Presynaptic establishment of the synaptic cleft extracellular matrix is required for post-synaptic differentiation

PubMed Central

Rohrbough, Jeffrey; Rushton, Emma; Woodruff, Elvin; Fergestad, Tim; Vigneswaran, Krishanthan; Broadie, Kendal

2007-01-01

Formation and regulation of excitatory glutamatergic synapses is essential for shaping neural circuits throughout development. In a Drosophila genetic screen for synaptogenesis mutants, we identified mind the gap (mtg), which encodes a secreted, extracellular N-glycosaminoglycan-binding protein. MTG is expressed neuronally and detected in the synaptic cleft, and is required to form the specialized transsynaptic matrix that links the presynaptic active zone with the post-synaptic glutamate receptor (GluR) domain. Null mtg embryonic mutant synapses exhibit greatly reduced GluR function, and a corresponding loss of localized GluR domains. All known post-synaptic signaling/scaffold proteins functioning upstream of GluR localization are also grossly reduced or mislocalized in mtg mutants, including the dPix–dPak–Dock cascade and the Dlg/PSD-95 scaffold. Ubiquitous or neuronally targeted mtg RNA interference (RNAi) similarly reduce post-synaptic assembly, whereas post-synaptically targeted RNAi has no effect, indicating that presynaptic MTG induces and maintains the post-synaptic pathways driving GluR domain formation. These findings suggest that MTG is secreted from the presynaptic terminal to shape the extracellular synaptic cleft domain, and that the cleft domain functions to mediate transsynaptic signals required for post-synaptic development. PMID:17901219

Drosophila fragile X mental retardation protein and metabotropic glutamate receptor A convergently regulate the synaptic ratio of ionotropic glutamate receptor subclasses.

PubMed

Pan, Luyuan; Broadie, Kendal S

2007-11-07

A current hypothesis proposes that fragile X mental retardation protein (FMRP), an RNA-binding translational regulator, acts downstream of glutamatergic transmission, via metabotropic glutamate receptor (mGluR) G(q)-dependent signaling, to modulate protein synthesis critical for trafficking ionotropic glutamate receptors (iGluRs) at synapses. However, direct evidence linking FMRP and mGluR function with iGluR synaptic expression is limited. In this study, we use the Drosophila fragile X model to test this hypothesis at the well characterized glutamatergic neuromuscular junction (NMJ). Two iGluR classes reside at this synapse, each containing common GluRIIC (III), IID and IIE subunits, and variable GluRIIA (A-class) or GluRIIB (B-class) subunits. In Drosophila fragile X mental retardation 1 (dfmr1) null mutants, A-class GluRs accumulate and B-class GluRs are lost, whereas total GluR levels do not change, resulting in a striking change in GluR subclass ratio at individual synapses. The sole Drosophila mGluR, DmGluRA, is also expressed at the NMJ. In dmGluRA null mutants, both iGluR classes increase, resulting in an increase in total synaptic GluR content at individual synapses. Targeted postsynaptic dmGluRA overexpression causes the exact opposite GluR phenotype to the dfmr1 null, confirming postsynaptic GluR subtype-specific regulation. In dfmr1; dmGluRA double null mutants, there is an additive increase in A-class GluRs, and a similar additive impact on B-class GluRs, toward normal levels in the double mutants. These results show that both dFMRP and DmGluRA differentially regulate the abundance of different GluR subclasses in a convergent mechanism within individual postsynaptic domains.

Prenatal Exposure to Tributyltin Decreases GluR2 Expression in the Mouse Brain.

PubMed

Ishida, Keishi; Saiki, Takashi; Umeda, Kanae; Miyara, Masatsugu; Sanoh, Seigo; Ohta, Shigeru; Kotake, Yaichiro

2017-01-01

Tributyltin (TBT), a common environmental contaminant, is widely used as an antifouling agent in paint. We previously reported that exposure of primary cortical neurons to TBT in vitro decreased the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit glutamate receptor 2 (GluR2) expression and subsequently increased neuronal vulnerability to glutamate. Therefore, to identify whether GluR2 expression also decreases after TBT exposure in vivo, we evaluated the changes in GluR2 expression in the mouse brain after prenatal or postnatal exposure to 10 and 25 ppm TBT through pellet diets. Although the mean feed intake and body weight did not decrease in TBT-exposed mice compared with that in control mice, GluR2 expression in the cerebral cortex and hippocampus decreased after TBT exposure during the prenatal period. These results indicate that a decrease in neuronal GluR2 may be involved in TBT-induced neurotoxicity, especially during the fetal period.

Regulation of GluR2 promoter activity by neurotrophic factors via a neuron-restrictive silencer element.

PubMed

Brené, S; Messer, C; Okado, H; Hartley, M; Heinemann, S F; Nestler, E J

2000-05-01

The AMPA glutamate receptor subunit GluR2, which plays a critical role in regulation of AMPA channel function, shows altered levels of expression in vivo after several chronic perturbations. To evaluate the possibility that transcriptional mechanisms are involved, we studied a 1254-nucleotide fragment of the 5'-promoter region of the mouse GluR2 gene in neural-derived cell lines. We focused on regulation of GluR2 promoter activity by two neurotrophic factors, which are known to be altered in vivo in some of the same systems that show GluR2 regulation. Glial-cell line derived neurotrophic factor (GDNF) and brain-derived neurotrophic factor (BDNF) both induced GluR2 promoter activity. This was associated with increased expression of endogenous GluR2 immunoreactivity in the cells as measured by Western blotting. The effect of GDNF and BDNF appeared to be mediated via a NRSE (neuron-restrictive silencer element) present within the GluR2 promoter. The response to these neurotrophic factors was lost upon mutating or deleting this site, but not several other putative response elements present within the promoter. Moreover, overexpression of REST (restrictive element silencer transcription factor; also referred to as NRSF or neuron restrictive silencer factor), which is known to act on NRSEs in other genes to repress gene expression, blocked the ability of GDNF to induce GluR2 promoter activity. However, GDNF did not alter endogenous levels of REST in the cells. Together, these findings suggest that GluR2 expression can be regulated by neurotrophic factors via an apparently novel mechanism involving the NRSE present within the GluR2 gene promoter.

Increased Glutamate Receptor and Transporter Expression in the Cerebral Cortex and Striatum of Gcdh -/- Mice: Possible Implications for the Neuropathology of Glutaric Acidemia Type I

PubMed Central

Lagranha, Valeska Lizzi; Matte, Ursula; de Carvalho, Talita Giacomet; Seminotti, Bianca; Pereira, Carolina Coffi; Koeller, David M.; Woontner, Michael; Goodman, Stephen I.; de Souza, Diogo Onofre Gomes; Wajner, Moacir

2014-01-01

We determined mRNA expression of the ionotropic glutamate receptors NMDA (NR1, NR2A and NR2B subunits), AMPA (GluR2 subunit) and kainate (GluR6 subunit), as well as of the glutamate transporters GLAST and GLT1 in cerebral cortex and striatum of wild type (WT) and glutaryl-CoA dehydrogenase deficient (Gchh -/-) mice aged 7, 30 and 60 days. The protein expression levels of some of these membrane proteins were also measured. Overexpression of NR2A and NR2B in striatum and of GluR2 and GluR6 in cerebral cortex was observed in 7-day-old Gcdh -/-. There was also an increase of mRNA expression of all NMDA subunits in cerebral cortex and of NR2A and NR2B in striatum of 30-day-old Gcdh -/- mice. At 60 days of life, all ionotropic receptors were overexpressed in cerebral cortex and striatum of Gcdh -/- mice. Higher expression of GLAST and GLT1 transporters was also verified in cerebral cortex and striatum of Gcdh -/- mice aged 30 and 60 days, whereas at 7 days of life GLAST was overexpressed only in striatum from this mutant mice. Furthermore, high lysine intake induced mRNA overexpression of NR2A, NR2B and GLAST transcripts in striatum, as well as of GluR2 and GluR6 in both striatum and cerebral cortex of Gcdh -/- mice. Finally, we found that the protein expression of NR2A, NR2B, GLT1 and GLAST were significantly greater in cerebral cortex of Gcdh -/- mice, whereas NR2B and GLT1 was similarly enhanced in striatum, implying that these transcripts were translated into their products. These results provide evidence that glutamate receptor and transporter expression is higher in Gcdh -/- mice and that these alterations may be involved in the pathophysiology of GA I and possibly explain, at least in part, the vulnerability of striatum and cerebral cortex to injury in patients affected by GA I. PMID:24594605

Increased glutamate receptor and transporter expression in the cerebral cortex and striatum of gcdh-/- mice: possible implications for the neuropathology of glutaric acidemia type I.

PubMed

Lagranha, Valeska Lizzi; Matte, Ursula; de Carvalho, Talita Giacomet; Seminotti, Bianca; Pereira, Carolina Coffi; Koeller, David M; Woontner, Michael; Goodman, Stephen I; de Souza, Diogo Onofre Gomes; Wajner, Moacir

2014-01-01

We determined mRNA expression of the ionotropic glutamate receptors NMDA (NR1, NR2A and NR2B subunits), AMPA (GluR2 subunit) and kainate (GluR6 subunit), as well as of the glutamate transporters GLAST and GLT1 in cerebral cortex and striatum of wild type (WT) and glutaryl-CoA dehydrogenase deficient (Gchh-/-) mice aged 7, 30 and 60 days. The protein expression levels of some of these membrane proteins were also measured. Overexpression of NR2A and NR2B in striatum and of GluR2 and GluR6 in cerebral cortex was observed in 7-day-old Gcdh-/-. There was also an increase of mRNA expression of all NMDA subunits in cerebral cortex and of NR2A and NR2B in striatum of 30-day-old Gcdh-/- mice. At 60 days of life, all ionotropic receptors were overexpressed in cerebral cortex and striatum of Gcdh-/- mice. Higher expression of GLAST and GLT1 transporters was also verified in cerebral cortex and striatum of Gcdh-/- mice aged 30 and 60 days, whereas at 7 days of life GLAST was overexpressed only in striatum from this mutant mice. Furthermore, high lysine intake induced mRNA overexpression of NR2A, NR2B and GLAST transcripts in striatum, as well as of GluR2 and GluR6 in both striatum and cerebral cortex of Gcdh-/- mice. Finally, we found that the protein expression of NR2A, NR2B, GLT1 and GLAST were significantly greater in cerebral cortex of Gcdh-/- mice, whereas NR2B and GLT1 was similarly enhanced in striatum, implying that these transcripts were translated into their products. These results provide evidence that glutamate receptor and transporter expression is higher in Gcdh-/- mice and that these alterations may be involved in the pathophysiology of GA I and possibly explain, at least in part, the vulnerability of striatum and cerebral cortex to injury in patients affected by GA I.

Characterization, cell-surface expression and ligand-binding properties of different truncated N-terminal extracellular domains of the ionotropic glutamate receptor subunit GluR1.

PubMed

McIlhinney, R A; Molnár, E

1996-04-01

To identify the location of the first transmembrane segment of the GluR1 glutamate receptor subunit artificial stop codons have been introduced into the N-terminal domain at amino acid positions 442, 510, and 563, namely just before and spanning the proposed first two transmembrane regions. The resultant truncated N-terminal fragments of GluR1, termed NT1, NT2, and NT3 respectively were expressed in Cos-7 cells and their cellular distribution and cell-surface expression analysed using an N-terminal antibody to GluR1. All of the fragments were fully glycosylated and were found to be associated with cell membranes but none was secreted. Differential extraction of the cell membranes indicated that both NT1 and NT2 behave as peripheral membrane proteins. In contrast NT3, like the full subunit, has integral membrane protein properties. Furthermore only NT3 is expressed at the cell surface as determined by immunofluorescence and cell-surface biotinylation. Protease protection assays indicated that only NT3 had a cytoplasmic tail. Binding studies using the selective ligand [(3)H]alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate ([(3)H]AMPA) demonstrated that NT3 does not bind ligand. Together these results indicate that the first transmembrane domain of the GluR1 subunit lies between residues 509 and 562, that the N-terminal domain alone cannot form a functional ligand-binding site and that this domain can be targeted to the cell surface provided that it has a transmembrane-spanning region.

[Expression of AMPA receptors and related protein in immobilization stressed rats and effect of Xiaoyaosan].

PubMed

Yue, Guang-Xin; Wang, Zhu-Feng; Zhang, Qiao-Li; Zhao, Xin; Yue, Li-Feng; Ding, Jie; Chen, Jia-Xu

2008-05-01

To observe protein expression changes of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor and related regulatory protein in the hippocampus and amygdala in chronic immobilization stressed rat and Xiaoyaosan's regulatory effect. Rats were tied 3 h per day to establish immobilization stress condition and treatment with Xiaoyaosan. After 7 days and 21 days stress, the protein expression of AMPA receptor subunit (GluR2/3), N-ethylmaleimide sensitive factor (NSF) and protein interacting with C-kinase 1 (PICK1) in hippocampus and amygdala were detected by using Western blot techniques. The expression of GluR2/3, NSF in dentate gyrus (DG) and amygdala were markedly attenuated (P < 0.05) and PICK1 in CA1 region were significantly increased (P < 0.05) in 7 d immobilization stressed rats while 7 days xiaoyaosan treatment showed an effective regulatory result to PICK1's changes. Under 21 days immobilization stressed condition, the expression of GluR2/3, NSF in CA1 region showed an increasing trend, and GluR2/3 showed a markedly increase (P < 0.01), but showed an significantly decreased trend in amygdala, Xiaoyaosan showed an effective result to such changes above (P < 0.05). The expression of PICK1 showed increasing trend in amygdala and xiaoyaosan could lower its expression (P < 0.05). There are different trends of the expression of AMPA receptor in repeat short-term stress versus chronic immobilization stress, and in hippocampal CA1 region versus amygdala. Xiaoyaosan has better regulation effect on the expression of AMPA receptors in the condition of chronic immobilization stress than those of repeat shortterm stress.

The AMPA receptor subunit GluR1 regulates dendritic architecture of motor neurons

NASA Technical Reports Server (NTRS)

Inglis, Fiona M.; Crockett, Richard; Korada, Sailaja; Abraham, Wickliffe C.; Hollmann, Michael; Kalb, Robert G.

2002-01-01

The morphology of the mature motor neuron dendritic arbor is determined by activity-dependent processes occurring during a critical period in early postnatal life. The abundance of the AMPA receptor subunit GluR1 in motor neurons is very high during this period and subsequently falls to a negligible level. To test the role of GluR1 in dendrite morphogenesis, we reintroduced GluR1 into rat motor neurons at the end of the critical period and quantitatively studied the effects on dendrite architecture. Two versions of GluR1 were studied that differed by the amino acid in the "Q/R" editing site. The amino acid occupying this site determines single-channel conductance, ionic permeability, and other essential electrophysiologic properties of the resulting receptor channels. We found large-scale remodeling of dendritic architectures in a manner depending on the amino acid occupying the Q/R editing site. Alterations in the distribution of dendritic arbor were not prevented by blocking NMDA receptors. These observations suggest that the expression of GluR1 in motor neurons modulates a component of the molecular substrate of activity-dependent dendrite morphogenesis. The control of these events relies on subunit-specific properties of AMPA receptors.

AMPA/kainate glutamate receptors contribute to inflammation, degeneration and pain related behaviour in inflammatory stages of arthritis

PubMed Central

Bonnet, Cleo S; Williams, Anwen S; Gilbert, Sophie J; Harvey, Ann K; Evans, Bronwen A; Mason, Deborah J

2015-01-01

Objectives Synovial fluid glutamate concentrations increase in arthritis. Activation of kainate (KA) and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) glutamate receptors (GluRs) increase interleukin-6 (IL-6) release and cause arthritic pain, respectively. We hypothesised that AMPA and KA GluRs are expressed in human arthritis, and that intra-articular NBQX (AMPA/KA GluR antagonist) prevents pain and pathology in antigen-induced arthritis (AIA). Methods GluR immunohistochemistry was related to synovial inflammation and degradation in osteoarthritis (OA) and rheumatoid arthritis (RA). A single intra-articular NBQX injection was given at induction, and knee swelling and gait of AIA and AIA+NBQX rats compared over 21 days, before imaging, RT-qPCR, histology and immunohistochemistry of joints. Effects of NBQX on human primary osteoblast (HOB) activity were determined. Results AMPAR2 and KA1 immunolocalised to remodelling bone, cartilage and synovial cells in human OA and RA, and rat AIA. All arthritic tissues showed degradation and synovial inflammation. NBQX reduced GluR abundance, knee swelling (p<0.001, days 1–21), gait abnormalities (days 1–2), end-stage joint destruction (p<0.001), synovial inflammation (p<0.001), and messenger RNA expression of meniscal IL-6 (p<0.05) and whole joint cathepsin K (p<0.01). X-ray and MRI revealed fewer cartilage and bone erosions, and less inflammation after NBQX treatment. NBQX reduced HOB number and prevented mineralisation. Conclusions AMPA/KA GluRs are expressed in human OA and RA, and in AIA, where a single intra-articular injection of NBQX reduced swelling by 33%, and inflammation and degeneration scores by 34% and 27%, respectively, exceeding the efficacy of approved drugs in the same model. AMPA/KA GluR antagonists represent a potential treatment for arthritis. PMID:24130267

Input- and subunit-specific AMPA receptor trafficking underlying long-term potentiation at hippocampal CA3 synapses.

PubMed

Kakegawa, Wataru; Tsuzuki, Keisuke; Yoshida, Yukari; Kameyama, Kimihiko; Ozawa, Seiji

2004-07-01

Hippocampal CA3 pyramidal neurons receive synaptic inputs from both mossy fibres (MFs) and associational fibres (AFs). Long-term potentiation (LTP) at these synapses differs in its induction sites and N-methyl-D-aspartate receptor (NMDAR) dependence. Most evidence favours the presynaptic and postsynaptic mechanisms for induction of MF LTP and AF LTP, respectively. This implies that molecular and functional properties differ between MF and AF synapses at both presynaptic and postsynaptic sites. In this study, we focused on the difference in the postsynaptic trafficking of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) between these synapses. To trace the subunit-specific trafficking of AMPARs at each synapse, GluR1 and GluR2 subunits were introduced into CA3 pyramidal neurons in hippocampal organotypic cultures using the Sindbis viral expression system. The electrophysiologically-tagged GluR2 AMPARs, produced by the viral-mediated transfer of the unedited form of GluR2 (GluR2Q), were inserted into both MF and AF postsynaptic sites in a neuronal activity-independent manner. Endogenous Ca(2+)-impermeable AMPARs at these synapses were replaced with exogenous Ca(2+)-permeable receptors, and Ca(2+) influx via the newly expressed postsynaptic AMPARs induced NMDAR-independent LTP at AF synapses. In contrast, no GluR1 AMPAR produced by the gene transfer was constitutively incorporated into AF postsynaptic sites, and only a small amount into MF postsynaptic sites. The synaptic trafficking of GluR1 AMPARs was triggered by the activity of Ca(2+)/calmodulin-dependent kinase II or high-frequency stimulation to induce LTP at AF synapses, but not at MF synapses. These results indicate that MF and AF postsynaptic sites possess distinct properties for AMPAR trafficking in CA3 pyramidal neurons.

Plasticity-Related PKMζ Signaling in the Insular Cortex Is Involved in the Modulation of Neuropathic Pain after Nerve Injury

PubMed Central

Han, Jeongsoo; Kwon, Minjee; Cha, Myeounghoon; Tanioka, Motomasa; Hong, Seong-Karp; Bai, Sun Joon; Lee, Bae Hwan

2015-01-01

The insular cortex (IC) is associated with important functions linked with pain and emotions. According to recent reports, neural plasticity in the brain including the IC can be induced by nerve injury and may contribute to chronic pain. Continuous active kinase, protein kinase Mζ (PKMζ), has been known to maintain the long-term potentiation. This study was conducted to determine the role of PKMζ in the IC, which may be involved in the modulation of neuropathic pain. Mechanical allodynia test and immunohistochemistry (IHC) of zif268, an activity-dependent transcription factor required for neuronal plasticity, were performed after nerve injury. After ζ-pseudosubstrate inhibitory peptide (ZIP, a selective inhibitor of PKMζ) injection, mechanical allodynia test and immunoblotting of PKMζ, phospho-PKMζ (p-PKMζ), and GluR1 and GluR2 were observed. IHC demonstrated that zif268 expression significantly increased in the IC after nerve injury. Mechanical allodynia was significantly decreased by ZIP microinjection into the IC. The analgesic effect lasted for 12 hours. Moreover, the levels of GluR1, GluR2, and p-PKMζ were decreased after ZIP microinjection. These results suggest that peripheral nerve injury induces neural plasticity related to PKMζ and that ZIP has potential applications for relieving chronic pain. PMID:26457205

[Effect of electroacupuncture on expression of ionotropic glutamate receptor subunits and their genes in lumbar segments of spinal cord in rats with neuropathic pain].

PubMed

Ma, Cheng; Yu, Li; Yan, Li-ping

2010-12-01

To observe the effect of electroacupuncture (EA) on the expression of ionotropic glutamate receptor (iGluR) subunits and their mRNAs in the lumbar segments of spinal cord in rats with neuropathic pain, so as to explore its underlying mechanism in relieving spinal hyperalgesia. Thirty SD rats were randomly divided into control, model, and EA groups, with 10 rats in each. The spared nerve injury (SNI) model was established by ligature of the sural nerve after cutting off the common peroneal nerve and anterior tibial nerve. EA (2 Hz, 1 mA) was applied to "Huantiao" (GB 30) and "Weizhong" (BL 40) for 30 min, once daily for 7 days. Mechanical pain threshold was detected before and after modeling and before and after EA treatment. The expression levels of N-methyl-d-aspartic acid (NMDA) receptor subunits NR1 and NR 2 B,and AMPA receptor subunit GluR 1 of iGluR and their genes were assayed by Western blot and reverse transcription polymerase chain reaction (RT-PCR) separately. In comparison with control group, the mechanical pain thresholds were decreased significantly on day 2, 7 and day 14 following modeling in the model group (P < 0.05, P < 0.01). While compared with the model group, the pain threshold was increased considerably on day 14 in the EA group (P < 0.01). Compared with the control group, the expression levels of lumbar spinal cord NR 2 B and NR 2 B mRNA in the model group were increased significantly (P < 0.05), and those of lumbar spinal cord NR 1 and NR 1 mRNA, GluR 1 and GluR 1 mRNA in the model group increased slightly (P > 0.05). In comparison with the model group, the expression levels of lumbar spinal cord NR 2 B and NR 2 B mRNA in the EA group were downregulated remarkably (P < 0.05), and those of lumbar spinal cord NR 1 and NR 1 mRNA, GluR 1 and GluR 1 mRNA in the EA group down-regulated slightly (P > 0.05). EA can significantly suppress pain reaction in rats with neuropathic pain probably through down-regulating the expression of lumbar spinal cord NR 2 B protein and NR 2 B mRNA.

Subunit-dependent postsynaptic expression of kainate receptors on hippocampal interneurons in area CA1

PubMed Central

Wondolowski, Joyce; Frerking, Matthew

2009-01-01

Kainate receptors (KARs) contribute to postsynaptic excitation in only a select subset of neurons. To define the parameters that specify the postsynaptic expression of KARs, we examined the contribution of KARs to EPSCs on hippocampal interneurons in area CA1. Interneurons in stratum radiatum/lacunosum-moleculare (SR/SLM) express KARs both with and without the GluR5 subunit, but KAR-mediated EPSCs are generated mainly, if not entirely, by GluR5-containing KARs. Extrasynaptic glutamate spillover profoundly recruits AMPARs with little effect on KARs, indicating that KARs are targeted at the synapse more precisely than AMPARs. However, spontaneous EPSCs with a conventional AMPAR component did not have a resolvable contribution of KARs, suggesting that the KARs that contribute to the evoked EPSCs are at a distinct set of synapses. GluR5-containing KARs on interneurons in stratum oriens do not contribute substantially to the EPSC. We conclude that KARs are localized to synapses by cell type-, synapse-, and subunit-selective mechanisms. PMID:19144856

Different structural requirements for functional ion pore transplantation suggest different gating mechanisms of NMDA and kainate receptors.

PubMed

Villmann, Carmen; Hoffmann, Jutta; Werner, Markus; Kott, Sabine; Strutz-Seebohm, Nathalie; Nilsson, Tanja; Hollmann, Michael

2008-10-01

Although considerable progress has been made in characterizing the physiological function of the high-affinity kainate (KA) receptor subunits KA1 and KA2, no homomeric ion channel function has been shown. An ion channel transplantation approach was employed in this study to directly test if homomerically expressed KA1 and KA2 pore domains are capable of conducting currents. Transplantation of the ion pore of KA1 or KA2 into GluR6 generated perfectly functional ion channels that allowed characterization of those electrophysiological and pharmacological properties that are determined exclusively by the ion pore of KA1 or KA2. This demonstrates for the first time that KA1 and KA2 ion pore domains are intrinsically capable of conducting ions even in homomeric pore assemblies. NMDA receptors, similar to KA1- or KA2-containing receptors, function only as heteromeric complexes. They are composed of NR1 and NR2 subunits, which both are non-functional when expressed homomerically. In contrast to NR1, the homomeric NR2B ion pore failed to translate ligand binding into pore opening when transplanted into GluR6. Similarly, heteromeric coexpression of the ion channel domains of both NR1 and NR2 inserted into GluR6 failed to produce functional channels. Therefore, we conclude that the mechanism underlying the ion channel opening in the obligatorily heterotetrameric NMDA receptors differs significantly from that in the facultatively heterotetrameric alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate and KA receptors.

Dominant negative mutant of ionotropic glutamate receptor subunit GluR3: implications for the role of a cysteine residue for its channel activity and pharmacological properties.

PubMed Central

Watase, K; Sekiguchi, M; Matsui, T A; Tagawa, Y; Wada, K

1997-01-01

We reported that a 33-amino-acid deletion (from tyrosine-715 to glycine-747) in a putative extracellular loop of GluR3 produced a mutant that exhibited dominant negative effects upon the functional expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors [Sekiguchi et al. (1994) J. Biol. Chem. 269, 14559-14565]. In this study, we searched for a key residue in the dominant negative effects to explore the mechanism and examined the role of the residue in the function of the AMPA receptor. We prepared 20 GluR3 mutants with amino acid substitutions within the 33-amino-acid-region, and dominant negative effects were tested electrophysiologically in Xenopus oocytes co-expressing the mutant and normal subunits. Among the mutants, only a GluR3 mutant in which an original cysteine (Cys)-722 was replaced by alanine exhibited a dominant negative effect comparable with that of the original mutant in which the entire 33-amino-acid segment is deleted. The co-expression of the Cys-722 mutant did not inhibit the translation of normal subunits in oocytes. The Cys-722 mutant formed a functional homomeric receptor with significantly higher affinity for glutamate or kainate than a homomeric GluR3 receptor. The Cys-722 mutation greatly enhanced the sensitivity of GluR3 for aniracetam, which alters kinetic properties of AMPA receptors. The kainate-induced currents in oocytes expressing the Cys-722 mutant alone showed strong inward rectification. These results suggest that the Cys-722 in GluR3 is important for dominant negative effects and plays a crucial role in the determination of pharmacological properties in AMPA receptor function. PMID:9065754

Opposing effects of AMPA and 5-HT1A receptor blockade on passive avoidance and object recognition performance: correlation with AMPA receptor subunit expression in rat hippocampus.

PubMed

Schiapparelli, L; Simón, A M; Del Río, J; Frechilla, D

2006-06-01

It has been suggested that antagonists at serotonin 5-HT1A receptors may exert a procognitive effect by facilitating glutamatergic neurotransmission. Here we further explored this issue by looking for the ability of a 5-HT1A antagonist to prevent the learning deficit induced by AMPA receptor blockade in two behavioural procedures in rats, and for concomitant molecular changes presumably involved in memory formation in the hippocampus. Pretraining administration of the competitive AMPA receptor antagonist, NBQX, produced a dose-related retention impairment in a passive avoidance task 24h later, and also impaired retention in a novel object recognition test when an intertrial interval of 3h was selected. Pretreatment with the selective 5-HT1A receptor antagonist, WAY-100635, prevented the learning deficit induced by NBQX in the two behavioural procedures. In biochemical studies performed on rat hippocampus after the retention tests, we found that learning increased the membrane levels of AMPA receptor GluR1 and GluR2/3 subunits, as well as the phosphorylated forms of GluR1, effects that were abolished by NBQX administration before the training session. Pretreatment with WAY-100635 counteracted the NBQX effects and restored the initial learning-specific increase in Ca2+/calmodulin-dependent protein kinase II (CaMKII) function and the later increase in GluR2/3 and phosphorylated GluR1 surface expression. Moreover, administration of WAY-100635 before object recognition training improved recognition memory 24h later and potentiated the learning-associated increase in AMPA receptor subunits. The results support the proposed utility of 5-HT1A antagonists in the treatment of cognitive disorders.

Prenatal chronic mild stress induces depression-like behavior and sex-specific changes in regional glutamate receptor expression patterns in adult rats.

PubMed

Wang, Y; Ma, Y; Hu, J; Cheng, W; Jiang, H; Zhang, X; Li, M; Ren, J; Li, X

2015-08-20

Chronic stress during critical periods of human fetal brain development is associated with cognitive, behavioral, and mood disorders in later life. Altered glutamate receptor (GluR) expression has been implicated in the pathogenesis of stress-dependent disorders. To test whether prenatal chronic mild stress (PCMS) enhances offspring's vulnerability to stress-induced behavioral and neurobiological abnormalities and if this enhanced vulnerability is sex-dependent, we measured depression-like behavior in the forced swimming test (FST) and regional changes in GluR subunit expression in PCMS-exposed adult male and female rats. Both male and female PCMS-exposed rats exhibited stronger depression-like behavior than controls. Males and females exhibited unique regional changes in GluR expression in response to PCMS alone, FST alone (CON-FST), and PCMS with FST (PCMS-FST). In females, PCMS alone did not alter N-methyl-d-aspartate receptor (NMDAR) or metabotropic glutamate receptor (mGluR) expression, while in PCMS males, higher mGluR2/3, mGluR5, and NR1 expression levels were observed in the prefrontal cortex. In addition, PCMS altered the change in GluR expression induced by acute stress (the FST test), and this too was sex-specific. Male PCMS-FST rats expressed significantly lower mGluR5 levels in the hippocampus, lower mGluR5, NR1, postsynaptic density protein (PSD)95, and higher mGluR2/3 in the prefrontal cortex, and higher mGluR5 and PSD95 in the amygdala than male CON-FST rats. Female PCMS-FST rats expressed lower NR1 in the hippocampus, lower NR2B and PSD95 in the prefrontal cortex, lower mGluR2/3 in the amygdala, and higher PSD95 in the amygdala than female CON-FST rats. PCMS may increase the offspring's vulnerability to depression by altering sex-specific stress-induced changes in glutamatergic signaling. Copyright © 2015. Published by Elsevier Ltd.

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Editing for an AMPA receptor subunit RNA in prefrontal cortex and striatum in Alzheimer's disease, Huntington's disease and schizophrenia

NASA Technical Reports Server (NTRS)

Akbarian, S.; Smith, M. A.; Jones, E. G.; Bloom, F. E. (Principal Investigator)

1995-01-01

Animal studies and cell culture experiments demonstrated that posttranscriptional editing of the transcript of the GluR-2 gene, resulting in substitution of an arginine for glutamine in the second transmembrane region (TM II) of the expressed protein, is associated with a reduction in Ca2+ permeability of the receptor channel. Thus, disturbances in GluR-2 RNA editing with alteration of intracellular Ca2+ homeostasis could lead to neuronal dysfunction and even neuronal degeneration. The present study determined the proportions of edited and unedited GluR-2 RNA in the prefrontal cortex of brains from patients with Alzheimer's disease, in the striatum of brains from patients with Huntington's disease, and in the same areas of brains from age-matched schizophrenics and controls, by using reverse transcriptase-polymerase chain reaction, restriction endonuclease digestion, gel electrophoresis and scintillation radiometry. In the prefrontal cortex of controls, < 0.1% of all GluR-2 RNA molecules were unedited and > 99.9% were edited; in the prefrontal cortex both of schizophrenics and of Alzheimer's patients approximately 1.0% of all GluR-2 RNA molecules were unedited and 99% were edited. In the striatum of controls and of schizophrenics, approximately 0.5% of GluR-2 RNA molecules were unedited and 99.5% were edited; in the striatum of Huntington's patients nearly 5.0% of GluR-2 RNA was unedited. In the prefrontal white matter of controls, approximately 7.0% of GluR-2 RNA was unedited. In the normal human prefrontal cortex and striatum, the large majority of GluR-2 RNA molecules contains a CGG codon for arginine in the TMII coding region; this implies that the corresponding AMPA receptors have a low Ca2+ permeability, as previously demonstrated for the rat brain. The process of GluR-2 RNA editing is compromised in a region-specific manner in schizophrenia, in Alzheimer's disease and Huntington's Chorea although in each of these disorders there is still a large excess of edited GluR-2 RNA molecules. Disturbances of GluR-2 RNA editing leading to excessive Ca2+ permeability, may contribute to neuronal dysfunction in schizophrenia and to neuronal death in Alzheimer's disease and Huntington's disease.

Straight-chain alcohols exhibit a cutoff in potency for the inhibition of recombinant glutamate receptor subunits

PubMed Central

Akinshola, B Emmanuel

2001-01-01

The effects of n-alcohols (methanol to 1-decanol) on kainate-activated AMPA receptor subunit GluR1 and GluR3 ion currents were studied in Xenopus oocytes using the two-electrode voltage-clamp recording technique. For short-chain alcohols from methanol to 1-hexanol, potency for inhibition of GluR1 and GluR3 receptor-mediated current increased in proportion to the chain length or hydrophobicity of the alcohol. The IC50 values of these alcohols for GluR1 were: methanol, 702 mM; ethanol, 170 mM; 1-propanol, 69 mM; 1-butanol, 20 mM; 1-pentanol, 17 mM; and 1-hexanol, 10 mM. For GluR3, IC50 values were: methanol, 712 mM; ethanol, 238 mM; 1-propanol, 50 mM; 1-butanol, 32 mM; 1-pentanol, 13 mM; and 1-hexanol, 7 mM. For long-chain alcohols, 1-heptanol was less potent than 1-hexanol (estimated IC50: 19 mM for GluR1 and 18 mM for GluR3), 1-octanol had little effect only on GluR3, and 1-nonanol and 1-decanol did not significantly inhibit both GluR1 and GluR3 responses. The observations indicate that straight-chain n-alcohols exhibit a cutoff in their potency for inhibition of the function of non-NMDA glutamate receptor subunits, GluR1 and GluR3. The cutoff in potency of n-alcohols for inhibition of non-NMDA glutamate receptor function is consistent with the interpretation that alcohols affect the function of these receptor-channels by interacting with an alcohol binding site of specific dimensions on the receptor protein. PMID:11429388

Delayed Noradrenergic Activation in the Dorsal Hippocampus Promotes the Long-Term Persistence of Extinguished Fear

PubMed Central

Chai, Ning; Liu, Jian-Feng; Xue, Yan-Xue; Yang, Chang; Yan, Wei; Wang, Hui-Min; Luo, Yi-Xiao; Shi, Hai-Shui; Wang, Ji-Shi; Bao, Yan-Ping; Meng, Shi-Qiu; Ding, Zeng-Bo; Wang, Xue-Yi; Lu, Lin

2014-01-01

Fear extinction has been extensively studied, but little is known about the molecular processes that underlie the persistence of extinction long-term memory (LTM). We found that microinfusion of norepinephrine (NE) into the CA1 area of the dorsal hippocampus during the early phase (0 h) after extinction enhanced extinction LTM at 2 and 14 days after extinction. Intra-CA1 infusion of NE during the late phase (12 h) after extinction selectively promoted extinction LTM at 14 days after extinction that was blocked by the β-receptor antagonist propranolol, protein kinase A (PKA) inhibitor Rp-cAMPS, and protein synthesis inhibitors anisomycin and emetine. The phosphorylation levels of PKA, cyclic adenosine monophosphate response element-binding protein (CREB), GluR1, and the membrane GluR1 level were increased by NE during the late phase after extinction that was also blocked by propranolol and Rp-cAMPS. These results suggest that the enhancement of extinction LTM persistence induced by NE requires the activation of the β-receptor/PKA/CREB signaling pathway and membrane GluR1 trafficking. Moreover, extinction increased the phosphorylation levels of Erk1/2, CREB, and GluR1, and the membrane GluR1 level during the late phase, and anisomycin/emetine alone disrupted the persistence of extinction LTM, indicating that the persistence of extinction LTM requires late-phase protein synthesis in the CA1. Propranolol and Rp-cAMPS did not completely disrupt the persistence of extinction LTM, suggesting that another β-receptor/PKA-independent mechanism underlies the persistence of extinction LTM. Altogether, our results showed that enhancing hippocampal noradrenergic activity during the late phase after extinction selectively promotes the persistence of extinction LTM. PMID:24553734

Crystallization and preliminary X-ray crystallographic analysis of the GluR0 ligand-binding core from Nostoc punctiforme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan

2005-11-01

The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less

[Effect of rhynchophylline on behaviors of methamphetamine-dependent zebrafish and the mechanism].

PubMed

Chen, Yi-Fei; Peng, Ju; Fang, Miao; Liu, Yi; Nie, Ling-Hui; Mo, Zhi-Xian; Zhu, Ling-Ling

2016-11-20

To observe the effect of rhynchophylline on methamphetamine-dependent zebrafish and explore the possible mechanism. Zebrafish were divided into control group, amphetamine group, low- (50 mg/kg) and high (100 mg/kg)-dose rhynchophylline groups, and ketamine (150 mg/kg) group. Conditioned place preference (CPP) was induced in zebrafish with methamphetamine, and the staying time in the drug box and the tracking map of the zebrafish were observed with Noldus Ethovision XT system. The protein expressions of TH, NR2B and GLUR2 in the brain of zebrafish with CPP were detected with Western blotting. Compared with the control group, zebrafish in methamphetamine group showed significant variations in the staying time and swimming distance in the drug box after conditioning (P<0.05) with obvious alterations of NR2B, TH and GLUR2 expressions in the brain (P<0.05). Treatment of methamphetamine-dependent zebrafish with high-dose rhynchophylline significantly reduced the variations in the staying time and swimming distance in the drug box (P<0.05) and in the expressions of NR2B, TH and GLUR2 in the brain (P<0.05). Rhynchophylline can inhibit methamphetamine dependence in zebrafish, the mechanism of which may involve the expressions of TH, NR2B and GLUR2 proteins in the brain.

Trafficking of presynaptic AMPA receptors mediating neurotransmitter release: neuronal selectivity and relationships with sensitivity to cyclothiazide.

PubMed

Pittaluga, Anna; Feligioni, Marco; Longordo, Fabio; Luccini, Elisa; Raiteri, Maurizio

2006-03-01

Postsynaptic glutamate AMPA receptors (AMPARs) can recycle between plasma membrane and intracellular pools. In contrast, trafficking of presynaptic AMPARs has not been investigated. AMPAR surface expression involves interactions between the GluR2 carboxy tail and various proteins including glutamate receptor-interacting protein (GRIP), AMPA receptor-binding protein (ABP), protein interacting with C kinase 1 (PICK1), N-ethyl-maleimide-sensitive fusion protein (NSF). Here, peptides known to selectively block the above interactions were entrapped into synaptosomes to study the effects on the AMPA-evoked release of [3H]noradrenaline ([3H]NA) and [3H]acetylcholine ([3H]ACh) from rat hippocampal and cortical synaptosomes, respectively. Internalization of pep2-SVKI to prevent GluR2-GRIP/ABP/PICK1 interactions potentiated the AMPA-evoked release of [3H]NA but left unmodified that of [3H]ACh. Similar potentiation was caused by pep2-AVKI, the blocker of GluR2-PICK1 interaction. Conversely, a decrease in the AMPA-evoked release of [3H]NA, but not of [3H]ACh, was caused by pep2m, a selective blocker of the GluR2-NSF interaction. In the presence of pep2-SVKI the presynaptic AMPARs on noradrenergic terminals lost sensitivity to cyclothiazide. AMPARs releasing [3H]ACh, but not those releasing [3H]NA, were sensitive to spermine, suggesting that they are GluR2-lacking AMPARs. To conclude: (i) release-regulating presynaptic AMPARs constitutively cycle in isolated nerve terminals; (ii) the process exhibits neuronal selectivity; (iii) AMPAR trafficking and desensitization may be interrelated.

Cytochemical Organization of the Retino-Suprachiasmatic System

DTIC Science & Technology

1994-03-11

strongly expiessed of the, non-NMDA ionotropic receptors . Other AMPA-preferring receptors , GluR3 and -R4, were also found, but to lesser extent...kainate, and NMDA receptor RN was found in the hypothalamus. GluRi and GluR2 were ang the nmst strongly expressed of the non-NvDA ionotropic receptors ...several different glutamate receptors . The expression of many different types of ionotropic glutamate receptors throughout the hypothalamus suggests that

Distribution of AMPA receptor subunits GluR1-4 in the dorsal vagal complex of the rat: a light and electron microscope immunocytochemical study.

PubMed

Kessler, J P; Baude, A

1999-10-01

The dorsal vagal complex, localized in the dorsomedial medulla, includes the nucleus tractus solitarii (NTS), the dorsal motor nucleus of the vagus nerve (DMN) and the area postrema (AP). The distribution of AMPA-preferring glutamate receptors (AMPA receptors) within this region was investigated using immunohistochemistry and antibodies recognizing either one (GluR1 or GluR4) or two (GluR2 and GluR3) AMPA receptors subunits. The distribution of GluR1 immunoreactivity showed high contrast of staining between strongly and lightly labeled areas. Labeling was intense in the AP and weak in the NTS, except for its medial and dorsalmost parts which exhibited moderate staining. Almost no GluR1 immunoreactivity was found in the DMN. GluR2/3 immunolabeling was present in the entire dorsal vagal complex. This labeling was strong in the AP, the DMN and the medial half of the NTS and moderate in the lateral half of the NTS, except for the interstitial subdivision which exhibited intense staining. Labeling induced by the GluR4 antibody was very weak throughout the dorsal vagal complex. Ultrastructural examination showed that GluR1 and GluR2/3 immunoreactivity was localized in neuronal cell bodies and dendrites. No labeled axon terminal or glial cell body was found. Immunoperoxidase staining in labeled cell bodies and dendrites was associated with intracellular organelles (microtubules, mitochondria, cisternae of the endoplasmic reticulum,.) and/or parts of the plasma membrane. Plasma membrane labeling was often associated with asymmetrical synaptic differentiations. No labeled symmetrical synapse was found using either GluR1 or GluR2/3 antibody. The present results show that AMPA receptors have a widespread distribution in neuronal perikarya and dendrites of the rat dorsal vagal complex. They suggest differences in subunit composition between AMPA receptors localized in the NTS, the DMN and the AP. Ultrastructural data are consistent with the fact that AMPA receptors associated with the plasma membrane are mostly synaptic receptors. However, they also suggest the existence of a large intracellular pool of receptor subunits in neuronal soma and dendrites. Copyright 1999 Wiley-Liss, Inc.

Early continuous white noise exposure alters l-alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor subunit glutamate receptor 2 and gamma-aminobutyric acid type a receptor subunit beta3 protein expression in rat auditory cortex.

PubMed

Xu, Jinghong; Yu, Liping; Zhang, Jiping; Cai, Rui; Sun, Xinde

2010-02-15

Auditory experience during the postnatal critical period is essential for the normal maturation of auditory function. Previous studies have shown that rearing infant rat pups under conditions of continuous moderate-level noise delayed the emergence of adult-like topographic representational order and the refinement of response selectivity in the primary auditory cortex (A1) beyond normal developmental benchmarks and indefinitely blocked the closure of a brief, critical-period window. To gain insight into the molecular mechanisms of these physiological changes after noise rearing, we studied expression of the AMPA receptor subunit GluR2 and GABA(A) receptor subunit beta3 in the auditory cortex after noise rearing. Our results show that continuous moderate-level noise rearing during the early stages of development decreases the expression levels of GluR2 and GABA(A)beta3. Furthermore, noise rearing also induced a significant decrease in the level of GABA(A) receptors relative to AMPA receptors. However, in adult rats, noise rearing did not have significant effects on GluR2 and GABA(A)beta3 expression or the ratio between the two units. These changes could have a role in the cellular mechanisms involved in the delayed maturation of auditory receptive field structure and topographic organization of A1 after noise rearing. Copyright 2009 Wiley-Liss, Inc.

Modulation of spinal nociception by GluR5 kainate receptor ligands in acute and hyperalgesic states and the role of gabaergic mechanisms.

PubMed

Mascias, Paula; Scheede, Manuela; Bloms-Funke, Petra; Chizh, Boris

2002-09-01

GluR5 receptors modulate spinal nociception, however, their role in nociceptive hypersensitivity remains unclear. Using behavioural and electrophysiological approaches, we have investigated several GluR5 ligands in acute and hyperalgesic states. Furthermore, as the GABAergic system plays a role in GluR5 mediated effects in the brain, we also analysed the interaction between GluR5 agonists and GABA(A) antagonists in the spinal cord. In young rats in vivo, the GluR5 selective agonist ATPA was antinociceptive and antihyperalgesic in a model of inflammatory hyperalgesia (ED(50) approximately 4.6 and approximately 5.2 mg/kg, respectively), whereas the GluR5/GluR6 agonist SYM2081 was only antihyperalgesic. ATPA, but not SYM2081, was also able to inhibit nociceptive motoneurone responses in anaesthetised adult rats after intrathecal administration. In hemisected spinal cords in vitro, SYM2081 was inactive, whereas ATPA and another GluR5 agonist, (S)-5-iodowillardiine, inhibited nociceptive reflexes (EC(50) 1.1+/-0.4 micro M and 0.36+/-0.05 micro M, respectively). Both GluR5 agonists also inhibited motoneurone responses to repetitive dorsal root stimulation and their cumulative depolarisation, a correlate of wind-up. The GABA(A) antagonists bicuculline (10 micro M) and SR95531 (1 micro M) enhanced polysynaptic responses to single stimuli but abolished the cumulative depolarisation. Both bicuculline and SR95531 significantly attenuated the inhibition of nociceptive responses by 1 micro M ATPA (by approximately 50%). We conclude that selective GluR5 kainate receptor activation inhibits spinal nociception and its sensitisation caused by ongoing peripheral nociceptive drive. GABA(A) receptors are involved in tonic inhibition of segmental responses, but contribute to their sensitisation by repetitive primary afferent stimulation. Furthermore, there is a cross-talk between the two systems, presumably due to GluR5-mediated activation of GABAergic inhibitory interneurones in the spinal cord.

Neuron-to-glia signaling mediated by excitatory amino acid receptors regulates ErbB receptor function in astroglial cells of the neuroendocrine brain.

PubMed

Dziedzic, Barbara; Prevot, Vincent; Lomniczi, Alejandro; Jung, Heike; Cornea, Anda; Ojeda, Sergio R

2003-02-01

Hypothalamic astroglial erbB tyrosine kinase receptors are required for the timely initiation of mammalian puberty. Ligand-dependent activation of these receptors sets in motion a glia-to-neuron signaling pathway that prompts the secretion of luteinizing hormone-releasing hormone (LHRH), the neuropeptide controlling sexual development, from hypothalamic neuroendocrine neurons. The neuronal systems that may regulate this growth factor-mediated back signaling to neuroendocrine neurons have not been identified. Here we demonstrate that hypothalamic astrocytes contain metabotropic receptors of the metabotropic glutamate receptor 5 subtype and the AMPA receptor subunits glutamate receptor 2 (GluR2) and GluR3. As in excitatory synapses, these receptors are in physical association with their respective interacting/clustering proteins Homer and PICK1. In addition, they are associated with erbB-1 and erbB-4 receptors. Concomitant activation of astroglial metabotropic and AMPA receptors results in the recruitment of erbB tyrosine kinase receptors and their respective ligands to the glial cell membrane, transactivation of erbB receptors via a mechanism requiring metalloproteinase activity, and increased erbB receptor gene expression. By facilitating erbB-dependent signaling and promoting erbB receptor gene expression in astrocytes, a neuron-to-glia glutamatergic pathway may represent a basic cell-cell communication mechanism used by the neuroendocrine brain to coordinate the facilitatory transsynaptic and astroglial input to LHRH neurons during sexual development.

Glutamate receptor 1 phosphorylation at serine 831 and 845 modulates seizure susceptibility and hippocampal hyperexcitability after early life seizures.

PubMed

Rakhade, Sanjay N; Fitzgerald, Erin F; Klein, Peter M; Zhou, Chengwen; Sun, Hongyu; Huganir, Richard L; Hunganir, Richard L; Jensen, Frances E

2012-12-05

Neonatal seizures can lead to later life epilepsy and neurobehavioral deficits, and there are no treatments to prevent these sequelae. We showed previously that hypoxia-induced seizures in a neonatal rat model induce rapid phosphorylation of serine-831 (S831) and Serine 845 (S845) sites of the AMPA receptor GluR1 subunit and later neuronal hyperexcitability and epilepsy, suggesting that seizure-induced posttranslational modifications may represent a novel therapeutic target. To unambiguously assess the contribution of these sites, we examined seizure susceptibility in wild-type mice versus transgenic knock-in mice with deficits in GluR1 S831 and S845 phosphorylation [GluR1 double-phosphomutant (GluR1 DPM) mice]. Phosphorylation of the GluR1 S831 and S845 sites was significantly increased in the hippocampus and cortex after a single episode of pentyleneterazol-induced seizures in postnatal day 7 (P7) wild-type mouse pups and that transgenic knock-in mice have a higher threshold and longer latencies to seizures. Like the rat, hypoxic seizures in P9 C57BL/6N wild-type mice resulted in transient increases in GluR1 S831 and GluR1 S845 phosphorylation in cortex and were associated with enhanced seizure susceptibility to later-life kainic-acid-induced seizures. In contrast, later-life seizure susceptibility after hypoxia-induced seizures was attenuated in GluR1 DPM mice, supporting a role for posttranslational modifications in seizure-induced network excitability. Finally, human hippocampal samples from neonatal seizure autopsy cases also showed an increase in GluR1 S831 and S845, supporting the validation of this potential therapeutic target in human tissue.

Glutamate receptor 1 phosphorylation at Serine 831 and 845 modulates seizure susceptibility and hippocampal hyperexcitability following early life seizures

PubMed Central

Rakhade, S.N.; Fitzgerald, E.F.; Klein, P.M.; Zhou, C.; Sun, H; Huganir, R.L.; Jensen, F.E.

2012-01-01

Neonatal seizures can lead to later life epilepsy and neurobehavioral deficits, and there are no treatments to prevent these sequelae. We previously showed that hypoxia-induced seizures in a neonatal rat model induce rapid phosphorylation of S831 and S845 sites of the AMPA receptor GluR1 subunit and later neuronal hyperexcitability and epilepsy, suggesting that seizure-induced post-translational modifications may represent a novel therapeutic target. To unambiguously assess the contribution of these sites, we examined seizure susceptibility in wild type mice versus transgenic knock-in mice with deficits in GluR1 S831 and S845 phosphorylation (GluR1 double phosphomutant (GluR1DPM) mice). Phosphorylation of the GluR1 S831 and S845 sites was significantly increased in the hippocampus and cortex following a single episode of pentyleneterazol (PTZ) induced seizures in postnatal day 9 (P9) wild type mouse pups, and that transgenic knock-in mice have a higher threshold and longer latencies to seizures. Like the rat, hypoxic seizures in P9 C57BL/6N wild type mice resulted in transient increases in GluR1 S831 and GluR1 S845 phosphorylation in cortex, and were associated with enhanced seizure susceptibility to later-life kainic acid induced seizures. In contrast, later-life seizure susceptibility following hypoxia-induced seizures was attenuated in GluR1 DPM mice, supporting a role for post-translational modifications in seizure-induced network excitability. Finally, human hippocampal samples from neonatal seizure autopsy cases also showed an increase in GluR1 S831 and S845, supporting the validation of this potential therapeutic target in human tissue. PMID:23223299

Phrenic motoneuron expression of serotonergic and glutamatergic receptors following upper cervical spinal cord injury

PubMed Central

Mantilla, Carlos B.; Bailey, Jeffrey P.; Zhan, Wen-Zhi; Sieck, Gary C.

2012-01-01

Following cervical spinal cord injury at C2 (SH hemisection model) there is progressive recovery of phrenic activity. Neuroplasticity in the postsynaptic expression of neurotransmitter receptors may contribute to functional recovery. Phrenic motoneurons express multiple serotonergic (5-HTR) and glutamatergic (GluR) receptors, but the timing and possible role of these different neurotransmitter receptor subtypes in the neuroplasticity following SH are not clear. The current study was designed to test the hypothesis that there is an increased expression of serotonergic and glutamatergic neurotransmitter receptors within phrenic motoneurons after SH. In adult male rats, phrenic motoneurons were labeled retrogradely by intrapleural injection of Alexa 488-conjugated cholera toxin B. In thin (10 μm) frozen sections of the spinal cord, fluorescently-labeled phrenic motoneurons were visualized for laser capture microdissection (LCM). Using quantitative real-time RT-PCR in LCM samples, the time course of changes in 5-HTR and GluR mRNA expression was determined in phrenic motoneurons up to 21 days post-SH. Expression of 5-HTR subtypes 1b, 2a and 2c and GluR subtypes AMPA, NMDA, mGluR1 and mGluR5 was evident in phrenic motoneurons from control and SH rats. Phrenic motoneuron expression of 5-HTR2a increased ~8-fold (relative to control) at 14 days post-SH, whereas NMDA expression increased ~16-fold by 21-days post-SH. There were no other significant changes in receptor expression at any time post-SH. This is the first study to systematically document changes in motoneuron expression of multiple neurotransmitter receptors involved in regulation of motoneuron excitability. By providing information on the neuroplasticity of receptors expressed in a motoneuron pool that is inactivated by a higher-level spinal cord injury, appropriate pharmacological targets can be identified to alter motoneuron excitability. PMID:22227062

Functional kainate-selective glutamate receptors in cultured hippocampal neurons.

PubMed

Lerma, J; Paternain, A V; Naranjo, J R; Mellström, B

1993-12-15

Glutamate mediates fast synaptic transmission at the majority of excitatory synapses throughout the central nervous system by interacting with different types of receptor channels. Cloning of glutamate receptors has provided evidence for the existence of several structurally related subunit families, each composed of several members. It has been proposed that KA1 and KA2 and GluR-5, GluR-6, and GluR-7 families represent subunit classes of high-affinity kainate receptors and that in vivo different kainate receptor subtypes might be constructed from these subunits in heteromeric assembly. However, despite some indications from autoradiographic studies and binding data in brain membranes, no functional pure kainate receptors have so far been detected in brain cells. We have found that early after culturing, a high percentage of rat hippocampal neurons express functional, kainate-selective glutamate receptors. These kainate receptors show pronounced desensitization with fast onset and very slow recovery and are also activated by quisqualate and domoate, but not by alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate. Our results provide evidence for the existence of functional glutamate receptors of the kainate type in nerve cells, which are likely to be native homomeric GluR-6 receptors.

Functional kainate-selective glutamate receptors in cultured hippocampal neurons.

PubMed Central

Lerma, J; Paternain, A V; Naranjo, J R; Mellström, B

1993-01-01

Glutamate mediates fast synaptic transmission at the majority of excitatory synapses throughout the central nervous system by interacting with different types of receptor channels. Cloning of glutamate receptors has provided evidence for the existence of several structurally related subunit families, each composed of several members. It has been proposed that KA1 and KA2 and GluR-5, GluR-6, and GluR-7 families represent subunit classes of high-affinity kainate receptors and that in vivo different kainate receptor subtypes might be constructed from these subunits in heteromeric assembly. However, despite some indications from autoradiographic studies and binding data in brain membranes, no functional pure kainate receptors have so far been detected in brain cells. We have found that early after culturing, a high percentage of rat hippocampal neurons express functional, kainate-selective glutamate receptors. These kainate receptors show pronounced desensitization with fast onset and very slow recovery and are also activated by quisqualate and domoate, but not by alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate. Our results provide evidence for the existence of functional glutamate receptors of the kainate type in nerve cells, which are likely to be native homomeric GluR-6 receptors. PMID:7505445

Glutamate increases pancreatic cancer cell invasion and migration via AMPA receptor activation and Kras-MAPK signaling.

PubMed

Herner, Alexander; Sauliunaite, Danguole; Michalski, Christoph W; Erkan, Mert; De Oliveira, Tiago; Abiatari, Ivane; Kong, Bo; Esposito, Irene; Friess, Helmut; Kleeff, Jörg

2011-11-15

Glutamate has been implicated in tumorigenesis through activation of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors (AMPAR). However, the function of a glutamate-to-AMPAR signal in pancreatic ductal adenocarcinoma (PDAC) has remained elusive. We now show that glutamate-mediated AMPA receptor activation increases invasion and migration of pancreatic cancer cells via activation of the classical MAPK pathway. Glutamate levels were increased in pancreatic cancer accompanied by downregulation of GluR subunits 1, 2, and 4. In pancreatic cancer precursor lesions, pancreatic intraepithelial neoplasia (PanIN), GluR1 subunit levels were strikingly and step-wise increased but its expression was rare in PDAC. Pharmacological inhibition or RNAi-mediated suppression of GluR1 or GluR2 did not affect cancer cell growth but significantly decreased invasion. In a K-ras wildtype cell line, AMPA receptor activation enhanced K-ras activity and--further downstream--phosphorylation of p38 and of p44/42. Preemptive blockade of AMPA receptors in a mouse model of pancreatic cancer inhibited tumor cell settling. AMPA receptor activation thus not only activates MAPK signalling but also directly increases activity of K-ras. Glutamate might serve as a molecular switch that decreases the threshold of K-ras-induced oncogenic signalling and increases the chance of malignant transformation of pancreatic cancer precursor lesions. Copyright © 2011 UICC.

Isoflurane unveils a critical role of glutamate transporter type 3 in regulating hippocampal GluR1 trafficking and context-related learning and memory in mice.

PubMed

Cao, J; Wang, Z; Mi, W; Zuo, Z

2014-07-11

Glutamate transporter type 3 (EAAT3) may play a role in cognition. Isoflurane enhances EAAT3 trafficking to the plasma membrane. Thus, we used isoflurane to determine how EAAT3 might regulate learning and memory and the trafficking of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors, such as GluR1, to the plasma membrane, a fundamental biochemical process for learning and memory. Here, isoflurane increased EAAT3 but did not change GluR1 levels in the plasma membrane of wild-type mouse hippocampus. Isoflurane increased protein phosphatase activity in the wild-type and EAAT3(-/-) mouse hippocampus. Also, isoflurane reduced GluR1 in the plasma membrane and decreased phospho-GluR1 in EAAT3(-/-) mice. The phosphatase inhibitor okadaic acid attenuated these effects. Finally, isoflurane inhibited context-related fear conditioning in EAAT3(-/-) mice but not in wild-type mice. Thus, isoflurane may increase GluR1 trafficking to the plasma membrane via EAAT3 and inhibit GluR1 trafficking via protein phosphatase. Lack of EAAT3 effects leads to decreased GluR1 trafficking and impaired cognition after isoflurane exposure in EAAT3(-/-) mice. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

NMDA and AMPA receptors in the anterior cingulate cortex mediates visceral pain in visceral hypersensitivity rats.

PubMed

Zhou, Lin; Huang, Junjing; Gao, Jun; Zhang, Guanpo; Jiang, Jinjin

2014-02-01

Several studies have shown that N-methyl-D-aspartate (NMDA)-receptor activation in anterior cingulate cortex (ACC) neurons plays critical roles in modulating visceral pain responses in visceral hypersensitivity (VH) rats. However, there are few reports about the expressions of NMDA and α-amino-3-hydroxy-5-methyl-4-isox-azolepropionic-acid (AMPA) receptor subtypes in ACC of VH model rats at different time points. The current study was undertaken to investigate NR2A, NR2B and GluR2 expressions in ACC of VH rats that were induced by administration with 5% mustard oil. Our results indicated that NR2B, but not NR2A, was highly expressed in VH model group on day 15, 22, and 36 compared with normal group (p < 0.05). GluR2 expression was also higher in VH model group on day 15, 22, and 36 than that of normal group (p < 0.05). These findings suggested increased expression of NR2B and GluR2 might be key mechanisms for long-term synaptic plastic changes in VH rats. Copyright © 2014. Published by Elsevier Inc.

Motor Skills Training Enhances α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid Receptor Subunit mRNA Expression in the Ipsilateral Sensorimotor Cortex and Striatum of Rats Following Intracerebral Hemorrhage.

PubMed

Tamakoshi, Keigo; Ishida, Kazuto; Kawanaka, Kentaro; Takamatsu, Yasuyuki; Tamaki, Hiroyuki

2017-10-01

We investigated the effects of acrobatic training (AT) on expression of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR) subunits in the sensorimotor cortex and striatum after intracerebral hemorrhage (ICH). Male Wistar rats were divided into 4 groups: ICH without AT (ICH), ICH with AT (ICH + AT), sham operation without AT (SHAM), and sham operation with AT (SHAM + AT). ICH was induced by collagenase injection into the left striatum. The ICH + AT group performed 5 acrobatic tasks daily on days 4-28 post ICH. Forelimb sensorimotor function was evaluated using the forelimb placing test. On days 14 and 29, mRNA expression levels of AMPAR subunits GluR1-4 were measured by real-time reverse transcription-polymerase chain reaction. Forelimb placing test scores were significantly higher in the ICH + AT group than in the ICH group. Expression levels of all AMPAR subunit mRNAs were significantly higher in the ipsilateral sensorimotor cortex of rats in the ICH + AT group than in that of rats in the ICH group on day 29. GluR3 and GluR4 expression levels were reduced in the ipsilateral striatum of rats in the ICH group compared with that of rats in the SHAM group on day 14. These changes may play a critical role in motor skills training-induced recovery after ICH. Copyright © 2017 National Stroke Association. Published by Elsevier Inc. All rights reserved.

Sex-specific effects of prenatal chronic mild stress on adult spatial learning capacity and regional glutamate receptor expression profiles.

PubMed

Wang, Yan; Ma, Yuchao; Hu, Jingmin; Zhang, Xinxin; Cheng, Wenwen; Jiang, Han; Li, Min; Ren, Jintao; Zhang, Xiaosong; Liu, Mengxi; Sun, Anji; Wang, Qi; Li, Xiaobai

2016-07-01

Both animal experiments and clinical studies have demonstrated that prenatal stress can cause cognitive disorders in offspring. To explore the scope of these deficits and identify potential underlying mechanisms, we examined the spatial learning and memory performance and glutamate receptor (GluR) expression patterns of adult rats exposed to prenatal chronic mild stress (PCMS). Principal component analysis (PCA) was employed to reveal the interrelationships among spatial learning indices and GluR expression changes. Female PCMS-exposed offspring exhibited markedly impaired spatial learning and memory in the Morris water maze (MWM) task compared to control females, while PCMS-exposed males showed better initial spatial learning in the MWM compared to control males. PCMS also altered basal and post-MWM glutamate receptor expression patterns, but these effects differed markedly between sexes. Male PCMS-exposed offspring exhibited elevated basal expression of NR1, mGluR5, and mGluR2/3 in the prefrontal cortex (PFC), whereas females showed no basal expression changes. Following MWM training, PCMS-exposed males expressed higher NR1 in the PFC and mammillary body (MB), higher mGluR2/3 in PFC, and lower NR2B in the hippocampus (HIP), PFC, and MB compared to unstressed MWM-trained males. Female PCMS-exposed offspring showed strongly reduced NR1 in MB and NR2B in the HIP, PFC, and MB, and increased mGluR2/3 in PFC compared to unstressed MWM-trained females. This is the first report suggesting that NMDA subunits in the MB are involved in spatial learning. Additionally, PCA further suggests that the NR1-NR2B form is the most important for spatial memory formation. These results reveal long-term sex-specific effects of PCMS on spatial learning and memory performance in adulthood and implicate GluR expression changes within HIP, PFC, and MB as possible molecular mechanisms underlying cognitive dysfunction in offspring exposed to prenatal stress. Copyright © 2016 Elsevier Inc. All rights reserved.

Chronic renal failure induces cell death in rat hippocampal CA1 via upregulation of αCaMKII/NR2A synaptic complex and phosphorylated GluR1-containing AMPA receptor cascades.

PubMed

Kim, Jong Wan; Ha, Gyoung Yim; Jung, Yong Wook

2014-09-01

N-methyl-D-aspartate (NMDA) and alpha-amino-3-hydroxy-5-methylisoxazole-4-propinoic acid (AMPA) receptors bound to postsynaptic density-95 (PSD-95) and α isoform of calcium/calmodulin-dependent protein kinase II (αCaMKII) is fundamentally involved in the regulation of working memory. The aim of present study was to investigate the alterations of NMDA and AMPA receptors responsible for hippocampal synaptic dysfunction and selective neuronal cell death after chronic renal failure (CRF) which may be associated with impairment of working memory. Altered interactions between NMDA and AMPA receptors and PSD-95 and αCaMKII were analyzed in the cornu ammonis (CA) 1 and CA3/dentate gyrus (DG) subfields of the uremic rat hippocampi using the immunoblotting and immunoprecipitation methods. Uremia induced by CRF produced necrotic cell death and decreased neuronal nucleoli protein levels in the hippocampal CA1 subfield, but not in the CA3/DG subfields. The CA1 subfields of CRF rats exhibited significant decreases and increases, respectively, in the expressions of PSD-95/NR2B and αCaMKII/NR2A synaptic complex. Moreover, increased phosphorylation of glutamate receptor type 1 (GluR1) AMPA receptor at ser831 was observed in the CA1 subfield after CRF. These hippocampal CA1 neuronal vulnerability may be responsible for memory dysfunction after CRF as mediated by an increase in NR2A-containing NMDA receptors bound to αCaMKII and subsequent activation of GluR1-containing AMPA receptors caused by the phosphorylation of GluR1 at ser831.

Boutons containing vesicular zinc define a subpopulation of synapses with low AMPAR content in rat hippocampus.

PubMed

Sindreu, Carlos Balet; Varoqui, Hélène; Erickson, Jeffrey D; Pérez-Clausell, Jeús

2003-08-01

Cortical regions of the brain stand out for their high content in synaptic zinc, which may thus be involved in synaptic function. The relative number, chemical nature and transmitter receptor profile of synapses that sequester vesicular zinc are largely unknown. To address this, we combined pre-embedding zinc histochemistry and post-embedding immunogold electron microscopy in rat hippocampus. All giant mossy fibre (MF) terminals in the CA3 region and approximately 45% of boutons making axospinous synapses in stratum radiatum in CA1 contained synaptic vesicles that stained for zinc. Both types of zinc-positive boutons selectively expressed the vesicular zinc transporter ZnT-3. Zinc-positive boutons further immunoreacted to the vesicular glutamate transporter VGLUT-1, but not to the transmitter gamma-aminobutyric acid. Most dendritic spines in CA1 immunoreacted to alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor (AMPAR) subunits GluR1-3 (approximately 80%) and to N-methyl-D-aspartate receptor (NMDAR) subunits NR1 + NR2A/B (approximately 90%). Synapses made by zinc-positive boutons contained 40% less AMPAR particles than those made by zinc-negative boutons, whereas NMDAR counts were similar. Further analysis indicated that this was due to the reduced synaptic expression of both GluR1 and GluR2 subunits. Hence, the levels of postsynaptic AMPARs may vary according to the presence of vesicular zinc in excitatory afferents to CA1. Zinc-positive and zinc-negative synapses may represent two glutamatergic subpopulations with distinct synaptic signalling.

Myelin Proteolipid Protein Complexes with αv Integrin and AMPA Receptors In Vivo and Regulates AMPA-Dependent Oligodendrocyte Progenitor Cell Migration through the Modulation of Cell-Surface GluR2 Expression

PubMed Central

Harlow, Danielle E.; Saul, Katherine E.; Komuro, Hitoshi

2015-01-01

In previous studies, stimulation of ionotropic AMPA/kainate glutamate receptors on cultured oligodendrocyte cells induced the formation of a signaling complex that includes the AMPA receptor, integrins, calcium-binding proteins, and, surprisingly, the myelin proteolipid protein (PLP). AMPA stimulation of cultured oligodendrocyte progenitor cells (OPCs) also caused an increase in OPC migration. The current studies focused primarily on the formation of the PLP–αv integrin–AMPA receptor complex in vivo and whether complex formation impacts OPC migration in the brain. We found that in wild-type cerebellum, PLP associates with αv integrin and the calcium-impermeable GluR2 subunit of the AMPA receptor, but in mice lacking PLP, αv integrin did not associate with GluR2. Live imaging studies of OPC migration in ex vivo cerebellar slices demonstrated altered OPC migratory responses to neurotransmitter stimulation in the absence of PLP and GluR2 or when αv integrin levels were reduced. Chemotaxis assays of purified OPCs revealed that AMPA stimulation was neither attractive nor repulsive but clearly increased the migration rate of wild-type but not PLP null OPCs. AMPA receptor stimulation of wild-type OPCs caused decreased cell-surface expression of the GluR2 AMPA receptor subunit and increased intracellular Ca2+ signaling, whereas PLP null OPCs did not reduce GluR2 at the cell surface or increase Ca2+ signaling in response to AMPA treatment. Together, these studies demonstrate that PLP is critical for OPC responses to glutamate signaling and has important implications for OPC responses when levels of glutamate are high in the extracellular space, such as following demyelination. SIGNIFICANCE STATEMENT After demyelination, such as occurs in multiple sclerosis, remyelination of axons is often incomplete, leading to loss of neuronal function and clinical disability. Remyelination may fail because oligodendrocyte precursor cells (OPCs) do not completely migrate into demyelinated areas or OPCs in lesions may not mature into myelinating oligodendrocytes. We have found that the myelin proteolipid protein is critical to regulating OPC migratory responses to the neurotransmitter glutamate through modulation of cell-surface expression of the calcium-impermeable GluR2 subunit of the AMPA glutamate receptor and increased intercellular Ca2+ signaling. Altered glutamate homeostasis has been reported in demyelinated lesions. Therefore, understanding how OPCs respond to glutamate has important implications for treatment after white matter injury and disease. PMID:26311781

LY404187: a novel positive allosteric modulator of AMPA receptors.

PubMed

Quirk, Jennifer C; Nisenbaum, Eric S

2002-01-01

LY404187 is a selective, potent and centrally active positive allosteric modulator of AMPA receptors. LY404187 preferentially acts at recombinant human homomeric GluR2 and GluR4 versus GluR1 and GluR3 AMPA receptors. In addition, LY404187 potentiates the flip splice variant of these AMPA receptors to a greater degree than the flop splice variant. In both recombinant and native AMPA receptors, potentiation by LY404187 displays a unique time-dependent growth that appears to involve a suppression of the desensitization process of these ion channels. LY404187 has been shown to enhance glutamatergic synaptic transmission both in vitro and in vivo. This augmentation of synaptic activity is due to the direct potentiation of AMPA receptor function, as well as an indirect recruitment of voltage-dependent NMDA receptor activity. Enhanced calcium influx through NMDA receptors is known to be a critical step in initiating long-term modifications in synaptic function (e.g., long-term potentiation, LTP). These modifications in synaptic function may be substrates for certain forms of memory encoding. Consistent with a recruitment of NMDA receptor activity, LY404187 has been shown to enhance performance in animal models of cognitive function requiring different mnemonic processes. These data suggest that AMPA receptor potentiators may be therapeutically beneficial for treating cognitive deficits in a variety of disorders, particularly those that are associated with reduced glutamatergic signaling such as schizophrenia. In addition, LY404187 has been demonstrated to be efficacious in animal models of behavioral despair that possess considerable predictive validity for antidepressant activity. Although the therapeutic efficacy of AMPA receptor potentiators in these and other diseases will ultimately be determined in the clinic, evidence suggests that the benefit of these compounds will be mediated by multiple mechanisms of action. These mechanisms include direct enhancement of AMPA receptor function, secondary mobilization of intracellular signaling cascades, and prolonged modulation of gene expression.

A Single Brief Burst Induces GluR1-Dependent Associative Short-Term Potentiation: A Potential Mechanism for Short-Term Memory

ERIC Educational Resources Information Center

Erickson, Martha A.; Maramara, Lauren A.; Lisman, John

2010-01-01

Recent work showed that short-term memory (STM) is selectively reduced in GluR1 knockout mice. This raises the possibility that a form of synaptic modification dependent on GluR1 might underlie STM. Studies of synaptic plasticity have shown that stimuli too weak to induce long-term potentiation induce short-term potentiation (STP), a phenomenon…

Roles of Fragile X Mental Retardation Protein in Dopaminergic Stimulation-induced Synapse-associated Protein Synthesis and Subsequent α-Amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) Receptor Internalization*

PubMed Central

Wang, Hansen; Kim, Susan S.; Zhuo, Min

2010-01-01

Fragile X syndrome, the most common form of inherited mental retardation, is caused by the absence of the RNA-binding protein fragile X mental retardation protein (FMRP). FMRP regulates local protein synthesis in dendritic spines. Dopamine (DA) is involved in the modulation of synaptic plasticity. Activation of DA receptors can regulate higher brain functions in a protein synthesis-dependent manner. Our recent study has shown that FMRP acts as a key messenger for DA modulation in forebrain neurons. Here, we demonstrate that FMRP is critical for DA D1 receptor-mediated synthesis of synapse-associated protein 90/PSD-95-associated protein 3 (SAPAP3) in the prefrontal cortex (PFC). DA D1 receptor stimulation induced dynamic changes of FMRP phosphorylation. The changes in FMRP phosphorylation temporally correspond with the expression of SAPAP3 after D1 receptor stimulation. Protein phosphatase 2A, ribosomal protein S6 kinase, and mammalian target of rapamycin are the key signaling molecules for FMRP linking DA D1 receptors to SAPAP3. Knockdown of SAPAP3 did not affect surface expression of α-amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) GluR1 receptors induced by D1 receptor activation but impaired their subsequent internalization in cultured PFC neurons; the subsequent internalization of GluR1 was also impaired in Fmr1 knock-out PFC neurons, suggesting that FMRP may be involved in subsequent internalization of GluR1 through regulating the abundance of SAPAP3 after DA D1 receptor stimulation. Our study thus provides further insights into FMRP involvement in DA modulation and may help to reveal the molecular mechanisms underlying impaired learning and memory in fragile X syndrome. PMID:20457613

Roles of fragile X mental retardation protein in dopaminergic stimulation-induced synapse-associated protein synthesis and subsequent alpha-amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) receptor internalization.

PubMed

Wang, Hansen; Kim, Susan S; Zhuo, Min

2010-07-09

Fragile X syndrome, the most common form of inherited mental retardation, is caused by the absence of the RNA-binding protein fragile X mental retardation protein (FMRP). FMRP regulates local protein synthesis in dendritic spines. Dopamine (DA) is involved in the modulation of synaptic plasticity. Activation of DA receptors can regulate higher brain functions in a protein synthesis-dependent manner. Our recent study has shown that FMRP acts as a key messenger for DA modulation in forebrain neurons. Here, we demonstrate that FMRP is critical for DA D1 receptor-mediated synthesis of synapse-associated protein 90/PSD-95-associated protein 3 (SAPAP3) in the prefrontal cortex (PFC). DA D1 receptor stimulation induced dynamic changes of FMRP phosphorylation. The changes in FMRP phosphorylation temporally correspond with the expression of SAPAP3 after D1 receptor stimulation. Protein phosphatase 2A, ribosomal protein S6 kinase, and mammalian target of rapamycin are the key signaling molecules for FMRP linking DA D1 receptors to SAPAP3. Knockdown of SAPAP3 did not affect surface expression of alpha-amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) GluR1 receptors induced by D1 receptor activation but impaired their subsequent internalization in cultured PFC neurons; the subsequent internalization of GluR1 was also impaired in Fmr1 knock-out PFC neurons, suggesting that FMRP may be involved in subsequent internalization of GluR1 through regulating the abundance of SAPAP3 after DA D1 receptor stimulation. Our study thus provides further insights into FMRP involvement in DA modulation and may help to reveal the molecular mechanisms underlying impaired learning and memory in fragile X syndrome.

Synaptic Neurotransmission Depression in Ventral Tegmental Dopamine Neurons and Cannabinoid-Associated Addictive Learning

PubMed Central

Liu, Zhiqiang; Han, Jing; Jia, Lintao; Maillet, Jean-Christian; Bai, Guang; Xu, Lin; Jia, Zhengping; Zheng, Qiaohua; Zhang, Wandong; Monette, Robert; Merali, Zul; Zhu, Zhou; Wang, Wei; Ren, Wei; Zhang, Xia

2010-01-01

Drug addiction is an association of compulsive drug use with long-term associative learning/memory. Multiple forms of learning/memory are primarily subserved by activity- or experience-dependent synaptic long-term potentiation (LTP) and long-term depression (LTD). Recent studies suggest LTP expression in locally activated glutamate synapses onto dopamine neurons (local Glu-DA synapses) of the midbrain ventral tegmental area (VTA) following a single or chronic exposure to many drugs of abuse, whereas a single exposure to cannabinoid did not significantly affect synaptic plasticity at these synapses. It is unknown whether chronic exposure of cannabis (marijuana or cannabinoids), the most commonly used illicit drug worldwide, induce LTP or LTD at these synapses. More importantly, whether such alterations in VTA synaptic plasticity causatively contribute to drug addictive behavior has not previously been addressed. Here we show in rats that chronic cannabinoid exposure activates VTA cannabinoid CB1 receptors to induce transient neurotransmission depression at VTA local Glu-DA synapses through activation of NMDA receptors and subsequent endocytosis of AMPA receptor GluR2 subunits. A GluR2-derived peptide blocks cannabinoid-induced VTA synaptic depression and conditioned place preference, i.e., learning to associate drug exposure with environmental cues. These data not only provide the first evidence, to our knowledge, that NMDA receptor-dependent synaptic depression at VTA dopamine circuitry requires GluR2 endocytosis, but also suggest an essential contribution of such synaptic depression to cannabinoid-associated addictive learning, in addition to pointing to novel pharmacological strategies for the treatment of cannabis addiction. PMID:21187978

4-Alkylated homoibotenic acid (HIBO) analogues: versatile pharmacological agents with diverse selectivity profiles towards metabotropic and ionotropic glutamate receptor subtypes.

PubMed

Madsen, Ulf; Pickering, Darryl S; Nielsen, Birgitte; Bräuner-Osborne, Hans

2005-01-01

4-Alkylated analogues of homoibotenic acid (HIBO) have previously shown high potency and selectivity at ionotropic and metabotropic glutamic acid receptor (iGluR and mGluR) subtypes. Compounds with different selectivity profiles are valuable pharmacological tools for neuropharmacological studies, and the series of 4-alkyl-HIBO analogues have been extended in this paper in the search for versatile agents. Pharmacological characterization of five new analogues, branched and unbranched 4-alkyl-HIBO analogues, have been carried out. The present compounds are all weak antagonists at Group I mGluRs (mGluR1 and 5) presenting only small differences in potencies (Ki values ranging from 89 to 670 microM). Affinities were studied at native and cloned iGluRs, and the compounds described show preference for the AMPA receptor subtypes GluR1 and 2 over GluR3 and 4. However, compared to previous 4-alkyl-HIBO analogues, these compounds show a remarkably high affinity for the Kain preferring subtype GluR5. The observed GluR5 affinities were either similar or higher compared to their GluR1 and 2 affinity. Isopropyl-HIBO showed the highest affinity for GluR5 (Ki=0.16 microM), and represents a unique compound with high affinity towards the three subtypes GluR1, 2 and 5. In general, these compounds represent new selectivity profiles compared to previously reported Glu receptor analogues.

AMPK Signaling in the Dorsal Hippocampus Negatively Regulates Contextual Fear Memory Formation

PubMed Central

Han, Ying; Luo, Yixiao; Sun, Jia; Ding, Zengbo; Liu, Jianfeng; Yan, Wei; Jian, Min; Xue, Yanxue; Shi, Jie; Wang, Ji-Shi; Lu, Lin

2016-01-01

Both the formation of long-term memory (LTM) and dendritic spine growth that serves as a physical basis for the long-term storage of information require de novo protein synthesis. Memory formation also critically depends on transcription. Adenosine monophosphate-activated protein kinase (AMPK) is a transcriptional regulator that has emerged as a major energy sensor that maintains cellular energy homeostasis. However, still unknown is its role in memory formation. In the present study, we found that AMPK is primarily expressed in neurons in the hippocampus, and then we demonstrated a time-dependent decrease in AMPK activity and increase in mammalian target of rapamycin complex 1 (mTORC1) activity after contextual fear conditioning in the CA1 but not CA3 area of the dorsal hippocampus. Using pharmacological methods and adenovirus gene transfer to bidirectionally regulate AMPK activity, we found that increasing AMPK activity in the CA1 impaired the formation of long-term fear memory, and decreasing AMPK activity enhanced fear memory formation. These findings were associated with changes in the phosphorylation of AMPK and p70s6 kinase (p70s6k) and expression of BDNF and membrane GluR1 and GluR2 in the CA1. Furthermore, the prior administration of an mTORC1 inhibitor blocked the enhancing effect of AMPK inhibition on fear memory formation, suggesting that this negative regulation of contextual fear memory by AMPK in the CA1 depends on the mTORC1 signaling pathway. Finally, we found that AMPK activity regulated hippocampal spine growth associated with memory formation. In summary, our results indicate that AMPK is a key negative regulator of plasticity and fear memory formation. PMID:26647974

Immunocytochemical localization of metabotropic (mGluR2/3 and mGluR4a) and ionotropic (GluR2/3) glutamate receptors in adrenal medullary ganglion cells.

PubMed

Sarría, R; Díez, J; Losada, J; Doñate-Oliver, F; Kuhn, R; Grandes, P

2006-02-01

The localization of metabotropic glutamate receptors of groups II (mGluR2/3) and III (mGluR4a) and the subunits 2 and 3 of alfa-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) ionotropic glutamate receptors (GluR2/3) was investigated with immunocytochemical methods in the rat adrenal gland. MGluR2/3, mGluR4a and GluR2/3 immunoreactivities were observed in large-sized, centrally located type I adrenal medullary ganglion neurons. Furthermore, the small-sized type II adrenal ganglion neurons identified by their immunoreactivity to brain nitric oxide synthase (bNOS), also expressed mGluR2/3, mGluR4a and GluR2/3. These cells were disposed in the peripheral portion of the adrenal medulla. None of the type I neurons were positively labeled for bNOS. These morphological observations suggest that activation of glutamate receptors in ganglion neurons may be instrumental in the control of adrenal endocrine systems as well as blood regulation.

Agonist-stimulated cobalt uptake provides selective visualization of neurons expressing AMPA- or kainate-type glutamate receptors in the retina.

PubMed

Pourcho, Roberta G; Qin, Pu; Goebel, Dennis J; Fyk-Kolodziej, Bozena

2002-12-16

Fast-acting excitatory neurotransmission in the retina is mediated primarily by glutamate, acting at alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) -selective and kainate-selective receptors. To localize these sites of action, cat retinas were stimulated with either AMPA or kainate and processed for histochemical visualization of cobalt uptake through calcium-permeable channels. Treatment with both agonists resulted in staining of A- and B-type horizontal cells and several types of OFF cone bipolar cells; there was no evidence for staining of ON cone bipolar cells or rod bipolar cells. The subpopulations of OFF cone bipolar cells differed in their responses with two distinct types that stained heavily with cobalt after exposure to AMPA and three different types that were preferentially labeled after exposure to kainate. Although many amacrine and ganglion cells appeared to respond to both agonists, AII amacrine cells were stained after stimulation by AMPA but not by kainate. The OFF cone bipolar cells that exhibit AMPA-stimulated cobalt uptake were found to have a high level of correspondence with cells that show immunocytochemical staining for the AMPA-selective glutamate receptor subunits GluR1 and GluR2/3. Similarly, the cone bipolar cells exhibiting kainate-stimulated cobalt uptake resemble those that are immunoreactive for the kainate subunit GluR5. The results indicate that, whereas many retinal neurons express both AMPA and kainate receptors, AII amacrine cells and subpopulations of OFF cone bipolar cells are limited to the expression of either AMPA or kainate receptors. This differential expression may contribute to the unique character of transmission by these cell types. Copyright 2002 Wiley-Liss, Inc.

Role of spinal cord alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors in complete Freund's adjuvant-induced inflammatory pain.

PubMed

Park, Jang-Su; Yaster, Myron; Guan, Xiaowei; Xu, Ji-Tian; Shih, Ming-Hung; Guan, Yun; Raja, Srinivasa N; Tao, Yuan-Xiang

2008-12-30

Spinal cord alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) mediate acute spinal processing of nociceptive and non-nociceptive information, but whether and how their activation contributes to the central sensitization that underlies persistent inflammatory pain are still unclear. Here, we examined the role of spinal AMPARs in the development and maintenance of complete Freund's adjuvant (CFA)-induced persistent inflammatory pain. Intrathecal application of two selective non-competitive AMPAR antagonists, CFM-2 (25 and 50 microg) and GYKI 52466 (50 microg), significantly attenuated mechanical and thermal hypersensitivities on the ipsilateral hind paw at 2 and 24 h post-CFA injection. Neither CFM-2 nor GYKI 52466 affected the contralateral basal responses to thermal and mechanical stimuli. Locomotor activity was not altered in any of the drug-treated animals. CFA-induced inflammation did not change total expression or distribution of AMPAR subunits GluR1 and GluR2 in dorsal horn but did alter their subcellular distribution. The amount of GluR2 was markedly increased in the crude cytosolic fraction and decreased in the crude membrane fraction from the ipsilateral L4-5 dorsal horn at 24 h (but not at 2 h) post-CFA injection. Conversely, the level of GluR1 was significantly decreased in the crude cytosolic fraction and increased in the crude membrane fraction from the ipsilateral L4-5 dorsal horn at 24 h (but not at 2 h) post-CFA injection. These findings suggest that spinal AMPARs might participate in the central spinal mechanism of persistent inflammatory pain.

Cocaine-Induced Behavioral Sensitization Is Associated With Changes in the Expression of Endocannabinoid and Glutamatergic Signaling Systems in the Mouse Prefrontal Cortex

PubMed Central

Blanco, Eduardo; Pavón, Francisco J.; Palomino, Ana; Luque-Rojas, María Jesús; Serrano, Antonia; Rivera, Patricia; Bilbao, Ainhoa; Alen, Francisco; Vida, Margarita; Suárez, Juan

2015-01-01

Background: Endocannabinoids modulate the glutamatergic excitatory transmission by acting as retrograde messengers. A growing body of studies has reported that both signaling systems in the mesocorticolimbic neural circuitry are involved in the neurobiological mechanisms underlying drug addiction. Methods: We investigated whether the expression of both endocannabinoid and glutamatergic systems in the prefrontal cortex (PFC) were altered by an acute and/or repeated cocaine administration schedule that resulted in behavioral sensitization. We measured the protein and mRNA expression of the main endocannabinoid metabolic enzymes and the cannabinoid receptor type 1 (CB1). We also analyzed the mRNA expression of relevant components of the glutamate-signaling system, including glutamate-synthesizing enzymes, metabotropic receptors, and ionotropic receptors. Results: Although acute cocaine (10mg/kg) produced no significant changes in the endocannabinoid-related proteins, repeated cocaine administration (20mg/kg daily) induced a pronounced increase in the CB1 receptor expression. In addition, acute cocaine administration (10mg/kg) in cocaine-sensitized mice (referred to as cocaine priming) induced a selective increase in the endocannabinoid-degrading enzymes fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL). These protein changes were accompanied by an overall decrease in the ratios of endocannabinoid synthesis/degradation, especially the N-acyl phosphatidylethanolamine phospholipase D/FAAH and diacylglycerol lipase alpha/MAGL ratios. Regarding mRNA expression, while acute cocaine administration produced a decrease in CB1 receptors and N-acyl phosphatidylethanolamine phospholipase D, repeated cocaine treatment enhanced CB1 receptor expression. Cocaine-sensitized mice that were administered priming injections of cocaine mainly displayed an increased FAAH expression. These endocannabinoid changes were associated with modifications in glutamatergic transmission-related genes. An overall decrease was observed in the mRNA expression of the glutamate-synthesizing gene kidney-type glutaminase (KGA), the metabotropic glutamate receptors (mGluR3 and GluR), and subunits of NMDA ionotropic receptors (NR1, NR2A, NR2B and NR2C) after acute cocaine administration, while mice repeatedly exposed to cocaine only displayed an increase in NR2C. However, in cocaine-sensitized mice primed with cocaine, this inhibition was reversed and a strong increase was detected in the mGluR5, NR2 subunits, and both GluR1 and GluR3. Conclusions: These findings indicate that cocaine sensitization is associated with an endocannabinoid downregulation and a hyperglutamatergic state in the PFC that, overall, contribute to an enhanced glutamatergic input into PFC-projecting areas. PMID:25539508

Gating characteristics control glutamate receptor distribution and trafficking in vivo.

PubMed

Petzoldt, Astrid G; Lee, Yü-Hien; Khorramshahi, Omid; Reynolds, Eric; Plested, Andrew J R; Herzel, Hanspeter; Sigrist, Stephan J

2014-09-08

Glutamate-releasing synapses dominate excitatory release in the brain. Mechanisms governing their assembly are of major importance for circuit development and long-term plasticity underlying learning and memory. AMPA/Kainate-type glutamate receptors (GluRs) are tetrameric ligand-gated ion channels that open their ion-conducting pores in response to binding of the neurotransmitter. Changes in subunit composition of postsynaptic GluRs are highly relevant for plasticity and development of glutamatergic synapses [1-4]. To date, posttranslational modifications, mostly operating via the intracellular C-terminal domains (CTDs) of GluRs, are presumed to be the major regulator of trafficking [5]. In recent years, structural and electrophysiological analyses have improved our understanding of GluR gating mechanism [6-11]. However, whether conformational changes subsequent to glutamate binding may per se be able to influence GluR trafficking has remained an unaddressed question. Using a Drosophila system allowing for extended visualization of GluR trafficking in vivo, we here provide evidence that mutations changing the gating behavior alter GluR distribution and trafficking. GluR mutants associated with reduced charge transfer segregated from coexpressed wild-type GluRs on the level of individual postsynaptic densities. Segregation was lost upon blocking of evoked glutamate release. Photobleaching experiments suggested increased mobility of mutants with reduced charge transfer, which accumulated prematurely during early steps of synapse assembly, but failed to further increase their level in accordance with assembly of the presynaptic scaffold. In summary, gating characteristics seem to be a new variable for the understanding of GluR trafficking relevant to both development and plasticity. Copyright © 2014 Elsevier Ltd. All rights reserved.

Propofol inhibits invasion and proliferation of C6 glioma cells by regulating the Ca2+ permeable AMPA receptor-system xc- pathway.

PubMed

Wang, Xin-Yue; Li, Yan-Li; Wang, Hai-Yun; Zhu, Min; Guo, Di; Wang, Guo-Lin; Gao, Ying-Tang; Yang, Zhuo; Li, Tang; Yang, Chen-Yi; Chen, Yi-Meng

2017-10-01

Anesthetics are documented to affect tumors; therefore, we studied the antiglioma effect of propofol on proliferation and invasiveness of glioma cells and explored the underlying mechanism. C6 glioma cells were cultured and treated with propofol, and cell viability, invasiveness, and migration were measured. Glutamate release was measured using an enzyme-catalyzed kinetic reaction. xCT protein and α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor GluR2 subunit protein expression was assessed with Western blot analysis and immunofluorescent staining. We observed that propofol significantly inhibited C6 glioma cell viability, invasiveness, and migration and decreased glutamate release. An agonist of the cystine/glutamate antiporter system (system x c - ), N-acetylcysteine (NAC), reversed propofol's effects, and propofol could inhibit C6 glioma cell proliferation by adding excess exogenous glutamate (100μM). Finally, propofol increased the surface expression of GluR2, but decreased surface expression of xCT. The effects of propofol on surface expression of GluR2 and xCT could be rescued by (R, S)-AMPA, an agonist of Ca 2+ permeable AMPA receptor (CPAR). Thus, propofol can inhibit cell viability, invasiveness, and migration of C6 glioma cells, and the CPAR-system x c - pathway contributes to these events. Copyright © 2017 Elsevier Ltd. All rights reserved.

Distinct subunits in heteromeric kainate receptors mediate ionotropic and metabotropic function at hippocampal mossy fiber synapses.

PubMed

Ruiz, Arnaud; Sachidhanandam, Shankar; Utvik, Jo Kristian; Coussen, Françoise; Mulle, Christophe

2005-12-14

Heteromeric kainate receptors (KARs) containing both glutamate receptor 6 (GluR6) and KA2 subunits are involved in KAR-mediated EPSCs at mossy fiber synapses in CA3 pyramidal cells. We report that endogenous glutamate, by activating KARs, reversibly inhibits the slow Ca2+-activated K+ current I(sAHP) and increases neuronal excitability through a G-protein-coupled mechanism. Using KAR knockout mice, we show that KA2 is essential for the inhibition of I(sAHP) in CA3 pyramidal cells by low nanomolar concentrations of kainate, in addition to GluR6. In GluR6(-/-) mice, both ionotropic synaptic transmission and inhibition of I(sAHP) by endogenous glutamate released from mossy fibers was lost. In contrast, inhibition of I(sAHP) was absent in KA2(-/-) mice despite the preservation of KAR-mediated EPSCs. These data indicate that the metabotropic action of KARs did not rely on the activation of a KAR-mediated inward current. Biochemical analysis of knock-out mice revealed that KA2 was required for the interaction of KARs with Galpha(q/11)-proteins known to be involved in I(sAHP) modulation. Finally, the ionotropic and metabotropic actions of KARs at mossy fiber synapses were differentially sensitive to the competitive glutamate receptor ligands kainate (5 nM) and kynurenate (1 mM). We propose a model in which KARs could operate in two modes at mossy fiber synapses: through a direct ionotropic action of GluR6, and through an indirect G-protein-coupled mechanism requiring the binding of glutamate to KA2.

Input from the medial geniculate nucleus modulates amygdala encoding of fear memory discrimination.

