Metabolism: Part II. The Tricarboxylic Acid (TCA), Citric Acid, or Krebs Cycle.
ERIC Educational Resources Information Center
Bodner, George M.
1986-01-01
Differentiates the tricarboxylic acid (TCA) cycle (or Krebs cycle) from glycolysis, and describes the bridge between the two as being the conversion of pyruvate into acetyl coenzyme A. Discusses the eight steps in the TCA cycle, the results of isotopic labeling experiments, and the net effects of the TCA cycle. (TW)
van Rossum, Harmen M.; Kozak, Barbara U.; Niemeijer, Matthijs S.; Duine, Hendrik J.; Luttik, Marijke A. H.; Boer, Viktor M.; Kötter, Peter; Daran, Jean-Marc G.; van Maris, Antonius J. A.
2016-01-01
Pyruvate and acetyl-coenzyme A, located at the interface between glycolysis and TCA cycle, are important intermediates in yeast metabolism and key precursors for industrially relevant products. Rational engineering of their supply requires knowledge of compensatory reactions that replace predominant pathways when these are inactivated. This study investigates effects of individual and combined mutations that inactivate the mitochondrial pyruvate-dehydrogenase (PDH) complex, extramitochondrial citrate synthase (Cit2) and mitochondrial CoA-transferase (Ach1) in Saccharomyces cerevisiae. Additionally, strains with a constitutively expressed carnitine shuttle were constructed and analyzed. A predominant role of the PDH complex in linking glycolysis and TCA cycle in glucose-grown batch cultures could be functionally replaced by the combined activity of the cytosolic PDH bypass and Cit2. Strongly impaired growth and a high incidence of respiratory deficiency in pda1Δ ach1Δ strains showed that synthesis of intramitochondrial acetyl-CoA as a metabolic precursor requires activity of either the PDH complex or Ach1. Constitutive overexpression of AGP2, HNM1, YAT2, YAT1, CRC1 and CAT2 enabled the carnitine shuttle to efficiently link glycolysis and TCA cycle in l-carnitine-supplemented, glucose-grown batch cultures. Strains in which all known reactions at the glycolysis-TCA cycle interface were inactivated still grew slowly on glucose, indicating additional flexibility at this key metabolic junction. PMID:26895788
Tavsan, Zehra; Ayar Kayali, Hulya
2015-05-01
The efficiency of optimal metabolic function by microorganism depends on various parameters, especially essential metal supplementation. In the present study, the effects of iron and copper metals on metabolism were investigated by determination of glycolysis and tricarboxylic acid (TCA) cycle metabolites' levels with respect to the metal concentrations and incubation period in Trichoderma harzianum. The pyruvate and citrate levels of T. harzianum increased up to 15 mg/L of copper via redirection of carbon flux though glycolysis by suppression of pentose phosphate pathway (PPP). However, the α-ketoglutarate levels decreased at concentration higher than 5 mg/L of copper to overcome damage of oxidative stress. The fumarate levels correlated with the α-ketoglutarate levels because of substrate limitation. Besides, in T. harzianum cells grown in various concentrations of iron-containing medium, the intracellular pyruvate, citrate, and α-ketoglutarate levels showed positive correlation with iron concentration due to modifying of expression of glycolysis and TCA cycle enzymes via a mechanism involving cofactor or allosteric regulation. However, as a result of consuming of prior substrates required for fumarate production, its levels rose up to 10 mg/L.
The emerging role and targetability of the TCA cycle in cancer metabolism.
Anderson, Nicole M; Mucka, Patrick; Kern, Joseph G; Feng, Hui
2018-02-01
The tricarboxylic acid (TCA) cycle is a central route for oxidative phosphorylation in cells, and fulfills their bioenergetic, biosynthetic, and redox balance requirements. Despite early dogma that cancer cells bypass the TCA cycle and primarily utilize aerobic glycolysis, emerging evidence demonstrates that certain cancer cells, especially those with deregulated oncogene and tumor suppressor expression, rely heavily on the TCA cycle for energy production and macromolecule synthesis. As the field progresses, the importance of aberrant TCA cycle function in tumorigenesis and the potentials of applying small molecule inhibitors to perturb the enhanced cycle function for cancer treatment start to evolve. In this review, we summarize current knowledge about the fuels feeding the cycle, effects of oncogenes and tumor suppressors on fuel and cycle usage, common genetic alterations and deregulation of cycle enzymes, and potential therapeutic opportunities for targeting the TCA cycle in cancer cells. With the application of advanced technology and in vivo model organism studies, it is our hope that studies of this previously overlooked biochemical hub will provide fresh insights into cancer metabolism and tumorigenesis, subsequently revealing vulnerabilities for therapeutic interventions in various cancer types.
Carrasco-Pozo, Catalina
2017-01-01
Abstract Temporal lobe epilepsy is a common form of adult epilepsy and shows high resistance to treatment. Increasing evidence has suggested that metabolic dysfunction contributes to the development of seizures, with previous studies indicating impairments in brain glucose metabolism. Here we aim to elucidate which pathways involved in glucose metabolism are impaired, by tracing the hippocampal metabolism of injected [U-13C]glucose (i.p.) during the chronic stage of the pilocarpine-status epilepticus mouse model of epilepsy. The enrichment of 13C in the intermediates of glycolysis and the TCA cycle were quantified in hippocampal extracts using liquid chromatography–tandem mass spectroscopy, along with the measurement of the activities of enzymes in each pathway. We show that there is reduced incorporation of 13C in the intermediates of glycolysis, with the percentage enrichment of all downstream intermediates being highly correlated with those of glucose 6-phosphate. Furthermore, the activities of all enzymes in this pathway including hexokinase and phosphofructokinase were unaltered, suggesting that glucose uptake is reduced in this model without further impairments in glycolysis itself. The key findings were 33% and 55% losses in the activities of pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase, respectively, along with reduced 13C enrichment in TCA cycle intermediates. This lower 13C enrichment is best explained in part by the reduced enrichment in glycolytic intermediates, whereas the reduction of key TCA cycle enzyme activity indicates that TCA cycling is also impaired in the hippocampal formation. Together, these data suggest that multitarget approaches may be necessary to restore metabolism in the epileptic brain. PMID:28303258
Alternative Fuels in Epilepsy and Amyotrophic Lateral Sclerosis.
Tefera, Tesfaye W; Tan, Kah Ni; McDonald, Tanya S; Borges, Karin
2017-06-01
This review summarises the recent findings on metabolic treatments for epilepsy and Amyotrophic Lateral Sclerosis (ALS) in honour of Professor Ursula Sonnewald. The metabolic impairments in rodent models of these disorders as well as affected patients are being discussed. In both epilepsy and ALS, there are defects in glucose uptake and reduced tricarboxylic acid (TCA) cycling, at least in part due to reduced amounts of C4 TCA cycle intermediates. In addition there are impairments in glycolysis in ALS. A reduction in glucose uptake can be addressed by providing the brain with alternative fuels, such as ketones or medium-chain triglycerides. As anaplerotic fuels, such as the triglyceride of heptanoate, triheptanoin, refill the TCA cycle C4/C5 intermediate pool that is deficient, they are ideal to boost TCA cycling and thus the oxidative metabolism of all fuels.
Yu, Yongjun; Clippinger, Amy J.; Alwine, James C.
2011-01-01
Human cytomegalovirus (HCMV) infection causes dramatic alterations of intermediary metabolism, similar to those found in tumor cells. In infected cells, glucose carbon is not completely broken down by the tricarboxylic acid (TCA) cycle for energy; instead it is used biosynthetically. This process requires increased glucose uptake, increased glycolysis and the diversion of glucose carbon, in the form of citrate, from the TCA cycle for use in HCMV-induced fatty acid biosynthesis. The diversion of citrate from the TCA cycle (cataplerosis) requires induction of enzymes to promote glutaminolysis, the conversion of glutamine to -ketoglutarate in order to maintain the TCA cycle (anaplerosis) and ATP production. Such changes could result in heretofore uncharacterized pathogenesis, potentially implicating HCMV as a subtle co-factor in many maladies, including oncogenesis. Recognition of the effects of HCMV, and other viruses, on host cell metabolism will provide new understanding of viral pathogenesis and novel avenues for antiviral therapy. PMID:21570293
Li, Xinjian; Jiang, Yuhui; Meisenhelder, Jill; Yang, Weiwei; Hawke, David H; Zheng, Yanhua; Xia, Yan; Aldape, Kenneth; He, Jie; Hunter, Tony; Wang, Liwei; Lu, Zhimin
2016-03-03
It is unclear how the Warburg effect that exemplifies enhanced glycolysis in the cytosol is coordinated with suppressed mitochondrial pyruvate metabolism. We demonstrate here that hypoxia, EGFR activation, and expression of K-Ras G12V and B-Raf V600E induce mitochondrial translocation of phosphoglycerate kinase 1 (PGK1); this is mediated by ERK-dependent PGK1 S203 phosphorylation and subsequent PIN1-mediated cis-trans isomerization. Mitochondrial PGK1 acts as a protein kinase to phosphorylate pyruvate dehydrogenase kinase 1 (PDHK1) at T338, which activates PDHK1 to phosphorylate and inhibit the pyruvate dehydrogenase (PDH) complex. This reduces mitochondrial pyruvate utilization, suppresses reactive oxygen species production, increases lactate production, and promotes brain tumorigenesis. Furthermore, PGK1 S203 and PDHK1 T338 phosphorylation levels correlate with PDH S293 inactivating phosphorylation levels and poor prognosis in glioblastoma patients. This work highlights that PGK1 acts as a protein kinase in coordinating glycolysis and the tricarboxylic acid (TCA) cycle, which is instrumental in cancer metabolism and tumorigenesis. Copyright © 2016 Elsevier Inc. All rights reserved.
Reid, Michael A.; Lowman, Xazmin H.; Pan, Min; Tran, Thai Q.; Warmoes, Marc O.; Ishak Gabra, Mari B.; Yang, Ying; Locasale, Jason W.; Kong, Mei
2016-01-01
Glutamine is an essential nutrient for cancer cell survival and proliferation. Enhanced utilization of glutamine often depletes its local supply, yet how cancer cells adapt to low glutamine conditions is largely unknown. Here, we report that IκB kinase β (IKKβ) is activated upon glutamine deprivation and is required for cell survival independently of NF-κB transcription. We demonstrate that IKKβ directly interacts with and phosphorylates 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase isoform 3 (PFKFB3), a major driver of aerobic glycolysis, at Ser269 upon glutamine deprivation to inhibit its activity, thereby down-regulating aerobic glycolysis when glutamine levels are low. Thus, due to lack of inhibition of PFKFB3, IKKβ-deficient cells exhibit elevated aerobic glycolysis and lactate production, leading to less glucose carbons contributing to tricarboxylic acid (TCA) cycle intermediates and the pentose phosphate pathway, which results in increased glutamine dependence for both TCA cycle intermediates and reactive oxygen species suppression. Therefore, coinhibition of IKKβ and glutamine metabolism results in dramatic synergistic killing of cancer cells both in vitro and in vivo. In all, our results uncover a previously unidentified role of IKKβ in regulating glycolysis, sensing low-glutamine-induced metabolic stress, and promoting cellular adaptation to nutrient availability. PMID:27585591
Tennessen, Jason M; Bertagnolli, Nicolas M; Evans, Janelle; Sieber, Matt H; Cox, James; Thummel, Carl S
2014-03-12
Rapidly proliferating cells such as cancer cells and embryonic stem cells rely on a specialized metabolic program known as aerobic glycolysis, which supports biomass production from carbohydrates. The fruit fly Drosophila melanogaster also utilizes aerobic glycolysis to support the rapid growth that occurs during larval development. Here we use singular value decomposition analysis of modENCODE RNA-seq data combined with GC-MS-based metabolomic analysis to analyze the changes in gene expression and metabolism that occur during Drosophila embryogenesis, spanning the onset of aerobic glycolysis. Unexpectedly, we find that the most common pattern of co-expressed genes in embryos includes the global switch to glycolytic gene expression that occurs midway through embryogenesis. In contrast to the canonical aerobic glycolytic pathway, however, which is accompanied by reduced mitochondrial oxidative metabolism, the expression of genes involved in the tricarboxylic cycle (TCA cycle) and the electron transport chain are also upregulated at this time. Mitochondrial activity, however, appears to be attenuated, as embryos exhibit a block in the TCA cycle that results in elevated levels of citrate, isocitrate, and α-ketoglutarate. We also find that genes involved in lipid breakdown and β-oxidation are upregulated prior to the transcriptional initiation of glycolysis, but are downregulated before the onset of larval development, revealing coordinated use of lipids and carbohydrates during development. These observations demonstrate the efficient use of nutrient stores to support embryonic development, define sequential metabolic transitions during this stage, and demonstrate striking similarities between the metabolic state of late-stage fly embryos and tumor cells. Copyright © 2014 Tennessen et al.
NOK mediates glycolysis and nuclear PDC associated histone acetylation.
Shi, Wei-Ye; Yang, Xiao; Huang, Bo; Shen, Wen H; Liu, Li
2017-06-01
NOK is a potent oncogene that can transform normal cells to cancer cells. We hypothesized that NOK might impact cancer cell metabolism and histone acetylation. We show that NOK localizes in the mitochondria, and while it minimally impacts tricarboxylic acid (TCA) cycle, it markedly inhibits the process of electron transport and oxidative phosphorylation processes and dramatically enhances aerobic glycolysis in cancer cells. NOK promotes the mitochondrial-nuclear translocation of pyruvate dehydrogenase complex (PDC), and enhances histone acetylation in the nucleus. Together, these findings show that NOK mediates glycolysis and nuclear PDC associated histone acetylation.
Imaging Prostate Cancer (PCa) Phenotype and Evolution
2015-10-01
has two isoforms: m-Acon (mitochondrial aconitase) and c-Acon ( cytoplasmic ; additionally functions as iron regulatory protein 1, when the iron levels...migration, and invasiveness. Determine if knockdown of m-acon and Deferiprone inhibit TCA cycle activity, glycolysis and lactate, and increase
Hu, D; Luo, W; Fan, L F; Liu, F L; Gu, J; Deng, H M; Zhang, C; Huang, L H; Feng, Q L
2016-04-01
Significant changes usually take place in the internal metabolism of insects during metamorphosis. The glycolysis-tricarboxylic acid (glycolysis-TCA) pathway is important for energy metabolism. To elucidate its dynamics, the mRNA levels of genes involved in this pathway were examined in the midgut of Spodoptera litura during metamorphosis, and the pyruvate content was quantified. The expression patterns of these genes in response to starvation were examined, and the interaction between protein phosphatase 1 (PP1) and phosphofructokinase (PFK) was studied. The results revealed that the expression or activities of most glycolytic enzymes was down-regulated in prepupae and then recovered in some degree in pupae, and all TCA-related genes were remarkably suppressed in both the prepupae and pupae. Pyruvate was enriched in the pupal midgut. Taken together, these results suggest that insects decrease both glycolysis and TCA in prepupae to save energy and then up-regulate glycolysis but down-regulate TCA in pupae to increase the supply of intermediates for construction of new organs. The expression of all these genes were down-regulated by starvation, indicating that non-feeding during metamorphosis may be a regulator of glycolysis-TCA pathway in the midgut. Importantly, interaction between PP1 and PFK was identified and is suggested to be involved in the regulation of glycolysis. © 2015 The Royal Entomological Society.
Leukemia cells demonstrate a different metabolic perturbation provoked by 2-deoxyglucose.
Miwa, Hiroshi; Shikami, Masato; Goto, Mineaki; Mizuno, Shohei; Takahashi, Miyuki; Tsunekawa-Imai, Norikazu; Ishikawa, Takamasa; Mizutani, Motonori; Horio, Tomohiro; Gotou, Mayuko; Yamamoto, Hidesuke; Wakabayashi, Motohiro; Watarai, Masaya; Hanamura, Ichiro; Imamura, Akira; Mihara, Hidetsugu; Nitta, Masakazu
2013-05-01
The shift in energy metabolism from oxidative phosphorylation to glycolysis can serve as a target for the inhibition of cancer growth. Here, we examined the metabolic changes induced by 2-deoxyglucose (2-DG), a glycolysis inhibitor, in leukemia cells by metabolome analysis. NB4 cells mainly utilized glucose as an energy source by glycolysis and oxidative phosphorylation in mitochondria, since metabolites in the glycolytic pathway and in the tricarboxylic acid (TCA) cycle were significantly decreased by 2-DG. In THP-1 cells, metabolites in the TCA cycle were not decreased to the same extent by 2-DG as in NB4 cells, which indicates that THP-1 utilizes energy sources other than glucose. TCA cycle metabolites in THP-1 cells may be derived from acetyl-CoA by fatty acid β-oxidation, which was supported by abundant detection of carnitine and acetylcarnitine in THP-1 cells. 2-DG treatment increased the levels of pentose phosphate pathway (PPP) metabolites and augmented the generation of NADPH by glucose-6-phosphate dehydrogenase. An increase in NADPH and upregulation of glutathione synthetase expression resulted in the increase in the reduced form of glutathione by 2-DG in NB4 cells. We demonstrated that a combination of 2-DG and inhibition of PPP by dehydroepiandrosterone (DHEA) effectively suppressed the growth of NB4 cells. The replenishment of the TCA cycle by fatty acid oxidation by carnitine palmitoyltransferase in THP-1 cells, treated by 2-DG, might be regulated by AMPK, as the combination of 2-DG and inhibition of AMPK by compound C potently suppressed the growth of THP-1 cells. Although 2-DG has been effective in preclinical and clinical studies, this treatment has not been fully explored due to concerns related to potential toxicities such as brain toxicity at high doses. We demonstrated that a combination of 2-DG and DHEA or compound C at a relatively low concentration effectively inhibits the growth of NB4 and THP-1 cells, respectively. These observations may aid in the identification of appropriate combinations of metabolic inhibitors at low concentrations which do not cause toxicities.
Ji, Xiaotong; Ku, Tingting; Zhu, Na; Ning, Xia; Wei, Wei; Li, Guangke; Sang, Nan
2016-12-15
Buprofezin is known for its broad-spectrum action and environmental safety. The popularity of buprofezin has raised concerns about its potentially adverse effects on human health and risk to the environment. In this study, we first identified the liver as one of the major organs in which buprofezin accumulated, and we detected a severe oxidative stress response. Next, we demonstrated that sublethal concentrations of buprofezin promoted the conversion of energy metabolism from the aerobic tricarboxylic acid (TCA) cycle and oxidative phosphorylation to anaerobic glycolysis. Importantly, reactive oxygen species (ROS) generation partially accounted for the shunting of the energy metabolism through the buprofezin-mediated inhibition of cytochrome c oxidase activity. ROS directly perturbed the activities of several key TCA cycle enzymes, stimulated glycolysis, and indirectly disturbed the activity of the respiratory chain complex by altering mitochondrial DNA (mtDNA). These findings clarify the potential mechanisms of buprofezin toxicity and provide biomarkers for buprofezin-mediated hepatotoxicity at sublethal concentrations. Copyright © 2016 Elsevier B.V. All rights reserved.
