C. japonicus, but also expands the repertoire of characterized CAZymes for future deployment in biotechnological applications. In particular, the precise functional analysis provided here serves as a reference for informed bioinformatics on the genomes of other Cellvibrio and related species.« less

  16. Comprehensive functional characterization of the glycoside hydrolase family 3 enzymes from Cellvibrio japonicus reveals unique metabolic roles in biomass saccharification.

    PubMed

    Nelson, Cassandra E; Attia, Mohamed A; Rogowski, Artur; Morland, Carl; Brumer, Harry; Gardner, Jeffrey G

    2017-12-01

    Lignocellulose degradation is central to the carbon cycle and renewable biotechnologies. The xyloglucan (XyG), β(1→3)/β(1→4) mixed-linkage glucan (MLG) and β(1→3) glucan components of lignocellulose represent significant carbohydrate energy sources for saprophytic microorganisms. The bacterium Cellvibrio japonicus has a robust capacity for plant polysaccharide degradation, due to a genome encoding a large contingent of Carbohydrate-Active enZymes (CAZymes), many of whose specific functions remain unknown. Using a comprehensive genetic and biochemical approach, we have delineated the physiological roles of the four C. japonicus glycoside hydrolase family 3 (GH3) members on diverse β-glucans. Despite high protein sequence similarity and partially overlapping activity profiles on disaccharides, these β-glucosidases are not functionally equivalent. Bgl3A has a major role in MLG and sophorose utilization, and supports β(1→3) glucan utilization, while Bgl3B underpins cellulose utilization and supports MLG utilization. Bgl3C drives β(1→3) glucan utilization. Finally, Bgl3D is the crucial β-glucosidase for XyG utilization. This study not only sheds the light on the metabolic machinery of C. japonicus, but also expands the repertoire of characterized CAZymes for future deployment in biotechnological applications. In particular, the precise functional analysis provided here serves as a reference for informed bioinformatics on the genomes of other Cellvibrio and related species. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  17. Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

    PubMed

    Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

    2017-02-01

    Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Method for hull-less barley transformation and manipulation of grain mixed-linkage beta-glucan.

    PubMed

    Lim, Wai Li; Collins, Helen M; Singh, Rohan R; Kibble, Natalie A J; Yap, Kuok; Taylor, Jillian; Fincher, Geoffrey B; Burton, Rachel A

    2018-05-01

    Hull-less barley is increasingly offering scope for breeding grains with improved characteristics for human nutrition; however, recalcitrance of hull-less cultivars to transformation has limited the use of these varieties. To overcome this limitation, we sought to develop an effective transformation system for hull-less barley using the cultivar Torrens. Torrens yielded a transformation efficiency of 1.8%, using a modified Agrobacterium transformation method. This method was used to over-express genes encoding synthases for the important dietary fiber component, (1,3;1,4)-β-glucan (mixed-linkage glucan), primarily present in starchy endosperm cell walls. Over-expression of the HvCslF6 gene, driven by an endosperm-specific promoter, produced lines where mixed-linkage glucan content increased on average by 45%, peaking at 70% in some lines, with smaller increases in transgenic HvCslH1 grain. Transgenic HvCslF6 lines displayed alterations where grain had a darker color, were more easily crushed than wild type and were smaller. This was associated with an enlarged cavity in the central endosperm and changes in cell morphology, including aleurone and sub-aleurone cells. This work provides proof-of-concept evidence that mixed-linkage glucan content in hull-less barley grain can be increased by over-expression of the HvCslF6 gene, but also indicates that hull-less cultivars may be more sensitive to attempts to modify cell wall composition. © 2017 Institute of Botany, Chinese Academy of Sciences.

  19. Modulation of gene expression and cell cycle by botryosphaeran, a (1→3)(1→6)-β-d-glucan in human lymphocytes.

    PubMed

    Malini, Maressa; Souza, Marilesia Ferreira de; Oliveira, Marcelo Tempesta de; Antunes, Lusânia Maria Greggi; Figueiredo, Suely Gomes de; Barbosa, Aneli M; Dekker, Robert F H; Cólus, Ilce Mara de Syllos

    2015-01-01

    There is growing interest in the anticancer and immunomodulatory potential of fungal β-d-glucans. In the present study, the modulation of gene expression via RT-qPCR and cell cycle kinetics via flow cytometry were assessed in human normal and tumor (Jurkat) lymphocytes after treatment with botryosphaeran (a fungal (1→3)(1→6)-β-d-glucan) from Botryosphaeria rhodina MAMB-05. Cell cultures were treated with botryosphaeran either alone, or in combination with doxorubicin (DXR), in a post-treatment protocol. The expression of genes involved in immunomodulatory processes, apoptosis and cell cycle control, as well as β-d-glucans cell receptors were assessed. Flow cytometry analysis identified tetraploid Jurkat cells in G1 phase when treated with botryosphaeran combined with DXR. This antiproliferative effect in G1 may be associated with down-regulation of the expression of genes involved in the G1 checkpoint. The repression of the CCR5 gene following botryosphaeran treatment, either alone or in combination with DXR, in tumor lymphocytes indicates a possible affinity of this particular (1→3)(1→6)-β-d-glucan for the receptor CCR5. Therefore, botryosphaeran action appears to be involved in the repression of genes related to the G1 phase of the cell cycle and possibly in the interaction of the botryosphaeran, either alone, or in combination with DXR, with the CCR5 receptor. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Toxicological and immunomodulatory assessments of botryosphaeran (β-glucan) produced by Botryosphaeria rhodina RCYU 30101.

    PubMed

    Weng, Brian Bor-Chun; Lin, Yu-Chih; Hu, Chia-Wen; Kao, Ming-Yuan; Wang, Shih-Hao; Lo, Dan-Yuan; Lai, Tzu-Yuan; Kan, Lou-Sing; Chiou, Robin Yih-Yuan

    2011-04-01

    Toxicological and immunomodulatory activities of botryosphaeran (BR), a newly emerged β-glucan that comprises a β-(1 → 3) backbone and β-(1 → 6) branched glucose residues were assessed. BR was 1.82 × 10(6) Da (M.W.) estimated by reversely-linear equation constructed by regression of logarithms of standard polysaccharides and their retention times of gel permeation chromatography. Sprague-Dawley rats were daily gavage-administered with BR at doses of 0, 1.25, 12.5, and 125 mg/kg body weight (BW) for 28 d. Serum hematological and biochemical analysis of all treatment were all within normal ranges. Mitogen-stimulated lymphoblastogenesis of spleno-lymphocytes was enhanced by BR at doses of 1.25 and 12.5 mg/kg BW. Through in vitro comparative assessments, RAW 264.7 macrophage (RAW) cells were treated with BR and two commercial β-glucans, zymosan (ZY) and barley β-glucan (GB), to characterize their relative immunomodulatory properties. All three β-glucans stimulated phagocytosis on fluorescence-labeled Escherichia coli. At dose levels from 5 to 200 μg/mL for 24h, nitric oxide produced by BR- and ZY-treated cells were higher than those produced by GB-treated and control groups. BR, ZY but GB also stimulated RAW cells in producing TNF-α. The results demonstrate that BR is toxicologically accepted and features as a potent immunomodulator. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Use of β-glucan from spent brewer's yeast as a thickener in skimmed yogurt: Physicochemical, textural, and structural properties related to sensory perception.

    PubMed

    Raikos, Vassilios; Grant, Shannon B; Hayes, Helen; Ranawana, Viren

    2018-04-25

    Powdered β-glucan extracted from brewer's yeast (Yestimun, Leiber GmbH, Bramsche, Germany) was incorporated into skimmed-milk yogurt at varying concentrations (0.2-0.8% wt/wt) to investigate its potential application as a thickener. The effect of β-glucan fortification on the nutritional profile, microstructure, physicochemical properties, and texture of freshly prepared yogurts was investigated. Sensory evaluation was also conducted and was correlated with instrumental analysis. The addition of Yestimun significantly reduced the fermentation time of the yogurt mix from 4 h to 3 h. Scanning electron microscopy revealed that β-glucan particles formed small spherical clusters within the yogurt matrix. The majority of the physicochemical properties (syneresis, viscosity, color, and titratable acidity) remained unaffected by the incorporation of Yestimun in the recipe. Textural properties showed a gradual increment with increasing β-glucan concentration. Hardness, total work done, adhesive force, and adhesiveness increased by 19.27, 23.3, 21.53, and 20.76%, respectively, when using the highest amount of Yestimun powder. Sensory analysis (n = 40) indicated that fortifying yogurt with Yestimun at 0.8% (wt/wt) concentration may affect overall acceptance ratings, which was attributed to adverse flavor and aftertaste effects. However, the overall liking score of the yogurt (5.0/9.0) shows potential for commercialization of the product. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Novel Barley (1→3,1→4)-β-Glucan Endohydrolase Alleles Confer Increased Enzyme Thermostability.

    PubMed

    Lauer, Juanita C; Yap, Kuok; Cu, Suong; Burton, Rachel A; Eglinton, Jason K

    2017-01-18

    Barley (1→3,1→4)-β-glucan endohydrolases (β-glucanases; EI and EII) are primarily responsible for hydrolyzing high molecular weight (1→3,1→4)-β-glucans (β-glucan) during germination. Incomplete endosperm modification during malting results in residual β-glucan that can contribute to increased wort viscosity and beer chill haze. Four newly identified forms of EI and EII and the reference enzymes EI-a and EII-a were expressed in Escherichia coli, and the recombinant proteins were characterized for enzyme kinetics and thermostability. EI and EII variants that exhibited higher residual β-glucanase activity than EI-a and EII-a after heat treatment also exhibited increased substrate affinity and decreased turnover rates. The novel EII-l form exhibited significantly increased thermostability compared with the reference EII-a when activity was measured at elevated temperature. EII-l exhibited a T 50 value, which indicates the temperature at which 50% of β-glucanase activity remains, 1.3 °C higher than that of EII-a. The irreversible thermal inactivation difference between EII-a and EII-l after 5 min of heat treatment at 56 °C was 11.9%. The functional significance of the three amino acid differences between EII-a and EII-l was examined by making combinatorial mutations in EII-a using site-directed mutagenesis. The S20G and D284E amino acid substitutions were shown to be responsible for the increase in EII-1 thermostability.

  3. Quantitative Analysis of Carbon Flow into Photosynthetic Products Functioning as Carbon Storage in the Marine Coccolithophore, Emiliania huxleyi.

    PubMed

    Tsuji, Yoshinori; Yamazaki, Masatoshi; Suzuki, Iwane; Shiraiwa, Yoshihiro

    2015-08-01

    The bloom-forming coccolithophore Emiliania huxleyi (Haptophyta) is a dominant marine phytoplankton, cells of which are covered with calcareous plates (coccoliths). E. huxleyi produces unique lipids of C37-C40 long-chain ketones (alkenones) with two to four trans-unsaturated bonds, β-glucan (but not α-glucan) and acid polysaccharide (AP) associated with the morphogenesis of CaCO3 crystals in coccoliths. Despite such unique features, there is no detailed information on the patterns of carbon allocation into these compounds. Therefore, we performed quantitative estimation of carbon flow into various macromolecular products by conducting (14)C-radiotracer experiments using NaH(14)CO3 as a substrate. Photosynthetic (14)C incorporation into low molecular-mass compounds (LMC), extracellular AP, alkenones, and total lipids except alkenones was estimated to be 35, 13, 17, and 25 % of total (14)C fixation in logarithmic growth phase cells and 33, 19, 18, and 18 % in stationary growth phase cells, respectively. However, less than 1 % of (14)C was incorporated into β-glucan in both cells. (14)C-mannitol occupied ca. 5 % of total fixed (14)C as the most dominant LMC product. Levels of all (14)C compounds decreased in the dark. Therefore, alkenones and LMC (including mannitol), but not β-glucan, function in carbon/energy storage in E. huxleyi, irrespective of the growth phase. Compared with other algae, the low carbon flux into β-glucan is a unique feature of carbon metabolism in E. huxelyi.

  4. Effect of 1,3-1,6 β-Glucan on Natural and Experimental Deformed Wing Virus Infection in Newly Emerged Honeybees (Apis mellifera ligustica)

    PubMed Central

    Sagona, Simona; Carrozza, Maria Luisa; Forzan, Mario; Pizzurro, Federica; Bibbiani, Carlo; Miragliotta, Vincenzo; Abramo, Francesca; Millanta, Francesca; Bagliacca, Marco; Poli, Alessandro; Felicioli, Antonio

    2016-01-01

    The Western Honeybee is a key pollinator for natural as well as agricultural ecosystems. In the last decade massive honeybee colony losses have been observed worldwide, the result of a complex syndrome triggered by multiple stress factors, with the RNA virus Deformed Wing Virus (DWV) and the mite Varroa destructor playing crucial roles. The mite supports replication of DWV to high titers, which exert an immunosuppressive action and correlate with the onset of the disease. The aim of this study was to investigate the effect of 1,3–1,6 β-glucan, a natural innate immune system modulator, on honeybee response to low-titer natural and high-titer experimental DWV infection. As the effects exerted by ß-glucans can be remarkably different, depending on the target organism and the dose administered, two parallel experiments were performed, where 1,3–1,6 ß-glucan at a concentration of 0.5% and 2% respectively, was added to the diet of three cohorts of newly emerged honeybees, which were sampled from a Varroa-free apiary and harboured a low endogenous DWV viral titer. Each cohort was subjected to one of the following experimental treatments: no injection, injection of a high-copy number DWV suspension into the haemocel (experimental DWV infection) or injection of PBS into the haemocoel (physical injury). Control bees fed a ß-glucan-free diet were subjected to the same treatments. Viral load, survival rate, haemocyte populations and phenoloxidase activity of each experimental group were measured and compared. The results indicated that oral administration of 0.5% ß-glucan to naturally infected honeybees was associated with a significantly decrease of the number of infected bees and viral load they carried, and with a significant increase of the survival rate, suggesting that this natural immune modulator molecule might contribute to increase honeybee resistance to viral infection. PMID:27829027

  5. The genetics and transcriptional profiles of the cellulose synthase-like HvCslF gene family in barley.

    PubMed

    Burton, Rachel A; Jobling, Stephen A; Harvey, Andrew J; Shirley, Neil J; Mather, Diane E; Bacic, Antony; Fincher, Geoffrey B

    2008-04-01

    Cellulose synthase-like CslF genes have been implicated in the biosynthesis of (1,3;1,4)-beta-d-glucans, which are major cell wall constituents in grasses and cereals. Seven CslF genes from barley (Hordeum vulgare) can be divided into two classes on the basis of intron-exon arrangements. Four of the HvCslF genes have been mapped to a single locus on barley chromosome 2H, in a region corresponding to a major quantitative trait locus for grain (1,3;1,4)-beta-d-glucan content. The other HvCslF genes map to chromosomes 1H, 5H, and 7H, and in two cases the genes are close to other quantitative trait loci for grain (1,3;1,4)-beta-d-glucan content. Spatial and temporal patterns of transcription of the seven genes have been defined through quantitative polymerase chain reaction. In developing barley coleoptiles HvCslF6 mRNA is most abundant. Transcript levels are maximal in 4- to 5-d coleoptiles, at a time when (1,3;1,4)-beta-d-glucan content of coleoptile cell walls also reaches maximal levels. In the starchy endosperm of developing grain, HvCslF6 and HvCslF9 transcripts predominate. Two peaks of transcription are apparent. One occurs just after endosperm cellularization, 4 to 8 d after pollination, while the second occurs much later in grain development, more than 20 d after pollination. Marked varietal differences in transcription of the HvCslF genes are observed during endosperm development. Given the commercial importance of cereal (1,3;1,4)-beta-d-glucans in human nutrition, in stock feed, and in malting and brewing, the observation that only two genes, HvCslF6 and HvCslF9, are transcribed at high levels in developing grain is of potential relevance for the future manipulation of grain (1,3;1,4)-beta-d-glucan levels.

  6. [Biological contamination in office buildings related to ventilation/air conditioning system].

    PubMed

    Bródka, Karolina; Sowiak, Małgorzata; Kozajda, Anna; Cyprowski, Marcin; Irena, Szadkowska-Stańczyk

    2012-01-01

    Indoor air is contaminated with microorganisms coming from both the atmospheric air and sources present in premises. The aim of this study was to analyze the concentrations of biological agents in office buildings, dependending on ventilation/air conditioning system and season. The study covered office buildings (different in the system of ventila-tion/air conditioning). Air samples for assessing the levels of inhalable dust, endotoxins and (1-->3)-beta-D-glucans, were taken at the selected stationary points of each building during summer and winter. The air was sampled for 6 h, using portable sets consisting of the GilAir 5 pump and the head filled with a filter of fiber glass. The samples for the presence of airborne bacteria and fungi were collected twice during the day using the impaction method. Average concentrations of inhalable dust, bacteria, fungi, endotoxins and (1-->3)-beta-D-glucans in office premises were 0.09 mg/m3, 6.00 x 10(2) cfu/m3, 4.59 x 10(1) cfu/m3, 0.42 ng/m3 and 3.91 ng/m3, respectively. Higher concentrations of the investigated agents were found in summer. In premises with air conditioning concentrations of airborne fungi, (1-->3)-beta-D-glucans and inhalable dust were significantly lower in winter. In summer the trend was reverse except for (1-->3)-beta-D-glucans. Concentrations of biological agents were affected by the season and the presence of air conditioning. Concentrations of inhalable dust, bacteria, fungi, endotoxins and (1-->3)-beta-D-glucans, observed inside the office buildings, were significantly higher in summer than in winter. The presence of the air conditioning system modified in various ways the levels of biological agents. Its influence was greater on the concentration of fungi and (1-->3)-beta-D-glucans than on that of bacteria and endotoxins.

  7. Aerosolization of fungi, (1→3)-β-D glucan, and endotoxin from flood-affected materials collected in New Orleans homes

    PubMed Central

    Adhikari, Atin; Jung, Jaehee; Reponen, Tiina; Lewis, Jocelyn Suzanne; DeGrasse, Enjoli C.; Grimsley, L. Faye; Chew, Ginger L.; Grinshpun, Sergey A.

    2015-01-01

    Standing water and sediments remaining on flood-affected materials were the breeding ground for many microorganisms in flooded homes following Hurricane Katrina. The purpose of this laboratory study was to examine the aerosolization of culturable and total fungi, (1→3)-β-D glucan, and endotoxin from eight flood-affected floor and bedding materials collected in New Orleans homes, following Hurricane Katrina. Aerosolization was examined using the Fungal Spore Source Strength Tester (FSSST) connected to a BioSampler. Dust samples were collected by vacuuming. A two-stage cyclone sampler was used for size-selective analysis of aerosolized glucan and endotoxin. On average, levels of culturable fungi ranged from undetectable (lower limit = 8.3×104) to 2.6×105 CFU/m2; total fungi ranged from 2.07×105 to 1.6×106 spores/m2; (1→3)-β-D glucan and endotoxin were 2.0×103 – 2.9×104 ng/m2 and 7.0×102 – 9.3×104 EU/m2, respectively. The results showed that 5–15 min sampling is sufficient for detecting aerosolizable biocontaminants with the FSSST. Smaller particle size fractions (<1.0 μm and <1.8 μm) have levels of glucan and endotoxin comparable to larger (>1.8 μm) fractions, which raises additional exposure concerns. Vacuuming was found to overestimate inhalation exposure risks by a factor of approximately 102 for (1→3)-β-D glucan and by 103 to 104 for endotoxin as detected by the FSSST. The information generated from this study is important with respect to restoration and rejuvenation of the flood-affected areas in New Orleans. We believe the findings will be significant during similar disasters in other regions of the world including major coastal floods from tsunamis. PMID:19201399

  8. The effects of gene disruption of Kre6-like proteins on the phenotype of β-glucan-producing Aureobasidium pullulans.

    PubMed

    Uchiyama, Hirofumi; Iwai, Atsushi; Dohra, Hideo; Ohnishi, Toshiyuki; Kato, Tatsuya; Park, Enoch Y

    2018-05-01

    Killer toxin resistant 6 (Kre6) and its paralog, suppressor of Kre null 1 (Skn1), are thought to be involved in the biosynthesis of cell wall β-(1 → 6)-D-glucan in baker's yeast, Saccharomyces cerevisiae. The Δkre6Δskn1 mutant of S. cerevisiae and other fungi shows severe growth defects due to the failure to synthesize normal cell walls. In this study, two homologs of Kre6, namely, K6LP1 (Kre6-like protein 1) and K6LP2 (Kre6-like protein 2), were identified in Aureobasidium pullulans M-2 by draft genome analysis. The Δk6lp1, Δk6lp2, and Δk6lp1Δk6lp2 mutants were generated in order to confirm the functions of the Kre6-like proteins in A. pullulans M-2. The cell morphologies of Δk6lp1 and Δk6lp1Δk6lp2 appeared to be different from those of wild type and Δk6lp2 in both their yeast and hyphal forms. The productivity of the extracellular polysaccharides, mainly composed of β-(1 → 3),(1 → 6)-D-glucan (β-glucan), of the mutants was 5.1-17.3% less than that of wild type, and the degree of branching in the extracellular β-glucan of mutants was 14.5-16.8% lower than that of wild type. This study showed that the gene disruption of Kre6-like proteins affected the cell morphology, the productivity of extracellular polysaccharides, and the structure of extracellular β-glucan, but it did not have a definite effect on the cell viability even in Δk6lp1Δk6lp2, unlike in the Δkre6Δskn1 of S. cerevisiae.