PubMed

Ferrara, Nicole C; Cullen, Patrick K; Pullins, Shane P; Rotondo, Elena K; Helmstetter, Fred J

2017-09-01

Generalization of fear can involve abnormal responding to cues that signal safety and is common in people diagnosed with post-traumatic stress disorder. Differential auditory fear conditioning can be used as a tool to measure changes in fear discrimination and generalization. Most prior work in this area has focused on elevated amygdala activity as a critical component underlying generalization. The amygdala receives input from auditory cortex as well as the medial geniculate nucleus (MgN) of the thalamus, and these synapses undergo plastic changes in response to fear conditioning and are major contributors to the formation of memory related to both safe and threatening cues. The requirement for MgN protein synthesis during auditory discrimination and generalization, as well as the role of MgN plasticity in amygdala encoding of discrimination or generalization, have not been directly tested. GluR1 and GluR2 containing AMPA receptors are found at synapses throughout the amygdala and their expression is persistently up-regulated after learning. Some of these receptors are postsynaptic to terminals from MgN neurons. We found that protein synthesis-dependent plasticity in MgN is necessary for elevated freezing to both aversive and safe auditory cues, and that this is accompanied by changes in the expressions of AMPA receptor and synaptic scaffolding proteins (e.g., SHANK) at amygdala synapses. This work contributes to understanding the neural mechanisms underlying increased fear to safety signals after stress. © 2017 Ferrara et al.; Published by Cold Spring Harbor Laboratory Press.

Acquisition and expression of conditioned taste aversion differentially affects extracellular signal regulated kinase and glutamate receptor phosphorylation in rat prefrontal cortex and nucleus accumbens

PubMed Central

Marotta, Roberto; Fenu, Sandro; Scheggi, Simona; Vinci, Stefania; Rosas, Michela; Falqui, Andrea; Gambarana, Carla; De Montis, M. Graziella; Acquas, Elio

2014-01-01

Conditioned taste aversion (CTA) can be applied to study associative learning and its relevant underpinning molecular mechanisms in discrete brain regions. The present study examined, by immunohistochemistry and immunocytochemistry, the effects of acquisition and expression of lithium-induced CTA on activated Extracellular signal Regulated Kinase (p-ERK) in the prefrontal cortex (PFCx) and nucleus accumbens (Acb) of male Sprague-Dawley rats. The study also examined, by immunoblotting, whether acquisition and expression of lithium-induced CTA resulted in modified levels of phosphorylation of glutamate receptor subunits (NR1 and GluR1) and Thr34- and Thr75-Dopamine-and-cAMP-Regulated PhosphoProtein (DARPP-32). CTA acquisition was associated with an increase of p-ERK-positive neurons and phosphorylated NR1 receptor subunit (p-NR1) in the PFCx, whereas p-GluR1, p-Thr34- and p-Thr75-DARPP-32 levels were not changed in this brain region. CTA expression increased the number of p-ERK-positive neurons in the shell (AcbSh) and core (AcbC) but left unmodified p-NR1, p-GluR1, p-Thr34- and p-Thr75-DARPP-32 levels. Furthermore, post-embedding immunogold quantitative analysis in AcbSh revealed that CTA expression significantly increased nuclear p-ERK immunostaining as well as p-ERK-labeled axo-spinous contacts. Overall, these results indicate that ERK and NR1, but not GluR1 and DARPP-32, are differentially phosphorylated as a consequence of acquisition and expression of aversive associative learning. Moreover, these results confirm that CTA represents an useful approach to study the molecular basis of associative learning in rats and suggest the involvement of ERK cascade in learning-associated synaptic plasticity. PMID:24847227

Genistein inhibition of OGD-induced brain neuron death correlates with its modulation of apoptosis, voltage-gated potassium and sodium currents and glutamate signal pathway.

PubMed

Ma, Xue-Ling; Zhang, Feng; Wang, Yu-Xiang; He, Cong-Cong; Tian, Kun; Wang, Hong-Gang; An, Di; Heng, Bin; Liu, Yan-Qiang

2016-07-25

In the present study, we established an in vitro model of hypoxic-ischemia via exposing primary neurons of newborn rats to oxygen-glucose deprivation (OGD) and observing the effects of genistein, a soybean isoflavone, on hypoxic-ischemic neuron viability, apoptosis, voltage-activated potassium (Kv) and sodium (Nav) currents, and glutamate receptor subunits. The results indicated that OGD exposure reduced the viability and increased the apoptosis of brain neurons. Meanwhile, OGD exposure caused changes in the current-voltage curves and current amplitude values of voltage-activated potassium and sodium currents; OGD exposure also decreased GluR2 expression and increased NR2 expression. However, genistein at least partially reversed the effects caused by OGD. The results suggest that hypoxic-ischemia-caused neuronal apoptosis/death is related to an increase in K(+) efflux, a decrease in Na(+) influx, a down-regulation of GluR2, and an up-regulation of NR2. Genistein may exert some neuroprotective effects via the modulation of Kv and Nav currents and the glutamate signal pathway, mediated by GluR2 and NR2. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Alleviating neuropathic pain mechanical allodynia by increasing Cdh1 in the anterior cingulate cortex.

PubMed

Tan, Wei; Yao, Wen-Long; Hu, Rong; Lv, You-You; Wan, Li; Zhang, Chuan-Han; Zhu, Chang

2015-09-12

Plastic changes in the anterior cingulate cortex (ACC) are critical in the pathogenesis of pain hypersensitivity caused by injury to peripheral nerves. Cdh1, a co-activator subunit of anaphase-promoting complex/cyclosome (APC/C) regulates synaptic differentiation and transmission. Based on this, we hypothesised that the APC/C-Cdh1 played an important role in long-term plastic changes induced by neuropathic pain in ACC. We employed spared nerve injury (SNI) model in rat and found Cdh1 protein level in the ACC was down-regulated 3, 7 and 14 days after SNI surgery. We detected increase in c-Fos expression, numerical increase of organelles, swollen myelinated fibre and axon collapse of neuronal cells in the ACC of SNI rat. Additionally, AMPA receptor GluR1 subunit protein level was up-regulated on the membrane through a pathway that involves EphA4 mediated by APC/C-Cdh1, 3 and 7 days after SNI surgery. To confirm the effect of Cdh1 in neuropathic pain, Cdh1-expressing lentivirus was injected into the ACC of SNI rat. Intra-ACC treatment with Cdh1-expressing lentivirus vectors elevated Cdh1 levels, erased synaptic strengthening, as well as alleviating established mechanical allodynia in SNI rats. We also found Cdh1-expressing lentivirus normalised SNI-induced redistribution of AMPA receptor GluR1 subunit in ACC by regulating AMPA receptor trafficking. These results provide evidence that Cdh1 in ACC synapses may offer a novel therapeutic strategy for treating chronic neuropathic pain.

Orchestrated Regulation of Nogo Receptors, Lotus, AMPA Receptors and BDNF in an ECT Model Suggests Opening and Closure of a Window of Synaptic Plasticity

PubMed Central

Nordgren, Max; Karlsson, Tobias; Svensson, Maria; Koczy, Josefin; Josephson, Anna; Olson, Lars; Tingström, Anders; Brené, Stefan

2013-01-01

Electroconvulsive therapy (ECT) is an efficient and relatively fast acting treatment for depression. However, one severe side effect of the treatment is retrograde amnesia, which in certain cases can be long-term. The mechanisms behind the antidepressant effect and the amnesia are not well understood. We hypothesized that ECT causes transient downregulation of key molecules needed to stabilize synaptic structure and to prevent Ca2+ influx, and a simultaneous increase in neurotrophic factors, thus providing a short time window of increased structural synaptic plasticity. Here we followed regulation of NgR1, NgR3, LOTUS, BDNF, and AMPA subunits GluR1 and GluR2 flip and flop mRNA levels in hippocampus at 2, 4, 12, 24, and 72 hours after a single episode of induced electroconvulsive seizures (ECS) in rats. NgR1 and LOTUS mRNA levels were transiently downregulated in the dentate gyrus 2, 4, 12 and 4, 12, 24 h after ECS treatment, respectively. GluR2 flip, flop and GluR1 flop were downregulated at 4 h. GluR2 flip remained downregulated at 12 h. In contrast, BDNF, NgR3 and GluR1 flip mRNA levels were upregulated. Thus, ECS treatment induces a transient regulation of factors important for neuronal plasticity. Our data provide correlations between ECS treatment and molecular events compatible with the hypothesis that both effects and side effects of ECT may be caused by structural synaptic rearrangements. PMID:24244357

Orchestrated regulation of Nogo receptors, LOTUS, AMPA receptors and BDNF in an ECT model suggests opening and closure of a window of synaptic plasticity.

PubMed

Nordgren, Max; Karlsson, Tobias; Svensson, Maria; Koczy, Josefin; Josephson, Anna; Olson, Lars; Tingström, Anders; Brené, Stefan

2013-01-01

Electroconvulsive therapy (ECT) is an efficient and relatively fast acting treatment for depression. However, one severe side effect of the treatment is retrograde amnesia, which in certain cases can be long-term. The mechanisms behind the antidepressant effect and the amnesia are not well understood. We hypothesized that ECT causes transient downregulation of key molecules needed to stabilize synaptic structure and to prevent Ca2+ influx, and a simultaneous increase in neurotrophic factors, thus providing a short time window of increased structural synaptic plasticity. Here we followed regulation of NgR1, NgR3, LOTUS, BDNF, and AMPA subunits GluR1 and GluR2 flip and flop mRNA levels in hippocampus at 2, 4, 12, 24, and 72 hours after a single episode of induced electroconvulsive seizures (ECS) in rats. NgR1 and LOTUS mRNA levels were transiently downregulated in the dentate gyrus 2, 4, 12 and 4, 12, 24 h after ECS treatment, respectively. GluR2 flip, flop and GluR1 flop were downregulated at 4 h. GluR2 flip remained downregulated at 12 h. In contrast, BDNF, NgR3 and GluR1 flip mRNA levels were upregulated. Thus, ECS treatment induces a transient regulation of factors important for neuronal plasticity. Our data provide correlations between ECS treatment and molecular events compatible with the hypothesis that both effects and side effects of ECT may be caused by structural synaptic rearrangements.

Regulation of glutamate receptor internalization by the spine cytoskeleton is mediated by its PKA-dependent association with CPG2

PubMed Central

Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly

2013-01-01

A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017

Alterations in Hippocampal Oxidative Stress, Expression of AMPA Receptor GluR2 Subunit and Associated Spatial Memory Loss by Bacopa monnieri Extract (CDRI-08) in Streptozotocin-Induced Diabetes Mellitus Type 2 Mice.

PubMed

Pandey, Surya P; Singh, Hemant K; Prasad, S

2015-01-01

Bacopa monnieri extract has been implicated in the recovery of memory impairments due to various neurological disorders in animal models and humans. However, the precise molecular mechanism of the role of CDRI-08, a well characterized fraction of Bacopa monnieri extract, in recovery of the diabetes mellitus-induced memory impairments is not known. Here, we demonstrate that DM2 mice treated orally with lower dose of CDRI-08 (50- or 100 mg/kg BW) is able to significantly enhance spatial memory in STZ-DM2 mice and this is correlated with a significant decline in oxidative stress and up regulation of the AMPA receptor GluR2 subunit gene expression in the hippocampus. Treatment of DM2 mice with its higher dose (150 mg/kg BW or above) shows anti-diabetic effect in addition to its ability to recover the spatial memory impairment by reversing the DM2-induced elevated oxidative stress and decreased GluR2 subunit expression near to their values in normal and CDRI-08 treated control mice. Our results provide evidences towards molecular basis of the memory enhancing and anti diabetic role of the Bacopa monnieri extract in STZ-induced DM2 mice, which may have therapeutic implications.

Alterations in Hippocampal Oxidative Stress, Expression of AMPA Receptor GluR2 Subunit and Associated Spatial Memory Loss by Bacopa monnieri Extract (CDRI-08) in Streptozotocin-Induced Diabetes Mellitus Type 2 Mice

PubMed Central

Pandey, Surya P.; Singh, Hemant K.; Prasad, S.

2015-01-01

Bacopa monnieri extract has been implicated in the recovery of memory impairments due to various neurological disorders in animal models and humans. However, the precise molecular mechanism of the role of CDRI-08, a well characterized fraction of Bacopa monnieri extract, in recovery of the diabetes mellitus-induced memory impairments is not known. Here, we demonstrate that DM2 mice treated orally with lower dose of CDRI-08 (50- or 100 mg/kg BW) is able to significantly enhance spatial memory in STZ-DM2 mice and this is correlated with a significant decline in oxidative stress and up regulation of the AMPA receptor GluR2 subunit gene expression in the hippocampus. Treatment of DM2 mice with its higher dose (150 mg/kg BW or above) shows anti-diabetic effect in addition to its ability to recover the spatial memory impairment by reversing the DM2-induced elevated oxidative stress and decreased GluR2 subunit expression near to their values in normal and CDRI-08 treated control mice. Our results provide evidences towards molecular basis of the memory enhancing and anti diabetic role of the Bacopa monnieri extract in STZ-induced DM2 mice, which may have therapeutic implications. PMID:26161865

Nuclear and membrane estrogen receptor antagonists induce similar mTORC2 activation-reversible changes in synaptic protein expression and actin polymerization in the mouse hippocampus.

PubMed

Xing, Fang-Zhou; Zhao, Yan-Gang; Zhang, Yuan-Yuan; He, Li; Zhao, Ji-Kai; Liu, Meng-Ying; Liu, Yan; Zhang, Ji-Qiang

2018-06-01

Estrogens play pivotal roles in hippocampal synaptic plasticity through nuclear receptors (nERs; including ERα and ERβ) and the membrane receptor (mER; also called GPR30), but the underlying mechanism and the contributions of nERs and mER remain unclear. Mammalian target of rapamycin complex 2 (mTORC2) is involved in actin cytoskeleton polymerization and long-term memory, but whether mTORC2 is involved in the regulation of hippocampal synaptic plasticity by ERs is unclear. We treated animals with nER antagonists (MPP/PHTPP) or the mER antagonist (G15) alone or in combination with A-443654, an activator of mTORC2. Then, we examined the changes in hippocampal SRC-1 expression, mTORC2 signaling (rictor and phospho-AKTSer473), actin polymerization (phospho-cofilin and profilin-1), synaptic protein expression (GluR1, PSD95, spinophilin, and synaptophysin), CA1 spine density, and synapse density. All of the examined parameters except synaptophysin expression were significantly decreased by MPP/PHTPP and G15 treatment. MPP/PHTPP and G15 induced a similar decrease in most parameters except p-cofilin, GluR1, and spinophilin expression. The ER antagonist-induced decreases in these parameters were significantly reversed by mTORC2 activation, except for the change in SRC-1, rictor, and synaptophysin expression. nERs and mER contribute similarly to the changes in proteins and structures associated with synaptic plasticity, and mTORC2 may be a novel target of hippocampal-dependent dementia such as Alzheimer's disease as proposed by previous studies. © 2018 John Wiley & Sons Ltd.

Structure and assembly mechanism for heteromeric kainate receptors.

PubMed

Kumar, Janesh; Schuck, Peter; Mayer, Mark L

2011-07-28

Native glutamate receptor ion channels are tetrameric assemblies containing two or more different subunits. NMDA receptors are obligate heteromers formed by coassembly of two or three divergent gene families. While some AMPA and kainate receptors can form functional homomeric ion channels, the KA1 and KA2 subunits are obligate heteromers which function only in combination with GluR5-7. The mechanisms controlling glutamate receptor assembly involve an initial step in which the amino terminal domains (ATD) assemble as dimers. Here, we establish by sedimentation velocity that the ATDs of GluR6 and KA2 coassemble as a heterodimer of K(d) 11 nM, 32,000-fold lower than the K(d) for homodimer formation by KA2; we solve crystal structures for the GluR6/KA2 ATD heterodimer and heterotetramer assemblies. Using these structures as a guide, we perform a mutant cycle analysis to probe the energetics of assembly and show that high-affinity ATD interactions are required for biosynthesis of functional heteromeric receptors. Copyright © 2011 Elsevier Inc. All rights reserved.

Gene transfer of constitutively active protein kinase C into striatal neurons accelerates onset of levodopa-induced motor response alterations in parkinsonian rats

PubMed Central

Oh, Justin D.; Geller, Alfred I.; Zhang, Guo-rong; Chase, Thomas N.

2006-01-01

Alterations in motor response that complicate levodopa treatment of Parkinson’s disease appear to involve sensitization of striatal ionotropic glutamate receptors. Since protein kinase C (PKC)-mediated phosphorylation regulates glutamatergic receptors of the α-amino-3-hydroxyl-5-methyl-4-isoxazole propionic acid (AMPA) subtype and has been linked to several forms of behavioral plasticity, activation of PKC signaling in striatal spiny neurons may also contribute to the motor plasticity changes associated with chronic levodopa therapy. To evaluate this possibility, we sought to augment PKC signaling by using Herpes Simplex Virus type 1 vectors (pHSVpkcΔ) to directly transfer the catalytic domain of the PKCβII gene into striatal neurons of parkinsonian rats. Microinjection of pHSVpkcΔ vectors lead to the persistent expression of PkcΔ (35% loss over 21 days) in medium spiny neurons together with an increase in serine 831 phosphorylation on AMPA receptor GluR1 subunits and hastened the appearance of the shortened response duration produced by chronic levodopa treatment (P<0.05). In pHSVpkcΔ-infected animals, intrastriatal injection of the PKC inhibitor NPC-15437 (1.0 μg) attenuated both the increased GluR1 phosphorylation (P<0.01) and the accelerated onset of the levodopa-induced response modifications (P<0.01). However, in rats that received levodopa treatment for 21 days without the gene transfer, intrastriatal NPC-15437 had no effect on the response shortening or on GluR1 S831 phosphorylation. The results suggest that an increase in PKC-mediated signaling, including, in part, phosphorylation of AMPA receptors, on striatal spiny neurons may be sufficient to promote the initial appearance, but not necessary the ultimate expression, of the levodopa-induced motor response changes occurring in a rodent model of the human motor complication syndrome. PMID:12691833

The Timing of Multiple Retrieval Events Can Alter GluR1 Phosphorylation and the Requirement for Protein Synthesis in Fear Memory Reconsolidation

ERIC Educational Resources Information Center

Jarome, Timothy J.; Kwapis, Janine L.; Werner, Craig T.; Parsons, Ryan G.; Gafford, Georgette M.; Helmstetter, Fred J.

2012-01-01

Numerous studies have indicated that maintaining a fear memory after retrieval requires de novo protein synthesis. However, no study to date has examined how the temporal dynamics of repeated retrieval events affect this protein synthesis requirement. The present study varied the timing of a second retrieval of an established auditory fear memory…

Changes in expression of c-Fos protein following cocaine-cue extinction learning.

PubMed

Nic Dhonnchadha, B Á; Lovascio, B F; Shrestha, N; Lin, A; Leite-Morris, K A; Man, H Y; Kaplan, G B; Kantak, K M

2012-09-01

Extinguishing abnormally strengthened learned responses to cues associated with drugs of abuse remains a key tactic for alleviating addiction. To assist in developing pharmacotherapies to augment exposure therapy for relapse prevention, investigation into neurobiological underpinnings of drug-cue extinction learning is needed. We used regional analyses of c-Fos and GluR2 protein expression to delineate neural activity and plasticity that may be associated with cocaine-cue extinction learning. Rats were trained to self-administer cocaine paired with a light cue, and later underwent a single 2h extinction session for which cocaine was withheld but response-contingent cues were presented (cocaine-cue extinction). Control groups consisted of rats yoked to animals self-administering cocaine and receiving saline non-contingently followed by an extinction session, or rats trained to self-administer cocaine followed by a no-extinction session for which levers were retracted, and cocaine and cues were withheld. Among 11 brain sites examined, extinction training increased c-Fos expression in basolateral amygdala and prelimbic prefrontal cortex of cocaine-cue extinguished rats relative to both control conditions. In dorsal subiculum and infralimbic prefrontal cortex, extinction training increased c-Fos expression in both cocaine-cue and saline-cue extinguished rats relative to the no-extinction control condition. GluR2 protein expression was not altered in any site examined after extinction or control training. Findings suggest that basolateral amygdala and prelimbic prefrontal cortex neurons are activated during acquisition of cocaine-cue extinction learning, a process that is independent of changes in GluR2 abundance. Other sites are implicated in processing the significance of cues that are present early in extinction training. Copyright © 2012 Elsevier B.V. All rights reserved.

N-linked glycosylation of cortical N-methyl-D-aspartate and kainate receptor subunits in schizophrenia.

PubMed

Tucholski, Janusz; Simmons, Micah S; Pinner, Anita L; McMillan, Laurence D; Haroutunian, Vahram; Meador-Woodruff, James H

2013-08-21

Dysfunctional glutamate neurotransmission has been implicated in the pathophysiology of schizophrenia. Abnormal expressions in schizophrenia of ionotropic glutamate receptors (iGluRs) and the proteins that regulate their trafficking have been found to be region and subunit specific in brain, suggesting that abnormal trafficking of iGluRs may contribute toward altered glutamatergic neurotransmission. The post-translational modification N-glycosylation of iGluR subunits can be used as a proxy for their intracellular localization. Receptor complexes assemble in the lumen of the endoplasmic reticulum, where N-glycosylation begins with the addition of N-linked oligomannose glycans, and is subsequently trimmed and replaced by more elaborate glycans while trafficking through the Golgi apparatus. Previously, we found abnormalities in N-glycosylation of the GluR2 AMPA receptor subunit in schizophrenia. Here, we investigated N-glycosylation of N-methyl-D-aspartate and kainate (KA) receptor subunits in the dorsolateral prefrontal cortex from patients with schizophrenia and a comparison group. We used enzymatic deglycosylation with two glycosidases: endoglycosidase H (Endo H), which removes immature high mannose-containing sugars, and peptide-N-glycosidase F (PNGase F), which removes all N-linked sugars. The NR1, NR2A, NR2B, GluR6, and KA2 subunits were all sensitive to treatment with Endo H and PNGase F. The GluR6 KA receptor subunit was significantly more sensitive to Endo H-mediated deglycosylation in schizophrenia, suggesting a larger molecular mass of N-linked high mannose and/or hybrid sugars on GluR6. This finding, taken with our previous work, suggests that a cellular mechanism underlying abnormal glutamate neurotransmission in schizophrenia may involve abnormal trafficking of both AMPA and KA receptors.

Crystal structure and association behaviour of the GluR2 amino-terminal domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jin, Rongsheng; Singh, Satinder K.; Gu, Shenyan

2009-09-02

Fast excitatory neurotransmission is mediated largely by ionotropic glutamate receptors (iGluRs), tetrameric, ligand-gated ion channel proteins comprised of three subfamilies, AMPA, kainate and NMDA receptors, with each subfamily sharing a common, modular-domain architecture. For all receptor subfamilies, active channels are exclusively formed by assemblages of subunits within the same subfamily, a molecular process principally encoded by the amino-terminal domain (ATD). However, the molecular basis by which the ATD guides subfamily-specific receptor assembly is not known. Here we show that AMPA receptor GluR1- and GluR2-ATDs form tightly associated dimers and, by the analysis of crystal structures of the GluR2-ATD, propose mechanismsmore » by which the ATD guides subfamily-specific receptor assembly.« less

A noncognate aminoacyl-tRNA synthetase that may resolve a missing link in protein evolution.

PubMed

Skouloubris, Stephane; Ribas de Pouplana, Lluis; De Reuse, Hilde; Hendrickson, Tamara L

2003-09-30

Efforts to delineate the advent of many enzymes essential to protein translation are often limited by the fact that the modern genetic code evolved before divergence of the tree of life. Glutaminyl-tRNA synthetase (GlnRS) is one noteworthy exception to the universality of the translation apparatus. In eukaryotes and some bacteria, this enzyme is essential for the biosynthesis of Gln-tRNAGln, an obligate intermediate in translation. GlnRS is absent, however, in archaea, and most bacteria, organelles, and chloroplasts. Phylogenetic analyses predict that GlnRS arose from glutamyl-tRNA synthetase (GluRS), via gene duplication with subsequent evolution of specificity. A pertinent question to ask is whether, in the advent of GlnRS, a transient GluRS-like intermediate could have been retained in an extant organism. Here, we report the discovery of an essential GluRS-like enzyme (GluRS2), which coexists with another GluRS (GluRS1) in Helicobacter pylori. We show that GluRS2's primary role is to generate Glu-tRNAGln, not Glu-tRNAGlu. Thus, GluRS2 appears to be a transient GluRS-like ancestor of GlnRS and can be defined as a GluGlnRS.

Glutamate receptor antibodies directed against AMPA receptors subunit 3 peptide B (GluR3B) can be produced in DBA/2J mice, lower seizure threshold and induce abnormal behavior.

PubMed

Ganor, Yonatan; Goldberg-Stern, Hadassa; Cohen, Ran; Teichberg, Vivian; Levite, Mia

2014-04-01

Anti-GluR3B antibodies (GluR3B Ab's), directed against peptide B/aa372-395 of GluR3 subunit of glutamate/AMPA receptors, are found in ∼35% of epilepsy patients, activate glutamate/AMPA receptors, evoke ion currents, kill neurons and damage the brain. We recently found that GluR3B Ab's also associate with neurological/psychiatric/behavioral abnormalities in epilepsy patients. Here we asked if GluR3B Ab's could be produced in DBA/2J mice, and also modulate seizure threshold and/or cause behavioral/motor impairments in these mice. DBA/2J mice were immunized with the GluR3B peptide in Complete Freund's Adjuvant (CFA), or with controls: ovalbumin (OVA), CFA, or phosphate-buffer saline (PBS). GluR3B Ab's and OVA Ab's were tested. Seizures were induced in all mice by the chemoconvulsant pentylenetetrazole (PTZ) at three time points, each time with less PTZ to avoid non-specific death. Behavior was examined in Open-Field, RotaRod and Grip tests. GluR3B Ab's were produced only in GluR3B-immunized mice, while OVA Ab's were produced only in OVA-immunized mice, showing high Ab's specificity. In GluR3B Ab's negative mice, seizure severity scores and percentages of animals developing generalized seizures declined in response to decreasing PTZ doses. In contrast, both parameters remained unchanged/high in the GluR3B Ab's positive mice, showing that these mice were more susceptible to seizures. The seizure scores associated significantly with the GluR3B Ab's levels. GluR3B Ab's positive mice were also more anxious in Open-Field test, fell faster in RotaRod test, and fell more in Grip test, compared to all the control mice. GluR3B Ab's are produced in DBA/2J mice, facilitate seizures and induce behavioral/motor impairments. This animal model can therefore serve for studying autoimmune epilepsy and abnormal behavior mediated by pathogenic anti-GluR3B Ab's. Copyright © 2014 Elsevier Ltd. All rights reserved.

Role of amino acids in salivation and the localization of their receptors in the rat salivary gland.

PubMed

Shida, T; Kondo, E; Ueda, Y; Takai, N; Yoshida, Y; Araki, T; Kiyama, H; Tohyama, M

1995-11-01

The distribution of gamma-aminobutyric acid (GABA) receptor subunits such as GABAAR-gamma 1 and GABAAR-gamma 2, and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) type receptor subunits such as GluR-1, GluR-2/3 and GluR-4, and N-methyl-D-aspartic acid (NMDA) type subunits such as NR1 were investigated by immunocytochemistry. Furthermore, the roles of these amino acids, GABA and glutamate, on salivation were analyzed in the rat submandibular and sublingual glands. Some similarities were observed in the distribution patterns of GABAA type receptors and AMPA receptors. In the submandibular ganglion cells, collecting ducts and striated ducts, these subunits were expressed strongly; however, there were some differences in their expression patterns between the submandibular and sublingual gland acinar cells. Since these receptor subunits were expressed in the acinar cell bodies of the submandibular gland, they were not expressed in the acinar cells but were expressed in the myoepithelial cells in the sublingual gland. On the other hand, no NR1 expression was observed. To examine the roles of GABA and glutamate in salivation, the submandibular and sublingual glands were perfused partially with Ringer's solution via a facial artery to avoid systemic influence, and substrates were infused into the perfusion solution. No salivary secretion was evoked by GABA or glutamate infusion in the absence of electrical stimulation (2-3 V, 5 ms, 20 Hz). Salivary flow evoked by electrical stimulation of the chorda-lingual nerve caused significant inhibition by GABA (10(-6), 10(-5), 10(-4) and 10(-3) M) and the GABAAR agonist muscimol 10(-3) and 10(-6) M) (n = 6, P < 0.05). Such GABA-induced inhibition was antagonized by the GABAAR antagonists bicuculline (BCC; 10(-6) and 10(-3) M) and picrotoxin (PTX; 10(-6) and 10(-3) M). On the other hand, salivary flow evoked by electrical stimulation (8-10 V, 5 ms, 20 Hz) of the superior cervical ganglion (SCG) was not affected by GABA. While high doses of glutamate (10(-1) M) and NMDA (10(-1) M) showed no effects on salivary flow despite application of electrical stimulation, AMPA at a high concentration (10(-1) M) significantly inhibited salivary secretion (n = 6, P < 0.05). These studies revealed that inhibitory and excitatory amino acid receptors such as GABAA and AMPA type receptors are coexpressed in the rat salivary glands, and that GABA inhibits salivary secretion via GABAA receptors which may act with acetylcholine. However, the role of glutamate in salivation remains unclear despite the presence of AMPA type receptors. The present findings suggest that glutamate does not act alone but with other substances such as peptides and/or other amino acids.

Conformation change of tRNA/sub Glu/ in the complex with glutamyl-tRNA synthetase is required for the specific binding of L-glutamate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hara-Yokoyama, M.; Yokoyama, S.; Miyazawa, T.

1986-11-04

The binding of Thermus thermophilus glutamyl-tRNA synthetase (GluRS) with T. thermophilus tRNA/sup Glu/, Escherichia coli tRNA/sup Glu/, and amino acids was studied by fluorescence measurements. In the absence of tRNA/sup Glu/, GluRS binds with D-glutamate as well as L-glutamate. However, in the presence of E.coli tRNA/sup Glu/, GluRS binds specifically with L-glutamate. The KCl effects on the Michaelis constants (K/sub m/) for tRNA/sup Glu/, L-glutamate, and ATP were studied for the aminoacylation of the homologous tRNA/sup Glu/ and heterologous tRNA/sup Glu/ species. As the KCl concentration is raised from 0 to 100 mM, the K/sub m/ value for L-glutamate inmore » the heterologous system is remarkably increased whereas the K/sub m/ value for L-glutamate in the homologous system is only slightly increased. The circular dichroism analyses were made mainly of the bands due to the 2-thiouridine derivatives of tRNA/sup Glu/ in the complex. The conformation change of T. thermophilus tRNA/sup Glu/ upon complex formation with GluRS is not affected by addition of KCl. In contrast, the heterologous tRNA/sup Glu/GluRS complex is in equilibrium of two forms that depends on KCl concentration. The predominant form at low KCl concentration is closely related to the small K/sub m/ value for L-glutamate. In this form of the complex, the conformation of tRNA/sup Glu/ is appreciably different from that of free molecule. Accordingly, such a conformation change of tRNA/sup Glu/ in the complex with GluRS is required for the specific binding of L-glutamate as the substrate.« less

ApoE4 expression accelerates hippocampus-dependent cognitive deficits by enhancing Aβ impairment of insulin signaling in an Alzheimer’s disease mouse model

PubMed Central

Chan, Elizabeth S.; Shetty, Mahesh Shivarama; Sajikumar, Sreedharan; Chen, Christopher; Soong, Tuck Wah; Wong, Boon-Seng

2016-01-01

The apolipoprotein E4 (ApoE4) is the strongest genetic risk factor for Alzheimer’s disease (AD). The AD brain was shown to be insulin resistant at end stage, but the interplay between insulin signaling, ApoE4 and Aβ across time, and their involvement in memory decline is unclear. To investigate insulin response in the ageing mouse hippocampus, we crossed the human ApoE-targeted replacement mice with the mutant human amyloid precursor protein (APP) mice (ApoExAPP). While hippocampal Aβ levels were comparable between ApoE3xAPP and ApoE4xAPP mice at 26 weeks, insulin response was impaired in the ApoE4xAPP hippocampus. Insulin treatment was only able to stimulate insulin signaling and increased AMPA-GluR1 phosphorylation in forskolin pre-treated hippocampal slices from ApoE3xAPP mice. In ApoE4xAPP mice, insulin dysfunction was also associated with poorer spatial memory performance. Using dissociated hippocampal neuron in vitro, we showed that insulin response in ApoE3 and ApoE4 neurons increased AMPA receptor-mediated miniature excitatory postsynaptic current (mEPSC) amplitudes and GluR1-subunit insertion. Pre-treatment of ApoE3 neurons with Aβ42 did not affect insulin-mediated GluR1 subunit insertion. However, impaired insulin sensitivity observed only in the presence of ApoE4 and Aβ42, attenuated GluR1-subunit insertion. Taken together, our results suggest that ApoE4 enhances Aβ inhibition of insulin-stimulated AMPA receptor function, which accelerates memory impairment in ApoE4xAPP mice. PMID:27189808

Differential glutamate AMPA-receptor plasticity in subpopulations of VTA neurons in the presence or absence of residual cocaine: Implications for the development of addiction

PubMed Central

Lane, D.A.; Reed, B.; Kreek, M.J.; Pickel, V.M.

2011-01-01

Cocaine-induced plasticity of mesocorticolimbic dopamine (DA) neurons, originating in the ventral tegmental area (VTA), persists in the absence of cocaine and may contribute to both drug-craving and relapse. Glutamate AMPA receptors (AMPARs) in these neurons are implicated in this plasticity. However, there is no ultrastructural evidence that the absence of cocaine following repeated administrations affects the critical surface/synaptic availability of AMPAR GluR1 subunits in either DA or non-DA, putative GABAergic neurons within the VTA. To assess this, we used electron microscopic immunolabeling in the VTA of adult male mice sacrificed at 30 minutes or 72 hours after receiving the final of six (15 mg/kg) cocaine injections, a dosing paradigm that resulted in development of locomotor sensitization. At each time point, both cocaine- and saline-injected mice showed AMPAR GluR1 immunogold labeling in somatodendritic profiles, many of which contained immunoperoxidase labeling for the DA-synthesizing enzyme, tyrosine hydroxylase (TH). At 30 minutes after the last injection, when cocaine was systemically present, only the non-TH labeled dendrites showed a significant increase in the synaptic/plasmalemmal density of GluR1 immunogold particles. At 72 hours, when systemic cocaine was depleted, synaptic GluR1 labeling was greatly enhanced in TH-containing dendrites throughout the VTA and in non-TH dendrites of the limbic-associated paranigral VTA. Our results demonstrate that systemic cocaine produces GluR1 trafficking specifically in non-DA neurons of the VTA, which may subsequently contribute to the abstinent-induced enhancement of AMPA receptor synaptic transmission in mesocorticolimbic DA neurons leading to heightened drug seeking behavior. PMID:21215761

AMPA Receptors Mediate Acetylcholine Release from Starburst Amacrine Cells in the Rabbit Retina

PubMed Central

FIRTH, SALLY I.; LI, WEI; MASSEY, STEPHEN C.; MARSHAK, DAVID W.

2012-01-01

The light response of starburst amacrine cells is initiated by glutamate released from bipolar cells. To identify the receptors that mediate this response, we used a combination of anatomical and physiological techniques. An in vivo, rabbit eyecup was preloaded with [3H]-choline, and the [3H]-acetylcholine (ACh) released into the superfusate was monitored. A photopic, 3 Hz flashing light increased ACh release, and the selective AMPA receptor antagonist, GYKI 53655, blocked this light-evoked response. Nonselective AMPA/kainate agonists increased the release of ACh, but the specific kainate receptor agonist, SYM 2081, did not increase ACh release. Selective AMPA receptor antagonists, GYKI 53655 or GYKI 52466, also blocked the responses to agonists. We conclude that the predominant excitatory input to starburst amacrine cells is mediated by AMPA receptors. We also labeled lightly fixed rabbit retinas with antisera to choline acetyltransferase (ChAT), AMPA receptor subunits GluR1, GluR2/3, or GluR4, and kainate receptor subunits GluR6/7 and KA2. Labeled puncta were observed in the inner plexiform layer with each of these antisera to glutamate receptors, but only GluR2/3-IR puncta and GluR4-IR puncta were found on the ChAT-IR processes. The same was true of starburst cells injected intracellularly with Neurobiotin, and these AMPA receptor subunits were localized to two populations of puncta. The AMPA receptors are expected to desensitize rapidly, enhancing the sensitivity of starburst amacrine cells to moving or other rapidly changing stimuli. PMID:14515241

Exposure to 50 Hz electromagnetic radiation promote early maturation and differentiation in newborn rat cerebellar granule neurons.

PubMed

Lisi, A; Ciotti, M T; Ledda, M; Pieri, M; Zona, C; Mercanti, D; Rieti, S; Giuliani, L; Grimaldi, S

2005-08-01

The wish of this work is the study of the effect of electromagnetic (EMF) radiations at a frequency of 50 Hz on the development of cerebellar granule neurons (CGN). Granule neurons, prepared from newborn rat cerebellum (8 days after birth), were cultured after plate-seeding in the presence of EMF radiations, with the plan of characterizing their cellular and molecular biochemistry, after exposure to the electromagnetic stimulus. Five days challenge to EMF radiations showed, by the cytotoxic glutamate (Glu) pulse test, a 30% decrease of cells survival, while only 5% of mortality was reported for unexposed sample. Moreover, blocking the glutamate receptor (GluR) with the Glu competitor MK-801, no toxicity effect after CGN challenge to EMF radiations and Glu was detected. By patch-clamp recording technique, the Kainate-induced currents from 6 days old exposed CGN exhibited a significant increase with respect to control cells. Western blot and reverse transcription-polymerase chain reaction (RT-PCR) analyses show that EMF exposure of rats CGN, induces a change in both GluRs proteins and mRNAs expression with respect to control. In addition, the use of monoclonal antibody raised against neurofilament protein (NF-200) reveals an increase in NF-200 synthesis in the exposed CGN. All these results indicate that exposure to non-ionizing radiations contribute to a premature expression of GluRs reducing the life span of CGN, leading to a more rapid cell maturation. (c) 2005 Wiley-Liss, Inc.

Phosphatidylinositol 3-kinase is a key mediator of central sensitization in painful inflammatory conditions

PubMed Central

Pezet, Sophie; Marchand, Fabien; D'Mello, Richard; Grist, John; Clark, Anna K.; Malcangio, Marzia; Dickenson, Anthony H.; Williams, Robert J.; McMahon, Stephen B.

2010-01-01

Here we show that phosphatidylinositol 3-kinase (PI3K) is a key player in the establishment of central sensitization, the spinal cord phenomenon associated with persistent afferent inputs and contributing to chronic pain states. We demonstrated electrophysiologically that PI3K is required for the full expression of spinal neuronal wind-up. In an inflammatory pain model, intrathecal administration of LY294002, a potent PI3K inhibitor, dose-dependently inhibited pain related behavior. This effect was correlated with a reduction of the phosphorylation of extracellular signal-regulated kinase (ERK) and CaMKinase II. In addition, we observed a significant decrease in the phosphorylation of the NMDA receptor subunit NR2B, decreased translocation to the plasma membrane of the GluR1 AMPA receptor subunit in the spinal cord and a reduction of evoked neuronal activity as measured using c-Fos immunohistochemistry. Our study suggests that PI3K is a major factor in the expression of central sensitization after noxious inflammatory stimuli. PMID:18417706

Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus

PubMed Central

Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo

2007-01-01

Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC50 values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins. PMID:17881566

Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus.

PubMed

Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo

2007-09-25

Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC(50) values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins.

Capsaicin-induced glutamate release is implicated in nociceptive processing through activation of ionotropic glutamate receptors and group I metabotropic glutamate receptor in primary afferent fibers.

PubMed

Jin, You-Hong; Yamaki, Fumiko; Takemura, Motohide; Koike, Yuichi; Furuyama, Akira; Yonehara, Norifumi

2009-02-01

Glutamate (Glu) is the major excitatory neurotransmitter in the central nervous system. The role of peripheral Glu and Glu receptors (GluRs) in nociceptive transmission is, however, still unclear. In the present study, we examined Glu levels released in the subcutaneous perfusate of the rat hind instep using a microdialysis catheter and the thermal withdrawal latency using the Plantar Test following injection of drugs associated with GluRs with/without capsaicin into the hindpaw. The injection of capsaicin into the rat hind instep caused an increase of Glu level in the s.c. perfusate. Capsaicin also significantly decreased withdrawal latency to irradiation. These effects of capsaicin were inhibited by pretreatment with capsazepine, a transient receptor potential vanilloid receptor 1 (TRPV1) competitive antagonist. Capsaicin-induced Glu release was also suppressed by combination with each antagonist of ionotropic GluRs (iGluRs: NMDA/AMPA receptors) and group I metabotropic GluR (mGluR), but not group II and group III mGluRs. Furthermore, these GluRs antagonists showed remarkable inhibition against capsaicin-induced thermal hyperalgesia. These results suggest that Glu is released from the peripheral endings of small-diameter afferent fibers by noxious stimulation and then activates peripheral iGluRs and group I mGluR in development and/or maintenance of nociception. Furthermore, the activation of peripheral NMDA/AMPA receptors and group I mGluR may be important in mechanisms whereby capsaicin evokes nociceptive responses.

Effect of Progesterone on Cerebral Vasospasm and Neurobehavioral Outcomes in a Rodent Model of Subarachnoid Hemorrhage.

PubMed

Turan, Nefize; Miller, Brandon A; Huie, J Russell; Heider, Robert A; Wang, Jun; Wali, Bushra; Yousuf, Seema; Ferguson, Adam R; Sayeed, Iqbal; Stein, Donald G; Pradilla, Gustavo

2018-02-01

Subarachnoid hemorrhage (SAH) induces widespread inflammation leading to cellular injury, vasospasm, and ischemia. Evidence suggests that progesterone (PROG) can improve functional recovery in acute brain injury owing to its anti-inflammatory and neuroprotective properties, which could also be beneficial in SAH. We hypothesized that PROG treatment attenuates inflammation-mediated cerebral vasospasm and microglial activation, improves synaptic connectivity, and ameliorates functional recovery after SAH. We investigated the effect of PROG in a cisternal SAH model in adult male C57BL/6 mice. Neurobehavioral outcomes were evaluated using rotarod latency and grip strength tests. Basilar artery perimeter, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid glutamate receptor 1 (GluR1)/synaptophysin colocalization, and Iba-1 immunoreactivity were quantified histologically. PROG (8 mg/kg) significantly improved rotarod latency at day 6 and grip strength at day 9. PROG-treated mice had significantly reduced basilar artery vasospasm at 24 hours. GluR1/synaptophysin colocalization, indicative of synaptic GluR1, was significantly reduced in the SAH+Vehicle group at 24 hours, and PROG treatment significantly attenuated this reduction. PROG treatment significantly reduced microglial cell activation and proliferation in cerebellum and cortex but not in the brainstem at 10 days. PROG treatment ameliorated cerebral vasospasm, reduced microglial activation, restored synaptic GluR1 localization, and improved neurobehavioral performance in a murine model of SAH. These results provide a rationale for further translational testing of PROG therapy in SAH. Copyright © 2017 Elsevier Inc. All rights reserved.

Glutamate receptor mutations in psychiatric and neurodevelopmental disorders

PubMed Central

Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Àlex

2014-01-01

Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications. PMID:24605182

Glutamate receptor mutations in psychiatric and neurodevelopmental disorders.

PubMed

Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Alex

2014-01-01

Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications.

STRIATAL-ENRICHED PROTEIN TYROSINE PHOSPHATASE (STEP) KNOCKOUT MICE HAVE ENHANCED HIPPOCAMPAL MEMORY

PubMed Central

Venkitaramani, Deepa V.; Moura, Paula J.; Picciotto, Marina R.; Lombroso, Paul J.

2011-01-01

STEP is a brain-specific phosphatase that opposes synaptic strengthening by the regulation of key synaptic signaling proteins. Previous studies suggest a possible role for STriatal-Enriched protein tyrosine Phosphatase (STEP) in learning and memory. To demonstrate the functional importance of STEP in learning and memory, we generated STEP knockout (KO) mice and examined the effect of deletion of STEP on behavioral performance, as well as the phosphorylation and expression of its substrates. Here we report that loss of STEP leads to significantly enhanced performance in hippocampal-dependent learning and memory tasks. In addition, STEP KO mice displayed greater dominance behavior, although they were normal in their motivation, motor coordination, visual acuity and social interactions. STEP KO mice displayed enhanced tyrosine phosphorylation of extracellular-signal regulated kinase 1/2 (ERK1/2), the NR2B subunit of the N-methyl-D-aspartate receptor (NMDAR), Proline-rich tyrosine kinase (Pyk2), as well as an increased phosphorylation of ERK1/2 substrates. Concomitant to the increased phosphorylation of NR2B, synaptosomal expression of NR1/NR2B NMDARs was increased in STEP KO mice, as was the GluR1/GluR2 containing α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid receptors (AMPAR), providing a potential molecular mechanism for the improved cognitive performance. The data support a role for STEP in the regulation of synaptic strengthening. The absence of STEP improves cognitive performance, and may do so by the regulation of downstream effectors necessary for synaptic transmission. PMID:21501258

Prolonged seizure activity leads to increased Protein Kinase A activation in the rat pilocarpine model of status epilepticus.

PubMed

Bracey, James M; Kurz, Jonathan E; Low, Brian; Churn, Severn B

2009-08-04

Status epilepticus is a life-threatening form of seizure activity that represents a major medical emergency associated with significant morbidity and mortality. Protein Kinase A is an important regulator of synaptic strength that may play an important role in the development of status epilepticus-induced neuronal pathology. This study demonstrated an increase in PKA activity against exogenous and endogenous substrates during later stages of SE. As SE progressed, a significant increase in PKA-mediated phosphorylation of an exogenous peptide substrate was demonstrated in cortical structures. The increased activity was not due to altered expression of either regulatory or catalytic subunits of the enzyme. Through the use of phospho-specific antibodies, this study also investigated the effects of SE on the phosphorylation of the GluR1 subunit of the AMPA subtype of glutamate receptor. After the onset of continuous seizure activity, an increase in phosphorylation of the PKA site on the GluR1 subunit of the AMPA receptor was observed. These data suggest a potential mechanism by which SE may increase neuronal excitability in the cortex, potentially leading to maintenance of seizure activity or long-term neuronal pathology.

Identification of the kainate receptor subunits underlying modulation of excitatory synaptic transmission in the CA3 region of the hippocampus.

PubMed

Contractor, A; Swanson, G T; Sailer, A; O'Gorman, S; Heinemann, S F

2000-11-15

To understand the physiological role of kainate receptors and their participation in seizure induction in animal models of epilepsy, it will be necessary to develop a comprehensive description of their action in the CA3 region of the hippocampus. Activation of presynaptic kainate receptors depresses excitatory synaptic transmission at mossy fiber and associational-commissural inputs to CA3 pyramidal neurons (Vignes et al., 1998; Bortolotto et al., 1999; Kamiya and Ozawa, 2000). In this study, we use gene-targeted mice lacking glutamate receptor 5 (GluR5) or GluR6 kainate receptor subunits to identify the receptor subunits that comprise the kainate receptors responsible for presynaptic modulation of CA3 transmission. We found that bath application of kainate (3 microm) profoundly reduced EPSCs at mossy fiber and collateral synapses in neurons from wild-type and GluR5(-/-) mice but had no effect on EPSCs in neurons from GluR6(-/-) mice. These results therefore contrast with previous studies that supported a role for GluR5-containing receptors at mossy fiber and associational-commissural synapses (Vignes et al., 1998; Bortolotto et al., 1999). Surprisingly, at perforant path synapses kainate receptor activation enhanced transmission; this potentiation was abolished in both GluR5 and GluR6 knock-out mice. Kainate receptors thus play multiple and complex roles to modulate excitatory synaptic transmission in the CA3 region of the hippocampus.

Obesogenic diet intake during pregnancy programs aberrant synaptic plasticity and addiction-like behavior to a palatable food in offspring.

PubMed

Camacho, Alberto; Montalvo-Martinez, Larisa; Cardenas-Perez, Robbi E; Fuentes-Mera, Lizeth; Garza-Ocañas, Lourdes

2017-07-14

Contextual food conditioned behaviors require plasticity of glutamatergic neurotransmission in the reward system, involving changes in the expression of including a-amino-3-hydroxy-5-methylisoxazole 4-propionate receptors (AMPA), N-methyl-d-aspartic acid (NMDA) and metabotropic glutamate 2,3 (mGlur 2,3). However, the role of changes in glutamatergic synaptic markers on energy-dense palatable food preference during development has not been described. Here, we determine the effect of nutritional programing during gestation on fat food choices using a conditioned place preference (CPP) test and an operant training response and its effect on glutamatergic markers in the nucleus accumbens (Nac) shell and prefrontal cortex (PFC). Our data showed that rats displayed preference for palatable fat food and an increase in caloric intake when compared to a chow diet. Notably, 74% of rats showing a preference for fat food intake correlate with a positive HFD-paired score whereas 26% failed to get HFD-conditioned. Also, male rats trained under an operant training response schedule (FR1, FR5 and PR) showed high and low responder groups to work for food. Notably, hypercaloric nutritional programing of female rats leads to exacerbation for reinforcers in female offspring compared to offspring from chow diet. Finally, we found that an operant training response to palatable reinforcers correlates with upregulation of mGlur 2,3 in the NAc shell and PFC of male rats and female offspring. Also, we found selective Nr1 upregulation in NAc shell and the PFC of female offspring. Our data suggest that nutritional programing by hypercaloric intake leads to incentive motivation to work for food and synaptic plasticity alteration in the mesolimbic system. Copyright © 2017 Elsevier B.V. All rights reserved.

Alterations in GluR2 AMPA receptor phosphorylation at serine 880 following group I metabotropic glutamate receptor stimulation in the rat dorsal striatum.

PubMed

Ahn, Sung Min; Choe, Eun Sang

2010-04-01

Phosphorylation of ionotropic glutamate receptors in the brain plays a crucial role in the regulation of synaptic plasticity. In this study, we investigated the regulation of alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor phosphorylation by the stimulation of group I metabotropic glutamate receptors (mGluRs) in the dorsal striatum in vivo. The results showed that intrastriatal infusion of the group I mGluR agonist, (RS)-3,5-dihydroxyphenylglycine (DHPG, 250 nmol), enhanced the sensitivity of GluR2 subunit in its phosphorylation at serine 880 (S880) in the dorsal striatum. This enhancement of the sensitivity of GluR2-S880 phosphorylation was reduced by blocking group I mGluRs and N-methyl-D-aspartate (NMDA) receptors. Similar reduction of the enhancement was also induced by inhibiting phospholipase C (PLC), calcium/calmodulin-dependent protein kinase (CaMK), c-Jun N-terminal kinase (JNK), and protein kinase C (PKC). Inhibition of protein phosphatase (PP) 1/2A and calcineurin (PP2B) alone enhanced GluR2-S880 phosphorylation in the dorsal striatum, whereas inhibition of these phosphatases did not further enhance the S880 phosphorylation by DHPG stimulation. In addition, inhibition of PP1/2A or PP2B also enhanced the phosphorylation of CaMKII, JNK and PKC. These data suggest that the phosphorylation of AMPA receptor GluR2 subunit at S880 is subject to the upregulation by the stimulation of group I mGluRs. Interactions among glutamate receptors, protein kinases, and PPs participate in this upregulation. (c) 2009 Wiley-Liss, Inc.

Late calcium EDTA rescues hippocampal CA1 neurons from global ischemia-induced death.

PubMed

Calderone, Agata; Jover, Teresa; Mashiko, Toshihiro; Noh, Kyung-min; Tanaka, Hidenobu; Bennett, Michael V L; Zukin, R Suzanne

2004-11-03

Transient global ischemia induces a delayed rise in intracellular Zn2+, which may be mediated via glutamate receptor 2 (GluR2)-lacking AMPA receptors (AMPARs), and selective, delayed death of hippocampal CA1 neurons. The molecular mechanisms underlying Zn2+ toxicity in vivo are not well delineated. Here we show the striking finding that intraventricular injection of the high-affinity Zn2+ chelator calcium EDTA (CaEDTA) at 30 min before ischemia (early CaEDTA) or at 48-60 hr (late CaEDTA), but not 3-6 hr, after ischemia, afforded robust protection of CA1 neurons in approximately 50% (late CaEDTA) to 75% (early CaEDTA) of animals. We also show that Zn2+ acts via temporally distinct mechanisms to promote neuronal death. Early CaEDTA attenuated ischemia-induced GluR2 mRNA and protein downregulation (and, by inference, formation of Zn2+-permeable AMPARs), the delayed rise in Zn2+, and neuronal death. These findings suggest that Zn2+ acts at step(s) upstream from GluR2 gene downregulation and implicate Zn2+ in transcriptional regulation and/or GluR2 mRNA stability. Early CaEDTA also blocked mitochondrial release of cytochrome c and Smac/DIABLO (second mitochondria-derived activator of caspases/direct inhibitor of apoptosis protein-binding protein with low pI), caspase-3 activity (but not procaspase-3 cleavage), p75NTR induction, and DNA fragmentation. These findings indicate that CaEDTA preserves the functional integrity of the mitochondrial outer membrane and arrests the caspase death cascade. Late injection of CaEDTA at a time when GluR2 is downregulated and caspase is activated inhibited the delayed rise in Zn2+, p75NTR induction, DNA fragmentation, and cell death. The finding of neuroprotection by late CaEDTA administration has striking implications for intervention in the delayed neuronal death associated with global ischemia.

Ethanol up-regulates nucleus accumbens neuronal activity dependent pentraxin (Narp): implications for alcohol-induced behavioral plasticity.

PubMed

Ary, Alexis W; Cozzoli, Debra K; Finn, Deborah A; Crabbe, John C; Dehoff, Marlin H; Worley, Paul F; Szumlinski, Karen K

2012-06-01

Neuronal activity dependent pentraxin (Narp) interacts with α-amino-3-hydroxyl-5-methyl-4-isoxazole-propionate (AMPA) glutamate receptors to facilitate excitatory synapse formation by aggregating them at established synapses. Alcohol is well-characterized to influence central glutamatergic transmission, including AMPA receptor function. Herein, we examined the influence of injected and ingested alcohol upon Narp protein expression, as well as basal Narp expression in mouse lines selectively bred for high blood alcohol concentrations under limited access conditions. Alcohol up-regulated accumbens Narp levels, concomitant with increases in levels of the GluR1 AMPA receptor subunit. However, accumbens Narp or GluR1 levels did not vary as a function of selectively bred genotype. We next employed a Narp knock-out (KO) strategy to begin to understand the behavioral relevance of alcohol-induced changes in protein expression in several assays of alcohol reward. Compared to wild-type mice, Narp KO animals: fail to escalate daily intake of high alcohol concentrations under free-access conditions; shift their preference away from high alcohol concentrations with repeated alcohol experience; exhibit a conditioned place-aversion in response to the repeated pairing of 3 g/kg alcohol with a distinct environment and fail to exhibit alcohol-induced locomotor hyperactivity following repeated alcohol treatment. Narp deletion did not influence the daily intake of either food or water, nor did it alter any aspect of spontaneous or alcohol-induced motor activity, including the development of tolerance to its motor-impairing effects with repeated treatment. Taken together, these data indicate that Narp induction, and presumably subsequent aggregation of AMPA receptors, may be important for neuroplasticity within limbic subcircuits mediating or maintaining the rewarding properties of alcohol. Published by Elsevier Inc.

Ethanol up-regulates nucleus accumbens neuronal activity dependent pentraxin (Narp): implications for alcohol-induced behavioral plasticity

PubMed Central

Ary, Alexis W.; Cozzoli, Debra K.; Finn, Deborah A.; Crabbe, John C.; Dehoff, Marlin H.; Worley, Paul F.; Szumlinski, Karen K.

2012-01-01

Neuronal activity-dependent pentraxin (Narp) interacts with α-amino-3-hydroxyl-5-methyl-4-isoxazole-propionate (AMPA) glutamate receptors to facilitate excitatory synapse formation by aggregating them at established synapses. Alcohol is well-characterized to influence central glutamatergic transmission, including AMPA receptor function. Herein, we examined the influence of injected and ingested alcohol upon Narp protein expression, as well as basal Narp expression in mouse lines selectively bred for high blood alcohol concentrations under limited access conditions. Alcohol up-regulated accumbens Narp levels, concomitant with increases in levels of the GluR1 AMPA receptor subunit. However, accumbens Narp or GluR1 levels did not vary as a function of selectively bred genotype. We next employed a Narp knock-out (KO) strategy to begin to understand the behavioral relevance of alcohol-induced changes in protein expression in several assays of alcohol reward. Compared to wild-type mice, Narp KO animals: fail to escalate daily intake of high alcohol concentrations under free-access conditions; shift their preference away from high alcohol concentrations with repeated alcohol experience; exhibit a conditioned place-aversion in response to the repeated pairing of 3 g/kg alcohol with a distinct environment and fail to exhibit alcohol-induced locomotor hyperactivity following repeated alcohol treatment. Narp deletion did not influence the daily intake of either food or water, nor did it alter any aspect of spontaneous or alcohol-induced motor activity, including the development of tolerance to its motor-impairing effects with repeated treatment. Taken together, these data indicate that Narp induction, and presumably subsequent aggregation of AMPA receptors, may be important for neuroplasticity within limbic subcircuits mediating or maintaining the rewarding properties of alcohol. PMID:22444953

Xenon reduces glutamate-, AMPA-, and kainate-induced membrane currents in cortical neurones.

PubMed

Dinse, A; Föhr, K J; Georgieff, M; Beyer, C; Bulling, A; Weigt, H U

2005-04-01

The anaesthetic, analgesic, and neuroprotective effects of xenon (Xe) are believed to be mediated by a block of the NMDA (N-methyl-D-aspartate) receptor channel. Interestingly, the clinical profile of the noble gas differs markedly from that of specific NMDA receptor antagonists. The aim of this study was, therefore, to investigate whether Xe might be less specific, also inhibiting the two other subtypes of glutamate receptor channels, such as the alpha-amino-3-hydroxy-5-methyl-4-isoxazolole propionate (AMPA) and kainate receptors. The study was performed on voltage-clamped cortical neurones from embryonic mice and SH-SY5Y cells expressing GluR6 kainate receptors. Drugs were applied by a multi-barreled fast perfusion system. Xe, dissolved at approximately 3.45 mM in aqueous solution, diminished the peak and even more the plateau of AMPA and glutamate induced currents. At the control EC(50) value for AMPA (29 microM) these reductions were by about 40 and 56% and at 3 mM glutamate the reductions were by 45 and 66%, respectively. Currents activated at the control EC(50) value for kainate (57 microM) were inhibited by 42%. Likewise, Xe showed an inhibitory effect on kainate-induced membrane currents of SH-SY5Y cells transfected with the GluR6 subunit of the kainate receptor. Xe reduced kainate-induced currents by between 35 and 60%, depending on the kainate concentration. Xe blocks not only NMDA receptors, but also AMPA and kainate receptors in cortical neurones as well as GluR6-type receptors expressed in SH-SY5Y cells. Thus, Xe seems to be rather non-specific as a channel blocker and this may contribute to the analgesic and anaesthetic potency of Xe.

Enhanced susceptibility of Prnp-deficient mice to kainate-induced seizures, neuronal apoptosis, and death: Role of AMPA/kainate receptors.

PubMed

Rangel, Alejandra; Burgaya, Ferran; Gavín, Rosalina; Soriano, Eduardo; Aguzzi, Adriano; Del Río, José A

2007-09-01

Normal physiologic functions of the cellular prion protein (PrPc) are still elusive. This GPI-anchored protein exerts many functions, including roles in neuron proliferation, neuroprotection or redox homeostasis. There are, however, conflicting data concerning its role in synaptic transmission. Although several studies report that PrPc participates in NMDA-mediated neurotransmission, parallel studies describe normal behavior of PrPc-mutant mice. Abnormal axon connections have been described in the dentate gyrus of the hippocampi of PrPc-deficient mice similar to those observed in epilepsy. A study indicates increased susceptibility to kainate (KA) in these mutant mice. We extend the observation of these studies by means of several histologic and biochemical analyses of KA-treated mice. PrPc-deficient mice showed increased sensitivity to KA-induced seizures in vivo and in vitro in organotypic slices. In addition, we show that this sensitivity is cell-specific because interference experiments to abolish PrPc expression increased susceptibility to KA in PrPc-expressing cells. We indicate a correlation of susceptibility to KA in cells lacking PrPc with the differential expression of GluR6 and GluR7 KA receptor subunits using real-time RT-PCR methods. These results indicate that PrPc exerts a neuroprotective role against KA-induced neurotoxicity, probably by regulating the expression of KA receptor subunits. (c) 2007 Wiley-Liss, Inc.

Extinction Training Regulates Neuroadaptive Responses to Withdrawal from Chronic Cocaine Self-Administration

PubMed Central

Self, David W.; Choi, Kwang-Ho; Simmons, Diana; Walker, John R.; Smagula, Cynthia S.

2004-01-01

Cocaine produces multiple neuroadaptations with chronic repeated use. Many of these neuroadaptations can be reversed or normalized by extinction training during withdrawal from chronic cocaine self-administration in rats. This article reviews our past and present studies on extinction-induced modulation of the neuroadaptive response to chronic cocaine in the mesolimbic dopamine system, and the role of this modulation in addictive behavior in rats. Extinction training normalizes tyrosine hydroxylase levels in the nucleus accumbens (NAc) shell, an effect that could help ameliorate dysphoria and depression associated with withdrawal from chronic cocaine use. Extinction training also increases levels of GluR1 and GluR2/3 AMPA receptor subunits, while normalizing deficits in NR1 NMDA receptor subunits, in a manner consistent with long-term potentiation of excitatory synapses in the NAc shell. Our results suggest that extinction-induced increases in AMPA and NMDA receptors may restore deficits in cortico-accumbal neurotransmission in the NAc shell and facilitate inhibitory control over cocaine-seeking behavior. Other changes identified by gene expression profiling, including up-regulation in the AMPA receptor aggregating protein Narp, suggest that extinction training induces extensive synaptic reorganization. These studies highlight potential benefits for extinction training procedures in the treatment of drug addiction. PMID:15466321

Glutamate mediates platelet activation through the AMPA receptor

PubMed Central

Morrell, Craig N.; Sun, Henry; Ikeda, Masahiro; Beique, Jean-Claude; Swaim, Anne Marie; Mason, Emily; Martin, Tanika V.; Thompson, Laura E.; Gozen, Oguz; Ampagoomian, David; Sprengel, Rolf; Rothstein, Jeffrey; Faraday, Nauder; Huganir, Richard; Lowenstein, Charles J.

2008-01-01

Glutamate is an excitatory neurotransmitter that binds to the kainate receptor, the N-methyl-D-aspartate (NMDA) receptor, and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR). Each receptor was first characterized and cloned in the central nervous system (CNS). Glutamate is also present in the periphery, and glutamate receptors have been identified in nonneuronal tissues, including bone, heart, kidney, pancreas, and platelets. Platelets play a central role in normal thrombosis and hemostasis, as well as contributing greatly to diseases such as stroke and myocardial infarction. Despite the presence of glutamate in platelet granules, the role of glutamate during hemostasis is unknown. We now show that activated platelets release glutamate, that platelets express AMPAR subunits, and that glutamate increases agonist-induced platelet activation. Furthermore, we demonstrate that glutamate binding to the AMPAR increases intracellular sodium concentration and depolarizes platelets, which are important steps in platelet activation. In contrast, platelets treated with the AMPAR antagonist CNQX or platelets derived from GluR1 knockout mice are resistant to AMPA effects. Importantly, mice lacking GluR1 have a prolonged time to thrombosis in vivo. Our data identify glutamate as a regulator of platelet activation, and suggest that the AMPA receptor is a novel antithrombotic target. PMID:18283118

Changes of several brain receptor complexes in the cerebral cortex of patients with Alzheimer disease: probable new potential pharmaceutical targets.

PubMed

Falsafi, Soheil Keihan; Roßner, Steffen; Ghafari, Maryam; Groessl, Michael; Morawski, Markus; Gerner, Christopher; Lubec, Gert

2014-01-01

Although Alzheimer disease (AD) has been linked to defects in major brain receptors, studies thus far have been limited to the determination of receptor subunits or specific ligand binding studies. However, the availability of current technology enables the determination and quantification of brain receptor complexes. Thus, we examined levels of native receptor complexes in the brains of patients with AD. Cortical tissue was obtained from control subjects (n = 12 females and 12 males) and patients with AD (n = 12 females and 12 males) within a 3-h postmortem time period. The tissues were kept frozen until further biochemical analyses. Membrane proteins were extracted and subsequently enriched by ultracentrifugation using a sucrose gradient. Membrane proteins were then electrophoresed onto native gels and immunoblotted using antibodies against individual brain receptors. We found that the levels were comparable for complexes containing GluR2, GluR3 and GluR4 as well as 5-HT1A. Moreover, the levels of complexes containing muscarinic AChR M1, NR1 and GluR1 were significantly increased in male patients with AD. Nicotinic AChRs 4 and 7 as well as dopaminergic receptors D1 and D2 were also increased in males and females with AD. These findings reveal a pattern of altered receptor complex levels that may contribute to the deterioration of the concerted activity of these receptors and thus result in cognitive deficits observed in patients with AD. It should be emphasised that receptor complexes function as working units rather than individual subunits. Thus, the receptor deficits identified may be relevant for the design of experimental therapies. Therefore, specific pharmacological modulation of these receptors is within the pharmaceutical repertoire.

Association of the AMPA receptor-related postsynaptic density proteins GRIP and ABP with subsets of glutamate-sensitive neurons in the rat retina.

PubMed

Gábriel, Robert; de Souza, Sunita; Ziff, Edward B; Witkovsky, Paul

2002-07-22

We used specific antibodies against two postsynaptic density proteins, GRIP (glutamate receptor interacting protein) and ABP (AMPA receptor-binding protein), to study their distribution in the rat retina. In the central nervous system, it has been shown that both proteins bind strongly to the AMPA glutamate receptor (GluR) 2/3 subunits, but not other GluRs, through a set of three PDZ domains. Western blots detected a single GRIP protein that was virtually identical in retina and brain, whereas retinal ABP corresponded to only one of three ABP peptides found in brain. The retinal distributions of GluR2/3, GRIP, and ABP immunoreactivity (IR) were similar but not identical. GluR2/3 immunoreactivity (IR) was abundant in both plexiform layers and in large perikarya. ABP IR was concentrated in large perikarya but was sparse in the plexiform layers, whereas GRIP IR was relatively more abundant in the plexiform layers than in perikarya. Immunolabel for these three antibodies consisted of puncta < or = 0.2 microm in diameter. The cellular localization of GRIP and ABP IR was examined by double labeling subclasses of retinal neuron with characteristic marker proteins, e.g., calbindin. GRIP, ABP, and GluR2/3 IR were detected in horizontal cells, dopaminergic and glycinergic AII amacrine cells and large ganglion cells. Immunolabel was absent in rod bipolar and weak or absent in cholinergic amacrine cells. By using the tyramide method of signal amplification, a colocalization of GluR2/3 was found with either GRIP or ABP in horizontal cell terminals, and perikarya of amacrine and ganglion cells. Our results show that ABP and GRIP colocalize with GluR2/3 in particular subsets of retinal neuron, as was previously established for certain neurons in the brain. Copyright 2002 Wiley-Liss, Inc.

Environmental Enrichment Mitigates Deficits after Repetitive Mild Traumatic Brain Injury.

PubMed

Liu, Xixia; Qiu, Jianhua; Alcon, Sasha; Hashim, Jumana; Meehan, William P; Mannix, Rebekah

2017-08-15

Although environmental enrichment has been shown to improve functional and histologic outcomes in pre-clinical moderate-to-severe traumatic brain injury (TBI), there are a paucity of pre-clinical data regarding enrichment strategies in the setting of repetitive mild traumatic brain injury (rmTBI). Given the vast numbers of athletes and those in the military who sustain rmTBI, the mounting evidence of the long-term and progressive sequelae of rmTBI, and the lack of targeted therapies to mitigate these sequelae, successful enrichment interventions in rmTBI could have large public health significance. Here, we evaluated enrichment strategies in an established pre-clinical rmTBI model. Seventy-one male C57BL/6 mice were randomized to two different housing conditions, environmental enrichment (EE) or normal condition (NC), then subjected to rmTBI injury (seven injuries in 9 days) or sham injury (anesthesia only). Functional outcomes in all four groups (NC-TBI, EE-TBI, NC-sham, and EE-sham) were assessed by motor, exploratory/anxiety, and mnemonic behavioral tests. At the synaptic level, N-methyl d-aspartate receptor (NMDAR) subunit expression of phosphorylated glutamate receptor 1 (GluR1), phosphorylated Ca 2+ /calmodulin-dependent protein kinase II (CaMKII), and calpain were evaluated by western blot. Compared to injured NC-TBI mice, EE-TBI mice had improved memory and decreased anxiety and exploratory activity post-injury. Treatment with enrichment also corresponded to normal NMDAR subunit expression, decreased GluR1 phosphorylation, decreased phosphorylated CaMKII, and normal calpain expression post-rmTBI. These data suggest that enrichment strategies may improve functional outcomes and mitigate synaptic changes post-rmTBI. Given that enrichment strategies are feasible in the clinical setting, particularly for athletes and soldiers for whom the risk of repetitive injury is greatest, these data suggest that clinical trials may be warranted.

Altered expression of genes involved in GABAergic transmission and neuromodulation of granule cell activity in the cerebellum of schizophrenia patients.

PubMed

Bullock, W Michael; Cardon, Karen; Bustillo, Juan; Roberts, Rosalinda C; Perrone-Bizzozero, Nora I

2008-12-01

Deficits in gamma-aminobutyric acid (GABA) signaling have been described in the prefrontal cortex, limbic system, and cerebellum in individuals with schizophrenia. The purpose of the present study was to further investigate cerebellar gene expression alterations as they relate to decreases in GABAergic transmission by examining the expression of GABAergic markers, N-methyl-d-aspartic-acid (NMDA) receptor subunits, and cerebellum neuromodulators in individuals with schizophrenia. Subjects were postmortem men with a diagnosis of schizophrenia (N=13) and a postmortem interval-matched non-psychiatric male comparison group (N=13). The authors utilized real-time-quantitative polymerase chain reaction (PCR) to measure mRNA levels of the following GABAergic markers: glutamic acid decarboxylase (GAD) 65 and 67; GABA plasma membrane transporter-1 (GAT-1); GABA type A (GABA(A)) receptor subunits alpha(6), beta(3), and delta; and parvalbumin. In addition, real-time-quantitative PCR was utilized to assess mRNA levels of the NMDA receptor (NR) subunits NR1, NR2-A, NR2-B, NR2-C, and NR2-D as well as the cerebellar neuromodulators glutamate receptor (GluR)-6, kainate-preferring glutamate receptor subunit-2 (KA2), metabotropic glutamate receptor (mGluR)-2 and mGluR3, and neuronal nitric oxide synthase. Measurements for mRNA levels were determined using lateral cerebellar hemisphere tissue from both schizophrenia and comparison subjects. Schizophrenia subjects showed significant decreases in mRNA levels of GAD(67), GAD(65), GAT-1, mGluR2, and neuronal nitric oxide synthase. Increases in GABA(A)-alpha(6 )and GABA(A)-delta as well as GluR6 and KA2 were also observed. Medication effects on the expression of the same genes were examined in rats treated with either haloperidol (Sprague-Dawley rats [N=16]) or clozapine (Long-Evans rats [N=20]). Both haloperidol and clozapine increased the levels of GAD(67) in the cerebellum and altered the expression of other cerebellar mRNAs. These findings suggest that GABA transmission is decreased in the cerebellar cortices in individuals with schizophrenia and additional gene expression changes may reflect an attempt to increase GABA neurotransmission at the cerebellar glomerulus.

Activation of PPARγ Ameliorates Spatial Cognitive Deficits through Restoring Expression of AMPA Receptors in Seipin Knock-Out Mice.

PubMed

Zhou, Libin; Chen, Tingting; Li, Guoxi; Wu, Chaoming; Wang, Conghui; Li, Lin; Sha, Sha; Chen, Lei; Liu, George; Chen, Ling

2016-01-27

A characteristic phenotype of congenital generalized lipodystrophy 2 (CGL2) that is caused by loss-of-function of seipin gene is mental retardation. Here, we show that seipin deficiency in hippocampal CA1 pyramidal cells caused the reduction of peroxisome proliferator-activated receptor gamma (PPARγ). Twelve-week-old systemic seipin knock-out mice and neuronal seipin knock-out (seipin-nKO) mice, but not adipose seipin knock-out mice, exhibited spatial cognitive deficits as assessed by the Morris water maze and Y-maze, which were ameliorated by the treatment with the PPARγ agonist rosiglitazone (rosi). In addition, seipin-nKO mice showed the synaptic dysfunction and the impairment of NMDA receptor-dependent LTP in hippocampal CA1 regions. The density of AMPA-induced current (IAMPA) in CA1 pyramidal cells and GluR1/GluR2 expression were significantly reduced in seipin-nKO mice, whereas the NMDA-induced current (INMDA) and NR1/NR2 expression were not altered. Rosi treatment in seipin-nKO mice could correct the decrease in expression and activity of AMPA receptor (AMPAR) and was accompanied by recovered synaptic function and LTP induction. Furthermore, hippocampal ERK2 and CREB phosphorylation in seipin-nKO mice were reduced and this could be rescued by rosi treatment. Rosi treatment in seipin-nKO mice elevated BDNF concentration. The MEK inhibitor U0126 blocked rosi-restored AMPAR expression and LTP induction in seipin-nKO mice, but the Trk family inhibitor K252a did not. These findings indicate that the neuronal seipin deficiency selectively suppresses AMPAR expression through reducing ERK-CREB activities, leading to the impairment of LTP and spatial memory, which can be rescued by PPARγ activation. Congenital generalized lipodystrophy 2 (CGL2), caused by loss-of-function mutation of seipin gene, is characterized by mental retardation. By the generation of systemic or neuronal seipin knock-out mice, the present study provides in vivo evidence that neuronal seipin deficiency causes deficits in spatial memory and hippocampal LTP induction. Neuronal seipin deficiency selectively suppresses AMPA receptor expression, ERK-CREB phosphorylation with the decline of PPARγ. The PPARγ agonist rosiglitazone can ameliorate spatial cognitive deficits and rescue the LTP induction in seipin knock-out mice by restoring AMPA receptor expression and ERK-CREB activities. Copyright © 2016 the authors 0270-6474/16/361242-12$15.00/0.

Regulation of cellular plasticity and resilience by mood stabilizers: the role of AMPA receptor trafficking

PubMed Central

Du, Jing; Quiroz, Jorge A.; Gray, Neil A.; Szabo, Steve T.; Zarate Jr, Carlos A.; Manji, Husseini K.

2004-01-01

There is increasing evidence from a variety of sources that severe mood disorders are associated with regional reductions in brain volume, as well as reductions in the number, size, and density of glia and neurons in discrete brain areas. Although the precise pathophysiology underlying these morphometric changes remains to be fully elucidated, the data suggest that severe mood disorders are associated with impairments of structural plasticity and cellular resilience. In this context, it is noteworthy that a growing body of data suggests that the glutamaiergic system (which is known to play a major role in neuronal plasticity and cellular resilience) may be involved in the pathophysiology and treatment of mood disorders. Glutamate α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) GluR1 receptor trafficking plays a critical role in regulating various forms of neural plasticity. It is thus noteworthy that recent studies have shown that structurally dissimilar mood stabilizers lithium and valproate regulate GluR1 receptor subunit trafficking and localization at synapses. These studies suggest that regulation of glutamatergically mediated synaptic plasticity may play a role in the treatment of mood disorders, and raises the possibility that agents more directly affecting synaptic GluR1 represent novel therapies for these devastating illnesses. PMID:22034247

TPEN, a Specific Zn2+ Chelator, Inhibits Sodium Dithionite and Glucose Deprivation (SDGD)-Induced Neuronal Death by Modulating Apoptosis, Glutamate Signaling, and Voltage-Gated K+ and Na+ Channels.

PubMed

Zhang, Feng; Ma, Xue-Ling; Wang, Yu-Xiang; He, Cong-Cong; Tian, Kun; Wang, Hong-Gang; An, Di; Heng, Bin; Xie, Lai-Hua; Liu, Yan-Qiang

2017-03-01

Hypoxia-ischemia-induced neuronal death is an important pathophysiological process that accompanies ischemic stroke and represents a major challenge in preventing ischemic stroke. To elucidate factors related to and a potential preventative mechanism of hypoxia-ischemia-induced neuronal death, primary neurons were exposed to sodium dithionite and glucose deprivation (SDGD) to mimic hypoxic-ischemic conditions. The effects of N,N,N',N'-tetrakis (2-pyridylmethyl) ethylenediamine (TPEN), a specific Zn 2+ -chelating agent, on SDGD-induced neuronal death, glutamate signaling (including the free glutamate concentration and expression of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor (GluR2) and N-methyl-D-aspartate (NMDA) receptor subunits (NR2B), and voltage-dependent K + and Na + channel currents were also investigated. Our results demonstrated that TPEN significantly suppressed increases in cell death, apoptosis, neuronal glutamate release into the culture medium, NR2B protein expression, and I K as well as decreased GluR2 protein expression and Na + channel activity in primary cultured neurons exposed to SDGD. These results suggest that TPEN could inhibit SDGD-induced neuronal death by modulating apoptosis, glutamate signaling (via ligand-gated channels such as AMPA and NMDA receptors), and voltage-gated K + and Na + channels in neurons. Hence, Zn 2+ chelation might be a promising approach for counteracting the neuronal loss caused by transient global ischemia. Moreover, TPEN could represent a potential cell-targeted therapy.

Chronic SO2 inhalation above environmental standard impairs neuronal behavior and represses glutamate receptor gene expression and memory-related kinase activation via neuroinflammation in rats.

PubMed

Yao, Gaoyi; Yue, Huifeng; Yun, Yang; Sang, Nan

2015-02-01

Sulfur dioxide (SO2), as a ubiquitous air pollutant implicated in the genesis of pulmonary disease, is now being considered to be involved in neurotoxicity and increased risk for hospitalization of brain disorders. However, comparatively little is known about the impact of chronically SO2 inhalation on neuronal function. In the present study, by exposing male Wistar rats to SO2 at 3.50 and 7.00 mg/m(3) (approximately 1225 and 2450 ppb, 4.08-8.16 (24h average concentration) times higher than the EPA standard for environmental air concentrations) or filtered air for 90 days, we investigated the impact of chronic SO2 inhalation on performance in Morris water maze, and probed the accompanying neurobiological effects, including activity-regulated cytoskeletal associated gene (Arc) and glutamate receptor gene expression, memory-related kinase level and inflammatory cytokine release in the hippocampus. Here, we found that SO2 exposure reduced the number of target zone crossings and time spent in the target quadrant during the test session in the spatial memory retention of the Morris water maze. Following the neuro-functional abnormality, we detected that SO2 inhalation reduced the expression of Arc and glutamate receptor subunits (GluR1, GluR2, NR1, NR2A, and NR2B) with a concentration-dependent property in comparison to controls. Additionally, the expression of memory kinases was attenuated statistically in the animals receiving the higher concentration, including protein kinase A (PKA), protein kinase C (PKC) and calcium/calmodulin-dependent protein kinaseIIα (CaMKIIα). And the inflammatory cytokine release was increased in rats exposed to SO2. Taken together, our results suggest that long-term exposure to SO2 air pollution at concentrations above the environmental standard in rats impaired spatial learning and memory, and indicate a close link between the neurobiological changes highlighted in the brain and the behavioral disturbances. Copyright © 2014 Elsevier Inc. All rights reserved.

Blast waves from detonated military explosive reduce GluR1 and synaptophysin levels in hippocampal slice cultures✩

PubMed Central

Smith, Marquitta; Piehler, Thuvan; Benjamin, Richard; Farizatto, Karen L.; Pait, Morgan C.; Almeida, Michael F.; Ghukasyan, Vladimir V.; Bahr, Ben A.

2017-01-01

Explosives create shockwaves that cause blast-induced neurotrauma, one of the most common types of traumatic brain injury (TBI) linked to military service. Blast-induced TBIs are often associated with reduced cognitive and behavioral functions due to a variety of factors. To study the direct effects of military explosive blasts on brain tissue, we removed systemic factors by utilizing rat hippocampal slice cultures. The long-term slice cultures were briefly sealed air-tight in serum-free medium, lowered into a 37 °C water-filled tank, and small 1.7-gram assemblies of cyclotrimethylene trinitramine (RDX) were detonated 15 cm outside the tank, creating a distinct shockwave recorded at the culture plate position. Compared to control mock-treated groups of slices that received equal submerge time, 1–3 blast impacts caused a dose-dependent reduction in the AMPA receptor subunit GluR1. While only a small reduction was found in hippocampal slices exposed to a single RDX blast and harvested 1–2 days later, slices that received two consecutive RDX blasts 4 min apart exhibited a 26–40% reduction in GluR1, and the receptor subunit was further reduced by 64–72% after three consecutive blasts. Such loss correlated with increased levels of HDAC2, a histone deacetylase implicated in stress-induced reduction of glutamatergic transmission. No evidence of synaptic marker recovery was found at 72 h post-blast. The presynaptic marker synaptophysin was found to have similar susceptibility as GluR1 to the multiple explosive detonations. In contrast to the synaptic protein reductions, actin levels were unchanged, spectrin breakdown was not detected, and Fluoro-Jade B staining found no indication of degenerating neurons in slices exposed to three RDX blasts, suggesting that small, sub-lethal explosives are capable of producing selective alterations to synaptic integrity. Together, these results indicate that blast waves from military explosive cause signs of synaptic compromise without producing severe neurodegeneration, perhaps explaining the cognitive and behavioral changes in those blast-induced TBI sufferers that have no detectable neuropathology. PMID:27720798

tRNAGlu increases the affinity of glutamyl-tRNA synthetase for its inhibitor glutamyl-sulfamoyl-adenosine, an analogue of the aminoacylation reaction intermediate glutamyl-AMP: mechanistic and evolutionary implications.

PubMed

Blais, Sébastien P; Kornblatt, Jack A; Barbeau, Xavier; Bonnaure, Guillaume; Lagüe, Patrick; Chênevert, Robert; Lapointe, Jacques

2015-01-01

For tRNA-dependent protein biosynthesis, amino acids are first activated by aminoacyl-tRNA synthetases (aaRSs) yielding the reaction intermediates aminoacyl-AMP (aa-AMP). Stable analogues of aa-AMP, such as aminoacyl-sulfamoyl-adenosines, inhibit their cognate aaRSs. Glutamyl-sulfamoyl-adenosine (Glu-AMS) is the best known inhibitor of Escherichia coli glutamyl-tRNA synthetase (GluRS). Thermodynamic parameters of the interactions between Glu-AMS and E. coli GluRS were measured in the presence and in the absence of tRNA by isothermal titration microcalorimetry. A significant entropic contribution for the interactions between Glu-AMS and GluRS in the absence of tRNA or in the presence of the cognate tRNAGlu or of the non-cognate tRNAPhe is indicated by the negative values of -TΔSb, and by the negative value of ΔCp. On the other hand, the large negative enthalpy is the dominant contribution to ΔGb in the absence of tRNA. The affinity of GluRS for Glu-AMS is not altered in the presence of the non-cognate tRNAPhe, but the dissociation constant Kd is decreased 50-fold in the presence of tRNAGlu; this result is consistent with molecular dynamics results indicating the presence of an H-bond between Glu-AMS and the 3'-OH oxygen of the 3'-terminal ribose of tRNAGlu in the Glu-AMS•GluRS•tRNAGlu complex. Glu-AMS being a very close structural analogue of Glu-AMP, its weak binding to free GluRS suggests that the unstable Glu-AMP reaction intermediate binds weakly to GluRS; these results could explain why all the known GluRSs evolved to activate glutamate only in the presence of tRNAGlu, the coupling of glutamate activation to its transfer to tRNA preventing unproductive cleavage of ATP.

tRNAGlu Increases the Affinity of Glutamyl-tRNA Synthetase for Its Inhibitor Glutamyl-Sulfamoyl-Adenosine, an Analogue of the Aminoacylation Reaction Intermediate Glutamyl-AMP: Mechanistic and Evolutionary Implications

PubMed Central

Blais, Sébastien P.; Kornblatt, Jack A.; Barbeau, Xavier; Bonnaure, Guillaume; Lagüe, Patrick; Chênevert, Robert; Lapointe, Jacques

2015-01-01

For tRNA-dependent protein biosynthesis, amino acids are first activated by aminoacyl-tRNA synthetases (aaRSs) yielding the reaction intermediates aminoacyl-AMP (aa-AMP). Stable analogues of aa-AMP, such as aminoacyl-sulfamoyl-adenosines, inhibit their cognate aaRSs. Glutamyl-sulfamoyl-adenosine (Glu-AMS) is the best known inhibitor of Escherichia coli glutamyl-tRNA synthetase (GluRS). Thermodynamic parameters of the interactions between Glu-AMS and E. coli GluRS were measured in the presence and in the absence of tRNA by isothermal titration microcalorimetry. A significant entropic contribution for the interactions between Glu-AMS and GluRS in the absence of tRNA or in the presence of the cognate tRNAGlu or of the non-cognate tRNAPhe is indicated by the negative values of –TΔSb, and by the negative value of ΔCp. On the other hand, the large negative enthalpy is the dominant contribution to ΔGb in the absence of tRNA. The affinity of GluRS for Glu-AMS is not altered in the presence of the non-cognate tRNAPhe, but the dissociation constant K d is decreased 50-fold in the presence of tRNAGlu; this result is consistent with molecular dynamics results indicating the presence of an H-bond between Glu-AMS and the 3’-OH oxygen of the 3’-terminal ribose of tRNAGlu in the Glu-AMS•GluRS•tRNAGlu complex. Glu-AMS being a very close structural analogue of Glu-AMP, its weak binding to free GluRS suggests that the unstable Glu-AMP reaction intermediate binds weakly to GluRS; these results could explain why all the known GluRSs evolved to activate glutamate only in the presence of tRNAGlu, the coupling of glutamate activation to its transfer to tRNA preventing unproductive cleavage of ATP. PMID:25860020

Stable liquid glucagon formulations for rescue treatment and bi-hormonal closed-loop pancreas

PubMed Central

Jackson, Melanie A.; Caputo, Nicholas; Castle, Jessica R.; David, Larry L.; Roberts, Charles T.; Ward, W. Kenneth

2014-01-01

Small doses of glucagon given subcutaneously in the research setting by an automated system prevent most cases of hypoglycemia in persons with diabetes. However, glucagon is very unstable and cannot be kept in a portable pump. Glucagon rapidly forms amyloid fibrils, even within the first day after reconstitution. Aggregation eventually leads to insoluble gels, which occlude pump catheters. Fibrillation occurs rapidly at acid pH, but is absent or minimal at alkaline pH values of ~10. Glucagon also degrades over time; this problem is greater at alkaline pH. Several studies suggest that its primary degradative pathway is deamidation, which results in a conversion of asparagine to aspartic acid. A cell-based assay for glucagon bioactivity that assesses glucagon receptor (GluR) activation can screen promising glucagon formulations. However, mammalian hepatocytes are usually problematic as they can lose GluR expression during culture. Assays for cyclic AMP (cAMP) or its downstream effector, protein kinase A (PKA), in engineered cell systems, are more reliable and suitable for inexpensive, high-throughput assessment of bioactivity. PMID:22972416

Role of ionotropic glutamate receptors in LTP in rat hippocampal CA1 oriens-lacunosum moleculare interneurons

PubMed Central

Oren, Iris; Nissen, Wiebke; Kullmann, Dimitri M.; Somogyi, Peter; Lamsa, Karri P.

2009-01-01

Some interneurons of the hippocampus exhibit NMDA receptor-independent long-term potentiation (LTP) that is induced by presynaptic glutamate release when the postsynaptic membrane potential is hyperpolarized. This ‘anti-Hebbian’ form of LTP is prevented by postsynaptic depolarization or by blocking AMPA and kainate receptors. Although both AMPA and kainate receptors are expressed in hippocampal interneurons, their relative roles in anti-Hebbian LTP are not known. Because interneuron diversity potentially conceals simple rules underlying different forms of plasticity, we focus on glutamatergic synapses onto a subset of interneurons with dendrites in stratum oriens and a main ascending axon that projects to stratum lacunosum-moleculare, the O-LM cells. We show that anti-Hebbian LTP in O-LM interneurons has consistent induction and expression properties, and is prevented by selective inhibition of AMPA receptors. The majority of the ionotropic glutamatergic synaptic current in these cells is mediated by inwardly rectifying Ca2+ -permeable AMPA receptors. Although GluR5-containing kainate receptors contribute to synaptic currents at high stimulus frequency, they are not required for LTP induction. Glutamatergic synapses on O-LM cells thus behave in a homogeneous manner, and exhibit LTP dependent on Ca2+-permeable AMPA receptors. PMID:19176803

Disruption of the endocytic protein HIP1 results in neurological deficits and decreased AMPA receptor trafficking.

PubMed

Metzler, Martina; Li, Bo; Gan, Lu; Georgiou, John; Gutekunst, Claire-Anne; Wang, Yushan; Torre, Enrique; Devon, Rebecca S; Oh, Rosemary; Legendre-Guillemin, Valerie; Rich, Mark; Alvarez, Christine; Gertsenstein, Marina; McPherson, Peter S; Nagy, Andras; Wang, Yu Tian; Roder, John C; Raymond, Lynn A; Hayden, Michael R

2003-07-01

Huntingtin interacting protein 1 (HIP1) is a recently identified component of clathrin-coated vesicles that plays a role in clathrin-mediated endocytosis. To explore the normal function of HIP1 in vivo, we created mice with targeted mutation in the HIP1 gene (HIP1(-/-)). HIP1(-/-) mice develop a neurological phenotype by 3 months of age manifest with a failure to thrive, tremor and a gait ataxia secondary to a rigid thoracolumbar kyphosis accompanied by decreased assembly of endocytic protein complexes on liposomal membranes. In primary hippocampal neurons, HIP1 colocalizes with GluR1-containing AMPA receptors and becomes concentrated in cell bodies following AMPA stimulation. Moreover, a profound dose-dependent defect in clathrin-mediated internalization of GluR1-containing AMPA receptors was observed in neurons from HIP1(-/-) mice. Together, these data provide strong evidence that HIP1 regulates AMPA receptor trafficking in the central nervous system through its function in clathrin-mediated endocytosis.

Characterization and reversal of synaptic defects in the amygdala in a mouse model of fragile X syndrome.

PubMed

Suvrathan, Aparna; Hoeffer, Charles A; Wong, Helen; Klann, Eric; Chattarji, Sumantra

2010-06-22

Fragile X syndrome (FXS), a common inherited form of mental impairment and autism, is caused by transcriptional silencing of the fragile X mental retardation 1 (FMR1) gene. Earlier studies have identified a role for aberrant synaptic plasticity mediated by the metabotropic glutamate receptors (mGluRs) in FXS. However, many of these observations are derived primarily from studies in the hippocampus. The strong emotional symptoms of FXS, on the other hand, are likely to involve the amygdala. Unfortunately, little is known about how exactly FXS affects synaptic function in the amygdala. Here, using whole-cell recordings in brain slices from adult Fmr1 knockout mice, we find mGluR-dependent long-term potentiation to be impaired at thalamic inputs to principal neurons in the lateral amygdala. Consistent with this long-term potentiation deficit, surface expression of the AMPA receptor subunit, GluR1, is reduced in the lateral amygdala of knockout mice. In addition to these postsynaptic deficits, lower presynaptic release was manifested by a decrease in the frequency of spontaneous miniature excitatory postsynaptic currents (mEPSCs), increased paired-pulse ratio, and slower use-dependent block of NMDA receptor currents. Strikingly, pharmacological inactivation of mGluR5 with 2-methyl-6-phenylethynyl-pyridine (MPEP) fails to rescue either the deficit in long-term potentiation or surface GluR1. However, the same acute MPEP treatment reverses the decrease in mEPSC frequency, a finding of potential therapeutic relevance. Therefore, our results suggest that synaptic defects in the amygdala of knockout mice are still amenable to pharmacological interventions against mGluR5, albeit in a manner not envisioned in the original hippocampal framework.

The type II cGMP dependent protein kinase regulates GluA1 levels at the plasma membrane of developing cerebellar granule cells

PubMed Central

Incontro, Salvatore; Ciruela, Francisco; Ziff, Edward; Hofmann, Franz; Sánchez-Prieto, José; Torres, Magdalena

2014-01-01

Trafficking of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) is regulated by specific interactions with other proteins and by post-translational mechanisms, such as phosphorylation. We have found that the type II cGMP-dependent protein kinase (cGKII) phosphorylates GluA1 (formerly GluR1) at S845, augmenting the surface expression of AMPARs at both synaptic and extrasynaptic sites. Activation of cGKII by 8-Br-cGMP enhances the surface expression of GluA1, whereas its inhibition or suppression effectively diminished the expression of this protein at the cell surface. In granule cells, NMDA receptor activation (NMDAR) stimulates nitric oxide and cGMP production, which in turn activates cGKII and induces the phosphorylation of GluA1, promoting its accumulation in the plasma membrane. GluA1 is mainly incorporated into calcium permeable AMPARs as exposure to 8-Br-cGMP or NMDA activation enhanced AMPA-elicited calcium responses that are sensitive to NASPM inhibition. We summarize evidence for an increase of calcium permeable AMPA receptors downstream of NMDA receptor activation that might be relevant for granule cell development and plasticity. PMID:23545413

Membrane Localization is Critical for Activation of the PICK1 BAR Domain

PubMed Central

Madsen, Kenneth L.; Eriksen, Jacob; Milan-Lobo, Laura; Han, Daniel S.; Niv, Masha Y.; Ammendrup-Johnsen, Ina; Henriksen, Ulla; Bhatia, Vikram K.; Stamou, Dimitrios; Sitte, Harald H.; McMahon, Harvey T.; Weinstein, Harel; Gether, Ulrik

2013-01-01

The PSD-95/Discs-large/ZO-1 homology (PDZ) domain protein, protein interacting with C kinase 1 (PICK1) contains a C-terminal Bin/amphiphysin/Rvs (BAR) domain mediating recognition of curved membranes; however, the molecular mechanisms controlling the activity of this domain are poorly understood. In agreement with negative regulation of the BAR domain by the N-terminal PDZ domain, PICK1 distributed evenly in the cytoplasm, whereas truncation of the PDZ domain caused BAR domain-dependent redistribution to clusters colocalizing with markers of recycling endosomal compartments. A similar clustering was observed both upon truncation of a short putative α-helical segment in the linker between the PDZ and the BAR domains and upon coexpression of PICK1 with a transmembrane PDZ ligand, including the alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor GluR2 subunit, the GluR2 C-terminus transferred to the single transmembrane protein Tac or the dopamine transporter C-terminus transferred to Tac. In contrast, transfer of the GluR2 C-terminus to cyan fluorescent protein, a cytosolic protein, did not elicit BAR domain-dependent clustering. Instead, localizing PICK1 to the membrane by introducing an N-terminal myristoylation site produced BAR domain-dependent, but ligand-independent, PICK1 clustering. The data support that in the absence of PDZ ligand, the PICK1 BAR domain is inhibited through a PDZ domain-dependent and linker-dependent mechanism. Moreover, they suggest that unmasking of the BAR domain’s membrane-binding capacity is not a consequence of ligand binding to the PDZ domain per se but results from, and coincides with, recruitment of PICK1 to a membrane compartment. PMID:18466293

Roles of testosterone and amygdaloid LTP induction in determining sex differences in fear memory magnitude.

