Undifferentiated embryonic stem cells express ionotropic glutamate receptor mRNAs

PubMed Central

Pachernegg, Svenja; Joshi, Illah; Muth-Köhne, Elke; Pahl, Steffen; Münster, Yvonne; Terhag, Jan; Karus, Michael; Werner, Markus; Ma-Högemeier, Zhan-Lu; Körber, Christoph; Grunwald, Thomas; Faissner, Andreas; Wiese, Stefan; Hollmann, Michael

2013-01-01

Ionotropic glutamate receptors (iGluRs) do not only mediate the majority of excitatory neurotransmission in the vertebrate CNS, but also modulate pre- and postnatal neurogenesis. Most of the studies on the developmental role of iGluRs are performed on neural progenitors and neural stem cells (NSCs). We took a step back in our study by examining the role of iGluRs in the earliest possible cell type, embryonic stem cells (ESCs), by looking at the mRNA expression of the major iGluR subfamilies in undifferentiated mouse ESCs. For that, we used two distinct murine ES cell lines, 46C ESCs and J1 ESCs. Regarding 46C ESCs, we found transcripts of kainate receptors (KARs) (GluK2 to GluK5), AMPA receptors (AMPARs) (GluA1, GluA3, and GluA4), and NMDA receptors (NMDARs) (GluN1, and GluN2A to GluN2D). Analysis of 46C-derived cells of later developmental stages, namely neuroepithelial precursor cells (NEPs) and NSCs, revealed that the mRNA expression of KARs is significantly upregulated in NEPs and, subsequently, downregulated in NSCs. However, we could not detect any protein expression of any of the KAR subunits present on the mRNA level either in ESCs, NEPs, or NSCs. Regarding AMPARs and NMDARs, GluN2A is weakly expressed at the protein level only in NSCs. Matching our findings for iGluRs, all three cell types were found to weakly express pre- and postsynaptic markers of glutamatergic synapses only at the mRNA level. Finally, we performed patch-clamp recordings of 46C ESCs and could not detect any current upon iGluR agonist application. Similar to 46C ESCs, J1 ESCs express KARs (GluK2 to GluK5), AMPARs (GluA3), and NMDARs (GluN1, and GluN2A to GluN2D) at the mRNA level, but these transcripts are not translated into receptor proteins either. Thus, we conclude that ESCs do not contain functional iGluRs, although they do express an almost complete set of iGluR subunit mRNAs. PMID:24348335

Structural basis of subunit selectivity for competitive NMDA receptor antagonists with preference for GluN2A over GluN2B subunits

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lind, Genevieve E.; Mou, Tung-Chung; Tamborini, Lucia

NMDA-type glutamate receptors are ligand-gated ion channels that contribute to excitatory neurotransmission in the central nervous system (CNS). Most NMDA receptors comprise two glycine-binding GluN1 and two glutamate-binding GluN2 subunits (GluN2A–D). We describe highly potent (S)-5-[(R)-2-amino-2-carboxyethyl]-4,5-dihydro-1H-pyrazole-3-carboxylic acid (ACEPC) competitive GluN2 antagonists, of which ST3 has a binding affinity of 52 nM at GluN1/2A and 782 nM at GluN1/2B receptors. This 15-fold preference of ST3 for GluN1/2A over GluN1/2B is improved compared with NVP-AAM077, a widely used GluN2A-selective antagonist, which we show has 11-fold preference for GluN1/2A over GluN1/2B. Crystal structures of the GluN1/2A agonist binding domain (ABD) heterodimer with boundmore » ACEPC antagonists reveal a binding mode in which the ligands occupy a cavity that extends toward the subunit interface between GluN1 and GluN2A ABDs. Mutational analyses show that the GluN2A preference of ST3 is primarily mediated by four nonconserved residues that are not directly contacting the ligand, but positioned within 12 Å of the glutamate binding site. Two of these residues influence the cavity occupied by ST3 in a manner that results in favorable binding to GluN2A, but occludes binding to GluN2B. Thus, we reveal opportunities for the design of subunit-selective competitive NMDA receptor antagonists by identifying a cavity for ligand binding in which variations exist between GluN2A and GluN2B subunits. This structural insight suggests that subunit selectivity of glutamate-site antagonists can be mediated by mechanisms in addition to direct contributions of contact residues to binding affinity.« less

Deletion of Glutamate Delta-1 Receptor in Mouse Leads to Enhanced Working Memory and Deficit in Fear Conditioning

PubMed Central

Yadav, Roopali; Hillman, Brandon G.; Gupta, Subhash C.; Suryavanshi, Pratyush; Bhatt, Jay M.; Pavuluri, Ratnamala; Stairs, Dustin J.; Dravid, Shashank M.

2013-01-01

Glutamate delta-1 (GluD1) receptors are expressed throughout the forebrain during development with high levels in the hippocampus during adulthood. We have recently shown that deletion of GluD1 receptor results in aberrant emotional and social behaviors such as hyperaggression and depression-like behaviors and social interaction deficits. Additionally, abnormal expression of synaptic proteins was observed in amygdala and prefrontal cortex of GluD1 knockout mice (GluD1 KO). However the role of GluD1 in learning and memory paradigms remains unknown. In the present study we evaluated GluD1 KO in learning and memory tests. In the eight-arm radial maze GluD1 KO mice committed fewer working memory errors compared to wildtype mice but had normal reference memory. Enhanced working memory in GluD1 KO was also evident by greater percent alternation in the spontaneous Y-maze test. No difference was observed in object recognition memory in the GluD1 KO mice. In the Morris water maze test GluD1 KO mice showed no difference in acquisition but had longer latency to find the platform in the reversal learning task. GluD1 KO mice showed a deficit in contextual and cue fear conditioning but had normal latent inhibition. The deficit in contextual fear conditioning was reversed by D-Cycloserine (DCS) treatment. GluD1 KO mice were also found to be more sensitive to foot-shock compared to wildtype. We further studied molecular changes in the hippocampus, where we found lower levels of GluA1, GluA2 and GluK2 subunits while a contrasting higher level of GluN2B in GluD1 KO. Additionally, we found higher postsynaptic density protein 95 (PSD95) and lower glutamate decarboxylase 67 (GAD67) expression in GluD1 KO. We propose that GluD1 is crucial for normal functioning of synapses and absence of GluD1 leads to specific abnormalities in learning and memory. These findings provide novel insights into the role of GluD1 receptors in the central nervous system. PMID:23560106

Structural basis of subunit selectivity for competitive NMDA receptor antagonists with preference for GluN2A over GluN2B subunits

PubMed Central

Lind, Genevieve E.; Mou, Tung-Chung; Tamborini, Lucia; Pomper, Martin G.; De Micheli, Carlo; Conti, Paola; Pinto, Andrea

2017-01-01

NMDA-type glutamate receptors are ligand-gated ion channels that contribute to excitatory neurotransmission in the central nervous system (CNS). Most NMDA receptors comprise two glycine-binding GluN1 and two glutamate-binding GluN2 subunits (GluN2A–D). We describe highly potent (S)-5-[(R)-2-amino-2-carboxyethyl]-4,5-dihydro-1H-pyrazole-3-carboxylic acid (ACEPC) competitive GluN2 antagonists, of which ST3 has a binding affinity of 52 nM at GluN1/2A and 782 nM at GluN1/2B receptors. This 15-fold preference of ST3 for GluN1/2A over GluN1/2B is improved compared with NVP-AAM077, a widely used GluN2A-selective antagonist, which we show has 11-fold preference for GluN1/2A over GluN1/2B. Crystal structures of the GluN1/2A agonist binding domain (ABD) heterodimer with bound ACEPC antagonists reveal a binding mode in which the ligands occupy a cavity that extends toward the subunit interface between GluN1 and GluN2A ABDs. Mutational analyses show that the GluN2A preference of ST3 is primarily mediated by four nonconserved residues that are not directly contacting the ligand, but positioned within 12 Å of the glutamate binding site. Two of these residues influence the cavity occupied by ST3 in a manner that results in favorable binding to GluN2A, but occludes binding to GluN2B. Thus, we reveal opportunities for the design of subunit-selective competitive NMDA receptor antagonists by identifying a cavity for ligand binding in which variations exist between GluN2A and GluN2B subunits. This structural insight suggests that subunit selectivity of glutamate-site antagonists can be mediated by mechanisms in addition to direct contributions of contact residues to binding affinity. PMID:28760974

Specific Roles of NMDA Receptor Subunits in Mental Disorders.

PubMed

Yamamoto, H; Hagino, Y; Kasai, S; Ikeda, K

2015-01-01

N-methyl-D-aspartate (NMDA) receptor plays important roles in learning and memory. NMDA receptors are a tetramer that consists of two glycine-binding subunits GluN1, two glutamate-binding subunits (i.e., GluN2A, GluN2B, GluN2C, and GluN2D), a combination of a GluN2 subunit and glycine-binding GluN3 subunit (i.e., GluN3A or GluN3B), or two GluN3 subunits. Recent studies revealed that the specific expression and distribution of each subunit are deeply involved in neural excitability, plasticity, and synaptic deficits. The present article summarizes reports on the dysfunction of NMDA receptors and responsible subunits in various neurological and psychiatric disorders, including schizophrenia, autoimmune-induced glutamatergic receptor dysfunction, mood disorders, and autism. A key role for the GluN2D subunit in NMDA receptor antagonist-induced psychosis has been recently revealed.

Conformation change of tRNA/sub Glu/ in the complex with glutamyl-tRNA synthetase is required for the specific binding of L-glutamate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hara-Yokoyama, M.; Yokoyama, S.; Miyazawa, T.

1986-11-04

The binding of Thermus thermophilus glutamyl-tRNA synthetase (GluRS) with T. thermophilus tRNA/sup Glu/, Escherichia coli tRNA/sup Glu/, and amino acids was studied by fluorescence measurements. In the absence of tRNA/sup Glu/, GluRS binds with D-glutamate as well as L-glutamate. However, in the presence of E.coli tRNA/sup Glu/, GluRS binds specifically with L-glutamate. The KCl effects on the Michaelis constants (K/sub m/) for tRNA/sup Glu/, L-glutamate, and ATP were studied for the aminoacylation of the homologous tRNA/sup Glu/ and heterologous tRNA/sup Glu/ species. As the KCl concentration is raised from 0 to 100 mM, the K/sub m/ value for L-glutamate inmore » the heterologous system is remarkably increased whereas the K/sub m/ value for L-glutamate in the homologous system is only slightly increased. The circular dichroism analyses were made mainly of the bands due to the 2-thiouridine derivatives of tRNA/sup Glu/ in the complex. The conformation change of T. thermophilus tRNA/sup Glu/ upon complex formation with GluRS is not affected by addition of KCl. In contrast, the heterologous tRNA/sup Glu/GluRS complex is in equilibrium of two forms that depends on KCl concentration. The predominant form at low KCl concentration is closely related to the small K/sub m/ value for L-glutamate. In this form of the complex, the conformation of tRNA/sup Glu/ is appreciably different from that of free molecule. Accordingly, such a conformation change of tRNA/sup Glu/ in the complex with GluRS is required for the specific binding of L-glutamate as the substrate.« less

Effects of rhynchophylline on GluN1 and GluN2B expressions in primary cultured hippocampal neurons.

PubMed

He, Yan; Zeng, Sheng-Ya; Zhou, Shi-Wen; Qian, Gui-Sheng; Peng, Kang; Mo, Zhi-Xian; Zhou, Ji-Yin

2014-10-01

N-methyl-d-aspartate (NMDA) receptor subunits GluN1 and GluN2B in hippocampal neurons play key roles in anxiety. Our previous studies show that rhynchophylline, an active component of the Uncaria species, down-regulates GluN2B expression in the hippocampal CA1 area of amphetamine-induced rat. The effects of rhynchophylline on expressions of GluN1 and GluN2B in primary hippocampal neurons in neonatal rats in vitro were investigated. Neonatal hippocampal neurons were cultured with neurobasal-A medium. After incubation for 6h or 48 h with rhynchophylline (non-competitive NMDAR antagonist) and MK-801 (non-competitive NMDAR antagonist with anxiolytic effect, as the control drug) from day 6, neuron toxicity, mRNA and protein expressions of GluN1 and GluN2B were analyzed. GluN1 is mainly distributed on neuronal axons and dendritic trunks, cytoplasm and cell membrane near axons and dendrites. GluN2B is mainly distributed on the membrane, dendrites, and axon membranes. GluN1 and GluN2B are codistributed on dendritic trunks and dendritic spines. After 48 h incubation, a lower concentration of rhynchophylline (lower than 400 μmol/L) and MK-801 (lower than 200 μmol/L) have no toxicity on neonatal hippocampal neurons. Rhynchophylline up-regulated GluN1 mRNA expression at 6h and mRNA and protein expressions at 48h, but down-regulated GluN2B mRNA and protein expressions at 48 h. However, GluN1 and GluN2B mRNA expressions were down-regulated at 6h, and mRNA and protein expressions were both up-regulated by MK-801 at 48h. These findings show that rhynchophylline reciprocally regulates GluN1 and GluN2B expressions in hippocampal neurons, indicating a potential anxiolytic property for rhynchophylline. Copyright © 2014 Elsevier B.V. All rights reserved.

Supraspinal metabotropic glutamate receptor subtype 8: a switch to turn off pain.

PubMed

Palazzo, Enza; de Novellis, Vito; Rossi, Francesco; Maione, Sabatino

2014-06-01

Glutamate is the main excitatory neurotransmitter in the central nervous system and as such controls the majority of synapses. Glutamatergic neurotransmission is mediated via ionotropic and metabotropic glutamate receptors (iGluRs and mGluRs). Signaling via mGluRs permits to finely tune, rather than turning on/off, the excitatory neurotransmission as the iGluRs do. Eight mGluRs (mGluR1-8) have been cloned so far, which have been divided into three groups based on sequence homology, pharmacological properties and second messenger signaling. mGluRs are widely expressed both on glia and neurons. On neurons they are located both at postsynaptic (group I) and presynaptic sites (group II and III). Group II and III mGluR stimulation reduces glutamate release, which can prove useful in pathological conditions characterized by elevated glutamatergic neurotransmission which include chronic pain. Indeed, mGluRs are widely distributed on pain neuraxis. The recent development of selective mGluR ligands has permitted investigating the individual role of each mGluR on pain control. The development of (S)-3,4-dicarboxyphenylglycine, a selective mGluR8 agonist, has revealed the mGluR8 role in inhibiting pain and its related affective consequences in chronic pain conditions. mGluR8 proved also to be overexpressed in pain controlling areas during pathological pain guaranteeing the availability of a switch for turning off abnormal pain. Thus, mGluR8 corresponds to an ideal target in designing novel analgesics. This review will focus on the novel insights into the mGluR8 role on pain control, with particular emphasis on the supraspinal descending pathway, an antinociceptive endogenous source, whose activation or disinhibition (via mGluR8) induces analgesia.

Neurovascular control during exercise in acute coronary syndrome patients with Gln27Glu polymorphism of β2-adrenergic receptor

PubMed Central

Ferreira-Santos, Larissa; Martinez, Daniel G.; Nicolau, José Carlos; Moreira, Humberto G.; Alves, Maria Janieire; Pereira, Alexandre C.; Trombetta, Ivani C.; Negrão, Carlos Eduardo

2017-01-01

Background Gln27Glu (rs1042714) polymorphism of the β2-adrenergic receptor (ADRB2) has been association with cardiovascular functionality in healthy subjects. However, it is unknown whether the presence of the ADRB2 Gln27Glu polymorphism influences neurovascular responses during exercise in patients with acute coronary syndromes (ACS). We tested the hypothesis that patients with ACS homozygous for the Gln allele would have increased muscle sympathetic nerve activity (MSNA) responses and decreased forearm vascular conductance (FVC) responses during exercise compared with patients carrying the Glu allele (Gln27Glu and Glu27Glu). In addition, exercise training would restore these responses in Gln27Gln patients. Methods and results Thirty-days after an ischemic event, 61 patients with ACS without ventricular dysfunction were divided into 2 groups: (1) Gln27Gln (n = 35, 53±1years) and (2) Gln27Glu+Glu27Glu (n = 26, 52±2years). MSNA was directly measured using the microneurography technique, blood pressure (BP) was measured with an automatic oscillometric device, and blood flow was measured using venous occlusion plethysmography. MSNA, mean BP, and FVC were evaluated at rest and during a 3-min handgrip exercise. The MSNA (P = 0.02) and mean BP (P = 0.04) responses during exercise were higher in the Gln27Gln patients compared with that in the Gln27Glu+Glu27Glu patients. No differences were found in FVC. Two months of exercise training significantly decreased the MSNA levels at baseline (P = 0.001) and in their response during exercise (P = 0.02) in Gln27Gln patients, but caused no changes in Gln27Glu+Glu27Glu patients. Exercise training increased FVC responses in Gln27Glu+Glu27Glu patients (P = 0.03), but not in Gln27Gln patients. Conclusion The exaggerated MSNA and mean BP responses during exercise suggest an increased cardiovascular risk in patients with ACS and Gln27Gln polymorphism. Exercise training emerges as an important strategy for restoring this reflex control. Gln27Glu polymorphism of ADRB2 influences exercise-induced vascular adaptation in patients with ACS. PMID:28235084

Neurovascular control during exercise in acute coronary syndrome patients with Gln27Glu polymorphism of β2-adrenergic receptor.

PubMed

Ferreira-Santos, Larissa; Martinez, Daniel G; Nicolau, José Carlos; Moreira, Humberto G; Alves, Maria Janieire; Pereira, Alexandre C; Trombetta, Ivani C; Negrão, Carlos Eduardo; Rondon, Maria Urbana P B

2017-01-01

Gln27Glu (rs1042714) polymorphism of the β2-adrenergic receptor (ADRB2) has been association with cardiovascular functionality in healthy subjects. However, it is unknown whether the presence of the ADRB2 Gln27Glu polymorphism influences neurovascular responses during exercise in patients with acute coronary syndromes (ACS). We tested the hypothesis that patients with ACS homozygous for the Gln allele would have increased muscle sympathetic nerve activity (MSNA) responses and decreased forearm vascular conductance (FVC) responses during exercise compared with patients carrying the Glu allele (Gln27Glu and Glu27Glu). In addition, exercise training would restore these responses in Gln27Gln patients. Thirty-days after an ischemic event, 61 patients with ACS without ventricular dysfunction were divided into 2 groups: (1) Gln27Gln (n = 35, 53±1years) and (2) Gln27Glu+Glu27Glu (n = 26, 52±2years). MSNA was directly measured using the microneurography technique, blood pressure (BP) was measured with an automatic oscillometric device, and blood flow was measured using venous occlusion plethysmography. MSNA, mean BP, and FVC were evaluated at rest and during a 3-min handgrip exercise. The MSNA (P = 0.02) and mean BP (P = 0.04) responses during exercise were higher in the Gln27Gln patients compared with that in the Gln27Glu+Glu27Glu patients. No differences were found in FVC. Two months of exercise training significantly decreased the MSNA levels at baseline (P = 0.001) and in their response during exercise (P = 0.02) in Gln27Gln patients, but caused no changes in Gln27Glu+Glu27Glu patients. Exercise training increased FVC responses in Gln27Glu+Glu27Glu patients (P = 0.03), but not in Gln27Gln patients. The exaggerated MSNA and mean BP responses during exercise suggest an increased cardiovascular risk in patients with ACS and Gln27Gln polymorphism. Exercise training emerges as an important strategy for restoring this reflex control. Gln27Glu polymorphism of ADRB2 influences exercise-induced vascular adaptation in patients with ACS.

The PDZ scaffold NHERF-2 interacts with mGluR5 and regulates receptor activity.

PubMed

Paquet, Maryse; Asay, Matthew J; Fam, Sami R; Inuzuka, Hiroyuki; Castleberry, Amanda M; Oller, Heide; Smith, Yoland; Yun, C Chris; Traynelis, Stephen F; Hall, Randy A

2006-10-06

The two members of the group I metabotropic glutamate receptor family, mGluR1 and mGluR5, both couple to G(q) to mediate rises in intracellular calcium. The alternatively spliced C termini (CT) of mGluRs1 and 5are known to be critical for regulating receptor activity and to terminate in motifs suggestive of potential interactions with PDZ domains. We therefore screened the CTs of both mGluR1a and mGluR5 against a PDZ domain proteomic array. Out of 96 PDZ domains examined, the domain that bound most strongly to mGluR5-CT was the second PDZ domain of the Na(+)/H(+) exchanger regulatory factor 2 (NHERF-2). This interaction was confirmed by reverse overlay, and a single point mutation to the mGluR5-CT was found to completely disrupt the interaction. Full-length mGluR5 robustly associated with full-length NHERF-2 in cells, as assessed by co-immunoprecipitation and confocal microscopy experiments. In contrast, mGluR1a was found to bind NHERF-2 in vitro with a weaker affinity than mGluR5, and furthermore mGluR1a did not detectably associate with NHERF-2 in a cellular context. Immunohistochemical experiments revealed that NHERF-2 and mGluR5 exhibit overlapping patterns of expression in mouse brain, being found most abundantly in astrocytic processes and postsynaptic neuronal elements. In functional experiments, the interaction of NHERF-2 with mGluR5 in cells was found to prolong mGluR5-mediated calcium mobilization and to also potentiate mGluR5-mediated cell death, whereas coexpression of mGluR1a with NHERF-2 had no evident effects on mGluR1a functional activity. These observations reveal that NHERF-2 can selectively modulate mGluR5 signaling, which may contribute to cell-specific regulation of mGluR5 activity.

Metabotropic glutamate receptor 5 upregulates surface NMDA receptor expression in striatal neurons via CaMKII.

PubMed

Jin, Dao-Zhong; Xue, Bing; Mao, Li-Min; Wang, John Q

2015-10-22

Metabotropic and ionotropic glutamate receptors are closely clustered in postsynaptic membranes and are believed to interact actively with each other to control excitatory synaptic transmission. Metabotropic glutamate receptor 5 (mGluR5), for example, has been well documented to potentiate ionotropic NMDA receptor activity, although underlying mechanisms are poorly understood. In this study, we investigated the role of mGluR5 in regulating trafficking and subcellular distribution of NMDA receptors in adult rat striatal neurons. We found that the mGluR1/5 agonist DHPG concentration-dependently increased NMDA receptor GluN1 and GluN2B subunit expression in the surface membrane. Meanwhile, DHPG reduced GluN1 and GluN2B levels in the intracellular compartment. The effect of DHPG was blocked by an mGluR5 selective antagonist MTEP but not by an mGluR1 selective antagonist 3-MATIDA. Pretreatment with an inhibitor or a specific inhibitory peptide for synapse-enriched Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) also blocked the DHPG-stimulated redistribution of GluN1 and GluN2B. In addition, DHPG enhanced CaMKIIα activity and elevated GluN2B phosphorylation at a CaMKII-sensitive site (serine 1303). These results demonstrate that mGluR5 regulates trafficking of NMDA receptors in striatal neurons. Activation of mGluR5 appears to induce rapid trafficking of GluN1 and GluN2B to surface membranes through a signaling pathway involving CaMKII. Copyright © 2015 Elsevier B.V. All rights reserved.

Neurodevelopmental Expression Profile of Dimeric and Monomeric Group 1 mGluRs: Relevance to Schizophrenia Pathogenesis and Treatment.

PubMed

Lum, Jeremy S; Fernandez, Francesca; Matosin, Natalie; Andrews, Jessica L; Huang, Xu-Feng; Ooi, Lezanne; Newell, Kelly A

2016-10-10

Group 1 metabotropic glutamate receptors (mGluR1/mGluR5) play an integral role in neurodevelopment and are implicated in psychiatric disorders, such as schizophrenia. mGluR1 and mGluR5 are expressed as homodimers, which is important for their functionality and pharmacology. We examined the protein expression of dimeric and monomeric mGluR1α and mGluR5 in the prefrontal cortex (PFC) and hippocampus throughout development (juvenile/adolescence/adulthood) and in the perinatal phencyclidine (PCP) model of schizophrenia. Under control conditions, mGluR1α dimer expression increased between juvenile and adolescence (209-328%), while monomeric levels remained consistent. Dimeric mGluR5 was steadily expressed across all time points; monomeric mGluR5 was present in juveniles, dramatically declining at adolescence and adulthood (-97-99%). The mGluR regulators, Homer 1b/c and Norbin, significantly increased with age in the PFC and hippocampus. Perinatal PCP treatment significantly increased juvenile dimeric mGluR5 levels in the PFC and hippocampus (37-50%) but decreased hippocampal mGluR1α (-50-56%). Perinatal PCP treatment also reduced mGluR1α dimer levels in the PFC at adulthood (-31%). These results suggest that Group 1 mGluRs have distinct dimeric and monomeric neurodevelopmental patterns, which may impact their pharmacological profiles at specific ages. Perinatal PCP treatment disrupted the early expression of Group 1 mGluRs which may underlie neurodevelopmental alterations observed in this model.

Gender-specific desensitization of group I metabotropic glutamate receptors after maternal l-glutamate intake during lactation.

PubMed

López-Zapata, Antonio; León-Navarro, David Agustín; Crespo, María; Martín, Mairena

2018-04-22

In the present work we have studied the effect of maternal intake of l-Glutamate (l-Glu) (1 g/L) during lactation on group I mGluR transduction pathway in brain plasma membrane from 15 days-old neonates. Results obtained have shown that maternal l-glutamate intake did not significantly affect neither weights of pups nor negative geotaxis reflex, an index of neurobehavioral development, but increased l-Glu plasma level in both male and female neonates. In male neonates, maternal l-Glu intake evoked a loss of mGluR 1 whereas no variation on mGluR 5 was observed as revealed by Western-blotting assay. The loss of mGlu 1 R was accompanied by a decrease on l-Glu-stimulated phospholipase C activity suggesting, therefore, a loss of group I mGluR functionality. Concerning female neonates, no variations were detected neither mGluR 1 nor mGluR 5 and group I mGluR functionality was also preserved. Copyright © 2018 ISDN. Published by Elsevier Ltd. All rights reserved.

The aniracetam metabolite 2-pyrrolidinone induces a long-term enhancement in AMPA receptor responses via a CaMKII pathway.

PubMed

Nishizaki, Tomoyuki; Matsumura, Takuro

2002-01-31

The present study was conducted to assess the effect of aniracetam and its metabolites, such as 2-pyrrolidinone, p-anisic acid, and anisamide butyrate, on the alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors, heteromerically formed of GluR1,2 (GluR1 and GluR2), GluR1,3 (GluR1 and GluR3), and GluR1,2,3 (GluR1, GluR2, and GluR3), expressed in Xenopus oocytes. 2-Pyrrolidinone potentiated kainate-evoked currents through GluR1,2,3 channels in a bell-shaped dose-dependent manner at concentrations ranged from 1 nM to 300 microM, with a maximal effect at 100 microM. The potentiation was long-lasting, reaching approximately 180% of basal levels 60 min after 5-min treatment with 2-pyrrolidinone at 100 microM. 2-Pyrrolidinone (100 microM) potentiated GluR1,3 channel currents as observed in GluR1,2,3, but instead it depressed GluR1,2 currents. Aniracetam and p-anisic acid potentiated GluR1,2,3 channel currents, but to a lesser extent, each about 130 and 103% of basal levels 60 min after treatment at 100 microM. In contrast, anisamide butyrate had no potentiating effect on the currents. Potentiation of GluR1,2,3 channel currents obtained with 2-pyrrolidinone was inhibited by KN-93, a selective inhibitor of calcium/calmodulin-dependent protein kinase (CaMKII), while it was not affected by GF109203X, a selective inhibitor of protein kinase C or H-89, a selective inhibitor of cAMP-dependent protein kinase. The results of the present study suggest that 2-pyrrolidinone persistently enhances activity of the Ca2+-permeable AMPA receptors, GluR1,3 and GluR1,2,3, by interacting with CaMKII.

Differential changes in mGlu2 and mGlu3 gene expression following pilocarpine-induced status epilepticus: A comparative real-time PCR analysis

PubMed Central

Ermolinsky, Boris; Pacheco Otalora, Luis F.; Arshadmansab, Massoud F.; Zarei, Masoud; Garrido-Sanabria, Emilio R.

2008-01-01

Group II metabotropic glutamate (mGlu II) receptors subtype 2 and 3 (mGlu2 and mGlu3) are subtle regulators of neuronal excitability and synaptic plasticity in the hippocampus. In recent years, researchers have investigated the potential neuroprotective and anticonvulsant effects of compounds acting on mGlu II receptors. However, abnormal expression and function of mGlu2 and mGlu3 have been reported in temporal lobe epilepsy, a phenomena that may limit the therapeutic effectiveness of these potentially new antiepileptic drugs. Here, we investigated seizure-induced changes in mGlu2 and mGlu3 mRNA following pilocarpine-inducted status epilepticus (SE) and subsequent epileptogenesis. Relative changes in gene expression were assessed by comparative analysis of quantitative real-time PCR (qrtPCR) by the delta-delta CT method. Pilocarpine-treated and control rats were sacrificed at different periods (24h, 10 days, one month and more than two months) following SE. Total RNA was isolated from microdissected dentate gyrus and processed for RT-PCR and qrtPCR using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an endogenous control gene. Analysis of relative quantification (RQ) ratios of mGlu2 and mGlu3 mRNA expression revealed a significant down-regulation of both targets at 24h after SE. Gene expression partially recovered at 10 days following SE reaching control levels at one month after SE. Two month after SE, mGlu2 mRNA expression was significantly down-regulated to ~41% of control expression whereas mGlu3 mRNA was comparable to control levels. Our data indicate that mGlu2 and mGlu3 expression is dynamically down-regulated or selectively enhanced during critical periods of epileptogenesis. Seizure-induced differential dysregulation of mGlu2 and mGlu3 receptors may affect the availability of these molecular targets for therapeutic compounds in epilepsy. PMID:18585369

Neuroprotective effects of metabotropic glutamate receptor group II and III activators against MPP(+)-induced cell death in human neuroblastoma SH-SY5Y cells: the impact of cell differentiation state.

PubMed

Jantas, D; Greda, A; Golda, S; Korostynski, M; Grygier, B; Roman, A; Pilc, A; Lason, W

2014-08-01

Recent studies have documented that metabotropic glutamate receptors from group II and III (mGluR II/III) are a potential target in the symptomatic treatment of Parkinson's disease (PD), however, the neuroprotective effects of particular mGluR II/III subtypes in relation to PD pathology are recognized only partially. In the present study, we investigated the effect of various mGluR II/III activators in the in vitro model of PD using human neuroblastoma SH-SY5Y cell line and mitochondrial neurotoxin MPP(+). We demonstrated that all tested mGluR ligands: mGluR II agonist - LY354740, mGluR III agonist - ACPT-I, mGluR4 PAM - VU0361737, mGluR8 agonist - (S)-3,4-DCPG, mGluR8 PAM - AZ12216052 and mGluR7 allosteric agonist - AMN082 were protective against MPP(+)-evoked cell damage in undifferentiated (UN-) SH-SY5Y cells with the highest neuroprotection mediated by mGluR8-specific agents. However, in retinoic acid- differentiated (RA-) SH-SY5Y cells we found protection mediated only by mGluR8 activators. We also demonstrated the cell proliferation stimulating effect for mGluR4 and mGluR8 PAMs. Next, we showed that the protection mediated by mGluR II/III activators in UN-SH-SY5Y was not accompanied by the modulation of caspase-3 activity, however, a decrease in the number of apoptotic nuclei was found. Finally, we showed that the inhibitor of necroptosis, necrostatin-1 blocked the mGluR III-mediated protection. Altogether our comparative in vitro data add a further proof to neuroprotective effects of mGluR agonists or PAMs and point to mGluR8 as a promising target for neuroprotective interventions in PD. The results also suggest the participation of necroptosis-related molecular pathways in neuroprotective effects of mGluR III activation. Copyright © 2014 Elsevier Ltd. All rights reserved.

Acylated apelin-13 amide analogues exhibit enzyme resistance and prolonged insulin releasing, glucose lowering and anorexic properties.

PubMed

O'Harte, Finbarr P M; Parthsarathy, Vadivel; Hogg, Christopher; Flatt, Peter R

2017-12-15

The adipokine, apelin has many biological functions but its activity is curtailed by rapid plasma degradation. Fatty acid derived apelin analogues represent a new and exciting avenue for the treatment of obesity-diabetes. This study explores four novel fatty acid modified apelin-13 analogues, namely, (Lys 8 GluPAL)apelin-13 amide, pGlu(Lys 8 GluPAL)apelin-13 amide, Lys 8 GluPAL(Tyr 13 )apelin-13 and Lys 8 GluPAL(Val 13 )apelin-13. Fatty acid modification extended the half-life of native apelin-13 to >24 h in vitro. pGlu(Lys 8 GluPAL)apelin-13 amide was the most potent insulinotropic analogue in BRIN-BD11 cells and isolated islets with maximal stimulatory effects of up to 2.7-fold (p < .001). (Lys 8 GluPAL)apelin-13 amide (1.9-fold) and Lys 8 GluPAL(Tyr 13 )apelin-13 (1.7-fold) were less effective, whereas Lys 8 GluPAL(Val 13 )apelin-13 had an inhibitory effect on insulin secretion. Similarly, pGlu(Lys 8 GluPAL)apelin-13 amide was most potent in increasing beta-cell intracellular Ca 2+ concentrations (1.8-fold, p < .001) and increasing glucose uptake in 3T3-L1 adipocytes (2.3-fold, p < .01). Persistent biological action was observed with both pGlu(Lys 8 GluPAL)apelin-13 amide and (Lys 8 GluPAL)apelin-13 amide significantly reducing blood glucose (39-43%, p < .01) and enhancing insulin secretion (43-56%, p < .001) during glucose tolerance tests in diet-induced obese mice. pGlu(Lys 8 GluPAL)apelin-13 amide and (Lys 8 GluPAL)apelin-13 amide also inhibited feeding (28-40%, p < .001), whereas Lys 8 GluPAL(Val 13 )apelin-13 increased food intake (8%, p < .05) in mice. These data indicate that novel enzymatically stable analogues of apelin-13 may be suitable for future development as therapeutic agents for obesity-diabetes. Copyright © 2017 Elsevier Inc. All rights reserved.

Neonatal seizures alter NMDA glutamate receptor GluN2A and 3A subunit expression and function in hippocampal CA1 neurons

PubMed Central

Zhou, Chengwen; Sun, Hongyu; Klein, Peter M.; Jensen, Frances E.

2015-01-01

Neonatal seizures are commonly caused by hypoxic and/or ischemic injury during birth and can lead to long-term epilepsy and cognitive deficits. In a rodent hypoxic seizure (HS) model, we have previously demonstrated a critical role for seizure-induced enhancement of the AMPA subtype of glutamate receptor (GluA) in epileptogenesis and cognitive consequences, in part due to GluA maturational upregulation of expression. Similarly, as the expression and function of the N-Methyl-D-aspartate (NMDA) subtype of glutamate receptor (GluN) is also developmentally controlled, we examined how early life seizures during the critical period of synaptogenesis could modify GluN development and function. In a postnatal day (P)10 rat model of neonatal seizures, we found that seizures could alter GluN2/3 subunit composition of GluNs and physiological function of synaptic GluNs. In hippocampal slices removed from rats within 48–96 h following seizures, the amplitudes of synaptic GluN-mediated evoked excitatory postsynaptic currents (eEPSCs) were elevated in CA1 pyramidal neurons. Moreover, GluN eEPSCs showed a decreased sensitivity to GluN2B selective antagonists and decreased Mg2+ sensitivity at negative holding potentials, indicating a higher proportion of GluN2A and GluN3A subunit function, respectively. These physiological findings were accompanied by a concurrent increase in GluN2A phosphorylation and GluN3A protein. These results suggest that altered GluN function and expression could potentially contribute to future epileptogenesis following neonatal seizures, and may represent potential therapeutic targets for the blockade of future epileptogenesis in the developing brain. PMID:26441533

Interactions between Glu-1 and Glu-3 loci and associations of selected molecular markers with quality traits in winter wheat (Triticum aestivum L.) DH lines.

PubMed

Krystkowiak, Karolina; Langner, Monika; Adamski, Tadeusz; Salmanowicz, Bolesław P; Kaczmarek, Zygmunt; Krajewski, Paweł; Surma, Maria

2017-02-01

The quality of wheat depends on a large complex of genes and environmental factors. The objective of this study was to identify quantitative trait loci controlling technological quality traits and their stability across environments, and to assess the impact of interaction between alleles at loci Glu-1 and Glu-3 on grain quality. DH lines were evaluated in field experiments over a period of 4 years, and genotyped using simple sequence repeat markers. Lines were analysed for grain yield (GY), thousand grain weight (TGW), protein content (PC), starch content (SC), wet gluten content (WG), Zeleny sedimentation value (ZS), alveograph parameter W (APW), hectolitre weight (HW), and grain hardness (GH). A number of QTLs for these traits were identified in all chromosome groups. The Glu-D1 locus influenced TGW, PC, SC, WG, ZS, APW, GH, while locus Glu-B1 affected only PC, ZS, and WG. Most important marker-trait associations were found on chromosomes 1D and 5D. Significant effects of interaction between Glu-1 and Glu-3 loci on technological properties were recorded, and in all types of this interaction positive effects of Glu-D1 locus on grain quality were observed, whereas effects of Glu-B1 locus depended on alleles at Glu-3 loci. Effects of Glu-A3 and Glu-D3 loci per se were not significant, while their interaction with alleles present at other loci encoding HMW and LMW were important. These results indicate that selection of wheat genotypes with predicted good bread-making properties should be based on the allelic composition both in Glu-1 and Glu-3 loci, and confirm the predominant effect of Glu-D1d allele on technological properties of wheat grains.

Subunit-specific rules governing AMPA receptor trafficking to synapses in hippocampal pyramidal neurons.

PubMed

Shi, S; Hayashi, Y; Esteban, J A; Malinow, R

2001-05-04

AMPA-type glutamate receptors (AMPA-Rs) mediate a majority of excitatory synaptic transmission in the brain. In hippocampus, most AMPA-Rs are hetero-oligomers composed of GluR1/GluR2 or GluR2/GluR3 subunits. Here we show that these AMPA-R forms display different synaptic delivery mechanisms. GluR1/GluR2 receptors are added to synapses during plasticity; this requires interactions between GluR1 and group I PDZ domain proteins. In contrast, GluR2/GluR3 receptors replace existing synaptic receptors continuously; this occurs only at synapses that already have AMPA-Rs and requires interactions by GluR2 with NSF and group II PDZ domain proteins. The combination of regulated addition and continuous replacement of synaptic receptors can stabilize long-term changes in synaptic efficacy and may serve as a general model for how surface receptor number is established and maintained.

Dansylated octapeptide Dns-Glu-Asp-Asp-Ser-Asp-Glu-Glu-Asn inhibits the proliferation rate of HL-60 cells.

PubMed

Marsili, V; Nardicchi, V; Lupidi, G; Brozzetti, A; Gianfranceschi, G L

1996-12-01

Small acidic phosphorylated chromatin peptides show regulatory activity on gene expression. The peptide pyroGlu-Asp-Asp-Ser-Asp-Glu-Glu-Asn, synthesized on the basis of structural and biochemical studies, shows functional properties in vitro (phosphorylation by casein kinase II, control of DNA transcription by RNA polymerase II, inhibition of proliferation and promotion of differentiation in some cell lines) very similar to those of native chromatin peptides. In this report we show that the dansylated octapeptide Dns-Glu-Asp-Asp-Ser-Asp-Glu-Glu-Asn remarkably inhibits cell growth of the HL-60 cell line. The biological effect of the peptide seems to be considerably higher than that shown by the nondansylated peptide, and it cannot be attributed to a toxic effect of the Dns group. The measurement of uptake of 3H-labelled Glu-Asp-Asp-Ser-Asp-Glu-Glu-Asn demonstrates that it is unable to pass through the HL-60 cell membrane. It is our considered opinion that the addition of hydrophobic groups to the peptide N-terminus should increase the biological activity by improving its transport through the cellular membrane.

tRNAGlu increases the affinity of glutamyl-tRNA synthetase for its inhibitor glutamyl-sulfamoyl-adenosine, an analogue of the aminoacylation reaction intermediate glutamyl-AMP: mechanistic and evolutionary implications.

PubMed

Blais, Sébastien P; Kornblatt, Jack A; Barbeau, Xavier; Bonnaure, Guillaume; Lagüe, Patrick; Chênevert, Robert; Lapointe, Jacques

2015-01-01

For tRNA-dependent protein biosynthesis, amino acids are first activated by aminoacyl-tRNA synthetases (aaRSs) yielding the reaction intermediates aminoacyl-AMP (aa-AMP). Stable analogues of aa-AMP, such as aminoacyl-sulfamoyl-adenosines, inhibit their cognate aaRSs. Glutamyl-sulfamoyl-adenosine (Glu-AMS) is the best known inhibitor of Escherichia coli glutamyl-tRNA synthetase (GluRS). Thermodynamic parameters of the interactions between Glu-AMS and E. coli GluRS were measured in the presence and in the absence of tRNA by isothermal titration microcalorimetry. A significant entropic contribution for the interactions between Glu-AMS and GluRS in the absence of tRNA or in the presence of the cognate tRNAGlu or of the non-cognate tRNAPhe is indicated by the negative values of -TΔSb, and by the negative value of ΔCp. On the other hand, the large negative enthalpy is the dominant contribution to ΔGb in the absence of tRNA. The affinity of GluRS for Glu-AMS is not altered in the presence of the non-cognate tRNAPhe, but the dissociation constant Kd is decreased 50-fold in the presence of tRNAGlu; this result is consistent with molecular dynamics results indicating the presence of an H-bond between Glu-AMS and the 3'-OH oxygen of the 3'-terminal ribose of tRNAGlu in the Glu-AMS•GluRS•tRNAGlu complex. Glu-AMS being a very close structural analogue of Glu-AMP, its weak binding to free GluRS suggests that the unstable Glu-AMP reaction intermediate binds weakly to GluRS; these results could explain why all the known GluRSs evolved to activate glutamate only in the presence of tRNAGlu, the coupling of glutamate activation to its transfer to tRNA preventing unproductive cleavage of ATP.

tRNAGlu Increases the Affinity of Glutamyl-tRNA Synthetase for Its Inhibitor Glutamyl-Sulfamoyl-Adenosine, an Analogue of the Aminoacylation Reaction Intermediate Glutamyl-AMP: Mechanistic and Evolutionary Implications

PubMed Central

Blais, Sébastien P.; Kornblatt, Jack A.; Barbeau, Xavier; Bonnaure, Guillaume; Lagüe, Patrick; Chênevert, Robert; Lapointe, Jacques

2015-01-01

For tRNA-dependent protein biosynthesis, amino acids are first activated by aminoacyl-tRNA synthetases (aaRSs) yielding the reaction intermediates aminoacyl-AMP (aa-AMP). Stable analogues of aa-AMP, such as aminoacyl-sulfamoyl-adenosines, inhibit their cognate aaRSs. Glutamyl-sulfamoyl-adenosine (Glu-AMS) is the best known inhibitor of Escherichia coli glutamyl-tRNA synthetase (GluRS). Thermodynamic parameters of the interactions between Glu-AMS and E. coli GluRS were measured in the presence and in the absence of tRNA by isothermal titration microcalorimetry. A significant entropic contribution for the interactions between Glu-AMS and GluRS in the absence of tRNA or in the presence of the cognate tRNAGlu or of the non-cognate tRNAPhe is indicated by the negative values of –TΔSb, and by the negative value of ΔCp. On the other hand, the large negative enthalpy is the dominant contribution to ΔGb in the absence of tRNA. The affinity of GluRS for Glu-AMS is not altered in the presence of the non-cognate tRNAPhe, but the dissociation constant K d is decreased 50-fold in the presence of tRNAGlu; this result is consistent with molecular dynamics results indicating the presence of an H-bond between Glu-AMS and the 3’-OH oxygen of the 3’-terminal ribose of tRNAGlu in the Glu-AMS•GluRS•tRNAGlu complex. Glu-AMS being a very close structural analogue of Glu-AMP, its weak binding to free GluRS suggests that the unstable Glu-AMP reaction intermediate binds weakly to GluRS; these results could explain why all the known GluRSs evolved to activate glutamate only in the presence of tRNAGlu, the coupling of glutamate activation to its transfer to tRNA preventing unproductive cleavage of ATP. PMID:25860020

Essential role of GluD1 in dendritic spine development and GluN2B to GluN2A NMDAR subunit switch in the cortex and hippocampus reveals ability of GluN2B inhibition in correcting hyperconnectivity.

PubMed

Gupta, Subhash C; Yadav, Roopali; Pavuluri, Ratnamala; Morley, Barbara J; Stairs, Dustin J; Dravid, Shashank M

2015-06-01

The glutamate delta-1 (GluD1) receptor is highly expressed in the forebrain. We have previously shown that loss of GluD1 leads to social and cognitive deficits in mice, however, its role in synaptic development and neurotransmission remains poorly understood. Here we report that GluD1 is enriched in the medial prefrontal cortex (mPFC) and GluD1 knockout mice exhibit a higher dendritic spine number, greater excitatory neurotransmission as well as higher number of synapses in mPFC. In addition abnormalities in the LIMK1-cofilin signaling, which regulates spine dynamics, and a lower ratio of GluN2A/GluN2B expression was observed in the mPFC in GluD1 knockout mice. Analysis of the GluD1 knockout CA1 hippocampus similarly indicated the presence of higher spine number and synapses and altered LIMK1-cofilin signaling. We found that systemic administration of an N-methyl-d-aspartate (NMDA) receptor partial agonist d-cycloserine (DCS) at a high-dose, but not at a low-dose, and a GluN2B-selective inhibitor Ro-25-6981 partially normalized the abnormalities in LIMK1-cofilin signaling and reduced excess spine number in mPFC and hippocampus. The molecular effects of high-dose DCS and GluN2B inhibitor correlated with their ability to reduce the higher stereotyped behavior and depression-like behavior in GluD1 knockout mice. Together these findings demonstrate a critical requirement for GluD1 in normal spine development in the cortex and hippocampus. Moreover, these results identify inhibition of GluN2B-containing receptors as a mechanism for reducing excess dendritic spines and stereotyped behavior which may have therapeutic value in certain neurodevelopmental disorders such as autism. Copyright © 2015 Elsevier Ltd. All rights reserved.

Vesicular Glutamate Transporters: Spatio-Temporal Plasticity following Hearing Loss

PubMed Central

Fyk-Kolodziej, Bozena; Shimano, Takashi; Gong, Tzy-Wen; Holt, Avril Genene

2011-01-01

An immunocytochemical comparison of vGluT1 and vGluT3 in the cochlear nucleus (CN) of deafened versus normal hearing rats showed the first example of vGluT3 immunostaining in the dorsal and ventral CN and revealed temporal and spatial changes in vGluT1 localization in the CN after cochlear injury. In normal hearing rats vGluT1 immunostaining was restricted to terminals on CN neurons while vGluT3 immunolabeled the somata of the neurons. This changed in the VCN three days following deafness, where vGluT1 immunostaining was no longer seen in large auditory nerve terminals but was instead found in somata of VCN neurons. In the DCN, while vGluT1 labeling of terminals decreased, there was no labeling of neuronal somata. Therefore, loss of peripheral excitatory input results in co-localization of vGluT1 and vGluT3 in VCN neuronal somata. Postsynaptic glutamatergic neurons can use retrograde signaling to control their presynaptic inputs and these results suggest vGluTs could play a role in regulating retrograde signaling in the CN under different conditions of excitatory input. Changes in vGluT gene expression in CN neurons were found three weeks following deafness using qRT-PCR with significant increases in vGluT1 gene expression in both ventral and dorsal CN while vGluT3 gene expression decreased in VCN but increased in DCN. PMID:21211553

Mosquitocidal properties of IgG targeting the glutamate-gated chloride channel in three mosquito disease vectors (Diptera: Culicidae).

PubMed

Meyers, Jacob I; Gray, Meg; Foy, Brian D

2015-05-15

The glutamate-gated chloride channel (GluCl) is a highly sensitive insecticide target of the avermectin class of insecticides. As an alternative to using chemical insecticides to kill mosquitoes, we tested the effects of purified immunoglobulin G (IgG) targeting the extracellular domain of GluCl from Anopheles gambiae (AgGluCl) on the survivorship of three key mosquito disease vectors: Anopheles gambiae s.s., Aedes aegypti and Culex tarsalis. When administered through a single blood meal, anti-AgGluCl IgG reduced the survivorship of A. gambiae in a dose-dependent manner (LC50: 2.82 mg ml(-1), range 2.68-2.96 mg ml(-1)) but not A. aegypti or C. tarsalis. We previously demonstrated that AgGluCl is only located in tissues of the head and thorax of A. gambiae. To verify that AgGluCl IgG is affecting target antigens found outside the midgut, we injected it directly into the hemocoel via intrathoracic injection. A single, physiologically relevant concentration of anti-AgGluCl IgG injected into the hemocoel equally reduced mosquito survivorship of all three species. To test whether anti-AgGluCl IgG was entering the hemocoel of each of these mosquitoes, we fed mosquitoes a blood meal containing anti-AgGluCl IgG and subsequently extracted their hemolymph. We only detected IgG in the hemolymph of A. gambiae, suggesting that resistance of A. aegypti and C. tarsalis to anti-AgGluCl IgG found in blood meals is due to deficient IgG translocation across the midgut. We predicted that anti-AgGluCl IgG's mode of action is by antagonizing GluCl activity. To test this hypothesis, we fed A. gambiae blood meals containing anti-AgGluCl IgG and the GluCl agonist ivermectin (IVM). Anti-AgGluCl IgG attenuated the mosquitocidal effects of IVM, suggesting that anti-AgGluCl IgG antagonizes IVM-induced activation of GluCl. Lastly, we stained adult, female A. aegypti and C. tarsalis for GluCl expression. Neuronal GluCl expression in these mosquitoes was similar to previously reported A. gambiae GluCl expression; however, we also discovered GluCl staining on the basolateral surface of their midgut epithelial cells, suggesting important physiological differences in Culicine and Anopheline mosquitoes. © 2015. Published by The Company of Biologists Ltd.

Mosquitocidal properties of IgG targeting the glutamate-gated chloride channel in three mosquito disease vectors (Diptera: Culicidae)

PubMed Central

Meyers, Jacob I.; Gray, Meg; Foy, Brian D.

2015-01-01

ABSTRACT The glutamate-gated chloride channel (GluCl) is a highly sensitive insecticide target of the avermectin class of insecticides. As an alternative to using chemical insecticides to kill mosquitoes, we tested the effects of purified immunoglobulin G (IgG) targeting the extracellular domain of GluCl from Anopheles gambiae (AgGluCl) on the survivorship of three key mosquito disease vectors: Anopheles gambiae s.s., Aedes aegypti and Culex tarsalis. When administered through a single blood meal, anti-AgGluCl IgG reduced the survivorship of A. gambiae in a dose-dependent manner (LC50: 2.82 mg ml−1, range 2.68–2.96 mg ml−1) but not A. aegypti or C. tarsalis. We previously demonstrated that AgGluCl is only located in tissues of the head and thorax of A. gambiae. To verify that AgGluCl IgG is affecting target antigens found outside the midgut, we injected it directly into the hemocoel via intrathoracic injection. A single, physiologically relevant concentration of anti-AgGluCl IgG injected into the hemocoel equally reduced mosquito survivorship of all three species. To test whether anti-AgGluCl IgG was entering the hemocoel of each of these mosquitoes, we fed mosquitoes a blood meal containing anti-AgGluCl IgG and subsequently extracted their hemolymph. We only detected IgG in the hemolymph of A. gambiae, suggesting that resistance of A. aegypti and C. tarsalis to anti-AgGluCl IgG found in blood meals is due to deficient IgG translocation across the midgut. We predicted that anti-AgGluCl IgG's mode of action is by antagonizing GluCl activity. To test this hypothesis, we fed A. gambiae blood meals containing anti-AgGluCl IgG and the GluCl agonist ivermectin (IVM). Anti-AgGluCl IgG attenuated the mosquitocidal effects of IVM, suggesting that anti-AgGluCl IgG antagonizes IVM-induced activation of GluCl. Lastly, we stained adult, female A. aegypti and C. tarsalis for GluCl expression. Neuronal GluCl expression in these mosquitoes was similar to previously reported A. gambiae GluCl expression; however, we also discovered GluCl staining on the basolateral surface of their midgut epithelial cells, suggesting important physiological differences in Culicine and Anopheline mosquitoes. PMID:25994632

Immunocytochemical localization of metabotropic (mGluR2/3 and mGluR4a) and ionotropic (GluR2/3) glutamate receptors in adrenal medullary ganglion cells.

PubMed

Sarría, R; Díez, J; Losada, J; Doñate-Oliver, F; Kuhn, R; Grandes, P

2006-02-01

The localization of metabotropic glutamate receptors of groups II (mGluR2/3) and III (mGluR4a) and the subunits 2 and 3 of alfa-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) ionotropic glutamate receptors (GluR2/3) was investigated with immunocytochemical methods in the rat adrenal gland. MGluR2/3, mGluR4a and GluR2/3 immunoreactivities were observed in large-sized, centrally located type I adrenal medullary ganglion neurons. Furthermore, the small-sized type II adrenal ganglion neurons identified by their immunoreactivity to brain nitric oxide synthase (bNOS), also expressed mGluR2/3, mGluR4a and GluR2/3. These cells were disposed in the peripheral portion of the adrenal medulla. None of the type I neurons were positively labeled for bNOS. These morphological observations suggest that activation of glutamate receptors in ganglion neurons may be instrumental in the control of adrenal endocrine systems as well as blood regulation.

Identification of pyroglutamyl peptides in Japanese rice wine (sake): presence of hepatoprotective pyroGlu-Leu.

PubMed

Kiyono, Tamami; Hirooka, Kiyoo; Yamamoto, Yoshihiro; Kuniishi, Sunao; Ohtsuka, Maho; Kimura, Shikou; Park, Eun Young; Nakamura, Yasushi; Sato, Kenji

2013-11-27

Japanese rice wine, sake, is made from steamed rice, water, and lactic acid by "multiple parallel fermentation" with mold (Aspergillus oryzae) and yeast (Saccharomyces cerevisiae). Nineteen pyroglutamyl peptides were identified in commercially available sake. Among them, pyroGlu-Leu and pyroGlu-Gln were the major constituents. PyroGlu-Leu has been demonstrated to attenuate hepatitis and colitis in animal models. Commercial products (n = 5) contained pyroGlu-Leu at concentrations ranging from 40 to 60 μM (10-15 mg/L). The pyroGlu-Leu content in sake mash increased during the fermentation processes. However, no pyroGlu-Leu was produced by yeast inoculated into preheated mash. Furthermore, addition of (13)C-Leu to the mash did not increase the ratio of pyroGlu-(13)C-Leu to pyroGlu-(12)C-Leu. On the other hand, digestion of steamed rice with A. oryzae proteases increased the pyroGlu-Leu content. These results indicate that pyroGlu-Leu in sake is produced from rice proteins by digestion with A. oryzae proteases.

Ethanol Inhibition of Constitutively Open N-Methyl-d-Aspartate Receptors

PubMed Central

Xu, Minfu; Smothers, C. Thetford; Trudell, James

2012-01-01

N-Methyl-d-aspartate (NMDA) receptors gate a slow and calcium-rich component of the postsynaptic glutamate response. Like all ionotropic glutamate receptors, NMDA subunits contain a highly conserved motif (SYTANLAAF) in the transmembrane (TM) 3 domain that is critically involved in channel gating. Mutation of an alanine in this domain (A7; underlined above) results in constitutively open receptors that show reduced sensitivity to several allosteric modulators. In this study, we examined the effects of ethanol, a substance that inhibits NMDA currents via an unknown mechanism, on tonically active NMDA receptors expressed in human embryonic kidney 293 cells. Ethanol (100 mM) inhibited currents from GluN1(A7R)/GluN2A and GluN1(A7R)/GluN2B receptors by approximately 50%, whereas those from GluN1/GluN2B(A7R) receptors were reduced by less than 10%. In cysteine-substituted GluN1 and GluN2 A7 mutants, estimated ethanol IC50 values for agonist-gated currents were 101, 117, 103, and 69 mM for GluN1(A7C)/GluN2A, GluN1(A7C)/GluN2B, GluN1/GluN2A(A7C), and GluN1/GluN2B(A7C) receptors, respectively. After exposure to the thiol-modifying reagent 2-(trimethylammonium)ethyl methanethiosulfonate (MTSET), A7C mutants showed robust agonist-independent currents and reduced sensitivity to ethanol (IC50 values of 371, 256, 715, and 958 mM, respectively, as above). In contrast, cysteine modification of the ligand-binding domain resulted in constitutively open receptors that showed robust ethanol inhibition. Ethanol inhibition of MTSET-treated GluN1(A7C) receptors was further reduced by TM3/TM4 mutations previously shown to reduce ethanol sensitivity of agonist-gated receptors. Overall, these results show that ethanol affects NMDA receptor function at a site distal from agonist binding and appears to exert greater effects via perturbation of GluN2 subunits. PMID:22005043

Neurosteroid binding to the amino terminal and glutamate binding domains of ionotropic glutamate receptors.

PubMed

Cameron, Krasnodara; Bartle, Emily; Roark, Ryan; Fanelli, David; Pham, Melissa; Pollard, Beth; Borkowski, Brian; Rhoads, Sarah; Kim, Joon; Rocha, Monica; Kahlson, Martha; Kangala, Melinda; Gentile, Lisa

2012-06-01

The endogenous neurosteroids, pregnenolone sulfate (PS) and 3α-hydroxy-5β-pregnan-20-one sulfate (PREGAS), have been shown to differentially regulate the ionotropic glutamate receptor (iGluR) family of ligand-gated ion channels. Upon binding to these receptors, PREGAS decreases current flow through the channels. Upon binding to non-NMDA or NMDA receptors containing an GluN2C or GluN2D subunit, PS also decreases current flow through the channels, however, upon binding to NMDA receptors containing an GluN2A or GluN2B subunit, flow through the channels increases. To begin to understand this differential regulation, we have cloned the S1S2 and amino terminal domains (ATD) of the NMDA GluN2B and GluN2D and AMPA GluA2 subunits. Here we present results that show that PS and PREGAS bind to different sites in the ATD of the GluA2 subunit, which when combined with previous results from our lab, now identifies two binding domains for each neurosteroid. We also show both neurosteroids bind only to the ATD of the GluN2D subunit, suggesting that this binding is distinct from that of the AMPA GluA2 subunit, with both leading to iGluR inhibition. Finally, we provide evidence that both PS and PREGAS bind to the S1S2 domain of the NMDA GluN2B subunit. Neurosteroid binding to the S1S2 domain of NMDA subunits responsible for potentiation of iGluRs and to the ATD of NMDA subunits responsible for inhibition of iGluRs, provides an interesting option for therapeutic design. Copyright © 2012 Elsevier Inc. All rights reserved.

Induction and expression of GluA1 (GluR-A)-independent LTP in the hippocampus

PubMed Central

Romberg, Carola; Raffel, Joel; Martin, Lucy; Sprengel, Rolf; Seeburg, Peter H; Rawlins, J Nicholas P; Bannerman, David M; Paulsen, Ole

2009-01-01

Long-term potentiation (LTP) at hippocampal CA3–CA1 synapses is thought to be mediated, at least in part, by an increase in the postsynaptic surface expression of α-amino-3-hydroxy-5-methyl-4-isoxazole proprionic acid (AMPA) receptors induced by N-methyl-d-aspartate (NMDA) receptor activation. While this process was originally attributed to the regulated synaptic insertion of GluA1 (GluR-A) subunit-containing AMPA receptors, recent evidence suggests that regulated synaptic trafficking of GluA2 subunits might also contribute to one or several phases of potentiation. However, it has so far been difficult to separate these two mechanisms experimentally. Here we used genetically modified mice lacking the GluA1 subunit (Gria1−/− mice) to investigate GluA1-independent mechanisms of LTP at CA3–CA1 synapses in transverse hippocampal slices. An extracellular, paired theta-burst stimulation paradigm induced a robust GluA1-independent form of LTP lacking the early, rapidly decaying component characteristic of LTP in wild-type mice. This GluA1-independent form of LTP was attenuated by inhibitors of neuronal nitric oxide synthase and protein kinase C (PKC), two enzymes known to regulate GluA2 surface expression. Furthermore, the induction of GluA1-independent potentiation required the activation of GluN2B (NR2B) subunit-containing NMDA receptors. Our findings support and extend the evidence that LTP at hippocampal CA3–CA1 synapses comprises a rapidly decaying, GluA1-dependent component and a more sustained, GluA1-independent component, induced and expressed via a separate mechanism involving GluN2B-containing NMDA receptors, neuronal nitric oxide synthase and PKC. PMID:19302150

Determination of L-AP4-bound human mGlu8 receptor amino terminal domain structure and the molecular basis for L-AP4’s group III mGlu receptor functional potency and selectivity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schkeryantz, Jeffery M.; Chen, Qi; Ho, Joseph D.

Here, L-2-Amino-4-phosphonobutyric acid (L-AP4) is a known potent and selective agonist for the Group III mGlu receptors. However, it does not show any selectivity among the individual group III mGlu subtypes. In order to understand the molecular basis for this group selectivity, we solved the first human mGlu8 amino terminal domain (ATD) crystal structures in complex with L-glu and L-AP4. In comparison with other published L-glu-bound mGlu ATD structures, we have observed L-glu binds in a significantly different manner in mGlu1. Furthermore, these new structures provided evidence that both the electronic and steric nature of the distal phosphate of L-AP4more » contribute to its exquisite Group III functional agonist potency and selectivity.« less

A noncognate aminoacyl-tRNA synthetase that may resolve a missing link in protein evolution.

PubMed

Skouloubris, Stephane; Ribas de Pouplana, Lluis; De Reuse, Hilde; Hendrickson, Tamara L

2003-09-30

Efforts to delineate the advent of many enzymes essential to protein translation are often limited by the fact that the modern genetic code evolved before divergence of the tree of life. Glutaminyl-tRNA synthetase (GlnRS) is one noteworthy exception to the universality of the translation apparatus. In eukaryotes and some bacteria, this enzyme is essential for the biosynthesis of Gln-tRNAGln, an obligate intermediate in translation. GlnRS is absent, however, in archaea, and most bacteria, organelles, and chloroplasts. Phylogenetic analyses predict that GlnRS arose from glutamyl-tRNA synthetase (GluRS), via gene duplication with subsequent evolution of specificity. A pertinent question to ask is whether, in the advent of GlnRS, a transient GluRS-like intermediate could have been retained in an extant organism. Here, we report the discovery of an essential GluRS-like enzyme (GluRS2), which coexists with another GluRS (GluRS1) in Helicobacter pylori. We show that GluRS2's primary role is to generate Glu-tRNAGln, not Glu-tRNAGlu. Thus, GluRS2 appears to be a transient GluRS-like ancestor of GlnRS and can be defined as a GluGlnRS.

Chemoenzymatic synthesis of new 2,4-syn-functionalized (S)-glutamate analogues and structure-activity relationship studies at ionotropic glutamate receptors and excitatory amino acid transporters.

PubMed

Assaf, Zeinab; Larsen, Anja P; Venskutonytė, Raminta; Han, Liwei; Abrahamsen, Bjarke; Nielsen, Birgitte; Gajhede, Michael; Kastrup, Jette S; Jensen, Anders A; Pickering, Darryl S; Frydenvang, Karla; Gefflaut, Thierry; Bunch, Lennart

2013-02-28

In the mammalian central nervous system, (S)-glutamate (Glu) is released from the presynaptic neuron where it activates a plethora of pre- and postsynaptic Glu receptors. The fast acting ionotropic Glu receptors (iGluRs) are ligand gated ion channels and are believed to be involved in a vast number of neurological functions such as memory and learning, synaptic plasticity, and motor function. The synthesis of 14 enantiopure 2,4-syn-Glu analogues 2b-p is accessed by a short and efficient chemoenzymatic approach starting from readily available cyclohexanone 3. Pharmacological characterization at the iGluRs and EAAT1-3 subtypes revealed analogue 2i as a selective GluK1 ligand with low nanomolar affinity. Two X-ray crystal structures of the key analogue 2i in the ligand-binding domain (LBD) of GluA2 and GluK3 were determined. Partial domain closure was seen in the GluA2-LBD complex with 2i comparable to that induced by kainate. In contrast, full domain closure was observed in the GluK3-LBD complex with 2i, similar to that of GluK3-LBD with glutamate bound.

Disrupted mGluR5-Homer scaffolds mediate abnormal mGluR5 signaling, circuit function and behavior in a mouse model of Fragile X Syndrome

PubMed Central

Ronesi, Jennifer A.; Collins, Katie A.; Hays, Seth A.; Tsai, Nien-Pei; Guo, Weirui; Birnbaum, Shari G.; Hu, Jia-Hua; Worley, Paul F.; Gibson, Jay R.; Huber, Kimberly M.

2012-01-01

Enhanced mGluR5 function is causally associated with the pathophysiology of Fragile X Syndrome (FXS), a leading inherited cause of intellectual disability and autism. Here we provide evidence that altered mGluR5-Homer scaffolds contribute to mGluR5 dysfunction and phenotypes in the FXS mouse model, Fmr1 KO. In Fmr1 KO mice mGluR5 is less associated with long Homer isoforms, but more associated with the short Homer1a. Genetic deletion of Homer1a restores mGluR5- long Homer scaffolds and corrects multiple phenotypes in Fmr1 KO mice including altered mGluR5 signaling, neocortical circuit dysfunction, and behavior. Acute, peptide-mediated disruption of mGluR5-Homer scaffolds in wildtype mice mimics many Fmr1 KO phenotypes. In contrast, Homer1a deletion does not rescue altered mGluR-dependent long-term synaptic depression or translational control of FMRP target mRNAs. Our findings reveal novel functions for mGluR5-Homer interactions in the brain and delineate distinct mechanisms of mGluR5 dysfunction in a mouse model of cognitive dysfunction and autism. PMID:22267161

Expression of the vesicular glutamate transporter vGluT2 in a subset of cones of the mouse retina.

PubMed

Wässle, Heinz; Regus-Leidig, Hanna; Haverkamp, Silke

2006-06-01

Cone photoreceptors have a continuous release of glutamate that is modulated by light. Vesicular glutamate transporters (vGluT) play an essential role for sustaining this release by loading synaptic vesicles in the cone synapse, the so-called cone pedicle. In the present study mouse retinas were immunostained for vGluT1 and vGluT2. vGluT1 was localized to all cone pedicles and rod spherules, whereas vGluT2 was found in only 10% of the cone pedicles. The vGluT2-expressing cones were characterized in more detail. They are distributed in a regular array, suggesting they are a distinct type. Their proportion does not differ between dorsal (L-cone-dominated) and ventral (S-cone-dominated) retina, and they are not the genuine blue cones of the mouse retina. During development, vGluT1 and vGluT2 expression in cones starts at around P0 and right from the beginning vGluT2 is only expressed in a subset of cones. Bipolar cells contact the vGluT2-expressing cones and other cones nonselectively. The possible functional role of vGluT2 expression in a small fraction of cones is discussed.

Costimulation of AMPA and metabotropic glutamate receptors underlies phospholipase C activation by glutamate in hippocampus.

PubMed

Kim, Hye-Hyun; Lee, Kyu-Hee; Lee, Doyun; Han, Young-Eun; Lee, Suk-Ho; Sohn, Jong-Woo; Ho, Won-Kyung

2015-04-22

Glutamate, a major neurotransmitter in the brain, activates ionotropic and metabotropic glutamate receptors (iGluRs and mGluRs, respectively). The two types of glutamate receptors interact with each other, as exemplified by the modulation of iGluRs by mGluRs. However, the other way of interaction (i.e., modulation of mGluRs by iGluRs) has not received much attention. In this study, we found that group I mGluR-specific agonist (RS)-3,5-dihydroxyphenylglycine (DHPG) alone is not sufficient to activate phospholipase C (PLC) in rat hippocampus, while glutamate robustly activates PLC. These results suggested that additional mechanisms provided by iGluRs are involved in group I mGluR-mediated PLC activation. A series of experiments demonstrated that glutamate-induced PLC activation is mediated by mGluR5 and is facilitated by local Ca(2+) signals that are induced by AMPA-mediated depolarization and L-type Ca(2+) channel activation. Finally, we found that PLC and L-type Ca(2+) channels are involved in hippocampal mGluR-dependent long-term depression (mGluR-LTD) induced by paired-pulse low-frequency stimulation, but not in DHPG-induced chemical LTD. Together, we propose that AMPA receptors initiate Ca(2+) influx via the L-type Ca(2+) channels that facilitate mGluR5-PLC signaling cascades, which underlie mGluR-LTD in rat hippocampus. Copyright © 2015 the authors 0270-6474/15/356401-12$15.00/0.

Nedd4 is a Specific E3 Ubiquitin Ligase for the NMDA Receptor Subunit GluN2D

PubMed Central

Gautam, Vivek; Trinidad, Jonathan C.; Rimerman, Ronald A.; Costa, Blaise M.; Burlingame, Alma L.; Monaghan, Daniel T.

2013-01-01

NMDA receptors are a family of glutamate-gated ion channels that regulate various CNS functions such as synaptic plasticity and learning. However hypo-or hyper-activation of NMDA receptors is critically involved in many neurological and psychiatric conditions such as pain, stroke, epilepsy, neurodegeneration, schizophrenia, and depression. Thus, it is important to identify mechanisms (such as by targeted ubiquitination) that regulate the levels of individual subtypes of NMDA receptors. In this study, we used a series of tagged, carboxy terminal constructs of GluN2D to identify associating proteins from rat brain. Of seven different GluN2D C-terminal fragments used as bait, only the construct containing amino acids 983-1097 associated with an E3 ligase, Nedd4. A direct interaction between GluN2D and Nedd4 was confirmed both in vivo and in vitro. This association is mediated by an interaction between GluN2D's C-terminal PPXY motif and the 2nd and 3rd WW domains of Nedd4. Of the four GluN2 subunits, Nedd4 directly interacted with GluN2D and also weakly with GluN2A. Nedd4 coexpression with GluN2D enhances GluN2D ubiquitination and reduces GluN1/GluN2D NMDA receptor responses. These results identify Nedd4 as a novel binding partner for GluN2D and suggest a mechanism for the regulation of NMDA receptors that contains GluN2D subunit through ubiquitination-dependent downregulation. PMID:23639431

Metabotropic glutamate receptors mGluR4 and mGluR8 regulate transmission in the lateral olfactory tract-piriform cortex synapse

PubMed Central

Jones, Paulianda J.; Xiang, Zixiu; Conn, P. Jeffrey

2008-01-01

The piriform cortex (PC) is the primary terminal zone of projections from the olfactory bulb, termed the lateral olfactory tract (LOT). The PC plays a critical role in processing of olfactory stimuli and is also a highly seizure prone area thought to be involved in some forms of temporal lobe epilepsy. Pharmacological and immunohistochemical studies provide evidence for the localization of various metabotropic glutamate receptors (GluRs) in the PC. We employed whole cell patch clamp recordings from PC pyramidal cells to determine the roles of group III mGluRs in modulating synaptic transmission at the LOT–PC synapse. The group III mGluR agonist, L-AP4, induced a concentration-dependent inhibition of synaptic transmission at the LOT-PC synapse at concentrations that activate mGluR4 and mGluR8, but not mGluR7 or other mGluR subtypes (EC50 = 473 nM). In addition, the selective mGluR8 agonist, DCPG (300 nM), also suppressed synaptic transmission at the LOT synapse. Furthermore, the inhibitory actions of L-AP4 and Z-cyclopentyl-AP4, a selective mGluR4 agonist, were potentiated by the mGluR4 positive allosteric modulator, PHCCC (30 µM). The high potency of L-AP4, combined with the observed effects of DCPG and PHCCC, suggests that both mGluR4 and mGluR8 play a role in the L-AP4-induced inhibition of synaptic transmission at the LOT-PC synapse. PMID:18625254

Endocytosis and recycling of AMPA receptors lacking GluR2/3.

PubMed

Biou, Virginie; Bhattacharyya, Samarjit; Malenka, Robert C

2008-01-22

Excitatory synapses in the mammalian brain contain two types of ligand-gated ion channels: AMPA receptors (AMPARs) and NMDA receptors (NMDARs). AMPARs are responsible for generating excitatory synaptic responses, whereas NMDAR activation triggers long-lasting changes in these responses by modulating the trafficking of AMPARs toward and away from synapses. AMPARs are tetramers composed of four subunits (GluR1-GluR4), which current models suggest govern distinct AMPAR trafficking behavior during synaptic plasticity. Here, we address the roles of GluR2 and GluR3 in controlling the recycling- and activity-dependent endocytosis of AMPARs by using cultured hippocampal neurons prepared from knockout (KO) mice lacking these subunits. We find that synapses and dendritic spines form normally in cells lacking GluR2/3 and that upon NMDAR activation, GluR2/3-lacking AMPARs are endocytosed in a manner indistinguishable from GluR2-containing AMPARs in wild-type (WT) neurons. AMPARs lacking GluR2/3 also recycle to the plasma membrane identically to WT AMPARs. However, because of their permeability to calcium, GluR2-lacking but not WT AMPARs exhibited robust internalization throughout the dendritic tree in response to AMPA application. Dendritic endocytosis of AMPARs also was observed in GABAergic neurons, which express a high proportion of GluR2-lacking AMPARs. These results demonstrate that GluR2 and GluR3 are not required for activity-dependent endocytosis of AMPARs and suggest that the most important property of GluR2 in the context of AMPAR trafficking may be its influence on calcium permeability.

A deletion in the alpha2B-adrenergic receptor gene and autonomic nervous function in central obesity.

PubMed

Sivenius, Katariina; Niskanen, Leo; Laakso, Markku; Uusitupa, Matti

2003-08-01

We investigated the impact of a three-amino acid deletion (12Glu9) polymorphism in the alpha(2B)-adrenergic receptor gene on autonomic nervous function. The short form (Glu(9)/Glu(9)) of the polymorphism has previously been associated with a reduced basal metabolic rate in obese subjects. Because autonomic nervous function participates in the regulation of energy metabolism, there could be a link between this polymorphism and autonomic nervous function. Data of a 10-year follow-up study with 126 nondiabetic control subjects and 84 type 2 diabetic patients were used to determine the effects of the 12Glu9 polymorphism on autonomic nervous function. A deep breathing test and an orthostatic test were used to investigate parasympathetic and sympathetic autonomic nervous function. In addition, cardiovascular autonomic function was studied using power spectral analysis of heart rate variability. No significant differences were found in the frequency of the 12Glu9 deletion polymorphism between nondiabetic and diabetic subjects. The nondiabetic men with the Glu(9)/Glu(9) genotype, especially those with abdominal obesity, had significantly lower total and low-frequency power values in the power spectral analysis when compared with other men. Furthermore, in a longitudinal analysis of 10 years, the decrease in parasympathetic function was greater in nondiabetic men with the Glu(9)/Glu(9) genotype than in the men with the Glu(9)/Glu(12) or Glu(12)/Glu(12) genotypes. The results of the present study suggest that the 12Glu9 polymorphism of the alpha(2B)-adrenergic receptor gene modulates autonomic nervous function in Finnish nondiabetic men. In the nondiabetic men with the Glu(9)/Glu(9) genotype, the general autonomic tone is depressed, and vagal activity especially becomes impaired with time. Furthermore, this association is accentuated by central obesity.

Therapeutic Molecules and Endogenous Ligands Regulate the Interaction between Brain Cellular Prion Protein (PrPC) and Metabotropic Glutamate Receptor 5 (mGluR5)*

PubMed Central

Haas, Laura T.; Kostylev, Mikhail A.; Strittmatter, Stephen M.

2014-01-01

Soluble Amyloid-β oligomers (Aβo) can trigger Alzheimer disease (AD) pathophysiology by binding to cell surface cellular prion protein (PrPC). PrPC interacts physically with metabotropic glutamate receptor 5 (mGluR5), and this interaction controls the transmission of neurotoxic signals to intracellular substrates. Because the interruption of the signal transduction from PrPC to mGluR5 has therapeutic potential for AD, we developed assays to explore the effect of endogenous ligands, agonists/antagonists, and antibodies on the interaction between PrPC and mGluR5 in cell lines and mouse brain. We show that the PrPC segment of amino acids 91–153 mediates the interaction with mGluR5. Agonists of mGluR5 increase the mGluR5-PrPC interaction, whereas mGluR5 antagonists suppress protein association. Synthetic Aβo promotes the protein interaction in mouse brain and transfected HEK-293 cell membrane preparations. The interaction of PrPC and mGluR5 is enhanced dramatically in the brains of familial AD transgenic model mice. In brain homogenates with Aβo, the interaction of PrPC and mGluR5 is reversed by mGluR5-directed antagonists or antibodies directed against the PrPC segment of amino acids 91–153. Silent allosteric modulators of mGluR5 do not alter Glu or basal mGluR5 activity, but they disrupt the Aβo-induced interaction of mGluR5 with PrPC. The assays described here have the potential to identify and develop new compounds that inhibit the interaction of PrPC and mGluR5, which plays a pivotal role in the pathogenesis of Alzheimer disease by transmitting the signal from extracellular Aβo into the cytosol. PMID:25148681

IgE binding to peanut allergens is inhibited by combined D-aspartic and D-glutamic acids.

PubMed

Chung, Si-Yin; Reed, Shawndrika

2015-01-01

The objective of this study was to determine if D-amino acids (D-aas) bind and inhibit immunoglobulin E (IgE) binding to peanut allergens. D-aas such as D-Asp (aspartic acid), D-Glu (glutamic acid), combined D-[Asp/Glu] and others were each prepared in a cocktail of 9 other D-aas, along with L-amino acids (L-aas) and controls. Each sample was mixed with a pooled plasma from peanut-allergic donors, and tested by ELISA (enzyme-linked immunosorbent assay) and Western blots for IgE binding to peanut allergens. Results showed that D-[Asp/Glu] (4 mg/ml) inhibited IgE binding (75%) while D-Glu, D-Asp and other D-aas had no inhibitory effect. A higher inhibition was seen with D-[Asp/Glu] than with L-[Asp/Glu]. We concluded that IgE was specific for D-[Asp/Glu], not D-Asp or D-Glu, and that D-[Asp/Glu] was more reactive than was L-[Asp/Glu] in IgE inhibition. The finding indicates that D-[Asp/Glu] may have the potential for removing IgE or reducing IgE binding to peanut allergens in vitro. Published by Elsevier Ltd.

Co-Requirement of PICK1 Binding and PKC Phosphorylation for Stable Surface Expression of the Metabotropic Glutamate Receptor mGluR7

PubMed Central

Suh, Young Ho; Pelkey, Kenneth A.; Lavezzari, Gabriela; Roche, Paul A.; Huganir, Richard L.; McBain, Chris J.; Roche, Katherine W.

2008-01-01

SUMMARY The presynaptic metabotropic glutamate receptor (mGluR) mGluR7 modulates excitatory neurotransmission by regulating neurotransmitter release, and plays a critical role in certain forms of synaptic plasticity. Although the dynamic regulation of mGluR7 surface expression governs a novel form of metaplasticity in the hippocampus, little is known about the molecular mechanisms regulating mGluR7 trafficking. We now show that mGluR7 surface expression is stabilized by both PKC phosphorylation and by receptor binding to the PDZ domain-containing protein PICK1. Phosphorylation of mGluR7 on serine 862 (S862) inhibits CaM binding thereby increasing mGluR7 surface expression and receptor binding to PICK1. Furthermore, in mice lacking PICK1, PKC-dependent increases in mGluR7 phosphorylation and surface expression are diminished, and mGluR7-dependent plasticity at mossy fiber-interneuron hippocampal synapses is impaired. These data support a model in which PICK1 binding and PKC phosphorylation act together to stabilize mGluR7 on the cell surface in vivo. PMID:18549785

4-Alkylated homoibotenic acid (HIBO) analogues: versatile pharmacological agents with diverse selectivity profiles towards metabotropic and ionotropic glutamate receptor subtypes.

PubMed

Madsen, Ulf; Pickering, Darryl S; Nielsen, Birgitte; Bräuner-Osborne, Hans

2005-01-01

4-Alkylated analogues of homoibotenic acid (HIBO) have previously shown high potency and selectivity at ionotropic and metabotropic glutamic acid receptor (iGluR and mGluR) subtypes. Compounds with different selectivity profiles are valuable pharmacological tools for neuropharmacological studies, and the series of 4-alkyl-HIBO analogues have been extended in this paper in the search for versatile agents. Pharmacological characterization of five new analogues, branched and unbranched 4-alkyl-HIBO analogues, have been carried out. The present compounds are all weak antagonists at Group I mGluRs (mGluR1 and 5) presenting only small differences in potencies (Ki values ranging from 89 to 670 microM). Affinities were studied at native and cloned iGluRs, and the compounds described show preference for the AMPA receptor subtypes GluR1 and 2 over GluR3 and 4. However, compared to previous 4-alkyl-HIBO analogues, these compounds show a remarkably high affinity for the Kain preferring subtype GluR5. The observed GluR5 affinities were either similar or higher compared to their GluR1 and 2 affinity. Isopropyl-HIBO showed the highest affinity for GluR5 (Ki=0.16 microM), and represents a unique compound with high affinity towards the three subtypes GluR1, 2 and 5. In general, these compounds represent new selectivity profiles compared to previously reported Glu receptor analogues.

An Artifact in LC-MS/MS Measurement of Glutamine and Glutamic Acid: In-Source Cyclization to Pyroglutamic Acid

PubMed Central

2015-01-01

Advances in metabolomics, particularly for research on cancer, have increased the demand for accurate, highly sensitive methods for measuring glutamine (Gln) and glutamic acid (Glu) in cell cultures and other biological samples. N-terminal Gln and Glu residues in proteins or peptides have been reported to cyclize to pyroglutamic acid (pGlu) during liquid chromatography (LC)-mass spectrometry (MS) analysis, but cyclization of free Gln and Glu to free pGlu during LC-MS analysis has not been well-characterized. Using an LC-MS/MS protocol that we developed to separate Gln, Glu, and pGlu, we found that free Gln and Glu cyclize to pGlu in the electrospray ionization source, revealing a previously uncharacterized artifact in metabolomic studies. Analysis of Gln standards over a concentration range from 0.39 to 200 μM indicated that a minimum of 33% and maximum of almost 100% of Gln was converted to pGlu in the ionization source, with the extent of conversion dependent on fragmentor voltage. We conclude that the sensitivity and accuracy of Gln, Glu, and pGlu quantitation by electrospray ionization-based mass spectrometry can be improved dramatically by using (i) chromatographic conditions that adequately separate the three metabolites, (ii) isotopic internal standards to correct for in-source pGlu formation, and (iii) user-optimized fragmentor voltage for acquisition of the MS spectra. These findings have immediate impact on metabolomics and metabolism research using LC-MS technologies. PMID:24892977

An artifact in LC-MS/MS measurement of glutamine and glutamic acid: in-source cyclization to pyroglutamic acid.

PubMed

Purwaha, Preeti; Silva, Leslie P; Hawke, David H; Weinstein, John N; Lorenzi, Philip L

2014-06-17

Advances in metabolomics, particularly for research on cancer, have increased the demand for accurate, highly sensitive methods for measuring glutamine (Gln) and glutamic acid (Glu) in cell cultures and other biological samples. N-terminal Gln and Glu residues in proteins or peptides have been reported to cyclize to pyroglutamic acid (pGlu) during liquid chromatography (LC)-mass spectrometry (MS) analysis, but cyclization of free Gln and Glu to free pGlu during LC-MS analysis has not been well-characterized. Using an LC-MS/MS protocol that we developed to separate Gln, Glu, and pGlu, we found that free Gln and Glu cyclize to pGlu in the electrospray ionization source, revealing a previously uncharacterized artifact in metabolomic studies. Analysis of Gln standards over a concentration range from 0.39 to 200 μM indicated that a minimum of 33% and maximum of almost 100% of Gln was converted to pGlu in the ionization source, with the extent of conversion dependent on fragmentor voltage. We conclude that the sensitivity and accuracy of Gln, Glu, and pGlu quantitation by electrospray ionization-based mass spectrometry can be improved dramatically by using (i) chromatographic conditions that adequately separate the three metabolites, (ii) isotopic internal standards to correct for in-source pGlu formation, and (iii) user-optimized fragmentor voltage for acquisition of the MS spectra. These findings have immediate impact on metabolomics and metabolism research using LC-MS technologies.

Presynaptic mGlu1 and mGlu5 autoreceptors facilitate glutamate exocytosis from mouse cortical nerve endings.

PubMed

Musante, Veronica; Neri, Elisa; Feligioni, Marco; Puliti, Aldamaria; Pedrazzi, Marco; Conti, Valerio; Usai, Cesare; Diaspro, Alberto; Ravazzolo, Roberto; Henley, Jeremy M; Battaglia, Giuseppe; Pittaluga, Anna

2008-09-01

The effects of mGlu1 and mGlu5 receptor activation on the depolarization-evoked release of [3H]d-aspartate ([3H]D-ASP) from mouse cortical synaptosomes were investigated. The mGlu1/5 receptor agonist 3,5-DHPG (0.1-100microM) potentiated the K+(12mM)-evoked [3H]D-ASP overflow. The potentiation occurred in a concentration-dependent manner showing a biphasic pattern. The agonist potentiated [3H]D-ASP exocytosis when applied at 0.3microM; the efficacy of 3,5-DHPG then rapidly declined and reappeared at 30-100microM. The fall of efficacy of agonist at intermediate concentration may be consistent with 3,5-DHPG-induced receptor desensitization. Facilitation of [3H]D-ASP exocytosis caused by 0.3microM 3,5-DHPG was prevented by the selective mGlu5 receptor antagonist MPEP, but was insensitive to the selective mGlu1 receptor antagonist CPCCOEt. In contrast, CPCCOEt prevented the potentiation by 50microM 3,5-DHPG, while MPEP had minimal effect. Unexpectedly, LY 367385 antagonized both the 3,5-DHPG-induced effects. A total of 0.3microM 3,5-DHPG failed to facilitate the K+-evoked [3H]D-ASP overflow from mGlu5 receptor knockout (mGlu5-/-) cortical synaptosomes, but not from nerve terminals prepared from the cortex of animals lacking the mGlu1 receptors, the crv4/crv4 mice. On the contrary, 50microM 3,5-DHPG failed to affect the [3H]D-ASP exocytosis from cortical synaptosomes obtained from crv4/crv4 and mGlu5-/-mice. Western blot analyses in subsynaptic fractions support the existence of both mGlu1 and mGlu5 autoreceptors located presynaptically, while immunocytochemistry revealed their presence at glutamatergic terminals. We propose that mGlu1 and mGlu5 autoreceptors exist on mouse glutamatergic cortical terminals; mGlu5 receptors may represent the "high affinity" binding sites for 3,5-DHPG, while mGlu1 autoreceptors represent the "low affinity" binding sites.

ABA Renewal Involves Enhancements in Both GluA2-Lacking AMPA Receptor Activity and GluA1 Phosphorylation in the Lateral Amygdala

PubMed Central

Park, Sungmo; Kim, Jihye; An, Bobae; Lee, Hyun Woo; Lee, Seungbok; Kim, Hyun; Lee, Justin C.; Lee, Sukwon; Choi, Sukwoo

2014-01-01

Fear renewal, the context-specific relapse of fear following fear extinction, is a leading animal model of post-traumatic stress disorders (PTSD) and fear-related disorders. Although fear extinction can diminish fear responses, this effect is restricted to the context where the extinction is carried out, and the extinguished fear strongly relapses when assessed in the original acquisition context (ABA renewal) or in a context distinct from the conditioning and extinction contexts (ABC renewal). We have previously identified Ser831 phosphorylation of GluA1 subunit in the lateral amygdala (LA) as a key molecular mechanism for ABC renewal. However, molecular mechanisms underlying ABA renewal remain to be elucidated. Here, we found that both the excitatory synaptic efficacy and GluA2-lacking AMPAR activity at thalamic input synapses onto the LA (T-LA synapses) were enhanced upon ABA renewal. GluA2-lacking AMPAR activity was also increased during low-threshold potentiation, a potential cellular substrate of renewal, at T-LA synapses. The microinjection of 1-naphtylacetyl-spermine (NASPM), a selective blocker of GluA2-lacking AMPARs, into the LA attenuated ABA renewal, suggesting a critical role of GluA2-lacking AMPARs in ABA renewal. We also found that Ser831 phosphorylation of GluA1 in the LA was increased upon ABA renewal. We developed a short peptide mimicking the Ser831-containing C-tail region of GluA1, which can be phosphorylated upon renewal (GluA1S); thus, the phosphorylated GluA1S may compete with Ser831-phosphorylated GluA1. This GluA1S peptide blocked the low-threshold potentiation when dialyzed into a recorded neuron. The microinjection of a cell-permeable form of GluA1S peptide into the LA attenuated ABA renewal. In support of the GluA1S experiments, a GluA1D peptide (in which the serine at 831 is replaced with a phosphomimetic amino acid, aspartate) attenuated ABA renewal when microinjected into the LA. These findings suggest that enhancements in both the GluA2-lacking AMPAR activity and GluA1 phosphorylation at Ser831 are required for ABA renewal. PMID:24925360

ABA renewal involves enhancements in both GluA2-lacking AMPA receptor activity and GluA1 phosphorylation in the lateral amygdala.

PubMed

Park, Kyungjoon; Song, Beomjong; Kim, Jeongyeon; Hong, Ingie; Song, Sangho; Lee, Junuk; Park, Sungmo; Kim, Jihye; An, Bobae; Lee, Hyun Woo; Lee, Seungbok; Kim, Hyun; Lee, Justin C; Lee, Sukwon; Choi, Sukwoo

2014-01-01

Fear renewal, the context-specific relapse of fear following fear extinction, is a leading animal model of post-traumatic stress disorders (PTSD) and fear-related disorders. Although fear extinction can diminish fear responses, this effect is restricted to the context where the extinction is carried out, and the extinguished fear strongly relapses when assessed in the original acquisition context (ABA renewal) or in a context distinct from the conditioning and extinction contexts (ABC renewal). We have previously identified Ser831 phosphorylation of GluA1 subunit in the lateral amygdala (LA) as a key molecular mechanism for ABC renewal. However, molecular mechanisms underlying ABA renewal remain to be elucidated. Here, we found that both the excitatory synaptic efficacy and GluA2-lacking AMPAR activity at thalamic input synapses onto the LA (T-LA synapses) were enhanced upon ABA renewal. GluA2-lacking AMPAR activity was also increased during low-threshold potentiation, a potential cellular substrate of renewal, at T-LA synapses. The microinjection of 1-naphtylacetyl-spermine (NASPM), a selective blocker of GluA2-lacking AMPARs, into the LA attenuated ABA renewal, suggesting a critical role of GluA2-lacking AMPARs in ABA renewal. We also found that Ser831 phosphorylation of GluA1 in the LA was increased upon ABA renewal. We developed a short peptide mimicking the Ser831-containing C-tail region of GluA1, which can be phosphorylated upon renewal (GluA1S); thus, the phosphorylated GluA1S may compete with Ser831-phosphorylated GluA1. This GluA1S peptide blocked the low-threshold potentiation when dialyzed into a recorded neuron. The microinjection of a cell-permeable form of GluA1S peptide into the LA attenuated ABA renewal. In support of the GluA1S experiments, a GluA1D peptide (in which the serine at 831 is replaced with a phosphomimetic amino acid, aspartate) attenuated ABA renewal when microinjected into the LA. These findings suggest that enhancements in both the GluA2-lacking AMPAR activity and GluA1 phosphorylation at Ser831 are required for ABA renewal.

Metabotropic Glutamate2 Receptors Play a Key Role in Modulating Head Twitches Induced by a Serotonergic Hallucinogen in Mice

PubMed Central

Benvenga, Mark J.; Chaney, Stephen F.; Baez, Melvyn; Britton, Thomas C.; Hornback, William J.; Monn, James A.; Marek, Gerard J.

2018-01-01

There is substantial evidence that glutamate can modulate the effects of 5-hydroxytryptamine2A (5-HT2A) receptor activation through stimulation of metabotropic glutamate2/3 (mGlu2/3) receptors in the prefrontal cortex. Here we show that constitutive deletion of the mGlu2 gene profoundly attenuates an effect of 5-HT2A receptor activation using the mouse head twitch response (HTR). MGlu2 and mGlu3 receptor knockout (KO) as well as age-matched ICR (CD-1) wild type (WT) mice were administered (±)1-(2,5-dimethoxy-4-iodophenyl)-2-aminopropane (DOI) and observed for head twitch activity. DOI failed to produce significant head twitches in mGlu2 receptor KO mice at a dose 10-fold higher than the peak effective dose in WT or mGlu3 receptor KO mice. In addition, the mGlu2/3 receptor agonist LY379268, and the mGlu2 receptor positive allosteric modulator (PAM) CBiPES, potently blocked the HTR to DOI in WT and mGlu3 receptor KO mice. Conversely, the mGlu2/3 receptor antagonist LY341495 (10 mg/kg) increased the HTR produced by DOI (3 mg/kg) in mGlu3 receptor KO mice. Finally, the mGlu2 receptor potentiator CBiPES was able to attenuate the increase in the HTR produced by LY341495 in mGlu3 receptor KO mice. Taken together, all of these results are consistent with the hypothesis that that DOI-induced head twitches are modulated by mGlu2 receptor activation. These results also are in keeping with a critical autoreceptor function for mGlu2 receptors in the prefrontal cortex with differential effects of acute vs. chronic perturbation (e.g., constitutive mGlu2 receptor KO mice). The robust attenuation of DOI-induced head twitches in the mGlu2 receptor KO mice appears to reflect the critical role of glutamate in ongoing regulation of 5-HT2A receptors in the prefrontal cortex. Future experiments with inducible knockouts for the mGlu2 receptor and/or selective mGlu3 receptor agonists/PAMs/antagonists could provide an important tools in understanding glutamatergic modulation of prefrontal cortical 5-HT2A receptor function. PMID:29599719

[Analysis of diversity of Russian and Ukrainian bread wheat (Triticum aestivum L.) cultivars for high-molecular-weight glutenin subunits].

PubMed

Dobrotvorskaia, T V; Martynov, S P

2011-07-01

The allelic diversity of high-moleculat-weght glutenin subunits (H WIGS) in Russian and Ukrainian bread wheat cultivars was analyzed. The diversity of spring wheat cultivars for alleles of the Glu-1 loci is characterized by medium values of the polymorphism index (polymorphism information content, PlC), and in winter wheats it varies from high at the Glu-A1 locus to low at the Glu-D1 locus. The spring and winter cultivars differ significantly in the frequencies of alleles of the glutenin loci. The combination of the Glu-A1b, Glu-B1c, and Glu-D1a alleles prevails among the spring cultivars, and the combination of the Glu-A1a, Glu-B1c, and Glu-D1d alleles prevails among the winter cultivars. The distribution of the Glu-1 alleles significantly depends on the moisture and heat supply in the region of origin of the cultivars. Drought resistance is associated with the Glu-D1a allele in the spring wheat and with the Glu-B1b allele in the winter wheat. The sources of the Glu-1 alleles were identified in the spring and wheat cultivars. The analysis of independence of the distribution of the spring and winter cultivars by the market classes and by the alleles of the HMWGS loci showed a highly significant association of the alleles of three Glu-1 loci with the market classes in foreign cultivars and independence or a weak association in the Russian and Ukrainian cultivars. This seems to be due to the absence of a statistically substantiated system of classification of the domestic cultivars on the basis of their quality.

Separate Intramolecular Targets for Protein Kinase A Control N-Methyl-d-aspartate Receptor Gating and Ca2+ Permeability*

PubMed Central

Aman, Teresa K.; Maki, Bruce A.; Ruffino, Thomas J.; Kasperek, Eileen M.; Popescu, Gabriela K.

2014-01-01

Protein kinase A (PKA) enhances synaptic plasticity in the central nervous system by increasing NMDA receptor current amplitude and Ca2+ flux in an isoform-dependent yet poorly understood manner. PKA phosphorylates multiple residues on GluN1, GluN2A, and GluN2B subunits in vivo, but the functional significance of this multiplicity is unknown. We examined gating and permeation properties of recombinant NMDA receptor isoforms and of receptors with altered C-terminal domain (CTDs) prior to and after pharmacological inhibition of PKA. We found that PKA inhibition decreased GluN1/GluN2B but not GluN1/GluN2A gating; this effect was due to slower rates for receptor activation and resensitization and was mediated exclusively by the GluN2B CTD. In contrast, PKA inhibition reduced NMDA receptor-relative Ca2+ permeability (PCa/PNa) regardless of the GluN2 isoform and required the GluN1 CTD; this effect was due primarily to decreased unitary Ca2+ conductance, because neither Na+ conductance nor Ca2+-dependent block was altered substantially. Finally, we show that both the gating and permeation effects can be reproduced by changing the phosphorylation state of a single residue: GluN2B Ser-1166 and GluN1 Ser-897, respectively. We conclude that PKA effects on NMDA receptor gating and Ca2+ permeability rely on distinct phosphorylation sites located on the CTD of GluN2B and GluN1 subunits. This separate control of NMDA receptor properties by PKA may account for the specific effects of PKA on plasticity during synaptic development and may lead to drugs targeted to alter NMDA receptor gating or Ca2+ permeability. PMID:24847051

Importance of the GluN2B Carboxy-Terminal Domain for Enhancement of Social Memories

ERIC Educational Resources Information Center

Jacobs, Stephanie; Wei, Wei; Wang, Deheng; Tsien, Joe Z.

2015-01-01

The N-methyl-D-aspartate (NMDA) receptor is known to be necessary for many forms of learning and memory, including social recognition memory. Additionally, the GluN2 subunits are known to modulate multiple forms of memory, with a high GluN2A:GluN2B ratio leading to impairments in long-term memory, while a low GluN2A:GluN2B ratio enhances some…

Expression of group III metabotropic glutamate receptors in the reproductive system of male mice.