Choi, Yong-Min; Kim, Han-Kyul; Shim, Wooyoung; Anwar, Muhammad Ayaz; Kwon, Ji-Woong; Kwon, Hyuk-Kwon; Kim, Hyung Joong; Jeong, Hyobin; Kim, Hwan Myung; Hwang, Daehee; Kim, Hyung Sik; Choi, Sangdun
2015-01-01
The chemotherapeutic use of cisplatin is limited by its severe side effects. In this study, by conducting different omics data analyses, we demonstrated that cisplatin induces cell death in a proximal tubular cell line by suppressing glycolysis- and tricarboxylic acid (TCA)/mitochondria-related genes. Furthermore, analysis of the urine from cisplatin-treated rats revealed the lower expression levels of enzymes involved in glycolysis, TCA cycle, and genes related to mitochondrial stability and confirmed the cisplatin-related metabolic abnormalities. Additionally, an increase in the level of p53, which directly inhibits glycolysis, has been observed. Inhibition of p53 restored glycolysis and significantly reduced the rate of cell death at 24 h and 48 h due to p53 inhibition. The foremost reason of cisplatin-related cytotoxicity has been correlated to the generation of mitochondrial reactive oxygen species (ROS) that influence multiple pathways. Abnormalities in these pathways resulted in the collapse of mitochondrial energy production, which in turn sensitized the cells to death. The quenching of ROS led to the amelioration of the affected pathways. Considering these observations, it can be concluded that there is a significant correlation between cisplatin and metabolic dysfunctions involving mROS as the major player.
Overexpression of the human DEK oncogene reprograms cellular metabolism and promotes glycolysis
Watanabe, Miki; Muraleedharan, Ranjithmenon; Lambert, Paul F.; Lane, Andrew N.; Romick-Rosendale, Lindsey E.; Wells, Susanne I.
2017-01-01
The DEK oncogene is overexpressed in many human malignancies including at early tumor stages. Our reported in vitro and in vivo models of squamous cell carcinoma have demonstrated that DEK contributes functionally to cellular and tumor survival and to proliferation. However, the underlying molecular mechanisms remain poorly understood. Based on recent RNA sequencing experiments, DEK expression was necessary for the transcription of several metabolic enzymes involved in anabolic pathways. This identified a possible mechanism whereby DEK may drive cellular metabolism to enable cell proliferation. Functional metabolic Seahorse analysis demonstrated increased baseline and maximum extracellular acidification rates, a readout of glycolysis, in DEK-overexpressing keratinocytes and squamous cell carcinoma cells. DEK overexpression also increased the maximum rate of oxygen consumption and therefore increased the potential for oxidative phosphorylation (OxPhos). To detect small metabolites that participate in glycolysis and the tricarboxylic acid cycle (TCA) that supplies substrate for OxPhos, we carried out NMR-based metabolomics studies. We found that high levels of DEK significantly reprogrammed cellular metabolism and altered the abundances of amino acids, TCA cycle intermediates and the glycolytic end products lactate, alanine and NAD+. Taken together, these data support a scenario whereby overexpression of the human DEK oncogene reprograms keratinocyte metabolism to fulfill energy and macromolecule demands required to enable and sustain cancer cell growth. PMID:28558019
Overexpression of the human DEK oncogene reprograms cellular metabolism and promotes glycolysis.
Matrka, Marie C; Watanabe, Miki; Muraleedharan, Ranjithmenon; Lambert, Paul F; Lane, Andrew N; Romick-Rosendale, Lindsey E; Wells, Susanne I
2017-01-01
The DEK oncogene is overexpressed in many human malignancies including at early tumor stages. Our reported in vitro and in vivo models of squamous cell carcinoma have demonstrated that DEK contributes functionally to cellular and tumor survival and to proliferation. However, the underlying molecular mechanisms remain poorly understood. Based on recent RNA sequencing experiments, DEK expression was necessary for the transcription of several metabolic enzymes involved in anabolic pathways. This identified a possible mechanism whereby DEK may drive cellular metabolism to enable cell proliferation. Functional metabolic Seahorse analysis demonstrated increased baseline and maximum extracellular acidification rates, a readout of glycolysis, in DEK-overexpressing keratinocytes and squamous cell carcinoma cells. DEK overexpression also increased the maximum rate of oxygen consumption and therefore increased the potential for oxidative phosphorylation (OxPhos). To detect small metabolites that participate in glycolysis and the tricarboxylic acid cycle (TCA) that supplies substrate for OxPhos, we carried out NMR-based metabolomics studies. We found that high levels of DEK significantly reprogrammed cellular metabolism and altered the abundances of amino acids, TCA cycle intermediates and the glycolytic end products lactate, alanine and NAD+. Taken together, these data support a scenario whereby overexpression of the human DEK oncogene reprograms keratinocyte metabolism to fulfill energy and macromolecule demands required to enable and sustain cancer cell growth.
Khurshed, Mohammed; Molenaar, Remco J; Lenting, Krissie; Leenders, William P; van Noorden, Cornelis J F
2017-07-25
Hotspot mutations in isocitrate dehydrogenase 1 (IDH1) initiate low-grade glioma and secondary glioblastoma and induce a neomorphic activity that converts α-ketoglutarate (α-KG) to the oncometabolite D-2-hydroxyglutarate (D-2-HG). It causes metabolic rewiring that is not fully understood. We investigated the effects of IDH1 mutations (IDH1MUT) on expression of genes that encode for metabolic enzymes by data mining The Cancer Genome Atlas. We analyzed 112 IDH1 wild-type (IDH1WT) versus 399 IDH1MUT low-grade glioma and 157 IDH1WT versus 9 IDH1MUT glioblastoma samples. In both glioma types, IDH1WT was associated with high expression levels of genes encoding enzymes that are involved in glycolysis and acetate anaplerosis, whereas IDH1MUT glioma overexpress genes encoding enzymes that are involved in the oxidative tricarboxylic acid (TCA) cycle. In vitro, we observed that IDH1MUT cancer cells have a higher basal respiration compared to IDH1WT cancer cells and inhibition of the IDH1MUT shifts the metabolism by decreasing oxygen consumption and increasing glycolysis. Our findings indicate that IDH1WT glioma have a typical Warburg phenotype whereas in IDH1MUT glioma the TCA cycle, rather than glycolytic lactate production, is the predominant metabolic pathway. Our data further suggest that the TCA in IDH1MUT glioma is driven by lactate and glutamate anaplerosis to facilitate production of α-KG, and ultimately D-2-HG. This metabolic rewiring may be a basis for novel therapies for IDH1MUT and IDH1WT glioma.
Shim, Wooyoung; Anwar, Muhammad Ayaz; Kwon, Ji-Woong; Kwon, Hyuk-Kwon; Kim, Hyung Joong; Jeong, Hyobin; Kim, Hwan Myung; Hwang, Daehee; Kim, Hyung Sik; Choi, Sangdun
2015-01-01
The chemotherapeutic use of cisplatin is limited by its severe side effects. In this study, by conducting different omics data analyses, we demonstrated that cisplatin induces cell death in a proximal tubular cell line by suppressing glycolysis- and tricarboxylic acid (TCA)/mitochondria-related genes. Furthermore, analysis of the urine from cisplatin-treated rats revealed the lower expression levels of enzymes involved in glycolysis, TCA cycle, and genes related to mitochondrial stability and confirmed the cisplatin-related metabolic abnormalities. Additionally, an increase in the level of p53, which directly inhibits glycolysis, has been observed. Inhibition of p53 restored glycolysis and significantly reduced the rate of cell death at 24 h and 48 h due to p53 inhibition. The foremost reason of cisplatin-related cytotoxicity has been correlated to the generation of mitochondrial reactive oxygen species (ROS) that influence multiple pathways. Abnormalities in these pathways resulted in the collapse of mitochondrial energy production, which in turn sensitized the cells to death. The quenching of ROS led to the amelioration of the affected pathways. Considering these observations, it can be concluded that there is a significant correlation between cisplatin and metabolic dysfunctions involving mROS as the major player. PMID:26247588
Hirasawa, Takashi; Saito, Masaki; Yoshikawa, Katsunori; Furusawa, Chikara; Shmizu, Hiroshi
2018-05-01
Corynebacterium glutamicum is known for its ability to produce glutamic acid and has been utilized for the fermentative production of various amino acids. Glutamic acid production in C. glutamicum is induced by penicillin. In this study, the transcriptome and metabolome of C. glutamicum is analyzed to understand the mechanism of penicillin-induced glutamic acid production. Transcriptomic analysis with DNA microarray revealed that expression of some glycolysis- and TCA cycle-related genes, which include those encoding the enzymes involved in conversion of glucose to 2-oxoglutaric acid, is upregulated after penicillin addition. Meanwhile, expression of some TCA cycle-related genes, encoding the enzymes for conversion of 2-oxoglutaric acid to oxaloacetic acid, and the anaplerotic reactions decreased. In addition, expression of NCgl1221 and odhI, encoding proteins involved in glutamic acid excretion and inhibition of the 2-oxoglutarate dehydrogenase, respectively, is upregulated. Functional category enrichment analysis of genes upregulated and downregulated after penicillin addition revealed that genes for signal transduction systems are enriched among upregulated genes, whereas those for energy production and carbohydrate and amino acid metabolisms are enriched among the downregulated genes. As for the metabolomic analysis using capillary electrophoresis time-of-flight mass spectrometry, the intracellular content of most metabolites of the glycolysis and the TCA cycle decreased dramatically after penicillin addition. Overall, these results indicate that the cellular metabolism and glutamic acid excretion are mainly optimized at the transcription level during penicillin-induced glutamic acid production by C. glutamicum. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rueda, Elda M.; Johnson, Jerry E.; Giddabasappa, Anand; Swaroop, Anand; Brooks, Matthew J.; Sigel, Irena; Chaney, Shawnta Y.
2016-01-01
Purpose The homeostatic regulation of cellular ATP is achieved by the coordinated activity of ATP utilization, synthesis, and buffering. Glucose is the major substrate for ATP synthesis through glycolysis and oxidative phosphorylation (OXPHOS), whereas intermediary metabolism through the tricarboxylic acid (TCA) cycle utilizes non-glucose-derived monocarboxylates, amino acids, and alpha ketoacids to support mitochondrial ATP and GTP synthesis. Cellular ATP is buffered by specialized equilibrium-driven high-energy phosphate (~P) transferring kinases. Our goals were twofold: 1) to characterize the gene expression, protein expression, and activity of key synthesizing and regulating enzymes of energy metabolism in the whole mouse retina, retinal compartments, and/or cells and 2) to provide an integrative analysis of the results related to function. Methods mRNA expression data of energy-related genes were extracted from our whole retinal Affymetrix microarray data. Fixed-frozen retinas from adult C57BL/6N mice were used for immunohistochemistry, laser scanning confocal microscopy, and enzymatic histochemistry. The immunoreactivity levels of well-characterized antibodies, for all major retinal cells and their compartments, were obtained using our established semiquantitative confocal and imaging techniques. Quantitative cytochrome oxidase (COX) and lactate dehydrogenase (LDH) activity was determined histochemically. Results The Affymetrix data revealed varied gene expression patterns of the ATP synthesizing and regulating enzymes found in the muscle, liver, and brain. Confocal studies showed differential cellular and compartmental distribution of isozymes involved in glucose, glutamate, glutamine, lactate, and creatine metabolism. The pattern and intensity of the antibodies and of the COX and LDH activity showed the high capacity of photoreceptors for aerobic glycolysis and OXPHOS. Competition assays with pyruvate revealed that LDH-5 was localized in the photoreceptor inner segments. The combined results indicate that glycolysis is regulated by the compartmental expression of hexokinase 2, pyruvate kinase M1, and pyruvate kinase M2 in photoreceptors, whereas the inner retinal neurons exhibit a lower capacity for glycolysis and aerobic glycolysis. Expression of nucleoside diphosphate kinase, mitochondria-associated adenylate kinase, and several mitochondria-associated creatine kinase isozymes was highest in the outer retina, whereas expression of cytosolic adenylate kinase and brain creatine kinase was higher in the cones, horizontal cells, and amacrine cells indicating the diversity of ATP-buffering strategies among retinal neurons. Based on the antibody intensities and the COX and LDH activity, Müller glial cells (MGCs) had the lowest capacity for glycolysis, aerobic glycolysis, and OXPHOS. However, they showed high expression of glutamate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate thiokinase, GABA transaminase, and ~P transferring kinases. This suggests that MGCs utilize TCA cycle anaplerosis and cataplerosis to generate GTP and ~P transferring kinases to produce ATP that supports MGC energy requirements. Conclusions Our comprehensive and integrated results reveal that the adult mouse retina expresses numerous isoforms of ATP synthesizing, regulating, and buffering genes; expresses differential cellular and compartmental levels of glycolytic, OXPHOS, TCA cycle, and ~P transferring kinase proteins; and exhibits differential layer-by-layer LDH and COX activity. New insights into cell-specific and compartmental ATP and GTP production, as well as utilization and buffering strategies and their relationship with known retinal and cellular functions, are discussed. Developing therapeutic strategies for neuroprotection and treating retinal deficits and degeneration in a cell-specific manner will require such knowledge. This work provides a platform for future research directed at identifying the molecular targets and proteins that regulate these processes. PMID:27499608
Rueda, Elda M; Johnson, Jerry E; Giddabasappa, Anand; Swaroop, Anand; Brooks, Matthew J; Sigel, Irena; Chaney, Shawnta Y; Fox, Donald A
2016-01-01
The homeostatic regulation of cellular ATP is achieved by the coordinated activity of ATP utilization, synthesis, and buffering. Glucose is the major substrate for ATP synthesis through glycolysis and oxidative phosphorylation (OXPHOS), whereas intermediary metabolism through the tricarboxylic acid (TCA) cycle utilizes non-glucose-derived monocarboxylates, amino acids, and alpha ketoacids to support mitochondrial ATP and GTP synthesis. Cellular ATP is buffered by specialized equilibrium-driven high-energy phosphate (~P) transferring kinases. Our goals were twofold: 1) to characterize the gene expression, protein expression, and activity of key synthesizing and regulating enzymes of energy metabolism in the whole mouse retina, retinal compartments, and/or cells and 2) to provide an integrative analysis of the results related to function. mRNA expression data of energy-related genes were extracted from our whole retinal Affymetrix microarray data. Fixed-frozen retinas from adult C57BL/6N mice were used for immunohistochemistry, laser scanning confocal microscopy, and enzymatic histochemistry. The immunoreactivity levels of well-characterized antibodies, for all major retinal cells and their compartments, were obtained using our established semiquantitative confocal and imaging techniques. Quantitative cytochrome oxidase (COX) and lactate dehydrogenase (LDH) activity was determined histochemically. The Affymetrix data revealed varied gene expression patterns of the ATP synthesizing and regulating enzymes found in the muscle, liver, and brain. Confocal studies showed differential cellular and compartmental distribution of isozymes involved in glucose, glutamate, glutamine, lactate, and creatine metabolism. The pattern and intensity of the antibodies and of the COX and LDH activity showed the high capacity of photoreceptors for aerobic glycolysis and OXPHOS. Competition assays with pyruvate revealed that LDH-5 was localized in the photoreceptor inner segments. The combined results indicate that glycolysis is regulated by the compartmental expression of hexokinase 2, pyruvate kinase M1, and pyruvate kinase M2 in photoreceptors, whereas the inner retinal neurons exhibit a lower capacity for glycolysis and aerobic glycolysis. Expression of nucleoside diphosphate kinase, mitochondria-associated adenylate kinase, and several mitochondria-associated creatine kinase isozymes was highest in the outer retina, whereas expression of cytosolic adenylate kinase and brain creatine kinase was higher in the cones, horizontal cells, and amacrine cells indicating the diversity of ATP-buffering strategies among retinal neurons. Based on the antibody intensities and the COX and LDH activity, Müller glial cells (MGCs) had the lowest capacity for glycolysis, aerobic glycolysis, and OXPHOS. However, they showed high expression of glutamate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate thiokinase, GABA transaminase, and ~P transferring kinases. This suggests that MGCs utilize TCA cycle anaplerosis and cataplerosis to generate GTP and ~P transferring kinases to produce ATP that supports MGC energy requirements. Our comprehensive and integrated results reveal that the adult mouse retina expresses numerous isoforms of ATP synthesizing, regulating, and buffering genes; expresses differential cellular and compartmental levels of glycolytic, OXPHOS, TCA cycle, and ~P transferring kinase proteins; and exhibits differential layer-by-layer LDH and COX activity. New insights into cell-specific and compartmental ATP and GTP production, as well as utilization and buffering strategies and their relationship with known retinal and cellular functions, are discussed. Developing therapeutic strategies for neuroprotection and treating retinal deficits and degeneration in a cell-specific manner will require such knowledge. This work provides a platform for future research directed at identifying the molecular targets and proteins that regulate these processes.
The role of Pyruvate Dehydrogenase Complex in cardiovascular diseases.
Sun, Wanqing; Liu, Quan; Leng, Jiyan; Zheng, Yang; Li, Ji
2015-01-15
The regulation of mammalian myocardial carbohydrate metabolism is complex; many factors such as arterial substrate and hormone levels, coronary flow, inotropic state and the nutritional status of the tissue play a role in regulating mammalian myocardial carbohydrate metabolism. The Pyruvate Dehydrogenase Complex (PDHc), a mitochondrial matrix multienzyme complex, plays an important role in energy homeostasis in the heart by providing the link between glycolysis and the tricarboxylic acid (TCA) cycle. In TCA cycle, PDHc catalyzes the conversion of pyruvate into acetyl-CoA. This review determines that there is altered cardiac glucose in various pathophysiological states consequently causing PDC to be altered. This review further summarizes evidence for the metabolism mechanism of the heart under normal and pathological conditions including ischemia, diabetes, hypertrophy and heart failure. Copyright © 2014 Elsevier Inc. All rights reserved.