PubMed

Chen, Li-Shen; Tzeng, Wen-Yu; Chuang, Jia-Ying; Cherng, Chianfang G; Gean, Po-Wu; Yu, Lung

2014-08-01

Women are thought to form fear memory more robust than men do and testosterone is suspected to play a role in determining such a sex difference. Mouse cued fear freezing was used to study the sex-related susceptibility and the role of testosterone in fear memory in humans. A 75-dB tone was found to provoke weak freezing, while 0.15-mA and 0.20-mA footshock caused strong freezing responses. No sex differences were noticed in the tone- or footshock-induced (naïve fear) freezing. Following the conditionings, female mice exhibited greater tone (cued fear)-induced freezing than did male mice. Nonetheless, female mice demonstrated indistinctive cued fear freezing across the estrous phases and ovariectomy did not affect such freezing in female mice. Orchidectomy enhanced the cued fear freezing in male mice. Systemic testosterone administrations and an intra-lateral nucleus of amygdala (LA) testosterone infusion diminished the cued fear freezing in orchidectomized male mice, while pretreatment with flutamide (Flu) eradicated these effects. Long-term potentiation (LTP) magnitude in LA has been known to correlate with the strength of the cued fear conditioning. We found that LA LTP magnitude was indeed greater in female than male mice. Orchidectomy enhanced LTP magnitude in males' LA, while ovariectomy decreased LTP magnitude in females' LA. Testosterone decreased LTP magnitude in orchidectomized males' LA and estradiol enhanced LTP magnitude in ovariectomized females' LA. Finally, male mice had lower LA GluR1 expression than female mice and orchidectomy enhanced the GluR1 expression in male mice. These findings, taken together, suggest that testosterone plays a critical role in rendering the sex differences in the cued fear freezing and LA LTP. Testosterone is negatively associated with LA LTP and the cued fear memory in male mice. However, ovarian hormones and LA LTP are loosely associated with the cued fear memory in female mice. Copyright © 2014 Elsevier Inc. All rights reserved.

Somatic and neuritic spines on tyrosine hydroxylase–immunopositive cells of rat retina

PubMed Central

Fasoli, Anna; Dang, James; Johnson, Jeffrey S.; Gouw, Aaron H.; Iseppe, Alex Fogli; Ishida, Andrew T.

2018-01-01

Dopamine- and tyrosine hydroxylase–immunopositive cells (TH cells) modulate visually driven signals as they flow through retinal photoreceptor, bipolar, and ganglion cells. Previous studies suggested that TH cells release dopamine from varicose axons arborizing in the inner and outer plexiform layers after glutamatergic synapses depolarize TH cell dendrites in the inner plexiform layer and these depolarizations propagate to the varicosities. Although it has been proposed that these excitatory synapses are formed onto appendages resembling dendritic spines, spines have not been found on TH cells of most species examined to date or on TH cell somata that release dopamine when exposed to glutamate receptor agonists. By use of protocols that preserve proximal retinal neuron morphology, we have examined the shape, distribution, and synapse-related immunoreactivity of adult rat TH cells. We report here that TH cell somata, tapering and varicose inner plexiform layer neurites, and varicose outer plexiform layer neurites all bear spines, that some of these spines are immunopositive for glutamate receptor and postsynaptic density proteins (viz., GluR1, GluR4, NR1, PSD-95, and PSD-93), that TH cell somata and tapering neurites are also immunopositive for a γ-aminobutyric acid (GABA) receptor subunit (GABAARα1), and that a synaptic ribbon-specific protein (RIBEYE) is found adjacent to some colocalizations of GluR1 and TH in the inner plexiform layer. These results identify previously undescribed sites at which glutamatergic and GABAergic inputs may stimulate and inhibit dopamine release, especially at somata and along varicose neurites that emerge from these somata and arborize in various levels of the retina. PMID:28035673

Disruption of the endocytic protein HIP1 results in neurological deficits and decreased AMPA receptor trafficking

PubMed Central

Metzler, Martina; Li, Bo; Gan, Lu; Georgiou, John; Gutekunst, Claire-Anne; Wang, Yushan; Torre, Enrique; Devon, Rebecca S.; Oh, Rosemary; Legendre-Guillemin, Valerie; Rich, Mark; Alvarez, Christine; Gertsenstein, Marina; McPherson, Peter S.; Nagy, Andras; Wang, Yu Tian; Roder, John C.; Raymond, Lynn A.; Hayden, Michael R.

2003-01-01

Huntingtin interacting protein 1 (HIP1) is a recently identified component of clathrin-coated vesicles that plays a role in clathrin-mediated endocytosis. To explore the normal function of HIP1 in vivo, we created mice with targeted mutation in the HIP1 gene (HIP1–/–). HIP1–/– mice develop a neurological phenotype by 3 months of age manifest with a failure to thrive, tremor and a gait ataxia secondary to a rigid thoracolumbar kyphosis accompanied by decreased assembly of endocytic protein complexes on liposomal membranes. In primary hippocampal neurons, HIP1 colocalizes with GluR1-containing AMPA receptors and becomes concentrated in cell bodies following AMPA stimulation. Moreover, a profound dose-dependent defect in clathrin-mediated internalization of GluR1-containing AMPA receptors was observed in neurons from HIP1–/– mice. Together, these data provide strong evidence that HIP1 regulates AMPA receptor trafficking in the central nervous system through its function in clathrin-mediated endocytosis. PMID:12839988

Protective effect of the daming capsule on impaired baroreflexes in STZ-induced diabetic rats with hyperlipoidemia.

PubMed

Ai, Jing; Wang, Li-Hong; Zhang, Rong; Qiao, Guo-Fen; Wang, Ning; Sun, Li-Hua; Lu, Guan-Yi; Sun, Chao; Yang, Bao-Feng

2010-12-22

The Daming capsule (DMC) is a traditional Chinese medicine used to treat hyperlipoidemia. Both clinic trials and studies on animal models have demonstrated that DMC is beneficial against diabetic symptoms. Impairment of the baroreflex can cause life-threatening arrhythmias and sudden cardiac death in patients with diabetes mellitus (DM). This study was designed to elucidate the effects of DMC on baroreflexes in streptozocin (STZ)-induced diabetic rats with hyperlipoidemia. Wistar rats were randomly divided into three groups: untreated controls, rats pretreated STZ and high lipids (a diabetes model or DM rats), and DM rats treated with DMC. The baroreflex sensitivity was examined during intravenous injection of phenylephrine (PE) or sodium nitroprusside (SNP) and quantified by the change in heart rate over the change in mean arterial blood pressure (ΔHR/ΔMABP). Morphological remodeling of baroreceptors was analyzed by transmission electron microscopy (TEM). The mRNA levels and expression of GluR2 and a GABAA receptor subunit were measured by quantitative RT-PCR and Western blotting. Compared to untreated DM rats, DMC significantly elevated the ratio of ΔHR/ΔMABP by enhancing the compensatory reduction in HR (-ΔHR) in response to PE-induced hypertension (+ΔMABP) (P < 0.05). In the presence of SNP, DMC increased the ΔMABP (P < 0.05). In addition, DMC markedly shortened the duration of blood pressure changes elicited by PE or SNP in DM rats compared to the untreated DM group (P < 0.05). Electron microscopy revealed disrupted myelin sheaths, swollen ER, and lysed mitochondria in the nucleus ambiguous (NAm) DM rats. These signs of neuropathology were largely prevented by treatment with DMC for 30 days. Treatment with DMC elevated both mRNA and protein level of GluR2 in the NAm of DM rats, but had no effect on GABAA receptor expression. The Daming capsule partially reversed the parasympathetic baroreflex impairment observed in STZ-induced diabetic rats with hyperlipoidemia. Treatment with DMC also prevented the degeneration of neurons and myelinated axons in the brain stem NAm and reversed the down-regulation of GluR2 mRNA. Rescue of NAm function may contribute to the medicinal properties of DMC in diabetic rats.

An essential role for UBE2A/HR6A in learning and memory and mGLUR-dependent long-term depression.

PubMed

Bruinsma, Caroline F; Savelberg, Sanne M C; Kool, Martijn J; Jolfaei, Mehrnoush Aghadavoud; Van Woerden, Geeske M; Baarends, Willy M; Elgersma, Ype

2016-01-01

UBE2A deficiency syndrome (also known as X-linked intellectual disability type Nascimento) is an intellectual disability syndrome characterized by prominent dysmorphic features, impaired speech and often epilepsy. The syndrome is caused by Xq24 deletions encompassing the UBE2A (HR6A) gene or by intragenic UBE2A mutations. UBE2A encodes an E2 ubiquitin-conjugating enzyme involved in DNA repair and female fertility. A recent study in Drosophila showed that dUBE2A binds to the E3 ligase Parkin, which is required for mitochondrial function and responsible for juvenile Parkinson's disease. In addition, these studies showed impairments in synaptic transmission in dUBE2A mutant flies. However, a causal role of UBE2A in of cognitive deficits has not yet been established. Here, we show that Ube2a knockout mice have a major deficit in spatial learning tasks, whereas other tested phenotypes, including epilepsy and motor coordination, were normal. Results from electrophysiological measurements in the hippocampus showed no deficits in synaptic transmission nor in the ability to induce long-term synaptic potentiation. However, a small but significant deficit was observed in mGLUR-dependent long-term depression, a pathway previously implied in several other mouse models for neurodevelopmental disorders. Our results indicate a causal role of UBE2A in learning and mGLUR-dependent long-term depression, and further indicate that the Ube2a knockout mouse is a good model to study the molecular mechanisms underlying UBE2A deficiency syndrome. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Enriched environment influences hormonal status and hippocampal brain derived neurotrophic factor in a sex dependent manner.

PubMed

Bakos, J; Hlavacova, N; Rajman, M; Ondicova, K; Koros, C; Kitraki, E; Steinbusch, H W M; Jezova, D

2009-12-01

The present study is aimed at testing the hypothesis that an enriched environment (EE) induces sex-dependent changes in stress hormone release and in markers of increased brain plasticity. The focus was on hypothalamic-pituitary-adrenocortical (HPA) axis activity, plasma levels of stress hormones, gene expression of glutamate receptor subunits and concentrations of brain-derived neurotrophic factor (BDNF) in selected brain regions. Rats exposed to EE were housed in groups of 12 in large cages with various objects, which were frequently changed, for 6 weeks. Control animals were housed four per cage under standard conditions. In females the EE-induced rise in hippocampal BDNF, a neurotrophic factor associated with increased neural plasticity, was more pronounced than in males. Similar sex-specific changes were observed in BDNF concentrations in the hypothalamus. EE also significantly attenuated oxytocin and aldosterone levels only in female but not male rats. Plasma testosterone positively correlated with hippocampal BDNF in female but not male rats housed in EE. In male rats housing in EE led to enhanced levels of testosterone and adrenocorticotropic hormone (ACTH), this was not seen in females. Hippocampal glucocorticoid but not mineralocorticoid receptor levels decreased in rats housed in EE irrespective of sex. Housing conditions failed to modify mRNA levels of glutamate receptor type 1 (Glur1) and metabotropic glutamate receptor subtype 5 (mGlur5) subunits of glutamate receptors in the forebrain. Moreover, a negative association between corticosterone and BDNF was observed in both sexes. The results demonstrate that the association between hormones and changes in brain plasticity is sex related. In particular, testosterone seems to be involved in the regulatory processes related to neuroplasticity in females.

FMRP acts as a key messenger for dopamine modulation in the forebrain.

PubMed

Wang, Hansen; Wu, Long-Jun; Kim, Susan S; Lee, Frank J S; Gong, Bo; Toyoda, Hiroki; Ren, Ming; Shang, Yu-Ze; Xu, Hui; Liu, Fang; Zhao, Ming-Gao; Zhuo, Min

2008-08-28

The fragile X mental retardation protein (FMRP) is an RNA-binding protein that controls translational efficiency and regulates synaptic plasticity. Here, we report that FMRP is involved in dopamine (DA) modulation of synaptic potentiation. AMPA glutamate receptor subtype 1 (GluR1) surface expression and phosphorylation in response to D1 receptor stimulation were reduced in cultured Fmr1(-/-) prefrontal cortex (PFC) neurons. Furthermore, D1 receptor signaling was impaired, accompanied by D1 receptor hyperphosphorylation at serine sites and subcellular redistribution of G protein-coupled receptor kinase 2 (GRK2) in both PFC and striatum of Fmr1(-/-) mice. FMRP interacted with GRK2, and pharmacological inhibition of GRK2 rescued D1 receptor signaling in Fmr1(-/-) neurons. Finally, D1 receptor agonist partially rescued hyperactivity and enhanced the motor function of Fmr1(-/-) mice. Our study has identified FMRP as a key messenger for DA modulation in the forebrain and may provide insights into the cellular and molecular mechanisms underlying fragile X syndrome.

Developmental regulation of N-methyl-D-aspartate- and kainate-type glutamate receptor expression in the rat spinal cord

NASA Technical Reports Server (NTRS)

Stegenga, S. L.; Kalb, R. G.

2001-01-01

Spinal motor neurons undergo experience-dependent development during a critical period in early postnatal life. It has been suggested that the repertoire of glutamate receptor subunits differs between young and mature motor neurons and contributes to this activity-dependent development. In the present study we examined the expression patterns of N-methyl-D-aspartate- and kainate-type glutamate receptor subunits during the postnatal maturation of the spinal cord. Young motor neurons express much higher levels of the N-methyl-D-aspartate receptor subunit NR1 than do adult motor neurons. Although there are eight potential splice variants of NR1, only a subgroup is expressed by motor neurons. With respect to NR2 receptor subunits, young motor neurons express NR2A and C, while adult motor neurons express only NR2A. Young motor neurons express kainate receptor subunits GluR5, 6 and KA2 but we are unable to detect these or any other kainate receptor subunits in the adult spinal cord. Other spinal cord regions display a distinct pattern of developmental regulation of N-methyl-D-aspartate and kainate receptor subunit expression in comparison to motor neurons. Our findings indicate a precise spatio-temporal regulation of individual subunit expression in the developing spinal cord. Specific combinations of subunits in developing neurons influence their excitable properties and could participate in the emergence of adult neuronal form and function.

Potentiation of mouse vagal afferent mechanosensitivity by ionotropic and metabotropic glutamate receptors

PubMed Central

Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley

2006-01-01

Glutamate acts at central synapses via ionotropic (iGluR – NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed. PMID:16945965

Potentiation of mouse vagal afferent mechanosensitivity by ionotropic and metabotropic glutamate receptors.

PubMed

Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley

2006-11-15

Glutamate acts at central synapses via ionotropic (iGluR--NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed.

Prostacyclin regulates spinal nociceptive processing through cyclic adenosine monophosphate-induced translocation of glutamate receptors.

PubMed

Schuh, Claus Dieter; Brenneis, Christian; Zhang, Dong Dong; Angioni, Carlo; Schreiber, Yannick; Ferreiros-Bouzas, Nerea; Pierre, Sandra; Henke, Marina; Linke, Bona; Nüsing, Rolf; Scholich, Klaus; Geisslinger, Gerd

2014-02-01

Prostacyclin (PGI2) is known to be an important mediator of peripheral pain sensation (nociception) whereas little is known about its role in central sensitization. The levels of the stable PGI2-metabolite 6-keto-prostaglandin F1α (6-keto-PGF1α) and of prostaglandin E2 (PGE2) were measured in the dorsal horn with the use of mass spectrometry after peripheral inflammation. Expression of the prostanoid receptors was determined by immunohistology. Effects of prostacyclin receptor (IP) activation on spinal neurons were investigated with biochemical assays (cyclic adenosine monophosphate-, glutamate release-measurement, Western blot analysis) in embryonic cultures and adult spinal cord. The specific IP antagonist Cay10441 was applied intrathecally after zymosan-induced mechanical hyperalgesia in vivo. Peripheral inflammation caused a significant increase of the stable PGI2 metabolite 6-keto-PGF1α in the dorsal horn of wild-type mice (n = 5). IP was located on spinal neurons and did not colocalize with the prostaglandin E2 receptors EP2 or EP4. The selective IP-agonist cicaprost increased cyclic adenosine monophosphate synthesis in spinal cultures from wild-type but not from IP-deficient mice (n = 5-10). The combination of fluorescence-resonance-energy transfer-based cyclic adenosine monophosphate imaging and calcium imaging showed a cicaprost-induced cyclic adenosine monophosphate synthesis in spinal cord neurons (n = 5-6). Fittingly, IP activation increased glutamate release from acute spinal cord sections of adult mice (n = 13-58). Cicaprost, but not agonists for EP2 and EP4, induced protein kinase A-dependent phosphorylation of the GluR1 subunit and its translocation to the membrane. Accordingly, intrathecal administration of the IP receptor antagonist Cay10441 had an antinociceptive effect (n = 8-11). Spinal prostacyclin synthesis during early inflammation causes the recruitment of GluR1 receptors to membrane fractions, thereby augmenting the onset of central sensitization.

Presynaptic DLG regulates synaptic function through the localization of voltage-activated Ca2+ Channels

PubMed Central

Astorga, César; Jorquera, Ramón A.; Ramírez, Mauricio; Kohler, Andrés; López, Estefanía; Delgado, Ricardo; Córdova, Alex; Olguín, Patricio; Sierralta, Jimena

2016-01-01

The DLG-MAGUK subfamily of proteins plays a role on the recycling and clustering of glutamate receptors (GLUR) at the postsynaptic density. discs-large1 (dlg) is the only DLG-MAGUK gene in Drosophila and originates two main products, DLGA and DLGS97 which differ by the presence of an L27 domain. Combining electrophysiology, immunostaining and genetic manipulation at the pre and postsynaptic compartments we study the DLG contribution to the basal synaptic-function at the Drosophila larval neuromuscular junction. Our results reveal a specific function of DLGS97 in the regulation of the size of GLUR fields and their subunit composition. Strikingly the absence of any of DLG proteins at the presynaptic terminal disrupts the clustering and localization of the calcium channel DmCa1A subunit (Cacophony), decreases the action potential-evoked release probability and alters short-term plasticity. Our results show for the first time a crucial role of DLG proteins in the presynaptic function in vivo. PMID:27573697

Presynaptic DLG regulates synaptic function through the localization of voltage-activated Ca(2+) Channels.

PubMed

Astorga, César; Jorquera, Ramón A; Ramírez, Mauricio; Kohler, Andrés; López, Estefanía; Delgado, Ricardo; Córdova, Alex; Olguín, Patricio; Sierralta, Jimena

2016-08-30

The DLG-MAGUK subfamily of proteins plays a role on the recycling and clustering of glutamate receptors (GLUR) at the postsynaptic density. discs-large1 (dlg) is the only DLG-MAGUK gene in Drosophila and originates two main products, DLGA and DLGS97 which differ by the presence of an L27 domain. Combining electrophysiology, immunostaining and genetic manipulation at the pre and postsynaptic compartments we study the DLG contribution to the basal synaptic-function at the Drosophila larval neuromuscular junction. Our results reveal a specific function of DLGS97 in the regulation of the size of GLUR fields and their subunit composition. Strikingly the absence of any of DLG proteins at the presynaptic terminal disrupts the clustering and localization of the calcium channel DmCa1A subunit (Cacophony), decreases the action potential-evoked release probability and alters short-term plasticity. Our results show for the first time a crucial role of DLG proteins in the presynaptic function in vivo.

Differences in kainate receptor involvement in hippocampal mossy fibre long-term potentiation depending on slice orientation.

PubMed

Sherwood, John L; Amici, Mascia; Dargan, Sheila L; Culley, Georgia R; Fitzjohn, Stephen M; Jane, David E; Collingridge, Graham L; Lodge, David; Bortolotto, Zuner A

2012-09-01

Long-term potentiation (LTP) is a well-established experimental model used to investigate the synaptic basis of learning and memory. LTP at mossy fibre - CA3 synapses in the hippocampus is unusual because it is normally N-methyl-d-aspartate (NMDA) receptor-independent. Instead it seems that the trigger for mossy fibre LTP involves kainate receptors (KARs). Although it is generally accepted that pre-synaptic KARs play an essential role in frequency facilitation and LTP, their subunit composition remains a matter of significant controversy. We have reported previously that both frequency facilitation and LTP can be blocked by selective antagonism of GluK1 (formerly GluR5/Glu(K5))-containing KARs, but other groups have failed to reproduce this effect. Moreover, data from receptor knockout and mRNA expression studies argue against a major role of GluK1, supporting a more central role for GluK2 (formerly GluR6/Glu(K6)). A potential reason underlying the controversy in the pharmacological experiments may reside in differences in the preparations used. Here we show differences in pharmacological sensitivity of synaptic plasticity at mossy fibre - CA3 synapses depend critically on slice orientation. In transverse slices, LTP of fEPSPs was invariably resistant to GluK1-selective antagonists whereas in parasagittal slices LTP was consistently blocked by GluK1-selective antagonists. In addition, there were pronounced differences in the magnitude of frequency facilitation and the sensitivity to the mGlu2/3 receptor agonist DCG-IV. Using anterograde labelling of granule cells we show that slices of both orientations possess intact mossy fibres and both large and small presynaptic boutons. Transverse slices have denser fibre tracts but a smaller proportion of giant mossy fibre boutons. These results further demonstrate a considerable heterogeneity in the functional properties of the mossy fibre projection. Copyright © 2012 Elsevier Ltd. All rights reserved.

Early memory formation disrupted by atypical PKC inhibitor ZIP in the medial prefrontal cortex but not hippocampus

PubMed Central

Evuarherhe, Obaro; Barker, Gareth R. I.; Savalli, Giorgia; Warburton, Elizabeth C.; Brown, Malcolm W.

2014-01-01

Atypical isoforms of protein kinase C (aPKCs; particularly protein kinase M zeta: PKMζ) have been hypothesised to be necessary and sufficient for the maintenance of long-term potentiation (LTP) and long term memory by maintaining postsynaptic AMPA receptors via the GluR2 subunit. A myristoylated PKMζ pseudosubstrate peptide (ZIP) blocks PKMζ activity. We examined the actions of ZIP in medial prefrontal cortex (mPFC) and hippocampus in associative recognition memory in rats during early memory formation and memory maintenance. ZIP infusion in either hippocampus or mPFC impaired memory maintenance. However, early memory formation was impaired by ZIP in mPFC but not hippocampus; and blocking GluR2-dependent removal of AMPA receptors did not affect this impairment caused by ZIP in the mPFC. The findings indicate: (i) a difference in the actions of ZIP in hippocampus and medial prefrontal cortex, and (ii) a GluR2-independent target of ZIP (possibly PKCλ) in the mPFC during early memory formation. PMID:24729442

A Critical Role for Protein Degradation in the Nucleus Accumbens Core in Cocaine Reward Memory

PubMed Central

Ren, Zhen-Yu; Liu, Meng-Meng; Xue, Yan-Xue; Ding, Zeng-Bo; Xue, Li-Fen; Zhai, Suo-Di; Lu, Lin

2013-01-01

The intense associative memories that develop between cocaine-paired contexts and rewarding stimuli contribute to cocaine seeking and relapse. Previous studies have shown impairment in cocaine reward memories by manipulating a labile state induced by memory retrieval, but the mechanisms that underlie the destabilization of cocaine reward memory are unknown. In this study, using a Pavlovian cocaine-induced conditioned place preference (CPP) procedure in rats, we tested the contribution of ubiquitin-proteasome system-dependent protein degradation in destabilization of cocaine reward memory. First, we found that polyubiquitinated protein expression levels and polyubiquitinated N-ethylmaleimide-sensitive fusion (NSF) markedly increased 15 min after retrieval while NSF protein levels decreased 1 h after retrieval in the synaptosomal membrane fraction in the nucleus accumbens (NAc) core. We then found that infusion of the proteasome inhibitor lactacystin into the NAc core prevented the impairment of memory reconsolidation induced by the protein synthesis inhibitor anisomycin and reversed the effects of anisomycin on NSF and glutamate receptor 2 (GluR2) protein levels in the synaptosomal membrane fraction in the NAc core. We also found that lactacystin infusion into the NAc core but not into the shell immediately after extinction training sessions inhibited CPP extinction and reversed the extinction training-induced decrease in NSF and GluR2 in the synaptosomal membrane fraction in the NAc core. Finally, infusions of lactacystin by itself into the NAc core immediately after each training session or before the CPP retrieval test had no effect on the consolidation and retrieval of cocaine reward memory. These findings suggest that ubiquitin-proteasome system-dependent protein degradation is critical for retrieval-induced memory destabilization. PMID:23303053

Ethanol-mediated facilitation of AMPA receptor function in the dorsomedial striatum: implications for alcohol drinking behavior.

PubMed

Wang, Jun; Ben Hamida, Sami; Darcq, Emmanuel; Zhu, Wenheng; Gibb, Stuart L; Lanfranco, Maria Fe; Carnicella, Sebastien; Ron, Dorit

2012-10-24

We found previously that acute ex vivo as well as repeated cycles of in vivo ethanol exposure and withdrawal, including excessive voluntary consumption of ethanol, produces a long-lasting increase in the activity of NR2B-containing NMDA receptors (NR2B-NMDARs) in the dorsomedial striatum (DMS) of rats (Wang et al., 2010a). Activation of NMDARs is required for the induction of long-term potentiation (LTP) of AMPA receptor (AMPAR)-mediated synaptic response. We therefore examined whether the ethanol-mediated upregulation of NMDAR activity alters the induction of LTP in the DMS. We found that ex vivo acute exposure of striatal slices to, and withdrawal from, ethanol facilitates the induction of LTP in DMS neurons, which is abolished by the inhibition of NR2B-NMDARs. We also report that repeated systemic administration of ethanol causes an NR2B-NMDAR-dependent facilitation of LTP in the DMS. LTP is mediated by the insertion of AMPAR subunits into the synaptic membrane, and we found that repeated systemic administration of ethanol, as well as cycles of excessive ethanol consumption and withdrawal, produced a long-lasting increase in synaptic localization of the GluR1 and GluR2 subunits of AMPARs in the DMS. Importantly, we report that inhibition of AMPARs in the DMS attenuates operant self-administration of ethanol, but not of sucrose. Together, our data suggest that aberrant synaptic plasticity in the DMS induced by repeated cycles of ethanol exposure and withdrawal contributes to the molecular mechanisms underlying the development and/or maintenance of excessive ethanol consumption.

Genetic Validation of Aminoacyl-tRNA Synthetases as Drug Targets in Trypanosoma brucei

PubMed Central

Kalidas, Savitha; Cestari, Igor; Monnerat, Severine; Li, Qiong; Regmi, Sandesh; Hasle, Nicholas; Labaied, Mehdi; Parsons, Marilyn; Stuart, Kenneth

2014-01-01

Human African trypanosomiasis (HAT) is an important public health threat in sub-Saharan Africa. Current drugs are unsatisfactory, and new drugs are being sought. Few validated enzyme targets are available to support drug discovery efforts, so our goal was to obtain essentiality data on genes with proven utility as drug targets. Aminoacyl-tRNA synthetases (aaRSs) are known drug targets for bacterial and fungal pathogens and are required for protein synthesis. Here we survey the essentiality of eight Trypanosoma brucei aaRSs by RNA interference (RNAi) gene expression knockdown, covering an enzyme from each major aaRS class: valyl-tRNA synthetase (ValRS) (class Ia), tryptophanyl-tRNA synthetase (TrpRS-1) (class Ib), arginyl-tRNA synthetase (ArgRS) (class Ic), glutamyl-tRNA synthetase (GluRS) (class 1c), threonyl-tRNA synthetase (ThrRS) (class IIa), asparaginyl-tRNA synthetase (AsnRS) (class IIb), and phenylalanyl-tRNA synthetase (α and β) (PheRS) (class IIc). Knockdown of mRNA encoding these enzymes in T. brucei mammalian stage parasites showed that all were essential for parasite growth and survival in vitro. The reduced expression resulted in growth, morphological, cell cycle, and DNA content abnormalities. ThrRS was characterized in greater detail, showing that the purified recombinant enzyme displayed ThrRS activity and that the protein localized to both the cytosol and mitochondrion. Borrelidin, a known inhibitor of ThrRS, was an inhibitor of T. brucei ThrRS and showed antitrypanosomal activity. The data show that aaRSs are essential for T. brucei survival and are likely to be excellent targets for drug discovery efforts. PMID:24562907

Chronic treatment with ginsenoside Rg1 promotes memory and hippocampal long-term potentiation in middle-aged mice.

PubMed

Zhu, G; Wang, Y; Li, J; Wang, J

2015-04-30

Ginseng serves as a potential candidate for the treatment of aging-related memory decline or memory loss. However, the related mechanism is not fully understood. In this study, we applied an intraperitoneal injection of ginsenoside Rg1, an active compound from ginseng in middle-aged mice and detected memory improvement and the underlying mechanisms. Our results showed that a period of 30-day administration of ginsenoside Rg1 enhanced long-term memory in the middle-aged animals. Consistent with the memory improvement, ginsenoside Rg1 administration facilitated weak theta-burst stimulation (TBS)-induced long-term potentiation (LTP) in acute hippocampal slices from middle-aged animals. Ginsenoside Rg1 administration increased the dendritic apical spine numbers and area in the CA1 region. In addition, ginsenoside Rg1 administration up-regulated the expression of hippocampal p-AKT, brain-derived neurotrophic factor (BDNF), proBDNF and glutamate receptor 1 (GluR1), but not p-ERK. Interestingly, the phosphatase and tensin homolog deleted on chromosome ten (PTEN) inhibitor (bpV) mimicked the ginsenoside Rg1 effects, including increasing p-AKT expression, promoting hippocampal basal synaptic transmission, LTP and memory. Taken together, our data suggest that ginsenoside Rg1 treatment improves memory in middle-aged mice possibly through regulating the PI3K/AKT pathway, altering apical spines and facilitating hippocampal LTP. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

ERK-GluR1 phosphorylation in trigeminal spinal subnucleus caudalis neurons is involved in pain associated with dry tongue.

PubMed

Nakaya, Yuka; Tsuboi, Yoshiyuki; Okada-Ogawa, Akiko; Shinoda, Masamichi; Kubo, Asako; Chen, Jui Yen; Noma, Noboru; Batbold, Dulguun; Imamura, Yoshiki; Sessle, Barry J; Iwata, Koichi

2016-01-01

Dry mouth is known to cause severe pain in the intraoral structures, and many dry mouth patients have been suffering from intraoral pain. In development of an appropriate treatment, it is crucial to study the mechanisms underlying intraoral pain associated with dry mouth, yet the detailed mechanisms are not fully understood. To evaluate the mechanisms underlying pain related to dry mouth, the dry-tongue rat model was developed. Hence, the mechanical or heat nocifensive reflex, the phosphorylated extracellular signal-regulated kinase and phosphorylated GluR1-IR immunohistochemistries, and the single neuronal activity were examined in the trigeminal spinal subnucleus caudalis of dry-tongue rats. The head-withdrawal reflex threshold to mechanical, but not heat, stimulation of the tongue was significantly decreased on day 7 after tongue drying. The mechanical, but not heat, responses of trigeminal spinal subnucleus caudalis nociceptive neurons were significantly enhanced in dry-tongue rats compared to sham rats on day 7. The number of phosphorylated extracellular signal-regulated kinase-immunoreactive cells was also significantly increased in the trigeminal spinal subnucleus caudalis following noxious stimulation of the tongue in dry-tongue rats compared to sham rats on day 7. The decrement of the mechanical head-withdrawal reflex threshold (HWT) was reversed during intracisternal administration of the mitogen-activated protein kinase kinase 1 inhibitor, PD98059. The trigeminal spinal subnucleus caudalis neuronal activities and the number of phosphorylated extracellular signal-regulated kinase-immunoreactive cells following noxious mechanical stimulation of dried tongue were also significantly decreased following intracisternal administration of PD98059 compared to vehicle-administrated rats. Increased number of the phosphorylated GluR1-IR cells was observed in the trigeminal spinal subnucleus caudalis of dry-tongue rats, and the number of phosphorylated GluR1-IR cells was significantly reduced in PD98059-administrated rats compared to the vehicle-administrated tongue-dry rats. These findings suggest that the pERK-pGluR1 cascade is involved in central sensitization of trigeminal spinal subnucleus caudalis nociceptive neurons, thus resulting in tongue mechanical hyperalgesia associated with tongue drying. © The Author(s) 2016.

Nefiracetam facilitates hippocampal neurotransmission by a mechanism independent of the piracetam and aniracetam action.

PubMed

Nomura, T; Nishizaki, T

2000-07-07

Nefiracetam, a nootropic (cognition-enhancing) agent, facilitated neurotransmission in the dentate gyrus of rat hippocampal slices in a dose-dependent manner at concentrations ranged from 1 nM to 1 microM, being evident at 60-min washing-out of the drug. The facilitatory action was blocked by the nicotinic acetylcholine (ACh) receptor antagonists, alpha-bungarotoxin and mecamylamine. A similar facilitation was induced by the other nootropic agents, piracetam and aniracetam, but the facilitation was not inhibited by nicotinic ACh receptor antagonists and it did not occlude the potentiation induced by nefiracetam. In the Xenopus oocyte expression systems, nefiracetam potentiated currents through a variety of neuronal nicotinic ACh receptors (alpha 3beta 2, alpha 3beta 4, alpha 4 beta 2, alpha 4 beta 4, and alpha 7) to a different extent. In contrast, neither piracetam nor aniracetam had any potentiating action on alpha 7 receptor currents. While aniracetam delayed the decay time of currents through the alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor, GluR1, -2, -3, expressed in oocytes, nefiracetam or piracetam had no effect on the currents. Nefiracetam, thus, appears to facilitate hippocampal neurotransmission by functionally targeting nicotinic ACh receptors, independently of the action of piracetam and aniracetam.

Human Neural Cell-Based Biosensor

DTIC Science & Technology

2010-04-26

SNAP25 (SNAP25), GluR1 (GRIA1) glutamate receptor , ionotropic , AMPA1, Nav1.2 (SCN2A), Nav1.6 (SCN8A), CaV 2.1 (CACNA1A), HERG (KCNH2), and KCC2...transitions to mesenchymal progenitor cells." Tissue Eng Part A 15(8): 1897-907. Haltiwanger, R. S. and P. Stanley (2002). "Modulation of receptor ...cytometry studies previously conducted by the Stice lab identified ciliary neurotrophic factor receptor alpha (CNTFRα) as a novel cell surface marker to

Glutamate Receptor Aptamers and ALS

DTIC Science & Technology

2008-01-01

XXGATC ACC Consensus sequence RNA library Cloning and sequencing SELEX DIAGRAM Fig. 1. (a) Flow chart of SELEX. The library we used for SELEX...recording electrode and placed ~100 µm away from the hole. The linear flow rate of the solution is 1-4 cm/s. An optical fiber through which laser light for...channel recording (26) GluR6Q 1.1 × 104 4.2 × 102 Laser-pulse photolysis (67) 1.0 × 104 4.4 × 102 Fitting (52) 1.0 × 104 Flow measurement (46

Molecular alterations in the hippocampus after experimental subarachnoid hemorrhage

PubMed Central

Han, Sang Myung; Wan, Hoyee; Kudo, Gen; Foltz, Warren D; Vines, Douglass C; Green, David E; Zoerle, Tommaso; Tariq, Asma; Brathwaite, Shakira; D'Abbondanza, Josephine; Ai, Jinglu; Macdonald, R Loch

2014-01-01

Patients with aneurysmal subarachnoid hemorrhage (SAH) frequently have deficits in learning and memory that may or may not be associated with detectable brain lesions. We examined mediators of long-term potentiation after SAH in rats to determine what processes might be involved. There was a reduction in synapses in the dendritic layer of the CA1 region on transmission electron microscopy as well as reduced colocalization of microtubule-associated protein 2 (MAP2) and synaptophysin. Immunohistochemistry showed reduced staining for GluR1 and calmodulin kinase 2 and increased staining for GluR2. Myelin basic protein staining was decreased as well. There was no detectable neuronal injury by Fluoro-Jade B, TUNEL, or activated caspase-3 staining. Vasospasm of the large arteries of the circle of Willis was mild to moderate in severity. Nitric oxide was increased and superoxide anion radical was decreased in hippocampal tissue. Cerebral blood flow, measured by magnetic resonance imaging, and cerebral glucose metabolism, measured by positron emission tomography, were no different in SAH compared with control groups. The results suggest that the etiology of loss of LTP after SAH is not cerebral ischemia but may be mediated by effects of subarachnoid blood such as oxidative stress and inflammation. PMID:24064494

Segregation and Crosstalk of D1 Receptor-Mediated Activation of ERK in Striatal Medium Spiny Neurons upon Acute Administration of Psychostimulants

PubMed Central

Gutierrez-Arenas, Omar; Eriksson, Olivia; Hellgren Kotaleski, Jeanette

2014-01-01

The convergence of corticostriatal glutamate and dopamine from the midbrain in the striatal medium spiny neurons (MSN) triggers synaptic plasticity that underlies reinforcement learning and pathological conditions such as psychostimulant addiction. The increase in striatal dopamine produced by the acute administration of psychostimulants has been found to activate not only effectors of the AC5/cAMP/PKA signaling cascade such as GluR1, but also effectors of the NMDAR/Ca2+/RAS cascade such as ERK. The dopamine-triggered effects on both these cascades are mediated by D1R coupled to Golf but while the phosphorylation of GluR1 is affected by reductions in the available amount of Golf but not of D1R, the activation of ERK follows the opposite pattern. This segregation is puzzling considering that D1R-induced Golf activation monotonically increases with DA and that there is crosstalk from the AC5/cAMP/PKA cascade to the NMDAR/Ca2+/RAS cascade via a STEP (a tyrosine phosphatase). In this work, we developed a signaling model which accounts for this segregation based on the assumption that a common pool of D1R and Golf is distributed in two D1R/Golf signaling compartments. This model integrates a relatively large amount of experimental data for neurons in vivo and in vitro. We used it to explore the crosstalk topologies under which the sensitivities of the AC5/cAMP/PKA signaling cascade to reductions in D1R or Golf are transferred or not to the activation of ERK. We found that the sequestration of STEP by its substrate ERK together with the insensitivity of STEP activity on targets upstream of ERK (i.e. Fyn and NR2B) to PKA phosphorylation are able to explain the experimentally observed segregation. This model provides a quantitative framework for simulation based experiments to study signaling required for long term potentiation in MSNs. PMID:24499932

The effect of propofol postconditioning on the expression of K(+)-Cl(-)-co-transporter 2 in GABAergic inhibitory interneurons of acute ischemia/reperfusion injury rats.

PubMed

Wang, Hongbai; Liu, Shuying; Wang, Haiyun; Wang, Guolin; Zhu, Ai

2015-02-09

It has been shown in our previous study that propofol postconditioning enhanced the activity of phosphatidylinositol-3-kinase (PI3K) and prevented the internalization of GluR2 subunit of α-amino-3-hydroxyl-5-methyl-4-isoxazolepropionic acid (AMPA) receptors, thus provided neuroprotection in cerebral ischemia/reperfusion (I/R) injury. Regarding inhibitory system in CNS, K(+)-Cl(-)-co-transporter 2 (KCC2), a Cl(-) extruder, plays a critical role in gamma-aminobutyric acid (GABA) inhibitory effect in mature central neurons. However, the effect of propofol postconditioning on the expression of KCC2 in GABAergic interneurons is unclear. Therefore, in this article we describe the role of KCC2 in GABAergic interneurons in the ipsilateral hippocampal CA1 region of adult rats and the effects of propofol postconditioning on this region. Herein we demonstrate that propofol postconditioning (20mg/kg/h, 2h) improved rats' neurobehavioral abilities, increased the number of survival neurons, and up-regulated neuronal KCC2 expression in glutamic acid decarboxylase 67 (GAD67) expressing GABAergic interneurons in hippocampal CA1 region at 24h after I/R. In contrast, when rats were injected with the KCC2 antagonist, [(dihydroindenyl)oxy] alkanoic acid (DIOA), the neuroprotective effects induced by propofol postconditioning were reversed. Our study indicated that propofol postconditioning increased the expression of KCC2 in inhibitory GABAergic interneurons, thus providing acute neuroprotection to rats who had undergone cerebral I/R injury. Copyright © 2014 Elsevier B.V. All rights reserved.

Overexpressed Calponin3 by Subsonic Vibration Induces Neural Differentiation of hUC-MSCs by Regulating the Ionotropic Glutamate Receptor.

PubMed

Kim, Hyun-Jung; Kim, Jin-Hee; Song, Yeo-Ju; Seo, Young-Kwon; Park, Jung-Keug; Kim, Chan-Wha

2015-09-01

In this study, we used proteomics to investigate the effects of sonic vibration (SV) on mesenchymal stem cells derived from human umbilical cords (hUC-MSCs) during neural differentiation to understand how SV enhances neural differentiation of hUC-MSCs. We investigated the levels of gene and protein related to neural differentiation after 3 or 5 days in a group treated with 40-Hz SV. In addition, protein expression patterns were compared between the control and the 40-Hz SV-treated hUC-MSC groups via a proteomic approach. Among these proteins, calponin3 (CNN3) was confirmed to have 299 % higher expression in the 40-Hz SV stimulated hUC-MSCs group than that in the control by Western blotting. Notably, overexpression of CNN3-GFP in Chinese hamster ovary (CHO)-K1 cells had positive effects on the stability and reorganization of F-actin compared with that in GFP-transfected cells. Moreover, CNN3 changed the morphology of the cells by making a neurite-like form. After being subjected to SV, messenger RNA (mRNA) levels of glutamate receptors such as PSD95, GluR1, and NR1 as well as intracellular calcium levels were upregulated. These results suggest that the activity of glutamate receptors increased because of CNN3 characteristics. Taken together, these results demonstrate that overexpressed CNN3 during SV increases expression of glutamate receptors and promotes functional neural differentiation of hUC-MSCs.

Comparative analysis of A-to-I editing in human and non-human primate brains reveals conserved patterns and context-dependent regulation of RNA editing.

PubMed

O'Neil, Richard T; Wang, Xiaojing; Morabito, Michael V; Emeson, Ronald B

2017-04-06

A-to-I RNA editing is an important process for generating molecular diversity in the brain through modification of transcripts encoding several proteins important for neuronal signaling. We investigated the relationships between the extent of editing at multiple substrate transcripts (5HT2C, MGLUR4, CADPS, GLUR2, GLUR4, and GABRA3) in brain tissue obtained from adult humans and rhesus macaques. Several patterns emerged from these studies revealing conservation of editing across primate species. Additionally, variability in the human population allows us to make novel inferences about the co-regulation of editing at different editing sites and even across different brain regions.

WITHDRAWN: H-reflex up-conditioning after sciatic nerve transection and regeneration may increase VGLUT-1 terminals and GluR2/3 immunoreactivity in spinal motoneurons.

PubMed

Sun, Chenyou; Wang, Yu; Chen, Xiang Yang

2011-12-17

This article has been withdrawn at the request of the author(s) and/or editor. The Publisher apologizes for any inconvenience this may cause. The full Elsevier Policy on Article Withdrawal can be found at http://www.elsevier.com/locate/withdrawalpolicy. Copyright © 2011. Published by Elsevier Ireland Ltd.. All rights reserved.

Organophosphates dysregulate dopamine signaling, glutamatergic neurotransmission, and induce neuronal injury markers in striatum

PubMed Central

Torres-Altoro, Melissa I.; Mathur, Brian N.; Drerup, Justin M.; Thomas, Rachel; Lovinger, David; O’Callaghan, James P.; Bibb, James A.

2011-01-01

The neurological effects of organophosphate pesticides, commonly used on foods and in households, are an important public health concern. Furthermore, subclinical exposure to combinations of organophosphates is implicated in Gulf War illness. Here we characterized the effects of the broadly-used insecticide chlorpyrifos on dopamine and glutamatergic neurotransmission effectors in corticostriatal motor/reward circuitry. Chlorpyrifos potentiated PKA-dependent phosphorylation of the striatal protein DARPP-32 and the GluR1 subunit of AMPA receptors in mouse brain slices. It also increased GluR1 phosphorylation by PKA when administered systemically. This correlated with enhanced glutamate release from cortical projections in rat striatum. Similar effects were induced by the sarin congener, diisopropyl fluorophosphate, alone or in combination with the putative neuroprotectant, pyridostigmine bromide and the pesticide DEET. This combination, meant to mimic the neurotoxicant exposure encountered by veterans of the 1991 Persian Gulf War, also induced hyperphosphorylation of the neurofibrillary tangle-associated protein tau. Diisopropyl fluorophosphate and pyrodostigmine bromide, alone or in combination, also increased the aberrant activity of the protein kinase, Cdk5, as indicated by conversion of its activating cofactor p35 to p25. Thus consistent with recent findings in humans and animals, organophosphate exposure causes dysregulation in the motor/reward circuitry and invokes mechanisms associated with neurological disorders and neurodegeneration. PMID:21848865

Differential Binding of Human ApoE Isoforms to Insulin Receptor is Associated with Aberrant Insulin Signaling in AD Brain Samples.

PubMed

Chan, Elizabeth S; Chen, Christopher; Soong, Tuck Wah; Wong, Boon-Seng

2018-03-01

Apolipoprotein E4 (ApoE4) is the strongest genetic risk factor for sporadic Alzheimer's disease (AD), where inheritance of this isoform predisposes development of AD in a gene dose-dependent manner. Although the mode of action of ApoE4 on AD onset and progression remains unknown, we have previously shown that ApoE4, and not ApoE3 expression, resulted in insulin signaling deficits in the presence of amyloid beta (Aβ). However, these reports were not conducted with clinical samples that more accurately reflect human disease. In this study, we investigated the effect of ApoE genotype on the insulin signaling pathway in control and AD human brain samples. We found that targets of the insulin signaling pathway were attenuated in AD cases, regardless of ApoE isoform. We also found a decrease in GluR1 subunit expression, and an increase NR2B subunit expression in AD cases, regardless of ApoE isoform. Lastly, we observed that more insulin receptor (IR) was immunoprecipitated in control cases, and more Aβ was immunoprecipitated with AD cases. But, when comparing among AD cases, we found that more IR was immunoprecipitated with ApoE3 than ApoE4, and more Aβ was immunoprecipitated with ApoE4 than ApoE3. Our results suggest that the difference in IR binding and effect on protein expression downstream of the IR may affect onset and progression of AD.

Role of Major NMDA or AMPA Receptor Subunits in MK-801 Potentiation of Ethanol Intoxication

PubMed Central

Palachick, Benjamin; Chen, Yi-Chyan; Enoch, Abigail J.; Karlsson, Rose-Marie; Mishina, Masayoshi; Holmes, Andrew

2008-01-01

Background The glutamate system plays a major role in mediating EtOH’s effects on brain and behavior, and is implicated in the pathophysiology of alcohol-related disorders. N-methyl-D-aspartate receptor (NMDAR) antagonists such as MK-801 (dizocilpine) interact with EtOH at the behavioral level, but the molecular basis of this interaction is unclear. Methods We first characterized the effects of MK-801 treatment on responses to the ataxic (accelerating rotarod), hypothermic and sedative/hypnotic effects of acute EtOH administration in C57BL/6J and 129/SvImJ inbred mice. Effects of another NMDAR antagonist, phencyclidine, on EtOH-induced sedation/hypnosis were also assessed. Gene knockout of the NMDAR subunit NR2A or L-alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate GluR1 or pharmacological antagonism of the NMDAR subunit NR2B (via Ro 25-6981) was employed to examine whether inactivating any one of these glutamate signaling molecules modified MK-801’s effect on EtOH-related behaviors. Results MK-801 markedly potentiated the ataxic effects of 1.75 g/kg EtOH and the sedative/hypnotic effects of 3.0 g/kg EtOH, but not the hypothermic effects of 3.0 g/kg EtOH, in C57BL/6J and 129/SvImJ mice. Phencyclidine potentiated EtOH-induced sedation/hypnosis in both inbred strains. Neither NR2A nor GluR1 KO significantly altered basal EtOH-induced ataxia, hypothermia, or sedation/hypnosis. Ro 25-6981 modestly increased EtOH-induced sedation/hypnosis. The ability of MK-801 to potentiate EtOH-induced ataxia and sedation/hypnosis was unaffected by GluR1 KO or NR2B antagonism. NR2A KO partially reduced MK-801 + EtOH-induced sedation/hypnosis, but not ataxia or hypothermia. Conclusions Data confirm a robust and response-specific potentiating effect of MK-801 on sensitivity to EtOH’s intoxicating effects. Inactivation of three major components of glutamate signaling had no or only partial impact on the ability of MK-801 to potentiate behavioral sensitivity to EtOH. Further work to elucidate the mechanisms underlying NMDAR × EtOH interactions could ultimately provide novel insight into the role of NMDARs in alcoholism and its treatment. PMID:18565157

MicroRNA expression, target genes, and signaling pathways in infants with a ventricular septal defect.

PubMed

Chai, Hui; Yan, Zhaoyuan; Huang, Ke; Jiang, Yuanqing; Zhang, Lin

2018-02-01

This study aimed to systematically investigate the relationship between miRNA expression and the occurrence of ventricular septal defect (VSD), and characterize the miRNA target genes and pathways that can lead to VSD. The miRNAs that were differentially expressed in blood samples from VSD and normal infants were screened and validated by implementing miRNA microarrays and qRT-PCR. The target genes regulated by differentially expressed miRNAs were predicted using three target gene databases. The functions and signaling pathways of the target genes were enriched using the GO database and KEGG database, respectively. The transcription and protein expression of specific target genes in critical pathways were compared in the VSD and normal control groups using qRT-PCR and western blotting, respectively. Compared with the normal control group, the VSD group had 22 differentially expressed miRNAs; 19 were downregulated and three were upregulated. The 10,677 predicted target genes participated in many biological functions related to cardiac development and morphogenesis. Four target genes (mGLUR, Gq, PLC, and PKC) were involved in the PKC pathway and four (ECM, FAK, PI3 K, and PDK1) were involved in the PI3 K-Akt pathway. The transcription and protein expression of these eight target genes were significantly upregulated in the VSD group. The 22 miRNAs that were dysregulated in the VSD group were mainly downregulated, which may result in the dysregulation of several key genes and biological functions related to cardiac development. These effects could also be exerted via the upregulation of eight specific target genes, the subsequent over-activation of the PKC and PI3 K-Akt pathways, and the eventual abnormal cardiac development and VSD.

Neuroplasticity and Calcium Signaling in Stressed Rat Amygdala

DTIC Science & Technology

2005-02-01

kainate receptor and neuroplasticity in the amygdala. National Institute of aging, November, 2001. • He Li: GluR5 kainate receptor mediated synaptic...functions in the amygdala. National Institute of Mental Health, April, 2002. 50 " Maria F. M. Braga: Chronic Stress Causes Impairment of aI-Adrenoceptor...resistance All animal experiments were performed in accordance with of 1.5-5.0 Mf when filled with a solution containing (in our institutional guidelines

Early effects of 16O radiation on neuronal morphology and cognition in a murine model

NASA Astrophysics Data System (ADS)

Carr, Hannah; Alexander, Tyler C.; Groves, Thomas; Kiffer, Frederico; Wang, Jing; Price, Elvin; Boerma, Marjan; Allen, Antiño R.

2018-05-01

Astronauts exposed to high linear energy transfer radiation may experience cognitive injury. The pathogenesis of this injury is unknown but may involve glutamate receptors or modifications to dendritic structure and/or dendritic spine density and morphology. Glutamate is the major excitatory neurotransmitter in the central nervous system, where it acts on ionotropic and metabotropic glutamate receptors located at the presynaptic terminal and in the postsynaptic membrane at synapses in the hippocampus. Dendritic spines are sites of excitatory synaptic transmission, and changes in spine structure and dendrite morphology are thought to be morphological correlates of altered brain function associated with hippocampal-dependent learning and memory. The aim of the current study is to assess whether behavior, glutamate receptor gene expression, and dendritic structure in the hippocampus are altered in mice after early exposure to 16O radiation in mice. Two weeks post-irradiation, animals were tested for hippocampus-dependent cognitive performance in the Y-maze. During Y-maze testing, mice exposed to 0.1 Gy and 0.25 Gy radiation failed to distinguish the novel arm, spending approximately the same amount of time in all 3 arms during the retention trial. Exposure to 16O significantly reduced the expression of Nr1 and GluR1 in the hippocampus and modulated spine morphology in the dentate gyrus and cornu Ammon 1 within the hippocampus. The present data provide evidence that 16O radiation has early deleterious effects on mature neurons that are associated with hippocampal learning and memory.

Decreased levels of NMDA but not AMPA receptors in the lipid-raft fraction of 3xTg-AD model of Alzheimer's disease: Relation to Arc/Arg3.1 protein expression.

PubMed

Morin, Jean-Pascal; Díaz-Cintra, Sofía; Bermúdez-Rattoni, Federico; Delint-Ramírez, Ilse

2016-11-01

It was recently suggested that alteration in lipid raft composition in Alzheimer's disease may lead to perturbations in neurons signalosome, which may help explain the deficits observed in synaptic plasticity mechanisms and long-term memory impairments in AD models. As a first effort to address this issue, we evaluated lipid-raft contents of distinct NMDA and AMPA receptor subunits in the hippocampus of the 3xTg-AD model of Alzheimer's disease. Our results show that compared to controls, 10 months-old 3xTg-AD mice have diminished levels of NMDA receptors in rafts but not in post-synaptic density or total fractions. Additionally, the levels of GluR1 were unaltered in all the analyzed fractions. Finally, we went on to show that the diminished levels of NMDA receptors in rafts correlated with diminished global levels of Arc/Arg3.1, a synaptic protein with a central role in long-term memory formation. This study adds to our current understanding of the signaling pathways disruptions observed in current Alzheimer's disease models. Copyright © 2016 Elsevier Ltd. All rights reserved.

Assessment of the cerebellar neurotoxic effects of nicotine in prenatal alcohol exposure in rats.

PubMed

Bhattacharya, Dwipayan; Majrashi, Mohammed; Ramesh, Sindhu; Govindarajulu, Manoj; Bloemer, Jenna; Fujihashi, Ayaka; Crump, Bailee-Ryan; Hightower, Harrison; Bhattacharya, Subhrajit; Moore, Timothy; Suppiramaniam, Vishnu; Dhanasekaran, Muralikrishnan

2018-02-01

The adverse effects of prenatal nicotine and alcohol exposure on human reproductive outcomes are a major scientific and public health concern. In the United States, substantial percentage of women (20-25%) of childbearing age currently smoke cigarettes and consume alcohol, and only a small percentage of these individuals quit after learning of their pregnancy. However, there are very few scientific reports on the effect of nicotine in prenatal alcohol exposure on the cerebellum of the offspring. Therefore, this study was conducted to investigate the cerebellar neurotoxic effects of nicotine in a rodent model of Fetal Alcohol Spectrum Disorder (FASD). In this study, we evaluated the behavioral changes, biochemical markers of oxidative stress and apoptosis, mitochondrial functions and the molecular mechanisms associated with nicotine in prenatal alcohol exposure on the cerebellum. Prenatal nicotine and alcohol exposure induced oxidative stress, did not affect the mitochondrial functions, increased the monoamine oxidase activity, increased caspase expression and decreased ILK, PSD-95 and GLUR1 expression without affecting the GSK-3β. Thus, our current study of prenatal alcohol and nicotine exposure on cerebellar neurotoxicity may lead to new scientific perceptions and novel and suitable therapeutic actions in the future. Copyright © 2017. Published by Elsevier Inc.

Effects of acute versus repeated cocaine exposure on the expression of endocannabinoid signaling-related proteins in the mouse cerebellum.

PubMed

Palomino, Ana; Pavón, Francisco-Javier; Blanco-Calvo, Eduardo; Serrano, Antonia; Arrabal, Sergio; Rivera, Patricia; Alén, Francisco; Vargas, Antonio; Bilbao, Ainhoa; Rubio, Leticia; Rodríguez de Fonseca, Fernando; Suárez, Juan

2014-01-01

Growing awareness of cerebellar involvement in addiction is based on the cerebellum's intermediary position between motor and reward, potentially acting as an interface between motivational and cognitive functions. Here, we examined the impact of acute and repeated cocaine exposure on the two main signaling systems in the mouse cerebellum: the endocannabinoid (eCB) and glutamate systems. To this end, we investigated whether eCB signaling-related gene and protein expression {cannabinoid receptor type 1 receptors and enzymes that produce [diacylglycerol lipase alpha/beta (DAGLα/β) and N-acyl phosphatidylethanolamine phospholipase D (NAPE-PLD)] and degrade [monoacylglycerol lipase (MAGL) and fatty acid amino hydrolase (FAAH)] eCB} were altered. In addition, we analyzed the gene expression of relevant components of the glutamate signaling system [glutamate synthesizing enzymes liver-type glutaminase isoform (LGA) and kidney-type glutaminase isoform (KGA), metabotropic glutamatergic receptor (mGluR3/5), NMDA-ionotropic glutamatergic receptor (NR1/2A/2B/2C) and AMPA-ionotropic receptor subunits (GluR1/2/3/4)] and the gene expression of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, because noradrenergic terminals innervate the cerebellar cortex. Results indicated that acute cocaine exposure decreased DAGLα expression, suggesting a down-regulation of 2-arachidonylglycerol (2-AG) production, as well as gene expression of TH, KGA, mGluR3 and all ionotropic receptor subunits analyzed in the cerebellum. The acquisition of conditioned locomotion and sensitization after repeated cocaine exposure were associated with an increased NAPE-PLD/FAAH ratio, suggesting enhanced anandamide production, and a decreased DAGLβ/MAGL ratio, suggesting decreased 2-AG generation. Repeated cocaine also increased LGA gene expression but had no effect on glutamate receptors. These findings indicate that acute cocaine modulates the expression of the eCB and glutamate systems. Repeated cocaine results in normalization of glutamate receptor expression, although sustained changes in eCB is observed. We suggest that cocaine-induced alterations to cerebellar eCB should be considered when analyzing the adaptations imposed by psychostimulants that lead to addiction.

Effects of acute versus repeated cocaine exposure on the expression of endocannabinoid signaling-related proteins in the mouse cerebellum

PubMed Central

Palomino, Ana; Pavón, Francisco-Javier; Blanco-Calvo, Eduardo; Serrano, Antonia; Arrabal, Sergio; Rivera, Patricia; Alén, Francisco; Vargas, Antonio; Bilbao, Ainhoa; Rubio, Leticia; Rodríguez de Fonseca, Fernando; Suárez, Juan

2014-01-01

Growing awareness of cerebellar involvement in addiction is based on the cerebellum’s intermediary position between motor and reward, potentially acting as an interface between motivational and cognitive functions. Here, we examined the impact of acute and repeated cocaine exposure on the two main signaling systems in the mouse cerebellum: the endocannabinoid (eCB) and glutamate systems. To this end, we investigated whether eCB signaling-related gene and protein expression {cannabinoid receptor type 1 receptors and enzymes that produce [diacylglycerol lipase alpha/beta (DAGLα/β) and N-acyl phosphatidylethanolamine phospholipase D (NAPE-PLD)] and degrade [monoacylglycerol lipase (MAGL) and fatty acid amino hydrolase (FAAH)] eCB} were altered. In addition, we analyzed the gene expression of relevant components of the glutamate signaling system [glutamate synthesizing enzymes liver-type glutaminase isoform (LGA) and kidney-type glutaminase isoform (KGA), metabotropic glutamatergic receptor (mGluR3/5), NMDA-ionotropic glutamatergic receptor (NR1/2A/2B/2C) and AMPA-ionotropic receptor subunits (GluR1/2/3/4)] and the gene expression of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, because noradrenergic terminals innervate the cerebellar cortex. Results indicated that acute cocaine exposure decreased DAGLα expression, suggesting a down-regulation of 2-arachidonylglycerol (2-AG) production, as well as gene expression of TH, KGA, mGluR3 and all ionotropic receptor subunits analyzed in the cerebellum. The acquisition of conditioned locomotion and sensitization after repeated cocaine exposure were associated with an increased NAPE-PLD/FAAH ratio, suggesting enhanced anandamide production, and a decreased DAGLβ/MAGL ratio, suggesting decreased 2-AG generation. Repeated cocaine also increased LGA gene expression but had no effect on glutamate receptors. These findings indicate that acute cocaine modulates the expression of the eCB and glutamate systems. Repeated cocaine results in normalization of glutamate receptor expression, although sustained changes in eCB is observed. We suggest that cocaine-induced alterations to cerebellar eCB should be considered when analyzing the adaptations imposed by psychostimulants that lead to addiction. PMID:24634647

The N-terminal domain of GluR6-subtype glutamate receptor ion channels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Janesh; Schuck, Peter; Jin, Rongsheng

2009-09-25

The amino-terminal domain (ATD) of glutamate receptor ion channels, which controls their selective assembly into AMPA, kainate and NMDA receptor subtypes, is also the site of action of NMDA receptor allosteric modulators. Here we report the crystal structure of the ATD from the kainate receptor GluR6. The ATD forms dimers in solution at micromolar protein concentrations and crystallizes as a dimer. Unexpectedly, each subunit adopts an intermediate extent of domain closure compared to the apo and ligand-bound complexes of LIVBP and G protein-coupled glutamate receptors (mGluRs), and the dimer assembly has a markedly different conformation from that found in mGluRs.more » This conformation is stabilized by contacts between large hydrophobic patches in the R2 domain that are absent in NMDA receptors, suggesting that the ATDs of individual glutamate receptor ion channels have evolved into functionally distinct families.« less

AMPA receptors mediate passive avoidance deficits induced by sleep deprivation.

PubMed

Dubiela, Francisco Paulino; Queiroz, Claudio Marcos; Moreira, Karin Di Monteiro; Nobrega, Jose N; Sita, Luciane Valéria; Tufik, Sergio; Hipolide, Debora Cristina

2013-11-15

The present study addressed the effects of sleep deprivation (SD) on AMPA receptor (AMPAR) binding in brain regions associated with learning and memory, and investigated whether treatment with drugs acting on AMPAR could prevent passive avoidance deficits in sleep deprived animals. [(3)H]AMPA binding and GluR1 in situ hybridization signals were quantified in different brain regions of male Wistar rats either immediately after 96 h of sleep deprivation or after 24h of sleep recovery following 96 h of sleep deprivation. Another group of animals were sleep deprived and then treated with either the AMPAR potentiator, aniracetam (25, 50 and 100mg/kg, acute administration) or the AMPAR antagonist GYKI-52466 (5 and 10mg/kg, acute and chronic administration) before passive avoidance training. Task performance was evaluated 2h and 24h after training. A significant reduction in [(3)H]AMPA binding was found in the hippocampal formation of SD animals, while no alterations were observed in GluR1 mRNA levels. The highest dose of aniracetam (100mg/kg) reverted SD-induced impairment of passive avoidance performance in both retention tests, whereas GYKI-52466 treatment had no effect. Pharmacological enhancement of AMPAR function may revert hippocampal-dependent learning impairments produced after SD. We argue that such effects might be associated with reduced AMPAR binding in the hippocampus of sleep deprived animals. Copyright © 2013 Elsevier B.V. All rights reserved.

Dopamine D1 vs D5 receptor-dependent induction of seizures in relation to DARPP-32, ERK1/2 and GluR1-AMPA signalling

PubMed Central

O’Sullivan, Gerard J.; Dunleavy, Mark; Hakansson, Kerstin; Clementi, Mario; Kinsella, Anthony; Croke, David T.; Drago, John; Fienberg, Allen A.; Greengard, Paul; Sibley, David R.; Fisone, Gilberto; Henshall, David C.; Waddington, John L.

2013-01-01

Summary Recent reports have shown that the selective dopamine D1-like agonist SKF 83822 [which stimulates adenylate cyclase, but not phospholipase C] induces prominent behavioral seizures in mice, whereas its benzazepine congener SKF 83959 [which stimulates phospholipase C, but not adenylate cyclase] does not. To investigate the relative involvement of D1 vs D5 receptors in mediating seizures, ethological behavioral topography and cortical EEGs were recorded in D1, D5 and DARPP-32 knockout mice in response to a convulsant dose of SKF 83822. SKF 83822-induced behavioral and EEG seizures were gene dose-dependently abolished in D1 knockouts. In both heterozygous and homozygous D5 knockouts, the latency to first seizure was significantly increased and total EEG seizures were reduced relative to wild-types. The majority (60%) of homozygous DARPP-32 knockouts did not have seizures; of those having seizures (40%), the latency to first seizure was significantly increased and the number of high amplitude, high frequency polyspike EEG events was reduced. In addition, immunoblotting was performed to investigate downstream intracellular signalling mechanisms at D1-like receptors following challenge with SKF 83822 and SKF 83959. In wild-types administered SKF 83822, levels of ERK1/2 and GluR1 AMPA receptor phosphorylation increased two-fold in both the striatum and hippocampus; in striatal slices DARPP-32 phosphorylation at Thr34 increased five-fold relative to vehicle-treated controls. These findings indicate that D1, and to a lesser extent D5, receptor coupling to DARPP-32, ERK1/2 and glutamatergic signalling is involved in mediating the convulsant effects of SKF 83822. PMID:18367215

[Rasmussen encephalitis and non-herpetic acute limbic encephalitis].

PubMed

Takahashi, Yukitoshi; Kubota, Yuko; Yamasaki, Etsuko; Matsuda, Kazumi

2008-03-01

Rasmussen syndrome (RS) and non-herpetic acute limbic encephalitis (NHALE) have pathophysiological background related with autoimmunity to glutamate receptors (GluRs) after infections. RS and NHALE were reviewed, depending mainly on our recent studies. RS is the prototype of autoimmune-mediated epilepsy. In patients with RS, several kinds of autoantibodies against neuronal molecules, for example, GluR3, GluRepsilon2 (NMDA-R2B), etc., are reported. These autoantibodies are not specific for RS. About autoantibodies against GluR3, significance and stimulating effects to GluR3 are controversial. Autoantibodies against GluRepsilon2 were detected in all patients within six months from epilepsy onset, and in some patients at chronic stage. These data suggest that autoantibodies against GluRepsilon2 may be involved in the pathological mechanisms in the early stage, but we could not confirm the effect of the autoantibodies from RS patients on excitatory postsynaptic NMDA current using patch clump methods. However, anti-double-stranded DNA antibodies in patients with SLE are reported to cross-react with n-terminal of GluRepsilon2, and cause neuronal apoptosis in rat hippocampus, ensuing memory impairment, and emotional behavior impairment in mice. Therefore, autoantibodies against GluRepsilon2 may contribute to the cognitive and behavioral changes in RS. Concerning about cellular immunity in RS, lymphocytes stimulating tests revealed peripheral lymphocytes sensitized by antigens containing GluRepsilon2. Cytotoxic T cells (CTLs) excreting Granzyme B were reported in resected brain tissue, and we confirmed the elevated levels of Granzyme B, not in sera, but in CSF. These data suggest that CTLs activated by infection invade into CNS, and recognize neural antigens, and excrete Granzyme B. The incidence of NHALE is 4.1/1 million/year in Japanese adults. Our study in 91 adult patients with NHALE revealed the following characteristics. Mean onset age was 35.2 +/- 16.9 years old, and preceding infections existed in 68.7% of patients, and predominant symptoms at the onset were psychiatric symptoms (33.3%) and convulsions (25.0%). CSF showed slightly elevated cell counts (55.5 +/- 139.9), protein levels (48.1 +/- 36.0 mg/dl), and IgG levels (4.5 +/- 3.9 mg/dl). MRI lesions with high intensity were found in 40.8% (DWI) and 54.2% (FLAIR) of patients in various stages after onsets. Autoantibodies against GluRepsilon2 in sera were detected in approximately 60% of NHALE patients from acute to chronic stages, and the autoantibodies in CSF were detected in 51.8% (acute stage), 41.4% (recovery stage), 28.6% (chronic stage) of patients and included epitopes to n-terminal of GluRepsilon2 (NT1). These data suggest that autoantibodies against GluRepsilon2 produced in sera after infection infiltrate into CNS through damaged BBB in acute stages, and affect n-terminal of GluRepsilon2. In chronic stage, recovery of function of BBB reduces levels of the autoantibodies in CSF. Because BBB in hippocampi and amygdala are vulnerable, autoantibodies against GluRepsilon2 including epitopes to n-terminal may contribute to the limbic symptoms around onset. Among several autoantibodies related with NHALE, autoantibodies against GluRepsilon2 were found in patients around 15-34 years old, autoantibodies against VGKC were around 50.4 years old, autoantibodies against NAE were around 59 years old, autoantibodies against Hu were around 61.5 years old. These data suggest that autoantibodies related with NHALE have age-dependent heterogeneity.

Modulation of opiate-related signaling molecules in morphine-dependent conditioned behavior: conditioned place preference to morphine induces CREB phosphorylation.

PubMed

Morón, José A; Gullapalli, Srinivas; Taylor, Chirisse; Gupta, Achla; Gomes, Ivone; Devi, Lakshmi A

2010-03-01

Opiate addiction is a chronic, relapsing behavioral disorder where learned associations that develop between the abused opiate and the environment in which it is consumed are brought about through Pavlovian (classical) conditioning processes. However, the signaling mechanisms/pathways regulating the mechanisms that underlie the responses to opiate-associated cues or the development of sensitization as a consequence of repeated context-independent administration of opiates are unknown. In this study we examined the phosphorylation levels of various classic signaling molecules in brain regions implicated in addictive behaviors after acute and repeated morphine administration. An unbiased place conditioning protocol was used to examine changes in phosphorylation that are associated with (1) the expression of the rewarding effects of morphine and (2) the sensitization that develops to this effect. We also examined the effects of a delta-receptor antagonist on morphine-induced conditioned behavior and on the phosphorylation of classic signaling molecules in view of data showing that blockade of delta-opioid receptor (deltaOR) prevents the development of sensitization to the rewarding effects of morphine. We find that CREB phosphorylation is specifically induced upon the expression of a sensitized response to morphine-induced conditioned behavior in brain areas related to memory consolidation, such as the hippocampus and cortex. A similar effect is also observed, albeit to a lesser extent, in the case of the GluR1 subunit of AMPA glutamate receptor. These increases in the phosphorylation levels of CREB and pGluR1 are significantly blocked by pretreatment with a deltaOR antagonist. These results indicate a critical role for phospho-CREB, AMPA, and deltaOR activities in mediating the expression of a sensitized response to morphine-dependent conditioned behavior.

Kalirin, a Key Player in Synapse Formation, Is Implicated in Human Diseases

PubMed Central

Mandela, Prashant; Ma, Xin-Ming

2012-01-01

Synapse formation is considered to be crucial for learning and memory. Understanding the underlying molecular mechanisms of synapse formation is a key to understanding learning and memory. Kalirin-7, a major isoform of Kalirin in adult rodent brain, is an essential component of mature excitatory synapses. Kalirin-7 interacts with multiple PDZ-domain-containing proteins including PSD95, spinophilin, and GluR1 through its PDZ-binding motif. In cultured hippocampal/cortical neurons, overexpression of Kalirin-7 increases spine density and spine size whereas reduction of endogenous Kalirin-7 expression decreases synapse number, and spine density. In Kalirin-7 knockout mice, spine length, synapse number, and postsynaptic density (PSD) size are decreased in hippocampal CA1 pyramidal neurons; these morphological alterations are accompanied by a deficiency in long-term potentiation (LTP) and a decreased spontaneous excitatory postsynaptic current (sEPSC) frequency. Human Kalirin-7, also known as Duo or Huntingtin-associated protein-interacting protein (HAPIP), is equivalent to rat Kalirin-7. Recent studies show that Kalirin is relevant to many human diseases such as Huntington's Disease, Alzheimer's Disease, ischemic stroke, schizophrenia, depression, and cocaine addiction. This paper summarizes our recent understanding of Kalirin function. PMID:22548195

Kalirin, a key player in synapse formation, is implicated in human diseases.

PubMed

Mandela, Prashant; Ma, Xin-Ming

2012-01-01

Synapse formation is considered to be crucial for learning and memory. Understanding the underlying molecular mechanisms of synapse formation is a key to understanding learning and memory. Kalirin-7, a major isoform of Kalirin in adult rodent brain, is an essential component of mature excitatory synapses. Kalirin-7 interacts with multiple PDZ-domain-containing proteins including PSD95, spinophilin, and GluR1 through its PDZ-binding motif. In cultured hippocampal/cortical neurons, overexpression of Kalirin-7 increases spine density and spine size whereas reduction of endogenous Kalirin-7 expression decreases synapse number, and spine density. In Kalirin-7 knockout mice, spine length, synapse number, and postsynaptic density (PSD) size are decreased in hippocampal CA1 pyramidal neurons; these morphological alterations are accompanied by a deficiency in long-term potentiation (LTP) and a decreased spontaneous excitatory postsynaptic current (sEPSC) frequency. Human Kalirin-7, also known as Duo or Huntingtin-associated protein-interacting protein (HAPIP), is equivalent to rat Kalirin-7. Recent studies show that Kalirin is relevant to many human diseases such as Huntington's Disease, Alzheimer's Disease, ischemic stroke, schizophrenia, depression, and cocaine addiction. This paper summarizes our recent understanding of Kalirin function.

The drugs don't work-or do they? Pharmacological and transgenic studies of the contribution of NMDA and GluR-A-containing AMPA receptors to hippocampal-dependent memory.

PubMed

Bannerman, D M; Rawlins, J N P; Good, M A

2006-11-01

The aim of this article is to provide a review of studies using N-methyl-D-aspartate (NMDA) receptor antagonists to assess the hippocampal long-term potentiation (LTP)/learning hypothesis. In particular, we will re-examine the validity of both (1) the original hippocampal LTP/spatial learning hypothesis of Morris and (2) the sensorimotor account put forward by Cain, among others, both from the point of view of the pharmacological studies on which they were based and with regard to recent studies with genetically modified mice. More specifically, we will review the pharmacological studies in the light of recent work on the glutamate receptor A (GluR-A or GluR1) L-alpha-amino-3-hydroxy-5-methyl-4-isoxazelopropionate (AMPA) receptor sub-unit knockout mouse. We will argue that neither the original hippocampal LTP/spatial learning hypothesis nor a sensorimotor account can adequately explain all of the available data. We argue instead that hippocampal synaptic plasticity, which requires NMDA receptors for its induction and GluR-A-containing AMPA receptors for its continued expression, contributes to a process whereby appropriate behavioural responses are selected rapidly on the basis of conditional information provided by the context. These contextual cues could include not only the spatial context (i.e. the 'where') and the temporal context (the 'when'), but also other aspects of context, such as internal state cues (hunger and fear state), and can be used to rapidly and flexibly alter valences of specific response options. We also suggest that there is a separate, distinct, NMDA/GluR-A-independent mechanism through which the context can gradually (incrementally or decrementally) alter the valence of a particular response option.

GLYX-13, a NMDA Receptor Glycine-Site Functional Partial Agonist, Induces Antidepressant-Like Effects Without Ketamine-Like Side Effects

PubMed Central

Burgdorf, Jeffrey; Zhang, Xiao-lei; Nicholson, Katherine L; Balster, Robert L; David Leander, J; Stanton, Patric K; Gross, Amanda L; Kroes, Roger A; Moskal, Joseph R

2013-01-01

Recent human clinical studies with the NMDA receptor (NMDAR) antagonist ketamine have revealed profound and long-lasting antidepressant effects with rapid onset in several clinical trials, but antidepressant effects were preceded by dissociative side effects. Here we show that GLYX-13, a novel NMDAR glycine-site functional partial agonist, produces an antidepressant-like effect in the Porsolt, novelty induced hypophagia, and learned helplessness tests in rats without exhibiting substance abuse-related, gating, and sedative side effects of ketamine in the drug discrimination, conditioned place preference, pre-pulse inhibition and open-field tests. Like ketamine, the GLYX-13-induced antidepressant-like effects required AMPA/kainate receptor activation, as evidenced by the ability of NBQX to abolish the antidepressant-like effect. Both GLYX-13 and ketamine persistently (24 h) enhanced the induction of long-term potentiation of synaptic transmission and the magnitude of NMDAR-NR2B conductance at rat Schaffer collateral-CA1 synapses in vitro. Cell surface biotinylation studies showed that both GLYX-13 and ketamine led to increases in both NR2B and GluR1 protein levels, as measured by Western analysis, whereas no changes were seen in mRNA expression (microarray and qRT-PCR). GLYX-13, unlike ketamine, produced its antidepressant-like effect when injected directly into the medial prefrontal cortex (MPFC). These results suggest that GLYX-13 produces an antidepressant-like effect without the side effects seen with ketamine at least in part by directly modulating NR2B-containing NMDARs in the MPFC. Furthermore, the enhancement of ‘metaplasticity' by both GLYX-13 and ketamine may help explain the long-lasting antidepressant effects of these NMDAR modulators. GLYX-13 is currently in a Phase II clinical development program for treatment-resistant depression. PMID:23303054

High affinity kainate receptor subunits are necessary for ionotropic but not metabotropic signaling

PubMed Central

Fernandes, Herman B.; Catches, Justin S.; Petralia, Ronald S.; Copits, Bryan A.; Xu, Jian; Russell, Theron A.; Swanson, Geoffrey T.; Contractor, Anis

2009-01-01

Summary Kainate receptors are atypical members of the glutamate receptor family which are able to signal through both ionotropic and metabotropic pathways. Of the five individual kainate receptor subunits the high-affinity subunits, GluK4 (KA1) and GluK5 (KA2), are unique in that they do not form functional homomeric receptors in recombinant expression systems, but combine with the primary subunits GluK1-3 (GluR5-7) to form heteromeric assemblies. Here we generated a GluK4 mutant mouse by disrupting the Grik4 gene locus. We found that loss of the GluK4 subunit leads to a significant reduction in synaptic kainate receptor currents. Moreover, ablation of both high-affinity subunits in GluK4/GluK5 double knockout mice leads to a complete loss of pre- and postsynaptic ionotropic function of synaptic kainate receptors. The principal subunits remain at the synaptic plasma membrane, but are distributed away from postsynaptic densities and presynaptic active zones. There is also an alteration in the properties of the remaining kainate receptors, as kainic acid application fails to elicit responses in GluK4/GluK5 knockout neurons. Despite the lack of detectable ionotropic synaptic receptors, the kainate receptor-mediated inhibition of the slow afterhyperpolarization current (IsAHP), which is dependent on metabotropic pathways, was intact in GluK4/GluK5 knockout mice. These results uncover a previously unknown critical role for the high-affinity kainate receptor subunits as obligatory components of ionotropic kainate receptor function, and further, demonstrate that kainate receptor participation in metabotropic signaling pathways does not require their classic role as ion channels. PMID:19778510

The phosphorylation status and cytoskeletal remodeling of striatal astrocytes treated with quinolinic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pierozan, Paula; Ferreira, Fernanda; Ortiz de Lima, Bárbara

2014-04-01

Quinolinic acid (QUIN) is a glutamate agonist which markedly enhances the vulnerability of neural cells to excitotoxicity. QUIN is produced from the amino acid tryptophan through the kynurenine pathway (KP). Dysregulation of this pathway is associated with neurodegenerative conditions. In this study we treated striatal astrocytes in culture with QUIN and assayed the endogenous phosphorylating system associated with glial fibrillary acidic protein (GFAP) and vimentin as well as cytoskeletal remodeling. After 24 h incubation with 100 µM QUIN, cells were exposed to {sup 32}P-orthophosphate and/or protein kinase A (PKA), protein kinase dependent of Ca{sup 2+}/calmodulin II (PKCaMII) or protein kinasemore » C (PKC) inhibitors, H89 (20 μM), KN93 (10 μM) and staurosporin (10 nM), respectively. Results showed that hyperphosphorylation was abrogated by PKA and PKC inhibitors but not by the PKCaMII inhibitor. The specific antagonists to ionotropic NMDA and non-NMDA (50 µM DL-AP5 and CNQX, respectively) glutamate receptors as well as to metabotropic glutamate receptor (mGLUR; 50 µM MCPG), mGLUR1 (100 µM MPEP) and mGLUR5 (10 µM 4C3HPG) prevented the hyperphosphorylation provoked by QUIN. Also, intra and extracellular Ca{sup 2+} quelators (1 mM EGTA; 10 µM BAPTA-AM, respectively) prevented QUIN-mediated effect, while Ca{sup 2+} influx through voltage-dependent Ca{sup 2+} channel type L (L-VDCC) (blocker: 10 µM verapamil) is not implicated in this effect. Morphological analysis showed dramatically altered actin cytoskeleton with concomitant change of morphology to fusiform and/or flattened cells with retracted cytoplasm and disruption of the GFAP meshwork, supporting misregulation of actin cytoskeleton. Both hyperphosphorylation and cytoskeletal remodeling were reversed 24 h after QUIN removal. Astrocytes are highly plastic cells and the vulnerability of astrocyte cytoskeleton may have important implications for understanding the neurotoxicity of QUIN in neurodegenerative disorders. - Highlights: • Quinolinic acid (QUIN) induces hypersphorylation of cytoskeletal proteins in striatal astrocytes. • Glutamate, Ca{sup 2+}, PKA and PKC are implicated in the aberrantly phosphorylated GFAP and vimentin. • QUIN induces reorganization of actin and GFAP cytoskeleton. • Hyperphosphorylation and cytoskeletal remodeling are reversed after QUIN removal. • Disruption of cytoskeleton is a cytotoxic action of QUIN in striatal astrocytes.« less

Morphology and kainate-receptor immunoreactivity of identified neurons within the entorhinal cortex projecting to superior temporal sulcus in the cynomolgus monkey

NASA Technical Reports Server (NTRS)

Good, P. F.; Morrison, J. H.; Bloom, F. E. (Principal Investigator)

1995-01-01

Projections of the entorhinal cortex to the hippocampus are well known from the classical studies of Cajal (Ramon y Cajal, 1904) and Lorente de No (1933). Projections from the entorhinal cortex to neocortical areas are less well understood. Such connectivity is likely to underlie the consolidation of long-term declarative memory in neocortical sites. In the present study, a projection arising in layer V of the entorhinal cortex and terminating in a polymodal association area of the superior temporal gyrus has been identified with the use of retrograde tracing. The dendritic arbors of neurons giving rise to this projection were further investigated by cell filling and confocal microscopy with computer reconstruction. This analysis demonstrated that the dendritic arbor of identified projection neurons was largely confined to layer V, with the exception of a solitary, simple apical dendrite occasionally ascending to superficial laminae but often confined to the lamina dissecans (layer IV). Finally, immunoreactivity for glutamate-receptor subunit proteins GluR 5/6/7 of the dendritic arbor of identified entorhinal projection neurons was examined. The solitary apical dendrite of identified entorhinal projection neurons was prominently immunolabeled for GluR 5/6/7, as was the dendritic arbor of basilar dendrites of these neurons. The restriction of the large bulk of the dendritic arbor of identified entorhinal projection neurons to layer V implies that these neurons are likely to be heavily influenced by hippocampal output arriving in the deep layers of the entorhinal cortex. Immunoreactivity for GluR 5/6/7 throughout the dendritic arbor of such neurons indicates that this class of glutamate receptor is in a position to play a prominent role in mediating excitatory neurotransmission within hippocampal-entorhinal circuits.

Simultaneous monitoring of presynaptic transmitter release and postsynaptic receptor trafficking reveals an enhancement of presynaptic activity in metabotropic glutamate receptor-mediated long-term depression.

PubMed

Xu, Wei; Tse, Yiu Chung; Dobie, Frederick A; Baudry, Michel; Craig, Ann Marie; Wong, Tak Pan; Wang, Yu Tian

2013-03-27

Although the contribution of postsynaptic mechanisms to long-term synaptic plasticity has been studied extensively, understanding the contribution of presynaptic modifications to this process lags behind, primarily because of a lack of techniques with which to directly and quantifiably measure neurotransmitter release from synaptic terminals. Here, we developed a method to measure presynaptic activity through the biotinylation of vesicular transporters in vesicles fused with presynaptic membranes during neurotransmitter release. This method allowed us for the first time to selectively quantify the spontaneous or evoked release of glutamate or GABA at their respective synapses. Using this method to investigate presynaptic changes during the expression of group I metabotropic glutamate receptor (mGluR1/5)-mediated long-term depression (LTD) in cultured rat hippocampal neurons, we discovered that this form of LTD was associated with increased presynaptic release of glutamate, despite reduced miniature EPSCs measured with whole-cell recording. Moreover, we found that specific blockade of AMPA receptor (AMPAR) endocytosis with a membrane-permeable GluR2-derived peptide not only prevented the expression of LTD but also eliminated LTD-associated increase in presynaptic release. Thus, our work not only demonstrates that mGluR1/5-mediated LTD is associated with increased endocytosis of postsynaptic AMPARs but also reveals an unexpected homeostatic/compensatory increase in presynaptic release. In addition, this study indicates that biotinylation of vesicular transporters in live cultured neurons is a valuable tool for studying presynaptic function.

Early in vivo changes in calcium ions, oxidative stress markers, and ion channel immunoreactivity following partial injury to the optic nerve.

PubMed

Wells, Jonathan; Kilburn, Matthew R; Shaw, Jeremy A; Bartlett, Carole A; Harvey, Alan R; Dunlop, Sarah A; Fitzgerald, Melinda

2012-03-01

CNS injury is often localized but can be followed by more widespread secondary degenerative events that usually result in greater functional loss. Using a partial transection model in rat optic nerve (ON). we recently demonstrated in vivo increases in the oxidative stress-associated enzyme MnSOD 5 min after injury. However, mechanisms by which early oxidative stress spreads remain unclear. In the present study, we assessed ion distributions, additional oxidative stress indicators, and ion channel immunoreactivity in ON in the first 24 hr after partial transection. Using nanoscale secondary ion mass spectroscopy (NanoSIMS), we demonstrate changes in the distribution pattern of Ca ions following partial ON transection. Regions of elevated Ca ions in normal ON in vivo rapidly decrease following partial ON transection, but there is an increasingly punctate distribution at 5 min and 24 hr after injury. We also show rapid decreases in catalase activity and later increases in immunoreactivity of the advanced glycation end product carboxymethyl lysine in astrocytes. Increased oxidative stress in astrocytes is accompanied by significantly increased immunoreactivity of the AMPA receptor subunit GluR1 and aquaporin 4 (AQP4). Taken together, the results indicate that Ca ion changes and oxidative stress are early events following partial ON injury that are associated with changes in GluR1 AMPA receptor subunits and altered ionic balance resulting from increased AQP4. Copyright © 2011 Wiley Periodicals, Inc.

Glutamate receptors as seen by light: Spectroscopic studies of structure-function relationships

PubMed Central

Mankiewicz, Kimberly A.; Jayaraman, Vasanthi

2010-01-01

Ionotropic glutamate receptors are major excitatory receptors in the central nervous system and also have far reaching influence in other areas of the body. Their modular nature has allowed for the isolation of the ligand binding domain and subsequent structural studies using a variety of spectroscopic techniques. This review will discuss the role of specific ligand:protein interactions in mediating activation in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) subtype of glutamate receptors as established by various spectroscopic investigations of the GluR2 and GluR4 subunits of this receptor. Specifically, this review will provide an introduction of the insight gained from X-ray crystallography and nuclear magnetic resonance (NMR) investigations and then go on to focus on studies utilizing vibrational spectroscopy and fluorescence resonance energy transfer (FRET) to study the behavior of the isolated ligand binding domain in solution and discuss the importance of specific ligand:protein interactions in the mechanism of receptor activation. PMID:17934637

Bacopa monnieri ameliorates memory deficits in olfactory bulbectomized mice: possible involvement of glutamatergic and cholinergic systems.

PubMed

Le, Xoan Thi; Pham, Hang Thi Nguyet; Do, Phuong Thi; Fujiwara, Hironori; Tanaka, Ken; Li, Feng; Van Nguyen, Tai; Nguyen, Khoi Minh; Matsumoto, Kinzo

2013-10-01

This study investigated the effects of alcoholic extract of Bacopa monnieri (L.) Wettst. (BM) on cognitive deficits using olfactory bulbectomized (OBX) mice and the underlying molecular mechanisms of its action. OBX mice were treated daily with BM (50 mg/kg, p.o.) or a reference drug, tacrine (2.5 mg/kg, i.p.), 1 week before and continuously 3 days after OBX. Cognitive performance of the animals was analyzed by the novel object recognition test, modified Y maze test, and fear conditioning test. Brain tissues of OBX animals were used for neurochemical and immunohistochemical studies. OBX impaired non-spatial short-term memory, spatial working memory, and long-term fair memory. BM administration ameliorated these memory disturbances. The effect of BM on short-term memory deficits was abolished by a muscarinic receptor antagonist, scopolamine. OBX downregulated phosphorylation of synaptic plasticity-related signaling proteins: NR1 subunit of N-methyl-D-aspartate receptor, glutamate receptor 1 (GluR1), and calmodulin-dependent kinase II but not cyclic AMP-responsive element binding protein (CREB), and reduced brain-derived neurotrophic factor (BDNF) mRNA in the hippocampus. OBX also reduced choline acetyltransferase in the hippocampus and cholinergic neurons in the medial septum, and enlarged the size of lateral ventricle. BM administration reversed these OBX-induced neurochemical and histological alterations, except the decrease of GluR1 phosphorylation, and enhanced CREB phosphorylation. Moreover, BM treatment inhibited ex vivo activity of acetylcholinesterase in the brain. These results indicate that BM treatment ameliorates OBX-induced cognition dysfunction via a mechanism involving enhancement of synaptic plasticity-related signaling and BDNF transcription and protection of cholinergic systems from OBX-induced neuronal damage.

Immature morphological properties in subcellular-scale structures in the dentate gyrus of Schnurri-2 knockout mice: a model for schizophrenia and intellectual disability.

PubMed

Nakao, Akito; Miyazaki, Naoyuki; Ohira, Koji; Hagihara, Hideo; Takagi, Tsuyoshi; Usuda, Nobuteru; Ishii, Shunsuke; Murata, Kazuyoshi; Miyakawa, Tsuyoshi

2017-12-12

Accumulating evidence suggests that subcellular-scale structures such as dendritic spine and mitochondria may be involved in the pathogenesis/pathophysiology of schizophrenia and intellectual disability. Previously, we proposed mice lacking Schnurri-2 (Shn2; also called major histocompatibility complex [MHC]-binding protein 2 [MBP-2], or human immunodeficiency virus type I enhancer binding protein 2 [HIVEP2]) as a schizophrenia and intellectual disability model with mild chronic inflammation. In the mutants' brains, there are increases in C4b and C1q genes, which are considered to mediate synapse elimination during postnatal development. However, morphological properties of subcellular-scale structures such as dendritic spine in Shn2 knockout (KO) mice remain unknown. In this study, we conducted three-dimensional morphological analyses in subcellular-scale structures in dentate gyrus granule cells of Shn2 KO mice by serial block-face scanning electron microscopy. Shn2 KO mice showed immature dendritic spine morphology characterized by increases in spine length and decreases in spine diameter. There was a non-significant tendency toward decrease in spine density of Shn2 KO mice over wild-type mice, and spine volume was indistinguishable between genotypes. Shn2 KO mice exhibited a significant reduction in GluR1 expression and a nominally significant decrease in SV2 expression, while PSD95 expression had a non-significant tendency to decrease in Shn2 KO mice. There were significant decreases in dendrite diameter, nuclear volume, and the number of constricted mitochondria in the mutants. Additionally, neuronal density was elevated in Shn2 KO mice. These results suggest that Shn2 KO mice serve as a unique tool for investigating morphological abnormalities of subcellular-scale structures in schizophrenia, intellectual disability, and its related disorders.

Sorting of β1-Adrenergic Receptors Is Mediated by Pathways That Are Either Dependent on or Independent of Type I PDZ, Protein Kinase A (PKA), and SAP97*

PubMed Central

Nooh, Mohammed M.; Chumpia, Maryanne M.; Hamilton, Thomas B.; Bahouth, Suleiman W.

2014-01-01

The β1-adrenergic receptor (β1-AR) is a target for treatment of major cardiovascular diseases, such as heart failure and hypertension. Recycling of agonist-internalized β1-AR is dependent on type I PSD-95/DLG/ZO1 (PDZ) in the C-tail of the β1-AR and on protein kinase A (PKA) activity (Gardner, L. A., Naren, A. P., and Bahouth, S. W. (2007) J. Biol. Chem. 282, 5085–5099). We explored the effects of point mutations in the PDZ and in the activity of PKA on recycling of the β1-AR and its binding to the PDZ-binding protein SAP97. These studies indicated that β1-AR recycling was inhibited by PKA inhibitors and by mutations in the PDZ that interfered with SAP97 binding. The trafficking effects of short sequences differing in PDZ and SAP97 binding were examined using chimeric mutant β1-AR. β1-AR chimera containing the type I PDZ of the β2-adrenergic receptor that does not bind to SAP97 failed to recycle except when serine 312 was mutated to aspartic acid. β1-AR chimera with type I PDZ sequences from the C-tails of aquaporin-2 or GluR1 recycled in a SAP97- and PKA-dependent manner. Non-PDZ β1-AR chimera derived from μ-opioid, dopamine 1, or GluR2 receptors promoted rapid recycling of chimeric β1-AR in a SAP97- and PKA-independent manner. Moreover, the nature of the residue at position −3 in the PDZ regulated whether the β1-AR was internalized alone or in complex with SAP97. These results indicate that divergent pathways were involved in trafficking the β1-AR and provide a roadmap for its trafficking via type I PDZs versus non-PDZs. PMID:24324269

Soman Induces Ictogenesis in the Amygdala and Interictal Activity in the Hippocampus That Are Blocked by a GluR5 Kainate Receptor Antagonist In Vitro

DTIC Science & Technology

2009-01-01

to organophosphorus nerve agents in- uces brain seizures, which can cause profound brain dam- ge resulting in death or long-term cognitive deficits...The mygdala and the hippocampus are two of the most seizure- rone brain structures, but their relative contribution to the eneration of seizures after...nerve agent exposure is unclear. ere, we report that application of 1 M soman for 30 min, in at coronal brain slices containing both the hippocampus

Synaptic Proteins Are Tonotopically Graded in Postnatal and Adult Type I and Type II Spiral Ganglion Neurons

PubMed Central

Flores-Otero, Jacqueline; Davis, Robin L.