PubMed

Marciniak, Marcin; Chruścicka, Barbara; Lech, Tomasz; Burnat, Grzegorz; Pilc, Andrzej

2016-03-01

Although the presence of metabotropic glutamate (mGlu) receptors in the central nervous system is well documented, they have recently been found in peripheral and non-neuronal tissues. In the present study we investigated the expression of group III mGlu receptors in the reproductive system of male mice. Reverse transcription-polymerase chain reaction analysis revealed the presence of mGlu6, mGlu7 and mGlu8 (but not mGlu4) receptor transcripts in testes and epididymides from adult mice. In addition, expression of mGlu6 (Grm6) and mGlu8 receptor (Grm8) mRNA was detected in spermatozoa isolated from the vas deferens. The vas deferens was found to contain only mGlu7 receptor (Grm7) mRNA, which was particularly intense in 21-day-old male mice. In penile homogenates, only the mGlu7 receptor signal was detected. Genetic ablation of the mGlu7 receptor in males led to fertility disorders manifested by decreased insemination capability as well as deterioration of sperm parameters, particularly sperm motility, vitality, sperm membrane integrity and morphology, with a simultaneous increase in sperm concentration. These results indicate that constitutively expressed mGlu receptors in the male reproductive system may play an important role in ejaculation and/or erection processes, as well as in the formation and maturation of spermatozoa.

Intracellular mGluR5 plays a critical role in neuropathic pain

PubMed Central

Vincent, Kathleen; Cornea, Virginia M.; Jong, Yuh-Jiin I.; Laferrière, André; Kumar, Naresh; Mickeviciute, Aiste; Fung, Jollee S. T.; Bandegi, Pouya; Ribeiro-da-Silva, Alfredo; O'Malley, Karen L.; Coderre, Terence J.

2016-01-01

Spinal mGluR5 is a key mediator of neuroplasticity underlying persistent pain. Although brain mGluR5 is localized on cell surface and intracellular membranes, neither the presence nor physiological role of spinal intracellular mGluR5 is established. Here we show that in spinal dorsal horn neurons >80% of mGluR5 is intracellular, of which ∼60% is located on nuclear membranes, where activation leads to sustained Ca2+ responses. Nerve injury inducing nociceptive hypersensitivity also increases the expression of nuclear mGluR5 and receptor-mediated phosphorylated-ERK1/2, Arc/Arg3.1 and c-fos. Spinal blockade of intracellular mGluR5 reduces neuropathic pain behaviours and signalling molecules, whereas blockade of cell-surface mGluR5 has little effect. Decreasing intracellular glutamate via blocking EAAT-3, mimics the effects of intracellular mGluR5 antagonism. These findings show a direct link between an intracellular GPCR and behavioural expression in vivo. Blockade of intracellular mGluR5 represents a new strategy for the development of effective therapies for persistent pain. PMID:26837579

Channel-Opening Kinetic Mechanism of Wild-Type GluK1 Kainate Receptors and a C-Terminal Mutant

PubMed Central

Han, Yan; Wang, Congzhou; Park, Jae Seon; Niu, Li

2012-01-01

GluK1 is a kainate receptor subunit in the ionotropic glutamate receptor family and can form functional channels when expressed, for instance, in HEK-293 cells. However, the channel-opening mechanism of GluK1 is poorly understood. One major challenge to studying the GluK1 channel is its apparent low surface expression, which results in a low whole-cell current response even to a saturating concentration of agonist. The low surface expression is thought to be contributed by an endoplasmic reticulum (ER) retention signal sequence. When this sequence motif is present as in the wild-type GluK1-2b C-terminus, the receptor is significantly retained in the ER. Conversely, when this sequence is lacking, as in wild-type GluK1-2a (i.e., a different alternatively spliced isoform at the C-terminus) and in a GluK1-2b mutant (i.e., R896A, R897A, R900A and K901A) that disrupts the ER retention signal, there is higher surface expression and greater whole-cell current response. Here we characterize the channel-opening kinetic mechanism for these three GluK1 receptors expressed in HEK-293 cells by using a laser-pulse photolysis technique. Our results show that the wild-type GluK1-2a, wild-type GluK1-2b and the mutant GluK1-2b have identical channel-opening and channel-closing rate constants. These results indicate that the C-terminal ER retention signal sequence, which affects receptor trafficking/expression, does not affect channel-gating properties. Furthermore, as compared with the GluK2 kainate receptor, the GluK1 channel is faster to open, close, and desensitize by at least two-fold, yet the EC50 value of GluK1 is similar to that of GluK2. PMID:22191429

7TM X-ray structures for class C GPCRs as new drug-discovery tools. 1. mGluR5.

PubMed

Topiol, Sid; Sabio, Michael

2016-01-15

We illustrate, with a focus on mGluR5, how the recently published, first X-ray structures of mGluR 7TM domains, specifically those of mGluR1 and mGluR5 complexed with negative allosteric modulators (NAMs), will begin to influence ligand- (e.g., drug- or sweetener-) discovery efforts involving class C GPCRs. With an extensive docking study allowing full ligand flexibility and full side chain flexibility of all residues in the ligand-binding cavity, we have predicted and analyzed the binding modes of a variety of structurally diverse mGluR5 NAM ligands, showing how the X-ray structures serve to effectively rationalize each ligand's binding characteristics. We demonstrated that the features that are inherent in our earlier overlay model are preserved in the protein structure-based docking models. We identified structurally diverse compounds, which potentially act as mGluR NAMs, and revealed binding-site differences by performing high-throughput docking using a database of approximately six million structures of commercially available compounds and the mGluR1 and mGluR5 X-ray structures. By comparing the 7TM domains of the mGluR5 and mGluR1 X-rays structures, we identified selectivity factors within group I of the mGluRs. Similarly, using homology models that we built for mGluR2 and mGluR4, we have identified the factors leading to the selectivity between group I and groups II and III for ligands occupying the deepest portion of the mGluR5 binding cavity. Finally, we have proposed a structure-based explanation of the pharmacological switching within a set of positive allosteric modulators (PAMs) and their corresponding, very close NAM analogs. Copyright © 2015 Elsevier Ltd. All rights reserved.

DYRK1A-mediated phosphorylation of GluN2A at Ser(1048) regulates the surface expression and channel activity of GluN1/GluN2A receptors.

PubMed

Grau, Cristina; Arató, Krisztina; Fernández-Fernández, José M; Valderrama, Aitana; Sindreu, Carlos; Fillat, Cristina; Ferrer, Isidre; de la Luna, Susana; Altafaj, Xavier

2014-01-01

N-methyl-D-aspartate glutamate receptors (NMDARs) play a pivotal role in neural development and synaptic plasticity, as well as in neurological disease. Since NMDARs exert their function at the cell surface, their density in the plasma membrane is finely tuned by a plethora of molecules that regulate their production, trafficking, docking and internalization in response to external stimuli. In addition to transcriptional regulation, the density of NMDARs is also influenced by post-translational mechanisms like phosphorylation, a modification that also affects their biophysical properties. We previously described the increased surface expression of GluN1/GluN2A receptors in transgenic mice overexpressing the Dual specificity tyrosine-phosphorylation-regulated kinase 1A (DYRK1A), suggesting that DYRK1A regulates NMDARs. Here we have further investigated whether the density and activity of NMDARs were modulated by DYRK1A phosphorylation. Accordingly, we show that endogenous DYRK1A is recruited to GluN2A-containing NMDARs in the adult mouse brain, and we identify a DYRK1A phosphorylation site at Ser(1048) of GluN2A, within its intracellular C-terminal domain. Mechanistically, the DYRK1A-dependent phosphorylation of GluN2A at Ser(1048) hinders the internalization of GluN1/GluN2A, causing an increase of surface GluN1/GluN2A in heterologous systems, as well as in primary cortical neurons. Furthermore, GluN2A phosphorylation at Ser(1048) increases the current density and potentiates the gating of GluN1/GluN2A receptors. We conclude that DYRK1A is a direct regulator of NMDA receptors and we propose a novel mechanism for the control of NMDAR activity in neurons.

DYRK1A-mediated phosphorylation of GluN2A at Ser1048 regulates the surface expression and channel activity of GluN1/GluN2A receptors

PubMed Central

Grau, Cristina; Arató, Krisztina; Fernández-Fernández, José M.; Valderrama, Aitana; Sindreu, Carlos; Fillat, Cristina; Ferrer, Isidre; de la Luna, Susana; Altafaj, Xavier

2014-01-01

N-methyl-D-aspartate glutamate receptors (NMDARs) play a pivotal role in neural development and synaptic plasticity, as well as in neurological disease. Since NMDARs exert their function at the cell surface, their density in the plasma membrane is finely tuned by a plethora of molecules that regulate their production, trafficking, docking and internalization in response to external stimuli. In addition to transcriptional regulation, the density of NMDARs is also influenced by post-translational mechanisms like phosphorylation, a modification that also affects their biophysical properties. We previously described the increased surface expression of GluN1/GluN2A receptors in transgenic mice overexpressing the Dual specificity tyrosine-phosphorylation-regulated kinase 1A (DYRK1A), suggesting that DYRK1A regulates NMDARs. Here we have further investigated whether the density and activity of NMDARs were modulated by DYRK1A phosphorylation. Accordingly, we show that endogenous DYRK1A is recruited to GluN2A-containing NMDARs in the adult mouse brain, and we identify a DYRK1A phosphorylation site at Ser1048 of GluN2A, within its intracellular C-terminal domain. Mechanistically, the DYRK1A-dependent phosphorylation of GluN2A at Ser1048 hinders the internalization of GluN1/GluN2A, causing an increase of surface GluN1/GluN2A in heterologous systems, as well as in primary cortical neurons. Furthermore, GluN2A phosphorylation at Ser1048 increases the current density and potentiates the gating of GluN1/GluN2A receptors. We conclude that DYRK1A is a direct regulator of NMDA receptors and we propose a novel mechanism for the control of NMDAR activity in neurons. PMID:25368549

Structure of an archaeal non-discriminating glutamyl-tRNA synthetase: a missing link in the evolution of Gln-tRNAGln formation.

PubMed

Nureki, Osamu; O'Donoghue, Patrick; Watanabe, Nobuhisa; Ohmori, Atsuhiko; Oshikane, Hiroyuki; Araiso, Yuhei; Sheppard, Kelly; Söll, Dieter; Ishitani, Ryuichiro

2010-11-01

The molecular basis of the genetic code relies on the specific ligation of amino acids to their cognate tRNA molecules. However, two pathways exist for the formation of Gln-tRNA(Gln). The evolutionarily older indirect route utilizes a non-discriminating glutamyl-tRNA synthetase (ND-GluRS) that can form both Glu-tRNA(Glu) and Glu-tRNA(Gln). The Glu-tRNA(Gln) is then converted to Gln-tRNA(Gln) by an amidotransferase. Since the well-characterized bacterial ND-GluRS enzymes recognize tRNA(Glu) and tRNA(Gln) with an unrelated α-helical cage domain in contrast to the β-barrel anticodon-binding domain in archaeal and eukaryotic GluRSs, the mode of tRNA(Glu)/tRNA(Gln) discrimination in archaea and eukaryotes was unknown. Here, we present the crystal structure of the Methanothermobacter thermautotrophicus ND-GluRS, which is the evolutionary predecessor of both the glutaminyl-tRNA synthetase (GlnRS) and the eukaryotic discriminating GluRS. Comparison with the previously solved structure of the Escherichia coli GlnRS-tRNA(Gln) complex reveals the structural determinants responsible for specific tRNA(Gln) recognition by GlnRS compared to promiscuous recognition of both tRNAs by the ND-GluRS. The structure also shows the amino acid recognition pocket of GluRS is more variable than that found in GlnRS. Phylogenetic analysis is used to reconstruct the key events in the evolution from indirect to direct genetic encoding of glutamine.

Usefulness of simultaneous and sequential monitoring of glucose level and electrocardiogram in monkeys treated with gatifloxacin under conscious and nonrestricted conditions.

PubMed

Yoshimatsu, Yu; Ishizaka, Tomomichi; Chiba, Katsuyoshi; Mori, Kazuhiko

2018-05-10

Drug-induced cardiac electrophysiological abnormalities accompanied by hypoglycemia or hyperglycemia increase the risk for life-threatening arrhythmia. To assess the drug-induced cardiotoxic potential associated with extraordinary blood glucose (GLU) levels, the effect of gatifloxacin (GFLX) which was frequently associated with GLU abnormality and QT/QTc prolongations in the clinic on blood GLU and electrocardiogram (ECG) parameters was investigated in cynomolgus monkeys (n=4) given GFLX orally in an ascending dose regimen (10, 30, 60 and 100 mg/kg). Simultaneous and sequential GLU and ECG monitoring with a continuous GLU monitoring system and Holter ECG, respectively, were conducted for 24 h under free-moving conditions. Consequently, GFLX at 30 and 60 mg/kg dose-dependently induced a transient decrease in GLU without any ECG abnormality 2-4 h postdose. Highest dose of 100 mg/kg caused severe hypoglycemia with a mean GLU of <30 mg/dL, accompanied by remarkable QT/QTc prolongations by 20-30% in all animals. In contrast, hyperglycemia without QT/QTc prolongations was noted 24 h after dosing in one animal. A close correlation between GLU and QTc values was observed in animals treated with 100 mg/kg, suggesting that GFLX-induced hypoglycemia enhanced QT/QTc prolongations. Furthermore, the 24-h sequential GLU monitoring data clearly distinguished between GFLX-induced GLU abnormality and physiological GLU changes influenced by feeding throughout the day. In conclusion, the combined assessment of continuous GLU and ECG monitoring is valuable in predicting the drug-induced cardio-electrophysiological risk associated with both GLU and ECG abnormalities.

The role of S-nitrosylation of kainate-type of ionotropic glutamate receptor 2 in epilepsy induced by kainic acid.

PubMed

Wang, Linxiao; Liu, Yanyan; Lu, Rulan; Dong, Guoying; Chen, Xia; Yun, Wenwei; Zhou, Xianju

2018-02-01

Epilepsy is a chronic brain disease affecting millions of individuals. Kainate receptors, especially kainate-type of ionotropic glutamate receptor 2 (GluK2), play an important role in epileptogenesis. Recent data showed that GluK2 could undergo post-translational modifications in terms of S-nitrosylation (SNO), and affect the signaling pathway of cell death in cerebral ischemia-reperfusion. However, it is unclear whether S-nitrosylation of GluK2 (SNO-GluK2) contributes to cell death induced by epilepsy. Here, we report that kainic acid-induced SNO-GluK2 is mediated by GluK2 itself, regulated by neuronal nitric oxide synthase (nNOS) and the level of cytoplasmic calcium in vivo and in vitro hippocampus neurons. The whole-cell patch clamp recordings showed the influence of SNO-GluK2 on ion channel characterization of GluK2-Kainate receptors. Moreover, immunohistochemistry staining results showed that inhibition of SNO-GluK2 by blocking nNOS or GluK2 or by reducing the level of cytoplasmic calcium-protected hippocampal neurons from kainic acid-induced injury. Finally, immunoprecipitation and western blotting data revealed the involvement of assembly of a GluK2-PSD95-nNOS signaling complex in epilepsy. Taken together, our results showed that the SNO-GluK2 plays an important role in neuronal injury of epileptic rats by forming GluK2-PSD95-nNOS signaling module in a cytoplasmic calcium-dependent way, suggesting a potential therapeutic target site for epilepsy. © 2017 International Society for Neurochemistry.

Apical localization of glutamate in GLAST-1, glutamine synthetase positive ciliary body nonpigmented epithelial cells

PubMed Central

Langford, Marlyn P; Gosslee, Jeffrey M; Liang, Chanping; Chen, Dequan; Redens, Thomas B.; Welbourne, Tomas C

2007-01-01

The distribution of glutamate (Glu), the Glu transporter GLAST-1, and glutamine synthetase (GS) in human and monkey anterior uveal tissue, as well as serum (S) to aqueous humor (AH) Glu and glutamine (Gln) gradients were investigated. Cross-linked Glu (xGlu), GLAST-1, and GS were detected using the immunofluorescent antibody technique. S/AH Glu, Gln, and alanine (Ala) concentrations were quantified by high performance liquid chromatography. xGlu immunoreactivity was detected in melanocytes, posterior pigmented epithelial/dilator muscle cells, vascular endothelial cells, and lymphocytes of the iris, as well as the pigmented (PE) and nonpigmented epithelial (NPE) cells and muscle cells of ciliary body. xGlu immunoreactivity was highly concentrated at the apices of GLAST-1, GS positive ciliary body NPE cells, and in GLAST-1 positive iris melanocytes and iris dilator muscle cells. AH Glu concentrations were lower (p < 0.001), while Gln was higher in monkey (p = 0.01) and human cataractous (p = 0.15) AH than serum. The results indicate that Glu is concentrated within GLAST-1, GS positive NPE cells and are consistent with the suggestion that Glu and Gln concentrations in AH may be due in part to GLAST-1 and GS activity in iris and ciliary body epithelial cells. PMID:19668465

Activity-induced synaptic delivery of the GluN2A-containing NMDA receptor is dependent on endoplasmic reticulum chaperone Bip and involved in fear memory

PubMed Central

Zhang, Xiao-min; Yan, Xun-yi; Zhang, Bin; Yang, Qian; Ye, Mao; Cao, Wei; Qiang, Wen-bin; Zhu, Li-jun; Du, Yong-lan; Xu, Xing-xing; Wang, Jia-sheng; Xu, Fei; Lu, Wei; Qiu, Shuang; Yang, Wei; Luo, Jian-hong

2015-01-01

The N-methyl-D-aspartate receptor (NMDAR) in adult forebrain is a heterotetramer mainly composed of two GluN1 subunits and two GluN2A and/or GluN2B subunits. The synaptic expression and relative numbers of GluN2A- and GluN2B-containing NMDARs play critical roles in controlling Ca2+-dependent signaling and synaptic plasticity. Previous studies have suggested that the synaptic trafficking of NMDAR subtypes is differentially regulated, but the precise molecular mechanism is not yet clear. In this study, we demonstrated that Bip, an endoplasmic reticulum (ER) chaperone, selectively interacted with GluN2A and mediated the neuronal activity-induced assembly and synaptic incorporation of the GluN2A-containing NMDAR from dendritic ER. Furthermore, the GluN2A-specific synaptic trafficking was effectively disrupted by peptides interrupting the interaction between Bip and GluN2A. Interestingly, fear conditioning in mice was disrupted by intraperitoneal injection of the interfering peptide before training. In summary, we have uncovered a novel mechanism for the activity-dependent supply of synaptic GluN2A-containing NMDARs, and demonstrated its relevance to memory formation. PMID:26088419

Glu298Asp eNOS gene polymorphism causes attenuation in nonexercising muscle vasodilatation.

PubMed

Dias, Rodrigo G; Alves, Maria-Janieire N N; Pereira, Alexandre C; Rondon, Maria Urbana P B; Dos Santos, Marcelo R; Krieger, José E; Krieger, Marta H; Negrão, Carlos E

2009-04-10

The influence of Glu298Asp endothelial nitric oxide synthase (eNOS) polymorphism in exercise-induced reflex muscle vasodilatation is unknown. We hypothesized that nonexercising forearm blood flow (FBF) responses during handgrip isometric exercise would be attenuated in individuals carrying the Asp298 allele. In addition, these responses would be mediated by reduced eNOS function and NO-mediated vasodilatation or sympathetic vasoconstriction. From 287 volunteers previously genotyped, we selected 33 healthy individuals to represent three genotypes: Glu/Glu [n = 15, age 43 +/- 3 yr, body mass index (BMI) 22.9 +/- 0.3 kg/m(2)], Glu/Asp (n = 9, age 41 +/- 3 yr, BMI 23.7 +/- 1.0 kg/m(2)), and Asp/Asp (n = 9, age 40 +/- 4 yr, BMI 23.5 +/- 0.9 kg/m(2)). Heart rate (HR), mean blood pressure (MBP), and FBF (plethysmography) were recorded for 3 min at baseline and 3 min during isometric handgrip exercise. Baseline HR, MBP, FBF, and forearm vascular conductance (FVC) were similar among genotypes. FVC responses to exercise were significantly lower in Asp/Asp when compared with Glu/Asp and Glu/Glu (Delta = 0.07 +/- 0.14 vs. 0.64 +/- 0.20 and 0.57 +/- 0.09 units, respectively; P = 0.002). Further studies showed that intra-arterial infusion of NG-monomethyl-L-arginine (L-NMMA) did not change FVC responses to exercise in Asp/Asp, but significantly reduced FVC in Glu/Glu (Delta = 0.79 +/- 0.14 vs. 0.14 +/- 0.09 units). Thus the differences between Glu/Glu and Asp/Asp were no longer observed (P = 0.62). l-NMMA + phentolamine increased similarly FVC responses to exercise in Glu/Glu and Asp/Asp (P = 0.43). MBP and muscle sympathetic nerve activity increased significant and similarly throughout experimental protocols in Glu/Glu and Asp/Asp. Individuals who are homozygous for the Asp298 allele of the eNOS enzyme have attenuated nonexercising muscle vasodilatation in response to exercise. This genotype difference is due to reduced eNOS function and NO-mediated vasodilatation, but not sympathetic vasoconstriction.

The plasticity of the association between mu-opioid receptor and glutamate ionotropic receptor N in opioid analgesic tolerance and neuropathic pain.

PubMed

Sánchez-Blázquez, Pilar; Rodríguez-Muñoz, Maria; Berrocoso, Esther; Garzón, Javier

2013-09-15

Multiple groups have reported the functional cross-regulation between mu-opioid (MOP) receptor and glutamate ionotropic receptor N (GluN), and the post-synaptic association of these receptors has been implicated in the transmission and modulation of nociceptive signals. Opioids, such as morphine, disrupt the MOP receptor-GluN receptor complex to stimulate the activity of GluN receptors via protein kinase C (PKC)/Src. This increased GluN receptor activity opposes MOP receptor signalling, and via neural nitric oxide synthase (nNOS) and calcium and calmodulin regulated kinase II (CaMKII) induces the phosphorylation and uncoupling of the opioid receptor, which results in the development of morphine analgesic tolerance. Both experimental in vivo activation of GluN receptors and neuropathic pain separate the MOP receptor-GluN receptor complex via protein kinase A (PKA) and reduce the analgesic capacity of morphine. The histidine triad nucleotide-binding protein 1 (HINT1) associates with the MOP receptor C-terminus and connects the activities of MOP receptor and GluN receptor. In HINT1⁻/⁻ mice, morphine promotes enhanced analgesia and produces tolerance that is not related to GluN receptor activity. In these mice, the GluN receptor agonist N-methyl-D-aspartate acid (NMDA) does not antagonise the analgesic effects of morphine. Treatments that rescue morphine from analgesic tolerance, such as GluN receptor antagonism or PKC, nNOS and CaMKII inhibitors, all induce MOP receptor-GluN receptor re-association and reduce GluN receptor/CaMKII activity. In mice treated with NMDA or suffering from neuropathic pain (induced by chronic constriction injury, CCI), GluN receptor antagonists, PKA inhibitors or certain antidepressants also diminish CaMKII activity and restore the MOP receptor-GluN receptor association. Thus, the HINT1 protein stabilises the association between MOP receptor and GluN receptor, necessary for the analgesic efficacy of morphine, and this coupling is reduced following the activation of GluN receptors, similar to what is observed in neuropathic pain. © 2013 Elsevier B.V. All rights reserved.

L-Asp is a useful tool in the purification of the ionotropic glutamate receptor A2 ligand-binding domain.

PubMed

Krintel, Christian; Frydenvang, Karla; Ceravalls de Rabassa, Anna; Kaern, Anne M; Gajhede, Michael; Pickering, Darryl S; Kastrup, Jette S

2014-05-01

In purification of the ionotropic glutamate receptor A2 (GluA2) ligand-binding domain (LBD), L-Glu-supplemented buffers have previously been used for protein stabilization during the procedure. This sometimes hampers structural studies of low-affinity ligands, because L-Glu is difficult to displace, despite extensive dialysis. Here, we show that L-Asp binds to full-length GluA2 with low affinity (Ki = 0.63 mM) and to the GluA2 LBD with even lower affinity (Ki = 2.6 mM), and we use differential scanning fluorimetry to show that L-Asp is able to stabilize the isolated GluA2 LBD. We also show that L-Asp can replace L-Glu during purification, providing both equal yields and purity of the resulting protein sample. Furthermore, we solved three structures of the GluA2 LBD in the presence of 7.5, 50 and 250 mM L-Asp. Surprisingly, with 7.5 mM L-Asp, the GluA2 LBD crystallized as a mixed dimer, with L-Glu being present in one subunit, and neither L-Asp nor L-Glu being present in the other subunit. Thus, residual L-Glu is retained from the expression medium. On the other hand, only L-Asp was found at the binding site when 50 or 250 mM L-Asp was used for crystallization. The binding mode observed for L-Asp at the GluA2 LBD is very similar to that described for L-Glu. Taking our findings together, we have shown that L-Asp can be used instead of L-Glu for ligand-dependent stabilization of the GluA2 LBD during purification. This will enable structural studies of low-affinity ligands for lead optimization in structure-based drug design. Structural data are available in the Protein Data Bank under accession numbers 4O3B (7.5 mM L-Asp), 4O3C (50 mM L-Asp), and 4O3A (250 mM L-Asp). © 2014 FEBS.

Comparative pharmacology of flatworm and roundworm glutamate-gated chloride channels: Implications for potential anthelmintics.

PubMed

Lynagh, Timothy; Cromer, Brett A; Dufour, Vanessa; Laube, Bodo

2014-12-01

Pharmacological targeting of glutamate-gated chloride channels (GluCls) is a potent anthelmintic strategy, evidenced by macrocyclic lactones that eliminate numerous roundworm infections by activating roundworm GluCls. Given the recent identification of flatworm GluCls and the urgent need for drugs against schistosomiasis, flatworm GluCls should be evaluated as potential anthelmintic targets. This study sought to identify agonists or modulators of one such GluCl, SmGluCl-2 from the parasitic flatworm Schistosoma mansoni. The effects of nine glutamate-like compounds and three monoterpenoid ion channel modulators were measured by electrophysiology at SmGluCl-2 recombinantly expressed in Xenopus laevis oocytes. For comparison with an established anthelmintic target, experiments were also performed on the AVR-14B GluCl from the parasitic roundworm Haemonchus contortus. l-Glutamate was the most potent agonist at both GluCls, but l-2-aminoadipate, d-glutamate and d-2-aminoadipate activated SmGluCl-2 (EC50 1.0 ± 0.1 mM, 2.4 ± 0.4 mM, 3.6 ± 0.7 mM, respectively) more potently than AVR-14B. Quisqualate activated only SmGluCl-2 whereas l-aspartate activated only AVR-14B GluCls. Regarding the monoterpenoids, both GluCls were inhibited by propofol, thymol and menthol, SmGluCl-2 most potently by thymol (IC50 484 ± 85 μM) and least potently by menthol (IC50 > 3 mM). Computational docking suggested that agonist and inhibitor potency is attributable to particular interactions with extracellular or membrane-spanning amino acid residues. These results reveal that flatworm GluCls are pharmacologically susceptible to numerous agonists and modulators and indicate that changes to the glutamate γ-carboxyl or to the propofol 6-isopropyl group can alter the differential pharmacology at flatworm and roundworm GluCls. This should inform the development of more potent compounds and in turn lead to novel anthelmintics.

Group 1 mGluR-dependent synaptic long-term depression (mGluR-LTD): mechanisms and implications for circuitry & disease

PubMed Central

Lüscher, Christian; Huber, Kimberly M.

2010-01-01

Many excitatory synapses express Group 1, or Gq coupled, metabotropic glutamate receptors (Gp1 mGluRs) at the periphery of their postsynaptic density. Activation of Gp1 mGluRs typically occurs in response to strong activity and triggers long-term plasticity of synaptic transmission in many brain regions including the neocortex, hippocampus, midbrain, striatum and cerebellum. Here we focus on mGluR-induced long-term synaptic depression (LTD) and review the literature that implicates Gp1 mGluRs in the plasticity of behavior, learning and memory. Moreover, recent studies investigating the molecular mechanisms of mGluR-LTD have discovered links to mental retardation, autism, Alzheimer’s disease, Parkinson’s disease and drug addiction. We discuss how mGluRs lead to plasticity of neural circuits and how the understanding of the molecular mechanisms of mGluR plasticity provides insight into brain disease. PMID:20188650

Selective Disruption of Metabotropic Glutamate Receptor 5-Homer Interactions Mimics Phenotypes of Fragile X Syndrome in Mice

PubMed Central

Guo, Weirui; Molinaro, Gemma; Collins, Katie A.; Hays, Seth A.; Paylor, Richard; Worley, Paul F.; Szumlinski, Karen K.

2016-01-01

Altered function of the Gq-coupled, Group 1 metabotropic glutamate receptors, specifically mGlu5, is implicated in multiple mouse models of autism and intellectual disability. mGlu5 dysfunction has been most well characterized in the fragile X syndrome mouse model, the Fmr1 knock-out (KO) mouse, where pharmacological and genetic reduction of mGlu5 reverses many phenotypes. mGlu5 is less associated with its scaffolding protein Homer in Fmr1 KO mice, and restoration of mGlu5-Homer interactions by genetic deletion of a short, dominant negative of Homer, H1a, rescues many phenotypes of Fmr1 KO mice. These results suggested that disruption of mGlu5-Homer leads to phenotypes of FXS. To test this idea, we examined mice with a knockin mutation of mGlu5 (F1128R; mGlu5R/R) that abrogates binding to Homer. Although FMRP levels were normal, mGlu5R/R mice mimicked multiple phenotypes of Fmr1 KO mice, including reduced mGlu5 association with the postsynaptic density, enhanced constitutive mGlu5 signaling to protein synthesis, deficits in agonist-induced translational control, protein synthesis-independent LTD, neocortical hyperexcitability, audiogenic seizures, and altered behaviors, including anxiety and sensorimotor gating. These results reveal new roles for the Homer scaffolds in regulation of mGlu5 function and implicate a specific molecular mechanism in a complex brain disease. SIGNIFICANCE STATEMENT Abnormal function of the metabotropic, or Gq-coupled, glutamate receptor 5 (mGlu5) has been implicated in neurodevelopmental disorders, including a genetic cause of intellectual disability and autism called fragile X syndrome. In brains of a mouse model of fragile X, mGlu5 is less associated with its binding partner Homer, a scaffolding protein that regulates mGlu5 localization to synapses and its ability to activate biochemical signaling pathways. Here we show that a mouse expressing a mutant mGlu5 that cannot bind to Homer is sufficient to mimic many of the biochemical, neurophysiological, and behavioral symptoms observed in the fragile X mouse. This work provides strong evidence that Homer-mGlu5 binding contributes to symptoms associated with neurodevelopmental disorders. PMID:26888925

Selective Disruption of Metabotropic Glutamate Receptor 5-Homer Interactions Mimics Phenotypes of Fragile X Syndrome in Mice.

PubMed

Guo, Weirui; Molinaro, Gemma; Collins, Katie A; Hays, Seth A; Paylor, Richard; Worley, Paul F; Szumlinski, Karen K; Huber, Kimberly M

2016-02-17

Altered function of the Gq-coupled, Group 1 metabotropic glutamate receptors, specifically mGlu5, is implicated in multiple mouse models of autism and intellectual disability. mGlu5 dysfunction has been most well characterized in the fragile X syndrome mouse model, the Fmr1 knock-out (KO) mouse, where pharmacological and genetic reduction of mGlu5 reverses many phenotypes. mGlu5 is less associated with its scaffolding protein Homer in Fmr1 KO mice, and restoration of mGlu5-Homer interactions by genetic deletion of a short, dominant negative of Homer, H1a, rescues many phenotypes of Fmr1 KO mice. These results suggested that disruption of mGlu5-Homer leads to phenotypes of FXS. To test this idea, we examined mice with a knockin mutation of mGlu5 (F1128R; mGlu5(R/R)) that abrogates binding to Homer. Although FMRP levels were normal, mGlu5(R/R) mice mimicked multiple phenotypes of Fmr1 KO mice, including reduced mGlu5 association with the postsynaptic density, enhanced constitutive mGlu5 signaling to protein synthesis, deficits in agonist-induced translational control, protein synthesis-independent LTD, neocortical hyperexcitability, audiogenic seizures, and altered behaviors, including anxiety and sensorimotor gating. These results reveal new roles for the Homer scaffolds in regulation of mGlu5 function and implicate a specific molecular mechanism in a complex brain disease. Abnormal function of the metabotropic, or Gq-coupled, glutamate receptor 5 (mGlu5) has been implicated in neurodevelopmental disorders, including a genetic cause of intellectual disability and autism called fragile X syndrome. In brains of a mouse model of fragile X, mGlu5 is less associated with its binding partner Homer, a scaffolding protein that regulates mGlu5 localization to synapses and its ability to activate biochemical signaling pathways. Here we show that a mouse expressing a mutant mGlu5 that cannot bind to Homer is sufficient to mimic many of the biochemical, neurophysiological, and behavioral symptoms observed in the fragile X mouse. This work provides strong evidence that Homer-mGlu5 binding contributes to symptoms associated with neurodevelopmental disorders. Copyright © 2016 the authors 0270-6474/16/362131-17$15.00/0.

Short-term sleep deprivation impairs spatial working memory and modulates expression levels of ionotropic glutamate receptor subunits in hippocampus.

PubMed

Xie, Meilan; Yan, Jie; He, Chao; Yang, Li; Tan, Gang; Li, Chao; Hu, Zhian; Wang, Jiali

2015-06-01

Hippocampus-dependent learning memory is sensitive to sleep deprivation (SD). Although the ionotropic glutamate receptors play a vital role in synaptic plasticity and learning and memory, however, whether the expression of these receptor subunits is modulated by sleep loss remains unclear. In the present study, western blotting was performed by probing with specific antibodies against the ionotropic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunits GluA1, GluA2, GluA3, and against the N-methyl-d-aspartate (NMDA) glutamate receptor subunits GluN1, GluN2A, GluN2B. In hippocampus, down regulation of surface GluA1 and GluN2A surface expression were observed in both SD groups. However, surface expression level of GluA2, GluA3, GluN1 and GluN2B was significantly up-regulated in 8h-SD rats when compared to the 4h-SD rats. In parallel with the complex changes in AMPA and NMDA receptor subunit expressions, we found the 8h-SD impaired rat spatial working memory in 30-s-delay T-maze task, whereas no impairment of spatial learning was observed in 4h-SD rats. These results indicate that sleep loss alters the relative expression levels of the AMPA and NMDA receptors, thus affects the synaptic strength and capacity for plasticity and partially contributes to spatial memory impairment. Copyright © 2015. Published by Elsevier B.V.

Pharmacological modulation of metabotropic glutamate receptor subtype 5 and 7 impairs extinction of social fear in a time-point-dependent manner.

PubMed

Slattery, David A; Neumann, Inga D; Flor, Peter J; Zoicas, Iulia

2017-06-15

Pharmacological modulation of metabotropic glutamate receptor subtype 5 (mGluR5) and 7 (mGluR7) was shown to attenuate the acquisition and to facilitate the extinction of cued and contextual, non-social, fear. Using the allosteric mGluR5 antagonist 2-methyl-6-(phenylethynyl)-pyridine (MPEP) and the allosteric mGluR7 agonist N,N'-dibenzyhydryl-ethane-1,2-diamine dihydrochloride (AMN082), we aimed to study how pharmacological blockade of mGluR5 and activation of mGluR7 influence acquisition and extinction of social fear in mice. We could show that when administered before social fear conditioning, neither MPEP nor AMN082 affected acquisition and extinction of social fear, suggesting that mGluR5 inactivation and mGluR7 activation do not alter social fear. However, when administered before social fear extinction, both MPEP and AMN082 impaired social fear extinction and extinction recall. These findings suggest that mGluR5 inactivation and mGluR7 activation are unlikely to prevent the formation of traumatic social memories. Furthermore, medication strategies aimed at augmenting exposure-based therapies for psychiatric disorders associated with social deficits via modulation of mGluR5 and mGluR7 must be pursued cautiously because of their potential to delay social fear extinction processes. Copyright © 2017 Elsevier B.V. All rights reserved.

43.1 GENETIC INSIGHTS LEAD TO DISCOVERY OF SELECTIVE ACTIVATORS OF MGLU1 AND MGLU3 METABOTROPIC GLUTAMATE RECEPTORS AS POTENTIAL TREATMENTS FOR SCHIZOPHRENIA

PubMed Central

Conn, P Jeffrey; Yohn, Samantha; Stansley, Branden; Foster, Dan; Plumley, Hyekyung; Lindsley, Craig

2018-01-01

Abstract Background A large number of clinical and preclinical studies suggest that dysfunction at synapses for the excitatory neurotransmitter glutamate may play a critical role in the pathophysiological changes that underlie each of the major symptom clusters observed in schizophrenia patients. Interestingly, recent genetic studies identified multiple nonsynonymous single nucleotide polymorphisms (SNPs) in the human genes encoding two specific subtypes of metabotropic glutamate (mGlu) receptors that are associated with schizophrenia. These include GRM1 and GRM3, the genes encoding for the mGlu1 and mGlu3 receptor subtypes respectively. Furthermore, postmortem studies suggest that expression of these mGlu receptor subtypes is altered brains of schizophrenia patients compared to controls. Mutations in GRM1 were identified a range of schizophrenia patients, whereas SNPs in the human gene encoding mGlu3 (GRM3) are selectively associated with poor performance on cognitive tests that are dependent on function of the prefrontal cortex (PFC) and hippocampus. These studies raise the possibility that disrupted signaling of mGlu1 and/or mGlu3 could contribute to the symptoms of schizophrenia and that selective modulators of these receptors could provide a novel approach to treatment of this disorder. Methods Wild-type and mutant forms of mGlu receptors were expressed in cell lines and used for discovery and optimization of highly selective positive allosteric modulators (PAMs) of mGlu1 and mGlu3. Optimized mGlu1 and mGlu3 PAMs were then used along with mouse genetic studies to evaluate the roles of these receptors in specific basal ganglia and forebrain circuits that have been implicated in schizophrenia. Finally, these compounds were used in animal models to assess potential efficacy in rodent models that are relevant for reducing positive, negative, and cognitive symptoms that are observed in schizophrenia patients. Results GRM1 mutations associated with schizophrenia were found to reduce mGlu1 signaling, suggesting that loss of function of this receptor could contribute to symptoms associated with schizophrenia. Furthermore, we found that highly selective mGlu1 PAMs reverse deficits in mGlu1 signaling observed in these mutant receptors, induced a profound reduction in dopamine release in striatal areas implicated in schizophrenia, and have robust antipsychotic-like effects that are mediated by localized inhibition of dopamine release in striatum. In contrast to existing antipsychotic medications, selective mGlu1 PAMs also improve motivation and reduce anhedonia in animal models. Interestingly, selective mGlu3 PAMs have multiple effects in the prefrontal cortex and hippocampus that would be expected to improve cognitive function. Consistent with this, highly selective mGlu3 PAMs have robust cognition-enhancing effects in rodent models that are relevant for the cognitive deficits observed in schizophrenia patients. Discussion These studies provide exciting new evidence that highly selective activators of two glutamate receptors identified in human genetic studies have potential utility in treatment of positive (mGLu1), negative (mGlu1), and cognitive (mGlu3) symptoms of schizophrenia patients. Furthermore, the novel mGlu1 and mGlu3 PAMs discovered in these studies provide excellent drug leads for further optimization and ultimate clinical testing.

Evidence of intralocus recombination at the Glu-3 loci in bread wheat (Triticum aestivum L.)

USDA-ARS?s Scientific Manuscript database

The low-molecular weight glutenin subunits (LMW-GSs) are a class of wheat seed storage proteins that play a critical role in the determination of wheat flour bread-making quality. These proteins are encoded by multigene families located at the orthologous Glu-3 loci (Glu-A3, Glu-B3 and Glu-D3), on t...

Solid-state, triboelectrostatic and dissolution characteristics of spray-dried piroxicam-glucosamine solid dispersions.

PubMed

Adebisi, Adeola O; Kaialy, Waseem; Hussain, Tariq; Al-Hamidi, Hiba; Nokhodchi, Ali; Conway, Barbara R; Asare-Addo, Kofi

2016-10-01

This work explores the use of both spray drying and d-glucosamine HCl (GLU) as a hydrophilic carrier to improve the dissolution rate of piroxicam (PXM) whilst investigating the electrostatic charges associated with the spray drying process. Spray dried PXM:GLU solid dispersions were prepared and characterised (XRPD, DSC, SEM). Dissolution and triboelectric charging were also conducted. The results showed that the spray dried PXM alone, without GLU produced some PXM form II (DSC results) with no enhancement in solubility relative to that of the parent PXM. XRPD results also showed the spray drying process to decrease the crystallinity of GLU and solid dispersions produced. The presence of GLU improved the dissolution rate of PXM. Spray dried PXM: GLU at a ratio of 2:1 had the most improved dissolution. The spray drying process generally yielded PXM-GLU spherical particles of around 2.5μm which may have contributed to the improved dissolution. PXM showed a higher tendency for charging in comparison to the carrier GLU (-3.8 versus 0.5nC/g for untreated material and -7.5 versus 3.1nC/g for spray dried materials). Spray dried PXM and spray dried GLU demonstrated higher charge densities than untreated PXM and untreated GLU, respectively. Regardless of PXM:GLU ratio, all spray dried PXM:GLU solid dispersions showed a negligible charge density (net-CMR: 0.1-0.3nC/g). Spray drying of PXM:GLU solid dispersions can be used to produce formulation powders with practically no charge and thereby improving handling as well as dissolution behaviour of PXM. Copyright © 2016 Elsevier B.V. All rights reserved.

Potentiation of mGlu5 receptors with the novel enhancer, VU0360172, reduces spontaneous absence seizures in WAG/Rij rats

PubMed Central

D’Amore, V.; Santolini, I.; van Rijn, C.M.; Biagioni, F.; Molinaro, G.; Prete, A.; Conn, P.J.; Lindsley, C.W.; Zhou, Y.; Vinson, P.N.; Rodriguez, A.L.; Jones, C.K.; Stauffer, S.R.; Nicoletti, F.; van Luijtelaar, G.; Ngomba, R.T.

2013-01-01

Absence epilepsy is generated by the cortico-thalamo-cortical network, which undergoes a finely tuned regulation by metabotropic glutamate (mGlu) receptors. We have shown previously that potentiation of mGlu1 receptors reduces spontaneous occurring spike and wave discharges (SWDs) in the WAG/Rij rat model of absence epilepsy, whereas activation of mGlu2/3 and mGlu4 receptors produces the opposite effect. Here, we have extended the study to mGlu5 receptors, which are known to be highly expressed within the cortico-thalamo-cortical network. We used presymptomatic and symptomatic WAG/Rij rats and aged-matched ACI rats. WAG/Rij rats showed a reduction in the mGlu5 receptor protein levels and in the mGlu5-receptor mediated stimulation of polyphosphoinositide hydrolysis in the ventrobasal thalamus, whereas the expression of mGlu5 receptors was increased in the somatosensory cortex. Interestingly, these changes preceded the onset of the epileptic phenotype, being already visible in pre-symptomatic WAG/Rij rats. SWDs in symptomatic WAG/Rij rats were not influenced by pharmacological blockade of mGlu5 receptors with MTEP (10 or 30 mg/kg, i.p.), but were significantly decreased by mGlu5 receptor potentiation with the novel enhancer, VU0360172 (3 or 10 mg/kg, s.c.), without affecting motor behaviour. The effect of VU0360172 was prevented by co-treatment with MTEP. These findings suggest that changes in mGlu5 receptors might lie at the core of the absence-seizure prone phenotype of WAG/Rij rats, and that mGlu5 receptor enhancers are potential candidates to the treatment of absence epilepsy. PMID:22705340

The Role of mGluR Copy Number Variation in Genetic and Environmental Forms of Syndromic Autism Spectrum Disorder.

PubMed

Wenger, Tara L; Kao, Charlly; McDonald-McGinn, Donna M; Zackai, Elaine H; Bailey, Alice; Schultz, Robert T; Morrow, Bernice E; Emanuel, Beverly S; Hakonarson, Hakon

2016-01-19

While abnormal signaling mediated through metabotropic glutamate receptor 5 (mGluR5) is involved in the pathophysiology of Autism Spectrum Disorder (ASD), Fragile X Syndrome and Tuberous Sclerosis, the role of other mGluRs and their associated signaling network genes in syndromic ASD is unknown. This study sought to determine whether mGluR Copy Number Variants (CNV's) were overrepresented in children with syndromic ASD and if mGluR "second hit" confers additional risk for ASD in 22q11.2 Deletion Syndrome (22q11DS). To determine whether mGluR network CNV'S are enriched in syndromic ASD, we examined microarrays from children with ASD (n = 539). Patient categorization (syndromic vs nonsyndromic) was done via blinded medical chart review in mGluR positive and randomly selected mGluR negative cases. 11.5% of ASD had mGluR CNV's vs. 3.2% in controls (p < 0.001). Syndromic ASD was more prevalent in children with mGluR CNVs (74% vs 16%, p < 0.001). A comparison cohort with 22q11DS (n = 25 with ASD, n = 50 without ASD), all haploinsufficient for mGluR network gene RANBP1, were evaluated for "second mGluR hits". 20% with 22q11.2DS + ASD had "second hits" in mGluR network genes vs 2% in 22q11.2DS-ASD (p < 0.014). We propose that altered RANBP1 expression may provide a mechanistic link for several seemingly unrelated genetic and environmental forms of ASD.

The Role of mGluR Copy Number Variation in Genetic and Environmental Forms of Syndromic Autism Spectrum Disorder

PubMed Central

Wenger, Tara L.; Kao, Charlly; McDonald-McGinn, Donna M.; Zackai, Elaine H.; Bailey, Alice; Schultz, Robert T.; Morrow, Bernice E.; Emanuel, Beverly S.; Hakonarson, Hakon

2016-01-01

While abnormal signaling mediated through metabotropic glutamate receptor 5 (mGluR5) is involved in the pathophysiology of Autism Spectrum Disorder (ASD), Fragile X Syndrome and Tuberous Sclerosis, the role of other mGluRs and their associated signaling network genes in syndromic ASD is unknown. This study sought to determine whether mGluR Copy Number Variants (CNV’s) were overrepresented in children with syndromic ASD and if mGluR “second hit” confers additional risk for ASD in 22q11.2 Deletion Syndrome (22q11DS). To determine whether mGluR network CNV’S are enriched in syndromic ASD, we examined microarrays from children with ASD (n = 539). Patient categorization (syndromic vs nonsyndromic) was done via blinded medical chart review in mGluR positive and randomly selected mGluR negative cases. 11.5% of ASD had mGluR CNV’s vs. 3.2% in controls (p < 0.001). Syndromic ASD was more prevalent in children with mGluR CNVs (74% vs 16%, p < 0.001). A comparison cohort with 22q11DS (n = 25 with ASD, n = 50 without ASD), all haploinsufficient for mGluR network gene RANBP1, were evaluated for “second mGluR hits”. 20% with 22q11.2DS + ASD had “second hits” in mGluR network genes vs 2% in 22q11.2DS-ASD (p < 0.014). We propose that altered RANBP1 expression may provide a mechanistic link for several seemingly unrelated genetic and environmental forms of ASD. PMID:26781481

Expression of NMDA receptor subunits in human blood lymphocytes: A peripheral biomarker in online computer game addiction.

PubMed

Sadat-Shirazi, Mitra-Sadat; Vousooghi, Nasim; Alizadeh, Bentolhoda; Makki, Seyed Mohammad; Zarei, Seyed Zeinolabedin; Nazari, Shahrzad; Zarrindast, Mohammad Reza

2018-05-23

Background and aims Repeated performance of some behaviors such as playing computer games could result in addiction. The NMDA receptor is critically involved in the development of behavioral and drug addictions. It has been claimed that the expression level of neurotransmitter receptors in the brain may be reflected in peripheral blood lymphocytes (PBLs). Methods Here, using a real-time PCR method, we have investigated the mRNA expression of GluN2A, GluN2D, GluN3A, and GluN3B subunits of the NMDA receptor in PBLs of male online computer game addicts (n = 25) in comparison with normal subjects (n = 26). Results Expression levels of GluN2A, GluN2D, and GluN3B subunits were not statistically different between game addicts and the control group. However, the mRNA expression of the GluN3A subunit was downregulated in PBLs of game addicts. Discussion and conclusions Transcriptional levels of GluN2A and GluN2D subunits in online computer game addicts are similar to our previously reported data of opioid addiction and are not different from the control group. However, unlike our earlier finding of drug addiction, the mRNA expression levels of GluN3A and GluN3B subunits in PBLs of game addicts are reduced and unchanged, respectively, compared with control subjects. It seems that the downregulated state of the GluN3A subunit of NMDA receptor in online computer game addicts is a finding that deserves more studies in the future to see whether it can serve as a peripheral biomarker in addiction studies, where the researcher wants to rule out the confusing effects of abused drugs.

Glutamate metabotropic receptors as targets for drug therapy in epilepsy.

PubMed

Moldrich, Randal X; Chapman, Astrid G; De Sarro, Giovambattista; Meldrum, Brian S

2003-08-22

Metabotropic glutamate (mGlu) receptors have multiple actions on neuronal excitability through G-protein-linked modifications of enzymes and ion channels. They act presynaptically to modify glutamatergic and gamma-aminobutyric acid (GABA)-ergic transmission and can contribute to long-term changes in synaptic function. The recent identification of subtype-selective agonists and antagonists has permitted evaluation of mGlu receptors as potential targets in the treatment of epilepsy. Agonists acting on group I mGlu receptors (mGlu1 and mGlu5) are convulsant. Antagonists acting on mGlu1 or mGlu5 receptors are anticonvulsant against 3,5-dihydroxyphenylglycine (DHPG)-induced seizures and in mouse models of generalized motor seizures and absence seizures. The competitive, phenylglycine mGlu1/5 receptor antagonists generally require intracerebroventricular administration for potent anticonvulsant efficacy but noncompetitive antagonists, e.g., (3aS,6aS)-6a-naphthalen-2-ylmethyl-5-methyliden-hexahydrocyclopenta[c]furan-1-on (BAY36-7620), 2-methyl-6-(phenylethynyl)pyridine hydrochloride (MPEP), and 2-methyl-6-(2-phenylethenyl)pyridine (SIB-1893) block generalized seizures with systemic administration. Agonists acting on group II mGlu receptors (mGlu2, mGlu3) to reduce glutamate release are anticonvulsant, e.g., 2R,4R-aminopyrrolidine-2,4-dicarboxylate [(2R,4R)-APDC], (+)-2-aminobicyclo[3.1.0]hexane-2,6-dicarboxylic acid (LY354740), and (-)-2-oxa-4-aminobicyclo[3.1.0]hexane-4,6-dicarboxylate (LY379268). The classical agonists acting on group III mGlu receptors such as L-(+)-2-amino-4-phosphonobutyric acid, and L-serine-O-phosphate are acutely proconvulsant with some anticonvulsant activity. The more recently identified agonists (R,S)-4-phosphonophenylglycine [(R,S)-PPG] and (S)-3,4-dicarboxyphenylglycine [(S)-3,4-DCPG] and (1S,3R,4S)-1-aminocyclopentane-1,2,4-tricarboxylic acid [ACPT-1] are all anticonvulsant without proconvulsant effects. Studies in animal models of kindling reveal some efficacy of mGlu receptor ligands against fully kindled limbic seizures. In genetic mouse models, mGlu1/5 antagonists and mGlu2/3 agonists are effective against absence seizures. Thus, antagonists at group I mGlu receptors and agonists at groups II and III mGlu receptors are potential antiepileptic agents, but their clinical usefulness will depend on their acute and chronic side effects. Potential also exists for combining mGlu receptor ligands with other glutamatergic and non-glutamatergic agents to produce an enhanced anticonvulsant effect. This review also discusses what is known about mGlu receptor expression and function in rodent epilepsy models and human epileptic conditions.

eNOS Glu298Asp polymorphism and hypertension in a cohort study in Japanese.

PubMed

Kishimoto, Takuji; Misawa, Yumiko; Kaetu, Akihiko; Nagai, Maria; Osaki, Yoneatsu; Okamoto, Mikizoh; Yoshida, Soiti; Kurosawa, Yoichi; Fukumoto, Soji

2004-11-01

Some recent case-control association studies have suggested negative and positive relationship between Glu298Asp (the substitution of aspartic acid for glutamic acid at amino acid position 298) polymorphism of the endothelial nitric oxide synthase (eNOS) gene and hypertension. To investigate whether the Glu298Asp polymorphism of the eNOS gene affects the incidence of hypertension, a retrospective cohort study was performed. The baseline data among Japanese workers in Shimane Prefecture, Japan, were obtained at regular health examination in 1992, and a retrospective cohort study was performed to analyze the influence of Glu298Asp polymorphism on the incidence of hypertension in 1998. The incidences of Glu298Glu, Glu298Asp, and Asp298Asp genotypes in the subjects were 86.4%, 12.6% and 1.1%, respectively. The risk ratios of Glu298Asp and Asp298Asp against Glu298Glu for the incidence of hypertension by single variance analysis were 0.830 in total subjects [95% confidence interval (CI) 0.474-1.452], 0.596 in subjects 20-39 years old (95% CI; 0.207-1.717), and 0.915 in subjects 40-59 years old (95% CI; 0.464-1.805). The risk ratios of Glu298Asp and Asp298Asp against Glu298Glu for the incidence of hypertension by multiple variance analysis adjusted for sex, BMI, serum total cholesterol, serum high-density lipoprotein (HDL) cholesterol, fasting glucose, cigarette smoking, drinking habits, eating habits, and exercise in 1992 were 0.750 in total subjects (95% CI; 0.421-1.335), 0.505 in subjects 20-39 years old (95% CI; 0.170-1.496), and 0.873 in subjects 40-59 years old (95% CI; 0.434-1.757). These results suggested no association between the Glu298Asp gene polymorphism and the incidence of hypertension in this selected population.

Selective activation of group III metabotropic glutamate receptor subtypes produces different patterns of γ-aminobutyric acid immunoreactivity and glutamate release in the retina.

PubMed

Guimarães-Souza, E M; Calaza, K C

2012-12-01

Glutamate, the major excitatory neurotransmitter in the retina, functions by activation of both ionotropic (iGluR) and metabotropic (mGluR) glutamate receptors. Group III mGluRs, except for mGluR6, are mostly found in the inner plexiform layer (IPL), and their retinal functions are not well known. Therefore, we decided to investigate the effect of mGluRIII on glutamate release and GABAergic amacrine cells in the chick retina. The nonselective mGluRIII agonist L-SOP promoted a decrease in the number of γ-aminobutyric acid (GABA)-positive cells and in the GABA immunoreactivity in all sublayers of the IPL. This effect was prevented by the antagonist MAP-4, by GAT-1 inhibitor, and by antagonists of iGluR. Under the conditions used, L-SOP did not alter endogenous glutamate release. VU0155041, an mGluR4-positive allosteric modulator, reduced GABA immunoreactivity in amacrine cells and in sublayers 2 and 4 of the IPL but evoked an increase in the glutamate released. VU0155041's effect was inhibited by the absence of calcium. AMN082, a selective mGluR7-positive allosteric modulator, also decreased GABA immunoreactivity in amacrine cells and sublayers 1, 2, and 3 and increased glutamate release, and this effect was also inhibited by calcium absence. DCPG, an mGluR8-selective agonist, did not significantly alter GABA immunoreactivity in amacrine cells or glutamate release. However, it did significantly increase GABA immunoreactivity in sublayers 4 and 5. The results suggest that mGluRIIIs are involved in the modulation of glutamate and GABA release in the retina, possibly participating in distinct visual pathways: mGluR4 might be involved with cholinergic circuitry, whereas mGluR7 and mGluR8 might participate, respectively, in the OFF and the ON pathways. Copyright © 2012 Wiley Periodicals, Inc.

Native presynaptic metabotropic glutamate receptor 4 (mGluR4) interacts with exocytosis proteins in rat cerebellum.

PubMed

Ramos, Cathy; Chardonnet, Solenne; Marchand, Christophe H; Decottignies, Paulette; Ango, Fabrice; Daniel, Hervé; Le Maréchal, Pierre

2012-06-08

The eight pre- or/and post-synaptic metabotropic glutamatergic receptors (mGluRs) modulate rapid excitatory transmission sustained by ionotropic receptors. They are classified in three families according to their percentage of sequence identity and their pharmacological properties. mGluR4 belongs to group III and is mainly localized presynaptically. Activation of group III mGluRs leads to depression of excitatory transmission, a process that is exclusively provided by mGluR4 at parallel fiber-Purkinje cell synapse in rodent cerebellum. This function relies at least partly on an inhibition of presynaptic calcium influx, which controls glutamate release. To improve the understanding of molecular mechanisms of the mGluR4 depressant effect, we decided to identify the proteins interacting with this receptor. Immunoprecipitations using anti-mGluR4 antibodies were performed with cerebellar extracts. 183 putative partners that co-immunoprecipitated with anti-mGluR4 antibodies were identified and classified according to their cellular functions. It appears that native mGluR4 interacts with several exocytosis proteins such as Munc18-1, synapsins, and syntaxin. In addition, native mGluR4 was retained on a Sepharose column covalently grafted with recombinant Munc18-1, and immunohistochemistry experiments showed that Munc18-1 and mGluR4 colocalized at plasma membrane in HEK293 cells, observations in favor of an interaction between the two proteins. Finally, affinity chromatography experiments using peptides corresponding to the cytoplasmic domains of mGluR4 confirmed the interaction observed between mGluR4 and a selection of exocytosis proteins, including Munc18-1. These results could give indications to explain how mGluR4 can modulate glutamate release at parallel fiber-Purkinje cell synapses in the cerebellum in addition to the inhibition of presynaptic calcium influx.

Developmental shift from long-term depression to long-term potentiation in the rat medial vestibular nuclei: role of group I metabotropic glutamate receptors.

PubMed

Puyal, Julien; Grassi, Silvarosa; Dieni, Cristina; Frondaroli, Adele; Demêmes, Danielle; Raymond, Jaqueline; Pettorossi, Vito Enrico

2003-12-01

The effects of high frequency stimulation (HFS) of the primary vestibular afferents on synaptic transmission in the ventral part of the medial vestibular nuclei (vMVN) were studied during postnatal development and compared with the changes in the expression of the group I metabotropic glutamate receptor (mGluR) subtypes, mGluR1 and mGluR5. During the first stages of development, HFS always induced a mGluR5- and GABAA-dependent long-term depression (LTD) which did not require NMDA receptor and mGluR1 activation. The probability of inducing LTD decreased progressively throughout the development and it was zero at about the end of the second postnatal week. Conversely, long-term potentiation (LTP) appeared at the beginning of the second week and its occurrence increased to reach the adult value at the end of the third week. Of interest, the sudden change in the LTP frequency occurred at the time of eye opening, about the end of the second postnatal week. LTP depended on NMDA receptor and mGluR1 activation. In parallel with the modifications in synaptic plasticity, we observed that the expression patterns and localizations of mGluR5 and mGluR1 in the medial vestibular nuclei (MVN) changed during postnatal development. At the earlier stages the mGluR1 expression was minimal, then increased progressively. In contrast, mGluR5 expression was initially high, then decreased. While mGluR1 was exclusively localized in neuronal compartments and concentrated at the postsynaptic sites at all stages observed, mGluR5 was found mainly in neuronal compartments at immature stages, then preferentially in glial compartments at mature stages. These results provide the first evidence for a progressive change from LTD to LTP accompanied by a distinct maturation expression of mGluR1 and mGluR5 during the development of the MVN.

Necessary, but not sufficient: insights into the mechanisms of mGluR mediated long-term depression from a rat model of early life seizures.

PubMed

Bernard, Paul B; Castano, Anna M; Bayer, K Ulrich; Benke, Tim A

2014-09-01

Using the rat model of early life seizures (ELS), which has exaggerated mGluR mediated long-term depression of synaptic strength (mGluR-LTD) in adulthood, we probed the signaling cascades underlying mGluR-LTD induction. Several inhibitors completely blocked mGluR-LTD in control but not in ELS rats: the proteasome, the mammalian target of rapamycin (mTOR), S6 kinase (S6K), or L-type voltage-gated calcium channels (L-type VGCC). Inhibition of the Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) resulted in a near complete block of mGluR-LTD in control rats and a slight reduction of mGluR-LTD in ELS rats. "Autonomous" CaMKII was found to be upregulated in ELS rats, while elevated S6K activity, which is stimulated by mTOR, was described previously. Thus, modulation of each of these factors was necessary for mGluR-LTD induction in control rats, but even their combined, permanent activation in the ELS rats was not sufficient to individually support mGluR-LTD induction following ELS. This implies that while these factors may act sequentially in controls to mediate mGluR-LTD, this is no longer the case after ELS. In contrast, activated ERK was found to be significantly down-regulated in ELS rats. Inhibition of MEK/ERK activation in control rats elevated mGluR-LTD to the exaggerated levels seen in ELS rats. Together, these results elucidate both the mechanisms that persistently enhance mGluR-LTD after ELS and the mechanisms underlying normal mGluR-LTD by providing evidence for multiple, convergent pathways that mediate mGluR-LTD induction. With our prior work, this ties these signaling cascades to the ELS behavioral phenotype that includes abnormal working memory, fear conditioning and socialization. Copyright © 2014 Elsevier Ltd. All rights reserved.

Metabotropic glutamate receptor 5, and its trafficking molecules Norbin and Tamalin, are increased in the CA1 hippocampal region of subjects with schizophrenia.

PubMed

Matosin, Natalie; Fernandez-Enright, Francesca; Lum, Jeremy S; Andrews, Jessica L; Engel, Martin; Huang, Xu-Feng; Newell, Kelly A

2015-08-01

Metabotropic glutamate receptor 5 (mGluR5) is involved in hippocampal-dependent learning and memory, which are processes disrupted in schizophrenia. Recent evidence from human genetic and animal studies suggests that the regulation of mGluR5, including its interaction with trafficking molecules, may be altered in the disorder. However there have been no investigations of hippocampal mGluR5 or mGluR5 trafficking molecules in the postmortem schizophrenia brain to confirm this. In the present study, we investigated whether protein expression of mGluR5, as well as Norbin and Tamalin (modulators of mGluR5 signalling and trafficking), might be altered in the schizophrenia brain, using postmortem samples from the hippocampal CA1 region of schizophrenia subjects and matched controls (n=20/group). Protein levels of mGluR5 (total: 42%, p<0.001; monomer: 25%, p=0.011; dimer: 52%, p<0.001) and mGluR5 trafficking molecules (Norbin: 47%, p<0.001; Tamalin: 34%, p=0.009) were significantly higher in schizophrenia subjects compared to controls. To determine any influence of antipsychotic drug treatment, all proteins were also correlated with lifetime chlorpromazine equivalents in patients, and separately measured in the hippocampus of rats exposed to haloperidol or olanzapine treatment. mGluR5 was negatively correlated with lifetime antipsychotic drug exposure in schizophrenia patients, suggesting antipsychotic drugs could reduce mGluR5 protein in schizophrenia subjects. In contrast, mGluR5 and mGluR5 trafficking molecules were not altered in the hippocampus of antipsychotic drug treated rats. This investigation provides strong support for the hypothesis that mGluR5 is involved in the pathology of schizophrenia, and that alterations to mGluR5 trafficking might contribute to the hippocampal-dependent cognitive dysfunctions associated with this disorder. Copyright © 2015 Elsevier B.V. All rights reserved.

Separate intramolecular targets for protein kinase A control N-methyl-D-aspartate receptor gating and Ca2+ permeability.

PubMed

Aman, Teresa K; Maki, Bruce A; Ruffino, Thomas J; Kasperek, Eileen M; Popescu, Gabriela K

2014-07-04

Protein kinase A (PKA) enhances synaptic plasticity in the central nervous system by increasing NMDA receptor current amplitude and Ca(2+) flux in an isoform-dependent yet poorly understood manner. PKA phosphorylates multiple residues on GluN1, GluN2A, and GluN2B subunits in vivo, but the functional significance of this multiplicity is unknown. We examined gating and permeation properties of recombinant NMDA receptor isoforms and of receptors with altered C-terminal domain (CTDs) prior to and after pharmacological inhibition of PKA. We found that PKA inhibition decreased GluN1/GluN2B but not GluN1/GluN2A gating; this effect was due to slower rates for receptor activation and resensitization and was mediated exclusively by the GluN2B CTD. In contrast, PKA inhibition reduced NMDA receptor-relative Ca(2+) permeability (PCa/PNa) regardless of the GluN2 isoform and required the GluN1 CTD; this effect was due primarily to decreased unitary Ca(2+) conductance, because neither Na(+) conductance nor Ca(2+)-dependent block was altered substantially. Finally, we show that both the gating and permeation effects can be reproduced by changing the phosphorylation state of a single residue: GluN2B Ser-1166 and GluN1 Ser-897, respectively. We conclude that PKA effects on NMDA receptor gating and Ca(2+) permeability rely on distinct phosphorylation sites located on the CTD of GluN2B and GluN1 subunits. This separate control of NMDA receptor properties by PKA may account for the specific effects of PKA on plasticity during synaptic development and may lead to drugs targeted to alter NMDA receptor gating or Ca(2+) permeability. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Memory in aged mice is rescued by enhanced expression of the GluN2B subunit of the NMDA receptor

PubMed Central

Brim, B. L.; Haskell, R.; Awedikian, R.; Ellinwood, N.M.; Jin, L.; Kumar, A.; Foster, T.C.; Magnusson, K.

2012-01-01

The GluN2B subunit of the N-methyl-D-aspartate (NMDA) receptor shows age-related declines in expression across the frontal cortex and hippocampus. This decline is strongly correlated to age-related memory declines. This study was designed to determine if increasing GluN2B subunit expression in the frontal lobe or hippocampus would improve memory in aged mice. Mice were injected bilaterally with either the GluN2B vector, containing cDNA specific for the GluN2B subunit and enhanced Green Fluorescent Protein (eGFP); a control vector or vehicle. Spatial memory, cognitive flexibility, and associative memory were assessed using the Morris water maze. Aged mice, with increased GluN2B subunit expression, exhibited improved long-term spatial memory, comparable to young mice. However, memory was rescued on different days in the Morris water maze; early for hippocampal GluN2B subunit enrichment and later for the frontal lobe. A higher concentration of the GluN2B antagonist, Ro 25-6981, was required to impair long-term spatial memory in aged mice with enhanced GluN2B expression, as compared to aged controls, suggesting there was an increase in the number of GluN2B-containing NMDA receptors. In addition, hippocampal slices from aged mice with increased GluN2B subunit expression exhibited enhanced NMDA receptor-mediated excitatory post-synaptic potentials (EPSP). Treatment with Ro 25-6981 showed that a greater proportion of the NMDA receptor-mediated EPSP was due to the GluN2B subunit in these animals, as compared to aged controls. These results suggest that increasing the production of the GluN2B subunit in aged animals enhances memory and synaptic transmission. Therapies that enhance GluN2B subunit expression within the aged brain may be useful for ameliorating age-related memory declines. PMID:23103326

Curcumin Modulates the NMDA Receptor Subunit Composition Through a Mechanism Involving CaMKII and Ser/Thr Protein Phosphatases.

PubMed

Mallozzi, Cinzia; Parravano, Mariacristina; Gaddini, Lucia; Villa, Marika; Pricci, Flavia; Malchiodi-Albedi, Fiorella; Matteucci, Andrea

2018-05-30

Curcumin is one of the major compounds contained in turmeric, the powdered rhizome of Curcuma longa. Results obtained in various experimental models indicate that curcumin has the potential to treat a large variety of neuronal diseases. Excitotoxicity, the toxicity due to pathological glutamate receptors stimulation, has been considered to be involved in several ocular pathologies including ischemia, glaucoma, and diabetic retinopathy. The NMDA receptor (NMDAR), a heteromeric ligand-gated ion channel, is composed of GluN1 and GluN2 subunits. There are four GluN2 subunits (GluN2A-D), which are major determinants of the functional properties of NMDARs. It is widely accepted that GluN2B has a pivotal role in excitotoxicity while the role of GluN2A remains controversial. We previously demonstrated that curcumin is neuroprotective against NMDA-induced excitotoxicity with a mechanism involving an increase of GluN2A subunit activity. In this paper, we investigate the mechanisms involved in curcumin-induced GluN2A increase in retinal cultures. Our results show that curcumin treatment activated CaMKII with a time-course that paralleled those of GluN2A increase. Moreover, KN-93, a CaMKII inhibitor, was able to block the effect of curcumin on GluN2A expression. Finally, in our experimental model, curcumin reduced ser/thr phosphatases activity. Using okadaic acid, a specific PP1 and PP2A blocker, we observed an increase in GluN2A levels in cultures. The ability of okadaic acid to mimic the effect of curcumin on GluN2A expression suggests that curcumin might regulate GluN2A expression through a phosphatase-dependent mechanism. In conclusion, our findings indicate curcumin modulation of CaMKII and/or ser/thr phosphatases activities as a mechanism involved in GluN2A expression and neuroprotection against excitotoxicity.

The separation of Gln and Glu in STEAM: a comparison study using short and long TEs/TMs at 3 and 7 T.

PubMed

Dou, Weiqiang; Kaufmann, Jörn; Li, Meng; Zhong, Kai; Walter, Martin; Speck, Oliver

2015-08-01

This study aimed to determine the optimal echo time (TE) and mixing time (TM) for in vivo glutamine (Gln) and glutamate (Glu) separation in stimulated-echo acquisition mode at 3 and 7 T. We applied a short TE/TM (20/10 ms) for a high signal-to-noise-ratio and a field-specific long TE/TM (3 T: 72/6 ms; 7 T: 74/68 ms) for optimal Gln and Glu separation of the Carbon-4 proton resonances. Corresponding Gln and Glu spectra were simulated using VeSPA software, and measured in a phantom and human brains at 3 and 7 T. Higher spectral separation for Gln and Glu was achieved at 7 than 3 T. At 7 T, short TE/TM provided comparable spectral separation and in vitro Gln and Glu quantification compared to long TE/TM. Moreover, it showed greater reliability in in vivo Gln and Glu detection and separation than long TE/TM, with significantly lower Cramer-Rao lower bounds (Gln: 14.9 vs. 75.8; Glu: 3.8 vs. 6.5) and correlation between Gln and Glu (p = 0.004). Based on the optimal separation for Gln and Glu, a short TE/TM at 7 T is proposed for future in vivo Gln and Glu acquisition.

A Critical Role for Ubiquitination in the Endocytosis of Glutamate Receptors.

PubMed

Gulia, Ravinder; Sharma, Rohan; Bhattacharyya, Samarjit

2017-01-27

Group I metabotropic glutamate receptors (mGluRs) play important roles in various neuronal processes and elicit changes in synaptic efficacy through AMPA receptor (AMPAR) endocytosis. Trafficking of mGluRs plays an important role in controlling the precise localization of these receptors at specific region of the cell; it also regulates the activity of these receptors. Despite this obvious significance, we know very little about the cellular mechanisms that control the trafficking of group I mGluRs. We show here that ligand-mediated internalization of group I mGluRs is ubiquitination-dependent. A lysine residue (Lys 1112 ) at the C-terminal tail of mGluR1 (a member of the group I mGluR family) plays crucial role in this process. Our data suggest that Lys 63 -linked polyubiquitination is involved in the ligand-mediated endocytosis of mGluR1. We also show here that the mGluR1 internalization is dependent on a specific E3 ubiquitin ligase, Siah-1A. Furthermore, acute knockdown of Siah-1A enhances the mGluR-mediated AMPAR endocytosis. These studies reveal a novel function of ubiquitination in the regulation of group I mGluRs, as well as its role in mGluR-dependent AMPAR endocytosis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Disrupted Homer scaffolds mediate abnormal mGluR5 function in a mouse model of fragile X syndrome.

PubMed

Ronesi, Jennifer A; Collins, Katie A; Hays, Seth A; Tsai, Nien-Pei; Guo, Weirui; Birnbaum, Shari G; Hu, Jia-Hua; Worley, Paul F; Gibson, Jay R; Huber, Kimberly M

2012-01-22

Enhanced metabotropic glutamate receptor subunit 5 (mGluR5) function is causally associated with the pathophysiology of fragile X syndrome, a leading inherited cause of intellectual disability and autism. Here we provide evidence that altered mGluR5-Homer scaffolds contribute to mGluR5 dysfunction and phenotypes in the fragile X syndrome mouse model, Fmr1 knockout (Fmr1(-/y)). In Fmr1(-/y) mice, mGluR5 was less associated with long Homer isoforms but more associated with the short Homer1a. Genetic deletion of Homer1a restored mGluR5-long Homer scaffolds and corrected several phenotypes in Fmr1(-/y) mice, including altered mGluR5 signaling, neocortical circuit dysfunction and behavior. Acute, peptide-mediated disruption of mGluR5-Homer scaffolds in wild-type mice mimicked many Fmr1(-/y) phenotypes. In contrast, Homer1a deletion did not rescue altered mGluR-dependent long-term synaptic depression or translational control of target mRNAs of fragile X mental retardation protein, the gene product of Fmr1. Our findings reveal new functions for mGluR5-Homer interactions in the brain and delineate distinct mechanisms of mGluR5 dysfunction in a mouse model of cognitive dysfunction and autism.

Group 1 mGluR-dependent synaptic long-term depression: mechanisms and implications for circuitry and disease.

PubMed

Lüscher, Christian; Huber, Kimberly M

2010-02-25

Many excitatory synapses express Group 1, or Gq coupled, metabotropic glutamate receptors (Gp1 mGluRs) at the periphery of their postsynaptic density. Activation of Gp1 mGluRs typically occurs in response to strong activity and triggers long-term plasticity of synaptic transmission in many brain regions, including the neocortex, hippocampus, midbrain, striatum, and cerebellum. Here we focus on mGluR-induced long-term synaptic depression (LTD) and review the literature that implicates Gp1 mGluRs in the plasticity of behavior, learning, and memory. Moreover, recent studies investigating the molecular mechanisms of mGluR-LTD have discovered links to mental retardation, autism, Alzheimer's disease, Parkinson's disease, and drug addiction. We discuss how mGluRs lead to plasticity of neural circuits and how the understanding of the molecular mechanisms of mGluR plasticity provides insight into brain disease.

Molecular mechanisms of group I metabotropic glutamate receptor mediated LTP and LTD in basolateral amygdala in vitro.

PubMed

Chen, A; Hu, W W; Jiang, X L; Potegal, M; Li, H

2017-02-01

The roles of group I metabotropic glutamate receptors, metabotropic glutamate receptor 1 (mGluR1) and mGluR5, in regulating synaptic plasticity and metaplasticity in the basolateral amygdala (BLA) remain unclear. The present study examined mGluR1- and mGluR5-mediated synaptic plasticity in the BLA and their respective signaling mechanisms. Bath application of the group I mGluR agonist, 3,5-dihydroxyphenylglycine (DHPG) (20 μM), directly suppressed basal fEPSPs (84.5 ± 6.3% of the baseline). The suppressive effect persisted for at least 30 min after washout; it was abolished by the mGluR1 antagonist 7-(hydroxyimino)cyclopropa[b]chromen-1a-carboxylate ethyl ester (CPCCOEt) but was unaffected by the mGluR5 antagonist 2-methyl-6- (phenylethynyl)-pyridine (MPEP). Interestingly, application of DHPG (at both 2 and 20 μM), regardless of the presence of CPCCOEt, could transform single theta burst stimulation (TBS)-induced short-term synaptic potentiation into a long-term potentiation (LTP). Such a facilitating effect could be blocked by the mGluR5 antagonist MPEP. Blockade of phospholipase C (PLC), the downstream enzyme of group I mGluR, with U73122, prevented both mGluR1- and mGluR5-mediated effects on synaptic plasticity. Nevertheless, blockade of protein kinase C (PKC), the downstream enzyme of PLC, with chelerythrine (5 μM) only prevented the transforming effect of DHPG on TBS-induced LTP and did not affect DHPG-induced long-term depression (LTD). These results suggest that mGluR1 activation induced LTD via a PLC-dependent and PKC-independent mechanism, while the priming action of mGluR5 receptor on the BLA LTP is both PLC and PKC dependent. The BLA metaplasticity mediated by mGluR1 and mGluR5 may provide signal switching mechanisms mediating learning and memory with emotional significance.

Evidence for association of a common variant of the endothelial nitric oxide synthase gene (Glu298→Asp polymorphism) to the presence, extent, and severity of coronary artery disease

PubMed Central

Colombo, M G; Andreassi, M G; Paradossi, U; Botto, N; Manfredi, S; Masetti, S; Rossi, G; Clerico, A; Biagini, A

2002-01-01

Background: Genetic variants of endothelial nitric oxide synthase (eNOS) could influence individual susceptibility to coronary artery disease. Objective: To assess whether Glu298→Asp polymorphism of the eNOS gene is associated with the occurrence and severity of angiographically defined coronary artery disease in the Italian population. Methods: Polymerase chain reaction/restriction fragment length polymorphism analysis was done to detect the Glu298→Asp variant of the eNOS gene in 201 patients with coronary artery disease and 114 controls. The severity of coronary artery disease was expressed by the number of affected vessels and by the Duke scoring system. Results: The frequencies of the eNOS Glu/Glu, Glu/Asp, and Asp/Asp genotypes in the coronary artery disease group were significantly different from those of controls (45.3%, 38.8%, and 15.9% v 42.1%, 51.8%, and 6.1%, respectively; χ2 = 8.589, p = 0.0136). In comparison with subjects who had a Glu298 allele in the eNOS gene, the risk of coronary artery disease was increased among Asp/Asp carriers (odds ratio 2.9, 95% confidence interval 1.2 to 6.8, p = 0.01) and was independent of the other common risk factors (p = 0.04). There was a significant association between the eNOS Glu298→Asp variant and both the number of stenosed vessels (mean (SEM), 2.3 (0.1) for Asp/Asp v 1.9 (0.1) and 1.8 (0.1) for Glu/Glu and Glu/Asp, respectively; p = 0.01) and the Duke score (56.1 (3.1) for Asp/Asp v 46.7 (2.0) and 46.1 (1.9) for Glu/Glu and Glu/Asp, respectively; p = 0.02). Conclusions: Glu298→Asp polymorphism of the eNOS gene appears to be associated with the presence, extent, and severity of angiographically assessed coronary artery disease. PMID:12010932

Selectivity and evolutionary divergence of metabotropic glutamate receptors for endogenous ligands and G proteins coupled to phospholipase C or TRP channels.

PubMed

Kang, Hye Jin; Menlove, Kit; Ma, Jianpeng; Wilkins, Angela; Lichtarge, Olivier; Wensel, Theodore G

2014-10-24

To define the upstream and downstream signaling specificities of metabotropic glutamate receptors (mGluR), we have examined the ability of representative mGluR of group I, II, and III to be activated by endogenous amino acids and catalyze activation of G proteins coupled to phospholipase C (PLC), or activation of G(i/o) proteins coupled to the ion channel TRPC4β. Fluorescence-based assays have allowed us to observe interactions not previously reported or clearly identified. We have found that the specificity for endogenous amino acids is remarkably stringent. Even at millimolar levels, structurally similar compounds do not elicit significant activation. As reported previously, the clear exception is L-serine-O-phosphate (L-SOP), which strongly activates group III mGluR, especially mGluR4,-6,-8 but not group I or II mGluR. Whereas L-SOP cannot activate mGluR1 or mGluR2, it acts as a weak antagonist for mGluR1 and a potent antagonist for mGluR2, suggesting that co-recognition of L-glutamate and L-SOP arose early in evolution, and was followed later by divergence of group I and group II mGluR versus group III in l-SOP responses. mGluR7 has low affinity and efficacy for activation by both L-glutamate and L-SOP. Molecular docking studies suggested that residue 74 corresponding to lysine in mGluR4 and asparagine in mGluR7 might play a key role, and, indeed, mutagenesis experiments demonstrated that mutating this residue to lysine in mGluR7 enhances the potency of L-SOP. Experiments with pertussis toxin and dominant-negative Gα(i/o) proteins revealed that mGluR1 couples strongly to TRPC4β through Gα(i/o), in addition to coupling to PLC through Gα(q/11). © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Control of rectification and permeation by two distinct sites after the second transmembrane region in Kir2.1 K+ channel

PubMed Central

Kubo, Yoshihiro; Murata, Yoshimichi

2001-01-01

The rectification property of the inward rectifier K+ channel is chiefly due to the block of outward current by cytoplasmic Mg2+ and polyamines. In the cloned inward rectifier K+ channel Kir2.1 (IRK1), Asp172 in the second transmembrane region (M2) and Glu224 in the putative cytoplasmic region after M2 are reported to be critical for the sensitivity to these blockers. However, the difference in the inward rectification properties between Kir2.1 and a very weak inward rectifier sWIRK could not be explained by differences at these two sites. Following sequence comparison of Kir2.1 and sWIRK, we focused this study on Glu299 located in the centre of the putative cytoplasmic region after M2. Single-point mutants of Kir2.1 (Glu224Gly and Glu299Ser) and a double-point mutant (Glu224Gly-Glu299Ser) were made and expressed in Xenopus oocytes or in HEK293T cells. Their electrophysiological properties were compared with those of wild-type (WT) Kir2.1 and the following observations were made. (a) Glu299Ser showed a weaker inward rectification, a slower activation upon hyperpolarization, a slower decay of the outward current upon depolarization, a lower sensitivity to block by cytoplasmic spermine and a smaller single-channel conductance than WT. (b) The features of Glu224Gly were similar to those of Glu299Ser. (c) In the double mutant (Glu224Gly-Glu299Ser), the differences from WT described above were more prominent. These results demonstrate that Glu299 as well as Glu224 control rectification and permeation, and suggest the possibility that the two sites contribute to the inner vestibule of the channel pore. The slowing down of the on- and off-blocking processes by mutation of these sites implies that Glu224 and Glu299 function to facilitate the entry (and exit) of spermine to (and from) the blocking site. PMID:11251047

Metabotropic glutamate receptor mGluR2/3 and mGluR5 binding in the anterior cingulate cortex in psychotic and nonpsychotic depression, bipolar disorder and schizophrenia: implications for novel mGluR-based therapeutics.

PubMed

Matosin, Natalie; Fernandez-Enright, Francesca; Frank, Elisabeth; Deng, Chao; Wong, Jenny; Huang, Xu-Feng; Newell, Kelly A

2014-11-01

Metabotropic glutamate receptors 2/3 (mGluR2/3) and 5 (mGluR5) are novel therapeutic targets for major depression (MD), bipolar disorder (BD) and schizophrenia. We aimed to determine whether mGluR2/3 and mGluR5 binding in the anterior cingulate cortex (ACC), a brain region essential for the regulation of mood, cognition and emotion, were differentially altered in these pathologies. Using postmortem human brains derived from 2 cohorts, [(3)H]LY341495 binding to mGluR2/3 and [(3)H]MPEP binding to mGluR5 were measured by receptor autoradiography in the ACC. The first cohort comprised samples from individuals who had MD with psychosis (MDP), MD without psychosis (MDNP) and matched controls (n = 11-12 per group). The second cohort comprised samples from individuals who had MDNP, BD, schizophrenia and matched controls (n = 15 per group). No differences in mGluR2/3 or mGluR5 binding were observed in the MDP, MDNP, BD or schizophrenia groups compared with the control group (all p > 0.05). Importantly, there were also no differences in binding densities between the psychiatric disorders (p > 0.05). We did, however, observe age-related effects, with consistent negative associations between mGluR2/3 and age in the control group (r < -0.575, p < 0.025) and the psychotic disorder groups (MDP and schizophrenia: r = -0.765 to -0.515, p < 0.05), but not in the mood disorder groups (MDNP, BD). Replication in larger independent cohorts and medication-naive individuals would strengthen these findings. Our findings suggest that mGluRs are unaltered in the ACC; however, the presence of altered receptor function cannot be discounted and requires further investigation. Taken together with previous studies, which report differential changes in mGluR2, 3 and 5 across these disorders, we suggest mGluRs may be affected in a brain region-specific manner.

Agonist- and subunit-dependent potentiation of glutamate receptors by a nootropic drug aniracetam.

PubMed

Tsuzuki, K; Takeuchi, T; Ozawa, S

1992-11-01

GluR1 and GluR2 cDNAs encoding non-NMDA subtypes of glutamate receptor were isolated from a rat brain cDNA library by Boulter et al. (Science, 249 (1990) 1033-1037). Functional receptors activated by kainate, alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) and glutamate were expressed in Xenopus oocytes injected with GluR1, GluR2 or a mixture of GluR1 and GluR2 RNAs. In GluR1-expressed oocytes, 1 mM aniracetam potentiated AMPA-induced currents by 99 +/- 10% (mean +/- S.E.M., n = 5) and glutamate-induced currents by 140 +/- 8% (n = 4), but little affected kainate-induced currents. Aniracetam was effective from a concentration of 0.1 mM, and it exhibited more conspicuous effects with the increase of the dose. In oocytes injected with GluR1 plus GluR2 RNAs, aniracetam more markedly potentiated current responses to AMPA and glutamate than those in oocytes injected with GluR1 RNA alone. For example, 1 mM aniracetam potentiated AMPA-induced currents by 396 +/- 76% (n = 4) and glutamate-induced currents by 970 +/- 65% (n = 5) in oocytes injected with 10% GluR1 and 90% GluR2 RNAs. In these oocytes, however, the potentiation of kainate-induced currents by 1 mM aniracetam was only 8 +/- 5% (n = 4). Thus, we conclude that the potentiation of the AMPA/kainate receptor by aniracetam depends on both species of agonists and subunit composition of the receptor.

Impaired expression and function of group II metabotropic glutamate receptors in pilocarpine-treated chronically epileptic rats

PubMed Central

Garrido-Sanabria, Emilio R.; Otalora, Luis F. Pacheco; Arshadmansab, Massoud F.; Herrera, Berenice; Francisco, Sebastian; Ermolinsky, Boris

2008-01-01

Group II metabotropic (mGlu II) receptor subtypes mGlu2 and mGlu3 are important modulators of synaptic plasticity and glutamate release in the brain. Accordingly, several pharmacological ligands have been designed to target these receptors for the treatment of neurological disorders characterized by anomalous glutamate regulation including epilepsy. In this study, we examine whether the expression level and function of mGlu2 and mGlu3 are altered in experimental epilepsy by using immunohistochemistry, Western blot analysis, RT-PCR and extracellular recordings. A down-regulation of mGlu2/3 protein expression at the mossy fiber pathway was associated with a significant reduction in mGlu2/3 protein expression in the hippocampus and cortex of chronically epileptic rats. Moreover, a reduction in mGlu2 and mGlu3 transcripts levels was noticed as early as 24h after pilocarpine-induced status epilepticus (SE) and persisted during subsequent “latent” and chronic periods. In addition, a significant impairment of mGlu II-mediated depression of field excitatory postsynaptic potentials at mossy fiber-CA3 synapses was detected in chronically epileptic rats. Application of mGlu II agonists (2S,2'R,3'R)-2-(2',3'-dicarboxycyclopropyl)glycine (DCG-IV) induced a significant reduction of the fEPSP amplitude in control rats, but not in chronic epileptic rats. These data indicate a long-lasting impairment of mGlu2/3 expression that may contribute to abnormal presynaptic plasticity, exaggerate glutamate release and hyperexcitability in temporal lobe epilepsy. PMID:18804094

A parallel panning scheme used for selection of a GluA4-specific Fab targeting the ligand-binding domain.

PubMed

Clausen, Rasmus P; Mohr, Andreas Ø; Riise, Erik; Jensen, Anders A; Gill, Avinash; Madden, Dean R; Kastrup, Jette S; Skottrup, Peter D

2016-11-01

A method for development of murine Fab fragments towards extracellular domains of a surface receptor is presented. The GluA4 ionotropic glutamate receptor is used as a model system. Recombinant GluA4 ectodomain comprising both the N-terminal domain (NTD) and the ligand-binding domain (LBD) in one molecule was used for immunization. A Fab-phage library was constructed and a parallel panning approach enabled selection of murine Fab fragments towards either intact ectodomain or the isolated LBD of the GluA4 receptor. One LBD-Fab (FabL9) showed exclusive selectivity for the GluA4 LBD, over a panel of LBDs from GluA2, GluK1, GluK2 and GluD2. Soluble FabL9 was produced in amounts suitable for characterization. Competitive ELISA and rat-brain immunoprecipitation experiments confirmed that the FabL9 epitope is conserved in the LBD and in the intact native receptor. By an alignment of GluA2 and GluA4, the likely binding epitope for FabL9 was predicted. This study demonstrates a simple approach for development of antibody fragments towards specific sub-domains of a large ligand-gated ion channel, and this method could be utilized for all multi-domain surface receptors where antibody domain-selectivity may be desirable. Furthermore, we present for the first time a GluA4 subtype-specific murine Fab fragment targeting the LBD of the receptor. Copyright © 2016 Elsevier B.V. All rights reserved.

OptoGluNAM4.1, a Photoswitchable Allosteric Antagonist for Real-Time Control of mGlu4 Receptor Activity.

PubMed

Rovira, Xavier; Trapero, Ana; Pittolo, Silvia; Zussy, Charleine; Faucherre, Adèle; Jopling, Chris; Giraldo, Jesús; Pin, Jean-Philippe; Gorostiza, Pau; Goudet, Cyril; Llebaria, Amadeu

2016-08-18

OptoGluNAM4.1, a negative allosteric modulator (NAM) of metabotropic glutamate receptor 4 (mGlu4) contains a reactive group that covalently binds to the receptor and a blue-light-activated, fast-relaxing azobenzene group that allows reversible receptor activity photocontrol in vitro and in vivo. OptoGluNAM4.1 induces light-dependent behavior in zebrafish and reverses the activity of the mGlu4 agonist LSP4-2022 in a mice model of chronic pain, defining a photopharmacological tool to better elucidate the physiological roles of the mGlu4 receptor in the nervous system. Copyright © 2016 Elsevier Ltd. All rights reserved.

Gln27Glu polymorphism in the beta2 adrenergic receptor gene and lipid metabolism during exercise in obese women.

PubMed

Macho-Azcarate, T; Marti, A; González, A; Martinez, J A; Ibañez, J

2002-11-01

The Glu27Glu genotype in the beta-2-adrenergic receptor (ADRB2) is associated with fat mass, body mass index and obesity in females. In our population, we previously found an association of higher body mass index (BMI) among women who reported more physical activity and carried the Glu27 allele as compared to non carriers with the same level of activity. To examine the lipid metabolism differences, both at rest and during submaximal exercise in ADRB2 Glu27Glu vs Gln27Gln obese women. Eight obese women with the Glu27Glu genotype (age, 43+/-5 y; body mass index (BMI), 31.7+/-0.9 kg/m(2); percentage fat mass, 42.0+/-1.3; WHR, 0.83+/-0.02; and VO(2max), 21.6+/-0.9 ml/kg/min) were compared with seven obese women with the Gln27Gln genotype (age, 43+/-5 y; BMI, 33.9+/-1.3 kg/m(2); percentage fat mass, 41.6+/-1.2; WHR, 0.83+/-0.02; and VO(2max), 20.6+/-0.8 ml/kg/min). The ADRB2 polymorphism was identified by PCR-RFLP. Respiratory quotient was determined by indirect calorimetry at baseline, during 1 h of walking on a treadmill and 1 h after the exercise. Plasma triglycerides, glycerol, FFA, hydroxybutyrate, glucose and lactate were assayed by spectrophotometric methods. Insulin, leptin and progesterone were measured by radioimmunoassay. Adrenaline and noradrenaline were quantified by high performance liquid chromatography. The ADRB2 Glu27Glu subjects had lower plasma glycerol (P=0.047) and lower hydroxybutyrate (P=0.001) throughout the study than the Gln27Gln group. Plasma triglycerides (P=0.001), lactate (P<0.05) and serum insulin (P<0.05) remained higher in the Glu27Glu group vs the Gln27Gln group. The respiratory quotient (RQ) was higher in the Glu27Glu obese women along the study (P=0.046), and fat oxidation was significantly lower in this group during the recovery (P=0.048). The other variables did not differ statistically between groups. These data suggest that both lipolysis and fat oxidation promoted by an acute submaximal exercise intervention could be blunted in the polymorphic ADRB2 Glu27Glu group of our female obese population.

Glutamate receptor antibodies directed against AMPA receptors subunit 3 peptide B (GluR3B) can be produced in DBA/2J mice, lower seizure threshold and induce abnormal behavior.

PubMed

Ganor, Yonatan; Goldberg-Stern, Hadassa; Cohen, Ran; Teichberg, Vivian; Levite, Mia

2014-04-01

Anti-GluR3B antibodies (GluR3B Ab's), directed against peptide B/aa372-395 of GluR3 subunit of glutamate/AMPA receptors, are found in ∼35% of epilepsy patients, activate glutamate/AMPA receptors, evoke ion currents, kill neurons and damage the brain. We recently found that GluR3B Ab's also associate with neurological/psychiatric/behavioral abnormalities in epilepsy patients. Here we asked if GluR3B Ab's could be produced in DBA/2J mice, and also modulate seizure threshold and/or cause behavioral/motor impairments in these mice. DBA/2J mice were immunized with the GluR3B peptide in Complete Freund's Adjuvant (CFA), or with controls: ovalbumin (OVA), CFA, or phosphate-buffer saline (PBS). GluR3B Ab's and OVA Ab's were tested. Seizures were induced in all mice by the chemoconvulsant pentylenetetrazole (PTZ) at three time points, each time with less PTZ to avoid non-specific death. Behavior was examined in Open-Field, RotaRod and Grip tests. GluR3B Ab's were produced only in GluR3B-immunized mice, while OVA Ab's were produced only in OVA-immunized mice, showing high Ab's specificity. In GluR3B Ab's negative mice, seizure severity scores and percentages of animals developing generalized seizures declined in response to decreasing PTZ doses. In contrast, both parameters remained unchanged/high in the GluR3B Ab's positive mice, showing that these mice were more susceptible to seizures. The seizure scores associated significantly with the GluR3B Ab's levels. GluR3B Ab's positive mice were also more anxious in Open-Field test, fell faster in RotaRod test, and fell more in Grip test, compared to all the control mice. GluR3B Ab's are produced in DBA/2J mice, facilitate seizures and induce behavioral/motor impairments. This animal model can therefore serve for studying autoimmune epilepsy and abnormal behavior mediated by pathogenic anti-GluR3B Ab's. Copyright © 2014 Elsevier Ltd. All rights reserved.

Type II and III Taste Bud Cells Preferentially Expressed Kainate Glutamate Receptors in Rats.

PubMed

Lee, Sang-Bok; Lee, Cil-Han; Kim, Se-Nyun; Chung, Ki-Myung; Cho, Young-Kyung; Kim, Kyung-Nyun

2009-12-01

Glutamate-induced cobalt uptake reveals that non-NMDA glutamate receptors (GluRs) are present in rat taste bud cells. Previous studies involving glutamate induced cobalt staining suggest this uptake mainly occurs via kainate type GluRs. It is not known which of the 4 types of taste bud cells express subunits of kainate GluR. Circumvallate and foliate papillae of Sprague-Dawley rats (45~60 days old) were used to search for the mRNAs of subunits of non-NMDA GluRs using RT-PCR with specific primers for GluR1-7, KA1 and KA2. We also performed RT-PCR for GluR5, KA1, PLCbeta2, and NCAM/SNAP 25 in isolated single cells from taste buds. Taste epithelium, including circumvallate or foliate papilla, express mRNAs of GluR5 and KA1. However, non-taste tongue epithelium expresses no subunits of non-NMDA GluRs. Isolated single cell RT-PCR reveals that the mRNAs of GluR5 and KA1 are preferentially expressed in Type II and Type III cells over Type I cells.

Identification of a hepatoprotective peptide in wheat gluten hydrolysate against D-galactosamine-induced acute hepatitis in rats.

PubMed

Sato, Kenji; Egashira, Yukari; Ono, Shin; Mochizuki, Satoshi; Shimmura, Yuki; Suzuki, Yoshio; Nagata, Megumi; Hashimoto, Kaori; Kiyono, Tamami; Park, Eun Young; Nakamura, Yasushi; Itabashi, Mariko; Sakata, Yuka; Furuta, Seigo; Sanada, Hiroo

2013-07-03

A hepatoprotective peptide, pyroglutamyl leucine (pyroGlu-Leu), was identified in wheat gluten hydrolysate through an in vivo activity-guided fractionation approach based on D-galactosamine-induced acute hepatitis in rats and fractionation of peptides with large-scale preparative ampholine-free isoelectric focusing. The active acidic fraction predominantly consisted of pyroglutamyl peptides and free pyroglutamic acid. Pyroglutamyl peptides were derivatized with phenyl isothiocyanate after removal of a pyroglutamyl residue by pyroglutamate aminopeptidase. The derivatives were purified by reversed-phase HPLC and subjected to sequence analysis. The active fraction contained pyroGlu-Ile, pyroGlu-Leu, pyroGlu-Gln, pyroGlu-Gln-Gln, and free pyroGlu. Ingestion of pyroGlu-Leu at 20 mg/kg body weight significantly decreased serum aspartate and alanine aminotransferases to approximately 30% and 20% of those values of the vehicle group, respectively, which were near the normal levels. Thirty minutes after ingestion of pyroGlu-Leu at 20 mg/kg, the concentration of pyroGlu-Leu in portal blood plasma increased to approximately 2 μM.

Group 1 metabotropic glutamate receptors 1 and 5 form a protein complex in mouse hippocampus and cortex.