Lee, Hooi Xian; Ahmad, Fisal; Saad, Bahruddin; Ismail, Mohd Nazri
2017-11-26
Date fruits are well known to be very nutritious. Nevertheless, the protein contents of the fruit, particularly the seed and flesh, are still understudied, largely due to their difficult physical characteristics. This study was conducted to compare three different protein extraction methods which were the trichloroacetic acid (TCA)-acetone (TCA-A), phenol (Phe), and TCA-acetone-phenol (TCA-A-Phe), and to perform proteomic analysis on date palm seed and flesh. Phe extraction method showed the highest protein yields for both seed (8.26 mg/g) and flesh (1.57 mg/g). Through sodium dodecyl sulfate-polyacrylamide gel electrophoresis, Phe, and TCA-A-Phe extraction methods were shown to be efficient in removing interfering compounds and gave well-resolved bands over a wide range of molecular weights. Following liquid chromatography-tandem mass spectrometry analysis, about 50-64% of extracted proteins were identified with known functions including those involved in glycolysis, Krebs cycle, defense, and storage. Phe protein extraction method was proven to be the optimal method for date flesh and seed.
Leke, Renata; Bak, Lasse K; Anker, Malene; Melø, Torun M; Sørensen, Michael; Keiding, Susanne; Vilstrup, Hendrik; Ott, Peter; Portela, Luis V; Sonnewald, Ursula; Schousboe, Arne; Waagepetersen, Helle S
2011-04-01
Cerebral hyperammonemia is believed to play a pivotal role in the development of hepatic encephalopathy (HE), a debilitating condition arising due to acute or chronic liver disease. In the brain, ammonia is thought to be detoxified via the activity of glutamine synthetase, an astrocytic enzyme. Moreover, it has been suggested that cerebral tricarboxylic acid (TCA) cycle metabolism is inhibited and glycolysis enhanced during hyperammonemia. The aim of this study was to characterize the ammonia-detoxifying mechanisms as well as the effects of ammonia on energy-generating metabolic pathways in a mouse neuronal-astrocytic co-culture model of the GABAergic system. We found that 5 mM ammonium chloride affected energy metabolism by increasing the neuronal TCA cycle activity and switching the astrocytic TCA cycle toward synthesis of substrate for glutamine synthesis. Furthermore, ammonia exposure enhanced the synthesis and release of alanine. Collectively, our results demonstrate that (1) formation of glutamine is seminal for detoxification of ammonia; (2) neuronal oxidative metabolism is increased in the presence of ammonia; and (3) synthesis and release of alanine is likely to be important for ammonia detoxification as a supplement to formation of glutamine.
NASA Astrophysics Data System (ADS)
Ye, Guozhu; Chen, Yajie; Wang, Hong-Ou; Ye, Ting; Lin, Yi; Huang, Qiansheng; Chi, Yulang; Dong, Sijun
2016-10-01
Tetrabromobisphenol A and tetrachlorobisphenol A are halogenated bisphenol A (H-BPA), and has raised concerns about their adverse effects on the development of fetuses and infants, however, the molecular mechanisms are unclear, and related metabolomics studies are limited. Accordingly, a metabolomics study based on gas chromatography-mass spectrometry was employed to elucidate the molecular developmental toxicology of H-BPA using the marine medaka (Oryzias melastigmas) embryo model. Here, we revealed decreased synthesis of nucleosides, amino acids and lipids, and disruptions in the TCA (tricarboxylic acid) cycle, glycolysis and lipid metabolism, thus inhibiting the developmental processes of embryos exposed to H-BPA. Unexpectedly, we observed enhanced neural activity accompanied by lactate accumulation and accelerated heart rates due to an increase in dopamine pathway and a decrease in inhibitory neurotransmitters following H-BPA exposure. Notably, disorders of the neural system, and disruptions in glycolysis, the TCA cycle, nucleoside metabolism, lipid metabolism, glutamate and aspartate metabolism induced by H-BPA exposure were heritable. Furthermore, lactate and dopa were identified as potential biomarkers of the developmental toxicity of H-BPA and related genetic effects. This study has demonstrated that the metabolomics approach is a useful tool for obtaining comprehensive and novel insights into the molecular developmental toxicity of environmental pollutants.
Qattan, Amal T.; Radulovic, Marko; Crawford, Mark; Godovac-Zimmermann, Jasminka
2014-01-01
Concurrent proteomics analysis of the nuclei and mitochondria of MCF7 breast cancer cells identified 985 proteins (40% of all detected proteins) present in both organelles. Numerous proteins from all five complexes involved in oxidative phosphorylation (e.g., NDUFA5, NDUFB10, NDUFS1, NDUF2, SDHA, UQRB, UQRC2, UQCRH, COX5A, COX5B, MT-CO2, ATP5A1, ATP5B, ATP5H, etc.), from the TCA-cycle (DLST, IDH2, IDH3A, OGDH, SUCLAG2, etc.), and from glycolysis (ALDOA, ENO1, FBP1, GPI, PGK1, TALDO1, etc.) were distributed to both the nucleus and mitochondria. In contrast, proteins involved in nuclear/mitochondrial RNA processing/translation and Ras/Rab signaling showed different partitioning patterns. The identity of the OxPhos, TCA-cycle, and glycolysis proteins distributed to both the nucleus and mitochondria provides evidence for spatio-functional integration of these processes over the two different subcellular organelles. We suggest that there are unrecognized aspects of functional coordination between the nucleus and mitochondria, that integration of core functional processes via wide subcellular distribution of constituent proteins is a common characteristic of cells, and that subcellular spatial integration of function may be a vital aspect of cancer. PMID:23051583
Shimada, Tomohiro; Tanaka, Kan
2016-10-01
Regulation of central carbon metabolism has long been an important research subject in every organism. While the dynamics of metabolic flows during changes in available carbon sources have been estimated based on changes in metabolism-related gene expression, as well as on changes in the metabolome, the flux change itself has scarcely been measured because of technical difficulty, which has made conclusions elusive in many cases. Here, we used a monitoring system employing Vibrio fischeri luciferase to probe the intracellular metabolic condition in Escherichia coli Using a batch culture provided with a limited amount of glucose, we performed a time course analysis, where the predominant carbon source shifts from glucose to acetate, and identified a series of sequential peaks in the luciferase activity (peaks 1 to 4). Two major peaks, peaks 1 and 3, were considered to correspond to the glucose and acetate consuming phases, respectively, based on the glucose, acetate, and dissolved oxygen concentrations in the medium. The pattern of these peaks was changed by the addition of a different carbon source or by an increasing concentration of glucose, which was consistent with the present model. Genetically, mutations involved in glycolysis or the tricarboxylic acid (TCA) cycle/gluconeogenesis specifically affected peak 1 or peak 3, respectively, as expected from the corresponding metabolic phase. Intriguingly, mutants for the acetate excretion pathway showed a phenotype of extended peak 2 and delayed transition to the TCA cycle/gluconeogenesis phase, which suggests that peak 2 represents the metabolic transition phase. These results indicate that the bacterial luciferase monitoring system is useful to understand the real-time dynamics of metabolism in living bacterial cells. Intracellular metabolic flows dynamically change during shifts in available carbon sources. However, because of technical difficulty, the flux change has scarcely been measured in living cells. Here, we used a Vibrio fischeri luciferase monitoring system to probe the intracellular metabolic condition in Escherichia coli Using a limited amount of glucose batch culture, a series of sequential peaks (peaks 1 to 4) in the luciferase activity was observed. Changes in the pattern of these peaks by the addition of extra carbon sources and in mutant strains involved in glycolysis or the TCA cycle/gluconeogenesis gene assigned the metabolic phase corresponding to peak 1 as the glycolysis phase and peak 3 as the TCA cycle/gluconeogenesis phase. Intriguingly, the acetate excretion pathway engaged in peak 2 represents the metabolic transition phase. These results indicate that the bacterial luciferase monitoring system is useful to understand the real-time dynamics of metabolism in living bacterial cells. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Jucker, B M; Cline, G W; Barucci, N; Shulman, G I
1999-01-01
To examine the effects of safflower oil versus fish oil feeding on in vivo intramuscular glucose metabolism and relative pyruvate dehydrogenase (PDH) versus tricarboxylic acid (TCA) cycle flux, rats were pair-fed on diets consisting of 1) 59% safflower oil, 2) 59% menhaden fish oil, or 3) 59% carbohydrate (control) in calories. Rates of glycolysis and glycogen synthesis were assessed by monitoring [1-(13)C]glucose label incorporation into [1-(13)C]glycogen, [3-(13)C]lactate, and [3-(13)C]alanine in the hindlimb of awake rats via 13C nuclear magnetic resonance (NMR) spectroscopy during a euglycemic (approximately 6 mmol/l) hyperinsulinemic (approximately 180 microU/ml) clamp. A steady-state isotopic analysis of lactate, alanine, and glutamate was used to determine the relative PDH versus TCA cycle flux present in muscle under these conditions. The safflower oil-fed rats were insulin resistant compared with control and fish oil-fed rats, as reflected by a markedly reduced glucose infusion rate (Ginf) during the clamp (21.4 +/- 2.3 vs. 31.6 +/- 2.8 and 31.7 +/- 1.9 mg x kg(-1) x min(-1) in safflower oil versus control and fish oil groups, respectively, P < 0.006). This decrease in insulin-stimulated glucose disposal in the safflower oil group was associated with a lower rate of glycolysis (21.7 +/- 2.2 nmol x g(-1) x min(-1)) versus control (62.1 +/- 10.3 nmol x g(-1) x min(-1), P < 0.001) and versus fish oil (45.7 +/- 6.7 nmol x g(-1) x min(-1), P < 0.04), as no change in glycogen synthesis (103 +/- 15, 133 +/- 19, and 125 +/- 14 nmol x g(-1) x min(-1) in safflower oil, fish oil, and control, respectively) was detected. The intramuscular triglyceride (TG) content was increased in the safflower oil group (7.3 +/- 0.8 micromol/g) compared with the control group (5.2 +/- 0.8 micromol/g, P < 0.05) and the fish oil group (3.6 +/- 1.1 micromol/g, P < 0.01). Conversely, the percent PDH versus TCA cycle flux was decreased in the safflower oil (43 +/- 8%) versus the control (73 +/- 8%, P < 0.01) and fish oil (64 +/- 6%, P < 0.05) groups. These data suggest that the reduced insulin-stimulated glucose disposal attributed to safflower oil feeding was a consequence of reduced glycolytic flux associated with an increase in relative free fatty acid/ketone oxidation versus TCA cycle flux, whereas fish oil feeding did not alter glucose metabolism and may in part be protective of insulin-stimulated glucose disposal by limiting intramuscular TG deposition.
Collagen Matrix Density Drives the Metabolic Shift in Breast Cancer Cells.
Morris, Brett A; Burkel, Brian; Ponik, Suzanne M; Fan, Jing; Condeelis, John S; Aguirre-Ghiso, Julio A; Castracane, James; Denu, John M; Keely, Patricia J
2016-11-01
Increased breast density attributed to collagen I deposition is associated with a 4-6 fold increased risk of developing breast cancer. Here, we assessed cellular metabolic reprogramming of mammary carcinoma cells in response to increased collagen matrix density using an in vitro 3D model. Our initial observations demonstrated changes in functional metabolism in both normal mammary epithelial cells and mammary carcinoma cells in response to changes in matrix density. Further, mammary carcinoma cells grown in high density collagen matrices displayed decreased oxygen consumption and glucose metabolism via the tricarboxylic acid (TCA) cycle compared to cells cultured in low density matrices. Despite decreased glucose entry into the TCA cycle, levels of glucose uptake, cell viability, and ROS were not different between high and low density matrices. Interestingly, under high density conditions the contribution of glutamine as a fuel source to drive the TCA cycle was significantly enhanced. These alterations in functional metabolism mirrored significant changes in the expression of metabolic genes involved in glycolysis, oxidative phosphorylation, and the serine synthesis pathway. This study highlights the broad importance of the collagen microenvironment to cellular expression profiles, and shows that changes in density of the collagen microenvironment can modulate metabolic shifts of cancer cells. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Wan, Wenting; Li, Hongxiang; Xiang, Jiamei; Yi, Fan; Xu, Lijia; Jiang, Baoping; Xiao, Peigen
2018-01-01
Maca ( Lepidium meyenii Walpers) has been used as a dietary supplement and ethnomedicine for centuries. Recently, maca has become a high profile functional food worldwide because of its multiple biological activities. This study is the first explorative research to investigate the prevention and amelioration capacity of the aqueous extract of black maca (AEM) on high-fat, high-fructose diet (HFD)-induced metabolism disorder in golden hamsters and to identify the potential mechanisms involved in these effects. For 20 weeks, 6-week-old male golden hamsters were fed the following respective diets: (1) a standard diet, (2) HFD, (3) HFD supplemented with metformin, or (4) HFD supplemented with three doses of AEM (300, 600, or 1,200 mg/kg). After 20 weeks, the golden hamsters that received daily AEM supplementation presented with the beneficial effects of improved hyperlipidemia, hyperinsulinemia, insulin resistance, and hepatic steatosis in vivo . Based on the hepatic metabolomic analysis results, alterations in metabolites associated with pathological changes were examined. A total of 194 identified metabolites were mapped to 46 relative metabolic pathways, including those of energy metabolism. In addition, via in silico profiling for secondary maca metabolites by a joint pharmacophore- and structure-based approach, a compound-target-disease network was established. The results revealed that 32 bioactive compounds in maca targeted 16 proteins involved in metabolism disorder. Considering the combined metabolomics and virtual screening results, we employed quantitative real-time PCR assays to verify the gene expression of key enzymes in the relevant pathways. AEM promoted glycolysis and inhibited gluconeogenesis via regulating the expression of key genes such as Gck and Pfkm . Moreover, AEM upregulated tricarboxylic acid (TCA) cycle flux by changing the concentrations of intermediates and increasing the mRNA levels of Aco2 , Fh , and Mdh2 . In addition, the lipid-lowering effects of AEM in boththe serum and liver may be partly related to PPARα signaling activation, including enhanced fatty acid β-oxidation and lipogenesis pathway inhibition. Together, our data demonstrated that AEM intervention significantly improved lipid and glucose metabolism disorder by regulating the glycolysis/gluconeogenesis-TCA cycle and by modulating gene expression levels involved in the PPARα signaling pathway.
Wan, Wenting; Li, Hongxiang; Xiang, Jiamei; Yi, Fan; Xu, Lijia; Jiang, Baoping; Xiao, Peigen
2018-01-01
Maca (Lepidium meyenii Walpers) has been used as a dietary supplement and ethnomedicine for centuries. Recently, maca has become a high profile functional food worldwide because of its multiple biological activities. This study is the first explorative research to investigate the prevention and amelioration capacity of the aqueous extract of black maca (AEM) on high-fat, high-fructose diet (HFD)-induced metabolism disorder in golden hamsters and to identify the potential mechanisms involved in these effects. For 20 weeks, 6-week-old male golden hamsters were fed the following respective diets: (1) a standard diet, (2) HFD, (3) HFD supplemented with metformin, or (4) HFD supplemented with three doses of AEM (300, 600, or 1,200 mg/kg). After 20 weeks, the golden hamsters that received daily AEM supplementation presented with the beneficial effects of improved hyperlipidemia, hyperinsulinemia, insulin resistance, and hepatic steatosis in vivo. Based on the hepatic metabolomic analysis results, alterations in metabolites associated with pathological changes were examined. A total of 194 identified metabolites were mapped to 46 relative metabolic pathways, including those of energy metabolism. In addition, via in silico profiling for secondary maca metabolites by a joint pharmacophore- and structure-based approach, a compound-target-disease network was established. The results revealed that 32 bioactive compounds in maca targeted 16 proteins involved in metabolism disorder. Considering the combined metabolomics and virtual screening results, we employed quantitative real-time PCR assays to verify the gene expression of key enzymes in the relevant pathways. AEM promoted glycolysis and inhibited gluconeogenesis via regulating the expression of key genes such as Gck and Pfkm. Moreover, AEM upregulated tricarboxylic acid (TCA) cycle flux by changing the concentrations of intermediates and increasing the mRNA levels of Aco2, Fh, and Mdh2. In addition, the lipid-lowering effects of AEM in boththe serum and liver may be partly related to PPARα signaling activation, including enhanced fatty acid β-oxidation and lipogenesis pathway inhibition. Together, our data demonstrated that AEM intervention significantly improved lipid and glucose metabolism disorder by regulating the glycolysis/gluconeogenesis-TCA cycle and by modulating gene expression levels involved in the PPARα signaling pathway. PMID:29681858
13C-labelled microdialysis studies of cerebral metabolism in TBI patients☆
Carpenter, Keri L.H.; Jalloh, Ibrahim; Gallagher, Clare N.; Grice, Peter; Howe, Duncan J.; Mason, Andrew; Timofeev, Ivan; Helmy, Adel; Murphy, Michael P.; Menon, David K.; Kirkpatrick, Peter J.; Carpenter, T. Adrian; Sutherland, Garnette R.; Pickard, John D.; Hutchinson, Peter J.