2011-01-01

Inherent in the design of the mammalian auditory system is the precision necessary to transduce complex sounds and transmit the resulting electrical signals to higher neural centers. Unique specializations in the organ of Corti are required to make this conversion, such that mechanical and electrical properties of hair cell receptors are tailored to their specific role in signal coding. Electrophysiological and immunocytochemical characterizations have shown that this principle also applies to neurons of the spiral ganglion, as evidenced by distinctly different firing features and synaptic protein distributions of neurons that innervate high- and low-frequency regions of the cochlea. However, understanding the fine structure of how these properties are distributed along the cochlear partition and within the type I and type II classes of spiral ganglion neurons is necessary to appreciate their functional significance fully. To address this issue, we assessed the localization of the postsynaptic AMPA receptor subunits GluR2 and GluR3 and the presynaptic protein synaptophysin by using immunocytochemical labeling in both postnatal and adult tissue. We report that these presynaptic and postsynaptic proteins are distributed oppositely in relation to the tonotopic map and that they are equally distributed in each neuronal class, thus having an overall gradation from one end of the cochlea to the other. For synaptophysin, an additional layer of heterogeneity was superimposed orthogonal to the tonotopic axis. The highest anti-synaptophysin antibody levels were observed within neurons located close to the scala tympani compared with those located close to the scala vestibuli. Furthermore, we noted that the protein distribution patterns observed in postnatal preparations were largely retained in adult tissue sections, indicating that these features characterize spiral ganglion neurons in the fully developed ear. PMID:21452215

CORM-A1 prevents blood-brain barrier dysfunction caused by ionotropic glutamate receptor-mediated endothelial oxidative stress and apoptosis.

PubMed

Basuroy, Shyamali; Leffler, Charles W; Parfenova, Helena

2013-06-01

In cerebral microvascular endothelial cells (CMVEC) of newborn pigs, glutamate at excitotoxic concentrations (mM) causes apoptosis mediated by reactive oxygen species (ROS). Carbon monoxide (CO) produced by CMVEC or delivered by a CO-releasing molecule, CORM-A1, has antioxidant properties. We tested the hypothesis that CORM-A1 prevents cerebrovascular endothelial barrier dysfunction caused by glutamate excitotoxicity. First, we identified the glutamate receptors (GluRs) and enzymatic sources of ROS involved in the mechanism of endothelial apoptosis. In glutamate-exposed CMVEC, ROS formation and apoptosis were blocked by rotenone, 2-thenoyltrifluoroacetone (TTFA), and antimycin, indicating that mitochondrial complexes I, II, and III are the major sources of oxidative stress. Agonists of ionotropic GluRs (iGluRs) N-methyl-D-aspartate (NMDA), cis-ACPD, AMPA, and kainate increased ROS production and apoptosis, whereas iGluR antagonists exhibited antiapoptotic properties, suggesting that iGluRs mediate glutamate-induced endothelial apoptosis. The functional consequences of endothelial injury were tested in the model of blood-brain barrier (BBB) composed of CMVEC monolayer on semipermeable membranes. Glutamate and iGluR agonists reduced transendothelial electrical resistance and increased endothelial paracellular permeability to 3-kDa dextran. CORM-A1 exhibited potent antioxidant and antiapoptotic properties in CMVEC and completely prevented BBB dysfunction caused by glutamate and iGluR agonists. Overall, the endothelial component of the BBB is a cellular target for excitotoxic glutamate that, via a mechanism involving a iGluR-mediated activation of mitochondrial ROS production and apoptosis, leads to BBB opening that may be prevented by the antioxidant and antiapoptotic actions of CORMs. Antioxidant CORMs therapy may help preserve BBB functional integrity in neonatal cerebrovascular disease.

Spinal electro-magnetic stimulation combined with transgene delivery of neurotrophin NT-3 and exercise: novel combination therapy for spinal contusion injury

PubMed Central

Petrosyan, Hayk A.; Alessi, Valentina; Hunanyan, Arsen S.; Sisto, Sue A.

2015-01-01

Our recent terminal experiments revealed that administration of a single train of repetitive spinal electromagnetic stimulation (sEMS; 35 min) enhanced synaptic plasticity in spinal circuitry following lateral hemisection spinal cord injury. In the current study, we have examined effects of repetitive sEMS applied as a single train and chronically (5 wk, every other day) following thoracic T10 contusion. Chronic studies involved examination of systematic sEMS administration alone and combined with exercise training and transgene delivery of neurotrophin [adeno-associated virus 10-neurotrophin 3 (AAV10-NT3)]. Electrophysiological intracellular/extracellular recordings, immunohistochemistry, behavioral testing, and anatomical tracing were performed to assess effects of treatments. We found that administration of a single sEMS train induced transient facilitation of transmission through preserved lateral white matter to motoneurons and hindlimb muscles in chronically contused rats with effects lasting for at least 2 h. These physiological changes associated with increased immunoreactivity of GluR1 and GluR2/3 glutamate receptors in lumbar neurons. Systematic administration of sEMS alone for 5 wk, however, was unable to induce cumulative improvements of transmission in spinomuscular circuitry or improve impaired motor function following thoracic contusion. Encouragingly, chronic administration of sEMS, followed by exercise training (running in an exercise ball and swimming), induced the following: 1) sustained strengthening of transmission to lumbar motoneurons and hindlimb muscles, 2) better retrograde transport of anatomical tracer, and 3) improved locomotor function. Greatest improvements were seen in the group that received exercise combined with sEMS and AAV-NT3. PMID:26424579

Spinal electro-magnetic stimulation combined with transgene delivery of neurotrophin NT-3 and exercise: novel combination therapy for spinal contusion injury.

PubMed

Petrosyan, Hayk A; Alessi, Valentina; Hunanyan, Arsen S; Sisto, Sue A; Arvanian, Victor L

2015-11-01

Our recent terminal experiments revealed that administration of a single train of repetitive spinal electromagnetic stimulation (sEMS; 35 min) enhanced synaptic plasticity in spinal circuitry following lateral hemisection spinal cord injury. In the current study, we have examined effects of repetitive sEMS applied as a single train and chronically (5 wk, every other day) following thoracic T10 contusion. Chronic studies involved examination of systematic sEMS administration alone and combined with exercise training and transgene delivery of neurotrophin [adeno-associated virus 10-neurotrophin 3 (AAV10-NT3)]. Electrophysiological intracellular/extracellular recordings, immunohistochemistry, behavioral testing, and anatomical tracing were performed to assess effects of treatments. We found that administration of a single sEMS train induced transient facilitation of transmission through preserved lateral white matter to motoneurons and hindlimb muscles in chronically contused rats with effects lasting for at least 2 h. These physiological changes associated with increased immunoreactivity of GluR1 and GluR2/3 glutamate receptors in lumbar neurons. Systematic administration of sEMS alone for 5 wk, however, was unable to induce cumulative improvements of transmission in spinomuscular circuitry or improve impaired motor function following thoracic contusion. Encouragingly, chronic administration of sEMS, followed by exercise training (running in an exercise ball and swimming), induced the following: 1) sustained strengthening of transmission to lumbar motoneurons and hindlimb muscles, 2) better retrograde transport of anatomical tracer, and 3) improved locomotor function. Greatest improvements were seen in the group that received exercise combined with sEMS and AAV-NT3.

Preservation of long-term memory and synaptic plasticity despite short-term impairments in the Tc1 mouse model of Down syndrome.

PubMed

Morice, Elise; Andreae, Laura C; Cooke, Sam F; Vanes, Lesley; Fisher, Elizabeth M C; Tybulewicz, Victor L J; Bliss, Timothy V P

2008-07-01

Down syndrome (DS) is a genetic disorder arising from the presence of a third copy of the human chromosome 21 (Hsa21). Recently, O'Doherty and colleagues in an earlier study generated a new genetic mouse model of DS (Tc1) that carries an almost complete Hsa21. Since DS is the most common genetic cause of mental retardation, we have undertaken a detailed analysis of cognitive function and synaptic plasticity in Tc1 mice. Here we show that Tc1 mice have impaired spatial working memory (WM) but spared long-term spatial reference memory (RM) in the Morris watermaze. Similarly, Tc1 mice are selectively impaired in short-term memory (STM) but have intact long-term memory (LTM) in the novel object recognition task. The pattern of impaired STM and normal LTM is paralleled by a corresponding phenotype in long-term potentiation (LTP). Freely-moving Tc1 mice exhibit reduced LTP 1 h after induction but normal maintenance over days in the dentate gyrus of the hippocampal formation. Biochemical analysis revealed a reduction in membrane surface expression of the AMPAR (alpha-amino-3-hydroxy-5-methyl-4-propionic acid receptor) subunit GluR1 in the hippocampus of Tc1 mice, suggesting a potential mechanism for the impairment in early LTP. Our observations also provide further evidence that STM and LTM for hippocampus-dependent tasks are subserved by parallel processing streams.

AMPA receptor desensitization mutation results in severe developmental phenotypes and early postnatal lethality

PubMed Central

Christie, Louisa A.; Russell, Theron A.; Xu, Jian; Wood, Lydia; Shepherd, Gordon M. G.; Contractor, Anis

2010-01-01

AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazole-propionate) recep-tors desensitize rapidly and completely in the continued presence of their endogenous ligand glutamate; however, it is not clear what role AMPA receptor desensitization plays in the brain. We generated a knock-in mouse in which a single amino acid residue, which controls desensitization, was mutated in the GluA2 (GluR2) receptor subunit (GluA2L483Y). This mutation was homozygous lethal. However, mice carrying a single mutated allele, GluA2L483Y/wt, survived past birth, but displayed severe and progressive neurological deficits including seizures and, ultimately, increased mortality. The expression of the AMPA receptor subunits GluA1 and GluA2 was decreased, whereas NMDA receptor protein expression was increased in GluA2L483Y/wt mice. Despite this, basal synaptic transmission and plasticity in the hippocampus were largely unaffected, suggesting that neurons preferentially target receptors to synapses to normalize synaptic weight. We found no gross neuroanatomical alterations in GluA2L483Y/wt mice. Moreover, there was no accumulation of AMPA receptor subunits in intracellular compartments, suggesting that folding and assembly of AMPA receptors are not affected by this mutation. Interestingly, EPSC paired pulse ratios in the CA1 were enhanced without a change in synaptic release probability, demonstrating that postsynaptic receptor properties can contribute to facilitation. The dramatic phenotype observed in this study by the introduction of a single amino acid change demonstrates an essential role in vivo for AMPA receptor desensitization. PMID:20439731

Dual-targeted tRNA-dependent amidotransferase ensures both mitochondrial and chloroplastic Gln-tRNAGln synthesis in plants

PubMed Central

Pujol, Claire; Bailly, Marc; Kern, Daniel; Maréchal-Drouard, Laurence; Becker, Hubert; Duchêne, Anne-Marie

2008-01-01

Aminoacyl-tRNAs are generally formed by direct attachment of an amino acid to tRNAs by aminoacyl-tRNA synthetases, but Gln-tRNA is an exception to this rule. Gln-tRNAGln is formed by this direct pathway in the eukaryotic cytosol and in protists or fungi mitochondria but is formed by an indirect transamidation pathway in most of bacteria, archaea, and chloroplasts. We show here that the formation of Gln-tRNAGln is also achieved by the indirect pathway in plant mitochondria. The mitochondrial-encoded tRNAGln, which is the only tRNAGln present in mitochondria, is first charged with glutamate by a nondiscriminating GluRS, then is converted into Gln-tRNAGln by a tRNA-dependent amidotransferase (AdT). The three subunits GatA, GatB, and GatC are imported into mitochondria and assemble into a functional GatCAB AdT. Moreover, the mitochondrial pathway of Gln-tRNAGln formation is shared with chloroplasts as both the GluRS, and the three AdT subunits are dual-imported into mitochondria and chloroplasts. PMID:18441100

Dendritic Glutamate Receptor mRNAs Show Contingent Local Hotspot-Dependent Translational Dynamics

PubMed Central

Kim, Tae Kyung; Sul, Jai-Yoon; Helmfors, Henrik; Langel, Ulo; Kim, Junhyong; Eberwine, James

2014-01-01

SUMMARY Protein synthesis in neuronal dendrites underlies long-term memory formation in the brain. Local translation of reporter mRNAs has demonstrated translation in dendrites at focal points called translational hotspots. Various reports have shown that hundreds to thousands of mRNAs are localized to dendrites, yet the dynamics of translation of multiple dendritic mRNAs has remained elusive. Here, we show that the protein translational activities of two dendritically localized mRNAs are spatiotemporally complex but constrained by the translational hotspots in which they are colocalized. Cotransfection of glutamate receptor 2 (GluR2) and GluR4 mRNAs (engineered to encode different fluorescent proteins) into rat hippocampal neurons demonstrates a heterogeneous distribution of translational hotspots for the two mRNAs along dendrites. Stimulation with s-3,5-dihydroxy-phenylglycine modifies the translational dynamics of both of these RNAs in a complex saturable manner. These results suggest that the translational hotspot is a primary structural regulator of the simultaneous yet differential translation of multiple mRNAs in the neuronal dendrite. PMID:24075992

Differential Expression of Glutamate Receptors in Avian Neural Pathways for Learned Vocalization

PubMed Central

WADA, KAZUHIRO; SAKAGUCHI, HIRONOBU; JARVIS, ERICH D.; HAGIWARA, MASATOSHI

2008-01-01

Learned vocalization, the substrate for human language, is a rare trait. It is found in three distantly related groups of birds—parrots, hummingbirds, and songbirds. These three groups contain cerebral vocal nuclei for learned vocalization not found in their more closely related vocal nonlearning relatives. Here, we cloned 21 receptor subunits/subtypes of all four glutamate receptor families (AMPA, kainate, NMDA, and metabotropic) and examined their expression in vocal nuclei of songbirds. We also examined expression of a subset of these receptors in vocal nuclei of hummingbirds and parrots, as well as in the brains of dove species as examples of close vocal nonlearning relatives. Among the 21 subunits/subtypes, 19 showed higher and/or lower prominent differential expression in songbird vocal nuclei relative to the surrounding brain subdivisions in which the vocal nuclei are located. This included relatively lower levels of all four AMPA subunits in lMAN, strikingly higher levels of the kainite subunit GluR5 in the robust nucleus of the arcopallium (RA), higher and lower levels respectively of the NMDA subunits NR2A and NR2B in most vocal nuclei and lower levels of the metabotropic group I subtypes (mGluR1 and -5) in most vocal nuclei and the group II subtype (mGluR2), showing a unique expression pattern of very low levels in RA and very high levels in HVC. The splice variants of AMPA subunits showed further differential expression in vocal nuclei. Some of the receptor subunits/subtypes also showed differential expression in hummingbird and parrot vocal nuclei. The magnitude of differential expression in vocal nuclei of all three vocal learners was unique compared with the smaller magnitude of differences found for nonvocal areas of vocal learners and vocal nonlearners. Our results suggest that evolution of vocal learning was accompanied by differential expression of a conserved gene family for synaptic transmission and plasticity in vocal nuclei. They also suggest that neural activity and signal transduction in vocal nuclei of vocal learners will be different relative to the surrounding brain areas. PMID:15236466

Glutamate-dependent transcriptional regulation in bergmann glia cells: involvement of p38 MAP kinase.

PubMed

Zepeda, Rossana C; Barrera, Iliana; Castelán, Francisco; Soto-Cid, Abraham; Hernández-Kelly, Luisa C; López-Bayghen, Esther; Ortega, Arturo

2008-07-01

Glutamate (Glu) is the major excitatory neurotransmitter in the Central Nervous System (CNS). Ionotropic and metabotropic glutamate receptors (GluRs) are present in neurons and glial cells and are involved in gene expression regulation. Mitogen-activated proteins kinases (MAPK) are critical for all the membrane to nuclei signaling pathways described so far. In cerebellar Bergmann glial cells, glutamate-dependent transcriptional regulation is partially dependent on p42/44 MAPK activity. Another member of this kinase family, p38 MAPK is activated by non-mitogenic stimuli through its Thr180/Tyr182 phosphorylation and phosphorylates cytoplasmic and nuclear protein targets involved in translational and transcriptional events. Taking into consideration that the role of p38MAPK in glial cells is not well understood, we demonstrate here that glutamate increases p38 MAPK phosphorylation in a time and dose dependent manner in cultured chick cerebellar Bergmann glial cells (BGC). Moreover, p38 MAPK is involved in the glutamate-induced transcriptional activation in these cells. Ionotropic as well as metabotropic glutamate receptors participate in p38 MAPK activation. The present findings demonstrate the involvement of p38 MAPK in glutamate-dependent gene expression regulation in glial cells.

Rapid modulation of gene expression profiles in the telencephalon of male goldfish following exposure to waterborne sex pheromones.

PubMed

Lado, Wudu E; Zhang, Dapeng; Mennigen, Jan A; Zamora, Jacob M; Popesku, Jason T; Trudeau, Vance L

2013-10-01

Sex pheromones rapidly affect endocrine physiology and behaviour, but little is known about their effects on gene expression in the neural tissues that mediate olfactory processing. In this study, we exposed male goldfish for 6h to waterborne 17,20βP (4.3 nM) and PGF2α (3 nM), the main pre-ovulatory and post-ovulatory pheromones, respectively. Both treatments elevated milt volume (P=0.001). Microarray analysis of male telencephalon following PGF2α treatment identified 71 unique transcripts that were differentially expressed (q<5%; 67 up, 4 down). Functional annotation of these regulated genes indicates that PGF2α pheromone exposure affects diverse biological processes including nervous system functions, energy metabolism, cholesterol/lipoprotein transport, translational regulation, transcription and chromatin remodelling, protein processing, cytoskeletal organization, and signalling. By using real-time RT-PCR, we further validated three candidate genes, ependymin-II, calmodulin-A and aldolase C, which exhibited 3-5-fold increase in expression following PGF2α exposure. Expression levels of some other genes that are thought to be important for reproduction were also determined using real-time RT-PCR. Expression of sGnRH was increased by PGF2α, but not 17,20βP, whereas cGnRH expression was increased by 17,20βP but not PGF2α. In contrast, both pheromones increase the expression of glutamate (GluR2a, NR2A) and γ-aminobutyric acid (GABAA γ2) receptor subunit mRNAs. Milt release and rapid modulation of neuronal transcription are part of the response of males to female sex pheromones. Copyright © 2013 Elsevier Inc. All rights reserved.

Activation of AMPA receptor in the infralimbic cortex facilitates extinction and attenuates the heroin-seeking behavior in rats.

PubMed

Chen, Weisheng; Wang, Yiqi; Sun, Anna; Zhou, Linyi; Xu, Wenjin; Zhu, Huaqiang; Zhuang, Dingding; Lai, Miaojun; Zhang, Fuqiang; Zhou, Wenhua; Liu, Huifen

2016-01-26

Infralimbic cortex (IL) is proposed to suppress cocaine seeking after extinction, but whether the IL regulates the extinction and reinstatement of heroin-seeking behavior is unknown. To address this issue, the male SD rats were trained to self-administer heroin under a FR1 schedule for consecutive 14 days, then the rats underwent 7 daily 2h extinction session in the operant chamber. The activation of IL by microinjection PEPA, an allosteric AMPA receptor potentiator into IL before each of extinction session facilitated the extinction responding after heroin self-administration, but did not alter the locomotor activity in an open field testing environment. Other rats were first trained under a FR1 schedule for heroin self-administration for 14 days, followed by 14 days of extinction training, and reinstatement of heroin-seeking induced by cues was measured for 2h. Intra-IL microinjecting of PEPA at 15min prior to test inhibited the reinstatement of heroin-seeking induced by cues. Moreover, the expression of GluR1 in the IL and NAc remarkably increased after treatment with PEPA during the reinstatement. These finding suggested that activation of glutamatergic projection from IL to NAc shell may be involved in the extinction and reinstatement of heroin-seeking. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Stereochemistry of quinoxaline antagonist binding to a glutamate receptor investigated by Fourier transform infrared spectroscopy.

PubMed

Madden, D R; Thiran, S; Zimmermann, H; Romm, J; Jayaraman, V

2001-10-12

The stereochemistry of the interactions between quinoxaline antagonists and the ligand-binding domain of the glutamate receptor 4 (GluR4) have been investigated by probing their vibrational modes using Fourier transform infrared spectroscopy. In solution, the electron-withdrawing nitro groups of both compounds establish a resonance equilibrium that appears to stabilize the keto form of one of the cyclic amide carbonyl bonds. Changes in the 6,7-dinitro-2,3-dihydroxyquinoxaline vibrational spectra on binding to the glutamate receptor, interpreted within the framework of a published crystal structure, illuminate the stereochemistry of the interaction and suggest that the binding site imposes a more polarized electronic bonding configuration on this antagonist. Similar spectral changes are observed for 6-cyano-7-dinitro-2,3-dihydroxyquinoxaline, confirming that its interactions with the binding site are highly similar to those of 6,7-dinitro-2,3-dihydroxyquinoxaline and leading to a model of the 6-cyano-7-dinitro-2,3-dihydroxyquinoxaline-S1S2 complex, for which no crystal structure is available. Conformational changes within the GluR ligand binding domain were also monitored. Compared with the previously reported spectral changes seen on binding of the agonist glutamate, only a relatively small change is detected on antagonist binding. This correlation between the functional effects of different classes of ligand and the magnitude of the spectroscopic changes they induce suggests that the spectral data reflect physiologically relevant conformational processes.

Molecular mapping of 21 features associated with partial monosomy 21: Involvement of the APP-SODI region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chettouh, Z.; Maunoury, C.; Sinet, P.M.

1995-07-01

We compared the phenotypes, karyotypes, and molecular data for six cases of partial monosomy 21. Regions of chromosome 21, the deletion of which corresponds to particular features of monosomy 21, were thereby defined. Five such regions were identified for 21 features. Ten of the features could be assigned to the region flanked by genes APP and SOD1: six facial features, transverse palmar crease, arthrogryposis-like symptoms, hypertonia, and contribution to mental retardation. This region, covering the interface of bands 21q21-21q22.1, is 4.7-6.4 Mb long and contains the gene encoding the glutamate receptor subunit GluR5 (GRIK1). 82 refs., 5 figs., 1 tab.

Identification of a cone bipolar cell in cat retina which has input from both rod and cone photoreceptors.

PubMed

Fyk-Kolodziej, Bozena; Qin, Pu; Pourcho, Roberta G

2003-09-08

It has been generally accepted that rod photoreceptor cells in the mammalian retina make synaptic contact with only a single population of rod bipolar cells, whereas cone photoreceptors contact a variety of cone bipolar cells. This assumption has been challenged in rodents by reports of a type of cone bipolar cell which receives input from both rods and cones. Questions remained as to whether similar pathways are present in other mammals. We have used an antiserum against the glutamate transporter GLT1-B to visualize a population of cone bipolar cells in the cat retina which make flat contacts with axon terminals of both rod and cone photoreceptor cells. These cells are identified as OFF-cone bipolar cells and correspond morphologically to type cb1 (CBa2) cone bipolar cells which are a major source of input to OFF-beta ganglion cells in the cat retina. The GLT1-B transporter was also localized to processes making flat contacts with photoreceptor terminals in rat and rabbit retinas. Examination of tissue processed for the GluR1 glutamate receptor subunit showed that cb1 cone bipolar cells, like their rodent counterparts, express this alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA)-selective receptor at their contacts with rod spherules. Thus, a direct excitatory pathway from rod photoreceptors to OFF-cone bipolar cells appears to be a common feature of mammalian retinas. Copyright 2003 Wiley-Liss, Inc.

Acute inactivation of PSD-95 destabilizes AMPA receptors at hippocampal synapses.

PubMed

Yudowski, Guillermo A; Olsen, Olav; Adesnik, Hillel; Marek, Kurt W; Bredt, David S

2013-01-01

Postsynatptic density protein (PSD-95) is a 95 kDa scaffolding protein that assembles signaling complexes at synapses. Over-expression of PSD-95 in primary hippocampal neurons selectively increases synaptic localization of AMPA receptors; however, mice lacking PSD-95 display grossly normal glutamatergic transmission in hippocampus. To further study the scaffolding role of PSD-95 at excitatory synapses, we generated a recombinant PSD-95-4c containing a tetracysteine motif, which specifically binds a fluorescein derivative and allows for acute and permanent inactivation of PSD-95. Interestingly, acute inactivation of PSD-95 in rat hippocampal cultures rapidly reduced surface AMPA receptor immunostaining, but did not affected NMDA or transferrin receptor localization. Acute photoinactivation of PSD-95 in dissociated neurons causes ∼80% decrease in GluR2 surface staining observed by live-cell microscopy within 15 minutes of PSD-95-4c ablation. These results confirm that PSD-95 stabilizes AMPA receptors at postsynaptic sites and provides insight into the dynamic interplay between PSD-95 and AMPA receptors in live neurons.

Plasticity of calcium-permeable AMPA glutamate receptors in Pro-opiomelanocortin neurons.

PubMed

Suyama, Shigetomo; Ralevski, Alexandra; Liu, Zhong-Wu; Dietrich, Marcelo O; Yada, Toshihiko; Simonds, Stephanie E; Cowley, Michael A; Gao, Xiao-Bing; Diano, Sabrina; Horvath, Tamas L

2017-08-01

POMC neurons integrate metabolic signals from the periphery. Here, we show in mice that food deprivation induces a linear current-voltage relationship of AMPAR-mediated excitatory postsynaptic currents (EPSCs) in POMC neurons. Inhibition of EPSCs by IEM-1460, an antagonist of calcium-permeable (Cp) AMPARs, diminished EPSC amplitude in the fed but not in the fasted state, suggesting entry of GluR2 subunits into the AMPA receptor complex during food deprivation. Accordingly, removal of extracellular calcium from ACSF decreased the amplitude of mEPSCs in the fed but not the fasted state. Ten days of high-fat diet exposure, which was accompanied by elevated leptin levels and increased POMC neuronal activity, resulted in increased expression of Cp-AMPARs on POMC neurons. Altogether, our results show that entry of calcium via Cp-AMPARs is inherent to activation of POMC neurons, which may underlie a vulnerability of these neurons to calcium overload while activated in a sustained manner during over-nutrition.

Enhancement of Extinction Learning Attenuates Ethanol-Seeking Behavior and Alters Plasticity in the Prefrontal Cortex

PubMed Central

Trantham-Davidson, Heather; Kassab, Amanda S.; Glen, William B.; Olive, M. Foster; Chandler, L. Judson

2014-01-01

Addiction is a chronic relapsing disorder in which relapse is often initiated by exposure to drug-related cues. The present study examined the effects of mGluR5 activation on extinction of ethanol-cue-maintained responding, relapse-like behavior, and neuronal plasticity. Rats were trained to self-administer ethanol and then exposed to extinction training during which they were administered either vehicle or the mGluR5 positive allosteric modulator 3-cyano-N-(1,3-diphenyl-1H-pyrazol-5-yl) or CDPPB. CDPPB treatment reduced active lever responding during extinction, decreased the total number of extinction sessions required to meet criteria, and attenuated cue-induced reinstatement of ethanol seeking. CDPPB facilitation of extinction was blocked by the local infusion of the mGluR5 antagonist 3-((2-methyl-4-thiazolyl)ethynyl) pyridine into the infralimbic (IfL) cortex, but had no effect when infused into the prelimbic (PrL) cortex. Analysis of dendritic spines revealed alterations in structural plasticity, whereas electrophysiological recordings demonstrated differential alterations in glutamatergic neurotransmission in the PrL and IfL cortex. Extinction was associated with increased amplitude of evoked synaptic PrL and IfL NMDA currents but reduced amplitude of PrL AMPA currents. Treatment with CDPPB prevented the extinction-induced enhancement of NMDA currents in PrL without affecting NMDA currents in the IfL. Whereas CDPPB treatment did not alter the amplitude of PrL or IfL AMPA currents, it did promote the expression of IfL calcium-permeable GluR2-lacking receptors in both abstinence- and extinction-trained rats, but had no effect in ethanol-naive rats. These results confirm changes in the PrL and IfL cortex in glutamatergic neurotransmission during extinction learning and demonstrate that manipulation of mGluR5 facilitates extinction of ethanol cues in association with neuronal plasticity. PMID:24872560

Enhancement of extinction learning attenuates ethanol-seeking behavior and alters plasticity in the prefrontal cortex.

PubMed

Gass, Justin T; Trantham-Davidson, Heather; Kassab, Amanda S; Glen, William B; Olive, M Foster; Chandler, L Judson

2014-05-28

Addiction is a chronic relapsing disorder in which relapse is often initiated by exposure to drug-related cues. The present study examined the effects of mGluR5 activation on extinction of ethanol-cue-maintained responding, relapse-like behavior, and neuronal plasticity. Rats were trained to self-administer ethanol and then exposed to extinction training during which they were administered either vehicle or the mGluR5 positive allosteric modulator 3-cyano-N-(1,3-diphenyl-1H-pyrazol-5-yl) or CDPPB. CDPPB treatment reduced active lever responding during extinction, decreased the total number of extinction sessions required to meet criteria, and attenuated cue-induced reinstatement of ethanol seeking. CDPPB facilitation of extinction was blocked by the local infusion of the mGluR5 antagonist 3-((2-methyl-4-thiazolyl)ethynyl) pyridine into the infralimbic (IfL) cortex, but had no effect when infused into the prelimbic (PrL) cortex. Analysis of dendritic spines revealed alterations in structural plasticity, whereas electrophysiological recordings demonstrated differential alterations in glutamatergic neurotransmission in the PrL and IfL cortex. Extinction was associated with increased amplitude of evoked synaptic PrL and IfL NMDA currents but reduced amplitude of PrL AMPA currents. Treatment with CDPPB prevented the extinction-induced enhancement of NMDA currents in PrL without affecting NMDA currents in the IfL. Whereas CDPPB treatment did not alter the amplitude of PrL or IfL AMPA currents, it did promote the expression of IfL calcium-permeable GluR2-lacking receptors in both abstinence- and extinction-trained rats, but had no effect in ethanol-naive rats. These results confirm changes in the PrL and IfL cortex in glutamatergic neurotransmission during extinction learning and demonstrate that manipulation of mGluR5 facilitates extinction of ethanol cues in association with neuronal plasticity. Copyright © 2014 the authors 0270-6474/14/347562-13$15.00/0.

Focused microwave irradiation-assisted immunohistochemistry to study effects of ketamine on phospho-ERK expression in the mouse brain.

PubMed

Fernandes, Alda; Li, Yu-Wen

2017-09-01

Ketamine produces rapid and long-lasting antidepressant effects in depressive patients. Preclinical studies demonstrate that ketamine stimulates AMPA receptor transmission and activates BDNF/TrkB-Akt/ERK-mTOR signaling cascades, leading to a sustained increase in synaptic protein synthesis and strengthening of synaptic plasticity, a potential mechanism underlying the antidepressant effects. The purpose of this study was to develop an immunohistochemistry (IHC) assay to map the distribution of extracellular signal-regulated kinase (ERK) phosphorylation in the mouse brain in response to systemic ketamine treatment. We established a focused microwave irradiation-assisted IHC assay to detect phosphorylated (phospho) proteins including phospho-ERK, phospho- cAMP-response- element-binding protein (CREB), phospho- glutamate receptor 1 (GluR1) and phospho- calcium/calmodulin-dependent protein kinase II (CaMKII) with greater sensitivity and reproducibility in comparison to conventional IHC methods. A single dose of ketamine produced a robust, dose- and time-dependent increase in phospho-ERK immunoreactive (phospho-ERK-ir) neurons in the medial prefrontal cortex (mPFC) and the central nucleus of the amygdala. Phospho-ERK-ir neurons in the mPFC were primarily located in the prelimbic and anterior cingulate subregions with the morphology resembling pyramidal neurons. An increase in phospho-ERK-ir was also observed in the brainstem dorsal raphe nucleus and locus coeruleus. The NMDA GluN2B subtype receptor antagonist Ro 25-6981 increased phospho-ERK expression in the brain in a similar pattern as ketamine. In summary, we have established a sensitive and reliable focused microwave irradiation-assisted IHC assay, and defined the activation pattern of ERK, in response to systemic ketamine and Ro 25-6981 treatment, in brain regions that are potentially responsible for mediating the antidepressant effects. Copyright © 2017 Elsevier B.V. All rights reserved.

Maturation profile of inferior olivary neurons expressing ionotropic glutamate receptors in rats: role in coding linear accelerations.

PubMed

Li, Chuan; Han, Lei; Ma, Chun-Wai; Lai, Suk-King; Lai, Chun-Hong; Shum, Daisy Kwok Yan; Chan, Ying-Shing

2013-07-01

Using sinusoidal oscillations of linear acceleration along both the horizontal and vertical planes to stimulate otolith organs in the inner ear, we charted the postnatal time at which responsive neurons in the rat inferior olive (IO) first showed Fos expression, an indicator of neuronal recruitment into the otolith circuit. Neurons in subnucleus dorsomedial cell column (DMCC) were activated by vertical stimulation as early as P9 and by horizontal (interaural) stimulation as early as P11. By P13, neurons in the β subnucleus of IO (IOβ) became responsive to horizontal stimulation along the interaural and antero-posterior directions. By P21, neurons in the rostral IOβ became also responsive to vertical stimulation, but those in the caudal IOβ remained responsive only to horizontal stimulation. Nearly all functionally activated neurons in DMCC and IOβ were immunopositive for the NR1 subunit of the NMDA receptor and the GluR2/3 subunit of the AMPA receptor. In situ hybridization studies further indicated abundant mRNA signals of the glutamate receptor subunits by the end of the second postnatal week. This is reinforced by whole-cell patch-clamp data in which glutamate receptor-mediated miniature excitatory postsynaptic currents of rostral IOβ neurons showed postnatal increase in amplitude, reaching the adult level by P14. Further, these neurons exhibited subthreshold oscillations in membrane potential as from P14. Taken together, our results support that ionotropic glutamate receptors in the IO enable postnatal coding of gravity-related information and that the rostral IOβ is the only IO subnucleus that encodes spatial orientations in 3-D.

Antinociceptive effects of MSVIII-19, a functional antagonist of the GluK1 kainate receptor

PubMed Central

Qiu, Chang-Shen; Wyhe, Leanne Lash-Van; Sasaki, Makoto; Sakai, Ryuichi; Swanson, Geoffrey T.; Gereau, Robert W.

2011-01-01

The ionotropic glutamate receptor subunit, GluK1 (GluR5), is expressed in many regions of nervous system related to sensory transmission. Recently, a selective ligand for the GluK1 receptor, MSVIII-19 (8,9-dideoxy-neodysiherbaine), was synthesized as a derivative of dysiherbaine, a toxin isolated from the marine sponge Lendenfeldia chodrodes. MSVIII-19 potently desensitizes GluK1 receptors without channel activation, rendering it useful as a functional antagonist. Given the high selectivity for GluK1 and the proposed role for this glutamate receptor in nociception, we sought to test the analgesic potential of MSVIII-19 in a series of models of inflammatory, neuropathic, and visceral pain in mice. MSVIII-19 delivered intrathecally (i.t.) dose-dependently reduced formalin-induced spontaneous behaviors and reduced thermal hypersensitivity 3 hours after formalin injection and 24 hours after complete freund’s adjuvant-induced inflammation, but had no effect on mechanical sensitivity in the same models. I.T. MSVIII-19 significantly reduced both thermal hyperalgesia and mechanical hypersensitivity in the chronic constriction injury model of neuropathic pain, but had no effect in the acetic acid model of visceral pain. Peripheral administration of MSVIII-19 had no analgesic efficacy in any of these models. Finally, i.t. MSVIII-19 did not alter responses in tail flick tests or performance on the accelerating RotaRod. These data suggest that spinal administration of MSVIII-19 reverses hypersensitivity in several models of pain in mice, supporting the clinical potential of GluK1 antagonists for the management of pain. PMID:21324591

Pituitary adenylyl cyclase-activating polypeptide (PACAP) and its receptor (PAC1-R) are positioned to modulate afferent signaling in the cochlea.

PubMed

Drescher, M J; Drescher, D G; Khan, K M; Hatfield, J S; Ramakrishnan, N A; Abu-Hamdan, M D; Lemonnier, L A

2006-09-29

Pituitary adenylyl cyclase-activating polypeptide (PACAP), via its specific receptor pituitary adenylyl cyclase-activating polypeptide receptor 1 (PAC1-R), is known to have roles in neuromodulation and neuroprotection associated with glutamatergic and cholinergic neurotransmission, which, respectively, are believed to form the primary basis for afferent and efferent signaling in the organ of Corti. Previously, we identified transcripts for PACAP preprotein and multiple splice variants of its receptor, PAC1-R, in microdissected cochlear subfractions. In the present work, neural localizations of PACAP and PAC1-R within the organ of Corti and spiral ganglion were examined, defining sites of PACAP action. Immunolocalization of PACAP and PAC1-R in the organ of Corti and spiral ganglion was compared with immunolocalization of choline acetyltransferase (ChAT) and synaptophysin as efferent neuronal markers, and glutamate receptor 2/3 (GluR2/3) and neurofilament 200 as afferent neuronal markers, for each of the three cochlear turns. Brightfield microscopy giving morphological detail for individual immunolocalizations was followed by immunofluorescence detection of co-localizations. PACAP was found to be co-localized with ChAT in nerve fibers of the intraganglionic spiral bundle and beneath the inner and outer hair cells within the organ of Corti. Further, evidence was obtained that PACAP is expressed in type I afferent axons leaving the spiral ganglion en route to the auditory nerve, potentially serving as a neuromodulator in axonal terminals. In contrast to the efferent localization of PACAP within the organ of Corti, PAC1-R immunoreactivity was co-localized with afferent dendritic neuronal marker GluR2/3 in nerve fibers passing beneath and lateral to the inner hair cell and in fibers at supranuclear and basal sites on outer hair cells. Given the known association of PACAP with catecholaminergic neurotransmission in sympathoadrenal function, we also re-examined the issue of whether the organ of Corti receives adrenergic innervation. We now demonstrate the existence of nerve fibers within the organ of Corti which are immunoreactive for the adrenergic marker dopamine beta-hydroxylase (DBH). DBH immunoreactivity was particularly prominent in nerve fibers both at the base and near the cuticular plate of outer hair cells of the apical turn, extending to the non-sensory Hensen's cell region. Evidence was obtained for limited co-localization of DBH with PAC1-R and PACAP. In the process of this investigation, we obtained evidence that efferent and afferent nerve fibers, in addition to adrenergic nerve fibers, are present at supranuclear sites on outer hair cells and distributed within the non-sensory epithelium of the apical cochlear turn for rat, based upon immunoreactivity for the corresponding neuronal markers. Overall, PACAP is hypothesized to act within the organ of Corti as an efferent neuromodulator of afferent signaling via PAC1-R that is present on type I afferent dendrites, in position to afford protection from excitotoxicity. Additionally, PACAP/PAC1-R may modulate secretion of catecholamines from adrenergic terminals within the organ of Corti.

Distribution of protein kinase C isoforms in the cat retina.

PubMed

Fyk-Kolodziej, Bozena; Cai, Wenhui; Pourcho, Roberta G

2002-01-01

Immunocytochemical localization was carried out for five isoforms of protein kinase C (PKC) in the cat retina. In common with other mammalian species, PKCalpha was found in rod bipolar cells. Staining was also seen in a small population of cone bipolar cells with axon terminals ramifying near the middle of the inner plexiform layer (IPL). PKCbetaI was localized to rod bipolar cells, one class of cone bipolar cell, and numerous amacrine and displaced amacrine cells. Staining for PKCbetaI was seen in three types of cone bipolar cells as well as in amacrine and ganglion cells. Immunoreactivity for both PKCepsilon and PKCzeta was found in rod bipolar cells; PKCepsilon was also seen in a population of cone bipolar cells and a few amacrine and ganglion cells whereas PKCzeta was found in all ganglion cells. Double-label immunofluorescence studies showed that dendrites of the two PKCbetaII-positive OFF-cone bipolar cells exhibit immmunoreactivity for the kainate-selective glutamate receptor GluR5. The third PKCbetaII cone bipolar is an ON-type cell and did not stain for GluR5. The retinal distribution of these isoforms of PKC is consistent with a role in modulation of various aspects of neurotransmission including synaptic vesicle release and regulation of receptor molecules.

On the binding determinants of the glutamate agonist with the glutamate receptor ligand binding domain.

PubMed

Speranskiy, Kirill; Kurnikova, Maria

2005-08-30

Ionotropic glutamate receptors (GluRs) are ligand-gated membrane channel proteins found in the central neural system that mediate a fast excitatory response of neurons. In this paper, we report theoretical analysis of the ligand-protein interactions in the binding pocket of the S1S2 (ligand binding) domain of the GluR2 receptor in the closed conformation. By utilizing several theoretical methods ranging from continuum electrostatics to all-atom molecular dynamics simulations and quantum chemical calculations, we were able to characterize in detail glutamate agonist binding to the wild-type and E705D mutant proteins. A theoretical model of the protein-ligand interactions is validated via direct comparison of theoretical and Fourier transform infrared spectroscopy (FTIR) measured frequency shifts of the ligand's carboxylate group vibrations [Jayaraman et al. (2000) Biochemistry 39, 8693-8697; Cheng et al. (2002) Biochemistry 41, 1602-1608]. A detailed picture of the interactions in the binding site is inferred by analyzing contributions to vibrational frequencies produced by protein residues forming the ligand-binding pocket. The role of mobility and hydrogen-bonding network of water in the ligand-binding pocket and the contribution of protein residues exposed in the binding pocket to the binding and selectivity of the ligand are discussed. It is demonstrated that the molecular surface of the protein in the ligand-free state has mainly positive electrostatic potential attractive to the negatively charged ligand, and the potential produced by the protein in the ligand-binding pocket in the closed state is complementary to the distribution of the electrostatic potential produced by the ligand itself. Such charge complementarity ensures specificity to the unique charge distribution of the ligand.

Glutamatergic Receptor Activation in the Commisural Nucleus Tractus Solitarii (cNTS) Mediates Brain Glucose Retention (BGR) Response to Anoxic Carotid Chemoreceptor (CChr) Stimulation in Rats.

PubMed

Cuéllar, R; Montero, S; Luquín, S; García-Estrada, J; Dobrovinskaya, O; Melnikov, V; Lemus, M; de Álvarez-Buylla, E Roces

2015-01-01

Glutamate, released from central terminals of glossopharyngeal nerve, is a major excitatory neurotransmitter of commissural nucleus tractus solitarii (cNTS) afferent terminals, and brain derived neurotrophic factor (BDNF) has been shown to attenuate glutamatergic AMPA currents in NTS neurons. To test the hypothesis that AMPA contributes to glucose regulation in vivo modulating the hyperglycemic reflex with brain glucose retention (BGR), we microinjected AMPA and NBQX (AMPA antagonist) into the cNTS before carotid chemoreceptor stimulation in anesthetized normal Wistar rats, while hyperglycemic reflex an brain glucose retention (BGR) were analyzed. To investigate the underlying mechanisms, GluR2/3 receptor and c-Fos protein expressions in cNTS neurons were determined. We showed that AMPA in the cNTS before CChr stimulation inhibited BGR observed in aCSF group. In contrast, NBQX in similar conditions, did not modify the effects on glucose variables observed in aCSF control group. These experiments suggest that glutamatergic pathways, via AMPA receptors, in the cNTS may play a role in glucose homeostasis.

TrkB activation by 7, 8-dihydroxyflavone increases synapse AMPA subunits and ameliorates spatial memory deficits in a mouse model of Alzheimer's disease.

PubMed

Gao, Lei; Tian, Mi; Zhao, Hong-Yun; Xu, Qian-Qian; Huang, Yu-Ming; Si, Qun-Cao; Tian, Qing; Wu, Qing-Ming; Hu, Xia-Min; Sun, Li-Bo; McClintock, Shawn M; Zeng, Yan

2016-02-01

We recently demonstrated that activation of tyrosine receptor kinase B (TrkB) by 7, 8-dihydroxyflavone (7, 8-DHF), the selective TrkB agonist, increased surface alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors (AMPARs) AMPA receptor subunit GluR1 (GluA1) subunit expression at the synapses of Fragile X Syndrome mutant mice. This present study investigated the effects of 7, 8-DHF on both memory function and synapse structure in relation to the synapse protein level of AMPARs in the Tg2576 Alzheimer's disease (AD) mouse model. The study found that chronic oral administration of 7, 8-DHF significantly improved spatial memory and minimized dendrite loss in the hippocampus of Tg2576 mice. A key feature of 7, 8-DHF action was the increased expression of both GluA1 and GluA2 at synapses. Interestingly, 7, 8-DHF had no effect on the attenuation of amyloid precursor protein or Aβ exhibiting in the Tg2576 AD brains, yet it activated the phosphorylation of TrkB receptors and its downstream signals including CaMKII, Akt, Erk1/2, and cAMP-response element-binding protein. Importantly, cyclotraxin B (a TrkB inhibitor), U0126 (a Ras-ERK pathway inhibitor), Wortmannin (an Akt phosphorylation inhibitor), and KN-93 (a CaMKII inhibitor) counteracted the enhanced expression and phosphorylation of AMPAR subunits induced by 7, 8-DHF. Collectively, our results demonstrated that 7, 8-DHF acted on TrkB and resolved learning and memory impairments in the absence of reduced amyloid in amyloid precursor protein transgenic mice partially through improved synaptic structure and enhanced synaptic AMPARs. The findings suggest that the application of 7, 8-DHF may be a promising new approach to improve cognitive abilities in AD. We provided extensive data demonstrating that 7, 8-dihydroflavone, the TrkB agonist, improved Tg2576 mice spatial memory. This improvement is correlated with a reversion to normal values of GluA1 and GluA2 AMPA receptor subunits and dendritic spines in CA1. This work suggests that 7, 8-DHF is a suitable drug to potentiate in vivo Tropomyosin receptor kinase B (TrkB) signaling in the Alzheimer's disease mice model. © 2015 International Society for Neurochemistry.

Individual stress vulnerability is predicted by short-term memory and AMPA receptor subunit ratio in the hippocampus.

PubMed

Schmidt, Mathias V; Trümbach, Dietrich; Weber, Peter; Wagner, Klaus; Scharf, Sebastian H; Liebl, Claudia; Datson, Nicole; Namendorf, Christian; Gerlach, Tamara; Kühne, Claudia; Uhr, Manfred; Deussing, Jan M; Wurst, Wolfgang; Binder, Elisabeth B; Holsboer, Florian; Müller, Marianne B

2010-12-15

Increased vulnerability to aversive experiences is one of the main risk factors for stress-related psychiatric disorders as major depression. However, the molecular bases of vulnerability, on the one hand, and stress resilience, on the other hand, are still not understood. Increasing clinical and preclinical evidence suggests a central involvement of the glutamatergic system in the pathogenesis of major depression. Using a mouse paradigm, modeling increased stress vulnerability and depression-like symptoms in a genetically diverse outbred strain, and we tested the hypothesis that differences in AMPA receptor function may be linked to individual variations in stress vulnerability. Vulnerable and resilient animals differed significantly in their dorsal hippocampal AMPA receptor expression and AMPA receptor binding. Treatment with an AMPA receptor potentiator during the stress exposure prevented the lasting effects of chronic social stress exposure on physiological, neuroendocrine, and behavioral parameters. In addition, spatial short-term memory, an AMPA receptor-dependent behavior, was found to be predictive of individual stress vulnerability and response to AMPA potentiator treatment. Finally, we provide evidence that genetic variations in the AMPA receptor subunit GluR1 are linked to the vulnerable phenotype. Therefore, we propose genetic variations in the AMPA receptor system to shape individual stress vulnerability. Those individual differences can be predicted by the assessment of short-term memory, thereby opening up the possibility for a specific treatment by enhancing AMPA receptor function.

Rescuing effects of RXR agonist bexarotene on aging-related synapse loss depend on neuronal LRP1.

PubMed

Tachibana, Masaya; Shinohara, Mitsuru; Yamazaki, Yu; Liu, Chia-Chen; Rogers, Justin; Bu, Guojun; Kanekiyo, Takahisa

2016-03-01

Apolipoprotein E (apoE) plays a critical role in maintaining synaptic integrity by transporting cholesterol to neurons through the low-density lipoprotein receptor related protein-1 (LRP1). Bexarotene, a retinoid X receptor (RXR) agonist, has been reported to have potential beneficial effects on cognition by increasing brain apoE levels and lipidation. To investigate the effects of bexarotene on aging-related synapse loss and the contribution of neuronal LRP1 to the pathway, forebrain neuron-specific LRP1 knockout (nLrp1(-/-)) and littermate control mice were administered with bexarotene-formulated diet (100mg/kg/day) or control diet at the age of 20-24 months for 8 weeks. Upon bexarotene treatment, levels of brain apoE and ATP-binding cassette sub-family A member 1 (ABCA1) were significantly increased in both mice. While levels of PSD95, glutamate receptor 1 (GluR1), and N-methyl-d-aspartate receptor NR1 subunit (NR1), which are key postsynaptic proteins that regulate synaptic plasticity, were decreased with aging, they were restored by bexarotene treatment in the brains of control but not nLrp1(-/-) mice. These results indicate that the beneficial effects of bexarotene on synaptic integrity depend on the presence of neuronal LRP1. However, we also found that bexarotene treatment led to the activation of glial cells, weight loss and hepatomegaly, which are likely due to hepatic failure. Taken together, our results demonstrate that apoE-targeted treatment through the RXR pathway has a potential beneficial effect on synapses during aging; however, the therapeutic application of bexarotene requires extreme caution due to its toxic side effects. Copyright © 2015 Elsevier Inc. All rights reserved.

Ketogenic diet does not impair spatial ability controlled by the hippocampus in male rats.

PubMed

Fukushima, Atsushi; Ogura, Yuji; Furuta, Miyako; Kakehashi, Chiaki; Funabashi, Toshiya; Akema, Tatsuo

2015-10-05

A ketogenic diet was recently shown to reduce glutamate accumulation in synaptic vesicles, decreasing glutamate transmission. We questioned whether a ketogenic diet affects hippocampal function, as glutamate transmission is critically involved in visuospatial ability. In the present study, male Wistar rats were maintained on a ketogenic diet containing 10% protein and 90% fat with complements for 3 weeks to change their energy expenditure from glucose-dependent to fat-dependent. Control rats were fed a diet containing 10% protein, 10% fat, and 80% carbohydrates. The fat-dependent energy expenditure induced by the ketogenic diet led to decreased body weight and increased blood ketone production, though the rats in the two groups consumed the same number of calories. The ketogenic diet did not alter food preferences for the control or high-fat diet containing 10% protein, 45% fat, and 45% carbohydrates. Anxiety in the open field was not altered by ingestion the ketogenic diet. However, rats fed the ketogenic diet performed better in the Y-maze test than rats fed the control diet. No difference was observed between the two groups in the Morris water maze test. Finally, Western blot revealed that the hippocampal expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-type glutamate receptor subunit 1 (GluR1) was significantly increased in mice fed a ketogenic diet. These results suggest that hippocampal function is not impaired by a ketogenic diet and we speculate that the fat-dependent energy expenditure does not impair visuospatial ability. Copyright © 2015 Elsevier B.V. All rights reserved.

Lead Exposure Impairs Hippocampus Related Learning and Memory by Altering Synaptic Plasticity and Morphology During Juvenile Period.

PubMed

Wang, Tao; Guan, Rui-Li; Liu, Ming-Chao; Shen, Xue-Feng; Chen, Jing Yuan; Zhao, Ming-Gao; Luo, Wen-Jing

2016-08-01

Lead (Pb) is an environmental neurotoxic metal. Pb exposure may cause neurobehavioral changes, such as learning and memory impairment, and adolescence violence among children. Previous animal models have largely focused on the effects of Pb exposure during early development (from gestation to lactation period) on neurobehavior. In this study, we exposed Sprague-Dawley rats during the juvenile stage (from juvenile period to adult period). We investigated the synaptic function and structural changes and the relationship of these changes to neurobehavioral deficits in adult rats. Our results showed that juvenile Pb exposure caused fear-conditioned memory impairment and anxiety-like behavior, but locomotion and pain behavior were indistinguishable from the controls. Electrophysiological studies showed that long-term potentiation induction was affected in Pb-exposed rats, and this was probably due to excitatory synaptic transmission impairment in Pb-exposed rats. We found that NMDA and AMPA receptor-mediated current was inhibited, whereas the GABA synaptic transmission was normal in Pb-exposed rats. NR2A and phosphorylated GluR1 expression decreased. Moreover, morphological studies showed that density of dendritic spines declined by about 20 % in the Pb-treated group. The spine showed an immature form in Pb-exposed rats, as indicated by spine size measurements. However, the length and arborization of dendrites were unchanged. Our results suggested that juvenile Pb exposure in rats is associated with alterations in the glutamate receptor, which caused synaptic functional and morphological changes in hippocampal CA1 pyramidal neurons, thereby leading to behavioral changes.

Contextual Information Drives the Reconsolidation-Dependent Updating of Retrieved Fear Memories

PubMed Central

Jarome, Timothy J; Ferrara, Nicole C; Kwapis, Janine L; Helmstetter, Fred J

2015-01-01

Stored memories enter a temporary state of vulnerability following retrieval known as ‘reconsolidation', a process that can allow memories to be modified to incorporate new information. Although reconsolidation has become an attractive target for treatment of memories related to traumatic past experiences, we still do not know what new information triggers the updating of retrieved memories. Here, we used biochemical markers of synaptic plasticity in combination with a novel behavioral procedure to determine what was learned during memory reconsolidation under normal retrieval conditions. We eliminated new information during retrieval by manipulating animals' training experience and measured changes in proteasome activity and GluR2 expression in the amygdala, two established markers of fear memory lability and reconsolidation. We found that eliminating new contextual information during the retrieval of memories for predictable and unpredictable fear associations prevented changes in proteasome activity and glutamate receptor expression in the amygdala, indicating that this new information drives the reconsolidation of both predictable and unpredictable fear associations on retrieval. Consistent with this, eliminating new contextual information prior to retrieval prevented the memory-impairing effects of protein synthesis inhibitors following retrieval. These results indicate that under normal conditions, reconsolidation updates memories by incorporating new contextual information into the memory trace. Collectively, these results suggest that controlling contextual information present during retrieval may be a useful strategy for improving reconsolidation-based treatments of traumatic memories associated with anxiety disorders such as post-traumatic stress disorder. PMID:26062788

Activation of 5-HT7 serotonin receptors reverses metabotropic glutamate receptor-mediated synaptic plasticity in wild-type and Fmr1 knockout mice, a model of Fragile X syndrome.

PubMed

Costa, Lara; Spatuzza, Michela; D'Antoni, Simona; Bonaccorso, Carmela M; Trovato, Chiara; Musumeci, Sebastiano A; Leopoldo, Marcello; Lacivita, Enza; Catania, Maria V; Ciranna, Lucia

2012-12-01

Fragile X syndrome (FXS) is a genetic cause of intellectual disability and autism. Fmr1 knockout (Fmr1 KO) mice, an animal model of FXS, exhibit spatial memory impairment and synapse malfunctioning in the hippocampus, with abnormal enhancement of long-term depression mediated by metabotropic glutamate receptors (mGluR-LTD). The neurotransmitter serotonin (5-HT) modulates hippocampal-dependent learning through serotonin 1A (5-HT1A) and serotonin 7 (5-HT7) receptors; the underlying mechanisms are unknown. We used electrophysiology to test the effects of 5-HT on mGluR-LTD in wild-type and Fmr1 KO mice and immunocytochemistry and biotinylation assay to study related changes of 2-amino-3-(5-methyl-3-oxo-1,2-oxazol-4-yl)propanoic acid (AMPA) glutamate receptor surface expression. Application of 5-HT or 8-OH-DPAT (a mixed 5-HT1A/5-HT7 agonist) reversed mGluR-LTD in hippocampal slices. Reversal of mGluR-LTD by 8-OH-DPAT persisted in the presence of the 5-HT1A receptor antagonist WAY-100635, was abolished by SB-269970 (5-HT7 receptor antagonist), and was mimicked by LP-211, a novel selective 5-HT7 receptor agonist. Consistently, 8-OH-DPAT decreased mGluR-mediated reduction of AMPA glutamate receptor 2 (GluR2) subunit surface expression in hippocampal slices and cultured hippocampal neurons, an effect mimicked by LP-211 and blocked by SB-269970. In Fmr1 KO mice, mGluR-LTD was abnormally enhanced; similarly to wild-type, 8-OH-DPAT reversed mGluR-LTD and decreased mGluR-induced reduction of surface AMPA receptors, an effect antagonized by SB-269970. Serotonin 7 receptor activation reverses metabotropic glutamate receptor-induced AMPA receptor internalization and LTD both in wild-type and in Fmr1 KO mice, correcting excessive mGluR-LTD. Therefore, selective activation of 5-HT7 receptors may represent a novel strategy in the therapy of FXS. Copyright © 2012 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Inhibition of spontaneous recovery of fear by mGluR5 after prolonged extinction training.

PubMed

Mao, Sheng-Chun; Chang, Chih-Hua; Wu, Chia-Chen; Orejarena, M Juliana; Orejanera, Maria Juliana; Manzoni, Olivier J; Gean, Po-Wu

2013-01-01

Fear behavior is vital for survival and involves learning contingent associations of non-threatening cues with aversive stimuli. In contrast, excessive levels of fear can be maladaptive and lead to anxiety disorders. Generally, extensive sessions of extinction training correlates with reduced spontaneous recovery. The molecular mechanisms underlying the long-term inhibition of fear recovery following repeated extinction training are not fully understood. Here we show that in rats, prolonged extinction training causes greater reduction in both fear-potentiated startle and spontaneous recovery. This effect was specifically blocked by metabotropic glutamate receptor 5 (mGluR5), but not by mGluR1 antagonists and by a protein synthesis inhibitor. Similar inhibition of memory recovery following prolonged extinction training was also observed in mice. In agreement with the instrumental role of mGluR5 in the prolonged inhibition of fear recovery, we found that FMR1-/- mice which exhibit enhanced mGluR5-mediated signaling exhibit lower spontaneous recovery of fear after extinction training than wild-type littermates. At the molecular level, we discovered that prolonged extinction training reversed the fear conditioning-induced increase in surface expression of GluR1, AMPA/NMDA ratio, postsynaptic density-95 (PSD-95) and synapse-associated protein-97 (SAP97). Accordingly, delivery of Tat-GluR2(3Y), a synthetic peptide that blocks AMPA receptor endocytosis, inhibited prolonged extinction training-induced inhibition of fear recovery. Together, our results demonstrate that prolonged extinction training results in the mGluR5-dependent long-term inhibition of fear recovery. This effect may involve the degradation of original memory and may explain the beneficial effects of prolonged exposure therapy for the treatment of phobias.

Glutamate receptors in the nucleus tractus solitarius contribute to ventilatory acclimatization to hypoxia in rat

PubMed Central

Pamenter, Matthew E; Carr, J Austin; Go, Ariel; Fu, Zhenxing; Reid, Stephen G; Powell, Frank L

2014-01-01

When exposed to a hypoxic environment the body's first response is a reflex increase in ventilation, termed the hypoxic ventilatory response (HVR). With chronic sustained hypoxia (CSH), such as during acclimatization to high altitude, an additional time-dependent increase in ventilation occurs, which increases the HVR. This secondary increase persists after exposure to CSH and involves plasticity within the circuits in the central nervous system that control breathing. Currently these mechanisms of HVR plasticity are unknown and we hypothesized that they involve glutamatergic synapses in the nucleus tractus solitarius (NTS), where afferent endings from arterial chemoreceptors terminate. To test this, we treated rats held in normoxia (CON) or 10% O2 (CSH) for 7 days and measured ventilation in conscious, unrestrained animals before and after microinjecting glutamate receptor agonists and antagonists into the NTS. In normoxia, AMPA increased ventilation 25% and 50% in CON and CSH, respectively, while NMDA doubled ventilation in both groups (P < 0.05). Specific AMPA and NMDA receptor antagonists (NBQX and MK801, respectively) abolished these effects. MK801 significantly decreased the HVR in CON rats, and completely blocked the acute HVR in CSH rats but had no effect on ventilation in normoxia. NBQX decreased ventilation whenever it was increased relative to normoxic controls; i.e. acute hypoxia in CON and CSH, and normoxia in CSH. These results support our hypothesis that glutamate receptors in the NTS contribute to plasticity in the HVR with CSH. The mechanism underlying this synaptic plasticity is probably glutamate receptor modification, as in CSH rats the expression of phosphorylated NR1 and GluR1 proteins in the NTS increased 35% and 70%, respectively, relative to that in CON rats. PMID:24492841

Glutamate receptors in the nucleus tractus solitarius contribute to ventilatory acclimatization to hypoxia in rat.

PubMed

Pamenter, Matthew E; Carr, J Austin; Go, Ariel; Fu, Zhenxing; Reid, Stephen G; Powell, Frank L

2014-04-15

When exposed to a hypoxic environment the body's first response is a reflex increase in ventilation, termed the hypoxic ventilatory response (HVR). With chronic sustained hypoxia (CSH), such as during acclimatization to high altitude, an additional time-dependent increase in ventilation occurs, which increases the HVR. This secondary increase persists after exposure to CSH and involves plasticity within the circuits in the central nervous system that control breathing. Currently these mechanisms of HVR plasticity are unknown and we hypothesized that they involve glutamatergic synapses in the nucleus tractus solitarius (NTS), where afferent endings from arterial chemoreceptors terminate. To test this, we treated rats held in normoxia (CON) or 10% O2 (CSH) for 7 days and measured ventilation in conscious, unrestrained animals before and after microinjecting glutamate receptor agonists and antagonists into the NTS. In normoxia, AMPA increased ventilation 25% and 50% in CON and CSH, respectively, while NMDA doubled ventilation in both groups (P < 0.05). Specific AMPA and NMDA receptor antagonists (NBQX and MK801, respectively) abolished these effects. MK801 significantly decreased the HVR in CON rats, and completely blocked the acute HVR in CSH rats but had no effect on ventilation in normoxia. NBQX decreased ventilation whenever it was increased relative to normoxic controls; i.e. acute hypoxia in CON and CSH, and normoxia in CSH. These results support our hypothesis that glutamate receptors in the NTS contribute to plasticity in the HVR with CSH. The mechanism underlying this synaptic plasticity is probably glutamate receptor modification, as in CSH rats the expression of phosphorylated NR1 and GluR1 proteins in the NTS increased 35% and 70%, respectively, relative to that in CON rats.

Structure of an archaeal non-discriminating glutamyl-tRNA synthetase: a missing link in the evolution of Gln-tRNAGln formation.

PubMed

Nureki, Osamu; O'Donoghue, Patrick; Watanabe, Nobuhisa; Ohmori, Atsuhiko; Oshikane, Hiroyuki; Araiso, Yuhei; Sheppard, Kelly; Söll, Dieter; Ishitani, Ryuichiro

2010-11-01

The molecular basis of the genetic code relies on the specific ligation of amino acids to their cognate tRNA molecules. However, two pathways exist for the formation of Gln-tRNA(Gln). The evolutionarily older indirect route utilizes a non-discriminating glutamyl-tRNA synthetase (ND-GluRS) that can form both Glu-tRNA(Glu) and Glu-tRNA(Gln). The Glu-tRNA(Gln) is then converted to Gln-tRNA(Gln) by an amidotransferase. Since the well-characterized bacterial ND-GluRS enzymes recognize tRNA(Glu) and tRNA(Gln) with an unrelated α-helical cage domain in contrast to the β-barrel anticodon-binding domain in archaeal and eukaryotic GluRSs, the mode of tRNA(Glu)/tRNA(Gln) discrimination in archaea and eukaryotes was unknown. Here, we present the crystal structure of the Methanothermobacter thermautotrophicus ND-GluRS, which is the evolutionary predecessor of both the glutaminyl-tRNA synthetase (GlnRS) and the eukaryotic discriminating GluRS. Comparison with the previously solved structure of the Escherichia coli GlnRS-tRNA(Gln) complex reveals the structural determinants responsible for specific tRNA(Gln) recognition by GlnRS compared to promiscuous recognition of both tRNAs by the ND-GluRS. The structure also shows the amino acid recognition pocket of GluRS is more variable than that found in GlnRS. Phylogenetic analysis is used to reconstruct the key events in the evolution from indirect to direct genetic encoding of glutamine.

Transplacental Exposure to AZT Induces Adverse Neurochemical and Behavioral Effects in a Mouse Model: Protection by L-Acetylcarnitine

PubMed Central

Venerosi Pesciolini, Aldina; Tramutola, Antonella; Ajmone-Cat, Maria Antonietta; Cinque, Carlo; Alemà, Giovanni Sebastiano; Giovine, Angela; Peluso, Gianfranco; Minghetti, Luisa; Nicolai, Raffaella; Calamandrei, Gemma; Casolini, Paola

2013-01-01

Maternal-fetal HIV-1 transmission can be prevented by administration of AZT, alone or in combination with other antiretroviral drugs to pregnant HIV-1-infected women and their newborns. In spite of the benefits deriving from this life-saving prophylactic therapy, there is still considerable uncertainty on the potential long-term adverse effects of antiretroviral drugs on exposed children. Clinical and experimental studies have consistently shown the occurrence of mitochondrial dysfunction and increased oxidative stress following prenatal treatment with antiretroviral drugs, and clinical evidence suggests that the developing brain is one of the targets of the toxic action of these compounds possibly resulting in behavioral problems. We intended to verify the effects on brain and behavior of mice exposed during gestation to AZT, the backbone of antiretroviral therapy during human pregnancy. We hypothesized that glutamate, a neurotransmitter involved in excitotoxicity and behavioral plasticity, could be one of the major actors in AZT-induced neurochemical and behavioral alterations. We also assessed the antioxidant and neuroprotective effect of L-acetylcarnitine, a compound that improves mitochondrial function and is successfully used to treat antiretroviral-induced polyneuropathy in HIV-1 patients. We found that transplacental exposure to AZT given per os to pregnant mice from day 10 of pregnancy to delivery impaired in the adult offspring spatial learning and memory, enhanced corticosterone release in response to acute stress, increased brain oxidative stress also at birth and markedly reduced expression of mGluR1 and mGluR5 subtypes and GluR1 subunit of AMPA receptors in the hippocampus. Notably, administration during the entire pregnancy of L-acetylcarnitine was effective in preventing/ameliorating the neurochemical, neuroendocrine and behavioral adverse effects induced by AZT in the offspring. The present preclinical findings provide a mechanistic hypothesis for the neurobehavioral effects of AZT and strongly suggest that preventive administration of L-acetylcarnitine might be effective in reducing the neurological side-effects of antiretroviral therapy in fetus/newborn. PMID:23409035

Measurement of Conformational Changes Accompanying Desensitization in an Ionotropic Glutamate Receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Armstrong,N.; Jasti, J.; Beich-Frandsen, M.

2006-01-01

The canonical conformational states occupied by most ligand-gated ion channels, and many cell-surface receptors, are the resting, activated, and desensitized states. While the resting and activated states of multiple receptors are well characterized, elaboration of the structural properties of the desensitized state, a state that is by definition inactive, has proven difficult. Here we use electrical, chemical, and crystallographic experiments on the AMPA-sensitive GluR2 receptor, defining the conformational rearrangements of the agonist binding cores that occur upon desensitization of this ligand-gated ion channel. These studies demonstrate that desensitization involves the rupture of an extensive interface between domain 1 of 2-foldmore » related glutamate-binding core subunits, compensating for the ca. 21{sup o} of domain closure induced by glutamate binding. The rupture of the domain 1 interface allows the ion channel to close and thereby provides a simple explanation to the long-standing question of how agonist binding is decoupled from ion channel gating upon receptor desensitization.« less

Rapidly progressive neurological deterioration in anti-AMPA receptor encephalitis with additional CRMP5 antibodies.

PubMed

Yang, Shuangshuang; Qin, Jie; Li, Jinghong; Gao, Yuan; Zhao, Lu; Wu, Jun; Song, Bo; Xu, Yuming; Sun, Shilei

2016-11-01

Anti-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR) encephalitis positive for additional onconeural antibodies is rarely reported. Here we report the clinical features of a patient who developed limbic encephalitis with both glutamate receptor 2 (GluR2) and collapsin response mediator protein 5 (CRMP5) antibodies. Brain magnetic resonance imaging revealed multifocal encephalopathy. Chest computed tomography showed a highly suspicious malignant thymoma. He experienced rapid neurological deterioration during hospitalization. This report indicates that the clinical diversity of anti-AMPAR encephalitis and the presence of onconeural antibodies may lead to poor prognosis.

Smartphone-enabled optofluidic exosome diagnostic for concussion recovery

NASA Astrophysics Data System (ADS)

Ko, Jina; Hemphill, Matthew A.; Gabrieli, David; Wu, Leon; Yelleswarapu, Venkata; Lawrence, Gladys; Pennycooke, Wesley; Singh, Anup; Meaney, Dave F.; Issadore, David

2016-08-01

A major impediment to improving the treatment of concussion is our current inability to identify patients that will experience persistent problems after the injury. Recently, brain-derived exosomes, which cross the blood-brain barrier and circulate following injury, have shown great potential as a noninvasive biomarker of brain recovery. However, clinical use of exosomes has been constrained by their small size (30-100 nm) and the extensive sample preparation (>24 hr) needed for traditional exosome measurements. To address these challenges, we developed a smartphone-enabled optofluidic platform to measure brain-derived exosomes. Sample-to-answer on our chip is 1 hour, 10x faster than conventional techniques. The key innovation is an optofluidic device that can detect enzyme amplified exosome biomarkers, and is read out using a smartphone camera. Using this approach, we detected and profiled GluR2+ exosomes in the post-injury state using both in vitro and murine models of concussion.

Smartphone-enabled optofluidic exosome diagnostic for concussion recovery.

PubMed

Ko, Jina; Hemphill, Matthew A; Gabrieli, David; Wu, Leon; Yelleswarapu, Venkata; Lawrence, Gladys; Pennycooke, Wesley; Singh, Anup; Meaney, Dave F; Issadore, David

2016-08-08

A major impediment to improving the treatment of concussion is our current inability to identify patients that will experience persistent problems after the injury. Recently, brain-derived exosomes, which cross the blood-brain barrier and circulate following injury, have shown great potential as a noninvasive biomarker of brain recovery. However, clinical use of exosomes has been constrained by their small size (30-100 nm) and the extensive sample preparation (>24 hr) needed for traditional exosome measurements. To address these challenges, we developed a smartphone-enabled optofluidic platform to measure brain-derived exosomes. Sample-to-answer on our chip is 1 hour, 10x faster than conventional techniques. The key innovation is an optofluidic device that can detect enzyme amplified exosome biomarkers, and is read out using a smartphone camera. Using this approach, we detected and profiled GluR2+ exosomes in the post-injury state using both in vitro and murine models of concussion.

Phosphodiesterase 2A Inhibitor TAK-915 Ameliorates Cognitive Impairments and Social Withdrawal in N-Methyl-d-Aspartate Receptor Antagonist-Induced Rat Models of Schizophrenia.

PubMed

Nakashima, Masato; Imada, Haruka; Shiraishi, Eri; Ito, Yuki; Suzuki, Noriko; Miyamoto, Maki; Taniguchi, Takahiko; Iwashita, Hiroki

2018-04-01

The pathophysiology of schizophrenia has been associated with glutamatergic dysfunction. Modulation of the glutamatergic signaling pathway, including N -methyl-d-aspartate (NMDA) receptors, can provide a new therapeutic target for schizophrenia. Phosphodiesterase 2A (PDE2A) is highly expressed in the forebrain, and is a dual substrate enzyme that hydrolyzes both cAMP and cGMP, which play pivotal roles as intracellular second messengers downstream of NMDA receptors. Here we characterize the in vivo pharmacological profile of a selective and brain-penetrant PDE2A inhibitor, ( N -{(1 S )-1-[3-fluoro-4-(trifluoromethoxy)phenyl]-2-methoxyethyl}-7-methoxy-2-oxo-2,3-dihydropyrido[2,3- b ]pyrazine-4(1 H )-carboxamide) (TAK-915) as a novel treatment of schizophrenia. Oral administration of TAK-915 at 3 and 10 mg/kg significantly increased cGMP levels in the frontal cortex, hippocampus, and striatum of rats. TAK-915 at 10 mg/kg significantly upregulated the phosphorylation of α -amino-3-hydroxy-5-methylisoxazole-4-proprionic acid receptor subunit GluR1 in the rat hippocampus. TAK-915 at 3 and 10 mg/kg significantly attenuated episodic memory deficits induced by the NMDA receptor antagonist (+)-MK-801 hydrogen maleate (MK-801) in the rat passive avoidance test. TAK-915 at 10 mg/kg significantly attenuated working memory deficits induced by MK-801 in the rat radial arm maze test. Additionally, TAK-915 at 10 mg/kg prevented subchronic phencyclidine-induced social withdrawal in social interaction in rats. In contrast, TAK-915 did not produce antipsychotic-like activity; TAK-915 had little effect on MK-801- or methamphetamine-induced hyperlocomotion in rats. These results suggest that TAK-915 has a potential to ameliorate cognitive impairments and social withdrawal in schizophrenia. Copyright © 2018 by The American Society for Pharmacology and Experimental Therapeutics.

Probing the Allosteric Modulator Binding Site of GluR2 with Thiazide Derivatives

PubMed Central

Ptak, Christopher P.; Ahmed, Ahmed H.; Oswald, Robert E.

2009-01-01

Ionotropic glutamate receptors mediate the majority of vertebrate excitatory synaptic transmission and are therapeutic targets for cognitive enhancement and treatment of schizophrenia. The binding domains of these tetrameric receptors consist of two dimers, and the dissociation of the dimer interface of the ligand-binding domain leads to desensitization in the continued presence of agonist. Positive allosteric modulators act by strengthening the dimer interface and reducing desensitization, thereby increasing steady-state activation. Removing the desensitized state for simplified analysis of receptor activation is commonly achieved using cyclothiazide (CTZ), the most potent modulator of the benzothiadiazide class, with the flip form of the AMPA receptor subtype. IDRA-21, the first benzothiadiazide to have an effect in behavioral tests, is an important lead compound in clinical trials for cognitive enhancement as it can cross the blood-brain barrier. Intermediate structures between CTZ and IDRA-21 show reduced potency suggesting that these two compounds have different contact points associated with binding. To understand how benzothiadiazides bind to the pocket bridging the dimer interface, we generated a series of crystal structures of the GluR2 ligand-binding domain complexed with benzothiadiazide derivatives (IDRA-21, hydroflumethiazide, hydrochlorothiazide, chlorothiazide, trichlormethiazide, and althiazide) for comparison with an existing structure for cyclothiazide. The structures detail how changes in the substituents in the 3- and 7-positions of the hydrobenzothiadiazide ring shift the orientation of the drug in the binding site and, in some cases, change the stoichiometry of binding. All derivatives maintain a hydrogen bond with the Ser754 hydroxyl, affirming the partial selectivity of the benzothiadiazides for the flip form of AMPA receptors. PMID:19673491

Preclinical Evidence of Rapid-Onset Antidepressant-Like Effect in Radix Polygalae Extract

PubMed Central

Park, Hyunwoo; Kim, Yoorim; Park, Sung Hyun; Swanberg, Kelley; Shin, Joo-Yeon; Ha, Sang-Kyu; Cho, Yoonju; Bang, Soo-Yong; Lew, Jae-Hwan; Cho, Seung-Hun; Maeng, Sungho

2014-01-01

Radix Polygalae (the root of Polygala tenuifolia) is a herb widely used in traditional Asian medicine that is thought to exert a variety of neuropsychiatric effects. Radix Polygalae extract can protect against N-methyl D-aspartate (NMDA) neurotoxicity and induce brain-derived neurotrophic factor (BDNF) expression, suggesting modulatory roles at glutamatergic synapses and possible antidepressant action. In accordance with this hypothesis, Radix Polygalae extract demonstrated antidepressant-like effects in 8-week-old male C57Bl/6 mice by decreasing behavioral despair in the forced swim and tail suspension tasks and increasing hedonic-like behavior in the female urine sniffing test 30 minutes after a single oral administration of 0.1 mg/kg. Reduced latency to acquire a food pellet in the novely suppressed feeding paradigm, without change in anxiety-like behaviors suggested a rapid-onset nature of the antidepressant-like effect. In addition, it decreased the number of failed escapes in the learned helplessness paradigm after two oral administrations 24 hours and 30 minutes before the first test. Finally, it reversed anhedonia as measured by saccharin preference in mice exposed to the chronic stress model after two administrations of 0.1 mg/kg, in contrast to the repeated administration generally needed for similar effect by monoamergic antidepressants. Immobility reduction in tail suspension task was blocked by the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor antagonist NBQX, a pattern previously demonstrated by ketamine and other ketamine-like rapid-onset antidepressants. Also similarly to ketamine, Radix Polygalae appeared to acutely decrease phosphorylation of GluR1 serine-845 in the hippocampus while leaving the phosphorylation of hippocampal mTOR serine 2448 unchanged. These findings serve as preclinical evidence that Radix Polygalae extract exerts rapid-onset antidepressant effects by modulating glutamatergic synapses in critical brain circuits of depression and may be worthy of further evaluation as a safe substitute to other rapid-onset antidepressants known to have unacceptable side effects. PMID:24520403

BDNF and AMPA receptors in the cNTS modulate the hyperglycemic reflex after local carotid body NaCN stimulation.

PubMed

Cuéllar, R; Montero, S; Luquín, S; García-Estrada, J; Melnikov, V; Virgen-Ortiz, A; Lemus, M; Pineda-Lemus, M; de Álvarez-Buylla, E

2017-07-01

The application of sodium cyanide (NaCN) to the carotid body receptors (CBR) (CBR stimulation) induces rapid blood hyperglycemia and an increase in brain glucose retention. The commissural nucleus tractus solitarius (cNTS) is an essential relay nucleus in this hyperglycemic reflex; it receives glutamatergic afferents (that also release brain derived neurotrophic factor, BDNF) from the nodose-petrosal ganglia that relays CBR information. Previous work showed that AMPA in NTS blocks hyperglycemia and brain glucose retention after CBR stimulation. In contrast, BDNF, which attenuates glutamatergic AMPA currents in NTS, enhances these glycemic responses. Here we investigated the combined effects of BDNF and AMPA (and their antagonists) in NTS on the glycemic responses to CBR stimulation. Microinjections of BDNF plus AMPA into the cNTS before CBR stimulation in anesthetized rats, induced blood hyperglycemia and an increase in brain arteriovenous (a-v) of blood glucose concentration difference, which we infer is due to increased brain glucose retention. By contrast, the microinjection of the TrkB antagonist K252a plus AMPA abolished the glycemic responses to CBR stimulation similar to what is observed after AMPA pretreatments. In BDNF plus AMPA microinjections preceding CBR stimulation, the number of c-fos immunoreactive cNTS neurons increased. In contrast, in the rats microinjected with K252a plus AMPA in NTS, before CBR stimulation, c-fos expression in cNTS decreased. The expression of AMPA receptors GluR2/3 did not change in any of the studied groups. These results indicate that BDNF in cNTS plays a key role in the modulation of the hyperglycemic reflex initiated by CBR stimulation. Copyright © 2017. Published by Elsevier B.V.

Early natural stimulation through environmental enrichment accelerates neuronal development in the mouse dentate gyrus.

PubMed

Liu, Na; He, Shan; Yu, Xiang

2012-01-01

The dentate gyrus is the primary afferent into the hippocampal formation, with important functions in learning and memory. Granule cells, the principle neuronal type in the dentate gyrus, are mostly formed postnatally, in a process that continues into adulthood. External stimuli, including environmental enrichment, voluntary exercise and learning, have been shown to significantly accelerate the generation and maturation of dentate granule cells in adult rodents. Whether, and to what extent, such environmental stimuli regulate the development and maturation of dentate granule cells during early postnatal development is largely unknown. Furthermore, whether natural stimuli affect the synaptic properties of granule cells had been investigated neither in newborn neurons of the adult nor during early development. To examine the effect of natural sensory stimulation on the dentate gyrus, we reared newborn mice in an enriched environment (EE). Using immunohistochemistry, we showed that dentate granule cells from EE-reared mice exhibited earlier morphological maturation, manifested as faster peaking of doublecortin expression and elevated expression of mature neuronal markers (including NeuN, calbindin and MAP2) at the end of the second postnatal week. Also at the end of the second postnatal week, we found increased density of dendritic spines across the entire dentate gyrus, together with elevated levels of postsynaptic scaffold (post-synaptic density 95) and receptor proteins (GluR2 and GABA(A)Rγ2) of excitatory and inhibitory synapses. Furthermore, dentate granule cells of P14 EE-reared mice had lower input resistances and increased glutamatergic and GABAergic synaptic inputs. Together, our results demonstrate that EE-rearing promotes morphological and electrophysiological maturation of dentate granule cells, underscoring the importance of natural environmental stimulation on development of the dentate gyrus.

Transcription regulation of the Saccharomyces cerevisiae PIS1 gene by inositol and the pleiotropic regulator, Ume6p.

PubMed

Jani, Niketa M; Lopes, John M

2008-12-01

In Saccharomyces cerevisiae, transcription of most of the phospholipid biosynthetic genes (e.g. INO1, CHO1, CHO2 and OPI3) is repressed by growth in the presence of inositol and choline and derepressed in their absence. This regulation requires the Ino2p and Ino4p activators and the Opi1p repressor. The PIS1 structural gene is required for the synthesis of the essential lipid phosphatidylinositol. Previous reports show that PIS1 expression is uncoupled from inositol/choline regulation, but is regulated by carbon source, hypoxia and zinc. However, in this study we found that the expression of PIS1 is induced twofold by inositol. This regulation did not require Ino2p and Ino4p, although Ino4p was required for full expression. Ino4p is a basic helix-loop-helix protein that requires a binding partner. Curiously, none of the other basic helix-loop-helix proteins affected PIS1 expression. Inositol induction did require another general regulator of phospholipid biosynthesis, Ume6p. Ume6p was found to be a positive regulator of PIS1 gene expression. Ume6p, and several associated factors, were required for inositol-mediated induction and chromatin immunoprecipitation analysis showed that Ume6p directly regulates PIS1 expression. Thus, we demonstrate novel regulation of the PIS1 gene by Ume6p.

Platelet Kainate Receptor Signaling Promotes Thrombosis by Stimulating Cyclooxygenase Activation

PubMed Central

Sun, Henry; Swaim, AnneMarie; Herrera, Jesus Enrique; Becker, Diane; Becker, Lewis; Srivastava, Kalyan; Thompson, Laura E.; Shero, Michelle R.; Perez-Tamayo, Alita; Suktitpat, Bhoom; Mathias, Rasika; Contractor, Anis; Faraday, Nauder; Morrell, Craig N.

2009-01-01

Rationale Glutamate is a major signaling molecule that binds to glutamate receptors including the ionotropic glutamate receptors; kainate (KA) receptor (KAR), the N-methyl-D-aspartate (NMDA) receptor (NMDAR), and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR). Each is well characterized in the central nervous system (CNS), but glutamate has important signaling roles in peripheral tissues as well, including a role in regulating platelet function. Objective Our previous work has demonstrated that glutamate is released by platelets in high concentrations within a developing thrombus and increases platelet activation and thrombosis. We now show that platelets express a functional KAR that drives increased agonist induced platelet activation. Methods and Results KAR induced increase in platelet activation is in part the result of activation of platelet cyclooxygenase (COX) in a Mitogen Activated Protein Kinase (MAPK) dependent manner. Platelets derived from KA receptor subunit knockout mice (GluR6−/−) are resistant to KA effects and have a prolonged time to thrombosis in vivo. Importantly, we have also identified polymorphisms in KA receptor subunits that are associated with phenotypic changes in platelet function in a large group of Caucasians and African Americans. Conclusion Our data demonstrate that glutamate regulation of platelet activation is in part COX dependent, and suggest that the KA receptor is a novel anti-thrombotic target. PMID:19679838

Effects of exposure to Streptococcus iniae on microRNA expression in the head kidney of genetically improved farmed tilapia (Oreochromis niloticus).

PubMed

Qiang, Jun; Tao, Fanyi; He, Jie; Sun, Lanyi; Xu, Pao; Bao, Wenjin

2017-02-20

Genetically improved farmed tilapia (GIFT, Oreochromis niloticus) are susceptible to infection by Streptococcus iniae when maintained in modern intensive culture systems. GIFT are commercially important fishes that are cultured widely in southern China. The role of microRNAs (miRNAs) in the regulatory response of GIFT to S. iniae infection has been underestimated and has not yet been well studied. Head kidney has an important immune function in teleost fishes. The main aim of this study was to determine the possible function of miRNAs in head kidney of S. iniae-infected GIFT. MiRNAs are small, non-coding RNAs that regulate gene expression by binding to the 3'-untranslated regions of their target mRNAs. MiRNAs are known to regulate immune-regulated signaling and inflammatory response pathways. High-throughput deep sequencing of two libraries (control group [CO] and infected group [IN]) of RNA extracted from GIFT head kidney tissues generated 12,089,630 (CO) and 12,624,975 (IN) clean reads. Bioinformatics analysis identified 1736 and 1729 conserved miRNAs and 164 and 165 novel miRNAs in the CO and IN libraries, respectively. Three miRNAs (miR-310-3p, miR-92, and miR-127) were found to be up-regulated and four miRNAs (miR-92d-3p, miR-375-5p, miR-146-3p, and miR-694) were found to be down-regulated in the S. iniae-infected GIFT. The expressions of these miRNAs were verified by quantitative real-time PCR. RNAhybrid and TargetScan were used to identify complementary miRNA and mRNA target sites, and the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes databases were used to annotate and predict potential downstream regulation of biological pathways. Seven target genes, which encode immune-related proteins (complement C3, cytidine deaminase, regulator of G-protein Rgs22, mitogen-activated protein kinase Mapk1, metabotropic glutamate receptorm GluR8, calcium-sensing receptor CaSR, and microtubule-associated protein Map1S) were predicted to play crucial roles in the GIFT response to S. iniae infection. S. iniae outbreaks have hindered the development of the tilapia industry in China. Understanding the miRNA transcriptome of S. iniae-infected GIFT is important for exploring the immune responses regulated by miRNAs as well as for studying novel regulated networks to prevent and treat S. iniae infections in the future.

Mechanism of Positive Allosteric Modulators Acting on AMPA Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jin,R.; Clark, S.; Weeks, A.

2005-01-01

Ligand-gated ion channels involved in the modulation of synaptic strength are the AMPA, kainate, and NMDA glutamate receptors. Small molecules that potentiate AMPA receptor currents relieve cognitive deficits caused by neurodegenerative diseases such as Alzheimer's disease and show promise in the treatment of depression. Previously, there has been limited understanding of the molecular mechanism of action for AMPA receptor potentiators. Here we present cocrystal structures of the glutamate receptor GluR2 S1S2 ligand-binding domain in complex with aniracetam [1-(4-methoxybenzoyl)-2-pyrrolidinone] or CX614 (pyrrolidino-1, 3-oxazino benzo-1, 4-dioxan-10-one), two AMPA receptor potentiators that preferentially slow AMPA receptor deactivation. Both potentiators bind within the dimermore » interface of the nondesensitized receptor at a common site located on the twofold axis of molecular symmetry. Importantly, the potentiator binding site is adjacent to the 'hinge' in the ligand-binding core 'clamshell' that undergoes conformational rearrangement after glutamate binding. Using rapid solution exchange, patch-clamp electrophysiology experiments, we show that point mutations of residues that interact with potentiators in the cocrystal disrupt potentiator function. We suggest that the potentiators slow deactivation by stabilizing the clamshell in its closed-cleft, glutamate-bound conformation.« less

Smartphone-enabled optofluidic exosome diagnostic for concussion recovery

PubMed Central

Ko, Jina; Hemphill, Matthew A.; Gabrieli, David; Wu, Leon; Yelleswarapu, Venkata; Lawrence, Gladys; Pennycooke, Wesley; Singh, Anup; Meaney, Dave F.; Issadore, David

2016-01-01

A major impediment to improving the treatment of concussion is our current inability to identify patients that will experience persistent problems after the injury. Recently, brain-derived exosomes, which cross the blood-brain barrier and circulate following injury, have shown great potential as a noninvasive biomarker of brain recovery. However, clinical use of exosomes has been constrained by their small size (30–100 nm) and the extensive sample preparation (>24 hr) needed for traditional exosome measurements. To address these challenges, we developed a smartphone-enabled optofluidic platform to measure brain-derived exosomes. Sample-to-answer on our chip is 1 hour, 10x faster than conventional techniques. The key innovation is an optofluidic device that can detect enzyme amplified exosome biomarkers, and is read out using a smartphone camera. Using this approach, we detected and profiled GluR2+ exosomes in the post-injury state using both in vitro and murine models of concussion. PMID:27498963

A comparison of GluR-A-deficient and wild-type mice on a test battery assessing sensorimotor, affective, and cognitive behaviors.

PubMed

Bannerman, D M; Deacon, R M J; Brady, S; Bruce, A; Sprengel, R; Seeburg, P H; Rawlins, J N P

2004-06-01

Previous studies have demonstrated a spatial working memory deficit in glutamate receptor (GluR)-A (GluR1) AMPA receptor subunit knockout mice. The present study evaluated male and female wild-type and GluR-A-/- mice on a test battery that assessed sensorimotor, affective, and cognitive behaviors. Results revealed a behavioral phenotype more extensive than previously described. GluR-A-/- mice were hyperactive, displayed a subtle lack of motor coordination, and were generally more anxious than wild-type controls. In addition, they showed a deficit in spontaneous alternation, consistent with previous reports of a role for GluR-A-dependent plasticity in hippocampus-dependent, spatial working memory. Although changes in motor coordination or anxiety cannot explain the dissociations already reported within the spatial memory domain, it is clear that they could significantly affect interpretation of results obtained in other kinds of behavioral tasks. ((c) 2004 APA, all rights reserved)

Genetic Evidence for a Role for Protein Kinase A in the Maintenance of Sleep and Thalamocortical Oscillations

PubMed Central

Hellman, Kevin; Hernandez, Pepe; Park, Alice; Abel, Ted

2010-01-01

Study Objectives: Genetic manipulation of cAMP-dependent protein kinase A (PKA) in Drosophila has implicated an important role for PKA in sleep/wake state regulation. Here, we characterize the role of this signaling pathway in the regulation of sleep using electroencephalographic (EEG) and electromyographic (EMG) recordings in R(AB) transgenic mice that express a dominant negative form of the regulatory subunit of PKA in neurons within cortex and hippocampus. Previous studies have revealed that these mutant mice have reduced PKA activity that results in the impairment of hippocampus-dependent long-term memory and long-lasting forms of hippocampal synaptic plasticity. Design: PKA assays, in situ hybridization, immunoblots, and sleep studies were performed in R(AB) transgenic mice and wild-type control mice. Measurements and Results: We have found that R(AB) transgenic mice have reduced PKA activity within cortex and reduced Ser845 phosphorylation of the glutamate receptor subunit GluR1. R(AB) transgenic mice exhibit non-rapid eye movement (NREM) sleep fragmentation and increased amounts of rapid eye movement (REM) sleep relative to wild-type mice. Further, R(AB) transgenic mice have more delta power but less sigma power during NREM sleep relative to wild-type mice. After sleep deprivation, the amounts of NREM and REM sleep were comparable between wild-type and R(AB) transgenic mice. However, the homeostatic rebound of sigma power in R(AB) transgenic mice was reduced. Conclusions: Alterations in cortical synaptic receptors, impairments in sleep continuity, and alterations in sleep oscillations in R(AB) mice imply that PKA is involved not only in synaptic plasticity and memory storage but also in the regulation of sleep/wake states. Citation: Hellman K; Hernandez P; Park A; Abel T. Genetic evidence for a role for protein kinase a in the maintenance of sleep and thalamocortical oscillations. SLEEP 2010;33(1):19-28. PMID:20120617

Marine Toxins Targeting Ion Channels

PubMed Central

Arias, Hugo R.

2006-01-01

This introductory minireview points out the importance of ion channels for cell communication. The basic concepts on the structure and function of ion channels triggered by membrane voltage changes, the so-called voltage-gated ion channels (VGICs), as well as those activated by neurotransmitters, the so-called ligand-gated ion channel (LGICs), are introduced. Among the most important VGIC superfamiles, we can name the voltage-gated Na+ (NaV), Ca2+ (CaV), and K+ (KV) channels. Among the most important LGIC super families, we can include the Cys-loop or nicotinicoid, the glutamate-activated (GluR), and the ATP-activated (P2XnR) receptor superfamilies. Ion channels are transmembrane proteins that allow the passage of different ions in a specific or unspecific manner. For instance, the activation of NaV, CaV, or KV channels opens a pore that is specific for Na+, Ca2+, or K+, respectively. On the other hand, the activation of certain LGICs such as nicotinic acetylcholine receptors, GluRs, and P2XnRs allows the passage of cations (e.g., Na+, K+, and/or Ca2+), whereas the activation of other LGICs such as type A γ-butyric acid and glycine receptors allows the passage of anions (e.g., Cl− and/or HCO3−). In this regard, the activation of NaV and CaV as well as ligand-gated cation channels produce membrane depolarization, which finally leads to stimulatory effects in the cell, whereas the activation of KV as well as ligand-gated anion channels induce membrane hyperpolarization that finally leads to inhibitory effects in the cell. The importance of these ion channel superfamilies is emphasized by considering their physiological functions throughout the body as well as their pathophysiological implicance in several neuronal diseases. In this regard, natural molecules, and especially marine toxins, can be potentially used as modulators (e.g., inhibitors or prolongers) of ion channel functions to treat or to alleviate a specific ion channel-linked disease (e.g., channelopaties).