  9. Differential Effects of Two Fermentable Carbohydrates on Central Appetite Regulation and Body Composition

    PubMed Central

    Gibson, Glenn R.; Tuohy, Kieran M.; Sharma, Raj Kumar; Swann, Jonathan R.; Deaville, Eddie R.; Sleeth, Michele L.; Thomas, E. Louise; Holmes, Elaine; Bell, Jimmy D.; Frost, Gary

    2012-01-01

    Background Obesity is rising at an alarming rate globally. Different fermentable carbohydrates have been shown to reduce obesity. The aim of the present study was to investigate if two different fermentable carbohydrates (inulin and β-glucan) exert similar effects on body composition and central appetite regulation in high fat fed mice. Methodology/Principal Findings Thirty six C57BL/6 male mice were randomized and maintained for 8 weeks on a high fat diet containing 0% (w/w) fermentable carbohydrate, 10% (w/w) inulin or 10% (w/w) β-glucan individually. Fecal and cecal microbial changes were measured using fluorescent in situ hybridization, fecal metabolic profiling was obtained by proton nuclear magnetic resonance (1H NMR), colonic short chain fatty acids were measured by gas chromatography, body composition and hypothalamic neuronal activation were measured using magnetic resonance imaging (MRI) and manganese enhanced MRI (MEMRI), respectively, PYY (peptide YY) concentration was determined by radioimmunoassay, adipocyte cell size and number were also measured. Both inulin and β-glucan fed groups revealed significantly lower cumulative body weight gain compared with high fat controls. Energy intake was significantly lower in β-glucan than inulin fed mice, with the latter having the greatest effect on total adipose tissue content. Both groups also showed an increase in the numbers of Bifidobacterium and Lactobacillus-Enterococcus in cecal contents as well as feces. β- glucan appeared to have marked effects on suppressing MEMRI associated neuronal signals in the arcuate nucleus, ventromedial hypothalamus, paraventricular nucleus, periventricular nucleus and the nucleus of the tractus solitarius, suggesting a satiated state. Conclusions/Significance Although both fermentable carbohydrates are protective against increased body weight gain, the lower body fat content induced by inulin may be metabolically advantageous. β-glucan appears to suppress neuronal activity in the hypothalamic appetite centers. Differential effects of fermentable carbohydrates open new possibilities for nutritionally targeting appetite regulation and body composition. PMID:22952656

  10. A novel glucan-binding protein with lipase activity from the oral pathogen Streptococcus mutans.

    PubMed

    Shah, Deepan S H; Russell, Roy R B

    2004-06-01

    Streptococcus mutans produces extracellular glucosyltransferases (GTFs) that synthesize glucans from sucrose. These glucans are important in determining the permeability properties and adhesiveness of dental plaque. GTFs and the GbpA glucan-binding protein are characterized by a binding domain containing a series of 33-amino-acid repeats, called 'A' repeats. The S. mutans genome sequence was searched for ORFs containing 'A' repeats, and one novel gene, gbpD, which appears to be unique to the mutans group of streptococci, was identified. The GbpD sequence revealed the presence of three 'A' repeats, in the middle of the protein, and a novel glucan-binding assay showed that GbpD binds to dextran with a K(D) of 2-3 nM. Construction of truncated derivatives of GbpD confirmed that the 'A' repeat region was essential for binding. Furthermore, a gbpD knockout mutant was modified in the extent of aggregation induced by polymers derived from sucrose. The N-terminus of GbpD has a signal sequence, followed by a region with no homologues in the public databases, while the C-terminus has homology to the alpha/beta hydrolase family (including lipases and carboxylesterases). GbpD contains the two regions typical of these enzymes: a GxSxG active site 'lipase box' and an 'oxyanion hole'. GbpD released free fatty acids (FFAs) from a range of triglycerides in the presence of calcium, indicating a lipase activity. The glucan binding/lipase bifunctionality suggested the natural substrate for the enzyme may be a surface macromolecule consisting of carbohydrate linked to lipid. The gbpD mutant was less hydrophobic than wild-type and pure recombinant GbpD reduced the hydrophobicity of S. mutans and another plaque bacterium, Streptococcus sanguinis. GbpD bound to and released FFA from lipoteichoic acid (LTA) of S. sanguinis, but had no effect on LTA from S. mutans. These results raise the intriguing possibility that GbpD may be involved in direct interspecies competition within the plaque biofilm.

  11. Comparison of methods for glycogen analysis of in vitro fermentation pellets produced with strained ruminal inoculum.

    PubMed

    Hall, Mary Beth; Hatfield, Ronald D

    2015-11-01

    Microbial glycogen measurement is used to account for fates of carbohydrate substrates. It is commonly applied to washed cells or pure cultures which can be accurately subsampled, allowing the use of smaller sample sizes. However, the nonhomogeneous fermentation pellets produced with strained rumen inoculum cannot be accurately subsampled, requiring analysis of the entire pellet. In this study, two microbial glycogen methods were compared for analysis of such fermentation pellets: boiling samples for 3h in 30% KOH (KOH) or for 15min in 0.2M NaOH (NaOH), followed by enzymatic hydrolysis with α-amylase and amyloglucosidase, and detection of released glucose. Total α-glucan was calculated as glucose×0.9. KOH and NaOH did not differ in the α-glucan detected in fermentation pellets (29.9 and 29.6mg, respectively; P=0.61). Recovery of different control α-glucans was also tested using KOH, NaOH, and a method employing 45min of bead beating (BB). For purified beef liver glycogen (water-soluble) recovery, BB (95.0%)>KOH (91.4%)>NaOH (87.4%; P<0.05), and for wheat starch (water-insoluble granules) recovery, NaOH (96.9%)>BB (93.8%)>KOH (91.0%; P<0.05). Recovery of isolated protozoal glycogen (water-insoluble granules) did not differ among KOH (87.0%), NaOH (87.6%), and BB (86.0%; P=0.81), but recoveries for all were below 90%. Differences among substrates in the need for gelatinization and susceptibility to destruction by alkali likely affected the results. In conclusion, KOH and NaOH glycogen methods provided comparable determinations of fermentation pellet α-glucan. The tests on purified α-glucans indicated that assessment of recovery in glycogen methods can differ by the control α-glucan selected. Published by Elsevier B.V.

  12. Sterigmatomyces halophilus β-glucan improves the immune response and bacterial resistance in Pacific red snapper (Lutjanus peru) peripheral blood leucocytes: In vitro study.

    PubMed

    Reyes-Becerril, Martha; Guardiola, Francisco A; Sanchez, Veronica; Maldonado, Minerva; Angulo, Carlos

    2018-04-21

    β-Glucans are naturally occurring polysaccharides that are produced by bacteria, fungi and yeast. They are considered immunostimulants in fish acting on non-specific defense mechanism. Yeast-derived glucans from cell wall (Sterigmatomyces halophilus, β-Gluc/Sh) have been used for this purpose in this study. Therefore, an in vitro assay using peripheral blood leucocytes (PBLs) from Pacific red snapper was performed to evaluate the stimulant effects of β-Gluc/Sh and zymosan A (positive control) for 12 and 24 h and after bacterial challenge with Aeromonas hydrophila at 24 h. In addition, structural characterization of this marine yeast glucan was performed by proton nuclear magnetic resonance (NMR) revealing structures containing (1-6)-branched (1-3)-β-D-glucan. PBLs responded positively to β-Gluc/Sh where cell viability was higher than 80%. After challenge, β-Gluc/Sh was able to inhibit cytotoxicity caused by A. hydrophila, highlighting that the PBLs incubated with β-Gluc/Sh significantly increased the non-specific immune response, such as phagocytic activity, respiratory burst, nitric oxide and peroxidase activities followed by an increase in superoxide dismutase and catalase activities after 12 and 24 h post-stimulation and after challenge with the pathogen. Regarding induction of antioxidant gene expression, it was more pronounced in stimulated β-Gluc/Sh leucocytes compared to other groups at all experimental times of the trial and after bacterial challenge. Indeed, our results clearly showed the ability of leucocytes to strongly react to β-Gluc/Sh with an increase in cytokine gene expression, particularly the IL-1β, IL-10 and IL-17 genes. These results confirm that S. halophilus yeast-derived β-glucan, isolated from an extreme marine environment, is beneficial for increasing innate immune response and enhancing resistance against A. hydrophila in vitro. Copyright © 2018. Published by Elsevier Ltd.

  13. The effect of oat β-glucan on LDL-cholesterol, non-HDL-cholesterol and apoB for CVD risk reduction: a systematic review and meta-analysis of randomised-controlled trials.

    PubMed

    Ho, Hoang V T; Sievenpiper, John L; Zurbau, Andreea; Blanco Mejia, Sonia; Jovanovski, Elena; Au-Yeung, Fei; Jenkins, Alexandra L; Vuksan, Vladimir

    2016-10-01

    Oats are a rich source of β-glucan, a viscous, soluble fibre recognised for its cholesterol-lowering properties, and are associated with reduced risk of CVD. Our objective was to conduct a systematic review and meta-analysis of randomised-controlled trials (RCT) investigating the cholesterol-lowering potential of oat β-glucan on LDL-cholesterol, non-HDL-cholesterol and apoB for the risk reduction of CVD. MEDLINE, Embase, CINAHL and Cochrane CENTRAL were searched. We included RCT of ≥3 weeks of follow-up, assessing the effect of diets enriched with oat β-glucan compared with controlled diets on LDL-cholesterol, non-HDL-cholesterol or apoB. Two independent reviewers extracted data and assessed study quality and risk of bias. Data were pooled using the generic inverse-variance method with random effects models and expressed as mean differences with 95 % CI. Heterogeneity was assessed by the Cochran's Q statistic and quantified by the I 2-statistic. In total, fifty-eight trials (n 3974) were included. A median dose of 3·5 g/d of oat β-glucan significantly lowered LDL-cholesterol (-0·19; 95 % CI -0·23, -0·14 mmol/l, P<0·00001), non-HDL-cholesterol (-0·20; 95 % CI -0·26, -0·15 mmol/l, P<0·00001) and apoB (-0·03; 95 % CI -0·05, -0·02 g/l, P<0·0001) compared with control interventions. There was evidence for considerable unexplained heterogeneity in the analysis of LDL-cholesterol (I 2=79 %) and non-HDL-cholesterol (I 2=99 %). Pooled analyses showed that oat β-glucan has a lowering effect on LDL-cholesterol, non-HDL-cholesterol and apoB. Inclusion of oat-containing foods may be a strategy for achieving targets in CVD reduction.

  14. β-1,4-Glucanase-like protein from the cyanobacterium Synechocystis PCC6803 is a β-1,3-1,4-glucanase and functions in salt stress tolerance

    PubMed Central

    Tamoi, Masahiro; Kurotaki, Hideki; Fukamizo, Tamo

    2007-01-01

    In the present study, we characterized the gene (Cyanobase accession number slr0897) designated Ssglc encoding a β-1,4-glucanase-like protein (SsGlc) from Synechocystis PCC6803. The deduced amino acid sequence for Ssglc showed a high degree of similarity to sequences of GH (glycoside hydrolase) family 9 β-1,4-glucanases (cellulases) from various sources. Surprisingly, the recombinant protein obtained from the Escherichia coli expression system was able to hydrolyse barley β-glucan and lichenan (β-1,3-1,4-glucan), but not cellulose (β-1,4-glucan), curdlan (β-1,3-glucan), or laminarin (β-1,3-1,6-glucan). A 1H-NMR analysis of the enzymatic products revealed that the enzyme hydrolyses the β-1,4-glycosidic linkage of barley β-glucan through an inverting mechanism. The data indicated that SsGlc was a novel type of GH9 glucanase which could specifically hydrolyse the β-1,3-1,4-linkage of glucan. The growth of mutant Synechocystis cells in which the Ssglc gene was disrupted by a kanamycin-resistance cartridge gene was almost the same as that of the wild-type cells under continuous light (40 μmol of photons/m2 per s), a 12 h light (40 μmol of photons/m2 per s)/12 h dark cycle, cold stress (4 °C), and high light stress (200 μmol of photons/m2 per s). However, under salt stress (300–450 mM NaCl), growth of the Ssglc-disrupted mutant cells was significantly inhibited as compared with that of the wild-type cells. The Ssglc-disrupted mutant cells showed a decreased rate of O2 consumption and NaHCO3-dependent O2 evolution as compared with the wild-type cells under salt stress. Under osmotic stress (100–400 mM sorbitol), there was no difference in growth between the wild-type and the Ssglc-disrupted mutant cells. These results suggest that SsGlc functions in salt stress tolerance in Synechocystis PCC6803. PMID:17331074

  15. β-1,3/1,6-Glucan-supplemented diets antagonize immune inhibitory effects of hypoxia and enhance the immune response to a model vaccine.

    PubMed

    Rodríguez, Felipe E; Valenzuela, Beatriz; Farías, Ana; Sandino, Ana María; Imarai, Mónica

    2016-12-01

    The diets of farmed salmon are usually supplemented with immunostimulants to improve health status. Because β-glucan is one of the most common immunostimulants used in diets, here we examined the effect of two β-1,3/1,6-glucan-supplemented diets on the expression of immune response genes of Atlantic salmon. The relative abundances of IFN-α1, Mx, IFN-γ, IL-12, TGF-β1, IL-10, and CD4 transcripts were evaluated in head kidney by qRT-PCR. We assessed the effects of the diets under normoxia and acute hypoxia, as salmon are especially sensitive to changes in the concentration of dissolved oxygen, which can also affect immunity. These effects were also tested on vaccinated fish, as we expected that β-1,3/1,6-glucan-supplemented diets would enhance the adaptive immune response to the vaccine. We found that administration of the Bg diet (containing β-1,3/1,6-glucan) under normoxia had no effects on the expression of the analyzed genes in the kidney of the diet-fed fish, but under hypoxia/re-oxygenation (90 min of acute hypoxia), the βg diet affected the expression of the antiviral genes, IFN-α1 and Mx, preventing their decrease caused by hypoxia. The Bax diet, which in addition to β-1,3/1,6-glucan, contained astaxanthin, increased IL-12 and IFN-γ in kidneys. With fish exposed to hypoxia/reoxygenation, the diet prevented the decrease of IFN-α1 and Mx levels observed after hypoxia. When fish were vaccinated, only the levels of IL-12 and CD4 transcripts increased, but interestingly if fish were also fed the Bax diet, the vaccination induced a significant increase in all the analyzed transcripts. Finally, when vaccinated fish were exposed to hypoxia, the effect of the Bax diet was greatly reduced for all genes tested and moreover, inducible effects completely disappeared for IL-12, IFN-α, and Mx. Altogether, these results showed that the tested β-1,3/1,6-glucan diets increased the levels of transcripts of key genes involved in innate and adaptive immune response of salmon, potentiating the response to a model vaccine and also antagonizing the effects of hypoxia. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Elevated Serum Beta-D-Glucan with Pseudomonas, Aspergillus, and a Partially Acid-Fast Organism in Respiratory Cultures: A Case of Hickam's Dictum Over Occam's Razor.

    PubMed

    Khan, Salman; Hamula, Camille; Rana, Meenakshi; Sullivan, Timothy; Dunn, Dallas; Patel, Pinki; Mishkin, Aaron; Huprikar, Shirish

    2017-10-01

    We describe a case of a man with ectopic Cushing's syndrome, elevated serum beta-D-glucan, and respiratory cultures with Pseudomonas, Aspergillus, and a partially acid-fast organism. Our case highlights challenges in diagnosis and management of coinfection in an immunocompromised host.

  17. Annual Research Report, 1 October 1977-30 September 1978.

    DTIC Science & Technology

    1978-09-30

    and other lipid components. Collaboratihe studies with the National Cancer Institute and other medical centers include research on the immunological...copolymer, or glucan were administered intraperitoneally within 2 hours after sublethal X irradiation (600 rads), the adjuvant- induced cytotoxic...concentrations of inducer. When BCG, pyran, or glucan was administered intraperitoneally concurrently with subcutaneous cyclophosphamide, only the ability

  18. Use of (1-3)-β-D-glucan Concentrations in Dust as a Surrogate Method for Estimating Specific Mold Exposures

    EPA Science Inventory

    Indoor exposure to fungi has been associated with respiratory symptoms, often attributed to their major cell wall component, (1-3)-β-D-glucan (DG). This and the ease and low cost of performing DG analysis rather than cultivation or microscopic counting of mold spores, has prompte...

  19. Influence of jet-cooking and pH on extraction and molecular weight of ß-glucan and arabinoxylan from barley (Hordeum vulgare Prowashonupana)

    USDA-ARS?s Scientific Manuscript database

    Food processing conditions may affect the solubility and molecular weight of beta-glucans and arabinoxylans in cereal products. This can dramatically affect the functional and physiological properties of the final products. Therefore, the purpose of the research was to explore the effects of jet-c...

  20. Effect of a single point mutation on the interaction of glucans with a glucansucrase from Leuconostoc mesenteroides NRRL B-1118

    USDA-ARS?s Scientific Manuscript database

    The type strain of the lactic acid bacterium Leuconostoc mesenteroides produces a water-insoluble glucan from sucrose via an extracellular glucansucrase. Substitution of an amino acid that is coupled with the +2 subsite adjacent to the transition stabilizer of this glucansucrase, results in signific...

  1. Pattern Recognition Protein Binds to Lipopolysaccharide and β-1,3-Glucan and Activates Shrimp Prophenoloxidase System*

    PubMed Central

    Amparyup, Piti; Sutthangkul, Jantiwan; Charoensapsri, Walaiporn; Tassanakajon, Anchalee

    2012-01-01

    The prophenoloxidase (proPO) system is activated upon recognition of pathogens by pattern recognition proteins (PRPs), including a lipopolysaccharide- and β-1,3-glucan-binding protein (LGBP). However, shrimp LGBPs that are involved in the proPO system have yet to be clarified. Here, we focus on characterizing the role of a Penaeus monodon LGBP (PmLGBP) in the proPO system. We found that PmLGBP transcripts are expressed primarily in the hemocytes and are increased at 24 h after pathogenic bacterium Vibrio harveyi challenge. The binding studies carried out using ELISA indicated that recombinant (r)PmLGBP binds to β-1,3-glucan and LPS with a dissociation constant of 6.86 × 10−7 m and 3.55 × 10−7 m, respectively. Furthermore, we found that rPmLGBP could enhance the phenoloxidase (PO) activity of hemocyte suspensions in the presence of LPS or β-1,3-glucan. Using dsRNA interference-mediated gene silencing assay, we further demonstrated that knockdown of PmLGBP in shrimp in vivo significantly decreased the PmLGBP transcript level but had no effect on the expression of the other immune genes tested, including shrimp antimicrobial peptides (AMPs). However, suppression of proPO expression down-regulated PmLGBP, proPO-activating enzyme (PmPPAE2), and AMPs (penaeidin and crustin). Such PmLGBP down-regulated shrimp showed significantly decreased total PO activity. We conclude that PmLGBP functions as a pattern recognition protein for LPS and β-1,3-glucan in the shrimp proPO activating system. PMID:22235126

  2. Effect of GM-CSF on cytokine induction by soluble beta-glucan SCG in vitro in beta-glucan-treated mice.

    PubMed

    Hida, Toshie H; Kawaminami, Hiromi; Ishibashi, Ken-Ichi; Miura, Noriko N; Adachi, Yoshiyuki; Yadomae, Toshiro; Ohno, Naohito

    2009-07-01

    SCG is a 6-branched 1,3-beta-D-glucan, which are major cell wall structural components in fungi. Leukocytes from DBA/1 and DBA/2 mice are highly sensitive to SCG, producing cytokines such as GM-CSF, IFN-gamma, TNF-alpha and IL-12p70, but not IL-6. GM-CSF plays a key biological role in this activity. In the present study, we examined the effect of giving i.p. SCG to DBA/2 mice on cytokine production in vitro. SCG was given i.p. to DBA/2 mice on day 0. Splenocytes were prepared on day 7 and cultured in the presence of SCG in vitro. The levels of cytokine production induced by SCG in vitro were lower in the cells from SCG-treated mice than in control mice. Expression of the beta-glucan receptor, dectin-1, in SCG-treated mice was comparable with that shown in control mice. However, the consumption of exogenously added rmGM-CSF in vitro was observed in SCG-treated mice. The addition of a large amount of rmGM-CSF to the culture medium resulted in larger amounts of TNF-alpha and IL-6 in SCG-treated mice than in normal mice. These results suggested that GM-CSF was closely related with the reactivity of beta-glucan. Giving SCG increased the number of macrophages and granulocytes in the spleen. These results suggested that in SCG-treated mice, a change of cell population would be related to modulation of the profile of cytokine production induced by SCG in vitro.

  3. Host-Pathogen Interactions 1

    PubMed Central

    Kopp, Marguerite; Rouster, Jacques; Fritig, Bernard; Darvill, Alan; Albersheim, Peter

    1989-01-01

    A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described. Images Figure 1 Figure 4 PMID:16666737

  4. The dynamics of cereal cyst nematode infection differ between susceptible and resistant barley cultivars and lead to changes in (1,3;1,4)-β-glucan levels and HvCslF gene transcript abundance.

    PubMed

    Aditya, Jessika; Lewis, John; Shirley, Neil J; Tan, Hwei-Ting; Henderson, Marilyn; Fincher, Geoffrey B; Burton, Rachel A; Mather, Diane E; Tucker, Matthew R

    2015-07-01

    Heterodera avenae (cereal cyst nematode, CCN) infects the roots of barley (Hordeum vulgare) forming syncytial feeding sites. In resistant host plants, relatively few females develop to maturity. Little is known about the physiological and biochemical changes induced during CCN infection. Responses to CCN infection were investigated in resistant (Rha2) and susceptible barley cultivars through histological, compositional and transcriptional analysis. Two phases were identified that influence CCN viability, including feeding site establishment and subsequent cyst maturation. Syncytial development progressed faster in the resistant cultivar Chebec than in the susceptible cultivar Skiff, and was accompanied by changes in cell wall polysaccharide abundance, particularly (1,3;1,4)-β-glucan. Transcriptional profiling identified several glycosyl transferase genes, including CELLULOSE SYNTHASE-LIKE F10 (HvCslF10), which may contribute to differences in polysaccharide abundance between resistant and susceptible cultivars. In barley, Rha2-mediated CCN resistance drives rapid deterioration of CCN feeding sites, specific changes in cell wall-related transcript abundance and changes in cell wall composition. During H. avenae infection, (1,3;1,4)-β-glucan may influence CCN feeding site development by limiting solute flow, similar to (1,3)-β-glucan during dicot cyst nematode infections. Dynamic transcriptional changes in uncharacterized HvCslF genes, possibly involved in (1,3;1,4)-β-glucan synthesis, suggest a role for these genes in the CCN infection process. © 2015 The University of Adelaide. New Phytologist © 2015 New Phytologist Trust.

  5. Characterization and biocompatibility of glucan: a safe food additive from probiotic Lactobacillus plantarum DM5.

    PubMed

    Das, Deeplina; Goyal, Arun

    2014-03-15

    Exopolysaccharide produced by lactic acid bacteria are the subject of an increasing number of studies for their potential applications in the food industry as stabilizing, bio-thickening and immunostimulating agents. In this regard, the authors isolated an exopolysaccharide producing probiotic lactic acid bacterium from fermented beverage Marcha of north eastern Himalayas. The isolate Lactobacillus plantarum DM5 showed extracellular glucansucrase activity of 0.48 U mg⁻¹ by synthesizing natural exopolysaccharide glucan (1.87 mg mL⁻¹) from sucrose. Zymogram analysis of purified enzyme confirms the presence of glucosyltransferase of approximately 148 kDa with optimal activity of 18.7 U mg⁻¹ at 30 °C and pH 5.4. The exopolysaccharide was purified by gel permeation chromatography and had an average molecular weight of 1.11 × 10⁶ Da. Acid hydrolysis and structural characterization of exopolysaccharide revealed that it was composed of d-glucose residues, containing 86.5% of α-(1→6) and 13.5% of α-(1→3) linkages. Rheological study exhibited a shear thinning effect of glucan appropriate for food additives. A cytotoxicity test of glucan on human embryonic kidney 293 (HEK 293) and human cervical cancer (HeLa) cell lines revealed its nontoxic biocompatible nature. This is the first report on the structure and biocompatibility of homopolysaccharide α-D-glucan (dextran) from probiotic Lactobacillus plantarum strain and its unique physical and rheological properties that facilitate its application in the food industry as viscosifying and gelling agent. © 2013 Society of Chemical Industry.

  6. Biosynthesis of a (1. -->. 4)-. beta. -D-glucan. [Lupinus albus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brummond, D.O.