PubMed

Pandya, Nikhil J; Klaassen, Remco V; van der Schors, Roel C; Slotman, Johan A; Houtsmuller, Adriaan; Smit, August B; Li, Ka Wan

2016-10-01

The group 1 metabotropic glutamate receptors 1 and 5 (mGluR1/5) have been implicated in mechanisms of synaptic plasticity and may serve as potential therapeutic targets in autism spectrum disorders. The interactome of group 1 mGluRs has remained largely unresolved. Using a knockout-controlled interaction proteomics strategy we examined the mGluR5 protein complex in two brain regions, hippocampus and cortex, and identified mGluR1 as its major interactor in addition to the well described Homer proteins. We confirmed the presence of mGluR1/5 complex by (i) reverse immunoprecipitation using an mGluR1 antibody to pulldown mGluR5 from hippocampal tissue, (ii) coexpression in HEK293 cells followed by coimmunoprecipitation to reveal the direct interaction of mGluR1 and 5, and (iii) superresolution microscopy imaging of hippocampal primary neurons to show colocalization of the mGluR1/5 in the synapse. © 2016 The Authors. Proteomics Published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Essential Role of NMDA Receptor Channel ε4 Subunit (GluN2D) in the Effects of Phencyclidine, but Not Methamphetamine

PubMed Central

Hagino, Yoko; Kasai, Shinya; Han, Wenhua; Yamamoto, Hideko; Nabeshima, Toshitaka; Mishina, Masayoshi; Ikeda, Kazutaka

2010-01-01

Phencyclidine (PCP), a noncompetitive N-methyl-D-aspartate (NMDA) receptor antagonist, increases locomotor activity in rodents and causes schizophrenia-like symptoms in humans. Although activation of the dopamine (DA) pathway is hypothesized to mediate these effects of PCP, the precise mechanisms by which PCP induces its effects remain to be elucidated. The present study investigated the effect of PCP on extracellular levels of DA (DAex) in the striatum and prefrontal cortex (PFC) using in vivo microdialysis in mice lacking the NMDA receptor channel ε1 or ε4 subunit (GluRε1 [GluN2A] or GluRε4 [GluN2D]) and locomotor activity. PCP significantly increased DAex in wildtype and GluRε1 knockout mice, but not in GluRε4 knockout mice, in the striatum and PFC. Acute and repeated administration of PCP did not increase locomotor activity in GluRε4 knockout mice. The present results suggest that PCP enhances dopaminergic transmission and increases locomotor activity by acting at GluRε4. PMID:21060893

Cytoprotective Effect of Epigallocatechin Gallate (EGCG)-5'-O-α-Glucopyranoside, a Novel EGCG Derivative.

PubMed

Han, Sang Yun; Kim, Eunji; Hwang, Kyeonghwan; Ratan, Zubair Ahmed; Hwang, Hyunsik; Kim, Eun-Mi; Kim, Doman; Park, Junseong; Cho, Jae Youl

2018-05-15

Epigallocatechin gallate (EGCG) is a well-studied polyphenol with antioxidant effects. Since EGCG has low solubility and stability, many researchers have modified EGCG residues to ameliorate these problems. A novel EGCG derivative, EGCG-5'- O -α-glucopyranoside (EGCG-5'Glu), was synthesized, and its characteristics were investigated. EGCG-5'Glu showed antioxidant effects in cell and cell-free systems. Under SNP-derived radical exposure, EGCG-5'Glu decreased nitric oxide (NO) production, and recovered ROS-mediated cell viability. Moreover, EGCG-5'Glu regulated apoptotic pathways (caspases) and cell survival molecules (phosphoinositide 3-kinase (PI3K) and phosphoinositide-dependent kinase 1 (PDK1)). In another radical-induced condition, ultraviolet B (UVB) irradiation, EGCG-5'Glu protected cells from UVB and regulated the PI3K/PDK1/AKT pathway. Next, the proliferative effect of EGCG-5'Glu was examined. EGCG-5'Glu increased cell proliferation by modulating nuclear factor (NF)-κB activity. EGCG-5'Glu protects and repairs cells from external damage via its antioxidant effects. These results suggest that EGCG-5'Glu could be used as a cosmetics ingredient or dietary supplement.

Different metabotropic glutamate receptors play opposite roles in synaptic plasticity of the rat medial vestibular nuclei

PubMed Central

Grassi, Silvarosa; Frondaroli, Adele; Pettorossi, Vito Enrico

2002-01-01

In the medial vestibular nuclei (MVN) of rat brainstem slices, the role of group II and III metabotropic glutamate receptors (mGluRs) and of the subtypes of group I mGluRs: mGluR1, mGluR5, was investigated in basal synaptic transmission and in the induction and maintenance of long-term potentiation (LTP). We used selective antagonists and agonists for mGluRs and we analysed the field potentials evoked by vestibular afferent stimulation before and after high-frequency stimulation (HFS) to induce LTP. The group II and III mGluR antagonist, (R,S)-α-2-methyl-4sulphonophenylglycine (MSPG), induced LTP per se and caused a reduction of the paired-pulse facilitation (PPF) ratio indicating an enhancement of glutamate release. This suggests that group II and III mGluRs are activated under basal conditions to limit glutamate release. Both the group II and III mGluR selective antagonists, 2S-2-amino-2-(1S,2S-2-carboxycycloprop-1-yl)-3-(xanth-9-yl)propanoate (LY341495) and (R,S)-α-methylserine-O-phosphate (MSOP), induced LTP, and the selective agonists, (2R,4R)-4-aminopyrrolidine-2,4-dicarboxylate (APDC) and L(+)-2-amino-4-phosphonobutyric acid (L-AP4) depressed the field potentials and prevented HFS-LTP, with a prevailing contribution of group II mGluRs over that of group III mGluRs. The mGluR1 antagonist, 7-(hydroxyimino)cyclopropa[b]chromen-1a-carboxylate ethyl ester (CPCCOEt) prevented the full development and maintenance of HFS-LTP. By contrast, the mGluR5 antagonist, 2-methyl-6-phenylethynylpyridine (MPEP) induced LTP per se, which was impeded by CPCCOEt, and it had no effect on LTP once induced by HFS. The PPF analysis showed an enhancement of glutamate release during MPEP potentiation. The group I mGluR agonist, (R,S)-3,5-dihydroxyphenylglycine (DHPG) induced LTP per se, which was blocked by CPCCOEt. By contrast the mGluR5 agonist, (R,S)-2-chloro-5-hydroxypheylglycine (CHPG) prevented LTP elicited by HFS and DHPG as well. In conclusion vestibular LTP is inhibited by group II and III mGluRs during the early induction phase while it is facilitated by mGluR1 for achieving its full expression and consolidation. An additional inhibitory control is exerted by mGluR5 at the level of this facilitatory phase. PMID:12231639

Different metabotropic glutamate receptors play opposite roles in synaptic plasticity of the rat medial vestibular nuclei.

PubMed

Grassi, Silvarosa; Frondaroli, Adele; Pettorossi, Vito Enrico

2002-09-15

In the medial vestibular nuclei (MVN) of rat brainstem slices, the role of group II and III metabotropic glutamate receptors (mGluRs) and of the subtypes of group I mGluRs: mGluR1, mGluR5, was investigated in basal synaptic transmission and in the induction and maintenance of long-term potentiation (LTP). We used selective antagonists and agonists for mGluRs and we analysed the field potentials evoked by vestibular afferent stimulation before and after high-frequency stimulation (HFS) to induce LTP. The group II and III mGluR antagonist, (R,S)-alpha-2-methyl-4sulphonophenylglycine (MSPG), induced LTP per se and caused a reduction of the paired-pulse facilitation (PPF) ratio indicating an enhancement of glutamate release. This suggests that group II and III mGluRs are activated under basal conditions to limit glutamate release. Both the group II and III mGluR selective antagonists, 2S-2-amino-2-(1S,2S-2-carboxycycloprop-1-yl)-3-(xanth-9-yl)propanoate (LY341495) and (R,S)-alpha-methylserine-O-phosphate (MSOP), induced LTP, and the selective agonists, (2R,4R)-4-aminopyrrolidine-2,4-dicarboxylate (APDC) and L(+)-2-amino-4-phosphonobutyric acid (L-AP4) depressed the field potentials and prevented HFS-LTP, with a prevailing contribution of group II mGluRs over that of group III mGluRs. The mGluR1 antagonist, 7-(hydroxyimino)cyclopropa[b]chromen-1a-carboxylate ethyl ester (CPCCOEt) prevented the full development and maintenance of HFS-LTP. By contrast, the mGluR5 antagonist, 2-methyl-6-phenylethynylpyridine (MPEP) induced LTP per se, which was impeded by CPCCOEt, and it had no effect on LTP once induced by HFS. The PPF analysis showed an enhancement of glutamate release during MPEP potentiation. The group I mGluR agonist, (R,S)-3,5-dihydroxyphenylglycine (DHPG) induced LTP per se, which was blocked by CPCCOEt. By contrast the mGluR5 agonist, (R,S)-2-chloro-5-hydroxypheylglycine (CHPG) prevented LTP elicited by HFS and DHPG as well. In conclusion vestibular LTP is inhibited by group II and III mGluRs during the early induction phase while it is facilitated by mGluR1 for achieving its full expression and consolidation. An additional inhibitory control is exerted by mGluR5 at the level of this facilitatory phase.

Study on bamboo gluing performance numerical simulation

NASA Astrophysics Data System (ADS)

Zhao, Z. R.; Sun, W. H.; Sui, X. M.; Zhang, X. F.

2018-01-01

Bamboo gluing timber is a green building materials, can be widely used as modern building beams and columns. The existing bamboo gluing timber is usually produced by bamboo columns or bamboo bundle rolled into by bamboo columns. The performance of new bamboo gluing timber is decided by bamboo adhesion character. Based on this, the cohesive damage model of bamboo gluing is created, experiment results are used to validate the model. The model proposed in the work is agreed on the experimental results. Different bamboo bonding length and bamboo gluing performance is analysed. The model is helpful to bamboo integrated timber application.

Dynamic Changes in Striatal mGluR1 But Not mGluR5 during Pathological Progression of Parkinson's Disease in Human Alpha-Synuclein A53T Transgenic Rats: A Multi-PET Imaging Study.

PubMed

Yamasaki, Tomoteru; Fujinaga, Masayuki; Kawamura, Kazunori; Furutsuka, Kenji; Nengaki, Nobuki; Shimoda, Yoko; Shiomi, Satoshi; Takei, Makoto; Hashimoto, Hiroki; Yui, Joji; Wakizaka, Hidekatsu; Hatori, Akiko; Xie, Lin; Kumata, Katsushi; Zhang, Ming-Rong

2016-01-13

Parkinson's disease (PD) is a prevalent degenerative disorder affecting the CNS that is primarily characterized by resting tremor and movement deficits. Group I metabotropic glutamate receptor subtypes 1 and 5 (mGluR1 and mGluR5, respectively) are important targets for investigation in several CNS disorders. In the present study, we investigated the in vivo roles of mGluR1 and mGluR5 in chronic PD pathology by performing longitudinal positron emission tomography (PET) imaging in A53T transgenic (A53T-Tg) rats expressing an abnormal human α-synuclein (ASN) gene. A53T-Tg rats showed a dramatic decline in general motor activities with age, along with abnormal ASN aggregation and striatal neuron degeneration. In longitudinal PET imaging, striatal nondisplaceable binding potential (BPND) values for [(11)C]ITDM (N-[4-[6-(isopropylamino) pyrimidin-4-yl]-1,3-thiazol-2-yl]-N-methyl-4-[(11)C]methylbenzamide), a selective PET ligand for mGluR1, temporarily increased before PD symptom onset and dramatically decreased afterward with age. However, striatal BPND values for (E)-[(11)C]ABP688 [3-(6-methylpyridin-2-ylethynyl)-cyclohex-2-enone-(E)-O-[(11)C]methyloxime], a specific PET ligand for mGluR5, remained constant during experimental terms. The dynamic changes in striatal mGluR1 BPND values also showed a high correlation in pathological decreases in general motor activities. Furthermore, declines in mGluR1 BPND values were correlated with decreases in BPND values for [(18)F]FE-PE2I [(E)-N-(3-iodoprop-2E-enyl)-2β-carbo-[(18)F]fluoroethoxy-3β-(4-methylphenyl) nortropane], a specific PET ligand for the dopamine transporter, a biomarker for dopaminergic neurons. In conclusion, our results have demonstrated for the first time that dynamic changes occur in mGluR1, but not mGluR5, that accompany pathological progression in a PD animal model. Synaptic signaling by glutamate, the principal excitatory neurotransmitter in the brain, is modulated by group I metabotropic glutamate receptors, including the mGluR1 and mGluR5 subtypes. In the brain, mGluR1 and mGluR5 have distinct functional roles and regional distributions. Their roles in brain pathology, however, are not well characterized. Using longitudinal PET imaging in a chronic rat model of PD, we demonstrated that expression of mGluR1, but not mGluR5, dynamically changed in the striatum accompanying pathological PD progression. These findings imply that monitoring mGluR1 in vivo may provide beneficial information to further understand central nervous system disorders. Copyright © 2016 the authors 0270-6474/16/360376-10$15.00/0.

Effects of metabotropic glutamate receptor ligands on male sexual behavior in rats.

PubMed

Li, Xia; Higley, Amanda; Song, Rui; Xi, Zheng-Xiong

2013-03-01

Metabotropic glutamate receptors (mGluRs), particularly mGluR2/3, mGluR5 and mGluR7, have received much attention in medication development for the treatment of drug addiction and other neuropsychiatric diseases. However, little is known as to whether mGluR ligands also alter natural sexual behavior, a possible unwanted effect when used in humans. In the present study, we used classical copulatory behaviors to evaluate the effects of LY379268 (a selective mGluR2/3 agonist), MPEP (a selective mGluR5 antagonist) and AMN082 (a selective mGluR7 agonist), on male sexual performance in rats. We found that systemic administration of LY379268 (1, 3 mg/kg, i.p.) had no effect, while MPEP (20 mg/kg, but not 10 mg/kg, i.p.) and AMN082 (10, 20 mg/kg, but not 3 mg/kg) produced a significant and dose-dependent reduction in both sex-seeking and sex-performance behaviors, manifested as an increase in mount or intromission latency and time required for ejaculation, and a reduction in mount or intromission frequency. This inhibition lasted for about 30-60 min. These findings suggest that compounds that target mGluR5 or mGluR7, but not mGluR2/3, may have short-term inhibitory effects on male sexual performance. This article is part of a Special Issue entitled 'Metabotropic Glutamate Receptors'. Published by Elsevier Ltd.

Metabotropic Glutamate Receptor Subtype 7 in the Bed Nucleus of the Stria Terminalis is Essential for Intermale Aggression

PubMed Central

Masugi-Tokita, Miwako; Flor, Peter J; Kawata, Mitsuhiro

2016-01-01

Metabotropic glutamate receptor subtype 7 (mGluR7) is a member of group III mGluRs, which localize to the presynaptic active zones of the mammalian central nervous system. Although histological, genetic, and electrophysiological studies ensure the importance of mGluR7, its roles in behavior and physiology remain largely unknown. Using a resident–intruder paradigm, we found a severe reduction in intermale aggressive behavior in mGluR7 knockout (KO) mice. We also found alterations in other social behaviors in male mGluR7 KO mice, including sexual behavior toward male intruders. Because olfaction is critical for rodent social behavior, including aggression, we performed an olfaction test, finding that mGluR7 KO mice failed to show interest in the smell of male urine. To clarify the olfactory deficit, we then exposed mice to urine and analyzed c-Fos-immunoreactivity, discovering a remarkable reduction in neural activity in the bed nucleus of the stria terminalis (BNST) of mGluR7 KO mice. Finally, intra-BNST administration of the mGluR7-selective antagonist 6-(4-methoxyphenyl)-5-methyl-3-pyridin-4-ylisoxazolo[4,5-c]pyridin-4(5H)-one (MMPIP) also reproduced the phenotype of mGluR7 KO mice, including reduced aggression and altered social interaction. Thus mGluR7 may work as an ‘enhancer of neural activity' in the BNST and is important for intermale aggression. Our findings demonstrate that mGluR7 is essential for social behavior and innate behavior. Our study on mGluR7 in the BNST will shed light on future therapies for emotional disorders in humans. PMID:26149357

Shifting towards a model of mGluR5 dysregulation in schizophrenia: Consequences for future schizophrenia treatment.

PubMed

Matosin, Natalie; Fernandez-Enright, Francesca; Lum, Jeremy S; Newell, Kelly A

2017-03-15

Metabotropic glutamate receptor subtype 5 (mGluR5), encoded by the GRM5 gene, represents a compelling novel drug target for the treatment of schizophrenia. mGluR5 is a postsynaptic G-protein coupled glutamate receptor strongly linked with several critical cellular processes that are reported to be disrupted in schizophrenia. Accordingly, mGluR5 positive allosteric modulators show encouraging therapeutic potential in preclinical schizophrenia models, particularly for the treatment of cognitive dysfunctions against which currently available therapeutics are largely ineffective. More work is required to support the progression of mGluR5-targeting drugs into the clinic for schizophrenia treatment, although some obstacles may be overcome by comprehensively understanding how mGluR5 itself is involved in the neurobiology of the disorder. Several processes that are necessary for the regulation of mGluR5 activity have been identified, but not examined, in the context of schizophrenia. These processes include protein-protein interactions, dimerisation, subcellular trafficking, the impact of genetic variability or mutations on protein function, as well as epigenetic, post-transcriptional and post-translational processes. It is essential to understand these aspects of mGluR5 to determine whether they are affected in schizophrenia pathology, and to assess the consequences of mGluR5 dysfunction for the future use of mGluR5-based drugs. Here, we summarise the known processes that regulate mGluR5 and those that have already been studied in schizophrenia, and discuss the consequences of this dysregulation for current mGluR5 pharmacological strategies. This article is part of the Special Issue entitled 'Metabotropic Glutamate Receptors, 5 years on'. Copyright © 2015 Elsevier Ltd. All rights reserved.

Metabotropic glutamate receptor I (mGluR1) antagonism impairs cocaine-induced conditioned place preference via inhibition of protein synthesis.

PubMed

Yu, Fei; Zhong, Peng; Liu, Xiaojie; Sun, Dalong; Gao, Hai-Qing; Liu, Qing-Song

2013-06-01

Antagonism of group I metabotropic glutamate receptors (mGluR1 and mGluR5) reduces behavioral effects of drugs of abuse, including cocaine. However, the underlying mechanisms remain poorly understood. Activation of mGluR5 increases protein synthesis at synapses. Although mGluR5-induced excessive protein synthesis has been implicated in the pathology of fragile X syndrome, it remains unknown whether group I mGluR-mediated protein synthesis is involved in any behavioral effects of drugs of abuse. We report that group I mGluR agonist DHPG induced more pronounced initial depression of inhibitory postsynaptic currents (IPSCs) followed by modest long-term depression (I-LTD) in dopamine neurons of rat ventral tegmental area (VTA) through the activation of mGluR1. The early component of DHPG-induced depression of IPSCs was mediated by the cannabinoid CB1 receptors, while DHPG-induced I-LTD was dependent on protein synthesis. Western blotting analysis indicates that mGluR1 was coupled to extracellular signal-regulated kinase (ERK) and mammalian target of rapamycin (mTOR) signaling pathways to increase translation. We also show that cocaine conditioning activated translation machinery in the VTA via an mGluR1-dependent mechanism. Furthermore, intra-VTA microinjections of mGluR1 antagonist JNJ16259685 and protein synthesis inhibitor cycloheximide significantly attenuated or blocked the acquisition of cocaine-induced conditioned place preference (CPP) and activation of translation elongation factors. Taken together, these results suggest that mGluR1 antagonism inhibits de novo protein synthesis; this effect may block the formation of cocaine-cue associations and thus provide a mechanism for the reduction in CPP to cocaine.

The levels of the GluN2A NMDA receptor subunit are modified in both the neonatal and adult rat brain by an early experience involving denial of maternal contact.

PubMed

Manatos, V; Stylianopoulou, F; Stamatakis, A

2016-01-26

The composition of the N-methyl-d-aspartate receptor receptor in GluN2A/GluN2B subunits is important in determining its characteristics and its role in plasticity, a property of the brain which is known to be critically affected by early experiences. In the present work we employed an early experience model involving either receipt (RER) or denial (DER) of the expected reward of maternal contact within the context of learning by the pups of a T-maze on postnatal days (PND) 10-13. We investigated the effects of the RER and DER early experiences on GluN1, GluN2A and GluN2B levels in the prefrontal cortex (PFC), hippocampus and amygdala of the rat. We show that on PND13 the DER animals had lower GluN2A levels in the PFC. In adulthood DER males had higher GluN2A levels in the hippocampus, both under basal conditions and after exposure to a novel environment. The early experiences did not affect the response to the novelty. After exposure to a novel environment animals of all three groups (DER, RER, Control) responded with an increase in GluN2A levels in the brain areas examined. We did not detect any effects on GluN1 or GluN2B levels. The alterations in GluN2A levels observed in the DER animals could in part be responsible for their behavioral phenotype, described previously, which includes an increased susceptibility for the expression of depressive-like behavior. Copyright © 2015. Published by Elsevier Ireland Ltd.

Immunohistochemical localization of ionotropic glutamate receptors in the rat red nucleus

PubMed Central

Minbay, Zehra; Kocoglu, Sema Serter; Yurtseven, Duygu Gok; Eyigor, Ozhan

2017-01-01

In this study, we aimed to determine the presence as well as the diverse distribution of N-methyl-D-aspartate (NMDA) and non-NMDA glutamate receptor subunits in the rat red nucleus. Using adult Sprague-Dawley rats as the experimental animals, immunohistochemistry was performed on 30 µm thick coronal brain sections with antibodies against α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (GluA1-4), kainate (GluK1, GluK2/3, and GluK5), and NMDA (GluN1 and GluN2A) receptor subunits. The results showed that all ionotropic glutamate receptor subunits are expressed in the red nucleus. Specific staining was localized in the neuron bodies and processes. However, the pattern of immunoreactivity and the number of labeled neurons changed depending on the type of ionotropic glutamate receptor subunits and the localization of neurons in the red nucleus. The neurons localized in the magnocellular part of the red nucleus were particularly immunopositive for GluA2, GluA4, GluK2/3, GluK5, GluN1, and GluN2A receptor proteins. In the parvocellular part of the red nucleus, ionotropic glutamate receptor subunit immunoreactivity of variable intensity (lightly to moderately stained) was detected in the neurons. These results suggest that red nucleus neurons in rat heterogeneously express ionotropic glutamate receptor subunits to form functional receptor channels. In addition, the likelihood of the coexpression of different subunits in the same subgroup of neurons suggests the formation of receptor channels with diverse structure by way of different subunit combination, and the possibility of various neuronal functions through these channels in the red nucleus. PMID:28027456

Immunohistochemical localization of ionotropic glutamate receptors in the rat red nucleus.

PubMed

Minbay, Zehra; Serter Kocoglu, Sema; Gok Yurtseven, Duygu; Eyigor, Ozhan

2017-02-21

In this study, we aimed to determine the presence as well as the diverse distribution of N-methyl-D-aspartate (NMDA) and non-NMDA glutamate receptor subunits in the rat red nucleus. Using adult Sprague-Dawley rats as the experimental animals, immunohistochemistry was performed on 30 µm thick coronal brain sections with antibodies against α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (GluA1-4), kainate (GluK1, GluK2/3, and GluK5), and NMDA (GluN1 and GluN2A) receptor subunits. The results showed that all ionotropic glutamate receptor subunits are expressed in the red nucleus. Specific staining was localized in the neuron bodies and processes. However, the pattern of immunoreactivity and the number of labeled neurons changed depending on the type of ionotropic glutamate receptor subunits and the localization of neurons in the red nucleus. The neurons localized in the magnocellular part of the red nucleus were particularly immunopositive for GluA2, GluA4, GluK2/3, GluK5, GluN1, and GluN2A receptor proteins. In the parvocellular part of the red nucleus, ionotropic glutamate receptor subunit immunoreactivity of variable intensity (lightly to moderately stained) was detected in the neurons. These results suggest that red nucleus neurons in rat heterogeneously express ionotropic glutamate receptor subunits to form functional receptor channels. In addition, the likelihood of the coexpression of different subunits in the same subgroup of neurons suggests the formation of receptor channels with diverse structure by way of different subunit combination, and the possibility of various neuronal functions through these channels in the red nucleus.

High affinity kainate receptor subunits are necessary for ionotropic but not metabotropic signaling

PubMed Central

Fernandes, Herman B.; Catches, Justin S.; Petralia, Ronald S.; Copits, Bryan A.; Xu, Jian; Russell, Theron A.; Swanson, Geoffrey T.; Contractor, Anis

2009-01-01

Summary Kainate receptors are atypical members of the glutamate receptor family which are able to signal through both ionotropic and metabotropic pathways. Of the five individual kainate receptor subunits the high-affinity subunits, GluK4 (KA1) and GluK5 (KA2), are unique in that they do not form functional homomeric receptors in recombinant expression systems, but combine with the primary subunits GluK1-3 (GluR5-7) to form heteromeric assemblies. Here we generated a GluK4 mutant mouse by disrupting the Grik4 gene locus. We found that loss of the GluK4 subunit leads to a significant reduction in synaptic kainate receptor currents. Moreover, ablation of both high-affinity subunits in GluK4/GluK5 double knockout mice leads to a complete loss of pre- and postsynaptic ionotropic function of synaptic kainate receptors. The principal subunits remain at the synaptic plasma membrane, but are distributed away from postsynaptic densities and presynaptic active zones. There is also an alteration in the properties of the remaining kainate receptors, as kainic acid application fails to elicit responses in GluK4/GluK5 knockout neurons. Despite the lack of detectable ionotropic synaptic receptors, the kainate receptor-mediated inhibition of the slow afterhyperpolarization current (IsAHP), which is dependent on metabotropic pathways, was intact in GluK4/GluK5 knockout mice. These results uncover a previously unknown critical role for the high-affinity kainate receptor subunits as obligatory components of ionotropic kainate receptor function, and further, demonstrate that kainate receptor participation in metabotropic signaling pathways does not require their classic role as ion channels. PMID:19778510

Analysis of Glu-1 deletion lines reveals the importance of high molecular weight glutenin subunits 7+9 Glu-B1 in wheat flour tortilla making

USDA-ARS?s Scientific Manuscript database

High molecular weight glutenin subunits (HMW-GS) play a significant role in the functional properties of wheat flour. Wheat lines in which one or more of the HMW-GS alleles were absent from Glu-A1, Glu-B1 or Glu-D1 loci (deletion lines) were compared with non-deletion lines for dough and tortilla ma...

MPX-004 and MPX-007: New Pharmacological Tools to Study the Physiology of NMDA Receptors Containing the GluN2A Subunit.

PubMed

Volkmann, Robert A; Fanger, Christopher M; Anderson, David R; Sirivolu, Venkata Ramana; Paschetto, Kathy; Gordon, Earl; Virginio, Caterina; Gleyzes, Melanie; Buisson, Bruno; Steidl, Esther; Mierau, Susanna B; Fagiolini, Michela; Menniti, Frank S

2016-01-01

GluN2A is the most abundant of the GluN2 NMDA receptor subunits in the mammalian CNS. Physiological and genetic evidence implicate GluN2A-containing receptors in susceptibility to autism, schizophrenia, childhood epilepsy and neurodevelopmental disorders such as Rett Syndrome. However, GluN2A-selective pharmacological probes to explore the therapeutic potential of targeting these receptors have been lacking. Here we disclose a novel series of pyrazine-containing GluN2A antagonists exemplified by MPX-004 (5-(((3-chloro-4-fluorophenyl)sulfonamido)methyl)-N-((2-methylthiazol-5-yl)methyl)pyrazine-2-carboxamide) and MPX-007 (5-(((3-fluoro-4-fluorophenyl)sulfonamido)methyl)-N-((2-methylthiazol-5-yl)methyl)methylpyrazine-2-carboxamide). MPX-004 and MPX-007 inhibit GluN2A-containing NMDA receptors expressed in HEK cells with IC50s of 79 nM and 27 nM, respectively. In contrast, at concentrations that completely inhibited GluN2A activity these compounds have no inhibitory effect on GluN2B or GluN2D receptor-mediated responses in similar HEK cell-based assays. Potency and selectivity were confirmed in electrophysiology assays in Xenopus oocytes expressing GluN2A-D receptor subtypes. Maximal concentrations of MPX-004 and MPX-007 inhibited ~30% of the whole-cell current in rat pyramidal neurons in primary culture and MPX-004 inhibited ~60% of the total NMDA receptor-mediated EPSP in rat hippocampal slices. GluN2A-selectivity at native receptors was confirmed by the finding that MPX-004 had no inhibitory effect on NMDA receptor mediated synaptic currents in cortical slices from GRIN2A knock out mice. Thus, MPX-004 and MPX-007 offer highly selective pharmacological tools to probe GluN2A physiology and involvement in neuropsychiatric and developmental disorders.

The number and distribution of AMPA receptor channels containing fast kinetic GluA3 and GluA4 subunits at auditory nerve synapses depend on the target cells.

PubMed

Rubio, María E; Matsui, Ko; Fukazawa, Yugo; Kamasawa, Naomi; Harada, Harumi; Itakura, Makoto; Molnár, Elek; Abe, Manabu; Sakimura, Kenji; Shigemoto, Ryuichi

2017-11-01

The neurotransmitter receptor subtype, number, density, and distribution relative to the location of transmitter release sites are key determinants of signal transmission. AMPA-type ionotropic glutamate receptors (AMPARs) containing GluA3 and GluA4 subunits are prominently expressed in subsets of neurons capable of firing action potentials at high frequencies, such as auditory relay neurons. The auditory nerve (AN) forms glutamatergic synapses on two types of relay neurons, bushy cells (BCs) and fusiform cells (FCs) of the cochlear nucleus. AN-BC and AN-FC synapses have distinct kinetics; thus, we investigated whether the number, density, and localization of GluA3 and GluA4 subunits in these synapses are differentially organized using quantitative freeze-fracture replica immunogold labeling. We identify a positive correlation between the number of AMPARs and the size of AN-BC and AN-FC synapses. Both types of AN synapses have similar numbers of AMPARs; however, the AN-BC have a higher density of AMPARs than AN-FC synapses, because the AN-BC synapses are smaller. A higher number and density of GluA3 subunits are observed at AN-BC synapses, whereas a higher number and density of GluA4 subunits are observed at AN-FC synapses. The intrasynaptic distribution of immunogold labeling revealed that AMPAR subunits, particularly GluA3, are concentrated at the center of the AN-BC synapses. The central distribution of AMPARs is absent in GluA3-knockout mice, and gold particles are evenly distributed along the postsynaptic density. GluA4 gold labeling was homogenously distributed along both synapse types. Thus, GluA3 and GluA4 subunits are distributed at AN synapses in a target-cell-dependent manner.

Variability in glutenin subunit composition of Mediterranean durum wheat germplasm and its relationship with gluten strength.

PubMed

Nazco, R; Peña, R J; Ammar, K; Villegas, D; Crossa, J; Moragues, M; Royo, C

2014-06-01

The allelic composition at five glutenin loci was assessed by one-dimensional sodium dodecyl sulphate polyacrylamide gel electrophoresis (1D SDS-PAGE) on a set of 155 landraces (from 21 Mediterranean countries) and 18 representative modern varieties. Gluten strength was determined by SDS-sedimentation on samples grown under rainfed conditions during 3 years in north-eastern Spain. One hundred and fourteen alleles/banding patterns were identified (25 at Glu-1 and 89 at Glu-2 / Glu-3 loci); 0·85 of them were in landraces at very low frequency and 0·72 were unreported. Genetic diversity index was 0·71 for landraces and 0·38 for modern varieties. All modern varieties exhibited medium to strong gluten type with none of their 13 banding patterns having a significant effect on gluten-strength type. Ten banding patterns significantly affected gluten strength in landraces. Alleles Glu-B1e (band 20), Glu-A3a (band 6), Glu-A3d (bands 6 + 11), Glu-B3a (bands 2 + 4+15 + 19) and Glu-B2a (band 12) significantly increased the SDS-value, and their effects were associated with their frequency. Two alleles, Glu-A3b (band 5) and Glu-B2b (null), significantly reduced gluten strength, but only the effect of the latter locus could be associated with its frequency. Only three rare banding patterns affected gluten strength significantly: Glu-B1a (band 7), found in six landraces, had a negative effect, whereas banding patterns 2 + 4+14 + 15 + 18 and 2 + 4+15 + 18 + 19 at Glu-B3 had a positive effect. Landraces with outstanding gluten strength were more frequent in eastern than in western Mediterranean countries. The geographical pattern displayed from the frequencies of Glu-A1c is discussed.

Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus

PubMed Central

Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo

2007-01-01

Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC50 values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins. PMID:17881566

Loss of dysbindin-1, a risk gene for schizophrenia, leads to impaired group 1 metabotropic glutamate receptor function in mice

PubMed Central

Bhardwaj, Sanjeev K.; Ryan, Richard T.; Wong, Tak Pan; Srivastava, Lalit K.

2015-01-01

The expression of dysbindin-1, a protein coded by the risk gene dtnbp1, is reduced in the brains of schizophrenia patients. Evidence indicates a role of dysbindin-1 in dopaminergic and glutamatergic transmission. Glutamatergic transmission and plasticity at excitatory synapses is critically regulated by G-protein coupled metabotropic glutamate receptor (mGluR) family members, that have been implicated in schizophrenia. Here, we report a role of dysbindin-1 in hippocampal group 1 mGluR (mGluRI) function in mice. In hippocampal synaptoneurosomal preparations from sandy (sdy) mice, that have a loss of function mutation in dysbindin-1 gene, we observed a striking reduction in mGluRI agonist [(S)-3, 5-dihydroxyphenylglycine] (DHPG)-induced phosphorylation of extracellular signal regulated kinase 1/2 (ERK1/2). This mGluR-ERK1/2 deficit occurred in the absence of significant changes in protein levels of the two members of the mGluRI family (i.e., mGluR1 and mGluR5) or in another mGluRI signaling pathway, i.e., protein kinase C (PKC). Aberrant mGluRI-ERK1/2 signaling affected hippocampal synaptic plasticity in the sdy mutants as DHPG-induced long-term depression (LTD) at CA1 excitatory synapses was significantly reduced. Behavioral data suggest that the mGluRI hypofunction may underlie some of the cognitive abnormalities described in sdy mice as the administration of CDPPB (3-cyano-N-(1, 3-diphenyl-1H-pyrazol-5-yl benzamide), a positive allosteric modulator of mGluR5, rescued short-term object recognition and spatial learning and memory deficits in these mice. Taken together, our data suggest a novel role of dysbindin-1 in regulating mGluRI functions. PMID:25859193

Straight-chain alcohols exhibit a cutoff in potency for the inhibition of recombinant glutamate receptor subunits

PubMed Central

Akinshola, B Emmanuel

2001-01-01

The effects of n-alcohols (methanol to 1-decanol) on kainate-activated AMPA receptor subunit GluR1 and GluR3 ion currents were studied in Xenopus oocytes using the two-electrode voltage-clamp recording technique. For short-chain alcohols from methanol to 1-hexanol, potency for inhibition of GluR1 and GluR3 receptor-mediated current increased in proportion to the chain length or hydrophobicity of the alcohol. The IC50 values of these alcohols for GluR1 were: methanol, 702 mM; ethanol, 170 mM; 1-propanol, 69 mM; 1-butanol, 20 mM; 1-pentanol, 17 mM; and 1-hexanol, 10 mM. For GluR3, IC50 values were: methanol, 712 mM; ethanol, 238 mM; 1-propanol, 50 mM; 1-butanol, 32 mM; 1-pentanol, 13 mM; and 1-hexanol, 7 mM. For long-chain alcohols, 1-heptanol was less potent than 1-hexanol (estimated IC50: 19 mM for GluR1 and 18 mM for GluR3), 1-octanol had little effect only on GluR3, and 1-nonanol and 1-decanol did not significantly inhibit both GluR1 and GluR3 responses. The observations indicate that straight-chain n-alcohols exhibit a cutoff in their potency for inhibition of the function of non-NMDA glutamate receptor subunits, GluR1 and GluR3. The cutoff in potency of n-alcohols for inhibition of non-NMDA glutamate receptor function is consistent with the interpretation that alcohols affect the function of these receptor-channels by interacting with an alcohol binding site of specific dimensions on the receptor protein. PMID:11429388

Expression of a novel gene, gluP, is essential for normal Bacillus subtilis cell division and contributes to glucose export

PubMed Central

Mesak, Lili R; Mesak, Felix M; Dahl, Michael K

2004-01-01

Background The Bacillus subtilis glucokinase operon was predicted to be comprised of the genes, yqgP (now named gluP), yqgQ, and glcK. We have previously established a role for glcK in glucose metabolism. In the absence of enzymes that phosphorylate glucose, such as GlcK and/or enzyme IIGlc, accumulated cytoplasmic glucose can be transported out of the cell. Genes within the glucokinase operon were not previously known to play a role in glucose transport. Here we describe the expression of gluP and its function in glucose transport. Results We found that transcription of the glucokinase operon was regulated, putatively, by two promoters: σA and σH. Putative σA and σH-recognition sites were located upstream of and within gluP, respectively. Transcriptional glucokinase operon – lacZ fusions and Northern blotting were used to analyze the expression of gluP. GluP was predicted to be an integral membrane protein. Moreover, the prediction of GluP structure revealed interesting signatures: a rhomboid domain and two tetracopeptide repeat (TPR) motifs. Microscopic analysis showed that GluP minus cells were unable to divide completely, resulting in a filamentous phenotype. The cells were grown in either rich or minimal medium. We found GluP may be involved in glucose transport. [14C]-glucose uptake by the GluP minus strain was slightly less than in the wild type. On the other hand, trehalose-derived glucose in the growth medium of the GluP minus strain was detected in very low amounts. Experimental controls comprised of single or multiple genes mutations within the glucose transporting phosphotransferase system. Conclusions gluP seems to be regulated only by a putative σA-dependent promoter. The glucose uptake and export assays suggest that GluP is important for glucose export and may act as an exporter. This also supports the role of the glucokinase operon in glucose utilization. PMID:15050034

Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus.

PubMed

Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo

2007-09-25

Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC(50) values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins.

The low binding affinity of D-serine at the ionotropic glutamate receptor GluD2 can be attributed to the hinge region

NASA Astrophysics Data System (ADS)

Tapken, Daniel; Steffensen, Thomas Bielefeldt; Leth, Rasmus; Kristensen, Lise Baadsgaard; Gerbola, Alexander; Gajhede, Michael; Jørgensen, Flemming Steen; Olsen, Lars; Kastrup, Jette Sandholm

2017-04-01

Ionotropic glutamate receptors (iGluRs) are responsible for most of the fast excitatory communication between neurons in our brain. The GluD2 receptor is a puzzling member of the iGluR family: It is involved in synaptic plasticity, plays a role in human diseases, e.g. ataxia, binds glycine and D-serine with low affinity, yet no ligand has been discovered so far that can activate its ion channel. In this study, we show that the hinge region connecting the two subdomains of the GluD2 ligand-binding domain is responsible for the low affinity of D-serine, by analysing GluD2 mutants with electrophysiology, isothermal titration calorimetry and molecular dynamics calculations. The hinge region is highly variable among iGluRs and fine-tunes gating activity, suggesting that in GluD2 this region has evolved to only respond to micromolar concentrations of D-serine.

The low binding affinity of D-serine at the ionotropic glutamate receptor GluD2 can be attributed to the hinge region.

PubMed

Tapken, Daniel; Steffensen, Thomas Bielefeldt; Leth, Rasmus; Kristensen, Lise Baadsgaard; Gerbola, Alexander; Gajhede, Michael; Jørgensen, Flemming Steen; Olsen, Lars; Kastrup, Jette Sandholm

2017-04-07

Ionotropic glutamate receptors (iGluRs) are responsible for most of the fast excitatory communication between neurons in our brain. The GluD2 receptor is a puzzling member of the iGluR family: It is involved in synaptic plasticity, plays a role in human diseases, e.g. ataxia, binds glycine and D-serine with low affinity, yet no ligand has been discovered so far that can activate its ion channel. In this study, we show that the hinge region connecting the two subdomains of the GluD2 ligand-binding domain is responsible for the low affinity of D-serine, by analysing GluD2 mutants with electrophysiology, isothermal titration calorimetry and molecular dynamics calculations. The hinge region is highly variable among iGluRs and fine-tunes gating activity, suggesting that in GluD2 this region has evolved to only respond to micromolar concentrations of D-serine.

The low binding affinity of D-serine at the ionotropic glutamate receptor GluD2 can be attributed to the hinge region

PubMed Central

Tapken, Daniel; Steffensen, Thomas Bielefeldt; Leth, Rasmus; Kristensen, Lise Baadsgaard; Gerbola, Alexander; Gajhede, Michael; Jørgensen, Flemming Steen; Olsen, Lars; Kastrup, Jette Sandholm

2017-01-01

Ionotropic glutamate receptors (iGluRs) are responsible for most of the fast excitatory communication between neurons in our brain. The GluD2 receptor is a puzzling member of the iGluR family: It is involved in synaptic plasticity, plays a role in human diseases, e.g. ataxia, binds glycine and D-serine with low affinity, yet no ligand has been discovered so far that can activate its ion channel. In this study, we show that the hinge region connecting the two subdomains of the GluD2 ligand-binding domain is responsible for the low affinity of D-serine, by analysing GluD2 mutants with electrophysiology, isothermal titration calorimetry and molecular dynamics calculations. The hinge region is highly variable among iGluRs and fine-tunes gating activity, suggesting that in GluD2 this region has evolved to only respond to micromolar concentrations of D-serine. PMID:28387240

PICK1 interacts with ABP/GRIP to regulate AMPA receptor trafficking.

PubMed

Lu, Wei; Ziff, Edward B

2005-08-04

PICK1 and ABP/GRIP bind to the AMPA receptor (AMPAR) GluR2 subunit C terminus. Transfer of the receptor from ABP/GRIP to PICK1, facilitated by GluR2 S880 phosphorylation, may initiate receptor trafficking. Here we report protein interactions that regulate these steps. The PICK1 BAR domain interacts intermolecularly with the ABP/GRIP linker II region and intramolecularly with the PICK1 PDZ domain. Binding of PKCalpha or GluR2 to the PICK1 PDZ domain disrupts the intramolecular interaction and facilitates the PICK1 BAR domain association with ABP/GRIP. Interference with the PICK1-ABP/GRIP interaction impairs S880 phosphorylation of GluR2 by PKC and decreases the constitutive surface expression of GluR2, the NMDA-induced endocytosis of GluR2, and recycling of internalized GluR2. We suggest that the PICK1 interaction with ABP/GRIP is a critical step in controlling GluR2 trafficking.

The role of GluN2A and GluN2B NMDA receptor subunits in AgRP and POMC neurons on body weight and glucose homeostasis.

PubMed

Üner, Aykut; Gonçalves, Gabriel H M; Li, Wenjing; Porceban, Matheus; Caron, Nicole; Schönke, Milena; Delpire, Eric; Sakimura, Kenji; Bjørbæk, Christian

2015-10-01

Hypothalamic agouti-related peptide (AgRP) and pro-opiomelanocortin (POMC) expressing neurons play critical roles in control of energy balance. Glutamatergic input via n-methyl-d-aspartate receptors (NMDARs) is pivotal for regulation of neuronal activity and is required in AgRP neurons for normal body weight homeostasis. NMDARs typically consist of the obligatory GluN1 subunit and different GluN2 subunits, the latter exerting crucial differential effects on channel activity and neuronal function. Currently, the role of specific GluN2 subunits in AgRP and POMC neurons on whole body energy and glucose balance is unknown. We used the cre-lox system to genetically delete GluN2A or GluN2B only from AgRP or POMC neurons in mice. Mice were then subjected to metabolic analyses and assessment of AgRP and POMC neuronal function through morphological studies. We show that loss of GluN2B from AgRP neurons reduces body weight, fat mass, and food intake, whereas GluN2B in POMC neurons is not required for normal energy balance control. GluN2A subunits in either AgRP or POMC neurons are not required for regulation of body weight. Deletion of GluN2B reduces the number of AgRP neurons and decreases their dendritic length. In addition, loss of GluN2B in AgRP neurons of the morbidly obese and severely diabetic leptin-deficient Lep (ob/ob) mice does not affect body weight and food intake but, remarkably, leads to full correction of hyperglycemia. Lep (ob/ob) mice lacking GluN2B in AgRP neurons are also more sensitive to leptin's anti-obesity actions. GluN2B-containing NMDA receptors in AgRP neurons play a critical role in central control of body weight homeostasis and blood glucose balance via mechanisms that likely involve regulation of AgRP neuronal survival and structure, and modulation of hypothalamic leptin action.

Developmental shift from long-term depression to long-term potentiation in the rat medial vestibular nuclei: role of group I metabotropic glutamate receptors

PubMed Central

Puyal, Julien; Grassi, Silvarosa; Dieni, Cristina; Frondaroli, Adele; Demêmes, Danielle; Raymond, Jaqueline; Pettorossi, Vito Enrico

2003-01-01

The effects of high frequency stimulation (HFS) of the primary vestibular afferents on synaptic transmission in the ventral part of the medial vestibular nuclei (vMVN) were studied during postnatal development and compared with the changes in the expression of the group I metabotropic glutamate receptor (mGluR) subtypes, mGluR1 and mGluR5. During the first stages of development, HFS always induced a mGluR5- and GABAA-dependent long-term depression (LTD) which did not require NMDA receptor and mGluR1 activation. The probability of inducing LTD decreased progressively throughout the development and it was zero at about the end of the second postnatal week. Conversely, long-term potentiation (LTP) appeared at the beginning of the second week and its occurrence increased to reach the adult value at the end of the third week. Of interest, the sudden change in the LTP frequency occurred at the time of eye opening, about the end of the second postnatal week. LTP depended on NMDA receptor and mGluR1 activation. In parallel with the modifications in synaptic plasticity, we observed that the expression patterns and localizations of mGluR5 and mGluR1 in the medial vestibular nuclei (MVN) changed during postnatal development. At the earlier stages the mGluR1 expression was minimal, then increased progressively. In contrast, mGluR5 expression was initially high, then decreased. While mGluR1 was exclusively localized in neuronal compartments and concentrated at the postsynaptic sites at all stages observed, mGluR5 was found mainly in neuronal compartments at immature stages, then preferentially in glial compartments at mature stages. These results provide the first evidence for a progressive change from LTD to LTP accompanied by a distinct maturation expression of mGluR1 and mGluR5 during the development of the MVN. PMID:12972627

Metabotropic glutamate receptor subtype 7 has critical roles in regulation of the endocrine system and social behaviours.

PubMed

Masugi-Tokita, M; Yoshida, T; Kageyama, S; Kawata, M; Kawauchi, A

2018-03-01

Metabotropic glutamate receptor subtype 7 (mGluR7) is one of the group III mGluRs, which are negatively coupled to adenylate cyclase via Gi/Go proteins and localised to presynaptic active zones of the mammalian central nervous system. We previously reported that mGluR7 is essential for intermale aggression and amygdala-dependent fear learning. To elucidate the role of mGluR7 in the neuroendocrine system, we performed biochemical analyses and found a significant reduction of testosterone levels in mGluR7 knockout (KO) mice. Testosterone replacement restored intermale aggressive behaviour in castrated wild-type mice to the level of gonadally intact wild-type mice. However, given the same dosage of testosterone replacement, mGluR7 KO mice showed almost no aggressive behaviour. These results indicate that reduction of plasma testosterone is unrelated to the deficit in intermale aggression in mGluR7 KO mice. Social investigating behaviour of intact mGluR7 KO mice also differed from that of wild-type mice; e.g. the KO mice showing less frequent anogenital sniffing and more frequent grooming behaviour. Testosterone replacement increased anogenital sniffing and grooming behaviour in castrated mGluR7 KO mice, while the differences were still present between castrated wild-type mice and KO mice after both underwent testosterone replacement. These results imply that reduction of plasma testosterone may partially inhibit social investigating behaviours in intact mGluR7 KO mice. Furthermore, castrated mGluR7 KO mice have smaller seminal vesicles than those of castrated wild-type mice, although seminal vesicle weights were normal in intact mice. These observations suggest that, besides testicular testosterone, some other hormone levels may be dysregulated in mGluR7 KO mice, and indicate a critical role of mGluR7 in the endocrine system. Taken together, our findings demonstrate that mGluR7 is essential for the regulation of the endocrine system, in addition to innate behaviours such as intermale aggression and fear response. © 2018 British Society for Neuroendocrinology.

Digestive physiology of the pig symposium: detection of dietary glutamate via gut-brain axis.

PubMed

Bannai, M; Torii, K

2013-05-01

Gustatory and visceral stimulation from food regulates digestion and nutrient use. Free L-glutamate (Glu) release from digested protein is responsible for umami taste perception in the gut. Moreover, monosodium Glu (MSG) is widely used as a flavor enhancer to add umami taste in various cuisines. Recent studies indicate that dietary Glu sensors and their signal transduction system exist in both gut mucosa and taste cells. Oral Glu sensing has been well studied. In this review, we focus on the role of Glu on digestion and absorption of food. Infusion of Glu into the stomach and intestine increase afferent nerve activity of the gastric and the celiac branches of the vagus nerve, respectively. Luminal Glu also evokes efferent nerve activation of the abdominal vagus nerve branches simultaneously. Additionally, intragastric infusion of Glu activates the insular cortex, limbic system, hypothalamus, nucleus tractus solitaries, and amygdala, as determined by functional magnetic resonance imaging, and is able to induce flavor-preference learning as a result of postingestive effects in rats. These results indicate that Glu signaling via gustatory and visceral pathways plays an important role in the processes of digestion, absorption, metabolism, and other physiological functions via activation of the brain.

Ligand-specific Deactivation Time Course of GluN1/GluN2D NMDA Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

K Vance; N Simorowski; S Traynelis

2011-12-31

N-methyl-D-aspartate (NMDA) receptors belong to the family of ionotropic glutamate receptors that mediate a majority of excitatory synaptic transmission. One unique property of GluN1/GluN2D NMDA receptors is an unusually prolonged deactivation time course following the removal of L-glutamate. Here we show, using x-ray crystallography and electrophysiology, that the deactivation time course of GluN1/GluN2D receptors is influenced by the conformational variability of the ligand-binding domain (LBD) as well as the structure of the activating ligand. L-glutamate and L-CCG-IV induce significantly slower deactivation time courses compared with other agonists. Crystal structures of the isolated GluN2D LBD in complex with various ligands revealmore » that the binding of L-glutamate induces a unique conformation at the backside of the ligand-binding site in proximity to the region at which the transmembrane domain would be located in the intact receptors. These data suggest that the activity of the GluN1/GluN2D NMDA receptor is controlled distinctively by the endogenous neurotransmitter L-glutamate.« less

Glycine Potentiates AMPA Receptor Function through Metabotropic Activation of GluN2A-Containing NMDA Receptors

PubMed Central

Li, Li-Jun; Hu, Rong; Lujan, Brendan; Chen, Juan; Zhang, Jian-Jian; Nakano, Yasuko; Cui, Tian-Yuan; Liao, Ming-Xia; Chen, Jin-Cao; Man, Heng-Ye; Feng, Hua; Wan, Qi

2016-01-01

NMDA receptors are Ca2+-permeable ion channels. The activation of NMDA receptors requires agonist glutamate and co-agonist glycine. Recent evidence indicates that NMDA receptor also has metabotropic function. Here we report that in cultured mouse hippocampal neurons, glycine increases AMPA receptor-mediated currents independent of the channel activity of NMDA receptors and the activation of glycine receptors. The potentiation of AMPA receptor function by glycine is antagonized by the inhibition of ERK1/2. In the hippocampal neurons and in the HEK293 cells transfected with different combinations of NMDA receptors, glycine preferentially acts on GluN2A-containing NMDA receptors (GluN2ARs), but not GluN2B-containing NMDA receptors (GluN2BRs), to enhance ERK1/2 phosphorylation independent of the channel activity of GluN2ARs. Without requiring the channel activity of GluN2ARs, glycine increases AMPA receptor-mediated currents through GluN2ARs. Thus, these results reveal a metabotropic function of GluN2ARs in mediating glycine-induced potentiation of AMPA receptor function via ERK1/2 activation. PMID:27807405

Bidirectional regulation of neurite elaboration by alternatively spliced metabotropic glutamate receptor 5 (mGluR5) isoforms.

PubMed

Mion, S; Corti, C; Neki, A; Shigemoto, R; Corsi, M; Fumagalli, G; Ferraguti, F

2001-06-01

Alternative splicing in the mGluR5 gene generates two different receptor isoforms, of which expression is developmentally regulated. However, little is known about the functional significance of mGluR5 splice variants. We have examined the functional coupling, subcellular targeting, and effect on neuronal differentiation of epitope-tagged mGluR5 isoforms by expression in neuroblastoma NG108-15 cells. We found that both mGluR5 splice variants give rise to comparable [Ca2+]i transients and have similar pharmacological profile. Tagged receptors were shown by immunofluorescence to be inserted in the plasma membrane. In undifferentiated cells the subcellular localization of the two mGluR5 isoforms was partially segregated, whereas in differentiated cells the labeling largely redistributed to the newly formed neurites. Interestingly, we demonstrate that mGluR5 splice variants dramatically influence the formation and maturation of neurites; mGluR5a hinders the acquisition of mature neuronal traits and mGluR5b fosters the elaboration and extension of neurites. These effects are partly inhibited by MPEP. Copyright 2001 Academic Press.

Molecular basis for subtype-specificity and high-affinity zinc inhibition in the GluN1-GluN2A NMDA receptor amino terminal domain

PubMed Central

Romero-Hernandez, Annabel; Simorowski, Noriko; Karakas, Erkan

2016-01-01

Summary Zinc is vastly present in the mammalian brain and controls functions of various cell surface receptors to regulate neurotransmission. A distinctive characteristic of N-methyl-D-aspartate (NMDA) receptors containing a GluN2A subunit is that their ion channel activity is allosterically inhibited by a nano-molar concentration of zinc that binds to an extracellular domain called an amino terminal domain (ATD). Despite physiological importance, the molecular mechanism underlying the high-affinity zinc inhibition has been incomplete due to lack of a GluN2A ATD structure. Here we show the first crystal structures of the heterodimeric GluN1-GluN2A ATD, which provide the complete map of the high-affinity zinc binding site and reveals distinctive features from the ATD of the GluN1-GluN2B subtype. Perturbation of hydrogen bond networks at the hinge of the GluN2A bi-lobe structure affects both zinc inhibition and open probability supporting the general model where the bi-lobe motion in ATD regulates the channel activity in NMDA receptors. PMID:27916457

Metabotropic glutamate receptor subtype 7 ablation causes dysregulation of the HPA axis and increases hippocampal BDNF protein levels: implications for stress-related psychiatric disorders.

PubMed

Mitsukawa, Kayo; Mombereau, Cedric; Lötscher, Erika; Uzunov, Doncho P; van der Putten, Herman; Flor, Peter J; Cryan, John F

2006-06-01

Regulation of neurotransmission via group-III metabotropic glutamate receptors (mGluR4, -6, -7, and -8) has recently been implicated in the pathophysiology of affective disorders, such as major depression and anxiety. For instance, mice with a targeted deletion of the gene for mGluR7 (mGluR7-/-) showed antidepressant and anxiolytic-like effects in a variety of stress-related paradigms, including the forced swim stress and the stress-induced hyperthermia tests. Deletion of mGluR7 reduces also amygdala- and hippocampus-dependent conditioned fear and aversion responses. Since the hypothalamic-pituitary-adrenal (HPA) axis regulates the stress response we investigate whether parameters of the HPA axis at the levels of selected mRNA transcripts and endocrine hormones are altered in mGluR7-deficient mice. Over all, mGluR7-/- mice showed only moderately lower serum levels of corticosterone and ACTH compared with mGluR7+/+ mice. More strikingly however, we found strong evidence for upregulated glucocorticoid receptor (GR)-dependent feedback suppression of the HPA axis in mice with mGluR7 deficiency: (i) mRNA transcripts of GR were significantly upregulated in the hippocampus of mGluR7-/- animals, (ii) similar increases were seen with 5-HT1A receptor transcripts, which are thought to be directly controlled by the transcription factor GR and finally (iii) mGluR7-/- mice showed elevated sensitivity to dexamethasone-induced suppression of serum corticosterone when compared with mGluR7+/+ animals. These results indicate that mGluR7 deficiency causes dysregulation of HPA axis parameters, which may account, at least in part, for the phenotype of mGluR7-/- mice in animal models for anxiety and depression. In addition, we present evidence that protein levels of brain-derived neurotrophic factor are also elevated in the hippocampus of mGluR7-/- mice, which we discuss in the context of the antidepressant-like phenotype found in those animals. We conclude that genetic ablation of mGluR7 in mice interferes at multiple sites in the neuronal circuitry and molecular pathways implicated in affective disorders.

Malaria vaccine research.

PubMed

Ballou, W R; Diggs, C L; Landry, S; Hall, B F

1994-12-16

In our report "Activation of Raf as a result of recruitment to the plasma membrane" (3 June, p. 1463) (1), panels E and F of figure 1 on page 1464 were incorrect. The correct photographs appear below. In addition, the [See figure in the PDF file] second sentence of the legend to figure 1 should have read, "The Raf constructs were tagged at the COOH-terminus with a Glu-Glu epitope (MEYMPME) (24) for c-Raf, or at the NH(2)-terminus with both the Glu-Glu and the Myc (MEQKLISEEDL) (23) epitopes for RafCAAX"; the next-to-the-last sentence of the legend to figure 1 should have read, "The c-Raf constructs in (A through D) are Glu-Glu-tagged and were detected by using an anti Glu-Glu antibody, and the RafCAAX and Raf6QCAAX constructs used in E and F were detected by using the antibody to Raf COOH-terminal peptide"; and the third sentence of note 26 should have read, "After blocking with 5% milk in phosphate-buffered saline (M-PBS), cells were incubated with a mouse monoclonal antibody to Glu-Glu or a rabbit polyclonal antibody to a 20-amino acid COOH-terminal peptide of Raf-1 (Santa Cruz Biotechnology, Santa Cruz, California), washed, and incubated with donkey antibodies to mouse or rabbit IgG combined with Texas Red (Jackson) in M-PBS, washed, and mounted in FITC-Guard (Testog)."

The ratio of N-acetyl aspartate to glutamate correlates with disease duration of amyotrophic lateral sclerosis.

PubMed

Sako, Wataru; Abe, Takashi; Izumi, Yuishin; Harada, Masafumi; Kaji, Ryuji

2016-05-01

Glutamate (Glu)-induced excitotoxicity has been implicated in the neuronal loss of amyotrophic lateral sclerosis. To test the hypothesis that Glu in the primary motor cortex contributes to disease severity and/or duration, the Glu level was investigated using MR spectroscopy. Seventeen patients with amyotrophic lateral sclerosis were diagnosed according to the El Escorial criteria for suspected, possible, probable or definite amyotrophic lateral sclerosis, and enrolled in this cross-sectional study. We measured metabolite concentrations, including N-acetyl aspartate (NAA), creatine, choline, inositol, Glu and glutamine, and performed partial correlation between each metabolite concentration or NAA/Glu ratio and disease severity or duration using age as a covariate. Considering our hypothesis that Glu is associated with neuronal cell death in amyotrophic lateral sclerosis, we investigated the ratio of NAA to Glu, and found a significant correlation between NAA/Glu and disease duration (r=-0.574, p=0.02). The "suspected" amyotrophic lateral sclerosis patients showed the same tendency as possible, probable and definite amyotrophic lateral sclerosis patients in regard to correlation of NAA/Glu ratio with disease duration. The other metabolites showed no significant correlation. Our findings suggested that glutamatergic neurons are less vulnerable compared to other neurons and this may be because inhibitory receptors are mainly located presynaptically, which supports the notion of Glu-induced excitotoxicity. Copyright © 2015 Elsevier Ltd. All rights reserved.

Genetically encoding a light switch in an ionotropic glutamate receptor reveals subunit-specific interfaces.

PubMed

Zhu, Shujia; Riou, Morgane; Yao, C Andrea; Carvalho, Stéphanie; Rodriguez, Pamela C; Bensaude, Olivier; Paoletti, Pierre; Ye, Shixin

2014-04-22

Reprogramming receptors to artificially respond to light has strong potential for molecular studies and interrogation of biological functions. Here, we design a light-controlled ionotropic glutamate receptor by genetically encoding a photoreactive unnatural amino acid (UAA). The photo-cross-linker p-azido-L-phenylalanine (AzF) was encoded in NMDA receptors (NMDARs), a class of glutamate-gated ion channels that play key roles in neuronal development and plasticity. AzF incorporation in the obligatory GluN1 subunit at the GluN1/GluN2B N-terminal domain (NTD) upper lobe dimer interface leads to an irreversible allosteric inhibition of channel activity upon UV illumination. In contrast, when pairing the UAA-containing GluN1 subunit with the GluN2A subunit, light-dependent inactivation is completely absent. By combining electrophysiological and biochemical analyses, we identify subunit-specific structural determinants at the GluN1/GluN2 NTD dimer interfaces that critically dictate UV-controlled inactivation. Our work reveals that the two major NMDAR subtypes differ in their ectodomain-subunit interactions, in particular their electrostatic contacts, resulting in GluN1 NTD coupling more tightly to the GluN2B NTD than to the GluN2A NTD. It also paves the way for engineering light-sensitive ligand-gated ion channels with subtype specificity through the genetic code expansion.

Development of Glutamatergic Proteins in Human Visual Cortex across the Lifespan.

PubMed

Siu, Caitlin R; Beshara, Simon P; Jones, David G; Murphy, Kathryn M

2017-06-21

Traditionally, human primary visual cortex (V1) has been thought to mature within the first few years of life, based on anatomical studies of synapse formation, and establishment of intracortical and intercortical connections. Human vision, however, develops well beyond the first few years. Previously, we found prolonged development of some GABAergic proteins in human V1 (Pinto et al., 2010). Yet as >80% of synapses in V1 are excitatory, it remains unanswered whether the majority of synapses regulating experience-dependent plasticity and receptive field properties develop late, like their inhibitory counterparts. To address this question, we used Western blotting of postmortem tissue from human V1 (12 female, 18 male) covering a range of ages. Then we quantified a set of postsynaptic glutamatergic proteins (PSD-95, GluA2, GluN1, GluN2A, GluN2B), calculated indices for functional pairs that are developmentally regulated (GluA2:GluN1; GluN2A:GluN2B), and determined interindividual variability. We found early loss of GluN1, prolonged development of PSD-95 and GluA2 into late childhood, protracted development of GluN2A until ∼40 years, and dramatic loss of GluN2A in aging. The GluA2:GluN1 index switched at ∼1 year, but the GluN2A:GluN2B index continued to shift until ∼40 year before changing back to GluN2B in aging. We also identified young childhood as a stage of heightened interindividual variability. The changes show that human V1 develops gradually through a series of five orchestrated stages, making it likely that V1 participates in visual development and plasticity across the lifespan. SIGNIFICANCE STATEMENT Anatomical structure of human V1 appears to mature early, but vision changes across the lifespan. This discrepancy has fostered two hypotheses: either other aspects of V1 continue changing, or later changes in visual perception depend on extrastriate areas. Previously, we showed that some GABAergic synaptic proteins change across the lifespan, but most synapses in V1 are excitatory leaving unanswered how they change. So we studied expression of glutamatergic proteins in human V1 to determine their development. Here we report prolonged maturation of glutamatergic proteins, with five stages that map onto life-long changes in human visual perception. Thus, the apparent discrepancy between development of structure and function may be explained by life-long synaptic changes in human V1. Copyright © 2017 the authors 0270-6474/17/376031-12$15.00/0.

Dysregulated NMDA-Receptor Signaling Inhibits Long-Term Depression in a Mouse Model of Fragile X Syndrome.

PubMed

Toft, Anna Karina Hugger; Lundbye, Camilla Johanne; Banke, Tue G

2016-09-21

Fragile X syndrome (FXS) is a neurodevelopmental disease. It is one of the leading monogenic causes of intellectual disability among boys with most also displaying autism spectrum disorder traits. Here we investigated the role of NMDA receptors on mGluR-dependent long-term depression (mGluR-LTD), a key biomarker in the disease, at four different developmental stages. First, we applied the mGluR agonist 3,5-dihydroxyphenylglycine in the absence or presence of the NMDAR blocker, APV, hereby unmasking the NMDAR component in this process. As expected, in the presence of APV, we found more LTD in the mouse KO than in WT. This, however, was only observed in the p30-60 age group. At all other age groups tested, mGluR-LTD was almost identical between KO and WT. Interestingly, at p60, in the absence of APV, no or very little LTD was found in KO that was completely restored by application of APV. This suggests that the underlying cause of the enhanced mGluR-LTD in KO (at p30) is caused by dysregulated NMDAR signaling. To investigate this further, we next used NMDAR-subunit-specific antagonists. Inhibition of GluN2B, but not GluN2A, blocked mGluR-LTD only in WT. This was in contrast in the KO where blocking GluN2B rescued mGluR-LTD, suggesting GluN2B-containing NMDARs in the KO are hyperactive. Thus, these findings suggest strong involvement of GluN2B-containing-NMDARs in the pathophysiology of FXS and highlight a potential path for treatment for the disease. There is currently no cure for fragile X, although medications targeting specific FXS symptoms do exist. The FXS animal model, the Fmr1 knock-out mouse, has demonstrated an increased mGluR5-mediated long-term depression (LTD) leading to several clinical trials of mGluR5 inhibitors/modulators, yet all have failed. In addition, surprisingly little information exists about the possible role of other ion channels/receptors, including NMDA receptors (NMDAR), in mGluR-LTD. Here we focus on NMDARs and their regulation of mGluR-mediated LTD at different developmental stages using several different NMDAR blockers/antagonists. Our findings suggest dysregulated NMDARs in the pathophysiology of FXS leading to altered mGluR-mediated LTD. Together, these data will help to develop new drug candidates that could lead to reversal of the FXS phenotype. Copyright © 2016 the authors 0270-6474/16/369817-11$15.00/0.

Design, Synthesis, and Structure–Activity Relationship of a Novel Series of GluN2C-Selective Potentiators

PubMed Central

2015-01-01

NMDA receptors are tetrameric complexes composed of GluN1 and GluN2A–D subunits that mediate a slow Ca2+-permeable component of excitatory synaptic transmission. NMDA receptors have been implicated in a wide range of neurological diseases and thus represent an important therapeutic target. We herein describe a novel series of pyrrolidinones that selectively potentiate only NMDA receptors that contain the GluN2C subunit. The most active analogues tested were over 100-fold selective for recombinant GluN2C-containing receptors over GluN2A/B/D-containing NMDA receptors as well as AMPA and kainate receptors. This series represents the first class of allosteric potentiators that are selective for diheteromeric GluN2C-containing NMDA receptors. PMID:24512267

Inhibition of Group I Metabotropic Glutamate Receptors Reverses Autistic-Like Phenotypes Caused by Deficiency of the Translation Repressor eIF4E Binding Protein 2

PubMed Central

Aguilar-Valles, Argel; Matta-Camacho, Edna; Khoutorsky, Arkady; Gkogkas, Christos; Nader, Karim

2015-01-01

Exacerbated mRNA translation during brain development has been linked to autism spectrum disorders (ASDs). Deletion of the eukaryotic initiation factor 4E (eIF4E)-binding protein 2 gene (Eif4ebp2), encoding the suppressor of mRNA translation initiation 4E-BP2, leads to an imbalance in excitatory-to-inhibitory neurotransmission and ASD-like behaviors. Inhibition of group I metabotropic glutamate receptors (mGluRs) mGluR1 and mGluR5 reverses the autistic phenotypes in several ASD mouse models. Importantly, these receptors control synaptic physiology via activation of mRNA translation. We investigated the potential reversal of autistic-like phenotypes in Eif4ebp2−/− mice by using antagonists of mGluR1 (JNJ16259685) or mGluR5 (fenobam). Augmented hippocampal mGluR-induced long-term depression (LTD; or chemically induced mGluR-LTD) in Eif4ebp2−/− mice was rescued by mGluR1 or mGluR5 antagonists. While rescue by mGluR5 inhibition occurs through the blockade of a protein synthesis-dependent component of LTD, normalization by mGluR1 antagonists requires the activation of protein synthesis. Synaptically induced LTD was deficient in Eif4ebp2−/− mice, and this deficit was not rescued by group I mGluR antagonists. Furthermore, a single dose of mGluR1 (0.3 mg/kg) or mGluR5 (3 mg/kg) antagonists in vivo reversed the deficits in social interaction and repetitive behaviors (marble burying) in Eif4ebp2−/− mice. Our results demonstrate that Eif4ebp2−/− mice serve as a relevant model to test potential therapies for ASD symptoms. In addition, we provide substantive evidence that the inhibition of mGluR1/mGluR5 is an effective treatment for physiological and behavioral alterations caused by exacerbated mRNA translation initiation. SIGNIFICANCE STATEMENT Exacerbated mRNA translation during brain development is associated with several autism spectrum disorders (ASDs). We recently demonstrated that the deletion of a negative regulator of mRNA translation initiation, the eukaryotic initiation factor 4E-binding protein 2, leads to ASD-like behaviors and increased excitatory synaptic activity. Here we demonstrated that autistic behavioral and electrophysiological phenotypes can be treated in adult mice with antagonists of group I metabotropic glutamate receptors (mGluRs), which have been previously used in other ASD models (i.e., fragile X syndrome). These findings support the use of group I mGluR antagonists as a potential therapy that extends to autism models involving exacerbated mRNA translation initiation. PMID:26245973

Inhibition of Group I Metabotropic Glutamate Receptors Reverses Autistic-Like Phenotypes Caused by Deficiency of the Translation Repressor eIF4E Binding Protein 2.

PubMed

Aguilar-Valles, Argel; Matta-Camacho, Edna; Khoutorsky, Arkady; Gkogkas, Christos; Nader, Karim; Lacaille, Jean-Claude; Sonenberg, Nahum

2015-08-05

Exacerbated mRNA translation during brain development has been linked to autism spectrum disorders (ASDs). Deletion of the eukaryotic initiation factor 4E (eIF4E)-binding protein 2 gene (Eif4ebp2), encoding the suppressor of mRNA translation initiation 4E-BP2, leads to an imbalance in excitatory-to-inhibitory neurotransmission and ASD-like behaviors. Inhibition of group I metabotropic glutamate receptors (mGluRs) mGluR1 and mGluR5 reverses the autistic phenotypes in several ASD mouse models. Importantly, these receptors control synaptic physiology via activation of mRNA translation. We investigated the potential reversal of autistic-like phenotypes in Eif4ebp2(-/-) mice by using antagonists of mGluR1 (JNJ16259685) or mGluR5 (fenobam). Augmented hippocampal mGluR-induced long-term depression (LTD; or chemically induced mGluR-LTD) in Eif4ebp2(-/-) mice was rescued by mGluR1 or mGluR5 antagonists. While rescue by mGluR5 inhibition occurs through the blockade of a protein synthesis-dependent component of LTD, normalization by mGluR1 antagonists requires the activation of protein synthesis. Synaptically induced LTD was deficient in Eif4ebp2(-/-) mice, and this deficit was not rescued by group I mGluR antagonists. Furthermore, a single dose of mGluR1 (0.3 mg/kg) or mGluR5 (3 mg/kg) antagonists in vivo reversed the deficits in social interaction and repetitive behaviors (marble burying) in Eif4ebp2(-/-) mice. Our results demonstrate that Eif4ebp2(-/-) mice serve as a relevant model to test potential therapies for ASD symptoms. In addition, we provide substantive evidence that the inhibition of mGluR1/mGluR5 is an effective treatment for physiological and behavioral alterations caused by exacerbated mRNA translation initiation. Exacerbated mRNA translation during brain development is associated with several autism spectrum disorders (ASDs). We recently demonstrated that the deletion of a negative regulator of mRNA translation initiation, the eukaryotic initiation factor 4E-binding protein 2, leads to ASD-like behaviors and increased excitatory synaptic activity. Here we demonstrated that autistic behavioral and electrophysiological phenotypes can be treated in adult mice with antagonists of group I metabotropic glutamate receptors (mGluRs), which have been previously used in other ASD models (i.e., fragile X syndrome). These findings support the use of group I mGluR antagonists as a potential therapy that extends to autism models involving exacerbated mRNA translation initiation. Copyright © 2015 the authors 0270-6474/15/3511126-08$15.00/0.

Insulin modulates hippocampally-mediated spatial working memory via glucose transporter-4.

PubMed

Pearson-Leary, J; Jahagirdar, V; Sage, J; McNay, E C

2018-02-15

The insulin-regulated glucose transporter, GluT4, is a key molecule in peripheral insulin signaling. Although GluT4 is abundantly expressed in neurons of specific brain regions such as the hippocampus, the functional role of neuronal GluT4 is unclear. Here, we used pharmacological inhibition of GluT4-mediated glucose uptake to determine whether GluT4 mediates insulin-mediated glucose uptake in the hippocampus. Consistent with previous reports, we found that glucose utilization increased in the dorsal hippocampus of male rats during spontaneous alternation (SA), a hippocampally-mediated spatial working memory task. We previously showed that insulin signaling within the hippocampus is required for processing this task, and that administration of exogenous insulin enhances performance. At baseline levels of hippocampal insulin, inhibition of GluT4-mediated glucose uptake did not affect SA performance. However, inhibition of an upstream regulator of GluT4, Akt, did impair SA performance. Conversely, when a memory-enhancing dose of insulin was delivered to the hippocampus prior to SA-testing, inhibition of GluT4-mediated glucose transport prevented cognitive enhancement. These data suggest that baseline hippocampal cognitive processing does not require functional hippocampal GluT4, but that cognitive enhancement by supra-baseline insulin does. Consistent with these findings, we found that in neuronal cell culture, insulin increases glucose utilization in a GluT4-dependent manner. Collectively, these data demonstrate a key role for GluT4 in transducing the procognitive effects of elevated hippocampal insulin. Copyright © 2017 Elsevier B.V. All rights reserved.

Compensatory molecular and functional mechanisms in nervous system of the Grm1(crv4) mouse lacking the mGlu1 receptor: a model for motor coordination deficits.

PubMed

Rossi, Pia Irene Anna; Musante, Ilaria; Summa, Maria; Pittaluga, Anna; Emionite, Laura; Ikehata, Masami; Rastaldi, Maria Pia; Ravazzolo, Roberto; Puliti, Aldamaria

2013-09-01

The metabotropic glutamate type 1 (mGlu1) and type 5 (mGlu5) receptors, the only members of group I mGlu receptors, are implicated in synaptic plasticity and mechanisms of feedback control of glutamate release. They exhibit nearly complementary distributions throughout the central nervous system, well evident in the cerebellum, where mGlu1 receptor is most intensely expressed while mGlu5 receptor is not. Despite their different distribution, they show a similar subcellular localization and use common transducing pathways. We recently described the Grm1(crv4) mouse with motor coordination deficits and renal anomalies caused by a spontaneous mutation inactivating the mGlu1 receptor. To define the neuropathological mechanisms in these mice, we evaluated expression and function of the mGlu5 receptor in cerebral and cerebellar cortices. Western blot and immunofluorescence analyses showed mGlu5 receptor overexpression. Quantitative reverse transcriptase-polymerase chain reaction results indicated that the up-regulation is already evident at RNA level. Functional studies confirmed an enhanced glutamate release from cortical cerebral and cerebellar synaptosomes when compared with wild-type that is abolished by the mGlu5 receptor-specific inhibitor, 2-methyl-6-(phenylethynyl) pyridine hydrochloride (MPEP). Finally, acute MPEP treatment of Grm1(crv4/crv4) mice induced an evident although incomplete improvement of motor coordination, suggesting that mGlu5 receptors enhanced activity worsens, instead of improving, the motor-coordination defects in the Grm1(crv4/crv4) mice.

NMDA receptor subunits change in the prefrontal cortex of pure-opioid and multi-drug abusers: a post-mortem study.

PubMed

Daneshparvar, Hamidreza; Sadat-Shirazi, Mitra-Sadat; Fekri, Monir; Khalifeh, Solmaz; Ziaie, Ali; Esfahanizadeh, Nasrin; Vousooghi, Nasim; Zarrindast, Mohammad-Reza

2018-05-16

Addiction is a chronic relapsing disorder and is one of the most important issues in the world. Changing the level of neurotransmitters and the activities of their receptors, play a major role in the pathophysiology of substance abuse disorders. It is well-established that N-methyl-D-aspartate receptors (NMDARs) play a significant role in the molecular basis of addiction. NMDAR has two obligatory GluN1 and two regionally localized GluN2 subunits. This study investigated changes in the protein level of GluN1, GluN2A, and GluN2B in the prefrontal cortex of drug abusers. The medial prefrontal cortex (mPFC), lateral prefrontal cortex (lPFC), and orbitofrontal cortex (OFC) were dissected from the brain of 101 drug addicts brains and were compared with the brains of non-addicts (N = 13). Western blotting technique was used to show the alteration in NMDAR subunits level. Data obtained using Western blotting technique showed a significant increase in the level of GluN1 and GluN2B, but not in GluN2A subunits in all the three regions (mPFC, lPFC, and OFC) of men whom suffered from addiction as compared to the appropriate controls. These findings showed a novel role for GluN1, GluN2B subunits, rather than the GluN2A subunit of NMDARs, in the pathophysiology of addiction and suggested their role in the drug-induced plasticity of NMDARs.

Prevalence and influence of cys407* Grm2 mutation in Hannover-derived Wistar rats: mGlu2 receptor loss links to alcohol intake, risk taking and emotional behaviour.

PubMed

Wood, Christian M; Nicolas, Celine S; Choi, Sun-Lim; Roman, Erika; Nylander, Ingrid; Fernandez-Teruel, Alberto; Kiianmaa, Kalervo; Bienkowski, Przemyslaw; de Jong, Trynke R; Colombo, Giancarlo; Chastagnier, Denis; Wafford, Keith A; Collingridge, Graham L; Wildt, Sheryl J; Conway-Campbell, Becky L; Robinson, Emma S J; Lodge, David

2017-03-15

Modulation of metabotropic glutamate 2 (mGlu2) receptor function has huge potential for treating psychiatric and neurological diseases. Development of drugs acting on mGlu2 receptors depends on the development and use of translatable animal models of disease. We report here a stop codon mutation at cysteine 407 in Grm2 (cys407*) that is common in some Wistar rats. Therefore, researchers in this field need to be aware of strains with this mutation. Our genotypic survey found widespread prevalence of the mutation in commercial Wistar strains, particularly those known as Han Wistar. Such Han Wistar rats are ideal for research into the separate roles of mGlu2 and mGlu3 receptors in CNS function. Previous investigations, unknowingly using such mGlu2 receptor-lacking rats, provide insights into the role of mGlu2 receptors in behaviour. The Grm2 mutant rats, which dominate some selectively bred lines, display characteristics of altered emotionality, impulsivity and risk-related behaviours and increased voluntary alcohol intake compared with their mGlu2 receptor-competent counterparts. In addition, the data further emphasize the potential therapeutic role of mGlu2 receptors in psychiatric and neurological disease, and indicate novel methods of studying the role of mGlu2 and mGlu3 receptors. This article is part of the Special Issue entitled 'Metabotropic Glutamate Receptors, 5 years on'. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Effect of short peptides on expression of signaling molecules in organotypic pineal cell culture.

PubMed

Khavinson, V Kh; Linkova, N S; Chalisova, N I; Dudkov, A V; Koncevaya, E A

2011-11-01

We demonstrated the influence of short peptides on the expression of signaling molecules in organotypic culture of the pineal gland from 3-month-old rats. Peptides Ala-Glu-Asp-Gly and Lys-Glu-Asp stimulate the expression of proliferative protein Ki-67 in pineal gland culture. These peptides as well as Glu-Asp-Arg and Lys-Glu do not affect the expression of apoptosis marker AIF. The synthesis of transcription factor CGRP by pinealocytes was stimulated only by Ala-Glu-Asp-Gly. Thus, peptide Ala-Glu-Asp-Gly tissue-specifically stimulates proliferative and secretory activities of pinealocytes, which can be used for recovery of pineal gland functions at the molecular level.

Density functional computational studies on the glucose and glycine Maillard reaction: Formation of the Amadori rearrangement products

NASA Astrophysics Data System (ADS)

Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin

Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0

Glued structural members

Treesearch

Russell C. Moody; Jen Y. Liu

1999-01-01

Glued structural members are manufactured in a variety of configurations. Structural composite lumber (SCL) products consist of small pieces of wood glued together into sizes common for solid-sawn lumber. Glued-laminated timber (glulam) is an engineered stress-rated product that consists of two or more layers of lumber in which the grain of all layers is oriented...

Glycine triggers a non-ionotropic activity of GluN2A-containing NMDA receptors to confer neuroprotection.

PubMed

Hu, Rong; Chen, Juan; Lujan, Brendan; Lei, Ruixue; Zhang, Mi; Wang, Zefen; Liao, Mingxia; Li, Zhiqiang; Wan, Yu; Liu, Fang; Feng, Hua; Wan, Qi

2016-10-03

Ionotropic activation of NMDA receptors (NMDARs) requires agonist glutamate and co-agonist glycine. Here we show that glycine enhances the activation of cell survival-promoting kinase Akt in cultured cortical neurons in which both the channel activity of NMDARs and the glycine receptors are pre-inhibited. The effect of glycine is reduced by shRNA-mediated knockdown of GluN2A subunit-containing NMDARs (GluN2ARs), suggesting that a non-ionotropic activity of GluN2ARs mediates glycine-induced Akt activation. In support of this finding, glycine enhances Akt activation in HEK293 cells over-expressing GluN2ARs. The effect of glycine on Akt activation is sensitive to the antagonist of glycine-GluN1 binding site. As a functional consequence, glycine protects against excitotoxicity-induced neuronal death through the non-ionotropic activity of GluN2ARs and the neuroprotective effect is attenuated by Akt inhibition. Thus, this study reveals an unexpected role of glycine in eliciting a non-ionotropic activity of GluN2ARs to confer neuroprotection via Akt activation.

Role of group II metabotropic glutamate receptors 2/3 and group I metabotropic glutamate receptor 5 in developing rat medial vestibular nuclei.

PubMed

Grassi, Silvarosa; Frondaroli, Adele; Pettorossi, Vito Enrico

2005-08-22

In brainstem slices from developing rats, metabotropic glutamate receptors mGluR2/3 and mGluR5 play different inhibitory roles in synaptic transmission and plasticity of the medial vestibular nuclei. The mGluR2/3 block (LY341495) reduces the occurrence of long-term depression after vestibular afferent high frequency stimulation at P8-P10, and increases that of long-term potentiation, while the mGluR5 block prevents high frequency stimulation long-term depression. Later on, the receptor block does not influence high frequency stimulation effects. In addition, while mGluR2/3 agonist (APDC) always provokes a transient reduction of synaptic responses, that of mGluR5 (CHPG) induces long-term depression per se at P8-P10. These results show a key role of mGluR5 in inducing high frequency stimulation long-term depression in developing medial vestibular nuclei, while mGluR2/3 modulate synaptic transmission, probably through presynaptic control of glutamate release.

Glycine triggers a non-ionotropic activity of GluN2A-containing NMDA receptors to confer neuroprotection

PubMed Central

Hu, Rong; Chen, Juan; Lujan, Brendan; Lei, Ruixue; Zhang, Mi; Wang, Zefen; Liao, Mingxia; Li, Zhiqiang; Wan, Yu; Liu, Fang; Feng, Hua; Wan, Qi

2016-01-01

Ionotropic activation of NMDA receptors (NMDARs) requires agonist glutamate and co-agonist glycine. Here we show that glycine enhances the activation of cell survival-promoting kinase Akt in cultured cortical neurons in which both the channel activity of NMDARs and the glycine receptors are pre-inhibited. The effect of glycine is reduced by shRNA-mediated knockdown of GluN2A subunit-containing NMDARs (GluN2ARs), suggesting that a non-ionotropic activity of GluN2ARs mediates glycine-induced Akt activation. In support of this finding, glycine enhances Akt activation in HEK293 cells over-expressing GluN2ARs. The effect of glycine on Akt activation is sensitive to the antagonist of glycine-GluN1 binding site. As a functional consequence, glycine protects against excitotoxicity-induced neuronal death through the non-ionotropic activity of GluN2ARs and the neuroprotective effect is attenuated by Akt inhibition. Thus, this study reveals an unexpected role of glycine in eliciting a non-ionotropic activity of GluN2ARs to confer neuroprotection via Akt activation. PMID:27694970

Dbo/Henji Modulates Synaptic dPAK to Gate Glutamate Receptor Abundance and Postsynaptic Response.

PubMed

Wang, Manyu; Chen, Pei-Yi; Wang, Chien-Hsiang; Lai, Tzu-Ting; Tsai, Pei-I; Cheng, Ying-Ju; Kao, Hsiu-Hua; Chien, Cheng-Ting

2016-10-01

In response to environmental and physiological changes, the synapse manifests plasticity while simultaneously maintains homeostasis. Here, we analyzed mutant synapses of henji, also known as dbo, at the Drosophila neuromuscular junction (NMJ). In henji mutants, NMJ growth is defective with appearance of satellite boutons. Transmission electron microscopy analysis indicates that the synaptic membrane region is expanded. The postsynaptic density (PSD) houses glutamate receptors GluRIIA and GluRIIB, which have distinct transmission properties. In henji mutants, GluRIIA abundance is upregulated but that of GluRIIB is not. Electrophysiological results also support a GluR compositional shift towards a higher IIA/IIB ratio at henji NMJs. Strikingly, dPAK, a positive regulator for GluRIIA synaptic localization, accumulates at the henji PSD. Reducing the dpak gene dosage suppresses satellite boutons and GluRIIA accumulation at henji NMJs. In addition, dPAK associated with Henji through the Kelch repeats which is the domain essential for Henji localization and function at postsynapses. We propose that Henji acts at postsynapses to restrict both presynaptic bouton growth and postsynaptic GluRIIA abundance by modulating dPAK.

Dbo/Henji Modulates Synaptic dPAK to Gate Glutamate Receptor Abundance and Postsynaptic Response

PubMed Central

Wang, Manyu; Chen, Pei-Yi; Wang, Chien-Hsiang; Lai, Tzu-Ting; Tsai, Pei-I; Cheng, Ying-Ju; Kao, Hsiu-Hua; Chien, Cheng-Ting

2016-01-01

In response to environmental and physiological changes, the synapse manifests plasticity while simultaneously maintains homeostasis. Here, we analyzed mutant synapses of henji, also known as dbo, at the Drosophila neuromuscular junction (NMJ). In henji mutants, NMJ growth is defective with appearance of satellite boutons. Transmission electron microscopy analysis indicates that the synaptic membrane region is expanded. The postsynaptic density (PSD) houses glutamate receptors GluRIIA and GluRIIB, which have distinct transmission properties. In henji mutants, GluRIIA abundance is upregulated but that of GluRIIB is not. Electrophysiological results also support a GluR compositional shift towards a higher IIA/IIB ratio at henji NMJs. Strikingly, dPAK, a positive regulator for GluRIIA synaptic localization, accumulates at the henji PSD. Reducing the dpak gene dosage suppresses satellite boutons and GluRIIA accumulation at henji NMJs. In addition, dPAK associated with Henji through the Kelch repeats which is the domain essential for Henji localization and function at postsynapses. We propose that Henji acts at postsynapses to restrict both presynaptic bouton growth and postsynaptic GluRIIA abundance by modulating dPAK. PMID:27736876

Metabotropic glutamate receptors in auditory processing

PubMed Central

Lu, Yong

2014-01-01

As the major excitatory neurotransmitter used in the vertebrate brain, glutamate activates ionotropic and metabotropic glutamate receptors (mGluRs), which mediate fast and slow neuronal actions, respectively. Important modulatory roles of mGluRs have been shown in many brain areas, and drugs targeting mGluRs have been developed for treatment of brain disorders. Here, I review the studies on mGluRs in the auditory system. Anatomical expression of mGluRs in the cochlear nucleus has been well characterized, while data for other auditory nuclei await more systematic investigations at both the light and electron microscopy levels. The physiology of mGluRs has been extensively studied using in vitro brain slice preparations, with a focus on the lower auditory brainstem in both mammals and birds. These in vitro physiological studies have revealed that mGluRs participate in neurotransmission, regulate ionic homeostasis, induce synaptic plasticity, and maintain the balance between excitation and inhibition in a variety of auditory structures. However, very few in vivo physiological studies on mGluRs in auditory processing have been undertaken at the systems level. Many questions regarding the essential roles of mGluRs in auditory processing still remain unanswered and more rigorous basic research is warranted. PMID:24909898

Endo-β-1,3-Glucanase GLU1, from the Fruiting Body of Lentinula edodes, Belongs to a New Glycoside Hydrolase Family ▿ †

PubMed Central

Sakamoto, Yuichi; Nakade, Keiko; Konno, Naotake

2011-01-01

The cell wall of the fruiting body of the mushroom Lentinula edodes is degraded after harvesting by enzymes such as β-1,3-glucanase. In this study, a novel endo-type β-1,3-glucanase, GLU1, was purified from L. edodes fruiting bodies after harvesting. The gene encoding it, glu1, was isolated by rapid amplification of cDNA ends (RACE)-PCR using primers designed from the N-terminal amino acid sequence of GLU1. The putative amino acid sequence of the mature protein contained 247 amino acid residues with a molecular mass of 26 kDa and a pI of 3.87, and recombinant GLU1 expressed in Pichia pastoris exhibited β-1,3-glucanase activity. GLU1 catalyzed depolymerization of glucans composed of β-1,3-linked main chains, and reaction product analysis by thin-layer chromatography (TLC) clearly indicated that the enzyme had an endolytic mode. However, the amino acid sequence of GLU1 showed no significant similarity to known glycoside hydrolases. GLU1 has similarity to several hypothetical proteins in fungi, and GLU1 and highly similar proteins should be classified as a novel glycoside hydrolase family (GH128). PMID:21965406

Anxiolytic properties of Valeriana officinalis in the zebrafish: a possible role for metabotropic glutamate receptors.

PubMed

Del Valle-Mojica, Lisa M; Ortíz, José G

2012-11-01

Valerian extract is used in complementary and alternative medicine for its anxiolytic and sedative properties. Our previous research demonstrated valerian interactions with glutamate receptors. The purpose of this study was to determine if valerian anxiolytic properties are mediated by metabotropic glutamate receptors (mGluR) such as mGluR (1/5) (mGluR I) and mGluR (2/3) (mGluR II). Adult wild-type zebrafish (Danio rerio) prefer the black compartment and avoid the white compartment in the dark/light preference task. Zebrafish exposed to 1 mg/mL of valerian extract or 0.00117 mg/mL valerenic acid increased their residence time in the white side by 84.61 ± 6.55 % and 58.30 ± 8.97 %, respectively. LAP3 (mGluR I antagonist) and EGLU (mGluR II antagonist) significantly inhibited the effects of valerian and valerenic acid. These results demonstrated that valerian and valerenic acid have anxiolytic properties in the zebrafish. Moreover, the selective interaction of valerian with mGluR I and II represent an alternative explanation for the anxiolytic properties of this plant and support the role of mGluR in anxiety. Georg Thieme Verlag KG Stuttgart · New York.

Potentiation of GluN2C/D NMDA receptor subtypes in the amygdala facilitates the retention of fear and extinction learning in mice.

PubMed

Ogden, Kevin K; Khatri, Alpa; Traynelis, Stephen F; Heldt, Scott A

2014-02-01

NMDA receptors are glutamate receptor ion channels that contribute to synaptic plasticity and are important for many forms of learning and memory. In the amygdala, NMDA receptors are critical for the acquisition, retention, and extinction of classically conditioned fear responses. Although the GluN2B subunit has been implicated in both the acquisition and extinction of conditioned fear, GluN2C-knockout mice show reduced conditioned fear responses. Moreover, D-cycloserine (DCS), which facilitates fear extinction, selectively enhances the activity of GluN2C-containing NMDA receptors. To further define the contribution of GluN2C receptors to fear learning, we infused the GluN2C/GluN2D-selective potentiator CIQ bilaterally into the basolateral amygdala (3, 10, or 30 μg/side) following either fear conditioning or fear extinction training. CIQ both increased the expression of conditioned fear 24 h later and enhanced the extinction of the previously conditioned fear response. These results support a critical role for GluN2C receptors in the amygdala in the consolidation of learned fear responses and suggest that increased activity of GluN2C receptors may underlie the therapeutic actions of DCS.

Direct assessment of the metabolic origin of carbon atoms in glutamate from illuminated leaves using 13 C-NMR.

PubMed

Abadie, Cyril; Lothier, Jérémy; Boex-Fontvieille, Edouard; Carroll, Adam; Tcherkez, Guillaume

2017-12-01

Glutamate (Glu) is the cornerstone of nitrogen assimilation and photorespiration in illuminated leaves. Despite this crucial role, our knowledge of the flux to Glu de novo synthesis is rather limited. Here, we used isotopic labelling with 13 CO 2 and 13 C-NMR analyses to examine the labelling pattern and the appearance of multi-labelled species of Glu molecules to trace the origin of C-atoms found in Glu. We also compared this with 13 C-labelling patterns in Ala and Asp, which reflect citrate (and thus Glu) precursors, that is, pyruvate and oxaloacetate. Glu appeared to be less 13 C-labelled than Asp and Ala, showing that the Glu pool was mostly formed by 'old' carbon atoms. There were modest differences in intramolecular 13 C- 13 C couplings between Glu C-2 and Asp C-3, showing that oxaloacetate metabolism to Glu biosynthesis did not involve C-atom redistribution by the Krebs cycle. The apparent carbon allocation increased with carbon net photosynthesis. However, when expressed relative to CO 2 fixation, it was clearly higher at low CO 2 while it did not change in 2% O 2 , as compared to standard conditions. We conclude that Glu production from current photosynthetic carbon represents a small flux that is controlled by the gaseous environment, typically upregulated at low CO 2 . © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Low molecular weight glutenin subunit gene Glu-B3h confers superior dough strength and breadmaking quality in wheat (Triticum aestivum L.)

PubMed Central

Wang, Yaping; Zhen, Shoumin; Luo, Nana; Han, Caixia; Lu, Xiaobing; Li, Xiaohui; Xia, Xianchun; He, Zhonghu; Yan, Yueming

2016-01-01

Low molecular weight glutenin subunit is one of the important quality elements in wheat (Triticum aestivum L.). Although considerable allelic variation has been identified, the functional properties of individual alleles at Glu-3 loci are less studied. In this work, we performed the first comprehensive study on the molecular characteristics and functional properties of the Glu-B3h gene using the wheat cultivar CB037B and its Glu-B3 deletion line CB037C. The results showed that the Glu-B3h deletion had no significant effects on plant morphological or yield traits, but resulted in a clear reduction in protein body number and size and main quality parameters, including inferior mixing property, dough strength, loaf volume, and score. Molecular characterization showed that the Glu-B3h gene consists of 1179 bp, and its encoded B-subunit has a longer repetitive domain and an increased number of α-helices, as well as higher expression, which could contribute to superior flour quality. The SNP-based allele-specific PCR markers designed for the Glu-B3h gene were developed and validated with bread wheat holding various alleles at Glu-B3 locus, which could effectively distinguish the Glu-B3h gene from others at the Glu-B3 locus, and have potential applications for wheat quality improvement through marker-assisted selection. PMID:27273251

Metabolism of oxybenzone in a hairy root culture: Perspectives for phytoremediation of a widely used sunscreen agent.

PubMed

Chen, Feiran; Huber, Christian; May, Robert; Schröder, Peter

2016-04-05

Oxybenzone (OBZ), known as Benzophenone-3, is a commonly used UV filter in sun tans and skin protectants, entering aquatic systems either directly during recreational activities or indirectly through wastewater treatment plants discharge. To study the potential degradation capacity of plants for OBZ in phytotreatment, a well-established hairy root culture (Armoracia rusticana) was treated with OBZ. More than 20% of spiked OBZ (100μM) was eliminated from the medium by hairy roots after 3h of exposure. Two metabolites were identified as oxybenzone-glucoside (OBZ-Glu) and oxybenzone-(6-O-malonyl)-glucoside (OBZ-Mal-Glu) by LC-MS/MS and TOF-MS. Formation of these metabolites was confirmed by enzymatic synthesis, as well as enzymatic and alkaline hydrolysis. Incubation with O-glucosyltransferase (O-GT) extracted from roots formed OBZ-Glu; whereas β-d-Glucosidase hydrolyzed OBZ-Glu. However, alkaline hydrolysis led to cleavage of OBZ-Mal-Glu and yielded OBZ-Glu. In the hairy root culture, an excretion of OBZ-Glu into the growth medium was observed while the corresponding OBZ-Mal-Glu remained stored in root cells over the incubation time. We propose that metabolism of oxybenzone in plants involves initial conjugation with glucose to form OBZ-Glu followed by malonylation to yield OBZ-Mal-Glu. To our best knowledge this first finding presenting the potential of plants to degrade benzophenone type UV filters by phytoremediation. Copyright © 2015 Elsevier B.V. All rights reserved.

Vinpocetine inhibits glutamate release induced by the convulsive agent 4-aminopyridine more potently than several antiepileptic drugs.

PubMed

Sitges, M; Sanchez-Tafolla, B M; Chiu, L M; Aldana, B I; Guarneros, A

2011-10-01

4-Aminopyridine (4-AP) is a convulsing agent that in vivo preferentially releases Glu, the most important excitatory amino acid neurotransmitter in the brain. Here the ionic dependence of 4-AP-induced Glu release and the effects of several of the most common antiepileptic drugs (AEDs) and of the new potential AED, vinpocetine on 4-AP-induced Glu release were characterized in hippocampus isolated nerve endings pre-loaded with labelled Glu ([3H]Glu). 4-AP-induced [3H]Glu release was composed by a tetrodotoxin (TTX) sensitive and external Ca2+ dependent fraction and a TTX insensitive fraction that was sensitive to the excitatory amino acid transporter inhibitor, TBOA. The AEDs: carbamazepine, phenytoin, lamotrigine and oxcarbazepine at the highest dose tested only reduced [3H]Glu release to 4-AP between 50-60%, and topiramate was ineffective. Vinpocetine at a much lower concentration than the above AEDs, abolished [3H]Glu release to 4-AP. We conclude that the decrease in [3H]Glu release linked to the direct blockade of presynaptic Na+ channels, may importantly contribute to the anticonvulsant actions of all the drugs tested here (except topiramate); and that the significantly greater vinpocetine effect in magnitude and potency on [3H]Glu release when excitability is exacerbated like during seizures, may involve the increase additionally exerted by vinpocetine in some K+ channels permeability. Copyright © 2011 Elsevier B.V. All rights reserved.

Deletion of the GluA1 AMPA receptor subunit impairs recency-dependent object recognition memory

PubMed Central

Sanderson, David J.; Hindley, Emma; Smeaton, Emily; Denny, Nick; Taylor, Amy; Barkus, Chris; Sprengel, Rolf; Seeburg, Peter H.; Bannerman, David M.