SWI/SNF chromatin remodeling complex is critical for the expression of microphthalmia-associated transcription factor in melanoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vachtenheim, Jiri, E-mail: jivach@upn.anet.cz; Ondrusova, Lubica; Borovansky, Jan

2010-02-12

The microphthalmia-associated transcription factor (MITF) is required for melanocyte development, maintenance of the melanocyte-specific transcription, and survival of melanoma cells. MITF positively regulates expression of more than 25 genes in pigment cells. Recently, it has been demonstrated that expression of several MITF downstream targets requires the SWI/SNF chromatin remodeling complex, which contains one of the two catalytic subunits, Brm or Brg1. Here we show that the expression of MITF itself critically requires active SWI/SNF. In several Brm/Brg1-expressing melanoma cell lines, knockdown of Brg1 severely compromised MITF expression with a concomitant dowregulation of MITF targets and decreased cell proliferation. Although Brmmore » was able to substitute for Brg1 in maintaining MITF expression and melanoma cell proliferation, sequential knockdown of both Brm and Brg1 in 501mel cells abolished proliferation. In Brg1-null SK-MEL-5 melanoma cells, depletion of Brm alone was sufficient to abrogate MITF expression and cell proliferation. Chromatin immunoprecipitation confirmed the binding of Brg1 or Brm to the promoter of MITF. Together these results demonstrate the essential role of SWI/SNF for expression of MITF and suggest that SWI/SNF may be a promissing target in melanoma therapy.« less

Integration of a splicing regulatory network within the meiotic gene expression program of Saccharomyces cerevisiae

PubMed Central

Munding, Elizabeth M.; Igel, A. Haller; Shiue, Lily; Dorighi, Kristel M.; Treviño, Lisa R.; Ares, Manuel

2010-01-01

Splicing regulatory networks are essential components of eukaryotic gene expression programs, yet little is known about how they are integrated with transcriptional regulatory networks into coherent gene expression programs. Here we define the MER1 splicing regulatory network and examine its role in the gene expression program during meiosis in budding yeast. Mer1p splicing factor promotes splicing of just four pre-mRNAs. All four Mer1p-responsive genes also require Nam8p for splicing activation by Mer1p; however, other genes require Nam8p but not Mer1p, exposing an overlapping meiotic splicing network controlled by Nam8p. MER1 mRNA and three of the four Mer1p substrate pre-mRNAs are induced by the transcriptional regulator Ume6p. This unusual arrangement delays expression of Mer1p-responsive genes relative to other genes under Ume6p control. Products of Mer1p-responsive genes are required for initiating and completing recombination and for activation of Ndt80p, the activator of the transcriptional network required for subsequent steps in the program. Thus, the MER1 splicing regulatory network mediates the dependent relationship between the UME6 and NDT80 transcriptional regulatory networks in the meiotic gene expression program. This study reveals how splicing regulatory networks can be interlaced with transcriptional regulatory networks in eukaryotic gene expression programs. PMID:21123654

The Mediator Complex Subunits MED14, MED15, and MED16 Are Involved in Defense Signaling Crosstalk in Arabidopsis.

PubMed

Wang, Chenggang; Du, Xuezhu; Mou, Zhonglin

2016-01-01

Mediator is a highly conserved protein complex that functions as a transcriptional coactivator in RNA polymerase II (RNAPII)-mediated transcription. The Arabidopsis Mediator complex has recently been implicated in plant immune responses. Here, we compared salicylic acid (SA)-, methyl jasmonate (MeJA)-, and the ethylene (ET) precursor 1-aminocyclopropane-1-carboxylic acid (ACC)-induced defense and/or wound-responsive gene expression in 14 Arabidopsis Mediator subunit mutants. Our results show that MED14, MED15, and MED16 are required for SA-activated expression of the defense marker gene PATHOEGNESIS-RELATED GENE1 , MED25 is required for MeJA-induced expression of the wound-responsive marker gene VEGATATIVE STORAGE PROTEIN1 ( VSP1 ), MED8, MED14, MED15, MED16, MED18, MED20a, MED25, MED31, and MED33A/B (MED33a and MED33B) are required for MeJA-induced expression of the defense maker gene PLANT DEFENSIN1.2 ( PDF1.2 ), and MED8, MED14, MED15, MED16, MED25, and MED33A/B are also required for ACC-triggered expression of PDF1.2 . Furthermore, we investigated the involvement of MED14, MED15, and MED16 in plant defense signaling crosstalk and found that MED14, MED15, and MED16 are required for SA- and ET-mediated suppression of MeJA-induced VSP1 expression. This result suggests that MED14, MED15, and MED16 not only relay defense signaling from the SA and JA/ET defense pathways to the RNAPII transcription machinery, but also fine-tune defense signaling crosstalk. Finally, we show that MED33A/B contributes to the necrotrophic fungal pathogen Botrytis cinerea- induced expression of the defense genes PDF1.2, HEVEIN-LIKE , and BASIC CHITINASE and is required for full-scale basal resistance to B. cinerea , demonstrating a positive role for MED33 in plant immunity against necrotrophic fungal pathogens.

Phospholipase D-mediated hypersensitivity at central synapses is associated with abnormal behaviours and pain sensitivity in rats exposed to prenatal stress.

PubMed

Sun, Liting; Gooding, Hayley L; Brunton, Paula J; Russell, John A; Mitchell, Rory; Fleetwood-Walker, Sue

2013-11-01

Adverse events at critical stages of development can lead to lasting dysfunction in the central nervous system (CNS). To seek potential underlying changes in synaptic function, we used a newly developed protocol to measure alterations in receptor-mediated Ca(2+) fluorescence responses of synaptoneurosomes, freshly isolated from selected regions of the CNS concerned with emotionality and pain processing. We compared adult male controls and offspring of rats exposed to social stress in late pregnancy (prenatal stress, PS), which showed programmed behavioural changes indicating anxiety, anhedonia and pain hypersensitivity. We found corresponding increases, in PS rats compared with normal controls, in responsiveness of synaptoneurosomes from frontal cortex to a glutamate receptor (GluR) agonist, and from spinal cord to activators of nociceptive afferents. Through a combined pharmacological and biochemical strategy, we found evidence for a role of phospholipase D1 (PLD1)-mediated signalling, that may involve 5-HT2A receptor (5-HT2AR) activation, at both levels of the nervous system. These changes might participate in underpinning the enduring alterations in behaviour induced by PS. Copyright © 2013 Elsevier Ltd. All rights reserved.

Regulation of COL1A1 expression in type I collagen producing tissues: identification of a 49 base pair region which is required for transgene expression in bone of transgenic mice

NASA Technical Reports Server (NTRS)

Bedalov, A.; Salvatori, R.; Dodig, M.; Kronenberg, M. S.; Kapural, B.; Bogdanovic, Z.; Kream, B. E.; Woody, C. O.; Clark, S. H.; Mack, K.;

(+/-)-3-[4-(2-dimethylamino-1-methylethoxy)-phenyl]-1H-pyrazolo[3,4- B]pyridine-1-acetic acid (Y-25510) stimulates production of IL-1 beta and IL-6 at the level of messenger RNA expression in cultured human monocytes.

PubMed

Kusuhara, H; Komatsu, H; Hisadome, M; Ikeda, Y

1996-12-01

(+/-)-3-[4-(2-Dimethylamino-1-methylethoxy)phenyl]-1H-pyrazolo[3, 4-b]pyridine-1-acetic acid (Y-25510) stimulated the mRNA expression for interleukin-1 beta (IL-1 beta), and enhanced the expression induced by lipopolysaccharide (LPS) in cultured human peripheral blood mononuclear cells (PBMC) and THP-1 cells, a cell-line derived from human monocytic leukemia. Y-25510 also stimulated the mRNA expression for IL-6 in both types of the cells, however, the stimulation required the presence of LPS. In THP-1 cells, the stimulation of IL-1 beta mRNA expression by Y-25510 was suppressed by cycloheximide, an inhibitor of protein synthesis. This phenomenon indicates that the stimulation requires de norv protein synthesis. In contrast, the stimulation of mRNA expression for IL-6 by Y-25510 was not suppressed by cycloheximide but suppressed by N alpha-p-tosyl-L-phenylalanine chloromethyl ketone (TPCK), an inhibitor of nuclear transcription factor-kappa B (NF-kappa B) activation, in the presence of LPS, suggesting that the stimulation requires NF-kappa activation. These results demonstrate that Y-25510 stimulates the mRNA expression for IL-1 beta and IL-6 by different mechanisms. Dexamethasone suppressed the LPS-induced expression of mRNA for IL-1 beta and IL-6 in THP-1 cells, whereas the drug never suppressed the mRNA expression for these cytokines in the presence of Y-25510. The result indicates that Y-25510 stimulates the mRNA expression for IL-1 beta and IL-6 by different mechanisms from those of LPS.

Effects of MK-886, a 5-lipoxygenase activating protein (FLAP) inhibitor, and 5-lipoxygenase deficiency on the forced swimming behavior of mice

PubMed Central

Uz, Tolga; Dimitrijevic, Nikola; Imbesi, Marta; Manev, Hari; Manev, Radmila

2008-01-01

A common biological pathway may contribute to the comorbidity of atherosclerosis and depression. Increased activity of the enzymatic 5-lipoxygenase (5-LOX; 5LO) pathway is a contributing factor in atherosclerosis and a 5-LOX inhibitor, MK-886, is beneficial in animal models of atherosclerosis. In the brain, MK-886 increases phosphorylation of the glutamate receptor subunit GluR1, and the increased phosphorylation of this receptor has been associated with antidepressant treatment. In this work, we evaluated the behavioral effects of MK-886 in an automated assay of mouse forced swimming, which identifies antidepressant activity as increased climbing behavior and/or decreased rest time. Whereas a single injection of MK-886 (3 and 10 mg/kg) did not affect forced swimming behaviors assayed 30 min later, 6 daily injections of 3 mg/kg MK-886 slightly increased climbing and significantly reduced rest time in wild-type mice but not in 5-LOX-deficient mice. A diet delivery of MK-886, 4 μg per 100 mg body-weight per day, required three weeks to affect forced swimming; it increased climbing behavior. Climbing behavior was also increased in naive 5-LOX-deficient mice compared to naive wild-type controls. These results suggest that 5-LOX inhibition and deficiency may be associated with antidepressant activity. Increased climbing in a forced swimming assay is a typical outcome of antidepressants that increase noradrenergic and dopaminergic activity. Interestingly, 5-LOX deficiency and MK-886 treatment have been shown to be capable of increasing the behavioral effects of a noradrenaline/dopamine-potentiating drug, cocaine. Future research is needed to evaluate the clinical relevance of our findings. PMID:18403121

Cocaine-and Amphetamine Regulated Transcript (CART) Peptide Is Expressed in Precursor Cells and Somatotropes of the Mouse Pituitary Gland

PubMed Central

Mortensen, Amanda H.

2016-01-01

Cocaine-and Amphetamine Regulated Transcript (CART) peptide is expressed in the brain, endocrine and neuroendocrine systems and secreted into the serum. It is thought to play a role in regulation of hypothalamic pituitary functions. Here we report a spatial and temporal analysis of Cart expression in the pituitaries of adult and developing normal and mutant mice with hypopituitarism. We found that Prop1 is not necessary for initiation of Cart expression in the fetal pituitary at e14.5, but it is required indirectly for maintenance of Cart expression in the postnatal anterior pituitary gland. Pou1f1 deficiency has no effect on Cart expression before or after birth. There is no 1:1 correspondence between CART and any particular cell type. In neonates, CART is detected primarily in non-proliferating, POU1F1-positive cells. CART is also found in some cells that express TSH and GH suggesting a correspondence with committed progenitors of the POU1F1 lineage. In summary, we have characterized the normal temporal and cell specific expression of CART in mouse development and demonstrate that postnatal CART expression in the pituitary gland requires PROP1. PMID:27685990

MRG-1, an autosome-associated protein, silences X-linked genes and protects germline immortality in Caenorhabditis elegans

PubMed Central

Takasaki, Teruaki; Liu, Zheng; Habara, Yasuaki; Nishiwaki, Kiyoji; Nakayama, Jun-ichi; Inoue, Kunio; Sakamoto, Hiroshi; Strome, Susan

2008-01-01

MRG15, a mammalian protein related to the mortality factor MORF4, is required for cell proliferation and embryo survival. Our genetic analysis has revealed that the Caenorhabditis elegans ortholog MRG-1 serves similar roles. Maternal MRG-1 promotes embryo survival and is required for proliferation and immortality of the primordial germ cells (PGCs). As expected of a chromodomain protein, MRG-1 associates with chromatin. Unexpectedly, it is concentrated on the autosomes and not detectable on the X chromosomes. This association is not dependent on the autosome-enriched protein MES-4. Focusing on possible roles of MRG-1 in regulating gene expression, we determined that MRG-1 is required to maintain repression in the maternal germ line of transgenes on extrachromosomal arrays, and of several X-linked genes previously shown to depend on MES-4 for repression. MRG-1 is not required for PGCs to acquire transcriptional competence or for the turn-on of expression of several PGC-expressed genes (pgl-1, glh-1, glh-4 and nos-1). By contrast to this result in PGCs, MRG-1 is required for ectopic expression of those germline genes in somatic cells lacking the NuRD complex component MEP-1. We discuss how an autosome-enriched protein might repress genes on the X chromosome, promote PGC proliferation and survival, and influence the germ versus soma distinction. PMID:17215300

Activation of dynamin I gene expression by Sp1 and Sp3 is required for neuronal differentiation of N1E-115 cells.

PubMed

Yoo, Jiyun; Jeong, Moon-Jin; Kwon, Byoung-Mog; Hur, Man-Wook; Park, Young-Mee; Han, Mi Young

2002-04-05

Dynamin I is a key molecule required for the recycling of synaptic vesicles in neurons, and it has been known that dynamin I gene expression is induced during neuronal differentiation. Our previous studies established that neuronal restriction of dynamin I gene expression is controlled by Sp1 and nuclear factor-kappaB-like element-1. Here, using a series of deletion constructs and site-directed mutation, we found that transcription of dynamin I gene during neuronal differentiation of N1E-115 cells is controlled primarily by the Sp1 element located between -13 to -4 bp of the dynamin I promoter. Gel shift analysis demonstrated that in addition to Sp1, Sp3 could interact with this Sp1 element. The requirement for Sp family transcription factors in dynamin I gene expression was confirmed by using mithramycin, an inhibitor of Sp1/Sp3 binding. Mithramycin repressed dynamin I gene expression and resulted in blocking of neuronal differentiation of N1E-115 cells. The localization of the dynamin I protein was also restricted in the peripheral region of the nucleus by the mithramycin treatment. Thus, all of our results suggest that induction of dynamin I gene expression during N1E-115 cell differentiation is modulated by Sp1/Sp3 interactions with the dynamin I promoter, and its expression is important for neuronal differentiation of the N1E-115 cells.

Modulation of extracellular matrix/adhesion molecule expression by BRG1 is associated with increased melanoma invasiveness.

PubMed

Saladi, Srinivas Vinod; Keenen, Bridget; Marathe, Himangi G; Qi, Huiling; Chin, Khew-Voon; de la Serna, Ivana L

2010-10-22

Metastatic melanoma is an aggressive malignancy that is resistant to therapy and has a poor prognosis. The progression of primary melanoma to metastatic disease is a multi-step process that requires dynamic regulation of gene expression through currently uncharacterized epigenetic mechanisms. Epigenetic regulation of gene expression often involves changes in chromatin structure that are catalyzed by chromatin remodeling enzymes. Understanding the mechanisms involved in the regulation of gene expression during metastasis is important for developing an effective strategy to treat metastatic melanoma. SWI/SNF enzymes are multisubunit complexes that contain either BRG1 or BRM as the catalytic subunit. We previously demonstrated that heterogeneous SWI/SNF complexes containing either BRG1 or BRM are epigenetic modulators that regulate important aspects of the melanoma phenotype and are required for melanoma tumorigenicity in vitro. To characterize BRG1 expression during melanoma progression, we assayed expression of BRG1 in patient derived normal skin and in melanoma specimen. BRG1 mRNA levels were significantly higher in stage IV melanomas compared to stage III tumors and to normal skin. To determine the role of BRG1 in regulating the expression of genes involved in melanoma metastasis, we expressed BRG1 in a melanoma cell line that lacks BRG1 expression and examined changes in extracellular matrix and adhesion molecule expression. We found that BRG1 modulated the expression of a subset of extracellular matrix remodeling enzymes and adhesion proteins. Furthermore, BRG1 altered melanoma adhesion to different extracellular matrix components. Expression of BRG1 in melanoma cells that lack BRG1 increased invasive ability while down-regulation of BRG1 inhibited invasive ability in vitro. Activation of metalloproteinase (MMP) 2 expression greatly contributed to the BRG1 induced increase in melanoma invasiveness. We found that BRG1 is recruited to the MMP2 promoter and directly activates expression of this metastasis associated gene. We provide evidence that BRG1 expression increases during melanoma progression. Our study has identified BRG1 target genes that play an important role in melanoma metastasis and we show that BRG1 promotes melanoma invasive ability in vitro. These results suggest that increased BRG1 levels promote the epigenetic changes in gene expression required for melanoma metastasis to proceed.

Sequences required for induction of neurotensin receptor gene expression during neuronal differentiation of N1E-115 neuroblastoma cells.

PubMed

Tavares, D; Tully, K; Dobner, P R

1999-10-15

The promoter region of the mouse high affinity neurotensin receptor (Ntr-1) gene was characterized, and sequences required for expression in neuroblastoma cell lines that express high affinity NT-binding sites were characterized. Me(2)SO-induced neuronal differentiation of N1E-115 neuroblastoma cells increased both the expression of the endogenous Ntr-1 gene and reporter genes driven by NTR-1 promoter sequences by 3-4-fold. Deletion analysis revealed that an 83-base pair promoter region containing the transcriptional start site is required for Me(2)SO activation. Detailed mutational analysis of this region revealed that a CACCC box and the central region of a large GC-rich palindrome are the crucial cis-regulatory elements required for Me(2)SO induction. The CACCC box is bound by at least one factor that is induced upon Me(2)SO treatment of N1E-115 cells. The Me(2)SO effect was found to be both selective and cell type-restricted. Basal expression in the neuroblastoma cell lines required a distinct set of sequences, including an Sp1-like sequence, and a sequence resembling an NGFI-A-binding site; however, a more distal 5' sequence was found to repress basal activity in N1E-115 cells. These results provide evidence that Ntr-1 gene regulation involves both positive and negative regulatory elements located in the 5'-flanking region and that Ntr-1 gene activation involves the coordinate activation or induction of several factors, including a CACCC box binding complex.

Identification of Dlk1, Ptpru and Klhl1 as novel Nurr1 target genes in meso-diencephalic dopamine neurons

PubMed Central

Jacobs, Frank M. J.; van der Linden, Annemarie J. A.; Wang, Yuhui; von Oerthel, Lars; Sul, Hei Sook; Burbach, J. Peter H.; Smidt, Marten P.

2009-01-01

The orphan nuclear receptor Nurr1 is essential for the development of meso-diencephalic dopamine (mdDA) neurons and is required, together with the homeobox transcription factor Pitx3, for the expression of genes involved in dopamine metabolism. In order to elucidate the molecular mechanisms that underlie the neuronal deficits in Nurr1-/- mice, we performed combined gene expression microarrays and ChIP-on-chip analysis and thereby identified Dlk1, Ptpru and Klhl1 as novel Nurr1 target genes in vivo. In line with the previously described cooperativity between Nurr1 and Pitx3, we show that the expression of Ptpru and Klhl1 in mdDA neurons is also dependent on Pitx3. Furthermore, we demonstrate that Nurr1 interacts with the Ptpru promoter directly and requires Pitx3 for full expression of Ptpru in mdDA neurons. By contrast, the expression of Dlk1 is maintained in Pitx3-/- embryos and is even expanded into the rostral part of the mdDA area, suggesting a unique position of Dlk1 in the Nurr1 and Pitx3 transcriptional cascades. Expression analysis in Dlk1-/- embryos reveals that Dlk1 is required to prevent premature expression of Dat in mdDA neuronal precursors as part of the multifaceted process of mdDA neuronal differentiation driven by Nurr1 and Pitx3. Taken together, the involvement of Nurr1 and Pitx3 in the expression of novel target genes involved in important neuronal processes such as neuronal patterning, axon outgrowth and terminal differentiation, opens up new avenues to study the properties of mdDA neurons during development and in neuronal pathology as observed in Parkinson's disease. PMID:19515692

Opposing Shh and Fgf signals initiate nasotemporal patterning of the zebrafish retina.

PubMed

Hernández-Bejarano, María; Gestri, Gaia; Spawls, Lana; Nieto-López, Francisco; Picker, Alexander; Tada, Masazumi; Brand, Michael; Bovolenta, Paola; Wilson, Stephen W; Cavodeassi, Florencia

2015-11-15

The earliest known determinants of retinal nasotemporal identity are the transcriptional regulators Foxg1, which is expressed in the prospective nasal optic vesicle, and Foxd1, which is expressed in the prospective temporal optic vesicle. Previous work has shown that, in zebrafish, Fgf signals from the dorsal forebrain and olfactory primordia are required to specify nasal identity in the dorsal, prospective nasal, optic vesicle. Here, we show that Hh signalling from the ventral forebrain is required for specification of temporal identity in the ventral optic vesicle and is sufficient to induce temporal character when activated in the prospective nasal retina. Consequently, the evaginating optic vesicles become partitioned into prospective nasal and temporal domains by the opposing actions of Fgfs and Shh emanating from dorsal and ventral domains of the forebrain primordium. In absence of Fgf activity, foxd1 expression is established irrespective of levels of Hh signalling, indicating that the role of Shh in promoting foxd1 expression is only required in the presence of Fgf activity. Once the spatially complementary expression of foxd1 and foxg1 is established, the boundary between expression domains is maintained by mutual repression between Foxd1 and Foxg1. © 2015. Published by The Company of Biologists Ltd.

Expression of multiple slow myosin heavy chain genes reveals a diversity of zebrafish slow twitch muscle fibres with differing requirements for Hedgehog and Prdm1 activity.

PubMed

Elworthy, Stone; Hargrave, Murray; Knight, Robert; Mebus, Katharina; Ingham, Philip W

2008-06-01

The zebrafish embryo develops a series of anatomically distinct slow twitch muscle fibres that characteristically express genes encoding lineage-specific isoforms of sarcomeric proteins such as MyHC and troponin. We show here that different subsets of these slow fibres express distinct members of a tandem array of slow MyHC genes. The first slow twitch muscle fibres to differentiate, which are specified by the activity of the transcription factor Prdm1 (also called Ubo or Blimp1) in response to Hedgehog (Hh) signalling, express the smyhc1 gene. Subsequently, secondary slow twitch fibres differentiate in most cases independently of Hh activity. We find that although some of these later-forming fibres also express smyhc1, others express smyhc2 or smyhc3. We show that the smyhc1-positive fibres express the ubo (prdm1) gene and adopt fast twitch fibre characteristics in the absence of Prdm1 activity, whereas those that do not express smyhc1 can differentiate independently of Prdm1 function. Conversely, some smyhc2-expressing fibres, although independent of Prdm1 function, require Hh activity to form. The adult trunk slow fibres express smyhc2 and smyhc3, but lack smyhc1 expression. The different slow fibres in the craniofacial muscles variously express smyhc1, smyhc2 and smyhc3, and all differentiate independently of Prdm1.

Fractalkine receptor is expressed in mature ovarian teratomas and required for epidermal lineage differentiation

PubMed Central

2013-01-01

Background The goal of this study was to determine a predominant cell type expressing fractalkine receptor (CX3CR1) in mature ovarian teratomas and to establish functional significance of its expression in cell differentiation. Methods Specimens of ovarian teratoma and human fetal tissues were analyzed by immunohistochemistry for CX3CR1expression. Ovarian teratocarcinoma cell line PA-1 was used as a model for cell differentiation. Results We found that the majority of the specimens contained CX3CR1-positive cells of epidermal lineage. Skin keratinocytes in fetal tissues were also CX3CR1- positive. PA-1 cells with downregulated CX3CR1 failed to express a skin keratinocyte marker cytokeratin 14 when cultured on Matrigel in the presence of a morphogen, bone morphogenic protein 4 (BMP-4), as compared to those expressing scrambled shRNA. Conclusions Here we demonstrate that CX3CR1 is expressed in both normally (fetal skin) and abnormally (ovarian teratoma) differentiated keratinocytes and is required for cell differentiation into epidermal lineage. PMID:23958497

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhan, Yu; Abi Saab, Widian F.; Modi, Nidhi

Mixed lineage kinase 3 (MLK3) is a mitogen-activated protein kinase kinase kinase (MAP3K) that activates MAPK signaling pathways and regulates cellular responses such as proliferation, migration and apoptosis. Here we report high levels of total and phospho-MLK3 in ovarian cancer cell lines in comparison to immortalized nontumorigenic ovarian epithelial cell lines. Using small interfering RNA (siRNA)-mediated gene silencing, we determined that MLK3 is required for the invasion of SKOV3 and HEY1B ovarian cancer cells. Furthermore, mlk3 silencing substantially reduced matrix metalloproteinase (MMP)-1, -2, -9 and -12 gene expression and MMP-2 and -9 activities in SKOV3 and HEY1B ovarian cancer cells.more » MMP-1, -2, -9 and-12 expression, and MLK3-induced activation of MMP-2 and MMP-9 requires both extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK) activities. In addition, inhibition of activator protein-1 (AP-1) reduced MMP-1, MMP-9 and MMP-12 gene expression. Collectively, these findings establish MLK3 as an important regulator of MMP expression and invasion in ovarian cancer cells. -- Highlights: Black-Right-Pointing-Pointer Ovarian cancer cell lines have high levels of total and phosphorylated MLK3. Black-Right-Pointing-Pointer MLK3 is required for MMP expression and activity in ovarian cancer cells. Black-Right-Pointing-Pointer MLK3 is required for invasion of SKOV3 and HEY1B ovarian cancer cells. Black-Right-Pointing-Pointer MLK3-dependent regulation of MMP-2 and MMP-9 activities requires ERK and JNK.« less

Specificity protein 1 (Sp1) maintains basal epithelial expression of the miR-200 family: implications for epithelial-mesenchymal transition.

PubMed

Kolesnikoff, Natasha; Attema, Joanne L; Roslan, Suraya; Bert, Andrew G; Schwarz, Quenten P; Gregory, Philip A; Goodall, Gregory J

2014-04-18

Epithelial-mesenchymal transition (EMT) is required for the specification of tissues during embryonic development and is recapitulated during the metastatic progression of tumors. The miR-200 family plays a critical role in enforcing the epithelial state with their expression lost in cells undergoing EMT. EMT can be mediated by activation of the ZEB1 and ZEB2 (ZEB) transcription factors, which repress miR-200 expression via a self-reinforcing double negative feedback loop to promote the mesenchymal state. However, it remains unclear what factors drive and maintain epithelial-specific expression of miR-200 in the absence of EMT-inducing factors. Here, we show that the transcription factor Specificity Protein 1 (Sp1) binds to the miR-200b∼200a∼429 proximal promoter and activates miR-200 expression in epithelial cells. In mesenchymal cells, Sp1 expression is maintained, but its ability to activate the miR-200 promoter is perturbed by ZEB-mediated repression. Reduction of Sp1 expression caused changes in EMT-associated markers in epithelial cells. Furthermore, we observed co-expression of Sp1 and miR-200 during mouse embryonic development wherein miR-200 expression was only lost in regions with high ZEB expression. Together, these findings indicate that miR-200 family members require Sp1 to drive basal expression and to maintain an epithelial state.

β-Arrestin1 and Distinct CXCR4 Structures Are Required for Stromal Derived Factor-1 to Downregulate CXCR4 Cell-Surface Levels in Neuroblastoma

PubMed Central

Clift, Ian C.; Bamidele, Adebowale O.; Rodriguez-Ramirez, Christie; Kremer, Kimberly N.

2014-01-01

CXC chemokine receptor 4 (CXCR4) is a G protein–coupled receptor (GPCR) located on the cell surface that signals upon binding the chemokine stromal derived factor-1 (SDF-1; also called CXCL 12). CXCR4 promotes neuroblastoma proliferation and chemotaxis. CXCR4 expression negatively correlates with prognosis and drives neuroblastoma growth and metastasis in mouse models. All functions of CXCR4 require its expression on the cell surface, yet the molecular mechanisms that regulate CXCR4 cell-surface levels in neuroblastoma are poorly understood. We characterized CXCR4 cell-surface regulation in the related SH-SY5Y and SK-N-SH human neuroblastoma cell lines. SDF-1 treatment caused rapid down-modulation of CXCR4 in SH-SY5Y cells. Pharmacologic activation of protein kinase C similarly reduced CXCR4, but via a distinct mechanism. Analysis of CXCR4 mutants delineated two CXCR4 regions required for SDF-1 treatment to decrease cell-surface CXCR4 in neuroblastoma cells: the isoleucine-leucine motif at residues 328 and 329 and residues 343–352. In contrast, and unlike CXCR4 regulation in other cell types, serines 324, 325, 338, and 339 were not required. Arrestin proteins can bind and regulate GPCR cell-surface expression, often functioning together with kinases such as G protein–coupled receptor kinase 2 (GRK2). Using SK-N-SH cells which are naturally deficient in β-arrestin1, we showed that β-arrestin1 is required for the CXCR4 343–352 region to modulate CXCR4 cell-surface expression following treatment with SDF-1. Moreover, GRK2 overexpression enhanced CXCR4 internalization, via a mechanism requiring both β-arrestin1 expression and the 343–352 region. Together, these results characterize CXCR4 structural domains and β-arrestin1 as critical regulators of CXCR4 cell-surface expression in neuroblastoma. β-Arrestin1 levels may therefore influence the CXCR4-driven metastasis of neuroblastoma as well as prognosis. PMID:24452472

A novel positive transcriptional feedback loop in midbrain-hindbrain boundary development is revealed through analysis of the zebrafish pax2.1 promoter in transgenic lines.

PubMed

Picker, Alexander; Scholpp, Steffen; Böhli, Heike; Takeda, Hiroyuki; Brand, Michael

2002-07-01

The pax2.1 gene encodes a paired-box transcription factor that is one of the earliest genes to be specifically activated in development of the midbrain and midbrain-hindbrain boundary (MHB), and is required for the development and organizer activity of this territory. To understand how this spatially restricted transcriptional activity of pax2.1 is achieved, we have isolated and characterized the pax2.1-promoter using a lacZ and a GFP reporter gene in transient injection assays and transgenic lines. Stable transgenic expression of this reporter gene shows that a 5.3-kb fragment of the 5' region contains most, but not all, elements required for driving pax2.1 expression. The expressing tissues include the MHB, hindbrain, spinal cord, ear and pronephros. Transgene activation in the pronephros and developing ear suggests that these pax2.1-expressing tissues are composed of independently regulated subdomains. In addition, ectopic but spatially restricted activation of the reporter genes in rhombomeres 3 and 5 and in the forebrain, which do not normally express endogenous pax2.1, demonstrates the importance of negative regulation of pax2.1. Comparison of transgene expression in wild-type and homozygous pax2.1 mutant no isthmus (noi) embryos reveals that the transgene contains control element(s) for a novel, positive transcriptional feedback loop in MHB development. Transcription of endogenous pax2.1 at the MHB is known to be initially Pax2.1 independent, during activation in late gastrulation. In contrast, transgene expression requires the endogenous Pax2.1 function. Transplantations, mRNA injections and morpholino knock-down experiments show that this feedback regulation of pax2.1 transcription occurs cell-autonomously, and that it requires eng2 and eng3 as known targets for Pax2.1 regulation. We suggest that this novel feedback loop may allow continuation of pax2.1 expression, and hence development of the MHB organizer, to become independent of the patterning machinery of the gastrula embryo.

Control of her1 expression during zebrafish somitogenesis by a Delta-dependent oscillator and an independent wave-front activity

PubMed Central

Holley, Scott A.; Geisler, Robert; Nüsslein-Volhard, Christiane

2000-01-01

Somitogenesis has been linked both to a molecular clock that controls the oscillation of gene expression in the presomitic mesoderm (PSM) and to Notch pathway signaling. The oscillator, or clock, is thought to create a prepattern of stripes of gene expression that regulates the activity of the Notch pathway that subsequently directs somite border formation. Here, we report that the zebrafish gene after eight (aei) that is required for both somitogenesis and neurogenesis encodes the Notch ligand DeltaD. Additional analysis revealed that stripes of her1 expression oscillate within the PSM and that aei/DeltaD signaling is required for this oscillation. aei/DeltaD expression does not oscillate, indicating that the activity of the Notch pathway upstream of her1 may function within the oscillator itself. Moreover, we found that her1 stripes are expressed in the anlage of consecutive somites, indicating that its expression pattern is not pair-rule. Analysis of her1 expression in aei/DeltaD, fused somites (fss), and aei;fss embryos uncovered a wave-front activity that is capable of continually inducing her1 expression de novo in the anterior PSM in the absence of the oscillation of her1. The wave-front activity, in reference to the clock and wave-front model, is defined as such because it interacts with the oscillator-derived pattern in the anterior PSM and is required for somite morphogenesis. This wave-front activity is blocked in embryos mutant for fss but not aei/DeltaD. Thus, our analysis indicates that the smooth sequence of formation, refinement, and fading of her1 stripes in the PSM is governed by two separate activities. PMID:10887161

Hmx1 is required for the normal development of somatosensory neurons in the geniculate ganglion

PubMed Central

Quina, Lely A.; Tempest, Lynne; Hsu, Yun-Wei A.; Cox, Timothy C.; Turner, Eric E.

2012-01-01

Hmx1 is a variant homeodomain transcription factor expressed in the developing sensory nervous system, retina, and craniofacial mesenchyme. Recently, mutations at the Hmx1 locus have been linked to craniofacial defects in humans, rats, and mice, but its role in nervous system development is largely unknown. Here we show that Hmx1 is expressed in a subset of sensory neurons in the cranial and dorsal root ganglia which does not correspond to any specific sensory modality. Sensory neurons in the dorsal root and trigeminal ganglia of Hmx1dm/dm mouse embryos have no detectable Hmx1 protein, yet they undergo neurogenesis and express sensory subtype markers normally, demonstrating that Hmx1 is not globally required for the specification of sensory neurons from neural crest precursors. Loss of Hmx1 expression has no obvious effect on the early development of the trigeminal (V), superior (IX/X), or dorsal root ganglia neurons in which it is expressed, but results in marked defects in the geniculate (VII) ganglion. Hmx1dm/dm mouse embryos possess only a vestigial posterior auricular nerve, and general somatosensory neurons in the geniculate ganglion are greatly reduced by mid-gestation. Although Hmx1 is expressed in geniculate neurons prior to cell cycle exit, it does not appear to be required for neurogenesis, and the loss of geniculate neurons is likely to be the result of increased cell death. Fate mapping of neural crest-derived tissues indicates that Hmx1-expressing somatosensory neurons at different axial levels may be derived from either the neural crest or the neurogenic placodes. PMID:22586713

Bisphenol A Impairs Synaptic Plasticity by Both Pre‐ and Postsynaptic Mechanisms

PubMed Central

Li, Tingting; Gong, Huarui; Chen, Zhi; Jin, Yan; Xu, Guangwei

2017-01-01

Bisphenol A (BPA), an environmental xenoestrogen, has been reported to induce learning and memory impairments in rodent animals. However, effects of BPA exposure on synaptic plasticity and the underlying physiological mechanisms remain elusive. Our behavioral and electrophysiological analyses show that BPA obviously perturbs hippocampal spatial memory of juvenile Sprague–Dawley rats after four weeks exposure, with significantly impaired long‐term potentiation (LTP) in the hippocampus. These effects involve decreased spine density of pyramidal neurons, especially the apical dendritic spine. Further presynaptic findings show an overt inhibition of pulse‐paired facilitation during electrophysiological recording, which suggest the decrease of presynaptic transmitter release and is consistent with reduced production of presynaptic glutamate after BPA exposure. Meanwhile, LTP‐related glutamate receptors, NMDA receptor 2A (NR2A) and AMPA receptor 1 (GluR1), are significantly downregulated in BPA‐exposed rats. Excitatory postsynaptic currents (EPSCs) results also show that EPSCNMDA, but not EPSCAMPA, is declined by 40% compared to the baseline in BPA‐perfused brain slices. Taken together, these findings reveal that juvenile BPA exposure has negative effects on synaptic plasticity, which result from decreases in dendritic spine density and excitatory synaptic transmission. Importantly, this study also provides new insights into the dynamics of BPA‐induced memory deterioration during the whole life of rats. PMID:28852612

Phenformin suppresses calcium responses to glutamate and protects hippocampal neurons against excitotoxicity.

PubMed

Lee, Jaewon; Chan, Sic L; Lu, Chengbiao; Lane, Mark A; Mattson, Mark P

2002-05-01

Phenformin is a biguanide compound that can modulate glucose metabolism and promote weight loss and is therefore used to treat patients with type-2 diabetes. While phenformin may indirectly affect neurons by changing peripheral energy metabolism, the possibility that it directly affects neurons has not been examined. We now report that phenformin suppresses responses of hippocampal neurons to glutamate and decreases their vulnerability to excitotoxicity. Pretreatment of embryonic rat hippocampal cell cultures with phenformin protected neurons against glutamate-induced death, which was correlated with reduced calcium responses to glutamate. Immunoblot analyses showed that levels of the N-methyl-d-aspartate (NMDA) subunits NR1 and NR2A were significantly decreased in neurons exposed to phenformin, whereas levels of the AMPA receptor subunit GluR1 were unchanged. Whole-cell patch clamp analyses revealed that NMDA-induced currents were decreased, and AMPA-induced currents were unchanged in neurons pretreated with phenformin. Our data demonstrate that phenformin can protect neurons against excitotoxicity by differentially modulating levels of NMDA receptor subunits in a manner that decreases glutamate-induced calcium influx. These findings show that phenformin can modulate neuronal responses to glutamate, and suggest possible use of phenformin and related compounds in the prevention and/or treatment of neurodegenerative conditions. Copyright 2002 Elsevier Science (USA).

OsCSLD1, a cellulose synthase-like D1 gene, is required for root hair morphogenesis in rice.

PubMed

Kim, Chul Min; Park, Sung Han; Je, Byoung Il; Park, Su Hyun; Park, Soon Ju; Piao, Hai Long; Eun, Moo Young; Dolan, Liam; Han, Chang-deok

2007-03-01

Root hairs are long tubular outgrowths that form on the surface of specialized epidermal cells. They are required for nutrient and water uptake and interact with the soil microflora. Here we show that the Oryza sativa cellulose synthase-like D1 (OsCSLD1) gene is required for root hair development, as rice (Oryza sativa) mutants that lack OsCSLD1 function develop abnormal root hairs. In these mutants, while hair development is initiated normally, the hairs elongate less than the wild-type hairs and they have kinks and swellings along their length. Because the csld1 mutants develop the same density and number of root hairs along their seminal root as the wild-type plants, we propose that OsCSLD1 function is required for hair elongation but not initiation. Both gene trap expression pattern and in situ hybridization analyses indicate that OsCSLD1 is expressed in only root hair cells. Furthermore, OsCSLD1 is the only member of the four rice CSLD genes that shows root-specific expression. Given that the Arabidopsis (Arabidopsis thaliana) gene KOJAK/AtCSLD3 is required for root hair elongation and is expressed in the root hair, it appears that OsCSLD1 may be the functional ortholog of KOJAK/AtCSLD3 and that these two genes represent the root hair-specific members of this family of proteins. Thus, at least part of the mechanism of root hair morphogenesis in Arabidopsis is conserved in rice.

Monocyte 15-lipoxygenase gene expression requires ERK1/2 MAPK activity.

PubMed

Bhattacharjee, Ashish; Mulya, Anny; Pal, Srabani; Roy, Biswajit; Feldman, Gerald M; Cathcart, Martha K

2010-11-01

IL-13 induces profound expression of 15-lipoxygenase (15-LO) in primary human monocytes. Our studies have defined the functional IL-13R complex, association of Jaks with the receptor components, and the tyrosine phosphorylation of several Stat molecules in response to IL-13. Furthermore, we identified both p38MAPK and protein kinase Cδ as critical regulators of 15-LO expression. In this study, we report an ERK1/2-dependent signaling cascade that regulates IL-13-mediated 15-LO gene expression. We show the rapid phosphorylation/activation of ERK1/2 upon IL-13 exposure. Our results indicate that Tyk2 kinase is required for the activation of ERK1/2, which is independent of the Jak2, p38MAPK, and protein kinase Cδ pathways, suggesting bifurcating parallel regulatory pathways downstream of the receptor. To investigate the signaling mechanisms associated with the ERK1/2-dependent expression of 15-LO, we explored the involvement of transcription factors, with predicted binding sites in the 15-LO promoter, in this process including Elk1, early growth response-1 (Egr-1), and CREB. Our findings indicate that IL-13 induces Egr-1 nuclear accumulation and CREB serine phosphorylation and that both are markedly attenuated by inhibition of ERK1/2 activity. We further show that ERK1/2 activity is required for both Egr-1 and CREB DNA binding to their cognate sequences identified within the 15-LO promoter. Furthermore, by transfecting monocytes with the decoy oligodeoxyribonucleotides specific for Egr-1 and CREB, we discovered that Egr-1 and CREB are directly involved in regulating 15-LO gene expression. These studies characterize an important regulatory role for ERK1/2 in mediating IL-13-induced monocyte 15-LO expression via the transcription factors Egr-1 and CREB.

Redundancy in Kiss1 Expression Safeguards Reproduction in the Mouse

PubMed Central

Popa, Simina M.; Moriyama, Ryutaro M.; Caligioni, Claudia S.; Yang, Jasmine J.; Cho, Caroline M.; Concepcion, Tessa L.; Oakley, Amy E.; Lee, In Hae; Sanz, Elisenda; Amieux, Paul S.; Caraty, Alain; Palmiter, Richard D.; Navarro, Victor M.; Chan, Yee-Ming; Seminara, Stephanie B.; Clifton, Donald K.

2013-01-01

Kisspeptin (Kiss1) signaling to GnRH neurons is widely acknowledged to be a prerequisite for puberty and reproduction. Animals lacking functional genes for either kisspeptin or its receptor exhibit low gonadotropin secretion and infertility. Paradoxically, a recent study reported that genetic ablation of nearly all Kiss1-expressing neurons (Kiss1 neurons) does not impair reproduction, arguing that neither Kiss1 neurons nor their products are essential for sexual maturation. We posited that only minute quantities of kisspeptin are sufficient to support reproduction. If this were the case, animals having dramatically reduced Kiss1 expression might retain fertility, testifying to the redundancy of Kiss1 neurons and their products. To test this hypothesis and to determine whether males and females differ in the required amount of kisspeptin needed for reproduction, we used a mouse (Kiss1-CreGFP) that has a severe reduction in Kiss1 expression. Mice that are heterozygous and homozygous for this allele (Kiss1Cre/+ and Kiss1Cre/Cre) have ∼50% and 95% reductions in Kiss1 transcript, respectively. We found that although male Kiss1Cre/Cre mice sire normal-sized litters, female Kiss1Cre/Cre mice exhibit significantly impaired fertility and ovulation. These observations suggest that males require only 5% of normal Kiss1 expression to be reproductively competent, whereas females require higher levels for reproductive success. PMID:23736293

HilD and PhoP independently regulate the expression of grhD1, a novel gene required for Salmonella Typhimurium invasion of host cells.

PubMed

Banda, María M; López, Carolina; Manzo, Rubiceli; Rico-Pérez, Gadea; García, Pablo; Rosales-Reyes, Roberto; De la Cruz, Miguel A; Soncini, Fernando C; García-Del Portillo, Francisco; Bustamante, Víctor H

2018-03-19

When Salmonella is grown in the nutrient-rich lysogeny broth (LB), the AraC-like transcriptional regulator HilD positively controls the expression of genes required for Salmonella invasion of host cells, such as the Salmonella pathogenicity island 1 (SPI-1) genes. However, in minimal media, the two-component system PhoP/Q activates the expression of genes necessary for Salmonella replication inside host cells, such as the SPI-2 genes. Recently, we found that the SL1344_1872 hypothetical gene, located in a S. Typhimurium genomic island, is co-expressed with the SPI-1 genes. In this study we demonstrate that HilD induces indirectly the expression of SL1344_1872 when S. Typhimurium is grown in LB; therefore, we named SL1344_1872 as grhD1 for gene regulated by HilD. Furthermore, we found that PhoP positively controls the expression of grhD1, independently of HilD, when S. Typhimurium is grown in LB or N-minimal medium. Moreover, we demonstrate that the grhD1 gene is required for the invasion of S. Typhimurium into epithelial cells, macrophages and fibroblasts, as well as for the intestinal inflammatory response caused by S. Typhimurium in mice. Thus, our results reveal a novel virulence factor of Salmonella, whose expression is positively and independently controlled by the HilD and PhoP transcriptional regulators.

The lineage-specific gene ponzr1 is essential for zebrafish pronephric and pharyngeal arch development.

PubMed

Bedell, Victoria M; Person, Anthony D; Larson, Jon D; McLoon, Anna; Balciunas, Darius; Clark, Karl J; Neff, Kevin I; Nelson, Katie E; Bill, Brent R; Schimmenti, Lisa A; Beiraghi, Soraya; Ekker, Stephen C

2012-02-01

The Homeobox (Hox) and Paired box (Pax) gene families are key determinants of animal body plans and organ structure. In particular, they function within regulatory networks that control organogenesis. How these conserved genes elicit differences in organ form and function in response to evolutionary pressures is incompletely understood. We molecularly and functionally characterized one member of an evolutionarily dynamic gene family, plac8 onzin related protein 1 (ponzr1), in the zebrafish. ponzr1 mRNA is expressed early in the developing kidney and pharyngeal arches. Using ponzr1-targeting morpholinos, we show that ponzr1 is required for formation of the glomerulus. Loss of ponzr1 results in a nonfunctional glomerulus but retention of a functional pronephros, an arrangement similar to the aglomerular kidneys found in a subset of marine fish. ponzr1 is integrated into the pax2a pathway, with ponzr1 expression requiring pax2a gene function, and proper pax2a expression requiring normal ponzr1 expression. In addition to pronephric function, ponzr1 is required for pharyngeal arch formation. We functionally demonstrate that ponzr1 can act as a transcription factor or co-factor, providing the first molecular mode of action for this newly described gene family. Together, this work provides experimental evidence of an additional mechanism that incorporates evolutionarily dynamic, lineage-specific gene families into conserved regulatory gene networks to create functional organ diversity.

[PD-L1 expression: An emerging biomarker in non-small cell lung cancer].

PubMed

Adam, Julien; Planchard, David; Marabelle, Aurélien; Soria, Jean-Charles; Scoazec, Jean-Yves; Lantuéjoul, Sylvie

2016-01-01

Therapies targeting immune checkpoints, in particular programmed death 1 (PD-1) and its ligand programmed death ligand 1 (PD-L1), are major new strategies for the treatment of several malignancies including mestatatic non-small cell lung cancer (NSCLC). The identification of predictive biomarkers of response is required, considering efficacy, cost and potential adverse events. Expression of PD-L1 by immunohistochemistry has been associated with higher response rate and overall survival in several clinical trials evaluating anti-PD-1 and anti-PD-L1 monoclonal antibodies. Thus, PD-L1 immunohistochemical companion assays could be required for treatment with some of these therapies in NSCLC. However, heterogeneity in methodologies of PD-L1 assays in terms of primary antibodies and scoring algorithms, and tumor heterogenity for PD-L1 expression are important issues to be considered. More studies are required to compare the different assays, ensure their harmonization and standardization and identify the optimal conditions for testing. PD-L1 expression is likely an imperfect predictive biomarker for patient selection and association with other markers of the tumor immune microenvironment will be probably necessary in the future. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Activation of the Arabidopsis B class homeotic genes by APETALA1.

PubMed

Ng, M; Yanofsky, M F

2001-04-01

Proper development of petals and stamens in Arabidopsis flowers requires the activities of APETALA3 (AP3) and PISTILLATA (PI), whose transcripts can be detected in the petal and stamen primordia. Localized expression of AP3 and PI requires the activities of at least three genes: APETALA1 (AP1), LEAFY (LFY), and UNUSUAL FLORAL ORGANS (UFO). It has been proposed that UFO provides spatial cues and that LFY specifies competence for AP3 and PI expression in the developing flower. To understand the epistatic relationship among AP1, LFY, and UFO in regulating AP3 and PI expression, we generated two versions of AP1 that have strong transcriptional activation potential. Genetic and molecular analyses of transgenic plants expressing these activated AP1 proteins show that the endogenous AP1 protein acts largely as a transcriptional activator in vivo and that AP1 specifies petals by regulating the spatial domains of AP3 and PI expression through UFO.

Cyclin D1 Repression of Peroxisome Proliferator-Activated Receptor γ Expression and Transactivation

PubMed Central

Wang, Chenguang; Pattabiraman, Nagarajan; Zhou, Jian Nian; Fu, Maofu; Sakamaki, Toshiyuki; Albanese, Chris; Li, Zhiping; Wu, Kongming; Hulit, James; Neumeister, Peter; Novikoff, Phyllis M.; Brownlee, Michael; Scherer, Philipp E.; Jones, Joan G.; Whitney, Kathleen D.; Donehower, Lawrence A.; Harris, Emily L.; Rohan, Thomas; Johns, David C.; Pestell, Richard G.

2003-01-01

The cyclin D1 gene is overexpressed in human breast cancers and is required for oncogene-induced tumorigenesis. Peroxisome proliferator-activated receptor γ (PPARγ) is a nuclear receptor selectively activated by ligands of the thiazolidinedione class. PPARγ induces hepatic steatosis, and liganded PPARγ promotes adipocyte differentiation. Herein, cyclin D1 inhibited ligand-induced PPARγ function, transactivation, expression, and promoter activity. PPARγ transactivation induced by the ligand BRL49653 was inhibited by cyclin D1 through a pRB- and cdk-independent mechanism, requiring a region predicted to form an helix-loop-helix (HLH) structure. The cyclin D1 HLH region was also required for repression of the PPARγ ligand-binding domain linked to a heterologous DNA binding domain. Adipocyte differentiation by PPARγ-specific ligands (BRL49653, troglitazone) was enhanced in cyclin D1−/− fibroblasts and reversed by retroviral expression of cyclin D1. Homozygous deletion of the cyclin D1 gene, enhanced expression by PPARγ ligands of PPARγ and PPARγ-responsive genes, and cyclin D1−/− mice exhibit hepatic steatosis. Finally, reduction of cyclin D1 abundance in vivo using ponasterone-inducible cyclin D1 antisense transgenic mice, increased expression of PPARγ in vivo. The inhibition of PPARγ function by cyclin D1 is a new mechanism of signal transduction cross talk between PPARγ ligands and mitogenic signals that induce cyclin D1. PMID:12917338

TPA can overcome the requirement for EIa and together act synergistically in stimulating expression of the adenovirus EIII promoter.

PubMed Central

Buckbinder, L; Miralles, V J; Reinberg, D

1989-01-01

We have examined the control of gene expression from the adenovirus early region III (Ad-EIII) promoter, which contains two previously defined elements, the AP1 and ATF sites. We found that the AP1 element is capable of mediating activation by the adenovirus immediate early (EIa) gene products. Consistent with studies demonstrating that the AP1 site mediates signal transduction in response to 12-O-tetradecanoylphorbol 13-acetate (TPA) we have shown that TPA can activate Ad-EIII expression and overcome the requirement for EIa. Together TPA and EIa elicited a synergistic response in expression from the Ad-EIII promoter during both transient expression assays and viral infections. This synergistic effect required the AP1 element. An EIII promoter construct, in which sequences upstream of the TATA box had been replaced with four AP1 sites, was responsive to TPA and EIa and in combination promoted the synergistic effect. The analysis of specific factors involved in transcription from the Ad-EIII indicated that proteins recognizing the ATF and AP1 sites were important in expression from this promoter in vitro. Purification of protein factors that specifically stimulated EIII expression resulted in the isolation of a set of factors of the AP1 family. Affinity purified AP1 recognized and activated transcription through both the AP1 and ATF elements. In addition, a protein fraction was identified with DNA binding activity specific for the ATF element. This fraction was dependent on the ATF site for transcriptional activity. Images PMID:2531661

Role of the ventral tegmental area in methamphetamine extinction: AMPA receptor-mediated neuroplasticity

PubMed Central

Chen, Han-Ting

2015-01-01

The molecular mechanisms underlying drug extinction remain largely unknown, although a role for medial prefrontal cortex (mPFC) glutamate neurons has been suggested. Considering that the mPFC sends glutamate efferents to the ventral tegmental area (VTA), we tested whether the VTA is involved in methamphetamine (METH) extinction via conditioned place preference (CPP). Among various METH-CPP stages, we found that the amount of phospho-GluR1/Ser845 increased in the VTA at behavioral extinction, but not the acquisition or withdrawal stage. Via surface biotinylation, we found that levels of membrane GluR1 were significantly increased during METH-CPP extinction, while no change was observed at the acquisition stage. Specifically, the number of dendritic spines in the VTA was increased at behavioral extinction, but not during acquisition. To validate the role of the mPFC in METH-CPP extinction, we lesioned the mPFC. Ibotenic acid lesioning of the mPFC did not affect METH-CPP acquisition, however, it abolished the extinction stage and reversed the enhanced phospho-GluR1/Ser845 levels as well as increases in VTA dendritic spines during METH-CPP extinction. Overall, this study demonstrates that the mPFC plays a critical role in METH-CPP extinction and identifies the VTA as an alternative target in mediating the extinction of drug conditioning. PMID:25691515

HIV-1 Infection Induces Interleukin-1β Production via TLR8 Protein-dependent and NLRP3 Inflammasome Mechanisms in Human Monocytes*

PubMed Central

Guo, Haitao; Gao, Jianmei; Taxman, Debra J.; Ting, Jenny P. Y.; Su, Lishan

2014-01-01

The induction of inflammatory cytokines such as IL-1β is associated with the progression of human immunodeficiency virus, type 1 (HIV-1) disease or AIDS. Unlike most inflammatory cytokines that are regulated by NF-κB at the transcriptional level, production of mature IL-1β also depends on inflammasome activation. The mechanism by which HIV-1 induces pro-IL-1β expression and activates inflammasomes to cleave pro-IL-1β into its bioactive form is not clearly defined. We report here that HIV-1 infection in human monocytes efficiently induced IL-1β expression and inflammasome activation. Toll-like receptor 8 (TLR8) was required for inducing pro-IL-1β expression, whereas the NLRP3 inflammasome was required for IL-1β maturation and release. Furthermore, the lysosomal protease cathepsin B and HIV-1 induced production of reactive oxygen species were critical for HIV-induced inflammasome activation and IL-1β production. HIV-1 entry, reverse transcription, and integration were all required for both pro-IL-1β expression and inflammasome activation. Finally, we show that HIV-1-derived RNA was sufficient to induce both pro-IL-1β expression and inflammasome activation. We conclude that HIV-1 infection induced the expression of pro-IL-1β via TLR8-mediated mechanisms and activated caspase-1 through the NLRP3 inflammasome to cleave pro-IL-1β into bioactive IL-1β. These findings help to elucidate mechanisms of HIV-1 disease progression and identify novel targets for treating HIV-1 induced inflammation and immune activation. PMID:24939850

SIRT1 inhibits proliferation of pancreatic cancer cells expressing pancreatic adenocarcinoma up-regulated factor (PAUF), a novel oncogene, by suppression of {beta}-catenin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cho, Il-Rae; Koh, Sang Seok; Department of Functional Genomics, University of Science and Technology, Daejeon 305-333

2012-06-29

Highlights: Black-Right-Pointing-Pointer SIRT1 inhibits protein levels of {beta}-catenin and its transcriptional activity. Black-Right-Pointing-Pointer Nuclear localization of SIRT1 is not required for the decrease of {beta}-catenin expression. Black-Right-Pointing-Pointer SIRT1-mediated degradation of {beta}-catenin is not required for GSK-3{beta} and Siah-1 but for proteosome. Black-Right-Pointing-Pointer SIRT1 activation inhibits proliferation of pancreatic cancer cells expressing PAUF. -- Abstract: Because we found in a recent study that pancreatic adenocarcinoma up-regulated factor (PAUF), a novel oncogene, induces a rapid proliferation of pancreatic cells by up-regulation of {beta}-catenin, we postulated that {beta}-catenin might be a target molecule for pancreatic cancer treatment. We thus speculated whether SIRT1, knownmore » to target {beta}-catenin in a colon cancer model, suppresses {beta}-catenin in those pancreatic cancer cells that express PAUF (Panc-PAUF). We further evaluated whether such suppression would lead to inhibition of the proliferation of these cells. The ectopic expression of either SIRT1 or resveratrol (an activator of SIRT1) suppressed levels of {beta}-catenin protein and its transcriptional activity in Panc-PAUF cells. Conversely, suppression of SIRT1 expression by siRNA enhanced {beta}-catenin expression and transcriptional activity. SIRT1 mutant analysis showed that nuclear localization of SIRT1 is not required for reduction of {beta}-catenin. Treatment with MG132, a proteasomal inhibitor, restored {beta}-catenin protein levels, suggesting that SIRT1-mediated degradation of {beta}-catenin requires proteasomal activity. It was reported that inhibition of GSK-3{beta} or Siah-1 stabilizes {beta}-catenin in colon cancer cells, but suppression of GSK-3{beta} or Siah-1 using siRNA in the presence of resveratrol instead diminished {beta}-catenin protein levels in Panc-PAUF cells. This suggests that GSK-3{beta} and Siah-1 are not involved in SIRT1-mediated degradation of {beta}-catenin in the cells. Finally, activation of SIRT1 inhibited the proliferation of Panc-PAUF cells by down-regulation of cyclin-D1, a target molecule of {beta}-catenin. These results suggest that SIRT1 activation may be a therapeutic strategy for treatment of pancreatic cancer cells that express PAUF via the down-regulation of {beta}-catenin.« less

The C. elegans che-1 gene encodes a zinc finger transcription factor required for specification of the ASE chemosensory neurons.

PubMed

Uchida, Okiko; Nakano, Hiroyuki; Koga, Makoto; Ohshima, Yasumi

2003-04-01

Chemotaxis to water-soluble chemicals such as NaCl is an important behavior of C. elegans when seeking food. ASE chemosensory neurons have a major role in this behavior. We show that che-1, defined by chemotaxis defects, encodes a zinc-finger protein similar to the GLASS transcription factor required for photoreceptor cell differentiation in Drosophila, and that che-1 is essential for specification and function of ASE neurons. Expression of a che-1::gfp fusion construct was predominant in ASE. In che-1 mutants, expression of genes characterizing ASE such as seven-transmembrane receptors, guanylate cyclases and a cyclic-nucleotide gated channel is lost. Ectopic expression of che-1 cDNA induced expression of ASE-specific marker genes, a dye-filling defect in neurons other than ASE and dauer formation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frampton, Gabriel; Coufal, Monique; Li, Huang

The endocannabinoids anandamide (AEA) and 2-arachidonylglycerol (2-AG) have opposing effects on cholangiocarcinoma growth. Implicated in cancer, Notch signaling requires the {gamma}-secretase complex for activation. The aims of this study were to determine if the opposing effects of endocannabinoids depend on the differential activation of the Notch receptors and to demonstrate that the differential activation of these receptors are due to presenilin 1 containing- and presenilin 2 containing-{gamma}-secretase complexes. Mz-ChA-1 cells were treated with AEA or 2-AG. Notch receptor expression, activation, and nuclear translocation were determined. Specific roles for Notch 1 and 2 on cannabinoid-induced effects were determined by transient transfectionmore » of Notch 1 or 2 shRNA vectors before stimulation with AEA or 2-AG. Expression of presenilin 1 and 2 was determined after AEA or 2-AG treatment, and the involvement of presenilin 1 and 2 in the cannabinoid-induced effects was demonstrated in cell lines with low presenilin 1 or 2 expression. Antiproliferative effects of AEA required increased Notch 1 mRNA, activation, and nuclear translocation, whereas the growth-promoting effects induced by 2-AG required increased Notch 2 mRNA expression, activation, and nuclear translocation. AEA increased presenilin 1 expression and recruitment into the {gamma}-secretase complex, whereas 2-AG increased expression and recruitment of presenilin 2. The development of novel therapeutic strategies aimed at modulating the endocannabinoid system or mimicking the mode of action of AEA on Notch signaling pathways would prove beneficial for cholangiocarcinoma management.« less

Isl1 Is required for multiple aspects of motor neuron development

PubMed Central

Liang, Xingqun; Song, Mi-Ryoung; Xu, ZengGuang; Lanuza, Guillermo M.; Liu, Yali; Zhuang, Tao; Chen, Yihan; Pfaff, Samuel L.; Evans, Sylvia M.; Sun, Yunfu

2011-01-01

The LIM homeodomain transcription factor Islet1 (Isl1) is expressed in multiple organs and plays essential roles during embryogenesis. Isl1 is required for the survival and specification of spinal cord motor neurons. Due to early embryonic lethality and loss of motor neurons, the role of Isl1 in other aspects of motor neuron development remains unclear. In this study, we generated Isl1 mutant mouse lines expressing graded doses of Isl1. Our study has revealed essential roles of Isl1 in multiple aspects of motor neuron development, including motor neuron cell body localization, motor column formation and axon growth. In addition, Isl1 is required for survival of cranial ganglia neurons. PMID:21569850

OsCSLD1, a Cellulose Synthase-Like D1 Gene, Is Required for Root Hair Morphogenesis in Rice1[C][W

PubMed Central

Kim, Chul Min; Park, Sung Han; Je, Byoung Il; Park, Su Hyun; Park, Soon Ju; Piao, Hai Long; Eun, Moo Young; Dolan, Liam; Han, Chang-deok

2007-01-01

Root hairs are long tubular outgrowths that form on the surface of specialized epidermal cells. They are required for nutrient and water uptake and interact with the soil microflora. Here we show that the Oryza sativa cellulose synthase-like D1 (OsCSLD1) gene is required for root hair development, as rice (Oryza sativa) mutants that lack OsCSLD1 function develop abnormal root hairs. In these mutants, while hair development is initiated normally, the hairs elongate less than the wild-type hairs and they have kinks and swellings along their length. Because the csld1 mutants develop the same density and number of root hairs along their seminal root as the wild-type plants, we propose that OsCSLD1 function is required for hair elongation but not initiation. Both gene trap expression pattern and in situ hybridization analyses indicate that OsCSLD1 is expressed in only root hair cells. Furthermore, OsCSLD1 is the only member of the four rice CSLD genes that shows root-specific expression. Given that the Arabidopsis (Arabidopsis thaliana) gene KOJAK/AtCSLD3 is required for root hair elongation and is expressed in the root hair, it appears that OsCSLD1 may be the functional ortholog of KOJAK/AtCSLD3 and that these two genes represent the root hair-specific members of this family of proteins. Thus, at least part of the mechanism of root hair morphogenesis in Arabidopsis is conserved in rice. PMID:17259288

NbActiv4 medium improvement to Neurobasal/B27 increases neuron synapse densities and network spike rates on multielectrode arrays.

PubMed

Brewer, Gregory J; Boehler, Michael D; Jones, Torrie T; Wheeler, Bruce C

2008-05-30

The most interesting property of neurons is their long-distance propagation of signals as spiking action potentials. Since 1993, Neurobasal/B27 has been used as a serum-free medium optimized for hippocampal neuron survival. Neurons on microelectrode arrays (MEA) were used as an assay system to increase spontaneous spike rates in media of different compositions. We find spike rates of 0.5 s(-1) (Hz) for rat embryonic hippocampal neurons cultured in Neurobasal/B27, lower than cultures in serum-based media and offering an opportunity for improvement. NbActiv4 was formulated by addition of creatine, cholesterol and estrogen to Neurobasal/B27 that synergistically produced an eightfold increase in spontaneous spike activity. The increased activity with NbActiv4 correlated with a twofold increase in immunoreactive synaptophysin bright puncta and GluR1 total puncta. Characteristic of synaptic scaling, immunoreactive GABAAbeta puncta also increased 1.5-fold and NMDA-R1 puncta increased 1.8-fold. Neuron survival in NbActiv4 equaled that in Neurobasal/B27, but with slightly higher astroglia. Resting respiratory demand was decreased and demand capacity was increased in NbActiv4, indicating less stress and higher efficiency. These results show that NbActiv4 is an improvement to Neurobasal/B27 for cultured networks with an increased density of synapses and transmitter receptors which produces higher spontaneous spike rates in neuron networks.

Lentiviral vectors containing mouse Csf1r control elements direct macrophage-restricted expression in multiple species of birds and mammals

PubMed Central

Pridans, Clare; Lillico, Simon; Whitelaw, Bruce; Hume, David A

2014-01-01

The development of macrophages requires signaling through the lineage-restricted receptor Csf1r. Macrophage-restricted expression of transgenic reporters based upon Csf1r requires the highly conserved Fms-intronic regulatory element (FIRE). We have created a lentiviral construct containing mouse FIRE and promoter. The lentivirus is capable of directing macrophage-restricted reporter gene expression in mouse, rat, human, pig, cow, sheep, and even chicken. Rat bone marrow cells transduced with the lentivirus were capable of differentiating into macrophages expressing the reporter gene in vitro. Macrophage-restricted expression may be desirable for immunization or immune response modulation, and for gene therapy for lysosomal storage diseases and some immunodeficiencies. The small size of the Csf1r transcription control elements will allow the insertion of large “cargo” for applications in gene therapy and vaccine delivery. PMID:26015955

BIG: a calossin-like protein required for polar auxin transport in Arabidopsis

PubMed Central

Gil, Pedro; Dewey, Elizabeth; Friml, Jiri; Zhao, Yunde; Snowden, Kimberley C.; Putterill, Jo; Palme, Klaus; Estelle, Mark; Chory, Joanne

2001-01-01

Polar auxin transport is crucial for the regulation of auxin action and required for some light-regulated responses during plant development. We have found that two mutants of Arabidopsis—doc1, which displays altered expression of light-regulated genes, and tir3, known for its reduced auxin transport—have similar defects and define mutations in a single gene that we have renamed BIG. BIG is very similar to the Drosophila gene Calossin/Pushover, a member of a gene family also present in Caenorhabditis elegans and human genomes. The protein encoded by BIG is extraordinary in size, 560 kD, and contains several putative Zn-finger domains. Expression-profiling experiments indicate that altered expression of multiple light-regulated genes in doc1 mutants can be suppressed by elevated levels of auxin caused by overexpression of an auxin biosynthetic gene, suggesting that normal auxin distribution is required to maintain low-level expression of these genes in the dark. Double mutants of tir3 with the auxin mutants pin1, pid, and axr1 display severe defects in auxin-dependent growth of the inflorescence. Chemical inhibitors of auxin transport change the intracellular localization of the auxin efflux carrier PIN1 in doc1/tir3 mutants, supporting the idea that BIG is required for normal auxin efflux. PMID:11485992

ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE1 (ADPG1), ADPG2, and QUARTET2 Are Polygalacturonases Required for Cell Separation during Reproductive Development in Arabidopsis[W

PubMed Central

Ogawa, Mikihiro; Kay, Pippa; Wilson, Sarah; Swain, Stephen M.

2009-01-01

Cell separation is thought to involve degradation of pectin by several hydrolytic enzymes, particularly polygalacturonase (PG). Here, we characterize an activation tagging line with reduced growth and male sterility caused by increased expression of a PG encoded by QUARTET2 (QRT2). QRT2 is essential for pollen grain separation and is part of a small family of three closely related endo-PGs in the Arabidopsis thaliana proteome, including ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE1 (ADPG1) and ADPG2. Functional assays and complementation experiments confirm that ADPG1, ADPG2, and QRT2 are PGs. Genetic analysis demonstrates that ADPG1 and ADPG2 are essential for silique dehiscence. In addition, ADPG2 and QRT2 contribute to floral organ abscission, while all three genes contribute to anther dehiscence. Expression analysis is consistent with the observed mutant phenotypes. INDEHISCENT (IND) encodes a putative basic helix-loop-helix required for silique dehiscence, and we demonstrate that the closely related HECATE3 (HEC3) gene is required for normal seed abscission and show that IND and HEC3 are required for normal expression of ADPG1 in the silique dehiscence zone and seed abscission zone, respectively. We also show that jasmonic acid and ethylene act together with abscisic acid to regulate floral organ abscission, in part by promoting QRT2 expression. These results demonstrate that multiple cell separation events, including both abscission and dehiscence, require closely related PG genes. PMID:19168715

The Bmi-1 helix–turn and ring finger domains are required for Bmi-1 antagonism of (–) epigallocatechin-3-gallate suppression of skin cancer cell survival

PubMed Central

Balasubramanian, Sivaprakasam; Scharadin, Tiffany M.; Han, Bingshe; Xu, Wen; Eckert, Richard L.

2016-01-01

The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (–) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21Cip1 and p27Kip1 expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix–turn–helix–turn–helix–turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. PMID:25843776

Differential IFN-gamma stimulation of HLA-A gene expression through CRM-1-dependent nuclear RNA export.

PubMed

Browne, Sarah K; Roesser, James R; Zhu, Sheng Zu; Ginder, Gordon D

2006-12-15

IFNs regulate most MHC class I genes by stimulating transcription initiation. As shown previously, IFN-gamma controls HLA-A expression primarily at the posttranscriptional level. We have defined two 8-base sequences in a 39-nucleotide region in the 3'-transcribed region of the HLA-A gene that are required for the posttranscriptional response to IFN-gamma. Stimulation of HLA-A expression by IFN-gamma requires nuclear export of HLA-A mRNA by chromosome maintenance region 1 (CRM-1). Treatment of cells with leptomycin B, a specific inhibitor of CRM-1, completely inhibited IFN-gamma induction of HLA-A. Expression of a truncated, dominant-negative form of the nucleoporin NUP214/CAN, DeltaCAN, that specifically interacts with CRM-1, also prevented IFN-gamma stimulation of HLA-A, providing confirmation of the role of CRM-1. Increased expression of HLA-A induced by IFN-gamma also requires protein methylation, as shown by the fact that treatment of SK-N-MC cells or HeLa cells with the PRMT1 inhibitor 5'-methyl-5'-thioadenosine abolished the cellular response to IFN-gamma. In contrast with HLA-A, IFN-gamma-induced expression of the HLA class Ib gene, HLA-E, was not affected by either 5'-methyl-5'-thioadenosine or leptomycin B. These results provide proof of principle that it is possible to differentially modulate the IFN-gamma-induced expression of the HLA-E and HLA-A genes, whose products often mediate opposing effects on cellular immunity to tumor cells, pathogens, and autoantigens.

Urban air pollutants reduce synaptic function of CA1 neurons via an NMDA/NO• pathway in vitro

PubMed Central

Davis, David A.; Akopian, Garnik; Walsh, John P.; Sioutas, Constantinos; Morgan, Todd E.; Finch, Caleb E.

2013-01-01

Airborne particulate matter (PM) from urban vehicular aerosols altered glutamate receptor functions and induced glial inflammatory responses in rodent models after chronic exposure. Potential neurotoxic mechanisms were analyzed in vitro. In hippocampal slices, 2 h exposure to aqueous nanosized PM (nPM) selectively altered postsynaptic proteins in CA1 neurons: increased GluA1, GluN2A, and GluN2B, but not GluA2, GluN1 or mGlur5; increased PSD95 and spinophilin, but not synaptophysin, while dentate gyrus (DG) neurons were unresponsive. In hippocampal slices and neurons, MitoSOX red fluorescence was increased by nPM, implying free radical production. Specifically, NO• production by slices was increased within 15 min of exposure to nPM with dose dependence, 1–10 µg/ml. Correspondingly, CA1 neurons exhibited increased nitrosylation of the GluN2A receptor and dephosphorylation of GluN2B (S1303) and of GluA1 (S831 & S845). Again, DG neurons were unresponsive to nPM. The induction of NO• and nitrosylation were inhibited by AP5, an NMDA receptor antagonist, which also protects neurite outgrowth in vitro from inhibition by nPM. Membrane injury (EthidiumD-1 uptake) showed parallel specificity. Finally, nPM decreased evoked excitatory postsynaptic currents (EPSCs) of CA1 neurons. These findings further document the selective impact of nPM on glutamatergic functions and identify novel responses of NMDA receptor-stimulated NO• production and nitrosylation reactions during nPM-mediated neurotoxicity. PMID:23927064

Ascl1-induced neuronal differentiation of P19 cells requires expression of a specific inhibitor protein of cAMP-dependent protein kinase

PubMed Central

Huang, Holly S.; Turner, David L.; Thompson, Robert C.; Uhler, Michael D.

2011-01-01

cAMP-dependent protein kinase (PKA) plays a critical role in nervous system development by modulating sonic hedgehog and bone morphogenetic protein signaling. In the current studies, P19 embryonic carcinoma cells were neuronally differentiated by expression of the proneural basic helix-loop-helix transcription factor Ascl1. After expression of Ascl1, but prior to expression of neuronal markers such as microtubule associated protein 2 and neuronal β-tubulin, P19 cells demonstrated a large, transient increase in both mRNA and protein for the endogenous protein kinase inhibitor (PKI)β. PKIβ-targeted shRNA constructs both reduced the levels of PKIβ expression and blocked the neuronal differentiation of P19 cells. This inhibition of differentiation was rescued by transfection of a shRNA-resistant expression vector for the PKIβ protein, and this rescue required the PKA-specific inhibitory sequence of the PKIβprotein. PKIβ played a very specific role in the Ascl1-mediated differentiation process since other PKI isoforms were unable to rescue the deficit conferred by shRNA-mediated knockdown of PKIβ. Our results define a novel requirement for PKIβ and its inhibition of PKA during neuronal differentiation of P19 cells. PMID:21623794

Requirement of 8-mercaptoguanosine as a costimulus for IL-4-dependent mu to gamma1 class switch recombination in CD38-activated B cells.

PubMed

Tsukamoto, Yumiko; Uehara, Shoji; Mizoguchi, Chieko; Sato, Atsushi; Horikawa, Keisuke; Takatsu, Kiyoshi

2005-10-21

Mature B-2 cells expressing surface IgM and IgD proliferate upon stimulation by CD38, CD40 or lipopolysaccharide (LPS) and differentiate into IgG1-producing plasma cells in the presence of cytokines. The process of class switch recombination (CSR) from IgM to other isotypes is highly regulated by cytokines and activation-induced cytidine deaminase (AID). Blimp-1 and XBP-1 play an essential role in the terminal differentiation of switched B-2 cells to Ig-producing plasma cells. IL-5 induces AID and Blimp-1 expression in CD38- and CD40-activated B-2 cells, leading to mu to gamma1 CSR at DNA level and IgG1 production. IL-4, a well-known IgG1-inducing factor, does not induce mu to gamma1 CSR in CD38-activated B-2 cells or Blimp-1, while IL-4 induces mu to gamma1 CSR, XBP-1 expression, and IgG1 production expression in CD40-activated B-2 cells. Interestingly, the addition of 8-mercaptoguanosine (8-SGuo) with IL-4 to the culture of CD38-activated B cells can induce mu to gamma1 CSR, Blimp-1 expression, and IgG1 production. Intriguingly, 8-SGuo by itself induces AID expression in CD38-activated B cells. However, it does not induce mu to gamma1 CSR. These results imply that the mode of B-cell activation for extracellular stimulation affects the outcome of cytokine stimulation with respect to the efficiency and direction of CSR, and the requirements of the transcriptional regulator and the generation of antibody-secreting cells. Furthermore, our data suggest the requirement of additional molecules in addition to AID for CSR.

Expression of short hairpin RNAs using the compact architecture of retroviral microRNA genes.

PubMed

Burke, James M; Kincaid, Rodney P; Aloisio, Francesca; Welch, Nicole; Sullivan, Christopher S

2017-09-29

Short hairpin RNAs (shRNAs) are effective in generating stable repression of gene expression. RNA polymerase III (RNAP III) type III promoters (U6 or H1) are typically used to drive shRNA expression. While useful for some knockdown applications, the robust expression of U6/H1-driven shRNAs can induce toxicity and generate heterogeneous small RNAs with undesirable off-target effects. Additionally, typical U6/H1 promoters encompass the majority of the ∼270 base pairs (bp) of vector space required for shRNA expression. This can limit the efficacy and/or number of delivery vector options, particularly when delivery of multiple gene/shRNA combinations is required. Here, we develop a compact shRNA (cshRNA) expression system based on retroviral microRNA (miRNA) gene architecture that uses RNAP III type II promoters. We demonstrate that cshRNAs coded from as little as 100 bps of total coding space can precisely generate small interfering RNAs (siRNAs) that are active in the RNA-induced silencing complex (RISC). We provide an algorithm with a user-friendly interface to design cshRNAs for desired target genes. This cshRNA expression system reduces the coding space required for shRNA expression by >2-fold as compared to the typical U6/H1 promoters, which may facilitate therapeutic RNAi applications where delivery vector space is limiting. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

The lineage-specific gene ponzr1 is essential for zebrafish pronephric and pharyngeal arch development

PubMed Central

Bedell, Victoria M.; Person, Anthony D.; Larson, Jon D.; McLoon, Anna; Balciunas, Darius; Clark, Karl J.; Neff, Kevin I.; Nelson, Katie E.; Bill, Brent R.; Schimmenti, Lisa A.; Beiraghi, Soraya; Ekker, Stephen C.

2012-01-01

The Homeobox (Hox) and Paired box (Pax) gene families are key determinants of animal body plans and organ structure. In particular, they function within regulatory networks that control organogenesis. How these conserved genes elicit differences in organ form and function in response to evolutionary pressures is incompletely understood. We molecularly and functionally characterized one member of an evolutionarily dynamic gene family, plac8 onzin related protein 1 (ponzr1), in the zebrafish. ponzr1 mRNA is expressed early in the developing kidney and pharyngeal arches. Using ponzr1-targeting morpholinos, we show that ponzr1 is required for formation of the glomerulus. Loss of ponzr1 results in a nonfunctional glomerulus but retention of a functional pronephros, an arrangement similar to the aglomerular kidneys found in a subset of marine fish. ponzr1 is integrated into the pax2a pathway, with ponzr1 expression requiring pax2a gene function, and proper pax2a expression requiring normal ponzr1 expression. In addition to pronephric function, ponzr1 is required for pharyngeal arch formation. We functionally demonstrate that ponzr1 can act as a transcription factor or co-factor, providing the first molecular mode of action for this newly described gene family. Together, this work provides experimental evidence of an additional mechanism that incorporates evolutionarily dynamic, lineage-specific gene families into conserved regulatory gene networks to create functional organ diversity. PMID:22274699

Arachidonic acid alters tomato HMG expression and fruit growth and induces 3-hydroxy-3-methylglutaryl coenzyme A reductase-independent lycopene accumulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rodriguez-Concepcion, M.; Gruissem, W.

Regulation of isoprenoid end-product synthesis required for normal growth and development in plants is not well understood. To investigate the extent to which specific genes for the enzyme 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) are involved in end-product regulation, the authors manipulated expression of the HMG1 and HMG2 genes in tomato (Lycopersicon esculentum) fruit using arachidonic acid (AA). In developing young fruit AA blocked fruit growth, inhibited HMG1, and activated HMG2 expression. These results are consistent with other reports indicating that HMG1 expression is closely correlated with growth processes requiring phytosterol production. In mature-green fruit AA strongly induced the expression ofmore » HMG2, PSY1 (the gene for phytoene synthase), and lycopene accumulation before the normal onset of carotenoid synthesis and ripening. The induction of lycopene synthesis was not blocked by inhibition of HMGR activity using mevinolin, suggesting that cytoplasmic HMGR is not required for carotenoid synthesis. Their results are consistent with the function of an alternative plastid isoprenoid pathway (the Rohmer pathway) that appears to direct the production of carotenoids during tomato fruit ripening.« less

Rhizobial infection does not require cortical expression of upstream common symbiosis genes responsible for the induction of Ca(2+) spiking.

PubMed

Hayashi, Teruyuki; Shimoda, Yoshikazu; Sato, Shusei; Tabata, Satoshi; Imaizumi-Anraku, Haruko; Hayashi, Makoto

2014-01-01

For the establishment of an effective root nodule symbiosis, a coordinated regulation of the infection processes between the epidermis and cortex is required. However, it remains unclear whether the symbiotic genes identified so far are involved in epidermal and/or cortical infection, e.g. epidermal and cortical infection thread formation or cortical cell division. To analyze the symbiotic gene requirements of the infection process, we have developed an epidermis-specific expression system (pEpi expression system) and examined the symbiotic genes NFR1, NFR5, NUP85, NUP133, CASTOR, POLLUX, CCaMK, CYCLOPS, NSP1 and NSP2 for involvement in the infection process in the epidermis and cortex. Our study shows that expression of the upstream common symbiosis genes CASTOR, POLLUX, NUP85 and NUP133 in the epidermis is sufficient to induce formation of infection threads and cortical cell division, leading to the development of fully effective nodules. Our system also shows a requirement of CCaMK, CYCLOPS, NSP1 and NSP2 for the entire nodulation process, and the different contributions of NFR1 and NFR5 to cortical infection thread formation. Based on these analyses using the pEpi expression system, we propose a functional model of symbiotic genes for epidermal and cortical infection. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

The zinc finger transcription factor Gfi1, implicated in lymphomagenesis, is required for inner ear hair cell differentiation and survival

NASA Technical Reports Server (NTRS)

Wallis, Deeann; Hamblen, Melanie; Zhou, Yi; Venken, Koen J T.; Schumacher, Armin; Grimes, H. Leighton; Zoghbi, Huda Y.; Orkin, Stuart H.; Bellen, Hugo J.

2003-01-01

Gfi1 was first identified as causing interleukin 2-independent growth in T cells and lymphomagenesis in mice. Much work has shown that Gfi1 and Gfi1b, a second mouse homolog, play pivotal roles in blood cell lineage differentiation. However, neither Gfi1 nor Gfi1b has been implicated in nervous system development, even though their invertebrate homologues, senseless in Drosophila and pag-3 in C. elegans are expressed and required in the nervous system. We show that Gfi1 mRNA is expressed in many areas that give rise to neuronal cells during embryonic development in mouse, and that Gfi1 protein has a more restricted expression pattern. By E12.5 Gfi1 mRNA is expressed in both the CNS and PNS as well as in many sensory epithelia including the developing inner ear epithelia. At later developmental stages, Gfi1 expression in the ear is refined to the hair cells and neurons throughout the inner ear. Gfi1 protein is expressed in a more restricted pattern in specialized sensory cells of the PNS, including the eye, presumptive Merkel cells, the lung and hair cells of the inner ear. Gfi1 mutant mice display behavioral defects that are consistent with inner ear anomalies, as they are ataxic, circle, display head tilting behavior and do not respond to noise. They have a unique inner ear phenotype in that the vestibular and cochlear hair cells are differentially affected. Although Gfi1-deficient mice initially specify inner ear hair cells, these hair cells are disorganized in both the vestibule and cochlea. The outer hair cells of the cochlea are improperly innervated and express neuronal markers that are not normally expressed in these cells. Furthermore, Gfi1 mutant mice lose all cochlear hair cells just prior to and soon after birth through apoptosis. Finally, by five months of age there is also a dramatic reduction in the number of cochlear neurons. Hence, Gfi1 is expressed in the developing nervous system, is required for inner ear hair cell differentiation, and its loss causes programmed cell death.

Intercellular Adhesion Molecule 1 Knockout Abrogates Radiation Induced Pulmonary Inflammation

NASA Astrophysics Data System (ADS)

Hallahan, Dennis E.; Virudachalam, Subbulakshmi

1997-06-01

Increased expression of intercellular adhesion molecule 1 (ICAM-1; CD54) is induced by exposure to ionizing radiation. The lung was used as a model to study the role of ICAM-1 in the pathogenesis of the radiation-induced inflammation-like response. ICAM-1 expression increased in the pulmonary microvascular endothelium and not in the endothelium of larger pulmonary vessels following treatment of mice with thoracic irradiation. To quantify radiation-induced ICAM-1 expression, we utilized fluorescence-activated cell sorting analysis of anti-ICAM-1 antibody labeling of pulmonary microvascular endothelial cells from human cadaver donors (HMVEC-L cells). Fluorochrome conjugates and UV microscopy were used to quantify the fluorescence intensity of ICAM in the irradiated lung. These studies showed a dose- and time-dependent increase in ICAM-1 expression in the pulmonary microvascular endothelium. Peak expression occurred at 24 h, while threshold dose was as low as 2 Gy. To determine whether ICAM-1 is required for inflammatory cell infiltration into the irradiated lung, the anti-ICAM-1 blocking antibody was administered by tail vein injection to mice following thoracic irradiation. Inflammatory cells were quantified by immunofluorescence for leukocyte common antigen (CD45). Mice treated with the anti-ICAM-1 blocking antibody showed attenuation of inflammatory cell infiltration into the lung in response to ionizing radiation exposure. To verify the requirement of ICAM-1 in the inflammation-like radiation response, we utilized the ICAM-1 knockout mouse. ICAM-1 was not expressed in the lungs of ICAM-1-deficient mice following treatment with thoracic irradiation. ICAM-1 knockout mice had no increase in the inflammatory cell infiltration into the lung in response to thoracic irradiation. These studies demonstrate a radiation dose-dependent increase in ICAM-1 expression in the pulmonary microvascular endothelium, and show that ICAM-1 is required for inflammatory cell infiltration into the irradiated lung.

Isl1 is required for multiple aspects of motor neuron development.

PubMed

Liang, Xingqun; Song, Mi-Ryoung; Xu, ZengGuang; Lanuza, Guillermo M; Liu, Yali; Zhuang, Tao; Chen, Yihan; Pfaff, Samuel L; Evans, Sylvia M; Sun, Yunfu

2011-07-01

The LIM homeodomain transcription factor Islet1 (Isl1) is expressed in multiple organs and plays essential roles during embryogenesis. Isl1 is required for the survival and specification of spinal cord motor neurons. Due to early embryonic lethality and loss of motor neurons, the role of Isl1 in other aspects of motor neuron development remains unclear. In this study, we generated Isl1 mutant mouse lines expressing graded doses of Isl1. Our study has revealed essential roles of Isl1 in multiple aspects of motor neuron development, including motor neuron cell body localization, motor column formation and axon growth. In addition, Isl1 is required for survival of cranial ganglia neurons. Copyright © 2011 Elsevier Inc. All rights reserved.

EGO-1, a C. elegans RdRP, Modulates Gene Expression via Production of mRNA-Templated Short Antisense RNAs

PubMed Central

Maniar, Jay M.; Fire, Andrew Z.

2011-01-01

SUMMARY Background The development of the germline in Caenorhabditis elegans is a complex process involving the regulation of thousands of genes in a coordinated manner. Several genes required for small RNA biogenesis and function are among those required for the proper organization of the germline. EGO-1 is a putative RNA-directed RNA polymerase (RdRP) that is required for multiple aspects of C. elegans germline development and efficient RNAi of germline-expressed genes. RdRPs have been proposed to act through a variety of mechanisms including the post-transcriptional targeting of specific mRNAs as well as through a direct interaction with chromatin. Despite extensive investigation, the molecular role of EGO-1 has remained enigmatic. Results Here we use high-throughput small RNA and messenger RNA sequencing to investigate EGO-1 function. We found that EGO-1 is required to produce a distinct pool of small RNAs antisense to a number of germline-expressed mRNAs through several developmental stages. These potential mRNA targets fall into distinct classes, including genes required for kinetochore and nuclear pore assembly, histone-modifying activities and centromeric proteins. We also found several RNAi-related genes to be targets of EGO-1. Finally, we show a strong association between the loss of small RNAs and the rise of mRNA levels in ego-1(−) animals. Conclusions Our data support the conclusion that EGO-1 produces triphosphorylated small RNAs derived from mRNA templates and that these small RNAs modulate gene expression through the targeting of their cognate mRNAs. PMID:21396820

Docking, characterization and investigation of β-cyclodextrin complexed with citronellal, a monoterpene present in the essential oil of Cymbopogon species, as an anti-hyperalgesic agent in chronic muscle pain model.

PubMed

Santos, Priscila L; Brito, Renan G; Oliveira, Marlange A; Quintans, Jullyana S S; Guimarães, Adriana G; Santos, Márcio R V; Menezes, Paula P; Serafini, Mairim R; Menezes, Irwin R A; Coutinho, Henrique D M; Araújo, Adriano A S; Quintans-Júnior, Lucindo J

2016-08-15

Citronellal (CT) is a monoterpene with antinociceptive acute effect. β-Cyclodextrin (βCD) has enhanced the analgesic effect of various substances. To evaluate the effect of CT both complexed in β-cyclodextrin (CT-βCD) and non-complexed, in a chronic muscle pain model (CMP) in mice. The complex containing CT in βCD was obtained and characterized in the laboratory. The anti-hyperalgesic effect of CT and CT-βCD was evaluated in a pre-clinical in vivo study in a murine CMP. The complex was characterized through differential scanning calorimetry, derivative thermogravimetry, moisture determination, infrared spectroscopy and scanning electron microscopy. Male Swiss mice were pre-treated with CT (50mg/kg, po), CT-βCD (50mg/kg, po), vehicle (isotonic saline, po) or standard drug (tramadol4 mg/kg, ip). 60 min after the treatment and then each 1h, the mechanic hyperalgesia was evaluated to obtain the time effect. In addition, the muscle strength using grip strength meter and hyperalgesia were also performed daily, for 7 days. We assessed by immunofluorescence for Fos protein on brains and spinal cords of mice. The involvement of the CT with the glutamatergic system was studied with molecular docking. All characterization methods showed the CT-βCD complexation. CT-induced anti-hyperalgesic effect lasted until 6h (p <0.001) while CT-βCD lasted until 8h (p <0.001vs vehicle and p <0.001vs CT from the 6th h). CT-βCD reduced mechanical hyperalgesia on all days of treatment (p <0.05), without changing muscle strength. Periaqueductal gray (p <0.01) and rostroventromedular area (p <0.05) showed significant increase in the Fos protein expression while in the spinal cord, there was a reduction (p <0.001). CT showed favorable energy binding (-5.6 and -6.1) to GluR2-S1S2J protein based in the docking score function. We can suggest that βCD improved the anti-hyperalgesic effect of CT, and that effect seems to involve the descending pain-inhibitory mechanisms, with a possible interaction of the glutamate receptors, which are considered as promising molecules for the management of chronic pain such as CMP. Copyright © 2016 Elsevier GmbH. All rights reserved.

Cooperative activity of GABP with PU.1 or C/EBPε regulates lamin B receptor gene expression, implicating their roles in granulocyte nuclear maturation1

PubMed Central

Malu, Krishnakumar; Garhwal, Rahul; Pelletier, Margery G. H.; Gotur, Deepali; Halene, Stephanie; Zwerger, Monika; Yang, Zhong-Fa; Rosmarin, Alan G.; Gaines, Peter

2016-01-01

Nuclear segmentation is a hallmark feature of mammalian neutrophil differentiation, but the mechanisms that control this process are poorly understood. Gene expression in maturing neutrophils requires combinatorial actions of lineage-restricted and more widely expressed transcriptional regulators. Examples include interactions of the widely expressed ETS transcription factor, GA-binding protein (GABP), with the relatively lineage-restricted ETS factor, PU.1, and with CCAAT enhancer binding proteins, C/EBPα and C/EBPε. Whether such cooperative interactions between these transcription factors also regulate the expression of genes encoding proteins that control nuclear segmentation is unclear. We investigated the roles of ETS and C/EBP family transcription factors in regulating the gene encoding the lamin B receptor (LBR), an inner nuclear membrane protein whose expression is required for neutrophil nuclear segmentation. Although C/EBPε was previously shown to bind the Lbr promoter, surprisingly, we found that neutrophils derived from Cebpe null mice exhibited normal Lbr gene and protein expression. Instead, GABP provided transcriptional activation through the Lbr promoter in the absence of C/EBPε, and activities supported by GABP were greatly enhanced by either C/EBPε or PU.1. Both GABP and PU.1 bound Ets sites in the Lbr promoter in vitro, and in vivo within both early myeloid progenitors and differentiating neutrophils. These findings demonstrate that GABP, PU.1, and C/EBPε cooperate to control transcription of the gene encoding LBR, a nuclear envelope protein that is required for the characteristic lobulated morphology of mature neutrophils. PMID:27342846

Lost in Translation: Strategies Japanese Language Learners Use in Communicating Culturally Specific L1 Expressions in English

ERIC Educational Resources Information Center

Inoue, Noriyuki; Molina, Sarina Chugani

2011-01-01

Communicating in a second language could be seen as a process requiring the deconstruction and reconstruction of cultural meanings. If this is the case, how do second language (L2) learners express cultural meanings of their first language (L1) expressions that do not have semantically equivalent L2 expressions? Twenty-nine Japanese students…

Monocyte 15-Lipoxygenase Gene Expression Requires ERK1/2 MAPK Activity

PubMed Central

Bhattacharjee, Ashish; Mulya, Anny; Pal, Srabani; Roy, Biswajit; Feldman, Gerald M.; Cathcart, Martha K.

2011-01-01

IL-13 induces profound expression of 15-lipoxygenase (15-LO) in primary human monocytes. Our studies have defined the functional IL-13R complex, association of Jaks with the receptor components, and the tyrosine phosphorylation of several Stat molecules in response to IL-13. Furthermore, we identified both p38MAPK and protein kinase Cδ as critical regulators of 15-LO expression. In this study, we report an ERK1/2-dependent signaling cascade that regulates IL-13–mediated 15-LO gene expression. We show the rapid phosphorylation/activation of ERK1/2 upon IL-13 exposure. Our results indicate that Tyk2 kinase is required for the activation of ERK1/2, which is independent of the Jak2, p38MAPK, and protein kinase Cδ pathways, suggesting bifurcating parallel regulatory pathways downstream of the receptor. To investigate the signaling mechanisms associated with the ERK1/2-dependent expression of 15-LO, we explored the involvement of transcription factors, with predicted binding sites in the 15-LO promoter, in this process including Elk1, early growth response-1 (Egr-1), and CREB. Our findings indicate that IL-13 induces Egr-1 nuclear accumulation and CREB serine phosphorylation and that both are markedly attenuated by inhibition of ERK1/2 activity. We further show that ERK1/2 activity is required for both Egr-1 and CREB DNA binding to their cognate sequences identified within the 15-LO promoter. Furthermore, by transfecting monocytes with the decoy oligodeoxyribonucleotides specific for Egr-1 and CREB, we discovered that Egr-1 and CREB are directly involved in regulating 15-LO gene expression. These studies characterize an important regulatory role for ERK1/2 in mediating IL-13–induced monocyte 15-LO expression via the transcription factors Egr-1 and CREB. PMID:20861348

α6β1- and αV-integrins are required for long-term self-renewal of murine embryonic stem cells in the absence of LIF.

PubMed

Cattavarayane, Sandhanakrishnan; Palovuori, Riitta; Tanjore Ramanathan, Jayendrakishore; Manninen, Aki

2015-02-27

The growth properties and self-renewal capacity of embryonic stem (ES) cells are regulated by their immediate microenvironment such as the extracellular matrix (ECM). Integrins, a central family of cellular ECM receptors, have been implicated in these processes but their specific role in ES cell self-renewal remains unclear. Here we have studied the effects of different ECM substrates and integrins in mouse ES cells in the absence of Leukemia Inhibitory Factor (LIF) using short-term assays as well as long-term cultures. Removal of LIF from ES cell culture medium induced morphological differentiation of ES cells into polarized epistem cell-like cells. These cells maintained epithelial morphology and expression of key stemness markers for at least 10 passages in the absence of LIF when cultured on laminin, fibronectin or collagen IV substrates. The specific functional roles of α6-, αV- and β1-integrin subunits were dissected using stable lentivirus-mediated RNAi methodology. β1-integrins were required for ES cell survival in long-term cultures and for the maintenance of stem cell marker expression. Inhibition of α6-integrin expression compromised self-renewal on collagen while αV-integrins were required for robust ES cell adhesion on laminin. Analysis of the stemness marker expression revealed subtle differences between α6- and αV-depleted ES cells but the expression of both was required for optimal self-renewal in long-term ES cell cultures. In the absence of LIF, long-term ES cell cultures adapt an epistem cell-like epithelial phenotype and retain the expression of multiple stem cell markers. Long-term maintenance of such self-renewing cultures depends on the expression of β1-, α6- and αV-integrins.