    1983-01-01

    An enzymatic activity isolated from Lupinus albus that produced an insoluble (1..-->..4)-..beta..-D-glucan from UDP-D-glucose has been solubilized and partially purified. Some of the properties of the enzyme system have been characterized. A proposed sequence of reactions between UDP-D-glucose and the final dextran may involve a (1..-->..4)-..beta..-linked polysaccharide bonded to UDP.

  7. Specifically targeted delivery of protein to phagocytic macrophages

    PubMed Central

    Yu, Min; Chen, Zeming; Guo, Wenjun; Wang, Jin; Feng, Yupeng; Kong, Xiuqi; Hong, Zhangyong

    2015-01-01

    Macrophages play important roles in the pathogenesis of various diseases, and are important potential therapeutic targets. Furthermore, macrophages are key antigen-presenting cells and important in vaccine design. In this study, we report on the novel formulation (bovine serum albumin [BSA]-loaded glucan particles [GMP-BSA]) based on β-glucan particles from cell walls of baker’s yeast for the targeted delivery of protein to macrophages. Using this formulation, chitosan, tripolyphosphate, and alginate were used to fabricate colloidal particles with the model protein BSA via electrostatic interactions, which were caged and incorporated BSA very tightly within the β-glucan particle shells. The prepared GMP-BSA exhibited good protein-release behavior and avoided protein leakage. The particles were also highly specific to phagocytic macrophages, such as Raw 264.7 cells, primary bone marrow-derived macrophages, and peritoneal exudate macrophages, whereas the particles were not taken up by nonphagocytic cells, including NIH3T3, AD293, HeLa, and Caco-2. We hypothesize that these tightly encapsulated protein-loaded glucan particles deliver various types of proteins to macrophages with notably high selectivity, and may have broad applications in targeted drug delivery or vaccine design against macrophages. PMID:25784802

  8. Effect of β-glucan-rich barley flour fraction on rheology and quality of frozen yeasted dough.

    PubMed

    Hamed, Abdelmagid; Ragaee, Sanaa; Abdel-Aal, El-Sayed M

    2014-12-01

    Research has shown that prolonged frozen storage of bread dough reduces the quality of the end product. In this study, the effect of air-classified barley flour fraction rich in β-glucan (approximately 25%) on rheology and quality of frozen yeasted bread dough was investigated. Wheat flour (W) was replaced by air-classified barley flour fraction (B) at 10% without or with 1.4% vital gluten to produce β-glucan enriched barley dough (WB) or barley dough plus gluten (WB + G). Dough products were stored at -18 ºC for 8 wk and their rheological properties were investigated weekly. During frozen storage dough extensibility increased, while elastic and viscous moduli decreased. Differential scanning calorimeter and nuclear magnetic resonance data indicated that WB and WB + G dough products contained approximately 10% less freezable water and 9% more bound water compared to the control dough (W). β-Glucan enriched dough also exhibited less changes in gluten network as shown by SEM photographs. The addition of air-classified barley flour fraction at 10% in frozen dough reduced deterioration effects caused by frozen storage via minimizing water redistribution and maintaining rheological properties of frozen dough. © 2014 Institute of Food Technologists®

  9. Phase behaviour of casein micelles and barley beta-glucan polymer molecules in dietary fibre-enriched dairy systems.

    PubMed

    Repin, Nikolay; Scanlon, Martin G; Fulcher, R Gary

    2012-07-01

    Enrichment of colloidal dairy systems with dietary fibre frequently causes quality defects because of phase separation. We investigate phase separation in skimmed milk enriched with Glucagel (a commercial product made from barley that is predominantly comprised of the polysaccharide β-glucan). The driving force for phase separation was depletion flocculation of casein micelles in the presence of molecules of the polysaccharide. Depending on the volume fraction of casein micelles and the concentration of Glucagel, the stable system phase separated either as a transient gel or as a sedimented system. The rate at which phase separation progressed also depended on the volume fraction of casein micelles and the concentration of Glucagel. To confirm the role of depletion flocculation in the phase separation process, enzymatic reduction in the molecular weight of β-glucan was shown to limit the range of attraction between micelles and allow the stable phase to exist at a higher β-glucan concentration for any given volume fraction of casein micelles. These phase diagrams will be useful to dairy product manufacturers striving to improve the nutrient profile of their products while avoiding product quality impairment. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Purification and characterization of a novel alkaline β-1,3-1,4-glucanase (lichenase) from thermophilic fungus Malbranchea cinnamomea.

    PubMed

    Yang, Shaoqing; Xiong, Hao; Yan, Qiaojuan; Yang, Hongye; Jiang, Zhengqiang

    2014-10-01

    A novel alkaline β-1,3-1,4-glucanase (McLic1) from a thermophilic fungus, Malbranchea cinnamomea, was purified and biochemically characterized. McLic1 was purified to homogeneity with a purification fold of 3.1 and a recovery yield of 3.7 %. The purified enzyme was most active at pH 10.0 and 55 °C, and exhibited a wide range of pH stability (pH 4.0-10.0). McLic1 displayed strict substrate specificity for barley β-glucan, oat β-glucan and lichenan, but did not show activity towards other tested polysaccharides and synthetic p-nitrophenyl derivates, suggesting that it is a specific β-1,3-1,4-glucanase. The K m values for barley β-glucan, oat β-glucan and lichenan were determined to be 0.69, 1.11 and 0.63 mg mL(-1), respectively. Moreover, the enzyme was stable in various non ionic surfactants, oxidizing agents and several commercial detergents. Thus, the alkaline β-1,3-1,4-glucanase may have potential in industrial applications, such as detergent, paper and pulp industries.

  11. Microwave pretreatment of paramylon enhances the enzymatic production of soluble β-1,3-glucans with immunostimulatory activity.

    PubMed

    Gissibl, Alexander; Care, Andrew; Parker, Lindsay M; Iqbal, Sameera; Hobba, Graham; Nevalainen, Helena; Sunna, Anwar

    2018-09-15

    A hydrothermal microwave pretreatment was established to facilitate the enzymatic production of soluble bioactive β-1,3-glucans from the recalcitrant substrate paramylon. The efficacy of this pretreatment was monitored with a newly developed direct Congo Red dye-based assay over a range of temperatures. Microwave pretreatment at 170 °C for 2 min resulted in a significantly enhanced enzymatic hydrolysis of paramylon. The action of endo-β-1,3- and exo- β-1,3-glucanases on the microwave-pretreated paramylon produced soluble β-1,3-glucans with degrees of polymerisation (DP) ranging from 2-59 and 2-7, respectively. In comparison, acid-mediated hydrolysis of untreated paramylon resulted in β-1,3-glucans with a DP range of 2-38. The hydrolysates were assayed on their immunostimulatory effect on murine macrophages by measuring the production of the inflammation-linked marker tumour necrosis factor alpha (TNFα) using immunofluorescence. All of the tested hydrolysis products were shown to induce TNFα production, with the most significant immunostimulatory effect observed with the hydrolysate from the exo-β-1,3-glucanase treatment. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Dietary fiber and satiety: the effects of oats on satiety

    PubMed Central

    O’Neil, Carol E.; Greenway, Frank L.

    2016-01-01

    This review examines the effect of β-glucan, the viscous soluble fiber in oats, on satiety. A literature search for studies that examined delivery of the fiber in whole foods or as an extract was conducted. Viscosity interferes with the peristaltic mixing process in the small intestine to impede digestion and absorption of nutrients, which precipitates satiety signals. From measurements of the physicochemical and rheological properties of β-glucan, it appears that viscosity plays a key role in modulating satiety. However, the lack of standardized methods to measure viscosity and the inherent nature of appetite make it difficult to pinpoint the reasons for inconsistent results of the effects of oats on satiety. Nevertheless, the majority of the evidence suggests that oat β-glucan has a positive effect on perceptions of satiety. PMID:26724486

  13. Catheter-related bloodstream infection due to Rhodotorula mucilaginosa with normal serum (1→3)-β-D-glucan level.

    PubMed

    Kitazawa, T; Ishigaki, S; Seo, K; Yoshino, Y; Ota, Y

    2018-06-01

    Rhodotorula species are environmental basidiomycete yeasts that have emerged as a cause of fungemia in immunocompromised hosts. The insertion of a central venous catheter was identified as a major risk factor for Rhodotorula fungemia. Few cases reports have reported (1→3)-β-D-glucan testing at the onset of Rhodotorula mucilaginosa fungemia. We report a case of catheter-related bloodstream infection due to R. mucilaginosa. Serum β-D-glucan level was normal at the onset of the bloodstream infection. It took 5 days to culture the isolate. The patient's fever persisted after empiric treatment with micafungin, and a switch to oral voriconazole immediately resolved the fungemia. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  14. Suppressing effects of glucan on micronuclei induced by cyclophosphamide in mice.

    PubMed

    Chorvatovicová, D; Navarová, J

    1992-07-01

    The effect of pretreatment with carboxymethylglucan (CMG) on the frequency of micronuclei induced by cyclophosphamide administration in mice was evaluated. Two doses of CMG (50 mg/kg body weight) injected either intraperitoneally 24 h or intravenously 1 h prior to two cyclophosphamide administrations (80 mg/kg) significantly decreased the frequency of micronucleated PCE in bone marrow. Of two evaluated derivatives of carboxymethylglucan, the K3 derivative was most efficient. The results show that it is possible to achieve a suppressive effect of soluble carboxymethylglucan prepared from Saccharomyces cerevisiae against cyclophosphamide mutagenicity. The notion may be useful for glucan's effects against pharmacocarcinogenesis. Therapeutic application of glucan with cyclophosphamide therapy may provide a remarkable decrease of the secondary tumour risk. The utilization of these results for human patients needs to be considered.

  15. Complementary Sample Preparation Strategies for Analysis of Cereal β-Glucan Oxidation Products by UPLC-MS/MS.

    PubMed

    Boulos, Samy; Nyström, Laura

    2017-01-01

    The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO • ) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO • -attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO • -attack on glucose units irrespective of glycosidic linkage and neighborhood. The method was demonstrated to be (1) sufficiently sensitive to allow for the analysis of oxidation products also from a mild ascorbate-driven Fenton reaction, and (2) to be specific for cereal β-glucan even in the presence of other co-oxidized polysaccharides. This opens doors to applications in food processing to assess potential oxidations and provides the detailed structural basis to understand the effect oxidized functional groups have on β-glucan's health promoting and technological properties.

  16. Complementary Sample Preparation Strategies for Analysis of Cereal β-Glucan Oxidation Products by UPLC-MS/MS

    PubMed Central

    Boulos, Samy; Nyström, Laura

    2017-01-01

    The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO•-attack on glucose units irrespective of glycosidic linkage and neighborhood. The method was demonstrated to be (1) sufficiently sensitive to allow for the analysis of oxidation products also from a mild ascorbate-driven Fenton reaction, and (2) to be specific for cereal β-glucan even in the presence of other co-oxidized polysaccharides. This opens doors to applications in food processing to assess potential oxidations and provides the detailed structural basis to understand the effect oxidized functional groups have on β-glucan's health promoting and technological properties. PMID:29164106

  17. Armed Forces Radiobiology Research Institute Annual Research Report, Fiscal Year 1984.

    DTIC Science & Technology

    1984-01-01

    thromboxane B2, cyclic AMP and GMP, ACTH, beta -endorphin, cortisol/corticosterone, and complement in bio- logical fluids and tissues. Mediators will...immunomodulators are being tested for their ability to enhance the *recovery of hemopoiesis following irradiation. These include glucan , detoxified...endotoxin, and selected agents from the Biological Response Modifiers Program (NCI, Frederick, MD). Glucan has proved to be very effective in stimulating

  18. beta-Glucan production by Botryosphaeria rhodina on undiluted olive-mill wastewaters.

    PubMed

    Crognale, S; Federici, F; Petruccioli, M

    2003-12-01

    Botryosphaeria rhodina produced beta-glucan when grown on undiluted olive-mill wastewaters (OMW). The production of exopolysaccharide increased with the COD up to 17.2 g l(-1) on the most loaded OMW (151 and 66 g l(-1) of COD and total sugar, respectively). The total phenol content of OMW was reduced from 8 to 4.1 g l(-1).

  19. Biochemical Characterization of Paracoccidioides brasiliensis α-1,3-Glucanase Agn1p, and Its Functionality by Heterologous Expression in Schizosaccharomyces pombe

    PubMed Central

    Villalobos-Duno, Héctor; San-Blas, Gioconda; Paulinkevicius, Maryan; Sánchez-Martín, Yolanda; Nino-Vega, Gustavo

    2013-01-01

    α-1,3-Glucan is present as the outermost layer of the cell wall in the pathogenic yeastlike (Y) form of Paracoccidioides brasiliensis. Based on experimental evidence, this polysaccharide has been proposed as a fungal virulence factor. To degrade α-1,3-glucan and allow remodeling of the cell wall, α-1,3-glucanase is required. Therefore, the study of this enzyme, its encoding gene, and regulatory mechanisms, might be of interest to understand the morphogenesis and virulence process in this fungus. A single gene, orthologous to other fungal α-1,3-glucanase genes, was identified in the Paracoccidioides genome, and labeled AGN1. Transcriptional levels of AGN1 and AGS1 (α-1,3-glucan synthase-encoding gene) increased sharply when the pathogenic Y phase was cultured in the presence of 5% horse serum, a reported booster for cell wall α-1,3-glucan synthesis in this fungus. To study the biochemical properties of P. brasiliensis Agn1p, the enzyme was heterologously overexpressed, purified, and its activity profile determined by means of the degradation of carboxymethyl α-1,3-glucan (SCMG, chemically modified from P. brasiliensis α-1,3-glucan), used as a soluble substrate for the enzymatic reaction. Inhibition assays, thin layer chromatography and enzymatic reactions with alternative substrates (dextran, starch, chitin, laminarin and cellulose), showed that Agn1p displays an endolytic cut pattern and high specificity for SCMG. Complementation of a Schizosaccharomyces pombe agn1Δ strain with the P. brasiliensis AGN1 gene restored the wild type phenotype, indicating functionality of the gene, suggesting a possible role of Agn1p in the remodeling of P. brasiliensis Y phase cell wall. Based on amino acid sequence, P. brasiliensis Agn1p, groups within the family 71 of fungal glycoside hydrolases (GH-71), showing similar biochemical characteristics to other members of this family. Also based on amino acid sequence alignments, we propose a subdivision of fungal GH-71 into at least five groups, for which specific conserved sequences can be identified. PMID:23825576

  20. The Response of Human Macrophages to β-Glucans Depends on the Inflammatory Milieu

    PubMed Central

    Montero, Olimpio; Hugo, Etzel; Rodríguez, Mario; Domingo, Esther; Alonso, Sara

    2013-01-01

    Background β-glucans are fungal cell wall components that bind to the C-type lectin-like receptor dectin-1. Polymorphisms of dectin-1 gene are associated with susceptibility to invasive fungal infection and medically refractory ulcerative colitis. The purpose of this study has been addressing the response of human macrophages to β-glucans under different conditions mimicking the composition of the inflammatory milieu in view of the wide plasticity and large range of phenotypical changes showed by these cells, and the relevant role of dectin-1 in several pathophysiological conditions. Principal Findings Serum-differentiated macrophages stimulated with β-glucans showed a low production of TNFα and IL-1β, a high production of IL-6 and IL-23, and a delayed induction of cyclooxygenase-2 and PGE2 biosynthesis that resembled the responses elicited by crystals and those produced when phagosomal degradation of the phagocytic cargo increases ligand access to intracellular pattern recognition receptors. Priming with a low concentration of LPS produced a rapid induction of cyclooxygenase-2 and a synergistic release of PGE2. When the differentiation of the macrophages was carried out in the presence of M-CSF, an increased expression of dectin-1 B isoform was observed. In addition, this treatment made the cells capable to release arachidonic acid in response to β-glucan. Conclusions These results indicate that the macrophage response to fungal β-glucans is strongly influenced by cytokines and microbial-derived factors that are usual components of the inflammatory milieu. These responses can be sorted into three main patterns i) an elementary response dependent on phagosomal processing of pathogen-associated molecular patterns and/or receptor-independent, direct membrane binding linked to the immunoreceptor tyrosine-based activation motif-bearing transmembrane adaptor DNAX-activating protein 12, ii) a response primed by TLR4-dependent signals, and iii) a response dependent on M-CSF and dectin-1 B isoform expression that mainly signals through the dectin-1 B/spleen tyrosine kinase/cytosolic phospholipase A2 route. PMID:23637950

  1. Effects of dietary β-1,3-glucan, chitosan or raffinose on the growth, innate immunity and resistance of koi (Cyprinus carpio koi).

    PubMed

    Lin, Shimei; Pan, Yu; Luo, Lin; Luo, Li

    2011-12-01

    This study was performed to determine the efficacy of three immunomodulators viz., β-1,3 glucan, chitosan and raffinose on the innate immune response of koi, Cyprinus carpio koi. Kois were divided into 4 groups and each group was fed with diets supplemented with or without immunostimulant for 56 days. Total leukocyte counts (WBC), the non-specific humoral (lysozyme, alternative complement pathway and superoxide dismutase) and cellular (phagocytic capacity and respiratory burst activity) responses were determined and compared with controls (no supplement) after 7, 14, 21 and 56 days of feeding. The results of 8 weeks feeding trial showed that β-1,3 glucan supplementation significantly enhanced koi growth, whereas other immunostimulants did not. Variation in the levels of responses was evident among different supplements. Compared with chitosan or raffinose, β-1,3 glucan could maintain the immunity of kois at a higher level during the experimental period. However, continuously applying β-1,3 glucan, chitosan or raffinose into the diet caused immunity fatigue in koi. No significant change in alternative complement pathway (ACP) activity was observed for any of the three supplements over the four different periods. After feeding for 14 days, the total leukocyte count (WBC), respiratory burst activity and superoxide dismutase (SOD) activity of the kois fed with chitosan or raffinose continuously remained relatively unchanged, subsequently decreased on the 56th day, but SOD did not. Meanwhile, lysozyme activity was no longer significantly higher on the 7th day, and for phagocytic capacity on the 14th day. After 56 days, these three immunostimulants groups also exhibited a decrease in the cumulative symptom rates compared to the controls when challenged with Aeromonas veronii. These results indicated that dietary intake containing immunostimulants could enhance the immune responses of koi and improve its resistance to infection by A.veronii. Especially supplementation with β-1,3 glucan to the kois for 56 days showed considerable improvement in the growth, survival and immune response of the kois. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. The role of meal viscosity and oat β-glucan characteristics in human appetite control: a randomized crossover trial.

    PubMed

    Rebello, Candida J; Chu, Yi-Fang; Johnson, William D; Martin, Corby K; Han, Hongmei; Bordenave, Nicolas; Shi, Yuhui; O'Shea, Marianne; Greenway, Frank L

    2014-05-28

    Foods that enhance satiety can help consumers to resist environmental cues to eat, and improve the nutritional quality of their diets. Viscosity generated by oat β-glucan, influences gastrointestinal mechanisms that mediate satiety. Differences in the source, processing treatments, and interactions with other constituents in the food matrix affect the amount, solubility, molecular weight, and structure of the β-glucan in products, which in turn influences the viscosity. This study examined the effect of two types of oatmeal and an oat-based ready-to-eat breakfast cereal (RTEC) on appetite, and assessed differences in meal viscosity and β-glucan characteristics among the cereals. Forty-eight individuals were enrolled in a randomized crossover trial. Subjects consumed isocaloric breakfast meals containing instant oatmeal (IO), old-fashioned oatmeal (SO) or RTEC in random order at least a week apart. Each breakfast meal contained 218 kcal (150 kcal cereal, and 68 kcal milk) Visual analogue scales measuring appetite were completed before breakfast, and over four hours, following the meal. Starch digestion kinetics, meal viscosities, and β-glucan characteristics for each meal were determined. Appetite responses were analyzed by area under the curve. Mixed models were used to analyze response changes over time. IO increased fullness (p = 0.04), suppressed desire to eat (p = 0.01) and reduced prospective intake (p < 0.01) more than the RTEC over four hours, and consistently at the 60 minute time-point. SO reduced prospective intake (p = 0.04) more than the RTEC. Hunger scores were not significantly different except that IO reduced hunger more than the RTEC at the 60 minute time-point. IO and SO had higher β-glucan content, molecular weight, gastric viscosity, and larger hydration spheres than the RTEC, and IO had greater viscosity after oral and initial gastric digestion (initial viscosity) than the RTEC. IO and SO improved appetite control over four hours compared to RTEC. Initial viscosity of oatmeal may be especially important for reducing appetite.

  3. Endotoxin and β-1,3-d-Glucan in Concentrated Ambient Particles Induce Rapid Increase in Blood Pressure in Controlled Human Exposures.

    PubMed

    Zhong, Jia; Urch, Bruce; Speck, Mary; Coull, Brent A; Koutrakis, Petros; Thorne, Peter S; Scott, James; Liu, Ling; Brook, Robert D; Behbod, Behrooz; Gibson, Heike; Silverman, Frances; Mittleman, Murray A; Baccarelli, Andrea A; Gold, Diane R

    2015-09-01

    Short-term exposure to particulate matter (PM) is associated with increased blood pressure (BP) in epidemiological studies. Understanding the impact of specific PM components on BP is essential in developing effective risk-reduction strategies. We investigated the association between endotoxin and β-1,3-d-Glucan-two major biological PM components-and BP. We also examined whether vascular endothelial growth factor, a vasodilatory inflammatory marker, modified these associations. We conducted a single-blind, randomized, crossover trial of controlled human exposure to concentrated ambient particles with 50 healthy adults. Particle-associated-endotoxin and β-1,3-d-Glucan were sampled using polycarbonate-membrane-filters. Supine resting systolic BP and diastolic BP were measured pre-, 0.5-hour post-, and 20-hour postexposure. Urine vascular endothelial growth factor concentration was determined using enzyme-linked immunosorbant assay and creatinine-corrected. Exposures to endotoxin and β-1,3-d-Glucan for 130 minutes were associated with increases in BPs: at 0.5-hour postexposure, every doubling in endotoxin concentration was associated with 1.73 mm Hg higher systolic BP (95% confidence interval, 0.28, 3.18; P=0.02) and 2.07 mm Hg higher diastolic BP (95% confidence interval, 0.74, 3.39; P=0.003); every doubling in β-1,3-d-Glucan concentration was associated with 0.80 mm Hg higher systolic BP (95% confidence interval, -0.07, 1.67; P=0.07) and 0.88 mm Hg higher diastolic BP (95% confidence interval, 0.09, 1.66; P=0.03). Vascular endothelial growth factor rose after concentrated ambient particle endotoxin exposure and attenuated the association between endotoxin and 0.5-hour postexposure diastolic BP (Pinteraction=0.02). In healthy adults, short-term endotoxin and β-1,3-d-Glucan exposures were associated with increased BP. Our findings suggest that the biological PM components contribute to PM-related cardiovascular outcomes, and postexposure vascular endothelial growth factor elevation might be an adaptive response that attenuates these effects. © 2015 American Heart Association, Inc.