2011-01-01

Deletion of the GluA1 AMPA receptor subunit impairs short-term spatial recognition memory. It has been suggested that short-term recognition depends upon memory caused by the recent presentation of a stimulus that is independent of contextual–retrieval processes. The aim of the present set of experiments was to test whether the role of GluA1 extends to nonspatial recognition memory. Wild-type and GluA1 knockout mice were tested on the standard object recognition task and a context-independent recognition task that required recency-dependent memory. In a first set of experiments it was found that GluA1 deletion failed to impair performance on either of the object recognition or recency-dependent tasks. However, GluA1 knockout mice displayed increased levels of exploration of the objects in both the sample and test phases compared to controls. In contrast, when the time that GluA1 knockout mice spent exploring the objects was yoked to control mice during the sample phase, it was found that GluA1 deletion now impaired performance on both the object recognition and the recency-dependent tasks. GluA1 deletion failed to impair performance on a context-dependent recognition task regardless of whether object exposure in knockout mice was yoked to controls or not. These results demonstrate that GluA1 is necessary for nonspatial as well as spatial recognition memory and plays an important role in recency-dependent memory processes. PMID:21378100

The metabotropic glutamate receptor mGluR3 is critically required for hippocampal long-term depression and modulates long-term potentiation in the dentate gyrus of freely moving rats.

PubMed

Pöschel, Beatrice; Wroblewska, Barbara; Heinemann, Uwe; Manahan-Vaughan, Denise

2005-09-01

Group II metabotropic glutamate receptors (mGluRs) play an important role in the regulation of hippocampal synaptic plasticity in vivo: long-term potentiation (LTP) is inhibited and long-term depression (LTD) is enhanced by activation of these receptors. The contribution, in vivo, of the individual group II mGluR subtypes has not been characterized. We analysed the involvement of the subtype mGluR3 in LTD and LTP. Rats were implanted with electrodes to enable chronic measurement of evoked potentials from medial perforant path-dentate gyrus synapses. Neither the selective mGluR3 agonist, N-acetylaspartylglutamate (NAAG), nor the antagonist beta-NAAG, given intracerebrally, affected basal synaptic transmission. beta-NAAG significantly inhibited LTD expression. NAAG exhibited transient inhibitory effects on the intermediate phase of LTD. Whereas NAAG altered paired-pulse responses, beta-NAAG had no effect, suggesting that antagonism of mGluR3 prevents LTD via a postsynaptic mechanism, whereas agonist activation of mGluR3 modulates LTD at a presynaptic locus. NAAG impaired the expression of LTP, whereas beta-NAAG had no effect. NAAG effects on LTP were blocked by EGLU, a selective group II mGluR antagonist. Our data suggest an essential role for mGluR3 in LTD, and a modulatory role for mGluR3 in LTP, with effects being mediated by distinct pre- and post-synaptic loci.

Environmental factors and beta2-adrenergic receptor polymorphism: influence on the energy expenditure and nutritional status of obese women.

PubMed

Rosado, Eliane Lopes; Bressan, Josefina; Martínez, J Alfredo

2015-05-01

Our aim was to evaluate the influence of the Gln27Glu polymorphism of the β2-adrenergic receptor (ADRβ2) gene, fat intake and physical activity on the energy expenditure (EE) and nutritional status of obese women. Sixty obese women (30-46 years) participated in the study and were assigned to three groups depending on the genotypes: Gln27Gln, Gln27Glu and Glu27Glu. At baseline and after nutritional intervention, the anthropometric and body composition (bioelectrical impedance), dietary, EE (indirect calorimetry) and biochemical variables were measured. All women received a high-fat test meal to determine the postprandial EE (short-term) and an energy-restricted diet for 10 weeks (long term). The frequencies of Gln27Gln, Gln27Glu and Glu27Glu were 36.67, 40.0 and 23.33 %, respectively. Anthropometric and biochemical variables and EE did not differ between groups, although women who had no polymorphism demonstrated decreased carbohydrate oxidation. On the other hand, the Glu27Glu genotype showed a positive relation with EE in physical activity and fat oxidation. The environmental factors and Gln27Glu polymorphism did not influence the nutritional status and EE of obese women, but physical activity in obese women with the polymorphism in the ADRβ2 gene can promote fat oxidation. The results suggest that encouraging the practice of physical exercise is important considering the high frequency of this polymorphism in obese subjects.

Allosteric Modulation of Metabotropic Glutamate Receptors

PubMed Central

Sheffler, Douglas J.; Gregory, Karen J.; Rook, Jerri M.; Conn, P. Jeffrey

2013-01-01

The development of receptor subtype-selective ligands by targeting allosteric sites of G protein-coupled receptors (GPCRs) has proven highly successful in recent years. One GPCR family that has greatly benefited from this approach is the metabotropic glutamate receptors (mGlus). These family C GPCRs participate in the neuromodulatory actions of glutamate throughout the CNS, where they play a number of key roles in regulating synaptic transmission and neuronal excitability. A large number of mGlu subtype-selective allosteric modulators have been identified, the majority of which are thought to bind within the transmembrane regions of the receptor. These modulators can either enhance or inhibit mGlu functional responses and, together with mGlu knockout mice, have furthered the establishment of the physiologic roles of many mGlu subtypes. Numerous pharmacological and receptor mutagenesis studies have been aimed at providing a greater mechanistic understanding of the interaction of mGlu allosteric modulators with the receptor, which have revealed evidence for common allosteric binding sites across multiple mGlu subtypes and the presence for multiple allosteric sites within a single mGlu subtype. Recent data have also revealed that mGlu allosteric modulators can display functional selectivity toward particular signal transduction cascades downstream of an individual mGlu subtype. Studies continue to validate the therapeutic utility of mGlu allosteric modulators as a potential therapeutic approach for a number of disorders including anxiety, schizophrenia, Parkinson’s disease, and Fragile X syndrome. PMID:21907906

Changes in glutamate receptor subunits within the medulla in goats after section of the carotid sinus nerves

PubMed Central

Miller, Justin Robert; Neumueller, Suzanne; Muere, Clarissa; Olesiak, Samantha; Pan, Lawrence; Bukowy, John D.; Daghistany, Asem O.; Hodges, Matthew R.

2014-01-01

The mechanisms which contribute to the time-dependent recovery of resting ventilation and the ventilatory CO2 chemoreflex after carotid body denervation (CBD) are poorly understood. Herein we tested the hypothesis that there are time-dependent changes in the expression of specific AMPA, NMDA, and/or neurokinin-1 (NK1R) receptors within respiratory-related brain stem nuclei acutely or chronically after CBD in adult goats. Brain stem tissues were collected acutely (5 days) or chronically (30 days) after sham or bilateral CBD, immunostained with antibodies targeting AMPA (GluA1 or GluA2), NMDA (GluN1), or NK-1 receptors, and optical density (OD) compared. Physiological measurement confirmed categorization of each group and showed ventilatory effects consistent with bilateral CBD (Miller et al. J Appl Physiol 115: 1088–1098, 2013). Acutely after CBD, GluA1 OD was unchanged or slightly increased, but GluA2 and GluN1 OD were reduced 15–30% within the nucleus tractus solitarius (NTS) and in other medullary respiratory nuclei. Chronically after CBD, GluA1 was reduced (P < 0.05) within the caudal NTS and in other nuclei, but there was significant recovery of GluA2 and GluN1 OD. NK1 OD was not significantly different from control after CBD. We conclude that the initial decrease in GluA2 and GluN1 after CBD likely contributes to hypoventilation and the reduced CO2 chemoreflex. The partial recovery of ventilation and the CO2 chemoreflex after CBD parallel a time-dependent return of these receptors to near control levels but likely depend upon additional initiating and maintenance factors for neuroplasticity. PMID:24790015

Cannabis use in early psychosis is associated with reduced glutamate levels in the prefrontal cortex.

PubMed

Rigucci, Silvia; Xin, Lijing; Klauser, Paul; Baumann, Philipp S; Alameda, Luis; Cleusix, Martine; Jenni, Raoul; Ferrari, Carina; Pompili, Maurizio; Gruetter, Rolf; Do, Kim Q; Conus, Philippe

2018-01-01

Recent studies have shown that cannabis may disrupt glutamate (Glu) signaling depressing Glu tone in frequent users. Current evidence have also consistently reported lower Glu-levels in various brain regions, particularly in the medial prefrontal cortex (mPFC) of chronic schizophrenia patients, while findings in early psychosis (EP) are not conclusive. Since cannabis may alter Glu synaptic plasticity and its use is a known risk factor for psychosis, studies focusing on Glu signaling in EP with or without a concomitant cannabis-usage seem crucial. We investigate the effect of cannabis use on prefrontal Glu-levels in EP users vs. both EP non-users and healthy controls (HC). Magnetic resonance spectroscopy was used to measure [Glu mPFC ] of 35 EP subjects (18 of whom were cannabis users) and 33 HC. For correlative analysis, neuropsychological performances were scored by the MATRICS-consensus cognitive battery. [Glu mPFC ] was lower in EP users comparing to both HC and EP non-users (p < 0.001 and p = 0.01, respectively), while no differences were observed between EP non-users and HC. A greater [Glu mPFC ]-decline with age was observed in EP users (r = -.46; p = 0.04), but not in EP non-users or HC. Among neuropsychological outcomes, working memory was the only domain that differentiates patients depending on their cannabis use, with users having poorer performances. Cannabis use is associated with reduced prefrontal [Glu mPFC ] and with a stronger Glu-levels decline with age. Glutamatergic abnormalities might influence the cognitive impairment observed in users and have some relevance for the progression of the disease.

Metabotropic glutamate receptors as therapeutic targets in Parkinson's disease: An update from the last 5 years of research.

PubMed

Litim, Nadhir; Morissette, Marc; Di Paolo, Thérèse

2017-03-15

Disturbance of glutamate neurotransmission in Parkinson's disease (PD) and l-DOPA induced dyskinesia (LID) is well documented. This review focuses on advances during the past five years on pharmacological modulation of metabotropic glutamate (mGlu) receptors in relation to anti-parkinsonian activity, LID attenuation, and neuroprotection. Drug design and characterization have led to the development of orthosteric agonists binding the same site as glutamate and Positive and Negative Allosteric modulators (PAMs and NAMs) binding sites different from the orthosteric site and offering subtype selectivity. Inhibition of group I (mGlu1 and mGlu5) receptors with NAMs and activation of group II (mGlu2 and 3 receptors) and group III (mGlu 4, 7 and 8 receptors) with PAMs and orthosteric agonists have shown their potential to inhibit glutamate release and attenuate excitotoxicity. Earlier and recent studies have led to the development of mGlu5 receptors NAMs to reduce LID and for neuroprotection, mGlu3 receptor agonists for neuroprotection while mGlu4 receptor PAMs and agonists for antiparkinsonian effects and neuroprotection. Furthermore, homo- and heterodimers of mGlu receptors are documented and highlight the complexity of the functioning of these receptors. Research on partial allosteric modulators and biased mGlu receptor allosteric modulators offer new glutamatergic drugs with better therapeutic effects and less off target adverse activity. Thus these various mGlu receptor targets will enable the development of novel drugs with improved clinical effects for normalization of glutamate transmission, treat PD and LID relief. This article is part of the Special Issue entitled 'Metabotropic Glutamate Receptors, 5 years on'. Copyright © 2016 Elsevier Ltd. All rights reserved.

Regulation of GluR2 promoter activity by neurotrophic factors via a neuron-restrictive silencer element.

PubMed

Brené, S; Messer, C; Okado, H; Hartley, M; Heinemann, S F; Nestler, E J

2000-05-01

The AMPA glutamate receptor subunit GluR2, which plays a critical role in regulation of AMPA channel function, shows altered levels of expression in vivo after several chronic perturbations. To evaluate the possibility that transcriptional mechanisms are involved, we studied a 1254-nucleotide fragment of the 5'-promoter region of the mouse GluR2 gene in neural-derived cell lines. We focused on regulation of GluR2 promoter activity by two neurotrophic factors, which are known to be altered in vivo in some of the same systems that show GluR2 regulation. Glial-cell line derived neurotrophic factor (GDNF) and brain-derived neurotrophic factor (BDNF) both induced GluR2 promoter activity. This was associated with increased expression of endogenous GluR2 immunoreactivity in the cells as measured by Western blotting. The effect of GDNF and BDNF appeared to be mediated via a NRSE (neuron-restrictive silencer element) present within the GluR2 promoter. The response to these neurotrophic factors was lost upon mutating or deleting this site, but not several other putative response elements present within the promoter. Moreover, overexpression of REST (restrictive element silencer transcription factor; also referred to as NRSF or neuron restrictive silencer factor), which is known to act on NRSEs in other genes to repress gene expression, blocked the ability of GDNF to induce GluR2 promoter activity. However, GDNF did not alter endogenous levels of REST in the cells. Together, these findings suggest that GluR2 expression can be regulated by neurotrophic factors via an apparently novel mechanism involving the NRSE present within the GluR2 gene promoter.

Calmodulin activity regulates group I metabotropic glutamate receptor-mediated signal transduction and synaptic depression.

PubMed

Sethna, Ferzin; Zhang, Ming; Kaphzan, Hanoch; Klann, Eric; Autio, Dawn; Cox, Charles L; Wang, Hongbing

2016-05-01

Group I metabotropic glutamate receptors (mGluR), including mGluR1 and mGluR 5 (mGluR1/5), are coupled to Gq and modulate activity-dependent synaptic plasticity. Direct activation of mGluR1/5 causes protein translation-dependent long-term depression (LTD). Although it has been established that intracellular Ca(2+) and the Gq-regulated signaling molecules are required for mGluR1/5 LTD, whether and how Ca(2+) regulates Gq signaling and upregulation of protein expression remain unknown. Through pharmacological inhibition, we tested the function of the Ca(2+) sensor calmodulin (CaM) in intracellular signaling triggered by the activation of mGluR1/5. CaM inhibitor N-[4-aminobutyl]-5-chloro-2-naphthalenesulfonamide hydrochloride (W13) suppressed the mGluR1/5-stimulated activation of extracellular signal-regulated kinase 1/2 (ERK1/2) and p70-S6 kinase 1 (S6K1) in hippocampal neurons. W13 also blocked the mGluR1/5 agonist-induced synaptic depression in hippocampal slices and in anesthetized mice. Consistent with the function of CaM, inhibiting the downstream targets Ca(2+) /CaM-dependent protein kinases (CaMK) blocked ERK1/2 and S6K1 activation. Furthermore, disruption of the CaM-CaMK-ERK1/2 signaling cascade suppressed the mGluR1/5-stimulated upregulation of Arc expression. Altogether, our data suggest CaM as a new Gq signaling component for coupling Ca(2+) and protein upregulation and regulating mGluR1/5-mediated synaptic modification. © 2016 Wiley Periodicals, Inc.

Metabotropic glutamate mGlu2 receptor is necessary for the pharmacological and behavioral effects induced by hallucinogenic 5-HT2A receptor agonists.

PubMed

Moreno, José L; Holloway, Terrell; Albizu, Laura; Sealfon, Stuart C; González-Maeso, Javier

2011-04-15

Hallucinogenic drugs, including mescaline, psilocybin and lysergic acid diethylamide (LSD), act at serotonin 5-HT2A receptors (5-HT2ARs). Metabotropic glutamate receptor 2/3 (mGluR2/3) ligands show efficacy in modulating the responses induced by activation of 5-HT2ARs. The formation of a 5-HT2AR-mGluR2 complex suggests a functional interaction that affects the hallucinogen-regulated cellular signaling pathways. Here, we tested the cellular and behavioral effects of hallucinogenic 5-HT2AR agonists in mGluR2 knockout (mGluR2-KO) mice. Mice were intraperitoneally injected with the hallucinogens DOI (2 mg/kg) and LSD (0.24 mg/kg), or vehicle. Head-twitch behavioral response, expression of c-fos, which is induced by all 5-HT2AR agonists, and expression of egr-2, which is hallucinogen-specific, were determined in wild type and mGluR2-KO mice. [(3)H]Ketanserin binding displacement curves by DOI were performed in mouse frontal cortex membrane preparations. Head twitch behavior was abolished in mGluR2-KO mice. The high-affinity binding site of DOI was undetected in mGluR2-KO mice. The hallucinogen DOI induced c-fos in both wild type and mGluR2-KO mice. However, the induction of egr-2 by DOI was eliminated in mGlu2-KO mice. These findings suggest that the 5-HT2AR-mGluR2 complex is necessary for the neuropsychological responses induced by hallucinogens. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Metabotropic glutamate mGlu2 receptor is necessary for the pharmacological and behavioral effects induced by hallucinogenic 5-HT2A receptor agonists

PubMed Central

Moreno, José L.; Holloway, Terrell; Albizu, Laura; Sealfon, Stuart C.; González-Maeso, Javier

2011-01-01

Hallucinogenic drugs, including mescaline, psilocybin and lysergic acid diethylamide (LSD), act at serotonin 5-HT2A receptors (5-HT2ARs). Metabotropic glutamate receptor 2/3 (mGluR2/3) ligands show efficacy in modulating the responses induced by activation of 5-HT2ARs. The formation of a 5-HT2AR-mGluR2 complex suggests a functional interaction that affects the hallucinogen-regulated cellular signaling pathways. Here, we tested the cellular and behavioral effects of hallucinogenic 5-HT2AR agonists in mGluR2 knockout (mGluR2-KO) mice. Mice were intraperitoneally injected with the hallucinogens DOI (2 mg/kg) and LSD (0.24 mg/kg), or vehicle. Head-twitch behavioral response, expression of c-fos, which is induced by all 5-HT2AR agonists, and expression of egr-2, which is hallucinogen-specific, were determined in wild type and mGluR2-KO mice. [3H]Ketanserin binding displacement curves by DOI were performed in mouse frontal cortex membrane preparations. Head twitch behavior was abolished in mGluR2-KO mice. The high-affinity binding site of DOI was undetected in mGluR2-KO mice. The hallucinogen DOI induced c-fos in both wild type and mGluR2-KO mice. However, the induction of egr-2 by DOI was eliminated in mGlu2-KO mice. These findings suggest that the 5-HT2AR-mGluR2 complex is necessary for the neuropsychological responses induced by hallucinogens. PMID:21276828

HSV-Mediated Transgene Expression of Chimeric Constructs to Study Behavioral Function of GPCR Heteromers in Mice.

PubMed

Holloway, Terrell; Moreno, Jose L; González-Maeso, Javier

2016-07-09

The heteromeric receptor complex between 5-HT2A and mGlu2 has been implicated in some of the behavioral phenotypes in mouse models of psychosis(1,2). Consequently, investigation of structural details of the interaction between 5-HT2A and mGlu2 affecting schizophrenia-related behaviors represents a powerful translational tool. As previously shown, the head-twitch response (HTR) in mice is elicited by hallucinogenic drugs and this behavioral response is absent in 5-HT2A knockout (KO) mice(3,4). Additionally, by conditionally expressing the 5-HT2A receptor only in cortex, it was demonstrated that 5-HT2A receptor-dependent signaling pathways on cortical pyramidal neurons are sufficient to elicit head-twitch behavior in response to hallucinogenic drugs(3). Finally, it has been shown that the head-twitch behavioral response induced by the hallucinogens DOI and lysergic acid diethylamide (LSD) is significantly decreased in mGlu2-KO mice(5). These findings suggest that mGlu2 is at least in part necessary for the 5-HT2A receptor-dependent psychosis-like behavioral effects induced by LSD-like drugs. However, this does not provide evidence as to whether the 5-HT2A-mGlu2 receptor complex is necessary for this behavioral phenotype. To address this question, herpes simplex virus (HSV) constructs to express either mGlu2 or mGlu2ΔTM4N (mGlu2/mGlu3 chimeric construct that does not form the 5-HT2A-mGlu2 receptor complex) in the frontal cortex of mGlu2-KO mice were used to examine whether this GPCR heteromeric complex is needed for the behavioral effects induced by LSD-like drugs(6).

Salivary exoglycosidases as markers of alcohol dependence.

PubMed

Waszkiewicz, Napoleon; Chojnowska, Sylwia; Zalewska, Anna; Zwierz, Krzysztof; Szulc, Agata; Szajda, Sławomir Dariusz

2014-01-01

Some salivary markers of alcohol abuse/dependence have been proposed so far: aminotransferases, gamma-glutamyltransferase, ethanol, ethyl glucuronide, ethyl sulfate, sialic acid, β-hexosaminidase A, oral peroxidase, methanol, diethylene/ethylene glycol, α-amylase, clusterin, haptoglobin, heavy/light chains of immunoglobulins and transferrin. To investigate the effect of chronic alcohol drinking and smoking on the activity (pKat/ml) and output (pKat/min) of salivary lysosomal exoglycosidases: α-fucosidase (FUC), α-mannosidase (MAN), β-galactosidase (GAL), and β-glucuronidase (GLU), and their applicability as markers of alcohol dependence. The activity of FUC, MAN, GAL and GLU was measured colorimetrically in the saliva of healthy social drinkers, alcohol-dependent non-smokers and alcohol-dependent smokers. We observed an increased salivary activity of FUC, GAL, GLU and MAN, as well as an increased output of GAL and GLU, in comparison with controls. The highest increase in the activity/output was found in salivary GLU and MAN (GLU, even 7- to 18-fold), and the least in GAL. We found an excellent sensitivity and specificity and a high accuracy (measured by the area under the ROC curve) for salivary FUC, GLU and MAN activities. The salivary GLU activity positively correlated with the number of days of last alcohol intoxication. Salivary activity of FUC, GAL and MAN, but not GLU, positively correlated with the periodontal parameters such as gingival index and papilla bleeding index. Although we found an excellent sensitivity and specificity as well as a high accuracy for the salivary activity of FUC, GLU and MAN, the GLU activity seems to be mostly applicable as a marker of chronic alcohol drinking (alcohol dependence). © The Author 2014. Medical Council on Alcohol and Oxford University Press. All rights reserved.

Group III mGluR regulation of synaptic transmission at the SC-CA1 synapse is developmentally regulated

PubMed Central

Ayala, Jennifer E.; Niswender, Colleen M.; Luo, Qingwei; Banko, Jessica L.; Conn, P. Jeffrey

2008-01-01

Summary Group III metabotropic glutamate receptors (mGluRs) reduce synaptic transmission at the Schaffer collateral-CA1 (SC-CA1) synapse in rats by a presynaptic mechanism. Previous studies show that low concentrations of the group III-selective agonist, L-AP4, reduce synaptic transmission in slices from neonatal but not adult rats, whereas high micromolar concentrations reduce transmission in both age groups. L-AP4 activates mGluRs 4 and 8 at much lower concentrations than those required to activate mGluR7, suggesting that the group III mGluR subtype modulating transmission is a high affinity receptor in neonates and a low affinity receptor in adults. The previous lack of subtype selective ligands has made it difficult to test this hypothesis. We have measured fEPSPs in the presence of novel subtype selective agents to address this question. We show that the effects of L-AP4 can be blocked by LY341495 in both neonates and adults, verifying that these effects are mediated by mGluRs. In addition, the selective mGluR8 agonist, DCPG, has a significant effect in slices from neonatal rats but does not reduce synaptic transmission in adult slices. The mGluR4 selective allosteric potentiator, PHCCC, is unable to potentiate the L-AP4-induced effects at either age. Taken together, our data suggest that group III mGluRs regulate transmission at the SC-CA1 synapse throughout development but there is a developmental regulation of the subtypes involved so that that both mGluR8 serves this role in neonates but not adults whereas mGluR7 is involved in regulating transmission at this synapse in throughout postnatal development. PMID:18255102

The Metabotropic Glutamate Receptor Subtype 5 (mGluR5) Mediates Sensitivity to the Sedative Properties of Ethanol

PubMed Central

Downing, Chris; Marks, Michael J.; Larson, Colin; Johnson, Thomas E.

2010-01-01

Objective Inbred Long-Sleep and Short-Sleep mice (ILS and ISS) were selectively bred for differential sensitivity to the sedative effects of ethanol. Lines of mice derived from these progenitors have been used to identify several Quantitative Trait Loci (QTLs) mediating Loss Of the Righting reflex due to Ethanol (LORE). The present study investigated mGluR5 as a candidate gene underlying Lore7, a QTL mediating differential LORE sensitivity. Methods We used knockout mice, a quantitative complementation test, pharmacological antagonism of mGluR5, real-time quantitative PCR, radioligand binding, DNA sequencing and bioinformatics to examine the role of mGluR5 in ethanol-induced sedation. Results mGluR5 knockout mice had a significantly longer LORE duration than wild-type controls. Administration of the mGluR5 antagonist 2-methyl-6-(phenylethyl)-pyridine (MPEP) had differential effects on LORE in ILS and ISS mice. A quantitative complementation test also supported mGluR5 mediating LORE. Two intronic single-nucleotide polymorphisms in mGluR5 were highly correlated with LORE in recombinant inbred mice derived from a cross between ILS and ISS (LXS RIs). Differences in mGluR5 mRNA level and receptor density were observed between ILS and ISS in distinct brain regions. Finally, data from WebQTL showed that mGluR5 expression was highly correlated with several LORE phenotypes in the LXS RIs. Conclusions Taken together, this data provides convincing evidence that mGluR5 mediates differential sensitivity to the sedative effects of ethanol. Studies from the human literature have also identified MGLUR5 as a potential candidate gene for ethanol sensitivity. PMID:20657349

Opiate withdrawal induces dynamic expressions of AMPA receptors and its regulatory molecule CaMKIIalpha in hippocampal synapses.

PubMed

Zhong, Weixia; Dong, Zhifang; Tian, Meng; Cao, Jun; Xu, Tianle; Xu, Lin; Luo, Jianhong

2006-07-24

Adaptive changes in brain areas following drug withdrawal are believed to contribute to drug seeking and relapse. Cocaine withdrawal alters the expression of GluR1 and GluR2/3 subunits of alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors in nucleus accumbens or amygdala, but the influence of drug withdrawal on hippocampus is little known. Here, we have examined the expression of GluR1 and GluR2/3 in hippocampal membrane and synaptic fractions following repeated morphine exposure and subsequent withdrawal. Repeated morphine exposure for 12 d increased GluR1 and GluR2/3 in synaptosome but not in membrane fraction. Interestingly, CaMKIIalpha, known to be able to regulate the function of AMPA receptors, was decreased in synaptosome but not in membrane fraction; pCaMKIIalpha, the phosphorylated form of CaMKIIalpha, was increased in both fractions. However, during opiate withdrawal, GluR1 was generally reduced while GluR2/3 was prominently increased in both fractions; pCaMKIIalpha was strongly decreased immediately after withdrawal, but detectably increased in late phase of morphine withdrawal in both fractions. Importantly, the opiate withdrawal-induced increase in GluR2/3 was dependent on the activation of glucocorticoid receptors and NMDA receptors, as it was prevented by the glucocorticoid receptor antagonist RU38486, or intrahippocampal injection of the NMDA receptor antagonist AP-5 or the antagonist to NR2B-containing NMDA receptors, Ro25-6981. These findings indicate that opiate withdrawal induces dynamic expression of GluR1 and GluR2/3 subunits of AMPA receptors in hippocampal synapses, possibly revealing an adaptive process of the hippocampal functions following opiate withdrawal.

Synthesis and Pharmacological Characterization of C4-(Thiotriazolyl)-substituted-2-aminobicyclo[3.1.0]hexane-2,6-dicarboxylates. Identification of (1R,2S,4R,5R,6R)-2-Amino-4-(1H-1,2,4-triazol-3-ylsulfanyl)bicyclo[3.1.0]hexane-2,6-dicarboxylic Acid (LY2812223), a Highly Potent, Functionally Selective mGlu2 Receptor Agonist.

PubMed

Monn, James A; Prieto, Lourdes; Taboada, Lorena; Hao, Junliang; Reinhard, Matthew R; Henry, Steven S; Beadle, Christopher D; Walton, Lesley; Man, Teresa; Rudyk, Helene; Clark, Barry; Tupper, David; Baker, S Richard; Lamas, Carlos; Montero, Carlos; Marcos, Alicia; Blanco, Jaime; Bures, Mark; Clawson, David K; Atwell, Shane; Lu, Frances; Wang, Jing; Russell, Marijane; Heinz, Beverly A; Wang, Xushan; Carter, Joan H; Getman, Brian G; Catlow, John T; Swanson, Steven; Johnson, Bryan G; Shaw, David B; McKinzie, David L

2015-09-24

Identification of orthosteric mGlu(2/3) receptor agonists capable of discriminating between individual mGlu2 and mGlu3 subtypes has been highly challenging owing to the glutamate-site sequence homology between these proteins. Herein we detail the preparation and characterization of a series of molecules related to (1S,2S,5R,6S)-2-aminobicyclo[3.1.0]hexane-2,6-dicarboxylate 1 (LY354740) bearing C4-thiotriazole substituents. On the basis of second messenger responses in cells expressing other recombinant human mGlu2/3 subtypes, a number of high potency and efficacy mGlu2 receptor agonists exhibiting low potency mGlu3 partial agonist/antagonist activity were identified. From this, (1R,2S,4R,5R,6R)-2-amino-4-(1H-1,2,4-triazol-3-ylsulfanyl)bicyclo[3.1.0]hexane-2,6-dicarboxylic acid 14a (LY2812223) was further characterized. Cocrystallization of 14a with the amino terminal domains of hmGlu2 and hmGlu3 combined with site-directed mutation studies has clarified the underlying molecular basis of this unique pharmacology. Evaluation of 14a in a rat model responsive to mGlu2 receptor activation coupled with a measure of central drug disposition provides evidence that this molecule engages and activates central mGlu2 receptors in vivo.

Effects of ethanol and anesthetics on type 1 and 5 metabotropic glutamate receptors expressed in Xenopus laevis oocytes.

PubMed

Minami, K; Gereau, R W; Minami, M; Heinemann, S F; Harris, R A

1998-01-01

Previous studies have demonstrated that ethanol and volatile anesthetics inhibit the function of some metabotropic (G protein-coupled) receptors, including the 5-hydroxytryptamine2 and muscarinic cholinergic receptors. The metabotropic glutamate receptors (mGluRs) show little sequence homology with most other metabotropic receptors and are important modulators of synaptic transmission in the mammalian central nervous system. It was of interest to determine drug actions on these receptors, and we investigated the effects of ethanol, halothane, the anesthetic compound F3 (1-chloro-1,2,2-trifluorocyclobutane), and the nonanesthetics F6 (1,2-dichlorohexafluorocyclobutane) and F8 (2,3-chlorooctafluorobutane) on the function of mGluR1 and mGluR5 expressed in Xenopus laevis oocytes. Halothane, F3, and ethanol inhibited mGluR5-induced Ca(2+)-dependent Cl- currents, yet pharmacologically relevant concentrations of these compounds had little effect on the glutamate-induced currents in the oocytes expressing mGluR1. F6 had inhibitory effects on both receptors, and F8 did not affect either mGluR1 or mGluR5 function. The protein kinase C (PKC) inhibitor GF109203X enhanced the glutamate-induced current, and the PKC activator phorbol-12-myristate-13-acetate inhibited this current in the oocytes expressing mGluR5, but these compounds had little effect on mGluR1 function. GF109203X abolished the inhibitory effects of halothane, F3, and ethanol on mGluR5s. Conversely, the phosphatase inhibitor calyculin A prolonged the action of halothane and ethanol. Furthermore, mutation of a PKC consensus site (Ser890) of mGluR5 abolished the inhibitory effects of halothane, F3, and ethanol. These results suggest that ethanol and volatile anesthetics inhibit mGluR5 because they promote PKC-mediated phosphorylation.

Mdm2 mediates FMRP- and Gp1 mGluR-dependent protein translation and neural network activity.

PubMed

Liu, Dai-Chi; Seimetz, Joseph; Lee, Kwan Young; Kalsotra, Auinash; Chung, Hee Jung; Lu, Hua; Tsai, Nien-Pei

2017-10-15

Activating Group 1 (Gp1) metabotropic glutamate receptors (mGluRs), including mGluR1 and mGluR5, elicits translation-dependent neural plasticity mechanisms that are crucial to animal behavior and circuit development. Dysregulated Gp1 mGluR signaling has been observed in numerous neurological and psychiatric disorders. However, the molecular pathways underlying Gp1 mGluR-dependent plasticity mechanisms are complex and have been elusive. In this study, we identified a novel mechanism through which Gp1 mGluR mediates protein translation and neural plasticity. Using a multi-electrode array (MEA) recording system, we showed that activating Gp1 mGluR elevates neural network activity, as demonstrated by increased spontaneous spike frequency and burst activity. Importantly, we validated that elevating neural network activity requires protein translation and is dependent on fragile X mental retardation protein (FMRP), the protein that is deficient in the most common inherited form of mental retardation and autism, fragile X syndrome (FXS). In an effort to determine the mechanism by which FMRP mediates protein translation and neural network activity, we demonstrated that a ubiquitin E3 ligase, murine double minute-2 (Mdm2), is required for Gp1 mGluR-induced translation and neural network activity. Our data showed that Mdm2 acts as a translation suppressor, and FMRP is required for its ubiquitination and down-regulation upon Gp1 mGluR activation. These data revealed a novel mechanism by which Gp1 mGluR and FMRP mediate protein translation and neural network activity, potentially through de-repressing Mdm2. Our results also introduce an alternative way for understanding altered protein translation and brain circuit excitability associated with Gp1 mGluR in neurological diseases such as FXS. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Evidence for a fragile X mental retardation protein-mediated translational switch in metabotropic glutamate receptor-triggered Arc translation and long-term depression.

PubMed

Niere, Farr; Wilkerson, Julia R; Huber, Kimberly M

2012-04-25

Group 1 metabotropic glutamate receptor (mGluR)-stimulated protein synthesis and long-term synaptic depression (mGluR-LTD) are altered in the mouse model of fragile X syndrome, Fmr1 knock-out (KO) mice. Fmr1 encodes fragile X mental retardation protein (FMRP), a dendritic RNA binding protein that functions, in part, as a translational suppressor. It is unknown whether and how FMRP acutely regulates LTD and/or the rapid synthesis of new proteins required for LTD, such as the activity-regulated cytoskeletal-associated protein (Arc). The protein phosphatase PP2A dephosphorylates FMRP, which contributes to translational activation of some target mRNAs. Here, we report that PP2A and dephosphorylation of FMRP at S500 are required for an mGluR-induced, rapid (5 min) increase in dendritic Arc protein and LTD in rat and mouse hippocampal neurons. In Fmr1 KO neurons, basal, dendritic Arc protein levels and mGluR-LTD are enhanced, but mGluR-triggered Arc synthesis is absent. Lentiviral-mediated expression of wild-type FMRP in Fmr1 KO neurons suppresses basal dendritic Arc levels and mGluR-LTD, and restores rapid mGluR-triggered Arc synthesis. A phosphomimic of FMRP (S500D) suppresses steady-state dendritic Arc levels but does not rescue mGluR-induced Arc synthesis. A dephosphomimic of FMRP (S500A) neither suppresses dendritic Arc nor supports mGluR-induced Arc synthesis. Accordingly, S500D-FMRP expression in Fmr1 KO neurons suppresses mGluR-LTD, whereas S500A-FMRP has no effect. These data support a model in which phosphorylated FMRP functions to suppress steady-state translation of Arc and LTD. Upon mGluR activation of PP2A, FMRP is rapidly dephosphorylated, which contributes to rapid new synthesis of Arc and mGluR-LTD.

Modulation of spinal nociception by GluR5 kainate receptor ligands in acute and hyperalgesic states and the role of gabaergic mechanisms.

PubMed

Mascias, Paula; Scheede, Manuela; Bloms-Funke, Petra; Chizh, Boris

2002-09-01

GluR5 receptors modulate spinal nociception, however, their role in nociceptive hypersensitivity remains unclear. Using behavioural and electrophysiological approaches, we have investigated several GluR5 ligands in acute and hyperalgesic states. Furthermore, as the GABAergic system plays a role in GluR5 mediated effects in the brain, we also analysed the interaction between GluR5 agonists and GABA(A) antagonists in the spinal cord. In young rats in vivo, the GluR5 selective agonist ATPA was antinociceptive and antihyperalgesic in a model of inflammatory hyperalgesia (ED(50) approximately 4.6 and approximately 5.2 mg/kg, respectively), whereas the GluR5/GluR6 agonist SYM2081 was only antihyperalgesic. ATPA, but not SYM2081, was also able to inhibit nociceptive motoneurone responses in anaesthetised adult rats after intrathecal administration. In hemisected spinal cords in vitro, SYM2081 was inactive, whereas ATPA and another GluR5 agonist, (S)-5-iodowillardiine, inhibited nociceptive reflexes (EC(50) 1.1+/-0.4 micro M and 0.36+/-0.05 micro M, respectively). Both GluR5 agonists also inhibited motoneurone responses to repetitive dorsal root stimulation and their cumulative depolarisation, a correlate of wind-up. The GABA(A) antagonists bicuculline (10 micro M) and SR95531 (1 micro M) enhanced polysynaptic responses to single stimuli but abolished the cumulative depolarisation. Both bicuculline and SR95531 significantly attenuated the inhibition of nociceptive responses by 1 micro M ATPA (by approximately 50%). We conclude that selective GluR5 kainate receptor activation inhibits spinal nociception and its sensitisation caused by ongoing peripheral nociceptive drive. GABA(A) receptors are involved in tonic inhibition of segmental responses, but contribute to their sensitisation by repetitive primary afferent stimulation. Furthermore, there is a cross-talk between the two systems, presumably due to GluR5-mediated activation of GABAergic inhibitory interneurones in the spinal cord.

Use of near-isogenic wheat lines to determine the glutenin composition and functionality requirements for flour tortillas.

PubMed

Mondal, Suchismita; Tilley, Michael; Alviola, Juma Novi; Waniska, Ralph D; Bean, Scott R; Glover, Karl D; Hays, Dirk B

2008-01-09

In wheat ( Triticum aestivum L), the synthesis of high molecular weight (HMW) glutenins (GS) is controlled by three heterologous genetic loci present on the long arms of group 1 wheat chromosomes. The loci Glu-A1, Glu-B1, and Glu-D1 and their allelic variants play important roles in the functional properties of wheat flour. This study focused on understanding the functionality of these protein subunits on tortilla quality. Near-isogenic wheat lines in which one or more of these loci were absent or deleted were used. Tortillas were prepared from each deletion line and the parent lines. The elimination of certain HMW-GS alleles alter distinct but critical aspects of tortilla quality such as diameter, shelf stability, and overall quality. Two deletion lines possessing HMW-GS 17 + 18 at Glu-B1 and deletions in Glu-A1 and Glu-D1 had significantly larger tortilla diameters, yet tortilla shelf life was compromised or unchanged from the parent lines used to develop the deletion lines or the commercial tortilla flour used as a control. Alternatively, a deletion line possessing Glu-A1 and Glu-D1 (HMW-GS 1, 5 + 10) and a deletion in Glu-B1 also significantly improved tortilla diameters. Whereas the increase in diameter was less than the line possessing only HMW-GS 17 + 18 at Glu-B1, the stability of the tortillas were, however, maintained and improved as compared to the parent lines containing a full compliment of HMW-GS. Thus, the presence of subunits 5 + 10 at Glu-D1 alone or in combination with subunit 1 at Glu-A1 appears to provide a compromise of improvement in dough extensibility for improved tortilla diameters while also providing sufficient gluten strength to maintain ideal shelf stability.

Prenatal chronic mild stress induces depression-like behavior and sex-specific changes in regional glutamate receptor expression patterns in adult rats.

PubMed

Wang, Y; Ma, Y; Hu, J; Cheng, W; Jiang, H; Zhang, X; Li, M; Ren, J; Li, X

2015-08-20

Chronic stress during critical periods of human fetal brain development is associated with cognitive, behavioral, and mood disorders in later life. Altered glutamate receptor (GluR) expression has been implicated in the pathogenesis of stress-dependent disorders. To test whether prenatal chronic mild stress (PCMS) enhances offspring's vulnerability to stress-induced behavioral and neurobiological abnormalities and if this enhanced vulnerability is sex-dependent, we measured depression-like behavior in the forced swimming test (FST) and regional changes in GluR subunit expression in PCMS-exposed adult male and female rats. Both male and female PCMS-exposed rats exhibited stronger depression-like behavior than controls. Males and females exhibited unique regional changes in GluR expression in response to PCMS alone, FST alone (CON-FST), and PCMS with FST (PCMS-FST). In females, PCMS alone did not alter N-methyl-d-aspartate receptor (NMDAR) or metabotropic glutamate receptor (mGluR) expression, while in PCMS males, higher mGluR2/3, mGluR5, and NR1 expression levels were observed in the prefrontal cortex. In addition, PCMS altered the change in GluR expression induced by acute stress (the FST test), and this too was sex-specific. Male PCMS-FST rats expressed significantly lower mGluR5 levels in the hippocampus, lower mGluR5, NR1, postsynaptic density protein (PSD)95, and higher mGluR2/3 in the prefrontal cortex, and higher mGluR5 and PSD95 in the amygdala than male CON-FST rats. Female PCMS-FST rats expressed lower NR1 in the hippocampus, lower NR2B and PSD95 in the prefrontal cortex, lower mGluR2/3 in the amygdala, and higher PSD95 in the amygdala than female CON-FST rats. PCMS may increase the offspring's vulnerability to depression by altering sex-specific stress-induced changes in glutamatergic signaling. Copyright © 2015. Published by Elsevier Ltd.

High Methotrexate Triglutamate Level Is an Independent Predictor of Adverse Effects in Asian Indian Rheumatoid Arthritis Patients-A Preliminary Study.

PubMed

Sandhu, Amit; Dhir, Varun; Bhatnagar, Archana; Dhawan, Veena; Kaur, Jasbinder; Sood, Ankita; Naidu, Shankar; Ahmad, Shabeer; Varma, Neelam; Sharma, Aman; Sharma, Shefali

2017-04-01

It is unclear whether erythrocyte methotrexate polyglutamate levels (MTX-glun) are associated with response or adverse effects to methotrexate in rheumatoid arthritis. This preliminary study evaluated their utility in Asian Indian patients over 24 weeks. Rheumatoid arthritis patients were started on oral methotrexate at a dose of 15 mg/wk, which was escalated to 25 mg by 12 weeks and continued till 24 weeks. Erythrocyte (RBC) MTX-glu1 to MTX-glu5 levels (nmol/L RBC) were determined at 4, 8, 16, and 24 weeks by using reverse-phase high-performance liquid chromatography. Area under the concentration curve (AUC) of MTX-glu1-5, MTX-glu3-5, and MTX-glu3 levels was compared between groups with regards to response and adverse effects. This study included 117 patients with mean (SD) age of 42.7 (±11.9) years and disease duration of 2.0 (1.7) years. Mean (SD) RBC MTX-glu1-5 levels at 4, 8, 16, and 24 weeks were 93 (±29), 129 (±46), 143 (±49), and 159 (±65) nmol/L RBC; the highest individual polyglutamate was MTX-glu3 (40%). There was significant correlation between MTX-glu1-5 (r = 0.38, P < 0.001) and MTX-glu3 (r = 0.49, P < 0.001) with methotrexate dose. There was no significant difference of AUC MTX-glun between responders and nonresponders. However, AUC MTX-glu3 was significantly (P = 0.03) higher in patients with adverse effects. On logistic regression, AUC of MTX-glu3 [odds ratio = 1.004 (95% confidence interval 1.002-1.007)] and methotrexate dose at 24 weeks were independent predictors of adverse effects. In this preliminary study, higher levels of RBC MTX-glu3 were found to be the independent predictors for adverse effects in rheumatoid arthritis patients.

Expression of messenger RNAs encoding ionotropic glutamate receptors in rat brain: regulation by haloperidol.

PubMed

Brené, S; Messer, C; Nestler, E J

1998-06-01

In situ hybridization was used to study the regional distribution of messenger RNAs encoding ionotropic glutamate receptor subtypes in the rat brain's dopaminergic cell body regions and their forebrain projection areas. Short oligonucleotide probes specific for the messenger RNAs encoding the flip or flop splice forms of the GluR1 and GluR2 AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate) receptor subunits, or for the messenger RNAs encoding the N-methyl-D-aspartate R1 subunit, were used. Significant differences were seen in the relative messenger RNA levels, and the distribution of the flip and flop splice forms, of GluR1 and GluR2. In the dopaminergic cell groups of the substantia nigra pars compacta and the ventral tegmental area, the flip form of both GluR1 and GluR2 dominated over the flop form. Similarly, in the core division of the nucleus accumbens, GluR1 and GluR2 flip forms dominated over the flop forms. In contrast, in the accumbens shell, the GluR1 and GluR2 flop forms dominated over the flip forms. As a comparison to the AMPA receptor subunits, N-methyl-D-aspartate R1 messenger RNA was relatively evenly distributed in all the regions analysed. The results demonstrate a heterogeneous distribution of the flip and flop splice forms of GluR1 and GluR2 in the brain's dopaminergic pathways, which could contribute to physiological differences in regulation of the pathways by glutamatergic neurotransmission. We also studied regulation of glutamate receptor subunit expression in these regions by antipsychotic drugs, based on previous reports of altered levels of subunit immunoreactivity after drug treatment. Chronic administration of the typical antipsychotic drug, haloperidol, caused a small but significant induction of GluR2 flip messenger RNA in the dorsolateral caudate putamen. This effect was not seen after chronic administration of the atypical antipsychotic drug, clozapine. Significant drug regulation of the other glutamate receptor subunits studied was not observed.

Increases in duodenal glutamic acid supply linearly increase small intestinal starch digestion but not nitrogen balance in cattle.

PubMed

Blom, E J; Anderson, D E; Brake, D W

2016-12-01

Small intestinal starch digestion (SISD) in cattle is often limited; however, greater postruminal flow of high-quality protein (e.g., casein) can increase SISD, and Glu can mimic responses to casein for SISD. We evaluated effects of increasing Glu flows to the duodenum on SISD and N retention in cattle. Cattle received (DM basis) continuous duodenal infusion of raw cornstarch (1.5 ± 0.08 kg/d) and 0, 30.9 ± 0.6, 62.4 ± 1.2, or 120.4 ± 3.4 g/d Glu or 387.9 ± 17.5 g/d casein. As expected, the positive control (i.e., casein) increased ( = 0.05) SISD. Interestingly, SISD linearly increased ( = 0.02) with increasing amounts of Glu. Starch flow to the ileum linearly decreased ( = 0.04) in response to greater postruminal Glu and tended to decrease ( = 0.07) with duodenal casein infusion. Ileal flow of ethanol-soluble starch was not affected by duodenal Glu ( = 0.16) or casein ( = 0.42). There was a tendency ( = 0.08) for a quadratic response to Glu for ileal glucose flow with greater flows for intermediate levels of Glu, but casein had no effect ( = 0.81) on glucose flows to the ileum. Greater postruminal supplies of Glu (linear, = 0.05) and casein ( = 0.02) decreased fecal starch flow. Postruminal starch digestion was increased by both casein ( = 0.03) and Glu (linear, = 0.05). Nitrogen intake from feed was not different among treatments ( ≥ 0.23). By design, infusate N increased from 0 to 13 ± 1.5 g/d with greater amounts of Glu, and casein provided 61 ± 1.3 g N/d. Urinary N excretion was not affected ( ≥ 0.30) by postruminal Glu flow, but urine N was increased by casein ( < 0.01). Glutamic acid did not affect N retention ( ≥ 0.34), but casein increased N retention ( < 0.01). However, N retained as a percent of N intake (26.7 ± 1.7%) was not different when cattle were provided Glu ( ≥ 0.16) or casein ( = 0.38).

Activation of NMDA receptors reduces metabotropic glutamate receptor-induced long-term depression in the nucleus accumbens via a CaMKII-dependent mechanism.

PubMed

Huang, Chiung-Chun; Hsu, Kuei-Sen

2012-12-01

Glutamate is the major excitatory neurotransmitter in the brain and exerts its actions through two distinct types of receptors, ionotropic and metabotropic glutamate receptors (mGluR). Although functional interplay between ionotropic N-methyl-d-aspartate receptors (NMDAR) and mGluR has been convincingly demonstrated in native and recombinant systems, the mechanism by which NMDAR activation leads to modulation of mGluR function has yet to be elucidated. Using whole-cell patch-clamp recordings in mouse nucleus accumbens (NAc) slices, we found that tetanic stimulation (TS) of excitatory afferents with a naturally occurring frequency (10 min at 13 Hz) reliably induces a mGluR1/5-dependent long-term depression (mGluR1/5-LTD) of excitatory synaptic transmission. Blockade of NMDAR during but not after TS showed enhanced mGluR1/5-LTD induction, which is associated with its antagonism of TS-induced calcium/calmodulin-dependent protein kinase II (CaMKII) activation. The ability of NMDAR antagonists to promote mGluR1/5-LTD induction was mimicked by a selective CaMKII inhibitor KN-62. However, the induction of mGluR1/5-LTD by bath-applied agonist (S)-3,5-dihydrophenylglycine was not affected by NMDAR blockade. We also observed that NMDAR or CaMKII blockade during TS significantly blunted TS-induced increased serine/threonine phosphorylation of the scaffold protein Homer1b/c and resulted in an increased interaction of mGluR5 with the Homer1b/c. These results indicate that synaptically released glutamate during TS of excitatory afferents can activate both NMDAR and mGluR1/5 in NAc neurons concomitantly and that activation of NMDAR may stimulate CaMKII-mediated phosphorylation of Homer1b/c and impair the interaction between mGluR5 and Homer1b/c, thereby attenuating mGluR1/5-LTD induction. This study provides a novel molecular mechanism by which NMDAR could regulate mGluR5 function. Copyright © 2012 Elsevier Ltd. All rights reserved.

Distribution of AMPA receptor subunits GluR1-4 in the dorsal vagal complex of the rat: a light and electron microscope immunocytochemical study.

PubMed

Kessler, J P; Baude, A

1999-10-01

The dorsal vagal complex, localized in the dorsomedial medulla, includes the nucleus tractus solitarii (NTS), the dorsal motor nucleus of the vagus nerve (DMN) and the area postrema (AP). The distribution of AMPA-preferring glutamate receptors (AMPA receptors) within this region was investigated using immunohistochemistry and antibodies recognizing either one (GluR1 or GluR4) or two (GluR2 and GluR3) AMPA receptors subunits. The distribution of GluR1 immunoreactivity showed high contrast of staining between strongly and lightly labeled areas. Labeling was intense in the AP and weak in the NTS, except for its medial and dorsalmost parts which exhibited moderate staining. Almost no GluR1 immunoreactivity was found in the DMN. GluR2/3 immunolabeling was present in the entire dorsal vagal complex. This labeling was strong in the AP, the DMN and the medial half of the NTS and moderate in the lateral half of the NTS, except for the interstitial subdivision which exhibited intense staining. Labeling induced by the GluR4 antibody was very weak throughout the dorsal vagal complex. Ultrastructural examination showed that GluR1 and GluR2/3 immunoreactivity was localized in neuronal cell bodies and dendrites. No labeled axon terminal or glial cell body was found. Immunoperoxidase staining in labeled cell bodies and dendrites was associated with intracellular organelles (microtubules, mitochondria, cisternae of the endoplasmic reticulum,.) and/or parts of the plasma membrane. Plasma membrane labeling was often associated with asymmetrical synaptic differentiations. No labeled symmetrical synapse was found using either GluR1 or GluR2/3 antibody. The present results show that AMPA receptors have a widespread distribution in neuronal perikarya and dendrites of the rat dorsal vagal complex. They suggest differences in subunit composition between AMPA receptors localized in the NTS, the DMN and the AP. Ultrastructural data are consistent with the fact that AMPA receptors associated with the plasma membrane are mostly synaptic receptors. However, they also suggest the existence of a large intracellular pool of receptor subunits in neuronal soma and dendrites. Copyright 1999 Wiley-Liss, Inc.

Identification of Novel 14-3-3 Residues That Are Critical for Isoform-specific Interaction with GluN2C to Regulate N-Methyl-d-aspartate (NMDA) Receptor Trafficking*

PubMed Central

Chung, Connie; Wu, Wei-Hua; Chen, Bo-Shiun

2015-01-01

The 14-3-3 family of proteins is widely distributed in the CNS where they are major regulators of essential neuronal functions. There are seven known mammalian 14-3-3 isoforms (ζ,, τ, ϵ, η, β, and σ), which generally function as adaptor proteins. Previously, we have demonstrated that 14-3-3ϵ isoform dynamically regulates forward trafficking of GluN2C-containing NMDA receptors (NMDARs) in cerebellar granule neurons, that when expressed on the surface, promotes neuronal survival following NMDA-induced excitotoxicity. Here, we report 14-3-3 isoform-specific binding and functional regulation of GluN2C. In particular, we show that GluN2C C-terminal domain (CTD) binds to all 14-3-3 isoforms except 14-3-3σ, and binding is dependent on GluN2C serine 1096 phosphorylation. Co-expression of 14-3-3 (ζ and ϵ) and GluN1/GluN2C promotes the forward delivery of receptors to the cell surface. We further identify novel residues serine 145, tyrosine 178, and cysteine 189 on α-helices 6, 7, and 8, respectively, within ζ-isoform as part of the GluN2C binding motif and independent of the canonical peptide binding groove. Mutation of these conserved residues abolishes GluN2C binding and has no functional effect on GluN2C trafficking. Reciprocal mutation of alanine 145, histidine 180, and isoleucine 191 on 14-3-3σ isoform promotes GluN2C binding and surface expression. Moreover, inhibiting endogenous 14-3-3 using a high-affinity peptide inhibitor, difopein, greatly diminishes GluN2C surface expression. Together, these findings highlight the isoform-specific structural and functional differences within the 14-3-3 family of proteins, which determine GluN2C binding and its essential role in targeting the receptor to the cell surface to facilitate glutamatergic neurotransmission. PMID:26229101

mGluR5 stimulating Homer–PIKE formation initiates icariin induced cardiomyogenesis of mouse embryonic stem cells by activating reactive oxygen species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Limin; Huang, Yujie; Zhang, Yingying

2013-06-10

Icariin (ICA) has been reported to facilitate cardiac differentiation of mouse embryonic stem (ES) cells; however, the mechanism by which ICA induced cardiomyogenesis has not been fully elucidated yet. Here, an underlying signaling network including metabotropic glutamate receptor 5 (mGluR5), Homer, phosphatidylinositol 3-Kinase Enhancer (PIKE), phosphatidylinositol 3-Kinase (PI3K), reactive oxygen species (ROS) and nuclear factor-kappaB (NF-κB) was investigated in ICA induced cardiomyogenesis. Our results showed that the co-expression of mGluR5 together with α-actinin or Troponin T in embryoid bodies (EBs) treated with ICA was elevated to 10.86% and 9.62%, compared with the case in the control (4.04% and 3.45%, respectively).more » Exposure of EBs to ICA for 2 h remarkably increased the dimeric form of mGluR5, which was inhibited by small interfering RNA targeting mGluR5 (si-mGluR5). Moreover, the extracellular glutamate concentration in ICA treatment medium was elevated to 28.9±3.5 μM. Furthermore, the activation of mGluR5 by ICA triggered the formation of Homer–PIKE complex and activated PI3K, stimulating ROS generation and NF-κB nuclear translocation. Knockdown of mGluR5 or inhibition of PI3K by LY294002 blocked ICA induced cardiomyogenesis via repressing mGluR5 pathway, reducing ROS and NF-κB activation. These results revealed that the inducible mechanisms of ICA were related to activate mGluR5 pathway. -- Highlights: • ICA increased mGluR5 expression in cardiac differentiation of ES cells. • ICA enhanced the glutamate level and the receptor mGluR5 dimerization, stimulating the formation of Homer–PIKE complex. • Knockdown of mGluR5 or inhibition of PI3K by LY294002 inhibited ICA induced ROS generation and NF-κB nuclear translocation.« less

Deletion of the low-molecular-weight glutenin subunit allele Glu-A3a of wheat (Triticum aestivum L.) significantly reduces dough strength and breadmaking quality.

PubMed

Zhen, Shoumin; Han, Caixia; Ma, Chaoying; Gu, Aiqin; Zhang, Ming; Shen, Xixi; Li, Xiaohui; Yan, Yueming

2014-12-19

Low-molecular-weight glutenin subunits (LMW-GS), encoded by Glu-3 complex loci in hexaploid wheat, play important roles in the processing quality of wheat flour. To date, the molecular characteristics and effects on dough quality of individual Glu-3 alleles and their encoding proteins have been poorly studied. We used a Glu-A3 deletion line of the Chinese Spring (CS-n) wheat variety to conduct the first comprehensive study on the molecular characteristics and functional properties of the LMW-GS allele Glu-A3a. The Glu-A3a allele at the Glu-A3 locus in CS and its deletion in CS-n were identified and characterized by proteome and molecular marker methods. The deletion of Glu-A3a had no significant influence on plant morphological and yield traits, but significantly reduced the dough strength and breadmaking quality compared to CS. The complete sequence of the Glu-A3a allele was cloned and characterized, which was found to encode a B-subunit with longer repetitive domains and an increased number of α-helices. The Glu-A3a-encoded B-subunit showed a higher expression level and accumulation rate during grain development. These characteristics of the Glu-A3a allele could contribute to achieving superior gluten quality and demonstrate its potential application to wheat quality improvement. Furthermore, an allele-specific polymerase chain reaction (AS-PCR) marker for the Glu-A3a allele was developed and validated using different bread wheat cultivars, including near-isogenic lines (NILs) and recombinant inbred lines (RILs), which could be used as an effective molecular marker for gluten quality improvement through marker-assisted selection. This work demonstrated that the LMW-GS allele Glu-A3a encodes a specific LMW-i type B-subunit that significantly affects wheat dough strength and breadmaking quality. The Glu-A3a-encoded B-subunit has a long repetitive domain and more α-helix structures as well as a higher expression level and accumulation rate during grain development, which could facilitate the formation of wheat with a stronger dough structure and superior breadmaking quality.

Positive and negative modulation of circadian activity rhythms by mGluR5 and mGluR2/3 metabotropic glutamate receptors.

PubMed

Gannon, Robert L; Millan, Mark J

2011-01-01

Glutamate released from retinal ganglion cells conveys information about the daily light:dark cycle to master circadian pacemaker neurons within the suprachiasmatic nucleus that then synchronize internal circadian rhythms with the external day-length. Glutamate activation of ionotropic glutamate receptors in the suprachiasmatic nucleus is well established, but the function of the metabotropic glutamate receptors that are also located in this nucleus is not known. Therefore, in this study we evaluated agonists and antagonists acting at orthosteric or allosteric sites for mGluR5 and mGluR2/3 metabotropic glutamate receptors for their ability to modulate light-induced phase advances and delays of hamster circadian activity rhythms. mGluR5 allosteric antagonists fenobam, MPEP and MTEP, each 10 mg/kg, potentiated light-induced phase advances of hamster circadian activity rhythms, while the mGluR5 agonists CHPG, (S)-3,5-DHPG or positive allosteric modulator CDPPB had no effect. Neither mGluR5 agonists nor antagonists had any effect on light-induced phase delays of activity rhythms. The competitive mGluR2/3 antagonist LY341495, 10 mg/kg, also potentiated light-induced phase advances, but inhibited light-induced phase delays. The mGluR2/3 agonists LY354740 and LY404039 were without effect on phase advances while a third agonist LY379268, 10 mg/kg, inhibited both light-induced advances and delays. Finally, mGluR2/3 agonists LY379268 and LY404039 also inhibited light-induced phase delays of activity rhythms. These results suggest that during light-induced phase advances, mGluR2/3 and mGluR5 receptors act to negatively modulate the effects of light on the circadian pacemaker or its output(s). mGluR5 receptors do not appear to be involved during light-induced phase delays. In contrast, the role for mGluR2/3 receptors during phase delays is more complicated as both agonists and antagonists inhibit light-induced phase delays. Dysfunctions in human circadian rhythms have been implicated in some forms of depression, and metabotropic glutamate receptor ligands, which are also being evaluated for antidepressant activity, are shown here to be capable of modifying light-induced phase shifts of circadian activity rhythms. Copyright © 2010 Elsevier Ltd. All rights reserved.

Increasing the GluN2A/GluN2B Ratio in Neurons of the Mouse Basal and Lateral Amygdala Inhibits the Modification of an Existing Fear Memory Trace.

PubMed

Holehonnur, Roopashri; Phensy, Aarron J; Kim, Lily J; Milivojevic, Milica; Vuong, Dat; Daison, Delvin K; Alex, Saira; Tiner, Michael; Jones, Lauren E; Kroener, Sven; Ploski, Jonathan E

2016-09-07

Reconsolidation updating is a form of memory modification in which an existing memory can become destabilized upon retrieval and subsequently be modified via protein-synthesis-dependent reconsolidation. However, not all memories appear to destabilize upon retrieval and thus are not modifiable via reconsolidation updating approaches and the neurobiological basis for this remains poorly understood. Here, we report that auditory fear memories created with 10 tone-shock pairings are resistant to retrieval-dependent memory destabilization and are associated with an increase in the synaptic GluN2A/GluN2B ratio in neurons of the basal and lateral amygdala (BLA) compared with weaker fear memories created via one or three tone-shock pairings. To increase the GluN2A/GluN2B ratio after learning, we generated a line of mice that expresses an inducible and doxycycline-dependent GFP-GluN2A transgene specifically in α-CaMKII-positive neurons. Our findings indicate that increasing the GluN2A/GluN2B ratio in BLA α-CaMKII-positive neurons after a weak fear memory has consolidated inhibits retrieval-dependent memory destabilization and modification of the fear memory trace. This was associated with a reduction in retrieval-dependent AMPA receptor trafficking, as evidenced by a reduction in retrieval-dependent phosphorylation of GluR1 at serine-845. In addition, we determined that increasing the GluN2A/GluN2B ratio before fear learning significantly impaired long term memory consolidation, whereas short-term memory remained unaltered. An increase in the GluN2A/GluN2B ratio after fear learning had no influence on fear extinction or expression. Our results underscore the importance of NMDAR subunit composition for memory destabilization and suggest a mechanism for why some memories are resistant to modification. Memory modification using reconsolidation updating is being examined as one of the potential treatment approaches for attenuating maladaptive memories associated with emotional disorders. However, studies have shown that, whereas weak memories can be modified using reconsolidation updating, strong memories can be resistant to this approach. Therefore, treatments targeting the reconsolidation process are unlikely to be clinically effective unless methods are devised to enhance retrieval-dependent memory destabilization. Currently, little is known about the cellular and molecular events that influence the induction of reconsolidation updating. Here, we determined that an increase in the GluN2A/GluN2B ratio interferes with retrieval-dependent memory destabilization and inhibits the initiation of reconsolidation updating. Copyright © 2016 the authors 0270-6474/16/369490-15$15.00/0.

Positive allosteric modulators of the metabotropic glutamate receptor subtype 4 (mGluR4). Part II: Challenges in hit-to-lead

PubMed Central

Williams, Richard; Niswender, Colleen M.; Luo, Qingwei; Le, Uyen; Conn, P. Jeffrey; Lindsley, Craig W.

2013-01-01

This Letter describes the synthesis and SAR of two mGluR4 positive allosteric modulator leads, 6 and 7. VU001171 (6) represents the most potent (EC50 = 650 nM), efficacious (141% Glu Max) and largest fold shift (36-fold) of any mGluR4 PAM reported to date. However, this work highlights the challenges in hit-to-lead for mGluR4 PAMs, with multiple confirmed HTS hits displaying little or no tractable SAR. PMID:19097893

Effect of peptides Lys-Glu-Asp-Gly and Ala-Glu-Asp-Gly on the morphology of the thymus in hypophysectomized young and old birds.

PubMed

Pateyk, A V; Baranchugova, L M; Rusaeva, N S; Obydenko, V I; Kuznik, B I

2013-03-01

Investigations were carried out on chicks of different age. It was found that the most pronounced changes in the morphology of the thymus occurred after neonatal hypophysectomy. These changes are least pronounced in old chicks. Peptides Lys-Glu-Asp-Gly and Ala-Glu-Asp-Gly synthesized on the basis of amino acid composition of peptide complexes of the anterior and posterior pituitary lobes administered to hypophysectomized birds regardless of age promoted recovery of the morphological structures of the thymus. The anterior pituitary peptide (Lys-Glu-Asp-Gly) had more pronounced effect on the recovery of thymic structure than posterior pituitary peptide (Ala-Glu-Asp-Gly).

Surface expression of hippocampal NMDA GluN2B receptors regulated by fear conditioning determines its contribution to memory consolidation in adult rats.

PubMed

Sun, Yan-Yan; Cai, Wei; Yu, Jie; Liu, Shu-Su; Zhuo, Min; Li, Bao-Ming; Zhang, Xue-Han

2016-08-04

The number and subtype composition of N-methyl-d-aspartate receptor (NMDAR) at synapses determines their functional properties and role in learning and memory. Genetically increased or decreased amount of GluN2B affects hippocampus-dependent memory in the adult brain. But in some experimental conditions (e.g., memory elicited by a single conditioning trial (1 CS-US)), GluN2B is not a necessary factor, which indicates that the precise role of GluN2B in memory formation requires further exploration. Here, we examined the role of GluN2B in the consolidation of fear memory using two training paradigms. We found that GluN2B was only required for the consolidation of memory elicited by five conditioning trials (5 CS-US), not by 1 CS-US. Strikingly, the expression of membrane GluN2B in CA1was training-strength-dependently increased after conditioning, and that the amount of membrane GluN2B determined its involvement in memory consolidation. Additionally, we demonstrated the increases in the activities of cAMP, ERK, and CREB in the CA1 after conditioning, as well as the enhanced intrinsic excitability and synaptic efficacy in CA1 neurons. Up-regulation of membrane GluN2B contributed to these enhancements. These studies uncover a novel mechanism for the involvement of GluN2B in memory consolidation by its accumulation at the cell surface in response to behavioral training.

GRIN1 mutation associated with intellectual disability alters NMDA receptor trafficking and function.

PubMed

Chen, Wenjuan; Shieh, Christine; Swanger, Sharon A; Tankovic, Anel; Au, Margaret; McGuire, Marianne; Tagliati, Michele; Graham, John M; Madan-Khetarpal, Suneeta; Traynelis, Stephen F; Yuan, Hongjie; Pierson, Tyler Mark

2017-06-01

N-methyl-d-aspartate receptors (NMDARs) play important roles in brain development and neurological disease. We report two individuals with similar dominant de novo GRIN1 mutations (c.1858 G>A and c.1858 G>C; both p.G620R). Both individuals presented at birth with developmental delay and hypotonia associated with behavioral abnormalities and stereotypical movements. Recombinant NMDARs containing the mutant GluN1-G620R together with either GluN2A or GluN2B were evaluated for changes in their trafficking to the plasma membrane and their electrophysiological properties. GluN1-G620R/GluN2A complexes showed a mild reduction in trafficking, a ~2-fold decrease in glutamate and glycine potency, a strong decrease in sensitivity to Mg 2+ block, and a significant reduction of current responses to a maximal effective concentration of agonists. GluN1-G620R/GluN2B complexes showed significantly reduced delivery of protein to the cell surface associated with similarly altered electrophysiology. These results indicate these individuals may have suffered neurodevelopmental deficits as a result of the decreased presence of GluN1-G620R/GluN2B complexes on the neuronal surface during embryonic brain development and reduced current responses of GluN1-G620R-containing NMDARs after birth. These cases emphasize the importance of comprehensive functional characterization of de novo mutations and illustrates how a combination of several distinct features of NMDAR expression, trafficking and function can be present and influence phenotype.

Potentiation of mouse vagal afferent mechanosensitivity by ionotropic and metabotropic glutamate receptors

PubMed Central

Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley

2006-01-01

Glutamate acts at central synapses via ionotropic (iGluR – NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed. PMID:16945965

Potentiation of mouse vagal afferent mechanosensitivity by ionotropic and metabotropic glutamate receptors.

PubMed

Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley

2006-11-15

Glutamate acts at central synapses via ionotropic (iGluR--NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed.

Viral-mediated knockdown of mGluR7 in the nucleus accumbens mediates excessive alcohol drinking and increased ethanol-elicited conditioned place preference in rats.

PubMed

Bahi, Amine

2013-10-01

Whether metabotropic glutamate 7 (mGluR7) -activation enhances or diminishes the reinforcing properties of psychostimulants remains unclear. We have previously shown that systemic mGluR7 activation reduced alcohol consumption and preference as well as locomotor-stimulating and rewarding properties of ethanol. In this study, we further examined the contribution of mGluR7 on the effect of ethanol within the nucleus accumbens (NAcc), a neural target for many drugs of abuse. Using short hairpin RNA (shRNA)-expressing lentiviral vectors (LV) to alter locally the activity of mGluR7 in male rats, we have shown that blocking mGluR7 expression increased ethanol consumption and preference in a two-bottle choice drinking paradigm with no effect either on saccharin or on quinine used for taste discrimination. In addition, mGluR7 knockdown increases preference for environments previously paired with low doses of ethanol in the conditioned place preference (CPP) test, as it shifted the dose-response curve for ethanol CPP to the left, indicating alterations in the rewarding effects of alcohol. More importantly, mGluR7 blockade in the dorsal striatum (DS) neither affected ethanol consumption nor ethanol-elicited CPP. These results show that levels of mGluR7 in the NAcc regulate responsiveness to alcohol. Taken together, these findings clearly demonstrate that mGluR7 signaling within the NAcc is a key modulator of functional responses to ethanol and offer an important target for regulating the addictive effects of alcohol.

High-molecular-weight glutenin subunit-deficient mutants induced by ion beam and the effects of Glu-1 loci deletion on wheat quality properties.

PubMed

Zhang, Lujun; Chen, Qiufang; Su, Mingjie; Yan, Biao; Zhang, Xiangqi; Jiao, Zhen

2016-03-15

High-molecular-weight glutenin subunits (HMW-GSs) play a critical role in determining the viscoelastic properties of wheat. Mutations induced by ion beam radiation have been applied to improve the yield and quality of crop. In this study, HMW-GS-deficient mutant lines were selected and the effects of Glu-1 loci deletion on wheat quality properties were illustrated according to the analysis of dry seeds of common wheat (Triticum aestivum L.) Xiaoyan 81 treated with a nitrogen ion beam. Three HMW-GS-deficient mutant lines were obtained and then detected by sodium dodecyl sulfate polyacrylamide gel electrophoresis. Large-chromosome-fragment deletion resulted in specific deficiencies, and the deleted region sizes were determined using molecular markers. Agronomic characters, quantity and proportion of glutenins and dough microstructure of the deletion lines all proved to be quite different from those of wild-type Xiaoyan 81. Analysis of quality properties suggested that GluA1(-) had superior property parameters, while GluB1(-) and GluD1(-) both showed a significant decrease in quality properties compared with Xiaoyan 81. The effects of the three Glu-1 loci on flour and dough quality-related parameters should be Glu-D1 > Glu-B1 > Glu-A1. Ion beam radiation can be used as a mutagen to create new crop mutants. © 2015 Society of Chemical Industry.

Glu-Trp-ONa or its acylated analogue (R-Glu-Trp-ONa) administration enhances the wound healing in the model of chronic skin wounds in rabbits.

PubMed

Shevtsov, Maxim A; Smagina, Larisa V; Kudriavtceva, Tatiana A; Petlenko, Sergey V; Voronkina, Irina V

2015-01-01

The management of chronic skin wounds represents a major therapeutic challenge. The synthesized dipeptide (Glu-Trp-ONa) and its acylated analogue (R-Glu-Trp-ONa) were assessed in the model of nonhealing dermal wounds in rabbits in relation to their healing properties in wound closure. Following wound modeling, the rabbits received a course of intraperitoneal injections of Glu-Trp-ONa or R-Glu-Trp-ONa. Phosphate-buffered saline and Solcoseryl® were applied as negative and positive control agents, respectively. An injection of Glu-Trp-ONa and R-Glu-Trp-ONa decreased the period of wound healing in animals in comparison to the control and Solcoseryl-treated groups. Acylation of Glu-Trp-ONa proved to be beneficial as related to the healing properties of the dipeptide. Subsequent zymography analyses showed that the applied peptides decreased the proteolytic activity of matrix metalloproteinases MMP-9, MMP-8, and MMP-2 in the early inflammatory phase and reversely increased the activity of MMP-9, MMP-8, and MMP-1 in the remodeling phase. Histological analyses of the wound sections (hematoxylin-eosin, Mallory's staining) confirmed the enhanced formation of granulation tissue and re-epithelialization in the experimental groups. By administering the peptides, wound closures increased significantly through the modulation of the MMPs' activity, indicating their role in wound healing.

Effects of Glucose with Casein Peptide Supplementation on Post-Exercise Muscle Glycogen Resynthesis in C57BL/6J Mice.

PubMed

Matsunaga, Yutaka; Sakata, Yasuyuki; Yago, Takumi; Nakamura, Hirohiko; Shimizu, Takashi; Takeda, Yasuhiro

2018-06-11

Numerous studies have reported that post-exercise ingestion of carbohydrates with protein supplementation can enhance glycogen recovery. However, few reports have focused on the degrees of degradation of the ingested proteins due to post-exercise glycogen resynthesis. Accordingly, the aim of this study was to clarify the effects of differences in protein degradation on muscle glycogen recovery. Male seven-week-old C57BL/6J mice performed a single bout of 60-min treadmill running exercise and were then orally administered glucose (Glu; 1.5 mg/g body weight (BW)), glucose with casein peptide (Glu + Pep; 1.5 + 0.5 mg/g BW) or its constituent amino acid mixture (Glu + AA; 1.5 + 0.5 mg/g BW). At 120 min after supplementation, the soleus muscle glycogen content in the Glu and Glu + AA groups was significantly higher than that immediately after exercise; however, no such difference was observed in the Glu + Pep group. Blood substrate concentration and insulin signaling did not differ among the three groups. Furthermore, energy expenditure during the recovery period in the Glu + Pep group was significantly higher than that in the Glu and Glu + AA groups. These findings suggest that post-exercise co-ingestion of glucose and casein peptide might delay glycogen resynthesis, at least in part through increased energy expenditure caused by casein peptide ingestion.

NMDA-induced potentiation of mGluR5 is mediated by activation of protein phosphatase 2B/calcineurin

PubMed Central

Alagarsamy, Sudar; Saugstad, Julie; Warren, Lee; Mansuy, Isabelle M.; Gereau, Robert W.; Conn, P. Jeffrey

2010-01-01

Previous reports have shown that activation of N-methyl-D-aspartate (NMDA) receptors potentiates responses to activation of the group I metabotropic glutamate receptor mGluR5 by reversing PKC-mediated desensitization of this receptor. NMDA-induced reversal of mGluR5 desensitization is dependent on activation of protein phosphatases. However, the specific protein phosphatase involved and the precise mechanism by which NMDA receptor activation reduces mGluR desensitization are not known. We have performed a series of molecular, biochemical, and genetic studies to show that NMDA-induced regulation of mGluR5 is dependent on activation of calcium-dependent protein phosphatase 2B/calcineurin (PP2B/CaN). Furthermore, we report that purified calcineurin directly dephosphorylates the C-terminal tail of mGluR5 at sites that are phosphorylated by PKC. Finally, immunoprecipitation and GST fusion protein pull-down experiments reveal that calcineurin interacts with mGluR5, suggesting that these proteins could be colocalized in a signaling complex. Taken together with previous studies, these data suggest that activation of NMDA receptors leads to activation of calcineurin and that calcineurin modulates mGluR5 function by directly dephosphorylating mGluR5 at PKC sites that are involved in desensitization of this receptor. 2005 Elsevier Ltd. All rights reserved. PMID:16005030

Potentiating mGluR5 Function with a Positive Allosteric Modulator Enhances Adaptive Learning

ERIC Educational Resources Information Center

Xu, Jian; Zhu, Yongling; Kraniotis, Stephen; He, Qionger; Marshall, John J.; Nomura, Toshihiro; Stauffer, Shaun R.; Lindsley, Craig W.; Conn, P. Jeffrey; Contractor, Anis

2013-01-01

Metabotropic glutamate receptor 5 (mGluR5) plays important roles in modulating neural activity and plasticity and has been associated with several neuropathological disorders. Previous work has shown that genetic ablation or pharmacological inhibition of mGluR5 disrupts fear extinction and spatial reversal learning, suggesting that mGluR5…

Fractionating spatial memory with glutamate receptor subunit-knockout mice.

PubMed

Bannerman, David M

2009-12-01

In recent years, the contribution that different glutamate receptor subtypes and subunits make to spatial learning and memory has been studied extensively using genetically modified mice in which key proteins are knocked out. This has revealed dissociations between different aspects of spatial memory that were not previously apparent from lesion studies. For example, studies with GluA1 AMPAR [AMPA (alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid) receptor] subunit-knockout mice have revealed the presence of a GluA1-dependent, non-associative short-term memory mechanism that is important for performance on spatial working memory tasks, and a GluA1-independent, long-term associative memory mechanism which underlies performance on spatial reference memory tasks. Within this framework we have also studied the contributions of different GluN2-containing NMDARs [NMDA (N-methyl-D-aspartate) receptors] to spatial memory. Studies with GluN2 NMDAR mutants have revealed different contributions from GluN2A- and GluN2B-containing NMDARs to spatial learning. Furthermore, comparison of forebrain- and hippocampus-specific GluN2B-knockout mice has demonstrated that both hippocampal and extra-hippocampal NMDARs make important contributions to spatial memory performance.

A family of photoswitchable NMDA receptors

PubMed Central

Berlin, Shai; Szobota, Stephanie; Reiner, Andreas; Carroll, Elizabeth C; Kienzler, Michael A; Guyon, Alice; Xiao, Tong; Trauner, Dirk; Isacoff, Ehud Y

2016-01-01

NMDA receptors, which regulate synaptic strength and are implicated in learning and memory, consist of several subtypes with distinct subunit compositions and functional properties. To enable spatiotemporally defined, rapid and reproducible manipulation of function of specific subtypes, we engineered a set of photoswitchable GluN subunits ('LiGluNs'). Photo-agonism of GluN2A or GluN2B elicits an excitatory drive to hippocampal neurons that can be shaped in time to mimic synaptic activation. Photo-agonism of GluN2A at single dendritic spines evokes spine-specific calcium elevation and expansion, the morphological correlate of LTP. Photo-antagonism of GluN2A alone, or in combination with photo-antagonism of GluN1a, reversibly blocks excitatory synaptic currents, prevents the induction of long-term potentiation and prevents spine expansion. In addition, photo-antagonism in vivo disrupts synaptic pruning of developing retino-tectal projections in larval zebrafish. By providing precise and rapidly reversible optical control of NMDA receptor subtypes, LiGluNs should help unravel the contribution of specific NMDA receptors to synaptic transmission, integration and plasticity. DOI: http://dx.doi.org/10.7554/eLife.12040.001 PMID:26929991

Hydrolytic cleavage of pyroglutamyl-peptide bond. V. selective removal of pyroglutamic acid from biologically active pyroglutamylpeptides in high concentrations of aqueous methanesulfonic acid.

PubMed

Kobayashi, Junko; Ohki, Kazuhiro; Okimura, Keiko; Hashimoto, Tadashi; Sakura, Naoki

2006-06-01

Application of aqueous methanesulfonic acid (MSA) for selective chemical removal of pyroglutamic acid (pGlu) residue from five biologically active pyroglutamyl-peptides (pGlu-X-peptides, X=amino acid residue at position 2) was examined. Gonadotropin releasing hormone (Gn-RH), dog neuromedin U-8 (d-NMU-8), physalaemin (PH), a bradykinin potentiating peptide (BPP-5a) and neurotensin (NT) as pGlu-X-peptides were incubated in either 70% or 90% aqueous MSA at 25 degrees C. HPLC analysis of the incubation solutions showed that the main decomposition product was H-X-peptide derived from each pGlu-X-peptide by the removal of pGlu. The results revealed that the pGlu-X peptide bond had higher susceptibility than various internal amide bonds in the five peptides examined, including the Trp-Ser bond in Gn-RH, the C-terminal Asn-NH(2) in d-NMU-8, and the Asp-Pro bond in PH, whose acid susceptibility is well known. Thus, mild hydrolysis with high concentrations of aqueous MSA may be applicable to chemically selective removal of pGlu from pGlu-X-peptides for structural examinations.

Positive Modulators of the N-Methyl-d-aspartate Receptor: Structure-Activity Relationship Study of Steroidal 3-Hemiesters.

PubMed

Krausova, Barbora; Slavikova, Barbora; Nekardova, Michaela; Hubalkova, Pavla; Vyklicky, Vojtech; Chodounska, Hana; Vyklicky, Ladislav; Kudova, Eva

2018-05-24

Here, we report the synthesis of pregn-5-ene and androst-5-ene dicarboxylic acid esters and explore the structure-activity relationship (SAR) for their modulation of N-methyl-d-aspartate receptors (NMDARs). All compounds were positive modulators of recombinant GluN1/GluN2B receptors (EC 50 varying from 1.8 to 151.4 μM and E max varying from 48% to 452%). Moreover, 10 compounds were found to be more potent GluN1/GluN2B receptor modulators than endogenous pregnenolone sulfate (EC 50 = 21.7 μM). The SAR study revealed a relationship between the length of the residues at carbon C-3 of the steroid molecule and the positive modulatory effect at GluN1/GluN2B receptors for various D-ring modifications. A selected compound, 20-oxo-pregnenolone hemiadipate, potentiated native NMDARs to a similar extent as GluN1/GluN2A-D receptors and inhibited AMPARs and GABA A R responses. These results provide a unique opportunity for the development of new steroid based drugs with potential use in the treatment of neuropsychiatric disorders involving hypofunction of NMDARs.

Quantitative Comparison Of Vesicular Glutamate Transporters in rat Deep Cerebellar Nuclei.

PubMed

Mao, Haian; Hamodeh, Salah; Sultan, Fahad

2018-04-15

The excitatory synapses of the rat deep cerebellar nuclei (DCN) were quantitatively analyzed by vesicular glutamate transporter 1 and 2 (vGluT1 and vGluT2) immunolabeling. We calculated the number and sizes of the labeled boutons and compared them between lateral/dentate nucleus (LN/DN), posterior interposed nucleus (PIN), anterior interposed nucleus (AIN), and medial nucleus (MN). The density of vGluT1+ boutons differs significantly within these nuclei. In contrast, the vGluT2+ bouton density is more similar between different nuclei. The phylogenetically newer DCN (LN/DN and PIN) have a 39% higher density of vGluT1+ boutons than the phylogenetically older DCN (AIN and MN). The volume of vGluT1+ boutons does not differ between the DCN, however the average volume of vGluT2+ boutons is larger in MN. In summary, our current results confirm and extend our previous findings showing that the increase in dendritic and axonal wiring in phylogenetically newer DCN is associated with an increase in vGluT1+ bouton density. Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.

On the ligand binding profile and desensitization of plant ionotropic glutamate receptor (iGluR)-like channels functioning in MAMP-triggered Ca²⁺ influx.

PubMed

Kwaaitaal, Mark; Maintz, Jens; Cavdar, Meltem; Panstruga, Ralph

2012-11-01

The generation of intracellular microbe-associated molecular pattern (MAMP)-triggered Ca²⁺ transients was recently demonstrated to involve ionotropic Glutamate Receptor (iGluR)-like channels in Arabidopsis and tobacco. Here we elaborate on our previous findings and refine our insights in the putative agonist binding profile and potential mode of desensitization of MAMP-activated plant iGluRs. Based on results from pharmacological inhibition and desensitization experiments, we propose that plant iGluR complexes responsible for the MAMP-triggered Ca²⁺ signature have a binding profile that combines the specificities of mammalian NMDA-and non-NMDA types of iGluRs, possibly reflecting the evolutionary history of plant and animal iGluRs. We further hypothesize that, analogous to the mammalian NMDA-NR1 receptor, desensitization of plant iGluR-like channels might involve binding of the ubiquitous Ca²⁺ sensor calmodulin to a cytoplasmic C-terminal domain.

Ionotropic glutamate receptor GluR2/3-immunoreactive neurons in the cat, rabbit, and hamster superficial superior colliculus.

PubMed

Park, Won-Mee; Kim, Min-Jeong; Jeon, Chang-Jin

2004-06-01

Ionotropic glutamate receptor (GluR) subtypes occur in various types of cells in the central nervous system. We studied the distribution of AMPA glutamate receptor subtype GluR2/3 in the superficial layers of cat, rabbit, and hamster superior colliculus (SC) with antibody immunocytochemistry and the effect of enucleation on this distribution. Furthermore, we compared this labeling to that of calbindin D28K and parvalbumin. Anti-GluR2/3-immunoreactive (IR) cells formed a dense band of labeled cells within the lower superficial gray layer (SGL) and upper optic layer (OL) in the cat SC. By contrast, GluR2/3-IR cells formed a dense band within the upper OL in the rabbit and within the OL in the hamster SC. Calbindin D28K-IR cells are located in three layers in the SC: one within the zonal layer (ZL) and the upper SGL in all three animals, a second within the lower OL and upper IGL in the cat, within the IGL in the rabbit and within the OL in the hamster, and a third within the deep gray layer (DGL) in all three animals. Many parvalbumin-IR neurons were found within the lower SGL and upper OL. Thus, the GluR2/3-IR band was sandwiched between the first and second layers of calbindin D28K-IR cells in the cat and rabbit SC while the distribution of GluR2/3-IR cells in the hamster matches the second layer of calbindin D28K-IR cells. The patterned distribution of GluR2/3-IR cells overlapped the tier of parvalbumin-IR neurons in cat, but only partially overlapped in hamster and rabbit. Two-color immunofluorescence revealed that more than half (55.1%) of the GluR2/3-IR cells in the hamster SC expressed calbindin D28K. By contrast, only 9.9% of GluR2/3-IR cells expressed calbindin D28K in the cat. Double-labeled cells were not found in the rabbit SC. Some (4.8%) GluR2/3-IR cells in the cat SC also expressed parvalbumin, while no GluR2/3-IR cells in rabbit and hamster SC expressed parvalbumin. In this dense band of GluR2/3, the majority of labeled cells were small to medium-sized round/oval or stellate cells. Immunoreactivity for the GluR2/3 was clearly reduced in the contralateral SC following unilateral enucleation in the hamster. By contrast, enucleation appeared to have had no effect on the GluR2/3 immunoreactivity in the cat and rabbit SC. The results indicate that neurons in the mammalian SC express GluR2/3 in specific layers, which does not correlate with the expression of calbindin D28K and parvalbumin among the animals.

Role for metabotropic glutamate receptor 5 (mGluR5) in the pathogenesis of fragile X syndrome.

PubMed

Dölen, Gül; Bear, Mark F

2008-03-15

Metabotropic glutamate receptors (mGluRs) have been implicated in a diverse variety of neuronal functions. Studies reviewed here indicate that exaggerated signalling through mGluR5 can account for multiple cognitive and syndromic features of fragile X syndrome, the most common inherited form of mental retardation and autism. Since a reduction of mGluR5 signalling can reverse fragile X phenotypes, these studies provide a compelling rationale for the use of mGluR5 antagonists for the treatment of fragile X and related disorders.

Glutamyl-gamma-boronate inhibitors of bacterial Glu-tRNA(Gln) amidotransferase.

PubMed

Decicco, C P; Nelson, D J; Luo, Y; Shen, L; Horiuchi, K Y; Amsler, K M; Foster, L A; Spitz, S M; Merrill, J J; Sizemore, C F; Rogers, K C; Copeland, R A; Harpel, M R

2001-09-17

Analogues of glutamyl-gamma-boronate (1) were synthesized as mechanism-based inhibitors of bacterial Glu-tRNA(Gln) amidotransferase (Glu-AdT) and were designed to engage a putative catalytic serine nucleophile required for the glutaminase activity of the enzyme. Although 1 provides potent enzyme inhibition, structure-activity studies revealed a narrow range of tolerated chemical changes that maintained activity. Nonetheless, growth inhibition of organisms that require Glu-AdT by the most potent enzyme inhibitors appears to validate mechanism-based inhibitor design of Glu-AdT as an approach to antimicrobial development.

Triclosan-Evoked Neurotoxicity Involves NMDAR Subunits with the Specific Role of GluN2A in Caspase-3-Dependent Apoptosis.

PubMed

Szychowski, Konrad A; Wnuk, Agnieszka; Rzemieniec, Joanna; Kajta, Małgorzata; Leszczyńska, Teresa; Wójtowicz, Anna K

2018-04-19

Triclosan (TCS) is an antimicrobial agent that is used extensively in personal care and in sanitising products. A number of studies have shown the presence of TCS in different human tissues such as blood, adipose tissue, the liver, brain as well as in breast milk and urine. N-Methyl-D-aspartate receptors (NMDARs) are glutamate-gated ion channels that are widely expressed in the central nervous system and which play key roles in excitatory synaptic transmission. There is, however, no data on the involvement of NMDAR subunits in the apoptotic and neurotoxic effects of TCS. Our experiments are the first to show that TCS used at environmentally relevant concentrations evoked NMDA-dependent effects in neocortical neurons in primary cultures, as MK-801, an uncompetitive NMDA receptor antagonist, reduced the levels of TCS-induced ROS production as well as caspase-3 activity and LDH release. TCS caused a decrease in protein expression of all the studied NMDA receptor subunits (GluN1, GluN2A, GluN2B) that were measured at 3, 6 and 24 h post-treatment. However, at 48 h of the experiment, the level of the GluN1 subunit returned to the control level, and the levels of the other subunits showed a tendency to increase. In TCS-treated neocortical cells, protein profiles of NMDAR subunits measured up to 24 h were similar to mRNA expression of GluN1 and GluN2A, but not to GluN2B mRNA. In this study, cells transiently transfected with GluN1, GluN2A or GluN2B siRNA exhibited reduced levels of LDH release, which suggests the involvement of all of the studied NMDAR subunits in the neurotoxic action of TCS. According to our data, GluN1 and GluN2A were mainly responsible for neuronal cell death as evidenced by neutral red uptake, whereas GluN2A was involved in TCS-induced caspase-3-dependent apoptosis. We suggest that TCS-evoked apoptosis and neurotoxicity could be related to transient degradation of NMDAR subunits in mouse neurons. Furthermore, recycling of NMDAR subunits in response to TCS is possible. Because transfections with specific siRNA did not completely abolish the effects of TCS as compared to cells transfected with negative siRNA in this study, other NMDAR-independent mechanisms of TCS action are also possible.

Reduced cAMP, Akt Activation and p65-c-Rel Dimerization: Mechanisms Involved in the Protective Effects of mGluR3 Agonists in Cultured Astrocytes

PubMed Central

Durand, Daniela; Carniglia, Lila; Caruso, Carla; Lasaga, Mercedes

2011-01-01

In recent decades, astrocytes have emerged as key pieces in the maintenance of normal functioning of the central nervous system. Any impairment in astroglial function can ultimately lead to generalized disturbance in the brain, thus pharmacological targets associated with prevention of astrocyte death are actually promising. Subtype 3 of metabotropic glutamate receptors (mGluR3) is present in astrocytes, its activation exerting neuroprotective roles. In fact, we have previously demonstrated that mGluR3 selective agonists prevent nitric oxide (NO)-induced astrocyte death. However, mechanisms responsible for that cytoprotective property are still subject to study. Although inhibition of adenylyl cyclase by mGluR3 activation was extensively reported, the involvement of reduced cAMP levels in the effects of mGluR3 agonists and the association between cAMP decrease and the downstream pathways activated by mGluR3 remain neglected. Thus, we studied intracellular signaling mediating anti-apoptotic actions of mGluR3 in cultured rat astrocytes exposed to NO. In the present work, we showed that the cytoprotective effect of mGluR3 agonists (LY379268 and LY404039) requires both the reduction of intracellular cAMP levels and activation of Akt, as assessed by MTT and TUNEL techniques. Moreover, dibutyryl-cAMP impairs Akt phosphorylation induced by LY404039, indicating a relationship between mGluR3-reduced cAMP levels and PI3K/Akt pathway activation. We also demonstrated, by co-immunoprecipitation followed by western-blot, that the mGluR3 agonists not only induce per se survival-linked interaction between members of the NF-κB family p65 and c-Rel, but also impede reduction of levels of p65-c-Rel dimers caused by NO, suggesting a possible anti-apoptotic role for p65-c-Rel. All together, these data suggest that mGluR3 agonists may regulate cAMP/Akt/p65-c-Rel pathway, which would contribute to the protective effect of mGluR3 against NO challenge in astrocytes. Our results widen the knowledge about mechanisms of action of mGluR3, potential targets for the treatment of neurodegenerative disorders where a pathophysiological role for NO has been established. PMID:21779400

Group I mGluRs increase excitability of hippocampal CA1 pyramidal neurons by a PLC-independent mechanism.

PubMed

Ireland, David R; Abraham, Wickliffe C

2002-07-01

Previous studies have implicated phospholipase C (PLC)-linked Group I metabotropic glutamate receptors (mGluRs) in regulating the excitability of hippocampal CA1 pyramidal neurons. We used intracellular recordings from rat hippocampal slices and specific antagonists to examine in more detail the mGluR receptor subtypes and signal transduction mechanisms underlying this effect. Application of the Group I mGluR agonist (RS)-3,5-dihydroxyphenylglycine (DHPG) suppressed slow- and medium-duration afterhyperpolarizations (s- and mAHP) and caused a consequent increase in cell excitability as well as a depolarization of the membrane and an increase in input resistance. Interestingly, with the exception of the suppression of the mAHP, these effects were persistent, and in the case of the sAHP lasting for more than 1 h of drug washout. Preincubation with the specific mGluR5 antagonist, 2-methyl-6-(phenylethynyl)-pyridine (MPEP), reduced but did not completely prevent the effects of DHPG. However, preincubation with both MPEP and the mGluR1 antagonist LY367385 completely prevented the DHPG-induced changes. These results demonstrate that the DHPG-induced changes are mediated partly by mGluR5 and partly by mGluR1. Because Group I mGluRs are linked to PLC via G-protein activation, we also investigated pathways downstream of PLC activation, using chelerythrine and cyclopiazonic acid to block protein kinase C (PKC) and inositol 1,4,5-trisphosphate-(IP(3))-activated Ca(2+) stores, respectively. Neither inhibitor affected the DHPG-induced suppression of the sAHP or the increase in excitability nor did an inhibitor of PLC itself, U-73122. Taken together, these results argue that in CA1 pyramidal cells in the adult rat, DHPG activates mGluRs of both the mGluR5 and mGluR1 subtypes, causing a long-lasting suppression of the sAHP and a consequent persistent increase in excitability via a PLC-, PKC-, and IP(3)-independent transduction pathway.

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Glaucarubinone sensitizes KB cells to paclitaxel by inhibiting ABC transporters via ROS-dependent and p53-mediated activation of apoptotic signaling pathways

PubMed Central

Karthikeyan, Subburayan; Hoti, Sugeerappa Laxmanappa; Nazeer, Yasin; Hegde, Harsha Vasudev

2016-01-01

Multidrug resistance (MDR) is considered to be the major contributor to failure of chemotherapy in oral squamous cell carcinoma (SCC). This study was aimed to explore the effects and mechanisms of glaucarubinone (GLU), one of the major quassinoids from Simarouba glauca DC, in potentiating cytotoxicity of paclitaxel (PTX), an anticancer drug in KB cells. Our data showed that the administration of GLU pre-treatment significantly enhanced PTX anti-proliferative effect in ABCB1 over-expressing KB cells. The Rh 123 drug efflux studies revealed that there was a significant transport function inhibition by GLU-PTX treatment. Interestingly, it was also found that this enhanced anticancer efficacy of GLU was associated with PTX-induced cell arrest in the G2/M phase of cell cycle. Further, the combined treatment of GLU-PTX had significant decrease in the expression levels of P-gp, MRPs, and BCRP in resistant KB cells at both mRNA and protein levels. Furthermore, the combination treatments showed significant reactive oxygen species (ROS) production, chromatin condensation and reduced mitochondrial membrane potential in resistant KB cells. The results from DNA fragmentation analysis also demonstrated the GLU induced apoptosis in KB cells and its synergy with PTX. Importantly, GLU and/or PTX triggered apoptosis through the activation of pro-apoptotic proteins such as p53, Bax, and caspase-9. Our findings demonstrated for the first time that GLU causes cell death in human oral cancer cells via the ROS-dependent suppression of MDR transporters and p53-mediated activation of the intrinsic mitochondrial pathway of apoptosis. Additionally, the present study also focussed on investigation of the protective effect of GLU and combination drugs in human normal blood lymphocytes. Normal blood lymphocytes assay indicated that GLU is able to induce selective toxicity in cancer cells and in silico molecular docking studies support the choice of GLU as ABC inhibitor to enhance PTX efficacy. Thus, GLU has the potential to enhance the activity of PTX and hence can be a good alternate treatment strategy for the reversal of PTX resistance. PMID:27304668

Cysteine Substitution of Transmembrane Domain Amino Acids Alters the Ethanol Inhibition of GluN1/GluN2A N-Methyl-d-Aspartate Receptors

PubMed Central

Xu, Minfu; Smothers, C. Thetford

2015-01-01

N-Methyl-d-aspartate receptors (NMDARs) are inhibited by behaviorally relevant concentrations of ethanol, and residues within transmembrane (TM) domains of NMDARs, including TM3 GluN1 phenylalanine 639 (F639), regulate this sensitivity. In the present study, we used cysteine (C) mutagenesis to determine whether there are additional residues within nearby TM domains that regulate ethanol inhibition on NMDARs. GluN1(F639C)/GluN2A receptors were less inhibited by ethanol than wild-type receptors, and inhibition was restored to wild-type levels following treatment with ethanol-like methanethiosulfonate reagents. Molecular modeling identified six residues in the GluN1 TM1 domain (valine V566; serine S569) and the GluN2A TM4 domain (methionine, M817; V820, F821, and leucine, L824) that were in close vicinity to the TM3 F639 residue, and these were individually mutated to cysteine and tested for ethanol inhibition and receptor function. The F639C-induced decrease in ethanol inhibition was blunted by coexpression of GluN1 TM1 mutants V566C and S569C, and statistically significant interactions were observed for ethanol inhibition among V566C, F639C, and GluN2A TM4 mutants V820C and F821C and S569C, F639C, and GluN2A TM4 mutants F821C and L824C. Ethanol inhibition was also reduced when either GluN1 TM1 mutant V566C or S569C was combined with GluN2A V820C, suggesting a novel TM1:TM4 intrasubunit site of action for ethanol. Cysteines substituted at TM3 and TM4 sites previously suggested to interact with ethanol had less dramatic effects on ethanol inhibition. Overall, the results from these studies suggest that interactions among TM1, TM3, and TM4 amino acids in NMDARs are important determinants of ethanol action at these receptors. PMID:25635140

The role of GluN2B-containing NMDA receptors in short- and long-term fear recall.