2014-01-01
Human brain chemistry is incompletely understood and better methodologies are needed. Traumatic brain injury (TBI) causes metabolic perturbations, one result of which includes increased brain lactate levels. Attention has largely focussed on glycolysis, whereby glucose is converted to pyruvate and lactate, and is proposed to act as an energy source by feeding into neurons’ tricarboxylic acid (TCA) cycle, generating ATP. Also reportedly upregulated by TBI is the pentose phosphate pathway (PPP) that does not generate ATP but produces various molecules that are putatively neuroprotective, antioxidant and reparative, in addition to lactate among the end products. We have developed a novel combination of 13C-labelled cerebral microdialysis both to deliver 13C-labelled substrates into brains of TBI patients and recover the 13C-labelled metabolites, with high-resolution 13C NMR analysis of the microdialysates. This methodology has enabled us to achieve the first direct demonstration in humans that the brain can utilise lactate via the TCA cycle. We are currently using this methodology to make the first direct comparison of glycolysis and the PPP in human brain. In this article, we consider the application of 13C-labelled cerebral microdialysis for studying brain energy metabolism in patients. We set this methodology within the context of metabolic pathways in the brain, and 13C research modalities addressing them. PMID:24361470
Hertz, Leif; Chen, Ye
2017-01-01
The 1988 observation by Fox et al. (1988) that brief intense brain activation increases glycolysis (pyruvate formation from glucose) much more than oxidative metabolism has been abundantly confirmed. Specifically glycolytic increase was unexpected because the amount of ATP it generates is much smaller than that formed by subsequent oxidative metabolism of pyruvate. The present article shows that preferential glycolysis can be explained by metabolic processes associated with activation of the glutamate-glutamine cycle. The flux in this cycle, which is essential for production of transmitter glutamate and GABA, equals 75% of brain glucose utilization and each turn is associated with utilization of ~1 glucose molecule. About one half of the association between cycle flux and glucose metabolism occurs during neuronal conversion of glutamine to glutamate in a process similar to the malate-aspartate shuttle (MAS) except that glutamate is supplied from glutamine, not formed from α-ketoglutarate (αKG) as during operation of conventional MAS. Regular MAS function is triggered by one oxidative process in the cytosol during glycolysis causing NAD+ reduction to NADH. Since NADH cannot cross the mitochondrial membrane (MEM) for oxidation NAD+ is re-generated by conversion of cytosolic oxaloacetate (OAA) to malate, which enters the mitochondria for oxidation and in a cyclic process regenerates cytosolic OAA. Therefore MAS as well as the “pseudo-MAS” necessary for neuronal glutamate formation can only operate together with cytosolic reduction of NAD+ to NADH. The major process causing NAD+ reduction is glycolysis which therefore also must occur during neuronal conversion of glutamine to glutamate and may energize vesicular glutamate uptake which preferentially uses glycolytically derived energy. Another major contributor to the association between glutamate-glutamine cycle and glucose utilization is the need for astrocytic pyruvate to generate glutamate. Although some oxidative metabolism occurs during glutamate formation it is only one half of that during normal tricarboxylic acid (TCA) cycle function. Glutamate’s receptor stimulation leads to potassium ion (K+) release and astrocytic uptake, preferentially fueled by glycolysis and followed by release and neuronal re-accumulation. The activation-induced preferential glycolysis diminishes with continued activation and is followed by an increased ratio between oxidative metabolism and glycolysis, reflecting oxidation of generated glutamate and accumulated lactate. PMID:28890689
Tefera, Tesfaye W; Borges, Karin
2018-01-01
Although alterations in energy metabolism are known in ALS, the specific mechanisms leading to energy deficit are not understood. We measured metabolite levels derived from injected [1- 13 C]glucose and [1,2- 13 C]acetate (i.p.) in cerebral cortex and spinal cord extracts of wild type and hSOD1 G93A mice at onset and mid disease stages using high-pressure liquid chromatography, 1 H and 13 C nuclear magnetic resonance spectroscopy. Levels of spinal and cortical CNS total lactate, [3- 13 C]lactate, total alanine and [3- 13 C]alanine, but not cortical glucose and [1- 13 C]glucose, were reduced mostly at mid stage indicating impaired glycolysis. The [1- 13 C]glucose-derived [4- 13 C]glutamate, [4- 13 C]glutamine and [2- 13 C]GABA amounts were diminished at mid stage in cortex and both time points in spinal cord, suggesting decreased [3- 13 C]pyruvate entry into the TCA cycle. Lack of changes in [1,2- 13 C]acetate-derived [4,5- 13 C]glutamate, [4,5- 13 C]glutamine and [1,2- 13 C]GABA levels indicate unchanged astrocytic 13 C-acetate metabolism. Reduced levels of leucine, isoleucine and valine in CNS suggest compensatory breakdown to refill TCA cycle intermediate levels. Unlabelled, [2- 13 C] and [4- 13 C]GABA concentrations were decreased in spinal cord indicating that impaired glucose metabolism contributes to hyperexcitability and supporting the use of treatments which increase GABA amounts. In conclusion, CNS glucose metabolism is compromised, while astrocytic TCA cycling appears to be normal in the hSOD1 G93A mouse model at symptomatic disease stages.
Wei, Bangdong; Shin, Sooan; LaPorte, David; Wolfe, Alan J.; Romeo, Tony
2000-01-01
The csrA gene encodes a small RNA-binding protein, which acts as a global regulator in Escherichia coli and other bacteria (T. Romeo, Mol. Microbiol. 29:1321–1330, 1998). Its key regulatory role in central carbon metabolism, both as an activator of glycolysis and as a potent repressor of glycogen biosynthesis and gluconeogenesis, prompted us to examine the involvement of csrA in acetate metabolism and the tricarboxylic acid (TCA) cycle. We found that growth of csrA rpoS mutant strains was very poor on acetate as a sole carbon source. Surprisingly, growth also was inhibited specifically by the addition of modest amounts of acetate to rich media (e.g., tryptone broth). Cultures grown in the presence of ≥25 mM acetate consisted substantially of glycogen biosynthesis (glg) mutants, which were no longer inhibited by acetate. Several classes of glg mutations were mapped to known and novel loci. Several hypotheses were examined to provide further insight into the effects of acetate on growth and metabolism in these strains. We determined that csrA positively regulates acs (acetyl-coenzyme A synthetase; Acs) expression and isocitrate lyase activity without affecting key TCA cycle enzymes or phosphotransacetylase. TCA cycle intermediates or pyruvate, but not glucose, galactose, or glycerol, restored growth and prevented the glg mutations in the presence of acetate. Furthermore, amino acid uptake was inhibited by acetate specifically in the csrA rpoS strain. We conclude that central carbon flux imbalance, inhibition of amino acid uptake, and a deficiency in acetate metabolism apparently are combined to cause metabolic stress by depleting the TCA cycle. PMID:10692369
Qin, Jiayang; Wang, Xiuwen; Wang, Landong; Zhu, Beibei; Zhang, Xiaohua; Yao, Qingshou; Xu, Ping
2015-01-01
Lactate production is enhanced by adding calcium carbonate or sodium hydroxide during fermentation. However, Bacillus coagulans 2-6 can produce more than 180 g/L L-lactic acid when calcium lactate is accumulated, but less than 120 g/L L-lactic acid when sodium lactate is formed. The molecular mechanisms by which B. coagulans responds to calcium lactate and sodium lactate remain unclear. In this study, comparative transcriptomic methods based on high-throughput RNA sequencing were applied to study gene expression changes in B. coagulans 2-6 cultured in non-stress, sodium lactate stress and calcium lactate stress conditions. Gene expression profiling identified 712 and 1213 significantly regulated genes in response to calcium lactate stress and sodium lactate stress, respectively. Gene ontology assignments of the differentially expressed genes were performed. KEGG pathway enrichment analysis revealed that 'ATP-binding cassette transporters' were significantly affected by calcium lactate stress, and 'amino sugar and nucleotide sugar metabolism' was significantly affected by sodium lactate stress. It was also found that lactate fermentation was less affected by calcium lactate stress than by sodium lactate stress. Sodium lactate stress had negative effect on the expression of 'glycolysis/gluconeogenesis' genes but positive effect on the expression of 'citrate cycle (TCA cycle)' genes. However, calcium lactate stress had positive influence on the expression of 'glycolysis/gluconeogenesis' genes and had minor influence on 'citrate cycle (TCA cycle)' genes. Thus, our findings offer new insights into the responses of B. coagulans to different lactate stresses. Notably, our RNA-seq dataset constitute a robust database for investigating the functions of genes induced by lactate stress in the future and identify potential targets for genetic engineering to further improve L-lactic acid production by B. coagulans.
Jekabsons, Mika B; Gebril, Hoda M; Wang, Yan-Hong; Avula, Bharathi; Khan, Ikhlas A
2017-10-01
A hexose phosphate recycling model previously developed to infer fluxes through the major glucose consuming pathways in cultured cerebellar granule neurons (CGNs) from neonatal rats metabolizing [1,2- 13 C 2 ]glucose was revised by considering reverse flux through the non-oxidative pentose phosphate pathway (PPP) and symmetrical succinate oxidation within the tricarboxylic acid (TCA) cycle. The model adjusts three flux ratios to effect 13 C distribution in the hexose, pentose, and triose phosphate pools, and in TCA cycle malate to minimize the error between predicted and measured 13 C labeling in exported lactate (i.e., unlabeled, single-, double-, and triple-labeled; M, M1, M2, and M3, respectively). Inclusion of reverse non-oxidative PPP flux substantially increased the number of calculations but ultimately had relatively minor effects on the labeling of glycolytic metabolites. From the error-minimized solution in which the predicted M-M3 lactate differed by 0.49% from that measured by liquid chromatography-triple quadrupole mass spectrometry, the neurons exhibited negligible forward non-oxidative PPP flux. Thus, no glucose was used by the pentose cycle despite explicit consideration of hexose phosphate recycling. Mitochondria consumed only 16% of glucose while 45% was exported as lactate by aerobic glycolysis. The remaining 39% of glucose was shunted to pentose phosphates presumably for de novo nucleotide synthesis, but the proportion metabolized through the oxidative PPP vs. the reverse non-oxidative PPP could not be determined. The lactate exported as M1 (2.5%) and M3 (1.2%) was attributed to malic enzyme, which was responsible for 7.8% of pyruvate production (vs. 92.2% by glycolysis). The updated model is more broadly applicable to different cell types by considering bi-directional flux through the non-oxidative PPP. Its application to cultured neurons utilizing glucose as the sole exogenous substrate has demonstrated substantial oxygen-independent glucose utilization by aerobic glycolysis as well as the oxidative PPP and/or reverse non-oxidative PPP, but negligible glucose consumption by the pentose cycle. Copyright © 2017 Elsevier Ltd. All rights reserved.
Brekke, Eva M F; Walls, Anne B; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula
2012-09-01
The brain is highly susceptible to oxidative injury, and the pentose phosphate pathway (PPP) has been shown to be affected by pathological conditions, such as Alzheimer's disease and traumatic brain injury. While this pathway has been investigated in the intact brain and in astrocytes, little is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-(13)C]glucose or [3-(13)C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism of (13)C-labeled glucose via the PPP does not appear to contribute to the production of releasable lactate, it contributes to labeling of tricarboxylic acid (TCA) cycle intermediates and related amino acids. Based on glutamate isotopomers, it was calculated that PPP activity accounts for ~6% of glucose metabolism in cortical neurons and ~4% in cerebellar neurons. This is the first demonstration that pyruvate generated from glucose via the PPP contributes to the synthesis of acetyl CoA for oxidation in the TCA cycle. Moreover, the fact that (13)C labeling from glucose is incorporated into glutamate proves that both the oxidative and the nonoxidative stages of the PPP are active in neurons.
Brekke, Eva M F; Walls, Anne B; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula
2012-01-01
The brain is highly susceptible to oxidative injury, and the pentose phosphate pathway (PPP) has been shown to be affected by pathological conditions, such as Alzheimer's disease and traumatic brain injury. While this pathway has been investigated in the intact brain and in astrocytes, little is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-13C]glucose or [3-13C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism of 13C-labeled glucose via the PPP does not appear to contribute to the production of releasable lactate, it contributes to labeling of tricarboxylic acid (TCA) cycle intermediates and related amino acids. Based on glutamate isotopomers, it was calculated that PPP activity accounts for ∼6% of glucose metabolism in cortical neurons and ∼4% in cerebellar neurons. This is the first demonstration that pyruvate generated from glucose via the PPP contributes to the synthesis of acetyl CoA for oxidation in the TCA cycle. Moreover, the fact that 13C labeling from glucose is incorporated into glutamate proves that both the oxidative and the nonoxidative stages of the PPP are active in neurons. PMID:22714050
Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production.
Carinhas, Nuno; Pais, Daniel A M; Koshkin, Alexey; Fernandes, Paulo; Coroadinha, Ana S; Carrondo, Manuel J T; Alves, Paula M; Teixeira, Ana P
2016-03-23
Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-(13)C]glucose and [U-(13)C]glutamine, we apply for the first time (13)C-Metabolic flux analysis ((13)C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells metabolism during growth and CAV2 production. MDCK cells displayed a marked glycolytic and ammoniagenic metabolism, and (13)C data revealed a large fraction of glutamine-derived labelling in TCA cycle intermediates, emphasizing the role of glutamine anaplerosis. (13)C-MFA demonstrated the importance of pyruvate cycling in balancing glycolytic and TCA cycle activities, as well as occurrence of reductive alphaketoglutarate (AKG) carboxylation. By turn, CAV2 infection significantly upregulated fluxes through most central metabolism, including glycolysis, pentose-phosphate pathway, glutamine anaplerosis and, more prominently, reductive AKG carboxylation and cytosolic acetyl-coenzyme A formation, suggestive of increased lipogenesis. Based on these results, we suggest culture supplementation strategies to stimulate nucleic acid and lipid biosynthesis for improved canine adenoviral vector production.
Li, Huihui; An, Yanpeng; Zhang, Lulu; Lei, Hehua; Zhang, Limin; Wang, Yulan; Tang, Huiru
2013-12-06
Inflammation is closely associated with pathogenesis of various metabolic disorders, cardiovascular diseases, and cancers. To understand the systems responses to localized inflammation, we analyzed the dynamic metabolic changes in rat plasma and urine associated with the carrageenan-induced self-limiting pleurisy using NMR spectroscopy in conjunction with multivariate data analysis. Fatty acids in plasma were also analyzed using GC-FID/MS with the data from clinical chemistry and histopathology as complementary information. We found that in the acute phase of inflammation rats with pleurisy had significantly lower levels in serum albumin, fatty acids, and lipoproteins but higher globulin level and larger quantity of pleural exudate than controls. The carrageenan-induced inflammation was accompanied by significant metabolic alterations involving TCA cycle, glycolysis, biosyntheses of acute phase proteins, and metabolisms of amino acids, fatty acids, ketone bodies, and choline in acute phase. The resolution process of pleurisy was heterogeneous, and two subgroups were observed for the inflammatory rats at day-6 post treatment with different metabolic features together with the quantity of pleural exudate and weights of thymus and spleen. The metabolic differences between these subgroups were reflected in the levels of albumin and acute-phase proteins, the degree of returning to normality for multiple metabolic pathways including glycolysis, TCA cycle, gut microbiota functions, and metabolisms of lipids, choline and vitamin B3. These findings provided some essential details for the dynamic metabolic changes associated with the carrageenan-induced self-limiting inflammation and demonstrated the combined NMR and GC-FID/MS analysis as a powerful approach for understanding biochemical aspects of inflammation.
Therapeutic targeting of cancer cell metabolism
Hamaker, Max; Sun, Peng; Le, Anne; Gao, Ping
2012-01-01
In 1927, Otto Warburg and coworkers reported the increased uptake of glucose and production of lactate by tumors in vivo as compared with normal tissues. This phenomenon, now known as the Warburg effect, was recapitulated in vitro with cancer tissue slices exhibiting excessive lactate production even with adequate oxygen. Warburg's in vivo studies of tumors further suggest that the dependency of tumors in vivo on glucose could be exploited for therapy, because reduction of arterial glucose by half resulted in a four-fold reduction in tumor fermentation. Recent work in cancer metabolism indicates that the Warburg effect or aerobic glycolysis contributes to redox balance and lipid synthesis, but glycolysis is insufficient to sustain a growing and dividing cancer cell. In this regard, glutamine, which contributes its carbons to the tricarboxylic acid (TCA) cycle, has been re-discovered as an essential bioenergetic and anabolic substrate for many cancer cell types. Could alterations in cancer metabolism be exploited for therapy? Here, we address this question by reviewing current concepts of normal metabolism and altered metabolism in cancer cells with specific emphasis on molecular targets involved directly in glycolysis or glutamine metabolism. PMID:21301795
Qin, Jiayang; Wang, Xiuwen; Wang, Landong; Zhu, Beibei; Zhang, Xiaohua; Yao, Qingshou; Xu, Ping
2015-01-01
Lactate production is enhanced by adding calcium carbonate or sodium hydroxide during fermentation. However, Bacillus coagulans 2-6 can produce more than 180 g/L L-lactic acid when calcium lactate is accumulated, but less than 120 g/L L-lactic acid when sodium lactate is formed. The molecular mechanisms by which B. coagulans responds to calcium lactate and sodium lactate remain unclear. In this study, comparative transcriptomic methods based on high-throughput RNA sequencing were applied to study gene expression changes in B. coagulans 2-6 cultured in non-stress, sodium lactate stress and calcium lactate stress conditions. Gene expression profiling identified 712 and 1213 significantly regulated genes in response to calcium lactate stress and sodium lactate stress, respectively. Gene ontology assignments of the differentially expressed genes were performed. KEGG pathway enrichment analysis revealed that ‘ATP-binding cassette transporters’ were significantly affected by calcium lactate stress, and ‘amino sugar and nucleotide sugar metabolism’ was significantly affected by sodium lactate stress. It was also found that lactate fermentation was less affected by calcium lactate stress than by sodium lactate stress. Sodium lactate stress had negative effect on the expression of ‘glycolysis/gluconeogenesis’ genes but positive effect on the expression of ‘citrate cycle (TCA cycle)’ genes. However, calcium lactate stress had positive influence on the expression of ‘glycolysis/gluconeogenesis’ genes and had minor influence on ‘citrate cycle (TCA cycle)’ genes. Thus, our findings offer new insights into the responses of B. coagulans to different lactate stresses. Notably, our RNA-seq dataset constitute a robust database for investigating the functions of genes induced by lactate stress in the future and identify potential targets for genetic engineering to further improve L-lactic acid production by B. coagulans. PMID:25875592
Xu, Shan; Tian, Yuan; Hu, Yili; Zhang, Nijia; Hu, Sheng; Song, Dandan; Wu, Zhengshun; Wang, Yulan; Cui, Yanfang; Tang, Huiru
2016-06-22
The effects of tumorigenesis and tumor growth on the non-involved organs remain poorly understood although many research efforts have already been made for understanding the metabolic phenotypes of various tumors. To better the situation, we systematically analyzed the metabolic phenotypes of multiple non-involved mouse organ tissues (heart, liver, spleen, lung and kidney) in an A549 lung cancer xenograft model at two different tumor-growth stages using the NMR-based metabonomics approaches. We found that tumor growth caused significant metabonomic changes in multiple non-involved organ tissues involving numerous metabolic pathways, including glycolysis, TCA cycle and metabolisms of amino acids, fatty acids, choline and nucleic acids. Amongst these, the common effects are enhanced glycolysis and nucleoside/nucleotide metabolisms. These findings provided essential biochemistry information about the effects of tumor growth on the non-involved organs.