  4. Thermodynamics of cellulose solvation in water and the ionic liquid 1-butyl-3-methylimidazolim chloride.

    PubMed

    Gross, Adam S; Bell, Alexis T; Chu, Jhih-Wei

    2011-11-24

    Cellulose is present in biomass as crystalline microfibrils held together by a complex network of intermolecular interactions making it difficult to initiate its hydrolysis and conversion to fuels. While cellulose is insoluble in water and most organic solvents, complete dissolution of cellulose can be achieved in certain classes of ionic liquids (ILs). The present study was undertaken to analyze the thermodynamic driving forces of this process and to understand how the anions and cations comprising an IL interact with the different moieties of glucose residues to cause dissolution. All-atom molecular dynamics (MD) simulations were performed at two extreme states of cellulose dissolution: a crystalline microfibril and a dissociated state in which all the glucan chains of the microfibril are fully separated from each other by at least four solvation shells. MD simulations of the two states were carried out in water and in the IL 1-butyl-3-methylimidazolium chloride (BmimCl) to provide a comprehensive analysis of solvent effects on cellulose dissolution. The results reveal two important molecular aspects of the mechanism of cellulose dissolution. The first is that the perturbation of solvent structures by the dissolved glucan chains can be a crucial factor in determining solubility, particularly for the insolubility of cellulose in water at 300 K. Second, both the Cl(-) and the Bmim(+) ions of BmimCl interact with the moieties of glucan residues that form intersheet contacts, the most robust component of the interaction network of crystalline cellulose. Cl(-) anions can form hydrogen bonds (HBs) with the hydroxyl groups of glucan chains from either the equatorial or the axial directions. For Bmim(+) cations, the calculated density profiles reveal that the contacts with glucan chains along the axial directions are closer than those along the equatorial directions. On the basis of the results of atomistic MD simulations, we propose that interacting with glucan chains along axial directions and disrupting the intersheet contacts of cellulose is an important ability of cellulose pretreatment solvents. © 2011 American Chemical Society

  5. Limited treatment with beta-1,3/1,6-glucan improves production values of broiler chickens challenged with Escherichia coli.

    PubMed

    Huff, G R; Huff, W E; Rath, N C; Tellez, G

    2006-04-01

    The development of antibiotic-resistant bacteria has led to a need for alternatives to antibiotics for growth promotion and disease prevention in poultry production. The helical polysaccharide beta-1,3/1,6-glucan is derived from the cell wall of Saccharomyces cervisiae and has immunomodulating activities. The objective of this study was to determine the ability of 2 supplementation programs with a commercial beta-1,3/1,6-glucan product to protect broiler chicks from experimental respiratory challenge with Escherichia coli. Chicks were housed in battery-brooders from 1 d of age and fed a standard starter diet or the same diet containing 20 g/ton (22 ppm) of purified beta-1,3/1,6-glucan either continuously (BG25d) or for only the first 7 d prior to challenge (BG7d). At d 7 one-half of the birds were inoculated in the thoracic air sac with 800 cfu of a serotype O2, nonmotile strain of E. coli. All surviving birds were necropsied at d 25. Body weight of survivors and feed conversion efficiency were protected from the adverse effects of E. coli challenge by BG7d but not by BG25d. Mortality was nominally decreased from 63% (control) to 53% in BG25d and 47% in BG7d, but these decreases were not significant. The relative weights of the liver and heart were increased, and the bursa of Fabricius relative weights were decreased by E. coli challenge, and these effects were modulated by beta-glucan treatment. Despite positive effects of BG7d in E. coli-challenged birds, the BW of nonchallenged birds was decreased by BG7d and BG25d. These results suggest that supplementation of broiler diets with beta-1,3/1,6-glucan may be valuable for decreasing production losses due to E. coli respiratory disease, but that the immune stimulation provided may also result in decreased production values under experimental battery conditions or for birds raised in an environment with minimal disease challenges.

  6. Conservation and Divergence in the Candida Species Biofilm Matrix Mannan-Glucan Complex Structure, Function, and Genetic Control.

    PubMed

    Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R

    2018-04-03

    Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which contributes to sequestration of antifungal drug, shielding the fungus from this external assault. Synthesis of a common polysaccharide backbone appears conserved. However, subtle structural differences in the branching side chains likely rely upon unique modification enzymes, which are species specific. Our findings identify MGCx backbone synthesis as a potential pan- Candida biofilm therapeutic target. Copyright © 2018 Dominguez et al.

  7. The role of meal viscosity and oat β-glucan characteristics in human appetite control: a randomized crossover trial

    PubMed Central

    2014-01-01

    Background Foods that enhance satiety can help consumers to resist environmental cues to eat, and improve the nutritional quality of their diets. Viscosity generated by oat β-glucan, influences gastrointestinal mechanisms that mediate satiety. Differences in the source, processing treatments, and interactions with other constituents in the food matrix affect the amount, solubility, molecular weight, and structure of the β-glucan in products, which in turn influences the viscosity. This study examined the effect of two types of oatmeal and an oat-based ready-to-eat breakfast cereal (RTEC) on appetite, and assessed differences in meal viscosity and β-glucan characteristics among the cereals. Methods Forty-eight individuals were enrolled in a randomized crossover trial. Subjects consumed isocaloric breakfast meals containing instant oatmeal (IO), old-fashioned oatmeal (SO) or RTEC in random order at least a week apart. Each breakfast meal contained 218 kcal (150 kcal cereal, and 68 kcal milk) Visual analogue scales measuring appetite were completed before breakfast, and over four hours, following the meal. Starch digestion kinetics, meal viscosities, and β-glucan characteristics for each meal were determined. Appetite responses were analyzed by area under the curve. Mixed models were used to analyze response changes over time. Results IO increased fullness (p = 0.04), suppressed desire to eat (p = 0.01) and reduced prospective intake (p < 0.01) more than the RTEC over four hours, and consistently at the 60 minute time-point. SO reduced prospective intake (p = 0.04) more than the RTEC. Hunger scores were not significantly different except that IO reduced hunger more than the RTEC at the 60 minute time-point. IO and SO had higher β-glucan content, molecular weight, gastric viscosity, and larger hydration spheres than the RTEC, and IO had greater viscosity after oral and initial gastric digestion (initial viscosity) than the RTEC. Conclusion IO and SO improved appetite control over four hours compared to RTEC. Initial viscosity of oatmeal may be especially important for reducing appetite. PMID:24884934

  8. Effects of extrusion variables on the properties of waxy hulless barley extrudates.

    PubMed

    Köksel, Hamit; Ryu, Gy-Hyung; Başman, Arzu; Demiralp, Hande; Ng, Perry K W

    2004-02-01

    The objective of this research was to investigate the extrudability of waxy hulless barley flour under various extrusion conditions. Waxy hulless barley flour was processed in a laboratory-scale corotating twin-screw extruder with different levels of feed moisture content (22.3, 26.8, and 30.7%) and die temperature (130, 150, and 170 degrees C) to develop a snack food with high beta-glucan content. The effects of extrusion condition variables (screw configuration, moisture, and temperature) on the system variables (pressure and specific mechanical energy), the extrudate physical properties (sectional expansion index, bulk density), starch gelatinization, pasting properties (cold peak viscosity, trough viscosity, and final viscosity), and beta-glucan contents were determined. Results were evaluated by using response surface methodology. Increased extrusion temperature and feed moisture content resulted in decreases in exit die pressure and specific mechanical energy values. For extrudates extruded under low shear screw configuration (LS), increased barrel temperature decreased sectional expansion index (SEI) values at both low and high moisture contents. The feed moisture seems to have an inverse relationship with SEI over the range studied. Bulk density was higher at higher moisture contents, for both low and high barrel temperatures, for samples extruded under high shear screw configuration (HS) and LS. Cold peak viscosities (CV) were observed in all samples. The CV increased with the increase in extrusion temperature and feed moisture content. Although beta-glucan contents of the LS extrudates were comparable to that of barley flour sample, HS samples had generally lower beta-glucan contents. The extrusion cooking technique seems to be promising for the production of snack foods with high beta-glucan content, especially using LS conditions.

  9. Effects of single or combined dietary supplementation of β-glucan and kefir on growth performance, blood characteristics and meat quality in broilers.

    PubMed

    Cho, J H; Zhang, Z F; Kim, I H

    2013-01-01

    1. This study was conducted to evaluate the effects of dietary β-glucan and kefir (a fermented milk product) on growth performance, blood profiles, relative organ weight and meat quality in broilers. 2. A total of 375 day-of-hatch mixed sex ROSS 308 broilers (BW of 46 ± 0.1 g) were used in a 5-week experiment and randomly allotted to one of the following dietary treatments: (1) NC, basal diet; (2) PC, basal diet + 40 mg/kg of avilamycin; (3) B, NC + 0.1% β-glucan; (4) K, NC + 0.1% kefir; (5) BK, NC + 0.1% β-glucan + 0.1% kefir. 3. During weeks 0-3, broilers in B, K and BK treatments had higher body weight gain (BWG) than those in NC treatment. During weeks 4-5, BK treatment had a higher BWG than NC treatment. Overall, broilers given PC, K and BK diets had higher BWG than those given NC diet. The feed efficiency ratio (FCR) was improved by PC treatment. 4. Relative liver weight was increased by B treatment, whereas the relative weight of breast meat and gizzard was higher in BK group than that in NC group. Broilers given PC, B and BK diets had greater breast meat redness value and reduced drip loss at d 5 and d 7. The cooking loss was also reduced by B and BK treatments compared with NC treatment. 5. In conclusion, the results suggested that inclusion of 0.1% β-glucan and 0.1% kefir, either individually or combined, would improve growth performance and benefit meat quality in broiler chickens.

  10. High molecular weight glucan of the culinary medicinal mushroom Agaricus bisporus is an alpha-glucan that forms complexes with low molecular weight galactan.

    PubMed

    Smiderle, Fhernanda R; Sassaki, Guilherme L; van Arkel, Jeroen; Iacomini, Marcello; Wichers, Harry J; Van Griensven, Leo J L D

    2010-08-25

    An alpha-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by alpha-amylase treatment. After heating in 1% SDS a small additional peak of low MW eluted from the G50 column. The monosaccharide composition of the main peak was evaluated by HPLC, and was found to consist of a majority of glucose (97.6%), and a minor proportion of galactose (2.4%). Methylation analysis and degradation by alpha-amylase indicated the presence of an alpha-glucan with a main chain consisting of (1(R)4)-linked units, substituted at O-6 by alpha-D-glucopyranose single-units in the relation 1:8. Mono- (13C-, 1H-NMR) and bidimensional [1H (obs.),13C-HSQC] spectroscopy analysis confirmed the alpha-configuration of the Glcp residues by low frequency resonances of C-1 at delta 100.6, 100.2, and 98.8 ppm and H-1 high field ones at delta 5.06, 5.11, and 4.74 ppm. The DEPT-13C-NMR allowed assigning the non-substituted and O-substituted -CH(2) signals at delta 60.3/60.8 and 66.2 ppm, respectively. Other assignments were attributed to C-2, C-3, C-4, C-5 and C-6 of the non-reducing ends at delta 71.8; 72.8; 70.0; 71.3 and 60.3/60.8 ppm, respectively. The minor proportion of galactose that was demonstrated was probably derived from a complex between the alpha-glucan and a low molecular weight galactan.

  11. Characterization of airborne molds, endotoxins, and glucans in homes in New Orleans after Hurricanes Katrina and Rita.

    PubMed

    Rao, Carol Y; Riggs, Margaret A; Chew, Ginger L; Muilenberg, Michael L; Thorne, Peter S; Van Sickle, David; Dunn, Kevin H; Brown, Clive

    2007-03-01

    In August and September 2005, Hurricanes Katrina and Rita caused breeches in the New Orleans, LA, levee system, resulting in catastrophic flooding. The city remained flooded for several weeks, leading to extraordinary mold growth in homes. To characterize the potential risks of mold exposures, we measured airborne molds and markers of molds and bacteria in New Orleans area homes. In October 2005, we collected air samples from 5 mildly water-damaged houses, 15 moderately to heavily water-damaged houses, and 11 outdoor locations. The air filters were analyzed for culturable fungi, spores, (1-->3,1-->6)-beta-D-glucans, and endotoxins. Culturable fungi were significantly higher in the moderately/heavily water-damaged houses (geometric mean=67,000 CFU/m3) than in the mildly water-damaged houses (geometric mean=3,700 CFU/m3) (P=0.02). The predominant molds found were Aspergillus niger, Penicillium spp., Trichoderma, and Paecilomyces. The indoor and outdoor geometric means for endotoxins were 22.3 endotoxin units (EU)/m3 and 10.5 EU/m3, respectively, and for (1-->3,1-->6)-beta-D-glucans were 1.7 microg/m3 and 0.9 microg/m3, respectively. In the moderately/heavily water-damaged houses, the geometric means were 31.3 EU/m3 for endotoxins and 1.8 microg/m3 for (1-->3,1-->6)-beta-D-glucans. Molds, endotoxins, and fungal glucans were detected in the environment after Hurricanes Katrina and Rita in New Orleans at concentrations that have been associated with health effects. The species and concentrations were different from those previously reported for non-water-damaged buildings in the southeastern United States.

  12. Diagnostic value of (1 → 3)-β-D-glucan in bronchoalveolar lavage fluid for invasive fungal disease: A meta-analysis.

    PubMed

    Shi, Xin-Yu; Liu, Yao; Gu, Xian-Min; Hao, Sheng-Yu; Wang, Yu-Hong; Yan, Di; Jiang, Shu-Juang

    2016-08-01

    The serum (1 → 3)-β-D-glucan (BG) assay has been approved for diagnosing invasive fungal diseases (IFDs). However, the performance of (1 → 3)-β-D-glucan assay in bronchoalveolar lavage (BAL) fluid is various among studies. The present study aimed to assess the accuracy of (1 → 3)-β-D-glucan assay in bronchoalveolar lavage fluid for the diagnosis of invasive fungal diseases by means of meta-analysis and systematic review of relevant studies. The sensitivity, specificity, positive likelihood ratio (PLR), negative likelihood ratio (NLR), diagnostic odds ratio (OR) and a summary receiver-operating characteristic curve of BAL-BG for diagnosing invasive fungal diseases were pooled using meta-analysis. We also performed meta-regression analysis. A total of 838 patients (138 with proven or probable invasive fungal diseases), included in 6 studies, were analyzed. The pooled sensitivity, specificity, PLR, NLR and diagnostic odds ratio were 0.52 (95%CI, 0.38-0.53), 0.58 (95%CI, 0.55-0.61), 1.34 (95%CI, 1.08-1.66), 0.82 (95% CI, 0.63-1.07) and 1.71 (95%CI, 1.01-2.92) respectively. The area under the summary receiver operating characteristic curve, with 95% confidence intervals was 0.61 (95%CI, 0.67-0.55). The accuracy of (1 → 3)-β-D-glucan test in bronchoalveolar lavage fluid is marginal, so that the results should not be interpreted alone but can be used as a part of full assessment with clinical features, image findings and other laboratory results for the diagnosis of invasive fungal diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Aphanomyces euteiches cell wall fractions containing novel glucan-chitosaccharides induce defense genes and nuclear calcium oscillations in the plant host Medicago truncatula.

    PubMed

    Nars, Amaury; Lafitte, Claude; Chabaud, Mireille; Drouillard, Sophie; Mélida, Hugo; Danoun, Saïda; Le Costaouëc, Tinaig; Rey, Thomas; Benedetti, Julie; Bulone, Vincent; Barker, David George; Bono, Jean-Jacques; Dumas, Bernard; Jacquet, Christophe; Heux, Laurent; Fliegmann, Judith; Bottin, Arnaud

    2013-01-01

    N-acetylglucosamine-based saccharides (chitosaccharides) are components of microbial cell walls and act as molecular signals during host-microbe interactions. In the legume plant Medicago truncatula, the perception of lipochitooligosaccharide signals produced by symbiotic rhizobia and arbuscular mycorrhizal fungi involves the Nod Factor Perception (NFP) lysin motif receptor-like protein and leads to the activation of the so-called common symbiotic pathway. In rice and Arabidopsis, lysin motif receptors are involved in the perception of chitooligosaccharides released by pathogenic fungi, resulting in the activation of plant immunity. Here we report the structural characterization of atypical chitosaccharides from the oomycete pathogen Aphanomyces euteiches, and their biological activity on the host Medicago truncatula. Using a combination of biochemical and biophysical approaches, we show that these chitosaccharides are linked to β-1,6-glucans, and contain a β-(1,3;1,4)-glucan backbone whose β-1,3-linked glucose units are substituted on their C-6 carbon by either glucose or N-acetylglucosamine residues. This is the first description of this type of structural motif in eukaryotic cell walls. Glucan-chitosaccharide fractions of A. euteiches induced the expression of defense marker genes in Medicago truncatula seedlings independently from the presence of a functional Nod Factor Perception protein. Furthermore, one of the glucan-chitosaccharide fractions elicited calcium oscillations in the nucleus of root cells. In contrast to the asymmetric oscillatory calcium spiking induced by symbiotic lipochitooligosaccharides, this response depends neither on the Nod Factor Perception protein nor on the common symbiotic pathway. These findings open new perspectives in oomycete cell wall biology and elicitor recognition and signaling in legumes.

  14. Isomalto/malto-polysaccharide, a novel soluble dietary fiber made via enzymatic conversion of starch.

    PubMed

    Leemhuis, Hans; Dobruchowska, Justyna M; Ebbelaar, Monique; Faber, Folkert; Buwalda, Pieter L; van der Maarel, Marc J E C; Kamerling, Johannis P; Dijkhuizen, Lubbert

    2014-12-10

    Dietary fibers are at the forefront of nutritional research because they positively contribute to human health. Much of our processed foods contain, however, only small quantities of dietary fiber, because their addition often negatively affects the taste, texture, and mouth feel. There is thus an urge for novel types of dietary fibers that do not cause unwanted sensory effects when applied as ingredient, while still positively contributing to the health of consumers. Here, we report the generation and characterization of a novel type of soluble dietary fiber with prebiotic properties, derived from starch via enzymatic modification, yielding isomalto/malto-polysaccharides (IMMPs), which consist of linear (α1 → 6)-glucan chains attached to the nonreducing ends of starch fragments. The applied Lactobacillus reuteri 121 GTFB 4,6-α-glucanotransferase enzyme synthesizes these molecules by transferring the nonreducing glucose moiety of an (α1 → 4)-glucan chain to the nonreducing end of another (α1 → 4)-α-glucan chain, forming an (α1 → 6)-glycosidic linkage. Once elongated in this way, the molecule becomes a better acceptor substrate and is then further elongated with (α1 → 6)-linked glucose residues in a linear way. Comparison of 30 starches, maltodextrins, and α-glucans of various botanical sources, demonstrated that substrates with long and linear (α1 → 4)-glucan chains deliver products with the highest percentage of (α1 → 6) linkages, up to 92%. In vitro experiments, serving as model of the digestive power of the gastrointestinal tract, revealed that the IMMPs, or more precisely the IMMP fraction rich in (α1 → 6) linkages, will largely pass the small intestine undigested and therefore end up in the large intestine. IMMPs are a novel type of dietary fiber that may have health promoting activity.

  15. Anti-infective properties of the melanin-glucan complex obtained from medicinal tinder bracket mushroom, Fomes fomentarius (L.: Fr.) Fr. (Aphyllophoromycetideae).

    PubMed

    Seniuk, Olga F; Gorovoj, Leontiy F; Beketova, Galina V; Savichuk, Hatalia O; Rytik, Petr G; Kucherov, Igor I; Prilutskay, Alla B; Prilutsky, Alexandr I

    2011-01-01

    The goal of this investigation was to comparatively study the efficiency of traditionally used anti-infective drugs and biopolymer complexes originated from the medicinal mushroom Fomes fomentarius (L.:Fr.) Fr.: 1) water-soluble melanin-glucan complex (MGC; -80% melanins and -20% beta-glucans) and 2) insoluble chitin-glucan-melanin complex (ChGMC; -70% chitin, -20% beta-glucans, and -10% melanins). Infectious materials (Helicobacter pylori, Candida albicans, and Herpes vulgaris I and HIV-1(zmb) were used in pure cultures of in vitro and in vivo models on experimental animals. Comparison studies of fungal biopolymers and effective modern antifungal, antibacterial, and antiviral drugs were used in in vitro models. The comparative clinical efficiency of ChGMC and of etiotropic pharmaceuticals in models of H. pylori, C. albicans, and H. vulgaris I infection contamination were studied. Using in vitro models, it was established that MGC completely depresses growth of C. albicans. MGC had an antimicrobial effect on H. pylori identical to erythromycin in all concentrations, and had a stronger action on this bacterium than other tested antibiotics. Tested MGC possesses simultaneously weak toxicity and high anti-HIV-1 activity in comparison with zidovudine (Retrovir). The obtained results show that CLUDDT therapy in Wistar rats with the application of ChGMC is, on average, 1.35-1.43 times as effective as a traditional one. Considering the absence of MGC and ChGMC toxic properties on blood cells even in very high concentrations, these complexes may be used as a source of biopolymers for the creation of essentially new agents for wide application in infectious pathology.

  16. Aphanomyces euteiches Cell Wall Fractions Containing Novel Glucan-Chitosaccharides Induce Defense Genes and Nuclear Calcium Oscillations in the Plant Host Medicago truncatula

    PubMed Central

    Nars, Amaury; Lafitte, Claude; Chabaud, Mireille; Drouillard, Sophie; Mélida, Hugo; Danoun, Saïda; Le Costaouëc, Tinaig; Rey, Thomas; Benedetti, Julie; Bulone, Vincent; Barker, David George; Bono, Jean-Jacques; Dumas, Bernard; Jacquet, Christophe; Heux, Laurent; Fliegmann, Judith; Bottin, Arnaud

    2013-01-01

    N-acetylglucosamine-based saccharides (chitosaccharides) are components of microbial cell walls and act as molecular signals during host-microbe interactions. In the legume plant Medicago truncatula, the perception of lipochitooligosaccharide signals produced by symbiotic rhizobia and arbuscular mycorrhizal fungi involves the Nod Factor Perception (NFP) lysin motif receptor-like protein and leads to the activation of the so-called common symbiotic pathway. In rice and Arabidopsis, lysin motif receptors are involved in the perception of chitooligosaccharides released by pathogenic fungi, resulting in the activation of plant immunity. Here we report the structural characterization of atypical chitosaccharides from the oomycete pathogen Aphanomyces euteiches, and their biological activity on the host Medicago truncatula. Using a combination of biochemical and biophysical approaches, we show that these chitosaccharides are linked to β-1,6-glucans, and contain a β-(1,3;1,4)-glucan backbone whose β-1,3-linked glucose units are substituted on their C-6 carbon by either glucose or N-acetylglucosamine residues. This is the first description of this type of structural motif in eukaryotic cell walls. Glucan-chitosaccharide fractions of A. euteiches induced the expression of defense marker genes in Medicago truncatula seedlings independently from the presence of a functional Nod Factor Perception protein. Furthermore, one of the glucan-chitosaccharide fractions elicited calcium oscillations in the nucleus of root cells. In contrast to the asymmetric oscillatory calcium spiking induced by symbiotic lipochitooligosaccharides, this response depends neither on the Nod Factor Perception protein nor on the common symbiotic pathway. These findings open new perspectives in oomycete cell wall biology and elicitor recognition and signaling in legumes. PMID:24086432

  17. Comparative evaluation of acid and alkaline sulfite pretreatments for enzymatic saccharification of bagasses from three different sugarcane hybrids.