PubMed

Mikics, Eva; Toth, Mate; Biro, Laszlo; Bruzsik, Biborka; Nagy, Boglarka; Haller, Jozsef

2017-08-01

N-methyl-d-aspartate (NMDA) receptors are crucial synaptic elements in long-term memory formation, including the associative learning of fearful events. Although NMDA blockers were consistently shown to inhibit fear memory acquisition and recall, the clinical use of general NMDA blockers is hampered by their side effects. Recent studies revealed significant heterogeneity in the distribution and neurophysiological characteristics of NMDA receptors with different GluN2 (NR2) subunit composition, which may have differential role in fear learning and recall. To investigate the specific role of NMDA receptor subpopulations with different GluN2 subunit compositions in the formation of lasting traumatic memories, we contrasted the effects of general NMDA receptor blockade with GluN2A-, GluN2B-, and GluN2C/D subunit selective antagonists (MK-801, PEAQX, Ro25-6981, PPDA, respectively). To investigate acute and lasting consequences, behavioral responses were investigated 1 and 28days after fear conditioning. We found that MK-801 (0.05 and 0.1mg/kg) decreased fear recall at both time points. GluN2B receptor subunit blockade produced highly similar effects, albeit efficacy was somewhat smaller 28days after fear conditioning. Unlike MK-801, Ro25-6981 (3 and 10mg/kg) did not affect locomotor activity in the open-field. In contrast, GluN2A and GluN2C/D blockers (6 and 20mg/kg PEAQX; 3 and 10mg/kg PPDA, respectively) had no effect on conditioned fear recall at any time point and dose. This sharp contrast between GluN2B- and other subunit-containing NMDA receptor function indicates that GluN2B receptor subunits are intimately involved in fear memory formation, and may provide a novel pharmacological target in post-traumatic stress disorder or other fear-related disorders. Copyright © 2017 Elsevier Inc. All rights reserved.

Type-7 metabotropic glutamate receptors negatively regulate α1-adrenergic receptor signalling.

PubMed

Iacovelli, Luisa; Di Menna, Luisa; Peterlik, Daniel; Stangl, Christina; Orlando, Rosamaria; Molinaro, Gemma; De Blasi, Antonio; Bruno, Valeria; Battaglia, Giuseppe; Flor, Peter J; Uschold-Schmidt, Nicole; Nicoletti, Ferdinando

2017-02-01

We studied the interaction between mGlu7 and α 1 -adrenergic receptors in heterologous expression systems, brain slices, and living animals. L-2-Amino-4-phosphonobutanoate (L-AP4), and l-serine-O-phosphate (L-SOP), which activate group III mGlu receptors, restrained the stimulation of polyphosphoinositide (PI) hydrolysis induced by the α 1 -adrenergic receptor agonist, phenylephrine, in HEK 293 cells co-expressing α 1 -adrenergic and mGlu7 receptors. The inibitory action of L-AP4 was abrogated by (i) the mGlu7 receptor antagonist, XAP044; (ii) the C-terminal portion of type-2 G protein coupled receptor kinase; and (iii) the MAP kinase inhibitors, UO126 and PD98059. This suggests that the functional interaction between mGlu7 and α 1 -adrenergic receptors was mediated by the βγ-subunits of the G i protein and required the activation of the MAP kinase pathway. Remarkably, activation of neither mGlu2 nor mGlu4 receptors reduced α 1 -adrenergic receptor-mediated PI hydrolysis. In mouse cortical slices, both L-AP4 and L-SOP were able to attenuate norepinephrine- and phenylephrine-stimulated PI hydrolysis at concentrations consistent with the activation of mGlu7 receptors. L-AP4 failed to affect norepinephrine-stimulated PI hydrolysis in cortical slices from mGlu7 -/- mice, but retained its inhibitory activity in slices from mGlu4 -/- mice. At behavioural level, i.c.v. injection of phenylephrine produced antidepressant-like effects in the forced swim test. The action of phenylephrine was attenuated by L-SOP, which was inactive per se. Finally, both phenylephrine and L-SOP increased corticosterone levels in mice, but the increase was halved when the two drugs were administered in combination. Our data demonstrate that α 1 -adrenergic and mGlu7 receptors functionally interact and suggest that this interaction might be targeted in the treatment of stress-related disorders. Copyright © 2016 Elsevier Ltd. All rights reserved.

In-vivo effects of knocking-down metabotropic glutamate receptor 5 in the SOD1G93A mouse model of amyotrophic lateral sclerosis.

PubMed

Bonifacino, Tiziana; Cattaneo, Luca; Gallia, Elena; Puliti, Aldamaria; Melone, Marcello; Provenzano, Francesca; Bossi, Simone; Musante, Ilaria; Usai, Cesare; Conti, Fiorenzo; Bonanno, Giambattista; Milanese, Marco

2017-09-01

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder due to loss of upper and lower motor neurons (MNs). The mechanisms of neuronal death are largely unknown, thus prejudicing the successful pharmacological treatment. One major cause for MN degeneration in ALS is represented by glutamate(Glu)-mediated excitotoxicity. We have previously reported that activation of Group I metabotropic Glu receptors (mGluR1 and mGluR5) at glutamatergic spinal cord nerve terminals produces abnormal Glu release in the widely studied SOD1 G93A mouse model of ALS. We also demonstrated that halving mGluR1 expression in the SOD1 G93A mouse had a positive impact on survival, disease onset, disease progression, and on a number of cellular and biochemical readouts of ALS. We generated here SOD1 G93A mice with reduced expression of mGluR5 (SOD1 G93A Grm5 -/+ ) by crossing the SOD1 G93A mutant mouse with the mGluR5 heterozigous Grm5 -/+ mouse. SOD1 G93A Grm5 -/+ mice showed prolonged survival probability and delayed pathology onset. These effects were associated to enhanced number of preserved MNs, decreased astrocyte and microglia activation, reduced cytosolic free Ca 2+ concentration, and regularization of abnormal Glu release in the spinal cord of SOD1 G93A Grm5 -/+ mice. Unexpectedly, only male SOD1 G93A Grm5 -/+ mice showed improved motor skills during disease progression vs. SOD1 G93A mice, while SOD1 G93A Grm5 -/+ females did not. These results demonstrate that a lower constitutive level of mGluR5 has a significant positive impact in mice with ALS and support the idea that blocking Group I mGluRs may represent a potentially effective pharmacological approach to the disease. Copyright © 2017 Elsevier Ltd. All rights reserved.

CRIP1a inhibits endocytosis of G-protein coupled receptors activated by endocannabinoids and glutamate by a common molecular mechanism.

PubMed

Mascia, Fabrizio; Klotz, Lisa; Lerch, Judith; Ahmed, Mostafa H; Zhang, Yan; Enz, Ralf

2017-05-01

The excitability of the central nervous system depends largely on the surface density of neurotransmitter receptors. The endocannabinoid receptor 1 (CB 1 R) and the metabotropic glutamate receptor mGlu 8 R are expressed pre-synaptically where they reduce glutamate release into the synaptic cleft. Recently, the CB 1 R interacting protein cannabinoid receptor interacting protein 1a (CRIP1a) was identified and characterized to regulate CB 1 R activity in neurons. However, underlying molecular mechanisms are largely unknown. Here, we identified a common mechanism used by CRIP1a to regulate the cell surface density of two different types of G-protein coupled receptors, CB 1 R and mGlu 8a R. Five amino acids within the CB 1 R C-terminus were required and sufficient to reduce constitutive CB 1 R endocytosis by about 72% in the presence of CRIP1a. Interestingly, a similar sequence is present in mGlu 8a R and consistently, endocytosis of mGlu 8a R depended on CRIP1a, as well. Docking analysis and molecular dynamics simulations identified a conserved serine in CB 1 R (S468) and mGlu 8a R (S894) that forms a hydrogen bond with the peptide backbone of CRIP1a at position R82. In contrast to mGlu 8a R, the closely related mGlu 8b R splice-variant carries a lysine (K894) at this position, and indeed, mGlu 8b R endocytosis was not affected by CRIP1a. Chimeric constructs between CB 1 R, mGlu 8a R, and mGlu 8b R underline the role of the identified five CRIP1a sensitive amino acids. In summary, we suggest that CRIP1a negatively regulates endocytosis of two different G-protein coupled receptor types, CB 1 R and mGlu 8a R. © 2017 International Society for Neurochemistry.

Synaptic GluN2A and GluN2B Containing NMDA Receptors within the Superficial Dorsal Horn Activated following Primary Afferent Stimulation

PubMed Central

MacDermott, Amy B.

2014-01-01

NMDA receptors are important elements in pain signaling in the spinal cord dorsal horn. They are heterotetramers, typically composed of two GluN1 and two of four GluN2 subunits: GluN2A-2D. Mice lacking some of the GluN2 subunits show deficits in pain transmission yet functional synaptic localization of these receptor subtypes in the dorsal horn has not been fully resolved. In this study, we have investigated the composition of synaptic NMDA receptors expressed in monosynaptic and polysynaptic pathways from peripheral sensory fibers to lamina I neurons in rats. We focused on substance P receptor-expressing (NK1R+) projection neurons, critical for expression of hyperalgesia and allodynia. EAB-318 and (R)-CPP, GluN2A/B antagonists, blocked both monosynaptic and polysynaptic NMDA EPSCs initiated by primary afferent activation by ∼90%. Physiological measurements exploiting the voltage dependence of monosynaptic EPSCs similarly indicated dominant expression of GluN2A/B types of synaptic NMDA receptors. In addition, at synapses between C fibers and NK1R+ neurons, NMDA receptor activation initiated a secondary, depolarizing current. Ifenprodil, a GluN2B antagonist, caused modest suppression of monosynaptic NMDA EPSC amplitudes, but had a widely variable, sometimes powerful, effect on polysynaptic responses following primary afferent stimulation when inhibitory inputs were blocked to mimic neuropathic pain. We conclude that GluN2B subunits are moderately expressed at primary afferent synapses on lamina I NK1R+ neurons, but play more important roles for polysynaptic NMDA EPSCs driven by primary afferents following disinhibition, supporting the view that the analgesic effect of the GluN2B antagonist on neuropathic pain is at least in part, within the spinal cord. PMID:25122884

VU0477573: Partial Negative Allosteric Modulator of the Subtype 5 Metabotropic Glutamate Receptor with In Vivo Efficacy.

PubMed

Nickols, Hilary Highfield; Yuh, Joannes P; Gregory, Karen J; Morrison, Ryan D; Bates, Brittney S; Stauffer, Shaun R; Emmitte, Kyle A; Bubser, Michael; Peng, Weimin; Nedelcovych, Michael T; Thompson, Analisa; Lv, Xiaohui; Xiang, Zixiu; Daniels, J Scott; Niswender, Colleen M; Lindsley, Craig W; Jones, Carrie K; Conn, P Jeffrey

2016-01-01

Negative allosteric modulators (NAMs) of metabotropic glutamate receptor subtype 5 (mGlu5) have potential applications in the treatment of fragile X syndrome, levodopa-induced dyskinesia in Parkinson disease, Alzheimer disease, addiction, and anxiety; however, clinical and preclinical studies raise concerns that complete blockade of mGlu5 and inverse agonist activity of current mGlu5 NAMs contribute to adverse effects that limit the therapeutic use of these compounds. We report the discovery and characterization of a novel mGlu5 NAM, N,N-diethyl-5-((3-fluorophenyl)ethynyl)picolinamide (VU0477573) that binds to the same allosteric site as the prototypical mGlu5 NAM MPEP but displays weak negative cooperativity. Because of this weak cooperativity, VU0477573 acts as a "partial NAM" so that full occupancy of the MPEP site does not completely inhibit maximal effects of mGlu5 agonists on intracellular calcium mobilization, inositol phosphate (IP) accumulation, or inhibition of synaptic transmission at the hippocampal Schaffer collateral-CA1 synapse. Unlike previous mGlu5 NAMs, VU0477573 displays no inverse agonist activity assessed using measures of effects on basal [(3)H]inositol phosphate (IP) accumulation. VU0477573 acts as a full NAM when measuring effects on mGlu5-mediated extracellular signal-related kinases 1/2 phosphorylation, which may indicate functional bias. VU0477573 exhibits an excellent pharmacokinetic profile and good brain penetration in rodents and provides dose-dependent full mGlu5 occupancy in the central nervous system (CNS) with systemic administration. Interestingly, VU0477573 shows robust efficacy, comparable to the mGlu5 NAM MTEP, in models of anxiolytic activity at doses that provide full CNS occupancy of mGlu5 and demonstrate an excellent CNS occupancy-efficacy relationship. VU0477573 provides an exciting new tool to investigate the efficacy of partial NAMs in animal models. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

VU0477573: Partial Negative Allosteric Modulator of the Subtype 5 Metabotropic Glutamate Receptor with In Vivo Efficacy

PubMed Central

Yuh, Joannes P.; Gregory, Karen J.; Morrison, Ryan D.; Bates, Brittney S.; Stauffer, Shaun R.; Emmitte, Kyle A.; Bubser, Michael; Peng, Weimin; Nedelcovych, Michael T.; Thompson, Analisa; Lv, Xiaohui; Xiang, Zixiu; Daniels, J. Scott; Niswender, Colleen M.; Lindsley, Craig W.; Jones, Carrie K.; Conn, P. Jeffrey

2016-01-01

Negative allosteric modulators (NAMs) of metabotropic glutamate receptor subtype 5 (mGlu5) have potential applications in the treatment of fragile X syndrome, levodopa-induced dyskinesia in Parkinson disease, Alzheimer disease, addiction, and anxiety; however, clinical and preclinical studies raise concerns that complete blockade of mGlu5 and inverse agonist activity of current mGlu5 NAMs contribute to adverse effects that limit the therapeutic use of these compounds. We report the discovery and characterization of a novel mGlu5 NAM, N,N-diethyl-5-((3-fluorophenyl)ethynyl)picolinamide (VU0477573) that binds to the same allosteric site as the prototypical mGlu5 NAM MPEP but displays weak negative cooperativity. Because of this weak cooperativity, VU0477573 acts as a “partial NAM” so that full occupancy of the MPEP site does not completely inhibit maximal effects of mGlu5 agonists on intracellular calcium mobilization, inositol phosphate (IP) accumulation, or inhibition of synaptic transmission at the hippocampal Schaffer collateral-CA1 synapse. Unlike previous mGlu5 NAMs, VU0477573 displays no inverse agonist activity assessed using measures of effects on basal [3H]inositol phosphate (IP) accumulation. VU0477573 acts as a full NAM when measuring effects on mGlu5-mediated extracellular signal-related kinases 1/2 phosphorylation, which may indicate functional bias. VU0477573 exhibits an excellent pharmacokinetic profile and good brain penetration in rodents and provides dose-dependent full mGlu5 occupancy in the central nervous system (CNS) with systemic administration. Interestingly, VU0477573 shows robust efficacy, comparable to the mGlu5 NAM MTEP, in models of anxiolytic activity at doses that provide full CNS occupancy of mGlu5 and demonstrate an excellent CNS occupancy-efficacy relationship. VU0477573 provides an exciting new tool to investigate the efficacy of partial NAMs in animal models. PMID:26503377

Facilitated extinction of morphine conditioned place preference with Tat-GluA2(3Y) interference peptide.

PubMed

Dias, C; Wang, Y T; Phillips, A G

2012-08-01

Neuroplasticity including long-term depression (LTD) has been implicated in both learning processes and addiction. LTD can be blocked by intravenous administration of the interference peptide Tat-GluA2(3Y) that prevents regulated endocytosis of the alpha-amino-3-hydroxy-5-methyl-isoxazole-4-propionic acid (AMPA) receptor. In this study, Tat-GluA2(3Y) was used to assess the role of LTD in the induction, expression, extinction and reinstatement of morphine-induced conditioned place preference (CPP). CPP was established in rats by pairing morphine (5 mg/kg, i.p.) or saline with a specific environmental context using a balanced protocol. Tat-GluA2(3Y) (0; 1.5; 2.25 nmol/g; i.v.), scrambled peptide (Tat-GluA2(Sc)), or vehicle was administered during the acquisition phase or prior to the test for CPP. Tat-GluA2(3Y) had no effect on the induction or initial expression of morphine-induced CPP. Rats that received Tat-GluA2(3Y) or Tat-GluA2(Sc) during acquisition were subsequently tested for 11 consecutive days in order to extinguish morphine CPP. CPP was then reinstated by an injection of morphine (5 mg/kg, i.p.). Co-administration of morphine and Tat-GluA2(3Y) during acquisition greatly facilitated extinction of CPP without affecting morphine-induced reinstatement of CPP. Using an intermittent retest schedule with bi-weekly tests to measure the maintenance of CPP, Tat-GluA2(3Y) during the acquisition phase had no effect on the maintenance of CPP. We propose that co-administration of Tat-GluA2(3Y) with morphine during acquisition of CPP weakens the association between morphine and contextual cues leading to rapid extinction of morphine CPP with repeated daily testing. Copyright © 2012 Elsevier B.V. All rights reserved.

Role of metabotropic glutamate receptor 5 signaling and homer in oxygen glucose deprivation-mediated astrocyte apoptosis.

PubMed

Paquet, Maryse; Ribeiro, Fabiola M; Guadagno, Jennifer; Esseltine, Jessica L; Ferguson, Stephen S G; Cregan, Sean P

2013-02-14

Group I metabotropic glutamate receptors (mGluR) are coupled via Gαq/11 to the activation of phospholipase Cβ, which hydrolyzes membrane phospholipids to form inositol 1,4,5 trisphosphate and diacylglycerol. In addition to functioning as neurotransmitter receptors to modulate synaptic activity, pathological mGluR5 signaling has been implicated in a number of disease processes including Fragile X, amyotrophic lateral sclerosis, multiple sclerosis, Alzheimer's disease, Parkinson's disease, Huntington's disease, epilepsy, and drug addiction. The expression of mGluR5 in astrocytes has been shown to be increased in several acute and chronic neurodegenerative conditions, but little is known about the functional relevance of mGluR5 up-regulation in astrocytes following injury. In the current study, we investigated primary mouse cortical astrocyte cell death in response to oxygen glucose deprivation (OGD) and found that OGD induced both necrotic and apoptotic cell death of astrocytes. OGD resulted in an increase in astrocytic mGluR5 protein expression, inositol phosphate formation and extracellular regulated kinase (ERK1/2) phosphorylation, but only inositol phosphate formation was blocked with the mGluR5 selective antagonist MPEP. Cortical astrocytes derived from mGluR5 knockout mice exhibited resistance to OGD-stimulated apoptosis, but a lack of mGluR5 expression did not confer protection against necrotic cell death. The antagonism of the inositol 1,4,5 trisphosphate receptor also reduced apoptotic cell death in wild-type astrocytes, but did not provide any additional protection to astrocytes derived from mGluR5 null mice. Moreover, the disruption of Homer protein interactions with mGluR5 also reduced astrocyte apoptosis. Taken together these observations indicated that mGluR5 up-regulation contributed selectively to the apoptosis of astrocytes via the activation of phospholipase C and the release of calcium from intracellular stores as well as via the association with Homer proteins.

The mGluR2/3 Agonist LY379268 Induced Anti-Reinstatement Effects in Rats Exhibiting Addiction-like Behavior

PubMed Central

Cannella, Nazzareno; Halbout, Briac; Uhrig, Stefanie; Evrard, Lionel; Corsi, Mauro; Corti, Corrado; Deroche-Gamonet, Veronique; Hansson, Anita C; Spanagel, Rainer

2013-01-01

Medication development for cocaine-addicted patients is difficult, and many promising preclinical candidates have failed in clinical trials. One reason for the difficulty in translating preclinical findings to the human condition is that drug testing is typically conducted in behavioral procedures in which animals do not show addiction-like traits. Recently, a DSM-IV-based animal model has been developed that allows studying the transition to an addiction-like behavior. Changes in synaptic plasticity are involved in the transition to cocaine addiction. In particular, it has been shown that metabotropic glutamate receptor 2/3 (mGluR2/3)-mediated long-term depression is suppressed in the prelimbic cortex in addict-like rats. We therefore hypothesized that cocaine-seeking in addict-like rats could be treated with an mGluR2/3 agonist. Indeed, addict-like rats that were treated systemically with the mGluR2/3 agonist LY379268 (0, 0.3, and 3 mg/kg) showed a pronounced reduction in cue-induced reinstatement of cocaine-seeking. In an attempt to dissect the role played by mGluR2 and mGluR3 in cue-induced reinstatement, we analyzed the mRNA expression patterns in several relevant brain areas but did not find any significant differences between cocaine addict-like and non-addict-like rats, suggesting that the behavioral differences observed are due to translational rather than transcriptional regulation. Another possibility to study the contributions of mGluR2 and mGluR3 in mediating addictive-like behavior is the use of knockout models. Because mGluR2 knockouts cannot be used in operant procedures due to motoric impairment, we only tested mGluR3 knockouts. These mice did not differ from controls in reinstatement, suggesting that mGluR2 receptors are critical in mediating addictive-like behavior. PMID:23624743

Ionotropic glutamate receptor mRNA editing in the prefrontal cortex: no alterations in schizophrenia or bipolar disorder.

PubMed

Lyddon, Rebecca; Navarrett, Scott; Dracheva, Stella

2012-07-01

Dysfunction of glutamate neurotransmission has been implicated in the pathology of schizophrenia and bipolar disorder, and one mechanism by which glutamate signalling can be altered is through RNA editing of ionotropic glutamate receptors (iGluRs). The objectives of the present study were to evaluate the editing status of iGluRs in the human prefrontal cortex, determine whether iGluR editing is associated with psychiatric disease or suicide and evaluate a potential association between editing and alternative splicing in the α-amino-3-hydroxy-5-methylisoxazole-4-propionate (AMPA) iGluR subunits' pre-mRNA. We studied specimens derived from patients with antemortem diagnoses of bipolar disorder (n = 31) or schizophrenia (n = 34) who died by suicide or other causes, and from psychiatrically healthy controls (n = 34) who died from causes other than suicide. The RNA editing at all 8 editing sites within AMPA (GluA2-4 subunits) and kainate (GluK1-2 subunits) iGluRs was analyzed using a novel real-time quantitative polymerase chain reaction assay. No differences in editing were detected among schizophrenia, bipolar or control groups or between suicide completers and patients who died from causes other than suicide. The editing efficiency was significantly higher in the flop than in the flip splicoforms of GluA3-4 AMPA subunits (all p < 0.001). The study is limited by the near absence of specimens from medicationnaive psychiatric patients and considerable variation in medication regimens among individuals, both of which introduce considerable uncertainty into the analysis of potential medication effects. We found that iGluR RNA editing status was not associated with bipolar disorder, schizophrenia or suicide. Differences in editing between flip and flop splicoforms suggest that glutamate sensitivity of receptors containing GluA3 and/or GluA4 flop subunits is moderated as a result of increased editing.

A Molecular Determinant of Subtype-Specific Desensitization in Ionotropic Glutamate Receptors.

PubMed

Alsaloum, Matthew; Kazi, Rashek; Gan, Quan; Amin, Johansen; Wollmuth, Lonnie P

2016-03-02

AMPA and NMDA receptors are glutamate-gated ion channels that mediate fast excitatory synaptic transmission throughout the nervous system. In the continual presence of glutamate, AMPA and NMDA receptors containing the GluN2A or GluN2B subunit enter into a nonconducting, desensitized state that can impact synaptic responses and glutamate-mediated excitotoxicity. The process of desensitization is dramatically different between subtypes, but the basis for these differences is unknown. We generated an extensive sequence alignment of ionotropic glutamate receptors (iGluRs) from diverse animal phyla and identified a highly conserved motif, which we termed the "hydrophobic box," located at the extracellular interface of transmembrane helices. A single position in the hydrophobic box differed between mammalian AMPA and NMDA receptors. Surprisingly, we find that an NMDAR-to-AMPAR exchange mutation at this position in the rat GluN2A or GluN2B subunit had a dramatic and highly specific effect on NMDAR desensitization, making it AMPAR-like. In contrast, a reverse exchange mutation in AMPARs had minimal effects on desensitization. These experiments highlight differences in desensitization between iGluR subtypes and the highly specific contribution of the GluN2 subunit to this process. Rapid communication between cells in the nervous system depends on ion channels that are directly activated by neurotransmitter molecules. Here, we studied ionotropic glutamate receptors (iGluRs), which are ion channels activated by the neurotransmitter glutamate. By comparing the sequences of a vast number of iGluR proteins from diverse animal species, assisted by available structural information, we identified a highly conserved motif. We showed that a single amino acid difference in this motif between mammalian iGluR subtypes has dramatic effects on receptor function. These results have implications in both the evolution of synaptic function, as well as the role of iGluRs in health and disease. Copyright © 2016 the authors 0270-6474/16/362617-06$15.00/0.

Mutations on M3 helix of Plutella xylostella glutamate-gated chloride channel confer unequal resistance to abamectin by two different mechanisms.

PubMed

Wang, Xingliang; Puinean, Alin M; O Reilly, Andrias O; Williamson, Martin S; Smelt, Charles L C; Millar, Neil S; Wu, Yidong

2017-07-01

Abamectin is one of the most widely used avermectins for agricultural pests control, but the emergence of resistance around the world is proving a major threat to its sustained application. Abamectin acts by directly activating glutamate-gated chloride channels (GluCls) and modulating other Cys-loop ion channels. To date, three mutations occurring in the transmembrane domain of arthropod GluCls are associated with target-site resistance to abamectin: A309V in Plutella xylostella GluCl (PxGluCl), G323D in Tetranychus urticae GluCl1 (TuGluCl1) and G326E in TuGluCl3. To compare the effects of these mutations in a single system, A309V/I/G and G315E (corresponding to G323 in TuGluCl1 and G326 in TuGluCl3) substitutions were introduced individually into the PxGluCl channel. Functional analysis using Xenopus oocytes showed that the A309V and G315E mutations reduced the sensitivity to abamectin by 4.8- and 493-fold, respectively. In contrast, the substitutions A309I/G show no significant effects on the response to abamectin. Interestingly, the A309I substitution increased the channel sensitivity to glutamate by one order of magnitude (∼12-fold). Analysis of PxGluCl homology models indicates that the G315E mutation interferes with abamectin binding through a steric hindrance mechanism. In contrast, the structural consequences of the A309 mutations are not so clear and an allosteric modification of the binding site is the most likely mechanism. Overall the results show that both A309V and G315E mutations may contribute to target-site resistance to abamectin and may be important for the future prediction and monitoring of abamectin resistance in P. xylostella and other arthropod pests. Copyright © 2017 Elsevier Ltd. All rights reserved.

Novel insights into the composition, variation, organization, and expression of the low-molecular-weight glutenin subunit gene family in common wheat

PubMed Central

Zhang, Xiaofei; Liu, Dongcheng; Zhang, Jianghua; Jiang, Wei; Luo, Guangbin; Yang, Wenlong; Sun, Jiazhu; Tong, Yiping; Cui, Dangqun; Zhang, Aimin

2013-01-01

Low-molecular-weight glutenin subunits (LMW-GS), encoded by a complex multigene family, play an important role in the processing quality of wheat flour. Although members of this gene family have been identified in several wheat varieties, the allelic variation and composition of LMW-GS genes in common wheat are not well understood. In the present study, using the LMW-GS gene molecular marker system and the full-length gene cloning method, a comprehensive molecular analysis of LMW-GS genes was conducted in a representative population, the micro-core collections (MCC) of Chinese wheat germplasm. Generally, >15 LMW-GS genes were identified from individual MCC accessions, of which 4–6 were located at the Glu-A3 locus, 3–5 at the Glu-B3 locus, and eight at the Glu-D3 locus. LMW-GS genes at the Glu-A3 locus showed the highest allelic diversity, followed by the Glu-B3 genes, while the Glu-D3 genes were extremely conserved among MCC accessions. Expression and sequence analysis showed that 9–13 active LMW-GS genes were present in each accession. Sequence identity analysis showed that all i-type genes present at the Glu-A3 locus formed a single group, the s-type genes located at Glu-B3 and Glu-D3 loci comprised a unique group, while high-diversity m-type genes were classified into four groups and detected in all Glu-3 loci. These results contribute to the functional analysis of LMW-GS genes and facilitate improvement of bread-making quality by wheat molecular breeding programmes. PMID:23536608

Group III metabotropic glutamate receptors inhibit hyperalgesia in animal models of inflammation and neuropathic pain.

PubMed

Goudet, Cyril; Chapuy, Eric; Alloui, Abdelkrim; Acher, Francine; Pin, Jean-Philippe; Eschalier, Alain

2008-07-01

Glutamate plays a key role in modulation of nociceptive processing. This excitatory amino acid exerts its action through two distinct types of receptors, ionotropic and metabotropic glutamate receptors (mGluRs). Eight mGluRs have been identified and divided in three groups based on their sequence similarity, pharmacology and G-protein coupling. While the role of group I and II mGluRs is now well established, little is known about the part played by group III mGluRs in pain. In this work, we studied comparatively the involvement of spinal group III mGluR in modulation of acute, inflammatory and neuropathic pain. While intrathecal injection of ACPT-I, a selective group III mGluR agonist, failed to induce any change in vocalization thresholds of healthy animals submitted to mechanical or thermal stimuli, it dose-dependently inhibited the nociceptive behavior of rats submitted to the formalin test and the mechanical hyperalgesia associated with different animal models of inflammatory (carrageenan-treated and monoarthritic rats) or neuropathic pain (mononeuropathic and vincristine-treated rats). Similar effects were also observed following intrathecal injection of PHCCC, a positive allosteric modulator of mGlu4. Antihyperalgesia induced by ACPT-I was blocked either by LY341495, a nonselective antagonist of mGluR, by MAP4, a selective group III antagonist. This study provide new evidences supporting the role of spinal group III mGluRs in the modulation of pain perception in different pathological pain states of various etiologies but not in normal conditions. It more particularly highlights the specific involvement of mGlu4 in this process and may be a useful therapeutic approach to chronic pain treatment.

Gating characteristics control glutamate receptor distribution and trafficking in vivo.

PubMed

Petzoldt, Astrid G; Lee, Yü-Hien; Khorramshahi, Omid; Reynolds, Eric; Plested, Andrew J R; Herzel, Hanspeter; Sigrist, Stephan J

2014-09-08

Glutamate-releasing synapses dominate excitatory release in the brain. Mechanisms governing their assembly are of major importance for circuit development and long-term plasticity underlying learning and memory. AMPA/Kainate-type glutamate receptors (GluRs) are tetrameric ligand-gated ion channels that open their ion-conducting pores in response to binding of the neurotransmitter. Changes in subunit composition of postsynaptic GluRs are highly relevant for plasticity and development of glutamatergic synapses [1-4]. To date, posttranslational modifications, mostly operating via the intracellular C-terminal domains (CTDs) of GluRs, are presumed to be the major regulator of trafficking [5]. In recent years, structural and electrophysiological analyses have improved our understanding of GluR gating mechanism [6-11]. However, whether conformational changes subsequent to glutamate binding may per se be able to influence GluR trafficking has remained an unaddressed question. Using a Drosophila system allowing for extended visualization of GluR trafficking in vivo, we here provide evidence that mutations changing the gating behavior alter GluR distribution and trafficking. GluR mutants associated with reduced charge transfer segregated from coexpressed wild-type GluRs on the level of individual postsynaptic densities. Segregation was lost upon blocking of evoked glutamate release. Photobleaching experiments suggested increased mobility of mutants with reduced charge transfer, which accumulated prematurely during early steps of synapse assembly, but failed to further increase their level in accordance with assembly of the presynaptic scaffold. In summary, gating characteristics seem to be a new variable for the understanding of GluR trafficking relevant to both development and plasticity. Copyright © 2014 Elsevier Ltd. All rights reserved.

The Role of mGlu Receptors in Hippocampal Plasticity Deficits in Neurological and Psychiatric Disorders: Implications for Allosteric Modulators as Novel Therapeutic Strategies

PubMed Central

Senter, Rebecca K.; Ghoshal, Ayan; Walker, Adam G.; Xiang, Zixiu; Niswender, Colleen M.; Conn, P. Jeffrey

2016-01-01

Long-term potentiation (LTP) and long-term depression (LTD) are two distinct forms of synaptic plasticity that have been extensively characterized at the Schaffer collateral-CA1 (SC-CA1) synapse and the mossy fiber (MF)-CA3 synapse within the hippocampus, and are postulated to be the molecular underpinning for several cognitive functions. Deficits in LTP and LTD have been implicated in the pathophysiology of several neurological and psychiatric disorders. Therefore, there has been a large effort focused on developing an understanding of the mechanisms underlying these forms of plasticity and novel therapeutic strategies that improve or rescue these plasticity deficits. Among many other targets, the metabotropic glutamate (mGlu) receptors show promise as novel therapeutic candidates for the treatment of these disorders. Among the eight distinct mGlu receptor subtypes (mGlu1-8), the mGlu1,2,3,5,7 subtypes are expressed throughout the hippocampus and have been shown to play important roles in the regulation of synaptic plasticity in this brain area. However, development of therapeutic agents that target these mGlu receptors has been hampered by a lack of subtype-selective compounds. Recently, discovery of allosteric modulators of mGlu receptors has provided novel ligands that are highly selective for individual mGlu receptor subtypes. The mGlu receptors modulate the multiple forms of synaptic plasticity at both SC-CA1 and MF synapses and allosteric modulators of mGlu receptors have emerged as potential therapeutic agents that may rescue plasticity deficits and improve cognitive function in patients suffering from multiple neurological and psychiatric disorders. PMID:27296640

Separate functional properties of NMDARs regulate distinct aspects of spatial cognition.

PubMed

Sanders, Erin M; Nyarko-Odoom, Akua O; Zhao, Kevin; Nguyen, Michael; Liao, Hong Hong; Keith, Matthew; Pyon, Jane; Kozma, Alyssa; Sanyal, Mohima; McHail, Daniel G; Dumas, Theodore C

2018-06-01

N -methyl-d-aspartate receptors (NMDARs) at excitatory synapses are central to activity-dependent synaptic plasticity and learning and memory. NMDARs act as ionotropic and metabotropic receptors by elevating postsynaptic calcium concentrations and by direct intracellular protein signaling. In the forebrain, these properties are controlled largely by the auxiliary GluN2 subunits, GluN2A and GluN2B. While calcium conductance through NMDAR channels and intracellular protein signaling make separate contributions to synaptic plasticity, it is not known if these properties individually influence learning and memory. To address this issue, we created chimeric GluN2 subunits containing the amino-terminal domain and transmembrane domains from GluN2A or GluN2B fused to the carboxy-terminal domain of GluN2B (termed ABc) or GluN2A ATD (termed BAc), respectively, and expressed these mutated GluN2 subunits in transgenic mice. Expression was confirmed at the mRNA level and protein subunit translation and translocation into dendrites were observed in forebrain neurons. In the spatial version of the Morris water maze, BAc mice displayed signs of a learning deficit. In contrast, ABc animals performed similarly to wild-types during training, but showed a more direct approach to the goal location during a long-term memory test. There was no effect of ABc or BAc expression in a nonspatial water escape task. Since background expression is predominantly GluN2A in mature animals, the results suggest that spatial learning is more sensitive to manipulations of the amino-terminal domain and transmembrane domains (calcium conductance) and long-term memory is regulated more by the carboxy-terminal domain (intracellular protein signaling). © 2018 Sanders et al.; Published by Cold Spring Harbor Laboratory Press.

NMDA receptor subunits and associated signaling molecules mediating antidepressant-related effects of NMDA-GluN2B antagonism

PubMed Central

Kiselycznyk, Carly; Jury, Nicholas; Halladay, Lindsay; Nakazawa, Kazu; Mishina, Masayoshi; Sprengel, Rolf; Grant, Seth G.N.; Svenningsson, Per; Holmes, Andrew

2015-01-01

Drugs targeting the glutamate N-methyl-D-aspartate receptor (NMDAR) may be efficacious for treating mood disorders, as exemplified by the rapid antidepressant effects produced by single administration of the NMDAR antagonist ketamine. Though the precise mechanisms underlying the antidepressant-related effects of NMDAR antagonism remain unclear, recent studies implicate specific NMDAR subunits, including GluN2A and GluN2B, as well as the alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor (AMPAR) subunit glutamate receptor interacting molecule, PSD-95. Here, integrating mutant and pharmacological in mice, we investigated the contribution of these subunits and molecules to antidepressant-related behaviors and the antidepressant-related effects of the GluN2B blocker, Ro 25-6981. We found that global deletion of GluA1 or PSD-95 reduced forced swim test (FST) immobility, mimicking the antidepressant-related effect produced by systemically administered Ro 25-6981 in C57BL/6J mice. Moreover, the FST antidepressant-like effects of systemic Ro 25-6981 were intact in mutants with global GluA1 deletion or GluN1 deletion in forebrain interneurons, but were absent in mutants constitutively lacking GluN2A or PSD-95. Next, we found that microinfusing Ro 25-6981 into the medial prefrontal cortex (mPFC), but not basolateral amygdala, of C57BL/6J mice was sufficient to produce an antidepressant-like effect. Together, these findings extend and refine current understanding of the mechanisms mediating antidepressant-like effects produced by NMDAR-GluN2B antagonists, and may inform the development of a novel class of medications for treating depression that target the GluN2B subtype of NMDAR. PMID:25800971

Neuronal activity patterns in the mediodorsal thalamus and related cognitive circuits are modulated by metabotropic glutamate receptors

PubMed Central

Copeland, C.S.; Neale, S.A.; Salt, T.E.

2015-01-01

The mediodorsal thalamus (MD) likely plays an important role in cognition as it receives abundant afferent connections from the amygdala and prefrontal cortex (PFC). Indeed, disturbed activity within the MD is thought to precipitate cognitive deficits associated with schizophrenia. As compounds acting at the Group II metabotropic glutamate (mGlu) receptors (subtypes mGlu2/mGlu3) have efficacy in animal models of schizophrenia, we investigated whether a Group II agonist and an mGlu2 positive allosteric modulator (PAM) could modulate MD activity. Extracellular single-unit recordings were made in vivo from MD neurones in anaesthetised rats. Responses were elicited by electrical stimulation of the PFC and/or amygdala, with Group II compounds locally applied as required. The Group II agonist reduced inhibition evoked in the MD: an effect manifested as an increase in short-latency responses, and a decrease in long-latency burst-firing. This disinhibitory action of the Group II receptors in the MD represents a mechanism of potential therapeutic importance as increased inhibition in the MD has been associated with cognitive deficit-onset. Furthermore, as co-application of the mGlu2 PAM did not potentiate the Group II agonist effects in the MD, we suggest that the Group II disinhibitory effect is majority-mediated via mGlu3. This heterogeneity in Group II receptor thalamic physiology bears consequence, as compounds active exclusively at the mGlu2 subtype are unlikely to perturb maladapted MD firing patterns associated with cognitive deficits, with activity at mGlu3 receptors possibly more appropriate. Indeed, polymorphisms in the mGlu3, but not the mGlu2, gene have been detected in patients with schizophrenia. PMID:25576798

Disruption of GluA2 phosphorylation potentiates stress responsivity.

PubMed

Ellis, Alexandra S; Fosnocht, Anne Q; Lucerne, Kelsey E; Briand, Lisa A

2017-08-30

Cocaine addiction is characterized by persistent craving and addicts frequently relapse even after long periods of abstinence. Exposure to stress can precipitate relapse in humans and rodents. Stress and drug use can lead to common alterations in synaptic plasticity and these commonalities may contribute to the ability of stress to elicit relapse. These common changes in synaptic plasticity are mediated, in part, by alterations in the trafficking and stabilization of AMPA receptors. Exposure to both cocaine and stress can lead to alterations in protein kinase C-mediated phosphorylation of GluA2 AMPA subunits and thus alter the trafficking of GluA2-containing AMPARs. However, it is not clear what role AMPAR trafficking plays in the interactions between stress and cocaine. The current study utilized a mouse with a point mutation within the GluA2 subunit c-terminus resulting in a disruption of PKC-mediated GluA2 phosphorylation to examine stress responsivity. Although no differences were seen in the response to a forced swim stress in naïve mice, GluA2 K882A knock-in mice exhibited an increased stress response following cocaine self-administration. Furthermore, we demonstrated that disrupting GluA2 phosphorylation increases vulnerability to stress-induced reinstatement of both cocaine seeking and cocaine-conditioned reward. Finally, GluA2 K882A knock-in mice exhibit an increased vulnerability to social defeat as indicated by increased social avoidance. Taken together these results indicate that disrupting GluA2 phosphorylation leads to increased responsivity to acute stress following cocaine exposure and increased vulnerability to chronic stress. These results highlight the GluA2 phosphorylation site as a novel target for the stress-related disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

NAAG Peptidase Inhibitors Act via mGluR3: Animal Models of Memory, Alzheimer's, and Ethanol Intoxication.

PubMed

Olszewski, Rafal T; Janczura, Karolina J; Bzdega, Tomasz; Der, Elise K; Venzor, Faustino; O'Rourke, Brennen; Hark, Timothy J; Craddock, Kirsten E; Balasubramanian, Shankar; Moussa, Charbel; Neale, Joseph H

2017-09-01

Glutamate carboxypeptidase II (GCPII) inactivates the peptide neurotransmitter N-acetylaspartylglutamate (NAAG) following synaptic release. Inhibitors of GCPII increase extracellular NAAG levels and are efficacious in animal models of clinical disorders via NAAG activation of a group II metabotropic glutamate receptor. mGluR2 and mGluR3 knock-out (ko) mice were used to test the hypothesis that mGluR3 mediates the activity of GCPII inhibitors ZJ43 and 2-PMPA in animal models of memory and memory loss. Short- (1.5 h) and long- (24 h) term novel object recognition tests were used to assess memory. Treatment with ZJ43 or 2-PMPA prior to acquisition trials increased long-term memory in mGluR2, but not mGluR3, ko mice. Nine month-old triple transgenic Alzheimer's disease model mice exhibited impaired short-term novel object recognition memory that was rescued by treatment with a NAAG peptidase inhibitor. NAAG peptidase inhibitors and the group II mGluR agonist, LY354740, reversed the short-term memory deficit induced by acute ethanol administration in wild type mice. 2-PMPA also moderated the effect of ethanol on short-term memory in mGluR2 ko mice but failed to do so in mGluR3 ko mice. LY354740 and ZJ43 blocked ethanol-induced motor activation. Both GCPII inhibitors and LY354740 also significantly moderated the loss of motor coordination induced by 2.1 g/kg ethanol treatment. These data support the conclusion that inhibitors of glutamate carboxypeptidase II are efficacious in object recognition models of normal memory and memory deficits via an mGluR3 mediated process, actions that could have widespread clinical applications.

Virtual Screening and Molecular Dynamics Study of Potential Negative Allosteric Modulators of mGluR1 from Chinese Herbs.

PubMed

Jiang, Ludi; Zhang, Xianbao; Chen, Xi; He, Yusu; Qiao, Liansheng; Zhang, Yanling; Li, Gongyu; Xiang, Yuhong

2015-07-15

The metabotropic glutamate subtype 1 (mGluR1), a member of the metabotropic glutamate receptors, is a therapeutic target for neurological disorders. However, due to the lower subtype selectivity of mGluR1 orthosteric compounds, a new targeted strategy, known as allosteric modulators research, is needed for the treatment of mGluR1-related diseases. Recently, the structure of the seven-transmembrane domain (7TMD) of mGluR1 has been solved, which reveals the binding site of allosteric modulators and provides an opportunity for future subtype-selectivity drug design. In this study, a series of computer-aided drug design methods were utilized to discover potential mGluR1 negative allosteric modulators (NAMs). Pharmacophore models were constructed based on three different structure types of mGluR1 NAMs. After validation using the built-in parameters and test set, the optimal pharmacophore model of each structure type was selected and utilized as a query to screen the Traditional Chinese Medicine Database (TCMD). Then, three different hit lists of compounds were obtained. Molecular docking was used based on the latest crystal structure of mGluR1-7TMD to further filter these hits. As a compound with high QFIT and LibDock Score was preferred, a total of 30 compounds were retained. MD simulation was utilized to confirm the stability of potential compounds binding. From the computational results, thesinine-4'-O-β-d-glucoside, nigrolineaxanthone-P and nodakenin might exhibit negative allosteric moderating effects on mGluR1. This paper indicates the applicability of molecular simulation technologies for discovering potential natural mGluR1 NAMs from Chinese herbs.

[Effects of Lys-Glu-Asp-Gly and Ala-Glu-Asp-Gly peptides on hormonal activity and thyroid morphology in hypophysectomized mature and old birds].

PubMed

Kuznik, B I; Pateiuk, A V; Rusaeva, N S; Baranchugova, L M; Obydenko, V I

2011-01-01

The aim of the paper was to investigate effects of Lys-Glu-Asp-Gly and Ala-Glu-Asp-Gly peptides which were designed and synthesized on the basis of amino acid study of the hypophyseal anterior and posterior lobe peptides on the thyroid morphology and hormonal activity in mature chicken and old birds. Hypophysectomy was established to produce atrophic changes in the thyroid gland and development of secondary hypothyrosis. Administration of Lys-Glu-Asp-Gly and Ala-Glu-Asp-Gly tetrapeptides significantly prevented these impairments by increasing the levels of the thyroid-stimulating hormone (TSH) as well as T3 and T4. Restoration of the thyroid functions and morphology was registered to be greater in one-year-old chicken as compared to five-year-old ones.

Functional Dissociation of Group III Metabotropic Glutamate Receptors Revealed by Direct Comparison between the Behavioral Profiles of Knockout Mouse Lines.

PubMed

Goddyn, Hannelore; Callaerts-Vegh, Zsuzsanna; D'Hooge, Rudi

2015-05-21

Group III metabotropic glutamate receptors (mGlu4, mGlu7, mGlu8) display differential brain distribution, which suggests different behavioral functions. However, comparison across the available animal studies remains methodologically hazardous and controversial. The present report directly compares knockouts for each group III receptor subtype using a single behavioral test battery and multivariate analysis. The behavioral phenotypes of C57BL/6J mice lacking mGlu4, mGlu7, or mGlu8 and their respective littermates were examined using a multimetric test battery, which included elements of neuromotor performance, exploratory behavior, and learning and memory. Multivariate statistical methods were used to identify subtype-specific behavioral profiles and variables that distinguished between these mouse lines. It generally appears that mGlu7 plays a significant role in hippocampus-dependent spatial learning and in some fear-related behaviors, whereas mGlu4 is most clearly involved in startle and motivational processes. Excepting its influence on body weight, the effect of mGlu8 deletion on behavior appears more subtle than that of the other group III receptors. These receptors have been proposed as potential drug targets for a variety of psychopathological conditions. On the basis of these controlled comparisons, we presently conclude that the different group III receptors indeed have quite distinct behavioral functions. © The Author 2015. Published by Oxford University Press on behalf of CINP.

Structure of metabotropic glutamate receptor C-terminal domains in contact with interacting proteins.

PubMed

Enz, Ralf

2012-01-01

Metabotropic glutamate receptors (mGluRs) regulate intracellular signal pathways that control several physiological tasks, including neuronal excitability, learning, and memory. This is achieved by the formation of synaptic signal complexes, in which mGluRs assemble with functionally related proteins such as enzymes, scaffolds, and cytoskeletal anchor proteins. Thus, mGluR associated proteins actively participate in the regulation of glutamatergic neurotransmission. Importantly, dysfunction of mGluRs and interacting proteins may lead to impaired signal transduction and finally result in neurological disorders, e.g., night blindness, addiction, epilepsy, schizophrenia, autism spectrum disorders and Parkinson's disease. In contrast to solved crystal structures of extracellular N-terminal domains of some mGluR types, only a few studies analyzed the conformation of intracellular receptor domains. Intracellular C-termini of most mGluR types are subject to alternative splicing and can be further modified by phosphorylation and SUMOylation. In this way, diverse interaction sites for intracellular proteins that bind to and regulate the glutamate receptors are generated. Indeed, most of the known mGluR binding partners interact with the receptors' C-terminal domains. Within the last years, different laboratories analyzed the structure of these domains and described the geometry of the contact surface between mGluR C-termini and interacting proteins. Here, I will review recent progress in the structure characterization of mGluR C-termini and provide an up-to-date summary of the geometry of these domains in contact with binding partners.

Differential effects of protein phosphatases in the recycling of metabotropic glutamate receptor 5.

PubMed

Mahato, P K; Pandey, S; Bhattacharyya, S

2015-10-15

The major excitatory neurotransmitter Glutamate acts on both ionotropic and metabotropic glutamate receptors (mGluRs) in the central nervous system. mGluR5, a member of the group I mGluR family is widely expressed throughout the brain and plays important roles in a variety of neuronal processes including various forms of synaptic plasticity. This receptor is also involved in various neuropsychiatric disorders, viz., Fragile X syndrome, autism etc. It has been reported that mGluR5 undergoes desensitization and subsequently internalization on ligand exposure in various cell types. However, the downstream events after the internalization and the molecular players involved in the post-endocytic events of this receptor have not been studied. In the present study, we find that subsequent to internalization mGluR5 enters the recycling compartment. After that the receptor recycles back to the cell surface. We also show here that the recycling of mGluR5 is dependent on protein phosphatases. Our data suggest that mGluR5 recycling is completely dependent on the activity of PP2A whereas, PP2B has partial effect on this process. Thus our study suggests that mGluR5 recycles back to the cell surface after ligand-dependent internalization and protein phosphatases that have been implicated in various forms of synaptic plasticity have differential effects on the recycling of mGluR5. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

Activation of the mGlu7 receptor elicits antidepressant-like effects in mice.

PubMed

Palucha, Agnieszka; Klak, Kinga; Branski, Piotr; van der Putten, Herman; Flor, Peter J; Pilc, Andrzej

2007-11-01

Broad evidence indicates that modulation of the glutamatergic system could be an efficient way to achieve antidepressant activity. Metabotropic glutamate receptor (mGlu receptor) ligands seem to be promising agents to treat several central nervous system disorders, including psychiatric ones. The aim of our study was to investigate potential antidepressant-like activity of the first, selective, and bio-available mGlu7 receptor agonist, AMN082 (N,N'-dibenzyhydryl-ethane-1,2-diamine dihydrochloride), in wild-type (WT) and mGlu7 receptor knock-out (KO) mice. The forced swim test (FST) and the tail suspension test (TST) in mice were used to assess antidepressant-like activity of AMN082. We found that AMN082, administered IP, induced a dose-dependent decrease in the immobility time of WT animals in the FST and TST, suggesting antidepressant-like potency of an mGlu7 receptor agonist. Moreover, AMN082 did not change the behaviour of mGlu7 receptor KO mice compared to WT littermates in the TST, while imipramine, used as a reference control, significantly reduced their immobility, indicating an mGlu7 receptor-dependent mechanism of the antidepressant-like activity of AMN082. However, at high doses, AMN082 significantly decreased spontaneous locomotor activity of both mGlu7 receptor KO mice and WT control animals, suggesting off-target activity of AMN082 resulting in hypo-locomotion. These results strongly suggest that activation of the mGlu7 receptor elicits antidepressant-like effects.

Long-term exposure to endogenous levels of tributyltin decreases GluR2 expression and increases neuronal vulnerability to glutamate.

PubMed

Nakatsu, Yusuke; Kotake, Yaichiro; Takishita, Tomoko; Ohta, Shigeru

2009-10-15

Tributyltin (TBT), an endocrine-disrupting chemical, has been used commercially as a heat stabilizer, agricultural pesticide and component of antifouling paints. In this study, we investigated the effect of long-term exposure to endogenous levels of TBT on neuronal glutamate receptors. Cultured rat cortical neurons were exposed to 1-50 nM TBT for 9 days (from day 2 to day 10 in vitro). The number of neurons was reduced by long-term exposure to 50 nM TBT, but not to 1-20 nM TBT. Long-term exposure to 20 nM TBT decreased the mRNA expression of glutamate receptors NR1, NR2A, GluR1 and GluR2, and increased that of NR2B, GluR3 and GluR4. GluR2 protein was also reduced by long-term exposure to TBT. Because AMPA receptor lacking GluR2 exhibits Ca2+ permeability, we investigated whether Ca2+ influx or glutamate toxicity was affected. Indeed, glutamate-induced Ca2+ influx was increased in TBT-treated neurons. Consistent with this, neurons became more susceptible to glutamate toxicity as a result of long-term exposure to TBT and this susceptibility was abolished by an antagonist of GluR2-lacking AMPA receptor. Thus, it is suggested that long-term exposure to endogenous levels of TBT induces a decrease of GluR2 protein, causing neurons become more susceptible to glutamate toxicity.

Metabotropic and ionotropic glutamate receptors mediate the modulation of acetylcholine release at the frog neuromuscular junction.

PubMed

Tsentsevitsky, Andrei; Nurullin, Leniz; Nikolsky, Evgeny; Malomouzh, Artem

2017-07-01

There is some evidence that glutamate (Glu) acts as a signaling molecule at vertebrate neuromuscular junctions where acetylcholine (ACh) serves as a neurotransmitter. In this study, performed on the cutaneous pectoris muscle of the frog Rana ridibunda, Glu receptor mechanisms that modulate ACh release processes were analyzed. Electrophysiological experiments showed that Glu reduces both spontaneous and evoked quantal secretion of ACh and synchronizes its release in response to electrical stimulation. Quisqualate, an agonist of ionotropic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic receptors and metabotropic Group I mGlu receptors, also exerted Glu-like inhibitory effects on the secretion of ACh but had no effect on the kinetics of quantal release. Quisqualate's inhibitory effect did not occur when a blocker of Group I mGlu receptors (LY 367385) or an inhibitor of phospholipase C (U73122) was present. An increase in the degree of synchrony of ACh quantal release, such as that produced by Glu, was obtained after application of N-methyl-D-aspartic acid (NMDA). The presence of Group I mGlu and NMDA receptors in the neuromuscular synapse was confirmed by immunocytochemistry. Thus, the data suggest that both metabotropic Group I mGlu receptors and ionotropic NMDA receptors are present at the neuromuscular synapse of amphibians, and that the activation of these receptors initiates different mechanisms for the regulation of ACh release from motor nerve terminals. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Effect of tetrapeptides Lys-Glu-Asp-Gly and Ala-Glu-Asp-Gly on the structure and function of the thyroid gland in neonatally hypophysectomized chickens.

PubMed

Kuznik, B I; Pateyuk, A V; Rusaeva, N S

2008-01-01

Tetrapeptides Lys-Glu-Asp-Gly and Ala-Glu-Asp-Gly were synthesized on the basis of amino acid composition of pituitary cytomedins. Administration of these tetrapeptides to hypophysectomized chickens for 40 days was followed by an increase in the concentrations of thyrotropic hormone and thyroid hormones and recovery of thyroid gland structure.

mGluR5 Ablation in Cortical Glutamatergic Neurons Increases Novelty-Induced Locomotion

PubMed Central

Zhu, Jie; Huang, Jui-Yen; Yu, Dinghui; Justice, Nicholas J.; Lu, Hui-Chen

2013-01-01

The group I metabotropic glutamate receptor 5 (mGluR5) has been implicated in the pathology of various neurological disorders including schizophrenia, ADHD, and autism. mGluR5-dependent synaptic plasticity has been described at a variety of neural connections and its signaling has been implicated in several behaviors. These behaviors include locomotor reactivity to novel environment, sensorimotor gating, anxiety, and cognition. mGluR5 is expressed in glutamatergic neurons, inhibitory neurons, and glia in various brain regions. In this study, we show that deleting mGluR5 expression only in principal cortical neurons leads to defective cannabinoid receptor 1 (CB1R) dependent synaptic plasticity in the prefrontal cortex. These cortical glutamatergic mGluR5 knockout mice exhibit increased novelty-induced locomotion, and their locomotion can be further enhanced by treatment with the psychostimulant methylphenidate. Despite a modest reduction in repetitive behaviors, cortical glutamatergic mGluR5 knockout mice are normal in sensorimotor gating, anxiety, motor balance/learning and fear conditioning behaviors. These results show that mGluR5 signaling in cortical glutamatergic neurons is required for precisely modulating locomotor reactivity to a novel environment but not for sensorimotor gating, anxiety, motor coordination, several forms of learning or social interactions. PMID:23940572

Convergent evidence for mGluR5 in synaptic and neuroinflammatory pathways implicated in ASD.

PubMed

Zantomio, Daniela; Chana, Gursharan; Laskaris, Liliana; Testa, Renee; Everall, Ian; Pantelis, Christos; Skafidas, Efstratios

2015-05-01

The pathogenesis of Autism Spectrum Disorder (ASD), a serious neurodevelopmental disorder, is poorly understood. We review evidence for alterations in glutamatergic signalling in the aetiology of ASD, with a focus on the metabotropic glutamate receptor-5 (mGluR5). mGluR5 signalling is important for synapse formation, neuroplasticity and long term potentiation as well as neuroprotection and has been shown to have a regulatory role in neuroinflammation. Evidence for neuroinflammation in ASD is supported by increase in pro-inflammatory cytokines in the blood and cerebrospinal fluid (CSF) and increased number and activation of microglia in postmortem dorsolateral prefrontal cortex (DLPFC). mGlur5 signalling has also been shown to downregulate microglial activation. Therefore, we focus on mGluR5 as a potential unifying explanation for synapse alteration and neuroinflammation seen in ASD. Data from mGluR5 knockout mouse models, and syndromic and non syndromic forms of ASD are discussed in relation to how alterations in mGluR5 are associated with ASD symptoms. This review supports altered mGluR5 functioning as a convergent point in ASD pathogenesis and indicates more research is warranted into mGluR5 as a potential therapeutic target. Copyright © 2015 Elsevier Ltd. All rights reserved.

Isoflurane unveils a critical role of glutamate transporter type 3 in regulating hippocampal GluR1 trafficking and context-related learning and memory in mice.

PubMed

Cao, J; Wang, Z; Mi, W; Zuo, Z

2014-07-11

Glutamate transporter type 3 (EAAT3) may play a role in cognition. Isoflurane enhances EAAT3 trafficking to the plasma membrane. Thus, we used isoflurane to determine how EAAT3 might regulate learning and memory and the trafficking of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors, such as GluR1, to the plasma membrane, a fundamental biochemical process for learning and memory. Here, isoflurane increased EAAT3 but did not change GluR1 levels in the plasma membrane of wild-type mouse hippocampus. Isoflurane increased protein phosphatase activity in the wild-type and EAAT3(-/-) mouse hippocampus. Also, isoflurane reduced GluR1 in the plasma membrane and decreased phospho-GluR1 in EAAT3(-/-) mice. The phosphatase inhibitor okadaic acid attenuated these effects. Finally, isoflurane inhibited context-related fear conditioning in EAAT3(-/-) mice but not in wild-type mice. Thus, isoflurane may increase GluR1 trafficking to the plasma membrane via EAAT3 and inhibit GluR1 trafficking via protein phosphatase. Lack of EAAT3 effects leads to decreased GluR1 trafficking and impaired cognition after isoflurane exposure in EAAT3(-/-) mice. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

Magnetic tumor targeting of β-glucosidase immobilized iron oxide nanoparticles

NASA Astrophysics Data System (ADS)

Zhou, Jie; Zhang, Jian; David, Allan E.; Yang, Victor C.

2013-09-01

Directed enzyme/prodrug therapy (DEPT) has promising application for cancer therapy. However, most current DEPT strategies face shortcomings such as the loss of enzyme activity during preparation, low delivery and transduction efficiency in vivo and difficultly of monitoring. In this study, a novel magnetic directed enzyme/prodrug therapy (MDEPT) was set up by conjugating β-glucosidase (β-Glu) to aminated, starch-coated, iron oxide magnetic iron oxide nanoparticles (MNPs), abbreviated as β-Glu-MNP, using glutaraldehyde as the crosslinker. This β-Glu-MNP was then characterized in detail by size distribution, zeta potential, FTIR spectra, TEM, SQUID and magnetophoretic mobility analysis. Compared to free enzyme, the conjugated β-Glu on MNPs retained 85.54% ± 6.9% relative activity and showed much better temperature stability. The animal study results showed that β-Glu-MNP displays preferable pharmacokinetics characteristics in relation to MNPs. With an adscititious magnetic field on the surface of a tumor, a significant quantity of β-Glu-MNP was selectively delivered into a subcutaneous tumor of a glioma-bearing mouse. Remarkably, the enzyme activity of the delivered β-Glu in tumor lesions showed as high as 20.123±5.022 mU g-1 tissue with 2.14 of tumor/non-tumor β-Glu activity.

Functional Validation of Heteromeric Kainate Receptor Models.

PubMed

Paramo, Teresa; Brown, Patricia M G E; Musgaard, Maria; Bowie, Derek; Biggin, Philip C

2017-11-21

Kainate receptors require the presence of external ions for gating. Most work thus far has been performed on homomeric GluK2 but, in vivo, kainate receptors are likely heterotetramers. Agonists bind to the ligand-binding domain (LBD) which is arranged as a dimer of dimers as exemplified in homomeric structures, but no high-resolution structure currently exists of heteromeric kainate receptors. In a full-length heterotetramer, the LBDs could potentially be arranged either as a GluK2 homomer alongside a GluK5 homomer or as two GluK2/K5 heterodimers. We have constructed models of the LBD dimers based on the GluK2 LBD crystal structures and investigated their stability with molecular dynamics simulations. We have then used the models to make predictions about the functional behavior of the full-length GluK2/K5 receptor, which we confirmed via electrophysiological recordings. A key prediction and observation is that lithium ions bind to the dimer interface of GluK2/K5 heteromers and slow their desensitization. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Development of potent fluorescent polyamine toxins and application in labeling of ionotropic glutamate receptors in hippocampal neurons.

PubMed

Nørager, Niels G; Jensen, Christel B; Rathje, Mette; Andersen, Jacob; Madsen, Kenneth L; Kristensen, Anders S; Strømgaard, Kristian

2013-09-20

The natural product argiotoxin-636 (ArgTX-636) found in the venom of the Argiope lobata spider is a potent open-channel blocker of ionotropic glutamate (iGlu) receptors, and recently, two analogues, ArgTX-75 and ArgTX-48, were identified with increased potency and selectivity for iGlu receptor subtypes. Here, we have exploited these analogues as templates in the development of fluorescent iGlu receptor ligands to be employed as unique tools for dynamic studies. Eighteen fluorescent analogues were designed and synthesized, and subsequently pharmacologically evaluated at three iGlu receptor subtypes, which resulted in the discovery of highly potent fluorescent iGlu receptor antagonists with IC50 values as low as 11 nM. The most promising ligands were further characterized showing retention of their mechanism of action, as open-channel blockers of iGlu receptors, as well as preservation of the photophysical properties of the incorporated fluorophores. Finally, we demonstrate the applicability of the developed probes for imaging of iGlu receptors in hippocampal neurons.

Computationally Discovered Potentiating Role of Glycans on NMDA Receptors

NASA Astrophysics Data System (ADS)

Sinitskiy, Anton V.; Stanley, Nathaniel H.; Hackos, David H.; Hanson, Jesse E.; Sellers, Benjamin D.; Pande, Vijay S.

2017-04-01

N-methyl-D-aspartate receptors (NMDARs) are glycoproteins in the brain central to learning and memory. The effects of glycosylation on the structure and dynamics of NMDARs are largely unknown. In this work, we use extensive molecular dynamics simulations of GluN1 and GluN2B ligand binding domains (LBDs) of NMDARs to investigate these effects. Our simulations predict that intra-domain interactions involving the glycan attached to residue GluN1-N440 stabilize closed-clamshell conformations of the GluN1 LBD. The glycan on GluN2B-N688 shows a similar, though weaker, effect. Based on these results, and assuming the transferability of the results of LBD simulations to the full receptor, we predict that glycans at GluN1-N440 might play a potentiator role in NMDARs. To validate this prediction, we perform electrophysiological analysis of full-length NMDARs with a glycosylation-preventing GluN1-N440Q mutation, and demonstrate an increase in the glycine EC50 value. Overall, our results suggest an intramolecular potentiating role of glycans on NMDA receptors.

An optimized fluorescent probe for visualizing glutamate neurotransmission.

PubMed

Marvin, Jonathan S; Borghuis, Bart G; Tian, Lin; Cichon, Joseph; Harnett, Mark T; Akerboom, Jasper; Gordus, Andrew; Renninger, Sabine L; Chen, Tsai-Wen; Bargmann, Cornelia I; Orger, Michael B; Schreiter, Eric R; Demb, Jonathan B; Gan, Wen-Biao; Hires, S Andrew; Looger, Loren L

2013-02-01

We describe an intensity-based glutamate-sensing fluorescent reporter (iGluSnFR) with signal-to-noise ratio and kinetics appropriate for in vivo imaging. We engineered iGluSnFR in vitro to maximize its fluorescence change, and we validated its utility for visualizing glutamate release by neurons and astrocytes in increasingly intact neurological systems. In hippocampal culture, iGluSnFR detected single field stimulus-evoked glutamate release events. In pyramidal neurons in acute brain slices, glutamate uncaging at single spines showed that iGluSnFR responds robustly and specifically to glutamate in situ, and responses correlate with voltage changes. In mouse retina, iGluSnFR-expressing neurons showed intact light-evoked excitatory currents, and the sensor revealed tonic glutamate signaling in response to light stimuli. In worms, glutamate signals preceded and predicted postsynaptic calcium transients. In zebrafish, iGluSnFR revealed spatial organization of direction-selective synaptic activity in the optic tectum. Finally, in mouse forelimb motor cortex, iGluSnFR expression in layer V pyramidal neurons revealed task-dependent single-spine activity during running.

Potentiating mGluR5 function with a positive allosteric modulator enhances adaptive learning.

PubMed

Xu, Jian; Zhu, Yongling; Kraniotis, Stephen; He, Qionger; Marshall, John J; Nomura, Toshihiro; Stauffer, Shaun R; Lindsley, Craig W; Conn, P Jeffrey; Contractor, Anis

2013-07-18

Metabotropic glutamate receptor 5 (mGluR5) plays important roles in modulating neural activity and plasticity and has been associated with several neuropathological disorders. Previous work has shown that genetic ablation or pharmacological inhibition of mGluR5 disrupts fear extinction and spatial reversal learning, suggesting that mGluR5 signaling is required for different forms of adaptive learning. Here, we tested whether ADX47273, a selective positive allosteric modulator (PAM) of mGluR5, can enhance adaptive learning in mice. We found that systemic administration of the ADX47273 enhanced reversal learning in the Morris Water Maze, an adaptive task. In addition, we found that ADX47273 had no effect on single-session and multi-session extinction, but administration of ADX47273 after a single retrieval trial enhanced subsequent fear extinction learning. Together these results demonstrate a role for mGluR5 signaling in adaptive learning, and suggest that mGluR5 PAMs represent a viable strategy for treatment of maladaptive learning and for improving behavioral flexibility.

Potentiating mGluR5 function with a positive allosteric modulator enhances adaptive learning

PubMed Central

Xu, Jian; Zhu, Yongling; Kraniotis, Stephen; He, Qionger; Marshall, John J.; Nomura, Toshihiro; Stauffer, Shaun R.; Lindsley, Craig W.; Conn, P. Jeffrey; Contractor, Anis

2013-01-01

Metabotropic glutamate receptor 5 (mGluR5) plays important roles in modulating neural activity and plasticity and has been associated with several neuropathological disorders. Previous work has shown that genetic ablation or pharmacological inhibition of mGluR5 disrupts fear extinction and spatial reversal learning, suggesting that mGluR5 signaling is required for different forms of adaptive learning. Here, we tested whether ADX47273, a selective positive allosteric modulator (PAM) of mGluR5, can enhance adaptive learning in mice. We found that systemic administration of the ADX47273 enhanced reversal learning in the Morris Water Maze, an adaptive task. In addition, we found that ADX47273 had no effect on single-session and multi-session extinction, but administration of ADX47273 after a single retrieval trial enhanced subsequent fear extinction learning. Together these results demonstrate a role for mGluR5 signaling in adaptive learning, and suggest that mGluR5 PAMs represent a viable strategy for treatment of maladaptive learning and for improving behavioral flexibility. PMID:23869026

Treatment of Fragile X Syndrome with a Neuroactive Steroid

DTIC Science & Technology

2013-08-01

GABAA activity . We hypothesized that ganaxolone will significantly improve behavioral problems including anxiety, inattention and impulsivity...group I metabotropic glutamate receptors (mGluRs). In the hippocampal field CA1, activation of mGluR5 leads to long-term depression (LTD), which is seen...as a reduction in synaptic responses. Importantly, LTD triggered by mGluR activation (mGluR-LTD) requires the rapid translation of preexisting mRNA in

Regulation of DREAM Expression by Group I mGluR

PubMed Central

Lee, Jinu; Kim, Insook; Oh, So Ra; Ko, Suk Jin; Lim, Mi Kyung; Kim, Dong Goo

2011-01-01

DREAM (downstream regulatory element antagonistic modulator) is a calcium-binding protein that regulates dynorphin expression, promotes potassium channel surface expression, and enhances presenilin processing in an expression level-dependent manner. However, no molecular mechanism has yet explained how protein levels of DREAM are regulated. Here we identified group I mGluR (mGluR1/5) as a positive regulator of DREAM protein expression. Overexpression of mGluR1/5 increased the cellular level of DREAM. Up-regulation of DREAM resulted in increased DREAM protein in both the nucleus and cytoplasm, where the protein acts as a transcriptional repressor and a modulator of its interacting proteins, respectively. DHPG (3,5-dihydroxyphenylglycine), a group I mGluR agonist, also up-regulated DREAM expression in cortical neurons. These results suggest that group I mGluR is the first identified receptor that may regulate DREAM activity in neurons. PMID:21660149

Role of NMDA receptor GluN2D subunit in the antidepressant effects of enantiomers of ketamine.

PubMed

Ide, Soichiro; Ikekubo, Yuiko; Mishina, Masayoshi; Hashimoto, Kenji; Ikeda, Kazutaka

2017-11-01

We investigated the rapid and sustained antidepressant effects of enantiomers of ketamine in N-methyl-d-aspartate (NMDA) receptor GluN2D subunit knockout (GluN2D-KO) mice. Intraperitoneal administration of ketamine or its enantiomers 10 min before the tail-suspension test exerted significant antidepressant effects on restraint stress-induced depression in both wildtype and GluN2D-KO mice. The antidepressant effects of (RS)-ketamine and (S)-ketamine were sustained 96 h after the injection in both wildtype and GluN2D-KO mice, but such sustained antidepressant effects of (R)-ketamine were only observed in wildtype mice. These data suggest that the GluN2D subunit is critical for the sustained antidepressant effects of (R)-ketamine. Copyright © 2017 The Authors. Production and hosting by Elsevier B.V. All rights reserved.

Metabotropic glutamate receptor 3 activation is required for long-term depression in medial prefrontal cortex and fear extinction

PubMed Central

Walker, Adam G.; Wenthur, Cody J.; Xiang, Zixiu; Rook, Jerri M.; Emmitte, Kyle A.; Niswender, Colleen M.; Lindsley, Craig W.; Conn, P. Jeffrey

2015-01-01

Clinical studies have revealed that genetic variations in metabotropic glutamate receptor 3 (mGlu3) affect performance on cognitive tasks dependent upon the prefrontal cortex (PFC) and may be linked to psychiatric conditions such as schizophrenia, bipolar disorder, and addiction. We have performed a series of studies aimed at understanding how mGlu3 influences PFC function and cognitive behaviors. In the present study, we found that activation of mGlu3 can induce long-term depression in the mouse medial PFC (mPFC) in vitro. Furthermore, in vivo administration of a selective mGlu3 negative allosteric modulator impaired learning in the mPFC-dependent fear extinction task. The results of these studies implicate mGlu3 as a major regulator of PFC function and cognition. Additionally, potentiators of mGlu3 may be useful in alleviating prefrontal impairments associated with several CNS disorders. PMID:25583490

The mGlu5 receptor antagonist MTEP attenuates opiate self-administration and cue-induced opiate-seeking behaviour in mice.

PubMed

Brown, Robyn M; Stagnitti, Monique R; Duncan, Jhodie R; Lawrence, Andrew J

2012-06-01

The mGlu5 receptor (mGluR5) has been implicated in the rewarding effect of various drugs of abuse and drug-seeking behaviour. In the present study we investigated the impact of antagonism of mGluR5 with the selective negative allosteric, modulator 3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine (MTEP) on operant self-administration of morphine as well as cue-induced drug-seeking in adult CD1 mice. Administration of MTEP (20 mg/kg, i.p.) attenuated operant responding for morphine (0.1 mg/kg/infusion) and cue-induced morphine-seeking after a period of forced abstinence. Collectively, these data implicate mGluR5 in the reinforcing effects of opiates and support the proposition that mGluR5 is a potential therapeutic target for treatment of drug addiction. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Genome-wide identification, characterization and classification of ionotropic glutamate receptor genes (iGluRs) in the malaria vector Anopheles sinensis (Diptera: Culicidae).

PubMed

Wang, Ting-Ting; Si, Feng-Ling; He, Zheng-Bo; Chen, Bin

2018-01-15

Ionotropic glutamate receptors (iGluRs) are conserved ligand-gated ion channel receptors, and ionotropic receptors (IRs) were revealed as a new family of iGluRs. Their subdivision was unsettled, and their characteristics are little known. Anopheles sinensis is a major malaria vector in eastern Asia, and its genome was recently well sequenced and annotated. We identified iGluR genes in the An. sinensis genome, analyzed their characteristics including gene structure, genome distribution, domains and specific sites by bioinformatic methods, and deduced phylogenetic relationships of all iGluRs in An. sinensis, Anopheles gambiae and Drosophila melanogaster. Based on the characteristics and phylogenetics, we generated the classification of iGluRs, and comparatively analyzed the intron number and selective pressure of three iGluRs subdivisions, iGluR group, Antenna IR and Divergent IR subfamily. A total of 56 iGluR genes were identified and named in the whole-genome of An. sinensis. These genes were located on 18 scaffolds, and 31 of them (29 being IRs) are distributed into 10 clusters that are suggested to form mainly from recent gene duplication. These iGluRs can be divided into four groups: NMDA, non-NMDA, Antenna IR and Divergent IR based on feature comparison and phylogenetic analysis. IR8a and IR25a were suggested to be monophyletic, named as Putative in the study, and moved from the Antenna subfamily in the IR family to the non-NMDA group as a sister of traditional non-NMDA. The generated iGluRs of genes (including NMDA and regenerated non-NMDA) are relatively conserved, and have a more complicated gene structure, smaller ω values and some specific functional sites. The iGluR genes in An. sinensis, An. gambiae and D. melanogaster have amino-terminal domain (ATD), ligand binding domain (LBD) and Lig_Chan domains, except for IR8a that only has the LBD and Lig_Chan domains. However, the new concept IR family of genes (including regenerated Antenna IR, and Divergent IR), especially for Divergent IR are more variable, have a simpler gene structure (intron loss phenomenon) and larger ω values, and lack specific functional sites. These IR genes have no other domains except for Antenna IRs that only have the Lig_Chan domain. This study provides a comprehensive information framework for iGluR genes in An. sinensis, and generated the classification of iGluRs by feature and bioinformatics analyses. The work lays the foundation for further functional study of these genes.

Effects of lead exposure on hippocampal metabotropic glutamate receptor subtype 3 and 7 in developmental rats.

PubMed

Xu, Jian; Yan, Huai C; Yang, Bo; Tong, Lu S; Zou, Yu X; Tian, Ying

2009-04-20

A complete explanation of the mechanisms by which Pb2+ exerts toxic effects on developmental central nervous system remains unknown. Glutamate is critical to the developing brain through various subtypes of ionotropic or metabotropic glutamate receptors (mGluRs). Ionotropic N-methyl-D-aspartate receptors have been considered as a principal target in lead-induced neurotoxicity. The relationship between mGluR3/mGluR7 and synaptic plasticity had been verified by many recent studies. The present study aimed to examine the role of mGluR3/mGluR7 in lead-induced neurotoxicity. Twenty-four adult and female rats were randomly selected and placed on control or 0.2% lead acetate during gestation and lactation. Blood lead and hippocampal lead levels of pups were analyzed at weaning to evaluate the actual lead content at the end of the exposure. Impairments of short -term memory and long-term memory of pups were assessed by tests using Morris water maze and by detection of hippocampal ultrastructural alterations on electron microscopy. The impact of lead exposure on mGluR3 and mGluR7 mRNA expression in hippocampal tissue of pups were investigated by quantitative real-time polymerase chain reaction and its potential role in lead neurotoxicity were discussed. Lead levels of blood and hippocampi in the lead-exposed rats were significantly higher than those in the controls (P < 0.001). In tests using Morris Water Maze, the overall decrease in goal latency and swimming distance was taken to indicate that controls had shorter latencies and distance than lead-exposed rats (P = 0.001 and P < 0.001 by repeated-measures analysis of variance). On transmission electron microscopy neuronal ultrastructural alterations were observed and the results of real-time polymerase chain reaction showed that exposure to 0.2% lead acetate did not substantially change gene expression of mGluR3 and mGluR7 mRNA compared with controls. Exposure to lead before and after birth can damage short-term and long-term memory ability of young rats and hippocampal ultrastructure. However, the current study does not provide evidence that the expression of rat hippocampal mGluR3 and mGluR7 can be altered by systemic administration of lead during gestation and lactation, which are informative for the field of lead-induced developmental neurotoxicity noting that it seems not to be worthwhile to include mGluR3 and mGluR7 in future studies.

Effects of dimethylaminoethanol pyroglutamate (DMAE p-Glu) against memory deficits induced by scopolamine: evidence from preclinical and clinical studies.

PubMed

Blin, Olivier; Audebert, Christine; Pitel, Séverine; Kaladjian, Arthur; Casse-Perrot, Catherine; Zaim, Mohammed; Micallef, Joelle; Tisne-Versailles, Jacky; Sokoloff, Pierre; Chopin, Philippe; Marien, Marc

2009-12-01

Dimethylaminoethanol pyroglutamate (DMAE p-Glu) is a compound resulting from the reaction between dimethylaminoethanol (an indirect precursor of acetylcholine) and pyroglutamic acid (a cyclic derivative of glutamic acid having procholinergic properties and promnesic effects in both animals and man). The present study undertook preclinical and clinical evaluations to test a potential therapeutic utility for DMAE p-Glu in cognitive impairments related to central cholinergic deficit. In preclinical study, DMAE p-Glu was studied in rats by intracerebral microdialysis in conscious freely moving animals, on performance of rats in the Morris water maze test of spatial memory, and on the deficit in passive avoidance behavior induced by scopolamine. The clinical study examined the effect of DMAE p-Glu on cognitive deficits induced by an intravenous injection of scopolamine in healthy young male subjects. In rat experiments, DMAE p-Glu increased the extracellular levels of choline and acetylcholine in the medial prefrontal cortex, as assessed by intracerebral microdialysis, improved performance in a test of spatial memory, and reduced scopolamine-induced memory deficit in passive avoidance behavior. Clinical study results show that scopolamine induced a memory deficit and that DMAE p-Glu produced a significant positive effect on scores in the Buschke test, as well as a slight but significant difference on choice reaction time. These results indicate that DMAE p-Glu reduces the deleterious effect of scopolamine on long-term memory in healthy volunteers and suggest that DMAE p-Glu might be effective in reducing memory deficits in patients with cognitive impairment.

A tonoplast Glu/Asp/GABA exchanger that affects tomato fruit amino acid composition.

PubMed

Snowden, Christopher J; Thomas, Benjamin; Baxter, Charles J; Smith, J Andrew C; Sweetlove, Lee J

2015-03-01

Vacuolar accumulation of acidic metabolites is an important aspect of tomato fruit flavour and nutritional quality. The amino acids Asp and Glu accumulate to high concentrations during ripening, while γ-aminobutyrate (GABA) shows an approximately stoichiometric decline. Given that GABA can be catabolised to form Glu and subsequently Asp, and the requirement for the fruit to maintain osmotic homeostasis during ripening, we hypothesised the existence of a tonoplast transporter that exports GABA from the vacuole in exchange for import of either Asp or Glu. We show here that the tomato vacuolar membrane possesses such a transport property: transport of Glu across isolated tonoplast vesicle membranes was trans-stimulated in counterexchange mode by GABA, Glu and Asp. We identified SlCAT9 as a candidate protein for this exchanger using quantitative proteomics of a tonoplast-enriched membrane fraction. Transient expression of a SlCAT9-YFP fusion in tobacco confirmed a tonoplast localisation. The function of the protein was examined by overexpression of SlCAT9 in transgenic tomato plants. Tonoplast vesicles isolated from transgenic plants showed higher rates of Glu and GABA transport than wild-type (WT) only when assayed in counterexchange mode with Glu, Asp, or GABA. Moreover, there were substantial increases in the content of all three cognate amino acids in ripe fruit from the transgenic plants. We conclude that SlCAT9 is a tonoplast Glu/Asp/GABA exchanger that strongly influences the accumulation of these amino acids during fruit development. © 2015 The Authors The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.

Pituitary adenylyl cyclase-activating peptide: A pivotal modulator of glutamatergic regulation of the suprachiasmatic circadian clock

PubMed Central

Chen, Dong; Buchanan, Gordon F.; Ding, Jian M.; Hannibal, Jens; Gillette, Martha U.

1999-01-01

The circadian clock in the suprachiasmatic nucleus (SCN) of the hypothalamus organizes behavioral rhythms, such as the sleep–wake cycle, on a near 24-h time base and synchronizes them to environmental day and night. Light information is transmitted to the SCN by direct retinal projections via the retinohypothalamic tract (RHT). Both glutamate (Glu) and pituitary adenylyl cyclase-activating peptide (PACAP) are localized within the RHT. Whereas Glu is an established mediator of light entrainment, the role of PACAP is unknown. To understand the functional significance of this colocalization, we assessed the effects of nocturnal Glu and PACAP on phasing of the circadian rhythm of neuronal firing in slices of rat SCN. When coadministered, PACAP blocked the phase advance normally induced by Glu during late night. Surprisingly, blocking PACAP neurotransmission, with either PACAP6–38, a specific PACAP receptor antagonist, or anti-PACAP antibodies, augmented the Glu-induced phase advance. Blocking PACAP in vivo also potentiated the light-induced phase advance of the rhythm of hamster wheel-running activity. Conversely, PACAP enhanced the Glu-induced delay in the early night, whereas PACAP6–38 inhibited it. These results reveal that PACAP is a significant component of the Glu-mediated light-entrainment pathway. When Glu activates the system, PACAP receptor-mediated processes can provide gain control that generates graded phase shifts. The relative strengths of the Glu and PACAP signals together may encode the amplitude of adaptive circadian behavioral responses to the natural range of intensities of nocturnal light. PMID:10557344

Body Temperatures During Exercise in Deconditioned Dogs: Effect of NACL and Glucose Infusion

NASA Technical Reports Server (NTRS)

Greenleaf, J. E.; Kruk, B.; Nazar, K.; Kaciuba-Usciko, H.

2000-01-01

Infusion of glucose (Glu) into normal exercising dogs attenuates the rise in rectal temperature (Delta-Tre) when compared with delta-Tre during FFA infusion or no infusion. Rates of rise and delta-=Tre levels are higher during exercise after confinement. Therefore, the purpose of this study was to determine if Glu infusion would attenuate the exercise-induced excess hyperthermia after deconditioning. Rectal and quadricep femoris muscle temperatures (Tmu) were measured in 7 male, mongrel dogs dogs (19.6 +/- SD 3.0 kg) during 90 minutes of treadmill exercise (3.1 +/-SD 0.2 W/kg) with infusion (30ml/min/kg) of 40% Glu or 0.9% NaCL before BC) and after confinement (AC) in cages (40 x 110 x 80 cm) for 8 wk. Mean (+/-SE body wt. were 19.6 +/- 1.1 kg BC and 19.5 +/- 1.1kg AC, exercise VO2 were not different (40.0 - 42.0 mi/min/kg-1). With NaCl AC, NaCl BC, GluAC, and GluBC: Delta-Tre were, 1.8, 1.4, 1.3 and 0.9C respectively; and Delta-Tmu were 2.3, 1.9, 1.6, and 1.4C. respectively (P<0.05 from GluBC). Compared with NaCl infusion, attenuated both Delta-Tre and Delta-Tmu BC and AC, respectively. Compared with GluBC, GluAC attenuated Delta-Tmu but not Delta-Tre. Thus. with similar heat production, the mechanism for attenuation at bad body temperature with Glu infusion must affect avenues of heat dissipation.

Loss of GluN2D subunit results in social recognition deficit, social stress, 5-HT2C receptor dysfunction, and anhedonia in mice.

PubMed

Yamamoto, Hideko; Kamegaya, Etsuko; Hagino, Yoko; Takamatsu, Yukio; Sawada, Wakako; Matsuzawa, Maaya; Ide, Soichiro; Yamamoto, Toshifumi; Mishina, Masayoshi; Ikeda, Kazutaka

2017-01-01

The N-methyl-d-aspartate (NMDA) receptor channel is involved in various physiological functions, including learning and memory. The GluN2D subunit of the NMDA receptor has low expression in the mature brain, and its role is not fully understood. In the present study, the effects of GluN2D subunit deficiency on emotional and cognitive function were investigated in GluN2D knockout (KO) mice. We found a reduction of motility (i.e., a depressive-like state) in the tail suspension test and a reduction of sucrose preference (i.e., an anhedonic state) in GluN2D KO mice that were group-housed with littermates. Despite apparently normal olfactory function and social interaction, GluN2D KO mice exhibited a decrease in preference for social novelty, suggesting a deficit in social recognition or memory. Golgi-Cox staining revealed a reduction of the complexity of dendritic trees in the accessory olfactory bulb in GluN2D KO mice, suggesting a deficit in pheromone processing pathway activation, which modulates social recognition. The deficit in social recognition may result in social stress in GluN2D KO mice. Isolation housing is a procedure that has been shown to reduce stress in mice. Interestingly, 3-week isolation and treatment with agomelatine or the 5-hydroxytryptamine-2C (5-HT 2C ) receptor antagonist SB242084 reversed the anhedonic-like state in GluN2D KO mice. In contrast, treatment with the 5-HT 2C receptor agonist CP809101 induced depressive- and anhedonic-like states in isolated GluN2D KO mice. These results suggest that social stress that is caused by a deficit in social recognition desensitizes 5-HT 2c receptors, followed by an anhedonic- and depressive-like state, in GluN2D KO mice. The GluN2D subunit of the NMDA receptor appears to be important for the recognition of individuals and development of normal emotionality in mice. 5-HT 2C receptor antagonism may be a therapeutic target for treating social stress-induced anhedonia. This article is part of the Special Issue entitled 'Ionotropic glutamate receptors'. Copyright © 2016 Elsevier Ltd. All rights reserved.

Editing for an AMPA receptor subunit RNA in prefrontal cortex and striatum in Alzheimer's disease, Huntington's disease and schizophrenia

NASA Technical Reports Server (NTRS)

Akbarian, S.; Smith, M. A.; Jones, E. G.; Bloom, F. E. (Principal Investigator)

1995-01-01

Animal studies and cell culture experiments demonstrated that posttranscriptional editing of the transcript of the GluR-2 gene, resulting in substitution of an arginine for glutamine in the second transmembrane region (TM II) of the expressed protein, is associated with a reduction in Ca2+ permeability of the receptor channel. Thus, disturbances in GluR-2 RNA editing with alteration of intracellular Ca2+ homeostasis could lead to neuronal dysfunction and even neuronal degeneration. The present study determined the proportions of edited and unedited GluR-2 RNA in the prefrontal cortex of brains from patients with Alzheimer's disease, in the striatum of brains from patients with Huntington's disease, and in the same areas of brains from age-matched schizophrenics and controls, by using reverse transcriptase-polymerase chain reaction, restriction endonuclease digestion, gel electrophoresis and scintillation radiometry. In the prefrontal cortex of controls, < 0.1% of all GluR-2 RNA molecules were unedited and > 99.9% were edited; in the prefrontal cortex both of schizophrenics and of Alzheimer's patients approximately 1.0% of all GluR-2 RNA molecules were unedited and 99% were edited. In the striatum of controls and of schizophrenics, approximately 0.5% of GluR-2 RNA molecules were unedited and 99.5% were edited; in the striatum of Huntington's patients nearly 5.0% of GluR-2 RNA was unedited. In the prefrontal white matter of controls, approximately 7.0% of GluR-2 RNA was unedited. In the normal human prefrontal cortex and striatum, the large majority of GluR-2 RNA molecules contains a CGG codon for arginine in the TMII coding region; this implies that the corresponding AMPA receptors have a low Ca2+ permeability, as previously demonstrated for the rat brain. The process of GluR-2 RNA editing is compromised in a region-specific manner in schizophrenia, in Alzheimer's disease and Huntington's Chorea although in each of these disorders there is still a large excess of edited GluR-2 RNA molecules. Disturbances of GluR-2 RNA editing leading to excessive Ca2+ permeability, may contribute to neuronal dysfunction in schizophrenia and to neuronal death in Alzheimer's disease and Huntington's disease.

Acylation and deacylation mechanism of Helicobacter pylori AmiF formamidase: A computational DFT study

NASA Astrophysics Data System (ADS)

He, Rongxing; Yang, Qinlei; Li, Ming

2014-04-01

The acylation and deacylation mechanisms of Helicobacter pylori AmiF formamidase were investigated using DFT method. In the constructed active site, residues Glu60, Glu141 and His167 were taken into account besides Lys133 and Cys166. Calculations provided insight on the details of mechanism and explained crucial roles played by Glu60, Glu141 and His167. For acetylation, we proposed a new stepwise mechanism in which the thiol group first attacks the carbon atom of formamide and produces tetrahedral intermediate. In deacylation, Glu60 activates a water molecule to perform nucleophilic attack and then forms an intermediate, which is different from the usually suggested mechanism.

NMDA Receptor Subunits Change after Synaptic Plasticity Induction and Learning and Memory Acquisition.

PubMed

Baez, María Verónica; Cercato, Magalí Cecilia; Jerusalinsky, Diana Alicia

2018-01-01

NMDA ionotropic glutamate receptors (NMDARs) are crucial in activity-dependent synaptic changes and in learning and memory. NMDARs are composed of two GluN1 essential subunits and two regulatory subunits which define their pharmacological and physiological profile. In CNS structures involved in cognitive functions as the hippocampus and prefrontal cortex, GluN2A and GluN2B are major regulatory subunits; their expression is dynamic and tightly regulated, but little is known about specific changes after plasticity induction or memory acquisition. Data strongly suggest that following appropriate stimulation, there is a rapid increase in surface GluN2A-NMDAR at the postsynapses, attributed to lateral receptor mobilization from adjacent locations. Whenever synaptic plasticity is induced or memory is consolidated, more GluN2A-NMDARs are assembled likely using GluN2A from a local translation and GluN1 from local ER. Later on, NMDARs are mobilized from other pools, and there are de novo syntheses at the neuron soma. Changes in GluN1 or NMDAR levels induced by synaptic plasticity and by spatial memory formation seem to occur in different waves of NMDAR transport/expression/degradation, with a net increase at the postsynaptic side and a rise in expression at both the spine and neuronal soma. This review aims to put together that information and the proposed hypotheses.

FBXL5 interacts with p150 {sup Glued} and regulates its ubiquitination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang Ning; Liu Jing; Ding Xia

2007-07-20

The microtubule motor cytoplasmic dynein and its activator dynactin drive vesicular transport and mitotic spindle organization. p150 {sup Glued} is the dynactin subunit responsible for binding to dynein and microtubules. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which governs phosphorylation-dependent ubiquitination and subsequent proteolysis. Our recent study showed that the proteolysis of mitotic kinesin CENP-E is mediated by SCF via a direct Skp1 link [D. Liu, N. Zhang, J. Du, X. Cai, M. Zhu, C. Jin, Z. Dou, C. Feng, Y. Yang, L. Liu, K. Takeyasu, W. Xie, X. Yao,more » Interaction of Skp1 with CENP-E at the midbody is essential for cytokinesis, Biochem. Biophys. Res. Commun. 345 (2006) 394-402]. Here we show that F-box protein FBXL5 interacts with p150 {sup Glued} and orchestrates its turnover via ubiquitination. FBXL5 binds to p150 {sup Glued} in vitro and in vivo. FBXL5 and p150 {sup Glued} co-localize primarily in the cytoplasm with peri-nuclear enrichment in HeLa cells. Overexpression of FBXL5 promotes poly-ubiquitination of p150 {sup Glued} and protein turnover of p150 {sup Glued} . Our findings provide a potential mechanism by which p150 {sup Glued} protein function is regulated by SCFs.« less

Site-directed mutagenesis at aspartate and glutamate residues of xylanase from Bacillus pumilus.

PubMed Central

Ko, E P; Akatsuka, H; Moriyama, H; Shinmyo, A; Hata, Y; Katsube, Y; Urabe, I; Okada, H

1992-01-01

To elucidate the reaction mechanism of xylanase, the identification of amino acids essential for its catalysis is of importance. Studies have indicated the possibility that the reaction mechanism of xylanase is similar to that of hen's egg lysozyme, which involves acidic amino acid residues. On the basis of this assumption, together with the three-dimensional structure of Bacillus pumilus xylanase and its amino acid sequence similarity to other xylanases of different origins, three acidic amino acids, namely Asp-21, Glu-93 and Glu-182, were selected for site-directed mutagenesis. The Asp residue was altered to either Ser or Glu, and the Glu residues to Ser or Asp. The purified mutant xylanases D21E, D21S, E93D, E93S, E182D and E182S showed single protein bands of about 26 kDa on SDS/PAGE. C.d. spectra of these mutant enzymes show no effect on the secondary structure of xylanase, except that of D21E, which shows a little variation. Furthermore, mutations of Glu-93 and Glu-182 resulted in a drastic decrease in the specific activity of xylanase as compared with mutation of Asp-21. On the basis of these results we propose that Glu-93 and Glu-182 are the best candidates for the essential catalytic residues of xylanase. Images Fig. 1. Fig. 4 Fig. 5 PMID:1359880

Ghrelin upregulates the phosphorylation of the GluN2B subunit of the NMDA receptor by activating GHSR1a and Fyn in the rat hippocampus.

PubMed

Berrout, Liza; Isokawa, Masako

2018-01-01

Ghrelin and its receptor GHSR1a have been shown to exert numerous physiological functions in the brain, in addition to the well-established orexigenic role in the hypothalamus. Earlier work indicated that ghrelin stimulated the phosphorylation of the GluN1 subunit of the NMDA receptor (NMDAR) and enhanced synaptic transmission in the hippocampus. In the present study, we report that the exogenous application of ghrelin increased GluN2B phosphorylation. This increase was independent of GluN2B subunit activity or NMDAR channel activity. However, it depended on the activation of GHSR1a and Fyn as it was blocked by D-Lys3-GHRP-6 and PP2, respectively. Inhibitors for G-protein-regulated second messengers, such as Rp-cAMP, H89, TBB, ryanodine, and thapsigargin, unexpectedly enhanced GluN2B phosphorylation, suggesting that cAMP, PKA, casein kinase II, and cytosolic calcium signaling may oppose to the effect of ghrelin on the phosphorylation of GluN2B. Our findings suggest that 1) GluN2B is likely a molecular target of ghrelin and GHSR1a-driven signaling cascades, and 2) the ghrelin-mediated phosphorylation of GluN2B depends on Fyn activation under complex negative regulation by other second messengers. Copyright © 2017 Elsevier B.V. All rights reserved.

Production of pyroglutamic acid by thermophilic lactic acid bacteria in hard-cooked mini-cheeses.

PubMed

Mucchetti, G; Locci, F; Massara, P; Vitale, R; Neviani, E

2002-10-01

Pyroglutamic acid is present in high amounts (0.5g/ 100g) in many cheese varieties-and particularly in extensively ripened Italian cheeses such as Grana Padano and Parmigiano Reggiano. An in vivo model system for cooked mini-cheese production and ripening acceleration was set up to demonstrate the ability of thermophilic lactic acid bacteria, used as a starter, to produce pyroglutamic acid (pGlu). In mini-cheeses stored at 38 and 30 degrees C for up to 45 d, all starters tested produced different amounts of pGlu. In descending order of pGlu production, the bacteria analyzed were: Lactobacillus helveticus, Lactobacillus delbrueckii subsp. bulgaricus, Streptococcus thermophilus, and Lactobacillus delbrueckii subsp. lactis. Evidence for the presence of glutamine to pGlu cyclase activity in lactic acid bacteria was provided. Cell lysates obtained from cultures of L. helveticus, L. delbrueckii subsp. bulgaricus, L. delbrueckii subsp. lactis, and S. thermophilus showed the ability to cyclize glutamine to pGlu, resulting in processing yields from 1.4 to 30.3%, depending on the subspecies. Formation of pGlu from free glutamine appeared to be similar to that observed using a glutamine-glutamine dipeptide substrate. Under the experimental conditions applied, pGlu aminopeptidase activity was only detected in L. helveticus. Thus, pGlu formation in long-ripened cooked cheese may depend on the activity of thermophilic lactic acid bacteria.

Implication of mGlu5 receptor in the enhancement of morphine-induced hyperlocomotion under chronic treatment with zolpidem.

PubMed

Shibasaki, Masahiro; Ishii, Kazunori; Masukawa, Daiki; Ando, Koji; Ikekubo, Yuiko; Ishikawa, Yutori; Shibasaki, Yumiko; Mori, Tomohisa; Suzuki, Tsutomu

2014-09-05

Long-term exposure to zolpidem induces drug dependence, and it is well known that the balance between the GABAergic and glutamatergic systems plays a critical role in maintaining the neuronal network. In the present study, we investigated the interaction between GABAA receptor α1 subunit and mGlu5 receptor in the limbic forebrain including the N.Acc. after treatment with zolpidem for 7 days. mGlu5 receptor protein levels were significantly increased after treatment with zolpidem for 7 days, and this change was accompanied by the up-regulation of phospholipase Cβ1 and calcium/calmodulin-dependent protein kinase IIα, which are downstream of mGlu5 receptor in the limbic forebrain. To confirm that mGlu5 receptor is directly involved in dopamine-related behavior in mice following chronic treatment with zolpidem, we measured morphine-induced hyperlocomotion after chronic treatment with zolpidem in the presence or absence of an mGlu5 receptor antagonist. Although chronic treatment with zolpidem significantly enhanced morphine-induced hyperlocomotion, this enhancement of morphine-induced hyperlocomotion was suppressed by treating it with the mGlu5 receptor antagonist MPEP. These results suggest that chronic treatment with zolpidem caused neural plasticity in response to activation of the mesolimbic dopaminergic system accompanied by an increase in mGlu5 receptor. Copyright © 2014 Elsevier B.V. All rights reserved.