Deficits in morphofunctional maturation of hippocampal mossy fiber synapses in a mouse model of intellectual disability.

PubMed

Lanore, Frederic; Labrousse, Virginie F; Szabo, Zsolt; Normand, Elisabeth; Blanchet, Christophe; Mulle, Christophe

2012-12-05

The grik2 gene, coding for the kainate receptor subunit GluK2 (formerly GluR6), is associated with autism spectrum disorders and intellectual disability. Here, we tested the hypothesis that GluK2 could play a role in the appropriate maturation of synaptic circuits involved in learning and memory. We show that both the functional and morphological maturation of hippocampal mossy fiber to CA3 pyramidal cell (mf-CA3) synapses is delayed in mice deficient for the GluK2 subunit (GluK2⁻/⁻). In GluK2⁻/⁻ mice this deficit is manifested by a transient reduction in the amplitude of AMPA-EPSCs at a critical time point of postnatal development, whereas the NMDA component is spared. By combining multiple probability peak fluctuation analysis and immunohistochemistry, we have provided evidence that the decreased amplitude reflects a decrease in the quantal size per mf-CA3 synapse and in the number of active synaptic sites. Furthermore, we analyzed the time course of structural maturation of CA3 synapses by confocal imaging of YFP-expressing cells followed by tridimensional (3D) anatomical reconstruction of thorny excrescences and presynaptic boutons. We show that major changes in synaptic structures occur subsequently to the sharp increase in synaptic transmission, and more importantly that the course of structural maturation of synaptic elements is impaired in GluK2⁻/⁻ mice. This study highlights how a mutation in a gene linked to intellectual disability in the human may lead to a transient reduction of synaptic strength during postnatal development, impacting on the proper formation of neural circuits linked to memory.

Muscarinic Receptors Modulate Dendrodendritic Inhibitory Synapses to Sculpt Glomerular Output

PubMed Central

Shao, Zuoyi; Puche, Adam; Wachowiak, Matt; Rothermel, Markus

2015-01-01

Cholinergic [acetylcholine (ACh)] axons from the basal forebrain innervate olfactory bulb glomeruli, the initial site of synaptic integration in the olfactory system. Both nicotinic acetylcholine receptors (nAChRs) and muscarinic acetylcholine receptors (mAChRs) are expressed in glomeruli. The activation of nAChRs directly excites both mitral/tufted cells (MTCs) and external tufted cells (ETCs), the two major excitatory neurons that transmit glomerular output. The functional roles of mAChRs in glomerular circuits are unknown. We show that the restricted glomerular application of ACh causes rapid, brief nAChR-mediated excitation of both MTCs and ETCs in the mouse olfactory bulb. This excitation is followed by mAChR-mediated inhibition, which is blocked by GABAA receptor antagonists, indicating the engagement of periglomerular cells (PGCs) and/or short axon cells (SACs), the two major glomerular inhibitory neurons. Indeed, selective activation of glomerular mAChRs, with ionotropic GluRs and nAChRs blocked, increased IPSCs in MTCs and ETCs, indicating that mAChRs recruit glomerular inhibitory circuits. Selective activation of glomerular mAChRs in the presence of tetrodotoxin increased IPSCs in all glomerular neurons, indicating action potential-independent enhancement of GABA release from PGC and/or SAC dendrodendritic synapses. mAChR-mediated enhancement of GABA release also presynaptically suppressed the first synapse of the olfactory system via GABAB receptors on sensory terminals. Together, these results indicate that cholinergic modulation of glomerular circuits is biphasic, involving an initial excitation of MTC/ETCs mediated by nAChRs followed by inhibition mediated directly by mAChRs on PGCs/SACs. This may phasically enhance the sensitivity of glomerular outputs to odorants, an action that is consistent with recent in vivo findings. PMID:25855181

Muscarinic receptors modulate dendrodendritic inhibitory synapses to sculpt glomerular output.

PubMed

Liu, Shaolin; Shao, Zuoyi; Puche, Adam; Wachowiak, Matt; Rothermel, Markus; Shipley, Michael T

2015-04-08

Cholinergic [acetylcholine (ACh)] axons from the basal forebrain innervate olfactory bulb glomeruli, the initial site of synaptic integration in the olfactory system. Both nicotinic acetylcholine receptors (nAChRs) and muscarinic acetylcholine receptors (mAChRs) are expressed in glomeruli. The activation of nAChRs directly excites both mitral/tufted cells (MTCs) and external tufted cells (ETCs), the two major excitatory neurons that transmit glomerular output. The functional roles of mAChRs in glomerular circuits are unknown. We show that the restricted glomerular application of ACh causes rapid, brief nAChR-mediated excitation of both MTCs and ETCs in the mouse olfactory bulb. This excitation is followed by mAChR-mediated inhibition, which is blocked by GABAA receptor antagonists, indicating the engagement of periglomerular cells (PGCs) and/or short axon cells (SACs), the two major glomerular inhibitory neurons. Indeed, selective activation of glomerular mAChRs, with ionotropic GluRs and nAChRs blocked, increased IPSCs in MTCs and ETCs, indicating that mAChRs recruit glomerular inhibitory circuits. Selective activation of glomerular mAChRs in the presence of tetrodotoxin increased IPSCs in all glomerular neurons, indicating action potential-independent enhancement of GABA release from PGC and/or SAC dendrodendritic synapses. mAChR-mediated enhancement of GABA release also presynaptically suppressed the first synapse of the olfactory system via GABAB receptors on sensory terminals. Together, these results indicate that cholinergic modulation of glomerular circuits is biphasic, involving an initial excitation of MTC/ETCs mediated by nAChRs followed by inhibition mediated directly by mAChRs on PGCs/SACs. This may phasically enhance the sensitivity of glomerular outputs to odorants, an action that is consistent with recent in vivo findings. Copyright © 2015 the authors 0270-6474/15/355680-13$15.00/0.

Enhanced tolerance to NaCl and LiCl stresses by over-expressing Caragana korshinskii sodium/proton exchanger 1 (CkNHX1) and the hydrophilic C terminus is required for the activity of CkNHX1 in Atsos3-1 mutant and yeast

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Da-Hai, E-mail: gresea_young@hotmail.com; Department of Plant Physiology, Institute of General Botany and Plant Physiology, Friedrich-Schiller-University, Dornburger Strasse 159, 07743 Jena; Song, Li-Ying, E-mail: lysong@genetics.ac.cn

2012-01-13

Highlights: Black-Right-Pointing-Pointer CkNHX1 was isolated from Caragana korshinskii. Black-Right-Pointing-Pointer CkNHX1 was expressed mainly in roots, and significantly induced by NaCl in stems. Black-Right-Pointing-Pointer Expression of CkNHX1 enhanced the resistance to NaCl and LiCl in yeast and Atsos3-1. Black-Right-Pointing-Pointer Expression of CkNHX1-{Delta}C had little effect on NaCl/LiCl tolerance in Atsos3-1. Black-Right-Pointing-Pointer C-terminal region of CkNHX1 is required for its Na{sup +} and Li{sup +} transporting activity. -- Abstract: Sodium/proton exchangers (NHX antiporters) play important roles in plant responses to salt stress. Previous research showed that hydrophilic C-terminal region of Arabidopsis AtNHX1 negatively regulates the Na{sup +}/H{sup +} transporting activity. In thismore » study, CkNHX1 were isolated from Caragana korshinskii, a pea shrub with high tolerance to salt, drought, and cold stresses. Transcripts of CkNHX1 were detected predominantly in roots, and were significantly induced by NaCl stress in stems. Transgenic yeast and Arabidopsisthalianasos3-1 (Atsos3-1) mutant over-expressing CkNHX1 and its hydrophilic C terminus-truncated derivative, CkNHX1-{Delta}C, were generated and subjected to NaCl and LiCl stresses. Expression of CkNHX1 significantly enhanced the resistance to NaCl and LiCl stresses in yeast and Atsos3-1 mutant. Whereas, compared with expression of CkNHX1, the expression of CkNHX1-{Delta}C had much less effect on NaCl tolerance in Atsos3-1 and LiCl tolerance in yeast and Atsos3-1. All together, these results suggest that the predominant expression of CkNHX1 in roots might contribute to keep C. korshinskii adapting to the high salt condition in this plant's living environment; CkNHX1 could recover the phenotype of Atsos3-1 mutant; and the hydrophilic C-terminal region of CkNHX1 should be required for Na{sup +}/H{sup +} and Li{sup +}/H{sup +} exchanging activity of CkNHX1.« less

Epithelial-mesenchymal status influences how cells deposit fibrillin microfibrils.

PubMed

Baldwin, Andrew K; Cain, Stuart A; Lennon, Rachel; Godwin, Alan; Merry, Catherine L R; Kielty, Cay M

2014-01-01

Here, we show that epithelial-mesenchymal status influences how cells deposit extracellular matrix. Retinal pigmented epithelial (RPE) cells that expressed high levels of E-cadherin and had cell-cell junctions rich in zona occludens (ZO)-1, β-catenin and heparan sulfate, required syndecan-4 but not fibronectin or protein kinase C α (PKCα) to assemble extracellular matrix (fibrillin microfibrils and perlecan). In contrast, RPE cells that strongly expressed mesenchymal smooth muscle α-actin but little ZO-1 or E-cadherin, required fibronectin (like fibroblasts) and PKCα, but not syndecan-4. Integrins α5β1 and/or α8β1 and actomyosin tension were common requirements for microfibril deposition, as was heparan sulfate biosynthesis. TGFβ, which stimulates epithelial-mesenchymal transition, altered gene expression and overcame the dependency on syndecan-4 for microfibril deposition in epithelial RPE cells, whereas blocking cadherin interactions disrupted microfibril deposition. Renal podocytes had a transitional phenotype with pericellular β-catenin but little ZO-1; they required syndecan-4 and fibronectin for efficient microfibril deposition. Thus, epithelial-mesenchymal status modulates microfibril deposition.

Group I mGluR-Regulated Translation of the Neuronal Glutamate Transporter, Excitatory Amino Acid Carrier 1 (EAAC1)

PubMed Central

Ross, John R.; Ramakrishnan, Hariharasubramanian; Porter, Brenda E.; Robinson, Michael B.

2011-01-01

Recently, we demonstrated that mRNA for the neuronal glutamate transporter, excitatory amino acid carrier 1 (EAAC1), is found in dendrites of hippocampal neurons in culture and in dendrites of hippocampal pyramidal cells after pilocarpine-induced status epilepticus (SE). We also showed that SE increased the levels of EAAC1 mRNA ~15-fold in synaptoneurosomes. In the present study, the effects of SE on the distribution EAAC1 protein in hippocampus were examined. In addition, the effects of Group 1 mGluR receptor activation on the levels of EAAC1 protein were examined in synaptoneurosomes prepared from sham control animals and from animals that experience pilocarpine-induced SE. We find that EAAC1 immunoreactivity increases in pyramidal cells of the hippocampus after 3 h of SE. In addition, the group I mGluR agonist, (S)-3,5-dihydroxyphenylglycine (DHPG), caused an increase in EAAC1 protein levels in hippocampal synaptoneurosomes; this effect of DHPG was much larger (~3- to 5-fold) after 3 h of SE. The DHPG-induced increases in EAAC1 protein were blocked by two different inhibitors of translation but not by inhibitors of transcription. mGluR1 or mGluR5 antagonists completely blocked the DHPG-induced increases in EAAC1 protein. DHPG also increased the levels of GluR2/3 protein, but this effect was not altered by SE. The DHPG-induced increase in EAAC1 protein was blocked by an inhibitor of the mammalian target of rapamycin (mTOR) or an inhibitor of extracellular signal-regulated kinase (ERK). These studies provide the first evidence EAAC1 translation can be regulated, and they show that regulated translation of EAAC1 is up-regulated after SE. PMID:21371038

Protein kinase C activation decreases cell surface expression of the GLT-1 subtype of glutamate transporter. Requirement of a carboxyl-terminal domain and partial dependence on serine 486.

PubMed

Kalandadze, Avtandil; Wu, Ying; Robinson, Michael B

2002-11-29

Na(+)-dependent glutamate transporters are required for the clearance of extracellular glutamate and influence both physiological and pathological effects of this excitatory amino acid. In the present study, the effects of a protein kinase C (PKC) activator on the cell surface expression and activity of the GLT-1 subtype of glutamate transporter were examined in two model systems, primary co-cultures of neurons and astrocytes that endogenously express GLT-1 and C6 glioma cells transfected with GLT-1. In both systems, activation of PKC with phorbol ester caused a decrease in GLT-1 cell surface expression. This effect is opposite to the one observed for the EAAC1 subtype of glutamate transporter (Davis, K. E., Straff, D. J., Weinstein, E. A., Bannerman, P. G., Correale, D. M., Rothstein, J. D., and Robinson, M. B. (1998) J. Neurosci. 18, 2475-2485). Several recombinant chimeric proteins between GLT-1 and EAAC1 transporter subtypes were generated to identify domains required for the subtype-specific redistribution of GLT-1. We identified a carboxyl-terminal domain consisting of 43 amino acids (amino acids 475-517) that is required for PKC-induced GLT-1 redistribution. Mutation of a non-conserved serine residue at position 486 partially attenuated but did not completely abolish the PKC-dependent redistribution of GLT-1. Although we observed a phorbol ester-dependent incorporation of (32)P into immunoprecipitable GLT-1, mutation of serine 486 did not reduce this signal. We also found that chimeras containing the first 446 amino acids of GLT-1 were not functional unless amino acids 475-517 of GLT-1 were also present. These non-functional transporters were not as efficiently expressed on the cell surface and migrated to a smaller molecular weight, suggesting that a subtype-specific interaction is required for the formation of functional transporters. These studies demonstrate a novel effect of PKC on GLT-1 activity and define a unique carboxyl-terminal domain as an important determinant in cellular localization and regulation of GLT-1.

Identification of reference genes for RT-qPCR in ovine mammary tissue during late pregnancy and lactation and in response to maternal nutritional programming.

PubMed

Paten, A M; Pain, S J; Peterson, S W; Blair, H T; Kenyon, P R; Dearden, P K; Duncan, E J

2014-08-01

The mammary gland is a complex tissue consisting of multiple cell types which, over the lifetime of an animal, go through repeated cycles of development associated with pregnancy, lactation and involution. The mammary gland is also known to be sensitive to maternal programming by environmental stimuli such as nutrition. The molecular basis of these adaptations is of significant interest, but requires robust methods to measure gene expression. Reverse-transcription quantitative PCR (RT-qPCR) is commonly used to measure gene expression, and is currently the method of choice for validating genome-wide expression studies. RT-qPCR requires the selection of reference genes that are stably expressed over physiological states and treatments. In this study we identify suitable reference genes to normalize RT-qPCR data for the ovine mammary gland in two physiological states; late pregnancy and lactation. Biopsies were collected from offspring of ewes that had been subjected to different nutritional paradigms during pregnancy to examine effects of maternal programming on the mammary gland of the offspring. We evaluated eight candidate reference genes and found that two reference genes (PRPF3 and CUL1) are required for normalising RT-qPCR data from pooled RNA samples, but five reference genes are required for analyzing gene expression in individual animals (SENP2, EIF6, MRPL39, ATP1A1, CUL1). Using these stable reference genes, we showed that TET1, a key regulator of DNA methylation, is responsive to maternal programming and physiological state. The identification of these novel reference genes will be of utility to future studies of gene expression in the ovine mammary gland. Copyright © 2014 the American Physiological Society.

Expression of Magnaporthe grisea Avirulence Gene ACE1 Is Connected to the Initiation of Appressorium-Mediated Penetration▿

PubMed Central

Fudal, Isabelle; Collemare, Jérôme; Böhnert, Heidi U.; Melayah, Delphine; Lebrun, Marc-Henri

2007-01-01

Magnaporthe grisea is responsible for a devastating fungal disease of rice called blast. Current control of this disease relies on resistant rice cultivars that recognize M. grisea signals corresponding to specific secreted proteins encoded by avirulence genes. The M. grisea ACE1 avirulence gene differs from others, since it controls the biosynthesis of a secondary metabolite likely recognized by rice cultivars carrying the Pi33 resistance gene. Using a transcriptional fusion between ACE1 promoter and eGFP, we showed that ACE1 is only expressed in appressoria during fungal penetration into rice and barley leaves, onion skin, and cellophane membranes. ACE1 is almost not expressed in appressoria differentiated on Teflon and Mylar artificial membranes. ACE1 expression is not induced by cellophane and plant cell wall components, demonstrating that it does not require typical host plant compounds. Cyclic AMP (cAMP) signaling mutants ΔcpkA and Δmac1 sum1-99 and tetraspanin mutant Δpls1::hph differentiate melanized appressoria with normal turgor but are unable to penetrate host plant leaves. ACE1 is normally expressed in these mutants, suggesting that it does not require cAMP signaling or a successful penetration event. ACE1 is not expressed in appressoria of the buf1::hph mutant defective for melanin biosynthesis and appressorial turgor. The addition of hyperosmotic solutes to buf1::hph appressoria restores appressorial development and ACE1 expression. Treatments of young wild-type appressoria with actin and tubulin inhibitors reduce both fungal penetration and ACE1 expression. These experiments suggest that ACE1 appressorium-specific expression does not depend on host plant signals but is connected to the onset of appressorium-mediated penetration. PMID:17142568

Identification of Novel Glycosyltransferases Required for Assembly of the Pasteurella multocida A:1 Lipopolysaccharide and Their Involvement in Virulence▿ †

PubMed Central

Boyce, John D.; Harper, Marina; St. Michael, Frank; John, Marietta; Aubry, Annie; Parnas, Henrietta; Logan, Susan M.; Wilkie, Ian W.; Ford, Mark; Cox, Andrew D.; Adler, Ben

2009-01-01

We previously determined the structure of the Pasteurella multocida Heddleston type 1 lipopolysaccharide (LPS) molecule and characterized some of the transferases essential for LPS biosynthesis. We also showed that P. multocida strains expressing truncated LPS display reduced virulence. Here, we have identified all of the remaining glycosyltransferases required for synthesis of the oligosaccharide extension of the P. multocida Heddleston type 1 LPS, including a novel α-1,6 glucosyltransferase, a β-1,4 glucosyltransferase, a putative bifunctional galactosyltransferase, and two heptosyltransferases. In addition, we identified a novel oligosaccharide extension expressed only in a heptosyltransferase (hptE) mutant background. All of the analyzed mutants expressing LPS with a truncated main oligosaccharide extension displayed reduced virulence, but those expressing LPS with an intact heptose side chain were able to persist for long periods in muscle tissue. The hptC mutant, which expressed LPS with the shortest oligosaccharide extension and no heptose side chain, was unable to persist on the muscle or cause any disease. Furthermore, all of the mutants displayed increased sensitivity to the chicken antimicrobial peptide fowlicidin 1, with mutants expressing highly truncated LPS being the most sensitive. PMID:19168738

A PARP1-ERK2 synergism is required for the induction of LTP

PubMed Central

Visochek, L.; Grigoryan, G.; Kalal, A.; Milshtein-Parush, H.; Gazit, N.; Slutsky, I.; Yeheskel, A.; Shainberg, A.; Castiel, A.; Seger, R.; Langelier, M. F.; Dantzer, F.; Pascal, J. M.; Segal, M.; Cohen-Armon, M.

2016-01-01

Unexpectedly, a post-translational modification of DNA-binding proteins, initiating the cell response to single-strand DNA damage, was also required for long-term memory acquisition in a variety of learning paradigms. Our findings disclose a molecular mechanism based on PARP1-Erk synergism, which may underlie this phenomenon. A stimulation induced PARP1 binding to phosphorylated Erk2 in the chromatin of cerebral neurons caused Erk-induced PARP1 activation, rendering transcription factors and promoters of immediate early genes (IEG) accessible to PARP1-bound phosphorylated Erk2. Thus, Erk-induced PARP1 activation mediated IEG expression implicated in long-term memory. PARP1 inhibition, silencing, or genetic deletion abrogated stimulation-induced Erk-recruitment to IEG promoters, gene expression and LTP generation in hippocampal CA3-CA1-connections. Moreover, a predominant binding of PARP1 to single-strand DNA breaks, occluding its Erk binding sites, suppressed IEG expression and prevented the generation of LTP. These findings outline a PARP1-dependent mechanism required for LTP generation, which may be implicated in long-term memory acquisition and in its deterioration in senescence. PMID:27121568

A PARP1-ERK2 synergism is required for the induction of LTP.

PubMed

Visochek, L; Grigoryan, G; Kalal, A; Milshtein-Parush, H; Gazit, N; Slutsky, I; Yeheskel, A; Shainberg, A; Castiel, A; Seger, R; Langelier, M F; Dantzer, F; Pascal, J M; Segal, M; Cohen-Armon, M

2016-04-28

Unexpectedly, a post-translational modification of DNA-binding proteins, initiating the cell response to single-strand DNA damage, was also required for long-term memory acquisition in a variety of learning paradigms. Our findings disclose a molecular mechanism based on PARP1-Erk synergism, which may underlie this phenomenon. A stimulation induced PARP1 binding to phosphorylated Erk2 in the chromatin of cerebral neurons caused Erk-induced PARP1 activation, rendering transcription factors and promoters of immediate early genes (IEG) accessible to PARP1-bound phosphorylated Erk2. Thus, Erk-induced PARP1 activation mediated IEG expression implicated in long-term memory. PARP1 inhibition, silencing, or genetic deletion abrogated stimulation-induced Erk-recruitment to IEG promoters, gene expression and LTP generation in hippocampal CA3-CA1-connections. Moreover, a predominant binding of PARP1 to single-strand DNA breaks, occluding its Erk binding sites, suppressed IEG expression and prevented the generation of LTP. These findings outline a PARP1-dependent mechanism required for LTP generation, which may be implicated in long-term memory acquisition and in its deterioration in senescence.

Outer membrane protein A of Escherichia coli K1 selectively enhances the expression of intercellular adhesion molecule-1 in brain microvascular endothelial cells.

PubMed

Selvaraj, Suresh K; Periandythevar, Parameswaran; Prasadarao, Nemani V

2007-04-01

Escherichia coli K1 meningitis is a serious central nervous system disease with unchanged mortality and morbidity rates for last few decades. Intercellular adhesion molecule 1 (ICAM-1) is a cell adhesion molecule involved in leukocyte trafficking toward inflammatory stimuli at the vascular endothelium; however, the effect of E. coli invasion of endothelial cells on the expression of ICAM-1 is not known. We demonstrate here that E. coli K1 invasion of human brain microvascular endothelial cells (HBMEC) selectively up-regulates the expression of ICAM-1, which occurs only in HBMEC invaded by the bacteria. The interaction of outer membrane protein A (OmpA) of E. coli with its receptor, Ecgp, on HBMEC was critical for the up-regulation of ICAM-1 and was depend on PKC-alpha and PI3-kinase signaling. Of note, the E. coli-induced up-regulation of ICAM-1 was not due to the cytokines secreted by HBMEC upon bacterial infection. Activation of NF-kappaB was required for E. coli mediated expression of ICAM-1, which was significantly inhibited by over-expressing the dominant negative forms of PKC-alpha and p85 subunit of PI3-kinase. The increased expression of ICAM-1 also enhanced the binding of THP-1 cells to HBMEC. Taken together, these data suggest that localized increase in ICAM-1 expression in HBMEC invaded by E. coli requires a novel interaction between OmpA and its receptor, Ecgp.

Dlx1&2-Dependent Expression of Zfhx1b (Sip1, Zeb2) Regulates the Fate Switch Between Cortical and Striatal Interneurons

PubMed Central

McKinsey, Gabriel L.; Lindtner, Susan; Trzcinski, Brett; Visel, Axel; Pennacchio, Len A.; Huylebroeck, Danny; Higashi, Yujiro; Rubenstein, John L. R.

2013-01-01

Summary Mammalian pallial (cortical and hippocampal) and striatal interneurons are both generated in the embryonic subpallium, including the medial ganglionic eminence (MGE). Herein we demonstrate that the Zfhx1b (Sip1, Zeb2) zinc finger homeobox gene is required in the MGE, directly downstream of Dlx1&2, to generate cortical interneurons that express Cxcr7, MafB and cMaf. In its absence, Nkx2-1 expression is not repressed, and cells that ordinarily would become cortical interneurons appear to transform towards a subtype of GABAeric striatal interneurons. These results show that Zfhx1b is required to generate cortical interneurons, and suggest a mechanism for the epilepsy observed in humans with Zfhx1b mutations (Mowat-Wilson syndrome). PMID:23312518

NFκB–Pim-1–Eomesodermin axis is critical for maintaining CD8 T-cell memory quality

PubMed Central

Knudson, Karin M.; Saxena, Vikas; Altman, Amnon; Daniels, Mark A.; Teixeiro, Emma

2017-01-01

T-cell memory is critical for long-term immunity. However, the factors involved in maintaining the persistence, function, and phenotype of the memory pool are undefined. Eomesodermin (Eomes) is required for the establishment of the memory pool. Here, we show that in T cells transitioning to memory, the expression of high levels of Eomes is not constitutive but rather requires a continuum of cell-intrinsic NFκB signaling. Failure to maintain NFκB signals after the peak of the response led to impaired Eomes expression and a defect in the maintenance of CD8 T-cell memory. Strikingly, we found that antigen receptor [T-cell receptor (TCR)] signaling regulates this process through expression of the NFκB-dependent kinase proviral integration site for Moloney murine leukemia virus-1 (PIM-1), which in turn regulates NFκB and Eomes. T cells defective in TCR-dependent NFκB signaling were impaired in late expression of Pim-1, Eomes, and CD8 memory. These defects were rescued when TCR-dependent NFκB signaling was restored. We also found that NFκB–Pim-1 signals were required at memory to maintain memory CD8 T-cell longevity, effector function, and Eomes expression. Hence, an NFκB–Pim-1–Eomes axis regulates Eomes levels to maintain memory fitness. PMID:28193872

Snail1 is required for the maintenance of the pancreatic acinar phenotype

PubMed Central

Loubat-Casanovas, Jordina; Peña, Raúl; Gonzàlez, Núria; Alba-Castellón, Lorena; Rosell, Santi; Francí, Clara; Navarro, Pilar; de Herreros, Antonio García

2016-01-01

The Snail1 transcriptional factor is required for correct embryonic development, yet its expression in adult animals is very limited and its functional roles are not evident. We have now conditionally inactivated Snail1 in adult mice and analyzed the phenotype of these animals. Snail1 ablation rapidly altered pancreas structure: one month after Snail1 depletion, acinar cells were markedly depleted, and pancreas accumulated adipose tissue. Snail1 expression was not detected in the epithelium but was in pancreatic mesenchymal cells (PMCs). Snail1 ablation in cultured PMCs downregulated the expression of several β-catenin/Tcf-4 target genes, modified the secretome of these cells and decreased their ability to maintain acinar markers in cultured pancreas cells. Finally, Snail1 deficiency modified the phenotype of pancreatic tumors generated in transgenic mice expressing c-myc under the control of the elastase promoter. Specifically, Snail1 depletion did not significantly alter the size of the tumors but accelerated acinar-ductal metaplasia. These results demonstrate that Snail1 is expressed in PMCs and plays a pivotal role in maintaining acinar cells within the pancreas in normal and pathological conditions. PMID:26735179

A role for the mevalonate pathway in early plant symbiotic signaling

PubMed Central

Venkateshwaran, Muthusubramanian; Jayaraman, Dhileepkumar; Chabaud, Mireille; Genre, Andrea; Balloon, Allison J.; Maeda, Junko; Forshey, Kari; den Os, Désirée; Kwiecien, Nicholas W.; Coon, Joshua J.; Barker, David G.; Ané, Jean-Michel

2015-01-01

Rhizobia and arbuscular mycorrhizal fungi produce signals that are perceived by host legume receptors at the plasma membrane and trigger sustained oscillations of the nuclear and perinuclear Ca2+ concentration (Ca2+ spiking), which in turn leads to gene expression and downstream symbiotic responses. The activation of Ca2+ spiking requires the plasma membrane-localized receptor-like kinase Does not Make Infections 2 (DMI2) as well as the nuclear cation channel DMI1. A key enzyme regulating the mevalonate (MVA) pathway, 3-Hydroxy-3-Methylglutaryl CoA Reductase 1 (HMGR1), interacts with DMI2 and is required for the legume–rhizobium symbiosis. Here, we show that HMGR1 is required to initiate Ca2+ spiking and symbiotic gene expression in Medicago truncatula roots in response to rhizobial and arbuscular mycorrhizal fungal signals. Furthermore, MVA, the direct product of HMGR1 activity, is sufficient to induce nuclear-associated Ca2+ spiking and symbiotic gene expression in both wild-type plants and dmi2 mutants, but interestingly not in dmi1 mutants. Finally, MVA induced Ca2+ spiking in Human Embryonic Kidney 293 cells expressing DMI1. This demonstrates that the nuclear cation channel DMI1 is sufficient to support MVA-induced Ca2+ spiking in this heterologous system. PMID:26199419

A role for the mevalonate pathway in early plant symbiotic signaling.

PubMed

Venkateshwaran, Muthusubramanian; Jayaraman, Dhileepkumar; Chabaud, Mireille; Genre, Andrea; Balloon, Allison J; Maeda, Junko; Forshey, Kari; den Os, Désirée; Kwiecien, Nicholas W; Coon, Joshua J; Barker, David G; Ané, Jean-Michel

2015-08-04

Rhizobia and arbuscular mycorrhizal fungi produce signals that are perceived by host legume receptors at the plasma membrane and trigger sustained oscillations of the nuclear and perinuclear Ca(2+) concentration (Ca(2+) spiking), which in turn leads to gene expression and downstream symbiotic responses. The activation of Ca(2+) spiking requires the plasma membrane-localized receptor-like kinase Does not Make Infections 2 (DMI2) as well as the nuclear cation channel DMI1. A key enzyme regulating the mevalonate (MVA) pathway, 3-Hydroxy-3-Methylglutaryl CoA Reductase 1 (HMGR1), interacts with DMI2 and is required for the legume-rhizobium symbiosis. Here, we show that HMGR1 is required to initiate Ca(2+) spiking and symbiotic gene expression in Medicago truncatula roots in response to rhizobial and arbuscular mycorrhizal fungal signals. Furthermore, MVA, the direct product of HMGR1 activity, is sufficient to induce nuclear-associated Ca(2+) spiking and symbiotic gene expression in both wild-type plants and dmi2 mutants, but interestingly not in dmi1 mutants. Finally, MVA induced Ca(2+) spiking in Human Embryonic Kidney 293 cells expressing DMI1. This demonstrates that the nuclear cation channel DMI1 is sufficient to support MVA-induced Ca(2+) spiking in this heterologous system.

Production of ABA responses requires both the nuclear and cytoplasmic functional involvement of PYR1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, EunJoo; Kim, Tae-Houn

Abscisic acid (ABA) enhances stress tolerant responses in plants against unfavorable environmental conditions. In Arabidopsis, ABA promotes interactions between PYR/PYL/RCARs and PP2C, thereby allowing SnRK2s to phosphorylate downstream components required for the regulation of gene expression or for gating ion channels. Because PYR1 is known to localize to nucleus and cytoplasm it is a question whether nuclear or cytoplasmic PYR1 confer different functions to the ABA signaling pathway, as has been previously shown for regulatory proteins. In order to answer this question, transgenic lines expressing nuclear PYR1 were generated in an ABA insensitive mutant background. Enforced nuclear expression of PYR1more » was examined by confocal microscopy and western blot analysis. Physiological analyses of the transgenic lines demonstrated that nuclear PYR1 is sufficient to generate ABA responses, such as, the inhibition of seed germination, root growth inhibition, the induction of gene expression, and stomatal closing movement. However, for the full recovery of ABA responses in the mutant background cytoplasmic PYR1 was required. The study suggests both nuclear and cytoplasmic PYR1 participate in the control of ABA signal transduction. - Highlights: • Nuclear and cytoplasmic functions of PYR1 were studied in the mutant which lacked majority of ABA responses. • Nuclear PYR1 reconstituted partially the ABA responses during seed germination, root growth, and guard cell movement. • Both the nuclear and cytoplasmic functions of PYR1 were required for the full generation of ABA responses.« less

Foxm1 transcription factor is required for lung fibrosis and epithelial-to-mesenchymal transition

PubMed Central

Balli, David; Ustiyan, Vladimir; Zhang, Yufang; Wang, I-Ching; Masino, Alex J; Ren, Xiaomeng; Whitsett, Jeffrey A; Kalinichenko, Vladimir V; Kalin, Tanya V

2013-01-01

Alveolar epithelial cells (AECs) participate in the pathogenesis of pulmonary fibrosis, producing pro-inflammatory mediators and undergoing epithelial-to-mesenchymal transition (EMT). Herein, we demonstrated the critical role of Forkhead Box M1 (Foxm1) transcription factor in radiation-induced pulmonary fibrosis. Foxm1 was induced in AECs following lung irradiation. Transgenic expression of an activated Foxm1 transcript in AECs enhanced radiation-induced pneumonitis and pulmonary fibrosis, and increased the expression of IL-1β, Ccl2, Cxcl5, Snail1, Zeb1, Zeb2 and Foxf1. Conditional deletion of Foxm1 from respiratory epithelial cells decreased radiation-induced pulmonary fibrosis and prevented the increase in EMT-associated gene expression. siRNA-mediated inhibition of Foxm1 prevented TGF-β-induced EMT in vitro. Foxm1 bound to and increased promoter activity of the Snail1 gene, a critical transcriptional regulator of EMT. Expression of Snail1 restored TGF-β-induced loss of E-cadherin in Foxm1-deficient cells in vitro. Lineage-tracing studies demonstrated that Foxm1 increased EMT during radiation-induced pulmonary fibrosis in vivo. Foxm1 is required for radiation-induced pulmonary fibrosis by enhancing the expression of genes critical for lung inflammation and EMT. PMID:23288041

Tissue specific characterisation of Lim-kinase 1 expression during mouse embryogenesis

PubMed Central

Lindström, Nils O.; Neves, Carlos; McIntosh, Rebecca; Miedzybrodzka, Zosia; Vargesson, Neil; Collinson, J. Martin

2012-01-01

The Lim-kinase (LIMK) proteins are important for the regulation of the actin cytoskeleton, in particular the control of actin nucleation and depolymerisation via regulation of cofilin, and hence may control a large number of processes during development, including cell tensegrity, migration, cell cycling, and axon guidance. LIMK1/LIMK2 knockouts disrupt spinal cord morphogenesis and synapse formation but other tissues and developmental processes that require LIMK are yet to be fully determined. To identify tissues and cell-types that may require LIMK, we characterised the pattern of LIMK1 protein during mouse embryogenesis. We showed that LIMK1 displays an expression pattern that is temporally dynamic and tissue-specific. In several tissues LIMK1 is detected in cell-types that also express Wilms’ tumour protein 1 and that undergo transitions between epithelial and mesenchymal states, including the pleura, epicardium, kidney nephrons, and gonads. LIMK1 was also found in a subset of cells in the dorsal retina, and in mesenchymal cells surrounding the peripheral nerves. This detailed study of the spatial and temporal expression of LIMK1 shows that LIMK1 expression is more dynamic than previously reported, in particular at sites of tissue–tissue interactions guiding multiple developmental processes. PMID:21167960

Cognate interactions between helper T cells and B cells. IV. Requirements for the expression of effector phase activity by helper T cells.

PubMed

Bartlett, W C; McCann, J; Shepherd, D M; Roy, M; Noelle, R J

1990-12-15

After activation with anti-CD3, activated Th (THCD3), but not resting Th, fixed with paraformaldehyde induce B cell RNA synthesis when co-cultured with resting B cells. This activity is expressed by Th of both Th1 and Th2 subtypes, as well as a third Th clone that is not classified into either subtype. It is proposed that anti-CD3 activation of Th results in the expression of Th membrane proteins that trigger B cell cycle entry. Kinetic studies reveal that 4 to 8 h of activation with anti-CD3 is sufficient for ThCD3 to express B cell-activating function. However, activation of Th with anti-CD3 for extended periods of time results in reduced Th effector activity. Inhibition of Th RNA synthesis during the anti-CD3 activation period ablates the ability of ThCD3 to induce B cell cycle entry. This indicates that de novo synthesis of proteins is required for ThCD3 to express effector function. The ability of fixed ThCD3 to induce entry of B cell into cycle is not due to an increase in expression of CD3, CD4, LFA-1, ICAM-1, class I MHC or Thy-1. Other forms of Th activation (PMA and A23187, Con A) also induced Th effector function. Furthermore, purified plasma membranes from anti-CD3 activated, but not resting Th, induced resting B cells to enter cycle. The addition of IL-4, but not IL-2, IL-5, or IFN-gamma amplified the DNA synthetic response of B cells stimulated with PM from activated Th. Taken together these data indicate that de novo expression of Th surface proteins on activated Th is required for Th to induce B cell cycle entry into G1 and the addition of IL-4 is required for the heightened progression into S phase.

Identification of functional domains of the IR2 protein of equine herpesvirus 1 required for inhibition of viral gene expression and replication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Seong K., E-mail: skim1@lsuhsc.edu; Kim, Seongman; Dai Gan

2011-09-01

The equine herpesvirus 1 (EHV-1) negative regulatory IR2 protein (IR2P), an early 1,165-amino acid (aa) truncated form of the 1487-aa immediate-early protein (IEP), lacks the trans-activation domain essential for IEP activation functions but retains domains for binding DNA, TFIIB, and TBP and the nuclear localization signal. IR2P mutants of the N-terminal region which lack either DNA-binding activity or TFIIB-binding activity were unable to down-regulate EHV-1 promoters. In EHV-1-infected cells expressing full-length IR2P, transcription and protein expression of viral regulatory IE, early EICP0, IR4, and UL5, and late ETIF genes were dramatically inhibited. Viral DNA levels were reduced to 2.1% ofmore » control infected cells, but were vey weakly affected in cells that express the N-terminal 706 residues of IR2P. These results suggest that IR2P function requires the two N-terminal domains for binding DNA and TFIIB as well as the C-terminal residues 707 to 1116 containing the TBP-binding domain. - Highlights: > We examine the functional domains of IR2P that mediates negative regulation. > IR2P inhibits at the transcriptional level. > DNA-binding mutant or TFIIB-binding mutant fails to inhibit. > C-terminal aa 707 to 1116 are required for full inhibition. > Inhibition requires the DNA-binding domain, TFIIB-binding domain, and C-terminus.« less

Ornithine Decarboxylase Activity Is Required for Prostatic Budding in the Developing Mouse Prostate

PubMed Central

Gamat, Melissa; Malinowski, Rita L.; Parkhurst, Linnea J.; Steinke, Laura M.; Marker, Paul C.

2015-01-01

The prostate is a male accessory sex gland that produces secretions in seminal fluid to facilitate fertilization. Prostate secretory function is dependent on androgens, although the mechanism by which androgens exert their effects is still unclear. Polyamines are small cationic molecules that play pivotal roles in DNA transcription, translation and gene regulation. The rate-limiting enzyme in polyamine biosynthesis is ornithine decarboxylase, which is encoded by the gene Odc1. Ornithine decarboxylase mRNA decreases in the prostate upon castration and increases upon administration of androgens. Furthermore, testosterone administered to castrated male mice restores prostate secretory activity, whereas administering testosterone and the ornithine decarboxylase inhibitor D,L-α-difluromethylornithine (DFMO) to castrated males does not restore prostate secretory activity, suggesting that polyamines are required for androgens to exert their effects. To date, no one has examined polyamines in prostate development, which is also androgen dependent. In this study, we showed that ornithine decarboxylase protein was expressed in the epithelium of the ventral, dorsolateral and anterior lobes of the adult mouse prostate. Ornithine decarboxylase protein was also expressed in the urogenital sinus (UGS) epithelium of the male and female embryo prior to prostate development, and expression continued in prostatic epithelial buds as they emerged from the UGS. Inhibiting ornithine decarboxylase using DFMO in UGS organ culture blocked the induction of prostatic buds by androgens, and significantly decreased expression of key prostate transcription factor, Nkx3.1, by androgens. DFMO also significantly decreased the expression of developmental regulatory gene Notch1. Other genes implicated in prostatic development including Sox9, Wif1 and Srd5a2 were unaffected by DFMO. Together these results indicate that Odc1 and polyamines are required for androgens to exert their effect in mediating prostatic bud induction, and are required for the expression of a subset of prostatic developmental regulatory genes including Notch1 and Nkx3.1. PMID:26426536

Micronucleus-specific histone H1 is required for micronuclear chromosome integrity in Tetrahymena thermophila

PubMed Central

Qiao, Juxia; Xu, Jing; Bo, Tao

2017-01-01

Histone H1 molecules play a key role in establishing and maintaining higher order chromatin structures. They can bind to linker DNA entering and exiting the nucleosome and regulate transcriptional activity. Tetrahymena thermophila has two histone H1, namely, macronuclear histone H1 and micronuclear histone H1 (Mlh1). Mlh1 is specifically localized at micronuclei during growth and starvation stages. Moreover, Mlh1 is localized around micronuclei and forms a specific structure during the conjugation stage. It co-localizes partially with spindle apparatus during micronuclear meiosis. Analysis of MLH1 knock-out revealed that Mlh1 was required for the micronuclear integrity and development during conjugation stage. Overexpression of Mlh1 led to abnormal conjugation progression. RT-PCR analysis indicated that the expression level of HMGB3 increased in ΔMLH1 strains, while the expression level of MLH1 increased in ΔHMGB3 cells during conjugation. These results indicate that micronuclear integrity and sexual development require normal expression level of Mlh1 and that HmgB3 and Mlh1 may functionally compensate each other in regulating micronuclear structure in T. thermophila. PMID:29095884

Establishment of a tissue-specific RNAi system in C. elegans.

PubMed

Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D; Amano, Mutsuki; Moerman, Donald G; Kaibuchi, Kozo

2007-10-01

In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal-and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues.

Establishment of a tissue-specific RNAi system in C. elegans

PubMed Central

Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D.; Amano, Mutsuki; Moerman, Donald G.; Kaibuchi, Kozo

2011-01-01

In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal- and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues. PMID:17681718

Resveratrol upregulates Egr-1 expression and activity involving extracellular signal-regulated protein kinase and ternary complex factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rössler, Oliver G.; Glatzel, Daniel; Thiel, Gerald, E-mail: gerald.thiel@uks.eu

2015-03-01

Many intracellular functions have been attributed to resveratrol, a polyphenolic phytoalexin found in grapes and in other plants. Here, we show that resveratrol induces the expression of the transcription factor Egr-1 in human embryonic kidney cells. Using a chromosomally embedded Egr-1-responsive reporter gene, we show that the Egr-1 activity was significantly elevated in resveratrol-treated cells, indicating that the newly synthesized Egr-1 protein was biologically active. Stimulus-transcription coupling leading to the resveratrol-induced upregulation of Egr-1 expression and activity requires the protein kinases Raf and extracellular signal-regulated protein kinase ERK, while MAP kinase phosphatase-1 functions as a nuclear shut-off device that interruptsmore » the signaling cascade connecting resveratrol stimulation with enhanced Egr-1 expression. On the transcriptional level, Elk-1, a key transcriptional regulator of serum response element-driven gene transcription, connects the intracellular signaling cascade elicited by resveratrol with transcription of the Egr-1 gene. These data were corroborated by the observation that stimulation of the cells with resveratrol increased the transcriptional activation potential of Elk-1. The SRE as well as the GC-rich DNA binding site of Egr-1 function as resveratrol-responsive elements. Thus, resveratrol regulates gene transcription via activation of the stimulus-regulated protein kinases Raf and ERK and the stimulus-responsive transcription factors TCF and Egr-1. - Highlights: • The plant polyphenol resveratrol upregulates Egr-1 expression and activity. • The stimulation of Egr-1 requires the protein kinases ERK and Raf. • Resveratrol treatment upregulates the transcriptional activation potential of Elk-1. • Resveratrol-induced stimulation of Egr-1 requires ternary complex factors. • Two distinct resveratrol-responsive elements were identified.« less

The Bmi-1 helix-turn and ring finger domains are required for Bmi-1 antagonism of (-) epigallocatechin-3-gallate suppression of skin cancer cell survival.

PubMed

Balasubramanian, Sivaprakasam; Scharadin, Tiffany M; Han, Bingshe; Xu, Wen; Eckert, Richard L

2015-07-01

The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (-) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21(Cip1) and p27(Kip1) expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix-turn-helix-turn-helix-turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. Copyright © 2015 Elsevier Inc. All rights reserved.

G protein-coupled receptor 30 (GPR30) mediates gene expression changes and growth response to 17beta-estradiol and selective GPR30 ligand G-1 in ovarian cancer cells.

PubMed

Albanito, Lidia; Madeo, Antonio; Lappano, Rosamaria; Vivacqua, Adele; Rago, Vittoria; Carpino, Amalia; Oprea, Tudor I; Prossnitz, Eric R; Musti, Anna Maria; Andò, Sebastiano; Maggiolini, Marcello

2007-02-15

Estrogens play a crucial role in the development of ovarian tumors; however, the signal transduction pathways involved in hormone action are still poorly defined. The orphan G protein-coupled receptor 30 (GPR30) mediates the nongenomic signaling of 17beta-estradiol (E2) in a variety of estrogen-sensitive cancer cells through activation of the epidermal growth factor receptor (EGFR) pathway. Whether estrogen receptor alpha (ERalpha) also contributes to GPR30/EGFR signaling is less understood. Here, we show that, in ERalpha-positive BG-1 ovarian cancer cells, both E2 and the GPR30-selective ligand G-1 induced c-fos expression and estrogen-responsive element (ERE)-independent activity of a c-fos reporter gene, whereas only E2 stimulated an ERE-responsive reporter gene, indicating that GPR30 signaling does not activate ERalpha-mediated transcription. Similarly, both ligands up-regulated cyclin D1, cyclin E, and cyclin A, whereas only E2 enhanced progesterone receptor expression. Moreover, both GPR30 and ERalpha expression are required for c-fos stimulation and extracellular signal-regulated kinase (ERK) activation in response to either E2 or G-1. Inhibition of the EGFR transduction pathway inhibited c-fos stimulation and ERK activation by either ligand, suggesting that in ovarian cancer cells GPR30/EGFR signaling relays on ERalpha expression. Interestingly, we show that both GPR30 and ERalpha expression along with active EGFR signaling are required for E2-stimulated and G-1-stimulated proliferation of ovarian cancer cells. Because G-1 was able to induce both c-fos expression and proliferation in the ERalpha-negative/GPR30-positive SKBR3 breast cancer cells, the requirement for ERalpha expression in GPR30/EGFR signaling may depend on the specific cellular context of different tumor types.

Direct Role for the Rpd3 Complex in Transcriptional Induction of the Anaerobic DAN/TIR Genes in Yeast▿‡

PubMed Central

Sertil, Odeniel; Vemula, Arvind; Salmon, Sharon L.; Morse, Randall H.; Lowry, Charles V.

2007-01-01

Saccharomyces cerevisiae adapts to hypoxia by expressing a large group of “anaerobic” genes. Among these, the eight DAN/TIR genes are regulated by the repressors Rox1 and Mot3 and the activator Upc2/Mox4. In attempting to identify factors recruited by the DNA binding repressor Mot3 to enhance repression of the DAN/TIR genes, we found that the histone deacetylase and global repressor complex, Rpd3-Sin3-Sap30, was not required for repression. Strikingly, the complex was instead required for activation. In addition, the histone H3 and H4 amino termini, which are targets of Rpd3, were also required for DAN1 expression. Epistasis tests demonstrated that the Rpd3 complex is not required in the absence of the repressor Mot3. Furthermore, the Rpd3 complex was required for normal function and stable binding of the activator Upc2 at the DAN1 promoter. Moreover, the Swi/Snf chromatin remodeling complex was strongly required for activation of DAN1, and chromatin immunoprecipitation analysis showed an Rpd3-dependent reduction in DAN1 promoter-associated nucleosomes upon induction. Taken together, these data provide evidence that during anaerobiosis, the Rpd3 complex acts at the DAN1 promoter to antagonize the chromatin-mediated repression caused by Mot3 and Rox1 and that chromatin remodeling by Swi/Snf is necessary for normal expression. PMID:17210643

The RNA-Binding Protein Musashi1 Affects Medulloblastoma Growth via a Network of Cancer-Related Genes and Is an Indicator of Poor Prognosis

PubMed Central

Vo, Dat T.; Subramaniam, Dharmalingam; Remke, Marc; Burton, Tarea L.; Uren, Philip J.; Gelfond, Jonathan A.; de Sousa Abreu, Raquel; Burns, Suzanne C.; Qiao, Mei; Suresh, Uthra; Korshunov, Andrey; Dubuc, Adrian M.; Northcott, Paul A.; Smith, Andrew D.; Pfister, Stefan M.; Taylor, Michael D.; Janga, Sarath C.; Anant, Shrikant; Vogel, Christine; Penalva, Luiz O.F.

2013-01-01

Musashi1 (Msi1) is a highly conserved RNA-binding protein that is required during the development of the nervous system. Msi1 has been characterized as a stem cell marker, controlling the balance between self-renewal and differentiation, and has also been implicated in tumorigenesis, being highly expressed in multiple tumor types. We analyzed Msi1 expression in a large cohort of medulloblastoma samples and found that Msi1 is highly expressed in tumor tissue compared with normal cerebellum. Notably, high Msi1 expression levels proved to be a sign of poor prognosis. Msi1 expression was determined to be particularly high in molecular subgroups 3 and 4 of medulloblastoma. We determined that Msi1 is required for tumorigenesis because inhibition of Msi1 expression by small-interfering RNAs reduced the growth of Daoy medulloblastoma cells in xenografts. To characterize the participation of Msi1 in medulloblastoma, we conducted different high-throughput analyses. Ribonucleoprotein immunoprecipitation followed by microarray analysis (RIP-chip) was used to identify mRNA species preferentially associated with Msi1 protein in Daoy cells. We also used cluster analysis to identify genes with similar or opposite expression patterns to Msi1 in our medulloblastoma cohort. A network study identified RAC1, CTGF, SDCBP, SRC, PRL, and SHC1 as major nodes of an Msi1-associated network. Our results suggest that Msi1 functions as a regulator of multiple processes in medulloblastoma formation and could become an important therapeutic target. PMID:22985791

FGF signaling is required for brain left-right asymmetry and brain midline formation.

PubMed

Neugebauer, Judith M; Yost, H Joseph

2014-02-01

Early disruption of FGF signaling alters left-right (LR) asymmetry throughout the embryo. Here we uncover a role for FGF signaling that specifically disrupts brain asymmetry, independent of normal lateral plate mesoderm (LPM) asymmetry. When FGF signaling is inhibited during mid-somitogenesis, asymmetrically expressed LPM markers southpaw and lefty2 are not affected. However, asymmetrically expressed brain markers lefty1 and cyclops become bilateral. We show that FGF signaling controls expression of six3b and six7, two transcription factors required for repression of asymmetric lefty1 in the brain. We found that Z0-1, atypical PKC (aPKC) and β-catenin protein distribution revealed a midline structure in the forebrain that is dependent on a balance of FGF signaling. Ectopic activation of FGF signaling leads to overexpression of six3b, loss of organized midline adherins junctions and bilateral loss of lefty1 expression. Reducing FGF signaling leads to a reduction in six3b and six7 expression, an increase in cell boundary formation in the brain midline, and bilateral expression of lefty1. Together, these results suggest a novel role for FGF signaling in the brain to control LR asymmetry, six transcription factor expressions, and a midline barrier structure. Copyright © 2013 Elsevier Inc. All rights reserved.

FGF Signaling is Required for Brain Left-Right Asymmetry and Brain Midline Formation

PubMed Central

Neugebauer, Judith M.; Yost, H. Joseph

2014-01-01

Early disruption of FGF signaling alters left-right (LR) asymmetry throughout the embryo. Here we uncover a role for FGF signaling that specifically disrupts brain asymmetry, independent of normal lateral plate mesoderm (LPM) asymmetry. When FGF signaling is inhibited during mid-somitogenesis, asymmetrically expressed LPM markers southpaw and lefty2 are not affected. However, asymmetrically expressed brain markers lefty1 and cyclops become bilateral. We show that FGF signaling controls expression of six3b and six7, two transcription factors required for repression of asymmetric lefty1 in the brain. We found that Z0-1, atypical PKC (aPKC) and β-catenin protein distribution revealed a midline structure in the forebrain that is dependent on a balance of FGF signaling. Ectopic activation of FGF signaling leads to overexpression of six3b, loss of organized midline adherins junctions and bilateral loss of lefty1 expression. Reducing FGF signaling leads to a reduction in six3b and six7 expression, an increase in cell boundary formation in the brain midline, and bilateral expression of lefty1. Together, these results suggest a novel role for FGF signaling in the brain to control LR asymmetry, six transcription factor expression, and a midline barrier structure. PMID:24333178

Regulatory elements involved in constitutive and phorbol ester-inducible expression of the plasminogen activator inhibitor type 2 gene promoter.

PubMed Central

Cousin, E; Medcalf, R L; Bergonzelli, G E; Kruithof, E K

1991-01-01

Gene transcription rates and mRNA levels of plasminogen activator inhibitor type 2 (PAI-2) are markedly induced by the tumor promoting agent phorbol 12-myristate 13-acetate (PMA) in human HT1080 fibrosarcoma cells. To identify promoter elements required for basal-, and phorbol ester-inducible expression, deletion mutants of the PAI-1 promoter fused to the chloramphenicol acetyl transferase (CAT) reporter gene, were transiently expressed in HT1080 cells. Constitutive CAT activity was expressed from constructs containing more than 215 bp of promoter sequence, whereas deletion to position -91 bp abolished CAT gene expression. Treatment of transfected cells with PMA resulted in a three- to ten-fold increase in CAT expression from all constructs except from the construct shortened to position -91. DNAse1 protection analysis of the promoter region between -215 and the transcription initiation site revealed numerous protected regions, including two AP1-like binding sites (AP1a and AP1b) and one CRE-like element. Site-directed mutagenesis of the AP1a site or of the CRE-like site resulted in the loss of basal CAT activity and abolished the PMA effect, whereas mutagenesis of AP1b only partially inhibited basal and PMA-mediated expression. Our results suggest that the PAI-2 promoter contains at least two elements required for basal gene transcription and PMA-mediated induction. Images PMID:1650454

zic-1 Expression in Planarian Neoblasts after Injury Controls Anterior Pole Regeneration

PubMed Central

Vásquez-Doorman, Constanza; Petersen, Christian P.

2014-01-01

Mechanisms that enable injury responses to prompt regenerative outgrowth are not well understood. Planarians can regenerate essentially any tissue removed by wounding, even after decapitation, due to robust regulation of adult pluripotent stem cells of the neoblast population. Formation of pole signaling centers involving Wnt inhibitors or Wnt ligands promotes head or tail regeneration, respectively, and this process requires the use of neoblasts early after injury. We used expression profiling of purified neoblasts to identify factors needed for anterior pole formation. Using this approach, we identified zic-1, a Zic-family transcription factor, as transcriptionally activated in a subpopulation of neoblasts near wound sites early in head regeneration. As head regeneration proceeds, the Wnt inhibitor notum becomes expressed in the newly forming anterior pole in zic-1-expressing cells descended from neoblasts. Inhibition of zic-1 by RNAi resulted in a failure to express notum at the anterior pole and to regenerate a head, but did not affect tail regeneration. Both injury and canonical Wnt signaling inhibition are required for zic-1 expression, and double-RNAi experiments suggest zic-1 inhibits Wnt signaling to allow head regeneration. Analysis of neoblast fate determinants revealed that zic-1 controls specification of notum-expressing cells from foxD-expressing neoblasts to form the anterior pole, which organizes subsequent outgrowth. Specialized differentiation programs may in general underlie injury-dependent formation of tissue organizing centers used for regenerative outgrowth. PMID:24992682

The RNA Export Factor, Nxt1, Is Required for Tissue Specific Transcriptional Regulation

PubMed Central

Jiang, Jianqiao; White-Cooper, Helen

2013-01-01

The highly conserved, Nxf/Nxt (TAP/p15) RNA nuclear export pathway is important for export of most mRNAs from the nucleus, by interacting with mRNAs and promoting their passage through nuclear pores. Nxt1 is essential for viability; using a partial loss of function allele, we reveal a role for this gene in tissue specific transcription. We show that many Drosophila melanogaster testis-specific mRNAs require Nxt1 for their accumulation. The transcripts that require Nxt1 also depend on a testis-specific transcription complex, tMAC. We show that loss of Nxt1 leads to reduced transcription of tMAC targets. A reporter transcript from a tMAC-dependent promoter is under-expressed in Nxt1 mutants, however the same transcript accumulates in mutants if driven by a tMAC-independent promoter. Thus, in Drosophila primary spermatocytes, the transcription factor used to activate expression of a transcript, rather than the RNA sequence itself or the core transcription machinery, determines whether this expression requires Nxt1. We additionally find that transcripts from intron-less genes are more sensitive to loss of Nxt1 function than those from intron-containing genes and propose a mechanism in which transcript processing feeds back to increase activity of a tissue specific transcription complex. PMID:23754955

Biologic consequences of Stat1-independent IFN signaling

PubMed Central

Gil, M. Pilar; Bohn, Erwin; O'Guin, Andrew K.; Ramana, Chilakamarti V.; Levine, Beth; Stark, George R.; Virgin, Herbert W.; Schreiber, Robert D.

2001-01-01

Although Stat1 is required for many IFN-dependent responses, recent work has shown that IFNγ functions independently of Stat1 to affect the growth of tumor cells or immortalized fibroblasts. We now demonstrate that both IFNγ and IFNα/β regulate proliferative responses in cells of the mononuclear phagocyte lineage derived from Stat1-null mice. Using both representational difference analysis and gene arrays, we show that IFNγ exerts its Stat1-independent actions on mononuclear phagocytes by regulating the expression of many genes. This result was confirmed by monitoring changes in expression and function of the corresponding gene products. Regulation of the expression of these genes requires the IFNγ receptor and Jak1. The physiologic relevance of IFN-dependent, Stat1-independent signaling was demonstrated by monitoring antiviral responses in Stat1-null mice. Thus, the IFN receptors engage alternative Stat1-independent signaling pathways that have important physiological consequences. PMID:11390995

Impaired embryonic haematopoiesis yet normal arterial development in the absence of the Notch ligand Jagged1

PubMed Central

Robert-Moreno, Àlex; Guiu, Jordi; Ruiz-Herguido, Cristina; López, M Eugenia; Inglés-Esteve, Julia; Riera, Lluis; Tipping, Alex; Enver, Tariq; Dzierzak, Elaine; Gridley, Thomas; Espinosa, Lluis; Bigas, Anna

2008-01-01

Specific deletion of Notch1 and RBPjκ in the mouse results in abrogation of definitive haematopoiesis concomitant with the loss of arterial identity at embryonic stage. As prior arterial determination is likely to be required for the generation of embryonic haematopoiesis, it is difficult to establish the specific haematopoietic role of Notch in these mutants. By analysing different Notch-ligand-null embryos, we now show that Jagged1 is not required for the establishment of the arterial fate but it is required for the correct execution of the definitive haematopoietic programme, including expression of GATA2 in the dorsal aorta. Moreover, successful haematopoietic rescue of the Jagged1-null AGM cells was obtained by culturing them with Jagged1-expressing stromal cells or by lentiviral-mediated transduction of the GATA2 gene. Taken together, our results indicate that Jagged1-mediated activation of Notch1 is responsible for regulating GATA2 expression in the AGM, which in turn is essential for definitive haematopoiesis in the mouse. PMID:18528438

Lmx1b is essential for Fgf8 and Wnt1 expression in the isthmic organizer during tectum and cerebellum development in mice.

PubMed

Guo, Chao; Qiu, Hai-Yan; Huang, Ying; Chen, Haixu; Yang, Rong-Qiang; Chen, Sheng-Di; Johnson, Randy L; Chen, Zhou-Feng; Ding, Yu-Qiang

2007-01-01

Secreted factors FGF8 and WNT1 are essential either for the inductive activity of the isthmus organizer or for the regionalization of the midbrain-hindbrain boundary (MHB). However, transcriptional regulation of these secreted factors during development remains to be elucidated. Here we show that the LIM homeobox gene Lmx1b is expressed in the anterior embryo as early as E7.5 and its expression becomes progressively restricted to the isthmus at E9.0. Analysis of gene expression in the MHB of the mutant embryos showed that many genes were lost by E9.5. In the MHB of Lmx1b-/- embryos, the expression of Fgf8, which normally occurs at the 4-somite stage, was completely absent, whereas Wnt1 was downregulated before the 4-somite stage. Moreover, transcription factors En1 and Pax2 were also downregulated prior to the 4-somite stage, whereas Gbx2 downregulation occurred at the 4-somite stage. By contrast, Otx2 and Pax6 expression was not affected in Lmx1b-/- embryos. The requirement of specific Lmx1b expression in the MHB was further confirmed by Wnt1-Cre-mediated region-specific conditional knockout of Lmx1b. As a result of these molecular defects, the development of the tectum and cerebellum was severely impaired in Lmx1b-/- mice. Taken together, our results indicate that Lmx1b plays an essential role in the development of the tectum and cerebellum by regulating expression of Fgf8, Wnt1 and several isthmus-related transcription factors in the MHB, and is a crucial component of a cross-regulatory network required for the induction activity of the isthmic organizer in the MHB.

COL1A1 transgene expression in stably transfected osteoblastic cells. Relative contributions of first intron, 3'-flanking sequences, and sequences derived from the body of the human COL1A1 minigene

NASA Technical Reports Server (NTRS)

Breault, D. T.; Lichtler, A. C.; Rowe, D. W.

1997-01-01

Collagen reporter gene constructs have be used to identify cell-specific sequences needed for transcriptional activation. The elements required for endogenous levels of COL1A1 expression, however, have not been elucidated. The human COL1A1 minigene is expressed at high levels and likely harbors sequence elements required for endogenous levels of activity. Using stably transfected osteoblastic Py1a cells, we studied a series of constructs (pOBColCAT) designed to characterize further the elements required for high level of expression. pOBColCAT, which contains the COL1A1 first intron, was expressed at 50-100-fold higher levels than ColCAT 3.6, which lacks the first intron. This difference is best explained by improved mRNA processing rather than a transcriptional effect. Furthermore, variation in activity observed with the intron deletion constructs is best explained by altered mRNA splicing. Two major regions of the human COL1A1 minigene, the 3'-flanking sequences and the minigene body, were introduced into pOBColCAT to assess both transcriptional enhancing activity and the effect on mRNA stability. Analysis of the minigene body, which includes the first five exons and introns fused with the terminal six introns and exons, revealed an orientation-independent 5-fold increase in CAT activity. In contrast the 3'-flanking sequences gave rise to a modest 61% increase in CAT activity. Neither region increased the mRNA half-life of the parent construct, suggesting that CAT-specific mRNA instability elements may serve as dominant negative regulators of stability. This study suggests that other sites within the body of the COL1A1 minigene are important for high expression, e.g. during periods of rapid extracellular matrix production.

Efficient transcription of the glycolytic gene ADH1 and three translational component genes requires the GCR1 product, which can act through TUF/GRF/RAP binding sites.

PubMed Central

Santangelo, G M; Tornow, J

1990-01-01

Glycolytic gene expression in Saccharomyces cerevisiae is thought to be activated by the GCR and TUF proteins. We tested the hypothesis that GCR function is mediated by TUF/GRF/RAP binding sites (UASRPG elements). We found that UASRPG-dependent activation of a heterologous gene and transcription of ADH1, TEF1, TEF2, and RP59 were sensitive to GCR1 disruption. GCR is not required for TUF/GRF/RAP expression or in vitro DNA-binding activity. Images PMID:2405258

Axon-glia Synapses Are Highly Vulnerable to White Matter Injury in the Developing Brain

PubMed Central

Shen, Yan; Liu, Xiao-Bo; Pleasure, David E.; Deng, Wenbin

2011-01-01

The biology of cerebral white matter injury is woefully understudied, in part due to the difficulty to reliably model this type of injury in rodents. Periventricular leukomalacia (PVL) is the predominant form of brain injury and the most common cause of cerebral palsy in premature infants. PVL is characterized by predominant white matter injury. No specific therapy for PVL is presently available because the pathogenesis is not well understood. Here we report that two types of mouse PVL models have been created by hypoxia-ischemia with or without systemic co-administration of lipopolysaccharide (LPS). LPS co-administration exacerbated hypoxic-ischemic white matter injury and led to enhanced microglial activation and astrogliosis. Drug trials with the anti-inflammatory agent minocycline, the anti-excitotoxic agent NBQX and the antioxidant agent edaravone showed various degrees of protection in the two models, indicating that excitotoxic, oxidative and inflammatory forms of injury are involved in the pathogenesis of injury to immature white matter. We then applied immune-electron microscopy to reveal fine structural changes in the injured white matter, and found that synapses between axons and oligodendroglial precursor cells (OPCs) are quickly and profoundly damaged. Hypoxia-ischemia caused a drastic decrease in the number of postsynaptic densities associated with the glutamatergic axon-OPC synapses defined by the expression of vesicular glutamate transporters, vGluT1 and vGluT2, on axon terminals that formed contacts with OPCs in the periventricular white matter, resulted in selective shrinkage of the postsynaptic OPCs contacted by vGluT2 labeled synapses, and led to excitotoxicity mediated by GluR2-lacking, Ca2+-permeable AMPA receptors. Taken together, the present study provides novel mechanistic insights into the pathogenesis of PVL, and reveals that axon-glia synapses are highly vulnerable to white matter injury in the developing brain. More broadly, the study of white matter development and injury has general implications for a variety of neurological diseases including PVL, stroke, spinal cord injury and multiple sclerosis. PMID:21812016

Intracellular Action of a Secreted Peptide Required for Fungal Virulence.

PubMed

Homer, Christina M; Summers, Diana K; Goranov, Alexi I; Clarke, Starlynn C; Wiesner, Darin L; Diedrich, Jolene K; Moresco, James J; Toffaletti, Dena; Upadhya, Rajendra; Caradonna, Ippolito; Petnic, Sarah; Pessino, Veronica; Cuomo, Christina A; Lodge, Jennifer K; Perfect, John; Yates, John R; Nielsen, Kirsten; Craik, Charles S; Madhani, Hiten D

2016-06-08

Quorum sensing (QS) is a bacterial communication mechanism in which secreted signaling molecules impact population function and gene expression. QS-like phenomena have been reported in eukaryotes with largely unknown contributing molecules, functions, and mechanisms. We identify Qsp1, a secreted peptide, as a central signaling molecule that regulates virulence in the fungal pathogen Cryptococcus neoformans. QSP1 is a direct target of three transcription factors required for virulence, and qsp1Δ mutants exhibit attenuated infection, slowed tissue accumulation, and greater control by primary macrophages. Qsp1 mediates autoregulatory signaling that modulates secreted protease activity and promotes cell wall function at high cell densities. Peptide production requires release from a secreted precursor, proQsp1, by a cell-associated protease, Pqp1. Qsp1 sensing requires an oligopeptide transporter, Opt1, and remarkably, cytoplasmic expression of mature Qsp1 complements multiple phenotypes of qsp1Δ. Thus, C. neoformans produces an autoregulatory peptide that matures extracellularly but functions intracellularly to regulate virulence. Copyright © 2016 Elsevier Inc. All rights reserved.

Miz1, a Novel Target of ING4, Can Drive Prostate Luminal Epithelial Cell Differentiation.

PubMed

Berger, Penny L; Winn, Mary E; Miranti, Cindy K

2017-01-01

How prostate epithelial cells differentiate and how dysregulation of this process contributes to prostate tumorigenesis remain unclear. We recently identified a Myc target and chromatin reader protein, ING4, as a necessary component of human prostate luminal epithelial cell differentiation, which is often lost in primary prostate tumors. Furthermore, loss of ING4 in the context of oncogenic mutations is required for prostate tumorigenesis. Identifying the gene targets of ING4 can provide insight into how its loss disrupts differentiation and leads to prostate cancer. Using a combination of RNA-Seq, a best candidate approach, and chromatin immunoprecipitation (ChIP), we identified Miz1 as a new ING4 target. ING4 or Miz1 overexpression, shRNA knock-down, and a Myc-binding mutant were used in a human in vitro differentiation assay to assess the role of Miz1 in luminal cell differentiation. ING4 directly binds the Miz1 promoter and is required to induce Miz1 mRNA and protein expression during luminal cell differentiation. Miz1 mRNA was not induced in shING4 expressing cells or tumorigenic cells in which ING4 is not expressed. Miz1 dependency on ING4 was unique to differentiating luminal cells; Miz1 mRNA expression was not induced in basal cells. Although Miz1 is a direct target of ING4, and its overexpression can drive luminal cell differentiation, Miz1 was not required for differentiation. Miz1 is a newly identified ING4-induced target gene which can drive prostate luminal epithelial cell differentiation although it is not absolutely required. Prostate 77:49-59, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

An Independent Construct for Conditional Expression of Atonal Homolog-1

PubMed Central

Cheng, Yen-fu; Kinouchi, Hikaru; Bieber, Rebecca; Edge, Albert S.B.

2014-01-01

Abstract The mammalian homolog of the basic helix-loop-helix transcription factor atonal-1 (Atoh1 or Math1) is required for development of cochlear hair cells that function as the mechanosensory cells required for audition. Forced expression of Atoh1 in cochlear-supporting cells may provide a way to regenerate hair cells and provide for a therapy for hearing loss. Additionally, Atoh1 is an inhibitor of proliferation and has further clinical applications in anticancer therapies. The goal of these experiments was to improve the method for Atoh1 expression by engineering a genetic construct that may be used in future translational applications. To address the poor control of Atoh1 expression in standard gene expression systems where Atoh1 is expressed constitutively at abnormally elevated levels, our aim was to engineer an inducible system whereby Atoh1 was upregulated by an inducer and downregulated once the inducer was removed. A further aim was to engineer a single genetic construct that allowed for conditional expression of Atoh1 independent of secondary regulatory elements. Here we describe a stand-alone genetic construct that utilizes the tamoxifen sensitivity of a mutated estrogen receptor (ER) ligand-binding domain for the conditional expression of Atoh1. The Atoh1-ER-DsRed construct is translated into an ATOH1-ER-DSRED fusion protein that remains sequestered in the cytoplasm and therefore rendered inactive because it cannot enter the nucleus to activate Atoh1 signaling pathways. However, application of 4-hydroxytamoxifen results in translocation of the fusion protein to the nucleus, where it binds to the Atoh1 enhancer, upregulates transcription and translation of endogenous ATOH1 and activates downstream Atoh1 signaling such as upregulation of the hair cell protein MYOSIN 7A. Removal of tamoxifen reverses the upregulation of endogenous Atoh1 signaling. This construct serves as an independent genetic construct that allows for the conditional upregulation and downregulation of Atoh1, and may prove useful for manipulating Atoh1 expression in vivo. PMID:24066662

Transcription factors lhx1/5-1 and pitx are required for the maintenance and regeneration of serotonergic neurons in planarians.

PubMed

Currie, Ko W; Pearson, Bret J

2013-09-01

In contrast to most adult organisms, freshwater planarians can regenerate any injured body part, including their entire nervous system. This allows for the analysis of genes required for both the maintenance and regeneration of specific neural subtypes. In addition, the loss of specific neural subtypes may uncover previously unknown behavioral roles for that neural population in the context of the adult animal. Here we show that two homeodomain transcription factor homologs, Smed-lhx1/5-1 and Smed-pitx, are required for the maintenance and regeneration of serotonergic neurons in planarians. When either lhx1/5-1 or pitx was knocked down by RNA interference, the expression of multiple canonical markers for serotonergic neurons was lost. Surprisingly, the loss of serotonergic function uncovered a role for these neurons in the coordination of motile cilia on the ventral epidermis of planarians that are required for their nonmuscular gliding locomotion. Finally, we show that in addition to its requirement in serotonergic neurons, Smed-pitx is required for proper midline patterning during regeneration, when it is required for the expression of the midline-organizing molecules Smed-slit in the anterior and Smed-wnt1 in the posterior.

Regulation of collagenase-3 and osteocalcin gene expression by collagen and osteopontin in differentiating MC3T3-E1 cells

NASA Technical Reports Server (NTRS)

D'Alonzo, Richard C.; Kowalski, Aaron J.; Denhardt, David T.; Nickols, G. Allen; Partridge, Nicola C.

2002-01-01

Both collagenase-3 and osteocalcin mRNAs are expressed maximally during the later stages of osteoblast differentiation. Here, we demonstrate that collagenase-3 mRNA expression in differentiating MC3T3-E1 cells is dependent upon the presence of ascorbic acid, is inhibited in the presence of the collagen synthesis inhibitor, 3,4-dehydroproline, and is stimulated by growth on collagen in the absence of ascorbic acid. Transient transfection studies show that collagenase-3 promoter activity increases during cell differentiation and requires the presence of ascorbic acid. Additionally, we show that, in differentiating MC3T3-E1 cells, collagenase-3 gene expression increases in the presence of an anti-osteopontin monoclonal antibody that binds near the RGD motif of this protein, whereas osteocalcin expression is inhibited. Furthermore, an RGD peptidomimetic compound, designed to block interaction of ligands to the alpha(v) integrin subunit, increases osteocalcin expression and inhibits collagenase-3 expression, suggesting that the RGD peptidomimetic initiates certain alpha(v) integrin signaling in osteoblastic cells. Overall, these studies demonstrate that stimulation of collagenase-3 expression during osteoblast differentiation requires synthesis of a collagenous matrix and that osteopontin and alpha(v) integrins exert divergent regulation of collagenase-3 and osteocalcin expression during osteoblast differentiation.

Temporal Expression of a Master Regulator Drives Synchronous Sporulation in Budding Yeast.

PubMed

Chia, Minghao; van Werven, Folkert J

2016-09-07

Yeast cells enter and undergo gametogenesis relatively asynchronously, making it technically challenging to perform stage-specific genomic and biochemical analyses. Cell-to-cell variation in the expression of the master regulator of entry into sporulation IME1, has been implicated to be the underlying cause of asynchronous sporulation. Here we find that timing of IME1 expression is of critical importance for inducing cells to undergo sporulation synchronously. When we force expression of IME1 from an inducible promoter in cells incubated in sporulation medium for two hours, the vast majority of cells exhibit synchrony during pre-meiotic DNA replication and meiotic divisions. Inducing IME1 expression too early or too late affects the synchrony of sporulation. Surprisingly, our approach for synchronous sporulation does not require growth in acetate containing medium, but can be achieved in cells grown in rich medium until saturation. Our system solely requires IME1 because the expression of the N6-methyladenosine methyltransferase IME4, another key regulator of early sporulation, is controlled by IME1 itself. The approach described here can be easily combined with other stage specific synchronization methods, and thereby applied to study specific stages of sporulation or the complete sporulation program. Copyright © 2016 Author et al.

SF-1 in the ventral medial hypothalamic nucleus: A key regulator of homeostasis

USDA-ARS?s Scientific Manuscript database

The ventral medial hypothalamic nucleus (VMH) regulates food intake and body weight homeostasis. The nuclear receptor NR5A1 (steroidogenic factor 1; SF-1) is a transcription factor whose expression is highly restricted in the VMH and is required for the development of the nucleus. Neurons expressing...

Prox1 and fibroblast growth factor receptors form a novel regulatory loop controlling lens fiber differentiation and gene expression

PubMed Central

Audette, Dylan S.; Anand, Deepti; So, Tammy; Rubenstein, Troy B.; Lachke, Salil A.; Lovicu, Frank J.; Duncan, Melinda K.

2016-01-01

Lens epithelial cells differentiate into lens fibers (LFs) in response to a fibroblast growth factor (FGF) gradient. This cell fate decision requires the transcription factor Prox1, which has been hypothesized to promote cell cycle exit in differentiating LF cells. However, we find that conditional deletion of Prox1 from mouse lenses results in a failure in LF differentiation despite maintenance of normal cell cycle exit. Instead, RNA-seq demonstrated that Prox1 functions as a global regulator of LF cell gene expression. Intriguingly, Prox1 also controls the expression of fibroblast growth factor receptors (FGFRs) and can bind to their promoters, correlating with decreased downstream signaling through MAPK and AKT in Prox1 mutant lenses. Further, culturing rat lens explants in FGF increased their expression of Prox1, and this was attenuated by the addition of inhibitors of MAPK. Together, these results describe a novel feedback loop required for lens differentiation and morphogenesis, whereby Prox1 and FGFR signaling interact to mediate LF differentiation in response to FGF. PMID:26657765

TORNADO1 regulates root epidermal patterning through the WEREWOLF pathway in Arabidopsis thaliana.

PubMed

Kwak, Su-Hwan; Song, Sang-Kee; Lee, Myeong Min; Schiefelbein, John

2015-01-01

Cell fate in the root epidermis of Arabidopsis thaliana is determined in a position-dependent manner. SCRAMBLED (SCM), an atypical leucine-rich repeat receptor-like kinase, mediates this positional regulation via its effect on WEREWOLF (WER) expression, and subsequently, its downstream transcription factor, GLABRA2 (GL2), which are required for nonhair cell development. Previously, TORNADO1 (TRN1), a plant-specific protein with a leucine-rich repeat ribonuclease inhibitor-like domain, was shown to be required for proper epidermal patterning in Arabidopsis roots. In this work, we analyzed the possible involvement of TRN1 in the known root epidermal gene network. We discovered that the trn1 mutant caused the ectopic expression of WER and the randomized expression of GL2 and EGL3. This suggests that TRN1 regulates the position-dependent cell fate determination by affecting WER expression in Arabidopsis root epidermis. Additionally, the distinct phenotypes of the aerial parts of the trn1-t and scm-2 mutant suggest that TRN1 and SCM might have different functions in the development of aerial parts.

TORNADO1 regulates root epidermal patterning through the WEREWOLF pathway in Arabidopsis thaliana

PubMed Central

Kwak, Su-Hwan; Song, Sang-Kee; Lee, Myeong Min; Schiefelbein, John

2015-01-01

Cell fate in the root epidermis of Arabidopsis thaliana is determined in a position-dependent manner. SCRAMBLED (SCM), an atypical leucine-rich repeat receptor-like kinase, mediates this positional regulation via its effect on WEREWOLF (WER) expression, and subsequently, its downstream transcription factor, GLABRA2 (GL2), which are required for nonhair cell development. Previously, TORNADO1 (TRN1), a plant-specific protein with a leucine-rich repeat ribonuclease inhibitor-like domain, was shown to be required for proper epidermal patterning in Arabidopsis roots. In this work, we analyzed the possible involvement of TRN1 in the known root epidermal gene network. We discovered that the trn1 mutant caused the ectopic expression of WER and the randomized expression of GL2 and EGL3. This suggests that TRN1 regulates the position-dependent cell fate determination by affecting WER expression in Arabidopsis root epidermis. Additionally, the distinct phenotypes of the aerial parts of the trn1-t and scm-2 mutant suggest that TRN1 and SCM might have different functions in the development of aerial parts. PMID:26451798

Prox1 and fibroblast growth factor receptors form a novel regulatory loop controlling lens fiber differentiation and gene expression.

PubMed

Audette, Dylan S; Anand, Deepti; So, Tammy; Rubenstein, Troy B; Lachke, Salil A; Lovicu, Frank J; Duncan, Melinda K

2016-01-15

Lens epithelial cells differentiate into lens fibers (LFs) in response to a fibroblast growth factor (FGF) gradient. This cell fate decision requires the transcription factor Prox1, which has been hypothesized to promote cell cycle exit in differentiating LF cells. However, we find that conditional deletion of Prox1 from mouse lenses results in a failure in LF differentiation despite maintenance of normal cell cycle exit. Instead, RNA-seq demonstrated that Prox1 functions as a global regulator of LF cell gene expression. Intriguingly, Prox1 also controls the expression of fibroblast growth factor receptors (FGFRs) and can bind to their promoters, correlating with decreased downstream signaling through MAPK and AKT in Prox1 mutant lenses. Further, culturing rat lens explants in FGF increased their expression of Prox1, and this was attenuated by the addition of inhibitors of MAPK. Together, these results describe a novel feedback loop required for lens differentiation and morphogenesis, whereby Prox1 and FGFR signaling interact to mediate LF differentiation in response to FGF. © 2016. Published by The Company of Biologists Ltd.

Tyrosine kinase oncogenes abrogate interleukin-3 dependence of murine myeloid cells through signaling pathways involving c-myc: conditional regulation of c-myc transcription by temperature-sensitive v-abl.

PubMed Central

Cleveland, J L; Dean, M; Rosenberg, N; Wang, J Y; Rapp, U R

1989-01-01

Retroviral expression vectors carrying the tyrosine kinase oncogenes abl, fms, src, and trk abrogate the requirements of murine myeloid FDC-P1 cells for interleukin-3 (IL-3). Factor-independent clones constitutively express c-myc in the absence of IL-3, whereas in parental cultures c-myc transcription requires the presence of the ligand. To directly test the effect of a tyrosine kinase oncogene on c-myc expression, retroviral constructs containing three different temperature-sensitive mutants of v-abl were introduced into myeloid IL-3-dependent FDC-P1 and 32D cells. At the permissive temperature, clones expressing temperature-sensitive abl behaved like wild-type abl-containing cells in their growth properties and expressed c-myc constitutively. Temperature shift experiments demonstrated that both IL-3 abrogation and the regulation of c-myc expression correlated with the presence of functional v-abl. Induction of c-myc expression by reactivation of temperature-sensitive v-abl mimicked c-myc induction by IL-3 in that it did not require protein synthesis and occurred at the level of transcription, with effects on both initiation and a transcription elongation block. However, v-abl-regulated FDC-P1 cell growth differed from IL-3-regulated growth in that c-fos and junB, which are normally induced by IL-3, were not induced by activation of v-abl. Images PMID:2555703

spiel ohne grenzen/pou2 is required during establishment of the zebrafish midbrain-hindbrain boundary organizer.

PubMed

Belting, H G; Hauptmann, G; Meyer, D; Abdelilah-Seyfried, S; Chitnis, A; Eschbach, C; Söll, I; Thisse, C; Thisse, B; Artinger, K B; Lunde, K; Driever, W

2001-11-01

The vertebrate midbrain-hindbrain boundary (MHB) organizes patterning and neuronal differentiation in the midbrain and anterior hindbrain. Formation of this organizing center involves multiple steps, including positioning of the MHB within the neural plate, establishment of the organizer and maintenance of its regional identity and signaling activities. Juxtaposition of the Otx2 and Gbx2 expression domains positions the MHB. How the positional information is translated into activation of Pax2, Wnt1 and Fgf8 expression during MHB establishment remains unclear. In zebrafish spiel ohne grenzen (spg) mutants, the MHB is not established, neither isthmus nor cerebellum form, the midbrain is reduced in size and patterning abnormalities develop within the hindbrain. In spg mutants, despite apparently normal expression of otx2, gbx1 and fgf8 during late gastrula stages, the initial expression of pax2.1, wnt1 and eng2, as well as later expression of fgf8 in the MHB primordium are reduced. We show that spg mutants have lesions in pou2, which encodes a POU-domain transcription factor. Maternal pou2 transcripts are distributed evenly in the blastula, and zygotic expression domains include the midbrain and hindbrain primordia during late gastrulation. Microinjection of pou2 mRNA can rescue pax2.1 and wnt1 expression in the MHB of spg/pou2 mutants without inducing ectopic expression. This indicates an essential but permissive role for pou2 during MHB establishment. pou2 is expressed normally in noi/pax2.1 and ace/fgf8 zebrafish mutants, which also form no MHB. Thus, expression of pou2 does not depend on fgf8 and pax2.1. Our data suggest that pou2 is required for the establishment of the normal expression domains of wnt1 and pax2.1 in the MHB primordium.

From the Cover: Interplay Between IFN-γ and IL-6 Impacts the Inflammatory Response and Expression of Interferon-Regulated Genes in Environmental-Induced Autoimmunity.

PubMed

Cauvi, David M; Cauvi, Gabrielle; Toomey, Christopher B; Jacquinet, Eric; Pollard, Kenneth Michael

2017-07-01

IFN-γ has been found to be robustly important to disease pathogenesis in both idiopathic and induced models of murine lupus. In transgenic mice, over production of IFN-γ in the skin results in an inflammatory response and autoimmunity. This suggests that localized exposure to environmental factors that induce autoimmunity may be associated with expression of an IFN-γ-dependent inflammatory response. Using murine mercury-induced autoimmunity (mHgIA), the severity of inflammation and proinflammatory cytokine expression, including the cellular source of IFN-γ, were assessed at the site of subcutaneous exposure and in secondary lymphoid organs. Exposure induced a localized chronic inflammation comprising both innate and adaptive immune cells but only CD8+ T and NK cells were reduced in the absence of IFN-γ. IFN-γ+ cells began to appear as early as day 1 and comprised both resident (γδ T) and infiltrating cells (CD8+ T, NKT, CD11c+). The requirements for inflammation were examined in mice deficient in genes required (Ifng, Il6) or not required (Casp1) for mHgIA. None of these genes were essential for induction of inflammation, however IFN-γ and IL-6 were required for exacerbation of other proinflammatory cytokines. Additionally, lack of IFN-γ or IL-6 impacted expression of genes regulated by either IFN-γ or type I IFN. Significantly, both IFN-γ and IL-6 were required for increased expression of IRF-1 which regulates IFN stimulated genes and is required for mHgIA. Thus IRF-1 may be at the nexus of the interplay between IFN-γ and IL-6 in exacerbating a xenobiotic-induced inflammatory response, regulation of interferon responsive genes and autoimmunity. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Human Immunodeficiency Virus Type 1 (HIV-1) Viral Protein R (Vpr)-Mediated Cell Cycle Arrest: An Analysis of Current Mechanistic Models

DTIC Science & Technology

2006-06-08

entices speculation on Vpr-mediated modulation of cellular stress responses. The major human small Hsp, HSP27 , represents an important point of...intersection for the two eukaryotic stress response mechanisms, i.e. HSF-mediated HSP expression induction and SAPK cascade activation. While HSP27 ...expression up-regulation requires HSF activation, functional activation of HSP27 requires MK2-catalyzed phosphorylation, and, therefore, p38 pathway

Reduced calcium/calmodulin-dependent protein kinase II activity in the hippocampus is associated with impaired cognitive function in MPTP-treated mice.

PubMed

Moriguchi, Shigeki; Yabuki, Yasushi; Fukunaga, Kohji

2012-02-01

Parkinson's disease (PD) patients frequently reveal deficit in cognitive functions during the early stage in PD. The dopaminergic neurotoxin, MPTP-induced neurodegeneration causes an injury of the basal ganglia and is associated with PD-like behaviors. In this study, we demonstrated that deficits in cognitive functions in MPTP-treated mice were associated with reduced calcium/calmodulin-dependent protein kinase II (CaMKII) autophosphorylation and impaired long-term potentiation (LTP) induction in the hippocampal CA1 region. Mice were injected once a day for 5days with MPTP (25mg/kg i.p.). The impaired motor coordination was observed 1 or 2week after MPTP treatment as assessed by rota-rod and beam-walking tasks. In immunoblotting analyses, the levels of tyrosine hydroxylase protein and CaMKII autophosphorylation in the striatum were significantly decreased 1week after MPTP treatment. By contrast, deficits of cognitive functions were observed 3-4weeks after MPTP treatment as assessed by novel object recognition and passive avoidance tasks but not Y-maze task. Impaired LTP in the hippocampal CA1 region was also observed in MPTP-treated mice. Concomitant with impaired LTP induction, CaMKII autophosphorylation was significantly decreased 3weeks after MPTP treatment in the hippocampal CA1 region. Finally, the reduced CaMKII autophosphorylation was closely associated with reduced AMPA-type glutamate receptor subunit 1 (GluR1; Ser-831) phosphorylation in the hippocampal CA1 region of MPTP-treated mice. Taken together, decreased CaMKII activity with concomitant impaired LTP induction in the hippocampus likely account for the learning disability observed in MPTP-treated mice. © 2011 The Authors. Journal of Neurochemistry © 2011 International Society for Neurochemistry.

Expression of MUC1 and MUC4 in gallbladder adenocarcinoma.

PubMed

Kim, Su-Mi; Oh, Sun-Ju; Hur, Bang

2012-10-01

Recent reports have indicated that overexpression of mucin (MUC) 1 and/or MUC4 correlates with the occurrence and progression of extra-hepatobiliary malignancy. In this study, we investigated the expression of MUC1 and MUC4 and their prognostic significance in gallbladder adenocarcinoma. We examined 54 surgical gallbladder adenocarcinoma samples by immunohistochemistry for MUC1 and MUC4 expression. Staining was evaluated as a sum score of extent and intensity, dividing the samples into low and high expression groups. The low expression group for both MUC1 and MUC4 was 10 samples (18.5%), and the high expression group was 44 samples (81.5%). High MUC1 expression was significantly correlated with more differentiated tumors (p=0.033), whereas high expression of MUC4 correlated with negative nodal status (p=0.012). Other pathological features were not correlated with MUC expression. Multivariate cox regression analysis showed that neither MUC1 nor MUC4 expression correlated with survival. Although there were some correlations found, a prognostic role for either MUC1 or MUC4 expression in gallbladder carcinoma was not identified in this study. Further investigation is required.

Phenylbutyrate ameliorates cognitive deficit and reduces tau pathology in an Alzheimer's disease mouse model.

PubMed

Ricobaraza, Ana; Cuadrado-Tejedor, Mar; Pérez-Mediavilla, Alberto; Frechilla, Diana; Del Río, Joaquin; García-Osta, Ana

2009-06-01

Chromatin modification through histone acetylation is a molecular pathway involved in the regulation of transcription underlying memory storage. Sodium 4-phenylbutyrate (4-PBA) is a well-known histone deacetylase inhibitor, which increases gene transcription of a number of genes, and also exerts neuroprotective effects. In this study, we report that administration of 4-PBA reversed spatial learning and memory deficits in an established mouse model of Alzheimer's disease (AD) without altering beta-amyloid burden. We also observed that the phosphorylated form of tau was decreased in the AD mouse brain after 4-PBA treatment, an effect probably due to an increase in the inactive form of the glycogen synthase kinase 3beta (GSK3beta). Interestingly, we found a dramatic decrease in brain histone acetylation in the transgenic mice that may reflect an indirect transcriptional repression underlying memory impairment. The administration of 4-PBA restored brain histone acetylation levels and, as a most likely consequence, activated the transcription of synaptic plasticity markers such as the GluR1 subunit of the AMPA receptor, PSD95, and microtubule-associated protein-2. The results suggest that 4-PBA, a drug already approved for clinical use, may provide a novel approach for the treatment of AD.

DIDO as a Switchboard that Regulates Self-Renewal and Differentiation in Embryonic Stem Cells.

PubMed

Fütterer, Agnes; de Celis, Jésus; Navajas, Rosana; Almonacid, Luis; Gutiérrez, Julio; Talavera-Gutiérrez, Amaia; Pacios-Bras, Cristina; Bernascone, Ilenia; Martin-Belmonte, Fernando; Martinéz-A, Carlos

2017-04-11

Transition from symmetric to asymmetric cell division requires precise coordination of differential gene expression. We show that embryonic stem cells (ESCs) mainly express DIDO3 and that their differentiation after leukemia inhibitory factor withdrawal requires DIDO1 expression. C-terminal truncation of DIDO3 (Dido3ΔCT) impedes ESC differentiation while retaining self-renewal; small hairpin RNA-Dido1 ESCs have the same phenotype. Dido3ΔCT ESC differentiation is rescued by ectopic expression of DIDO3, which binds the Dido locus via H3K4me3 and RNA POL II and induces DIDO1 expression. DIDO1, which is exported to cytoplasm, associates with, and is N-terminally phosphorylated by PKCiota. It binds the E3 ubiquitin ligase WWP2, which contributes to cell fate by OCT4 degradation, to allow expression of primitive endoderm (PE) markers. PE formation also depends on phosphorylated DIDO3 localization to centrosomes, which ensures their correct positioning for PE cell polarization. We propose that DIDO isoforms act as a switchboard that regulates genetic programs for ESC transition from pluripotency maintenance to promotion of differentiation. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Segmental expression of Hoxb2 in r4 requires two separate sites that integrate cooperative interactions between Prep1, Pbx and Hox proteins.

PubMed

Ferretti, E; Marshall, H; Pöpperl, H; Maconochie, M; Krumlauf, R; Blasi, F

2000-01-01

Direct auto- and cross-regulatory interactions between Hox genes serve to establish and maintain segmentally restricted patterns in the developing hindbrain. Rhombomere r4-specific expression of both Hoxb1 and Hoxb2 depends upon bipartite cis Hox response elements for the group 1 paralogous proteins, Hoxal and Hoxbl. The DNA-binding ability and selectivity of these proteins depend upon the formation of specific heterodimeric complexes with members of the PBC homeodomain protein family (Pbx genes). The r4 enhancers from Hoxb1 and Hoxb2 have the same activity, but differ with respect to the number and organisation of bipartite Pbx/Hox (PH) sites required, suggesting the intervention of other components/sequences. We report here that another family of homeodomain proteins (TALE, Three-Amino acids-Loop-Extension: Prep1, Meis, HTH), capable of dimerizing with Pbx/EXD, is involved in the mechanisms of r4-restricted expression. We show that: (1) the r4-specific Hoxb1 and Hoxb2 enhancers are complex elements containing separate PH and Prep/Meis (PM) sites; (2) the PM site of the Hoxb2, but not Hoxb1, enhancer is essential in vivo for r4 expression and also influences other sites of expression; (3) both PM and PH sites are required for in vitro binding of Prepl-Pbx and formation and binding of a ternary Hoxbl-Pbxla (or 1b)-Prepl complex. (4) A similar ternary association forms in nuclear extracts from embryonal P19 cells, but only upon retinoic acid induction. This requires synthesis of Hoxbl and also contains Pbx with either Prepl or Meisl. Together these findings highlight the fact that PM sites are found in close proximity to bipartite PH motifs in several Hox responsive elements shown to be important in vivo and that such sites play an essential role in potentiating regulatory activity in combination with the PH motifs.