Li, Guanwu; Tsao, Sai-Wah; Chiu, Jen-Fu
2016-01-01
Arsenic and benzo[β]pyrene (B[a]P) are common contaminants in developing countries. Many studies have investigated the consequences of arsenic and/or B[a]P-induced cellular transformation, including altered metabolism. In the present study, we show that, in addition to elevated glycolysis, B[a]P/arsenic-induced transformation also stimulates oxidative phosphorylation (OXPHOS). Proteomic data and immunoblot studies demonstrated that enzymatic activities, involved in both glycolysis and OXPHOS, are upregulated in the primary transformed rat lung epithelial cell (TLEC) culture, as well as in subcloned TLEC cell lines (TMCs), indicating that OXPHOS was active and still contributed to energy production. LEC expression, of the glycolytic enzyme phosphoglycerate mutase (PGAM) and the TCA cycle enzyme alpha-ketoglutarate dehydrogenase (OGDH), revealed an alternating cyclic pattern of glycolysis and OXPHOS during cell transformation. We also found that the expression levels of hypoxia-inducible factor-1β were consistent with the pattern of glycolysis during the course of transformation. Low doses of an ATP synthase inhibitor depleted endogenous ATP levels to a greater extent in TLECs, compared to parental LECs, indicating greater sensitivity of B[a]P/arsenic-transformed cells to ATP depletion. However, TLEC cells exhibited better survival under hypoxia, possibly due to further induction of anaerobic glycolysis. Collectively, our data indicate that B[a]P/arsenic-transformed cells can maintain energy production through upregulation of both glycolysis and OXPHOS. Selective inhibition of metabolic pathways may serve as a therapeutic option for cancer therapy. PMID:27276679
Liu, Wenlan; Sun, Zhirong; Qu, Jixu; Yang, Chunning; Zhang, Xiaomin; Wei, Xinxin
2017-01-01
The aim of the present study was to investigate the correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis. Root respiration was determined using a biological oxygen analyzer. Respiration-related enzymes including glucose-6-phosphate dehydrogenase plus 6-phosphogluconate dehydrogenase, phosphohexose isomerase and succinate dehydrogenase, and respiratory pathways were evaluated. Biomass was determined by a drying-weighing method. In addition, the percentage of glycyrrhizic acid was detected using high-performance liquid chromatography. The association between root respiration and the levels of biomass and glycyrrhizic acid was investigated. The glycolysis pathway (EMP), tricarboxylic acid cycle (TCA) and pentose phosphate (PPP) pathway acted concurrently in the roots of G. uralensis. Grey correlation analysis showed that TCA had the strongest correlation (correlation coefficient, 0.8003) with biomass. Starch and acetyl coenzyme A had the closest association with above-ground biomass, while soluble sugar correlated less strongly with above-ground biomass. Grey correlation analysis between biochemical pathways and the intermediates showed that pyruvic acid had the strongest correlation with EMP, while acetyl coenzyme A correlated most strongly with TCA. Among the intermediates and pathways, pyruvic acid and EMP exhibited the greatest correlation with glycyrrhizic acid, while acetyl coenzyme A and TCA correlated with glycyrrhizic acid less closely. The results of this study may aid the cultivation of G. uralensis. However, these results require verification in further studies. PMID:28962162
Liu, Wenlan; Sun, Zhirong; Qu, Jixu; Yang, Chunning; Zhang, Xiaomin; Wei, Xinxin
2017-09-01
The aim of the present study was to investigate the correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis . Root respiration was determined using a biological oxygen analyzer. Respiration-related enzymes including glucose-6-phosphate dehydrogenase plus 6-phosphogluconate dehydrogenase, phosphohexose isomerase and succinate dehydrogenase, and respiratory pathways were evaluated. Biomass was determined by a drying-weighing method. In addition, the percentage of glycyrrhizic acid was detected using high-performance liquid chromatography. The association between root respiration and the levels of biomass and glycyrrhizic acid was investigated. The glycolysis pathway (EMP), tricarboxylic acid cycle (TCA) and pentose phosphate (PPP) pathway acted concurrently in the roots of G. uralensis . Grey correlation analysis showed that TCA had the strongest correlation (correlation coefficient, 0.8003) with biomass. Starch and acetyl coenzyme A had the closest association with above-ground biomass, while soluble sugar correlated less strongly with above-ground biomass. Grey correlation analysis between biochemical pathways and the intermediates showed that pyruvic acid had the strongest correlation with EMP, while acetyl coenzyme A correlated most strongly with TCA. Among the intermediates and pathways, pyruvic acid and EMP exhibited the greatest correlation with glycyrrhizic acid, while acetyl coenzyme A and TCA correlated with glycyrrhizic acid less closely. The results of this study may aid the cultivation of G. uralensis . However, these results require verification in further studies.
Inhaled ozone (O3)-induces changes in serum metabolomic and liver transcriptomic profiles in rats☆
Miller, Desinia B.; Karoly, Edward D.; Jones, Jan C.; Ward, William O.; Vallanat, Beena D.; Andrews, Debora L.; Schladweiler, Mette C.; Snow, Samantha J.; Bass, Virginia L.; Richards, Judy E.; Ghio, Andrew J.; Cascio, Wayne E.; Ledbetter, Allen D.; Kodavanti, Urmila P.
2016-01-01
Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O3) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O3 exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O3 at 0.25, 0.50, or 1.0 ppm, 6 h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a second experiment, rats were exposed to FA or 1.0 ppm O3, 6 h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18 h post-exposure. O3 increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18 h-post second exposure. O3 increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O3. In conclusion, short-term O3 exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress–response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. PMID:25838073
Folsom, James Patrick
2015-01-01
Escherichia coli physiological, biomass elemental composition and proteome acclimations to ammonium-limited chemostat growth were measured at four levels of nutrient scarcity controlled via chemostat dilution rate. These data were compared with published iron- and glucose-limited growth data collected from the same strain and at the same dilution rates to quantify general and nutrient-specific responses. Severe nutrient scarcity resulted in an overflow metabolism with differing organic byproduct profiles based on limiting nutrient and dilution rate. Ammonium-limited cultures secreted up to 35 % of the metabolized glucose carbon as organic byproducts with acetate representing the largest fraction; in comparison, iron-limited cultures secreted up to 70 % of the metabolized glucose carbon as lactate, and glucose-limited cultures secreted up to 4 % of the metabolized glucose carbon as formate. Biomass elemental composition differed with nutrient limitation; biomass from ammonium-limited cultures had a lower nitrogen content than biomass from either iron- or glucose-limited cultures. Proteomic analysis of central metabolism enzymes revealed that ammonium- and iron-limited cultures had a lower abundance of key tricarboxylic acid (TCA) cycle enzymes and higher abundance of key glycolysis enzymes compared with glucose-limited cultures. The overall results are largely consistent with cellular economics concepts, including metabolic tradeoff theory where the limiting nutrient is invested into essential pathways such as glycolysis instead of higher ATP-yielding, but non-essential, pathways such as the TCA cycle. The data provide a detailed insight into ecologically competitive metabolic strategies selected by evolution, templates for controlling metabolism for bioprocesses and a comprehensive dataset for validating in silico representations of metabolism. PMID:26018546
Nehela, Yasser; Hijaz, Faraj; Vincent, Christopher I.
2018-01-01
ABSTRACT Huanglongbing in citrus is caused by a phloem-limited, uncultivable, gram-negative α-proteobacterium, Candidatus Liberibacter asiaticus (CLas). CLas is transmitted by the phloem-sucking insect, Diaphorina citri (Hemiptera: Liviidae), in a persistent, circulative, and propagative manner. In this study, we investigated the metabolomic and respiration rates changes in D. citri upon infection with CLas using gas chromatography-mass spectrometry (GC-MS) and gas exchange analysis. The level of glycine, L-serine, L-threonine, and gamma-amino butyric acid were higher in CLas-infected D. citri, while L-proline, L-aspartic acid, and L-pyroglutamic acid were lower in CLas-infected D. citri compared with the control. Citric acid was increased in CLas-infected D. citri, whereas malic and succinic acids were reduced. Interestingly, most of the reduced metabolites such as malate, succinate, aspartate, and L-proline are required for the growth of CLas. The increase in citric acid, serine, and glycine indicated that CLas induced glycolysis and the tricarboxylic acid cycle (TCA) in its vector. In agreement with the GC-MS results, the gene expression results also indicated that glycolysis and TCA were induced in CLas-infected D. citri and this was accompanied with an increases in respiration rate. Phosphoric acid and most of the sugar alcohols were higher in CLas-infected D. citri, indicating a response to the biotic stress or cell damage. Only slight increases in the levels of few sugars were observed in CLas-infected D. citri, which indicated that sugars are tightly regulated by D. citri. Our results indicated that CLas induces nutrient and energetic stress in its host insect. This study may provide some insights into the mechanism of colonization of CLas in its vector. PMID:28594267
Killiny, Nabil; Nehela, Yasser; Hijaz, Faraj; Vincent, Christopher I
2018-01-01
Huanglongbing in citrus is caused by a phloem-limited, uncultivable, gram-negative α-proteobacterium, Candidatus Liberibacter asiaticus (CLas). CLas is transmitted by the phloem-sucking insect, Diaphorina citri (Hemiptera: Liviidae), in a persistent, circulative, and propagative manner. In this study, we investigated the metabolomic and respiration rates changes in D. citri upon infection with CLas using gas chromatography-mass spectrometry (GC-MS) and gas exchange analysis. The level of glycine, L -serine, L -threonine, and gamma-amino butyric acid were higher in CLas-infected D. citri, while L -proline, L -aspartic acid, and L -pyroglutamic acid were lower in CLas-infected D. citri compared with the control. Citric acid was increased in CLas-infected D. citri, whereas malic and succinic acids were reduced. Interestingly, most of the reduced metabolites such as malate, succinate, aspartate, and L -proline are required for the growth of CLas. The increase in citric acid, serine, and glycine indicated that CLas induced glycolysis and the tricarboxylic acid cycle (TCA) in its vector. In agreement with the GC-MS results, the gene expression results also indicated that glycolysis and TCA were induced in CLas-infected D. citri and this was accompanied with an increases in respiration rate. Phosphoric acid and most of the sugar alcohols were higher in CLas-infected D. citri, indicating a response to the biotic stress or cell damage. Only slight increases in the levels of few sugars were observed in CLas-infected D. citri, which indicated that sugars are tightly regulated by D. citri. Our results indicated that CLas induces nutrient and energetic stress in its host insect. This study may provide some insights into the mechanism of colonization of CLas in its vector.
Wang, Huicong; Ma, Fangfang; Cheng, Lailiang
2010-07-01
Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.
Inhaled ozone (O3)-induces changes in serum metabolomic and liver transcriptomic profiles in rats.
Miller, Desinia B; Karoly, Edward D; Jones, Jan C; Ward, William O; Vallanat, Beena D; Andrews, Debora L; Schladweiler, Mette C; Snow, Samantha J; Bass, Virginia L; Richards, Judy E; Ghio, Andrew J; Cascio, Wayne E; Ledbetter, Allen D; Kodavanti, Urmila P
2015-07-15
Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O3) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O3 exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O3 at 0.25, 0.50, or 1.0ppm, 6h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a second experiment, rats were exposed to FA or 1.0ppm O3, 6h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18h post-exposure. O3 increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18h-post second exposure. O3 increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O3. In conclusion, short-term O3 exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress-response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. Published by Elsevier Inc.
Glycolysis Is Dynamic and Relates Closely to Respiration Rate in Stored Sugarbeet Roots
Megguer, Clarice A.; Fugate, Karen K.; Lafta, Abbas M.; Ferrareze, Jocleita P.; Deckard, Edward L.; Campbell, Larry G.; Lulai, Edward C.; Finger, Fernando L.
2017-01-01
Although respiration is the principal cause of the loss of sucrose in postharvest sugarbeet (Beta vulgaris L.), the internal mechanisms that control root respiration rate are unknown. Available evidence, however, indicates that respiration rate is likely to be controlled by the availability of respiratory substrates, and glycolysis has a central role in generating these substrates. To determine glycolytic changes that occur in sugarbeet roots after harvest and to elucidate relationships between glycolysis and respiration, sugarbeet roots were stored for up to 60 days, during which activities of glycolytic enzymes and concentrations of glycolytic substrates, intermediates, cofactors, and products were determined. Respiration rate was also determined, and relationships between respiration rate and glycolytic enzymes and metabolites were evaluated. Glycolysis was highly variable during storage, with 10 of 14 glycolytic activities and 14 of 17 glycolytic metabolites significantly altered during storage. Changes in glycolytic enzyme activities and metabolites occurred throughout the 60 day storage period, but were greatest in the first 4 days after harvest. Positive relationships between changes in glycolytic enzyme activities and root respiration rate were abundant, with 10 of 14 enzyme activities elevated when root respiration was elevated and 9 glycolytic activities static during periods of unchanging respiration rate. Major roles for pyruvate kinase and phosphofructokinase in the regulation of postharvest sugarbeet root glycolysis were indicated based on changes in enzymatic activities and concentrations of their substrates and products. Additionally, a strong positive relationship between respiration rate and pyruvate kinase activity was found indicating that downstream TCA cycle enzymes were unlikely to regulate or restrict root respiration in a major way. Overall, these results establish that glycolysis is not static during sugarbeet root storage and that changes in glycolysis are closely related to changes in sugarbeet root respiration. PMID:28596778
Johansen, Maja L; Bak, Lasse K; Schousboe, Arne; Iversen, Peter; Sørensen, Michael; Keiding, Susanne; Vilstrup, Hendrik; Gjedde, Albert; Ott, Peter; Waagepetersen, Helle S
2007-06-01
Cerebral hyperammonemia is a hallmark of hepatic encephalopathy, a debilitating condition arising secondary to liver disease. Pyruvate oxidation including tricarboxylic acid (TCA) cycle metabolism has been suggested to be inhibited by hyperammonemia at the pyruvate and alpha-ketoglutarate dehydrogenase steps. Catabolism of the branched-chain amino acid isoleucine provides both acetyl-CoA and succinyl-CoA, thus by-passing both the pyruvate dehydrogenase and the alpha-ketoglutarate dehydrogenase steps. Potentially, this will enable the TCA cycle to work in the face of ammonium-induced inhibition. In addition, this will provide the alpha-ketoglutarate carbon skeleton for glutamate and glutamine synthesis by glutamate dehydrogenase and glutamine synthetase (astrocytes only), respectively, both reactions fixing ammonium. Cultured cerebellar neurons (primarily glutamatergic) or astrocytes were incubated in the presence of either [U-13C]glucose (2.5 mM) and isoleucine (1 mM) or [U-13C]isoleucine and glucose. Cell cultures were treated with an acute ammonium chloride load of 2 (astrocytes) or 5 mM (neurons and astrocytes) and incorporation of 13C-label into glutamate, aspartate, glutamine and alanine was determined employing mass spectrometry. Labeling from [U-13C]glucose in glutamate and aspartate increased as a result of ammonium-treatment in both neurons and astrocytes, suggesting that the TCA cycle was not inhibited. Labeling in alanine increased in neurons but not in astrocytes, indicating elevated glycolysis in neurons. For both neurons and astrocytes, labeling from [U-13C]isoleucine entered glutamate and aspartate albeit to a lower extent than from [U-13C]glucose. Labeling in glutamate and aspartate from [U-13C]isoleucine was decreased by ammonium treatment in neurons but not in astrocytes, the former probably reflecting increased metabolism of unlabeled glucose. In astrocytes, ammonia treatment resulted in glutamine production and release to the medium, partially supported by catabolism of [U-13C]isoleucine. In conclusion, i) neuronal and astrocytic TCA cycle metabolism was not inhibited by ammonium and ii) isoleucine may provide the carbon skeleton for synthesis of glutamate/glutamine in the detoxification of ammonium.
Glutamate metabolism in HIV-1 infected macrophages: Role of HIV-1 Vpr.
Datta, Prasun K; Deshmane, Satish; Khalili, Kamel; Merali, Salim; Gordon, John C; Fecchio, Chiara; Barrero, Carlos A
2016-09-01
HIV-1 infected macrophages play a significant role in the neuropathogenesis of AIDS. HIV-1 viral protein R (Vpr) not only facilitates HIV-1 infection but also contribute to long-lived persistence in macrophages. Our previous studies using SILAC-based proteomic analysis showed that the expression of critical metabolic enzymes in the glycolytic pathway and tricarboxylic acid (TCA) cycle were altered in response to Vpr expression in macrophages. We hypothesized that Vpr-induced modulation of glycolysis and TCA cycle regulates glutamate metabolism and release in HIV-1 infected macrophages. We assessed the amount of specific metabolites induced by Vpr and HIV-1 in macrophages at the intracellular and extracellular level in a time-dependent manner utilizing multiple reaction monitoring (MRM) targeted metabolomics. In addition, stable isotope-labeled glucose and an MRM targeted metabolomics assay were used to evaluate the de novo synthesis and release of glutamate in Vpr overexpressing macrophages and HIV-1 infected macrophages, throughout the metabolic flux of glycolytic pathway and TCA cycle activation. The metabolic flux studies demonstrated an increase in glucose uptake, glutamate release and accumulation of α-ketoglutarate (α-KG) and glutamine in the extracellular milieu in Vpr expressing and HIV-1 infected macrophages. Interestingly, glutamate pools and other intracellular intermediates (glucose-6-phosphate (G6P), fructose-6-phosphate (F6P), citrate, malate, α-KG, and glutamine) showed a decreased trend except for fumarate, in contrast to the glutamine accumulation observed in the extracellular space in Vpr overexpressing macrophages. Our studies demonstrate that dysregulation of mitochondrial glutamate metabolism induced by Vpr in HIV-1 infected macrophages commonly seen, may contribute to neurodegeneration via excitotoxic mechanisms in the context of NeuroAIDS.
Glutamate metabolism in HIV-1 infected macrophages: Role of HIV-1 Vpr
Datta, Prasun K.; Deshmane, Satish; Khalili, Kamel; Merali, Salim; Gordon, John C.; Fecchio, Chiara; Barrero, Carlos A.