An Examination of Rostral Anterior Cingulate Cortex Function and Neurochemistry in Obsessive–Compulsive Disorder

PubMed Central

Brennan, Brian P; Tkachenko, Olga; Schwab, Zachary J; Juelich, Richard J; Ryan, Erin M; Athey, Alison J; Pope, Harrison G; Jenike, Michael A; Baker, Justin T; Killgore, William DS; Hudson, James I; Jensen, J Eric; Rauch, Scott L

2015-01-01

The anterior cingulate cortex is implicated in the neurobiology of obsessive–compulsive disorder (OCD). However, few studies have examined functional and neurochemical abnormalities specifically in the rostral subdivision of the ACC (rACC) in OCD patients. We used functional magnetic resonance imaging (fMRI) during an emotional counting Stroop task and single-voxel J-resolved proton magnetic resonance spectroscopy (1H-MRS) in the rACC to examine the function and neurochemistry of the rACC in individuals with OCD and comparison individuals without OCD. Between-group differences in rACC activation and glutamine/glutamate ratio (Gln/Glu), Glu, and Gln levels, as well as associations between rACC activation, Gln/Glu, Glu, Gln, behavioral, and clinical measures were examined using linear regression. In a sample of 30 participants with OCD and 29 age- and sex-matched participants without OCD, participants with OCD displayed significantly reduced rACC deactivation compared with those without OCD in response to OCD-specific words versus neutral words on the emotional counting Stroop task. However, Gln/Glu, Glu, and Gln in the rACC did not differ between groups nor was there an association between reduced rACC deactivation and Gln/Glu, Glu, or Gln in the OCD group. Taken together, these findings strengthen the evidence for rACC dysfunction in OCD, but weigh against an underlying association with abnormal rACC glutamatergic neurotransmission. PMID:25662837

Knocking down metabotropic glutamate receptor 1 improves survival and disease progression in the SOD1(G93A) mouse model of amyotrophic lateral sclerosis.

PubMed

Milanese, Marco; Giribaldi, Francesco; Melone, Marcello; Bonifacino, Tiziana; Musante, Ilaria; Carminati, Enrico; Rossi, Pia I A; Vergani, Laura; Voci, Adriana; Conti, Fiorenzo; Puliti, Aldamaria; Bonanno, Giambattista

2014-04-01

Amyotrophic lateral sclerosis (ALS) is a late-onset fatal neurodegenerative disease reflecting degeneration of upper and lower motoneurons (MNs). The cause of ALS and the mechanisms of neuronal death are still largely obscure, thus impairing the establishment of efficacious therapies. Glutamate (Glu)-mediated excitotoxicity plays a major role in MN degeneration in ALS. We recently demonstrated that the activation of Group I metabotropic Glu autoreceptors, belonging to both type 1 and type 5 receptors (mGluR1 and mGluR5), at glutamatergic spinal cord nerve terminals, produces excessive Glu release in mice over-expressing human superoxide-dismutase carrying the G93A point mutation (SOD1(G93A)), a widely used animal model of human ALS. To establish whether these receptors are implicated in ALS, we generated mice expressing half dosage of mGluR1 in the SOD1(G93A) background (SOD1(G93A)Grm1(crv4/+)), by crossing the SOD1(G93A) mutant mouse with the Grm1(crv4/+) mouse, lacking mGluR1 because of a spontaneous recessive mutation. SOD1(G93A)Grm1(crv4/+) mice showed prolonged survival probability, delayed pathology onset, slower disease progression and improved motor performances compared to SOD1(G93A) mice. These effects were associated to reduction of mGluR5 expression, enhanced number of MNs, decreased astrocyte and microglia activation, normalization of metallothionein and catalase mRNA expression, reduced mitochondrial damage, and decrease of abnormal Glu release in spinal cord of SOD1(G93A)Grm1(crv4/+)compared to SOD1(G93A) mice. These results demonstrate that a lower constitutive level of mGluR1 has a significant positive impact on mice with experimental ALS, thus providing the rationale for future pharmacological approaches to ALS by selectively blocking Group I metabotropic Glu receptors. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Quantification of GABA, glutamate and glutamine in a single measurement at 3 T using GABA‐edited MEGA‐PRESS

PubMed Central

Sanaei Nezhad, Faezeh; Anton, Adriana; Michou, Emilia; Jung, JeYoung; Parkes, Laura M.

2017-01-01

γ‐Aminobutyric acid (GABA) and glutamate (Glu), major neurotransmitters in the brain, are recycled through glutamine (Gln). All three metabolites can be measured by magnetic resonance spectroscopy in vivo, although GABA measurement at 3 T requires an extra editing acquisition, such as Mescher–Garwood point‐resolved spectroscopy (MEGA‐PRESS). In a GABA‐edited MEGA‐PRESS spectrum, Glu and Gln co‐edit with GABA, providing the possibility to measure all three in one acquisition. In this study, we investigated the reliability of the composite Glu + Gln (Glx) peak estimation and the possibility of Glu and Gln separation in GABA‐edited MEGA‐PRESS spectra. The data acquired in vivo were used to develop a quality assessment framework which identified MEGA‐PRESS spectra in which Glu and Gln could be estimated reliably. Phantoms containing Glu, Gln, GABA and N‐acetylaspartate (NAA) at different concentrations were scanned using GABA‐edited MEGA‐PRESS at 3 T. Fifty‐six sets of spectra in five brain regions were acquired from 36 healthy volunteers. Based on the Glu/Gln ratio, data were classified as either within or outside the physiological range. A peak‐by‐peak quality assessment was performed on all data to investigate whether quality metrics can discriminate between these two classes of spectra. The quality metrics were as follows: the GABA signal‐to‐noise ratio, the NAA linewidth and the Glx Cramer–Rao lower bound (CRLB). The Glu and Gln concentrations were estimated with precision across all phantoms with a linear relationship between the measured and true concentrations: R 1 = 0.95 for Glu and R 1 = 0.91 for Gln. A quality assessment framework was set based on the criteria necessary for a good GABA‐edited MEGA‐PRESS spectrum. Simultaneous criteria of NAA linewidth <8 Hz and Glx CRLB <16% were defined as optimum features for reliable Glu and Gln quantification. Glu and Gln can be reliably quantified from GABA‐edited MEGA‐PRESS acquisitions. However, this reliability should be controlled using the quality assessment methods suggested in this work. PMID:29130590

Allosteric and Orthosteric Activators of mGluR8 differentially affect the Chemotherapeutic-induced Human Neuroblastoma SH-SY5Y Cell Damage: The Impact of Cell Differentiation State.

PubMed

Jantas, Danuta; Grygier, Beata; Zatorska, Justyna; Lasoń, Władysław

2018-05-12

The participation of group III metabotropic glutamate receptors (mGluRs) in cancer growth and progression is still an understudied issue. Based on our recent data on high expression of mGluR8 in human neuroblastoma SH-SY5Y cells, in the present study we evaluated the effect of an mGluR8-specific positive allosteric modulator (PAM: AZ12216052) and orthosteric agonist ((S)-3,4-DCPG) on chemotherapeutic (doxorubicin, irinotecan or cisplatin)-evoked cell damage in undifferentiated (UN-) and retinoic acid-differentiated (RA-) SH-SY5Y cells. The data showed that AZ12216052 as well as a group III mGluR antagonist (UBP1112) but not (S)-3,4-DCPG partially inhibited the cell damage evoked by doxorubicin, irinotecan or cisplatin in UN-SH-SY5Y cells. In RA-SH-SY5Y, we observed only a modest protective effect of mGluR8 PAM. In contrast, both types of mGluR8 activators significantly enhanced toxic effects of doxorubicin and irinotecan in RA-SH-SY5Y cells. These data suggest that in undifferentiated neuroblastoma malignant cells, some mGluR8 modulators can decrease cytotoxic effects of chemotherapeutics which exclude them from the group of putative anti-cancer agents. On the other hand, in SH-SY5Y cells differentiated to a more mature neuron-like phenotype, i.e. nonmalignant cells, the mGluR8 activators can aggravate the chemotherapeutic neurotoxicity which is a well-known undesired effect of these drugs. Our pharmacological data add new observations to the unexplored field of research on the role of mGluR8 in cancer, pointing to complexity of response which could be mediated by particular types of mGluR8 ligands at least in neuroblastoma cells. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Brain pyroglutamate amyloid-β is produced by cathepsin B and is reduced by the cysteine protease inhibitor E64d, representing a potential Alzheimer's disease therapeutic.

PubMed

Hook, Gregory; Yu, Jin; Toneff, Thomas; Kindy, Mark; Hook, Vivian

2014-01-01

Pyroglutamate amyloid-β peptides (pGlu-Aβ) are particularly pernicious forms of amyloid-β peptides (Aβ) present in Alzheimer's disease (AD) brains. pGlu-Aβ peptides are N-terminally truncated forms of full-length Aβ peptides (flAβ(1-40/42)) in which the N-terminal glutamate is cyclized to pyroglutamate to generate pGlu-Aβ(3-40/42). β-secretase cleavage of amyloid-β precursor protein (AβPP) produces flAβ(1-40/42), but it is not yet known whether the β-secretase BACE1 or the alternative β-secretase cathepsin B (CatB) participate in the production of pGlu-Aβ. Therefore, this study examined the effects of gene knockout of these proteases on brain pGlu-Aβ levels in transgenic AβPPLon mice, which express AβPP isoform 695 and have the wild-type (wt) β-secretase activity found in most AD patients. Knockout or overexpression of the CatB gene reduced or increased, respectively, pGlu-Aβ(3-40/42), flAβ(1-40/42), and pGlu-Aβ plaque load, but knockout of the BACE1 gene had no effect on those parameters in the transgenic mice. Treatment of AβPPLon mice with E64d, a cysteine protease inhibitor of CatB, also reduced brain pGlu-Aβ(3-42), flAβ(1-40/42), and pGlu-Aβ plaque load. Treatment of neuronal-like chromaffin cells with CA074Me, an inhibitor of CatB, resulted in reduced levels of pGlu-Aβ(3-40) released from the activity-dependent, regulated secretory pathway. Moreover, CatB knockout and E64d treatment has been previously shown to improve memory deficits in the AβPPLon mice. These data illustrate the role of CatB in producing pGlu-Aβ and flAβ that participate as key factors in the development of AD. The advantages of CatB inhibitors, especially E64d and its derivatives, as alternatives to BACE1 inhibitors in treating AD patients are discussed.

Deletion of the N-terminal Domain (NTD) Alters the Ethanol Inhibition of NMDA Receptors in a Subunit-Dependent Manner

PubMed Central

Smothers, C. Thetford; Jin, Chun; Woodward, John J.

2013-01-01

Background Ethanol inhibition of NMDA receptors is poorly understood due in part to the organizational complexity of the receptor that provides ample locations for sites of action. Among these the N-terminal domain of NMDA receptor subunits contains binding sites for a variety of modulatory agents including zinc, protons and GluN2B selective antagonists such as ifenprodil or Ro-25–6981. Ethanol inhibition of neuronal NMDA receptors expressed in some brain areas has been reported to be occluded by the presence of ifenprodil or similar compounds suggesting that the N-terminal domain may be important in regulating the ethanol sensitivity of NMDA receptors. Methods Wild-type GluN1 and GluN2 subunits and those in which the coding sequence for the N-terminal domain was deleted were expressed in HEK293 cells. Whole-cell voltage-clamp recording was used to assess ethanol inhibition of wild-type and mutant receptors lacking the N-terminal domain. Results As compared to wild-type GluN1/GluN2A receptors, ethanol inhibition was slightly greater in cells expressing GluN2A subunits lacking the N-terminal domain. In contrast, GluN2B N-terminal deletion mutants showed normal ethanol inhibition while those lacking the N-terminal domain in both GluN1 and GluN2B subunits had decreased ethanol inhibition as compared to wild-type receptors. N-terminal domain lacking GluN2B receptors were insensitive to ifenprodil but retained normal sensitivity to ethanol. Conclusions These findings indicate that the N-terminal domain modestly influences the ethanol sensitivity of NMDA receptors in a subunit-dependent manner. They also show that ifenprodil’s actions on GluN2B containing receptors can be dissociated from those of ethanol. These results suggest that while the N-terminal domain is not a primary site of action for ethanol on NMDA receptors, it likely affects sensitivity via actions on intrinsic channel properties. PMID:23905549

Effect of alternative peritoneal dialysis solutions on cell viability, apoptosis/necrosis and cytokine expression in human monocytes.

PubMed

Plum, J; Lordnejad, M R; Grabensee, B

1998-07-01

Cellular function, cell viability and the cytokine network of human monocytes are influenced by the specific composition of peritoneal dialysis (PD) fluids. In an in vitro study using isolated human blood monocytes, we investigated the effect of peritoneal dialysates containing amino acids (Amino) or glucose polymer (Glu-poly) instead of glucose (Glu) as the osmotic agent, and bicarbonate (Bic) or PBS instead of lactate (Lac) as a buffer. The following parameters were studied: mitochondrial dehydrogenase activity (using the MTT assay), interleukin (IL)-6 and IL-8 release (ELISA) and cellular IL-6 mRNA expression after lipopolysaccharide (LPS) stimulation (using RT-PCR). FACS flow cytometry with annexin V and propidium iodide as markers and fluorescence microscopic methods were used to study the effects of the test fluids on cell necrosis and apoptosis. Glu/Lac pH 5.5 and Glu-poly/PBS pH 7.4 both significantly reduced mitochondrial dehydrogenase activity by more than 50% after 60 minutes of incubation (30.5 +/- 7.6%, 42.5 +/- 6.5%, referred to RPMI 1640 as 100%). Amino/Bic and Glu/Bic were both superior (Mtt assay > 63%). The rate of necrotic cells after 15 minutes of incubation measured by FACS was mostly increased with Glu/Lac pH 5.5 (29.9 +/- 4.0%). The rate of apoptotic cells, however, was not significantly different between the test solutions. The concentration of IL-6 in the supernatant of stimulated monocytes was highest with Glu/Bic (1023 +/- 278 pg/ml) and Amino/Bic (776 +/- 296 pg/ml) an lowest with Glu/lac pH 5.5 (46 +/- 22 pg/ml) and Glu-poly/PBS (32 +/- 13 pg/ml). IL-8 release from stimulated monocytes showed a similar pattern. Glu-poly/PBS showed a suppressive effect on IL-6 mRNA expression (ratio IL-6/beta-Actin, 0.4 +/- 0.25 vs. RPMI 1.5 +/- 3.6). Bicarbonate buffered solutions both with glucose or amino acids as osmotic agents were superior when regarding cell metabolism, viability and cytokine release, while lactate buffered solutions and Glu-poly/PBS showed some reduced biocompatibility pattern for monocytes in vitro.

Phylogenetic analysis of ionotropic L-glutamate receptor genes in the Bilateria, with special notes on Aplysia californica.

PubMed

Greer, Justin B; Khuri, Sawsan; Fieber, Lynne A

2017-01-11

The neurotransmitter L-Glutamate (L-Glu) acting at ionotropic L-Glu receptors (iGluR) conveys fast excitatory signal transmission in the nervous systems of all animals. iGluR-dependent neurotransmission is a key component of the synaptic plasticity that underlies learning and memory. During learning, two subtypes of iGluR, α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPAR) and N-methyl-D-aspartate receptors (NMDAR), are dynamically regulated postsynaptically in vertebrates. Invertebrate organisms such as Aplysia californica (Aplysia) are well-studied models for iGluR-mediated function, yet no studies to date have analyzed the evolutionary relationships between iGluR genes in these species and those in vertebrates, to identify genes that may mediate plasticity. We conducted a thorough phylogenetic analysis spanning Bilateria to elucidate these relationships. The expression status of iGluR genes in the Aplysia nervous system was also examined. Our analysis shows that ancestral genes for both NMDAR and AMPAR subtypes were present in the common bilaterian ancestor. NMDAR genes show very high conservation in motifs responsible for forming the conductance pore of the ion channel. The number of NMDAR subunits is greater in vertebrates due to an increased number of splice variants and an increased number of genes, likely due to gene duplication events. AMPAR subunits form an orthologous group, and there is high variability in the number of AMPAR genes in each species due to extensive taxon specific gene gain and loss. qPCR results show that all 12 Aplysia iGluR subunits are expressed in all nervous system ganglia. Orthologous NMDAR subunits in all species studied suggests conserved function across Bilateria, and potentially a conserved mechanism of neuroplasticity and learning. Vertebrates display an increased number of NMDAR genes and splice variants, which may play a role in their greater diversity of physiological responses. Extensive gene gain and loss of AMPAR genes may result in different physiological properties that are taxon specific. Our results suggest a significant role for L-Glu mediated responses throughout the Aplysia nervous system, consistent with L-Glu's role as the primary excitatory neurotransmitter.

Characterization of ionotropic glutamate receptors in human lymphocytes

PubMed Central

Lombardi, Grazia; Dianzani, Chiara; Miglio, Gianluca; Canonico, Pier Luigi; Fantozzi, Roberto

2001-01-01

The effect of L-glutamate (Glu) on human lymphocyte function was studied by measuring anti-CD3 monoclonal antibody (mAb) or phytohaemagglutinin (PHA)-induced intracellular Ca2+ ([Ca2+]i) rise (Fura-2 method), and cell proliferation (MTT assay). Glu (0.001 – 100 μM) did not modify basal lymphocyte [Ca2+]i, but significantly potentiated the effects of anti-CD3 mAb or PHA. Maximal [Ca2+]i rises over resting cells were: 165±8 and 247±10 nM at 3.0×10−2 mg ml−1 anti-CD3 mAb; 201±4 and 266±9 nM at 5.0×10−2 mg ml−1 PHA, in the absence or presence of 1 μM Glu, respectively. The Glu effect showed a bell-shape concentration-dependent relationship, with a maximum (+90±3% for anti-CD3 mAb and +57±2% for PHA over Glu-untreated cells) at 1 μM. Non-NMDA receptor agonists (1 μM) showed a greater efficacy (+76±2% for (S)-AMPA; +78±4% for KA), if compared to NMDA (+46±2%), or Glu itself. Ionotropic Glu receptor antagonists completely inhibited the effects of the corresponding specific receptor agonists (1 μM). The IC50 values calculated were: 0.9 μM for D-AP5; 0.6 μM for (+)-MK801; 0.3 μM for NBQX. Both NBQX and KYNA were able to abolish Glu effect. The IC50s calculated were: 3.4 μM for NBQX; 0.4 μM for KYNA. Glu (0.1 – 1 mM) did not change the resting cell proliferation, whereas Glu (1 mM) significant inhibited (−27±4%) PHA (1.0×10−2 mg ml−1)-induced lymphocyte proliferation at 72 h. In conclusion, human lymphocytes express ionotropic Glu receptors functionally operating as modulators of cell activation. PMID:11454668

Activation of mGluR2/3 following stress hormone exposure restores sensitivity to alcohol in rats.

PubMed

Jaramillo, Anel A; Randall, Patrick A; Frisbee, Suzanne; Fisher, Kristen R; Besheer, Joyce

2015-09-01

Sensitivity to the interoceptive effects of alcohol is blunted following a period of exposure to the stress hormone corticosterone (CORT), an effect that is suggested to be related, in part, to glutamatergic neuroadaptations. Group II metabotropic glutamate receptors (subtypes 2 and 3; mGluR2/3) modulate several drug- and alcohol-related behaviors, including the interoceptive (discriminative stimulus) effects of alcohol. Therefore, we sought to determine if manipulation of mGluR2/3 would restore sensitivity to the interoceptive effects of alcohol following CORT exposure. Using a two-lever drug discrimination task, male Long-Evans rats were trained to discriminate alcohol (1 g/kg, intragastric [IG]) vs. water. First, the effect of mGluR2/3 antagonism on the discriminative stimulus effects of alcohol was determined using LY341495 (0.3-3.0 mg/kg; intraperitoneal [IP]). Next, the effects of mGluR2/3 antagonism and activation were assessed in discrimination-trained animals exposed to CORT (300 μg/mL) in the home cage drinking water or water only, for 7 days. Following CORT exposure, decreased sensitivity to alcohol (1 g/kg) was observed. Pretreatment with the mGluR2/3 agonist LY379268 (1.0-3.0 mg/kg; IP), but not the mGluR2/3 antagonist (0.3-1.0 mg/kg; IP), restored sensitivity to alcohol. Additionally, in water controls, mGluR2/3 antagonism and mGluR2/3 activation disrupted expression of the discriminative stimulus effects of alcohol. Together, these findings suggest that blunted sensitivity to the interoceptive effects of alcohol following an episode of heightened stress hormone levels may be due to adaptations in mGluR2/3-related systems. The ability of mGluR2/3 activation to restore sensitivity to alcohol under these conditions lends further support for the importance of these receptors under stress-related conditions. Copyright © 2015 Elsevier Inc. All rights reserved.

Gluing interface qualification test results and gluing process development of the EUCLID near-infrared spectro-photometer optical assembly

NASA Astrophysics Data System (ADS)

Mottaghibonab, A.; Thiele, H.; Gubbini, E.; Dubowy, M.; Gal, C.; Mecsaci, A.; Gawlik, K.; Vongehr, M.; Grupp, F.; Penka, D.; Wimmer, C.; Bender, R.

2016-07-01

The Near Infrared Spectro-Photometer Optical assembly (NIOA) of EUCLID satellite requires high precision large lens holders with different lens materials, shapes and diameters. The aspherical lenses are glued into their separate CTE matched lens holder. The gluing of the lenses in their holder with 2K epoxy is selected as bonding process to minimize the stress in the lenses to achieve the required surface form error (SFE) performance (32nm) and lens position stability (+/-10μm) due to glue shrinkage. Adhesive shrinkage stress occurs during the glue curing at room temperature and operation in cryogenic temperatures, which might overstress the lens, cause performance loss, lens breakage or failure of the gluing interface. The selection of the suitable glue and required bonding parameters, design and qualification of the gluing interface, development and verification of the gluing process was a great challenge because of the low TRL and heritage of the bonding technology. The different material combinations (CaF2 to SS316L, LF5G15 and S-FTM16 to Titanium, SUPRASIL3001 to Invar M93), large diameter (168mm) and thin edge of the lenses, cryogenic nonoperational temperature (100K) and high performance accuracy of the lenses were the main design driver of the development. The different coefficients of thermal expansion (CTE) between lens and lens holder produce large local mechanical stress. As hygroscopic crystal calcium fluoride (CaF2) is very sensitive to moisture therefore an additional surface treatment of the gluing area is necessary. Extensive tests e.g glue handling and single lap shear tests are performed to select the suitable adhesive. Interface connection tests are performed to verify the feasibility of selected design (double pad design), injection channel, the roughness and treatment of the metal and lens interfaces, glue thickness, glue pad diameter and the gluing process. CTE and dynamic measurements of the glue, thermal cycling, damp- heat, connection shear and tension tests with all material combinations at RT and 100K are carried out to qualify the gluing interface. The gluing interface of the glued lenses in their mounts is also qualified with thermal cycling, 3D coordinate measurements before and after environmental tests, Polarimetry and vibration test of the lens assemblies. A multi-function double pad gluing tool and lens mounting tool is designed, manufactured and verified to meet the lens positioning and alignment performance of the lens in the holder which provides the possibility to glue lenses, filters, mirrors with different diameters, shapes and thickness with +/-10μm accuracy in plane, out of plane and +/-10 arcsec in tip/tilt with respect to the lens holder interface. The paper presents the glue interface qualification results, the qualification/verification methods, the developed ground support equipment and the gluing process of the EUCLID high precision large cryogenic lens mounts. Test results achieved in the test campaign demonstrate the suitability of the selected adhesive, glue pad design, interface parameters and the processes for the precise gluing of the lenses in lens holders for all lenses. The qualification models of the NIOA are successfully glued and qualified. The developed process can also be used for other glass materials e.g. MaF2 and optical black coated metallic surfaces.

[Risk of type 2 diabetes mellitus in the Kyrgyz population in the presence of ADIPOQ (G276T), KCNJ11 (Glu23Lys), TCF7L2 (IVS3C>T) gene polymorphisms].

PubMed

Isakova, Zh T; Talaibekova, E T; Asambaeva, D A; Kerimkulova, A S; Lunegova, O S; Aldasheva, N M; Aldashev, A A

To analyze the association of genotype combinations of the polymorphic markers G276T in the ADIPOQ gene, Glu23Lys in the KCNJ11 gene, and IVS3C>T in the TCF7L2 gene with the development of type 2 diabetes mellitus (T2DM) in the Kyrgyz population. The investigation enrolled 23 Kyrgyz people, of whom there were 114 patients with T2DM and 109 without T2DM (a control group). T2DM was diagnosed in accordance with the WHO criteria (1999). The genotypes of ADIPOQ (G276T), KCNJ11 (Glu23Lys), and TCF7L2 (IVS3C>T) gene polymorphisms were identified using the restriction fragment length polymorphism analysis. When typing at the polymorphic loci G276T in the ADIPOQ gene, Glu23Lys in the KCNJ11 gene, and IVS3C>T in the TCF7L2 gene, the development of T2DM in the Kyrgyz population was associated with the T allele (odds ratio (OR), 1.68; p=0.025), the heterozygous G276T genotype (OR 1,8; p=0.036) in the ADIPOQ gene; the 23Lys allele (OR, 1.62; p=0.019) in the KCNJ11 gene; a two-locus genotype combination in the genes ADIPOQ/KCNJ11: G276T/Glu23Lys (OR, 4.88; p=0.0013), G276G/Lys23Lys (OR, 4.65; p=0.019), G276T/Glu23Glu (OR, 3.10; p=0.022), a two-locus genotype combination in the genes ADIPOQ/TCF7L2: G276T/СС (OR, 1.97; p=0.04); two-locus genotype combinations in the genes KCNJ11/TCF7L2: Lys23Lys/CC (ОR, 2.65; p=0.042), Glu23Lys/CT (OR, 3.88; p=0.027); and a three-locus genotype combination in the genes ADIPOQ/KCNJ11/TCF7L2: G276T/Glu23Lys/CT (OR, 14.48; p=0.02). The development of T2DM in the Kyrgyz population is genetically determined by ADIPOQ (G276T) gene, KCNJ11 (Glu23Lys), and TCF7L (IVS3C>T) gene polymorphisms with the predisposing value of the T allele of the heterozygous G276T genotype in the ADIPOQ gene; the 23Lys allele in the KCNJ1 gene; as well as by genotype combinations in the genes ADIPOQ/KCNJ11 (G276T/Glu23Lys, G276G/Lys23Lys, G276T/Glu23Glu); ADIPOQ/TCF7L2 (G276T/SS); KCNJ11/TCF7L2 (Lys23Lys/CC, Glu23Lys/CT); ADIPOQ/KCNJ11/TCF7L2 (G276T/Glu23Lys /CT). The IVS3C>T locus in the TCF7L2 gene is not independently statistically significantly associated with the development of T2DM; however, its predisposing effect has been identified in its combination with the variant genotypes of the polymorphic loci G276T in the ADIPOQ gene and Glu23Lys in the KCNJ11 gene.

[Rasmussen encephalitis and non-herpetic acute limbic encephalitis].

PubMed

Takahashi, Yukitoshi; Kubota, Yuko; Yamasaki, Etsuko; Matsuda, Kazumi

2008-03-01

Rasmussen syndrome (RS) and non-herpetic acute limbic encephalitis (NHALE) have pathophysiological background related with autoimmunity to glutamate receptors (GluRs) after infections. RS and NHALE were reviewed, depending mainly on our recent studies. RS is the prototype of autoimmune-mediated epilepsy. In patients with RS, several kinds of autoantibodies against neuronal molecules, for example, GluR3, GluRepsilon2 (NMDA-R2B), etc., are reported. These autoantibodies are not specific for RS. About autoantibodies against GluR3, significance and stimulating effects to GluR3 are controversial. Autoantibodies against GluRepsilon2 were detected in all patients within six months from epilepsy onset, and in some patients at chronic stage. These data suggest that autoantibodies against GluRepsilon2 may be involved in the pathological mechanisms in the early stage, but we could not confirm the effect of the autoantibodies from RS patients on excitatory postsynaptic NMDA current using patch clump methods. However, anti-double-stranded DNA antibodies in patients with SLE are reported to cross-react with n-terminal of GluRepsilon2, and cause neuronal apoptosis in rat hippocampus, ensuing memory impairment, and emotional behavior impairment in mice. Therefore, autoantibodies against GluRepsilon2 may contribute to the cognitive and behavioral changes in RS. Concerning about cellular immunity in RS, lymphocytes stimulating tests revealed peripheral lymphocytes sensitized by antigens containing GluRepsilon2. Cytotoxic T cells (CTLs) excreting Granzyme B were reported in resected brain tissue, and we confirmed the elevated levels of Granzyme B, not in sera, but in CSF. These data suggest that CTLs activated by infection invade into CNS, and recognize neural antigens, and excrete Granzyme B. The incidence of NHALE is 4.1/1 million/year in Japanese adults. Our study in 91 adult patients with NHALE revealed the following characteristics. Mean onset age was 35.2 +/- 16.9 years old, and preceding infections existed in 68.7% of patients, and predominant symptoms at the onset were psychiatric symptoms (33.3%) and convulsions (25.0%). CSF showed slightly elevated cell counts (55.5 +/- 139.9), protein levels (48.1 +/- 36.0 mg/dl), and IgG levels (4.5 +/- 3.9 mg/dl). MRI lesions with high intensity were found in 40.8% (DWI) and 54.2% (FLAIR) of patients in various stages after onsets. Autoantibodies against GluRepsilon2 in sera were detected in approximately 60% of NHALE patients from acute to chronic stages, and the autoantibodies in CSF were detected in 51.8% (acute stage), 41.4% (recovery stage), 28.6% (chronic stage) of patients and included epitopes to n-terminal of GluRepsilon2 (NT1). These data suggest that autoantibodies against GluRepsilon2 produced in sera after infection infiltrate into CNS through damaged BBB in acute stages, and affect n-terminal of GluRepsilon2. In chronic stage, recovery of function of BBB reduces levels of the autoantibodies in CSF. Because BBB in hippocampi and amygdala are vulnerable, autoantibodies against GluRepsilon2 including epitopes to n-terminal may contribute to the limbic symptoms around onset. Among several autoantibodies related with NHALE, autoantibodies against GluRepsilon2 were found in patients around 15-34 years old, autoantibodies against VGKC were around 50.4 years old, autoantibodies against NAE were around 59 years old, autoantibodies against Hu were around 61.5 years old. These data suggest that autoantibodies related with NHALE have age-dependent heterogeneity.

Differences in kainate receptor involvement in hippocampal mossy fibre long-term potentiation depending on slice orientation.

PubMed

Sherwood, John L; Amici, Mascia; Dargan, Sheila L; Culley, Georgia R; Fitzjohn, Stephen M; Jane, David E; Collingridge, Graham L; Lodge, David; Bortolotto, Zuner A

2012-09-01

Long-term potentiation (LTP) is a well-established experimental model used to investigate the synaptic basis of learning and memory. LTP at mossy fibre - CA3 synapses in the hippocampus is unusual because it is normally N-methyl-d-aspartate (NMDA) receptor-independent. Instead it seems that the trigger for mossy fibre LTP involves kainate receptors (KARs). Although it is generally accepted that pre-synaptic KARs play an essential role in frequency facilitation and LTP, their subunit composition remains a matter of significant controversy. We have reported previously that both frequency facilitation and LTP can be blocked by selective antagonism of GluK1 (formerly GluR5/Glu(K5))-containing KARs, but other groups have failed to reproduce this effect. Moreover, data from receptor knockout and mRNA expression studies argue against a major role of GluK1, supporting a more central role for GluK2 (formerly GluR6/Glu(K6)). A potential reason underlying the controversy in the pharmacological experiments may reside in differences in the preparations used. Here we show differences in pharmacological sensitivity of synaptic plasticity at mossy fibre - CA3 synapses depend critically on slice orientation. In transverse slices, LTP of fEPSPs was invariably resistant to GluK1-selective antagonists whereas in parasagittal slices LTP was consistently blocked by GluK1-selective antagonists. In addition, there were pronounced differences in the magnitude of frequency facilitation and the sensitivity to the mGlu2/3 receptor agonist DCG-IV. Using anterograde labelling of granule cells we show that slices of both orientations possess intact mossy fibres and both large and small presynaptic boutons. Transverse slices have denser fibre tracts but a smaller proportion of giant mossy fibre boutons. These results further demonstrate a considerable heterogeneity in the functional properties of the mossy fibre projection. Copyright © 2012 Elsevier Ltd. All rights reserved.

Dietary supplementation with arginine and glutamic acid enhances key lipogenic gene expression in growing pigs.

PubMed

Hu, C J; Jiang, Q Y; Zhang, T; Yin, Y L; Li, F N; Su, J Y; Wu, G Y; Kong, X F

2017-12-01

Our previous study showed dietary supplementation with Arg and Glu increased intramuscular fat deposition and decreased back fat thickness in pigs, suggesting that the genes involved in lipid metabolism might be regulated differently in muscle and s.c. adipose (SA) tissues. Sixty Duroc × Large White × Landrace pigs with an average initial BW of 77.1 ± 1.3 kg were randomly assigned to 1 of 5 treatment groups (castrated male to female ratio = 1:1). Pigs in the control group were fed a basic diet, and those in experimental groups were fed the basic diet supplemented with 2.05% alanine (isonitrogenous group), 1.00% arginine (Arg group), 1.00% glutamic acid + 1.44% alanine (Glu group), or 1.00% arginine + 1.00% glutamic acid (Arg+Glu group). Fatty acid percentages and mRNA expression levels of the genes involved in lipid metabolism in muscle and SA tissues were examined. The percentages of C14:0 and C16:0 in the SA tissue of Glu group pigs and C14:0 in the longissimus dorsi (LD) muscle of Glu and Arg+Glu groups decreased ( < 0.05) compared to the basic diet group. The Arg+Glu group showed the highest ( < 0.05) hormone-sensitive lipase expression level in SA tissue and higher ( < 0.05) mRNA levels of in the LD muscle than the basic diet and isonitrogenous groups. Additionally, the mRNA level of fatty acid synthase in the Arg+Glu group was more upregulated ( < 0.05) than that of the Arg group. An increase in the mRNA level of in the biceps femoris muscle was also observed in the Arg+Glu group ( < 0.05) compared with the basic diet and isonitrogenous groups. Collectively, these findings suggest that dietary supplementation with Arg and Glu upregulates the expression of genes involved in adipogenesis in muscle tissues and lipolysis in SA tissues.

Pathological reorganization of NMDA receptors subunits and postsynaptic protein PSD-95 distribution in Alzheimer's disease.

PubMed

Leuba, Genevieve; Vernay, Andre; Kraftsik, Rudolf; Tardif, Eric; Riederer, Beat Michel; Savioz, Armand

2014-01-01

In Alzheimer's disease (AD), synaptic alterations play a major role and are often correlated with cognitive changes. In order to better understand synaptic modifications, we compared alterations in NMDA receptors and postsynaptic protein PSD-95 expression in the entorhinal cortex (EC) and frontal cortex (FC; area 9) of AD and control brains. We combined immunohistochemical and image analysis methods to quantify on consecutive sections the distribution of PSD-95 and NMDA receptors GluN1, GluN2A and GluN2B in EC and FC from 25 AD and control cases. The density of stained receptors was analyzed using multivariate statistical methods to assess the effect of neurodegeneration. In both regions, the number of neuronal profiles immunostained for GluN1 receptors subunit and PSD-95 protein was significantly increased in AD compared to controls (3-6 fold), while the number of neuronal profiles stained for GluN2A and GluN2B receptors subunits was on the contrary decreased (3-4 fold). The increase in marked neuronal profiles was more prominent in a cortical band corresponding to layers 3 to 5 with large pyramidal cells. Neurons positive for GluN1 or PSD-95 staining were often found in the same localization on consecutive sections and they were also reactive for the anti-tau antibody AD2, indicating a neurodegenerative process. Differences in the density of immunoreactive puncta representing neuropile were not statistically significant. Altogether these data indicate that GluN1 and PSD-95 accumulate in the neuronal perikarya, but this is not the case for GluN2A and GluN2B, while the neuropile compartment is less subject to modifications. Thus, important variations in the pattern of distribution of the NMDA receptors subunits and PSD-95 represent a marker in AD and by impairing the neuronal network, contribute to functional deterioration.

On understanding proton transfer to the biocatalytic [Fe-Fe](H) sub-cluster in [Fe-Fe]H(2)ases: QM/MM MD simulations.

PubMed

Hong, G; Cornish, A J; Hegg, E L; Pachter, R

2011-05-01

Proton transfer to the [Fe-Fe](H) sub-cluster in the Desulfovibrio desulfuricans (DdH) and Clostridium pasteurianum (CpI) [Fe-Fe] hydrogenases was investigated by a combination of first principles and empirical molecular dynamics simulations. Pathways that can be inferred from the X-ray crystal structures of DdH and CpI, i.e., (Glu159→Ser198→Glu156→water460→Cys178→DTMA([Fe-Fe](H)) and (Glu282→Ser319→Glu279→water612→Cys299), respectively, were considered. Proton transfer from Cys178 to DTMA in the [Fe-Fe](H) sub-cluster in DdH was readily observed in our results, specifically when [Fe-Fe](H) was in the reduced state ([Fe(I)-Fe(I)]) or in the mixed valence state for the protonated distal iron Fe(d) ([Fe(I)-Fe(II)-H(-)](H)). A concerted mechanism is proposed, where proton transfer in DdH from Glu159 to Glu156 via Ser198 and Glu156 to Cys178 via water460 readily occurred, as well as from Glu282 to Glu279 via Ser319 and Glu279 to Cys299 via water612 in CpI. The theoretical prediction of the proton transfer characteristics is consistent with the assumed biocatalytic mechanism of the [Fe-Fe] hydrogenases in which the proton binds at Fe(d), providing confirmation that has not been explored so far. The computational results were qualitatively validated by the agreement with experimental hydrogen production activity data for mutated CpI enzymes, relative to the wild-type protein. Finally, the insight provided by the simulations, combined, in part, with experimental validation, are important for establishing an approach in future exploration of proton transfer to the active site in this class of enzymes, and possibly also for biomimetic analogs. Published by Elsevier B.V.

[Glycemic variability and short-term outcome in critically ill].

PubMed

Zhang, L P; Guo, Y B; Zhou, L H

2016-06-07

To analyze the association of blood glucose variability and short-term outcome in critically ill. The retrospective study including 552 patients admitted to the Affiliated Hospital of Inner Mongolia Medical University from January 2013 to March 2015. The initial blood glucose (GluAdm), the first 24 hours average blood glucose(GluMV1d) and glycemic lability index(GLI1d), 72-hour average blood glucose (GluMV3d) and glycemic lability index(GLI3d) were recorded. The receiver operating characteristic curve (ROC curve) was applied to evaluate the association between GluAdm, GLI1d, GLI3d and APACHE Ⅱ score and prognosis. The levels of APACHE Ⅱ, GluAdm, GLI 1d, GLI 3d of nonsurvivors were higher than those of survivors[(23.2±5.2) vs (16.7±4.4), (12.3±5.2)mmol/L vs(9.2±2.2)mmol/L, (23.3±12.2)vs(12.3±11.1), (21.6±19.3)vs(13.2±9.9), P<0.05]; there was no statistically significant difference between GluMV1d and GluMV3d; when ROC was applied, and the area under the curve (AUC) of APACHEⅡ, GLI1d and GLI3d were 0.826±0.035, 0.726±0.052 and 0.786±0.046, which were significantly higher than the GluMV1d and GluMV3d (0.412±0.031, 0.425±0.026, P<0.05) .It is correlated between GluAdm, GLI1d, GLI3d and the 28-day mortality, ICU days and total time of hospitalization. Blood glucose variability is closely related with the mortality in critical ill patients, GLI1d, GLI3d and APACHEⅡ score of critically ill patients have a similar predictive value in the short-term prognosis.

Activity-dependent control of NMDA receptor subunit composition at hippocampal mossy fibre synapses.

PubMed

Carta, Mario; Srikumar, Bettadapura N; Gorlewicz, Adam; Rebola, Nelson; Mulle, Christophe

2018-02-15

CA3 pyramidal cells display input-specific differences in the subunit composition of synaptic NMDA receptors (NMDARs). Although at low density, GluN2B contributes significantly to NMDAR-mediated EPSCs at mossy fibre synapses. Long-term potentiation (LTP) of NMDARs triggers a modification in the subunit composition of synaptic NMDARs by insertion of GluN2B. GluN2B subunits are essential for the expression of LTP of NMDARs at mossy fibre synapses. Single neurons express NMDA receptors (NMDARs) with distinct subunit composition and biophysical properties that can be segregated in an input-specific manner. The dynamic control of the heterogeneous distribution of synaptic NMDARs is crucial to control input-dependent synaptic integration and plasticity. In hippocampal CA3 pyramidal cells from mice of both sexes, we found that mossy fibre (MF) synapses display a markedly lower proportion of GluN2B-containing NMDARs than associative/commissural synapses. The mechanism involved in such heterogeneous distribution of GluN2B subunits is not known. Here we show that long-term potentiation (LTP) of NMDARs, which is selectively expressed at MF-CA3 pyramidal cell synapses, triggers a modification in the subunit composition of synaptic NMDARs by insertion of GluN2B. This activity-dependent recruitment of GluN2B at mature MF-CA3 pyramidal cell synapses contrasts with the removal of GluN2B subunits at other glutamatergic synapses during development and in response to activity. Furthermore, although expressed at low levels, GluN2B is necessary for the expression of LTP of NMDARs at MF-CA3 pyramidal cell synapses. Altogether, we reveal a previously unknown activity-dependent regulation and function of GluN2B subunits that may contribute to the heterogeneous plasticity induction rules in CA3 pyramidal cells. © 2017 Centre Nationnal de la Recherche Scientifique. The Journal of Physiology © 2017 The Physiological Society.

Photolabeling of Glu-129 of the S-1 subunit of pertussis toxin with NAD

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barbieri, J.T.; Mende-Mueller, L.M.; Rappuoli, R.

1989-11-01

UV irradiation was shown to induce efficient transfer of radiolabel from nicotinamide-labeled NAD to a recombinant protein (C180 peptide) containing the catalytic region of the S-1 subunit of pertussis toxin. Incorporation of label from (3H-nicotinamide)NAD was efficient (0.5 to 0.6 mol/mol of protein) relative to incorporation from (32P-adenylate)NAD (0.2 mol/mol of protein). Label from (3H-nicotinamide)NAD was specifically associated with Glu-129. Replacement of Glu-129 with glycine or aspartic acid made the protein refractory to photolabeling with (3H-nicotinamide)NAD, whereas replacement of a nearby glutamic acid, Glu-139, with serine did not. Photolabeling of the C180 peptide with NAD is similar to that observedmore » with diphtheria toxin and exotoxin A of Pseudomonas aeruginosa, in which the nicotinamide portion of NAD is transferred to Glu-148 and Glu-553, respectively, in the two toxins. These results implicate Glu-129 of the S-1 subunit as an active-site residue and a potentially important site for genetic modification of pertussis toxin for development of an acellular vaccine against Bordetella pertussis.« less

NMDA receptor GluN2A subunit deletion protects against dependence-like ethanol drinking.

PubMed

Jury, Nicholas J; Radke, Anna K; Pati, Dipanwita; Kocharian, Adrina; Mishina, Masayoshi; Kash, Thomas L; Holmes, Andrew

2018-06-25

The N-methyl- D -aspartate receptor (NMDAR) is mechanistically involved in the behavioral and neurophysiological effects of alcohol, but the specific role of the GluN2A subunit remains unclear. Here, we exposed mice with constitutive GluN2A gene knockout (KO) to chronic intermittent ethanol vapor (CIE) and tested for EtOH consumption/preference using a two-bottle choice paradigm, as well as NMDAR-mediated transmission at basolateral amygdala synapses via ex vivo slice electrophysiology. Results showed that GluN2A KO mice attained comparable blood EtOH levels in response to CIE exposure, but did not exhibit the significant increase in EtOH drinking that was observed in CIE-exposed wildtypes. GluN2A KO mice also showed no alterations in BLA NMDAR-mediated synaptic transmission after CIE, relative to air-exposed, whereas C57BL/6 J mice showed an attenuated synaptic response to GluN2B antagonism. Taken together, these data add to mounting evidence supporting GluN2A-containing NMDARs as a mechanism underlying relative risk for developing EtOH dependence after repeated EtOH exposure. Copyright © 2018. Published by Elsevier B.V.

Stable isotope dilution HILIC-MS/MS method for accurate quantification of glutamic acid, glutamine, pyroglutamic acid, GABA and theanine in mouse brain tissues.

PubMed

Inoue, Koichi; Miyazaki, Yasuto; Unno, Keiko; Min, Jun Zhe; Todoroki, Kenichiro; Toyo'oka, Toshimasa

2016-01-01

In this study, we developed the stable isotope dilution hydrophilic interaction liquid chromatography with tandem mass spectrometry (HILIC-MS/MS) technique for the accurate, reasonable and simultaneous quantification of glutamic acid (Glu), glutamine (Gln), pyroglutamic acid (pGlu), γ-aminobutyric acid (GABA) and theanine in mouse brain tissues. The quantification of these analytes was accomplished using stable isotope internal standards and the HILIC separating mode to fully correct the intramolecular cyclization during the electrospray ionization. It was shown that linear calibrations were available with high coefficients of correlation (r(2)  > 0.999, range from 10 pmol/mL to 50 mol/mL). For application of the theanine intake, the determination of Glu, Gln, pGlu, GABA and theanine in the hippocampus and central cortex tissues was performed based on our developed method. In the region of the hippocampus, the concentration levels of Glu and pGlu were significantly reduced during reality-based theanine intake. Conversely, the concentration level of GABA increased. This result showed that transited theanine has an effect on the metabolic balance of Glu analogs in the hippocampus. Copyright © 2015 John Wiley & Sons, Ltd.

GluR2-3Y Inhibits the Acquisition and Reinstatement of Morphine-Induced Conditioned Place Preference in Rats.

PubMed

Lin, Xiao-Jing; Zhang, Jian-Jun; Yu, Long-Chuan

2016-04-01

Accumulating evidence indicates that α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptors (AMPARs) are involved in the relapse to abused drugs. However, the role of AMPARs containing the GluR2 subunit in opiate addiction is still unclear. GluR2-3Y, an interfering peptide, prevents the endocytosis of AMPARs containing the GluR2 subunit. In this study, we explored the effect of intravenous injection of GluR2-3Y on the acquisition, expression, and reinstatement of morphine-induced conditioned place preference (mCPP) in rats. We found that infusion of GluR2-3Y (1.5 nmol/g) one hour before morphine during the conditioning phase inhibited the acquisition of mCPP, while an identical injection one hour before the post-conditioning test had no influence on the expression of mCPP. Injection of GluR2-3Y (1.5 nmol/g) after mCPP extinction blocked the morphine-induced reinstatement of mCPP. Our results strongly support the hypothesis that inhibition of AMPAR endocytosis provides a new target for the treatment of opiate addiction.

Selective suppression of excessive GluN2C expression rescues early epilepsy in a tuberous sclerosis murine model

PubMed Central

Lozovaya, N.; Gataullina, S.; Tsintsadze, T.; Tsintsadze, V.; Pallesi-Pocachard, E.; Minlebaev, M.; Goriounova, N. A.; Buhler, E.; Watrin, F.; Shityakov, S.; Becker, A. J.; Bordey, A.; Milh, M.; Scavarda, D.; Bulteau, C.; Dorfmuller, G.; Delalande, O.; Represa, A.; Cardoso, C.; Dulac, O.; Ben-Ari, Y.; Burnashev, N.

2014-01-01

Tuberous sclerosis complex (TSC), caused by dominant mutations in either TSC1 or TSC2 tumour suppressor genes is characterized by the presence of brain malformations, the cortical tubers that are thought to contribute to the generation of pharmacoresistant epilepsy. Here we report that tuberless heterozygote Tsc1+/− mice show functional upregulation of cortical GluN2C-containing N-methyl-D-aspartate receptors (NMDARs) in an mTOR-dependent manner and exhibit recurrent, unprovoked seizures during early postnatal life (

The association of metabotropic glutamate receptor type 5 with the neuronal Ca2+-binding protein 2 modulates receptor function.

PubMed

Canela, Laia; Fernández-Dueñas, Víctor; Albergaria, Catarina; Watanabe, Masahiko; Lluís, Carme; Mallol, Josefa; Canela, Enric I; Franco, Rafael; Luján, Rafael; Ciruela, Francisco

2009-10-01

Metabotropic glutamate (mGlu) receptors mediate in part the CNS effects of glutamate. These receptors interact with a large array of intracellular proteins in which the final role is to regulate receptor function. Here, using co-immunoprecipitation and pull-down experiments we showed a close and specific interaction between mGlu(5) receptor and NECAB2 in both transfected human embryonic kidney cells and rat hippocampus. Interestingly, in pull-down experiments increasing concentrations of calcium drastically reduced the ability of these two proteins to interact, suggesting that NECAB2 binds to mGlu(5) receptor in a calcium-regulated manner. Immunoelectron microscopy detection of NECAB2 and mGlu(5) receptor in the rat hippocampal formation indicated that both proteins are codistributed in the same subcellular compartment of pyramidal cells. In addition, the NECAB2/mGlu(5) receptor interaction regulated mGlu(5b)-mediated activation of both inositol phosphate accumulation and the extracellular signal-regulated kinase/mitogen-activated protein kinase pathway. Overall, these findings indicate that NECAB2 by its physical interaction with mGlu(5b) receptor modulates receptor function.

AMPA receptor phosphorylation and recognition memory: learning-related, time-dependent changes in the chick brain following filial imprinting.

PubMed

Solomonia, Revaz O; Meparishvili, Maia; Mikautadze, Ekaterine; Kunelauri, Nana; Apkhazava, David; McCabe, Brian J

2013-04-01

There is strong evidence that a restricted part of the chick forebrain, the intermediate medial mesopallium (IMM), stores information acquired through the learning process of visual imprinting. We have previously demonstrated that at 1 h but not 24 h after imprinting training, a learning-specific increase in the amount of membrane Thr286-autophosphorylated α-calcium/calmodulin-dependent protein kinase II (αCaMKII), and in the proportion of total αCaMKII that is phosphorylated, occurs in the IMM but not in a control brain region, the posterior pole of the nidopallium (PPN). αCaMKII directly phosphorylates Ser831 in the GluA1 subunit of the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor. In the present study we have inquired whether the learning-related increase in αCaMKII autophosphorylation is followed by changes in the Ser831 phosphorylation of GluA1 (P-GluA1) and in the total amount of this subunit (T-GluA1). Trained chicks together with untrained control chicks were killed either 1 or 24 h after training. Tissue was removed from the IMM together with tissue from the PPN as a control. Amounts of P-GluA1 and T-GluA1 were measured. In the left IMM of the 1 h group the P-GluA1/T-GluA1 ratio increased in a learning-specific way. No learning-related changes were observed in other brain regions at 1 h or in any region 24 h after training. The results indicate that a time- and regionally-dependent, learning-specific increase in GluA1 phosphorylation occurs early in recognition memory formation.

Endogenously Generated Plasmin at the Vascular Wall Injury Site Amplifies Lysine Binding Site-Dependent Plasminogen Accumulation in Microthrombi

PubMed Central

Brzoska, Tomasz; Tanaka-Murakami, Aki; Suzuki, Yuko; Sano, Hideto; Kanayama, Naohiro; Urano, Tetsumei

2015-01-01

The fibrinolytic system plays a pivotal role in the regulation of hemostasis; however, it remains unclear how and when the system is triggered to induce thrombolysis. Using intra-vital confocal fluorescence microscopy, we investigated the process of plasminogen binding to laser-induced platelet-rich microthrombi generated in the mesenteric vein of transgenic mice expressing green fluorescent protein (GFP). The accumulation of GFP-expressing platelets as well as exogenously infused Alexa Fluor 568-labeled Glu-plasminogen (Glu-plg) on the injured vessel wall was assessed by measuring the increase in the corresponding fluorescence intensities. Glu-plg accumulated in a time-dependent manner in the center of the microthrombus, where phosphatidylserine is exposed on platelet surfaces and fibrin formation takes place. The rates of binding of Glu-plg in the presence of ε-aminocaproic acid and carboxypeptidase B, as well as the rates of binding of mini-plasminogen lacking kringle domains 1-4 and lysine binding sites, were significantly lower than that of Glu-plg alone, suggesting that the binding was dependent on lysine binding sites. Furthermore, aprotinin significantly suppressed the accumulation of Glu-plg, suggesting that endogenously generated plasmin activity is a prerequisite for the accumulation. In spite of the endogenous generation of plasmin and accumulation of Glu-plg in the center of microthrombi, the microthrombi did not change in size during the 2-hour observation period. When human tissue plasminogen activator was administered intravenously, Glu-plg further accumulated and the microthrombi were lysed. Glu-plg appeared to accumulate in the center of microthrombi in the early phase of microthrombus formation, and plasmin activity and lysine binding sites were required for this accumulation. PMID:25806939

M1 muscarinic receptor facilitates cognitive function by interplay with AMPA receptor GluA1 subunit.

PubMed

Zhao, Lan-Xue; Ge, Yan-Hui; Xiong, Cai-Hong; Tang, Ling; Yan, Ying-Hui; Law, Ping-Yee; Qiu, Yu; Chen, Hong-Zhuan

2018-03-06

M1 muscarinic acetylcholine receptors (M1 mAChRs) are the most abundant muscarinic receptors in the hippocampus and have been shown to have procognitive effects. AMPA receptors (AMPARs), an important subtype of ionotropic glutamate receptors, are key components in neurocognitive networks. However, the role of AMPARs in procognitive effects of M1 mAChRs and how M1 mAChRs affect the function of AMPARs remain poorly understood. Here, we found that basal expression of GluA1, a subunit of AMPARs, and its phosphorylation at Ser845 were maintained by M1 mAChR activity. Activation of M1 mAChRs promoted membrane insertion of GluA1, especially to postsynaptic densities. Impairment of hippocampus-dependent learning and memory by antagonism of M1 mAChRs paralleled the reduction of GluA1 expression, and improvement of learning and memory by activation of M1 mAChRs was accompanied by the synaptic insertion of GluA1 and its increased phosphorylation at Ser845. Furthermore, abrogation of phosphorylation of Ser845 residue of GluA1 ablated M1 mAChR-mediated improvement of learning and memory. Taken together, these results show a functional correlation of M1 mAChRs and GluA1 and the essential role of GluA1 in M1 mAChR-mediated cognitive improvement.-Zhao, L.-X., Ge, Y.-H., Xiong, C.-H., Tang, L., Yan, Y.-H., Law, P.-Y., Qiu, Y., Chen, H.-Z. M1 muscarinic receptor facilitates cognitive function by interplay with AMPA receptor GluA1 subunit.

Regulation of Motivation to Self-Administer Ethanol by mGluR5 in Alcohol-Preferring (P) Rats

PubMed Central

Besheer, Joyce; Faccidomo, Sara; Grondin, Julie J. M.; Hodge, Clyde W.

2008-01-01

Background Emerging evidence indicates that Group I metabotropic glutamate receptors (mGluR1 and mGluR5) differentially regulates ethanol self-administration in several rodent behavioral models. The purpose of this work was to further characterize involvement of Group I mGluRs in the reinforcing effects of ethanol using a progressive ratio schedule of reinforcement. Methods Alcohol-preferring (P) rats were trained to self-administer ethanol (15% v/v) versus water on a concurrent schedule of reinforcement, and the effects of the Group I mGluR antagonists were evaluated on progressive ratio performance. The rats were then trained to self-administer sucrose (0.4% w/v) versus water, and the effects of the antagonists were tested on progressive ratio performance. Results The mGluR1 antagonist, 3,4-dihydro-2H-pyrano[2,3]b quinolin-7-yl (cis-4-methoxy-cyclohexyl) methanone (JNJ 16259685; 0 to 1 mg/kg) and the mGluR5 antagonist, 6-methyl-2-(phenylethynyl) pyridine (MPEP; 0 to 10 mg/kg) dose-dependently reduced ethanol break point. In separate locomotor activity assessments, the lowest effective dose of JNJ 16259685 (0.3 mg/kg) produced a motor impairment, whereas the lowest effective dose of MPEP (3 mg/kg) did not. Thus, the reduction in ethanol break point by mGluR1 antagonism was probably a result of a motor impairment. JNJ 16259685 (0.3 mg/kg) and MPEP (10 mg/kg) reduced sucrose break point and produced motor impairments. Thus, the reductions in sucrose break point produced by both Group I antagonists were probably because of nonspecific effects on motor activity. Conclusions Together, these results suggest that glutamate activity at mGluR5 regulates motivation to self-administer ethanol. PMID:18162077

Alterations in GluR2 AMPA receptor phosphorylation at serine 880 following group I metabotropic glutamate receptor stimulation in the rat dorsal striatum.

PubMed

Ahn, Sung Min; Choe, Eun Sang

2010-04-01

Phosphorylation of ionotropic glutamate receptors in the brain plays a crucial role in the regulation of synaptic plasticity. In this study, we investigated the regulation of alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor phosphorylation by the stimulation of group I metabotropic glutamate receptors (mGluRs) in the dorsal striatum in vivo. The results showed that intrastriatal infusion of the group I mGluR agonist, (RS)-3,5-dihydroxyphenylglycine (DHPG, 250 nmol), enhanced the sensitivity of GluR2 subunit in its phosphorylation at serine 880 (S880) in the dorsal striatum. This enhancement of the sensitivity of GluR2-S880 phosphorylation was reduced by blocking group I mGluRs and N-methyl-D-aspartate (NMDA) receptors. Similar reduction of the enhancement was also induced by inhibiting phospholipase C (PLC), calcium/calmodulin-dependent protein kinase (CaMK), c-Jun N-terminal kinase (JNK), and protein kinase C (PKC). Inhibition of protein phosphatase (PP) 1/2A and calcineurin (PP2B) alone enhanced GluR2-S880 phosphorylation in the dorsal striatum, whereas inhibition of these phosphatases did not further enhance the S880 phosphorylation by DHPG stimulation. In addition, inhibition of PP1/2A or PP2B also enhanced the phosphorylation of CaMKII, JNK and PKC. These data suggest that the phosphorylation of AMPA receptor GluR2 subunit at S880 is subject to the upregulation by the stimulation of group I mGluRs. Interactions among glutamate receptors, protein kinases, and PPs participate in this upregulation. (c) 2009 Wiley-Liss, Inc.

Activation of mGluR5 induces spike afterdepolarization and enhanced excitability in medium spiny neurons of the nucleus accumbens by modulating persistent Na+ currents

PubMed Central

D’Ascenzo, Marcello; Podda, Maria Vittoria; Fellin, Tommaso; Azzena, Gian Battista; Haydon, Philip; Grassi, Claudio

2009-01-01

The involvement of metabotropic glutamate receptors type 5 (mGluR5) in drug-induced behaviours is well-established but limited information is available on their functional roles in addiction-relevant brain areas like the nucleus accumbens (NAc). This study demonstrates that pharmacological and synaptic activation of mGluR5 increases the spike discharge of medium spiny neurons (MSNs) in the NAc. This effect was associated with the appearance of a slow afterdepolarization (ADP) which, in voltage-clamp experiments, was recorded as a slowly inactivating inward current. Pharmacological studies showed that ADP was elicited by mGluR5 stimulation via G-protein-dependent activation of phospholipase C and elevation of intracellular Ca2+ levels. Both ADP and spike aftercurrents were significantly inhibited by the Na+ channel-blocker, tetrodotoxin (TTX). Moreover, the selective blockade of persistent Na+ currents (INaP), achieved by NAc slice pre-incubation with 20 nm TTX or 10 μm riluzole, significantly reduced the ADP amplitude, indicating that this type of Na+ current is responsible for the mGluR5-dependent ADP. mGluR5 activation also produced significant increases in INaP, and the pharmacological blockade of this current prevented the mGluR5-induced enhancement of spike discharge. Collectively, these data suggest that mGluR5 activation upregulates INaP in MSNs of the NAc, thereby inducing an ADP that results in enhanced MSN excitability. Activation of mGluR5 will significantly alter spike firing in MSNs in vivo, and this effect could be an important mechanism by which these receptors mediate certain aspects of drug-induced behaviours. PMID:19433572

Fructose and Sucrose Intake Increase Exogenous Carbohydrate Oxidation during Exercise

PubMed Central

Trommelen, Jorn; Fuchs, Cas J.; Beelen, Milou; Lenaerts, Kaatje; Jeukendrup, Asker E.; Cermak, Naomi M.; van Loon, Luc J. C.

2017-01-01

Peak exogenous carbohydrate oxidation rates typically reach ~1 g·min−1 during exercise when ample glucose or glucose polymers are ingested. Fructose co-ingestion has been shown to further increase exogenous carbohydrate oxidation rates. The purpose of this study was to assess the impact of fructose co-ingestion provided either as a monosaccharide or as part of the disaccharide sucrose on exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. Ten trained male cyclists (VO2peak: 65 ± 2 mL·kg−1·min−1) cycled on four different occasions for 180 min at 50% Wmax during which they consumed a carbohydrate solution providing 1.8 g·min−1 of glucose (GLU), 1.2 g·min−1 glucose + 0.6 g·min−1 fructose (GLU + FRU), 0.6 g·min−1 glucose + 1.2 g·min−1 sucrose (GLU + SUC), or water (WAT). Peak exogenous carbohydrate oxidation rates did not differ between GLU + FRU and GLU + SUC (1.40 ± 0.06 vs. 1.29 ± 0.07 g·min−1, respectively, p = 0.999), but were 46% ± 8% higher when compared to GLU (0.96 ± 0.06 g·min−1: p < 0.05). In line, exogenous carbohydrate oxidation rates during the latter 120 min of exercise were 46% ± 8% higher in GLU + FRU or GLU + SUC compared with GLU (1.19 ± 0.12, 1.13 ± 0.21, and 0.82 ± 0.16 g·min−1, respectively, p < 0.05). We conclude that fructose co-ingestion (0.6 g·min−1) with glucose (1.2 g·min−1) provided either as a monosaccharide or as sucrose strongly increases exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. PMID:28230742

Fructose and Sucrose Intake Increase Exogenous  Carbohydrate Oxidation during Exercise.

PubMed

Trommelen, Jorn; Fuchs, Cas J; Beelen, Milou; Lenaerts, Kaatje; Jeukendrup, Asker E; Cermak, Naomi M; van Loon, Luc J C

2017-02-20

Peak exogenous carbohydrate oxidation rates typically reach ~1 g∙min-1 during exercise when ample glucose or glucose polymers are ingested. Fructose co-ingestion has been shown to further increase exogenous carbohydrate oxidation rates. The purpose of this study was to assess the impact of fructose co-ingestion provided either as a monosaccharide or as part of the disaccharide sucrose on exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. Ten trained male cyclists (VO2peak: 65 ± 2 mL∙kg-1∙min-1) cycled on four different occasions for 180 min at 50% Wmax during which they consumed a carbohydrate solution providing 1.8 g∙min-1 of glucose (GLU), 1.2 g∙min-1 glucose + 0.6 g∙min-1 fructose (GLU + FRU), 0.6 g∙min-1 glucose + 1.2 g∙min-1 sucrose (GLU + SUC), or water (WAT). Peak exogenous carbohydrate oxidation rates did not differ between GLU + FRU and GLU + SUC (1.40 ± 0.06 vs. 1.29 ± 0.07 g∙min-1, respectively, p = 0.999), but were 46% ± 8% higher when compared to GLU (0.96 ± 0.06 g∙min-1: p < 0.05). In line, exogenous carbohydrate oxidation rates during the latter 120 min of exercise were 46% ± 8% higher in GLU + FRU or GLU + SUC compared with GLU (1.19 ± 0.12, 1.13 ± 0.21, and 0.82 ± 0.16 g∙min-1, respectively, p < 0.05). We conclude that fructose co-ingestion (0.6 g∙min-1) with glucose (1.2 g∙min-1) provided either as a monosaccharide or as sucrose strongly increases exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists.

Coexistence of immune-neuro-endocrine substances in the rat central neurons.

PubMed

Zhu, C; Liu, Q; Wei, Y; Ma, C; Hao, J; Yan, P

1999-01-01

To investigate the expression of interleukin-2 (IL-2), metabotropic glutamate receptor subunit 1 (mGluR1) and estrogen receptor (ER) in neurons of the rat central nervous system (CNS) and identify the coexistence possibility of these immune-neuro-endocrine substances in the central neurons, the tri-labeling immunocytochemical technique with different species-specific primary antibodies (goat anti-IL-2 antibody, rabbit anti-mGluR1 antibody and mouse anti-ER antibody) were used to incubate two serial neighbor sections (one for demonstrating IL-2, another for mGluR1 and ER) of the cerebral cortex, medulla oblongata and spinal cord. There were IL-2-, mGluR1- and ER-immunoreactivity (IR)-positive labeled neurons in the above-mentioned central areas. The IL-2-IR production showed brown color, located in the cytoplasm; In the neighbor serial section, the mGluR1-IR, production showed blue-black color, located on the cell membrane; the ER-IR production also showed brown color, located in the cytoplasm and nuclei. There were mGluR1/ER double-labeled cells in the same section, which accounted for about 50%-60% of the total single and double labeled neurons. It was identified by projection check of serial neighbor sections that had mGluR1/ER/IL-2 tri-labeled cells, which accounted for about 30% of total mGluR1/ER double-labeled neurons. The results indicate that mGluR1, ER and Il-2 can coexist in the same rat central neurons, therefore, providing morphological basis for the theory about immune-neuro-endocrine network at the cellular level for the first time.

Regulation of Akt and Wnt signaling by the group II metabotropic glutamate receptor antagonist LY341495 and agonist LY379268.

PubMed

Sutton, Laurie P; Rushlow, Walter J

2011-06-01

Metabotropic glutamate receptors 2/3 (mGlu(2/3)) have been implicated in schizophrenia and as a novel treatment target for schizophrenia. The current study examined whether mGlu(2/3) regulates Akt (protein kinase B) and Wnt (Wingless/Int-1) signaling, two cascades associated with schizophrenia and modified by antipsychotics. Western blotting revealed increases in phosphorylated Akt (pAkt) and phosphorylated glycogen synthase kinase-3 (pGSK-3) following acute and repeated treatment of LY379268 (mGlu(2/3) agonist), whereas increases in dishevelled-2 (Dvl-2), dishevelled-3 (Dvl-3), GSK-3 and β-catenin were only observed following repeated treatment. LY341495 (mGlu(2/3) antagonist) induced the opposite response compared with LY379268. Co-immunoprecipitation experiments showed an association between the mGlu(2/3) complex and Dvl-2 providing a possible mechanism to explain how the mGlu(2/3) can mediate changes in Wnt signaling. However, there was no association between the mGlu(2/3) complex and Akt suggesting that changes in Akt signaling following LY341495 and LY379268 treatments may not be directly mediated by the mGlu(2/3) . Finally, an increase in locomotor activity induced by LY341495 treatment correlated with increased pAkt and pGSK-3 levels and was attenuated by the administration of the GSK-3 inhibitor, SB216763. Overall, the results suggest that mGlu(2/3) regulates Akt and Wnt signaling and LY379268 treatment has overlapping effects with D(2) dopamine receptor antagonists (antipsychotic drugs). © 2011 The Authors. Journal of Neurochemistry © 2011 International Society for Neurochemistry.

Glutamate receptor 1 phosphorylation at serine 831 and 845 modulates seizure susceptibility and hippocampal hyperexcitability after early life seizures.

PubMed

Rakhade, Sanjay N; Fitzgerald, Erin F; Klein, Peter M; Zhou, Chengwen; Sun, Hongyu; Huganir, Richard L; Hunganir, Richard L; Jensen, Frances E

2012-12-05

Neonatal seizures can lead to later life epilepsy and neurobehavioral deficits, and there are no treatments to prevent these sequelae. We showed previously that hypoxia-induced seizures in a neonatal rat model induce rapid phosphorylation of serine-831 (S831) and Serine 845 (S845) sites of the AMPA receptor GluR1 subunit and later neuronal hyperexcitability and epilepsy, suggesting that seizure-induced posttranslational modifications may represent a novel therapeutic target. To unambiguously assess the contribution of these sites, we examined seizure susceptibility in wild-type mice versus transgenic knock-in mice with deficits in GluR1 S831 and S845 phosphorylation [GluR1 double-phosphomutant (GluR1 DPM) mice]. Phosphorylation of the GluR1 S831 and S845 sites was significantly increased in the hippocampus and cortex after a single episode of pentyleneterazol-induced seizures in postnatal day 7 (P7) wild-type mouse pups and that transgenic knock-in mice have a higher threshold and longer latencies to seizures. Like the rat, hypoxic seizures in P9 C57BL/6N wild-type mice resulted in transient increases in GluR1 S831 and GluR1 S845 phosphorylation in cortex and were associated with enhanced seizure susceptibility to later-life kainic-acid-induced seizures. In contrast, later-life seizure susceptibility after hypoxia-induced seizures was attenuated in GluR1 DPM mice, supporting a role for posttranslational modifications in seizure-induced network excitability. Finally, human hippocampal samples from neonatal seizure autopsy cases also showed an increase in GluR1 S831 and S845, supporting the validation of this potential therapeutic target in human tissue.

Glutamate receptor 1 phosphorylation at Serine 831 and 845 modulates seizure susceptibility and hippocampal hyperexcitability following early life seizures

PubMed Central

Rakhade, S.N.; Fitzgerald, E.F.; Klein, P.M.; Zhou, C.; Sun, H; Huganir, R.L.; Jensen, F.E.

2012-01-01

Neonatal seizures can lead to later life epilepsy and neurobehavioral deficits, and there are no treatments to prevent these sequelae. We previously showed that hypoxia-induced seizures in a neonatal rat model induce rapid phosphorylation of S831 and S845 sites of the AMPA receptor GluR1 subunit and later neuronal hyperexcitability and epilepsy, suggesting that seizure-induced post-translational modifications may represent a novel therapeutic target. To unambiguously assess the contribution of these sites, we examined seizure susceptibility in wild type mice versus transgenic knock-in mice with deficits in GluR1 S831 and S845 phosphorylation (GluR1 double phosphomutant (GluR1DPM) mice). Phosphorylation of the GluR1 S831 and S845 sites was significantly increased in the hippocampus and cortex following a single episode of pentyleneterazol (PTZ) induced seizures in postnatal day 9 (P9) wild type mouse pups, and that transgenic knock-in mice have a higher threshold and longer latencies to seizures. Like the rat, hypoxic seizures in P9 C57BL/6N wild type mice resulted in transient increases in GluR1 S831 and GluR1 S845 phosphorylation in cortex, and were associated with enhanced seizure susceptibility to later-life kainic acid induced seizures. In contrast, later-life seizure susceptibility following hypoxia-induced seizures was attenuated in GluR1 DPM mice, supporting a role for post-translational modifications in seizure-induced network excitability. Finally, human hippocampal samples from neonatal seizure autopsy cases also showed an increase in GluR1 S831 and S845, supporting the validation of this potential therapeutic target in human tissue. PMID:23223299

Expression of the β-glucosidase gene Pgβglu-1 underpins natural resistance of white spruce against spruce budworm

PubMed Central

Mageroy, Melissa H; Parent, Geneviève; Germanos, Gaby; Giguère, Isabelle; Delvas, Nathalie; Maaroufi, Halim; Bauce, Éric; Bohlmann, Joerg; Mackay, John J

2015-01-01

Periodic outbreaks of spruce budworm (SBW) affect large areas of ecologically and economically important conifer forests in North America, causing tree mortality and reduced forest productivity. Host resistance against SBW has been linked to growth phenology and the chemical composition of foliage, but the underlying molecular mechanisms and population variation are largely unknown. Using a genomics approach, we discovered a β-glucosidase gene, Pgβglu-1, whose expression levels and function underpin natural resistance to SBW in mature white spruce (Picea glauca) trees. In phenotypically resistant trees, Pgβglu-1 transcripts were up to 1000 times more abundant than in non-resistant trees and were highly enriched in foliage. The encoded PgβGLU-1 enzyme catalysed the cleavage of acetophenone sugar conjugates to release the aglycons piceol and pungenol. These aglycons were previously shown to be active against SBW. Levels of Pgβglu-1 transcripts and biologically active acetophenone aglycons were substantially different between resistant and non-resistant trees over time, were positively correlated with each other and were highly variable in a natural white spruce population. These results suggest that expression of Pgβglu-1 and accumulation of acetophenone aglycons is a constitutive defence mechanism in white spruce. The progeny of resistant trees had higher Pgβglu-1 gene expression than non-resistant progeny, indicating that the trait is heritable. With reported increases in the intensity of SBW outbreaks, influenced by climate, variation of Pgβglu-1 transcript expression, PgβGLU-1 enzyme activity and acetophenone accumulation may serve as resistance markers to better predict impacts of SBW in both managed and wild spruce populations. PMID:25302566

Enduring abolishment of remote but not recent expression of conditioned fear by the blockade of calcium-permeable AMPA receptors before extinction training.

PubMed

Zelena, Dóra; Mikics, Éva; Balázsfi, Diána; Varga, János; Klausz, Barbara; Urbán, Eszter; Sipos, Eszter; Biró, László; Miskolczi, Christina; Kovács, Krisztina; Ferenczi, Szilamér; Haller, József

2016-06-01

Calcium-permeable (GluA2 subunit-free) AMPA receptors (CP-AMPAR) play prominent roles in fear extinction; however, no blockers of these receptors were studied in tests relevant to extinction learning so far. The CP-AMPAR antagonist IEM-1460 was administered once before extinction trainings, which were started either 1 or 28 days after fear conditioning (FC). We used a mild extinction protocol that durably decreased but did not abolish conditioned fear. The messenger RNA (mRNA) expression of GluA1 and GluA2 subunits were investigated at both time points in the ventromedial prefrontal cortex (vmPFC) and amygdala. IEM-1460 transiently facilitated extinction 1 day after conditioning, but learned fear spontaneously recovered 4 weeks later. When the extinction protocol was applied 28 days after training, IEM-1460 enhanced extinction memory, moreover abolished conditioned fear for at least a month. The expression of GluA1 and GluA2 mRNAs was increased at both time points in the vmPFC. In the basolateral and central amygdala, the GluA1/GluA2 mRNA ratio increased, suggesting a shift towards the preponderance of GluA1 over GluA2 expression. AMPAR blockade lastingly enhanced the extinction of remote but not recent fear memories. Time-dependent changes in AMPA receptor subunit mRNA expression may explain the differential effects of CP-AMPAR blockade on recent and remote conditioned fear, further supporting the notion that the mechanisms maintaining learned fear change over time. Our findings suggest clinical implications for CP-AMPAR blockers, particularly for acquired anxieties (e.g., post-traumatic stress disorder) which have a slow onset and are durable.

Fear Potentiated Startle Increases Phospholipase D (PLD) Expression/Activity and PLD-Linked Metabotropic Glutamate Receptor Mediated Post-Tetanic Potentiation in Rat Amygdala

PubMed Central

Krishnan, Balaji; Scott, Michael T.; Pollandt, Sebastian; Schroeder, Bradley; Kurosky, Alexander; Shinnick-Gallagher, Patricia

2016-01-01

Long-term memory (LTM) of fear stores activity dependent modifications that include changes in amygdala signaling. Previously, we identified an enhanced probability of release of glutamate mediated signaling to be important in rat fear potentiated startle (FPS), a well-established translational behavioral measure of fear. Here, we investigated short- and long-term synaptic plasticity in FPS involving metabotropic glutamate receptors (mGluRs) and associated downstream proteomic changes in the thalamic-lateral amygdala pathway (Th-LA). Aldolase A, an inhibitor of phospholipase D (PLD), expression was reduced, concurrent with significantly elevated PLD protein expression. Blocking the PLD-mGluR signaling significantly reduced PLD activity. While transmitter release probability increased in FPS, PLD-mGluR agonist and antagonist actions were occluded. In the unpaired group (UNP), blocking the PLD-mGluR increased while activating the receptor decreased transmitter release probability, consistent with decreased synaptic potentials during tetanic stimulation. FPS Post-tetanic potentiation (PTP) immediately following long-term potentiation (LTP) induction was significantly increased. Blocking PLD-mGluR signaling prevented PTP and reduced cumulative PTP probability but not LTP maintenance in both groups. These effects are similar to those mediated through mGluR7, which is co-immunoprecipitated with PLD in FPS. Lastly, blocking mGluR-PLD in the rat amygdala was sufficient to prevent behavioral expression of fear memory. Thus, our study in the Th-LA pathway provides the first evidence for PLD as an important target of mGluR signaling in amygdala fear-associated memory. Importantly, the PLD-mGluR provides a novel therapeutic target for treating maladaptive fear memories in posttraumatic stress and anxiety disorders. PMID:26748024

Metabotropic glutamate receptor modulation of dopamine release in the nucleus accumbens shell is unaffected by phencyclidine pretreatment: In vitro assessment using fast-scan cyclic voltammetry rat brain slices.

PubMed

Gupta, Ishan; Young, Andrew M J

2018-05-15

The non-competitive glutamate antagonist, phencyclidine is used in rodents to model behavioural deficits see in schizophrenia. Importantly, these deficits endure long after the cessation of short-term chronic treatment (sub-chronic), indicating that the drug treatment causes long-term changes in the physiology and/or chemistry of the brain. There is evidence that this may occur through glutamatergic modulation of mesolimbic dopamine release, perhaps involving metabotropic glutamate receptors (mGluR). This study sought to investigate the effect of sub-chronic phencyclidine pretreatment on modulation of dopamine neurotransmission by metabotropic glutamate receptors 2 and 5 (mGluR2 and mGluR5) in the nucleus accumbens shell in vitro, with the hypothesis that phencyclidine pretreatment would disrupt the mGluR-mediated modulation of dopamine release. We showed that the orthosteric mGluR2 agonist LY379268 (0.1 µM, 1 µM and 10 µM) and mGluR5 positive allosteric modulator CDPPB (1 µM and 10 µM) both attenuated potassium-evoked dopamine release, underscoring their role in modulating dopamine neurotransmission in the nucleus accumbens. Sub-chronic PCP treatment, which caused cognitive deficits measured by performance in the novel object recognition task, modelling aspects of behavioral deficits seen in schizophrenia, induced neurobiological changes that enhanced dopamine release in the nucleus accumbens, but had no effect on mGluR2 or mGluR5 mediated changes in dopamine release. Therefore it is unlikely that schizophrenia-related behavioural changes seen after sub-chronic phencyclidine pre-treatment are mediated through mGluR modulation of dopamine release. Copyright © 2018 Elsevier B.V. All rights reserved.

Gluing silicon with silicone

NASA Astrophysics Data System (ADS)

Abt, I.; Fox, H.; Moshous, B.; Richter, R. H.; Riechmann, K.; Rietz, M.; Riedl, J.; Denis, R. St; Wagner, W.

1998-02-01

Problems and solutions concerning the gluing of silicon detectors are discussed. The R & D work for the HERA- B vertex detector system led to gluing studies with epoxy and silicone-based adhesives used on ceramics and carbon fibre. The HERA- B solution using a silicone glue is presented.

Differential distribution of glutamate- and GABA-gated chloride channels in the housefly Musca domestica.

PubMed

Kita, Tomo; Ozoe, Fumiyo; Azuma, Masaaki; Ozoe, Yoshihisa

2013-09-01

l-Glutamic acid (glutamate) mediates fast inhibitory neurotransmission by affecting glutamate-gated chloride channels (GluCls) in invertebrates. The molecular function and pharmacological properties of GluCls have been well studied, but not much is known about their physiological role and localization in the insect body. The distribution of GluCls in the housefly (Musca domestica L.) was thus compared with the distribution of γ-aminobutyric acid (GABA)-gated chloride channels (GABACls). Quantitative PCR and ligand-binding experiments indicate that the GluCl and GABACl transcripts and proteins are predominantly expressed in the adult head. Intense GluCl immunostaining was detected in the lamina, leg motor neurons, and legs of adult houseflies. The GABACl (Rdl) immunostaining was more widely distributed, and was found in the medulla, lobula, lobula plate, mushroom body, antennal lobe, and ellipsoid body. The present findings suggest that GluCls have physiological roles in different tissues than GABACls. Copyright © 2013 Elsevier Ltd. All rights reserved.

Tetrahydronaphthyridine and Dihydronaphthyridinone Ethers As Positive Allosteric Modulators of the Metabotropic Glutamate Receptor 5 (mGlu5)

PubMed Central

2015-01-01

Positive allosteric modulators (PAMs) of metabotropic glutamate receptor 5 (mGlu5) represent a promising therapeutic strategy for the treatment of schizophrenia. Starting from an acetylene-based lead from high throughput screening, an evolved bicyclic dihydronaphthyridinone was identified. We describe further refinements leading to both dihydronaphthyridinone and tetrahydronaphthyridine mGlu5 PAMs containing an alkoxy-based linkage as an acetylene replacement. Exploration of several structural features including western pyridine ring isomers, positional amides, linker connectivity/position, and combinations thereof, reveal that these bicyclic modulators generally exhibit steep SAR and within specific subseries display a propensity for pharmacological mode switching at mGlu5 as well as antagonist activity at mGlu3. Structure–activity relationships within a dihydronaphthyridinone subseries uncovered 12c (VU0405372), a selective mGlu5 PAM with good in vitro potency, low glutamate fold-shift, acceptable DMPK properties, and in vivo efficacy in an amphetamine-based model of psychosis. PMID:24914612

A comparison of GluR-A-deficient and wild-type mice on a test battery assessing sensorimotor, affective, and cognitive behaviors.

PubMed

Bannerman, D M; Deacon, R M J; Brady, S; Bruce, A; Sprengel, R; Seeburg, P H; Rawlins, J N P

2004-06-01

Previous studies have demonstrated a spatial working memory deficit in glutamate receptor (GluR)-A (GluR1) AMPA receptor subunit knockout mice. The present study evaluated male and female wild-type and GluR-A-/- mice on a test battery that assessed sensorimotor, affective, and cognitive behaviors. Results revealed a behavioral phenotype more extensive than previously described. GluR-A-/- mice were hyperactive, displayed a subtle lack of motor coordination, and were generally more anxious than wild-type controls. In addition, they showed a deficit in spontaneous alternation, consistent with previous reports of a role for GluR-A-dependent plasticity in hippocampus-dependent, spatial working memory. Although changes in motor coordination or anxiety cannot explain the dissociations already reported within the spatial memory domain, it is clear that they could significantly affect interpretation of results obtained in other kinds of behavioral tasks. ((c) 2004 APA, all rights reserved)

Lack of association between the APEX1 Asp148Glu polymorphism and sporadic amyotrophic lateral sclerosis.

PubMed

Coppedè, Fabio; Lo Gerfo, Annalisa; Carlesi, Cecilia; Piazza, Selina; Mancuso, Michelangelo; Pasquali, Livia; Murri, Luigi; Migliore, Lucia; Siciliano, Gabriele

2010-02-01

Impairments in DNA repair enzymes have been observed in amyotrophic lateral sclerosis (ALS) tissues, particularly in the activity of the apurinic/apyrimidinic endonuclease 1 (APEX1). Moreover, it was suggested that the common APEX1 Asp148Glu polymorphism might be associated with ALS risk. To further address this question we performed the present study aimed at evaluating the contribution of the APEX1 Asp148Glu polymorphism in sporadic ALS (sALS) risk and clinical presentation, including age and site of onset and disease progression. We screened 134 sALS Italian patients and 129 matched controls for the presence of the APEX1 Asp148Glu polymorphism. No difference in APEX1 Asp148Glu allele and genotype frequencies was found between the groups, nor was the polymorphism associated with age and site of onset or disease progression. Present results do not support a role for the APEX1 Asp148Glu polymorphism in sALS pathogenesis in the Italian population.

In vitro studies on radiosensitization effect of glucose capped gold nanoparticles in photon and ion irradiation of HeLa cells

NASA Astrophysics Data System (ADS)

Kaur, Harminder; Pujari, Geetanjali; Semwal, Manoj K.; Sarma, Asitikantha; Avasthi, Devesh Kumar

2013-04-01

Noble metal nanoparticles are of great interest due to their potential applications in diagnostics and therapeutics. In the present work, we synthesized glucose capped gold nanoparticle (Glu-AuNP) for internalization in the HeLa cell line (human cervix cancer cells). The capping of glucose on Au nanoparticle was confirmed by Raman spectroscopy. The Glu-AuNP did not show any toxicity to the HeLa cell. The γ-radiation and carbon ion irradiation of HeLa cell with and without Glu-AuNP were performed to evaluate radiosensitization effects. The study revealed a significant reduction in radiation dose for killing the HeLa cells with internalized Glu-AuNPs as compared to the HeLa cells without Glu-AuNP. The Glu-AuNP treatment resulted in enhancement of radiation effect as evident from increase in relative biological effectiveness (RBE) values for carbon ion irradiated HeLa cells.

GluN2B in corticostriatal circuits governs choice learning and choice shifting

PubMed Central

Brigman, Jonathan L.; Daut, Rachel; Wright, Tara; Gunduz-Cinar, Ozge; Graybeal, Carolyn; Davis, Margaret I.; Jiang, Zhihong; Saksida, Lisa; Jinde, Seiichiro; Pease, Matthew; Bussey, Timothy J.; Lovinger, David M.; Nakazawa, Kazu; Holmes, Andrew

2013-01-01

A choice that reliably produces a preferred outcome can be automated to liberate cognitive resources for other tasks. Should an outcome become less desirable, behavior must adapt in parallel or become perseverative. Corticostriatal systems are known to mediate choice learning and flexibility, but the molecular mechanisms subserving the instantiation of these processes are not well understood. We integrated mouse behavioral, immunocytochemical, in vivo electrophysiological, genetic, and pharmacological approaches to study choice. We found that the dorsal striatum (DS) was increasingly activated with choice learning, whereas reversal of learned choice engaged prefrontal regions. In vivo, DS neurons showed activity associated with reward anticipation and receipt that emerged with learning and relearning. Corticostriatal or striatal GluN2B gene deletion, or DS-restricted GluN2B antagonism, impaired choice learning, whereas cortical GluN2B deletion or OFC GluN2B antagonism impaired shifting. Our convergent data demonstrate how corticostriatal GluN2B circuits govern the ability to learn and shift choice behavior. PMID:23831965

Prenatal Exposure to Tributyltin Decreases GluR2 Expression in the Mouse Brain.

PubMed

Ishida, Keishi; Saiki, Takashi; Umeda, Kanae; Miyara, Masatsugu; Sanoh, Seigo; Ohta, Shigeru; Kotake, Yaichiro

2017-01-01

Tributyltin (TBT), a common environmental contaminant, is widely used as an antifouling agent in paint. We previously reported that exposure of primary cortical neurons to TBT in vitro decreased the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit glutamate receptor 2 (GluR2) expression and subsequently increased neuronal vulnerability to glutamate. Therefore, to identify whether GluR2 expression also decreases after TBT exposure in vivo, we evaluated the changes in GluR2 expression in the mouse brain after prenatal or postnatal exposure to 10 and 25 ppm TBT through pellet diets. Although the mean feed intake and body weight did not decrease in TBT-exposed mice compared with that in control mice, GluR2 expression in the cerebral cortex and hippocampus decreased after TBT exposure during the prenatal period. These results indicate that a decrease in neuronal GluR2 may be involved in TBT-induced neurotoxicity, especially during the fetal period.

Metabotropic glutamate receptors 1 and 5 differentially regulate bulbar dopaminergic cell function.

PubMed

Jian, Kuihuan; Cifelli, Pierangelo; Pignatelli, Angela; Frigato, Elena; Belluzzi, Ottorino

2010-10-01

Effects of activation of metabotropic glutamatergic receptors (mGluR) were investigated in mouse dopaminergic olfactory bulb neurons. After blockage of ionotropic receptors, focal application of glutamate or of group I/II mGluR agonist t-ACPD resulted in a depolarization, paralleled by an inward current in voltage-clamp conditions. The Group I agonist DHPG induced a depolarization, which could be largely blocked by mGluR1 antagonists. The DHPG action i) was prevented by buffering intracellular Ca(2+) with BAPTA and by a phospholipase C inhibitor; ii) was not affected by the block of Ca(2+) entry, and iii) was blocked by inhibitors of the Na(+)/Ca(2+) exchanger. These observations were interpreted as a mGluR1-mediated intracellular Ca(2+) release, followed by the activation of an electrogenic Na(+)/Ca(2+) exchanger. The mGluR5 agonist CHPG induced a hyperpolarization of membrane potential, resulting in a decrease of the spontaneous firing frequency. CHPG induced i) a decrease in membrane resistance; ii) an increase in the action potential repolarization rate, and iii) an increase in the amplitude of the afterhyperpolarization. This was interpreted as a mGluR5-mediated opening of a K(+) conductance. These data suggest that mGluR1 and mGluR5 play different and non-overlapping roles in the regulation of the excitability of bulbar dopaminergic neurons. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Therapeutic potential of targeting group III metabotropic glutamate receptors in the treatment of Parkinson's disease

PubMed Central

Duty, Susan

2010-01-01

Current drugs used in the treatment of Parkinson's disease (PD), for example, L-DOPA and dopamine agonists, are very effective at reversing the motor symptoms of the disease. However, they do little to combat the underlying degeneration of dopaminergic neurones in the substantia nigra pars compacta (SNc) and their long-term use is associated with the appearance of adverse effects such as L-DOPA-induced dyskinesia. Much emphasis has therefore been placed on finding alternative non-dopaminergic drugs that may circumvent some or all of these problems. Group III metabotropic glutamate (mGlu) receptors were first identified in the basal ganglia a decade ago. One or more of these receptors (mGlu4, mGlu7 or mGlu8) is found on pre-synaptic terminals of basal ganglia pathways whose overactivity is implicated not only in the generation of motor symptoms in PD, but also in driving the progressive SNc degeneration. The finding that drugs which activate group III mGlu receptors can inhibit transmission across these overactive synapses has lead to the proposal that group III mGlu receptors are promising targets for drug discovery in PD. This paper provides a comprehensive review of the role and target potential of group III mGlu receptors in the basal ganglia. Overwhelming evidence obtained from in vitro studies and animal models of PD supports group III mGlu receptors as potentially important drug targets for providing both symptom relief and neuroprotection in PD. PMID:20735415

Pharmacological reversal of synaptic plasticity deficits in the mouse model of fragile X syndrome by group II mGluR antagonist or lithium treatment.

PubMed

Choi, Catherine H; Schoenfeld, Brian P; Bell, Aaron J; Hinchey, Paul; Kollaros, Maria; Gertner, Michael J; Woo, Newton H; Tranfaglia, Michael R; Bear, Mark F; Zukin, R Suzanne; McDonald, Thomas V; Jongens, Thomas A; McBride, Sean M J

2011-03-22

Fragile X syndrome is the leading single gene cause of intellectual disabilities. Treatment of a Drosophila model of Fragile X syndrome with metabotropic glutamate receptor (mGluR) antagonists or lithium rescues social and cognitive impairments. A hallmark feature of the Fragile X mouse model is enhanced mGluR-dependent long-term depression (LTD) at Schaffer collateral to CA1 pyramidal synapses of the hippocampus. Here we examine the effects of chronic treatment of Fragile X mice in vivo with lithium or a group II mGluR antagonist on mGluR-LTD at CA1 synapses. We find that long-term lithium treatment initiated during development (5-6 weeks of age) and continued throughout the lifetime of the Fragile X mice until 9-11 months of age restores normal mGluR-LTD. Additionally, chronic short-term treatment beginning in adult Fragile X mice (8 weeks of age) with either lithium or an mGluR antagonist is also able to restore normal mGluR-LTD. Translating the findings of successful pharmacologic intervention from the Drosophila model into the mouse model of Fragile X syndrome is an important advance, in that this identifies and validates these targets as potential therapeutic interventions for the treatment of individuals afflicted with Fragile X syndrome. Copyright © 2010 Elsevier B.V. All rights reserved.

The effect of the mGlu5 negative allosteric modulator MTEP and NMDA receptor partial agonist D-cycloserine on Pavlovian conditioned fear.

PubMed

Handford, Charlotte E; Tan, Shawn; Lawrence, Andrew J; Kim, Jee Hyun

2014-09-01

The metabotropic glutamate receptor 5 (mGlu5) and N-methyl-D-aspartate (NMDA) receptor are critical for processes underlying synaptic plasticity, such as long-term potentiation. mGlu5 signaling increases neuronal excitability and potentiates NMDA receptor currents in the amygdala and the hippocampus. The present study examined the involvement of mGlu5 in the acquisition and consolidation of conditioned fear to a tone and context in mice, and explored the functional relationship between mGlu5 and NMDA receptors in this regard. Experiment 1 showed that systemic administration of the mGlu5 negative allosteric modulator 3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine (MTEP) prior to conditioning significantly attenuated cue-elicited freezing during fear conditioning, which suggests that mGlu5 is necessary for the formation of a tone-shock association. This effect was dose-related (Experiment 2) and not due to any effects of MTEP on shock sensitivity or state-dependency (Experiment 3). Post-conditioning injection of MTEP had no effects (Experiment 4). Although post-conditioning injection of the NMDA receptor partial agonist D-cycloserine (DCS) alone facilitated consolidation of conditioned fear (Experiment 6), it was not able to rescue the acquisition deficit caused by MTEP (Experiment 5). Taken together, these findings indicate a crucial role for mGlu5 signaling in acquisition and NMDA receptor signaling in consolidation of conditioned fear.

Interstrain differences of ionotropic glutamate receptor subunits in the hippocampus and induction of hippocampal sclerosis with pilocarpine in mice.

PubMed

Dobó, Endre; Török, Ibolya; Mihály, András; Károly, Norbert; Krisztin-Péva, Beáta

2015-01-01

Rodent strains used in epilepsy research have various neurological characteristics. These differences were suggested to be attributed to the diverse densities of the ionotropic glutamate receptor (iGluR) subunits. However, previous studies failed to find interstrain differences in the hippocampal receptor levels. We supposed that a detailed layer-to-layer analysis of the iGluR subunits in the hippocampus might reveal strain-dependent differences in their base lines and reactions induced by pilocarpine (PILO) between two mouse strains without documented ancestors. Levels of iGluR subunits in Balb/c and NMRI mice were compared using semiquantitative immunohistochemistry. The alterations in the neuronal circuitry were validated by neuropeptide Y (NPY) and neuronal nuclear antigen (NeuN) immunostainings. Immunohistochemistry showed interstrain laminar differences in some subunits of both the control and PILO-treated animals. The seizure-induced irreversible neuronal changes were accompanied by reduced GluA1 and GluA2 levels. Their changes were inversely correlated in the individual NMRI mice by Pearson's method. Increase in NPY immunoreactivity showed positive correlation with GluA1, and negative correlation with GluA2. The NMRI strain was susceptible to PILO-induced hippocampal sclerosis, while the Balb/c animals showed resistance. Basal levels of iGluRs differ in mouse strains, which may account for the interstrain differences in their reactions to the convulsant. Copyright © 2015 Elsevier B.V. All rights reserved.

Impact of oral supplementation of Glutamate and GABA on memory performance and neurochemical profile in hippocampus of rats.

PubMed

Tabassum, Saiqa; Ahmad, Saara; Madiha, Syeda; Khaliq, Saima; Shahzad, Sidrah; Batool, Zehra; Haider, Saida

2017-05-01

Glutamate (GLU) and gamma-amino butyric acid (GABA) are essential amino acids (AA) for brain function serving as excitatory and inhibitory neurotransmitter respectively. Their tablets are available in market for improving gut function and muscle performance. Despite of having a major role during memory formation and processing, effects of these tablets on brain functioning like learning and memory have not been investigated. Therefore, present study is aimed to investigate the effects of orally supplemented GLU and GABA on learning and memory performance and further to monitor related effects of these orally supplemented GLU and GABA on brain levels of these AA. Three groups of rats were supplemented orally with drinking water (control group) or suspension of tablets of GABA and Glutamate, respectively for four weeks. Cognitive performance was determined using behavioral tests (Novel object recognition test, Morris water maze, Passive avoidance test) measuring recognition, spatial reference and aversive memory. Levels of GLU, GABA and acetylcholine (ACh) were estimated in rat hippocampus. Results showed that chronic oral administration of GLU and GABA tablets has a significant impact on brain function and can alter GLU and GABA content in rat hippocampus. Compared to GABA, GLU supplementation specifically enhances memory performance via increasing ACh. Thus, GLU can be suggested as a useful supplement for improving learning and memory performance and neurochemical status of brain and in future could be effective in the treatment of neurological disorders affecting learning and memory performance.