    PubMed

    Monte, Joseana R; Laurito-Friend, Debora F; Ferraz, André; Milagres, Adriane M F

    2018-04-26

    Sugarcane bagasses from three experimental sugarcane hybrids and a mill-reference sample were used to compare the efficiency and mode of action of acid and alkaline sulfite pretreatment processes. Varied chemical loads and reaction temperatures were used to prepare samples with distinguished characteristics regarding xylan and lignin removals, as well as sulfonation levels of residual lignins. The pretreatment with low sulfite loads (5%) under acidic conditions (pH 2) provided maximum glucose yield of 70% during enzymatic hydrolysis with cellulases (10 FPU/g) and β-glucosidases (20 UI/g bagasse). In this case, glucan enzymatic conversion from pretreated materials was mostly associated with extensive xylan removal (70-100%) and partial delignification occurred during the pretreatment. The use of low sulfite loads under acidic conditions required pretreatment temperatures of 160°C. In contrast, at a lower pretreatment temperature (120°C), alkaline sulfite process achieved similar glucan digestibility, but required a higher sulfite load (7.5%). Residual xylans from acid pretreated materials were almost completely hydrolysed by commercial enzymes, contrasting with relatively lower xylan to xylose conversions observed in alkaline pretreated samples. Efficient xylan removal during acid sulfite pretreatment and also during enzymatic digestion can be useful to enhance glucan accessibility and digestibility by cellulases. Alkaline sulfite process also provided substrates with high glucan digestibility, mainly associated with delignification and sulfonation of residual lignins. The results demonstrate that temperature, pH and sulfite can be combined for reducing lignocellulose recalcitrance and achieve similar glucan conversion rates in the alkaline and acid sulfite pretreated bagasses. This article is protected by copyright. All rights reserved. © 2018 American Institute of Chemical Engineers.

  18. Purification and characterization of highly branched α-glucan-producing enzymes from Paenibacillus sp. PP710.

    PubMed

    Tsusaki, Keiji; Watanabe, Hikaru; Yamamoto, Takuo; Nishimoto, Tomoyuki; Chaen, Hiroto; Fukuda, Shigeharu

    2012-01-01

    Highly branched α-glucan molecules exhibit low digestibility for α-amylase and glucoamylase, and abundant in α-(1→3)-, α-(1→6)-glucosidic linkages and α-(1→6)-linked branch points where another glucosyl chain is initiated through an α-(1→3)-linkage. From a culture supernatant of Paenibacillus sp. PP710, we purified α-glucosidase (AGL) and α-amylase (AMY), which were involved in the production of highly branched α-glucan from maltodextrin. AGL catalyzed the transglucosylation reaction of a glucosyl residue to a nonreducing-end glucosyl residue by α-1,6-, α-1,4-, and α-1,3-linkages. AMY catalyzed the hydrolysis of the α-1,4-linkage and the intermolecular or intramolecular transfer of maltooligosaccharide like cyclodextrin glucanotransferase (CGTase). It also catalyzed the transfer of an α-1,4-glucosyl chain to a C3- or C4-hydroxyl group in the α-1,4- or α-1,6-linked nonreducing-end residue or the α-1,6-linked residue located in the other chains. Hence AMY was regarded as a novel enzyme. We think that the mechanism of formation of highly branched α-glucan from maltodextrin is as follows: α-1,6- and α-1,3-linked residues are generated by the transglucosylation of AGL at the nonreducing ends of glucosyl chains. Then AMY catalyzes the transfer of α-1,4-chains to C3- or C4-hydroxyl groups in the α-1,4- or α-1,6-linked residues generated by AGL. Thus the concerted reactions of both AGL and AMY are necessary to produce the highly branched α-glucan from maltodextrin.

  19. Characterization of Airborne Molds, Endotoxins, and Glucans in Homes in New Orleans after Hurricanes Katrina and Rita▿

    PubMed Central

    Rao, Carol Y.; Riggs, Margaret A.; Chew, Ginger L.; Muilenberg, Michael L.; Thorne, Peter S.; Van Sickle, David; Dunn, Kevin H.; Brown, Clive

    2007-01-01

    In August and September 2005, Hurricanes Katrina and Rita caused breeches in the New Orleans, LA, levee system, resulting in catastrophic flooding. The city remained flooded for several weeks, leading to extraordinary mold growth in homes. To characterize the potential risks of mold exposures, we measured airborne molds and markers of molds and bacteria in New Orleans area homes. In October 2005, we collected air samples from 5 mildly water-damaged houses, 15 moderately to heavily water-damaged houses, and 11 outdoor locations. The air filters were analyzed for culturable fungi, spores, (1→3,1→6)-β-d-glucans, and endotoxins. Culturable fungi were significantly higher in the moderately/heavily water-damaged houses (geometric mean = 67,000 CFU/m3) than in the mildly water-damaged houses (geometric mean = 3,700 CFU/m3) (P = 0.02). The predominant molds found were Aspergillus niger, Penicillium spp., Trichoderma, and Paecilomyces. The indoor and outdoor geometric means for endotoxins were 22.3 endotoxin units (EU)/m3 and 10.5 EU/m3, respectively, and for (1→3,1→6)-β-d-glucans were 1.7 μg/m3 and 0.9 μg/m3, respectively. In the moderately/heavily water-damaged houses, the geometric means were 31.3 EU/m3 for endotoxins and 1.8 μg/m3 for (1→3,1→6)-β-d-glucans. Molds, endotoxins, and fungal glucans were detected in the environment after Hurricanes Katrina and Rita in New Orleans at concentrations that have been associated with health effects. The species and concentrations were different from those previously reported for non-water-damaged buildings in the southeastern United States. PMID:17209066

  20. Over-expression of (1,3;1,4)-β-D-glucanase isoenzyme EII gene results in decreased (1,3;1,4)-β-D-glucan content and increased starch level in barley grains.

    PubMed

    Han, Ning; Na, Chenglong; Chai, Yuqiong; Chen, Jianshu; Zhang, Zhongbo; Bai, Bin; Bian, Hongwu; Zhang, Yuhong; Zhu, Muyuan

    2017-01-01

    High content of (1,3;1,4)-β-d-glucan in barley grains is regarded as an undesirable factor affecting malting potential, brewing yield and feed utilization. Production of thermostable bacterial (1,3;1,4)-β-glucanase in transgenic barley grain or supplementation of exogenous bacterial (1,3;1,4)-β-glucanase has been used to improve malt and feed quality. The aim of the present study was to investigate the effect of over-expression of an endogenous (1,3;1,4)-β-glucanase on β-glucan content and grain composition in barley. A construct containing full-length HvGlb2 cDNA encoding barley (1,3;1,4)-β-glucanase isoenzyme EII under the control of a promoter of barley D-Hordein gene Hor3-1 was introduced into barley cultivar Golden Promise via Agrobacterium-mediated transformation, and transgenic plants were regenerated after hygromycin selection. The T 2 generation of proHor3:HvGlb2 transgenic lines showed increased activity of (1,3;1,4)-β-glucanase in grains. Total β-glucan content was reduced by more than 95.73% in transgenic grains compared with the wild-type control. Meanwhile, over-expression of (1,3;1,4)-β-glucanase led to an increase in 1000-grain weight, which might be due to elevated amounts of starch in the grain. Manipulating the expression of (1,3;1,4)-β-glucanase EII can control the β-glucan content in grain with no apparent harmful effects on grain quality of transgenic plants. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  1. Properties of Streptococcus mutans Grown in a Synthetic Medium: Binding of Glucosyltransferase and In Vitro Adherence, and Binding of Dextran/Glucan and Glycoprotein and Agglutination

    PubMed Central

    Wu-Yuan, Christine D.; Tai, Stella; Slade, Hutton D.

    1979-01-01

    The influence of culture media on various properties of Streptococcus mutans was investigated. Strains of S. mutans (serotypes c, d, f, and g) were grown in a complex medium (Todd-Hewitt broth [THB]) or a synthetic medium (SYN). The SYN cells, in contrast to THB cells, did not bind extracellular glucosyltransferase and did not produce in vitro adherence. Both types of cells possessed constitutive levels of glucosyltransferase. B13 cells grown in SYN plus invertase-treated glucose possessed the same level of constitutive enzyme as THB cells. In contrast to THB cells, the SYN cells of seven serotype strains did not agglutinate upon the addition of high-molecular-weight dextran/glucan. Significant quantities of lower-molecular-weight (2 × 104 or 7 × 104) dextran and B13 glucan were bound by SYN cells. SYN cells agglutinated weakly in anti-glucan serum (titers, 0 to 16), whereas THB cells possessed titers of 32 to 256. Evidence for the existence of a second binding site in agglutination which does not possess a glucan-like polymer has been obtained. B13 cells grown in invertase-treated THB agglutinated to the same degree as normal THB cells. The nature of this site is unknown. SYN cells possess the type-specific polysaccharide antigen. B13 cells did not bind from THB a glycoprotein which reacts with antisera to the A, B, or T blood group antigens or which allows agglutination upon the addition of dextran. The results demonstrate that S. mutans grown in a chemically defined medium possesse markedly different biochemical and biological activities than cells grown in a complex organic medium. PMID:457252

  2. Insight into multi-site mechanisms of glycosyl transfer in (1-->4)beta-D-glycans provided by the cereal mixed-linkage (1-->3),(1-->4)beta-D-glucan synthase.

    PubMed

    Buckeridge, M S; Vergara, C E; Carpita, N C

    2001-08-01

    Synthases of cellulose, chitin, hyaluronan, and all other polymers containing (1-->4)beta-linked glucosyl, mannosyl and xylosyl units have overcome a substrate orientation problem in catalysis because the (1-->4)beta-linkage requires that each of these sugar units be inverted nearly 180 degrees with respect to its neighbors. We and others have proposed that this problem is solved by two modes of glycosyl transfer within a single catalytic subunit to generate disaccharide units, which, when linked processively, maintain the proper orientation without rotation or re-orientation of the synthetic machinery in 3-dimensional space. A variant of the strict (1-->4)beta-D-linkage structure is the mixed-linkage (1-->3),(1-->4)beta-D-glucan, a growth-specific cell wall polysaccharide found in grasses and cereals. beta-Glucan is composed primarily of cellotriosyl and cellotetraosyl units linked by single (1-->3)beta-D-linkages. In reactions in vitro at high substrate concentration, a polymer composed of almost entirely cellotriosyl and cellopentosyl units is made. These results support a model in which three modes of glycosyl transfer occur within the synthase complex instead of just two. The generation of odd numbered units demands that they are connected by (1-->3)beta-linkages and not (1-->4)beta-. In this short review of beta-glucan synthesis in maize, we show how such a model not only provides simple mechanisms of synthesis for all (1-->4)beta-D-glycans but also explains how the synthesis of callose, or strictly (1-->3)beta-D-glucans, occurs upon loss of the multiple modes of glycosyl transfer to a single one.

  3. Synthesis and evaluation of di- and trimeric hydroxylamine-based β-(1→3)-glucan mimetics.

    PubMed

    Ferry, Angélique; Malik, Gaëlle; Guinchard, Xavier; Vĕtvička, Václav; Crich, David

    2014-10-22

    Di- and trimeric hydroxylamine-based mimetics of β-(1→3)-glucans have been accessed by an asymmetric synthesis route featuring an iterative double ring-closing reductive amination reaction. These oligomeric hydroxylamines are demonstrated to inhibit the staining of human neutrophils and of mouse macrophages by fluorescent anti-CR3 and anti-dectin-1 antibodies, respectively, and to stimulate phagocytosis, all in a linkage-dependent manner suggestive of binding to the lectin domains of complement receptor 3 (CR3) and dectin-1. The ability of these relatively short mimetics to bind to CR3 and dectin-1, as compared to the greater degree of polymerization required in β-(1→3)-glucans, is discussed in terms of the increased hydrophobicity of the α-face on replacement of the glycosidic bond by the hydroxylamine linkage.

  4. Effect of nagilactone E on cell morphology and glucan biosynthesis in budding yeast Saccharomyces cerevisiae.

    PubMed

    Hayashi, Kengo; Yamaguchi, Yoshihiro; Ogita, Akira; Tanaka, Toshio; Kubo, Isao; Fujita, Ken-Ichi

    2018-05-14

    Nagilactones are norditerpene dilactones isolated from the root bark of Podocarpus nagi. Although nagilactone E has been reported to show antifungal activities, its activity is weaker than that of antifungals on the market. Nagilactone E enhances the antifungal activity of phenylpropanoids such as anethole and isosafrole against nonpathogenic Saccharomyces cerevisiae and pathogenic Candida albicans. However, the detailed mechanisms underlying the antifungal activity of nagilactone E itself have not yet been elucidated. Therefore, we investigated the antifungal mechanisms of nagilactone E using S. cerevisiae. Although nagilactone E induced lethality in vegetatively growing cells, it did not affect cell viability in non-growing cells. Nagilactone E-induced morphological changes in the cells, such as inhomogeneous thickness of the glucan layer and leakage of cytoplasm. Furthermore, a dose-dependent decrease in the amount of newly synthesized (1, 3)-β-glucan was detected in the membrane fractions of the yeast incubated with nagilactone E. These results suggest that nagilactone E exhibits an antifungal activity against S. cerevisiae by depending on cell wall fragility via the inhibition of (1, 3)-β-glucan biosynthesis. Additionally, we confirmed nagilactone E-induced morphological changes of a human pathogenic fungus Aspergillus fumigatus. Therefore, nagilactone E is a potential antifungal drug candidate with fewer adverse effects. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Immune functions of insect βGRPs and their potential application.

    PubMed

    Rao, Xiang-Jun; Zhan, Ming-Yue; Pan, Yue-Min; Liu, Su; Yang, Pei-Jin; Yang, Li-Ling; Yu, Xiao-Qiang

    2018-06-01

    Insects rely completely on the innate immune system to sense the foreign bodies and to mount the immune responses. Germ-line encoded pattern recognition receptors play crucial roles in recognizing pathogen-associated molecular patterns. Among them, β-1,3-glucan recognition proteins (βGRPs) and gram-negative bacteria-binding proteins (GNBPs) belong to the same pattern recognition receptor family, which can recognize β-1,3-glucans. Typical insect βGRPs are comprised of a tandem carbohydrate-binding module in the N-terminal and a glucanase-like domain in the C-terminal. The former can recognize triple-helical β-1,3-glucans, whereas the latter, which normally lacks the enzymatic activity, can recruit adapter proteins to initiate the protease cascade. According to studies, insect βGRPs possess at least three types of functions. Firstly, some βGRPs cooperate with peptidoglycan recognition proteins to recognize the lysine-type peptidoglycans upstream of the Toll pathway. Secondly, some directly recognize fungal β-1,3-glucans to activate the Toll pathway and melanization. Thirdly, some form the 'attack complexes' with other immune effectors to promote the antifungal defenses. The current review will focus on the discovery of insect βGRPs, functions of some well-characterized members, structure-function studies and their potential application. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Morphology and Structural Properties of Novel Short Linear Glucan/Protein Hybrid Nanoparticles and Their Influence on the Rheological Properties of Starch Gel.

    PubMed

    Li, Xiaojing; Ji, Na; Li, Man; Zhang, Shuangling; Xiong, Liu; Sun, Qingjie

    2017-09-13

    Starch nanoparticles were potential texture modifiers. However, they have strong tendency to aggregate and poor water dispersibility, which limited their application. The interaction between glucan (prepared from starch by enzymatic modification) and protein could significantly improve the dispersity of starch nanoparticles and, thus, enhance the rheological properties of food gels. In this work, glucan/protein hybrid nanoparticles were successfully developed for the first time using short linear glucan (SLG) and edible proteins [soy protein isolate (SPI), rice protein (RP), and whey protein isolate (WPI)]. The results showed that the SLG/SPI hybrid nanoparticles exhibited hollow structures, of which the smallest size was approximately 10-20 nm when the SLG/SPI ratio was 10:5. In contrast, SLG/RP nanoparticles displayed flower-like superstructures, and SLG/WPI nanoparticles presented stacked lamellar nanostructures with a width of 5-10 nm and a length of 50-70 nm. In comparison to bare SLG nanoparticles, SLG/SPI and SLG/WPI hybrid nanoparticles had higher melting temperatures. The addition of all nanoparticles greatly increased the storage modulus of corn starch gels and decreased loss tangent values. Importantly, the G' value of starch gels increased by 567% with the addition of flower-like SLG/RP superstructures.

  7. Beta-1,3-1,6-glucan modulate the non-specific immune response to enhance the survival in the Vibrio alginolyticus infection of Taiwan abalone (Haliotis diversicolor supertexta).

    PubMed

    Wu, Yu-Sheng; Tseng, Tzu-Yu; Nan, Fan-Hua

    2016-07-01

    This research aims to investigate the non-specific immune response of Taiwan abalone (Haliotis diversicolor supertexta) which was treated with the beta-1,3-1,6-glucan to be observed in the survival impact after the Vibrio alginolyticus infection. The non-specific immune and physiological response of superoxide anion radical (O2(-)), phenoloxidase (PO), phagocytic index (PI), phagocytic rate (PR) and lucigenin-chemiluminescence for reactive oxygen intermediates (ROIs) were enhanced via in-vitro experiment. In the in-vivo experiment, the observed data presented that the haemolymph lysate supernatant (HLS), superoxide dismutase (SOD), glutamate oxalacetate transaminase (GOT) and glutamate pyruvate transaminase (GPT) were not significant enhanced, but the total haemocyte count (THC), O2(-), PO, phagocytic index (PI), phagocytic ratio (PR) and other parameters of immune were significantly promoted after treated with beta-1,3-1,6-glucan. In the challenge experiment, the survival rates of abalone in the 40 and 80 μl/ml groups of beta-1,3-1,6-glucan were observed from 6.67% up to 33.33% and 36.67% after injection with Vibrio alginolyticus, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Scaffolded Antigens in Yeast Cell Particle Vaccines Provide Protection against Systemic Polyoma Virus Infection.

    PubMed

    Tipper, Donald J; Szomolanyi-Tsuda, Eva

    2016-01-01

    Background. U65, a self-aggregating peptide scaffold, traps fused protein antigens in yeast cells. Conversion to Yeast Cell Particle (YCP) vaccines by partial removal of surface mannoproteins exposes β-glucan, mediating efficient uptake by antigen-presenting cells (APCs). YCP vaccines are inexpensive, capable of rapid large-scale production and have potential for both parenteral and oral use. Results. YCP processing by alkaline hydrolysis exposes up to 20% of the glucan but converts scaffolded antigen and internal yeast proteins into a common aggregate, preventing selective yeast protein removal. For U65-green fluorescent protein (GFP) or U65-Apolipoprotein A1 (ApoA1) subcutaneous vaccines, maximal IgG responses in mice required 10% glucan exposure. IgG responses to yeast proteins were 5-fold lower. Proteolytic mannoprotein removal produced YCPs with only 6% glucan exposure, insufficiently porous for selective removal of even native yeast proteins. Vaccine efficacy was reduced 10-fold. Current YCP formulations, therefore, are not suitable for human use but have considerable potential for use in feed animal vaccines. Significantly, a YCP vaccine expressing a GFP fusion to VP1, the murine polyoma virus major capsid protein, after either oral or subcutaneous administration, protected mice against an intraperitoneal polyoma virus challenge, reducing viral DNA levels in spleen and liver by >98%.

  9. Comparison of the mechanism of cellulose biosynthesis in plants and bacteria. [Acetobacter xylinum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Delmer, D.P.; Benziman, M.; Klein, A.S.

    1983-01-01

    Results of recent studies on the mechanism of cellulose biosynthesis in higher plants and in the bacterium Acetobacter xylinum are compared and contrasted. In higher plants, the synthesizing complex is thought to be mobile in the fluid-mosaic plasma membrane, whereas it is stationary in cells of A. xylinum. Similar patterns of sensitivity to inhibitors of cellulose synthesis as well as to changes in transmembrane electrical potential are shared by both plants and A. xylinum. In vivo tracer studies with both types of organisms support the concept the UDP-glucose is a precursor of cellulose. A characterization of additional compounds which maymore » serve as precursors in A. xylinum beyond the level of UDP-glucose is described. UDP-glucose:..beta..-glucan synthetases have been solubilized from plants and A. xylinum. Attempts at purification of solubilized soybean glucan synthetases indicate that a factor(s) is lost during purification which is necessary for activity; studies described elsewhere indicate that the A. xylinum ..beta..-1,4-glucan synthetase requires a protein factor for GTP activation. The stimulatory effect of polyethylene glycol (PEG) on glucan synthetases from both plants and A. xylinum may relate to stabilization by PEG of enzyme-factor associations. 34 references, 3 figures, 3 tables.« less

  10. D-lactic acid production from cellooligosaccharides and beta-glucan using L-LDH gene-deficient and endoglucanase-secreting Lactobacillus plantarum.

    PubMed

    Okano, Kenji; Zhang, Qiao; Yoshida, Shogo; Tanaka, Tsutomu; Ogino, Chiaki; Fukuda, Hideki; Kondo, Akihiko

    2010-01-01

    In order to achieve direct fermentation of an optically pure D: -lactic acid from cellulosic materials, an endoglucanase from a Clostridium thermocellum (CelA)-secreting plasmid was introduced into an L: -lactate dehydrogenase gene (ldhL1)-deficient Lactobacillus plantarum (ldhL1) bacterial strain. CelA expression and its degradation of beta-glucan was confirmed by western blot analysis and enzyme assay, respectively. Although the CelA-secreting ldhL1 assimilated cellooligosaccharides up to cellohexaose (although not cellotetraose), the main end product was acetic acid, not lactic acid, due to the conversion of lactic acid to acetic acid. Cultivation under anaerobic conditions partially suppressed this conversion resulting in the production of 1.27 g/l of D: -lactic acid with a high optical purity of 99.5% from a medium containing 2 g/l of cellohexaose. Subsequently, D: -lactic acid fermentation from barley beta-glucan was carried out with the addition of Aspergillus aculeatus beta-glucosidase produced by recombinant Aspergillus oryzae and 1.47 g/l of D: -lactic was produced with a high optical purity of 99.7%. This is the first report of direct lactic acid fermentation from beta-glucan and a cellooligosaccharide that is a more highly polymerized sugar than cellotriose.