Regulation of HIV-Gag Expression and Targeting to the Endolysosomal/Secretory Pathway by the Luminal Domain of Lysosomal-Associated Membrane Protein (LAMP-1) Enhance Gag-Specific Immune Response

PubMed Central

Lucas, Carolina Gonçalves de Oliveira; Rigato, Paula Ordonhez; Gonçalves, Jorge Luiz Santos; Sato, Maria Notomi; Maciel, Milton; Peçanha, Ligia Maria Torres; August, J. Thomas; de Azevedo Marques, Ernesto Torres; de Arruda, Luciana Barros

2014-01-01

We have previously demonstrated that a DNA vaccine encoding HIV-p55gag in association with the lysosomal associated membrane protein-1 (LAMP-1) elicited a greater Gag-specific immune response, in comparison to a DNA encoding the native gag. In vitro studies have also demonstrated that LAMP/Gag was highly expressed and was present in MHCII containing compartments in transfected cells. In this study, the mechanisms involved in these processes and the relative contributions of the increased expression and altered traffic for the enhanced immune response were addressed. Cells transfected with plasmid DNA constructs containing p55gag attached to truncated sequences of LAMP-1 showed that the increased expression of gag mRNA required p55gag in frame with at least 741 bp of the LAMP-1 luminal domain. LAMP luminal domain also showed to be essential for Gag traffic through lysosomes and, in this case, the whole sequence was required. Further analysis of the trafficking pathway of the intact LAMP/Gag chimera demonstrated that it was secreted, at least in part, associated with exosome-like vesicles. Immunization of mice with LAMP/gag chimeric plasmids demonstrated that high expression level alone can induce a substantial transient antibody response, but targeting of the antigen to the endolysosomal/secretory pathways was required for establishment of cellular and memory response. The intact LAMP/gag construct induced polyfunctional CD4+ T cell response, which presence at the time of immunization was required for CD8+ T cell priming. LAMP-mediated targeting to endolysosomal/secretory pathway is an important new mechanistic element in LAMP-mediated enhanced immunity with applications to the development of novel anti-HIV vaccines and to general vaccinology field. PMID:24932692

RIPK3 expression in cervical cancer cells is required for PolyIC-induced necroptosis, IL-1α release, and efficient paracrine dendritic cell activation.

PubMed

Schmidt, Susanne V; Seibert, Stefanie; Walch-Rückheim, Barbara; Vicinus, Benjamin; Kamionka, Eva-Maria; Pahne-Zeppenfeld, Jennifer; Solomayer, Erich-Franz; Kim, Yoo-Jin; Bohle, Rainer M; Smola, Sigrun

2015-04-20

Previous studies have shown that cervical cancer cells only release low levels of pro-inflammatory cytokines owing to infection with human papillomaviruses. This results in low immunogenicity of the cancer cells. The viral dsRNA analog PolyIC has been suggested as a promising adjuvant for cervical cancer immunotherapy. However, little is known about the molecular requirements resulting in successful immune activation. Here, we demonstrate that stimulation of cervical cancer cells with PolyIC induced necroptotic cell death, which was strictly dependent on the expression of the receptor-interacting protein kinase RIPK3. Necroptotic cancer cells released interleukin-1α (IL-1α), which was required for powerful activation of dendritic cells (DC) to produce IL-12, a cytokine critical for anti-tumor responses. Again both, IL-1α release and DC activation, were strictly dependent on RIPK3 expression in the tumor cells. Of note, our in situ analyses revealed heterogeneous RIPK3 expression patterns in cervical squamous cell carcinomas and adenocarcinomas. In summary, our study identified a novel RIPK3-dependent mechanism that explains how PolyIC-treatment of cervical cancer cells leads to potent DC activation. Our findings suggest that the RIPK3 expression status in cervical cancer cells might critically influence the outcome of PolyIC-based immunotherapeutic approaches and should therefore be assessed prior to immunotherapy.

Monocyte-lymphocyte fusion induced by the HIV-1 envelope generates functional heterokaryons with an activated monocyte-like phenotype

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martínez-Méndez, David; Rivera-Toledo, Evelyn; Ortega, Enrique

Enveloped viruses induce cell-cell fusion when infected cells expressing viral envelope proteins interact with target cells, or through the contact of cell-free viral particles with adjoining target cells. CD4{sup +} T lymphocytes and cells from the monocyte-macrophage lineage express receptors for HIV envelope protein. We have previously reported that lymphoid Jurkat T cells expressing the HIV-1 envelope protein (Env) can fuse with THP-1 monocytic cells, forming heterokaryons with a predominantly myeloid phenotype. This study shows that the expression of monocytic markers in heterokaryons is stable, whereas the expression of lymphoid markers is mostly lost. Like THP-1 cells, heterokaryons exhibited FcγR-dependentmore » phagocytic activity and showed an enhanced expression of the activation marker ICAM-1 upon stimulation with PMA. In addition, heterokaryons showed morphological changes compatible with maturation, and high expression of the differentiation marker CD11b in the absence of differentiation-inducing agents. No morphological change nor increase in CD11b expression were observed when an HIV-fusion inhibitor blocked fusion, or when THP-1 cells were cocultured with Jurkat cells expressing a non-fusogenic Env protein, showing that differentiation was not induced merely by cell-cell interaction but required cell-cell fusion. Inhibition of TLR2/TLR4 signaling by a TIRAP inhibitor greatly reduced the expression of CD11b in heterokaryons. Thus, lymphocyte-monocyte heterokaryons induced by HIV-1 Env are stable and functional, and fusion prompts a phenotype characteristic of activated monocytes via intracellular TLR2/TLR4 signaling. - Highlights: • Jurkat T cells expressing the HIV-1 envelope fuse with THP-1 monocytes. • Heterokaryons display a dominant myeloid phenotype and monocyte function. • Heterokaryons exhibit activation features in the absence of activation agents. • Activation is not due to cell-cell interaction but requires cell-cell fusion. • The activated monocyte-like phenotype is mediated by TLR2/TLR4 signaling.« less

Eomesodermin Promotes the Development of Type-1 Regulatory T (TR1) Cells

PubMed Central

Zhang, Ping; Lee, Jason S.; Gartlan, Kate H.; Schuster, Iona S; Comerford, Iain; Varelias, Antiopi; Ullah, Md Ashik; Vuckovic, Slavica; Koyama, Motoko; Kuns, Rachel D.; Locke, Kelly R.; Beckett, Kirrilee J.; Olver, Stuart D.; Samson, Luke D.; de Oca, Marcela Montes; de Labastida Rivera, Fabian; Clouston, Andrew D.; Belz, Gabrielle T.; Blazar, Bruce R.; MacDonald, Kelli P.; McColl, Shaun R.; Thomas, Ranjeny; Engwerda, Christian R.; Degli-Esposti, Mariapia A.; Kallies, Axel; Tey, Siok-Keen; Hill, Geoffrey R.

2017-01-01

Type-1 regulatory T (TR1) cells are Foxp3-negative IL-10-producing CD4+ T cells with potent immune suppressive properties but their requirements for lineage development have remained elusive. Here we show that TR1 cells constitute the most abundant regulatory population after allogeneic bone marrow transplantation (BMT), express the transcription factor Eomesodermin (Eomes) and are critical for the prevention of graft-versus-host disease (GVHD). We demonstrate that Eomes is required for TR1 cell differentiation during which it acts in concert with the transcription factor B-lymphocyte-induced maturation protein-1 (Blimp-1) by transcriptionally activating IL-10 expression and repressing differentiation into other Th lineages. We further show that Eomes induction in TR1 cells requires T-bet and donor macrophage-derived IL-27. We thus define the cellular and transcriptional control of TR1 cell differentiation during bone marrow transplantation, opening new avenues to therapeutic manipulation. PMID:28738016

Functional Genomic Screening Reveals Splicing of the EWS-FLI1 Fusion Transcript as a Vulnerability in Ewing Sarcoma.

PubMed

Grohar, Patrick J; Kim, Suntae; Rangel Rivera, Guillermo O; Sen, Nirmalya; Haddock, Sara; Harlow, Matt L; Maloney, Nichole K; Zhu, Jack; O'Neill, Maura; Jones, Tamara L; Huppi, Konrad; Grandin, Magdalena; Gehlhaus, Kristen; Klumpp-Thomas, Carleen A; Buehler, Eugen; Helman, Lee J; Martin, Scott E; Caplen, Natasha J

2016-01-26

Ewing sarcoma cells depend on the EWS-FLI1 fusion transcription factor for cell survival. Using an assay of EWS-FLI1 activity and genome-wide RNAi screening, we have identified proteins required for the processing of the EWS-FLI1 pre-mRNA. We show that Ewing sarcoma cells harboring a genomic breakpoint that retains exon 8 of EWSR1 require the RNA-binding protein HNRNPH1 to express in-frame EWS-FLI1. We also demonstrate the sensitivity of EWS-FLI1 fusion transcripts to the loss of function of the U2 snRNP component, SF3B1. Disrupted splicing of the EWS-FLI1 transcript alters EWS-FLI1 protein expression and EWS-FLI1-driven expression. Our results show that the processing of the EWS-FLI1 fusion RNA is a potentially targetable vulnerability in Ewing sarcoma cells. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Combinatorial Wnt control of zebrafish midbrain-hindbrain boundary formation.

PubMed

Buckles, Gerri R; Thorpe, Christopher J; Ramel, Marie-Christine; Lekven, Arne C

2004-05-01

Wnt signaling is known to be required for the normal development of the vertebrate midbrain and hindbrain, but genetic loss of function analyses in the mouse and zebrafish yield differing results regarding the relative importance of specific Wnt loci. In the zebrafish, Wnt1 and Wnt10b functionally overlap in their control of gene expression in the ventral midbrain-hindbrain boundary (MHB), but they are not required for the formation of the MHB constriction. Whether other wnt loci are involved in zebrafish MHB development is unclear, although the expression of at least two wnts, wnt3a and wnt8b, is maintained in wnt1/wnt10b mutants. In order to address the role of wnt3a in zebrafish, we have isolated a full length cDNA and examined its expression and function via knockdown by morpholino antisense oligonucleotide (MO)-mediated knockdown. The expression pattern of wnt3a appears to be evolutionarily conserved between zebrafish and mouse, and MO knockdown shows that Wnt3a, while not uniquely required for MHB development, is required in the absence of Wnt1 and Wnt10b for the formation of the MHB constriction. In zebrafish embryos lacking Wnt3a, Wnt1 and Wnt10b, the expression of engrailed orthologs, pax2a and fgf8 is not maintained after mid-somitogenesis. In contrast to acerebellar and no isthmus mutants, in which midbrain and hindbrain cells acquire new fates but cell number is not significantly affected until late in embryogenesis, zebrafish embryos lacking Wnt3a, Wnt1 and Wnt10b undergo extensive apoptosis in the midbrain and cerebellum anlagen beginning in mid-somitogenesis, which results in the absence of a significant portion of the midbrain and cerebellum. Thus, the requirement for Wnt signaling in forming the MHB constriction is evolutionarily conserved in vertebrates and it is possible in zebrafish to dissect the relative impact of multiple Wnt loci in midbrain and hindbrain development.

The Forkhead Transcription Factor FOXP2 Is Required for Regulation of p21WAF1/CIP1 in 143B Osteosarcoma Cell Growth Arrest.

PubMed

Gascoyne, Duncan M; Spearman, Hayley; Lyne, Linden; Puliyadi, Rathi; Perez-Alcantara, Marta; Coulton, Les; Fisher, Simon E; Croucher, Peter I; Banham, Alison H

2015-01-01

Mutations of the forkhead transcription factor FOXP2 gene have been implicated in inherited speech-and-language disorders, and specific Foxp2 expression patterns in neuronal populations and neuronal phenotypes arising from Foxp2 disruption have been described. However, molecular functions of FOXP2 are not completely understood. Here we report a requirement for FOXP2 in growth arrest of the osteosarcoma cell line 143B. We observed endogenous expression of this transcription factor both transiently in normally developing murine osteoblasts and constitutively in human SAOS-2 osteosarcoma cells blocked in early osteoblast development. Critically, we demonstrate that in 143B osteosarcoma cells with minimal endogenous expression, FOXP2 induced by growth arrest is required for up-regulation of p21WAF1/CIP1. Upon growth factor withdrawal, FOXP2 induction occurs rapidly and precedes p21WAF1/CIP1 activation. Additionally, FOXP2 expression could be induced by MAPK pathway inhibition in growth-arrested 143B cells, but not in traditional cell line models of osteoblast differentiation (MG-63, C2C12, MC3T3-E1). Our data are consistent with a model in which transient upregulation of Foxp2 in pre-osteoblast mesenchymal cells regulates a p21-dependent growth arrest checkpoint, which may have implications for normal mesenchymal and osteosarcoma biology.

The Forkhead Transcription Factor FOXP2 Is Required for Regulation of p21WAF1/CIP1 in 143B Osteosarcoma Cell Growth Arrest

PubMed Central

Gascoyne, Duncan M.; Spearman, Hayley; Lyne, Linden; Puliyadi, Rathi; Perez-Alcantara, Marta; Coulton, Les; Fisher, Simon E.; Croucher, Peter I.; Banham, Alison H.

2015-01-01

Mutations of the forkhead transcription factor FOXP2 gene have been implicated in inherited speech-and-language disorders, and specific Foxp2 expression patterns in neuronal populations and neuronal phenotypes arising from Foxp2 disruption have been described. However, molecular functions of FOXP2 are not completely understood. Here we report a requirement for FOXP2 in growth arrest of the osteosarcoma cell line 143B. We observed endogenous expression of this transcription factor both transiently in normally developing murine osteoblasts and constitutively in human SAOS-2 osteosarcoma cells blocked in early osteoblast development. Critically, we demonstrate that in 143B osteosarcoma cells with minimal endogenous expression, FOXP2 induced by growth arrest is required for up-regulation of p21WAF1/CIP1. Upon growth factor withdrawal, FOXP2 induction occurs rapidly and precedes p21WAF1/CIP1 activation. Additionally, FOXP2 expression could be induced by MAPK pathway inhibition in growth-arrested 143B cells, but not in traditional cell line models of osteoblast differentiation (MG-63, C2C12, MC3T3-E1). Our data are consistent with a model in which transient upregulation of Foxp2 in pre-osteoblast mesenchymal cells regulates a p21-dependent growth arrest checkpoint, which may have implications for normal mesenchymal and osteosarcoma biology. PMID:26034982

Increased levels of IAA are required for system 2 ethylene synthesis causing fruit softening in peach (Prunus persica L. Batsch)

PubMed Central

Tatsuki, Miho

2013-01-01

The fruit of melting-flesh peach (Prunus persica L. Batsch) cultivars produce high levels of ethylene caused by high expression of PpACS1 (an isogene of 1-aminocyclopropane-1-carboxylic acid synthase), resulting in rapid fruit softening at the late-ripening stage. In contrast, the fruit of stony hard peach cultivars do not soften and produce little ethylene due to low expression of PpACS1. To elucidate the mechanism for suppressing PpACS1 expression in stony hard peaches, a microarray analysis was performed. Several genes that displayed similar expression patterns as PpACS1 were identified and shown to be indole-3-acetic acid (IAA)-inducible genes (Aux/IAA, SAUR). That is, expression of IAA-inducible genes increased at the late-ripening stage in melting flesh peaches; however, these transcripts were low in mature fruit of stony hard peaches. The IAA concentration increased suddenly just before harvest time in melting flesh peaches exactly coinciding with system 2 ethylene production. In contrast, the IAA concentration did not increase in stony hard peaches. Application of 1-naphthalene acetic acid, a synthetic auxin, to stony hard peaches induced a high level of PpACS1 expression, a large amount of ethylene production and softening. Application of an anti-auxin, α-(phenylethyl-2-one)-IAA, to melting flesh peaches reduced levels of PpACS1 expression and ethylene production. These observations indicate that suppression of PpACS1 expression at the late-ripening stage of stony hard peach may result from a low level of IAA and that a high concentration of IAA is required to generate a large amount of system 2 ethylene in peaches. PMID:23364941

DOH1, a Class 1 knox Gene, Is Required for Maintenance of the Basic Plant Architecture and Floral Transition in Orchid

PubMed Central

Yu, Hao; Yang, Shu Hua; Goh, Chong Jin

2000-01-01

We report here the isolation and identification of an orchid homeobox gene, DOH1, from Dendrobium Madame Thong-In. Analyses of its sequence and genomic organization suggest that DOH1 may be the only class 1 knox gene in the genome. DOH1 mRNA accumulates in meristem-rich tissues, and its expression is greatly downregulated during floral transition. In situ hybridization analysis demonstrates that DOH1 is also expressed in the incipient leaf primordia and is later detected in the same region of the inflorescence apex, as in DOMADS1. Overexpression of DOH1 in orchid plants completely suppresses shoot organization and development. Transgenic orchid plants expressing antisense mRNA for DOH1 show multiple shoot apical meristem (SAM) formations and early flowering. In addition, both the sense and antisense transformants exhibit defects in leaf development. These findings suggest that DOH1 plays a key role in maintaining the basic plant architecture of orchid through control of the formation and development of the SAM and shoot structure. Investigations of DOMADS1 expression in the SAM during floral transition reveal that the precocious flowering phenotype exhibited by DOH1 antisense transformants is coupled with the early onset of DOMADS1 expression. This fact, together with the reciprocal expression of DOH1 and DOMADS1 during floral transition, indicates that downregulation of DOH1 in the SAM is required for floral transition in orchid and that DOH1 is a possible upstream regulator of DOMADS1. PMID:11090215

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murakami, Taro, E-mail: tamuraka@sgk.ac.jp; Yoshinaga, Mariko

Highlights: •Regulation of amino acid transporter expression in working muscle remains unclear. •Expression of amino acid transporters for leucine were induced by a bout of exercise. •Requirement of leucine in muscle cells might regulate expression of its transporters. •This information is beneficial for understanding the muscle remodeling by exercise. -- Abstract: We here investigated whether an acute bout of endurance exercise would induce the expression of amino acid transporters that regulate leucine transport across plasma and lysosomal membranes in rat skeletal muscle. Rats ran on a motor-driven treadmill at a speed of 28 m/min for 90 min. Immediately after themore » exercise, we observed that expression of mRNAs encoding L-type amino acid transporter 1 (LAT1) and CD98 was induced in the gastrocnemius, soleus, and extensor digitorum longus (EDL) muscles. Sodium-coupled neutral amino acid transporter 2 (SNAT2) mRNA was also induced by the exercise in those three muscles. Expression of proton-assisted amino acid transporter 1 (PAT1) mRNA was slightly but not significantly induced by a single bout of exercise in soleus and EDL muscles. Exercise-induced mRNA expression of these amino acid transporters appeared to be attenuated by repeated bouts of the exercise. These results suggested that the expression of amino acid transporters for leucine may be induced in response to an increase in the requirement for this amino acid in the cells of working skeletal muscles.« less

Hand2 loss-of-function in Hand1-expressing Cells Reveals Distinct Roles In Epicardial And Coronary Vessel Development

PubMed Central

Barnes, Ralston M.; Firulli, Beth A.; VanDusen, Nathan J.; Morikawa, Yuka; Conway, Simon J.; Cserjesi, Peter; Vincentz, Joshua W.; Firulli, Anthony B.

2011-01-01

Rationale The bHLH transcription factors Hand1 and Hand2 are essential for embryonic development. Given their requirement for cardiogenesis, it is imperative to determine their impact on cardiovascular function. Objective Deduce the role of Hand2 within the epicardium. Method & Results We engineered a Hand1 allele expressing Cre recombinase. Cardiac Hand1 expression is largely limited to cells of the primary heart field, overlapping little with Hand2 expression. Hand1 is expressed within the septum transversum (ST) and the Hand1-lineage marks the proepicardial organ and epicardium. To examine Hand factor functional overlap, we conditionally deleted Hand2 from Hand1-expressing cells. Hand2 mutants display defective epicardialization and fail to form coronary arteries, coincident with altered ECM deposition and Pdgfr expression. Conclusion These data demonstrate a hierarchal relationship whereby transient Hand1 ST expression defines epicardial precursors that are subsequently dependent upon Hand2 function. PMID:21350214

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srisuttee, Ratakorn; Koh, Sang Seok; Department of Functional Genomics, University of Science and Technology, Daejeon 305-333

Highlights: Black-Right-Pointing-Pointer Up-regulation of SIRT1 protein and activity sensitizes Hep3B-HBX cells to oxidative stress-induced apoptosis. Black-Right-Pointing-Pointer Nuclear localization of SIRT1 is not required for oxidation-induced apoptosis. Black-Right-Pointing-Pointer Ectopic expression and enhanced activity of SIRT1 attenuate JNK phosphorylation. Black-Right-Pointing-Pointer Inhibition of SIRT1 activity restores resistance to oxidation-induced apoptosis through JNK activation. -- Abstract: We previously showed that SIRT1 deacetylase inhibits proliferation of hepatocellular carcinoma cells expressing hepatitis B virus (HBV) X protein (HBX), by destabilization of {beta}-catenin. Here, we report another role for SIRT1 in HBX-mediated resistance to oxidative stress. Ectopic expression and enhanced activity of SIRT1 sensitize Hep3B cells stablymore » expressing HBX to oxidative stress-induced apoptosis. SIRT1 mutant analysis showed that nuclear localization of SIRT1 is not required for sensitization of oxidation-mediated apoptosis. Furthermore, ectopic expression of SIRT1 and treatment with resveratrol (a SIRT1 activator) attenuated JNK phosphorylation, which is a prerequisite for resistance to oxidative stress-induced apoptosis. Conversely, suppression of SIRT1 activity with nicotinamide inhibited the effect of resveratrol on JNK phosphorylation, leading to restoration of resistance to oxidation-induced apoptosis. Taken together, these results suggest that up-regulation of SIRT1 under oxidative stress may be a therapeutic strategy for treatment of hepatocellular carcinoma cells related to HBV through inhibition of JNK activation.« less

EFFECTIVE ACIDITY CONSTANT BEHAVIOR NEAR ZERO CHARGE CONDITIONS

EPA Science Inventory

Surface site (>SOH group) acidity reactions require expressions of the form: Ka = [>SOHn-1(z-1)]aH+EXP(-DG/RT)/[>SOHnz] (where all variables have their usual meaning). One can rearrange this expression to generate an effective acidity constant historically defined as: Qa = Ka...

TGF-β induction of FGF-2 expression in stromal cells requires integrated smad3 and MAPK pathways.

PubMed

Strand, Douglas W; Liang, Yao-Yun; Yang, Feng; Barron, David A; Ressler, Steven J; Schauer, Isaiah G; Feng, Xin-Hua; Rowley, David R

2014-01-01

Transforming Growth Factor-β (TGF-β) regulates the reactive stroma microenvironment associated with most carcinomas and mediates expression of many stromal derived factors important for tumor progression, including FGF-2 and CTGF. TGF-β is over-expressed in most carcinomas, and FGF-2 action is important in tumor-induced angiogenesis. The signaling mechanisms of how TGF-β regulates FGF-2 expression in the reactive stroma microenvironment are not understood. Accordingly, we have assessed key signaling pathways that mediate TGF-β1-induced FGF-2 expression in prostate stromal fibroblasts and mouse embryo fibroblasts (MEFs) null for Smad2 and Smad3. TGF-β1 induced phosphorylation of Smad2, Smad3, p38 and ERK1/2 proteins in both control MEFs and prostate fibroblasts. Of these, Smad3, but not Smad2 was found to be required for TGF-β1 induction of FGF-2 expression in stromal cells. ChIP analysis revealed a Smad3/Smad4 complex was associated with the -1.9 to -2.3 kb upstream proximal promoter of the FGF-2 gene, further suggesting a Smad3-specific regulation. In addition, chemical inhibition of p38 or ERK1/2 MAPK activity also blocked TGF-β1-induced FGF-2 expression in a Smad3-independent manner. Conversely, inhibition of JNK signaling enhanced FGF-2 expression. Together, these data indicate that expression of FGF-2 in fibroblasts in the tumor stromal cell microenvironment is coordinately dependent on both intact Smad3 and MAP kinase signaling pathways. These pathways and key downstream mediators of TGF-β action in the tumor reactive stroma microenvironment, may evolve as putative targets for therapeutic intervention.

Crosstalk between virulence loci: regulation of Salmonella enterica pathogenicity island 1 (SPI-1) by products of the std fimbrial operon.

PubMed

López-Garrido, Javier; Casadesús, Josep

2012-01-01

Invasion of intestinal epithelial cells is a critical step in Salmonella infection and requires the expression of genes located in Salmonella pathogenicity island 1 (SPI-1). A key factor for SPI-1 expression is DNA adenine (Dam) methylation, which activates synthesis of the SPI-1 transcriptional activator HilD. Dam-dependent regulation of hilD is postranscriptional (and therefore indirect), indicating the involvement of unknown cell functions under Dam methylation control. A genetic screen has identified the std fimbrial operon as the missing link between Dam methylation and SPI-1. We show that all genes in the std operon are part of a single transcriptional unit, and describe three previously uncharacterized ORFs (renamed stdD, stdE, and stdF). We present evidence that two such loci (stdE and stdF) are involved in Dam-dependent control of Salmonella SPI-1: in a Dam(-) background, deletion of stdE or stdF suppresses SPI-1 repression; in a Dam(+) background, constitutive expression of StdE and/or StdF represses SPI-1. Repression of SPI-1 by products of std operon explains the invasion defect of Salmonella Dam(-) mutants, which constitutively express the std operon. Dam-dependent repression of std in the ileum may be required to permit invasion, as indicated by two observations: constitutive expression of StdE and StdF reduces invasion of epithelial cells in vitro (1,000 fold) and attenuates Salmonella virulence in the mouse model (>60 fold). In turn, crosstalk between std and SPI-1 may play a role in intestinal infections by preventing expression of SPI-1 in the caecum, an intestinal compartment in which the std operon is known to be expressed.

The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.

PubMed

Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina

2004-12-03

The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.

In vivo regulation of Bcl6 and T follicular helper cell development1

PubMed Central

Poholek, Amanda C.; Hansen, Kyle; Hernandez, Sairy G.; Eto, Danelle; Chandele, Anmol; Weinstein, Jason S.; Dong, Xuemei; Odegard, Jared M.; Kaech, Susan M.; Dent, Alexander L.; Crotty, Shane; Craft, Joe

2010-01-01

Follicular helper T (TFH) cells, defined by expression of the surface markers CXCR5 and PD-1 and synthesis of IL-21, require upregulation of the transcriptional repressor Bcl6 for their development and function in B cell maturation in germinal centers. We have explored the role of B cells, and the cytokines IL-6 and IL-21, in the in vivo regulation of Bcl6 expression and TFH cell development. We found that TFH cells are characterized by a Bcl6-dependent downregulation of P-selectin glycoprotein ligand-1 (PSGL1, a CCL19- and CCL21-binding protein), indicating that, like CXCR5 and PD-1 upregulation, modulation of PSGL1 expression is part of the TFH cell program of differentiation. B cells were neither required for initial upregulation of Bcl6 nor PSGL1 downregulation, suggesting these events preceded T-B cell interactions, although they were required for full development of the TFH cell phenotype, including CXCR5 and PD-1 upregulation, and IL-21 synthesis. Bcl6 upregulation and TFH cell differentiation were independent of IL-6 and IL-21, revealing that either cytokine is not absolutely required for development of Bcl6+ TFH cells in vivo. These data increase our understanding of Bcl6 regulation in TFH cells and their differentiation in vivo, and identifies a new surface marker that may be functionally relevant in this subset. PMID:20519643

Spatially Restricted and Developmentally Dynamic Expression of Engrailed Genes in Multiple Cerebellar Cell Types

PubMed Central

Wilson, Sandra L.; Kalinovsky, Anna; Orvis, Grant D.

2011-01-01

The cerebellum is a highly organized structure partitioned into lobules along the anterior–posterior (A-P) axis and into striped molecular domains along the medial–lateral (M-L) axis. The Engrailed (En) homeobox genes are required for patterning the morphological and molecular domains along both axes, as well as for the establishment of the normal afferent topography required to generate a fully functional cerebellum. As a means to understand how the En genes regulate multiple levels of cerebellum construction, we characterized En1 and En2 expression around birth and at postnatal day (P)21 during the period when the cerebellum undergoes a remarkable transformation from a smooth ovoid structure to a highly foliated structure. We show that both En1 and En2 are expressed in many neuronal cell types in the cerebellum, and expression persists until at least P21. En1 and En2 expression, however, undergoes profound changes in their cellular and spatial distributions between embryonic stages and P21, and their expression domains become largely distinct. Comparison of the distribution of En-expressing Purkinje cells relative to early- and late-onset Purkinje cell M-L stripe proteins revealed that although En1- and En2-expressing Purkinje cell domains do not strictly align with those of ZEBRINII at P21, a clear pattern exists that is most evident at E17.5 by an inverse correlation between the level of En2 expression and PLCβ4 and EPHA4. PMID:21431469

The mRNA cap-binding protein Cbc1 is required for high and timely expression of genes by promoting the accumulation of gene-specific activators at promoters.

PubMed

Li, Tianlu; De Clercq, Nikki; Medina, Daniel A; Garre, Elena; Sunnerhagen, Per; Pérez-Ortín, José E; Alepuz, Paula

2016-02-01

The highly conserved Saccharomyces cerevisiae cap-binding protein Cbc1/Sto1 binds mRNA co-transcriptionally and acts as a key coordinator of mRNA fate. Recently, Cbc1 has also been implicated in transcription elongation and pre-initiation complex (PIC) formation. Previously, we described Cbc1 to be required for cell growth under osmotic stress and to mediate osmostress-induced translation reprogramming. Here, we observe delayed global transcription kinetics in cbc1Δ during osmotic stress that correlates with delayed recruitment of TBP and RNA polymerase II to osmo-induced promoters. Interestingly, we detect an interaction between Cbc1 and the MAPK Hog1, which controls most gene expression changes during osmostress, and observe that deletion of CBC1 delays the accumulation of the activator complex Hot1-Hog1 at osmostress promoters. Additionally, CBC1 deletion specifically reduces transcription rates of highly transcribed genes under non-stress conditions, such as ribosomal protein (RP) genes, while having low impact on transcription of weakly expressed genes. For RP genes, we show that recruitment of the specific activator Rap1, and subsequently TBP, to promoters is Cbc1-dependent. Altogether, our results indicate that binding of Cbc1 to the capped mRNAs is necessary for the accumulation of specific activators as well as PIC components at the promoters of genes whose expression requires high and rapid transcription. Copyright © 2016 Elsevier B.V. All rights reserved.

Differences in E-Cadherin and Syndecan-1 Expression in Different Types of Ameloblastomas

PubMed Central

López-Verdín, Sandra; Pereira-Prado, Vanesa

2018-01-01

Ameloblastomas are a group of benign, locally aggressive, recurrent tumors characterized by their slow and infiltrative growth. E-Cadherin and syndecan-1 are cell adhesion molecules related to the behavior of various tumors, including ameloblastomas. Ninety-nine ameloblastoma samples were studied; the expression of E-cadherin and syndecan-1 were evaluated by immunohistochemistry. E-Cadherin and epithelial syndecan-1 were more highly expressed in intraluminal/luminal unicystic ameloblastoma than in mural unicystic ameloblastoma and solid/multicystic ameloblastoma, whereas the stromal expression of syndecan-1 was higher in mural unicystic ameloblastoma and solid/multicystic ameloblastoma. Synchronicity was observed between E-cadherin and epithelial syndecan-1; the expression was correlated with intensity in all cases. There was a strong association between expression and tumor size and recurrence. The evaluation of the expression of E-cadherin and syndecan-1 are important for determining the potential aggressiveness of ameloblastoma variants. Future studies are required to understand how the expression of these markers is related to tumor aggressiveness.

Zebrafish Lmx1b.1 and Lmx1b.2 are required for maintenance of the isthmic organizer.

PubMed

O'Hara, F Patrick; Beck, Ernestine; Barr, Lauren K; Wong, Lily L; Kessler, Daniel S; Riddle, Robert D

2005-07-01

The mesencephalic and metencephalic region (MMR) of the vertebrate central nervous system develops in response to signals produced by the isthmic organizer (IsO). We have previously reported that the LIM homeobox transcription factor Lmx1b is expressed within the chick IsO, where it is sufficient to maintain expression of the secreted factor wnt1. In this paper, we show that zebrafish express two Lmx1b orthologs, lmx1b.1 and lmx1b.2, in the rostral IsO, and demonstrate that these genes are necessary for key aspects of MMR development. Simultaneous knockdown of Lmx1b.1 and Lmx1b.2 using morpholino antisense oligos results in a loss of wnt1, wnt3a, wnt10b, pax8 and fgf8 expression at the IsO, leading ultimately to programmed cell death and the loss of the isthmic constriction and cerebellum. Single morpholino knockdown of either Lmx1b.1 or Lmx1b.2 has no discernible effect on MMR development. Maintenance of lmx1b.1 and lmx1b.2 expression at the isthmus requires the function of no isthmus/pax2.1, as well as Fgf signaling. Transient misexpression of Lmx1b.1 or Lmx1b.2 during early MMR development induces ectopic wnt1 and fgf8 expression in the MMR, as well as throughout much of the embryo. We propose that Lmx1b.1- and Lmx1b.2-mediated regulation of wnt1, wnt3a, wnt10b, pax8 and fgf8 maintains cell survival in the isthmocerebellar region.

Neuropeptide Receptors NPR-1 and NPR-2 Regulate Caenorhabditis elegans Avoidance Response to the Plant Stress Hormone Methyl Salicylate

PubMed Central

Luo, Jintao; Xu, Zhaofa; Tan, Zhiping; Zhang, Zhuohua; Ma, Long

2015-01-01

Methyl salicylate (MeSa) is a stress hormone released by plants under attack by pathogens or herbivores . MeSa has been shown to attract predatory insects of herbivores and repel pests. The molecules and neurons underlying animal response to MeSa are not known. Here we found that the nematode Caenorhabditis elegans exhibits a strong avoidance response to MeSa, which requires the activities of two closely related neuropeptide receptors NPR-1 and NPR-2. Molecular analyses suggest that NPR-1 expressed in the RMG inter/motor neurons is required for MeSa avoidance. An NPR-1 ligand FLP-18 is also required. Using a rescuing npr-2 promoter to drive a GFP transgene, we identified that NPR-2 is expressed in multiple sensory and interneurons. Genetic rescue experiments suggest that NPR-2 expressed in the AIZ interneurons is required for MeSa avoidance. We also provide evidence that the AWB sensory neurons might act upstream of RMGs and AIZs to detect MeSa. Our results suggest that NPR-2 has an important role in regulating animal behavior and that NPR-1 and NPR-2 act on distinct interneurons to affect C. elegans avoidance response to MeSa. PMID:25527285

Steroid synthesis by primary human keratinocytes; implications for skin disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk; Michael, Anthony E.; Jaulim, Adil

2011-01-07

Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary humanmore » keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data show that PHK are capable of extra-adrenal cortisol synthesis, which could be a fundamental pathway in skin biology with implications in psoriasis and atopic dermatitis.« less

Fgf8 expression in the Tbx1 domain causes skeletal abnormalities and modifies the aortic arch but not the outflow tract phenotype of Tbx1 mutants

PubMed Central

Vitelli, Francesca; Zhang, Zhen; Huynh, Tuong; Sobotka, Angela; Mupo, Annalisa; Baldini, Antonio

2007-01-01

Fgf8 and Tbx1 have been shown to interact in patterning the aortic arch, and both genes are required in formation and growth of the outflow tract of the heart. However, the nature of the interaction of the two genes is unclear. We have utilized a novel Tbx1Fgf8 allele which drives Fgf8 expression in Tbx1-positive cells and an inducible Cre-LoxP recombination system to address the role of Fgf8 in Tbx1 positive cells in modulating cardiovascular development. Results support a requirement of Fgf8 in Tbx1 expressing cells to finely control patterning of the aortic arch and great arteries specifically during the pharyngeal arch artery remodeling process and indicate that the endoderm is the most likely site of this interaction. Furthermore, our data suggest that Fgf8 and Tbx1 play independent roles in regulating outflow tract development. This finding is clinically relevant since TBX1 is the candidate for DGS/VCFS, characterized clinically by variable expressivity and reduced penetrance of cardiovascular defects; Fgf8 gene variants may provide molecular clues to this variability. PMID:16696966

Deletion of the Ttf1 gene in differentiated neurons disrupts female reproduction without impairing basal ganglia function.

PubMed

Mastronardi, Claudio; Smiley, Gregory G; Raber, Jacob; Kusakabe, Takashi; Kawaguchi, Akio; Matagne, Valerie; Dietzel, Anja; Heger, Sabine; Mungenast, Alison E; Cabrera, Ricardo; Kimura, Shioko; Ojeda, Sergio R

2006-12-20

Thyroid transcription factor 1 (TTF1) [also known as Nkx2.1 (related to the NK-2 class of homeobox genes) and T/ebp (thyroid-specific enhancer-binding protein)], a homeodomain gene required for basal forebrain morphogenesis, remains expressed in the hypothalamus after birth, suggesting a role in neuroendocrine function. Here, we show an involvement of TTF1 in the control of mammalian puberty and adult reproductive function. Gene expression profiling of the nonhuman primate hypothalamus revealed that TTF1 expression increases at puberty. Mice in which the Ttf1 gene was ablated from differentiated neurons grew normally and had normal basal ganglia/hypothalamic morphology but exhibited delayed puberty, reduced reproductive capacity, and a short reproductive span. These defects were associated with reduced hypothalamic expression of genes required for sexual development and deregulation of a gene involved in restraining puberty. No extrapyramidal impairments associated with basal ganglia dysfunction were apparent. Thus, although TTF1 appears to fulfill only a morphogenic function in the ventral telencephalon, once this function is satisfied in the hypothalamus, TTF1 remains active as part of the transcriptional machinery controlling female sexual development.

Expression of Notch pathway genes in mammalian epidermis and modulation by beta-catenin.

PubMed

Ambler, Carrie A; Watt, Fiona M

2007-06-01

The Notch pathway is required for hair follicle maintenance and is activated through beta-catenin induced transcription of the Notch ligand Jagged1. We show that hair follicles in the resting phase express low levels of Jagged1 and Hes1, and other Notch target genes are undetectable. In growing (anagen) follicles, Jagged1 and Hes1 expression increases, Hes5 and HeyL are expressed in distinct cell layers, and Hey2 is expressed in the dermal papilla. When beta-catenin is activated by means of an inducible transgene, Jagged1, Hes1, Hes5, HeyL, and Hey2 are up-regulated, the sites of expression being the same in beta-catenin induced ectopic follicles as in anagen follicles. beta-Catenin also induces Hey1 in dermal papilla cells. beta-Catenin-induced up-regulation of Jagged1 precedes induction of other Notch target genes. The different sites of expression of Hes and Hey genes suggest input from additional signaling pathways. Copyright 2007 Wiley-Liss, Inc.

Histone deacetylase 1 is required for the development of the zebrafish inner ear

PubMed Central

He, Yingzi; Tang, Dongmei; Li, Wenyan; Chai, Renjie; Li, Huawei

2016-01-01

Histone deacetylase 1 (HDAC1) has been reported to be important for multiple aspects of normal embryonic development, but little is known about its function in the development of mechanosensory organs. Here, we first confirmed that HDAC1 is expressed in the developing otic vesicles of zebrafish by whole-mount in situ hybridization. Knockdown of HDAC1 using antisense morpholino oligonucleotides in zebrafish embryos induced smaller otic vesicles, abnormal otoliths, malformed or absent semicircular canals, and fewer sensory hair cells. HDAC1 loss of function also caused attenuated expression of a subset of key genes required for otic vesicle formation during development. Morpholino-mediated knockdown of HDAC1 resulted in decreased expression of members of the Fgf family in the otic vesicles, suggesting that HDAC1 is involved in the development of the inner ear through regulation of Fgf signaling pathways. Taken together, our results indicate that HDAC1 plays an important role in otic vesicle formation. PMID:26832938

Genetic Control of Seed Shattering in Rice by the APETALA2 Transcription Factor SHATTERING ABORTION1[C][W][OA

PubMed Central

Zhou, Yan; Lu, Danfeng; Li, Canyang; Luo, Jianghong; Zhu, Bo-Feng; Zhu, Jingjie; Shangguan, Yingying; Wang, Zixuan; Sang, Tao; Zhou, Bo; Han, Bin

2012-01-01

Seed shattering is an important agricultural trait in crop domestication. SH4 (for grain shattering quantitative trait locus on chromosome 4) and qSH1 (for quantitative trait locus of seed shattering on chromosome 1) genes have been identified as required for reduced seed shattering during rice (Oryza sativa) domestication. However, the regulatory pathways of seed shattering in rice remain unknown. Here, we identified a seed shattering abortion1 (shat1) mutant in a wild rice introgression line. The SHAT1 gene, which encodes an APETALA2 transcription factor, is required for seed shattering through specifying abscission zone (AZ) development in rice. Genetic analyses revealed that the expression of SHAT1 in AZ was positively regulated by the trihelix transcription factor SH4. We also identified a frameshift mutant of SH4 that completely eliminated AZs and showed nonshattering. Our results suggest a genetic model in which the persistent and concentrated expression of active SHAT1 and SH4 in the AZ during early spikelet developmental stages is required for conferring AZ identification. qSH1 functioned downstream of SHAT1 and SH4, through maintaining SHAT1 and SH4 expression in AZ, thus promoting AZ differentiation. PMID:22408071

Mesodermal expression of the C. elegans HMX homolog mls-2 requires the PBC homolog CEH-20

PubMed Central

Jiang, Yuan; Shi, Herong; Amin, Nirav M.; Sultan, Ibrahim; Liu, Jun

2008-01-01

Metazoan development proceeds primarily through the regulated expression of genes encoding transcription factors and components of cell signaling pathways. One way to decipher the complex developmental programs is to assemble the underlying gene regulatory networks by dissecting the cis-regulatory modules that direct temporal-spatial expression of developmental genes and identify corresponding trans-regulatory factors. Here, we focus on the regulation of a HMX homoebox gene called mls-2, which functions at the intersection of a network that regulates cleavage orientation, cell proliferation and fate specification in the C. elegans postembryonic mesoderm. In addition to its transient expression in the postembryonic mesodermal lineage, the M lineage, mls-2 expression is detected in a subset of embryonic cells, in three pairs of head neurons and transiently in the somatic gonad. Through mutational analysis of the mls-2 promoter, we identified two elements (E1 and E2) involved in regulating the temporal-spatial expression of mls-2. In particular, we showed that one of the elements (E1) required for mls-2 expression in the M lineage contains two critical putative PBC-Hox binding sites that are evolutionarily conserved in C. briggsae and C. remanei. Furthermore, the C. elegans PBC homolog CEH-20 is required for mls-2 expression in the M lineage. Our data suggests that mls-2 might be a direct target of CEH-20 in the M lineage and that the regulation of CEH-20 on mls-2 is likely Hox-independent. PMID:18316179

Transcriptional cosuppression of yeast Ty1 retrotransposons

PubMed Central

Jiang, Yi Wei

2002-01-01

Cosuppression, the silencing of dispersed homologous genes triggered by high copy number, may have evolved in eukaryotic organisms to control molecular parasites such as viruses and transposons. Ty1 retrotransposons are dispersed gene repeats in Saccharomyces cerevisiae, where no cosuppression has been previously observed. Ty1 elements are seemingly expressed undeterred to a level as high as 10% of total mRNA. Using Ty1–URA3 reporters and negative selection with 5-fluoroorotic acid, it is shown that Ty1 genes can undergo transcriptional cosuppression that is independent of DNA methylation and polycomb-mediated repression. Expression of Ty1-related genes was shown to be in one of two states, the coexpressed state with all Ty1-related genes transcribed or the cosuppressed state with all Ty1-related genes shut off, without uncoordinated or mosaic expression in any individual cell. Rapid switches between the two states were observed. A high copy number of Ty1 elements was shown to be required for the initiation of Ty1 homology-dependent gene silencing, implying that Ty1 gene expression is under negative feedback control. Ty1 transcriptional repressors facilitated the onset of Ty1 cosuppression, and the native Ty1 promoters were required for Ty1 cosuppression, indicating that Ty1 cosuppression occurs at the transcriptional level. PMID:11850409

Phosphate and calcium are required for TGFbeta-mediated stimulation of ANK expression and function during chondrogenesis.

PubMed

Oca, Paulina; Zaka, Raihana; Dion, Arnold S; Freeman, Theresa A; Williams, Charlene J

2010-08-01

The expression of ANK, a key player in biomineralization, is stimulated by treatment with TGFbeta. The purpose of this study was to determine whether TGFbeta stimulation of ANK expression during chondrogenesis was dependent upon the influx of calcium and phosphate into cells. Treatment of ATDC5 cells with TGFbeta increased ANK expression during all phases of chondrogenic differentiation, particularly at day 14 (proliferation) and day 32 (mineralizing hypertrophy) of culture. Phosphate uptake studies in the presence and absence of phosphonoformic acid (PFA), a competitive inhibitor of the type III Na(+)/Pi channels Pit-1 and Pit-2, indicated that the stimulation of ANK expression by TGFbeta required the influx of phosphate, specifically by the Pit-1 transporter, at all phases of differentiation. At hypertrophy, when alkaline phosphatase is highly expressed, inhibition of its activity with levamisole also abrogated the stimulatory effect of TGFbeta on ANK expression, further illustrating that Pi availability and uptake by the cells is necessary for stimulation of ANK expression in response to TGFbeta. Since previous studies of endochondral ossification in the growth plate have shown that L-type calcium channels are essential for chondrogenesis, we investigated their role in the TGFbeta-stimulated ANK response in ATDC5 cells. Treatment with nifedipine to inhibit calcium influx via the L-type channel Cav1.2 (alpha(1C)) inhibited the TGFbeta stimulated increase in ANK expression at all phases of chondrogenesis. Our findings indicate that TGFbeta stimulation of ANK expression is dependent upon the influx of phosphate and calcium into ATDC5 cells at all stages of differentiation.

Combinatorial regulation of a Blimp1 (Prdm1) enhancer in the mouse retina

PubMed Central

Mills, Taylor S.; Eliseeva, Tatiana; Bersie, Stephanie M.; Randazzo, Grace; Nahreini, Jhenya; Park, Ko Uoon

2017-01-01

The mouse retina comprises seven major cell types that exist in differing proportions. They are generated from multipotent progenitors in a stochastic manner, such that the relative frequency of any given type generated changes over time. The mechanisms determining the proportions of each cell type are only partially understood. Photoreceptors and bipolar interneurons are derived from cells that express Otx2. Within this population, Blimp1 (Prdm1) helps set the balance between photoreceptors and bipolar cells by suppressing bipolar identity in most of the cells. How only a subset of these Otx2+ cells decides to upregulate Blimp1 and adopt photoreceptor fate is unknown. To understand this, we investigated how Blimp1 transcription is regulated. We identified several potential Blimp1 retinal enhancer elements using DNase hypersensitivity sequencing. Only one of the elements recapitulated Blimp1 spatial and temporal expression in cultured explant assays and within the retinas of transgenic mice. Mutagenesis of this retinal Blimp1 enhancer element revealed four discrete sequences that were each required for its activity. These included highly conserved Otx2 and ROR (retinoic acid receptor related orphan receptor) binding sites. The other required sequences do not appear to be controlled by Otx2 or ROR factors, increasing the complexity of the Blimp1 gene regulatory network. Our results show that the intersection of three or more transcription factors is required to correctly regulate the spatial and temporal features of Blimp1 enhancer expression. This explains how Blimp1 expression can diverge from Otx2 and set the balance between photoreceptor and bipolar fates. PMID:28829770

PHYTOCHROME KINASE SUBSTRATE1 Regulates Root Phototropism and Gravitropism1[C][W][OA

PubMed Central

Boccalandro, Hernán E.; De Simone, Silvia N.; Bergmann-Honsberger, Ariane; Schepens, Isabelle; Fankhauser, Christian; Casal, Jorge J.

2008-01-01

Light promotes the expression of PHYTOCHROME KINASE SUBSTRATE1 (PKS1) in the root of Arabidopsis thaliana, but the function of PKS1 in this organ is unknown. Unilateral blue light induced a negative root phototropic response mediated by phototropin 1 in wild-type seedlings. This response was absent in pks1 mutants. In the wild type, unilateral blue light enhanced PKS1 expression in the subapical region of the root several hours before bending was detectable. The negative phototropism and the enhanced PKS1 expression in response to blue light required phytochrome A (phyA). In addition, the pks1 mutation enhanced the root gravitropic response when vertically oriented seedlings were placed horizontally. The negative regulation of gravitropism by PKS1 occurred even in dark-grown seedlings and did not require phyA. Blue light also failed to induce negative phototropism in pks1 under reduced gravitational stimulation, indicating that the effect of pks1 on phototropism is not simply the consequence of the counteracting effect of enhanced gravitropism. We propose a model where the background level of PKS1 reduces gravitropism. After a phyA-dependent increase in its expression, PKS1 positively affects root phototropism and both effects contribute to negative curvature in response to unilateral blue light. PMID:18024556

Identification of functional domains of the IR2 protein of equine herpesvirus 1 required for inhibition of viral gene expression and replication

PubMed Central

Kim, Seong K.; Kim, Seongman; Dai, Gan; Zhang, Yunfei; Ahn, Byung C.; O'Callaghan, Dennis J.

2012-01-01

The equine herpesvirus 1 (EHV-1) negative regulatory IR2 protein (IR2P), an early 1,165-amino acid (aa) truncated form of the 1,487-aa immediate-early protein (IEP), lacks the trans-activation domain essential for IEP activation functions but retains domains for binding DNA, TFIIB, and TBP and the nuclear localization signal. IR2P mutants of the N-terminal region which lack either DNA-binding activity or TFIIB-binding activity were unable to down-regulate EHV-1 promoters. In EHV-1-infected cells expressing full-length IR2P, transcription and protein expression of viral regulatory IE, early EICP0, IR4, and UL5, and late ETIF genes were dramatically inhibited. Viral DNA levels were reduced to 2.1% of control infected cells, but were vey weakly affected in cells that express the N-terminal 706 residues of IR2P. These results suggest that IR2P function requires the two N-terminal domains for binding DNA and TFIIB as well as the C-terminal residues 707 to 1116 containing the TBP-binding domain. PMID:21794889

Functional expression of a heterologous nickel-dependent, ATP-independent urease in Saccharomyces cerevisiae.

PubMed

Milne, N; Luttik, M A H; Cueto Rojas, H F; Wahl, A; van Maris, A J A; Pronk, J T; Daran, J M

2015-07-01

In microbial processes for production of proteins, biomass and nitrogen-containing commodity chemicals, ATP requirements for nitrogen assimilation affect product yields on the energy producing substrate. In Saccharomyces cerevisiae, a current host for heterologous protein production and potential platform for production of nitrogen-containing chemicals, uptake and assimilation of ammonium requires 1 ATP per incorporated NH3. Urea assimilation by this yeast is more energy efficient but still requires 0.5 ATP per NH3 produced. To decrease ATP costs for nitrogen assimilation, the S. cerevisiae gene encoding ATP-dependent urease (DUR1,2) was replaced by a Schizosaccharomyces pombe gene encoding ATP-independent urease (ure2), along with its accessory genes ureD, ureF and ureG. Since S. pombe ure2 is a Ni(2+)-dependent enzyme and Saccharomyces cerevisiae does not express native Ni(2+)-dependent enzymes, the S. pombe high-affinity nickel-transporter gene (nic1) was also expressed. Expression of the S. pombe genes into dur1,2Δ S. cerevisiae yielded an in vitro ATP-independent urease activity of 0.44±0.01 µmol min(-1) mg protein(-1) and restored growth on urea as sole nitrogen source. Functional expression of the Nic1 transporter was essential for growth on urea at low Ni(2+) concentrations. The maximum specific growth rates of the engineered strain on urea and ammonium were lower than those of a DUR1,2 reference strain. In glucose-limited chemostat cultures with urea as nitrogen source, the engineered strain exhibited an increased release of ammonia and reduced nitrogen content of the biomass. Our results indicate a new strategy for improving yeast-based production of nitrogen-containing chemicals and demonstrate that Ni(2+)-dependent enzymes can be functionally expressed in S. cerevisiae. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

XoxF Is Required for Expression of Methanol Dehydrogenase in Methylobacterium extorquens AM1 ▿

PubMed Central

Skovran, Elizabeth; Palmer, Alexander D.; Rountree, Austin M.; Good, Nathan M.; Lidstrom, Mary E.

2011-01-01

In Gram-negative methylotrophic bacteria, the first step in methylotrophic growth is the oxidation of methanol to formaldehyde in the periplasm by methanol dehydrogenase. In most organisms studied to date, this enzyme consists of the MxaF and MxaI proteins, which make up the large and small subunits of this heterotetrameric enzyme. The Methylobacterium extorquens AM1 genome contains two homologs of MxaF, XoxF1 and XoxF2, which are ∼50% identical to MxaF and ∼90% identical to each other. It was previously reported that xoxF is not required for methanol growth in M. extorquens AM1, but here we show that when both xoxF homologs are absent, strains are unable to grow in methanol medium and lack methanol dehydrogenase activity. We demonstrate that these defects result from the loss of gene expression from the mxa promoter and suggest that XoxF is part of a complex regulatory cascade involving the 2-component systems MxcQE and MxbDM, which are required for the expression of the methanol dehydrogenase genes. PMID:21873495

Leptin and Pro-Inflammatory Stimuli Synergistically Upregulate MMP-1 and MMP-3 Secretion in Human Gingival Fibroblasts.

PubMed

Williams, Rachel C; Skelton, Andrew J; Todryk, Stephen M; Rowan, Andrew D; Preshaw, Philip M; Taylor, John J

2016-01-01

Gingival fibroblast-mediated extracellular matrix remodelling is implicated in the pathogenesis of periodontitis, yet the stimuli that regulate this response are not fully understood. The immunoregulatory adipokine leptin is detectable in the gingiva, human gingival fibroblasts express functional leptin receptor mRNA and leptin is known to regulate extracellular matrix remodelling responses in cardiac fibroblasts. We therefore hypothesised that leptin would enhance matrix metalloproteinase secretion in human gingival fibroblasts. We used in vitro cell culture to investigate leptin signalling and the effect of leptin on mRNA and protein expression in human gingival fibroblasts. We confirmed human gingival fibroblasts expressed cell surface leptin receptor, found leptin increased matrix metalloproteinase-1, -3, -8 and -14 expression in human gingival fibroblasts compared to unstimulated cells, and observed that leptin stimulation activated MAPK, STAT1/3 and Akt signalling in human gingival fibroblasts. Furthermore, leptin synergised with IL-1 or the TLR2 agonist pam2CSK4 to markedly enhance matrix metalloproteinase-1 and -3 production by human gingival fibroblasts. Signalling pathway inhibition demonstrated ERK was required for leptin-stimulated matrix metalloproteinase-1 expression in human gingival fibroblasts; whilst ERK, JNK, p38 and STAT3 were required for leptin+IL-1- and leptin+pam2CSK4-induced matrix metalloproteinase-1 expression. A genome-wide expression array and gene ontology analysis confirmed genes differentially expressed in leptin+IL-1-stimulated human gingival fibroblasts (compared to unstimulated cells) were enriched for extracellular matrix organisation and disassembly, and revealed that matrix metalloproteinase-8 and -12 were also synergistically upregulated by leptin+IL-1 in human gingival fibroblasts. We conclude that leptin selectively enhances the expression and secretion of certain matrix metalloproteinases in human gingival fibroblasts, and suggest that gingival fibroblasts may have an ECM-degrading phenotype during conditions of hyperleptinaemia (e.g., obesity, type 2 diabetes mellitus, exogenous leptin therapy).

Leptin and Pro-Inflammatory Stimuli Synergistically Upregulate MMP-1 and MMP-3 Secretion in Human Gingival Fibroblasts

PubMed Central

Williams, Rachel C.; Skelton, Andrew J.; Todryk, Stephen M.; Rowan, Andrew D.; Preshaw, Philip M.; Taylor, John J.

2016-01-01

Introduction Gingival fibroblast-mediated extracellular matrix remodelling is implicated in the pathogenesis of periodontitis, yet the stimuli that regulate this response are not fully understood. The immunoregulatory adipokine leptin is detectable in the gingiva, human gingival fibroblasts express functional leptin receptor mRNA and leptin is known to regulate extracellular matrix remodelling responses in cardiac fibroblasts. We therefore hypothesised that leptin would enhance matrix metalloproteinase secretion in human gingival fibroblasts. Methods and Results We used in vitro cell culture to investigate leptin signalling and the effect of leptin on mRNA and protein expression in human gingival fibroblasts. We confirmed human gingival fibroblasts expressed cell surface leptin receptor, found leptin increased matrix metalloproteinase-1, -3, -8 and -14 expression in human gingival fibroblasts compared to unstimulated cells, and observed that leptin stimulation activated MAPK, STAT1/3 and Akt signalling in human gingival fibroblasts. Furthermore, leptin synergised with IL-1 or the TLR2 agonist pam2CSK4 to markedly enhance matrix metalloproteinase-1 and -3 production by human gingival fibroblasts. Signalling pathway inhibition demonstrated ERK was required for leptin-stimulated matrix metalloproteinase-1 expression in human gingival fibroblasts; whilst ERK, JNK, p38 and STAT3 were required for leptin+IL-1- and leptin+pam2CSK4-induced matrix metalloproteinase-1 expression. A genome-wide expression array and gene ontology analysis confirmed genes differentially expressed in leptin+IL-1-stimulated human gingival fibroblasts (compared to unstimulated cells) were enriched for extracellular matrix organisation and disassembly, and revealed that matrix metalloproteinase-8 and -12 were also synergistically upregulated by leptin+IL-1 in human gingival fibroblasts. Conclusions We conclude that leptin selectively enhances the expression and secretion of certain matrix metalloproteinases in human gingival fibroblasts, and suggest that gingival fibroblasts may have an ECM-degrading phenotype during conditions of hyperleptinaemia (e.g., obesity, type 2 diabetes mellitus, exogenous leptin therapy). PMID:26829555

Aqueous and Ethanolic Valeriana officinalis Extracts Change the Binding of Ligands to Glutamate Receptors

PubMed Central

Del Valle-Mojica, Lisa M.; Cordero-Hernández, José M.; González-Medina, Giselle; Ramos-Vélez, Igmeris; Berríos-Cartagena, Nairimer; Torres-Hernández, Bianca A.; Ortíz, José G.

2011-01-01

The effects of two valerian extracts (aqueous and hydroalcoholic) were investigated through [3H]Glutamate ([3H]Glu) and [3H]Fluorowillardine ([3H]FW) receptor binding assays using rat synaptic membranes in presence of different receptor ligands. In addition, the extract stability was monitored spectrophotometrically. Both extracts demonstrated interaction with ionotropic glutamate receptors (iGluRs). However, the extracts displayed considerable differences in receptor selectivity. The hydroalcoholic extract selectively interacted with quisqualic acid (QA), group I metabotropic glutamate receptor (mGluR) ligand, while the aqueous extract did not alter the binding of QA. The stability of the extracts was examined during several weeks. Freshly prepared extract inhibited 38–60% of [3H]FW binding (AMPA). After 10 days, the aqueous extract inhibited 85% of [3H]FW binding while the hydroalcoholic extract markedly potentiated (200%) [3H]FW binding to AMPA receptors. Thus, our results showed that factors such as extraction solvent and extract stability determine the selectivity for glutamate receptor (GluR) interactions. PMID:21151614

Aqueous and Ethanolic Valeriana officinalis Extracts Change the Binding of Ligands to Glutamate Receptors.

PubMed

Del Valle-Mojica, Lisa M; Cordero-Hernández, José M; González-Medina, Giselle; Ramos-Vélez, Igmeris; Berríos-Cartagena, Nairimer; Torres-Hernández, Bianca A; Ortíz, José G

2011-01-01

The effects of two valerian extracts (aqueous and hydroalcoholic) were investigated through [(3)H]Glutamate ([(3)H]Glu) and [(3)H]Fluorowillardine ([(3)H]FW) receptor binding assays using rat synaptic membranes in presence of different receptor ligands. In addition, the extract stability was monitored spectrophotometrically. Both extracts demonstrated interaction with ionotropic glutamate receptors (iGluRs). However, the extracts displayed considerable differences in receptor selectivity. The hydroalcoholic extract selectively interacted with quisqualic acid (QA), group I metabotropic glutamate receptor (mGluR) ligand, while the aqueous extract did not alter the binding of QA. The stability of the extracts was examined during several weeks. Freshly prepared extract inhibited 38-60% of [(3)H]FW binding (AMPA). After 10 days, the aqueous extract inhibited 85% of [(3)H]FW binding while the hydroalcoholic extract markedly potentiated (200%) [(3)H]FW binding to AMPA receptors. Thus, our results showed that factors such as extraction solvent and extract stability determine the selectivity for glutamate receptor (GluR) interactions.

PHYTOCHROME KINASE SUBSTRATE1 regulates root phototropism and gravitropism.

PubMed

Boccalandro, Hernán E; De Simone, Silvia N; Bergmann-Honsberger, Ariane; Schepens, Isabelle; Fankhauser, Christian; Casal, Jorge J

2008-01-01

Light promotes the expression of PHYTOCHROME KINASE SUBSTRATE1 (PKS1) in the root of Arabidopsis thaliana, but the function of PKS1 in this organ is unknown. Unilateral blue light induced a negative root phototropic response mediated by phototropin 1 in wild-type seedlings. This response was absent in pks1 mutants. In the wild type, unilateral blue light enhanced PKS1 expression in the subapical region of the root several hours before bending was detectable. The negative phototropism and the enhanced PKS1 expression in response to blue light required phytochrome A (phyA). In addition, the pks1 mutation enhanced the root gravitropic response when vertically oriented seedlings were placed horizontally. The negative regulation of gravitropism by PKS1 occurred even in dark-grown seedlings and did not require phyA. Blue light also failed to induce negative phototropism in pks1 under reduced gravitational stimulation, indicating that the effect of pks1 on phototropism is not simply the consequence of the counteracting effect of enhanced gravitropism. We propose a model where the background level of PKS1 reduces gravitropism. After a phyA-dependent increase in its expression, PKS1 positively affects root phototropism and both effects contribute to negative curvature in response to unilateral blue light.

Bmi1 represses Ink4a/Arf and Hox genes to regulate stem cells in the rodent incisor

PubMed Central

Biehs, Brian; Hu, Jimmy Kuang-Hsien; Strauli, Nicolas B.; Sangiorgi, Eugenio; Jung, Heekyung; Heber, Ralf-Peter; Ho, Sunita; Goodwin, Alice F.; Dasen, Jeremy S.; Capecchi, Mario R.; Klein, Ophir D.

2013-01-01

The polycomb group gene Bmi1 is required for maintenance of adult stem cells in many organs1, 2. Inactivation of Bmi1 leads to impaired stem cell self-renewal due to deregulated gene expression. One critical target of BMI1 is Ink4a/Arf, which encodes the cell cycle inhibitors p16ink4a and p19Arf3. However, deletion of Ink4a/Arf only partially rescues Bmi1 null phenotypes4, indicating that other important targets of BMI1 exist. Here, using the continuously-growing mouse incisor as a model system, we report that Bmi1 is expressed by incisor stem cells and that deletion of Bmi1 resulted in fewer stem cells, perturbed gene expression, and defective enamel production. Transcriptional profiling revealed that Hox expression is normally repressed by BMI1 in the adult, and functional assays demonstrated that BMI1-mediated repression of Hox genes preserves the undifferentiated state of stem cells. As Hox gene upregulation has also been reported in other systems when Bmi1 is inactivated1, 2, 5–7, our findings point to a general mechanism whereby BMI1-mediated repression of Hox genes is required for the maintenance of adult stem cells and for prevention of inappropriate differentiation. PMID:23728424

Neurospora crassa 1,3-α-glucan synthase, AGS-1, is required for cell wall biosynthesis during macroconidia development

PubMed Central

Fu, Ci; Tanaka, Asuma

2014-01-01

The Neurospora crassa genome encodes two 1,3-α-glucan synthases. One of these 1,3-α-glucan synthase genes, ags-1, was shown to be required for the synthesis of 1,3-α-glucan in the aerial hyphae and macroconidia cell walls. 1,3-α-Glucan was found in the conidia cell wall, but was absent from the vegetative hyphae cell wall. Deletion of ags-1 affected conidial development. Δags-1 produced only 5 % as many conidia as the WT and most of the conidia produced by Δags-1 were not viable. The ags-1 upstream regulatory elements were shown to direct cell-type-specific expression of red fluorescent protein in conidia and aerial hyphae. A haemagglutinin-tagged AGS-1 was found to be expressed in aerial hyphae and conidia. The research showed that 1,3-α-glucan is an aerial hyphae and conidia cell wall component, and is required for normal conidial differentiation. PMID:24847001

Regulation of mouse stomach development and Barx1 expression by specific microRNAs

PubMed Central

Kim, Byeong-Moo; Woo, Janghee; Kanellopoulou, Chryssa; Shivdasani, Ramesh A.

2011-01-01

Although microRNAs (miRNAs) are postulated to fine-tune many developmental processes, their relationships with specific targets and tissues remain largely undefined. The mesenchymal transcription factor Barx1 controls spleen and stomach morphogenesis and is required to specify stomach-specific epithelium in adjacent endoderm. Barx1 expression is precisely regulated in space and time, with a sharp drop in stomach levels after epithelial specification. We tested the hypothesis that specific miRNAs mediate this marked decline in Barx1 levels. Depletion of the miRNA-processing enzyme Dicer in cultured stomach mesenchyme and conditional Dicer gene deletion in mice significantly increased Barx1 levels, disrupted stomach and intestine development and caused spleen agenesis. Computational and experimental studies identified miR-7a and miR-203 as candidate miRNAs that regulate Barx1 and are expressed in inverse proportion to it in the fetal mouse stomach. Through specific interactions with cognate sequences in the Barx1 3′ untranslated region, miR-7a and miR-203 repress Barx1 expression in stomach mesenchymal cells and its function in inducing gastric epithelium. These results indicate that miRNAs are required for proper digestive tract organogenesis and that miR-7a and miR-203 control expression of the stomach homeotic regulator Barx1. PMID:21307095

Identification of the Doublesex protein binding sites that activate expression of lozenge in the female genital disc in Drosophila melanogaster.

PubMed

Wagamitsu, Shunsuke; Takase, Dan; Aoki, Fugaku; Suzuki, Masataka G

2017-02-01

Normal sexual differentiation in the genital organs is essential for the animal species that use sexual reproduction. Although it is known that doublesex (dsx) is required for the sexual development of the genitalia in various insect species, the direct target genes responsible for the sexual differentiation of the genitalia have not been identified. The lozenge (lz) gene is expressed in the female genital disc and is essential for developments of spermathecae and accessory glands in Drosophila melanogaster. The female-specific isoform of DSX (DSXF) is required for activating lz expression in the female genital disc. However, it still remains unclear whether the DSXF directly activates the transcription of lz in the female genital disc. In this study, we found two sequences (lz-DBS1 and lz-DBS2) within lz locus that showed high homoloty to the DSX binding motif identified previously. Competition assays using recombinant DSX DNA-binding domain (DSX-DBD) protein verified that the DSX-DBD protein bound to lz-DBS1 and lz-DBS2 in a sequence-specific manner with lower affinity than to the known DSX binding site in the bric-à-brac 1 (bab1) gene. Reporter gene analyses revealed that a 2.5-kbp lz genomic fragment containing lz-DBS1 and lz-DBS2 drove reporter gene (EGFP) expression in a manner similar to endogenous lz expression in the female genital disc. Mutations in lz-DBS1 alone significantly reduced the area of EGFP-expressing region, while EGFP expression in the female genital disc was abolished when both sites were mutated. These results demonstrated that DSX directly activates female-specific lz expression in the genital disc through lz-DBS1 and lz-DBS2. Copyright © 2017 Elsevier B.V. All rights reserved.

Regulation of hepatic fatty acid elongase and desaturase expression in diabetes and obesity

PubMed Central

Wang, Yun; Botolin, Daniela; Xu, Jinghua; Christian, Barbara; Mitchell, Ernestine; Jayaprakasam, Bolleddula; Nair, Muraleedharan; Peters, Jeffery M.; Busik, Julia; Olson, L. Karl; Jump, Donald B.

2009-01-01

Fatty acid elongases and desaturases play an important role in hepatic and whole body lipid composition. We examined the role that key transcription factors played in the control of hepatic elongase and desaturase expression. Studies with peroxisome proliferator-activated receptor α (PPARα)-deficient mice establish that PPARα was required for WY14643-mediated induction of fatty acid elongase-5 (Elovl-5), Elovl-6, and all three desaturases [Δ5 desaturase (Δ5D), Δ6D, and Δ9D]. Increased nuclear sterol-regulatory element binding protein-1 (SREBP-1) correlated with enhanced expression of Elovl-6, Δ5D, Δ6D, and Δ9D. Only Δ9D was also regulated independently by liver X receptor (LXR) agonist. Glucose induction of L-type pyruvate kinase, Δ9D, and Elovl-6 expression required the carbohydrate-regulatory element binding protein/MAX-like factor X (ChREBP/MLX) heterodimer. Suppression of Elovl-6 and Δ9D expression in livers of streptozotocin-induced diabetic rats and high fat-fed glucose-intolerant mice correlated with low levels of nuclear SREBP-1. In leptin-deficient obese mice (Lepob/ob), increased SREBP-1 and MLX nuclear content correlated with the induction of Elovl-5, Elovl-6, and Δ9D expression and the massive accumulation of monoun-saturated fatty acids (18:1,n-7 and 18:1,n-9) in neutral lipids. Diabetes- and obesity-induced changes in hepatic lipid composition correlated with changes in elongase and desaturase expression. In conclusion, these studies establish a role for PPARα, LXR, SREBP-1, ChREBP, and MLX in the control of hepatic fatty acid elongase and desaturase expression and lipid composition. PMID:16790840

HSF4 is required for normal cell growth and differentiation during mouse lens development

PubMed Central

Fujimoto, Mitsuaki; Izu, Hanae; Seki, Keisuke; Fukuda, Ken; Nishida, Teruo; Yamada, Shu-ichi; Kato, Kanefusa; Yonemura, Shigenobu; Inouye, Sachiye; Nakai, Akira

2004-01-01

The heat shock transcription factor (HSF) family consists of three members in mammals and regulates expression of heat shock genes via a heat shock element. HSF1 and HSF2 are required for some developmental processes, but it is unclear how they regulate these processes. To elucidate the mechanisms of developmental regulation by HSFs, we generated mice in which the HSF4 gene is mutated. HSF4-null mice had cataract with abnormal lens fiber cells containing inclusion-like structures, probably due to decreased expression of γ-crystallin, which maintains protein stability. Furthermore, we found increased proliferation and premature differentiation of the mutant lens epithelial cells, which is associated with increased expression of growth factors, FGF-1, FGF-4, and FGF-7. Unexpectedly, HSF1 competed with HSF4 for the expression of FGFs not only in the lens but also in other tissues. These findings reveal the lens-specific role of HSF4, which activates γ-crystallin genes, and also indicate that HSF1 and HSF4 are involved in regulating expression of growth factor genes, which are essential for cell growth and differentiation. PMID:15483628

Targeted overexpression of mitochondrial catalase prevents radiation-induced cognitive dysfunction.

PubMed

Parihar, Vipan K; Allen, Barrett D; Tran, Katherine K; Chmielewski, Nicole N; Craver, Brianna M; Martirosian, Vahan; Morganti, Josh M; Rosi, Susanna; Vlkolinsky, Roman; Acharya, Munjal M; Nelson, Gregory A; Allen, Antiño R; Limoli, Charles L

2015-01-01

Radiation-induced disruption of mitochondrial function can elevate oxidative stress and contribute to the metabolic perturbations believed to compromise the functionality of the central nervous system. To clarify the role of mitochondrial oxidative stress in mediating the adverse effects of radiation in the brain, we analyzed transgenic (mitochondrial catalase [MCAT]) mice that overexpress human catalase localized to the mitochondria. Compared with wild-type (WT) controls, overexpression of the MCAT transgene significantly decreased cognitive dysfunction after proton irradiation. Significant improvements in behavioral performance found on novel object recognition and object recognition in place tasks were associated with a preservation of neuronal morphology. While the architecture of hippocampal CA1 neurons was significantly compromised in irradiated WT mice, the same neurons in MCAT mice did not exhibit extensive and significant radiation-induced reductions in dendritic complexity. Irradiated neurons from MCAT mice maintained dendritic branching and length compared with WT mice. Protected neuronal morphology in irradiated MCAT mice was also associated with a stabilization of radiation-induced variations in long-term potentiation. Stabilized synaptic activity in MCAT mice coincided with an altered composition of the synaptic AMPA receptor subunits GluR1/2. Our findings provide the first evidence that neurocognitive sequelae associated with radiation exposure can be reduced by overexpression of MCAT, operating through a mechanism involving the preservation of neuronal morphology. Our article documents the neuroprotective properties of reducing mitochondrial reactive oxygen species through the targeted overexpression of catalase and how this ameliorates the adverse effects of proton irradiation in the brain.

Mice Deficient in lysophosphatidic acid acyltransferase delta (Lpaatδ)/acylglycerophosphate acyltransferase 4 (Agpat4) Have Impaired Learning and Memory.

PubMed

Bradley, Ryan M; Mardian, Emily B; Bloemberg, Darin; Aristizabal Henao, Juan J; Mitchell, Andrew S; Marvyn, Phillip M; Moes, Katherine A; Stark, Ken D; Quadrilatero, Joe; Duncan, Robin E

2017-11-15

We previously characterized LPAATδ/AGPAT4 as a mitochondrial lysophosphatidic acid acyltransferase that regulates brain levels of phosphatidylcholine (PC), phosphatidylethanolamine (PE), and phosphatidylinositol (PI). Here, we report that Lpaat δ -/- mice display impaired spatial learning and memory compared to wild-type littermates in the Morris water maze and our investigation of potential mechanisms associated with brain phospholipid changes. Marker protein immunoblotting suggested that the relative brain content of neurons, glia, and oligodendrocytes was unchanged. Relative abundance of the important brain fatty acid docosahexaenoic acid was also unchanged in phosphatidylserine, phosphatidylglycerol, and cardiolipin, in agreement with prior data on PC, PE and PI. In phosphatidic acid, it was increased. Specific decreases in ethanolamine-containing phospholipids were detected in mitochondrial lipids, but the function of brain mitochondria in Lpaat δ -/- mice was unchanged. Importantly, we found that Lpaat δ -/- mice have a significantly and drastically lower brain content of the N -methyl-d-asparate (NMDA) receptor subunits NR1, NR2A, and NR2B, as well as the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit GluR1, compared to wild-type mice. However, general dysregulation of PI-mediated signaling is not likely responsible, since phospho-AKT and phospho-mTOR pathway regulation was unaffected. Our findings indicate that Lpaat δ deficiency causes deficits in learning and memory associated with reduced NMDA and AMPA receptors. Copyright © 2017 American Society for Microbiology.

LMO2 is required for TAL1 DNA binding activity and initiation of definitive haematopoiesis at the haemangioblast stage.

PubMed

Stanulovic, Vesna S; Cauchy, Pierre; Assi, Salam A; Hoogenkamp, Maarten

2017-09-29

LMO2 is a bridging factor within a DNA binding complex and is required for definitive haematopoiesis to occur. The developmental stage of the block in haematopoietic specification is not known. We show that Lmo2-/- mouse embryonic stem cells differentiated to Flk-1+ haemangioblasts, but less efficiently to haemogenic endothelium, which only produced primitive haematopoietic progenitors. Genome-wide approaches indicated that LMO2 is required at the haemangioblast stage to position the TAL1/LMO2/LDB1 complex to regulatory elements that are important for the establishment of the haematopoietic developmental program. In the absence of LMO2, the target site recognition of TAL1 is impaired. The lack of LMO2 resulted in altered gene expression levels already at the haemangioblast stage, with transcription factor genes accounting for ∼15% of affected genes. Comparison of Lmo2-/- with Tal1-/- Flk-1+ cells further showed that TAL1 was required to initiate or sustain Lmo2 expression. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Fission yeast strains with circular chromosomes require the 9-1-1 checkpoint complex for the viability in response to the anti-cancer drug 5-fluorodeoxyuridine.

PubMed

Shamim, Hossain Mohammad; Minami, Yukako; Tanaka, Daiki; Ukimori, Shinobu; Murray, Johanne M; Ueno, Masaru

2017-01-01

Thymidine kinase converts 5-fluorodeoxyuridine to 5-fluorodeoxyuridine monophosphate, which causes disruption of deoxynucleotide triphosphate ratios. The fission yeast Schizosaccharomyces pombe does not express endogenous thymidine kinase but 5-fluorodeoxyuridine inhibits growth when exogenous thymidine kinase is expressed. Unexpectedly, we found that 5-fluorodeoxyuridine causes S phase arrest even without thymidine kinase expression. DNA damage checkpoint proteins such as the 9-1-1 complex were required for viability in the presence of 5-fluorodeoxyuridine. We also found that strains with circular chromosomes, due to loss of pot1+, which have higher levels of replication stress, were more sensitive to loss of the 9-1-1 complex in the presence of 5-fluorodeoxyuridine. Thus, our results suggest that strains carrying circular chromosomes exhibit a greater dependence on DNA damage checkpoints to ensure viability in the presence of 5-fluorodeoxyuridine compared to stains that have linear chromosomes.

Differential requirement for the IKKβ/NF-κB signaling module in regulating TLR versus RLR-induced type 1 IFN expression in dendritic cells1

PubMed Central

Wang, Xingyu; Wang, Junmei; Zheng, Hong; Xie, Mengyu; Hopewell, Emily L.; Albrecht, Randy A.; Nogusa, Shoko; García-Sastre, Adolfo; Balachandran, Siddharth; Beg, Amer A.

2014-01-01

Host innate-immune responses are tailored by cell-type to control and eradicate specific infectious agents. For example, an acute RNA virus infection can result in high-level expression of type 1 interferons (IFNs) by both conventional (cDCs) and plasmacytoid dendritic cells (pDCs), but while cDCs preferentially utilize RIG-I-like Receptor (RLR) signaling to produce type 1 IFNs, pDCs predominantly employ Toll-like Receptors (TLR) to induce these cytokines. We previously found that the IKKβ/NF-κB pathway regulates early IFN-β expression but not the magnitude of type 1 IFN expression following RLR engagement. In this study, we use IKKβ inhibition and mice deficient in IKKβ or canonical NF-κB subunits (p50, RelA/p65 and cRel) to demonstrate that the IKKβ/NF-κB axis is critically important for virus-induced type 1 IFN expression in pDCs, but not in cDCs. We also reveal a crucial and more general requirement for IKKβ/NF-κB in TLR - but not RLR- induced expression of type 1 IFNs and inflammatory cytokines. Together, these findings reveal a previously unappreciated specificity of the IKKβ/NF-κB signaling axis in regulation of anti-microbial responses by different classes of PRR, and therefore by individual cell-types reliant on particular PRRs for their innate-immune transcriptional responses. PMID:25057006

Sex and seasonal differences in mRNA expression of estrogen receptor α (ESR1) in red-sided garter snakes (Thamnophis sirtalis parietalis).

PubMed

Ashton, Sydney E; Vernasco, Ben J; Moore, Ignacio T; Parker, M Rockwell

2018-05-25

Estrogens are important regulators of reproductive physiology including sexual signal expression and vitellogenesis. For the regulation to occur, the hormone must bind and activate receptors in target tissues, and expression of the receptors can vary by sex and/or season. By simultaneously comparing circulating hormone levels with receptor expression, a more complete understanding of hormone action can be gained. Our study species, the red-sided garter snake (Thamnophis sirtalis parietalis), provides an excellent opportunity to study the interaction between sex steroid hormones and receptor expression in addition to sexual dimorphism and seasonality. During the spring mating season, male garter snakes rely exclusively on the female's skin-based, estrogen-dependent sex pheromone to direct courtship. Males can be stimulated to produce this sexual attractiveness pheromone by treatment with estradiol (E 2 ), which also induces male vitellogenesis. Estrogen receptors (ESRs) are required to transduce the effects of estrogens, thus we used quantitative RT-PCR to analyze expression of ESR alpha (ERα; gene ESR1) mRNA in the skin and liver of wild caught male and female garter snakes across simulated spring and fall conditions in the laboratory. While ESR1 was present in the skin of both sexes, there were no sex or seasonal differences in expression levels. Liver expression of ESR1, however, was sexually dimorphic, with females showing greatest expression in fall when circulating E 2 concentrations were lowest. There were no statistically significant correlations between E 2 and ESR1 expression. Our data suggest that the skin of both sexes is sensitive to estrogen signaling and thus the production of sex pheromone is dependent on bioavailable levels of E 2 . Female expression of ESR1 in the liver may increase in the fall to prime energy storage mechanisms required for vitellogenesis the following year. Copyright © 2018 Elsevier Inc. All rights reserved.

Control of Expression of the RNases J1 and J2 in Bacillus subtilis

PubMed Central

Jamalli, Ailar; Hébert, Agnès; Zig, Léna

2014-01-01

In Bacillus subtilis, the dual activity 5′ exo- and endoribonucleases J1 and J2 are important players in mRNA and stable RNA maturation and degradation. Recent work has improved our understanding of their structure and mechanism of action and identified numerous RNA substrates. However, almost nothing is known about the expression of these enzymes. Here, we have identified the transcriptional and translational signals that control the expression of the rnjA (RNase J1) and rnjB (RNase J2) genes. While the rnjB gene is transcribed constitutively from a sigma A promoter, optimal expression of RNase J1 requires cotranscription and cotranslation with the upstream ykzG gene, encoding a protein of unknown function. In the absence of coupled translation, RNase J1 expression is decreased more than 5-fold. Transcription of the ykzG operon initiates at a sigma A promoter with a noncanonical −35 box that is required for optimal transcription. Biosynthesis of RNase J1 is autocontrolled within a small range (1.4-fold) and also slightly stimulated (1.4-fold) in the absence of RNase J2. These controls are weak but might be useful to maintain the overall RNase J level and possibly also equimolar amounts of the two nucleases in the cell that primarily act as a heterodimer in vivo. PMID:24187087

The irreversible ERBB1/2/4 inhibitor neratinib interacts with the PARP1 inhibitor niraparib to kill ovarian cancer cells.

PubMed

Booth, Laurence; Roberts, Jane L; Samuel, Peter; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Poklepovic, Andrew; Dent, Paul

2018-06-03

The irreversible ERBB1/2/4 inhibitor neratinib has been shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET, PDGFRα and mutant RAS proteins via autophagic degradation. Neratinib interacted in an additive to synergistic fashion with the approved PARP1 inhibitor niraparib to kill ovarian cancer cells. Neratinib and niraparib caused the ATM-dependent activation of AMPK which in turn was required to cause mTOR inactivation, ULK-1 activation and ATG13 phosphorylation. The drug combination initially increased autophagosome levels followed later by autolysosome levels. Preventing autophagosome formation by expressing activated mTOR or knocking down of Beclin1, or knock down of the autolysosome protein cathepsin B, reduced drug combination lethality. The drug combination caused an endoplasmic reticulum stress response as judged by enhanced eIF2α phosphorylation that was responsible for reducing MCL-1 and BCL-XL levels and increasing ATG5 and Beclin1 expression. Knock down of BIM, but not of BAX or BAK, reduced cell killing. Expression of activated MEK1 prevented the drug combination increasing BIM expression and reduced cell killing. Downstream of the mitochondrion, drug lethality was partially reduced by knock down of AIF, but expression of dominant negative caspase 9 was not protective. Our data demonstrate that neratinib and niraparib interact to kill ovarian cancer cells through convergent DNA damage and endoplasmic reticulum stress signaling. Cell killing required the induction of autophagy and was cathepsin B and AIF -dependent, and effector caspase independent.

The Yeast Anaerobic Response Element AR1b Regulates Aerobic Antifungal Drug-dependent Sterol Gene Expression*

PubMed Central

Gallo-Ebert, Christina; Donigan, Melissa; Liu, Hsing-Yin; Pascual, Florencia; Manners, Melissa; Pandya, Devanshi; Swanson, Robert; Gallagher, Denise; Chen, WeiWei; Carman, George M.; Nickels, Joseph T.

2013-01-01

Saccharomyces cerevisiae ergosterol biosynthesis, like cholesterol biosynthesis in mammals, is regulated at the transcriptional level by a sterol feedback mechanism. Yeast studies defined a 7-bp consensus sterol-response element (SRE) common to genes involved in sterol biosynthesis and two transcription factors, Upc2 and Ecm22, which direct transcription of sterol biosynthetic genes. The 7-bp consensus SRE is identical to the anaerobic response element, AR1c. Data indicate that Upc2 and Ecm22 function through binding to this SRE site. We now show that it is two novel anaerobic AR1b elements in the UPC2 promoter that direct global ERG gene expression in response to a block in de novo ergosterol biosynthesis, brought about by antifungal drug treatment. The AR1b elements are absolutely required for auto-induction of UPC2 gene expression and protein and require Upc2 and Ecm22 for function. We further demonstrate the direct binding of recombinant expressed S. cerevisiae ScUpc2 and pathogenic Candida albicans CaUpc2 and Candida glabrata CgUpc2 to AR1b and SRE/AR1c elements. Recombinant endogenous promoter studies show that the UPC2 anaerobic AR1b elements act in trans to regulate ergosterol gene expression. Our results indicate that Upc2 must occupy UPC2 AR1b elements in order for ERG gene expression induction to take place. Thus, the two UPC2-AR1b elements drive expression of all ERG genes necessary for maintaining normal antifungal susceptibility, as wild type cells lacking these elements have increased susceptibility to azole antifungal drugs. Therefore, targeting these specific sites for antifungal therapy represents a novel approach to treat systemic fungal infections. PMID:24163365

Quantal amplitude at the cone ribbon synapse can be adjusted by changes in cytosolic glutamate

PubMed Central

Bartoletti, Theodore M.

2011-01-01

Purpose Vision is encoded at photoreceptor synapses by the number of released vesicles and size of the post-synaptic response. We hypothesized that elevating cytosolic glutamate could enhance quantal size by increasing glutamate in vesicles. Methods We introduced glutamate (10–40 mM) into cone terminals through a patch pipette and recorded excitatory post-synaptic currents (EPSCs) from horizontal or OFF bipolar cells in the Ambystoma tigrinum retinal slice preparation. Results Elevating cytosolic glutamate in cone terminals enhanced EPSCs as well as quantal miniature EPSCs (mEPSCs). Enhancement was prevented by inhibiting vesicular glutamate transport with 1S,3R-1-aminocyclopentane-1,3-dicarboxylate in the patch pipette. A low affinity glutamate receptor antagonist, γD-glutamylglycine (1 mM), less effectively inhibited EPSCs evoked from cones loaded with glutamate than control cones indicating that release from cones with supplemental glutamate produced higher glutamate levels in the synaptic cleft. Raising presynaptic glutamate did not alter exocytotic capacitance responses and exocytosis was observed after inhibiting glutamate loading with the vesicular ATPase inhibitor, concanamycin A, suggesting that release capability is not restricted by low vesicular glutamate levels. Variance-mean analysis of currents evoked by flash photolysis of caged glutamate indicated that horizontal cell AMPA receptors have a single channel conductance of 10.1 pS suggesting that ~8.7 GluRs contribute to each mEPSC. Conclusions Quantal amplitude at the cone ribbon synapse is capable of adjustment by changes in cytosolic glutamate levels. The small number of channels contributing to each mEPSC suggests that stochastic variability in channel opening could be an important source of quantal variability. PMID:21541265

Hippocampal and extrahippocampal systems compete for control of contextual fear: Role of ventral subiculum and amygdala

PubMed Central

Biedenkapp, Joseph C.; Rudy, Jerry W.

2009-01-01

Two neural systems, a hippocampal system and an extrahippocampal system compete for control over contextual fear, and the hippocampal system normally dominates. Our experiments reveal that output provided by the ventral subiculum is critical for the hippocampal system to win this competition. Bilateral electrolytic lesions of the ventral subiculum after conditioning, but not before conditioning, impaired contextual fear conditioning. Reversibly inactivating this region by bilateral injections of muscimol produced the same results—no impairment when the injection occurred prior to conditioning but a significant impairment when this region was inactivated after conditioning. Thus, the extrahippocampal system can support contextual fear conditioning if the ventral subiculum is disabled before conditioning but not if it is disabled after conditioning. Our experiments also reveal that the basolateral region of the amygdala (BLA) is where the two systems compete for associative control of the fear system. To test this hypothesis we reasoned that the extrahippocampal system would also acquire associative control over the fear system, even if the hippocampal system were functional, if the basal level of plasticity potential in the BLA could be increased. We did this by injecting the D1 dopamine agonist, SKF82958, into the BLA just prior to conditioning. This treatment resulted in a significant increase in freezing when the ventral subiculum was disabled prior to the test. These results are discussed in relationship to the idea that D1 agonists increase plasticity potential by increasing the pool of available extrasynaptic GluR1 receptors in the population of neurons supporting acquired fear. PMID:19117915

S-Adenosylmethionine-dependent protein methylation Is required for expression of selenoprotein P and gluconeogenic enzymes in HepG2 human hepatocytes

USDA-ARS?s Scientific Manuscript database

Cellular methylation processes enable expression of gluconeogenic enzymes and metabolism of the nutrient selenium (Se). Se status may relate to type-II diabetes and plasma levels of selenoprotein P (SEPP1) are positively correlated with insulin resistance. Increased expression of gluconeogenic enzym...

Regulation of SFRP-1 expression in the rat dental follicle.

PubMed

Liu, Dawen; Yao, Shaomian; Wise, Gary E

2012-01-01

Tooth eruption requires osteoclastogenesis and subsequent bone resorption. Secreted frizzled-related protein-1 (SFRP-1) negatively regulates osteoclastogenesis. Our previous studies indicated that SFRP-1 is expressed in the rat dental follicle (DF), with reduced expression at days 3 and 9 close to the times for the major and minor bursts of osteoclastogenesis, respectively; but it remains unclear as to what molecules contribute to its reduced expression at these critical times. Thus, it was the aim of this study to determine which molecules regulate the expression of SFRP-1 in the DF. To that end, the DF cells were treated with cytokines that are maximally expressed at days 3 or 9, and SFRP-1 expression was determined. Our study indicated that colony-stimulating factor-1 (CSF-1), a molecule maximally expressed in the DF at day 3, down-regulated SFRP-1 expression. As to endothelial monocyte-activating polypeptide II (EMAP-II), a highly expressed molecule in the DF at day 3, it had no effect on the expression of SFRP-1. However, when EMAP-II was knocked down by siRNA, the expression of SFRP-1 was elevated, and this elevated SFRP-1 expression could be reduced by adding recombinant EMAP-II protein. This suggests that EMAP-II maintained a lower level of SFRP-1 in the DF. TNF-α is a molecule maximally expressed at day 9, and this study indicated that it also down-regulated the expression of SFRP-1 in the DF cells. In conclusion, CSF-1 and EMAP-II may contribute to the reduced SFRP-1 expression seen on day 3, while TNF-α may contribute to the reduced SFRP-1 expression at day 9.