2016-01-01
ABSTRACT HIV-1 infected macrophages play a significant role in the neuropathogenesis of AIDS. HIV-1 viral protein R (Vpr) not only facilitates HIV-1 infection but also contribute to long-lived persistence in macrophages. Our previous studies using SILAC-based proteomic analysis showed that the expression of critical metabolic enzymes in the glycolytic pathway and tricarboxylic acid (TCA) cycle were altered in response to Vpr expression in macrophages. We hypothesized that Vpr-induced modulation of glycolysis and TCA cycle regulates glutamate metabolism and release in HIV-1 infected macrophages. We assessed the amount of specific metabolites induced by Vpr and HIV-1 in macrophages at the intracellular and extracellular level in a time-dependent manner utilizing multiple reaction monitoring (MRM) targeted metabolomics. In addition, stable isotope-labeled glucose and an MRM targeted metabolomics assay were used to evaluate the de novo synthesis and release of glutamate in Vpr overexpressing macrophages and HIV-1 infected macrophages, throughout the metabolic flux of glycolytic pathway and TCA cycle activation. The metabolic flux studies demonstrated an increase in glucose uptake, glutamate release and accumulation of α-ketoglutarate (α-KG) and glutamine in the extracellular milieu in Vpr expressing and HIV-1 infected macrophages. Interestingly, glutamate pools and other intracellular intermediates (glucose-6-phosphate (G6P), fructose-6-phosphate (F6P), citrate, malate, α-KG, and glutamine) showed a decreased trend except for fumarate, in contrast to the glutamine accumulation observed in the extracellular space in Vpr overexpressing macrophages. Our studies demonstrate that dysregulation of mitochondrial glutamate metabolism induced by Vpr in HIV-1 infected macrophages commonly seen, may contribute to neurodegeneration via excitotoxic mechanisms in the context of NeuroAIDS. PMID:27245560
Cheng, Zhi-Xue; Yang, Man-Jun; Peng, Bo; Peng, Xuan-Xian; Lin, Xiang-Min; Li, Hui
2018-06-15
The overuse and misuse of antibiotics lead to bacterial antibiotic resistance, challenging human health and intensive cultivation. It is especially required to understand for the mechanism of antibiotic resistance to control antibiotic-resistant pathogens. The present study characterized the differential proteome of levofloxacin-resistant Vibrio alginolyticus with the most advanced iTRAQ quantitative proteomics technology. A total of 160 proteins of differential abundance were identified, where 70 were decreased and 90 were increased. Further analysis demonstrated that crucial metabolic pathways like TCA cycle were significantly down-regulated. qRT-PCR analysis demonstrated the decreased gene expression of glycolysis/gluconeogenesis, the TCA cycle, and fatty acid biosynthesis. Moreover, Na(+)-NQR complex gene expression, membrane potential and the adenylate energy charge ratio were decreased, indicating that the decreased central carbon metabolism is associated to the acquisition of levofloxacin resistance. Therefore, the reduced central carbon and energy metabolisms form a characteristic feature as fitness costs of V. alginolyticus in resistance to levofloxacin. The overuse and misuse of antibiotics lead to bacterial antibiotic resistance, challenging human health and intensive cultivation. Understanding for the antibiotic resistance mechanisms is especially required to control these antibiotic-resistant pathogens. The present study characterized the differential proteome of levofloxacin-resistant Vibrio alginolyticus using the most advanced iTRAQ quantitative proteomics technology. A total of 160 differential abundance of proteins were identified with 70 decreases and 90 increases by liquid chromatography matrix assisted laser desorption ionization mass spectrometry. Most interestingly, crucial metabolic pathways such as the TCA cycle sharply fluctuated. This is the first report that the reduced central carbon and energy metabolisms form a characteristic feature as a mechanism of V. alginolyticus in resistance to levofloxacin. Copyright © 2018 Elsevier B.V. All rights reserved.
A reverse glyoxylate shunt to build a non-native route from C-4 to C-2 in Escherichia coli
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mainguet, SE; Gronenberg, LS; Wong, SS
2013-09-01
Most central metabolic pathways such as glycolysis, fatty acid synthesis, and the TCA cycle have complementary pathways that run in the reverse direction to allow flexible storage and utilization of resources. However, the glyoxylate shunt, which allows for the synthesis of four-carbon TCA cycle intermediates from acetyl-CoA, has not been found to be reversible to date. As a result, glucose can only be converted to acetyl-CoA via the decarboxylation of the three-carbon molecule pyruvate in heterotrophs. A reverse glyoxylate shunt (rGS) could be extended into a pathway that converts C-4 carboxylates into two molecules of acetyl-CoA without loss of CO2.more » Here, as a proof of concept, we engineered in Escherichia coli such a pathway to convert malate and succinate to oxaloacetate and two molecules of acetyl-CoA. We introduced ATP-coupled heterologous enzymes at the thermodynamically unfavorable steps to drive the pathway in the desired direction. This synthetic pathway in essence reverses the glyoxylate shunt at the expense of ATP. When integrated with central metabolism, this pathway has the potential to increase the carbon yield of acetate and biofuels from many carbon sources in heterotrophic microorganisms, and could be the basis of novel carbon fixation cycles. (C) 2013 Elsevier Inc. All rights reserved.« less
A reverse glyoxylate shunt to build a non-native route from C4 to C2 in Escherichia coli.
Mainguet, Samuel E; Gronenberg, Luisa S; Wong, Sio Si; Liao, James C
2013-09-01
Most central metabolic pathways such as glycolysis, fatty acid synthesis, and the TCA cycle have complementary pathways that run in the reverse direction to allow flexible storage and utilization of resources. However, the glyoxylate shunt, which allows for the synthesis of four-carbon TCA cycle intermediates from acetyl-CoA, has not been found to be reversible to date. As a result, glucose can only be converted to acetyl-CoA via the decarboxylation of the three-carbon molecule pyruvate in heterotrophs. A reverse glyoxylate shunt (rGS) could be extended into a pathway that converts C4 carboxylates into two molecules of acetyl-CoA without loss of CO2. Here, as a proof of concept, we engineered in Escherichia coli such a pathway to convert malate and succinate to oxaloacetate and two molecules of acetyl-CoA. We introduced ATP-coupled heterologous enzymes at the thermodynamically unfavorable steps to drive the pathway in the desired direction. This synthetic pathway in essence reverses the glyoxylate shunt at the expense of ATP. When integrated with central metabolism, this pathway has the potential to increase the carbon yield of acetate and biofuels from many carbon sources in heterotrophic microorganisms, and could be the basis of novel carbon fixation cycles. © 2013 Elsevier Inc. All rights reserved.
Mukherjee, Joy; Ow, Saw Yen; Noirel, Josselin; Biggs, Catherine A
2011-02-01
Cell surface physicochemical characterization techniques were combined with quantitative changes in protein expression, to investigate the biological and biophysical changes of Escherichia coli MG1655 cells when grown as a biofilm (BIO). The overall surface charge of BIO cells was found to be less negative, highlighting the need for a lower electrophoretic mobility for attachment to occur. Comparison of the chemical functional groups on the cell surface showed similar profiles, with the absorbance intensity higher for proteins and carbohydrates in the BIO cells. Quantitative proteomic analysis demonstrated that 3 proteins were significantly increased, and 9 proteins significantly decreased in abundance, in cells grown as a BIO compared to their planktonic counterparts, with 7 of these total 12 proteins unique to this study. Proteins showing significant increased or decreased abundance include proteins involved in acid resistance, DNA protection and binding and ABC transporters. Further predictive analysis of the metabolic pathways showed an increased abundance of the amino acid metabolism and tricarboxylic acid (TCA) cycle, with a decrease in expression within the pentose phosphate and glycolysis pathways. It is therefore hypothesized that cells grown as a BIO are still energetically viable potentially using amino acids as an indirect carbon backbone source into the TCA cycle. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zhang, Li-Li; Feng, Ren-Jun; Zhang, Yin-Dong
2012-08-15
Banana peels (Musa spp.) are a good example of a plant tissue where protein extraction is challenging due to the abundance of interfering metabolites. Sample preparation is a critical step in proteomic research and is critical for good results. We sought to evaluate three methods of protein extraction: trichloroacetic acid (TCA)-acetone precipitation, phenol extraction, and TCA precipitation. We found that a modified phenol extraction protocol was the most optimal method. SDS-PAGE and two-dimensional gel electrophoresis (2-DE) demonstrated good protein separation and distinct spots of high quality protein. Approximately 300 and 550 protein spots were detected on 2-DE gels at pH values of 3-10 and 4-7, respectively. Several spots were excised from the 2-DE gels and identified by mass spectrometry. The protein spots identified were found to be involved in glycolysis, the tricarboxylic acid cycle, and the biosynthesis of ethylene. Several of the identified proteins may play important roles in banana ripening. Copyright © 2012 Society of Chemical Industry.
Shibayama, Junko; Yuzyuk, Tatiana N.; Cox, James; Makaju, Aman; Miller, Mickey; Lichter, Justin; Li, Hui; Leavy, Jane D.; Franklin, Sarah; Zaitsev, Alexey V.
2015-01-01
Heart failure (HF) is accompanied by complex alterations in myocardial energy metabolism. Up to 40% of HF patients have dyssynchronous ventricular contraction, which is an independent indicator of mortality. We hypothesized that electromechanical dyssynchrony significantly affects metabolic remodeling in the course of HF. We used a canine model of tachypacing-induced HF. Animals were paced at 200 bpm for 6 weeks either in the right atrium (synchronous HF, SHF) or in the right ventricle (dyssynchronous HF, DHF). We collected biopsies from left ventricular apex and performed comprehensive metabolic pathway analysis using multi-platform metabolomics (GC/MS; MS/MS; HPLC) and LC-MS/MS label-free proteomics. We found important differences in metabolic remodeling between SHF and DHF. As compared to Control, ATP, phosphocreatine (PCr), creatine, and PCr/ATP (prognostic indicator of mortality in HF patients) were all significantly reduced in DHF, but not SHF. In addition, the myocardial levels of carnitine (mitochondrial fatty acid carrier) and fatty acids (12:0, 14:0) were significantly reduced in DHF, but not SHF. Carnitine parmitoyltransferase I, a key regulatory enzyme of fatty acid ß-oxidation, was significantly upregulated in SHF but was not different in DHF, as compared to Control. Both SHF and DHF exhibited a reduction, but to a different degree, in creatine and the intermediates of glycolysis and the TCA cycle. In contrast to this, the enzymes of creatine kinase shuttle were upregulated, and the enzymes of glycolysis and the TCA cycle were predominantly upregulated or unchanged in both SHF and DHF. These data suggest a systemic mismatch between substrate supply and demand in pacing-induced HF. The energy deficit observed in DHF, but not in SHF, may be associated with a critical decrease in fatty acid delivery to the ß-oxidation pipeline, primarily due to a reduction in myocardial carnitine content. PMID:25790351
NASA Astrophysics Data System (ADS)
Dixit, Garima; Singh, Amit Pal; Kumar, Amit; Dwivedi, Sanjay; Deeba, Farah; Kumar, Smita; Suman, Shankar; Adhikari, Bijan; Shukla, Yogeshwar; Trivedi, Prabodh Kumar; Pandey, Vivek; Tripathi, Rudra Deo
2015-11-01
Arsenic (As) contamination of water is a global concern and rice consumption is the biggest dietary exposure to human posing carcinogenic risks, predominantly in Asia. Sulfur (S) is involved in di-sulfide linkage in many proteins and plays crucial role in As detoxification. Present study explores role of variable S supply on rice leaf proteome, its inclination towards amino acids (AA) profile and non protein thiols under arsenite exposure. Analysis of 282 detected proteins on 2-DE gel revealed 113 differentially expressed proteins, out of which 80 were identified by MALDI-TOF-TOF. The identified proteins were mostly involved in glycolysis, TCA cycle, AA biosynthesis, photosynthesis, protein metabolism, stress and energy metabolism. Among these, glycolytic enzymes play a major role in AA biosynthesis that leads to change in AAs profiling. Proteins of glycolytic pathway, photosynthesis and energy metabolism were also validated by western blot analysis. Conclusively S supplementation reduced the As accumulation in shoot positively skewed thiol metabolism and glycolysis towards AA accumulation under AsIII stress.
Chen, Yong; Li, Shuya; Xiong, Jian; Li, Zhenjiang; Bai, Jianxin; Zhang, Lei; Ye, Qi; Ouyang, Pingkai; Ying, Hanjie
2010-03-01
A whole cell biocatalytic process for uridine 5'-monophosphate (UMP) production from orotic acid by Saccharomyces cerevisiae was developed. The concentration of UMP was increased by 23% when 1 g l(-1) sodium citrate was fed into the broth. Effects of citrate addition on UMP production were investigated. Glucose-6-phosphate pool was elevated by onefold, while FBP and pyruvate were decreased by 42% and 40%, respectively. Organic acid pools such as acetate and succinate were averagely decreased by 30% and 49%. The results demonstrated that manipulation of citrate levels could be used as a novel tool to regulate the metabolic fluxes distribution among glycolysis, pentose phosphate pathway, and TCA cycle.
McDonald, Tanya S; Borges, Karin
2017-07-01
To determine changes in glucose metabolism and the enzymes involved in the hippocampus ictally and postictally in the acute mouse flurothyl seizure model. [U- 13 C]-Glucose was injected (i.p.) prior to, or following a 5 min flurothyl-induced seizure. Fifteen minutes later, mice were killed and the total metabolite levels and % 13 C enrichment were analyzed in the hippocampal formation using gas chromatography-mass spectrometry. Activities of key metabolic and antioxidant enzymes and the phosphorylation status of pyruvate dehydrogenase were measured, along with lipid peroxidation. During seizures, total lactate levels increased 1.7-fold; however, [M + 3] enrichment of both lactate and alanine were reduced by 30% and 43%, respectively, along with a 28% decrease in phosphofructokinase activity. Postictally the % 13 C enrichments of all measured tricarboxylic acid (TCA) cycle intermediates and the amino acids were reduced by 46-93%. At this time, pyruvate dehydrogenase (PDH) activity was 56% of that measured in controls, and there was a 1.9-fold increase in the phosphorylation of PDH at ser232. Phosphorylation of PDH is known to decrease its activity. Here, we show that the increase of lactate levels during flurothyl seizures is from a source other than [U- 13 C]-glucose, such as glycogen. Surprisingly, although we saw a reduction in phosphofructokinase activity during the seizure, metabolism of [U- 13 C]-glucose into the TCA cycle seemed unaffected. Similar to our recent findings in the chronic phase of the pilocarpine model, postictally the metabolism of glucose by glycolysis and the TCA cycle was impaired along with reduced PDH activity. Although this decrease in activity may be a protective mechanism to reduce oxidative stress, which is observed in the flurothyl model, ATP is critical to the recovery of ion and neurotransmitter balance and return to normal brain function. Thus we identified promising novel strategies to enhance energy metabolism and recovery from seizures. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.
Zhang, Limin; Ye, Yangfang; An, Yanpeng; Tian, Yuan; Wang, Yulan; Tang, Huiru
2011-02-04
Exposure to aflatoxins causes liver fibrosis and hepatocellular carcinoma posing a significant health risk for human populations and livestock. To understand the mammalian systems responses to aflatoxin-B1 (AFB1) exposure, we analyzed the AFB1-induced metabonomic changes in multiple biological matrices (plasma, urine, and liver) of rats using (1)H NMR spectroscopy together with clinical biochemistry and histopathologic assessments. We found that AFB1 exposure caused significant elevation of glucose, amino acids, and choline metabolites (choline, phosphocholine, and glycerophosphocholine) in plasma but reduction of plasma lipids. AFB1 also induced elevation of liver lipids, amino acids (tyrosine, histidine, phenylalanine, leucine, isoleucine, and valine), choline, and nucleic acid metabolites (inosine, adenosine, and uridine) together with reduction of hepatic glycogen and glucose. AFB1 further caused decreases in urinary TCA cycle intermediates (2-oxoglutarate and citrate) and elevation of gut microbiota cometabolites (phenylacetylglycine and hippurate). These indicated that AFB1 exposure caused hepatic steatosis accompanied with widespread metabolic changes including lipid and cell membrane metabolisms, protein biosynthesis, glycolysis, TCA cycle, and gut microbiota functions. This implied that AFB1 exposure probably caused oxidative-stress-mediated impairments of mitochondria functions. These findings provide an overview of biochemical consequences of AFB1 exposure and comprehensive insights into the metabolic aspects of AFB1-induced hepatotoxicity in rats.
Kashyap, Des R; Kuzma, Marcin; Kowalczyk, Dominik A; Gupta, Dipika; Dziarski, Roman
2017-09-01
Mammalian Peptidoglycan Recognition Proteins (PGRPs) kill both Gram-positive and Gram-negative bacteria through simultaneous induction of oxidative, thiol and metal stress responses in bacteria. However, metabolic pathways through which PGRPs induce these bactericidal stress responses are unknown. We screened Keio collection of Escherichia coli deletion mutants and revealed that deleting genes for respiratory chain flavoproteins or for tricarboxylic acid (TCA) cycle resulted in increased resistance of E. coli to PGRP killing. PGRP-induced killing depended on the production of hydrogen peroxide, which required increased supply of NADH for respiratory chain oxidoreductases from central carbon catabolism (glycolysis and TCA cycle), and was controlled by cAMP-Crp. Bactericidal PGRP induced a rapid decrease in respiration, which suggested that the main source of increased production of hydrogen peroxide was a block in respiratory chain and diversion of electrons from NADH oxidoreductases to oxygen. CpxRA two-component system was a negative regulator of PGRP-induced oxidative stress. By contrast, PGRP-induced thiol stress (depletion of thiols) and metal stress (increase in intracellular free Zn 2+ through influx of extracellular Zn 2+ ) were mostly independent of oxidative stress. Thus, manipulating pathways that induce oxidative, thiol and metal stress in bacteria could be a useful strategy to design new approaches to antibacterial therapy. © 2017 John Wiley & Sons Ltd.
Shimada, Nami; Takasawa, Ryoko; Tanuma, Sei-Ichi
2018-01-15
Many cancer cells undergo metabolic reprogramming known as the Warburg effect, which is characterized by a greater dependence on glycolysis for ATP generation, even under normoxic conditions. Glyoxalase I (GLO I) is a rate-limiting enzyme involved in the detoxification of cytotoxic methylglyoxal formed in glycolysis and which is known to be highly expressed in many cancer cells. Thus, specific inhibitors of GLO I are expected to be effective anticancer drugs. We previously discovered a novel GLO I inhibitor named TLSC702. Although the strong inhibitory activity of TLSC702 was observed in the in vitro enzyme assay, higher concentrations were required to induce apoptosis at the cellular level. One of the proposed reasons for this difference is that cancer cells alter the energy metabolism leading them to become more dependent on mitochondrial respiration than glycolysis (Metabolic shift) to avoid apoptosis induction. Thus, we assumed that combination of TLSC702 with shikonin-a specific inhibitor of pyruvate kinase M2 (PKM2) that acts as a driver of TCA cycle by supplying pyruvate and which is known to be specifically expressed in cancer cells-would have anticancer effects. We herein show the anticancer effects of combination treatment with TLSC702 and shikonin, and a possible anticancer mechanism. Copyright © 2017 Elsevier Inc. All rights reserved.
Reprogramming metabolism by targeting sirtuin 6 attenuates retinal degeneration
Zhang, Lijuan; Du, Jianhai; Justus, Sally; Hsu, Chun-Wei; Bonet-Ponce, Luis; Wu, Wen-Hsuan; Tsai, Yi-Ting; Wu, Wei-Pu; Jia, Yading; Duong, Jimmy K.; Mahajan, Vinit B.; Lin, Chyuan-Sheng; Wang, Shuang; Hurley, James B.