  11. The effectiveness of natural and synthetic immunomodulators in the treatment of inflammatory bowel disease in dogs.

    PubMed

    Rychlik, Andrzej; Nieradka, Renata; Kander, Małgorzata; Nowicki, Marcin; Wdowiak, Michał; Kołodziejska-Sawerska, Anna

    2013-09-01

    The aim of the study was to evaluate the usefulness of immunomodulators in the treatment of inflammatory bowel disease (IBD) in dogs. Twenty-eight dogs diagnosed with IBD took part in the study. The animals received a food containing extruded immunomodulators: β-1,3/1,6-D-glucan, β-hydroxy-β-methyl-butyrate (HMB) and levamisole for 42 days. Whole blood samples were analysed before and after therapy assessing changes in phagocyte activity (respiratory burst activity, RBA and potential killing activity, PKA), evaluation of proliferation response of mitogen-stimulated lymphocytes and serum gamma globulin levels, lysozyme activity, ceruloplasmin levels and interleukin activity (IL-6 and IL-10). In this experiment, β-1,3/1,6-D-glucan delivered the highest level of treatment efficacy by producing the quickest therapeutic effect, lowering Canine Inflammatory Bowel Disease Activity Index (CIBDAI) values to below 3, improving histopathological parameters, decreasing IL-6 levels, increasing IL-10 concentrations, and producing remission periods longer than six months. HMB and levamisole were also effective in lowering CIBDAI scores, but the abatement of clinical symptoms was slower and less pronounced in comparison with β-1,3/1,6-D-glucan. The results indicate that β-1,3/1,6-D-glucan can be useful in the treatment of canine IBD.

  12. Polysaccharide-inducible endoglucanases from Lentinula edodes exhibit a preferential hydrolysis of 1,3-1,4-β-glucan and xyloglucan.

    PubMed

    Takeda, Takumi; Nakano, Yuki; Takahashi, Machiko; Sakamoto, Yuichi; Konno, Naotake

    2013-08-07

    Three genes encoding glycoside hydrolase family 12 (GH12) enzymes from Lentinula edodes, namely Lecel12A, Lecel12B, and Lecel12C, were newly cloned by PCR using highly conserved sequence primers. To investigate enzymatic properties, recombinant enzymes encoded by L. edodes DNAs and GH12 genes from Postia placenta (PpCel12A and PpCel12B) and Schizophyllum commune (ScCel12A) were prepared in Brevibacillus choshinensis. Recombinant LeCel12A, PpCel12A, and PpCel12B, which were grouped in GH12 subfamily 1, preferentially hydrolyzed 1,3-1,4-β-glucan. By contrast, LeCel12B, LeCel12C, and ScCel12A, members of the subfamily 2, exhibited specific hydrolysis of xyloglucan. These results suggest that two subfamilies of GH12 are separated based on the substrate specificity. Transcript levels of L. edodes genes increased 72 h after growth of L. edodes mycelia cells in the presence of plant cell wall polymers such as xyloglucan, 1,3-1,4-β-glucan, and cellulose. These results suggest that L. edodes GH12 enzymes have evolved to hydrolyze 1,3-1,4-β-glucan and xyloglucan, which might enhance hyphal extension and nutrient acquisition.

  13. Transcriptional regulation of fksA, a β-1,3-glucan synthase gene, by the APSES protein StuA during Aspergillus nidulans development.

    PubMed

    Park, Bum-Chan; Park, Yun-Hee; Yi, Soohyun; Choi, Yu Kyung; Kang, Eun-Hye; Park, Hee-Moon

    2014-11-01

    The temporal and spatial regulation of β-1,3-glucan synthesis plays an important role in morphogenesis during fungal growth and development. Northern blot analysis showed that the transcription of fksA, the gene encoding β-1,3-glucan synthase in Aspergillus nidulans, was cell-cycle-dependent and increased steadily over the duration of the vegetative period, but its overall expression during the asexual and sexual stages was fairly constant up until the time of transcription cessation. In an A. nidulans strain mutated in the eukaryotic bHLH-like APSES transcription factor stuA1, the transcriptional level of fksA, and consequently the content of alkali-insoluble cell wall β-glucan, significantly increased at the conidial chain formation and maturation stage. Electrophoretic mobility shift assays revealed that StuA was bound to StREs (StuA Response Elements) on the fksA promoter region. Promoter analysis with sGFP-fusion constructs also indicated the negative regulation of fksA expression by StuA, especially during asexual development. Taken together, these data suggest that StuA plays an important role in cell wall biogenesis during the development of A. nidulans, by controlling the transcription level of fksA.

  14. Dendritic Cell Activation by Glucan Isolated from Umbilicaria Esculenta

    PubMed Central

    Kim, Hyung Sook; Kim, Jee Youn; Lee, Hong Kyung; Kim, Moo Sung; Lee, Sang Rin; Kang, Jong Soon; Kim, Hwan Mook; Lee, Kyung-Ae; Hong, Jin Tae; Kim, Youngsoo

    2010-01-01

    Background Lichen-derived glucans have been known to stimulate the functions of immune cells. However, immunostimulatory activity of glucan obtained from edible lichen, Umbilicaria esculenta, has not been reported. Thus we evaluated the phenotype and functional maturation of dendritic cells (DCs) following treatment of extracted glucan (PUE). Methods The phenotypic and functional maturation of PUE-treated DCs was assessed by flow cytometric analysis and cytokine production, respectively. PUE-treated DCs was also used for mixed leukocyte reaction to evaluate T cell-priming capacity. Finally we detected the activation of MAPK and NF-κB by immunoblot. Results Phenotypic maturation of DCs was shown by the elevated expressions of CD40, CD80, CD86, and MHC class I/II molecules. Functional activation of DCs was proved by increased cytokine production of IL-12, IL-1β, TNF-α, and IFN-α/β, decreased endocytosis, and enhanced proliferation of allogenic T cells. Polymyxin B, specific inhibitor of lipopolysaccharide (LPS), did not affect PUE activity, which suggested that PUE was free of LPS contamination. As a mechanism of action, PUE increased phosphorylation of ERK, JNK, and p38 MAPKs, and enhanced nuclear translocation of NF-κB p50/p65 in DCs. Conclusion These results indicate that PUE induced DC maturation via MAPK and NF-κB signaling pathways. PMID:21286379

  15. USSR and Eastern Europe Scientific Abstracts Biomedical and Behavioral Sciences No. 77

    DTIC Science & Technology

    1977-09-02

    It was established that the preparations con- sist mainly of glucanes having molecular weights of 10,000-16,500. The prepa- ration from yeast extract...containing mannan is a stronger inhibitor of the virus infection than are the glucane preparations. The relationships between the physical parame...changes noted in the blood of the experimental animals, namely an increase in 18 the cholesterol level and the beta -lipoproteide level, and signs of

  16. Chemotherapy for ’Exotic’ RNA Viruses

    DTIC Science & Technology

    1985-01-01

    derived more effective against influenza infection in ti - human alpha, beta . and gamma interferons. sue culture as well as mice (W• sonet al., 1982...growing. Compounds, such as Enhancement of natural resistance to influenza glucan , muramyl di- hnd tripeptides, lipoidal virus in lipopolysaccharide...C. L., Peters. C. J.. Jemski. J. V.. Scott. Levin, M, J., Zaia. J. A., Preblud, S. R. & Arbeit. G. H. & DiLuzio. N. R. (1980). Glucan -induced R. A

  17. β-Glucan Reverses the Epigenetic State of LPS-Induced Immunological Tolerance

    PubMed Central

    Novakovic, Boris; Habibi, Ehsan; Wang, Shuang-Yin; Arts, Rob J.W.; Davar, Robab; Megchelenbrink, Wout; Kim, Bowon; Kuznetsova, Tatyana; Kox, Matthijs; Zwaag, Jelle; Matarese, Filomena; van Heeringen, Simon J.; Janssen-Megens, Eva M.; Sharifi, Nilofar; Wang, Cheng; Keramati, Farid; Schoonenberg, Vivien; Flicek, Paul; Clarke, Laura; Pickkers, Peter; Heath, Simon; Gut, Ivo; Netea, Mihai G.; Martens, Joost H.A.; Logie, Colin; Stunnenberg, Hendrik G.

    2018-01-01

    Summary Innate immune memory is the phenomenon whereby innate immune cells such as monocytes or macrophages undergo functional reprogramming after exposure to microbial components such as lipopolysaccharide (LPS). We apply an integrated epigenomic approach to characterize the molecular events involved in LPS-induced tolerance in a time-dependent manner. Mechanistically, LPS-treated monocytes fail to accumulate active histone marks at promoter and enhancers of genes in the lipid metabolism and phagocytic pathways. Transcriptional inactivity in response to a second LPS exposure in tolerized macrophages is accompanied by failure to deposit active histone marks at promoters of tolerized genes. In contrast, β-glucan partially reverses the LPS-induced tolerance in vitro. Importantly, ex vivo β-glucan treatment of monocytes from volunteers with experimental endotoxemia re-instates their capacity for cytokine production. Tolerance is reversed at the level of distal element histone modification and transcriptional reactivation of otherwise unresponsive genes. PMID:27863248

  18. Potent inhibitory effects of D-tagatose on the acid production and water-insoluble glucan synthesis of Streptococcus mutans GS5 in the presence of sucrose.

    PubMed

    Sawada, Daijo; Ogawa, Takaaki; Miyake, Minoru; Hasui, Yoshinori; Yamaguchi, Fuminori; Izumori, Ken; Tokuda, Masaaki

    2015-01-01

    We examined and compared the inhibitory effects of D-tagatose on the growth, acid production, and water-insoluble glucan synthesis of GS5, a bacterial strain of Streptococcus mutans, with those of xylitol, D-psicose, L-psicose and L-tagatose. GS5 was cultured for 12h in a medium containing 10% (w/v) of xylitol, D-psicose, L-psicose, D-tagatose or L-tagatose, and the inhibitory effect of GS5 growth was assessed. Each sugar showed different inhibitory effects on GS5. Both D-tagatose and xylitol significantly inhibited the acid production and water-insoluble glucan synthesis of GS5 in the presence of 1% (w/v) sucrose. However, the inhibitory effect of acid production by D-tagatose was significantly stronger than that of xylitol in presence of sucrose.

  19. Cyclic-β-glucans of Rhizobium (Sinorhizobium) sp. strain NGR234 are required for hypo-osmotic adaptation, motility, and efficient symbiosis with host plants.

    PubMed

    Gay-Fraret, Jérémie; Ardissone, Silvia; Kambara, Kumiko; Broughton, William J; Deakin, William J; Le Quéré, Antoine

    2012-08-01

    Cyclic-β-glucans (CβG) consist of cyclic homo-polymers of glucose that are present in the periplasmic space of many Gram-negative bacteria. A number of studies have demonstrated their importance for bacterial infection of plant and animal cells. In this study, a mutant of Rhizobium (Sinorhizobium) sp. strain NGR234 (NGR234) was generated in the cyclic glucan synthase (ndvB)-encoding gene. The great majority of CβG produced by wild-type NGR234 are negatively charged and substituted. The ndvB mutation abolished CβG biosynthesis. We found that, in NGR234, a functional ndvB gene is essential for hypo-osmotic adaptation and swimming, attachment to the roots, and efficient infection of Vigna unguiculata and Leucaena leucocephala. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hashim, Muzna; Univ. of Tennessee, Knoxville, TN; Sun, Qining

    The aim of this work was to evaluate the efficiency of an ionic liquid (IL) 1-butyl-3-methylimidazolium acetate ([C4mim][OAc]) pretreatment (110 C for 30 min) in comparison to high severity autohydrolysis pretreatment in terms of delignification, cellulose crystallinity and enzymatic digestibility. The increase in severity of autohydrolysis pretreatment had positive effect on glucan digestibility, but was limited by the crystallinity of cellulose. [C4mim][OAc] pretreated sugarcane bagasse exhibited a substantial decrease in lignin content, reduced cellulose crystallinity, and enhanced glucan and xylan digestibility. Glucan and xylan digestibility was determined as 97.4% and 98.6% from [C4mim][OAc] pretreated bagasse, and 62.1% and 57.5% frommore » the bagasse autohydrolyzed at 205 C for 6 min, respectively. The results indicated the improved digestibility and hydrolysis rates after [C4mim][OAc] pretreatment when compared against a comparable autohydrolyzed biomass.« less

  1. Comparison of (1->3)-β-D-glucan, mannan/anti-mannan antibodies, and Cand-Tec Candida antigen as serum biomarkers for candidemia.

    PubMed

    Held, Jürgen; Kohlberger, Isabelle; Rappold, Elfriede; Busse Grawitz, Andrea; Häcker, Georg

    2013-04-01

    We conducted a case-control study using the Fungitell assay, the novel Platelia Candida Antigen (Ag) Plus and Candida Antibody (Ab) Plus assays, and the Cand-Tec latex agglutination test to evaluate the usefulness of (1→3)-β-D-glucan (BDG), mannan antigen with/without anti-mannan antibody, and Cand-Tec Candida antigen measurement for the diagnosis of candidemia. A total of 56 patients fulfilled the inclusion criteria and were enrolled. One hundred patients with bacteremia and 100 patients with sterile blood cultures served as negative controls. In the candidemia group, median (1→3)-β-D-glucan, mannan antigen, and anti-mannan antibody levels were 427 pg/ml, 190 pg/ml, and 18.6 antibody units (AU)/ml, respectively. All three parameters were significantly elevated in patients with candidemia. The sensitivity and specificity were, respectively, 87.5% and 85.5% for (1→3)-β-D-glucan, 58.9% and 97.5% for mannan antigen, 62.5% and 65.0% for anti-mannan antibody, 89.3% and 63.0% for mannan antigen plus anti-mannan antibody, 89.3% and 85.0% for BDG plus mannan antigen, and 13.0% and 93.9% for Cand-Tec Candida antigen. The low mannan antigen sensitivity was in part caused by Candida parapsilosis and Candida guilliermondii fungemias, which were not detected by the Platelia Candida Ag Plus assay. When the cutoff was lowered from 125 pg/ml to 50 pg/ml, mannan antigen sensitivity increased to 69.6% without severely affecting the specificity (93.5%). Contrary to recently published data, superficial candidiasis was not associated with elevated mannan antigen levels, not even after the cutoff was lowered. Combining procalcitonin (PCT) with (1→3)-β-D-glucan to increase specificity provided a limited advantage because the benefit of the combination did not outweigh the loss of sensitivity. Our results demonstrate that the Cand-Tec Candida antigen and the mannan antigen plus anti-mannan antibody measurements have unacceptably low sensitivity or specificity. Of the four tests compared, (1→3)-β-D-glucan and mannan antigen are the superior biomarkers, depending on whether a sensitivity-driven or specificity-driven approach is used.

  2. Comparison of (1→3)-β-d-Glucan, Mannan/Anti-Mannan Antibodies, and Cand-Tec Candida Antigen as Serum Biomarkers for Candidemia

    PubMed Central

    Kohlberger, Isabelle; Rappold, Elfriede; Busse Grawitz, Andrea; Häcker, Georg

    2013-01-01

    We conducted a case-control study using the Fungitell assay, the novel Platelia Candida Antigen (Ag) Plus and Candida Antibody (Ab) Plus assays, and the Cand-Tec latex agglutination test to evaluate the usefulness of (1→3)-β-d-glucan (BDG), mannan antigen with/without anti-mannan antibody, and Cand-Tec Candida antigen measurement for the diagnosis of candidemia. A total of 56 patients fulfilled the inclusion criteria and were enrolled. One hundred patients with bacteremia and 100 patients with sterile blood cultures served as negative controls. In the candidemia group, median (1→3)-β-d-glucan, mannan antigen, and anti-mannan antibody levels were 427 pg/ml, 190 pg/ml, and 18.6 antibody units (AU)/ml, respectively. All three parameters were significantly elevated in patients with candidemia. The sensitivity and specificity were, respectively, 87.5% and 85.5% for (1→3)-β-d-glucan, 58.9% and 97.5% for mannan antigen, 62.5% and 65.0% for anti-mannan antibody, 89.3% and 63.0% for mannan antigen plus anti-mannan antibody, 89.3% and 85.0% for BDG plus mannan antigen, and 13.0% and 93.9% for Cand-Tec Candida antigen. The low mannan antigen sensitivity was in part caused by Candida parapsilosis and Candida guilliermondii fungemias, which were not detected by the Platelia Candida Ag Plus assay. When the cutoff was lowered from 125 pg/ml to 50 pg/ml, mannan antigen sensitivity increased to 69.6% without severely affecting the specificity (93.5%). Contrary to recently published data, superficial candidiasis was not associated with elevated mannan antigen levels, not even after the cutoff was lowered. Combining procalcitonin (PCT) with (1→3)-β-d-glucan to increase specificity provided a limited advantage because the benefit of the combination did not outweigh the loss of sensitivity. Our results demonstrate that the Cand-Tec Candida antigen and the mannan antigen plus anti-mannan antibody measurements have unacceptably low sensitivity or specificity. Of the four tests compared, (1→3)-β-d-glucan and mannan antigen are the superior biomarkers, depending on whether a sensitivity-driven or specificity-driven approach is used. PMID:23363830

  3. Immunomodulating compounds in Basidiomycetes

    PubMed Central

    Mizuno, Masashi; Nishitani, Yosuke

    2013-01-01

    Mushrooms are distinguished as important food containing immunomodulating and anticancer agents. These compounds belong mostly to polysaccharides especially β-d-glucans. Among them, β-1,3-glucan with side chain β-1,6-glucose residues have more important roles in immunomodulating and antitumor activities. In this review, we have introduced polysaccharide mainly from Lentinula edodes and Agaricus blazei Murill with immunomodulating and antitumor activities. In addition, the mechanism of activation of immune response and signal cascade are also reviewed. PMID:23704809

  4. Micafungin Enhances the Human Macrophage Response to Candida albicans through β-Glucan Exposure.

    PubMed

    Guirao-Abad, José Pedro; Sánchez-Fresneda, Ruth; Machado, Francisco; Argüelles, Juan Carlos; Martínez-Esparza, María

    2018-05-01

    Micafungin belongs to the antifungal family of echinocandins, which act as noncompetitive inhibitors of the fungal cell wall β-1,3-d-glucan synthase. Since Candida albicans is the most prevalent pathogenic fungus in humans, we study the involvement of micafungin in the modulation of the inflammatory response developed by human tissue macrophages against C. albicans The MIC for micafungin was 0.016 μg/ml on the C. albicans SC5314 standard strain. Micafungin induced a drastic reduction in the number of exponential SC5314 viable cells, with the fungicidal effect being dependent on the cellular metabolic activity. Notably, micafungin also caused a structural remodelling of the cell wall, leading to exposure of the β-glucan and chitin content on the external surface. At the higher doses used (0.05 μg/ml), the antifungal also induced the blowing up of budding yeasts. In addition, preincubation with micafungin before exposure to human tissue macrophages enhanced the secretion of tumor necrosis factor alpha (TNF-α), interleukin-17A (IL-17A), and IL-10 cytokines. Our results strongly suggest that in C. albicans treatment with micafungin, in addition to having the expected toxic antifungal effect, it potentiates the immune response, improving the interaction and activation of human macrophages, probably through the unmasking of β-glucans on the cell wall surface. Copyright © 2018 American Society for Microbiology.

  5. The effect of lignin removal by alkaline peroxide pretreatment on the susceptibility of corn stover to purified cellulolytic and xylanolytic enzymes.

    PubMed

    Selig, Michael J; Vinzant, Todd B; Himmel, Michael E; Decker, Stephen R

    2009-05-01

    Pretreatment of corn stover with alkaline peroxide (AP) at pH 11.5 resulted in reduction of lignin content in the residual solids as a function of increasing batch temperature. Scanning electron microscopy of these materials revealed notably more textured surfaces on the plant cell walls as a result of the delignifying pretreatment. As expected, digestion of the delignified samples with commercial cellulase preparations showed an inverse relationship between the content of lignin present in the residual solids after pretreatment and the extent of both glucan and xylan conversion achievable. Digestions with purified enzymes revealed that decreased lignin content in the pretreated solids did not significantly impact the extent of glucan conversion achievable by cellulases alone. Not until purified xylanolytic activities were included with the cellulases were significant improvements in glucan conversion realized. In addition, an inverse relationship was observed between lignin content after pretreatment and the extent of xylan conversion achievable in a 24-h period with the xylanolytic enzymes in the absence of the cellulases. This observation, coupled with the direct relationship between enzymatic xylan and glucan conversion observed in a number of cases, suggests that the presence of lignins may not directly occlude cellulose present in lignocelluloses but rather impact cellulase action indirectly by its association with xylan.

  6. Hydroxypropyl cyclic β-(1 → 2)-D-glucans and epichlorohydrin β-cyclodextrin dimers as effective carbohydrate-solubilizers for polycyclic aromatic hydrocarbons.

    PubMed

    Choi, Jae Min; Jeong, Daham; Piao, Jinglan; Kim, Kyoungtea; Nguyen, Andrew Bao Loc; Kwon, Nak-Jung; Lee, Mi-Kyung; Lee, Im Soon; Yu, Jae-Hyuk; Jung, Seunho

    2015-01-12

    The removal of polycyclic aromatic hydrocarbons by soil washing using water is extremely difficult due to their intrinsic hydrophobic nature. In this study, the effective aqueous solubility enhancements of seven polycyclic aromatic hydrocarbons by chemically modified hydroxypropyl rhizobial cyclic β-(1 → 2)-D-glucans and epichlorohydrin β-cyclodextrin dimer have been investigated for the first time. In the presence of hydroxypropyl cyclic β-(1 → 2)-D-glucans, the solubility of benzo[a]pyrene is increased up to 38 fold of its native solubility. The solubility of pyrene and phenanthrene dramatically increased up to 160 and 359. Coronene, chrysene, perylene, and fluoranthene also show an increase of 11, 23, 23, and 97 fold, respectively, of enhanced solubility by complexation with synthetic epichlorohydrin β-cyclodextrin dimer. The physicochemical properties of the complex are characterized by Fourier-transform infrared spectra and differential scanning calorimetry. Utilizing a scanning electron microscopy, the morphological structures of native benzo[a]pyrene, pyrene, phenanthrene, coronene, chrysene, perylene, fluoranthene and their complex with novel carbohydrate-solubilizers are studied. These results elucidate that polycyclic aromatic hydrocarbons are able to form an efficient complex with hydroxypropyl cyclic β-(1 → 2)-D-glucans and β-cyclodextrin dimer, suggesting the potential usage of chemically modified novel carbohydrate-solubilizers. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Homology modeling, molecular dynamics, and docking studies of pattern-recognition transmembrane protein-lipopolysaccharide and β-1,3 glucan-binding protein from Fenneropenaeus indicus.

    PubMed

    Sivakamavalli, Jeyachandran; Tripathi, Sunil Kumar; Singh, Sanjeev Kumar; Vaseeharan, Baskaralingam

    2015-01-01

    Lipopolysaccharide and β-1,3 glucan-binding protein (LGBP) is a family of pattern-recognition transmembrane proteins (PRPs) which plays a vital role in the immune mechanism of crustaceans in adverse conditions. Fenneropenaeus indicus LGBP-deduced amino acid has conserved potential recognition motif for β-1,3 linkages of polysaccharides and putative RGD (Arg-Gly-Asp) cell adhesion sites for the activation of innate defense mechanism. In order to understand the stimulating activity of β-1,3 glucan (β-glucan) and its interaction with LGBP, a 3D model of LGBP is generated. Molecular docking is performed with this model, and the results indicate Arg71 with strong hydrogen bond from RGD domain of LGBP. Moreover, from the docking studies, we also suggest that Arg34, Lys68, Val135, and Ala146 in LGBP are important amino acid residues in binding as they have strong bonding interaction in the active site of LGBP. In our in vitro studies, yeast agglutination results suggest that shrimp F. indicus LGBP possesses sugar binding and recognition sites in its structure, which is responsible for agglutination reaction. Our results were synchronized with the already reported evidence both in vivo and in vitro experiments. This investigation may be valuable for further experimental investigation in the synthesis of novel immunomodulator.