T227. THE METABOTROPIC GLUTAMATE RECEPTOR SUBTYPE 1 REGULATES STRIATAL DOPAMINE RELEASE VIA AN ENDOCANNABINOID-DEPENDENT MECHANISM: IMPLICATIONS FOR THE TREATMENT OF SCHIZOPHRENIA

PubMed Central

Yohn, Samantha; Covey, Daniel; Foster, Daniel; Moehle, Mark; Galbraith, Jordan; Cheer, Joseph; Lindsley, Craig; Jeffrey Conn, P

2018-01-01

Abstract Background Clinical and preclinical studies suggest that selective activators of the muscarinic M4 receptor have exciting potential as a novel approach for treatment of schizophrenia. M4 reduces striatal dopamine (DA) though release of endocannabinoids (eCB), providing a mechanism for local effects on DA signaling in the striatum. M4 signals through Gαi/o and does not couple to Gαq/11 or induce calcium (Ca++) mobilization. This raises the possibility that M4-induced eCB release and inhibition of DA release may require co-activation of another receptor that activates Gαq/11. If so, this receptor could provide a novel target that may be more proximal to inhibition of DA release. Interestingly, the group 1 metabotropic glutamate (mGlu) receptors (mGlu1 and Glu5), couple to Gαq/11 and activate eCB signaling in multiple brain regions. Methods We tested the hypothesis that M4-induced reductions in DA release and subsequent antipsychotic-effect requires co-activation of group 1 mGlu receptors. The effect of M4 activation on electrically-evoked DA release in striatal slices was assessed using fast-scan cyclic voltammetry (FSCV) in the absence or presence of selective negative allosteric modulators (NAMs) of group 1 mGlu receptor subtypes. To evaluate the potential role of mGlu1, we determined the effects of a selective mGlu1 positive allosteric modulators (PAMs) on striatal DA release and antipsychotic-like activity in rodent models that are dependent on increased DA transmission. Since reductions in DA signaling, including D1 signaling have been implicated in reduced motivation, we also determined the effects of an mGlu1 PAM, M4 PAM, and the typical antipsychotic haloperidol on motivational responding in a progressive ratio (PR) schedule. Results We now present exciting new data in which we found that activation of mGlu1 through application of exogenous agonists or selective stimulation of thalamostriatal afferents induces a reduction of striatal DA release and that selective mGlu1 PAMs have robust antipsychotic-like effects in rodent models. Interestingly, our studies also suggest that mGlu1 activation is required for M4 PAM-induced inhibition of DA release and antipsychotic-like effects. However, in contrast to available antipsychotic agents, the present results and previous studies suggest that mGlu1 and M4 PAMs reduce DA signaling through local release of an eCB from striatal SPNs and activation of CB2 receptors on neighboring DA terminals to reduce DA release. While these studies suggest that the effects of M4 PAMs on DA release require activation of mGlu1, we have also found that these targets have important differences. Most notably, M4 PAMs also directly inhibits D1 signaling in D1-SPN terminals in the substatnia nigra pars reticulata (SNr). Unlike M4, mGlu1 does not directly inhibit DA D1 receptor signaling and does not induce behavioral changes that could be associated with negative symptoms. Discussion Our findings are especially interesting in light of recent findings that multiple loss of function single nucleotide polymorphisms (SNPs) in the human gene encoding mGlu1 (GRM1) are associated with schizophrenia, and points to GRM1/mGlu1 as a gene within the “druggable genome” that could be targeted for treatment of schizophrenia. Recent clinical imaging studies suggesting that symptoms in schizophrenia patients are associated with selective increases in striatal DA signaling and while extrastriatal regions display hypo-dopaminergic function; thus, mGlu1 and M4 PAMs may provide a mechanism for selective inhibition of DA release in striatal regions that are important for antipsychotic efficacy, without further disruptions in extrastriatal DA signaling.

GluN1 and GluN2A NMDA Receptor Subunits Increase in the Hippocampus during Memory Consolidation in the Rat.

PubMed

Cercato, Magali C; Vázquez, Cecilia A; Kornisiuk, Edgar; Aguirre, Alejandra I; Colettis, Natalia; Snitcofsky, Marina; Jerusalinsky, Diana A; Baez, María V

2016-01-01

It is widely accepted that NMDA receptors (NMDAR) are required for learning and memory formation, and for synaptic plasticity induction. We have previously shown that hippocampal GluN1 and GluN2A NMDAR subunits significantly increased following habituation of rats to an open field (OF), while GluN2B remained unchanged. Similar results were obtained after CA1-long-term potentiation (LTP) induction in rat hippocampal slices. Other studies have also shown NMDAR up regulation at earlier and later time points after LTP induction or learning acquisition. In this work, we have studied NMDAR subunits levels in the hippocampus and prefrontal cortex (PFC) after OF habituation and after object recognition (OR), to find out whether rising of NMDAR subunits is a general and structure-specific feature during memory formation. In 1, 2 and 3 month old rats there was an increase in hippocampal GluN1 and GluN2A, but not in GluN2B levels 70 min after OF habituation. This rise overlaps with early phase of memory consolidation, suggesting a putative relationship between them. The increases fell down to control levels 90 min after training. Similar results were obtained in the hippocampus of adult rats 70 min after OR training, without changes in PFC. Following OF test or OR discrimination phase, NMDAR subunits remained unchanged. Hence, rising of hippocampal GluN1 and GluN2A appears to be a general feature after novel "spatial/discrimination" memory acquisition. To start investigating the dynamics and possible mechanisms of these changes, we have studied hippocampal neuron cultures stimulated by KCl to induce plasticity. GluN1 and GluN2A increased both in dendrites and neuronal bodies, reaching a maximum 75 min later and returning to control levels at 90 min. Translation and/or transcription and mobilization differentially contribute to this rise in subunits in bodies and dendrites. Our results showed that the NMDAR subunits increase follows a similar time course both in vitro and in vivo . These changes happen in the hippocampus where a spatial representation of the environment is being formed making possible short term and long term memories (STM and LTM); appear to be structure-specific; are preserved along life; and could be related to synaptic tagging and/or to memory consolidation of new spatial/discrimination information.

Computer-aided design of negative allosteric modulators of metabotropic glutamate receptor 5 (mGluR5): Comparative molecular field analysis of aryl ether derivatives.

PubMed

Selvam, Chelliah; Thilagavathi, Ramasamy; Narasimhan, Balasubramanian; Kumar, Pradeep; Jordan, Brian C; Ranganna, Kasturi

2016-02-15

The metabotropic glutamate receptors (mGlu receptors) have emerged as attractive targets for number of neurological and psychiatric disorders. Recently, mGluR5 negative allosteric modulators (NAMs) have gained considerable attention in pharmacological research. Comparative molecular field analysis (CoMFA) was performed on 73 analogs of aryl ether which were reported as mGluR5 NAMs. The study produced a statistically significant model with high correlation coefficient and good predictive abilities. Published by Elsevier Ltd.

[Correlation between succinate-dependent Ca2+ accumulation and transamination in the heart and the liver mitochondria of experimental animals].

PubMed

Saakian, I R; Saakian, G G

2006-01-01

Glutamate (GLU) and alpha-ketoglutarate (KGL), the substrates involved in transamination, have reciprocal effects on succinate-dependent respiration, NADH reduction, as well as on the accumulation and stable retention of Ca2+ in heart and liver mitochondria and homogenates from experimental animals. The succinate-dependent Ca2+ accumulation was shown to be highly sensitive to changes of the concentration ratios of GLU and KGL within the range 1:10 mM. GLU activated this process by transamination of oxalacetate (OAA) to aspartate. The predomination of KGL blocked the activating effect of GLU. The predomination of GLU eliminated the block produced by KGL or phosphoenolpyruvate (sources of OAA and GTP) but did not eliminate the Ca2+ accumulation-suppressing effect of aminoacetate, inhibitor of transaminases.

Crystal structure and association behaviour of the GluR2 amino-terminal domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jin, Rongsheng; Singh, Satinder K.; Gu, Shenyan

2009-09-02

Fast excitatory neurotransmission is mediated largely by ionotropic glutamate receptors (iGluRs), tetrameric, ligand-gated ion channel proteins comprised of three subfamilies, AMPA, kainate and NMDA receptors, with each subfamily sharing a common, modular-domain architecture. For all receptor subfamilies, active channels are exclusively formed by assemblages of subunits within the same subfamily, a molecular process principally encoded by the amino-terminal domain (ATD). However, the molecular basis by which the ATD guides subfamily-specific receptor assembly is not known. Here we show that AMPA receptor GluR1- and GluR2-ATDs form tightly associated dimers and, by the analysis of crystal structures of the GluR2-ATD, propose mechanismsmore » by which the ATD guides subfamily-specific receptor assembly.« less

Structure of an agonist-bound ionotropic glutamate receptor.

PubMed

Yelshanskaya, Maria V; Li, Minfen; Sobolevsky, Alexander I

2014-08-29

Ionotropic glutamate receptors (iGluRs) mediate most excitatory neurotransmission in the central nervous system and function by opening their ion channel in response to binding of agonist glutamate. Here, we report a structure of a homotetrameric rat GluA2 receptor in complex with partial agonist (S)-5-nitrowillardiine. Comparison of this structure with the closed-state structure in complex with competitive antagonist ZK 200775 suggests conformational changes that occur during iGluR gating. Guided by the structures, we engineered disulfide cross-links to probe domain interactions that are important for iGluR gating events. The combination of structural information, kinetic modeling, and biochemical and electrophysiological experiments provides insight into the mechanism of iGluR gating. Copyright © 2014, American Association for the Advancement of Science.

Numb deficiency in cerebellar Purkinje cells impairs synaptic expression of metabotropic glutamate receptor and motor coordination.

PubMed

Zhou, Liang; Yang, Dong; Wang, De-Juan; Xie, Ya-Jun; Zhou, Jia-Huan; Zhou, Lin; Huang, Hao; Han, Shuo; Shao, Chong-Yu; Li, Hua-Shun; Zhu, J Julius; Qiu, Meng-Sheng; De Zeeuw, Chris I; Shen, Ying

2015-12-15

Protein Numb, first identified as a cell-fate determinant in Drosophila, has been shown to promote the development of neurites in mammals and to be cotransported with endocytic receptors in clathrin-coated vesicles in vitro. Nevertheless, its function in mature neurons has not yet been elucidated. Here we show that cerebellar Purkinje cells (PCs) express high levels of Numb during adulthood and that conditional deletion of Numb in PCs is sufficient to impair motor coordination despite maintenance of a normal cerebellar cyto-architecture. Numb proved to be critical for internalization and recycling of metabotropic glutamate 1 receptor (mGlu1) in PCs. A significant decrease of mGlu1 and an inhibition of long-term depression at the parallel fiber-PC synapse were observed in conditional Numb knockout mice. Indeed, the trafficking of mGlu1 induced by agonists was inhibited significantly in these mutants, but the expression of ionotropic glutamate receptor subunits and of mGlu1-associated proteins was not affected by the loss of Numb. Moreover, transient and persistent forms of mGlu1 plasticity were robustly induced in mutant PCs, suggesting that they do not require mGlu1 trafficking. Together, our data demonstrate that Numb is a regulator for constitutive expression and dynamic transport of mGlu1.

Trafficking of α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid Receptor (AMPA) Receptor Subunit GluA2 from the Endoplasmic Reticulum Is Stimulated by a Complex Containing Ca2+/Calmodulin-activated Kinase II (CaMKII) and PICK1 Protein and by Release of Ca2+ from Internal Stores*

PubMed Central

Lu, Wei; Khatri, Latika; Ziff, Edward B.

2014-01-01

The GluA2 subunit of the AMPA receptor (AMPAR) dominantly blocks AMPAR Ca2+ permeability, and its trafficking to the synapse regulates AMPAR-dependent synapse Ca2+ permeability. Here we show that GluA2 trafficking from the endoplasmic reticulum (ER) to the plasma membrane of cultured hippocampal neurons requires Ca2+ release from internal stores, the activity of Ca2+/calmodulin activated kinase II (CaMKII), and GluA2 interaction with the PDZ protein, PICK1. We show that upon Ca2+ release from the ER via the IP3 and ryanodine receptors, CaMKII that is activated enters a complex that contains PICK1, dependent upon the PICK1 BAR (Bin-amphiphysin-Rvs) domain, and that interacts with the GluA2 C-terminal domain and stimulates GluA2 ER exit and surface trafficking. This study reveals a novel mechanism of regulation of trafficking of GluA2-containing receptors to the surface under the control of intracellular Ca2+ dynamics and CaMKII activity. PMID:24831007

3α5β-Pregnanolone glutamate, a use-dependent NMDA antagonist, reversed spatial learning deficit in an animal model of schizophrenia.

PubMed

Vales, Karel; Rambousek, Lukas; Holubova, Kristina; Svoboda, Jan; Bubenikova-Valesova, Vera; Chodounska, Hana; Vyklicky, Ladislav; Stuchlik, Ales

2012-11-01

Neuroactive steroids modulate receptors for neurotransmitters in the brain and thus might be efficacious in the treatment of various diseases of the central nervous system such as schizophrenia. We have designed and synthetized a novel use-dependent NMDA receptor antagonist 3α5β-pregnanolone glutamate (3α5β-P-Glu). In this study, we evaluate procognitive properties of 3α5β-P-Glu in an animal model of schizophrenia induced by systemic application of MK-801. The procognitive properties were evaluated using active place avoidance on a rotating arena (Carousel maze). We evaluated effects of 3α5β-P-Glu on the avoidance, on locomotor activity, and anxiety. 3α5β-P-Glu alone altered neither spatial learning nor locomotor activity in control animals. In the model animals, 3α5β-P-Glu reversed the MK-801-induced cognitive deficit without reducing hyperlocomotion. The highest dose of 3α5β-P-Glu also showed anxiolytic properties. Taken together, 3α5β-P-Glu may participate in the restoration of normal brain functioning and these results may facilitate the development of new promising drugs improving cognitive functioning in schizophrenia. Copyright © 2012 Elsevier B.V. All rights reserved.

Glucose-6-phosphate dehydrogenase-6-phosphogluconolactonase: a unique bifunctional enzyme from Plasmodium falciparum.

PubMed

Jortzik, Esther; Mailu, Boniface M; Preuss, Janina; Fischer, Marina; Bode, Lars; Rahlfs, Stefan; Becker, Katja

2011-06-15

The survival of malaria parasites in human RBCs (red blood cells) depends on the pentose phosphate pathway, both in Plasmodium falciparum and its human host. G6PD (glucose-6-phosphate dehydrogenase) deficiency, the most common human enzyme deficiency, leads to a lack of NADPH in erythrocytes, and protects from malaria. In P. falciparum, G6PD is combined with the second enzyme of the pentose phosphate pathway to create a unique bifunctional enzyme named GluPho (glucose-6-phosphate dehydrogenase-6-phosphogluconolactonase). In the present paper, we report for the first time the cloning, heterologous overexpression, purification and kinetic characterization of both enzymatic activities of full-length PfGluPho (P. falciparum GluPho), and demonstrate striking structural and functional differences with the human enzymes. Detailed kinetic analyses indicate that PfGluPho functions on the basis of a rapid equilibrium random Bi Bi mechanism, where the binding of the second substrate depends on the first substrate. We furthermore show that PfGluPho is inhibited by S-glutathionylation. The availability of recombinant PfGluPho and the major differences to hG6PD (human G6PD) facilitate studies on PfGluPho as an excellent drug target candidate in the search for new antimalarial drugs.

The GluN2A Subunit Regulates Neuronal NMDA receptor-Induced Microglia-Neuron Physical Interactions.

PubMed

Eyo, Ukpong B; Bispo, Ashley; Liu, Junting; Sabu, Sruchika; Wu, Rong; DiBona, Victoria L; Zheng, Jiaying; Murugan, Madhuvika; Zhang, Huaye; Tang, Yamei; Wu, Long-Jun

2018-01-16

Microglia are known to engage in physical interactions with neurons. However, our understanding of the detailed mechanistic regulation of microglia-neuron interactions is incomplete. Here, using high resolution two photon imaging, we investigated the regulation of NMDA receptor-induced microglia-neuron physical interactions. We found that the GluN2A inhibitor NVPAAM007, but not the GluN2B inhibitor ifenprodil, blocked the occurrence of these interactions. Consistent with the well-known developmental regulation of the GluN2A subunit, these interactions are absent in neonatal tissues. Furthermore, consistent with a preferential synaptic localization of GluN2A subunits, there is a differential sensitivity of their occurrence between denser (stratum radiatum) and less dense (stratum pyramidale) synaptic sub-regions of the CA1. Finally, consistent with differentially expressed GluN2A subunits in the CA1 and DG areas of the hippocampus, these interactions could not be elicited in the DG despite robust microglial chemotactic capabilities. Together, these results enhance our understanding of the mechanistic regulation of NMDA receptor-dependent microglia-neuronal physical interactions phenomena by the GluN2A subunit that may be relevant in the mammalian brain during heightened glutamatergic neurotransmission such as epilepsy and ischemic stroke.

Structure-Activity Relationship Study of Ionotropic Glutamate Receptor Antagonist (2S,3R)-3-(3-Carboxyphenyl)pyrrolidine-2-carboxylic Acid.

PubMed

Krogsgaard-Larsen, Niels; Storgaard, Morten; Møller, Charlotte; Demmer, Charles S; Hansen, Jeanette; Han, Liwei; Monrad, Rune N; Nielsen, Birgitte; Tapken, Daniel; Pickering, Darryl S; Kastrup, Jette S; Frydenvang, Karla; Bunch, Lennart

2015-08-13

Herein we describe the first structure-activity relationship study of the broad-range iGluR antagonist (2S,3R)-3-(3-carboxyphenyl)pyrrolidine-2-carboxylic acid (1) by exploring the pharmacological effect of substituents in the 4, 4', or 5' positions and the bioisosteric substitution of the distal carboxylic acid for a phosphonic acid moiety. Of particular interest is a hydroxyl group in the 4' position 2a which induced a preference in binding affinity for homomeric GluK3 over GluK1 (Ki = 0.87 and 4.8 μM, respectively). Two X-ray structures of ligand binding domains were obtained: 2e in GluA2-LBD and 2f in GluK1-LBD, both at 1.9 Å resolution. Compound 2e induces a D1-D2 domain opening in GluA2-LBD of 17.3-18.8° and 2f a domain opening in GluK1-LBD of 17.0-17.5° relative to the structures with glutamate. The pyrrolidine-2-carboxylate moiety of 2e and 2f shows a similar binding mode as kainate. The 3-carboxyphenyl ring of 2e and 2f forms contacts comparable to those of the distal carboxylate in kainate.

Oxaloacetate decreases the infarct size and attenuates the reduction in evoked responses after photothrombotic focal ischemia in the rat cortex.

PubMed

Nagy, David; Marosi, Mate; Kis, Zsolt; Farkas, Tamas; Rakos, Gabriella; Vecsei, Laszlo; Teichberg, Vivian I; Toldi, Jozsef

2009-09-01

A traumatic brain injury or a focal brain lesion is followed by acute excitotoxicity caused by the presence of abnormally high glutamate (Glu) levels in the cerebrospinal and interstitial fluids. It has recently been demonstrated that this excess Glu in the brain can be eliminated into the blood following the intravenous administration of oxaloacetate (OxAc), which, by scavenging the blood Glu, induces an enhanced and neuroprotective brain-to-blood Glu efflux. In this study, we subjected rats to a photothrombotic lesion and treated them after the illumination with a single 30-min-long administration of OxAc (1.2 mg/100 g, i.v.). Following induction of the lesion, we measured the infarct size and the amplitudes of the somatosensory evoked potentials (SEPs) as recorded from the skull surface. The photothrombotic lesion resulted in appreciably decreased amplitudes of the evoked potentials, but OxAc administration significantly attenuated this reduction, and also the infarct size assessed histologically. We suggest that the neuroprotective effects of OxAc are due to its blood Glu-scavenging activity, which, by increasing the brain-to-blood Glu efflux, reduces the excess Glu responsible for the anatomical and functional correlates of the ischemia, as evaluated by electrophysiological evoked potential (EP) measurements.

Prolonged post-inhibitory rebound firing in the cerebellar nuclei mediated by group I mGluR potentiation of L-type Ca currents

PubMed Central

Zheng, Nan; Raman, Indira M.

2011-01-01

Neurons in the cerebellar nuclei fire at accelerated rates for prolonged periods after trains of synaptic inhibition that interrupt spontaneous firing. Both in vitro and in vivo, however, this prolonged rebound firing is favored by strong stimulation of afferents, suggesting that neurotransmitters other than GABA may contribute to the increased firing rates. Here, we tested whether metabotropic glutamate receptors modulate excitability of nuclear cells in cerebellar slices from mouse. In current clamp, the prolonged rebound firing rate after high-frequency synaptic stimulation was reduced by a variety of group I mGluR antagonists, including CPCCOEt (7-(hydroxyimino)cyclopropa[b]chromen-1a-carboxylate ethyl ester), JNJ16259685 ((3,4-dihydro-2H-pyrano[2,3-b]quinolin-7-yl)-(cis-4-methoxycyclohexyl)-methanone)+MPEP, or 3-MATIDA (α-amino-5-carboxy-3-methyl-2-thiopheneacetic acid) +MPEP, as long as both mGluR1 and mGluR5 were blocked. This mGluR-dependent acceleration of firing was reduced but still evident when IPSPs were prevented by GABAA receptor antagonists. In voltage clamp, voltage ramps revealed a non-inactivating, low-voltage-activated, nimodipine-sensitive current that was enhanced by the selective group I mGluR agonist s-DHPG ((S)-3,5-dihydroxyphenylglycine). This putative L-type current also increased when mGluRs were activated by trains of evoked synaptic currents instead of direct application of agonist. In current clamp, blocking L-type Ca channels with the specific blocker nifedipine greatly reduced prolonged post-stimulus firing and occluded the effect of adding group I mGluR antagonists. Thus, potentiation of a low-voltage-activated L-type current by synaptically released glutamate accounted nearly fully for the mGluR-dependent acceleration of firing. Together, these data suggest that prolonged rebound firing in the cerebellar nuclei in vivo is most likely to occur when GABAA and mGluRs are simultaneously activated by concurrent excitation and inhibition. PMID:21753005

Gallium-67-labeled lactam bridge-cyclized alpha-melanocyte stimulating hormone peptide for primary and metastatic melanoma imaging.

PubMed

Guo, Haixun; Yang, Jianquan; Shenoy, Nalini; Miao, Yubin

2009-12-01

The purpose of this study was to examine the melanoma imaging properties of a novel 67Ga-labeled lactam bridge-cyclized alpha-melanocyte stimulating hormone (alpha-MSH) peptide. A lactam bridge-cyclized alpha-MSH peptide, DOTA-GlyGlu-CycMSH {DOTA-Gly-Glu-c[Lys-Nle-Glu-His-DPhe-Arg-Trp-Gly-Arg-Pro-Val-Asp]}, was synthesized and radiolabeled with 67Ga. The melanoma targeting and pharmacokinetic properties of 67Ga-DOTA-GlyGlu-CycMSH were determined in B16/F1 flank primary melanoma-bearing and B16/F10 pulmonary metastatic melanoma-bearing C57 mice. Flank primary melanoma and pulmonary metastatic melanoma imaging were performed by small animal single photon emission computed tomography (SPECT)/CT using 67Ga-DOTA-GlyGlu-CycMSH as an imaging probe. 67Ga-DOTA-GlyGlu-CycMSH was readily prepared with greater than 95% radiolabeling yield. 67Ga-DOTA-GlyGlu-CycMSH exhibited substantial tumor uptake (12.93 +/- 1.63%ID/g at 2 h postinjection) and prolonged tumor retention (5.02 +/- 1.35%ID/g at 24 h postinjection) in B16/F1 melanoma-bearing C57 mice. The uptake values for nontarget organs were generally low (<0.30%ID/g) except for the kidneys at 2, 4, and 24 h postinjection. 67Ga-DOTA-GlyGlu-CycMSH exhibited significantly (p < 0.05) higher uptakes (1.44 +/- 0.75%ID/g at 2 h postinjection and 1.49 +/- 0.69%ID/g at 4 h postinjection) in metastatic melanoma-bearing lung than those in normal lung (0.15 +/- 0.10%ID/g and 0.17 +/- 0.11%ID/g at 2 and 4 h postinjection, respectively). Both flank primary B16/F1 melanoma and B16/F10 pulmonary melanoma metastases were clearly visualized by SPECT/CT using 67Ga-DOTA-GlyGlu-CycMSH as an imaging probe 2 h postinjection. 67Ga-DOTA-GlyGlu-CycMSH exhibited favorable melanoma targeting and imaging properties, highlighting its potential as an effective imaging probe for early detection of primary and metastatic melanoma.

Genetic inactivation of mGlu5 receptor improves motor coordination in the Grm1crv4 mouse model of SCAR13 ataxia.

PubMed

Bossi, Simone; Musante, Ilaria; Bonfiglio, Tommaso; Bonifacino, Tiziana; Emionite, Laura; Cerminara, Maria; Cervetto, Chiara; Marcoli, Manuela; Bonanno, Giambattista; Ravazzolo, Roberto; Pittaluga, Anna; Puliti, Aldamaria

2018-01-01

Deleterious mutations in the glutamate receptor metabotropic 1 gene (GRM1) cause a recessive form of cerebellar ataxia, SCAR13. GRM1 and GRM5 code for the metabotropic glutamate type 1 (mGlu1) and type 5 (mGlu5) receptors, respectively. Their different expression profiles suggest they could have distinct functional roles. In a previous study, homozygous mice lacking mGlu1 receptors (Grm1 crv4/crv4 ) and exhibiting ataxia presented cerebellar overexpression of mGlu5 receptors, that was proposed to contribute to the mouse phenotype. To test this hypothesis, we here crossed Grm1 crv4 and Grm5 ko mice to generate double mutants (Grm1 crv4/crv4 Grm5 ko/ko ) lacking both mGlu1 and mGlu5 receptors. Double mutants and control mice were analyzed for spontaneous behavior and for motor activity by rotarod and footprint analyses. In the same mice, the release of glutamate from cerebellar nerve endings (synaptosomes) elicited by 12mM KCl or by α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) was also evaluated. Motor coordination resulted improved in double mutants when compared to Grm1 crv4/crv4 mice. Furthermore, in in vitro studies, glutamate release elicited by both KCl depolarization and activation of AMPA autoreceptors resulted reduced in Grm1 crv4/crv4 mice compared to wild type mice, while it presented normal levels in double mutants. Moreover, we found that Grm1 crv4/crv4 mice showed reduced expression of GluA2/3 AMPA receptor subunits in cerebellar synaptosomes, while it resulted restored to wild type level in double mutants. To conclude, blocking of mGlu5 receptor reduced the dysregulation of glutamate transmission and improved motor coordination in the Grm1 crv4 mouse model of SCAR13, thus suggesting the possible usefulness of pharmacological therapies based on modulation of mGlu5 receptor activity for the treatment of this type of ataxia. Copyright © 2017 Elsevier Inc. All rights reserved.

Postsynaptic and presynaptic group II metabotropic glutamate receptor activation reduces neuronal excitability in rat midline paraventricular thalamic nucleus.

PubMed

Hermes, M L H J; Renaud, L P

2011-03-01

Drugs that interact with group II metabotropic glutamate receptors (mGluRs) are presently being evaluated for a role in the treatment of anxiety disorders and symptoms of schizophrenia. Their mechanism of action is believed to involve a reduction in excitatory neurotransmission in limbic and forebrain regions commonly associated with these mental disorders. In rodents, the glutamatergic neurons in the midline paraventricular thalamic nucleus (PVT) provide excitatory inputs to the limbic system and forebrain. PVT also displays a high density of group II mGluRs, predominantly the metabotropic glutamate 2 receptor (mGluR2). Because the role of group II mGluRs in regulating cellular and synaptic excitability in this location has yet to be determined, we used whole-cell patch-clamp recording and acute rat brain slice preparations to evaluate PVT neuron responses to a selective group II mGluR agonist, (1R,4R,5S,6R)-4-amino-2-oxabicyclo[3.1.0]hexane-4,6-dicarboxylic acid (LY 379268). LY 379268 consistently induced membrane hyperpolarization and suppressed firing by postsynaptic receptor-mediated activation of a barium-sensitive background K(+) conductance. This effect could be blocked by (2S)-2-amino-2-[(1S,2S)-2-carboxycycloprop-1-yl]-3-(xanth-9-yl)propanoic acid (LY 341495), a selective group II mGluR antagonist. In addition, LY 379268 acted at presynaptic receptors to reduce ionotropic glutamate receptor-mediated excitatory synaptic transmission. An mGluR2-positive allosteric modulator, 2,2,2-trifluoro-N-[4-(2-methoxyphenoxy)phenyl]-N-(3-pyridinylmethyl)ethanesulfonamide hydrochloride (LY 487379), resulted in leftward shifts of the LY 379268 dose-response curve for both postsynaptic and presynaptic actions. The data demonstrate that activation of postsynaptic and presynaptic group II (presumably mGluR2) mGluRs reduces neuronal excitability in midline thalamus, an action that may contribute to the effectiveness of mGluR2-activating drugs in rodent models of anxiety and psychosis.

Activation of ERK1/2 and PI3K/Akt by IGF-1 on GAP-43 expression in DRG neurons with excitotoxicity induced by glutamate in vitro.

PubMed

Liu, Zhen; Cai, Heng; Zhang, Ping; Li, Hao; Liu, Huaxiang; Li, Zhenzhong

2012-03-01

Insulin-like growth factor-1 (IGF-1) is a neurotrophic factor and plays an important role in promoting axonal growth from dorsal root ganglion (DRG) neurons. Whether IGF-1 influences growth-associated protein 43 (GAP-43) expression and activates the extracellular signal-regulated protein kinase (ERK1/2) and the phosphatidylinositol 3-kinase (PI3K)/Akt signaling pathways in DRG neurons with excitotoxicity induced by glutamate (Glu) remains unknown. In this study, embryonic 15-day-old rat DRG explants were cultured for 48 h and then exposed to IGF-1, Glu, Glu + IGF-1, Glu + IGF-1 + PD98059, Glu + IGF-1 + LY294002, Glu + IGF-1 + PD98059 + LY294002 for additional 12 h. The DRG explants were continuously exposed to growth media as control. The levels of GAP-43 mRNA were detected by real time-PCR analysis. The protein levels of GAP-43, phosphorylated ERK1/2, phosphorylated Akt, total ERK1/2, and total Akt were detected by Western blot assay. GAP-43 expression in situ was determined by immunofluorescent labeling. Apoptotic cell death was monitored by Hoechst 33342 staining. IGF-1 alone increased GAP-43 and its mRNA levels in the absence of Glu. The decreased GAP-43 and its mRNA levels caused by Glu could be partially reversed by the presence of IGF-1. IGF-1 rescued neuronal cell death caused by Glu. Neither the ERK1/2 inhibitor PD98059 nor the PI3K inhibitor LY294002 blocked the effect of IGF-1, but both inhibitors together were effective. To validate the impact of GAP-43 expression by IGF-1, GAP-43 induction was blocked by administration of dexamethasone (DEX). IGF-1 partially rescued the decrease of GAP-43 and its mRNA levels induced by DEX. DEX induced an increase of cell apoptosis. IGF-1 may play an important role in neuroprotective effects on DRG neurons through regulating GAP-43 expression with excitotoxicity induced by Glu and the process was involved in both ERK1/2 and PI3K/Akt signaling pathways.

Preclinical evaluation of the antipsychotic potential of the mGlu2-positive allosteric modulator JNJ-40411813

PubMed Central

Lavreysen, Hilde; Langlois, Xavier; Donck, Luc Ver; Nuñez, José María Cid; Pype, Stefan; Lütjens, Robert; Megens, Anton

2015-01-01

JNJ-40411813/ADX71149 (1-butyl-3-chloro-4-(4-phenylpiperidin-1-yl) pyridin-2(1H)-one) is a positive allosteric modulator (PAM) of the mGlu2 receptor, which also displays 5-Hydroxytryptamine (5HT2A) antagonism after administration in rodents due to a rodent-specific metabolite. JNJ-40411813 was compared with the orthosteric mGlu2/3 agonist LY404039 (4-amino-2-thiabicyclo [3.1.0] hexane-4,6-dicarboxylic acid 2,2-dioxide), the selective mGlu2 PAM JNJ-42153605 (3-(cyclopropylmethyl)-7-(4-phenylpiperidin-1-yl)-8-(trifluoromethyl)[1,2,4]triazolo[4,3-a]pyridine) and the 5HT2A antagonist ritanserin in rodent models for antipsychotic activity and potential side effects, attempting to differentiate between the various compounds and mechanisms of action. In mice, JNJ-40411813, JNJ-42153605, and LY404039 inhibited spontaneous locomotion and phencyclidine- and scopolamine-induced but not d-amphetamine-induced hyperlocomotion; the 5HT2A antagonist ritanserin inhibited only spontaneous locomotion and phencyclidine-induced hyperlocomotion. As measured by 2-deoxyglucose uptake, all compounds reversed memantine-induced brain activation in mice. The two mGlu2 PAMs and LY404039, but not ritanserin, inhibited conditioned avoidance behavior in rats. Like ritanserin, the mGlu2 ligands antagonized 2,5-dimethoxy-4-methylamphetamine-induced head twitches in rats. LY404039 but not the mGlu2 PAMs impaired rotarod performance in rats and increased the acoustic startle response in mice. Our results show that although 5HT2A antagonism has effect in some models, mGlu2 receptor activation is sufficient for activity in several animal models of antipsychotic activity. The mGlu2 PAMs mimicked the in vivo pharmacodynamic effects observed with LY404039 except for effects on the rotarod and acoustic startle, suggesting that they produce a primary activity profile similar to that of the mGlu2/3 receptor agonist while they can be differentiated based on their secondary activity profile. The results are discussed in light of clinical data available for some of these molecules, in particular JNJ-40411813. PMID:25692027

Metabotropic glutamate receptor 5 shows different patterns of localization within the parallel visual pathways in macaque and squirrel monkeys.

PubMed

Shostak, Yuri; Wenger, Ashley; Mavity-Hudson, Julia; Casagrande, Vivien A

2014-09-24

Glutamate is used as an excitatory neurotransmitter by the koniocellular (K), magnocellular (M), and parvocellular (P) pathways to transfer signals from the primate lateral geniculate nucleus (LGN) to primary visual cortex (V1). Glutamate acts through both fast ionotropic receptors, which appear to carry the main sensory message, and slower, modulatory metabotropic receptors (mGluRs). In this study, we asked whether mGluR5 relates in distinct ways to the K, M, and P LGN axons in V1. To answer this question, we used light microscopic immunocytochemistry and preembedding electron microscopic immunogold labeling to determine the localization of mGluR5 within the layers of V1 in relation to the K, M, and P pathways in macaque and squirrel monkeys. These pathways were labeled separately via wheat germ agglutinin-horseradish peroxidase (WGA-HRP) injections targeting the LGN layers. mGluR5 is of interest because it: 1) has been shown to be expressed in the thalamic input layers; 2) appears to be responsible for some types of oscillatory firing, which could be important in the binding of visual features; and 3) has been associated with a number of sensory-motor gating-related pathologies, including schizophrenia and autism. Our results demonstrated the presence of mGluR5 in the neuropil of all V1 layers. This protein was lowest in IVCα (M input) and the infragranular layers. In layer IVC, mGluR5 also was found postsynaptic to about 30% of labeled axons, but the distribution was uneven, such that postsynaptic mGluR5 label tended to occur opposite smaller (presumed P), and not larger (presumed M) axon terminals. Only in the K pathway in layer IIIB, however, was mGluR5 always found in the axon terminals themselves. The presence of mGluR5 in K axons and not in M and P axons, and the presence of mGluR5 postsynaptic mainly to smaller P and not larger M axons suggest that the response to the release of glutamate is modulated in distinct ways within and between the parallel visual pathways of primates.

Glutamyl aminopeptidase in microvesicular and exosomal fractions of urine is related with renal dysfunction in cisplatin-treated rats.

PubMed

Quesada, Andrés; Segarra, Ana Belén; Montoro-Molina, Sebastián; de Gracia, María Del Carmen; Osuna, Antonio; O'Valle, Francisco; Gómez-Guzmán, Manuel; Vargas, Félix; Wangensteen, Rosemary

2017-01-01

The aim of this work was to investigate if the content of glutamyl aminopeptidase (GluAp) in microvesicular and exosomal fractions of urine is related with renal dysfunction in cisplatin-treated rats. Urine samples were collected 24 hours after injection of cisplatin (7 mg/kg, n = 10) or saline serum (n = 10), and they were subjected to differential centrifugation at 1.000, 17.000 and 200.000 g to obtain microvesicular and exosomal fractions. GluAp was measured with a commercial ELISA kit in both fractions. Serum creatinine (SCr) and body weight were measured 15 days after treatment. We analyzed if early excretion of GluAp in microsomal and exosomal fractions was correlated with final SCr and body weight increase. In a second experiment, enzymatic activities of GluAp and alanyl aminopeptidase (AlaAp) in urine, microvesicular and exosomal fractions were measured three days after injection. We analyzed the correlation of both markers with SCr determined at this point. Finally, we studied the expression of GluAp and extracellular vesicles markers Alix and tumor susceptibility gene (TSG101) in both fractions by immunoblotting. GluAp excretion was increased in all fractions of urine after cisplatin treatment, even if data were normalized per mg of creatinine, per body weight or per total protein content of each fraction. We found significant predictive correlations with SCr concentration, and inverse correlations with body weight increase determined 15 days later. Three days after injection, aminopeptidasic activities were markedly increased in all fractions of urine in cisplatin-treated rats. The highest correlation coefficient with SCr was found for GluAp in microvesicular fraction. Increase of GluAp in microvesicular and exosomal fractions from cisplatin-treated rats was confirmed by immunoblotting. Alix and TSG101 showed different patterns of expression in each fraction. Determination of GluAp content or its enzymatic activity in microvesicular and exosomal fractions of urine is an early and predictive biomarker of renal dysfunction in cisplatin-induced nephrotoxicity. Measurement of GluAp in these fractions can serve to detect proximal tubular damage independently of glomerular filtration status.

RNAi-Based GluN3A Silencing Prevents and Reverses Disease Phenotypes Induced by Mutant huntingtin.

PubMed

Marco, Sonia; Murillo, Alvaro; Pérez-Otaño, Isabel

2018-06-15

Huntington's disease (HD) is a dominantly inherited neurodegenerative disease caused by expansion of a polyglutamine tract in the huntingtin protein. HD symptoms include severe motor, cognitive, and psychiatric impairments that result from dysfunction and later degeneration of medium-sized spiny neurons (MSNs) in the striatum. A key early pathogenic mechanism is dysregulated synaptic transmission due to enhanced surface expression of juvenile NMDA-type glutamate receptors containing GluN3A subunits, which trigger the aberrant pruning of synapses formed by cortical afferents onto MSNs. Here, we tested the therapeutic potential of silencing GluN3A expression in YAC128 mice, a well-established HD model. Recombinant adeno-associated viruses encoding a short-hairpin RNA against GluN3A (rAAV-shGluN3A) were generated, and the ability of different serotypes to transduce MSNs was compared. A single injection of rAAV9-shGluN3A into the striatum of 1-month-old mice drove potent (>90%) and long-lasting reductions of GluN3A expression in MSNs, prevented dendritic spine loss and improved motor performance in YAC128 mice. Later delivery, when spine pathology is already apparent, was also effective. Our data provide proof-of-concept for GluN3A silencing as a beneficial strategy to prevent or reverse corticostriatal disconnectivity and motor impairment in HD and support the use of RNAi-based or small-molecule approaches for harnessing this therapeutic potential. Copyright © 2018 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

Pyroglutamate-3 Amyloid-β Deposition in the Brains of Humans, Non-Human Primates, Canines, and Alzheimer Disease–Like Transgenic Mouse Models

PubMed Central

Frost, Jeffrey L.; Le, Kevin X.; Cynis, Holger; Ekpo, Elizabeth; Kleinschmidt, Martin; Palmour, Roberta M.; Ervin, Frank R.; Snigdha, Shikha; Cotman, Carl W.; Saido, Takaomi C.; Vassar, Robert J.; George-Hyslop, Peter St.; Ikezu, Tsuneya; Schilling, Stephan; Demuth, Hans-Ulrich; Lemere, Cynthia A.

2014-01-01

Amyloid-β (Aβ) peptides, starting with pyroglutamate at the third residue (pyroGlu-3 Aβ), are a major species deposited in the brain of Alzheimer disease (AD) patients. Recent studies suggest that this isoform shows higher toxicity and amyloidogenecity when compared to full-length Aβ peptides. Here, we report the first comprehensive and comparative IHC evaluation of pyroGlu-3 Aβ deposition in humans and animal models. PyroGlu-3 Aβ immunoreactivity (IR) is abundant in plaques and cerebral amyloid angiopathy of AD and Down syndrome patients, colocalizing with general Aβ IR. PyroGlu-3 Aβ is further present in two nontransgenic mammalian models of cerebral amyloidosis, Caribbean vervets, and beagle canines. In addition, pyroGlu-3 Aβ deposition was analyzed in 12 different AD-like transgenic mouse models. In contrast to humans, all transgenic models showed general Aβ deposition preceding pyroGlu-3 Aβ deposition. The findings varied greatly among the mouse models concerning age of onset and cortical brain region. In summary, pyroGlu-3 Aβ is a major species of β-amyloid deposited early in diffuse and focal plaques and cerebral amyloid angiopathy in humans and nonhuman primates, whereas it is deposited later in a subset of focal and vascular amyloid in AD-like transgenic mouse models. Given the proposed decisive role of pyroGlu-3 Aβ peptides for the development of human AD pathology, this study provides insights into the usage of animal models in AD studies. PMID:23747948

Urban air pollutants reduce synaptic function of CA1 neurons via an NMDA/NO• pathway in vitro

PubMed Central

Davis, David A.; Akopian, Garnik; Walsh, John P.; Sioutas, Constantinos; Morgan, Todd E.; Finch, Caleb E.

2013-01-01

Airborne particulate matter (PM) from urban vehicular aerosols altered glutamate receptor functions and induced glial inflammatory responses in rodent models after chronic exposure. Potential neurotoxic mechanisms were analyzed in vitro. In hippocampal slices, 2 h exposure to aqueous nanosized PM (nPM) selectively altered postsynaptic proteins in CA1 neurons: increased GluA1, GluN2A, and GluN2B, but not GluA2, GluN1 or mGlur5; increased PSD95 and spinophilin, but not synaptophysin, while dentate gyrus (DG) neurons were unresponsive. In hippocampal slices and neurons, MitoSOX red fluorescence was increased by nPM, implying free radical production. Specifically, NO• production by slices was increased within 15 min of exposure to nPM with dose dependence, 1–10 µg/ml. Correspondingly, CA1 neurons exhibited increased nitrosylation of the GluN2A receptor and dephosphorylation of GluN2B (S1303) and of GluA1 (S831 & S845). Again, DG neurons were unresponsive to nPM. The induction of NO• and nitrosylation were inhibited by AP5, an NMDA receptor antagonist, which also protects neurite outgrowth in vitro from inhibition by nPM. Membrane injury (EthidiumD-1 uptake) showed parallel specificity. Finally, nPM decreased evoked excitatory postsynaptic currents (EPSCs) of CA1 neurons. These findings further document the selective impact of nPM on glutamatergic functions and identify novel responses of NMDA receptor-stimulated NO• production and nitrosylation reactions during nPM-mediated neurotoxicity. PMID:23927064

AMPA receptor desensitization mutation results in severe developmental phenotypes and early postnatal lethality

PubMed Central

Christie, Louisa A.; Russell, Theron A.; Xu, Jian; Wood, Lydia; Shepherd, Gordon M. G.; Contractor, Anis

2010-01-01

AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazole-propionate) recep-tors desensitize rapidly and completely in the continued presence of their endogenous ligand glutamate; however, it is not clear what role AMPA receptor desensitization plays in the brain. We generated a knock-in mouse in which a single amino acid residue, which controls desensitization, was mutated in the GluA2 (GluR2) receptor subunit (GluA2L483Y). This mutation was homozygous lethal. However, mice carrying a single mutated allele, GluA2L483Y/wt, survived past birth, but displayed severe and progressive neurological deficits including seizures and, ultimately, increased mortality. The expression of the AMPA receptor subunits GluA1 and GluA2 was decreased, whereas NMDA receptor protein expression was increased in GluA2L483Y/wt mice. Despite this, basal synaptic transmission and plasticity in the hippocampus were largely unaffected, suggesting that neurons preferentially target receptors to synapses to normalize synaptic weight. We found no gross neuroanatomical alterations in GluA2L483Y/wt mice. Moreover, there was no accumulation of AMPA receptor subunits in intracellular compartments, suggesting that folding and assembly of AMPA receptors are not affected by this mutation. Interestingly, EPSC paired pulse ratios in the CA1 were enhanced without a change in synaptic release probability, demonstrating that postsynaptic receptor properties can contribute to facilitation. The dramatic phenotype observed in this study by the introduction of a single amino acid change demonstrates an essential role in vivo for AMPA receptor desensitization. PMID:20439731

Spinal intracellular metabotropic glutamate receptor 5 (mGluR5) contributes to pain and c-fos expression in a rat model of inflammatory pain.

PubMed

Vincent, Kathleen; Wang, Shu Fan; Laferrière, André; Kumar, Naresh; Coderre, Terence J

2017-04-01

Metabotropic glutamate receptor 5 (mGluR5) is an excitatory G-protein-coupled receptor (GPCR) present in the spinal cord dorsal horn (SCDH) where it has a well-established role in pain. In addition to its traditional location on the cytoplasmic membrane, recent evidence shows that these receptors are present intracellularly on the nuclear membrane in the spinal cord dorsal horn and are implicated in neuropathic pain. Nuclear mGluR5 is a functional receptor that binds glutamate entering the cell through the neuronal glutamate transporter (GT) EAAT3 and activates transcription factor c-fos, whereas plasma membrane mGluR5 is responsible for c-jun activation. Here, we extend these findings to a model of inflammatory pain using complete Freund's adjuvant (CFA) and show that nuclear mGluR5 is also upregulated in the spinal cord dorsal horn following inflammation. We also show that pretreatment with an excitatory amino acid transporter (EAAT) inhibitor attenuates pain and decreases Fos, but not Jun, expression in complete Freund's adjuvant rats. In contrast, selective glial glutamate transporter inhibitors are pronociceptive and increase spinal glutamate concentrations. Additionally, we found that permeable mGluR5 antagonists are more effective at attenuating pain and Fos expression than nonpermeable group I mGluR antagonists. Taken together, these results suggest that under inflammatory conditions, intracellular mGluR5 is actively involved in the relay of nociceptive information in the spinal cord.

A Rare Variant Identified Within the GluN2B C-Terminus in a Patient with Autism Affects NMDA Receptor Surface Expression and Spine Density.

PubMed

Liu, Shuxi; Zhou, Liang; Yuan, Hongjie; Vieira, Marta; Sanz-Clemente, Antonio; Badger, John D; Lu, Wei; Traynelis, Stephen F; Roche, Katherine W

2017-04-12

NMDA receptors (NMDARs) are ionotropic glutamate receptors that are crucial for neuronal development and higher cognitive processes. NMDAR dysfunction is involved in a variety of neurological and psychiatric diseases; however, the mechanistic link between the human pathology and NMDAR dysfunction is poorly understood. Rare missense variants within NMDAR subunits have been identified in numerous patients with mental or neurological disorders. We specifically focused on the GluN2B NMDAR subunit, which is highly expressed in the hippocampus and cortex throughout development. We analyzed several variants located in the GluN2B C terminus and found that three variants in patients with autism (S1415L) or schizophrenia (L1424F and S1452F) (S1413L, L1422F, and S1450F in rodents, respectively) displayed impaired binding to membrane-associated guanylate kinase (MAGUK) proteins. In addition, we observed a deficit in surface expression for GluN2B S1413L. Furthermore, there were fewer dendritic spines in GluN2B S1413L-expressing neurons. Importantly, synaptic NMDAR currents in neurons transfected with GluN2B S1413L in GluN2A/B-deficient mouse brain slices revealed only partial rescue of synaptic current amplitude. Functional properties of GluN2B S1413L in recombinant systems revealed no change in receptor properties, consistent with synaptic defects being the result of reduced trafficking and targeting of GluN2B S1413L to the synapse. Therefore, we find that GluN2B S1413L displays deficits in NMDAR trafficking, synaptic currents, and spine density, raising the possibility that this mutation may contribute to the phenotype in this autism patient. More broadly, our research demonstrates that the targeted study of certain residues in NMDARs based on rare variants identified in patients is a powerful approach to studying receptor function. SIGNIFICANCE STATEMENT We have used a "bedside-to-bench" approach to investigate the functional regulation of NMDA receptors (NMDARs). Using information from deep sequencing of patients with neurological or psychiatric disorders, we investigated missense variants identified in the intracellular C-terminal domain of the GluN2B NMDAR subunit. We found several variants that displayed altered properties. In particular, one variant identified in a patient with autism, human GluN2B S1415L, displayed reduced surface expression and binding to PSD-95. Furthermore expression of GluN2B S1415L (S1413L in mouse) showed a deficit in rescue of synaptic NMDAR currents and fewer dendritic spines, consistent with other reports of spine abnormalities being associated with autism. More broadly, we demonstrate that using patient data is an effective approach to probing the structure/function relationship of NMDARs. Copyright © 2017 the authors 0270-6474/17/374094-10$15.00/0.

Bovine neuronal vesicular glutamate transporter activity is inhibited by ergovaline and other ergopeptines

USDA-ARS?s Scientific Manuscript database

L-Glutamate (Glu) is the major excitatory neurotransmitter responsible for neurotransmission in the vertebrate central nervous system, including the gastrointestinal tract (GIT) of cattle. Vesicular Glu transporters VGLUT1 and VGLUT2 concentrate (50 mM) Glu (Km = 1 to 4 mM) into synaptic vesicles (S...

Impaired discrimination learning in interneuronal NMDAR-GluN2B mutant mice.

PubMed

Brigman, Jonathan L; Daut, Rachel A; Saksida, Lisa; Bussey, Timothy J; Nakazawa, Kazu; Holmes, Andrew

2015-06-17

Previous studies have established a role for N-methyl-D-aspartate receptor (NMDAR) containing the GluN2B subunit in efficient learning behavior on a variety of tasks. Recent findings have suggested that NMDAR on GABAergic interneurons may underlie the modulation of striatal function necessary to balance efficient action with cortical excitatory input. Here we investigated how loss of GluN2B-containing NMDAR on GABAergic interneurons altered corticostriatal-mediated associative learning. Mutant mice (floxed-GluN2B×Ppp1r2-Cre) were generated to produce loss of GluN2B on forebrain interneurons and phenotyped on a touchscreen-based pairwise visual learning paradigm. We found that the mutants showed normal performance during Pavlovian and instrumental pretraining, but were significantly impaired on a discrimination learning task. Detailed analysis of the microstructure of discrimination performance revealed reduced win→stay behavior in the mutants. These results further support the role of NMDAR, and GluN2B in particular, on modulation of striatal function necessary for efficient choice behavior and suggest that NMDAR on interneurons may play a critical role in associative learning.

Cerebral mGluR5 availability contributes to elevated sleep need and behavioral adjustment after sleep deprivation

PubMed Central

Hefti, Katharina; Saberi-Moghadam, Sohrab; Buck, Alfred; Ametamey, Simon M; Scheidegger, Milan; Franken, Paul; Henning, Anke; Seifritz, Erich

2017-01-01

Increased sleep time and intensity quantified as low-frequency brain electrical activity after sleep loss demonstrate that sleep need is homeostatically regulated, yet the underlying molecular mechanisms remain elusive. We here demonstrate that metabotropic glutamate receptors of subtype 5 (mGluR5) contribute to the molecular machinery governing sleep-wake homeostasis. Using positron emission tomography, magnetic resonance spectroscopy, and electroencephalography in humans, we find that increased mGluR5 availability after sleep loss tightly correlates with behavioral and electroencephalographic biomarkers of elevated sleep need. These changes are associated with altered cortical myo-inositol and glycine levels, suggesting sleep loss-induced modifications downstream of mGluR5 signaling. Knock-out mice without functional mGluR5 exhibit severe dysregulation of sleep-wake homeostasis, including lack of recovery sleep and impaired behavioral adjustment to a novel task after sleep deprivation. The data suggest that mGluR5 contribute to the brain's coping mechanisms with sleep deprivation and point to a novel target to improve disturbed wakefulness and sleep. PMID:28980941

Chronic pharmacological mGlu5 inhibition corrects fragile X in adult mice.

PubMed

Michalon, Aubin; Sidorov, Michael; Ballard, Theresa M; Ozmen, Laurence; Spooren, Will; Wettstein, Joseph G; Jaeschke, Georg; Bear, Mark F; Lindemann, Lothar

2012-04-12

Fragile X syndrome (FXS) is the most common form of inherited intellectual disability. Previous studies have implicated mGlu5 in the pathogenesis of the disease, but a crucial unanswered question is whether pharmacological mGlu5 inhibition is able to reverse an already established FXS phenotype in mammals. Here we have used the novel, potent, and selective mGlu5 inhibitor CTEP to address this issue in the Fmr1 knockout mouse. Acute CTEP treatment corrects elevated hippocampal long-term depression, protein synthesis, and audiogenic seizures. Chronic treatment that inhibits mGlu5 within a receptor occupancy range of 81% ± 4% rescues cognitive deficits, auditory hypersensitivity, aberrant dendritic spine density, overactive ERK and mTOR signaling, and partially corrects macroorchidism. This study shows that a comprehensive phenotype correction in FXS is possible with pharmacological intervention starting in young adulthood, after development of the phenotype. It is of great interest how these findings may translate into ongoing clinical research testing mGlu5 inhibitors in FXS patients. Copyright © 2012 Elsevier Inc. All rights reserved.

High-affinity kainate receptor subunits are necessary for ionotropic but not metabotropic signaling.

PubMed

Fernandes, Herman B; Catches, Justin S; Petralia, Ronald S; Copits, Bryan A; Xu, Jian; Russell, Theron A; Swanson, Geoffrey T; Contractor, Anis

2009-09-24

Kainate receptors signal through both ionotropic and metabotropic pathways. The high-affinity subunits, GluK4 and GluK5, are unique among the five receptor subunits, as they do not form homomeric receptors but modify the properties of heteromeric assemblies. Disruption of the Grik4 gene locus resulted in a significant reduction in synaptic kainate receptor currents. Moreover, ablation of GluK4 and GluK5 caused complete loss of synaptic ionotropic kainate receptor function. The principal subunits were distributed away from postsynaptic densities and presynaptic active zones. There was also a profound alteration in the activation properties of the remaining kainate receptors. Despite this, kainate receptor-mediated inhibition of the slow afterhyperpolarization current (I(sAHP)), which is dependent on metabotropic pathways, was intact in GluK4/GluK5 knockout mice. These results uncover a previously unknown obligatory role for the high-affinity subunits for ionotropic kainate receptor function and further demonstrate that kainate receptor participation in metabotropic signaling pathways does not require their classic role as ion channels.

Distribution of Vesicular Glutamate Transporter 2 and Ionotropic Glutamate Receptors in the Auditory Ganglion and Cochlear Nuclei of Pigeons (Columba livia).

PubMed

Karim, M R; Atoji, Y

2016-02-01

Glutamate is a principal excitatory neurotransmitter in the auditory system. Our previous studies revealed localization of glutamate receptor mRNAs in the pigeon cochlear nuclei, suggesting the existence of glutamatergic input from the auditory nerve to the brainstem. This study demonstrated localization of mRNAs for vesicular glutamate transporter 2 (vGluT2) and ionotropic glutamate receptors (AMPA, kainate and NMDA) in the auditory ganglion (AG) and cochlear nuclei (magnocellular, angular and laminar nuclei). VGluT2 mRNA was intensely expressed in AG and intensely or moderately in the cochlear nuclei. The AG and cochlear nuclei showed intense-to-moderate mRNA signals for GluA2, GluA3, GluA4, GluK4 and GluN1. These results suggest that the pigeon AG neurons receives glutamatergic input from hair cells and in turn projects to the magnocellular and angular nuclei. Glutamate may play a pivotal role in the excitatory synapse transmission in the peripheral auditory pathway of birds. © 2015 Blackwell Verlag GmbH.

Tuberous sclerosis: aberrant metabolism of ornithine, proline and glutamate in cultured fibroblasts.

PubMed

Tanaka, H; Nakazawa, K; Arima, M; Hayashi, A

1987-01-01

To investigate aberrant metabolism of proline (Pro) and its precursors in tuberous sclerosis (TS), 6, 7 and 5 strains of control, TS (normal skin) and TS (tumor) fibroblasts, respectively, were cultured in Eagle's MEM containing dialyzed fetal bovine serum with or without 0.1 mM ornithine (Orn). Ornithine aminotransferase (OAT) activity was decreased in TS, especially in TS (tumor) after mild sonication treatment. The yield of the OAT protein was inhibited in TS (tumor) when cultured without Orn. Free glutamate (Glu) in the medium was significantly increased in TS (tumor). Free proline (Pro) in cells was significantly decreased in TS (tumor) when cultured with Orn, but protein-bound Pro was not. The relative concentration of free Glu to glutamine (Gln) in the medium and that of free Glu to Pro in cells cultured with Orn were increased in TS (tumor). These results suggest that the requirement for Orn, increased turnover of Pro to Glu and increased elimination of Glu into the medium occur in TS (tumor). Aberrant regulation or turnover of Pro and Glu metabolism may occur in TS, especially in tumor cells.

Inside story of Group I Metabotropic Glutamate Receptors (mGluRs).

PubMed

Bhattacharyya, Samarjit

2016-08-01

Metabotropic glutamate receptors (mGluRs) are G-protein coupled receptors (GPCRs) that are activated by the neurotransmitter glutamate in the central nervous system. Among the eight subtypes, mGluR1 and mGluR5 belong to the group I family. These receptors play important roles in the brain and are believed to be involved in multiple forms of experience dependent synaptic plasticity including learning and memory. In addition, group I mGluRs also have been implicated in various neuropsychiatric disorders like Fragile X syndrome, autism etc. The normal signaling depends on the precise location of these receptors in specific region of the neuron and the process of receptor trafficking plays a crucial role in controlling this localization. Intracellular trafficking could also regulate the desensitization, resensitization, down-regulation and intracellular signaling of these receptors. In this review I focus on the current understanding of group I mGluR regulation in the central nervous system and also their role in neuropsychiatric disorders. Copyright © 2016 Elsevier Ltd. All rights reserved.

Roles for Arc in metabotropic glutamate receptor-dependent LTD and synapse elimination: Implications in health and disease.

PubMed

Wilkerson, Julia R; Albanesi, Joseph P; Huber, Kimberly M

2018-05-01

The Arc gene is robustly transcribed in specific neural ensembles in response to experience-driven activity. Upon induction, Arc mRNA is transported to dendrites, where it can be rapidly and locally translated by activation of metabotropic glutamate receptors (mGluR1/5). mGluR-induced dendritic synthesis of Arc is implicated in weakening or elimination of excitatory synapses by triggering endocytosis of postsynaptic AMPARs in both hippocampal CA1 and cerebellar Purkinje neurons. Importantly, CA1 neurons with experience-induced Arc mRNA are susceptible, or primed for mGluR-induced long-term synaptic depression (mGluR-LTD). Here we review mechanisms and function of Arc in mGluR-LTD and synapse elimination and propose roles for these forms of plasticity in Arc-dependent formation of sparse neural representations of learned experience. We also discuss accumulating evidence linking dysregulation of Arc and mGluR-LTD in human cognitive disorders such as intellectual disability, autism and Alzheimer's disease. Copyright © 2017 Elsevier Ltd. All rights reserved.

Synthesis and Structure Activity Relationship of Tetrahydroisoquinoline-based Potentiators of GluN2C and GluN2D Containing N-Methyl-D-Aspartate Receptors

PubMed Central

Santangelo Freel, Rose M.; Ogden, Kevin K.; Strong, Katie L.; Khatri, Alpa; Chepiga, Kathryn M.; Jensen, Henrik S.; Traynelis, Stephen F.; Liotta, Dennis C.

2015-01-01

We describe here the synthesis and evaluation of a series of tetrahydroisoquinolines that show subunit-selective potentiation of NMDA receptors containing the GluN2C or GluN2D subunits. Bischler-Napieralski conditions were employed in the key step for the conversion of acyclic amides to the corresponding tetrahydroisoquinoline containing analogs. Compounds were evaluated using both two electrode voltage clamp recordings from Xenopus laevis oocytes and imaging of mammalian BHK cells loaded with Ca2+-sensitive dyes. The most potent analogues had EC50 values of 300 nM and showed over 2-fold potentiation of the response to maximally effective concentrations of glutamate and glycine, but had no effect on responses from NMDA receptors containing the GluN2A or GluN2B subunits, AMPA, kainate, GABA, or glycine receptors or a variety of other potential targets. These compounds represent a potent class of small molecule subunit-selective potentiators of NMDA receptors. PMID:23627311

Cerebral mGluR5 availability contributes to elevated sleep need and behavioral adjustment after sleep deprivation.

PubMed

Holst, Sebastian C; Sousek, Alexandra; Hefti, Katharina; Saberi-Moghadam, Sohrab; Buck, Alfred; Ametamey, Simon M; Scheidegger, Milan; Franken, Paul; Henning, Anke; Seifritz, Erich; Tafti, Mehdi; Landolt, Hans-Peter

2017-10-05

Increased sleep time and intensity quantified as low-frequency brain electrical activity after sleep loss demonstrate that sleep need is homeostatically regulated, yet the underlying molecular mechanisms remain elusive. We here demonstrate that metabotropic glutamate receptors of subtype 5 (mGluR5) contribute to the molecular machinery governing sleep-wake homeostasis. Using positron emission tomography, magnetic resonance spectroscopy, and electroencephalography in humans, we find that increased mGluR5 availability after sleep loss tightly correlates with behavioral and electroencephalographic biomarkers of elevated sleep need. These changes are associated with altered cortical myo-inositol and glycine levels, suggesting sleep loss-induced modifications downstream of mGluR5 signaling. Knock-out mice without functional mGluR5 exhibit severe dysregulation of sleep-wake homeostasis, including lack of recovery sleep and impaired behavioral adjustment to a novel task after sleep deprivation. The data suggest that mGluR5 contribute to the brain's coping mechanisms with sleep deprivation and point to a novel target to improve disturbed wakefulness and sleep.

Emerging structural insights into the function of ionotropic glutamate receptors

PubMed Central

Karakas, Erkan; Regan, Michael C.; Furukawa, Hiro

2015-01-01

Summary Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that mediate excitatory neurotransmission crucial for brain development and function including learning and memory formation. Recently a wealth of structural studies on iGluRs, including AMPA receptors (AMPARs), kainate receptors, and NMDA receptors (NMDARs) became available.. These studies showed structures of non-NMDARs including AMPAR and kainate receptor in various functional states, thereby providing the first visual sense of how non-NMDAR iGluRs may function in the context of homotetramers. Furthermore, they provided the first view of heterotetrameric NMDAR ion channels, which illuminated the similarities with and differences from non-NMDARs, thus raising a mechanistic distinction between the two groups of iGluRs. Here we review mechanistic insights into iGluR functions gained through structural studies of multiple groups. PMID:25941168

Electrostatic repulsion, compensatory mutations, and long-range non-additive effects at the dimerization interface of the HIV capsid protein.

PubMed

del Alamo, Marta; Mateu, Mauricio G

2005-01-28

In previous studies, thermodynamic dissection of the dimerization interface in CA-C, the C-terminal domain of the capsid protein of human immunodeficiency virus type 1, revealed that individual mutation to alanine of Ser178, Glu180, Glu187 or Gln192 led to significant increases in dimerization affinity. Four related aspects derived from this observation have been now addressed, and the results can be summarized as follows: (i) thermodynamic analyses indicate the presence of an intersubunit electrostatic repulsion between both Glu180 residues. (ii) The mutation Glu180 to Ala was detected in nearly all type 2 human immunodeficiency virus variants, and in several simian immunodeficiency viruses analyzed. However, this mutation was strictly co-variant with mutations Ser178Asp in a neighboring residue, and Glu187Gln. Thermodynamic analysis of multiple mutants showed that Ser178Asp compensated, alone or together with Glu187Gln, the increase in affinity caused by the mutation Glu180Ala, and restored a lower dimerization affinity. (iii) The increase in the affinity constant caused by the multiple mutation to Ala of Ser178, Glu180, Glu187 and Gln192 was more than one order of magnitude lower than predicted if additivity were present, despite the fact that the 178/180 pair and the two other residues were located more than 10A apart. (iv) Mutations in CA-C that caused non-additive increases in dimerization affinity also caused a non-additive increase in the capacity of the isolated CA-C domain to inhibit the assembly of capsid-like HIV-1 particles in kinetic assays. In summary, the study of a protein-protein interface involved in the building of a viral capsid has revealed unusual features, including intersubunit electrostatic repulsions, co-variant, compensatory mutations that may evolutionarily preserve a low association constant, and long-range, large magnitude non-additive effects on association.

ADX-47273, a mGlu5 receptor positive allosteric modulator, attenuates deficits in cognitive flexibility induced by withdrawal from 'binge-like' ethanol exposure in rats.

PubMed

Marszalek-Grabska, Marta; Gibula-Bruzda, Ewa; Bodzon-Kulakowska, Anna; Suder, Piotr; Gawel, Kinga; Talarek, Sylwia; Listos, Joanna; Kedzierska, Ewa; Danysz, Wojciech; Kotlinska, Jolanta H

2018-02-15

Repeated exposure to and withdrawal from ethanol induces deficits in spatial reversal learning. Data indicate that metabotropic glutamate 5 (mGlu5) receptors are implicated in synaptic plasticity and learning and memory. These receptors functionally interact with N-methyl-d-aspartate (NMDA) receptors, and activation of one type results in the activation of the other. We examined whether (S)-(4-fluorophenyl)(3-(3-(4-fluorophenyl)-1,2,4-oxadiazol-5-yl)-piperidin-1-yl (ADX-47273), a positive allosteric modulator (PAM) of mGlu5 receptor, attenuates deficits in reversal learning induced by withdrawal (11-13days) from 'binge-like' ethanol input (5.0g/kg, i.g. for 5days) in the Barnes maze (a spatial learning) task in rats. We additionally examined the effects of ADX-47273 on the expression of the NMDA receptors subunit, GluN2B, in the hippocampus and prefrontal cortex, on the 13th day of ethanol withdrawal. Herein, withdrawal from repeated ethanol administration impaired reversal learning, but not the probe trial. Moreover, ADX-47273 (30mg/kg, i.p.) given prior to the first reversal learning trial for 3days in the Barnes maze, significantly enhanced performance in the ethanol-treated group. The 13th day of ethanol abstinence decreased the expression of the GluN2B subunit in the selected brain regions, but ADX-47273 administration increased it. In conclusion, positive allosteric modulation of mGlu5 receptors recovered spatial reversal learning impairment induced by withdrawal from 'binge-like' ethanol exposure. Such effect seems to be correlated with the mGlu5 receptors mediated potentiation of GluN2B-NMDA receptor mediated responses in the hippocampus and prefrontal cortex. Thus, our results emphasize the role of mGlu5 receptor PAM in the adaptive learning impaired by ethanol exposure. Copyright © 2017 Elsevier B.V. All rights reserved.

Metabotropic Glutamate Receptor 5 Activity in the Nucleus Accumbens Is Required for the Maintenance of Ethanol Self-Administration in a Rat Genetic Model of High Alcohol Intake

PubMed Central

Besheer, Joyce; Grondin, Julie J.M.; Cannady, Reginald; Sharko, Amanda C.; Faccidomo, Sara; Hodge, Clyde W.

2010-01-01

Background Systemic modulation of Group I and II metabotropic glutamate receptors (mGluRs) regulate ethanol self-administration in a variety of animal models. Although these receptors are expressed in reward-related brain regions, the anatomical specificity of their functional involvement in ethanol self-administration remains to be characterized. This study sought to evaluate the functional role of Group I (mGluR5) and Group II (mGluR2/3) in mesocorticolimbic brain regions in ethanol self-administration. Methods Alcohol-preferring (P) rats, a genetic model of high alcohol drinking, were trained to self-administer ethanol (15% v/v) versus water in operant conditioning chambers. Effects of brain site-specific infusion of the mGluR5 antagonist 2-methyl-6-(phenylethynyl)pyridine hydrochloride (MPEP) and the mGluR2/3 agonist were then assessed on the maintenance of self-administration. Results Microinjection of the mGluR5 antagonist MPEP in the nucleus accumbens reduced ethanol self-administration at a dose that did not alter locomotor activity. By contrast, infusion of the mGluR2/3 agonist LY379268 in the nucleus accumbens reduced self-administration and produced nonspecific reductions in locomotor activity. The mGluR5 involvement showed anatomical specificity as evidenced by lack of effect of MPEP infusion in the dorsomedial caudate or medial prefrontal cortex on ethanol self-administration. To determine reinforcer specificity, P-rats were trained to self-administer sucrose (.4% w/v) versus water, and effects of intra-accumbens MPEP were tested. The MPEP did not alter sucrose self-administration or motor behavior. Conclusions These results suggest that mGluR5 activity specifically in the nucleus accumbens is required for the maintenance of ethanol self-administration in individuals with genetic risk for high alcohol consumption. PMID:19897175

AMPA receptor activation controls type I metabotropic glutamate receptor signalling via a tyrosine kinase at parallel fibre-Purkinje cell synapses.

PubMed

Auger, Céline; Ogden, David

2010-08-15

Metabotropic glutamate receptors type 1 (mGluR1s) and ionotropic AMPA receptors (AMPARs) are colocalized at parallel fibre (PF) to Purkinje cell synapses of the cerebellum. Single stimulation of PFs activates fast AMPAR excitatory postsynaptic currents, whereas the activation of mGluR1s requires burst stimulation. mGluR1s signal through several pathways in Purkinje cells and the most prominent is the activation of a slow EPSC (sEPSC). To separate the two synaptic currents, studies of the sEPSC have commonly been performed in the presence of AMPA/KA receptor antagonists. We show here in rat cerebellar slices that inhibition of the fast EPSC by AMPAR antagonists strongly and selectively potentiates the mGluR1 sEPSC, showing a negative regulation of mGluR1 by AMPAR. This effect is observed with low concentrations of NBQX (300 nM to 1 microM), with the selective AMPAR antagonist GYKI 53655 and also with gamma-DGG, a low affinity glutamate receptor antagonist. When photorelease of glutamate from MNI-glutamate was used to study the postsynaptic responses in isolation, AMPAR inhibition produced a similar potentiation of the mGluR1 sEPSC, showing that the interaction is postsynaptic. Finally, perfusion of the postsynaptic cell with PP1, an inhibitor of src-family tyrosine kinase, increased the amplitude of the mGluR1 sEPSC and occluded the effect of AMPAR inhibition. Thus, at PF to Purkinje cell synapses, AMPAR activation inhibits the mGluR1 sEPSC via activation of a src-family tyrosine kinase. Consequently mGluR1 signalling will be more sensitive to spillover of glutamate than to local synaptic release. Furthermore, it will be enhanced at silent PF synapses which are the majority in Purkinje cells.

Metabotropic glutamate receptor 5 activity in the nucleus accumbens is required for the maintenance of ethanol self-administration in a rat genetic model of high alcohol intake.

PubMed

Besheer, Joyce; Grondin, Julie J M; Cannady, Reginald; Sharko, Amanda C; Faccidomo, Sara; Hodge, Clyde W

2010-05-01

Systemic modulation of Group I and II metabotropic glutamate receptors (mGluRs) regulate ethanol self-administration in a variety of animal models. Although these receptors are expressed in reward-related brain regions, the anatomical specificity of their functional involvement in ethanol self-administration remains to be characterized. This study sought to evaluate the functional role of Group I (mGluR5) and Group II (mGluR2/3) in mesocorticolimbic brain regions in ethanol self-administration. Alcohol-preferring (P) rats, a genetic model of high alcohol drinking, were trained to self-administer ethanol (15% v/v) versus water in operant conditioning chambers. Effects of brain site-specific infusion of the mGluR5 antagonist 2-methyl-6-(phenylethynyl)pyridine hydrochloride (MPEP) and the mGluR2/3 agonist were then assessed on the maintenance of self-administration. Microinjection of the mGluR5 antagonist MPEP in the nucleus accumbens reduced ethanol self-administration at a dose that did not alter locomotor activity. By contrast, infusion of the mGluR2/3 agonist LY379268 in the nucleus accumbens reduced self-administration and produced nonspecific reductions in locomotor activity. The mGluR5 involvement showed anatomical specificity as evidenced by lack of effect of MPEP infusion in the dorsomedial caudate or medial prefrontal cortex on ethanol self-administration. To determine reinforcer specificity, P-rats were trained to self-administer sucrose (.4% w/v) versus water, and effects of intra-accumbens MPEP were tested. The MPEP did not alter sucrose self-administration or motor behavior. These results suggest that mGluR5 activity specifically in the nucleus accumbens is required for the maintenance of ethanol self-administration in individuals with genetic risk for high alcohol consumption. Copyright 2010 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Dynorphin up-regulation in the dentate granule cell mossy fiber pathway following chronic inhibition of GluN2B-containing NMDAR is associated with increased CREB (Ser 133) phosphorylation, but is independent of BDNF/TrkB signaling pathways.

PubMed

Rittase, W Bradley; Dong, Yu; Barksdale, DaRel; Galdzicki, Zygmunt; Bausch, Suzanne B

2014-05-01

Emerging evidence suggests that neuronal responses to N-methyl-d-aspartate (NMDAR) activation/inactivation are influenced by subunit composition. For example, activation of synaptic NMDAR (comprised of GluN2A>GluN2B) phosphorylates cAMP-response-element-binding protein (CREB) at Ser 133, induces BDNF expression and promotes neuronal survival. Activation of extrasynaptic NMDAR (comprised of GluN2B>GluN2) dephosphorylates CREB (Ser 133), reduces BDNF expression and triggers neuronal death. These results led us to hypothesize that chronic inhibition of GluN2B-containing NMDAR would increase CREB (Ser 133) phosphorylation, increase BDNF levels and subsequently alter downstream dynorphin (DYN) and neuropeptide Y (NPY) expression. We focused on DYN and NPY because these neuropeptides can decrease excitatory neurotransmission and seizure occurrence and we reported previously that seizure-like events are reduced following chronic treatment with GluN2B antagonists. Consistent with our hypothesis, chronic treatment (17-21days) of hippocampal slice cultures with the GluN2B-selective antagonists ifenprodil or Ro25,6981 increased both CREB (Ser 133) phosphorylation and granule cell mossy fiber pathway DYN expression. Similar treatment with the non-subtype-selective NMDAR antagonists d-APV or memantine had no significant effect on either CREB (Ser 133) phosphorylation or DYN expression. In contrast to our hypothesis, BDNF levels were decreased following chronic treatment with Ro25,6981, but not ifenprodil, d-APV or memantine. Blockade of BDNF actions and TrkB activation did not significantly augment hilar DYN expression in vehicle-treated cultures and had no effect in Ro25,6981 treated cultures. These findings suggest that chronic exposure to GluN2B-selective NMDAR antagonists increased DYN expression through a putatively pCREB-dependent, but BDNF/TrkB-independent mechanism. Published by Elsevier Inc.

mGluR2/3 in the Lateral Amygdala is Required for Fear Extinction: Cortical Input Synapses onto the Lateral Amygdala as a Target Site of the mGluR2/3 Action

PubMed Central

Kim, Jihye; An, Bobae; Kim, Jeongyeon; Park, Sewon; Park, Sungmo; Hong, Ingie; Lee, Sukwon; Park, Kyungjoon; Choi, Sukwoo

2015-01-01

Various subtypes of metabotropic glutamate receptors (mGluRs) have been implicated in fear extinction, but mGluR2/3 subtype has not been tested. Here, we found that microinjection of an mGluR2/3 antagonist, LY341495, into the lateral amygdala (LA), but not into the adjacent central amygdala (CeA), impaired extinction retention without affecting within-session extinction. In contrast, we failed to detect any significant changes in motility and anxiety during a period when extinction training or retention was performed after LY341495 injection, suggesting that the effect of LY341495 is specific to conditioned responses. Subsequently, on the basis of a previous finding that a long-term potentiation of presynaptic efficacy at cortical input synapses onto the lateral amygdala (C-LA synapses) supports conditioned fear, we tested the hypothesis that activation of mGluR2/3 leads to fear extinction via a long-term weakening of presynaptic functions at C-LA synapses. Fear extinction produced a decrease in C-LA synaptic efficacy, whereas LY341495 infusion into the LA blocked this extinction-induced C-LA efficacy decrease without altering synaptic efficacy at other LA synapses. Furthermore, extinction enhanced paired pulse ratio (PPR) of EPSCs, which inversely correlates with presynaptic release probability, whereas LY341495 infusion into the LA attenuated the extinction-induced increase in PPR, suggesting the presence of mGluR2/3-dependent presynaptic changes after extinction. Consistently, extinction occluded a presynaptic form of depression at C-LA synapses, whereas the LY341495 infusion into the LA rescued this occlusion. Together, our findings suggest that mGluR2/3 is required for extinction retention and that the mGluR2/3 action is mediated by the long-term weakening of release probability at C-LA synapses. PMID:26081171

GluN2C/GluN2D subunit-selective NMDA receptor potentiator CIQ reverses MK-801-induced impairment in prepulse inhibition and working memory in Y-maze test in mice

PubMed Central

Suryavanshi, P S; Ugale, R R; Yilmazer-Hanke, D; Stairs, D J; Dravid, S M

2014-01-01

Background and Purpose Despite ample evidence supporting the N-methyl-d-aspartate receptor (NMDAR) hypofunction hypothesis of schizophrenia, progress in the development of effective therapeutics based on this hypothesis has been limited. Facilitation of NMDA receptor function by co-agonists (d-serine or glycine) only partially alleviates the symptoms in schizophrenia; other means to facilitate NMDA receptors are required. NMDA receptor sub-types differ in their subunit composition, with varied GluN2 subunits (GluN2A-GluN2D) imparting different physiological, biochemical and pharmacological properties. CIQ is a positive allosteric modulator that is selective for GluN2C/GluN2D-containing NMDA receptors (Mullasseril et al.). Experimental Approach The effect of systemic administration of CIQ was tested on impairment in prepulse inhibition (PPI), hyperlocomotion and stereotypy induced by i.p. administration of MK-801 and methamphetamine. The effect of CIQ was also tested on MK-801-induced impairment in working memory in Y-maze spontaneous alternation test. Key Results We found that systemic administration of CIQ (20 mg·kg−1, i.p.) in mice reversed MK-801 (0.15 mg·kg−1, i.p.)-induced, but not methamphetamine (3 mg·kg−1, i.p.)-induced, deficit in PPI. MK-801 increased the startle amplitude to pulse alone, which was not reversed by CIQ. In contrast, methamphetamine reduced the startle amplitude to pulse alone, which was reversed by CIQ. CIQ also partially attenuated MK-801- and methamphetamine-induced hyperlocomotion and stereotyped behaviours. Additionally, CIQ reversed the MK-801-induced working memory deficit in spontaneous alternation in a Y-maze. Conclusion and Implications Together, these results suggest that facilitation of GluN2C/GluN2D-containing receptors may serve as an important therapeutic strategy for treating positive and cognitive symptoms in schizophrenia. PMID:24236947

Partial mGlu₅ Negative Allosteric Modulators Attenuate Cocaine-Mediated Behaviors and Lack Psychotomimetic-Like Effects.

PubMed

Gould, Robert W; Amato, Russell J; Bubser, Michael; Joffe, Max E; Nedelcovych, Michael T; Thompson, Analisa D; Nickols, Hilary H; Yuh, Johannes P; Zhan, Xiaoyan; Felts, Andrew S; Rodriguez, Alice L; Morrison, Ryan D; Byers, Frank W; Rook, Jerri M; Daniels, John S; Niswender, Colleen M; Conn, P Jeffrey; Emmitte, Kyle A; Lindsley, Craig W; Jones, Carrie K

2016-03-01

Cocaine abuse remains a public health concern for which pharmacotherapies are largely ineffective. Comorbidities between cocaine abuse, depression, and anxiety support the development of novel treatments targeting multiple symptom clusters. Selective negative allosteric modulators (NAMs) targeting the metabotropic glutamate receptor 5 (mGlu5) subtype are currently in clinical trials for the treatment of multiple neuropsychiatric disorders and have shown promise in preclinical models of substance abuse. However, complete blockade or inverse agonist activity by some full mGlu5 NAM chemotypes demonstrated adverse effects, including psychosis in humans and psychotomimetic-like effects in animals, suggesting a narrow therapeutic window. Development of partial mGlu5 NAMs, characterized by their submaximal but saturable levels of blockade, may represent a novel approach to broaden the therapeutic window. To understand potential therapeutic vs adverse effects in preclinical behavioral assays, we examined the partial mGlu5 NAMs, M-5MPEP and Br-5MPEPy, in comparison with the full mGlu5 NAM MTEP across models of addiction and psychotomimetic-like activity. M-5MPEP, Br-5MPEPy, and MTEP dose-dependently decreased cocaine self-administration and attenuated the discriminative stimulus effects of cocaine. M-5MPEP and Br-5MPEPy also demonstrated antidepressant- and anxiolytic-like activity. Dose-dependent effects of partial and full mGlu5 NAMs in these assays corresponded with increasing in vivo mGlu5 occupancy, demonstrating an orderly occupancy-to-efficacy relationship. PCP-induced hyperlocomotion was potentiated by MTEP, but not by M-5MPEP and Br-5MPEPy. Further, MTEP, but not M-5MPEP, potentiated the discriminative-stimulus effects of PCP. The present data suggest that partial mGlu5 NAM activity is sufficient to produce therapeutic effects similar to full mGlu5 NAMs, but with a broader therapeutic index.

Spatial separation of two different pathways accounting for the generation of calcium signals in astrocytes.

PubMed

Oschmann, Franziska; Mergenthaler, Konstantin; Jungnickel, Evelyn; Obermayer, Klaus

2017-02-01

Astrocytes integrate and process synaptic information and exhibit calcium (Ca2+) signals in response to incoming information from neighboring synapses. The generation of Ca2+ signals is mostly attributed to Ca2+ release from internal Ca2+ stores evoked by an elevated metabotropic glutamate receptor (mGluR) activity. Different experimental results associated the generation of Ca2+ signals to the activity of the glutamate transporter (GluT). The GluT itself does not influence the intracellular Ca2+ concentration, but it indirectly activates Ca2+ entry over the membrane. A closer look into Ca2+ signaling in different astrocytic compartments revealed a spatial separation of those two pathways. Ca2+ signals in the soma are mainly generated by Ca2+ release from internal Ca2+ stores (mGluR-dependent pathway). In astrocytic compartments close to the synapse most Ca2+ signals are evoked by Ca2+ entry over the plasma membrane (GluT-dependent pathway). This assumption is supported by the finding, that the volume ratio between the internal Ca2+ store and the intracellular space decreases from the soma towards the synapse. We extended a model for mGluR-dependent Ca2+ signals in astrocytes with the GluT-dependent pathway. Additionally, we included the volume ratio between the internal Ca2+ store and the intracellular compartment into the model in order to analyze Ca2+ signals either in the soma or close to the synapse. Our model results confirm the spatial separation of the mGluR- and GluT-dependent pathways along the astrocytic process. The model allows to study the binary Ca2+ response during a block of either of both pathways. Moreover, the model contributes to a better understanding of the impact of channel densities on the interaction of both pathways and on the Ca2+ signal.

2-Methyltetrahydro-3-benzazepin-1-ols - The missing link in SAR of GluN2B selective NMDA receptor antagonists.

PubMed

Dey, Sougata; Schepmann, Dirk; Wünsch, Bernhard

2018-01-15

The NMDA receptor containing GluN2B subunits represents a promising target for the development of drugs for the treatment of various neurological disorders including neurodegenerative diseases. In order to study the role of CH 3 and OH moieties trisubstituted tetrahydro-3-benzazepines 4 were designed as missing link between tetra- and disubstituted 3-benzazepines 2 and 5. The synthesis of 4 comprises eight reaction steps starting from alanine. The intramolecular Friedel-Crafts acylation to obtain the ketone 12 and the base-catalyzed elimination of trifluoromethanesulfinate (CF 3 SO 2 - ) followed by NaBH 4 reduction represent the key steps. The GluN2B affinity of the cis-configured 3-benzazepin-1-ol cis-4a with a 4-phenylbutyl side chain (K i  = 252 nM) is considerably lower than the GluN2B affinity of (R,R)-2 (K i  = 17 nM) indicating the importance of the phenolic OH moiety for the interaction with the receptor protein. Introduction of an additional CH 3 moiety in 2-position led to a slight decrease of GluN2B affinity as can be seen by comparing the affinity data of cis-4a and 5. The homologous phenylpentyl derivative cis-4b shows the highest GluN2B affinity (K i  = 56 nM) of this series of compounds. According to docking studies cis-4a adopts the same binding mode as the cocrystallized ligand ifenprodil-keto 1A and 5 at the interface of the GluN2B and GluN1a subunits. The same crucial H-bonds are formed between the C(O)NH 2 moiety of Gln110 within the GluN2B subunit and the protonated amino moiety and the OH moiety of (R,R)-cis-4a. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mimicking the biomolecular control of calcium oxalate monohydrate crystal growth: effect of contiguous glutamic acids.

PubMed

Grohe, Bernd; Hug, Susanna; Langdon, Aaron; Jalkanen, Jari; Rogers, Kem A; Goldberg, Harvey A; Karttunen, Mikko; Hunter, Graeme K

2012-08-21

Scanning confocal interference microscopy (SCIM) and molecular dynamics (MD) simulations were used to investigate the adsorption of the synthetic polypeptide poly(l-glutamic acid) (poly-glu) to calcium oxalate monohydrate (COM) crystals and its effect on COM formation. At low concentrations (1 μg/mL), poly-glu inhibits growth most effectively in ⟨001⟩ directions, indicating strong interactions of the polypeptide with {121} crystal faces. Growth in <010> directions was inhibited only marginally by 1 μg/mL poly-glu, while growth in <100> directions did not appear to be affected. This suggests that, at low concentrations, poly-glu inhibits lattice-ion addition to the faces of COM in the order {121} > {010} ≥ {100}. At high concentrations (6 μg/mL), poly-glu resulted in the formation of dumbbell-shaped crystals featuring concave troughs on the {100} faces. The effects on crystal growth indicate that, at high concentrations, poly-glu interacts with the faces of COM in the order {100} > {121} > {010}. This mirrors MD simulations, which predicted that poly-glu will adsorb to a {100} terrace plane (most calcium-rich) in preference to a {121} (oblique) riser plane but will adsorb to {121} riser plane in preference to an {010} terrace plane (least calcium-rich). The effects of different poly-glu concentration on COM growth (1-6 μg/mL) may be due to variations between the faces in terms of growth mechanism and/or (nano)roughness, which can affect surface energy. In addition, 1 μg/mL might not be adequate to reach the critical concentration for poly-glu to significantly pin step movement on {100} and {010} faces. Understanding the mechanisms involved in these processes is essential for the development of agents to reduce recurrence of kidney stone disease.

mGluR4 positive allosteric modulators with potential for the treatment of Parkinson's disease: WO09010455.

PubMed

East, Stephen P; Gerlach, Kai

2010-03-01

Stimulation of the metabotropic glutamate receptor 4 (mGluR4) represents a promising new approach to the symptomatic treatment of the neurodegenerative disorder Parkinson's disease (PD). Preclinical models using both agonists and positive allosteric modulators of mGluR4 have demonstrated the potential for this receptor for the treatment of PD. The present article evaluates a recent patent filed by Addex Pharma S.A. claiming a novel series of mGluR4 positive allosteric modulators. Many of the examples disclosed are active at EC(50)'s < 500 nM.

Protection but maintained dysfunction of nigral dopaminergic nerve cell bodies and striatal dopaminergic terminals in MPTP-lesioned mice after acute treatment with the mGluR5 antagonist MPEP.

PubMed

Aguirre, Jose A; Kehr, Jan; Yoshitake, Takashi; Liu, Fang-Ling; Rivera, Alicia; Fernandez-Espinola, Sergio; Andbjer, Beth; Leo, Giuseppina; Medhurst, Andrew D; Agnati, Luigi F; Fuxe, Kjell

2005-02-08

The mGluR5 antagonist MPEP was used to study the role of mGluR5 in MPTP-induced injury of the nigrostriatal DA neurons. The findings indicate that acute blockade of mGluR5 may result in neuroprotective actions against MPTP neurotoxicity on nigral DA cell bodies and striatal DA terminals using stereological analysis of TH immunoreactivity and microdensitometry. Biochemical analysis showed no restoration of DA levels and metabolism indicating a maintained reduction of DA transmission.

Immunomodulatory activity of a novel, synthetic beta-glucan (β-glu6) in murine macrophages and human peripheral blood mononuclear cells.

PubMed

Li, Xiaofei; Wang, Jing; Wang, Wei; Liu, Chunhong; Sun, Shuhui; Gu, Jianxin; Wang, Xun; Boraschi, Diana; Huang, Yuxian; Qu, Di

2013-01-01

Natural β-glucans extracted from plants and fungi have been used in clinical therapies since the late 20th century. However, the heterogeneity of natural β-glucans limits their clinical applicability. We have synthesized β-glu6, which is an analog of the lentinan basic unit, β-(1→6)-branched β-(1→3) glucohexaose, that contains an α-(1→3)-linked bond. We have demonstrated the stimulatory effect of this molecule on the immune response, but the mechanisms by which β-glu6 activates innate immunity have not been elucidated. In this study, murine macrophages and human PBMCs were used to evaluate the immunomodulatory effects of β-glu6. We showed that β-glu6 activated ERK and c-Raf phosphorylation but suppressed the AKT signaling pathway in murine macrophages. Additionally, β-glu6 enhanced the secretion of large levels of cytokines and chemokines, including CD54, IL-1α, IL-1β, IL-16, IL-17, IL-23, IFN-γ, CCL1, CCL3, CCL4, CCL12, CXCL10, tissue inhibitor of metalloproteinase-1 (TIMP-1) and G-CSF in murine macrophages as well as IL-6, CCL2, CCL3, CCL5, CXCL1 and macrophage migration inhibitory factor (MIF) in human PBMCs. In summary, it demonstrates the immunomodulatory activity of β-glu6 in innate immunity.

Beneficial effects of (pGlu-Gln)-CCK-8 on energy intake and metabolism in high fat fed mice are associated with alterations of hypothalamic gene expression.

PubMed

Montgomery, I A; Irwin, N; Flatt, P R

2013-06-01

Cholecystokinin (CCK) is a gastrointestinal hormone with potential therapeutic promise for obesity-diabetes. The present study examined the effects of twice daily administration of the N-terminally modified stable CCK-8 analogue, (pGlu-Gln)-CCK-8, on metabolic control and hypothalamic gene expression in high fat fed mice. Sub-chronic twice daily injection of (pGlu-Gln)-CCK-8 for 16 days significantly decreased body weight (p<0.05), energy intake (p<0.01), circulating blood glucose (p<0.001), and plasma insulin (p<0.001) compared to high fat controls. Furthermore, (pGlu-Gln)-CCK-8 markedly improved glucose tolerance (p<0.05) and insulin sensitivity (p<0.05). Assessment of hypothalamic gene expression on day 16 revealed significantly elevated NPY (p<0.05) and reduced POMC (p<0.05) and MC4R (p<0.05) mRNA expression in (pGlu-Gln)-CCK-8 treated mice. High fat feeding or (pGlu-Gln)-CCK-8 treatment had no significant effects on hypothalamic gene expression of receptors for leptin, CCK₁ and GLP-1. These studies underscore the potential of (pGlu-Gln)-CCK-8 for the treatment of obesity-diabetes and suggest modulation of NPY and melanocortin related pathways may be involved in the observed beneficial effects. © Georg Thieme Verlag KG Stuttgart · New York.

Metabotropic glutamate receptor 4 (mGlu4)-positive allosteric modulators for the treatment of Parkinson's disease: historical perspective and review of the patent literature.

PubMed

Lindsley, Craig W; Hopkins, Corey R

2012-05-01

Metabotropic glutamate receptor 4 (mGlu(4)) is a group III GPCR and has been demonstrated to play a major role in a number of therapeutic areas within the CNS. As the orthosteric site of all glutamate receptors is highly conserved, modulating mGlu(4) via allosteric modulation has emerged as a very attractive mode-of-action and has been validated preclinically in a number of animal models for Parkinson's disease, anxiety, pain, and neuroinflammation. In this review, the patent literature for mGlu(4)-positive allosteric modulators over the past 4 years will be provided. Patents from all companies are discussed and an overview of the chemical matter and relevant biological properties will be given. Although there has yet to be an mGlu(4)-positive allosteric modulator progressed into clinical trials, there is a wealth of preclinical data from the primary literature that shows the promise of this emerging target. A number of academic and industry laboratories have recently published exciting patent data covering a multitude of chemical matter. Positive allosteric modulation of mGlu(4) remains one of the more attractive non-dopaminergic therapies for Parkinson's disease, as well as emerging data for other indications such as pain, neuroinflammation, schizophrenia and diabetes, which could potentially make mGlu(4) a significant therapeutic target going forward.

Specificity of Processing α-glucosidase I is guided by the substrate conformation: crystallographic and in silico studies.

PubMed

Barker, Megan K; Rose, David R

2013-05-10

The enzyme “GluI” is key to the synthesis of critical glycoproteins in the cell. We have determined the structure of GluI, and modeled binding with its unique sugar substrate. The specificity of this interaction derives from a unique conformation of the substrate. Understanding the mechanism of the enzyme is of basic importance and relevant to potential development of antiviral inhibitors. Processing α-glucosidase I (GluI) is a key member of the eukaryotic N-glycosylation processing pathway, selectively catalyzing the first glycoprotein trimming step in the endoplasmic reticulum. Inhibition of GluI activity impacts the infectivity of enveloped viruses; however, despite interest in this protein from a structural, enzymatic, and therapeutic standpoint, little is known about its structure and enzymatic mechanism in catalysis of the unique glycan substrate Glc3Man9GlcNAc2. The first structural model of eukaryotic GluI is here presented at 2-Å resolution. Two catalytic residues are proposed, mutations of which result in catalytically inactive, properly folded protein. Using Autodocking methods with the known substrate and inhibitors as ligands, including a novel inhibitor characterized in this work, the active site of GluI was mapped. From these results, a model of substrate binding has been formulated, which is most likely conserved in mammalian GluI.

Metabotropic Glutamate Receptors in the Trafficking of Ionotropic Glutamate and GABAA Receptors at Central Synapses

PubMed Central

Xiao, Min-Yi; Gustafsson, Bengt; Niu, Yin-Ping

2006-01-01

The trafficking of ionotropic glutamate (AMPA, NMDA and kainate) and GABAA receptors in and out of, or laterally along, the postsynaptic membrane has recently emerged as an important mechanism in the regulation of synaptic function, both under physiological and pathological conditions, such as information processing, learning and memory formation, neuronal development, and neurodegenerative diseases. Non-ionotropic glutamate receptors, primarily group I metabotropic glutamate receptors (mGluRs), co-exist with the postsynaptic ionotropic glutamate and GABAA receptors. The ability of mGluRs to regulate postsynaptic phosphorylation and Ca2+ concentration, as well as their interactions with postsynaptic scaffolding/signaling proteins, makes them well suited to influence the trafficking of ionotropic glutamate and GABAA receptors. Recent studies have provided insights into how mGluRs may impose such an influence at central synapses, and thus how they may affect synaptic signaling and the maintenance of long-term synaptic plasticity. In this review we will discuss some of the recent progress in this area: i) long-term synaptic plasticity and the involvement of mGluRs; ii) ionotropic glutamate receptor trafficking and long-term synaptic plasticity; iii) the involvement of postsynaptic group I mGluRs in regulating ionotropic glutamate receptor trafficking; iv) involvement of postsynaptic group I mGluRs in regulating GABAA receptor trafficking; v) and the trafficking of postsynaptic group I mGluRs themselves. PMID:18615134

Metabotropic glutamate receptors in the trafficking of ionotropic glutamate and GABA(A) receptors at central synapses.

PubMed

Xiao, Min-Yi; Gustafsson, Bengt; Niu, Yin-Ping

2006-01-01

The trafficking of ionotropic glutamate (AMPA, NMDA and kainate) and GABA(A) receptors in and out of, or laterally along, the postsynaptic membrane has recently emerged as an important mechanism in the regulation of synaptic function, both under physiological and pathological conditions, such as information processing, learning and memory formation, neuronal development, and neurodegenerative diseases. Non-ionotropic glutamate receptors, primarily group I metabotropic glutamate receptors (mGluRs), co-exist with the postsynaptic ionotropic glutamate and GABA(A) receptors. The ability of mGluRs to regulate postsynaptic phosphorylation and Ca(2+) concentration, as well as their interactions with postsynaptic scaffolding/signaling proteins, makes them well suited to influence the trafficking of ionotropic glutamate and GABA(A) receptors. Recent studies have provided insights into how mGluRs may impose such an influence at central synapses, and thus how they may affect synaptic signaling and the maintenance of long-term synaptic plasticity. In this review we will discuss some of the recent progress in this area: i) long-term synaptic plasticity and the involvement of mGluRs; ii) ionotropic glutamate receptor trafficking and long-term synaptic plasticity; iii) the involvement of postsynaptic group I mGluRs in regulating ionotropic glutamate receptor trafficking; iv) involvement of postsynaptic group I mGluRs in regulating GABA(A) receptor trafficking; v) and the trafficking of postsynaptic group I mGluRs themselves.

Suppressing aberrant GluN3A expression rescues NMDA receptor dysfunction, synapse loss and motor and cognitive decline in Huntington's disease models

PubMed Central

Marco, Sonia; Giralt, Albert; Petrovic, Milos M.; Pouladi, Mahmoud A.; Martínez-Turrillas, Rebeca; Martínez-Hernández, José; Kaltenbach, Linda S.; Torres-Peraza, Jesús; Graham, Rona K.; Watanabe, Masahiko; Luján, Rafael; Nakanishi, Nobuki; Lipton, Stuart A.; Lo, Donald C.; Hayden, Michael R.; Alberch, Jordi; Wesseling, John F.

2013-01-01

Huntington's disease is caused by an expanded polyglutamine repeat in huntingtin (Htt), but the pathophysiological sequence of events that trigger synaptic failure and neuronal loss are not fully understood. Alterations in NMDA-type glutamate receptors (NMDARs) have been implicated, yet it remains unclear how the Htt mutation impacts NMDAR function and direct evidence for a causative role is missing. Here we show that mutant Htt re-directs an intracellular store of juvenile NMDARs to the surface of striatal neurons by sequestering and disrupting the subcellular localization of the GluN3A subunit-specific endocytic adaptor PACSIN1. Overexpressing GluN3A in wild-type striatum mimicked the synapse loss observed in Huntington's disease mouse models, whereas genetic deletion of GluN3A prevented synapse degeneration, ameliorated motor and cognitive decline, and reduced striatal atrophy and neuronal loss in the YAC128 model. Furthermore, GluN3A deletion corrected the abnormally enhanced NMDAR currents, which have been linked to cell death in Huntington's disease and other neurodegenerative conditions. Our findings reveal an early pathogenic role of GluN3A dysregulation in Huntington's disease, and suggest that therapies targeting GluN3A or pathogenic Htt-PACSIN1 interactions might prevent or delay disease progression. PMID:23852340

Performance deficits of mGluR8 knockout mice in learning tasks: the effects of null mutation and the background genotype.