2016-01-01
Retinitis pigmentosa (RP) encompasses a diverse group of Mendelian disorders leading to progressive degeneration of rods and then cones. For reasons that remain unclear, diseased RP photoreceptors begin to deteriorate, eventually leading to cell death and, consequently, loss of vision. Here, we have hypothesized that RP associated with mutations in phosphodiesterase-6 (PDE6) provokes a metabolic aberration in rod cells that promotes the pathological consequences of elevated cGMP and Ca2+, which are induced by the Pde6 mutation. Inhibition of sirtuin 6 (SIRT6), a histone deacetylase repressor of glycolytic flux, reprogrammed rods into perpetual glycolysis, thereby driving the accumulation of biosynthetic intermediates, improving outer segment (OS) length, enhancing photoreceptor survival, and preserving vision. In mouse retinae lacking Sirt6, effectors of glycolytic flux were dramatically increased, leading to upregulation of key intermediates in glycolysis, TCA cycle, and glutaminolysis. Both transgenic and AAV2/8 gene therapy–mediated ablation of Sirt6 in rods provided electrophysiological and anatomic rescue of both rod and cone photoreceptors in a preclinical model of RP. Due to the extensive network of downstream effectors of Sirt6, this study motivates further research into the role that these pathways play in retinal degeneration. Because reprogramming metabolism by enhancing glycolysis is not gene specific, this strategy may be applicable to a wide range of neurodegenerative disorders. PMID:27841758
Tao, Li; Zhang, Yulong; Fan, Shuru; Nobile, Clarissa J.; Guan, Guobo; Huang, Guanghua
2017-01-01
Morphological transitions and metabolic regulation are critical for the human fungal pathogen Candida albicans to adapt to the changing host environment. In this study, we generated a library of central metabolic pathway mutants in the tricarboxylic acid (TCA) cycle, and investigated the functional consequences of these gene deletions on C. albicans biology. Inactivation of the TCA cycle impairs the ability of C. albicans to utilize non-fermentable carbon sources and dramatically attenuates cell growth rates under several culture conditions. By integrating the Ras1-cAMP signaling pathway and the heat shock factor-type transcription regulator Sfl2, we found that the TCA cycle plays fundamental roles in the regulation of CO2 sensing and hyphal development. The TCA cycle and cAMP signaling pathways coordinately regulate hyphal growth through the molecular linkers ATP and CO2. Inactivation of the TCA cycle leads to lowered intracellular ATP and cAMP levels and thus affects the activation of the Ras1-regulated cAMP signaling pathway. In turn, the Ras1-cAMP signaling pathway controls the TCA cycle through both Efg1- and Sfl2-mediated transcriptional regulation in response to elevated CO2 levels. The protein kinase A (PKA) catalytic subunit Tpk1, but not Tpk2, may play a major role in this regulation. Sfl2 specifically binds to several TCA cycle and hypha-associated genes under high CO2 conditions. Global transcriptional profiling experiments indicate that Sfl2 is indeed required for the gene expression changes occurring in response to these elevated CO2 levels. Our study reveals the regulatory role of the TCA cycle in CO2 sensing and hyphal development and establishes a novel link between the TCA cycle and Ras1-cAMP signaling pathways. PMID:28787458
Shimoda, Yoichi; Han, Junkyu; Kawada, Kiyokazu; Smaoui, Abderrazak; Isoda, Hiroko
2012-01-01
Energy metabolism is a very important process to improve and maintain health from the point of view of physiology. It is well known that the intracellular ATP production is contributed to energy metabolism in cells. Cistus monspeliensis is widely used as tea, spices, and medical herb; however, it has not been focusing on the activation of energy metabolism. In this study, C. monspeliensis was investigated as the food resources by activation of energy metabolism in human intestinal epithelial cells. C. monspeliensis extract showed high antioxidant ability. In addition, the promotion of metabolites of glycolysis and TCA cycle was induced by C. monspeliensis treatment. These results suggest that C. monspeliensis extract has an ability to enhance the energy metabolism in human intestinal cells. PMID:22523469
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miller, Desinia B.; Karoly, Edward D.; Jones, Jan C.
Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O{sub 3}) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O{sub 3} exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O{sub 3} at 0.25, 0.50, or 1.0 ppm, 6 h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a secondmore » experiment, rats were exposed to FA or 1.0 ppm O{sub 3}, 6 h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18 h post-exposure. O{sub 3} increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18 h-post second exposure. O{sub 3} increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O{sub 3}. In conclusion, short-term O{sub 3} exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress–response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. - Highlights: • Ozone, an ubiquitous air pollutant induces acute systemic metabolic derangement. • Serum metabolomic approach provides novel insights in ozone-induced changes. • Ozone exposure induces leptinemia, hyperglycemia, and glucose intolerance. • Ozone increases serum free fatty acids, branched chain amino acids, cholesterols. • Ozone metabolic derangement is likely mediated by neuronal stress response pathway.« less
Xie, Wenping; Zhang, Wenpeng; Ren, Juan; Li, Wentao; Zhou, Lili; Cui, Yuan; Chen, Huiming; Yu, Wenlian; Zhuang, Xiaomei; Zhang, Zhenqing; Shen, Guolin; Li, Haishan
2018-02-14
Triclocarban (TCC) has been identified as a new environmental pollutant that is potentially hazardous to human health; however, the effects of short-term TCC exposure on cardiac function are not known. The aim of this study was to use metabonomics and molecular biology techniques to systematically elucidate the molecular mechanisms of TCC-induced effects on cardiac function in mice. Our results show that TCC inhibited the uptake, synthesis, and oxidation of fatty acids, suppressed the tricarboxylic acid (TCA) cycle, and increased aerobic glycolysis levels in heart tissue after short-term TCC exposure. TCC also inhibited the nuclear peroxisome proliferator-activated receptor α (PPARα), confirming its inhibitory effects on fatty acid uptake and oxidation. Histopathology and other analyses further confirm that TCC altered mouse cardiac physiology and pathology, ultimately affecting normal cardiac metabolic function. We elucidate the molecular mechanisms of TCC-induced harmful effects on mouse cardiac metabolism and function from a new perspective, using metabonomics and bioinformatics analysis data.
Feng, Shangguo; Jiao, Kaili; Guo, Hong; Jiang, Mengyi; Hao, Juan; Wang, Huizhong; Shen, Chenjia
2017-08-10
Lysine succinylation is a ubiquitous and important protein post-translational modification in various eukaryotic and prokaryotic cells. However, its functions in Dendrobium officinale, an important traditional Chinese orchid herb with high polysaccharide contents, are largely unknown. In our study, LC-MS/MS was used to identify the peptides that were enriched by immune-purification with a high-efficiency succinyl-lysine antibody. In total, 314 lysine succinylation sites in 207 proteins were identified. A gene ontology analysis showed that these proteins are associated with a wide range of cellular functions, from metabolic processes to stimuli responses. Moreover, two types of conserved succinylation motifs, '***K suc ******K**' and '****EK suc ***', were identified. Our data showed that lysine succinylation occurred on five key enzymes in the glycolysis pathway. The numbers of average succinylation sites on these five enzymes in plants were lower than those in bacteria and mammals. Interestingly, two active site amino acids residues, K103 and K225, could be succinylated in fructose-bisphosphate aldolase, indicating a potential function of lysine succinylation in the regulation of glycolytic enzyme activities. Furthermore, the protein-protein interaction network for the succinylated proteins showed that several functional terms, such as glycolysis, TCA cycle, oxidative phosphorylation and ribosome, are consisted. Our results provide the first comprehensive view of the succinylome of D. officinale and may accelerate future biological investigations of succinylation in the synthesis of polysaccharides, which are major active ingredients.
In vivo detection of brain Krebs cycle intermediate by hyperpolarized magnetic resonance.
Mishkovsky, Mor; Comment, Arnaud; Gruetter, Rolf
2012-12-01
The Krebs (or tricarboxylic acid (TCA)) cycle has a central role in the regulation of brain energy regulation and metabolism, yet brain TCA cycle intermediates have never been directly detected in vivo. This study reports the first direct in vivo observation of a TCA cycle intermediate in intact brain, namely, 2-oxoglutarate, a key biomolecule connecting metabolism to neuronal activity. Our observation reveals important information about in vivo biochemical processes hitherto considered undetectable. In particular, it provides direct evidence that transport across the inner mitochondria membrane is rate limiting in the brain. The hyperpolarized magnetic resonance protocol designed for this study opens the way to direct and real-time studies of TCA cycle kinetics.
Pancreatic Cancer Metabolism: Molecular Mechanisms and Clinical Applications.
Hosein, Abdel Nasser; Beg, Muhammad Shaalan
2018-05-11
Pancreatic adenocarcinoma is a leading cause of cancer mortality in western countries with a uniformly poor prognosis. Unfortunately, there has been little in the way of novel therapeutics for this malignancy over the last several decades. Derangements in metabolic circuitry favoring excess glycolysis are increasingly recognized as a key hallmark of cancer. The role of alterations in glutamine metabolism in pancreatic tumor progression has been elucidated in animal models and human cells lines, and there has been considerable interest in exploiting these aberrations for the treatment of pancreatic cancer. Other strategies targeting NQO1/GLS1 inhibition, NAD+ synthesis, and TCA cycle intermediates are being actively studied in the clinic. Aberrant metabolism in pancreatic cancer poses a unique therapeutic strategy. We review preclinical and clinical studies looking to exploit alterations in the metabolic circuitry of pancreatic cancer.
In vivo detection of brain Krebs cycle intermediate by hyperpolarized magnetic resonance
Mishkovsky, Mor; Comment, Arnaud; Gruetter, Rolf
2012-01-01
The Krebs (or tricarboxylic acid (TCA)) cycle has a central role in the regulation of brain energy regulation and metabolism, yet brain TCA cycle intermediates have never been directly detected in vivo. This study reports the first direct in vivo observation of a TCA cycle intermediate in intact brain, namely, 2-oxoglutarate, a key biomolecule connecting metabolism to neuronal activity. Our observation reveals important information about in vivo biochemical processes hitherto considered undetectable. In particular, it provides direct evidence that transport across the inner mitochondria membrane is rate limiting in the brain. The hyperpolarized magnetic resonance protocol designed for this study opens the way to direct and real-time studies of TCA cycle kinetics. PMID:22990416
Lipotoxicity in steatohepatitis occurs despite an increase in tricarboxylic acid cycle activity
Patterson, Rainey E.; Kalavalapalli, Srilaxmi; Williams, Caroline M.; Nautiyal, Manisha; Mathew, Justin T.; Martinez, Janie; Reinhard, Mary K.; McDougall, Danielle J.; Rocca, James R.; Yost, Richard A.; Cusi, Kenneth; Garrett, Timothy J.
2016-01-01
The hepatic tricarboxylic acid (TCA) cycle is central to integrating macronutrient metabolism and is closely coupled to cellular respiration, free radical generation, and inflammation. Oxidative flux through the TCA cycle is induced during hepatic insulin resistance, in mice and humans with simple steatosis, reflecting early compensatory remodeling of mitochondrial energetics. We hypothesized that progressive severity of hepatic insulin resistance and the onset of nonalcoholic steatohepatitis (NASH) would impair oxidative flux through the hepatic TCA cycle. Mice (C57/BL6) were fed a high-trans-fat high-fructose diet (TFD) for 8 wk to induce simple steatosis and NASH by 24 wk. In vivo fasting hepatic mitochondrial fluxes were determined by 13C-nuclear magnetic resonance (NMR)-based isotopomer analysis. Hepatic metabolic intermediates were quantified using mass spectrometry-based targeted metabolomics. Hepatic triglyceride accumulation and insulin resistance preceded alterations in mitochondrial metabolism, since TCA cycle fluxes remained normal during simple steatosis. However, mice with NASH had a twofold induction (P < 0.05) of mitochondrial fluxes (μmol/min) through the TCA cycle (2.6 ± 0.5 vs. 5.4 ± 0.6), anaplerosis (9.1 ± 1.2 vs. 16.9 ± 2.2), and pyruvate cycling (4.9 ± 1.0 vs. 11.1 ± 1.9) compared with their age-matched controls. Induction of the TCA cycle activity during NASH was concurrent with blunted ketogenesis and accumulation of hepatic diacylglycerols (DAGs), ceramides (Cer), and long-chain acylcarnitines, suggesting inefficient oxidation and disposal of excess free fatty acids (FFA). Sustained induction of mitochondrial TCA cycle failed to prevent accretion of “lipotoxic” metabolites in the liver and could hasten inflammation and the metabolic transition to NASH. PMID:26814015
Central metabolism controls transcription of a virulence gene regulator in Vibrio cholerae
Minato, Yusuke; Fassio, Sara R.; Wolfe, Alan J.
2013-01-01
ToxT is the central regulatory protein involved in activation of the main virulence genes in Vibrio cholerae. We have identified transposon insertions in central metabolism genes, whose disruption increases toxT transcription. These disrupted genes encode the primary respiration-linked sodium pump (NADH : ubiquinone oxidoreductase or NQR) and certain tricarboxylic acid (TCA) cycle enzymes. Observations made following stimulation of respiration in the nqr mutant or chemical inhibition of NQR activity in the TCA cycle mutants led to the hypothesis that NQR affects toxT transcription via the TCA cycle. That toxT transcription increased when the growth medium was supplemented with citrate, but decreased with oxaloacetate, focused our attention on the TCA cycle substrate acetyl-CoA and its non-TCA cycle metabolism. Indeed, both the nqr and the TCA cycle mutants increased acetate excretion. A similar correlation between acetate excretion and toxT transcription was observed in a tolC mutant and upon amino acid (NRES) supplementation. As acetate and its tendency to decrease pH exerted no strong effect on toxT transcription, and because disruption of the major acetate excretion pathway increased toxT transcription, we propose that toxT transcription is regulated by either acetyl-CoA or some close derivative. PMID:23429745
D'Alessandro, Angelo; Amelio, Ivano; Berkers, Celia R.; Antonov, Alexey; Vousden, Karen H.; Melino, Gerry; Zolla, Lello
2014-01-01
TAp63α is a member of the p53 family, which plays a central role in epithelial cancers. Recently, a role has emerged for p53 family members in cancer metabolic modulation. In order to assess whether TAp63α plays a role in cancer metabolism, we exploited p53-null osteosarcoma Tet-On Saos-2 cells, in which the expression of TAp63α was dependent on doxycycline supplementation to the medium. Metabolomics labeling experiments were performed by incubating the cells in 13C-glucose or 13C15N-glutamine-labeled culture media, as to monitor metabolic fluxes upon induced expression of TAp63α. Induced expression of TAp63α resulted in cell cycle arrest at the G1 phase. From a metabolic standpoint, expression of Tap63α promoted glycolysis and the pentose phosphate pathway, which was uncoupled from nucleotide biosynthesis, albeit prevented oxidative stress in the form of oxidized glutathione. Double 13C-glucose and 13C15N-glutamine metabolic labeling confirmed that induced expression of TAp63α corresponded to a decreased flux of pyruvate to the Krebs cycle and decreased utilization of glutamine for catabolic purposes in the TCA cycle. Results were not conclusive in relation to anabolic utilization of labeled glutamine, since it is unclear to what extent the observed minor TAp63α-dependent increases of glutamine-derived labeling in palmitate could be tied to increased rates of reductive carboxylation and de novo synthesis of fatty acids. Finally, bioinformatics elaborations highlighted a link between patient survival rates and the co-expression of p63 and rate limiting enzymes of the pentose phosphate pathway, G6PD and PGD. PMID:25229745
Hohnholt, Michaela C; Blumrich, Eva-Maria; Waagepetersen, Helle S; Dringen, Ralf
2017-11-01
Metformin is an antidiabetic drug that is used daily by millions of patients worldwide. Metformin is able to cross the blood-brain barrier and has recently been shown to increase glucose consumption and lactate release in cultured astrocytes. However, potential effects of metformin on mitochondrial tricarboxylic acid (TCA) cycle metabolism in astrocytes are unknown. We investigated this by mapping 13 C labeling in TCA cycle intermediates and corresponding amino acids after incubation of primary rat astrocytes with [U- 13 C]glucose. The presence of metformin did not compromise the viability of cultured astrocytes during 4 hr of incubation, but almost doubled cellular glucose consumption and lactate release. Compared with control cells, the presence of metformin dramatically lowered the molecular 13 C carbon labeling (MCL) of the cellular TCA cycle intermediates citrate, α-ketoglutarate, succinate, fumarate, and malate, as well as the MCL of the TCA cycle intermediate-derived amino acids glutamate, glutamine, and aspartate. In addition to the total molecular 13 C labeling, analysis of the individual isotopomers of TCA cycle intermediates confirmed a severe decline in labeling and a significant lowering in TCA cycling ratio in metformin-treated astrocytes. Finally, the oxygen consumption of mitochondria isolated from metformin-treated astrocytes was drastically reduced in the presence of complex I substrates, but not of complex II substrates. These data demonstrate that exposure to metformin strongly impairs complex I-mediated mitochondrial respiration in astrocytes, which is likely to cause the observed decrease in labeling of mitochondrial TCA cycle intermediates and the stimulation of glycolytic lactate production. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Correia, Cláudia; Koshkin, Alexey; Duarte, Patrícia; Hu, Dongjian; Carido, Madalena; Sebastião, Maria J; Gomes-Alves, Patrícia; Elliott, David A; Domian, Ibrahim J; Teixeira, Ana P; Alves, Paula M; Serra, Margarida
2018-03-01
Three-dimensional (3D) cultures of human pluripotent stem cell derived cardiomyocytes (hPSC-CMs) hold great promise for drug discovery, providing a better approximation to the in vivo physiology over standard two-dimensional (2D) monolayer cultures. However, the transition of CM differentiation protocols from 2D to 3D cultures is not straightforward. In this work, we relied on the aggregation of hPSC-derived cardiac progenitors and their culture under agitated conditions to generate highly pure cardiomyocyte aggregates. Whole-transcriptome analysis and 13 C-metabolic flux analysis allowed to demonstrate at both molecular and fluxome levels that such 3D culture environment enhances metabolic maturation of hiPSC-CMs. When compared to 2D, 3D cultures of hiPSC-CMs displayed down-regulation of genes involved in glycolysis and lipid biosynthesis and increased expression of genes involved in OXPHOS. Accordingly, 3D cultures of hiPSC-CMs had lower fluxes through glycolysis and fatty acid synthesis and increased TCA-cycle activity. Importantly, we demonstrated that the 3D culture environment reproducibly improved both CM purity and metabolic maturation across different hPSC lines, thereby providing a robust strategy to derive enriched hPSC-CMs with metabolic features closer to that of adult CMs. © 2017 Wiley Periodicals, Inc.
Physiological and Proteomic Analysis of Escherichia coli Iron-Limited Chemostat Growth
Folsom, James Patrick; Parker, Albert E.