  8. Redox-dependent interaction between thaumatin-like protein and β-glucan influences malting quality of barley.

    PubMed

    Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder

    2017-07-18

    Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.

  9. Characterization of β-glucan formation by Lactobacillus brevis TMW 1.2112 isolated from slimy spoiled beer.

    PubMed

    Fraunhofer, Marion E; Geissler, Andreas J; Wefers, Daniel; Bunzel, Mirko; Jakob, Frank; Vogel, Rudi F

    2018-02-01

    Despite several hurdles, which hinder bacterial growth in beer, certain bacteria are still able to spoil beer. One type of spoilage is characterized by an increased viscosity and slimy texture caused by exopolysaccharide (EPS) formation of lactic acid bacteria (LAB). In this study, we characterize for the first time EPS production in a beer-spoiling strain (TMW 1.2112) of Lactobacillus brevis, a species commonly involved in beer spoilage. The strain's growth dynamics were assessed and we found an increased viscosity or ropiness in liquid or on solid media, respectively. Capsular polysaccharides (CPS) and released EPS from the cells or supernatant, respectively, were analyzed via NMR spectroscopy and methylation analysis. Both are identical β-(1→3)-glucans, which are ramified with β-glucose residues at position O2. Therefore, we assume that this EPS is mainly produced as CPS and partially released into the surrounding medium, causing viscosity of e.g. beer. CPS formation was confirmed via an agglutination test. A plasmid-located glycosyltransferase-2 was found as responsible for excess β-glucan formation, chromosomal glucanases were proposed for its degradation. The glycosyltransferase-2 gene could also be specifically identified in beer-spoiling, slime-producing Lactobacillus rossiae and Lactobacillus parabuchneri strains, suggesting it as promising marker gene for the early detection of β-glucan-producing Lactobacilli in breweries. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. β-Glucan and dark chocolate: a randomized crossover study on short-term satiety and energy intake.

    PubMed

    Akyol, Asli; Dasgin, Halil; Ayaz, Aylin; Buyuktuncer, Zehra; Besler, H Tanju

    2014-09-23

    The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Study subjects (n = 25) were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON), oat β-glucan (B-GLU), dark chocolate (DARK) or oat β-glucan and dark chocolate (B-GLU + DARK) were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS) scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014). The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

  11. Chemical characterization and wound healing property of a β-D-glucan from edible mushroom Piptoporus betulinus.

    PubMed

    de Jesus, Liana Inara; Smiderle, Fhernanda R; Ruthes, Andrea C; Vilaplana, Francisco; Dal'Lin, Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Van Griensven, Leo J L D; Iacomini, Marcello

    2017-12-20

    A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle laser light scattering, showing a polysaccharide with an average molecular weight of 2.5 × 10 5  Da with a random coil conformation for molecular weights below 1 × 10 6  Da. Typical signals of β-(1 → 3)-linkages were observed in NMR spectrum (δ 102.7/4.76; 102.8/4.74; 102.9/4.52; and δ 85.1/3.78; 85.0/3.77) and also signals of O-6 substitution at δ 69.2/4.22 and 69.2/3.87. The analysis of partially O-methylated alditol acetates corroborates the NMR results, indicating the presence of a β-D-glucan with a main chain (1 → 3)-linked, substituted at O-6 by single-units of glucose. The β-D-glucan showed no toxicity on human colon carcinoma cell line (Caco-2) up to 1000 μg mL -1 and promoted cell migration on in vitro scratch assay, demonstrating a potential wound healing capacity. Copyright © 2017. Published by Elsevier B.V.

  12. Commercial breakfast cereals available in Mexican markets and their contribution in dietary fiber, β-glucans and protein quality by rat bioassays.

    PubMed

    Falcón-Villa, María R; Barrón-Hoyos, Jesús M; Cinco-Moroyoqui, Francisco J

    2014-09-01

    The beneficial effect of dietary fiber (DF) consumption has long been recognized. The global economy and open market trade policies have increased the availability of food products in Mexican markets, resulting in a wide variety of ready-to-eat commercial breakfast cereals classified as 'high fiber'. This research was aimed to evaluate the total dietary fiber contents, its fractions (soluble and insoluble) and β-glucan in 13 commercial 'high-fiber' breakfast cereals, as well as to evaluate their protein quality by rat bioassays. Commercial 'high-fiber' breakfast cereals had 7.42-39.82% insoluble dietary fiber, 2.53-12.85% soluble dietary fiber, and 0.45-4.96% β-glucan. These ready-to-eat commercial 'high-fiber' breakfast cereals differed significantly in their total dietary fiber, their soluble and insoluble DF fractions, and also in their β-glucan contents. When supplied as experimental diets, in 14-day rat feeding trials, the 'high-fiber' breakfast cereals showed an adverse effect on the % N digestibility but protein utilization, as measured as net protein ratio (NPR), was not significantly affected. The consumption of these commercial breakfast cereals, especially those made of oats as the basic ingredient, is highly recommended, since these products, being a concentrated source of dietary fiber, do not affect their protein quality.

  13. Beta-glucan-depleted, glycopeptide-rich extracts from Brewer's and Baker's yeast (Saccharomyces cerevisiae) lower interferon-gamma production by stimulated human blood cells in vitro.

    PubMed

    Williams, Roderick; Dias, Daniel A; Jayasinghe, Nirupama; Roessner, Ute; Bennett, Louise E

    2016-04-15

    Regulation of the human immune system requires controlled pro- and anti-inflammatory responses for host defence against infection and disease states. Yeasts (Saccharomyces cerevisiae), as used in brewing and baking, are mostly known for ability to stimulate the human immune-system predominantly reflecting the pro-inflammatory cell wall β-glucans. However, in this study, using food-compatible processing methods, glycopeptide-enriched and β-glucan-depleted products were each prepared from Brewer's and Baker's yeasts, which suppressed production of interferon-γ (IFN-γ) in human whole blood cell assay, signifying that anti-inflammatory factors are also present in yeast. Anti-inflammatory bioactivities of products prepared from Brewer's and Baker's yeast were compared with the commercial yeast product, Epicor®. While unfractionated Epicor was inactive, the C18 resin-binding fractions of Brewer's and Baker's yeast products and Epicor dose-dependently lowered IFN-γ, demonstrating that Epicor also contained both pro-inflammatory (β-glucans) and anti-inflammatory components. Anti-inflammatory activity was attributed to C18 resin-binding species glyco-peptides in Epicor and experimental yeast products. This study demonstrated that pro- and anti-inflammatory factors could be resolved and enriched in yeasts by suitable processing, with potential to improve specific activities. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

  14. Chitinase-like1/pom-pom1 and its homolog CTL2 are glucan-interacting proteins important for cellulose biosynthesis in Arabidopsis.

    PubMed

    Sánchez-Rodríguez, Clara; Bauer, Stefan; Hématy, Kian; Saxe, Friederike; Ibáñez, Ana Belén; Vodermaier, Vera; Konlechner, Cornelia; Sampathkumar, Arun; Rüggeberg, Markus; Aichinger, Ernst; Neumetzler, Lutz; Burgert, Ingo; Somerville, Chris; Hauser, Marie-Theres; Persson, Staffan

    2012-02-01

    Plant cells are encased by a cellulose-containing wall that is essential for plant morphogenesis. Cellulose consists of β-1,4-linked glucan chains assembled into paracrystalline microfibrils that are synthesized by plasma membrane-located cellulose synthase (CESA) complexes. Associations with hemicelluloses are important for microfibril spacing and for maintaining cell wall tensile strength. Several components associated with cellulose synthesis have been identified; however, the biological functions for many of them remain elusive. We show that the chitinase-like (CTL) proteins, CTL1/POM1 and CTL2, are functionally equivalent, affect cellulose biosynthesis, and are likely to play a key role in establishing interactions between cellulose microfibrils and hemicelluloses. CTL1/POM1 coincided with CESAs in the endomembrane system and was secreted to the apoplast. The movement of CESAs was compromised in ctl1/pom1 mutant seedlings, and the cellulose content and xyloglucan structures were altered. X-ray analysis revealed reduced crystalline cellulose content in ctl1 ctl2 double mutants, suggesting that the CTLs cooperatively affect assembly of the glucan chains, which may affect interactions between hemicelluloses and cellulose. Consistent with this hypothesis, both CTLs bound glucan-based polymers in vitro. We propose that the apoplastic CTLs regulate cellulose assembly and interaction with hemicelluloses via binding to emerging cellulose microfibrils.

  15. Exposure to biohazards in wood dust: bacteria, fungi, endotoxins, and (1-->3)-beta-D-glucans.

    PubMed

    Alwis, K U; Mandryk, J; Hocking, A D

    1999-09-01

    Personal exposure to fungi, bacteria, endotoxin, and (1-->3)-beta-D-glucan was determined at different woodworking sites--logging sites, sawmills, woodchipping sites, and joineries. Exposure levels to fungi at logging sites and sawmills were in the range of 10(3)-10(4) cfu/m3, at the woodchipping mill, 10(3)-10(5) cfu/m3, and at joineries, 10(2)-10(4) cfu/m3. Although mean endotoxin levels were lower than the suggested threshold value of 20 ng/m3, some personal exposures at sawmills and a joinery exceeded the standard. The geometric mean personal (1-->3)-beta-D-glucan exposure level at the woodchipping mill was 2.32 ng/m3, at sawmills, 1.37 ng/m3, at logging sites, 2.02 ng/m3, and at joineries, 0.43 ng/m3. Highly significant associations were found between mean personal inhalable endotoxin exposures and Gram-negative bacteria levels (p < 0.0001), and mean personal inhalable (1-->3)-beta-D-glucan exposures and fungi levels (p = 0.0003). The prevalence of cough, phlegm, chronic bronchitis, nasal symptoms, frequent headaches, and eye and throat irritations was significantly higher among woodworkers than controls. Dose-response relationships were found between personal exposures and work-related symptoms among joinery workers and sawmill and chip mill workers.

  16. A Multifunctional Bread Rich in Beta Glucans and Low in Starch Improves Metabolic Control in Type 2 Diabetes: A Controlled Trial

    PubMed Central

    Tessari, Paolo; Lante, Anna

    2017-01-01

    Design: Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed ‘functional’ bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods: Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Results: Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values (p = 0.028), and by ~0.6% vs. the control group (p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. Conclusions: A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes. PMID:28304350

  17. CHITINASE-LIKE1/POM-POM1 and Its Homolog CTL2 Are Glucan-Interacting Proteins Important for Cellulose Biosynthesis in Arabidopsis[W][OA

    PubMed Central

    Sánchez-Rodríguez, Clara; Bauer, Stefan; Hématy, Kian; Saxe, Friederike; Ibáñez, Ana Belén; Vodermaier, Vera; Konlechner, Cornelia; Sampathkumar, Arun; Rüggeberg, Markus; Aichinger, Ernst; Neumetzler, Lutz; Burgert, Ingo; Somerville, Chris; Hauser, Marie-Theres; Persson, Staffan

    2012-01-01

    Plant cells are encased by a cellulose-containing wall that is essential for plant morphogenesis. Cellulose consists of β-1,4-linked glucan chains assembled into paracrystalline microfibrils that are synthesized by plasma membrane–located cellulose synthase (CESA) complexes. Associations with hemicelluloses are important for microfibril spacing and for maintaining cell wall tensile strength. Several components associated with cellulose synthesis have been identified; however, the biological functions for many of them remain elusive. We show that the chitinase-like (CTL) proteins, CTL1/POM1 and CTL2, are functionally equivalent, affect cellulose biosynthesis, and are likely to play a key role in establishing interactions between cellulose microfibrils and hemicelluloses. CTL1/POM1 coincided with CESAs in the endomembrane system and was secreted to the apoplast. The movement of CESAs was compromised in ctl1/pom1 mutant seedlings, and the cellulose content and xyloglucan structures were altered. X-ray analysis revealed reduced crystalline cellulose content in ctl1 ctl2 double mutants, suggesting that the CTLs cooperatively affect assembly of the glucan chains, which may affect interactions between hemicelluloses and cellulose. Consistent with this hypothesis, both CTLs bound glucan-based polymers in vitro. We propose that the apoplastic CTLs regulate cellulose assembly and interaction with hemicelluloses via binding to emerging cellulose microfibrils. PMID:22327741

  18. β-Glucans in food modify colonic microflora by inducing antimicrobial protein, calprotectin, in a Dectin-1-induced-IL-17F-dependent manner.

    PubMed

    Kamiya, T; Tang, C; Kadoki, M; Oshima, K; Hattori, M; Saijo, S; Adachi, Y; Ohno, N; Iwakura, Y

    2018-05-01

    Dectin-1 (gene symbol: Clec7a) is a receptor for β-glucans that play an important role for the host defense against fungi. Recently, we showed that Clec7a -/- mice are resistant against dextran sodium sulfate (DSS)-induced colitis because of regulatory T-cell population expansion in the colon. The regulatory T-cell expansion is caused by expansion of commensal Lactobacillus murinus whose growth is suppressed by an antimicrobial protein, calprotectin S100A8/A9. In this report, we showed that S100A8 was mainly produced by mouse colonic epithelial cells. S100A8 was not induced directly by Dectin-1 but by Dectin-1-induced cytokines, especially interleukin-17F (IL-17F), that were produced by several types of innate immune cells including CD11c + /CD11b + myeloid cells in colonic lamina propria. S100A8/A9 heterodimer preferentially suppressed the growth of L. murinus that was increased in both Clec7a -/- and Il17f -/- mice. Furthermore, similar expansion of L. murinus and DSS-colitis resistance were observed in mice fed with β-glucan-free food. These observations suggest that food-derived β-glucans control the specific commensal microbiota via the Dectin-1-IL-17F-calprotectin axis to maintain the intestinal homeostasis.

  19. β-Glucan and Dark Chocolate: A Randomized Crossover Study on Short-Term Satiety and Energy Intake

    PubMed Central

    Akyol, Asli; Dasgin, Halil; Ayaz, Aylin; Buyuktuncer, Zehra; Besler, H. Tanju

    2014-01-01

    Aim: The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Materials and Methods: Study subjects (n = 25) were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON), oat β-glucan (B-GLU), dark chocolate (DARK) or oat β-glucan and dark chocolate (B-GLU + DARK) were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS) scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. Results: VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014). Conclusion: The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects. PMID:25251294

  20. Comparative studies on the induction of Trichoderma harzianum mutanase by α-(1→3)-glucan-rich fruiting bodies and mycelia of Laetiporus sulphureus.

    PubMed

    Wiater, Adrian; Pleszczyńska, Małgorzata; Szczodrak, Janusz; Janusz, Grzegorz

    2012-01-01

    Mutanase (α-(1→3)-glucanase) is a little-known inductive enzyme that is potentially useful in dentistry. Here, it was shown that the cell wall preparation (CWP) obtained from the fruiting body or vegetative mycelium of polypore fungus Laetiporus sulphureus is rich in α-(1→3)-glucan and can be successfully used for mutanase induction in Trichoderma harzianum. The content of this biopolymer in the CWP depended on the age of fruiting bodies and increased along with their maturation. In the case of CWP prepared from vegetative mycelia, the amount of α-(1→3)-glucan depended on the mycelium age and also on the kind of medium used for its cultivation. All CWPs prepared from the individually harvested fruiting body specimens induced high mutanase activity (0.53-0.82 U/mL) in T. harzianum after 3 days of cultivation. As for the CWPs obtained from the hyphal mycelia of L. sulpureus, the maximal enzyme productivity (0.34 U/mL after 3 days of incubation) was recorded for CWP prepared from the 3 week-old mycelium cultivated in Sabouraud medium. Statistically, a high positive correlation was found between the total percentage content of α-(1→3)-glucan in the CWP and the mutanase activity.

  1. Diagnostic potential of nested PCR, galactomannan EIA, and beta-D-glucan for invasive aspergillosis in pediatric patients.

    PubMed

    Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa

    2012-04-13

    Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen  (Platelia Aspergillus), nested  PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp.  The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders. 

  2. Immunomodulatory dietary polysaccharides: a systematic review of the literature

    PubMed Central

    2010-01-01

    Background A large body of literature suggests that certain polysaccharides affect immune system function. Much of this literature, however, consists of in vitro studies or studies in which polysaccharides were injected. Their immunologic effects following oral administration is less clear. The purpose of this systematic review was to consolidate and evaluate the available data regarding the specific immunologic effects of dietary polysaccharides. Methods Studies were identified by conducting PubMed and Google Scholar electronic searches and through reviews of polysaccharide article bibliographies. Only articles published in English were included in this review. Two researchers reviewed data on study design, control, sample size, results, and nature of outcome measures. Subsequent searches were conducted to gather information about polysaccharide safety, structure and composition, and disposition. Results We found 62 publications reporting statistically significant effects of orally ingested glucans, pectins, heteroglycans, glucomannans, fucoidans, galactomannans, arabinogalactans and mixed polysaccharide products in rodents. Fifteen controlled human studies reported that oral glucans, arabinogalactans, heteroglycans, and fucoidans exerted significant effects. Although some studies investigated anti-inflammatory effects, most studies investigated the ability of oral polysaccharides to stimulate the immune system. These studies, as well as safety and toxicity studies, suggest that these polysaccharide products appear to be largely well-tolerated. Conclusions Taken as a whole, the oral polysaccharide literature is highly heterogenous and is not sufficient to support broad product structure/function generalizations. Numerous dietary polysaccharides, particularly glucans, appear to elicit diverse immunomodulatory effects in numerous animal tissues, including the blood, GI tract and spleen. Glucan extracts from the Trametes versicolor mushroom improved survival and immune function in human RCTs of cancer patients; glucans, arabinogalactans and fucoidans elicited immunomodulatory effects in controlled studies of healthy adults and patients with canker sores and seasonal allergies. This review provides a foundation that can serve to guide future research on immune modulation by well-characterized polysaccharide compounds. PMID:21087484

  3. Inhibiting effects of fructanase on competence-stimulating peptide-dependent quorum sensing system in Streptococcus mutans.

    PubMed

    Suzuki, Yusuke; Nagasawa, Ryo; Senpuku, Hidenobu

    2017-09-01

    Streptococcus mutans produces glucosyltransferases encoded by the gtfB and gtfC genes, which synthesize insoluble glucan, and both insoluble and soluble glucans by conversion of sucrose, and are known as principal agents to provide strong biofilm formation and demineralization on tooth surfaces. S. mutans possess a Com-dependent quorum sensing (QS) system, which is important for survival in severe conditions. The QS system is stimulated by the interaction between ComD {Receptor to competence-stimulating peptide (CSP)} encoded by the comD and CSP encoded by the comC, and importantly associated with bacteriocin production and genetic competence. Previously, we found enzyme fructanase (FruA) as a new inhibitor for the glucan-dependent biofilm formation. In the present study, inhibiting effects by FruA on glucan-independent biofilm formation of S. mutans UA159, UA159.gtfB - , UA159.gtfC - , and UA159.gtfBC - were observed in sucrose and no sucrose sugars-supplemented conditions using the plate assay. The reduction of UA159.comC - and UA159.comD - biofilm formation were also observed as compared with UA159 in same conditions. These results suggested that inhibitions of glucan-independent and Com-dependent biofilm formation were involved in the inhibiting mechanism by FruA. To more thoroughly investigate effects by FruA on the QS system, we examined on CSP-stimulated and Com-dependent bacteriocin production and genetic transformation. FruA inhibited bacteriocin production in collaboration with CSP and genetic transformation in bacterial cell conditions treated with FruA. Our findings show that FruA has multiple effects that inhibit survival functions of S. mutans, including biofilm formation and CSP-dependent QS responses, indicating its potential use as an agent for prevention of dental caries. Copyright © 2017 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  4. Production of ethanol from winter barley by the EDGE (enhanced dry grind enzymatic) process

    PubMed Central

    2010-01-01

    Background US legislation requires the use of advanced biofuels to be made from non-food feedstocks. However, commercialization of lignocellulosic ethanol technology is more complex than expected and is therefore running behind schedule. This is creating a demand for non-food, but more easily converted, starch-based feedstocks other than corn that can fill the gap until the second generation technologies are commercially viable. Winter barley is such a feedstock but its mash has very high viscosity due to its high content of β-glucans. This fact, along with a lower starch content than corn, makes ethanol production at the commercial scale a real challenge. Results A new fermentation process for ethanol production from Thoroughbred, a winter barley variety with a high starch content, was developed. The new process was designated the EDGE (enhanced dry grind enzymatic) process. In this process, in addition to the normal starch-converting enzymes, two accessory enzymes were used to solve the β-glucan problem. First, β-glucanases were used to hydrolyze the β-glucans to oligomeric fractions, thus significantly reducing the viscosity to allow good mixing for the distribution of the yeast and nutrients. Next, β-glucosidase was used to complete the β-glucan hydrolysis and to generate glucose, which was subsequently fermented in order to produce additional ethanol. While β-glucanases have been previously used to improve barley ethanol production by lowering viscosity, this is the first full report on the benefits of adding β-glucosidases to increase the ethanol yield. Conclusions In the EDGE process, 30% of total dry solids could be used to produce 15% v/v ethanol. Under optimum conditions an ethanol yield of 402 L/MT (dry basis) or 2.17 gallons/53 lb bushel of barley with 15% moisture was achieved. The distillers dried grains with solubles (DDGS) co-product had extremely low β-glucan (below 0.2%) making it suitable for use in both ruminant and mono-gastric animal feeds. PMID:20426816

  5. Structural and thermodynamic insights into β-1,2-glucooligosaccharide capture by a solute-binding protein in Listeria innocua.

    PubMed

    Abe, Koichi; Sunagawa, Naoki; Terada, Tohru; Takahashi, Yuta; Arakawa, Takatoshi; Igarashi, Kiyohiko; Samejima, Masahiro; Nakai, Hiroyuki; Taguchi, Hayao; Nakajima, Masahiro; Fushinobu, Shinya

    2018-06-08

    β-1,2-Glucans are bacterial carbohydrates that exist in cyclic or linear forms and play an important role in infections and symbioses involving Gram-negative bacteria. Although several β-1,2-glucan-associated enzymes have been characterized, little is known about how β-1,2-glucan and its shorter oligosaccharides (Sop n s) are captured and imported into the bacterial cell. Here, we report the biochemical and structural characteristics of the Sop n -binding protein (SO-BP, Lin1841) associated with the ATP-binding cassette (ABC) transporter from the Gram-positive bacterium Listeria innocua Calorimetric analysis revealed that SO-BP specifically binds to Sop n s with a degree of polymerization of 3 or more, with K d values in the micromolar range. The crystal structures of SO-BP in an unliganded open form and in closed complexes with tri-, tetra-, and pentaoligosaccharides (Sop 3-5 ) were determined to a maximum resolution of 1.6 Å. The binding site displayed shape complementarity to Sop n , which adopted a zigzag conformation. We noted that water-mediated hydrogen bonds and stacking interactions play a pivotal role in the recognition of Sop 3-5 by SO-BP, consistent with its binding thermodynamics. Computational free-energy calculations and a mutational analysis confirmed that interactions with the third glucose moiety of Sop n s are significantly responsible for ligand binding. A reduction in unfavorable changes in binding entropy that were in proportion to the lengths of the Sop n s was explained by conformational entropy changes. Phylogenetic and sequence analyses indicated that SO-BP ABC transporter homologs, glycoside hydrolases, and other related proteins are co-localized in the genomes of several bacteria. This study may improve our understanding of bacterial β-1,2-glucan metabolism and promote the discovery of unidentified β-1,2-glucan-associated proteins. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Allergens and β-Glucans in Dutch Homes and Schools: Characterizing Airborne Levels

    PubMed Central

    Krop, Esmeralda J. M.; Jacobs, José H.; Sander, Ingrid; Raulf-Heimsoth, Monika; Heederik, Dick J. J.