PubMed

Gerlai, R; Adams, B; Fitch, T; Chaney, S; Baez, M

2002-08-01

mGluR8 is a G-protein coupled metabotropic glutamate receptor expressed in the mammalian brain. Members of the mGluR family have been shown to be modulators of neural plasticity and learning and memory. Here we analyze the consequences of a null mutation at the mGluR8 gene locus generated using homologous recombination in embryonic stem cells by comparing the learning performance of the mutants with that of wild type controls in the Morris water maze (MWM) and the context and cue dependent fear conditioning (CFC). Our results revealed robust performance deficits associated with the genetic background, the ICR outbred strain, in both mGluR8 null mutant and the wild type control mice. Mice of this strain origin suffered from impaired vision as compared to CD1 or C57BL/6 mice, a significant impediment in MWM, a visuo-spatial learning task. The CFC task, being less dependent on visual cues, allowed us to reveal subtle performance deficits in the mGluR8 mutants: novelty induced hyperactivity and temporally delayed and blunted responding to shocks and temporally delayed responding to contextual stimuli were detected. The role of mGluR8 as a presynaptic autoreceptor and its contribution to cognitive processes are hypothesized and the utility of gene targeting as compared to pharmacological methods is discussed.

Identification of functional amino acid residues involved in polyamine and agmatine transport by human organic cation transporter 2.

PubMed

Higashi, Kyohei; Imamura, Masataka; Fudo, Satoshi; Uemura, Takeshi; Saiki, Ryotaro; Hoshino, Tyuji; Toida, Toshihiko; Kashiwagi, Keiko; Igarashi, Kazuei

2014-01-01

Polyamine (putrescine, spermidine and spermine) and agmatine uptake by the human organic cation transporter 2 (hOCT2) was studied using HEK293 cells transfected with pCMV6-XL4/hOCT2. The Km values for putrescine and spermidine were 7.50 and 6.76 mM, and the Vmax values were 4.71 and 2.34 nmol/min/mg protein, respectively. Spermine uptake by hOCT2 was not observed at pH 7.4, although it inhibited both putrescine and spermidine uptake. Agmatine was also taken up by hOCT2, with Km value: 3.27 mM and a Vmax value of 3.14 nmol/min/mg protein. Amino acid residues involved in putrescine, agmatine and spermidine uptake by hOCT2 were Asp427, Glu448, Glu456, Asp475, and Glu516. In addition, Glu524 and Glu530 were involved in putrescine and spermidine uptake activity, and Glu528 and Glu540 were weakly involved in putrescine uptake activity. Furthermore, Asp551 was also involved in the recognition of spermidine. These results indicate that the recognition sites for putrescine, agmatine and spermidine on hOCT2 strongly overlap, consistent with the observation that the three amines are transported with similar affinity and velocity. A model of spermidine binding to hOCT2 was constructed based on the functional amino acid residues.

Genetic divergence for high-molecular weight glutenin subunits (HMW-GS) in indigenous landraces and commercial cultivars of bread wheat of Pakistan.

PubMed

Yasmeen, F; Khurshid, H; Ghafoor, A

2015-05-11

Wheat flour quality is an important consideration in the breeding and development of new cultivars. A strong association between high-molecular weight glutenin subunits (HMW-GS) and bread making quality has resulted in the widespread utilization of HMW-GS in wheat breeding. In this study, we analyzed 242 lines of wheat, including landraces from the provinces of Punjab and Baluchistan, as well as the commercial varieties of Pakistan, to determine allelic variation in the Glu-A1, Glu-B1, and Glu-D1 loci encoding HMW-GS. Higher genetic diversity was observed for HMW-GS in landraces from Baluchistan, followed by landraces collected from Punjab and then commercial varieties. Rare and uncommon subunits were observed in Glu-B1, whereas Glu-A1 was less polymorphic. However, Glu-B1 was the highest contributor to overall diversity (78%), with a total of 31 rare alleles, followed by Glu-D1 (20%) with the high quality 5+10 allele and other variants. Commercial cultivars possessed favorable alleles, potentially from indirect selection for wheat flour quality by the breeders; however, this indirect selection has decreased the pedigree base of commercial cultivars. The allelic combinations, including 2*, 5+10, and 17+18, showing high quality scores were frequent among landraces, indicating their usefulness in future crop improvement and breeding programs.

Permissive role for mGlu1 metabotropic glutamate receptors in excitotoxic retinal degeneration.

PubMed

Liberatore, Francesca; Bucci, Domenico; Mascio, Giada; Madonna, Michele; Di Pietro, Paola; Beneventano, Martina; Puliti, Alda Maria; Battaglia, Giuseppe; Bruno, Valeria; Nicoletti, Ferdinando; Romano, Maria Rosaria

2017-11-05

Neuroprotection is an unmet need in eye disorders characterized by retinal ganglion cell (RGC) death, such as prematurity-induced retinal degeneration, glaucoma, and age-related macular degeneration. In all these disorders excitotoxicity is a prominent component of neuronal damage, but clinical data discourage the development of NMDA receptor antagonists as neuroprotectants. Here, we show that activation of mGlu1 metabotropic glutamate receptors largely contributes to excitotoxic degeneration of RGCs. Mice at postnatal day 9 were challenged with a toxic dose of monosodium glutamate (MSG, 3g/kg), which caused the death of >70% of Brn-3a + RGCs. Systemic administration of the mGlu1 receptor negative allosteric modulator (NAM), JNJ16259685 (2.5mg/kg, s.c.), was largely protective against MSG-induced RGC death. This treatment did not cause changes in motor behavior in the pups. We also injected MSG to crv4 mice, which lack mGlu1 receptors because of a recessive mutation of the gene encoding the mGlu1 receptor. MSG did not cause retinal degeneration in crv4 mice, whereas it retained its toxic activity in their wild-type littermates. These findings demonstrate that mGlu1 receptors play a key role in excitotoxic degeneration of RGCs, and encourage the study of mGlu1 receptor NAMs in models of retinal neurodegeneration. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.

Low-Concentration Tributyltin Decreases GluR2 Expression via Nuclear Respiratory Factor-1 Inhibition

PubMed Central

Ishida, Keishi; Aoki, Kaori; Takishita, Tomoko; Miyara, Masatsugu; Sakamoto, Shuichiro; Sanoh, Seigo; Kimura, Tomoki; Kanda, Yasunari; Ohta, Shigeru; Kotake, Yaichiro

2017-01-01

Tributyltin (TBT), which has been widely used as an antifouling agent in paints, is a common environmental pollutant. Although the toxicity of high-dose TBT has been extensively reported, the effects of low concentrations of TBT are relatively less well studied. We have previously reported that low-concentration TBT decreases α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)-type glutamate receptor subunit 2 (GluR2) expression in cortical neurons and enhances neuronal vulnerability to glutamate. However, the mechanism of this TBT-induced GluR2 decrease remains unknown. Therefore, we examined the effects of TBT on the activity of transcription factors that control GluR2 expression. Exposure of primary cortical neurons to 20 nM TBT for 3 h to 9 days resulted in a decrease in GluR2 mRNA expression. Moreover, TBT inhibited the DNA binding activity of nuclear respiratory factor-1 (NRF-1), a transcription factor that positively regulates the GluR2. This result indicates that TBT inhibits the activity of NRF-1 and subsequently decreases GluR2 expression. In addition, 20 nM TBT decreased the expression of genes such as cytochrome c, cytochrome c oxidase (COX) 4, and COX 6c, which are downstream of NRF-1. Our results suggest that NRF-1 inhibition is an important molecular action of the neurotoxicity induced by low-concentration TBT. PMID:28800112

Low-Concentration Tributyltin Decreases GluR2 Expression via Nuclear Respiratory Factor-1 Inhibition.

PubMed

Ishida, Keishi; Aoki, Kaori; Takishita, Tomoko; Miyara, Masatsugu; Sakamoto, Shuichiro; Sanoh, Seigo; Kimura, Tomoki; Kanda, Yasunari; Ohta, Shigeru; Kotake, Yaichiro

2017-08-11

Tributyltin (TBT), which has been widely used as an antifouling agent in paints, is a common environmental pollutant. Although the toxicity of high-dose TBT has been extensively reported, the effects of low concentrations of TBT are relatively less well studied. We have previously reported that low-concentration TBT decreases α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)-type glutamate receptor subunit 2 ( GluR2 ) expression in cortical neurons and enhances neuronal vulnerability to glutamate. However, the mechanism of this TBT-induced GluR2 decrease remains unknown. Therefore, we examined the effects of TBT on the activity of transcription factors that control GluR2 expression. Exposure of primary cortical neurons to 20 nM TBT for 3 h to 9 days resulted in a decrease in GluR2 mRNA expression. Moreover, TBT inhibited the DNA binding activity of nuclear respiratory factor-1 (NRF-1), a transcription factor that positively regulates the GluR2 . This result indicates that TBT inhibits the activity of NRF-1 and subsequently decreases GluR2 expression. In addition, 20 nM TBT decreased the expression of genes such as cytochrome c, cytochrome c oxidase (COX) 4, and COX 6c, which are downstream of NRF-1. Our results suggest that NRF-1 inhibition is an important molecular action of the neurotoxicity induced by low-concentration TBT.

Central phencyclidine (PCP) receptor binding is glutamate dependent: evidence for a PCP/excitatory amino acid receptor (EAAR) complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loo, P.; Braunwalder, A.; Lehmann, J.

PCP and other dissociative anesthetica block the increase in neuronal firing rate evoked by the EAAR agonist, N-methyl-Daspartate. NMDA and other EAAs such as glutamate (glu) have not been previously shown to affect PCP ligand binding. In the present study, using once washed rat forebrain membranes, 10 ..mu..M-glu was found to increase the binding of (/sup 3/H)TCP, a PCP analog, to defined PCP recognition sites by 20%. Removal of glu and aspartate (asp) by extensive washing decreased TCP binding by 75-90%. In these membranes, 10 ..mu..M L-glu increased TCP binding 3-fold. This effect was stereospecific and evoked by other EAAsmore » with the order of activity, L-glu > D-asp > L- asp > NMDA > D-glu > quisqualate. Kainate, GABA, NE, DA, 5-HT, 2-chloroadenosine, oxotremorine and histamine had no effect on TCP binding at concentrations up to 100 ..mu..M. The effects of L-glu were attenuated by the NMDA-type receptor antagonist, 2-amino-7--phosphonoheptanoate (AP7; 10 ..mu..M-1 mM). These findings indicate that EAAS facilitate TCP binding, possibly through NMDA-type receptors. The observed interaction between the PCP receptor and EAARs may reflect the existence of a macromolecular receptor complex similar to that demonstrated for the benzodiazepines and GABA.« less

A conserved mechanism for gating in an ionotropic glutamate receptor.

PubMed

Moore, Bryn S; Mirshahi, Uyenlinh L; Ebersole, Tonya L; Mirshahi, Tooraj

2013-06-28

Ionotropic glutamate receptor (iGluR) channels control synaptic activity. The crystallographic structure of GluA2, the prototypical iGluR, reveals a clamshell-like ligand-binding domain (LBD) that closes in the presence of glutamate to open a gate on the pore lining α-helix. How LBD closure leads to gate opening remains unclear. Here, we show that bending the pore helix at a highly conserved alanine residue (Ala-621) below the gate is responsible for channel opening. Substituting Ala-621 with the smaller more flexible glycine resulted in a basally active, nondesensitizing channel with ∼39-fold increase in glutamate potency without affecting surface expression or binding. On GluA2(A621G), the partial agonist kainate showed efficacy similar to a full agonist, and competitive antagonists CNQX and DNQX acted as a partial agonists. Met-629 in GluA2 sits above the gate and is critical in transmitting LBD closure to the gate. Substituting Met-629 with the flexible glycine resulted in reduced channel activity and glutamate potency. The pore regions in potassium channels are structurally similar to iGluRs. Whereas potassium channels typically use glycines as a hinge for gating, iGluRs use the less flexible alanine as a hinge at a similar position to maintain low basal activity allowing for ligand-mediated gating.

Identification of the CAD gene from Eucalyptus urophylla GLU4 and its functional analysis in transgenic tobacco.

PubMed

Chen, B W; Xiao, Y F; Li, J J; Liu, H L; Qin, Z H; Gai, Y; Jiang, X N

2016-12-02

Cinnamyl alcohol dehydrogenase (CAD) catalyzes the final step in lignin biosynthesis. The genus Eucalyptus belongs to the family Myrtaceae, which is the main cultivated species in China. Eucalyptus urophylla GLU4 (GLU4) is widely grown in Guangxi. It is preferred for pulping because of its excellent cellulose content and fiber length. Based on GLU4 and CAD gene expression, a Eucalyptus variety low in lignin content should be obtained using transgenic technology, which could reduce the cost of pulp and improve the pulping rate, and have favorable prospects for application. However, the role and function of CAD in GLU4 is still unclear. In the present study, EuCAD was cloned from GLU4 and identified using bioinformatic tools. Subsequently, in order to evaluate its impact on lignin synthesis, a full-length EuCAD RNAi vector was constructed, and transgenic tobacco was obtained via Agrobacterium-mediated transformation. A significant decrease in CAD expression and lignin content in transgenic tobacco demonstrated a key role for EuCAD in lignin biosynthesis and established a regulatory role for RNAi. In our study, the direct molecular basis of EuCAD expression was determined, and the potential regulatory effects of this RNAi vector on lignin biosynthesis in E. urophylla GLU4 were demonstrated. Our results provide a theoretical basis for the study of lignin biosynthesis in Eucalyptus.

Nicergoline enhances glutamate re-uptake and protects against brain damage in rat global brain ischemia.

PubMed

Asai, S; Zhao, H; Yamashita, A; Jike, T; Kunimatsu, T; Nagata, T; Kohno, T; Ishikawa, K

1999-11-03

Whereas a 2-3 degrees C decrease in intraischemic brain temperature can be neuroprotective, mild brain hyperthermia significantly worsens outcome. Our previous study suggested that an ischemic injury mechanism which is sensitive to temperature may not actually increase the extracellular glutamate concentration ([Glu](e)) during the intraischemic period, but rather impairs the Glu re-uptake system, which has been suggested to be involved in the reversed uptake of Glu. We speculated that enhancing Glu re-uptake, pharmacologically or hypothermically, may shorten exposure to high [Glu](e) in the postischemic period and thereby decrease its deleterious excitotoxic effect on neuronal cells. In the present study, rats treated with nicergoline (32 mg/kg, i.p.), an ergot alkaloid derivative, showed minimal inhibition of the [Glu](e) elevation which characteristically occurs during the 10-min intraischemic period, while Glu re-uptake was dramatically improved in the postischemic period, when severe transient global ischemia was caused by mild hyperthermia. Moreover, the nicergoline (32 mg/kg, i.p.) treated rats showed reduced cell death morphologically and clearly had a far lower mortality. The present study suggests that the development of therapeutic strategies aimed at inhibition or prevention of the reversed uptake of glutamate release during ischemia, i.e., activation of the glutamate uptake mechanism, is a promising approach to reduce neural damage occurring in response to brain ischemia.

Structural Performance of the Second Oldest Glued-Laminated Structure in the United States

Treesearch

Douglas R. Rammer; Jorge de Melo Moura; Robert J. Ross

2014-01-01

The second glued-laminated structure built in the United States was constructed at the USDA Forest Products Laboratory (FPL) in 1934 to demonstrate the performance of wooden arch buildings. After 75 years of use the structure was decommissioned in 2010. Shortly after construction, researchers structurally evaluated the glued-laminated arch structure for uniform loading...

Structural Evaluation of the Second Oldest Glued-Laminated Structure in the United States

Treesearch

Douglas R. Rammer; Jorge de Melo Moura

2013-01-01

The second glued-laminated structure built in the United States was constructed at the USDA Forest Products Laboratory (FPL) in 1934 to demonstrate the performance of wooden arch buildings. After decades of use the structure was decommissioned in 2010. Shortly after construction, researchers structurally evaluated the glued-laminated arch structure for uniform loading...

Strength validation and fire endurance of glued-laminated timber beams

Treesearch

E. L. Schaffer; C. M. Marx; D. A. Bender; F. E. Woeste

A previous paper presented a reliability-based model to predict the strength of glued-laminated timber beams at both room temperature and during fire exposure. This Monte Carlo simulation procedure generates strength and fire endurance (time-to-failure, TTF) data for glued- laminated beams that allow assessment of mean strength and TTF as well as their variability....

Reliability formulation for the strength and fire endurance of glued-laminated beams

Treesearch

D. A. Bender

A model was developed for predicting the statistical distribution of glued-laminated beam strength and stiffness under normal temperature conditions using available long span modulus of elasticity data, end joint tension test data, and tensile strength data for laminating-grade lumber. The beam strength model predictions compared favorably with test data for glued-...

Evidence of intralocus recombination at the Glu-3 loci in bread wheat (Triticum aestivum L.)

USDA-ARS?s Scientific Manuscript database

The low-molecular weight glutenin subunits (LMW-GSs) are one of the major components of wheat seed storage proteins and play a critical role in the determination of wheat flour bread-making quality. The genes encoding for this class of proteins are mainly located at the orthologous Glu-3 loci (Glu-A...

Development of haplotype-specific molecular markers for the low-molecular-weight glutenin subunits

USDA-ARS?s Scientific Manuscript database

Low-molecular-weight glutenin subunits (LMW-GSs) are one of the major components of gluten and their allelic variation has been widely associated with numerous wheat end-use quality parameters. These proteins are encoded by multigene families located at the orthologous Glu-3 loci (Glu-A3, Glu-B3 and...

Alaska birch for edge-glued panel production—considerations for wood products manufacturers

Treesearch

David Nicholls

2010-01-01

Edge-glued panels could become a natural extension for the birch (Betula papyrifera Marsh.) lumber industry in Alaska, resulting in greater utilization of the birch resource while allowing producers to explore a wider variety of products and markets. Key advantages of edge-glued panel production include the relatively low cost of equipment, the...

Evaluation of 11C-Me-NB1 as a Potential PET Radioligand for Measuring GluN2B-Containing NMDA Receptors, Drug Occupancy, and Receptor Cross Talk.

PubMed

Krämer, Stefanie D; Betzel, Thomas; Mu, Linjing; Haider, Ahmed; Herde, Adrienne Müller; Boninsegni, Anna K; Keller, Claudia; Szermerski, Marina; Schibli, Roger; Wünsch, Bernhard; Ametamey, Simon M

2018-04-01

Clinical and preclinical research with modulators at the N -methyl-d-aspartate (NMDA) receptor GluN2B N-terminal domain (NTD) aims for the treatment of various neurologic diseases. The interpretation of the results is hampered by the lack of a suitable NMDA PET tracer for assessing the receptor occupancy of potential drugs. We have developed 11 C-Me-NB1 as a PET tracer for imaging GluN1/GluN2B-containing NMDA receptors and used it to investigate in rats the dose-dependent receptor occupancy of eliprodil, a GluN2B NTD modulator. Methods: 11 C-Me-NB1 was synthesized and characterized by in vitro displacement binding experiments with rat brain membranes, in vitro autoradiography, and blocking and displacement experiments by PET and PET kinetic modeling. Receptor occupancy by eliprodil was studied by PET with 11 C-Me-NB1. Results: 11 C-Me-NB1 was synthesized at 290 ± 90 GBq/μmol molar activity, 7.4 ± 1.9 GBq total activity at the end of synthesis ( n = 17), and more than 99% radiochemical purity. 11 C-Me-NB1 binding in rat brain was blocked in vitro and in vivo by the NTD modulators Ro-25-6981 and eliprodil. Half-maximal receptor occupancy by eliprodil occurred at 1.5 μg/kg. At 1 mg/kg of eliprodil, a dose with reported neuroprotective effects, more than 99.5% of binding sites were occupied. In vitro, 11 C-Me-NB1 binding was independent of the σ-1 receptor (Sigma1R), and the Sigma1R agonist (+)-pentazocine did not compete for high-affinity binding. In vivo, a 2.5 mg/kg dose of (+)-pentazocine abolished 11 C-Me-NB1-specific binding, indicating an indirect effect of Sigma1R on 11 C-Me-NB1 binding. Conclusion: 11 C-Me-NB1 is suitable for the in vivo imaging of NMDA GluN1/GluN2B receptors and the assessment of receptor occupancy by NTD modulators. GluN1/GluN2B NMDA receptors are fully occupied at neuroprotective doses of eliprodil. Furthermore, 11 C-Me-NB1 enables imaging of GluN1/GluN2B NMDA receptor cross talk. © 2018 by the Society of Nuclear Medicine and Molecular Imaging.

[Dynamic changes of 'substantianigra-ventralislateralis-cortex' pathway neural activity coherence and neurotransmitters in rat during exhausting exercise].

PubMed

Hu, Yan-Ru; Liu, Xiao-Li; Qiao, De-Cai

2017-03-08

To reveal the possible mechanism of changes of 'substantianigra-ventralislateralis-cortex' pathway neural activity during one bout of exhausting exercise through observing the neural activity coherence between different nucleus and the concentration of extra-cellular glutamate (Glu) and gamma-aminobutyric acid (GABA). Male Wistar rats were randomly divided into neural activity real-time observation group, substantianigra (SNr) extracellular neurotransmitters observation group, ventralislateralis (VL) extracellular neuro-transmitters observation group and supplementary motor area (SMA) extracellular neurotransmitters observation group, 10 rats in each group. For rats of neural activity real-time observation group, by using LFPs and ECoG recording technique, and self-comparison, we simultaneously recorded the dynamic changes of neural activity of rat SNr, VL and SMA during one bout of exhausting exercise. The dynamic changes of ex-tracellular Glu and GABA in rat SNr, VL and SMA were also observed through microdialysis combined high performance liquid chromatography (HPLC) technique and self-comparison method. Based on the behavioral performance, the exhausting exercise process could be di-vided into 5 different stages, the rest condition, auto exercise period, early fatigue period, exhaustion condition and recovery period. The elec-trophysiological study results showed that, the coherence between neural activity in rat SNr, VL and SMA was significant between 0~30 Hz during all the procedure of exhausting exercise. Compared with the rest condition, the microdialysis study showed that the Glu concentrations and Glu/GABA ratio in SNr were decreased significantly during automatic exercise period ( P < 0.05, P < 0.01), the GABA concentrations were increased significantly ( P < 0.05, P < 0.01), while, in VL and cortex, the Glu concentrations and Glu/GABA ratio were increased significantly ( P < 0.05, P < 0.01), the GABA concentrations were decreased significantly ( P < 0.05, P < 0.01). Under early fatigue and ex-haustion conditions, compared with the rest condition,the Glu concentrations and Glu/GABA ratio in SNr were increased significantly ( P < 0.05, P < 0.01), the GABA concentrations were decreased significantly ( P < 0.05, P < 0.01), while the Glu concentrations and Glu/GABA ratio in VL and cortex were decreased significantly ( P < 0.05, P < 0.01), the GABA concentrations were increased significantly ( P < 0.05, P < 0.01). The neural net work communication between 'substantianigra-ventralislateralis-cortex' pathway exists, changes of Glu and GABA in the nucelus of the pathway are one of the factors resulting in the changes of neural activity.

Expression of Shigella flexneri gluQ-rs gene is linked to dksA and controlled by a transcriptional terminator

PubMed Central

2012-01-01

Background Glutamyl queuosine-tRNAAsp synthetase (GluQ-RS) is a paralog of the catalytic domain of glutamyl-tRNA synthetase and catalyzes the formation of glutamyl-queuosine on the wobble position of tRNAAsp. Here we analyze the transcription of its gene in Shigella flexneri, where it is found downstream of dksA, which encodes a transcriptional regulator involved in stress responses. Results The genomic organization, dksA-gluQ-rs, is conserved in more than 40 bacterial species. RT-PCR assays show co-transcription of both genes without a significant change in transcript levels during growth of S. flexneri. However, mRNA levels of the intergenic region changed during growth, increasing at stationary phase, indicating an additional level of control over the expression of gluQ-rs gene. Transcriptional fusions with lacZ as a reporter gene only produced β-galactosidase activity when the constructs included the dksA promoter, indicating that gluQ-rs do not have a separate promoter. Using bioinformatics, we identified a putative transcriptional terminator between dksA and gluQ-rs. Deletion or alteration of the predicted terminator resulted in increased expression of the lacZ reporter compared with cells containing the wild type terminator sequence. Analysis of the phenotype of a gluQ-rs mutant suggested that it may play a role in some stress responses, since growth of the mutant was impaired in the presence of osmolytes. Conclusions The results presented here, show that the expression of gluQ-rs depends on the dksA promoter, and strongly suggest the presence and the functionality of a transcriptional terminator regulating its expression. Also, the results indicate a link between glutamyl-queuosine synthesis and stress response in Shigella flexneri. PMID:23035718

Expression of Shigella flexneri gluQ-rs gene is linked to dksA and controlled by a transcriptional terminator.

PubMed

Caballero, Valeria C; Toledo, Viviana P; Maturana, Cristian; Fisher, Carolyn R; Payne, Shelley M; Salazar, Juan Carlos

2012-10-05

Glutamyl queuosine-tRNA(Asp) synthetase (GluQ-RS) is a paralog of the catalytic domain of glutamyl-tRNA synthetase and catalyzes the formation of glutamyl-queuosine on the wobble position of tRNA(Asp). Here we analyze the transcription of its gene in Shigella flexneri, where it is found downstream of dksA, which encodes a transcriptional regulator involved in stress responses. The genomic organization, dksA-gluQ-rs, is conserved in more than 40 bacterial species. RT-PCR assays show co-transcription of both genes without a significant change in transcript levels during growth of S. flexneri. However, mRNA levels of the intergenic region changed during growth, increasing at stationary phase, indicating an additional level of control over the expression of gluQ-rs gene. Transcriptional fusions with lacZ as a reporter gene only produced β-galactosidase activity when the constructs included the dksA promoter, indicating that gluQ-rs do not have a separate promoter. Using bioinformatics, we identified a putative transcriptional terminator between dksA and gluQ-rs. Deletion or alteration of the predicted terminator resulted in increased expression of the lacZ reporter compared with cells containing the wild type terminator sequence. Analysis of the phenotype of a gluQ-rs mutant suggested that it may play a role in some stress responses, since growth of the mutant was impaired in the presence of osmolytes. The results presented here, show that the expression of gluQ-rs depends on the dksA promoter, and strongly suggest the presence and the functionality of a transcriptional terminator regulating its expression. Also, the results indicate a link between glutamyl-queuosine synthesis and stress response in Shigella flexneri.

Effects of the mGluR2/3 agonist LY379268 and the mGluR5 antagonist MPEP on handling-induced convulsions during ethanol withdrawal in mice

PubMed Central

Olive, M. Foster; Becker, Howard C.

2008-01-01

In alcoholic patients, ethanol is often consumed in a repeated cyclic pattern of intoxication followed by abstinence and the emergence of withdrawal symptoms. Repeated cycles of ethanol intoxication and withdrawal lead to a sensitization of CNS hyperexcitability as a result of an imbalance between inhibitory GABAergic transmission and excitatory glutamatergic transmission. Symptoms of alcohol withdrawal are usually treated pharmacologically with either benzodiazepines or anticonvulsant medications. However, recent evidence suggests that inhibition of glutamate transmission by stimulation of presynaptic inhibitory metabotropic glutamate receptors (i.e., mGluR2/3 receptors) or inhibition of mGluR5 receptors produces anticonvulsant effects. Therefore, the present study was designed to determine the effects the mGluR2/3 agonist LY379268 and the mGluR5 antagonist MPEP on ethanol withdrawal-induced seizure activity. Adult male C3H/He mice received chronic 16 h of ethanol vapor exposure in inhalation chambers followed by 8 hr of withdrawal daily for 4 consecutive days. During the final (fourth) withdrawal cycle, mice were evaluated hourly for handling-induced convulsions (HIC), and were treated with vehicle, LY379268 (0.3, 1 and 3 mg/kg) or MPEP (1, 3 and 10 mg/kg) treatment at 4 and 8 hr into withdrawal. Significant reductions in overall HIC activity were not observed following administration of either compound. These results suggest that inhibition of glutamate transmission by mGluR2/3 agonists or mGluR5 antagonists does not alter HIC activity during withdrawal from repeated ethanol exposure, and as such these compounds may have limited usefulness in the treatment of CNS hyperexcitability during alcohol withdrawal. PMID:18420113

Identification of surface-exposed domains on the reducing side of photosystem I

NASA Technical Reports Server (NTRS)

Xu, Q.; Guikema, J. A.; Chitnis, P. R.; Spooner, B. S. (Principal Investigator)

1994-01-01

Photosystem I (PSI) is a multisubunit enzyme that catalyzes the light-driven oxidation of plastocyanin or cytochrome c6 and the concomitant photoreduction of ferredoxin or flavodoxin. To identify the surface-exposed domains in PSI of the cyanobacterium Synechocystis sp. PCC 6803, we mapped the regions in PsaE, PsaD, and PsaF that are accessible to proteases and N-hydroxysuccinimidobiotin (NHS-biotin). Upon exposure of PSI complexes to a low concentration of endoproteinase glutamic acid (Glu)-C, PsaE was cleaved to 7.1- and 6.6-kD N-terminal fragments without significant cleavage of other subunits. Glu63 and Glu67, located near the C terminus of PsaE, were the most likely cleavage sites. At higher protease concentrations, the PsaE fragments were further cleaved and an N-terminal 9.8-kD PsaD fragment accumulated, demonstrating the accessibility of Glu residue(s) in the C-terminal domain of PsaD to the protease. Besides these major, primary cleavage products, several secondary cleavage sites on PsaD, PsaE, and PsaF were also identified. PsaF resisted proteolysis when PsaD and PsaE were intact. Glu88 and Glu124 of PsaF became susceptible to endoproteinase Glu-C upon extensive cleavage of PsaD and PsaE. Modification of PSI proteins with NHS-biotin and subsequent cleavage by endoproteinase Glu-C or thermolysin showed that the intact PsaE and PsaD, but not their major degradation products lacking C-terminal domains, were heavily biotinylated. Therefore, lysine-74 at the C terminus of PsaE was accessible for biotinylation. Similarly, lysine-107, or lysine-118, or both in PsaD could be modified by NHS-biotin.

The HIV-1 viral protein Tat increases glutamate and decreases GABA exocytosis from human and mouse neocortical nerve endings.

PubMed

Musante, Veronica; Summa, Maria; Neri, Elisa; Puliti, Aldamaria; Godowicz, Tomasz T; Severi, Paolo; Battaglia, Giuseppe; Raiteri, Maurizio; Pittaluga, Anna

2010-08-01

Human immunodeficiency virus-1 (HIV-1)-encoded transactivator of transcription (Tat) potentiated the depolarization-evoked exocytosis of [(3)H]D-aspartate ([(3)H]D-ASP) from human neocortical terminals. The metabotropic glutamate (mGlu) 1 receptor antagonist 7-(hydroxyimino)cyclopropa[b]chromen-1a-carboxylate ethyl ester (CPCCOEt) prevented this effect, whereas the mGlu5 receptor antagonist 2-methyl-6-(phenylethynyl) pyridine hydrochloride (MPEP) was ineffective. Western blot analysis showed that human neocortex synaptosomes possess mGlu1 and mGlu5 receptors. Tat potentiated the K(+)-evoked release of [(3)H]D-ASP or of endogenous glutamate from mouse neocortical synaptosomes in a CPCCOEt-sensitive and MPEP-insensitive manner. Deletion of mGlu1 receptors (crv4/crv4 mice) or mGlu5 receptors (mGlu5(-/-)mouse) silenced Tat effects. Tat enhanced inositol 1,4,5-trisphosphate production in human and mouse neocortical synaptosomes, consistent with the involvement of group I mGlu receptors. Tat inhibited the K(+)-evoked release of [(3)H]gamma-aminobutyric acid ([(3)H]GABA) from human synaptosomes and that of endogenous GABA or [(3)H]GABA from mouse nerve terminals; the inhibition was insensitive to CPCCOEt or MPEP. Tat-induced effects were retained by Tat(37-72) but not by Tat(48-85). In mouse neocortical slices, Tat facilitated the K(+)- and the veratridine-induced release of [(3)H]D-ASP in a CPCCOEt-sensitive manner and was ineffective in crv4/crv4 mouse slices. These observations are relevant to the comprehension of the pathophysiological effects of Tat in central nervous system and may suggest new potential therapeutic approaches to the cure of HIV-1-associated dementia.

The selective conversion of glutamic acid in amino acid mixtures using glutamate decarboxylase--a means of separating amino acids for synthesizing biobased chemicals.

PubMed

Teng, Yinglai; Scott, Elinor L; Sanders, Johan P M

2014-01-01

Amino acids (AAs) derived from hydrolysis of protein rest streams are interesting feedstocks for the chemical industry due to their functionality. However, separation of AAs is required before they can be used for further applications. Electrodialysis may be applied to separate AAs, but its efficiency is limited when separating AAs with similar isoelectric points. To aid the separation, specific conversion of an AA to a useful product with different charge behavior to the remaining compounds is desired. Here the separation of L-aspartic acid (Asp) and L-glutamic acid (Glu) was studied. L-Glutamate α-decarboxylase (GAD, Type I, EC 4.1.1.15) was applied to specifically convert Glu into γ-aminobutyric acid (GABA). GABA has a different charge behavior from Asp therefore allowing a potential separation by electrodialysis. Competitive inhibition and reduced operational stability caused by Asp could be eliminated by maintaining a sufficiently high concentration of Glu. Immobilization of GAD does not reduce the enzyme's initial activity. However, the operational stability was slightly reduced. An initial study on the reaction operating in a continuous mode was performed using a column reactor packed with immobilized GAD. As the reaction mixture was only passed once through the reactor, the conversion of Glu was lower than expected. To complete the conversion of Glu, the stream containing Asp and unreacted Glu might be recirculated back to the reactor after GABA has been removed. Overall, the reaction by GAD is specific to Glu and can be applied to aid the electrodialysis separation of Asp and Glu. © 2014 American Institute of Chemical Engineers.

Identification of novel modulators for ionotropic glutamate receptor, iGluA2 by in-silico screening

PubMed Central

2013-01-01

Background Ionotropic glutamate receptors (iGluAs, IUPHAR nomenclature) are the major excitatory amino acid neurotransmitter receptors in the mammalian central nervous system (CNS). iGluAs are potential therapeutic drug targets for various neurological disorders including ischemia, epilepsy, Parkinson’s and Alzheimer’s diseases. The known iGluA modulators, cyclothiazide (CTZ), IDRA-21, and other benzothiadiazide derivatives (ALTZ, HCTZ, and CLTZ) bind to the ligand-binding domain of flip-form of iGluA2 at the dimer interface, thereby increasing steady-state activation by reducing desensitization. Methods To discover new modulator compounds, we performed virtual screening for the ligand binding domain (LBD) of iGluA2 against NCI Diversity Set III library containing 1597 compounds, and subsequently performed binding-energy analysis for selected compounds. The crystal structure of rat iGluA2 S1S2J (PDB ID: 3IJO) was used for docking studies. Results and conclusion From this study, we obtained four compounds: (1) 10-2(methoxyethyl)-3-phenylbenzo[g]pteridine-2,4-dione, (2) 2-benzo[e]benzotriazol-2-yl-aniline, (3) 9-nitro-6H-indolo-(2,3,-b)quinoxaline, and (4) 1-hydroxy-n-(3-nitrophenyl)-2-napthamide. The binding mode of these four compounds is very similar to that of abovementioned established modulators: two molecules of each compound independently bind to the protein symmetrically at the dimer interface; occupy the subsites B, C, B’ and C’; potentially interact with Ser518 and Ser775. Binding energy analysis shows that all the four hits are comparable to the drug molecule, CTZ, and hence, we propose that the discovered hits may be potential molecules to develop new chemical libraries for modulating the flip form of iGluA2 function. PMID:23855825

The Emerging Role of Metabotropic Glutamate Receptors in the Pathophysiology of Chronic Stress-Related Disorders

PubMed Central

Peterlik, Daniel; Flor, Peter J.; Uschold-Schmidt, Nicole

2016-01-01

Chronic stress-related psychiatric conditions such as anxiety, depression, and alcohol abuse are an enormous public health concern. The etiology of these pathologies is complex, with psychosocial stressors being among the most frequently discussed risk factors. The brain glutamatergic neurotransmitter system has often been found involved in behaviors and pathophysiologies resulting from acute stress and fear. Despite this, relatively little is known about the role of glutamatergic system components in chronic psychosocial stress, neither in rodents nor in humans. Recently, drug discovery efforts at the metabotropic receptor subtypes of the glutamatergic system (mGlu1-8 receptors) led to the identification of pharmacological tools with emerging potential in psychiatric conditions. But again, the contribution of individual mGlu subtypes to the manifestation of physiological, molecular, and behavioral consequences of chronic psychosocial stress remains still largely unaddressed. The current review will describe animal models typically used to analyze acute and particularly chronic stress conditions, including models of psychosocial stress, and there we will discuss the emerging roles for mGlu receptor subtypes. Indeed, accumulating evidence indicates relevance and potential therapeutic usefulness of mGlu2/3 ligands and mGlu5 receptor antagonists in chronic stress-related disorders. In addition, a role for further mechanisms, e.g. mGlu7-selective compounds, is beginning to emerge. These mechanisms are important to be analyzed in chronic psychosocial stress paradigms, e.g. in the chronic subordinate colony housing (CSC) model. We summarize the early results and discuss necessary future investigations, especially for mGlu5 and mGlu7 receptor blockers, which might serve to suggest improved therapeutic strategies to treat stress-related disorders. PMID:27296643

Synergistic control of protein kinase Cgamma activity by ionotropic and metabotropic glutamate receptor inputs in hippocampal neurons.

PubMed

Codazzi, Franca; Di Cesare, Alessandra; Chiulli, Nino; Albanese, Alberto; Meyer, Tobias; Zacchetti, Daniele; Grohovaz, Fabio

2006-03-29

Conventional protein kinase C (PKC) isoforms are abundant neuronal signaling proteins with important roles in regulating synaptic plasticity and other neuronal processes. Here, we investigate the role of ionotropic and metabotropic glutamate receptor (iGluR and mGluR, respectively) activation on the generation of Ca2+ and diacylglycerol (DAG) signals and the subsequent activation of the neuron-specific PKCgamma isoform in hippocampal neurons. By combining Ca2+ imaging with total internal reflection microscopy analysis of specific biosensors, we show that elevation of both Ca2+ and DAG is necessary for sustained translocation and activation of EGFP (enhanced green fluorescent protein)-PKCgamma. Both DAG production and PKCgamma translocation were localized processes, typically observed within discrete microdomains along the dendritic branches. Markedly, intermediate-strength NMDA receptor (NMDAR) activation or moderate electrical stimulation generated Ca2+ but no DAG signals, whereas mGluR activation generated DAG but no Ca2+ signals. Both receptors were needed for PKCgamma activation. This suggests that a coincidence detection process exists between iGluRs and mGluRs that relies on a molecular coincidence detection process based on the corequirement of Ca2+ and DAG for PKCgamma activation. Nevertheless, the requirement for costimulation with mGluRs could be overcome for maximal NMDAR stimulation through a direct production of DAG via activation of the Ca2+-sensitive PLCdelta (phospholipase Cdelta) isoform. In a second important exception, mGluRs were sufficient for PKCgamma activation in neurons in which Ca2+ stores were loaded by previous electrical activity. Together, the dual activation requirement for PKCgamma provides a plausible molecular interpretation for different synergistic contributions of mGluRs to long-term potentiation and other synaptic plasticity processes.

Cross talk between metabotropic and ionotropic glutamate receptor-mediated signaling in parallel fiber-induced inositol 1,4,5-trisphosphate production in cerebellar Purkinje cells.

PubMed

Okubo, Yohei; Kakizawa, Sho; Hirose, Kenzo; Iino, Masamitsu

2004-10-27

In many excitatory glutamatergic synapses, both ionotropic glutamate receptors (iGluRs) and metabotropic glutamate receptors (mGluRs) are closely distributed on the postsynaptic membrane. However, the functional significance of the close distribution of the two types of glutamate receptors has not been fully clarified. In this study, we examined the functional interaction between iGluR and mGluR at parallel fiber (PF)--> Purkinje cell synapses in the generation of inositol 1,4,5-trisphosphate (IP3), a key second messenger that regulates many important cellular functions. We visualized local IP3 dynamics in Purkinje cells using the green fluorescent protein-tagged pleckstrin homology domain (GFP-PHD) as a fluorescent IP3 probe. Purkinje cells were transduced with Sindbis virus encoding GFP-PHD and imaged with a two-photon laser scanning microscope. Translocation of GFP-PHD from the plasma membrane to the cytoplasm attributable to an increase in IP3 concentration was observed on PF stimulation in fine dendrites of Purkinje cells. Surprisingly, this PF-induced IP3 production was blocked not only by the group I mGluR antagonist but also by the AMPA receptor (AMPAR) antagonist. The PF-induced IP3 production was blocked by either the inhibition of G-protein activation by GDP-betaS or intracellular Ca2+ buffering by BAPTA. These results show that IP3 production is mediated cooperatively by group I mGluR and AMPAR through G-protein activation and Ca2+ influx at PF--> Purkinje cell synapses, identifying the robust cross talk between iGluR and mGluR for the generation of IP3 signals.

Slow synaptic transmission mediated by TRPV1 channels in CA3 interneurons of the hippocampus.

PubMed

Eguchi, Noriomi; Hishimoto, Akitoyo; Sora, Ichiro; Mori, Masahiro

2016-03-11

Metabotropic glutamate receptors (mGluRs) modulate various neuronal functions in the central nervous system. Many studies reported that mGluRs have linkages to neuronal disorders such as schizophrenia and autism related disorders, indicating that mGluRs are involved in critical functions of the neuronal circuits. To study this possibility further, we recorded mGluR-induced synaptic responses in the interneurons of the CA3 stratum radiatum using rat hippocampal organotypic slice cultures. Electrical stimulation in the CA3 pyramidal cell layer evoked a slow inward current in the interneurons at a holding potential of -70mV in the presence of antagonists for AMPA/kainate receptors, NMDA receptors, GABAA receptors and GABAB receptors. The slow inward current was blocked in the absence of extracellular calcium, suggesting that this was a synaptic response. The slow excitatory postsynaptic current (EPSC) reversed near 0mV, reflecting an increase in a non-selective cationic conductance. The slow EPSC is mediated by group I mGluRs, as it was blocked by AP3, a group I mGluR antagonist. Neither a calcium chelator BAPTA nor a phospholipase C (PLC) inhibitor U73122 affected the slow EPSC. La(3+), a general TRP channel blocker or capsazepine, a selective TRPV1 channel antagonist significantly suppressed the slow EPSC. DHPG, a selective group I mGluRs agonist induced an inward current, which was suppressed by capsazepine. These results indicate that in the interneurons of the hippocampal CA3 stratum radiatum group I mGluRs activate TRPV1 channels independently of PLC and intracellular Ca(2+), resulting in the slow EPSC in the interneurons. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Metabotropic glutamate receptor-mediated use-dependent down-regulation of synaptic excitability involves the fragile X mental retardation protein.

PubMed

Repicky, Sarah; Broadie, Kendal

2009-02-01

Loss of the mRNA-binding protein FMRP results in the most common inherited form of both mental retardation and autism spectrum disorders: fragile X syndrome (FXS). The leading FXS hypothesis proposes that metabotropic glutamate receptor (mGluR) signaling at the synapse controls FMRP function in the regulation of local protein translation to modulate synaptic transmission strength. In this study, we use the Drosophila FXS disease model to test the relationship between Drosophila FMRP (dFMRP) and the sole Drosophila mGluR (dmGluRA) in regulation of synaptic function, using two-electrode voltage-clamp recording at the glutamatergic neuromuscular junction (NMJ). Null dmGluRA mutants show minimal changes in basal synapse properties but pronounced defects during sustained high-frequency stimulation (HFS). The double null dfmr1;dmGluRA mutant shows repression of enhanced augmentation and delayed onset of premature long-term facilitation (LTF) and strongly reduces grossly elevated post-tetanic potentiation (PTP) phenotypes present in dmGluRA-null animals. Null dfmr1 mutants show features of synaptic hyperexcitability, including multiple transmission events in response to a single stimulus and cyclic modulation of transmission amplitude during prolonged HFS. The double null dfmr1;dmGluRA mutant shows amelioration of these defects but does not fully restore wildtype properties in dfmr1-null animals. These data suggest that dmGluRA functions in a negative feedback loop in which excess glutamate released during high-frequency transmission binds the glutamate receptor to dampen synaptic excitability, and dFMRP functions to suppress the translation of proteins regulating this synaptic excitability. Removal of the translational regulator partially compensates for loss of the receptor and, similarly, loss of the receptor weakly compensates for loss of the translational regulator.

Effects of Ibuprofen on Cognition and NMDA Receptor Subunit Expression Across Aging

PubMed Central

Loza, Alejandra Márquez; Elias, Valerie; Wong, Carmen P.; Ho, Emily; Bermudez, Michelle; Magnusson, Kathy R.

2017-01-01

Age-related declines in long- and short-term memory show relationships to decreases in N-methyl-D-aspartate (NMDA) receptor expression, which may involve inflammation. This study was designed to determine effects of an anti-inflammatory drug, ibuprofen, on cognitive function and NMDA receptor expression across aging. Male C57BL/6 mice (ages 5, 14, 20, and 26 months) were fed ibuprofen (375 ppm) in NIH31 diet or diet alone for 6 weeks prior to testing. Behavioral testing using the Morris water maze showed that older mice performed significantly worse than younger in spatial long-term memory, reversal, and short-term memory tasks. Ibuprofen enhanced overall performance in the short-term memory task, but this appeared to be more related to improved executive function than memory. Ibuprofen induced significant decreases over all ages in the mRNA densities for GluN2B subunit, all GluN1 splice variants, and GluN1-1 splice forms in the frontal cortex and in protein expression of GluN2A, GluN2B and GluN1 C2′ cassettes in the hippocampus. GluN1-3 splice form mRNA and C2′ cassette protein were significantly increased across ages in frontal lobes of ibuprofen-treated mice. Ibuprofen did not alter expression of pro-inflammatory cytokines IL-1β and TNFα, but did reduce the area of reactive astrocyte immunostaining in frontal cortex of aged mice. Enhancement in executive function showed a relationship to increased GluN1-3 mRNA and decreased gliosis. These findings suggest that inflammation may play a role in executive function declines in aged animals, but other effects of ibuprofen on NMDA receptors appeared to be unrelated to aging or inflammation. PMID:28057539

Modulation of group II metabotropic glutamate receptor (mGlu2) elicits common changes in rat and mice sleep-wake architecture.

PubMed

Ahnaou, Abdellah; Dautzenberg, Frank M; Geys, Helena; Imogai, Hassan; Gibelin, Antoine; Moechars, Dieder; Steckler, Thomas; Drinkenburg, Wilhelmus H I M

2009-01-28

Compiling pharmacological evidence implicates metabotropic glutamate mGlu(2) receptors in the regulation of emotional states and suggests positive modulators as a novel therapeutic approach of Anxiety/Depression and Schizophrenia. Here, we investigated subcutaneous effects of the metabotropic glutamate mGlu(2/3) agonist (LY354740) on sleep-wake architecture in rat. To confirm the specific effects on rapid eye movement (REM) sleep were mediated via metabotropic glutamate mGlu(2) receptors, we characterized the sleep-wake cycles in metabotropic glutamate mGlu(2) receptor deficient mice (mGlu(2)R(-/-)) and their arousal response to LY354740. We furthermore examined effects on sleep behavior in rats of the positive allosteric modulator, biphenyl-indanone A (BINA) alone and in combination with LY354740 at sub-effective doses. LY354740 (1, 3 and 10 mg/kg) dose-dependently suppressed REM sleep and prolonged its onset latency. Metabotropic glutamate mGlu(2)R(-/-) and their wild type (WT) littermates exhibited similar spontaneous sleep-wake phenotype, while LY354740 (10 mg/kg) significantly affected REM sleep variables in WT but not in the mutant. In rats, BINA (1, 3, 10, 20, 40 mg/kg) dose-dependently suppressed REM sleep, lengthened its onset latency and slightly enhanced passive waking. Additionally, combined treatment elicited a synergistic action on REM sleep variables. Our findings show common changes of REM sleep variables following modulation of metabotropic glutamate mGlu(2) receptor and support an active role of this receptor in the regulation of REM sleep. The synergistic action of BINA on LY354740's effects on sleep pattern implies that positive modulators would tune the endogenous glutamate tone suggesting potential benefit in the treatment of psychiatric disorders, in which REM sleep overdrive is manifested.

Oxygen-Inducible Glutamate Oxaloacetate Transaminase as Protective Switch Transforming Neurotoxic Glutamate to Metabolic Fuel During Acute Ischemic Stroke

PubMed Central

Rink, Cameron; Gnyawali, Surya; Peterson, Laura

2011-01-01

Abstract This work rests on our previous report (J Cereb Blood Flow Metab 30: 1275–1287, 2010) recognizing that glutamate (Glu) oxaloacetate transaminase (GOT) is induced when brain tissue hypoxia is corrected during acute ischemic stroke (AIS). GOT can metabolize Glu into tricarboxylic acid cycle intermediates and may therefore be useful to harness excess neurotoxic extracellular Glu during AIS as a metabolic substrate. We report that in cultured neural cells challenged with hypoglycemia, extracellular Glu can support cell survival as long as there is sufficient oxygenation. This effect is abrogated by GOT knockdown. In a rodent model of AIS, supplemental oxygen (100% O2 inhaled) during ischemia significantly increased GOT expression and activity in the stroke-affected brain tissue and prevented loss of ATP. Biochemical analyses and in vivo magnetic resonance spectroscopy during stroke demonstrated that such elevated GOT decreased Glu levels at the stroke-affected site. In vivo lentiviral gene delivery of GOT minimized lesion volume, whereas GOT knockdown worsened stroke outcomes. Thus, brain tissue GOT emerges as a novel target in managing stroke outcomes. This work demonstrates that correction of hypoxia during AIS can help clear extracellular neurotoxic Glu by enabling utilization of this amino acid as a metabolic fuel to support survival of the hypoglycemic brain tissue. Strategies to mitigate extracellular Glu-mediated neurodegeneration via blocking receptor-mediated excitotoxicity have failed in clinical trials. We introduce the concept that under hypoglycemic conditions extracellular Glu can be transformed from a neurotoxin to a survival factor by GOT, provided there is sufficient oxygen to sustain cellular respiration. Antioxid. Redox Signal. 14, 1777–1785. PMID:21361730

CORM-A1 prevents blood-brain barrier dysfunction caused by ionotropic glutamate receptor-mediated endothelial oxidative stress and apoptosis.

PubMed

Basuroy, Shyamali; Leffler, Charles W; Parfenova, Helena

2013-06-01

In cerebral microvascular endothelial cells (CMVEC) of newborn pigs, glutamate at excitotoxic concentrations (mM) causes apoptosis mediated by reactive oxygen species (ROS). Carbon monoxide (CO) produced by CMVEC or delivered by a CO-releasing molecule, CORM-A1, has antioxidant properties. We tested the hypothesis that CORM-A1 prevents cerebrovascular endothelial barrier dysfunction caused by glutamate excitotoxicity. First, we identified the glutamate receptors (GluRs) and enzymatic sources of ROS involved in the mechanism of endothelial apoptosis. In glutamate-exposed CMVEC, ROS formation and apoptosis were blocked by rotenone, 2-thenoyltrifluoroacetone (TTFA), and antimycin, indicating that mitochondrial complexes I, II, and III are the major sources of oxidative stress. Agonists of ionotropic GluRs (iGluRs) N-methyl-D-aspartate (NMDA), cis-ACPD, AMPA, and kainate increased ROS production and apoptosis, whereas iGluR antagonists exhibited antiapoptotic properties, suggesting that iGluRs mediate glutamate-induced endothelial apoptosis. The functional consequences of endothelial injury were tested in the model of blood-brain barrier (BBB) composed of CMVEC monolayer on semipermeable membranes. Glutamate and iGluR agonists reduced transendothelial electrical resistance and increased endothelial paracellular permeability to 3-kDa dextran. CORM-A1 exhibited potent antioxidant and antiapoptotic properties in CMVEC and completely prevented BBB dysfunction caused by glutamate and iGluR agonists. Overall, the endothelial component of the BBB is a cellular target for excitotoxic glutamate that, via a mechanism involving a iGluR-mediated activation of mitochondrial ROS production and apoptosis, leads to BBB opening that may be prevented by the antioxidant and antiapoptotic actions of CORMs. Antioxidant CORMs therapy may help preserve BBB functional integrity in neonatal cerebrovascular disease.

Identification of novel modulators for ionotropic glutamate receptor, iGluA2 by in-silico screening.

PubMed

Padmanabhan, Balasundaram

2013-07-15

Ionotropic glutamate receptors (iGluAs, IUPHAR nomenclature) are the major excitatory amino acid neurotransmitter receptors in the mammalian central nervous system (CNS). iGluAs are potential therapeutic drug targets for various neurological disorders including ischemia, epilepsy, Parkinson's and Alzheimer's diseases. The known iGluA modulators, cyclothiazide (CTZ), IDRA-21, and other benzothiadiazide derivatives (ALTZ, HCTZ, and CLTZ) bind to the ligand-binding domain of flip-form of iGluA2 at the dimer interface, thereby increasing steady-state activation by reducing desensitization. To discover new modulator compounds, we performed virtual screening for the ligand binding domain (LBD) of iGluA2 against NCI Diversity Set III library containing 1597 compounds, and subsequently performed binding-energy analysis for selected compounds. The crystal structure of rat iGluA2 S1S2J (PDB ID: 3IJO) was used for docking studies. From this study, we obtained four compounds: (1) 10-2(methoxyethyl)-3-phenylbenzo[g]pteridine-2,4-dione, (2) 2-benzo[e]benzotriazol-2-yl-aniline, (3) 9-nitro-6H-indolo-(2,3,-b)quinoxaline, and (4) 1-hydroxy-n-(3-nitrophenyl)-2-napthamide. The binding mode of these four compounds is very similar to that of abovementioned established modulators: two molecules of each compound independently bind to the protein symmetrically at the dimer interface; occupy the subsites B, C, B' and C'; potentially interact with Ser518 and Ser775. Binding energy analysis shows that all the four hits are comparable to the drug molecule, CTZ, and hence, we propose that the discovered hits may be potential molecules to develop new chemical libraries for modulating the flip form of iGluA2 function.

Inhibition of spontaneous recovery of fear by mGluR5 after prolonged extinction training.

PubMed

Mao, Sheng-Chun; Chang, Chih-Hua; Wu, Chia-Chen; Orejarena, M Juliana; Orejanera, Maria Juliana; Manzoni, Olivier J; Gean, Po-Wu

2013-01-01

Fear behavior is vital for survival and involves learning contingent associations of non-threatening cues with aversive stimuli. In contrast, excessive levels of fear can be maladaptive and lead to anxiety disorders. Generally, extensive sessions of extinction training correlates with reduced spontaneous recovery. The molecular mechanisms underlying the long-term inhibition of fear recovery following repeated extinction training are not fully understood. Here we show that in rats, prolonged extinction training causes greater reduction in both fear-potentiated startle and spontaneous recovery. This effect was specifically blocked by metabotropic glutamate receptor 5 (mGluR5), but not by mGluR1 antagonists and by a protein synthesis inhibitor. Similar inhibition of memory recovery following prolonged extinction training was also observed in mice. In agreement with the instrumental role of mGluR5 in the prolonged inhibition of fear recovery, we found that FMR1-/- mice which exhibit enhanced mGluR5-mediated signaling exhibit lower spontaneous recovery of fear after extinction training than wild-type littermates. At the molecular level, we discovered that prolonged extinction training reversed the fear conditioning-induced increase in surface expression of GluR1, AMPA/NMDA ratio, postsynaptic density-95 (PSD-95) and synapse-associated protein-97 (SAP97). Accordingly, delivery of Tat-GluR2(3Y), a synthetic peptide that blocks AMPA receptor endocytosis, inhibited prolonged extinction training-induced inhibition of fear recovery. Together, our results demonstrate that prolonged extinction training results in the mGluR5-dependent long-term inhibition of fear recovery. This effect may involve the degradation of original memory and may explain the beneficial effects of prolonged exposure therapy for the treatment of phobias.

Synthesis and biological evaluation of aryl isoxazole derivatives as metabotropic glutamate receptor 1 antagonists: a potential treatment for neuropathic pain.

PubMed

Cho, Gyeong Hi; Kim, TaeHun; Son, Woo Seung; Seo, Seon Hee; Min, Sun-Joon; Cho, Yong Seo; Keum, Gyochang; Jeong, Kyu-Sung; Koh, Hun Yeong; Lee, Jiyoun; Pae, Ae Nim

2015-03-15

Glutamate is the major excitatory neurotransmitter and known to activate the metabotropic and ionotropic glutamate receptors in the brain. Among these glutamate receptors, metabotropic glutamate receptor 1 (mGluR1) has been implicated in various brain disorders including anxiety, schizophrenia and chronic pain. Several studies demonstrated that the blockade of mGluR1 signaling reduced pain responses in animal models, suggesting that mGluR1 is a promising target for the treatment of neuropathic pain. In this study, we have developed mGluR1 antagonists with an aryl isoxazole scaffold, and identify several compounds that are orally active in vivo. We believe that these compounds can serve as a useful tool for the investigation of the role of mGluR1 and a promising lead for the potential treatment of neuropathic pain. Copyright © 2015 Elsevier Ltd. All rights reserved.

Molecular Insights into Metabotropic Glutamate Receptor Allosteric Modulation

PubMed Central

Gregory, Karen J.

2015-01-01

The metabotropic glutamate (mGlu) receptors are a group of eight family C G protein–coupled receptors that are expressed throughout the central nervous system (CNS) and periphery. Within the CNS the different subtypes are found in neurons, both pre- and/or postsynaptically, where they mediate modulatory roles and in glial cells. The mGlu receptor family provides attractive targets for numerous psychiatric and neurologic disorders, with the majority of discovery programs focused on targeting allosteric sites, with allosteric ligands now available for all mGlu receptor subtypes. However, the development of allosteric ligands remains challenging. Biased modulation, probe dependence, and molecular switches all contribute to the complex molecular pharmacology exhibited by mGlu receptor allosteric ligands. In recent years we have made significant progress in our understanding of this molecular complexity coupled with an increased understanding of the structural basis of mGlu allosteric modulation. PMID:25808929

[Allelic variation at high-molecular-weight glutenin subunit loci in Aegilops biuncialis Vis].

PubMed

Kozub, N A; Sozinov, I A; Ksinias, I N; Sozinov, A A

2011-09-01

Alleles at the high-molecular-weight glutenin subunit loci Glu-U1 and Glu-M(b)1 were analyzed in the tetraploid species Aegilops biuncialis (UUM(b)M(b)). The material for the investigation included the collection of 39 accessions of Ae. biuncialis from Ukraine (the Crimea), one Hellenic accession, one accession of unknown origin, F2 seeds from different crosses, as well as samples from natural populations from the Crimea. Ae. umbellulata and Ae. comosa accessions were used to allocate components of the HMW glutenin subunit patterns of Ae. biuncialis to U or M(b) genomes. Eight alleles were identified at the Glu-U1 locus and ten alleles were revealed at the Glu-M(b) 1 locus. Among alleles at the Glu-M(b) 1 locus ofAe. biuncialis there were two alleles controlling the y-type subunit only and one allele encoding the x-subunit only.

Emerging structural insights into the function of ionotropic glutamate receptors.

PubMed

Karakas, Erkan; Regan, Michael C; Furukawa, Hiro

2015-06-01

Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that mediate excitatory neurotransmission crucial for brain development and function, including learning and memory formation. Recently a wealth of structural studies on iGluRs including AMPA receptors (AMPARs), kainate receptors, and NMDA receptors (NMDARs) became available. These studies showed structures of non-NMDARs including AMPAR and kainate receptor in various functional states, thereby providing the first visual sense of how non-NMDAR iGluRs may function in the context of homotetramers. Furthermore, they provided the first view of heterotetrameric NMDAR ion channels, and this illuminated the similarities with and differences from non-NMDARs, thus raising a mechanistic distinction between the two groups of iGluRs. We review mechanistic insights into iGluR functions gained through structural studies of multiple groups. Copyright © 2015 Elsevier Ltd. All rights reserved.

An L319F mutation in transmembrane region 3 (TM3) selectively reduces sensitivity to okaramine B of the Bombyx mori l-glutamate-gated chloride channel.

PubMed

Furutani, Shogo; Okuhara, Daiki; Hashimoto, Anju; Ihara, Makoto; Kai, Kenji; Hayashi, Hideo; Sattelle, David B; Matsuda, Kazuhiko

2017-10-01

Okaramines produced by Penicillium simplicissimum AK-40 activate l-glutamate-gated chloride channels (GluCls) and thus paralyze insects. However, the okaramine binding site on insect GluCls is poorly understood. Sequence alignment shows that the equivalent of residue Leucine319 of the okaramine B sensitive Bombyx mori (B. mori) GluCl is a phenylalanine in the okaramine B insensitive B. mori γ-aminobutyric acid-gated chloride channel of the same species. This residue is located in the third transmembrane (TM3) region, a location which in a nematode GluCl is close to the ivermectin binding site. The B. mori GluCl containing the L319F mutation retained its sensitivity to l-glutamate, but responses to ivermectin were reduced and those to okaramine B were completely blocked.

Glutamate receptor mutations in psychiatric and neurodevelopmental disorders

PubMed Central

Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Àlex

2014-01-01

Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications. PMID:24605182

Glutamate receptor mutations in psychiatric and neurodevelopmental disorders.

PubMed

Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Alex

2014-01-01

Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications.

Bending strength of shallow glued-laminated beams of a uniform grade

Treesearch

Catherine M. Marx; Russell C. Moody

1981-01-01

Ninety glued-laminated Douglas-fir or southern pine beams of a uniform grade with 2-, 4-, or 6-laminations were evaluated in static bending tests. No specially graded tension laminations or end joints were used. The purpose of the tests was to determine which of three present design criteria best predict near minimum bending strength values for shallow glued-laminated...

Lateral testing of glued laminated timber tudor arch

Treesearch

Douglas R. Rammer; Philip Line

2016-01-01

Glued laminated timber Tudor arches have been in wide use in the United States since the 1930s, but detailed knowledge related to seismic design in modern U.S. building codes is lacking. FEMA P-695 (P-695) is a methodology to determine seismic performance factors for a seismic force resisting system. A limited P-695 study for glued laminated timber arch structures...

Deletion of the GluA1 AMPA Receptor Subunit Alters the Expression of Short-Term Memory

ERIC Educational Resources Information Center

Sanderson, David J.; Sprengel, Rolf; Seeburg, Peter H.; Bannerman, David M.

2011-01-01

Deletion of the GluA1 AMPA receptor subunit selectively impairs short-term memory for spatial locations. We further investigated this deficit by examining memory for discrete nonspatial visual stimuli in an operant chamber. Unconditioned suppression of magazine responding to visual stimuli was measured in wild-type and GluA1 knockout mice.…

Effects of peptides Lys-Glu-Asp-Gly and Ala-Glu-Asp-Gly on hormonal activity and structure of the thyroid gland in hypophysectomized young chickens and old hens.

PubMed

Kuznik, B I; Pateyuk, A V; Rusaeva, N S; Baranchugova, L M; Obydenko, V I

2011-02-01

Hypophysectomy in 5-days chickens and old hens was followed by hormonal disturbances and structural changes in the thyroid gland. Administration of peptides Lys-Glu-Asp-Gly and Ala-Glu-Asp-Gly synthesized on the basis the amino acid composition of extracts from the anterior and posterior lobes of the pituitary gland, respectively, to hypophysectomized birds for 40 days significantly reduced the degree of these changes. The normalizing effect of synthetic peptides on the concentration of thyrotrophic hormone and thyroid hormones in old hens was less pronounced than in chickens.

Dual integrin and gastrin-releasing peptide receptor targeted tumor imaging using 18F-labeled PEGylated RGD-bombesin heterodimer 18F-FB-PEG3-Glu-RGD-BBN.

PubMed

Liu, Zhaofei; Yan, Yongjun; Chin, Frederic T; Wang, Fan; Chen, Xiaoyuan

2009-01-22

Radiolabeled RGD and bombesin peptides have been extensively investigated for tumor integrin alpha(v)beta(3) and GRPR imaging, respectively. Due to the fact that many tumors are both integrin and GRPR positive, we designed and synthesized a heterodimeric peptide Glu-RGD-BBN, which is expected to be advantageous over the monomeric peptides for dual-receptor targeting. A PEG(3) spacer was attached to the glutamate alpha-amino group of Glu-RGD-BBN to enhance the (18)F labeling yield and to improve the in vivo kinetics. PEG(3)-Glu-RGD-BBN possesses the comparable GRPR and integrin alpha(v)beta(3) receptor-binding affinities as the corresponding monomers, respectively. The dual-receptor targeting properties of (18)F-FB-PEG(3)-Glu-RGD-BBN were observed in PC-3 tumor model. (18)F-FB-PEG(3)-Glu-RGD-BBN with high tumor contrast and favorable pharmacokinetics is a promising PET tracer for dual integrin and GRPR positive tumor imaging. This heterodimer strategy may also be an applicable method to develop other molecules with improved in vitro and in vivo characterizations for tumor diagnosis and therapy.

The type II cGMP dependent protein kinase regulates GluA1 levels at the plasma membrane of developing cerebellar granule cells

PubMed Central

Incontro, Salvatore; Ciruela, Francisco; Ziff, Edward; Hofmann, Franz; Sánchez-Prieto, José; Torres, Magdalena

2014-01-01

Trafficking of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) is regulated by specific interactions with other proteins and by post-translational mechanisms, such as phosphorylation. We have found that the type II cGMP-dependent protein kinase (cGKII) phosphorylates GluA1 (formerly GluR1) at S845, augmenting the surface expression of AMPARs at both synaptic and extrasynaptic sites. Activation of cGKII by 8-Br-cGMP enhances the surface expression of GluA1, whereas its inhibition or suppression effectively diminished the expression of this protein at the cell surface. In granule cells, NMDA receptor activation (NMDAR) stimulates nitric oxide and cGMP production, which in turn activates cGKII and induces the phosphorylation of GluA1, promoting its accumulation in the plasma membrane. GluA1 is mainly incorporated into calcium permeable AMPARs as exposure to 8-Br-cGMP or NMDA activation enhanced AMPA-elicited calcium responses that are sensitive to NASPM inhibition. We summarize evidence for an increase of calcium permeable AMPA receptors downstream of NMDA receptor activation that might be relevant for granule cell development and plasticity. PMID:23545413

Structure and organization of heteromeric AMPA-type glutamate receptors.

PubMed

Herguedas, Beatriz; García-Nafría, Javier; Cais, Ondrej; Fernández-Leiro, Rafael; Krieger, James; Ho, Hinze; Greger, Ingo H

2016-04-29

AMPA-type glutamate receptors (AMPARs), which are central mediators of rapid neurotransmission and synaptic plasticity, predominantly exist as heteromers of the subunits GluA1 to GluA4. Here we report the first AMPAR heteromer structures, which deviate substantially from existing GluA2 homomer structures. Crystal structures of the GluA2/3 and GluA2/4 N-terminal domains reveal a novel compact conformation with an alternating arrangement of the four subunits around a central axis. This organization is confirmed by cysteine cross-linking in full-length receptors, and it permitted us to determine the structure of an intact GluA2/3 receptor by cryogenic electron microscopy. Two models in the ligand-free state, at resolutions of 8.25 and 10.3 angstroms, exhibit substantial vertical compression and close associations between domain layers, reminiscent of N-methyl-D-aspartate receptors. Model 1 resembles a resting state and model 2 a desensitized state, thus providing snapshots of gating transitions in the nominal absence of ligand. Our data reveal organizational features of heteromeric AMPARs and provide a framework to decipher AMPAR architecture and signaling. Copyright © 2016, American Association for the Advancement of Science.

Glutamate and Glutamine: A Review of In Vivo MRS in the Human Brain

PubMed Central

Ramadan, Saadallah; Lin, Alexander; Stanwell, Peter

2013-01-01

Our understanding of the roles that the amino acids glutamate (Glu) and glutamine (Gln) play in the mammalian central nervous system has increased rapidly in recent times. Many conditions are known to exhibit a disturbance in Glu-Gln equilibrium and the exact relationship between these changed conditions and these amino acids are not fully understood. This has led to increased interest in Glu/Gln quantitation in the human brain in an array of conditions (e.g. mental illness, tumor, neuro-degeneration) as well as in normal brain function. Accordingly, this review has been undertaken to describe the increasing number of in vivo techniques available to study Glu and Gln separately, or pooled as ‘Glx’. The present range of magnetic resonance spectroscopy (MRS) methods used to assess Glu and Gln, vary in approach, complexity and outcome, thus the focus of this review is on a description of MRS acquisition approaches, and an indication of relative utility of each technique rather than brain pathologies associated to Glu and/or Gln perturbation. Consequently, this review focuses particularly on (1) one-dimensional (1D) 1H MRS, (2) two-dimensional (2D) 1H MRS, and (3) 1D 13C MRS techniques. PMID:24123328

The AMPA receptor subunit GluR1 regulates dendritic architecture of motor neurons

NASA Technical Reports Server (NTRS)

Inglis, Fiona M.; Crockett, Richard; Korada, Sailaja; Abraham, Wickliffe C.; Hollmann, Michael; Kalb, Robert G.

2002-01-01

The morphology of the mature motor neuron dendritic arbor is determined by activity-dependent processes occurring during a critical period in early postnatal life. The abundance of the AMPA receptor subunit GluR1 in motor neurons is very high during this period and subsequently falls to a negligible level. To test the role of GluR1 in dendrite morphogenesis, we reintroduced GluR1 into rat motor neurons at the end of the critical period and quantitatively studied the effects on dendrite architecture. Two versions of GluR1 were studied that differed by the amino acid in the "Q/R" editing site. The amino acid occupying this site determines single-channel conductance, ionic permeability, and other essential electrophysiologic properties of the resulting receptor channels. We found large-scale remodeling of dendritic architectures in a manner depending on the amino acid occupying the Q/R editing site. Alterations in the distribution of dendritic arbor were not prevented by blocking NMDA receptors. These observations suggest that the expression of GluR1 in motor neurons modulates a component of the molecular substrate of activity-dependent dendrite morphogenesis. The control of these events relies on subunit-specific properties of AMPA receptors.

Dietary monosodium glutamate enhances gastric secretion.

PubMed

Khropycheva, Raisa; Uneyama, Hisayuki; Torii, Kunio; Zolotarev, Vasiliy

2009-01-01

Dietary L-glutamate (Glu), an amino acid abundant in many foodstuffs in a free form, is able to modulate physiological functions in the stomach, including secretion and motility. Recently, specific receptors for Glu were identified in the apical membrane of chief cells in the lower region of fundic glands and in the somatostatin-secreting D-cell fraction of the gastric mucosa. This Glu-sensing system in the stomach is linked to activation of the vagal afferents. Among 20 kinds of amino acid, luminal Glu alone activated the vagal afferents in the stomach through a paracrine cascade led by nitric oxide and followed by serotonin (5-HT). In dogs with Pavlov pouches, found that supplementation of an amino acid-rich diet lacking Glu with monosodium Glu (MSG) enhanced the secretion of acid, pepsinogen, and fluid. However, MSG did not affect these secretions induced by a carbohydrate-rich diet and it had no effect on basal secretion when MSG was applied alone without the diet. Enhancement of gastric secretion by MSG was abolished by blockage of the gastric afferents using intra-gastric applied lidocaine. This effect of MSG was due in part to stimulation of 5-HT(3) receptors in the gastric mucosa.

Neuralized1 activates CPEB3: a function for nonproteolytic ubiquitin in synaptic plasticity and memory storage.

PubMed

Pavlopoulos, Elias; Trifilieff, Pierre; Chevaleyre, Vivien; Fioriti, Luana; Zairis, Sakellarios; Pagano, Andrew; Malleret, Gaël; Kandel, Eric R

2011-12-09

The cytoplasmic polyadenylation element-binding protein 3 (CPEB3), a regulator of local protein synthesis, is the mouse homolog of ApCPEB, a functional prion protein in Aplysia. Here, we provide evidence that CPEB3 is activated by Neuralized1, an E3 ubiquitin ligase. In hippocampal cultures, CPEB3 activated by Neuralized1-mediated ubiquitination leads both to the growth of new dendritic spines and to an increase of the GluA1 and GluA2 subunits of AMPA receptors, two CPEB3 targets essential for synaptic plasticity. Conditional overexpression of Neuralized1 similarly increases GluA1 and GluA2 and the number of spines and functional synapses in the hippocampus and is reflected in enhanced hippocampal-dependent memory and synaptic plasticity. By contrast, inhibition of Neuralized1 reduces GluA1 and GluA2 levels and impairs hippocampal-dependent memory and synaptic plasticity. These results suggest a model whereby Neuralized1-dependent ubiquitination facilitates hippocampal plasticity and hippocampal-dependent memory storage by modulating the activity of CPEB3 and CPEB3-dependent protein synthesis and synapse formation. Copyright © 2011 Elsevier Inc. All rights reserved.

Co-agonists differentially tune GluN2B-NMDA receptor trafficking at hippocampal synapses

PubMed Central

Ferreira, Joana S; Papouin, Thomas; Ladépêche, Laurent; Yao, Andrea; Langlais, Valentin C; Bouchet, Delphine; Dulong, Jérôme; Mothet, Jean-Pierre; Sacchi, Silvia; Pollegioni, Loredano; Paoletti, Pierre; Oliet, Stéphane Henri Richard; Groc, Laurent

2017-01-01

The subunit composition of synaptic NMDA receptors (NMDAR), such as the relative content of GluN2A- and GluN2B-containing receptors, greatly influences the glutamate synaptic transmission. Receptor co-agonists, glycine and D-serine, have intriguingly emerged as potential regulators of the receptor trafficking in addition to their requirement for its activation. Using a combination of single-molecule imaging, biochemistry and electrophysiology, we show that glycine and D-serine relative availability at rat hippocampal glutamatergic synapses regulate the trafficking and synaptic content of NMDAR subtypes. Acute manipulations of co-agonist levels, both ex vivo and in vitro, unveil that D-serine alter the membrane dynamics and content of GluN2B-NMDAR, but not GluN2A-NMDAR, at synapses through a process requiring PDZ binding scaffold partners. In addition, using FRET-based FLIM approach, we demonstrate that D-serine rapidly induces a conformational change of the GluN1 subunit intracellular C-terminus domain. Together our data fuels the view that the extracellular microenvironment regulates synaptic NMDAR signaling. DOI: http://dx.doi.org/10.7554/eLife.25492.001 PMID:28598327

Adenosine A2A receptors are required for glutamate mGluR5- and dopamine D1 receptor-evoked ERK1/2 phosphorylation in rat hippocampus: involvement of NMDA receptor.

PubMed

Krania, Paraskevi; Dimou, Eleni; Bantouna, Maria; Kouvaros, Stylianos; Tsiamaki, Eirini; Papatheodoropoulos, Costas; Sarantis, Konstantinos; Angelatou, Fevronia

2018-05-01

Interaction between mGluR5 and NMDA receptors (NMDAR) is vital for synaptic plasticity and cognition. We recently demonstrated that stimulation of mGluR5 enhances NMDAR responses in hippocampus by phosphorylating NR2B(Tyr1472) subunit, and this reaction was enabled by adenosine A 2A receptors (A 2A R) (J Neurochem, 135, 2015, 714). In this study, by using in vitro phosphorylation and western blot analysis in hippocampal slices of male Wistar rats, we show that mGluR5 stimulation or mGluR5/NMDARs co-stimulation synergistically activate ERK1/2 signaling leading to c-Fos expression. Interestingly, both reactions are under the permissive control of endogenous adenosine acting through A 2A Rs. Moreover, mGluR5-mediated ERK1/2 phosphorylation depends on NMDAR, which however exhibits a metabotropic way of function, since no ion influx through its ion channel is required. Furthermore, our results demonstrate that mGluR5 and mGluR5/NMDAR-evoked ERK1/2 activation correlates well with the mGluR5/NMDAR-evoked NR2B(Tyr1472) phosphorylation, since both phenomena coincide temporally, are Src dependent, and are both enabled by A 2A Rs. This indicates a functional involvement of NR2B(Tyr1472) phosphorylation in the ERK1/2 activation. Our biochemical results are supported by electrophysiological data showing that in CA1 region of hippocampus, the theta burst stimulation (TBS)-induced long-term potentiation coincides temporally with an increase in ERK1/2 activation and both phenomena are dependent on the tripartite A 2A , mGlu5, and NMDARs. Furthermore, we show that the dopamine D1 receptors evoked ERK1/2 activation as well as the NR2B(Tyr1472) phosphorylation are also regulated by endogenous adenosine and A 2A Rs. In conclusion, our results highlight the A 2A Rs as a crucial regulator not only for NMDAR responses, but also for regulating ERK1/2 signaling and its downstream pathways, leading to gene expression, synaptic plasticity, and memory consolidation. © 2017 International Society for Neurochemistry.

Effects of oral glucose on exercise thermoregulation in men after water immersion

NASA Technical Reports Server (NTRS)

Dearborn, Alan S.; Ertl, Andrew C.; Greenleaf, John E.; Barnes, Paul R.; Jackson, Catherine G. R.; Breckler, Jennifer L.

1994-01-01

To test the hypothesis elevated blood glucose would attenuate the rise in exercise rectal temperature, six men age 35 plus or minus S.D. 7 years participated in each of three trials by 4-hr water immersion to the neck: (1) 2.0 g/kg body wt of oral glucose (33.8 percent wt./vol.) was consumed followed by 80 min controlled rest (Glu/Rest), and 70 min horizontal supine cycle exercise at 62.8 percent plus or minus S.E. 0.5 percent (1.97 plus or minus 0.02 L/min) of peak O2 uptake followed by 10 min recovery (2) with (Glu/Ex) and (3) without prior flucose (No Glu/Ex). Blood samples were taken at -25, 0, 15, 45, and 68 min of exercise and after plus 10 min of recovery for measurement of hemoglobin, hematocrit, and blood glucose. Both mean skin (T sub sk) (from six sites) and rectal temperatures (T sub re) were monitored continuously. Sweat rate was measured by resistanc hygrometry. The mean of delta PV for the exercise trials was -12.2 plus or minus 2.1 percent. Mean blood glucose for the Glu/Ex trial was higher than that of the No Glu/Ex trial was (108.4 equal or minus 3.9 and 85.6 plus or minus 1.6 mg/dl, respectively, P less than 0.05. At the end of exercise T(sub sk) for the Glu/Ex trial was lower than for No Glu/Ex(32.0 plus or minus 0.3 and 32.4 equals or minus 0.2 C, respectively, P less than 0.05); T(sub re) for the Glu/Ex trial was lower than for No Glu/Es (38.22 plus or minus 0.17 and 38.60 plus or minus 0.11 C, respectively, P less than 0.05); and forearm sweat rate for the Glu/Ex trial (0.34 plus or minus 0.04 and 0.43 plus or minus g/sq cm, respectively, P less than 0.05). These data suggest that elevation of blood glucose prior to horizontal exercise following hypohydration attenuates the increase in body temperature without altering heat production or exercise hypovolemia.

Activation of 5-HT7 serotonin receptors reverses metabotropic glutamate receptor-mediated synaptic plasticity in wild-type and Fmr1 knockout mice, a model of Fragile X syndrome.

PubMed

Costa, Lara; Spatuzza, Michela; D'Antoni, Simona; Bonaccorso, Carmela M; Trovato, Chiara; Musumeci, Sebastiano A; Leopoldo, Marcello; Lacivita, Enza; Catania, Maria V; Ciranna, Lucia

2012-12-01

Fragile X syndrome (FXS) is a genetic cause of intellectual disability and autism. Fmr1 knockout (Fmr1 KO) mice, an animal model of FXS, exhibit spatial memory impairment and synapse malfunctioning in the hippocampus, with abnormal enhancement of long-term depression mediated by metabotropic glutamate receptors (mGluR-LTD). The neurotransmitter serotonin (5-HT) modulates hippocampal-dependent learning through serotonin 1A (5-HT1A) and serotonin 7 (5-HT7) receptors; the underlying mechanisms are unknown. We used electrophysiology to test the effects of 5-HT on mGluR-LTD in wild-type and Fmr1 KO mice and immunocytochemistry and biotinylation assay to study related changes of 2-amino-3-(5-methyl-3-oxo-1,2-oxazol-4-yl)propanoic acid (AMPA) glutamate receptor surface expression. Application of 5-HT or 8-OH-DPAT (a mixed 5-HT1A/5-HT7 agonist) reversed mGluR-LTD in hippocampal slices. Reversal of mGluR-LTD by 8-OH-DPAT persisted in the presence of the 5-HT1A receptor antagonist WAY-100635, was abolished by SB-269970 (5-HT7 receptor antagonist), and was mimicked by LP-211, a novel selective 5-HT7 receptor agonist. Consistently, 8-OH-DPAT decreased mGluR-mediated reduction of AMPA glutamate receptor 2 (GluR2) subunit surface expression in hippocampal slices and cultured hippocampal neurons, an effect mimicked by LP-211 and blocked by SB-269970. In Fmr1 KO mice, mGluR-LTD was abnormally enhanced; similarly to wild-type, 8-OH-DPAT reversed mGluR-LTD and decreased mGluR-induced reduction of surface AMPA receptors, an effect antagonized by SB-269970. Serotonin 7 receptor activation reverses metabotropic glutamate receptor-induced AMPA receptor internalization and LTD both in wild-type and in Fmr1 KO mice, correcting excessive mGluR-LTD. Therefore, selective activation of 5-HT7 receptors may represent a novel strategy in the therapy of FXS. Copyright © 2012 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Glutamate Induced Thermal Equilibrium Intermediate and Counteracting Effect on Chemical Denaturation of Proteins.

PubMed

Anumalla, Bramhini; Prabhu, N Prakash

2018-01-25

When organisms are subjected to stress conditions, one of their adaptive responses is accumulation of small organic molecules called osmolytes. These osmolytes affect the structure and stability of the biological macromolecules including proteins. The present study examines the effect of a negatively charged amino acid osmolyte, glutamate (Glu), on two model proteins, ribonuclease A (RNase A) and α-lactalbumin (α-LA), which have positive and negative surface charges at pH 7, respectively. These proteins follow two-state unfolding transitions during both heat and chemical induced denaturation processes. The addition of Glu stabilizes the proteins against temperature and induces an early equilibrium intermediate during unfolding. The stability is found to be enthalpy-driven, and the free energy of stabilization is more for α-LA compared to RNase A. The decrease in the partial molar volume and compressibility of both of the proteins in the presence of Glu suggests that the proteins attain a more compact state through surface hydration which could provide a more stable conformation. This is also supported by molecule dynamic simulation studies which demonstrate that the water density around the proteins is increased upon the addition of Glu. Further, the intermediates could be completely destabilized by lower concentrations (∼0.5 M) of guanidinium chloride and salt. However, urea subverts the Glu-induced intermediate formed by α-LA, whereas it only slightly destabilizes in the case of RNase A which has a positive surface charge and could possess charge-charge interactions with Glu. This suggests that, apart from hydration, columbic interactions might also contribute to the stability of the intermediate. Gdm-induced denaturation of RNase A and α-LA in the absence and the presence of Glu at different temperatures was carried out. These results also show the Glu-induced stabilization of both of the proteins; however, all of the unfolding transitions followed two-state transitions during chemical denaturation. The extent of stability exerted by Glu is higher for RNase A at higher temperature, whereas it provides more stability for α-LA at lower temperature. Thus, the experiments indicate that Glu induces a thermal equilibrium intermediate and increases the thermodynamic stability of proteins irrespective of their surface charges. The extent of stability varies between the proteins in a temperature-dependent manner.

The Role of GluK4 in Synaptic Plasticity and Affective Behavior in Mice

NASA Astrophysics Data System (ADS)

Catches, Justin Samuel

Kainate receptors (KARs) are glutamate-gated ion channels that signal through both ionotropic and metabotropic pathways (Contractor et al., 2011). Combinations of five KAR subunits (GluK1-5) form tetrameric receptors with GluK1, GluK2, and GluK3 able to form functional homomeric channels. The high-affinity subunits, GluK4 and GluK5, do not form homomeric channels but modify the properties of heteromeric receptors. Expression of the GluK4 receptor subunit in the forebrain is restricted to the CA3 region of the hippocampus and dentate gyrus regions where KARs modulate synaptic plasticity. In this study, ablation of Grik4, which encodes GluK4, in mice reduced KAR synaptic currents and altered activation properties of postsynaptic receptors but left two forms of presynaptic short-term plasticity intact. Disruption of both Grik4 and Grik5 caused complete loss of the postsynaptic ionotropic KAR current and impaired presynaptic frequency facilitation. Additionally, KAR surface expression was altered at pre- and postsynaptic sites at the MF synapse. Despite the loss of ionotropic signaling, KAR-mediated inhibition of the slow afterhyperpolarization current, which is dependent on metabotropic signaling, was intact in CA3 neurons. Long-term potentiation at the MF-CA3 synapse was reduced, likely through a loss of KAR modulation of excitability of the presynaptic MF axons. Genetic variants in the human GRIK4 gene alter the susceptibility for affective disorders (Bloss and Hunter, 2010). We found that ablation of Grik4 in mice resulted in reduced anxiety and an antidepressant-like phenotype. In the elevated zero-maze, a test for anxiety and risk taking behavior, and in two anxiogenic tests, marble-burying and novelty-induced suppression of feeding, anxiety-like behavior was consistently reduced in knockout animals. In the forced swim, a test of learned helplessness used to determine depression-like behavior, knockout mice demonstrated significantly less immobility suggesting that Grik4 ablation has an antidepressant-like effect. Finally, in a sucrose preference test, a test for anhedonia in rodents, Grik4 -/- mice demonstrated increased sucrose preference. Our study demonstrates the importance of high-affinity subunits for ionotropic KAR function and provides support for the importance of GluK4 in affective disorders by uncovering a clear anxiolytic and antidepressant phenotype associated with ablation of Grik4 and a parallel disruption in hippocampal plasticity.

Cation-Size-Dependent Conformational Locking of Glutamic Acid by Alkali Ions: Infrared Photodissociation Spectroscopy of Cryogenic Ions.

PubMed

Klyne, Johanna; Bouchet, Aude; Ishiuchi, Shun-Ichi; Fujii, Masaaki; Dopfer, Otto

2018-03-01

Consolidated knowledge of conformation and stability of amino acids and their clusters is required to understand their biochemical recognition. Often, alkali ions interact with amino acids and proteins. Herein, infrared photodissociation (IRPD) spectra of cryogenic metalated glutamic acid ions (GluM + , M = Li-Cs) are systematically analyzed in the isomer-specific fingerprint and XH stretch ranges (1100-1900, 2600-3600 cm -1 ) to provide a direct measure for cation-size-dependent conformational locking. GluM + ions are generated by electrospray ionization and cooled down to 15 K in a cryogenic quadrupole ion trap. The assignment of the IRPD spectra is supported by density functional theory calculations at the dispersion-corrected B3LYP-D3/aug-cc-pVTZ level. In the global minimum of GluM + , the flexibility of Glu is strongly reduced by the formation of rigid ionic CO···M + ···OC metal bridges, corresponding to charge solvation. The M + binding energy decreases monotonically with increasing cation size from D 0 = 314 to 119 kJ/mol for Li-Cs. Whereas for Li and Na only the global minimum of GluM + is observed, for K-Cs at least three isomers exist at cryogenic temperature. The IRPD spectra of cold GluM + ions are compared to IR multiple-photon dissociation spectra measured at room temperature. Furthermore, we elucidate the differences of the impact of protonation and metalation on the structure and conformational locking of Glu.

Nonselective suppression of operant ethanol and sucrose self-administration by the mGluR7 positive allosteric modulator AMN082

PubMed Central

Salling, Michael C.; Faccidomo, Sara; Hodge, Clyde W.

2008-01-01

Emerging evidence indicates that specific metabotropic glutamate receptors (mGluRs) modulate ethanol self-administration. In general, inhibition of glutamate transmission through blockade of postsynaptic mGluRs, or activation of presynaptic mGluRs, inhibits ethanol self-administration. The goal of this preclinical study was to further characterize mGluR regulation of ethanol self-administration by examining effects of AMN082, an allosteric positive modulator of presynaptic mGluR7 activity. Separate groups of C57BL/6J male mice were trained to self-administer ethanol or sucrose on a fixed-ratio 4 schedule of reinforcement during 1 hour sessions. On test days, mice were pretreated with AMN082 (0, 1.0, 3.0, 5.6, or 10 mg/kg) 30 minutes prior to self-administration sessions. Functional specificity and activity was examined by testing the effects of AMN082 (0 – 10 mg/kg) on open-field locomotor activity and HPA axis function as measured by plasma corticosterone levels. AMN082 (10 mg/kg) produced a significant reduction in ethanol and sucrose reinforced responding, and inhibited locomotor activity. Plasma corticosterone levels were significantly increased following AMN082 (5.6 and 10 mg/kg) suggesting a dose-dependent dissociation between the behavioral and hormonal effects of the compound. These data suggest that activation of mGluR7 by AMNO82 produces non-specific reductions in motivated behavior that are associated with negative effects on motor activity. PMID:18593591

Identification of the kainate receptor subunits underlying modulation of excitatory synaptic transmission in the CA3 region of the hippocampus.

PubMed

Contractor, A; Swanson, G T; Sailer, A; O'Gorman, S; Heinemann, S F

2000-11-15

To understand the physiological role of kainate receptors and their participation in seizure induction in animal models of epilepsy, it will be necessary to develop a comprehensive description of their action in the CA3 region of the hippocampus. Activation of presynaptic kainate receptors depresses excitatory synaptic transmission at mossy fiber and associational-commissural inputs to CA3 pyramidal neurons (Vignes et al., 1998; Bortolotto et al., 1999; Kamiya and Ozawa, 2000). In this study, we use gene-targeted mice lacking glutamate receptor 5 (GluR5) or GluR6 kainate receptor subunits to identify the receptor subunits that comprise the kainate receptors responsible for presynaptic modulation of CA3 transmission. We found that bath application of kainate (3 microm) profoundly reduced EPSCs at mossy fiber and collateral synapses in neurons from wild-type and GluR5(-/-) mice but had no effect on EPSCs in neurons from GluR6(-/-) mice. These results therefore contrast with previous studies that supported a role for GluR5-containing receptors at mossy fiber and associational-commissural synapses (Vignes et al., 1998; Bortolotto et al., 1999). Surprisingly, at perforant path synapses kainate receptor activation enhanced transmission; this potentiation was abolished in both GluR5 and GluR6 knock-out mice. Kainate receptors thus play multiple and complex roles to modulate excitatory synaptic transmission in the CA3 region of the hippocampus.

Iron depletion strategy for targeted cancer therapy: utilizing the dual roles of neutrophil gelatinase-associated lipocalin protein.

PubMed

Tang, Hsin-Chieh; Chang, Pei-Chun; Chen, Yu-Chian

2016-01-01

Decreasing iron uptake and increasing iron efflux may result in cell death by oxidative inactivation of vital enzymes. Applying the dual function of neutrophil gelatinase-associated lipocalin (NGAL) could achieve the goal of iron depletion in the cancer cells. Tyr106, Lys125 or Lys134 was the key binding site for NGAL protein to sequester iron-chelating siderophores. In this study, we employed all bioactive peptides in peptide databank to dock with the siderophore-binding sites of NGAL protein by virtual screening. In addition, we performed molecular dynamics (MD) simulation to observe the molecular character and structural variation of ligand-protein interaction. Glu-Glu-Lys-Glu (EEKE), Glu-Glu-Asp-Cys-Lys (EEDCK), and Gly-Glu-Glu-Cys-Asp (GEECD) were selected preliminarily by rigorous scoring functions for further investigation. GEECD was excluded due to higher binding total energy than the others. Moreover, we also excluded EEKE due to larger influence to the stability of binding residues by the information of root mean square fluctuation (RMSF) and principal component analysis (PCA). Thus, we suggested that EEDCK was the potential bioactive peptide which had been proved to inhibit malignant cells for targeted cancer therapy. Graphical Abstract Perspective drug design of occupying the siderophore-binding sites of NGAL outside the cell temporarily by a potential short peptide until NGAL enters into the cell, and releasing the siderophore-binding sites inside the cell.

Roles of glutamates and metal ions in a rationally designed nitric oxide reductase based on myoglobin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Y.W.; Robinson, H.; Yeung, N.

2010-05-11

A structural and functional model of bacterial nitric oxide reductase (NOR) has been designed by introducing two glutamates (Glu) and three histidines (His) in sperm whale myoglobin. X-ray structural data indicate that the three His and one Glu (V68E) residues bind iron, mimicking the putative FeB site in NOR, while the second Glu (I107E) interacts with a water molecule and forms a hydrogen bonding network in the designed protein. Unlike the first Glu (V68E), which lowered the heme reduction potential by {approx}110 mV, the second Glu has little effect on the heme potential, suggesting that the negatively charged Glu hasmore » a different role in redox tuning. More importantly, introducing the second Glu resulted in a {approx}100% increase in NOR activity, suggesting the importance of a hydrogen bonding network in facilitating proton delivery during NOR reactivity. In addition, EPR and X-ray structural studies indicate that the designed protein binds iron, copper, or zinc in the FeB site, each with different effects on the structures and NOR activities, suggesting that both redox activity and an intermediate five-coordinate heme-NO species are important for high NOR activity. The designed protein offers an excellent model for NOR and demonstrates the power of using designed proteins as a simpler and more well-defined system to address important chemical and biological issues.« less

Roles of Glutamates and Metal ions in a Rationally Designed Nitric Oxide Reductase Based on Myoglobin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Y Lin; N Yeung; Y Gao

2011-12-31

A structural and functional model of bacterial nitric oxide reductase (NOR) has been designed by introducing two glutamates (Glu) and three histidines (His) in sperm whale myoglobin. X-ray structural data indicate that the three His and one Glu (V68E) residues bind iron, mimicking the putative FeB site in NOR, while the second Glu (I107E) interacts with a water molecule and forms a hydrogen bonding network in the designed protein. Unlike the first Glu (V68E), which lowered the heme reduction potential by {approx}110 mV, the second Glu has little effect on the heme potential, suggesting that the negatively charged Glu hasmore » a different role in redox tuning. More importantly, introducing the second Glu resulted in a {approx}100% increase in NOR activity, suggesting the importance of a hydrogen bonding network in facilitating proton delivery during NOR reactivity. In addition, EPR and X-ray structural studies indicate that the designed protein binds iron, copper, or zinc in the FeB site, each with different effects on the structures and NOR activities, suggesting that both redox activity and an intermediate five-coordinate heme-NO species are important for high NOR activity. The designed protein offers an excellent model for NOR and demonstrates the power of using designed proteins as a simpler and more well-defined system to address important chemical and biological issues.« less

Modulation of nociceptive dural input to the trigeminocervical complex through GluK1 kainate receptors.

PubMed

Andreou, Anna P; Holland, Philip R; Lasalandra, Michele P; Goadsby, Peter J

2015-03-01

Migraine is a common and disabling neurologic disorder, with important psychiatric comorbidities. Its pathophysiology involves activation of neurons in the trigeminocervical complex (TCC). Kainate receptors carrying the glutamate receptor subunit 5 (GluK1) are present in key brain areas involved in migraine pathophysiology. To study the influence of kainate receptors on trigeminovascular neurotransmission, we determined the presence of GluK1 receptors within the trigeminal ganglion and TCC with immunohistochemistry. We performed in vivo electrophysiologic recordings from TCC neurons and investigated whether local or systemic application of GluK1 receptor antagonists modulated trigeminovascular transmission. Microiontophoretic application of a selective GluK1 receptor antagonist, but not of a nonspecific ionotropic glutamate receptor antagonist, markedly attenuated cell firing in a subpopulation of neurons activated in response to dural stimulation, consistent with selective inhibition of postsynaptic GluK1 receptor-evoked firing seen in all recorded neurons. In contrast, trigeminovascular activation was significantly facilitated in a different neuronal population. The clinically active kainate receptor antagonist LY466195 attenuated trigeminovascular activation in all neurons. In addition, LY466195 demonstrated an N-methyl-d-aspartate receptor-mediated effect. This study demonstrates a differential role of GluK1 receptors in the TCC, antagonism of which can inhibit trigeminovascular activation through postsynaptic mechanisms. Furthermore, the data suggest a novel, possibly presynaptic, modulatory role of trigeminocervical kainate receptors in vivo. Differential activation of kainate receptors suggests unique roles for this receptor in pro- and antinociceptive mechanisms in migraine pathophysiology.

Modulation of neurological deficits and expression of glutamate receptors during experimental autoimmune encephalomyelitis after treatment with selected antagonists of glutamate receptors.

PubMed

Sulkowski, Grzegorz; Dąbrowska-Bouta, Beata; Strużyńska, Lidia

2013-01-01

The aim of our investigation was to characterize the role of group I mGluRs and NMDA receptors in pathomechanisms of experimental autoimmune encephalomyelitis (EAE), the rodent model of MS. We tested the effects of LY 367385 (S-2-methyl-4-carboxyphenylglycine, a competitive antagonist of mGluR1), MPEP (2-methyl-6-(phenylethynyl)-pyridine, an antagonist of mGluR5), and the uncompetitive NMDA receptor antagonists amantadine and memantine on modulation of neurological deficits observed in rats with EAE. The neurological symptoms of EAE started at 10-11 days post-injection (d.p.i.) and peaked after 12-13 d.p.i. The protein levels of mGluRs and NMDA did not increase in early phases of EAE (4 d.p.i.), but starting from 8 d.p.i. to 25 d.p.i., we observed a significant elevation of mGluR1 and mGluR5 protein expression by about 20% and NMDA protein expression by about 10% over the control at 25 d.p.i. The changes in protein levels were accompanied by changes in mRNA expression of group I mGluRs and NMDARs. During the late disease phase (20-25 d.p.i.), the mRNA expression levels reached 300% of control values. In contrast, treatment with individual receptor antagonists resulted in a reduction of mRNA levels relative to untreated animals.