Transferrin receptor regulates pancreatic cancer growth by modulating mitochondrial respiration and ROS generation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jeong, Seung Min, E-mail: smjeong@catholic.ac.kr; Institute for Aging and Metabolic Diseases, College of Medicine, The Catholic University of Korea, Seoul 137-701; Hwang, Sunsook

2016-03-11

The transferrin receptor (TfR1) is upregulated in malignant cells and its expression is associated with cancer progression. Because of its pre-eminent role in cell proliferation, TfR1 has been an important target for the development of cancer therapy. Although TfR1 is highly expressed in pancreatic cancers, what it carries out in these refractory cancers remains poorly understood. Here we report that TfR1 supports mitochondrial respiration and ROS production in human pancreatic ductal adenocarcinoma (PDAC) cells, which is required for their tumorigenic growth. Elevated TfR1 expression in PDAC cells contributes to oxidative phosphorylation, which allows for the generation of ROS. Importantly, mitochondrial-derivedmore » ROS are essential for PDAC growth. However, exogenous iron supplement cannot rescue the defects caused by TfR1 knockdown. Moreover, we found that TfR1 expression determines PDAC cells sensitivity to oxidative stress. Together, our findings reveal that TfR1 can contribute to the mitochondrial respiration and ROS production, which have essential roles in growth and survival of pancreatic cancer. - Highlights: • Pancreatic ductal adenocarcinoma (PDAC) exhibits an elevated transferrin receptor (TfR1) expression in comparison with non-transformed pancreatic cells. • TfR1 is required for PDAC growth by regulating mitochondrial respiration and ROS production. • TfR1 functions as a determinant of cell viability to oxidative stress in PDAC cells.« less

Lipin-1 Phosphatidic Phosphatase Activity Modulates Phosphatidate Levels to Promote Peroxisome Proliferator-activated Receptor γ (PPARγ) Gene Expression during Adipogenesis*

PubMed Central

Zhang, Peixiang; Takeuchi, Kazuharu; Csaki, Lauren S.; Reue, Karen

2012-01-01

Adipose tissue plays a key role in metabolic homeostasis. Disruption of the Lpin1 gene encoding lipin-1 causes impaired adipose tissue development and function in rodents. Lipin-1 functions as a phosphatidate phosphatase (PAP) enzyme in the glycerol 3-phosphate pathway for triglyceride storage and as a transcriptional coactivator/corepressor for metabolic nuclear receptors. Previous studies established that lipin-1 is required at an early step in adipocyte differentiation for induction of the adipogenic gene transcription program, including the key regulator peroxisome proliferator-activated receptor γ (PPARγ). Here, we investigate the requirement of lipin-1 PAP versus coactivator function in the establishment of Pparg expression during adipocyte differentiation. We demonstrate that PAP activity supplied by lipin-1, lipin-2, or lipin-3, but not lipin-1 coactivator activity, can rescue Pparg gene expression and lipogenesis during adipogenesis in lipin-1-deficient preadipocytes. In adipose tissue from lipin-1-deficient mice, there is an accumulation of phosphatidate species containing a range of medium chain fatty acids and an activation of the MAPK/extracellular signal-related kinase (ERK) signaling pathway. Phosphatidate inhibits differentiation of cultured adipocytes, and this can be rescued by the expression of lipin-1 PAP activity or by inhibition of ERK signaling. These results emphasize the importance of lipid intermediates as choreographers of gene regulation during adipogenesis, and the results highlight a specific role for lipins as determinants of levels of a phosphatidic acid pool that influences Pparg expression. PMID:22157014

Dnmt1 and Dnmt3a are required for the maintenance of DNA methylation and synaptic function in adult forebrain neurons

PubMed Central

Feng, Jian; Zhou, Yu; Campbell, Susan L.; Le, Thuc; Li, En; Sweatt, J. David; Silva, Alcino J.; Fan, Guoping

2011-01-01

Dnmt1 and Dnmt3a, two major DNA methyltransferases, are expressed in postmitotic neurons, but their function in the central nervous system (CNS) is unclear. We generated conditional mutant mice that lack either Dnmt1, or Dnmt3a, or both exclusively in forebrain excitatory neurons and found only double knockout (DKO) mice exhibited abnormal hippocampal CA1 long-term plasticity and deficits of learning and memory. While no neuronal loss was found, the size of hippocampal neurons in DKO was smaller; furthermore, DKO neurons showed a deregulation of gene expression including class I MHC and Stat1 that are known to play a role in synaptic plasticity. In addition, we observed a significant decrease in DNA methylation in DKO neurons. We conclude that Dnmt1 and Dnmt3a are required for synaptic plasticity, learning and memory through their overlapping roles in maintaining DNA methylation and modulating neuronal gene expression in adult CNS neurons. PMID:20228804

SET1A/COMPASS and shadow enhancers in the regulation of homeotic gene expression

PubMed Central

Cao, Kaixiang; Collings, Clayton K.; Marshall, Stacy A.; Morgan, Marc A.; Rendleman, Emily J.; Wang, Lu; Sze, Christie C.; Sun, Tianjiao; Bartom, Elizabeth T.; Shilatifard, Ali

2017-01-01

The homeotic (Hox) genes are highly conserved in metazoans, where they are required for various processes in development, and misregulation of their expression is associated with human cancer. In the developing embryo, Hox genes are activated sequentially in time and space according to their genomic position within Hox gene clusters. Accumulating evidence implicates both enhancer elements and noncoding RNAs in controlling this spatiotemporal expression of Hox genes, but disentangling their relative contributions is challenging. Here, we identify two cis-regulatory elements (E1 and E2) functioning as shadow enhancers to regulate the early expression of the HoxA genes. Simultaneous deletion of these shadow enhancers in embryonic stem cells leads to impaired activation of HoxA genes upon differentiation, while knockdown of a long noncoding RNA overlapping E1 has no detectable effect on their expression. Although MLL/COMPASS (complex of proteins associated with Set1) family of histone methyltransferases is known to activate transcription of Hox genes in other contexts, we found that individual inactivation of the MLL1-4/COMPASS family members has little effect on early Hox gene activation. Instead, we demonstrate that SET1A/COMPASS is required for full transcriptional activation of multiple Hox genes but functions independently of the E1 and E2 cis-regulatory elements. Our results reveal multiple regulatory layers for Hox genes to fine-tune transcriptional programs essential for development. PMID:28487406

Hes repressors are essential regulators of hematopoietic stem cell development downstream of Notch signaling

PubMed Central

Guiu, Jordi; Shimizu, Ritsuko; D’Altri, Teresa; Fraser, Stuart T.; Hatakeyama, Jun; Bresnick, Emery H.; Kageyama, Ryoichiro; Dzierzak, Elaine; Yamamoto, Masayuki; Espinosa, Lluis

2013-01-01

Previous studies have identified Notch as a key regulator of hematopoietic stem cell (HSC) development, but the underlying downstream mechanisms remain unknown. The Notch target Hes1 is widely expressed in the aortic endothelium and hematopoietic clusters, though Hes1-deficient mice show no overt hematopoietic abnormalities. We now demonstrate that Hes is required for the development of HSC in the mouse embryo, a function previously undetected as the result of functional compensation by de novo expression of Hes5 in the aorta/gonad/mesonephros (AGM) region of Hes1 mutants. Analysis of embryos deficient for Hes1 and Hes5 reveals an intact arterial program with overproduction of nonfunctional hematopoietic precursors and total absence of HSC activity. These alterations were associated with increased expression of the hematopoietic regulators Runx1, c-myb, and the previously identified Notch target Gata2. By analyzing the Gata2 locus, we have identified functional RBPJ-binding sites, which mutation results in loss of Gata2 reporter expression in transgenic embryos, and functional Hes-binding sites, which mutation leads to specific Gata2 up-regulation in the hematopoietic precursors. Together, our findings show that Notch activation in the AGM triggers Gata2 and Hes1 transcription, and next HES-1 protein represses Gata2, creating an incoherent feed-forward loop required to restrict Gata2 expression in the emerging HSCs. PMID:23267012

The Zn finger protein Iguana impacts Hedgehog signaling by promoting ciliogenesis.

PubMed

Glazer, Andrew M; Wilkinson, Alex W; Backer, Chelsea B; Lapan, Sylvain W; Gutzman, Jennifer H; Cheeseman, Iain M; Reddien, Peter W

2010-01-01

Hedgehog signaling is critical for metazoan development and requires cilia for pathway activity. The gene iguana was discovered in zebrafish as required for Hedgehog signaling, and encodes a novel Zn finger protein. Planarians are flatworms with robust regenerative capacities and utilize epidermal cilia for locomotion. RNA interference of Smed-iguana in the planarian Schmidtea mediterranea caused cilia loss and failure to regenerate new cilia, but did not cause defects similar to those observed in hedgehog(RNAi) animals. Smed-iguana gene expression was also similar in pattern to the expression of multiple other ciliogenesis genes, but was not required for expression of these ciliogenesis genes. iguana-defective zebrafish had too few motile cilia in pronephric ducts and in Kupffer's vesicle. Kupffer's vesicle promotes left-right asymmetry and iguana mutant embryos had left-right asymmetry defects. Finally, human Iguana proteins (dZIP1 and dZIP1L) localize to the basal bodies of primary cilia and, together, are required for primary cilia formation. Our results indicate that a critical and broadly conserved function for Iguana is in ciliogenesis and that this function has come to be required for Hedgehog signaling in vertebrates.

Kinematics and constraints associated with swashplate blade pitch control

NASA Technical Reports Server (NTRS)

Leyland, Jane A.

1993-01-01

An important class of techniques to reduce helicopter vibration is based on using a Higher Harmonic controller to optimally define the Higher Harmonic blade pitch. These techniques typically require solution of a general optimization problem requiring the determination of a control vector which minimizes a performance index where functions of the control vector are subject to inequality constraints. Six possible constraint functions associated with swashplate blade pitch control were identified and defined. These functions constrain: (1) blade pitch Fourier Coefficients expressed in the Rotating System, (2) blade pitch Fourier Coefficients expressed in the Nonrotating System, (3) stroke of the individual actuators expressed in the Nonrotating System, (4) blade pitch expressed as a function of blade azimuth and actuator stroke, (5) time rate-of-change of the aforementioned parameters, and (6) required actuator power. The aforementioned constraints and the associated kinematics of swashplate blade pitch control by means of the strokes of the individual actuators are documented.

Multiple zebrafish atoh1 genes specify a diversity of neuronal types in the zebrafish cerebellum.

PubMed

Kidwell, Chelsea U; Su, Chen-Ying; Hibi, Masahiko; Moens, Cecilia B

2018-06-01

A single Atoh1 basic-helix-loop-helix transcription factor specifies multiple neuron types in the mammalian cerebellum and anterior hindbrain. The zebrafish genome encodes three paralagous atoh1 genes whose functions in cerebellum and anterior hindbrain development we explore here. With use of a transgenic reporter, we report that zebrafish atoh1c-expressing cells are organized in two distinct domains that are separated both by space and developmental time. An early isthmic expression domain gives rise to an extracerebellar population in rhombomere 1 and an upper rhombic lip domain gives rise to granule cell progenitors that migrate to populate all four granule cell territories of the fish cerebellum. Using genetic mutants we find that of the three zebrafish atoh1 paralogs, atoh1c and atoh1a are required for the full complement of granule neurons. Surprisingly, the two genes are expressed in non-overlapping granule cell progenitor populations, indicating that fish use duplicate atoh1 genes to generate granule cell diversity that is not detected in mammals. Finally, live imaging of granule cell migration in wildtype and atoh1c mutant embryos reveals that while atoh1c is not required for granule cell specification per se, it is required for granule cells to delaminate and migrate away from the rhombic lip. Copyright © 2018 Elsevier Inc. All rights reserved.

CPT1{alpha} over-expression increases long-chain fatty acid oxidation and reduces cell viability with incremental palmitic acid concentration in 293T cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jambor de Sousa, Ulrike L.; Koss, Michael D.; Fillies, Marion

2005-12-16

To test the cellular response to an increased fatty acid oxidation, we generated a vector for an inducible expression of the rate-limiting enzyme carnitine palmitoyl-transferase 1{alpha} (CPT1{alpha}). Human embryonic 293T kidney cells were transiently transfected and expression of the CPT1{alpha} transgene in the tet-on vector was activated with doxycycline. Fatty acid oxidation was measured by determining the conversion of supplemented, synthetic cis-10-heptadecenoic acid (C17:1n-7) to C15:ln-7. CPT1{alpha} over-expression increased mitochondrial long-chain fatty acid oxidation about 6-fold. Addition of palmitic acid (PA) decreased viability of CPT1{alpha} over-expressing cells in a concentration-dependent manner. Both, PA and CPT1{alpha} over-expression increased cell death. Interestingly,more » PA reduced total cell number only in cells over-expressing CPT1{alpha}, suggesting an effect on cell proliferation that requires PA translocation across the mitochondrial inner membrane. This inducible expression system should be well suited to study the roles of CPT1 and fatty acid oxidation in lipotoxicity and metabolism in vivo.« less

Memory Impairment in Transgenic Alzheimer Mice Requires Cellular Prion Protein

PubMed Central

Gimbel, David A.; Nygaard, Haakon B.; Coffey, Erin E.; Gunther, Erik C.; Laurén, Juha; Gimbel, Zachary A.; Strittmatter, Stephen M.

2012-01-01

Soluble oligomers of the amyloid-β (Aβ) peptide are thought to play a key role in the pathophysiology of Alzheimer’s disease (AD). Recently, we reported that synthetic Aβ oligomers bind to cellular prion protein (PrPC) and that this interaction is required for suppression of synaptic plasticity in hippocampal slices by oligomeric Aβ peptide. We hypothesized that PrPC is essential for the ability of brain-derived Aβ to suppress cognitive function. Here, we crossed familial AD transgenes encoding APPswe and PSen1ΔE9 into Prnp−/− mice to examine the necessity of PrPC for AD-related phenotypes. Neither APP expression nor Aβ level is altered by PrPC absence in this transgenic AD model, and astrogliosis is unchanged. However, deletion of PrPC expression rescues 5-HT axonal degeneration, loss of synaptic markers, and early death in APPswe/PSen1ΔE9 transgenic mice. The AD transgenic mice with intact PrPC expression exhibit deficits in spatial learning and memory. Mice lacking PrPC, but containing Aβ plaque derived from APPswe/PSen1ΔE9 transgenes, show no detectable impairment of spatial learning and memory. Thus, deletion of PrPC expression dissociates Aβ accumulation from behavioral impairment in these AD mice, with the cognitive deficits selectively requiring PrPC. PMID:20445063

Antimicrobial activity of apple cider vinegar against Escherichia coli, Staphylococcus aureus and Candida albicans; downregulating cytokine and microbial protein expression.

PubMed

Yagnik, Darshna; Serafin, Vlad; J Shah, Ajit

2018-01-29

The global escalation in antibiotic resistance cases means alternative antimicrobials are essential. The aim of this study was to investigate the antimicrobial capacity of apple cider vinegar (ACV) against E. coli, S. aureus and C. albicans. The minimum dilution of ACV required for growth inhibition varied for each microbial species. For C. albicans, a 1/2 ACV had the strongest effect, S. aureus, a 1/25 dilution ACV was required, whereas for E-coli cultures, a 1/50 ACV dilution was required (p < 0.05). Monocyte co-culture with microbes alongside ACV resulted in dose dependent downregulation of inflammatory cytokines (TNFα, IL-6). Results are expressed as percentage decreases in cytokine secretion comparing ACV treated with non-ACV treated monocytes cultured with E-coli (TNFα, 99.2%; IL-6, 98%), S. aureus (TNFα, 90%; IL-6, 83%) and C. albicans (TNFα, 83.3%; IL-6, 90.1%) respectively. Proteomic analyses of microbes demonstrated that ACV impaired cell integrity, organelles and protein expression. ACV treatment resulted in an absence in expression of DNA starvation protein, citrate synthase, isocitrate and malate dehydrogenases in E-coli; chaperone protein DNak and ftsz in S. aureus and pyruvate kinase, 6-phosphogluconate dehydrogenase, fructose bisphosphate were among the enzymes absent in C.albican cultures. The results demonstrate ACV has multiple antimicrobial potential with clinical therapeutic implications.

Vasopressin up-regulates the expression of growth-related immediate-early genes via two distinct EGF receptor transactivation pathways

PubMed Central

Fuentes, Lida Q.; Reyes, Carlos E.; Sarmiento, José M.; Villanueva, Carolina I.; Figueroa, Carlos D.; Navarro, Javier; González, Carlos B.

2008-01-01

Activation of V1a receptor triggers the expression of growth-related immediate-early genes (IEGs), including c-Fos and Egr-1. Here we found that pre-treatment of rat vascular smooth muscle A-10 cell line with the EGF receptor inhibitor AG1478 or the over-expression of an EGFR dominant negative mutant (HEBCD533) blocked the vasopressin-induced expression of IEGs, suggesting that activation of these early genes mediated by V1a receptor is via transactivation of the EGF receptor. Importantly, the inhibition of the metalloproteinases, which catalyzed the shedding of the EGF receptor agonist HB-EGF, selectively blocked the vasopressin-induced expression c-Fos. On the other hand, the inhibition of c-Src selectively blocked the vasopressin-induced expression of Egr-1. Interestingly, in contrast to the expression of c-Fos, the expression of Egr-1 was mediated via the Ras/MEK/MAPK-dependent signalling pathway. Vasopressin-triggered expression of both genes required the release of intracellular calcium, activation of PKC and β-arrestin 2. These findings demonstrated that vasopressin up-regulated the expression of c-Fos and Erg-1 via transactivation of two distinct EGF receptor-dependent signalling pathways. PMID:18571897

A transgenic reporter under control of an es1 promoter/enhancer marks wound epidermis and apical epithelial cap during tail regeneration in Xenopus laevis tadpole.

PubMed

Sato, Kentaro; Umesono, Yoshihiko; Mochii, Makoto

2018-01-15

Rapid wound healing and subsequent formation of the apical epithelial cap (AEC) are believed to be required for successful appendage regeneration in amphibians. Despite the significant role of AEC in limb regeneration, its role in tail regeneration and the mechanisms that regulate the wound healing and AEC formation are not well understood. We previously identified Xenopus laevis es1, which is preferentially expressed in wounded regions, including the AEC after tail regeneration. In this study we established and characterized transgenic Xenopus laevis lines harboring the enhanced green fluorescent protein (EGFP) gene under control of an es1 gene regulatory sequence (es1:egfp). The EGFP reporter expression was clearly seen in several regions of the embryo and then declined to an undetectable level in larvae, recapitulating the endogenous es1 expression. After amputation of the tadpole tail, EGFP expression was re-activated at the edge of the stump epidermis and then increased in the wound epidermis (WE) covering the amputation surface. As the stump started to regenerate, the EGFP expression became restricted to the most distal epidermal region, including the AEC. EGFP was preferentially expressed in the basal or deep cells but not in the superficial cells of the WE and AEC. We performed a small-scale pharmacological screening for chemicals that affected the expression of EGFP in the stump epidermis after tail amputation. The EGFP expression was attenuated by treatment with an inhibitor for ERK, TGF-β or reactive oxygen species (ROS) signaling. These treatments also impaired wound closure of the amputation surface, suggesting that the three signaling activities are required for es1 expression in the WE and successful wound healing after tail amputation. These findings showed that es1:egfp Xenopus laevis should be a useful tool to analyze molecular mechanisms regulating wound healing and appendage regeneration. Copyright © 2017 Elsevier Inc. All rights reserved.

Transient development of ovotestes in XX Sox9 transgenic mice

PubMed Central

Gregoire, Elodie P.; Lavery, Rowena; Chassot, Anne-Amandine; Akiyama, Haruhiko; Treier, Mathias; Behringer, Richard R.; Chaboissier, Marie-Christine

2010-01-01

The sex of an individual results from the paternal transmission of the SRY gene located on the Y chromosome. In turn, SRY initiates Sox9 expression, a transcription factor required for testicular differentiation. Ectopic activation of SOX9 in XX Wt1:Sox9 transgenic mice, induces female-to-male sex reversal in adult mice. Here we show that complete sex reversal is preceded by a transient phase of ovotestis differentiation with XX Wt1:Sox9 transgenic gonads containing a testicular central region and one or both ovarian poles indicating that Wt1:Sox9 is not as efficient as Sry to induce male development. In XX Wt1:Sox9Tg/+ gonads, transgenic Sox9 is expressed earlier than Sox9 in XY gonads, and is able to induce the expression of EGFP, knocked into the 3′ UTR of Sox9 indicating that SOX9 is involved in the initiation and maintenance of its own expression. However, the delayed onset of expression of endogenous Sox9-EGFP suggests that this activation requires other factors, whose expression depends on SOX9. In the testicular regions of the XX Wt1:Sox9 ovotestes, proliferation of the XX foetal germ cells is hampered and they differentiate as pro-spermatogonia. This indicates that XX germ cells are not competent to respond to proliferative signals released from a testicular environment. In the ovarian regions, despite the continuous mRNA expression of the WT1:Sox9 transgene, the SOX9 protein does not accumulate suggesting that regulation of this gene in ovarian cells involves post-transcriptional mechanisms. Finally, ovarian cells of the XX Wt1:Sox9 ovotestis undergo apoptosis during late embryogenesis leading to complete female-to-male sex reversal of the transgenic mice at birth. PMID:20965161

ARG1 Functions in the Physiological Adaptation of Undifferentiated Plant Cells to Spaceflight

NASA Astrophysics Data System (ADS)

Zupanska, Agata K.; Schultz, Eric R.; Yao, JiQiang; Sng, Natasha J.; Zhou, Mingqi; Callaham, Jordan B.; Ferl, Robert J.; Paul, Anna-Lisa

2017-11-01

Scientific access to spaceflight and especially the International Space Station has revealed that physiological adaptation to spaceflight is accompanied or enabled by changes in gene expression that significantly alter the transcriptome of cells in spaceflight. A wide range of experiments have shown that plant physiological adaptation to spaceflight involves gene expression changes that alter cell wall and other metabolisms. However, while transcriptome profiling aptly illuminates changes in gene expression that accompany spaceflight adaptation, mutation analysis is required to illuminate key elements required for that adaptation. Here we report how transcriptome profiling was used to gain insight into the spaceflight adaptation role of Altered response to gravity 1 (Arg1), a gene known to affect gravity responses in plants on Earth. The study compared expression profiles of cultured lines of Arabidopsis thaliana derived from wild-type (WT) cultivar Col-0 to profiles from a knock-out line deficient in the gene encoding ARG1 (ARG1 KO), both on the ground and in space. The cell lines were launched on SpaceX CRS-2 as part of the Cellular Expression Logic (CEL) experiment of the BRIC-17 spaceflight mission. The cultured cell lines were grown within 60 mm Petri plates in Petri Dish Fixation Units (PDFUs) that were housed within the Biological Research In Canisters (BRIC) hardware. Spaceflight samples were fixed on orbit. Differentially expressed genes were identified between the two environments (spaceflight and comparable ground controls) and the two genotypes (WT and ARG1 KO). Each genotype engaged unique genes during physiological adaptation to the spaceflight environment, with little overlap. Most of the genes altered in expression in spaceflight in WT cells were found to be Arg1-dependent, suggesting a major role for that gene in the physiological adaptation of undifferentiated cells to spaceflight.

Temporal requirements of the fragile X mental retardation protein in the regulation of synaptic structure.

PubMed

Gatto, Cheryl L; Broadie, Kendal

2008-08-01

Fragile X syndrome (FraX), caused by the loss-of-function of one gene (FMR1), is the most common inherited form of both mental retardation and autism spectrum disorders. The FMR1 product (FMRP) is an mRNA-binding translation regulator that mediates activity-dependent control of synaptic structure and function. To develop any FraX intervention strategy, it is essential to define when and where FMRP loss causes the manifestation of synaptic defects, and whether the reintroduction of FMRP can restore normal synapse properties. In the Drosophila FraX model, dFMRP loss causes neuromuscular junction (NMJ) synapse over-elaboration (overgrowth, overbranching, excess synaptic boutons), accumulation of development-arrested satellite boutons, and altered neurotransmission. We used the Gene-Switch method to conditionally drive dFMRP expression to define the spatiotemporal requirements in synaptic mechanisms. Constitutive induction of targeted neuronal dFMRP at wild-type levels rescues all synaptic architectural defects in Drosophila Fmr1 (dfmr1)-null mutants, demonstrating a presynaptic requirement for synapse structuring. By contrast, presynaptic dFMRP expression does not ameliorate functional neurotransmission defects, indicating a postsynaptic dFMRP requirement. Strikingly, targeted early induction of dFMRP effects nearly complete rescue of synaptic structure defects, showing a primarily early-development role. In addition, acute dFMRP expression at maturity partially alleviates dfmr1-null defects, although rescue is not as complete as either early or constitutive dFMRP expression, showing a modest capacity for late-stage structural plasticity. We conclude that dFMRP predominantly acts early in synaptogenesis to modulate architecture, but that late dFMRP introduction at maturity can weakly compensate for early absence of dFMRP function.

Cerebellar GABAergic progenitors adopt an external granule cell-like phenotype in the absence of Ptf1a transcription factor expression.

PubMed

Pascual, Marta; Abasolo, Ibane; Mingorance-Le Meur, Ana; Martínez, Albert; Del Rio, José A; Wright, Christopher V E; Real, Francisco X; Soriano, Eduardo

2007-03-20

We report in this study that, in the cerebellum, the pancreatic transcription factor Ptf1a is required for the specific generation of Purkinje cells (PCs) and interneurons. Moreover, granule cell progenitors in the external GCL (EGL) appear to be unaffected by deletion of Ptf1a. Cell lineage analysis in Ptf1a(Cre/Cre) mice was used to establish that, in the absence of Ptf1a expression, ventricular zone progenitors, normally fated to produce PCs and interneurons, aberrantly migrate to the EGL and express typical markers of these cells, such as Math1, Reelin, and Zic1/2. Furthermore, these cells have a fine structure typical of EGL progenitors, indicating that they adopt an EGL-like cell phenotype. These findings indicate that Ptf1a is necessary for the specification and normal production of PCs and cerebellar interneurons. Moreover, our results suggest that Ptf1a is also required for the suppression of the granule cell specification program in cerebellar ventricular zone precursors.

β-Catenin Is Required for Hair-Cell Differentiation in the Cochlea

PubMed Central

Hu, Lingxiang; Jacques, Bonnie E.; Mulvaney, Joanna F.; Dabdoub, Alain

2014-01-01

The development of hair cells in the auditory system can be separated into steps; first, the establishment of progenitors for the sensory epithelium, and second, the differentiation of hair cells. Although the differentiation of hair cells is known to require the expression of basic helix-loop-helix transcription factor, Atoh1, the control of cell proliferation in the region of the developing cochlea that will ultimately become the sensory epithelium and the cues that initiate Atoh1 expression remain obscure. We assessed the role of Wnt/β-catenin in both steps in gain- and loss-of-function models in mice. The canonical Wnt pathway mediator, β-catenin, controls the expression of Atoh1. Knock-out of β-catenin inhibited hair-cell, as well as pillar-cell, differentiation from sensory progenitors but was not required to maintain a hair-cell fate once specified. Constitutive activation of β-catenin expanded sensory progenitors by inducing additional cell division and resulted in the differentiation of extra hair cells. Our data demonstrate that β-catenin plays a role in cell division and differentiation in the cochlear sensory epithelium. PMID:24806673

Expression of p27Kip1 and E-cadherin in Head and Neck Squamous Cell Carcinoma of Indonesian Patients.

PubMed

E I, Auerkari; V, Joewono; D R, Handjari; A T, Sarwono; A W, Suhartono; K, Eto; M A, Ikeda

2014-01-01

Cancer cells exhibit characteristic damage of DNA and its expression. The expression of the tumor suppressors E-cadherin and p27(Kip1) has been tested on 57 head and neck squamous cell carcinomas (HNSCC) of Indonesian subjects. HNSCC tumor samples including both primary and (unrelated) nodal cases were obtained from the archives of Indonesian hospitals, in accordance with acknowledged ethical requirements. Only modest correlation was found between reduced expression of E-cadherin or p27(Kip1) with increased malignancy of primary and nodal growth. The observed strong correlation regardless of malignancy between the expressed levels of E-cadherin and p27(Kip1) suggests that also in combination these would not help to better predict the outcome of HNSCC.

Intersection of FOXO- and RUNX1-mediated gene expression programs in single breast epithelial cells during morphogenesis and tumor progression.

PubMed

Wang, Lixin; Brugge, Joan S; Janes, Kevin A

2011-10-04

Gene expression networks are complicated by the assortment of regulatory factors that bind DNA and modulate transcription combinatorially. Single-cell measurements can reveal biological mechanisms hidden by population averages, but their value has not been fully explored in the context of mRNA regulation. Here, we adapted a single-cell expression profiling technique to examine the gene expression program downstream of Forkhead box O (FOXO) transcription factors during 3D breast epithelial acinar morphogenesis. By analyzing patterns of mRNA fluctuations among individual matrix-attached epithelial cells, we found that a subset of FOXO target genes was jointly regulated by the transcription factor Runt-related transcription factor 1 (RUNX1). Knockdown of RUNX1 causes hyperproliferation and abnormal morphogenesis, both of which require normal FOXO function. Down-regulating RUNX1 and FOXOs simultaneously causes widespread oxidative stress, which arrests proliferation and restores normal acinar morphology. In hormone-negative breast cancers lacking human epidermal growth factor receptor 2 (HER2) amplification, we find that RUNX1 down-regulation is strongly associated with up-regulation of FOXO1, which may be required to support growth of RUNX1-negative tumors. The coordinate function of these two tumor suppressors may provide a failsafe mechanism that inhibits cancer progression.

Neural crest specification and migration independently require NSD3-related lysine methyltransferase activity

PubMed Central

Jacques-Fricke, Bridget T.; Gammill, Laura S.

2014-01-01

Neural crest precursors express genes that cause them to become migratory, multipotent cells, distinguishing them from adjacent stationary neural progenitors in the neurepithelium. Histone methylation spatiotemporally regulates neural crest gene expression; however, the protein methyltransferases active in neural crest precursors are unknown. Moreover, the regulation of methylation during the dynamic process of neural crest migration is unclear. Here we show that the lysine methyltransferase NSD3 is abundantly and specifically expressed in premigratory and migratory neural crest cells. NSD3 expression commences before up-regulation of neural crest genes, and NSD3 is necessary for expression of the neural plate border gene Msx1, as well as the key neural crest transcription factors Sox10, Snail2, Sox9, and FoxD3, but not gene expression generally. Nevertheless, only Sox10 histone H3 lysine 36 dimethylation requires NSD3, revealing unexpected complexity in NSD3-dependent neural crest gene regulation. In addition, by temporally limiting expression of a dominant negative to migratory stages, we identify a novel, direct requirement for NSD3-related methyltransferase activity in neural crest migration. These results identify NSD3 as the first protein methyltransferase essential for neural crest gene expression during specification and show that NSD3-related methyltransferase activity independently regulates migration. PMID:25318671

Neuropilin-1 interacts with the second branchial arch microenvironment to mediate chick neural crest cell dynamics

PubMed Central

McLennan, Rebecca; Kulesa, Paul M.

2011-01-01

Cranial neural crest cells (NCCs) require neuropilin signaling to reach and invade the branchial arches. Here, we use an in vivo chick model to investigate whether the neuropilin-1 knockdown phenotype is specific to the second branchial arch (ba2), changes in NCC behaviors and phenotypic consequences, and whether neuropilins work together to facilitate entry into and invasion of ba2. We find that cranial NCCs with reduced neuropilin-1 expression displayed shorter protrusions and decreased cell body and nuclear length-to-width ratios characteristic of a loss in polarity and motility, after specific interaction with ba2. Directed NCC migration was rescued by transplantation of transfected cells into rhombomere 4 of younger hosts. Lastly, reduction of neuropilin-2 expression by shRNA either solely or with reduction of neuropilin-1 expression did not lead to a stronger head phenotype. Thus, NCCs, independent of rhombomere origin, require neuropilin-1, but not neuropilin-2 to maintain polarity and directed migration into ba2. PMID:20503363

Modeling Conformational Transitions and Energetics of Ligand Binding with the Glutamate Receptor Ligand Binding Domain

NASA Astrophysics Data System (ADS)

Kurnikova, Maria

2009-03-01

Understanding of protein motion and energetics of conformational transitions is crucial to understanding protein function. The glutamate receptor ligand binding domain (GluR2 S1S2) is a two lobe protein, which binds ligand at the interface of two lobes and undergoes conformational transition. The cleft closure conformational transition of S1S2 has been implicated in gating of the ion channel formed by the transmembrane domain of the receptor. In this study we present a composite multi-faceted theoretical analysis of the detailed mechanism of this conformational transition based on rigid cluster decomposition of the protein structure [1] and identifying hydrogen bonds that are responsible for stabilizing the closed conformation [2]. Free energy of the protein reorganization upon ligand binding was calculated using combined Thermodynamic Integration (TI) and Umbrella Sampling (US) simulations [3]. Ligand -- protein interactions in the binding cleft were analyzed using Molecular Dynamics, continuum electrostatics and QM/MM models [4]. All model calculations compare well with corresponding experimental measurements. [4pt] [1] Protein Flexibility using Constraints from Molecular Dynamics Simulations T. Mamonova, B. Hespenheide, R. Straub, M. F. Thorpe, M. G. Kurnikova , Phys. Biol., 2, S137 (2005)[0pt] [2] Theoretical Study of the Glutamate Receptor Ligand Binding Domain Flexibility and Conformational Reorganization T. Mamonova, K. Speranskiy, and M. Kurnikova , Prot.: Struct., Func., Bioinf., 73,656 (2008)[0pt] [3] Energetics of the cleft closing transition and glutamate binding in the Glutamate Receptor ligand Binding Domain T. Mamonova, M. Yonkunas, and M. Kurnikova Biochemistry 47, 11077 (2008)[0pt] [4] On the Binding Determinants of the Glutamate Agonist with the Glutamate Receptor Ligand Binding Domain K. Speranskiy and M. Kurnikova Biochemistry 44, 11208 (2005)

A Phosphoinositide 3-Kinase (PI3K)-serum- and glucocorticoid-inducible Kinase 1 (SGK1) Pathway Promotes Kv7.1 Channel Surface Expression by Inhibiting Nedd4-2 Protein*

PubMed Central

Andersen, Martin Nybo; Krzystanek, Katarzyna; Petersen, Frederic; Bomholtz, Sofia Hammami; Olesen, Søren-Peter; Abriel, Hugues; Jespersen, Thomas; Rasmussen, Hanne Borger

2013-01-01

Epithelial cell polarization involves several kinase signaling cascades that eventually divide the surface membrane into an apical and a basolateral part. One kinase, which is activated during the polarization process, is phosphoinositide 3-kinase (PI3K). In MDCK cells, the basolateral potassium channel Kv7.1 requires PI3K activity for surface-expression during the polarization process. Here, we demonstrate that Kv7.1 surface expression requires tonic PI3K activity as PI3K inhibition triggers endocytosis of these channels in polarized MDCK. Pharmacological inhibition of SGK1 gave similar results as PI3K inhibition, whereas overexpression of constitutively active SGK1 overruled it, suggesting that SGK1 is the primary downstream target of PI3K in this process. Furthermore, knockdown of the ubiquitin ligase Nedd4-2 overruled PI3K inhibition, whereas a Nedd4-2 interaction-deficient Kv7.1 mutant was resistant to both PI3K and SGK1 inhibition. Altogether, these data suggest that a PI3K-SGK1 pathway stabilizes Kv7.1 surface expression by inhibiting Nedd4-2-dependent endocytosis and thereby demonstrates that Nedd4-2 is a key regulator of Kv7.1 localization and turnover in epithelial cells. PMID:24214981

A phosphoinositide 3-kinase (PI3K)-serum- and glucocorticoid-inducible kinase 1 (SGK1) pathway promotes Kv7.1 channel surface expression by inhibiting Nedd4-2 protein.

PubMed

Andersen, Martin Nybo; Krzystanek, Katarzyna; Petersen, Frederic; Bomholtz, Sofia Hammami; Olesen, Søren-Peter; Abriel, Hugues; Jespersen, Thomas; Rasmussen, Hanne Borger

2013-12-27

Epithelial cell polarization involves several kinase signaling cascades that eventually divide the surface membrane into an apical and a basolateral part. One kinase, which is activated during the polarization process, is phosphoinositide 3-kinase (PI3K). In MDCK cells, the basolateral potassium channel Kv7.1 requires PI3K activity for surface-expression during the polarization process. Here, we demonstrate that Kv7.1 surface expression requires tonic PI3K activity as PI3K inhibition triggers endocytosis of these channels in polarized MDCK. Pharmacological inhibition of SGK1 gave similar results as PI3K inhibition, whereas overexpression of constitutively active SGK1 overruled it, suggesting that SGK1 is the primary downstream target of PI3K in this process. Furthermore, knockdown of the ubiquitin ligase Nedd4-2 overruled PI3K inhibition, whereas a Nedd4-2 interaction-deficient Kv7.1 mutant was resistant to both PI3K and SGK1 inhibition. Altogether, these data suggest that a PI3K-SGK1 pathway stabilizes Kv7.1 surface expression by inhibiting Nedd4-2-dependent endocytosis and thereby demonstrates that Nedd4-2 is a key regulator of Kv7.1 localization and turnover in epithelial cells.

Expression of alpha V integrin is modulated by Epstein-Barr virus nuclear antigen 3C and the metastasis suppressor Nm23-H1 through interaction with the GATA-1 and Sp1 transcription factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choudhuri, Tathagata; Verma, Subhash C.; Lan, Ke

Epstein-Barr virus (EBV) is a lymphotrophic herpesvirus infecting most of the world's population. It is associated with a number of human lymphoid and epithelial tumors and lymphoproliferative diseases in immunocompromised patients. A subset of latent EBV antigens is required for immortalization of primary B-lymphocytes. The metastatic suppressor Nm23-H1 which is downregulated in human invasive breast carcinoma reduces the migration and metastatic activity of breast carcinoma cells when expressed from a heterologous promoter. Interestingly, the EBV nuclear antigen 3C (EBNA3C) reverses these activities of Nm23-H1. The alpha V integrins recognize a variety of ligands for signaling and are involved in cellmore » migration and proliferation and also serve as major receptors for extracellular-matrix-mediated cell adhesion and migration. The goal of this study was to determine if Nm23-H1 and EBNA3C can modulate alpha V integrin expression and downstream activities. The results of our studies indicate that Nm23-H1 downregulates alpha V intregrin expression in a dose responsive manner. In contrast, EBNA3C can upregulate alpha V integrin expression. Furthermore, the study showed that the association of the Sp1 and GATA transcription factors with Nm23-H1 is required for modulation of the alpha V integrin activity. Thus, these results suggest a direct correlation between the alpha V integrin expression and the interaction of Nm23-H1 with EBNA3C.« less

Regulation of the Osem gene by abscisic acid and the transcriptional activator VP1: analysis of cis-acting promoter elements required for regulation by abscisic acid and VP1.

PubMed

Hattori, T; Terada, T; Hamasuna, S

1995-06-01

Osem, a rice gene homologous to the wheat Em gene, which encodes one of the late-embryogenesis abundant proteins was isolated. The gene was characterized with respect to control of transcription by abscisic acid (ABA) and the transcriptional activator VP1, which is involved in the ABA-regulated gene expression during late embryo-genesis. A fusion gene (Osem-GUS) consisting of the Osem promoter and the bacterial beta-glucuronidase (GUS) gene was constructed and tested in a transient expression system, using protoplasts derived from a suspension-cultured line of rice cells, for activation by ABA and by co-transfection with an expression vector (35S-Osvp1) for the rice VP1 (OSVP1) cDNA. The expression of Osem-GUS was strongly (40- to 150-fold) activated by externally applied ABA and by over-expression of (OS)VP1. The Osem promoter has three ACGTG-containing sequences, motif A, motif B and motif A', which resemble the abscisic acid-responsive element (ABRE) that was previously identified in the wheat Em and the rice Rab16. There is also a CATGCATG sequence, which is known as the Sph box and is shown to be essential for the regulation by VP1 of the maize anthocyanin regulatory gene C1. Focusing on these sequence elements, various mutant derivatives of the Osem promoter in the transient expression system were assayed. The analysis revealed that motif A functions not only as an ABRE but also as a sequence element required for the regulation by (OS)VP1.

Mouse cones require an arrestin for normal inactivation of phototransduction.

PubMed

Nikonov, Sergei S; Brown, Bruce M; Davis, Jason A; Zuniga, Freddi I; Bragin, Alvina; Pugh, Edward N; Craft, Cheryl M

2008-08-14

Arrestins are proteins that arrest the activity of G protein-coupled receptors (GPCRs). While it is well established that normal inactivation of photoexcited rhodopsin, the GPCR of rod phototransduction, requires arrestin (Arr1), it has been controversial whether the same requirement holds for cone opsin inactivation. Mouse cone photoreceptors express two distinct visual arrestins: Arr1 and Arr4. By means of recordings from cones of mice with one or both arrestins knocked out, this investigation establishes that a visual arrestin is required for normal cone inactivation. Arrestin-independent inactivation is 70-fold more rapid in cones than in rods, however. Dual arrestin expression in cones could be a holdover from ancient genome duplication events that led to multiple isoforms of arrestin, allowing evolutionary specialization of one form while the other maintains the basic function.

Permeation and block of TRPV1 channels by the cationic lidocaine derivative QX-314

PubMed Central

Puopolo, Michelino; Binshtok, Alexander M.; Yao, Gui-Lan; Oh, Seog Bae; Woolf, Clifford J.

2013-01-01

QX-314 (N-ethyl-lidocaine) is a cationic lidocaine derivative that blocks voltage-dependent sodium channels when applied internally to axons or neuronal cell bodies. Coapplication of external QX-314 with the transient receptor potential vanilloid 1 protein (TRPV1) agonist capsaicin produces long-lasting sodium channel inhibition in TRPV1-expressing neurons, suggestive of QX-314 entry into the neurons. We asked whether QX-314 entry occurs directly through TRPV1 channels or through a different pathway (e.g., pannexin channels) activated downstream of TRPV1 and whether QX-314 entry requires the phenomenon of “pore dilation” previously reported for TRPV1. With external solutions containing 10 or 20 mM QX-314 as the only cation, inward currents were activated by stimulation of both heterologously expressed and native TRPV1 channels in rat dorsal root ganglion neurons. QX-314-mediated inward current did not require pore dilation, as it activated within several seconds and in parallel with Cs-mediated outward current, with a reversal potential consistent with PQX-314/PCs = 0.12. QX-314-mediated current was no different when TRPV1 channels were expressed in C6 glioma cells, which lack expression of pannexin channels. Rapid addition of QX-314 to physiological external solutions produced instant partial inhibition of inward currents carried by sodium ions, suggesting that QX-314 is a permeant blocker. Maintained coapplication of QX-314 with capsaicin produced slowly developing reduction of outward currents carried by internal Cs, consistent with intracellular accumulation of QX-314 to concentrations of 50–100 μM. We conclude that QX-314 is directly permeant in the “standard” pore formed by TRPV1 channels and does not require either pore dilation or activation of additional downstream channels for entry. PMID:23303863

Increasing the GluN2A/GluN2B Ratio in Neurons of the Mouse Basal and Lateral Amygdala Inhibits the Modification of an Existing Fear Memory Trace.

PubMed

Holehonnur, Roopashri; Phensy, Aarron J; Kim, Lily J; Milivojevic, Milica; Vuong, Dat; Daison, Delvin K; Alex, Saira; Tiner, Michael; Jones, Lauren E; Kroener, Sven; Ploski, Jonathan E

2016-09-07

Reconsolidation updating is a form of memory modification in which an existing memory can become destabilized upon retrieval and subsequently be modified via protein-synthesis-dependent reconsolidation. However, not all memories appear to destabilize upon retrieval and thus are not modifiable via reconsolidation updating approaches and the neurobiological basis for this remains poorly understood. Here, we report that auditory fear memories created with 10 tone-shock pairings are resistant to retrieval-dependent memory destabilization and are associated with an increase in the synaptic GluN2A/GluN2B ratio in neurons of the basal and lateral amygdala (BLA) compared with weaker fear memories created via one or three tone-shock pairings. To increase the GluN2A/GluN2B ratio after learning, we generated a line of mice that expresses an inducible and doxycycline-dependent GFP-GluN2A transgene specifically in α-CaMKII-positive neurons. Our findings indicate that increasing the GluN2A/GluN2B ratio in BLA α-CaMKII-positive neurons after a weak fear memory has consolidated inhibits retrieval-dependent memory destabilization and modification of the fear memory trace. This was associated with a reduction in retrieval-dependent AMPA receptor trafficking, as evidenced by a reduction in retrieval-dependent phosphorylation of GluR1 at serine-845. In addition, we determined that increasing the GluN2A/GluN2B ratio before fear learning significantly impaired long term memory consolidation, whereas short-term memory remained unaltered. An increase in the GluN2A/GluN2B ratio after fear learning had no influence on fear extinction or expression. Our results underscore the importance of NMDAR subunit composition for memory destabilization and suggest a mechanism for why some memories are resistant to modification. Memory modification using reconsolidation updating is being examined as one of the potential treatment approaches for attenuating maladaptive memories associated with emotional disorders. However, studies have shown that, whereas weak memories can be modified using reconsolidation updating, strong memories can be resistant to this approach. Therefore, treatments targeting the reconsolidation process are unlikely to be clinically effective unless methods are devised to enhance retrieval-dependent memory destabilization. Currently, little is known about the cellular and molecular events that influence the induction of reconsolidation updating. Here, we determined that an increase in the GluN2A/GluN2B ratio interferes with retrieval-dependent memory destabilization and inhibits the initiation of reconsolidation updating. Copyright © 2016 the authors 0270-6474/16/369490-15$15.00/0.

T-bet Down-Modulation in Tolerized Th1 Effector CD4 Cells Confers a TCR-Distal Signaling Defect That Selectively Impairs IFN-γ Expression1

PubMed Central

Long, Meixiao; Slaiby, Aaron M.; Hagymasi, Adam T.; Mihalyo, Marianne A.; Lichtler, Alexander C.; Reiner, Steven L.; Adler, Adam J.

2010-01-01

When Th1 effector CD4 cells encounter tolerizing Ag in vivo, their capacity to express the effector cytokines IFN-γ and TNF-α is lost more rapidly than noneffector functions such as IL-2 production and proliferation. To localize the relevant intracellular signaling defects, cytokine expression was compared following restimulation with Ag vs agents that bypass TCR-proximal signaling. IFN-γ and TNF-α expression were both partially rescued when TCR-proximal signaling was bypassed, indicating that both TCR-proximal and -distal signaling defects impair the expression of these two effector cytokines. In contrast, bypassing TCR-proximal signaling fully rescued IL-2 expression. T-bet, a transcription and chromatin remodeling factor that is required to direct the differentiation of naive CD4 cells into IFN-γ -expressing Th1 effectors, was partially down-modulated in tolerized Th1 effectors. Enforcing T-bet expression during tolerization selectively rescued the ability to express IFN-γ, but not TNF-α. Conversely, expression of a dominant-negative T-bet in Th1 effectors selectively impaired the ability to express IFN-γ, but not TNF-α. Analysis of histone acetylation at the IFN-γ promoter further suggested that down-modulation of T-bet expression during Th1 effector CD4 cell tolerization does not impair IFN-γ expression potential through alterations in chromatin structure. PMID:16393991

Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored Meleagrid herpesvirus type 1 vaccines

USDA-ARS?s Scientific Manuscript database

Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspe...

Differentiation State-Specific Mitochondrial Dynamic Regulatory Networks Are Revealed by Global Transcriptional Analysis of the Developing Chicken Lens

PubMed Central

Chauss, Daniel; Basu, Subhasree; Rajakaruna, Suren; Ma, Zhiwei; Gau, Victoria; Anastas, Sara; Brennan, Lisa A.; Hejtmancik, J. Fielding; Menko, A. Sue; Kantorow, Marc

2014-01-01

The mature eye lens contains a surface layer of epithelial cells called the lens epithelium that requires a functional mitochondrial population to maintain the homeostasis and transparency of the entire lens. The lens epithelium overlies a core of terminally differentiated fiber cells that must degrade their mitochondria to achieve lens transparency. These distinct mitochondrial populations make the lens a useful model system to identify those genes that regulate the balance between mitochondrial homeostasis and elimination. Here we used an RNA sequencing and bioinformatics approach to identify the transcript levels of all genes expressed by distinct regions of the lens epithelium and maturing fiber cells of the embryonic Gallus gallus (chicken) lens. Our analysis detected more than 15,000 unique transcripts expressed by the embryonic chicken lens. Of these, more than 3000 transcripts exhibited significant differences in expression between lens epithelial cells and fiber cells. Multiple transcripts coding for separate mitochondrial homeostatic and degradation mechanisms were identified to exhibit preferred patterns of expression in lens epithelial cells that require mitochondria relative to lens fiber cells that require mitochondrial elimination. These included differences in the expression levels of metabolic (DUT, PDK1, SNPH), autophagy (ATG3, ATG4B, BECN1, FYCO1, WIPI1), and mitophagy (BNIP3L/NIX, BNIP3, PARK2, p62/SQSTM1) transcripts between lens epithelial cells and lens fiber cells. These data provide a comprehensive window into all genes transcribed by the lens and those mitochondrial regulatory and degradation pathways that function to maintain mitochondrial populations in the lens epithelium and to eliminate mitochondria in maturing lens fiber cells. PMID:24928582

Nodal signalling in Xenopus: the role of Xnr5 in left/right asymmetry and heart development.

PubMed

Tadjuidje, Emmanuel; Kofron, Matthew; Mir, Adnan; Wylie, Christopher; Heasman, Janet; Cha, Sang-Wook

2016-08-01

Nodal class TGF-β signalling molecules play essential roles in establishing the vertebrate body plan. In all vertebrates, nodal family members have specific waves of expression required for tissue specification and axis formation. In Xenopus laevis, six nodal genes are expressed before gastrulation, raising the question of whether they have specific roles or act redundantly with each other. Here, we examine the role of Xnr5. We find it acts at the late blastula stage as a mesoderm inducer and repressor of ectodermal gene expression, a role it shares with Vg1. However, unlike Vg1, Xnr5 depletion reduces the expression of the nodal family member xnr1 at the gastrula stage. It is also required for left/right laterality by controlling the expression of the laterality genes xnr1, antivin (lefty) and pitx2 at the tailbud stage. In Xnr5-depleted embryos, the heart field is established normally, but symmetrical reduction in Xnr5 levels causes a severely stunted midline heart, first evidenced by a reduction in cardiac troponin mRNA levels, while left-sided reduction leads to randomization of the left/right axis. This work identifies Xnr5 as the earliest step in the signalling pathway establishing normal heart laterality in Xenopus. © 2016 The Authors.

Acquisition of heroin conditioned immunosuppression requires IL-1 signaling in the dorsal hippocampus.

PubMed

Lebonville, Christina L; Jones, Meghan E; Hutson, Lee W; Cooper, Letty B; Fuchs, Rita A; Lysle, Donald T

2016-08-01

Opioid users experience increased incidence of infection, which may be partially attributable to both direct opiate-immune interactions and conditioned immune responses. Previous studies have investigated the neural circuitry governing opioid conditioned immune responses, but work remains to elucidate the mechanisms mediating this effect. Our laboratory has previously shown that hippocampal IL-1 signaling, specifically, is required for the expression of heroin conditioned immunosuppression following learning. The current studies were designed to further characterize the role of hippocampal IL-1 in this phenomenon by manipulating IL-1 during learning. Experiment 1 tested whether hippocampal IL-1 is also required for the acquisition of heroin conditioned immunosuppression, while Experiment 2 tested whether hippocampal IL-1 is required for the expression of unconditioned heroin immunosuppression. We found that blocking IL-1 signaling in the dorsal hippocampus with IL-1RA during each conditioning session, but not on interspersed non-conditioning days, significantly attenuated the acquisition of heroin conditioned immunosuppression. Strikingly, we found that the same IL-1RA treatment did not alter unconditioned immunosuppression to a single dose of heroin. Thus, IL-1 signaling is not a critical component of the response to heroin but rather may play a role in the formation of the association between heroin and the context. Collectively, these studies suggest that IL-1 signaling, in addition to being involved in the expression of a heroin conditioned immune response, is also involved in the acquisition of this effect. Importantly, this effect is likely not due to blocking the response to the unconditioned stimulus since IL-1RA did not affect heroin's immunosuppressive effects. Copyright © 2016 Elsevier Inc. All rights reserved.

Acquisition of Heroin Conditioned Immunosuppression Requires IL-1 Signaling in the Dorsal Hippocampus

PubMed Central

Lebonville, Christina L.; Jones, Meghan E.; Hutson, Lee W.; Cooper, Letty B.; Lysle, Donald T.

2016-01-01

Opioid users experience increased incidence of infection, which may be partially attributable to both direct opiate-immune interactions and conditioned immune responses. Previous studies have investigated the neural circuitry governing opioid conditioned immune responses, but work remains to elucidate the mechanisms mediating this effect. Our laboratory has previously shown that hippocampal IL-1 signaling, specifically, is required for the expression of heroin conditioned immunosuppression following learning. The current studies were designed to further characterize the role of hippocampal IL-1 in this phenomenon by manipulating IL-1 during learning. Experiment 1 tested whether hippocampal IL-1 is also required for the acquisition of heroin conditioned immunosuppression, while Experiment 2 tested whether hippocampal IL-1 is required for the expression of unconditioned heroin immunosuppression. We found that blocking IL-1 signaling in the dorsal hippocampus with IL-1RA during each conditioning session, but not on interspersed non-conditioning days, significantly attenuated the acquisition of heroin conditioned immunosuppression. Strikingly, we found that the same IL-1RA treatment did not alter unconditioned immunosuppression to a single dose of heroin. Thus, IL-1 signaling is not a critical component of the response to heroin but rather may play a role in the formation of the association between heroin and the context. Collectively, these studies suggest that IL-1 signaling, in addition to being involved in the expression of a heroin conditioned immune response, is also involved in the acquisition of this effect. Importantly, this effect is likely not due to blocking the response to the unconditioned stimulus since IL-1RA did not affect heroin’s immunosuppressive effects. PMID:27072068

Human T Cell Leukemia Virus Type 1 Tax Inhibits Innate Antiviral Signaling via NF-κB-Dependent Induction of SOCS1▿

PubMed Central

Charoenthongtrakul, Soratree; Zhou, Qinjie; Shembade, Noula; Harhaj, Nicole S.; Harhaj, Edward W.

2011-01-01

Human T cell leukemia virus type 1 (HTLV-1) inhibits host antiviral signaling pathways although the underlying mechanisms are unclear. Here we found that the HTLV-1 Tax oncoprotein induced the expression of SOCS1, an inhibitor of interferon signaling. Tax required NF-κB, but not CREB, to induce the expression of SOCS1 in T cells. Furthermore, Tax interacted with SOCS1 in both transfected cells and in HTLV-1-transformed cell lines. Although SOCS1 is normally a short-lived protein, in the presence of Tax, the stability of SOCS1 was greatly increased. Accordingly, Tax enhanced the replication of a heterologous virus, vesicular stomatitis virus (VSV), in a SOCS1-dependent manner. Surprisingly, Tax required SOCS1 to inhibit RIG-I-dependent antiviral signaling, but not the interferon-induced JAK/STAT pathway. Inhibition of SOCS1 by RNA-mediated interference in the HTLV-1-transformed cell line MT-2 resulted in increased IFN-β expression accompanied by reduced HTLV-1 replication and p19Gag levels. Taken together, our results reveal that Tax inhibits antiviral signaling, in part, by hijacking an interferon regulatory protein. PMID:21593151

STAT5-glucocorticoid receptor interaction and MTF-1 regulate the expression of ZnT2 (Slc30a2) in pancreatic acinar cells

PubMed Central

Guo, Liang; Lichten, Louis A.; Ryu, Moon-Suhn; Liuzzi, Juan P.; Wang, Fudi; Cousins, Robert J.

2010-01-01

The exocrine pancreas plays an important role in endogenous zinc loss by regulating excretion into the intestinal tract and hence influences the dietary zinc requirement. The present experiments show that the zinc transporter ZnT2 (Slc30a2) is localized to the zymogen granules and that dietary zinc restriction in mice decreased the zinc concentration of zymogen granules and ZnT2 expression. Excess zinc given orally increased ZnT2 expression and was associated with increased pancreatic zinc accumulation. Rat AR42J acinar cells when induced into a secretory phenotype, using the glucocorticoid analog dexamethasone (DEX), exhibited increased ZnT2 expression and labile zinc as measured with a fluorophore. DEX administrated to mice also induced ZnT2 expression that accompanied a reduction of the pancreatic zinc content. ZnT2 promoter analyses identified elements required for responsiveness to zinc and DEX. Zinc regulation was traced to a MRE located downstream from the ZnT2 transcription start site. Responsiveness to DEX is produced by two upstream STAT5 binding sites that require the glucocorticoid receptor for activation. ZnT2 knockdown in the AR42J cells using siRNA resulted in increased cytoplasmic zinc and decreased zymogen granule zinc that further demonstrated that ZnT2 may mediate the sequestration of zinc into zymogen granules. We conclude, based upon experiments with intact mice and pancreatic acinar cells in culture, that ZnT2 participates in zinc transport into pancreatic zymogen granules through a glucocorticoid pathway requiring glucocorticoid receptor and STAT5, and zinc-regulated signaling pathways requiring MTF-1. The ZnT2 transporter appears to function in a physiologically responsive manner involving entero-pancreatic zinc trafficking. PMID:20133611

ARG1 Functions in the Physiological Adaptation of Undifferentiated Plant Cells to Spaceflight.

PubMed

Zupanska, Agata K; Schultz, Eric R; Yao, JiQiang; Sng, Natasha J; Zhou, Mingqi; Callaham, Jordan B; Ferl, Robert J; Paul, Anna-Lisa

2017-11-01

Scientific access to spaceflight and especially the International Space Station has revealed that physiological adaptation to spaceflight is accompanied or enabled by changes in gene expression that significantly alter the transcriptome of cells in spaceflight. A wide range of experiments have shown that plant physiological adaptation to spaceflight involves gene expression changes that alter cell wall and other metabolisms. However, while transcriptome profiling aptly illuminates changes in gene expression that accompany spaceflight adaptation, mutation analysis is required to illuminate key elements required for that adaptation. Here we report how transcriptome profiling was used to gain insight into the spaceflight adaptation role of Altered response to gravity 1 (Arg1), a gene known to affect gravity responses in plants on Earth. The study compared expression profiles of cultured lines of Arabidopsis thaliana derived from wild-type (WT) cultivar Col-0 to profiles from a knock-out line deficient in the gene encoding ARG1 (ARG1 KO), both on the ground and in space. The cell lines were launched on SpaceX CRS-2 as part of the Cellular Expression Logic (CEL) experiment of the BRIC-17 spaceflight mission. The cultured cell lines were grown within 60 mm Petri plates in Petri Dish Fixation Units (PDFUs) that were housed within the Biological Research In Canisters (BRIC) hardware. Spaceflight samples were fixed on orbit. Differentially expressed genes were identified between the two environments (spaceflight and comparable ground controls) and the two genotypes (WT and ARG1 KO). Each genotype engaged unique genes during physiological adaptation to the spaceflight environment, with little overlap. Most of the genes altered in expression in spaceflight in WT cells were found to be Arg1-dependent, suggesting a major role for that gene in the physiological adaptation of undifferentiated cells to spaceflight. Key Words: ARG1-Spaceflight-Gene expression-Physiological adaptation-BRIC. Astrobiology 17, 1077-1111.

Zebrafish no isthmus reveals a role for pax2.1 in tubule differentiation and patterning events in the pronephric primordia.

PubMed

Majumdar, A; Lun, K; Brand, M; Drummond, I A

2000-05-01

Pax genes are important developmental regulators and function at multiple stages of vertebrate kidney organogenesis. In this report, we have used the zebrafish pax2.1 mutant no isthmus to investigate the role for pax2.1 in development of the pronephros. We demonstrate a requirement for pax2.1 in multiple aspects of pronephric development including tubule and duct epithelial differentiation and cloaca morphogenesis. Morphological analysis demonstrates that noi(- )larvae specifically lack pronephric tubules while glomerular cell differentiation is unaffected. In addition, pax2.1 expression in the lateral cells of the pronephric primordium is required to restrict the domains of Wilms' tumor suppressor (wt1) and vascular endothelial growth factor (VEGF) gene expression to medial podocyte progenitors. Ectopic podocyte-specific marker expression in pronephric duct cells correlates with loss of expression of the pronephric tubule and duct-specific markers mAb 3G8 and a Na(+)/K(+) ATPase (&agr;)1 subunit. The results suggest that the failure in pronephric tubule differentiation in noi arises from a patterning defect during differentiation of the pronephric primordium and that mutually inhibitory regulatory interactions play an important role in defining the boundary between glomerular and tubule progenitors in the forming nephron.

Energy homeostasis targets chromosomal reconfiguration of the human GH1 locus.

PubMed

Vakili, Hana; Jin, Yan; Cattini, Peter A

2014-11-01

Levels of pituitary growth hormone (GH), a metabolic homeostatic factor with strong lipolytic activity, are decreased in obese individuals. GH declines prior to the onset of weight gain in response to excess caloric intake and hyperinsulinemia; however, the mechanism by which GH is reduced is not clear. We used transgenic mice expressing the human GH (hGH) gene, GH1, to assess the effect of high caloric intake on expression as well as the local chromosome structure of the intact GH1 locus. Animals exposed to 3 days of high caloric intake exhibited hyperinsulinemia without hyperglycemia and a decrease in both hGH synthesis and secretion, but no difference in endogenous production of murine GH. Efficient GH1 expression requires a long-range intrachromosomal interaction between remote enhancer sequences and the proximal promoter region through "looping" of intervening chromatin. High caloric intake disrupted this interaction and decreased both histone H3/H4 hyperacetylation and RNA polymerase II occupancy at the GH1 promoter. Incorporation of physical activity muted the effects of excess caloric intake on insulin levels, GH1 promoter hyperacetylation, chromosomal architecture, and expression. These results indicate that energy homeostasis alters postnatal hGH synthesis through dynamic changes in the 3-dimensional chromatin structure of the GH1 locus, including structures required for cell type specificity during development.

DMRT1 Is Required for Mouse Spermatogonial Stem Cell Maintenance and Replenishment.

PubMed

Zhang, Teng; Oatley, Jon; Bardwell, Vivian J; Zarkower, David

2016-09-01

Male mammals produce sperm for most of postnatal life and therefore require a robust germ line stem cell system, with precise balance between self-renewal and differentiation. Prior work established doublesex- and mab-3-related transcription factor 1 (Dmrt1) as a conserved transcriptional regulator of male sexual differentiation. Here we investigate the role of Dmrt1 in mouse spermatogonial stem cell (SSC) homeostasis. We find that Dmrt1 maintains SSCs during steady state spermatogenesis, where it regulates expression of Plzf, another transcription factor required for SSC maintenance. We also find that Dmrt1 is required for recovery of spermatogenesis after germ cell depletion. Committed progenitor cells expressing Ngn3 normally do not contribute to SSCs marked by the Id4-Gfp transgene, but do so when spermatogonia are chemically depleted using busulfan. Removal of Dmrt1 from Ngn3-positive germ cells blocks the replenishment of Id4-GFP-positive SSCs and recovery of spermatogenesis after busulfan treatment. Our data therefore reveal that Dmrt1 supports SSC maintenance in two ways: allowing SSCs to remain in the stem cell pool under normal conditions; and enabling progenitor cells to help restore the stem cell pool after germ cell depletion.

Expression of Voltage-Gated Sodium Channel Nav1.8 in Human Prostate Cancer is Associated with High Histological Grade

PubMed Central

Suy, Simeng; Hansen, Todd P.; Auto, Heather D.; Kallakury, Bhaskar V.S.; Dailey, Vernon; Danner, Malika; MacArthur, Linda; Zhang, Ying; Miessau, Matthew J.; Collins, Sean P.; Brown, Milton L.

2013-01-01

Voltage-gated sodium (Nav) channels are required for impulse conductance in excitable tissues. Navs have been linked to human cancers, including prostate. The expression and distribution of Nav isoforms (Nav1.1-Nav1.9) in human prostate cancer are not well established. Here, we evaluated the expression of these isoforms and investigated the expression of Nav1.8 in human prostate cancer tissues. Nav1.8 was highly expressed in all examined cells. Expression of Nav1.1, Nav1.2, and Nav1.9 were high in DU-145, PC-3 and PC-3M cells compared to LNCaP (hormone-dependent), C4-2, C4-2B, and CWR22Rv-1 cells. Nav1.5 and Nav1.6 were expressed in all cells examined. Nav1.7 expression was absent in PC-3M and CWR22Rv-1, but expressed in the other cells examined. Immunohistochemistry revealed intensive Nav1.8 staining correlated with more advanced pathologic stage of disease. Increased intensity of nuclear Nav1.8 correlated with increased Gleason grade. Our results revealed that Nav1.8 is universally expressed in human prostate cancer cells. Nav1.8 expression statistically correlated with pathologic stage (P=0.04) and Gleason score (P=0.01) of human prostate tissue specimens. The aberrant nuclear localization of Nav1.8 with advanced prostate cancer tissues warrant further investigation into use of Nav1.8 as a potential biomarker to differentiate between early and advanced disease. PMID:24163825

Genetic disruption of tubulin acetyltransferase, αTAT1, inhibits proliferation and invasion of colon cancer cells through decreases in Wnt1/β-catenin signaling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oh, Somi; You, Eunae; Ko, Panseon

Microtubules are required for diverse cellular processes, and abnormal regulation of microtubule dynamics is closely associated with severe diseases including malignant tumors. In this study, we report that α-tubulin N-acetyltransferase (αTAT1), a regulator of α-tubulin acetylation, is required for colon cancer proliferation and invasion via regulation of Wnt1 and its downstream genes expression. Public transcriptome analysis showed that expression of ATAT1 is specifically upregulated in colon cancer tissue. A knockout (KO) of ATAT1 in the HCT116 colon cancer cell line, using the CRISPR/Cas9 system showed profound inhibition of proliferative and invasive activities of these cancer cells. Overexpression of αTAT1 ormore » the acetyl-mimic K40Q α-tubulin mutant in αTAT1 KO cells restored the invasiveness, indicating that microtubule acetylation induced by αTAT1 is critical for HCT116 cell invasion. Analysis of colon cancer-related gene expression in αTAT1 KO cells revealed that the loss of αTAT1 decreased the expression of WNT1. Mechanistically, abrogation of tubulin acetylation by αTAT1 knockout inhibited localization of β-catenin to the plasma membrane and nucleus, thereby resulting in the downregulation of Wnt1 and of its downstream genes including CCND1, MMP-2, and MMP-9. These results suggest that αTAT1-mediated Wnt1 expression via microtubule acetylation is important for colon cancer progression. - Highlights: • Ablation of αTAT1 inhibits HCT116 colon cancer cell invasion. • αTAT1/acetylated microtubules regulate expression of Wnt1/β-catenin target genes. • Acetylated microtubules regulate cellular localization of β-catenin. • Loss of αTAT1 prevents Wnt1 from inducing β-catenin-dependent and -independent pathways.« less

Type I γ Phosphatidylinositol Phosphate 5-Kinase i5 Controls the Ubiquitination and Degradation of the Tumor Suppressor Mitogen-inducible Gene 6*

PubMed Central

Sun, Ming; Cai, Jinyang; Anderson, Richard A.; Sun, Yue

2016-01-01

Mitogen-inducible gene 6 (Mig6) is a tumor suppressor, and the disruption of Mig6 expression is associated with cancer development. Mig6 directly interacts with epidermal growth factor receptor (EGFR) to suppress the activation and downstream signaling of EGFR. Therefore, loss of Mig6 enhances EGFR-mediated signaling and promotes EGFR-dependent carcinogenesis. The molecular mechanism modulating Mig6 expression in cancer remains unclear. Here we demonstrate that type I γ phosphatidylinositol phosphate 5-kinase i5 (PIPKIγi5), an enzyme producing phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2), stabilizes Mig6 expression. Knockdown of PIPKIγi5 leads to the loss of Mig6 expression, which dramatically enhances and prolongs EGFR-mediated cell signaling. Loss of PIPKIγi5 significantly promotes Mig6 protein degradation via proteasomes, but it does not affect the Mig6 mRNA level. PIPKIγi5 directly interacts with the E3 ubiquitin ligase neuronal precursor cell-expressed developmentally down-regulated 4-1 (NEDD4-1). The C-terminal domain of PIPKIγi5 and the WW1 and WW2 domains of NEDD4-1 are required for their interaction. The C2 domain of NEDD4-1 is required for its interaction with PtdIns(4,5)P2. By binding with NEDD4-1 and producing PtdIns(4,5)P2, PIPKIγi5 perturbs NEDD4-1-mediated Mig6 ubiquitination and the subsequent proteasomal degradation. Thus, loss of NEDD4-1 can rescue Mig6 expression in PIPKIγi5 knockdown cells. In this way, PIPKIγi5, NEDD4-1, and Mig6 form a novel molecular nexus that controls EGFR activation and downstream signaling. PMID:27557663

Distinct Contributions of TNF Receptor 1 and 2 to TNF-Induced Glomerular Inflammation in Mice

PubMed Central

Taubitz, Anela; Schwarz, Martin; Eltrich, Nuru; Lindenmeyer, Maja T.; Vielhauer, Volker

2013-01-01

TNF is an important mediator of glomerulonephritis. The two TNF-receptors TNFR1 and TNFR2 contribute differently to glomerular inflammation in vivo, but specific mechanisms of TNFR-mediated inflammatory responses in glomeruli are unknown. We investigated their expression and function in murine kidneys, isolated glomeruli ex vivo, and glomerular cells in vitro. In normal kidney TNFR1 and TNFR2 were preferentially expressed in glomeruli. Expression of both TNFRs and TNF-induced upregulation of TNFR2 mRNA was confirmed in murine glomerular endothelial and mesangial cell lines. In vivo, TNF exposure rapidly induced glomerular accumulation of leukocytes. To examine TNFR-specific inflammatory responses in intrinsic glomerular cells but not infiltrating leukocytes we performed microarray gene expression profiling on intact glomeruli isolated from wildtype and Tnfr-deficient mice following exposure to soluble TNF ex vivo. Most TNF-induced effects were exclusively mediated by TNFR1, including induced glomerular expression of adhesion molecules, chemokines, complement factors and pro-apoptotic molecules. However, TNFR2 contributed to TNFR1-dependent mRNA expression of inflammatory mediators in glomeruli when exposed to low TNF concentrations. Chemokine secretion was absent in TNF-stimulated Tnfr1-deficient glomeruli, but also significantly decreased in glomeruli lacking TNFR2. In vivo, TNF-induced glomerular leukocyte infiltration was abrogated in Tnfr1-deficient mice, whereas Tnfr2-deficiency decreased mononuclear phagocytes infiltrates, but not neutrophils. These data demonstrate that activation of intrinsic glomerular cells by soluble TNF requires TNFR1, whereas TNFR2 is not essential, but augments TNFR1-dependent effects. Previously described TNFR2-dependent glomerular inflammation may therefore require TNFR2 activation by membrane-bound, but not soluble TNF. PMID:23869211

Insulin-like growth factor-I regulates GPER expression and function in cancer cells.

PubMed

De Marco, P; Bartella, V; Vivacqua, A; Lappano, R; Santolla, M F; Morcavallo, A; Pezzi, V; Belfiore, A; Maggiolini, M

2013-02-07

Functional cross talk between insulin-like growth factor-I (IGF-I) system and estrogen signaling has been largely reported, although the underlying molecular mechanisms remain to be fully elucidated. As GPR30/GPER mediates rapid cell responses to estrogens, we evaluated the potential of IGF-I to regulate GPER expression and function in estrogen receptor (ER)α-positive breast (MCF-7) and endometrial (Ishikawa) cancer cells. We found that IGF-I transactivates the GPER promoter sequence and upregulates GPER mRNA and protein levels in both cells types. Similar data were found, at least in part, in carcinoma-associated fibroblasts. The upregulation of GPER expression by IGF-I involved the IGF-IR/PKCδ/ERK/c-fos/AP1 transduction pathway and required ERα, as ascertained by specific pharmacological inhibitors and gene-silencing. In both MCF-7 and Ishikawa cancer cells, the IGF-I-dependent cell migration required GPER and its main target gene CTGF, whereas the IGF-I-induced proliferation required both GPER and cyclin D1. Our data demonstrate that the IGF-I system regulates GPER expression and function, triggering the activation of a signaling network that leads to the migration and proliferation of cancer cells.

H3K9ac and HDAC2 Activity Are Involved in the Expression of Monocarboxylate Transporter 1 in Oligodendrocyte

PubMed Central

Lai, Qingwei; Du, Wantong; Wu, Jian; Wang, Xiao; Li, Xinyu; Qu, Xuebin; Wu, Xiuxiang; Dong, Fuxing; Yao, Ruiqin; Fan, Hongbin

2017-01-01

Recently, it is reported that monocarboxylate transporter 1 (MCT1) plays crucial role in oligodendrocyte differentiation and myelination. We found that MCT1 is strongly expressed in oligodendrocyte but weakly expressed in oligodendrocyte precursors (OPCs), and the underlying mechanisms remain elusive. Histone deacetylases (HDACs) activity is required for induction of oligodendrocyte differentiation and maturation. We asked whether HDACs are involved in the regulation of MCT1 expression. This work revealed that the acetylation level of histone H3K9 (H3K9ac) was much higher in mct1 gene (Slc16a1) promoter in OPCs than that in oligodendrocyte. H3K9ac regulates MCT1 expression was confirmed by HDAC acetyltransferase inhibitors trichostatin A and curcumin. Of note, there was a negative correlation between H3K9ac and MCT1 expression in oligodendrocyte. Further, we found that the levels of HDAC1, 2, and 3 protein in oligodendrocyte were obviously higher than those in OPCs. However, specific knockdown of HDAC2 but not HDAC1 and HDAC3 significantly decreased the expression of MCT1 in oligodendrocyte. Conversely, overexpression of HDAC2 remarkably enhanced the expression of MCT1. The results imply that HDAC2 is involved in H3K9ac modification which regulates the expression of MCT1 during the development of oligodendrocyte. PMID:29184483

Growth regulation by estrogen in breast cancer 1 (GREB1) is a novel progesterone-responsive gene required for human endometrial stromal decidualization.

PubMed

Camden, Alison J; Szwarc, Maria M; Chadchan, Sangappa B; DeMayo, Francesco J; O'Malley, Bert W; Lydon, John P; Kommagani, Ramakrishna

2017-09-01

Is Growth Regulation by Estrogen in Breast Cancer 1 (GREB1) required for progesterone-driven endometrial stromal cell decidualization? GREB1 is a novel progesterone-responsive gene required for progesterone-driven human endometrial stromal cell (HESC) decidualization. Successful establishment of pregnancy requires HESCs to transform from fibroblastic to epithelioid cells in a process called decidualization. This process depends on the hormone progesterone, but the molecular mechanisms by which it occurs have not been determined. Primary and transformed HESCs in which GREB1 expression was knocked down were decidualized in culture for up to 6 days. Wild-type and progesterone receptor (PR) knockout mice were treated with progesterone, and their uteri were assessed for levels of GREB1 expression. Analysis of previous data included data mining of expression profile data sets and in silico transcription factor-binding analysis. Endometrial biopsies obtained from healthy women of reproductive age during the proliferative phase (Days 8-12) of their menstrual cycle were used for isolating HESCs. Experiments were carried out with early passage (no more than four passages) HESCs isolated from at least three subjects. Transcript levels of decidualization markers prolactin (PRL) and insulin-like growth factor-binding protein-1 (IGFBP-1) were detected by quantitative RT-PCR as readouts for HESC decidualization. Cells were also imaged by phase-contrast microscopy. To assess the requirement for GREB1, PR and SRC-2, cells were transfected with specifically targeted small interfering RNAs. Results are shown as mean and SE from three replicates of one representative patient-derived primary endometrial cell line. Experiments were also conducted with transformed HESCs. Progesterone treatment of mice and transformed HESCs led to an ~5-fold (5.6 ± 0.81, P < 0.05, and 5.2 ± 0.26, P < 0.01, respectively) increase in GREB1 transcript levels. This increase was significantly reduced in the uteri of PR knock-out mice (P < 0.01), in HESCs treated with the PR antagonist RU486 (P < 0.01), or in HESCs in which PR expression was knocked down (P < 0.05). When GREB1 expression was knocked down, progesterone-driven decidualization markers in both immortalized and primary HESCs was significantly reduced (P < 0.05 and P < 0.01). Finally, GREB1 knock down signficantly reduced expression of the PR target genes WNT4 and FOXOA1 (P < 0.05 and P < 0.01, respectively). This study used the Nuclear Receptor Signaling Atlas. Although in vitro cell culture studies indicate that GREB1 is required for endoemtrial decidualization, the in vivo role of GREB1 in endometrial function and dysfunction should be assessed by using knock-out mouse models. Identification and functional analysis of GREB1 as a key molecular mediator of decidualization may lead to improved diagnosis and clinical management of women with peri-implantation loss due to inadequate endometrial decidualization. This research was funded in part by: a National Institutes of Health (NIH)/ National Institute of Child Health and Human Development (NICHD) grant (R00 HD080742) and Washington University School of Medicine start-up funds to R.K., an NIH/NICHD grant (RO1 HD-07857) to B.W.O.M., and a NIH/NICHD grant (R01 HD-042311) to J.P.L. The authors declare no conflicts of interests. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Deciphering the role of the signal- and Sty1 kinase-dependent phosphorylation of the stress-responsive transcription factor Atf1 on gene activation.

PubMed

Salat-Canela, Clàudia; Paulo, Esther; Sánchez-Mir, Laura; Carmona, Mercè; Ayté, José; Oliva, Baldo; Hidalgo, Elena

2017-08-18

Adaptation to stress triggers the most dramatic shift in gene expression in fission yeast ( Schizosaccharomyces pombe ), and this response is driven by signaling via the MAPK Sty1. Upon activation, Sty1 accumulates in the nucleus and stimulates expression of hundreds of genes via the nuclear transcription factor Atf1, including expression of atf1 itself. However, the role of stress-induced, Sty1-mediated Atf1 phosphorylation in transcriptional activation is unclear. To this end, we expressed Atf1 phosphorylation mutants from a constitutive promoter to uncouple Atf1 activity from endogenous, stress-activated Atf1 expression. We found that cells expressing a nonphosphorylatable Atf1 variant are sensitive to oxidative stress because of impaired transcription of a subset of stress genes whose expression is also controlled by another transcription factor, Pap1. Furthermore, cells expressing a phospho-mimicking Atf1 mutant display enhanced stress resistance, and although expression of the Pap1-dependent genes still relied on stress induction, another subset of stress-responsive genes was constitutively expressed in these cells. We also observed that, in cells expressing the phospho-mimicking Atf1 mutant, the presence of Sty1 was completely dispensable, with all stress defects of Sty1-deficient cells being suppressed by expression of the Atf1 mutant. We further demonstrated that Sty1-mediated Atf1 phosphorylation does not stimulate binding of Atf1 to DNA but, rather, establishes a platform of interactions with the basal transcriptional machinery to facilitate transcription initiation. In summary, our results provide evidence that Atf1 phosphorylation by the MAPK Sty1 is required for oxidative stress responses in fission yeast cells by promoting transcription initiation. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Androgen receptor agonism promotes an osteogenic gene program in preadipocytes

PubMed Central

Hartig, Sean M.; Feng, Qin; Ochsner, Scott A.; Xiao, Rui; McKenna, Neil J.; McGuire, Sean E.; He, Bin

2013-01-01

Androgens regulate body composition by interacting with the androgen receptor (AR) to control gene expression in a tissue-specific manner. To identify novel regulatory roles for AR in preadipocytes, we created a 3T3-L1 cell line stably expressing human AR. We found AR expression is required for androgen-mediated inhibition of 3T3-L1 adipogenesis. This inhibition is characterized by decreased lipid accumulation, reduced expression of adipogenic genes, and induction of genes associated with osteoblast differentiation. Collectively, our results suggest androgens promote an osteogenic gene program at the expense of adipocyte differentiation. PMID:23567971

IP{sub 3}-dependent intracellular Ca{sup 2+} release is required for cAMP-induced c-fos expression in hippocampal neurons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Wenting; Tingare, Asmita; Ng, David Chi-Heng

2012-08-24

Highlights: Black-Right-Pointing-Pointer cAMP-induced c-fos expression in hippocampal neurons requires a submembraneous Ca{sup 2+} pool. Black-Right-Pointing-Pointer The submembraneous Ca{sup 2+} pool derives from intracellular ER stores. Black-Right-Pointing-Pointer Expression of IP{sub 3}-metabolizing enzymes inhibits cAMP-induced c-fos expression. Black-Right-Pointing-Pointer SRE-mediated and CRE-mediated gene expression is sensitive to IP{sub 3}-metabolizing enzymes. Black-Right-Pointing-Pointer Intracellular Ca{sup 2+} release is required for cAMP-induced nuclear translocation of TORC1. -- Abstract: Ca{sup 2+} and cAMP are widely used in concert by neurons to relay signals from the synapse to the nucleus, where synaptic activity modulates gene expression required for synaptic plasticity. Neurons utilize different transcriptional regulators to integrate informationmore » encoded in the spatiotemporal dynamics and magnitude of Ca{sup 2+} and cAMP signals, including some that are Ca{sup 2+}-responsive, some that are cAMP-responsive and some that detect coincident Ca{sup 2+} and cAMP signals. Because Ca{sup 2+} and cAMP can influence each other's amplitude and spatiotemporal characteristics, we investigated how cAMP acts to regulate gene expression when increases in intracellular Ca{sup 2+} are buffered. We show here that cAMP-mobilizing stimuli are unable to induce expression of the immediate early gene c-fos in hippocampal neurons in the presence of the intracellular Ca{sup 2+} buffer BAPTA-AM. Expression of enzymes that attenuate intracellular IP{sub 3} levels also inhibited cAMP-dependent c-fos induction. Synaptic activity induces c-fos transcription through two cis regulatory DNA elements - the CRE and the SRE. We show here that in response to cAMP both CRE-mediated and SRE-mediated induction of a luciferase reporter gene is attenuated by IP{sub 3} metabolizing enzymes. Furthermore, cAMP-induced nuclear translocation of the CREB coactivator TORC1 was inhibited by depletion of intracellular Ca{sup 2+} stores. Our data indicate that Ca{sup 2+} release from IP{sub 3}-sensitive pools is required for cAMP-induced transcription in hippocampal neurons.« less

A first immunohistochemistry study of transketolase and transketolase-like 1 expression in canine hyperplastic and neoplastic mammary lesions.

PubMed

Burrai, Giovanni Pietro; Tanca, Alessandro; Cubeddu, Tiziana; Abbondio, Marcello; Polinas, Marta; Addis, Maria Filippa; Antuofermo, Elisabetta

2017-01-31

Canine mammary tumors represent the most common neoplasm in female dogs, and the discovery of cancer biomarkers and their translation to clinical relevant assays is a key requirement in the war on cancer. Since the description of the 'Warburg effect', the reprogramming of metabolic pathways is considered a hallmark of pathological changes in cancer cells. In this study, we investigate the expression of two cancer-related metabolic enzymes, transketolase (TKT) and transketolase-like 1 (TKTL1), involved in the pentose phosphate pathway (PPP), an alternative metabolic pathway for glucose breakdown that could promote cancer by providing the precursors and energy required for rapidly growing cells. TKT and TKTL1 protein expression was investigated by immunohistochemistry in canine normal (N = 6) and hyperplastic glands (N = 3), as well as in benign (N = 11) and malignant mammary tumors (N = 17). TKT expression was higher in hyperplastic lesions and in both benign and malignant tumors compared to the normal mammary gland, while TKTL1 levels were remarkably higher in hyperplastic lesions, simple adenomas and simple carcinomas than in the normal mammary glands (P < 0.05). This study reveals that the expression of a key PPP enzyme varies along the evolution of canine mammary neoplastic lesions, and supports a role of metabolic changes in the development of canine mammary tumors.

CRP-cAMP mediates silencing of Salmonella virulence at the post-transcriptional level

PubMed Central

El Mouali, Youssef; Gaviria-Cantin, Tania; Gibert, Marta; Westermann, Alexander J.; Vogel, Jörg

2018-01-01

Invasion of epithelial cells by Salmonella enterica requires expression of genes located in the pathogenicity island I (SPI-1). The expression of SPI-1 genes is very tightly regulated and activated only under specific conditions. Most studies have focused on the regulatory pathways that induce SPI-1 expression. Here, we describe a new regulatory circuit involving CRP-cAMP, a widely established metabolic regulator, in silencing of SPI-1 genes under non-permissive conditions. In CRP-cAMP-deficient strains we detected a strong upregulation of SPI-1 genes in the mid-logarithmic growth phase. Genetic analyses revealed that CRP-cAMP modulates the level of HilD, the master regulator of Salmonella invasion. This regulation occurs at the post-transcriptional level and requires the presence of a newly identified regulatory motif within the hilD 3’UTR. We further demonstrate that in Salmonella the Hfq-dependent sRNA Spot 42 is under the transcriptional repression of CRP-cAMP and, when this transcriptional repression is relieved, Spot 42 exerts a positive effect on hilD expression. In vivo and in vitro assays indicate that Spot 42 targets, through its unstructured region III, the 3’UTR of the hilD transcript. Together, our results highlight the biological relevance of the hilD 3’UTR as a hub for post-transcriptional control of Salmonella invasion gene expression. PMID:29879120

Downregulation of VRK1 by p53 in Response to DNA Damage Is Mediated by the Autophagic Pathway

PubMed Central

Valbuena, Alberto; Castro-Obregón, Susana; Lazo, Pedro A.

2011-01-01

Human VRK1 induces a stabilization and accumulation of p53 by specific phosphorylation in Thr18. This p53 accumulation is reversed by its downregulation mediated by Hdm2, requiring a dephosphorylated p53 and therefore also needs the removal of VRK1 as stabilizer. This process requires export of VRK1 to the cytosol and is inhibited by leptomycin B. We have identified that downregulation of VRK1 protein levels requires DRAM expression, a p53-induced gene. DRAM is located in the endosomal-lysosomal compartment. Induction of DNA damage by UV, IR, etoposide and doxorubicin stabilizes p53 and induces DRAM expression, followed by VRK1 downregulation and a reduction in p53 Thr18 phosphorylation. DRAM expression is induced by wild-type p53, but not by common human p53 mutants, R175H, R248W and R273H. Overexpression of DRAM induces VRK1 downregulation and the opposite effect was observed by its knockdown. LC3 and p62 were also downregulated, like VRK1, in response to UV-induced DNA damage. The implication of the autophagic pathway was confirmed by its requirement for Beclin1. We propose a model with a double regulatory loop in response to DNA damage, the accumulated p53 is removed by induction of Hdm2 and degradation in the proteasome, and the p53-stabilizer VRK1 is eliminated by the induction of DRAM that leads to its lysosomal degradation in the autophagic pathway, and thus permitting p53 degradation by Hdm2. This VRK1 downregulation is necessary to modulate the block in cell cycle progression induced by p53 as part of its DNA damage response. PMID:21386980

Nitrogen-responsive Regulation of GATA Protein Family Activators Gln3 and Gat1 Occurs by Two Distinct Pathways, One Inhibited by Rapamycin and the Other by Methionine Sulfoximine*

PubMed Central

Georis, Isabelle; Tate, Jennifer J.; Cooper, Terrance G.; Dubois, Evelyne

2011-01-01

Nitrogen availability regulates the transcription of genes required to degrade non-preferentially utilized nitrogen sources by governing the localization and function of transcription activators, Gln3 and Gat1. TorC1 inhibitor, rapamycin (Rap), and glutamine synthetase inhibitor, methionine sulfoximine (Msx), elicit responses grossly similar to those of limiting nitrogen, implicating both glutamine synthesis and TorC1 in the regulation of Gln3 and Gat1. To better understand this regulation, we compared Msx- versus Rap-elicited Gln3 and Gat1 localization, their DNA binding, nitrogen catabolite repression-sensitive gene expression, and the TorC1 pathway phosphatase requirements for these responses. Using this information we queried whether Rap and Msx inhibit sequential steps in a single, linear cascade connecting glutamine availability to Gln3 and Gat1 control as currently accepted or alternatively inhibit steps in two distinct parallel pathways. We find that Rap most strongly elicits nuclear Gat1 localization and expression of genes whose transcription is most Gat1-dependent. Msx, on the other hand, elicits nuclear Gln3 but not Gat1 localization and expression of genes that are most Gln3-dependent. Importantly, Rap-elicited nuclear Gln3 localization is absolutely Sit4-dependent, but that elicited by Msx is not. PP2A, although not always required for nuclear GATA factor localization, is highly required for GATA factor binding to nitrogen-responsive promoters and subsequent transcription irrespective of the gene GATA factor specificities. Collectively, our data support the existence of two different nitrogen-responsive regulatory pathways, one inhibited by Msx and the other by rapamycin. PMID:22039046

Nitrogen-responsive regulation of GATA protein family activators Gln3 and Gat1 occurs by two distinct pathways, one inhibited by rapamycin and the other by methionine sulfoximine.

PubMed

Georis, Isabelle; Tate, Jennifer J; Cooper, Terrance G; Dubois, Evelyne

2011-12-30

Nitrogen availability regulates the transcription of genes required to degrade non-preferentially utilized nitrogen sources by governing the localization and function of transcription activators, Gln3 and Gat1. TorC1 inhibitor, rapamycin (Rap), and glutamine synthetase inhibitor, methionine sulfoximine (Msx), elicit responses grossly similar to those of limiting nitrogen, implicating both glutamine synthesis and TorC1 in the regulation of Gln3 and Gat1. To better understand this regulation, we compared Msx- versus Rap-elicited Gln3 and Gat1 localization, their DNA binding, nitrogen catabolite repression-sensitive gene expression, and the TorC1 pathway phosphatase requirements for these responses. Using this information we queried whether Rap and Msx inhibit sequential steps in a single, linear cascade connecting glutamine availability to Gln3 and Gat1 control as currently accepted or alternatively inhibit steps in two distinct parallel pathways. We find that Rap most strongly elicits nuclear Gat1 localization and expression of genes whose transcription is most Gat1-dependent. Msx, on the other hand, elicits nuclear Gln3 but not Gat1 localization and expression of genes that are most Gln3-dependent. Importantly, Rap-elicited nuclear Gln3 localization is absolutely Sit4-dependent, but that elicited by Msx is not. PP2A, although not always required for nuclear GATA factor localization, is highly required for GATA factor binding to nitrogen-responsive promoters and subsequent transcription irrespective of the gene GATA factor specificities. Collectively, our data support the existence of two different nitrogen-responsive regulatory pathways, one inhibited by Msx and the other by rapamycin.

DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells

PubMed Central

Spike, Caroline A.; Bader, Jason; Reinke, Valerie; Strome, Susan

2008-01-01

P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs). PMID:18234720

DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells.

PubMed

Spike, Caroline A; Bader, Jason; Reinke, Valerie; Strome, Susan

2008-03-01

P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs).

The Chromatin Protein DUET/MMD1 Controls Expression of the Meiotic Gene TDM1 during Male Meiosis in Arabidopsis

PubMed Central

Andreuzza, Sébastien; Nishal, Bindu; Singh, Aparna; Siddiqi, Imran

2015-01-01

Meiosis produces haploid cells essential for sexual reproduction. In yeast, entry into meiosis activates transcription factors which trigger a transcriptional cascade that results in sequential co-expression of early, middle and late meiotic genes. However, these factors are not conserved, and the factors and regulatory mechanisms that ensure proper meiotic gene expression in multicellular eukaryotes are poorly understood. Here, we report that DUET/MMD1, a PHD finger protein essential for Arabidopsis male meiosis, functions as a transcriptional regulator in plant meiosis. We find that DUET-PHD binds H3K4me2 in vitro, and show that this interaction is critical for function during meiosis. We also show that DUET is required for proper microtubule organization during meiosis II, independently of its function in meiosis I. Remarkably, DUET protein shows stage-specific expression, confined to diplotene. We identify two genes TDM1 and JAS with critical functions in cell cycle transitions and spindle organization in male meiosis, as DUET targets, with TDM1 being a direct target. Thus, DUET is required to regulate microtubule organization and cell cycle transitions during male meiosis, and functions as a direct transcription activator of the meiotic gene TDM1. Expression profiling showed reduced expression of a subset comprising about 12% of a known set of meiosis preferred genes in the duet mutant. Our results reveal the action of DUET as a transcriptional regulator during male meiosis in plants, and suggest that transcription of meiotic genes is under stagewise control in plants as in yeast. PMID:26348709

The Chromatin Protein DUET/MMD1 Controls Expression of the Meiotic Gene TDM1 during Male Meiosis in Arabidopsis.

PubMed

Andreuzza, Sébastien; Nishal, Bindu; Singh, Aparna; Siddiqi, Imran

2015-09-01

Meiosis produces haploid cells essential for sexual reproduction. In yeast, entry into meiosis activates transcription factors which trigger a transcriptional cascade that results in sequential co-expression of early, middle and late meiotic genes. However, these factors are not conserved, and the factors and regulatory mechanisms that ensure proper meiotic gene expression in multicellular eukaryotes are poorly understood. Here, we report that DUET/MMD1, a PHD finger protein essential for Arabidopsis male meiosis, functions as a transcriptional regulator in plant meiosis. We find that DUET-PHD binds H3K4me2 in vitro, and show that this interaction is critical for function during meiosis. We also show that DUET is required for proper microtubule organization during meiosis II, independently of its function in meiosis I. Remarkably, DUET protein shows stage-specific expression, confined to diplotene. We identify two genes TDM1 and JAS with critical functions in cell cycle transitions and spindle organization in male meiosis, as DUET targets, with TDM1 being a direct target. Thus, DUET is required to regulate microtubule organization and cell cycle transitions during male meiosis, and functions as a direct transcription activator of the meiotic gene TDM1. Expression profiling showed reduced expression of a subset comprising about 12% of a known set of meiosis preferred genes in the duet mutant. Our results reveal the action of DUET as a transcriptional regulator during male meiosis in plants, and suggest that transcription of meiotic genes is under stagewise control in plants as in yeast.

Cold Induction of Arabidopsis CBF Genes Involves Multiple ICE (Inducer of CBF Expression) Promoter Elements and a Cold-Regulatory Circuit That Is Desensitized by Low Temperature1

PubMed Central

Zarka, Daniel G.; Vogel, Jonathan T.; Cook, Daniel; Thomashow, Michael F.

2003-01-01

The Arabidopsis CBF1, 2, and 3 genes (also known as DREB1b, c, and a, respectively) encode transcriptional activators that have a central role in cold tolerance. CBF1-3 are rapidly induced upon exposing plants to low temperature, followed by expression of CBF-targeted genes, the CBF regulon, resulting in an increase in plant freezing tolerance. At present, little is known about the cold-sensing mechanism that controls CBF expression. Results presented here indicate that this mechanism does not require a cold shock to bring about the accumulation of CBF transcripts, but instead, absolute temperature is monitored with a greater degree of input, i.e. lower temperature, resulting in a greater output, i.e. higher levels of CBF transcripts. Temperature-shift experiments also indicate that the cold-sensing mechanism becomes desensitized to a given low temperature, such as 4°C, and that resensitization to that temperature requires between 8 and 24 h at warm temperature. Gene fusion experiments identified a 125-bp section of the CBF2 promoter that is sufficient to impart cold-responsive gene expression. Mutational analysis of this cold-responsive region identified two promoter segments that work in concert to impart robust cold-regulated gene expression. These sequences, designated ICEr1 and ICEr2 (induction of CBF expression region 1 or 2), were also shown to stimulate transcription in response to mechanical agitation and the protein synthesis inhibitor, cycloheximide. PMID:14500791

Regulation of the expression of plant resistance gene SNC1 by a protein with a conserved BAT2 domain.

PubMed

Li, Yingzhong; Tessaro, Mark J; Li, Xin; Zhang, Yuelin

2010-07-01

Plant Resistance (R) genes encode immune receptors that recognize pathogens and activate defense responses. Because of fitness costs associated with maintaining R protein-mediated resistance, expression levels of R genes have to be tightly regulated. However, mechanisms on how R-gene expression is regulated are poorly understood. Here we show that MODIFIER OF snc1, 1 (MOS1) regulates the expression of SUPPRESSOR OF npr1-1, CONSTITUTIVE1 (SNC1), which encodes a Toll/interleukin receptor-nucleotide binding site-leucine-rich repeat type of R protein in Arabidopsis (Arabidopsis thaliana). In the mos1 loss-of-function mutant plants, snc1 expression is repressed and constitutive resistance responses mediated by snc1 are lost. The repression of snc1 expression in mos1 is released by knocking out DECREASE IN DNA METHYLATION1. In mos1 mutants, DNA methylation in a region upstream of SNC1 is altered. Furthermore, expression of snc1 transgenes using the native promoter does not require MOS1, indicating that regulation of SNC1 expression by MOS1 is at the chromatin level. Map-based cloning of MOS1 revealed that it encodes a novel protein with a HLA-B ASSOCIATED TRANSCRIPT2 (BAT2) domain that is conserved in plants and animals. Our study on MOS1 suggests that BAT2 domain-containing proteins may function in regulation of gene expression at chromatin level.

Analysis of Thioester-Containing Proteins during the Innate Immune Response of Drosophila melanogaster

PubMed Central

Bou Aoun, Richard; Hetru, Charles; Troxler, Laurent; Doucet, Daniel; Ferrandon, Dominique; Matt, Nicolas

2010-01-01

Thioester-containing proteins (TEPs) are conserved proteins among insects that are thought to be involved in innate immunity. In Drosophila, the Tep family is composed of 6 genes named Tep1–Tep6. In this study, we investigated the phylogeny, expression pattern and roles of these genes in the host defense of Drosophila. Protostomian Tep genes are clustered in 3 distinct branches, 1 of which is specific to mosquitoes. Most D. melanogaster Tep genes are expressed in hemocytes, can be induced in the fat body, and are expressed in specific regions of the hypodermis. This expression pattern is consistent with a role in innate immunity. However, we find that TEP1, TEP2, and TEP4 are not strictly required in the body cavity to fight several bacterial and fungal infections. One possibility is that Drosophila TEPs act redundantly or that their absence can be compensated by other components of the immune response. TEPs may thus provide a subtle selective advantage during evolution. Alternatively, they may be required in host defense against specific as yet unidentified natural pathogens of Drosophila. PMID:21063077