    2014-01-01

    Background Indoor air quality has an effect on respiratory health. Children are more vulnerable to a decreased indoor air quality as their lungs are still developing. We measured levels of allergens and β-(1,3)-glucans in 19 school buildings and determined whether measured levels could be reproduced. School levels were compared to those in 169 homes and the effect of building characteristics on both home and school exposure was explored. Methods Electrostatic Dust fall Collectors were placed in school buildings for 8 weeks and in homes for 2 weeks to collect settled airborne dust. Cat, dog, and mouse allergen levels, domestic mite antigen levels and β-(1,3)-glucans were measured in the extracts from the collectors. Results were corrected for sampling duration. Using questionnaire data, relations between measured levels and building and classroom characteristics were explored. Results In schools, exposure levels were highest in classrooms and were influenced by the socioeconomic status of the children, the season measurements were performed, moisture status of the building and pet ownership. Repeated measurements in different seasons and over the years showed significantly different levels. Home exposure was influenced by socioeconomic status, occupancy and pet ownership. Domestic mite antigen was found in higher levels in extracts from homes compared to schools while pet allergen levels were 13 times higher in schools compared to homes without pets. For mouse allergen overall levels of exposure were low but still two times higher in schools compared to homes. Levels of β-(1,3)-glucans were also approximately two times higher in schools than in homes. Conclusion Exposure levels of several allergens and β-(1,3)-glucans in schools differ over time and are higher than in homes. For children, exposure levels measured at school could contribute to their total exposure as especially animal allergen levels can be much higher in schools compared to homes. PMID:24551183

  7. Degree of polymerization of glucan chains shapes the structure fluctuations and melting thermodynamics of a cellulose microfibril.

    PubMed

    Chang, Rakwoo; Gross, Adam S; Chu, Jhih-Wei

    2012-07-19

    A Staggered LATtice (SLAT) model is developed for modeling cellulose microfibrils. The simple representation of molecular packing and interactions employed in SLAT allows simulations of structure fluctuations and phase transition of cellulose microfibrils at sufficiently long and large scales for comparison with experiments. Glucan chains in the microfibril are modeled as connected monomers, each corresponding to a cellobiose subunit, and the surrounding space around the cellulose is composed of solvent cells. Interaction parameters of monomer-monomer interactions were parametrized based on the results of atomistic molecular dynamics simulations. The monomer-solvent interaction was optimized to give a melting temperature of ∼695 K for the 36-glucan chain model cellulose microfibril, which is consistent with the estimation based on experimental data. Monte Carlo simulations of the SLAT model also capture experimentally measured X-ray diffraction patterns of cellulose as a function of temperature, including the region of melting transition, as well as predict the highly flexible regions in the microfibril. Beyond the diameter of ∼3 nm, we found that melting temperature of the cellulose microfibril is not significantly shifted by changing the thickness. On the other hand, a slight decrease in the degree of polymerization of glucan chains is shown to enhance structure fluctuations through the ends of glucan chains, i.e., the defect sites, and thereby significantly reduce the melting temperature. Analysis of the sizes, densities, and lifetimes of defect structures in the microfibril indicates a significant extent of fluctuations on the surfaces even at room temperature and that defect statistics are strong but distinct functions of temperature and solvent quality. The SLAT model is the first of its kind for simulating cellulosic materials, and this work shows that it can be used to incorporate information obtained from atomistic simulations and experimental data to enable the aforementioned findings through computation.

  8. The association between endotoxin and beta-(1 → 3)-D-glucan in house dust with asthma severity among schoolchildren.

    PubMed

    Oluwole, Oluwafemi; Rennie, Donna C; Senthilselvan, Ambikaipakan; Dyck, Roland; Afanasieva, Anna; Kirychuk, Shelley; Katselis, George; Lawson, Joshua A

    2018-05-01

    Asthma severity can be affected by microbial exposures. However, less is known about the specific indoor agents aggravating the disease in children. We examined the associations between indoor endotoxin and beta-(1 → 3)-D-glucan exposures and asthma severity in children with asthma. A clinical cross-sectional study of schoolchildren (aged 7-17 years) was conducted in the province of Saskatchewan, Canada. Children with asthma (n = 116) were identified from 335 participants using a combination of survey responses and objective clinical assessments. We then ascertained asthma severity based on recommended guidelines (continuous daytime asthma symptoms, frequent nighttime asthma symptoms, and ≤ 60% predicted FEV 1 ). Levels of indoor endotoxin and beta-(1 → 3)-D-glucan were measured in dust samples obtained from play area floors and child's mattresses. The study population of 116 children with asthma was comprised of 75.9% mild asthma and 24.1% moderate/severe asthma. Higher mattress endotoxin concentration was associated with increased odds of moderate/severe asthma [adjusted odds ratio (aOR) = 11.40, 95% confidence interval (CI): 1.45-89.43] while higher beta-(1 → 3)-D-glucan concentration (aOR = 0.16, 95% CI: 0.03-0.89) and load (aOR = 0.10, 95% CI: 0.02-0.72) in play areas were inversely associated with moderate/severe asthma. Furthermore, higher mattress endotoxin concentration was associated with lower FVC (p = 0.01) and FEV 1 (p = 0.03). These associations were not seen for beta-(1 → 3)-D-glucan. Our results showed differential effects of microbial exposures on childhood asthma severity and further highlight domestic endotoxin exposure effects on respiratory health outcomes in children with asthma. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Deletion of uncharacterized domain from α-1,3-glucanase of Bacillus circulans KA-304 enhances heterologous enzyme production in Escherichia coli.

    PubMed

    Yano, Shigekazu; Suyotha, Wasana; Zanma, Sumika; Konno, Hiroyuki; Cherdvorapong, Vipavee; Wakayama, Mamoru

    2018-05-08

    α-1,3-Glucanase (Agl-KA) of Bacillus circulans KA-304 consists of an N-terminal discoidin domain (DS1), a carbohydrate binding module family 6 (CBM6), threonine and proline repeats (TP), a second discoidin domain (DS2), an uncharacterized conserved domain (UCD), and a C-terminal catalytic domain. Previously, we reported that DS1, CBM6, and DS2 have α-1,3-glucan-binding activity and contribute to α-1,3-glucan hydrolysis. In this study, UCD deletion mutant (AglΔUCD) was constructed, and its properties were compared with those of Agl-KA. α-1,3-Glucan hydrolyzing, α-1,3-glucan binding, and protoplast-forming activities of AglΔUCD were almost the same as those of Agl-KA. k cat /K m values of AgΔUCD and Agl-KA were 11.4 and 11.1 s -1 mg -1 mL, respectively. AglΔUCD and Agl-KA exhibited similar characteristics, such as optimal pH, pH stability, optimal temperature, and thermostability. These results suggest that UCD is not α-1,3-glucan-binding and flexible linker domain, and that deletion of UCD does not affect the affinity of N-terminal binding domains and the catalytic action of the C-terminal domain. Subsequently, heterologous UCenzyme productivity of AglΔD in Escherichia coli was compared with that of Agl-KA. The productivity of AglΔUCD was about 4-fold larger than that of Agl-KA after an 8-h induction at 30°C. In the case of induction at 20°C, the productivity of AglΔUCD was also larger than that of Agl-KA. These findings indicate that deletion of only UCD enhances the enzyme productivity in E. coli.

  10. Characterization of endo-1,3-1,4-β-glucanases in GH family 12 from Magnaporthe oryzae.

    PubMed

    Takeda, Takumi; Takahashi, Machiko; Nakanishi-Masuno, Tsugumi; Nakano, Yuki; Saitoh, Hiromasa; Hirabuchi, Akiko; Fujisawa, Shizuko; Terauchi, Ryohei

    2010-11-01

    We have cloned three putative endoglucanase cDNAs, designated MoCel12A, MoCel12B, and MoCel12C, from Magnaporthe oryzae. The deduced peptide sequences of both MoCel12A and MoCel12B contain secretion signal peptides and a catalytic core domain that classify them into GH subfamily 12-1. In contrast, the deduced peptide sequence of MoCel12C consists of a signal peptide, a catalytic core domain, and a fungal-type carbohydrate binding module belonging to GH subfamily 12-2. Although most GH family 12 endoglucanases hydrolyze β-1,4-glucans such as carboxymethylcellulose or phosphoric acid-swollen cellulose, MoCel12A that was prepared by overexpression in M. oryzae and Brevibacillus choshinensis hydrolyzed specifically 1,3-1,4-β-glucans, such as barley β-glucan and lichenan. The specific activity of MoCel12A overexpressed in M. oryzae was about 20 times higher than that prepared from B. choshinensis. Furthermore, MoCel12B prepared by overexpression in B. choshinensis also revealed preferential hydrolysis of endo-1,3-1,4-β-glucans with limited hydrolysis on carboxymethylcellulose. In comparison with MoCel12A, the activity of MoCel12B was more stable under alkaline conditions. Levels of mRNA encoding MoCel12A were constitutively high during infection and spore formation. The overexpression and disruption of the MoCel12A gene did not affect germination, appressorium formation, or invasion rate; however, M. oryzae overexpressing MoCel12A produced larger numbers of spores than the wild type or a mutant in which the MoCel12A gene was disrupted. These results suggest that MoCel12A functions in part to hydrolyze 1,3-1,4-β-glucan during infection and spore formation.

  11. The structure of a β-(1→6)-d-glucan from yeast cell walls

    PubMed Central

    Manners, David J.; Masson, Alan J.; Patterson, James C.; Björndal, Håkan; Lindberg, Bengt

    1973-01-01

    By selective enzymolysis, or chemical fractionation, a minor polysaccharide component has been isolated from yeast (Saccharomyces cerevisiae) glucan. This minor component has a degree of polymerization of about 130–140, a highly branched structure, and a high proportion of β-(1→6)-glucosidic linkages. The molecules also contain a smaller proportion of β-(1→3)-glucosidic linkages that serve mainly as interchain linkages, but some may also be inter-residue linkages. PMID:4590991

  12. The effect of oyster mushroom β-1.3/1.6-D-glucan and oxytetracycline antibiotic on biometrical, haematological, biochemical, and immunological indices, and histopathological changes in common carp (Cyprinus carpio L.).

    PubMed

    Dobšíková, Radka; Blahová, Jana; Mikulíková, Ivana; Modrá, Helena; Prášková, Eva; Svobodová, Zdeňka; Skorič, Mišo; Jarkovský, Jiří; Siwicki, Andrzej-Krzysztof

    2013-12-01

    The aim of the study was to evaluate the effect of micronized β-1.3/1.6-D-glucan (BG) derived from the oyster mushroom Pleurotus ostreatus Hiratake and tetracycline antibiotic oxytetracycline (OTC) on biometrical, haematological, biochemical, and immunological indices, and histopathological changes in tissues of one- to two-year-old common carp (Cyprinus carpio L.). The fish tested were divided into five experimental groups and one control. Carp in the control group were fed commercial carp feed pellets. Fish in the five experimental groups were fed the same pellets supplemented with either OTC, a combination of OTC and BG, or BG as follows: 75 mg oxytetracycline kg(-1) bw (OTC group), 75 mg oxytetracycline kg(-1) bw and 0.5% β-glucan (OTC + 0.5% BG group), 75 mg oxytetracycline kg(-1) bw and 2.0% β-glucan (OTC + 2.0% BG group), 0.5% β-glucan (0.5% BG group), and 2.0% β-glucan (2.0% BG group). OTC- and BG-supplemented diets and the control diet were administered to experimental and control carp for 50 days (i.e. samplings 1-3, the exposure period); for the following 14 days, fish were fed only control feed pellets with no OTC or BG supplementation (i.e. sampling 4, the recovery period). Blood and tissue samples were collected both during, and at the end of the study. No significant changes in biometrical indices (i.e. total length, standard length, total weight, hepatosomatic and spleen somatic index, and Fulton's condition factor) were found in experimental carp compared to control in any sampling. In haematological indices, significant changes were found only in sampling 2, in which shifts in PCV (P < 0.01), Hb (P < 0.01), and WBC (P < 0.01), and in the counts of lymphocytes (P < 0.01), monocytes (P < 0.01), and neutrophil granulocytes-segments (P < 0.05) were revealed. As for biochemical profiling, plasma concentrations of glucose, albumins, cholesterol, natrium, and chlorides (all P < 0.01), and total proteins, lactate, phosphorus, and potassium (all P < 0.05) as well as the catalytic activity of ALP (P < 0.05) were altered in common carp. A significant change in induced (opsonizedzymosan particles, OZP) chemiluminescence (P < 0.05) in sampling 3 and no shifts in serum immunoglobulins concentration were found in the immunological analysis. Histopathological examination of skin, gills, liver, spleen, and cranial and caudal kidneys revealed no obvious specific changes in any tissue analysed. The use of β-glucans in clinically healthy aquaculture remains an issue. Nevertheless, their use in breeding endangered by stress stimuli, infectious disease, or adverse environmental factors is defensible. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Interactions of grape tannins and wine polyphenols with a yeast protein extract, mannoproteins and β-glucan.

    PubMed

    Mekoue Nguela, J; Poncet-Legrand, C; Sieczkowski, N; Vernhet, A

    2016-11-01

    At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored by binding experiments, ITC and DLS. Depending on the tannin structure, a different affinity between the polyphenols and the YPE was observed, as well as differences in the stability of the aggregates. This was attributed to the mean degree of polymerization of tannins in the polyphenol fractions and to chemical changes that occur during winemaking. Much lower affinities were found between polyphenols and polysaccharides, with different behaviors between mannoproteins and β-glucans. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Functional characterization of a thermostable endoglucanase belonging to glycoside hydrolase family 45 from Fomitopsis palustris.

    PubMed

    Cha, Ju-Hee; Yoon, Jeong-Jun; Cha, Chang-Jun

    2018-05-22

    A gene encoding an endoglucanase belonging to subfamily C of glycoside hydrolase family 45 (GH45) was identified in the brown rot fungus Fomitopsis palustris and functionally expressed in Pichia pastoris. The recombinant protein displayed hydrolytic activities toward various substrates such as carboxymethyl cellulose, phosphoric acid swollen cellulose, glucomannan, lichenan, and β-glucan. In particular, the enzyme had a unique catalytic efficiency on β-1,4-glucans rather than mixed β-1,3/1,4-glucans as compared to other GH45 endoglucanases. The fungal enzyme was relatively thermostable, retaining more than 91.4% activity at 80 °C for 1 h. Site-directed mutagenesis studies revealed that the mutants N95D and D117N had significantly reduced enzymatic activities, indicating that both residues are essential for the catalytic reaction. Our study expands knowledge and understanding of the catalytic mechanism of GH45 subfamily C enzymes and also suggests that this thermostable endoglucanase from F. palustris has great potential in industrial applications.

  15. Microstructure and mechanical properties of arabinoxylan and (1,3;1,4)-β-glucan gels produced by cryo-gelation.

    PubMed

    Lopez-Sanchez, Patricia; Wang, Dongjie; Zhang, Zhiyan; Flanagan, Bernadine; Gidley, Michael J

    2016-10-20

    The interactions between heteroxylans and mixed linkage glucans determine the architecture and mechanical properties of cereal endosperm cell walls. In this work hydrogels made of cross-linked arabinoxylan with addition of β-glucan were synthesised by cryogelation as a biomimetic tool to investigate endosperm walls. Molecular and microstructural properties were characterised by nuclear magnetic resonance ((13)C NMR), scanning electron microscopy (SEM) and immunolabelling/confocal laser scanning microscopy (CLSM). The response to mechanical stress was studied by compression-relaxation experiments. The hydrogels consisted of a scaffold characterised by dense walls interconnected by macropores with both hemicelluloses co-localised and homogeneously distributed. The gels showed a high degree of elasticity reflected in their ability to resist compression without developing cracks and recover 60-80% of their original height. Our results highlight the compatibility of these hemicelluloses to coexist in confined environments such as cell walls and their potential role in determining mechanical properties in the absence of cellulose. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Antigen-specific response of murine immune system toward a yeast beta-glucan preparation, zymosan.

    PubMed

    Miura, T; Ohno, N; Miura, N N; Adachi, Y; Shimada, S; Yadomae, T

    1999-06-01

    Zymosan, a particulate beta-glucan preparation from Saccharomyces cerevisiae, shows various biological activities, including anti-tumor activity. We have previously shown that soluble beta-glucan initiated anti-tumor activity was long-lived and was effective even by prophylactic treatment at 1 month prior to tumor challenge. However, the activity by zymosan was relatively short-lived. Antigen-specific responses of mice to zymosan might be a causative mechanism. In this paper, mice were immunized with zymosan and antibody production and antigen-specific responses of lymphocytes to zymosan were analyzed. Sera of zymosan immune mice contained zymosan-specific IgG assessed by enzyme-linked immunosorbent assay and FACS. Spleen and bone marrow cells of zymosan-immune mice showed higher cytokine production in response to zymosan. Specificity of zymosan-specific responses were also analyzed using various derivatives prepared from zymosan. These facts strongly suggested that mice recognize zymosan as antigen in addition to non-specific immune stimulant.

  17. Translational Development and Application of (1→3)-β-d-Glucan for Diagnosis and Therapeutic Monitoring of Invasive Mycoses

    PubMed Central

    McCarthy, Matthew W.; Petraitiene, Ruta; Walsh, Thomas J.

    2017-01-01

    Early diagnosis and prompt initiation of appropriate antimicrobial therapy are crucial steps in the management of patients with invasive fungal infections. However, the diagnosis of invasive mycoses remains a major challenge in clinical practice, because presenting symptoms may be subtle and non-invasive diagnostic assays often lack sensitivity and specificity. Diagnosis is often expressed on a scale of probability (proven, probable and possible) based on a constellation of imaging findings, microbiological tools and histopathology, as there is no stand-alone assay for diagnosis. Recent data suggest that the carbohydrate biomarker (1→3)-β-d-glucan may be useful in both the diagnosis and therapeutic monitoring of invasive fungal infections due to some yeasts, molds, and dimorphic fungi. In this paper, we review recent advances in the use of (1→3)-β-d-glucan to monitor clinical response to antifungal therapy and explore how this assay may be used in the future. PMID:28538702

  18. Electron and Fluorescence Microscopy of Extracellular Glucan and Aryl-Alcohol Oxidase during Wheat-Straw Degradation by Pleurotus eryngii

    PubMed Central

    Barrasa, J. M.; Gutiérrez, A.; Escaso, V.; Guillén, F.; Martínez, M. J.; Martínez, A. T.

    1998-01-01

    The ligninolytic fungus Pleurotus eryngii grown in liquid medium secreted extracellular polysaccharide (87% glucose) and the H2O2-producing enzyme aryl-alcohol oxidase (AAO). The production of both was stimulated by wheat-straw. Polyclonal antibodies against purified AAO were obtained, and a complex of glucanase and colloidal gold was prepared. With these tools, the localization of AAO and extracellular glucan in mycelium from liquid medium and straw degraded under solid-state fermentation conditions was investigated by transmission electron microscopy (TEM) and fluorescence microscopy. These studies revealed that P. eryngii produces a hyphal sheath consisting of a thin glucan layer. This sheath appeared to be involved in both mycelial adhesion to the straw cell wall during degradation and AAO immobilization on hyphal surfaces, with the latter evidenced by double labeling. AAO distribution during differential degradation of straw tissues was observed by immunofluorescence microscopy. Finally, TEM immunogold studies confirmed that AAO penetrates the plant cell wall during P. eryngii degradation of wheat straw. PMID:9435085

  19. Purification, characterization, and antitumor activity of a novel glucan from the fruiting bodies of Coriolus Versicolor

    PubMed Central

    Awadasseid, Annoor; Hou, Jie; Gamallat, Yaser; Xueqi, Shang; Eugene, Kuugbee D.; Musa Hago, Ahmed; Bamba, Djibril; Meyiah, Abdo; Gift, Chiwala; Xin, Yi

    2017-01-01

    Cancer is one of the most common causes of deaths worldwide. Herein, we report an efficient natural anticancer glucan (CVG) extracted from Coriolus Versicolar (CV). CVG was extracted by the hot water extraction method followed by ethanol precipitation and purified using gas exclusion chromatography. Structural analysis revealed that CVG has a linear α-glucan chain composed of only (1→ 6)-α-D-Glcp. The antitumor activity of CVG on Sarcoma-180 cells was investigated in vitro and in vivo. Mice were treated with three doses of CVG (40, 100, 200 mg/kg body weight) for 9 days. Tumor weight, relative spleen, thymus weight, and lymphocyte proliferation were studied. A significant increase (P< 0.01) in relative spleen and thymus weight and a decrease (P< 0.01) in tumor weight at the doses of 100 and 200 mg/kg were observed. The results obtained demonstrate CVG has antitumor activity towards Sarcoma-180 cells by its immunomodulation activity. PMID:28178285

  20. Purification, characterization, and antitumor activity of a novel glucan from the fruiting bodies of Coriolus Versicolor.

    PubMed

    Awadasseid, Annoor; Hou, Jie; Gamallat, Yaser; Xueqi, Shang; Eugene, Kuugbee D; Musa Hago, Ahmed; Bamba, Djibril; Meyiah, Abdo; Gift, Chiwala; Xin, Yi

    2017-01-01

    Cancer is one of the most common causes of deaths worldwide. Herein, we report an efficient natural anticancer glucan (CVG) extracted from Coriolus Versicolar (CV). CVG was extracted by the hot water extraction method followed by ethanol precipitation and purified using gas exclusion chromatography. Structural analysis revealed that CVG has a linear α-glucan chain composed of only (1→ 6)-α-D-Glcp. The antitumor activity of CVG on Sarcoma-180 cells was investigated in vitro and in vivo. Mice were treated with three doses of CVG (40, 100, 200 mg/kg body weight) for 9 days. Tumor weight, relative spleen, thymus weight, and lymphocyte proliferation were studied. A significant increase (P< 0.01) in relative spleen and thymus weight and a decrease (P< 0.01) in tumor weight at the doses of 100 and 200 mg/kg were observed. The results obtained demonstrate CVG has antitumor activity towards Sarcoma-180 cells by its immunomodulation activity.

Top