2014-01-01
Iron bioavailability is a major limiter of bacterial growth in mammalian host tissue and thus represents an important area of study. Escherichia coli K-12 metabolism was studied at four levels of iron limitation in chemostats using physiological and proteomic analyses. The data documented an E. coli acclimation gradient where progressively more severe iron scarcity resulted in a larger percentage of substrate carbon being directed into an overflow metabolism accompanied by a decrease in biomass yield on glucose. Acetate was the primary secreted organic by-product for moderate levels of iron limitation, but as stress increased, the metabolism shifted to secrete primarily lactate (∼70% of catabolized glucose carbon). Proteomic analysis reinforced the physiological data and quantified relative increases in glycolysis enzyme abundance and decreases in tricarboxylic acid (TCA) cycle enzyme abundance with increasing iron limitation stress. The combined data indicated that E. coli responds to limiting iron by investing the scarce resource in essential enzymes, at the cost of catabolic efficiency (i.e., downregulating high-ATP-yielding pathways containing enzymes with large iron requirements, like the TCA cycle). Acclimation to iron-limited growth was contrasted experimentally with acclimation to glucose-limited growth to identify both general and nutrient-specific acclimation strategies. While the iron-limited cultures maximized biomass yields on iron and increased expression of iron acquisition strategies, the glucose-limited cultures maximized biomass yields on glucose and increased expression of carbon acquisition strategies. This study quantified ecologically competitive acclimations to nutrient limitations, yielding knowledge essential for understanding medically relevant bacterial responses to host and to developing intervention strategies. PMID:24837288
Hung, Chun-Hsien; Kanehara, Kazue; Nakamura, Yuki
2016-09-01
Triacylglycerol (TAG), a major source of biodiesel production, accumulates in nitrogen-starved Chlamydomonas reinhardtii. However, the metabolic pathway of starch-to-TAG conversion remains elusive because an enzyme that affects the starch degradation is unknown. Here, we isolated a new class of mutant bgal1, which expressed an overaccumulation of starch granules and defective photosynthetic growth. The bgal1 was a null mutant of a previously uncharacterized β-galactosidase-like gene (Cre02.g119700), which decreased total β-galactosidase activity 40% of the wild type. Upon nitrogen starvation, the bgal1 mutant showed decreased TAG accumulation mainly due to the reduced flux of de novo TAG biosynthesis evidenced by increased unsaturation of fatty acid composition in TAG and reduced TAG accumulation by additional supplementation of acetate to the culture media. Metabolomic analysis of the bgal1 mutant showed significantly reduced levels of metabolites following the hydrolysis of starch and substrates for TAG accumulation, whereas metabolites in TCA cycle were unaffected. Upon nitrogen starvation, while levels of glucose 6-phosphate, fructose 6-phosphate and acetyl-CoA remained lower, most of the other metabolites in glycolysis were increased but those in the TCA cycle were decreased, supporting TAG accumulation. We suggest that BGAL1 may be involved in the degradation of starch, which affects TAG accumulation in nitrogen-starved C. reinhardtii. This article is part of a Special Issue entitled: Plant Lipid Biology edited by Kent D. Chapman and Ivo Feussner. Copyright © 2016 Elsevier B.V. All rights reserved.
Vicente, Joaquim A F; Gomes-Santos, Carina S S; Sousa, Ana Paula M; Madeira, Vítor M C
2005-03-01
Potato tubers and turnip roots were used to prepare purified mitochondria for laboratory practical work in the teaching of the citric acid cycle (TCA cycle). Plant mitochondria are particularly advantageous over the animal fractions to demonstrate the TCA cycle enzymatic steps, by using simple techniques to measure O(2) consumption and transmembrane potential (ΔΨ). The several TCA cycle intermediates induce specific enzyme activities, which can be identified by respiratory parameters. Such a strategy is also used to evidence properties of the TCA cycle enzymes: ADP stimulation of isocitrate dehydrogenase and α-ketoglutarate dehydrogenase; activation by citrate of downstream oxidation steps, e.g. succinate dehydrogenase; and regulation of the activity of isocitrate dehydrogenase by citrate action on the citrate/isocitrate carrier. Furthermore, it has been demonstrated that, in the absence of exogenous Mg(2+) , isocitrate-dependent respiration favors the alternative oxidase pathway, as judged by changes of the ADP/O elicited by the inhibitor n-propyl galate. These are some examples of assays related with TCA cycle intermediates we can use in laboratory courses. Copyright © 2005 International Union of Biochemistry and Molecular Biology, Inc.
Li, Zongwei; Wang, Yingying; Newton, Ian P; Zhang, Lichao; Ji, Pengyu; Li, Zhuoyu
2015-06-01
Compared with normal differentiated cells, cancer cells take up much more glucose and metabolize it mainly via aerobic glycolysis. This metabolic phenotype is characterized with high expression of glucose transporters (Gluts) and pyruvate kinase M2 (PKM2). Glucose regulated protein 78 (GRP78) is a glucose-sensing protein and frequently up-regulated in cancer cells, however, whether it is directly implicated in glucose metabolism remains to be elucidated. Here we report that upon glucose deficiency, the induction of GRP78 resulted in enhanced HIF-1α transcription, accompanied by a transient increased expression of Glut-1. In addition, GRP78 was likely to facilitate the membrane translocation of Glut-1 via protein-protein interaction. Glucose starvation-stimulated GRP78 also impaired the expression of PKM2 but promoted the expression of mitochondrial pyruvate dehydrogenase A (PDHA) and B (PDHB), resulting in the metabolic shift from glycolysis to the TCA cycle. Interestingly, the inhibition of PKM2 by GRP78 was abrogated when glucose supply was restored, suggesting that GRP78 and PKM2 expressions are adaptable to the nutritional levels in the microenvironment. Further mechanistic study indicated that GRP78 overexpression activated the Class III PI3K-mediated autophagy pathway and induced autophagic degradation of IKKβ, which caused inactivation of NF-κB pathway and subsequently altered the expression of PKM2 and HIF-1α. Our study establishes GRP78 and PKM2 as the crucial molecular links between cancer cell glucose metabolism and tumor microenvironment alterations. Copyright © 2015 Elsevier Inc. All rights reserved.
Adjustment of Trehalose Metabolism in Wine Saccharomyces cerevisiae Strains To Modify Ethanol Yields
Rossouw, D.; Heyns, E. H.; Setati, M. E.; Bosch, S.
2013-01-01
The ability of Saccharomyces cerevisiae to efficiently produce high levels of ethanol through glycolysis has been the focus of much scientific and industrial activity. Despite the accumulated knowledge regarding glycolysis, the modification of flux through this pathway to modify ethanol yields has proved difficult. Here, we report on the systematic screening of 66 strains with deletion mutations of genes encoding enzymes involved in central carbohydrate metabolism for altered ethanol yields. Five of these strains showing the most prominent changes in carbon flux were selected for further investigation. The genes were representative of trehalose biosynthesis (TPS1, encoding trehalose-6-phosphate synthase), central glycolysis (TDH3, encoding glyceraldehyde-3-phosphate dehydrogenase), the oxidative pentose phosphate pathway (ZWF1, encoding glucose-6-phosphate dehydrogenase), and the tricarboxylic acid (TCA) cycle (ACO1 and ACO2, encoding aconitase isoforms 1 and 2). Two strains exhibited lower ethanol yields than the wild type (tps1Δ and tdh3Δ), while the remaining three showed higher ethanol yields. To validate these findings in an industrial yeast strain, the TPS1 gene was selected as a good candidate for genetic modification to alter flux to ethanol during alcoholic fermentation in wine. Using low-strength promoters active at different stages of fermentation, the expression of the TPS1 gene was slightly upregulated, resulting in a decrease in ethanol production and an increase in trehalose biosynthesis during fermentation. Thus, the mutant screening approach was successful in terms of identifying target genes for genetic modification in commercial yeast strains with the aim of producing lower-ethanol wines. PMID:23793638
Liu, Zhongjian; Sun, Yang; Tan, Shirui; Liu, Liang; Hu, Suqiong; Huo, Hongyu; Li, Meizhang; Cui, Qinghua; Yu, Min
2016-05-01
Although the Warburg effect is a dominant metabolic phenotype observed in cancers, the metabolic changes and adaptation occurring in tumors have been demonstrated to extend beyond the Warburg effect and thus considered a secondary effect to the transformation process of carcinogenesis, including nutritional deficiencies. However, the role of nutritional deficiencies in this metabolic reprogramming (e. g., oxidative phosphorylation (OXPHOS)/glycolysis interconversion) is not completely known yet. Here, we showed that under regular culture condition, the proliferation of U251 cells, but not other tumor cell lines, preferentially performed the Warburg effect and was remarkably inhibited by oxamic acid which can inhibit the activity of lactate dehydrogenase (LDH); whereas under serum starvation, glycolysis was depressed, tricarboxylic acid cycle (TCA) was enhanced, and the activity of OXPHOS was reinforced to maintain cellular ATP content in a high level, but interestingly, we observed a decreased expression of reactive oxygen species (ROS). Moreover, the upregulated activity of mitochondrial complex I was confirmed by Western blots and showed that the mitochondrial-related protein, NDUFA9, NDUFB8, ND1, and VDAC1 were remarkably increased after serum starved. Mechanistically, nutritional deficiencies could reduce hypoxia-inducible factor α (HIF-1α) protein expression to increase C-MYC protein level, which in turn increased nuclear respiratory factor 1 (NRF1) and mitochondrial transcription factor A (TFAM) transcription to enhance the activity of OXPHOS, suggesting that metabolic reprogramming by the changes of microenvironment during the carcinogenesis can provide some novel therapeutic clues to traditional cancer treatments.
Tcherkez, Guillaume; Mahé, Aline; Gauthier, Paul; Mauve, Caroline; Gout, Elizabeth; Bligny, Richard; Cornic, Gabriel; Hodges, Michael
2009-01-01
While the possible importance of the tricarboxylic acid (TCA) cycle reactions for leaf photosynthesis operation has been recognized, many uncertainties remain on whether TCA cycle biochemistry is similar in the light compared with the dark. It is widely accepted that leaf day respiration and the metabolic commitment to TCA decarboxylation are down-regulated in illuminated leaves. However, the metabolic basis (i.e. the limiting steps involved in such a down-regulation) is not well known. Here, we investigated the in vivo metabolic fluxes of individual reactions of the TCA cycle by developing two isotopic methods, 13C tracing and fluxomics and the use of H/D isotope effects, with Xanthium strumarium leaves. We provide evidence that the TCA “cycle” does not work in the forward direction like a proper cycle but, rather, operates in both the reverse and forward directions to produce fumarate and glutamate, respectively. Such a functional division of the cycle plausibly reflects the compromise between two contrasted forces: (1) the feedback inhibition by NADH and ATP on TCA enzymes in the light, and (2) the need to provide pH-buffering organic acids and carbon skeletons for nitrate absorption and assimilation. PMID:19675152
Doi, Yuki; Shimizu, Motoyuki; Fujita, Tomoya; Nakamura, Akira; Takizawa, Noboru
2014-01-01
We identified the extremely nitrite-tolerant bacterium Achromobacter denitrificans YD35 that can grow in complex medium containing 100 mM nitrite (NO2−) under aerobic conditions. Nitrite induced global proteomic changes and upregulated tricarboxylate (TCA) cycle enzymes as well as antioxidant proteins in YD35. Transposon mutagenesis generated NO2−-hypersensitive mutants of YD35 that had mutations at genes for aconitate hydratase and α-ketoglutarate dehydrogenase in the TCA cycle and a pyruvate dehydrogenase (Pdh) E1 component, indicating the importance of TCA cycle metabolism to NO2− tolerance. A mutant in which the pdh gene cluster was disrupted (Δpdh mutant) could not grow in the presence of 100 mM NO2−. Nitrite decreased the cellular NADH/NAD+ ratio and the cellular ATP level. These defects were more severe in the Δpdh mutant, indicating that Pdh contributes to upregulating cellular NADH and ATP and NO2−-tolerant growth. Exogenous acetate, which generates acetyl coenzyme A and then is metabolized by the TCA cycle, compensated for these defects caused by disruption of the pdh gene cluster and those caused by NO2−. These findings demonstrate a link between NO2− tolerance and pyruvate/acetate metabolism through the TCA cycle. The TCA cycle mechanism in YD35 enhances NADH production, and we consider that this contributes to a novel NO2−-tolerating mechanism in this strain. PMID:24413603
Go, Younghoon; Jeong, Ji Yun; Jeoung, Nam Ho; Jeon, Jae-Han; Park, Bo-Yoon; Kang, Hyeon-Ji; Ha, Chae-Myeong; Choi, Young-Keun; Lee, Sun Joo; Ham, Hye Jin; Kim, Byung-Gyu; Park, Keun-Gyu; Park, So Young; Lee, Chul-Ho; Choi, Cheol Soo; Park, Tae-Sik; Lee, W N Paul; Harris, Robert A; Lee, In-Kyu
2016-10-01
Hepatic steatosis is associated with increased insulin resistance and tricarboxylic acid (TCA) cycle flux, but decreased ketogenesis and pyruvate dehydrogenase complex (PDC) flux. This study examined whether hepatic PDC activation by inhibition of pyruvate dehydrogenase kinase 2 (PDK2) ameliorates these metabolic abnormalities. Wild-type mice fed a high-fat diet exhibited hepatic steatosis, insulin resistance, and increased levels of pyruvate, TCA cycle intermediates, and malonyl-CoA but reduced ketogenesis and PDC activity due to PDK2 induction. Hepatic PDC activation by PDK2 inhibition attenuated hepatic steatosis, improved hepatic insulin sensitivity, reduced hepatic glucose production, increased capacity for β-oxidation and ketogenesis, and decreased the capacity for lipogenesis. These results were attributed to altered enzymatic capacities and a reduction in TCA anaplerosis that limited the availability of oxaloacetate for the TCA cycle, which promoted ketogenesis. The current study reports that increasing hepatic PDC activity by inhibition of PDK2 ameliorates hepatic steatosis and insulin sensitivity by regulating TCA cycle anaplerosis and ketogenesis. The findings suggest PDK2 is a potential therapeutic target for nonalcoholic fatty liver disease. © 2016 by the American Diabetes Association.
Edmunds, Lia R.; Sharma, Lokendra; Wang, Huabo; Kang, Audry; d’Souza, Sonia; Lu, Jie; McLaughlin, Michael; Dolezal, James M.; Gao, Xiaoli; Weintraub, Susan T.; Ding, Ying; Zeng, Xuemei; Yates, Nathan; Prochownik, Edward V.
2015-01-01
The c-Myc (Myc) oncoprotein and AMP-activated protein kinase (AMPK) regulate glycolysis and oxidative phosphorylation (Oxphos) although often for different purposes. Because Myc over-expression depletes ATP with the resultant activation of AMPK, we explored the potential co-dependency of and cross-talk between these proteins by comparing the consequences of acute Myc induction in ampk+/+ (WT) and ampk-/- (KO) murine embryo fibroblasts (MEFs). KO MEFs showed a higher basal rate of glycolysis than WT MEFs and an appropriate increase in response to activation of a Myc-estrogen receptor (MycER) fusion protein. However, KO MEFs had a diminished ability to increase Oxphos, mitochondrial mass and reactive oxygen species in response to MycER activation. Other differences between WT and KO MEFs, either in the basal state or following MycER induction, included abnormalities in electron transport chain function, levels of TCA cycle-related oxidoreductases and cytoplasmic and mitochondrial redox states. Transcriptional profiling of pathways pertinent to glycolysis, Oxphos and mitochondrial structure and function also uncovered significant differences between WT and KO MEFs and their response to MycER activation. Finally, an unbiased mass-spectrometry (MS)-based survey capable of quantifying ~40% of all mitochondrial proteins, showed about 15% of them to be AMPK- and/or Myc-dependent in their steady state. Significant differences in the activities of the rate-limiting enzymes pyruvate kinase and pyruvate dehydrogenase, which dictate pyruvate and acetyl coenzyme A abundance, were also differentially responsive to Myc and AMPK and could account for some of the differences in basal metabolite levels that were also detected by MS. Thus, Myc and AMPK are highly co-dependent and appear to engage in significant cross-talk across numerous pathways which support metabolic and ATP-generating functions. PMID:26230505
Ren, Xiu-Xia; Xue, Jing-Qi; Wang, Shun-Li; Xue, Yu-Qian; Zhang, Ping; Jiang, Hai-Dong; Zhang, Xiu-Xin
Seed germination is a critical process that is influenced by various factors. In the present study, the effect of low temperature (4 °C) on tree peony seed germination was investigated. Compared to seeds maintained at 25 °C, germination was inhibited when seeds were kept at 4 °C. Furthermore, low-temperature exposure of seeds resulted in a delay in water uptake, starch degradation, and soluble sugar consumption and a subsequent increase in soluble protein levels. Two-dimensional gel electrophoresis (2-DE) proteomic analysis identified 100 protein spots. Comparative analysis indicated that low-temperature exposure apparently mainly affected glycolysis and the tricarboxylic acid (TCA) cycle, while also significantly affecting proteometabolism-related factors. Moreover, low-temperature exposure led to the induction of abscisic acid, whereas the gibberellin pathway was not affected. Further comparison of the two temperature conditions showed that low-temperature exposure delays carbohydrate metabolism, adenosine triphosphate (ATP) production, respiration, and proteolysis and increases defense response factors. To further examine the obtained proteomic findings, four genes were evaluated by quantitative polymerase chain reaction (qPCR). The obtained transcriptional results for the GAPC gene coincided with the translational results, thus further suggesting that the delay in glycolysis may play a key role in low-temperature-induced inhibition of seed germination. However, the other three genes examined, which included FPP synthase, PCNT115, and endochitinase, showed non-correlative transcriptional and translational profiles. Our results suggest that the exposure of tree peony seeds to low temperature results in a delay in the degradation of starch and other metabolites, which in turn affects glycolysis and some other processes, thereby ultimately inhibiting seed germination. Copyright © 2017. Published by Elsevier GmbH.
Asparagine plays a critical role in regulating cellular adaptation to glutamine depletion.
Zhang, Ji; Fan, Jing; Venneti, Sriram; Cross, Justin R; Takagi, Toshimitsu; Bhinder, Bhavneet; Djaballah, Hakim; Kanai, Masayuki; Cheng, Emily H; Judkins, Alexander R; Pawel, Bruce; Baggs, Julie; Cherry, Sara; Rabinowitz, Joshua D; Thompson, Craig B
2014-10-23
Many cancer cells consume large quantities of glutamine to maintain TCA cycle anaplerosis and support cell survival. It was therefore surprising when RNAi screening revealed that suppression of citrate synthase (CS), the first TCA cycle enzyme, prevented glutamine-withdrawal-induced apoptosis. CS suppression reduced TCA cycle activity and diverted oxaloacetate, the substrate of CS, into production of the nonessential amino acids aspartate and asparagine. We found that asparagine was necessary and sufficient to suppress glutamine-withdrawal-induced apoptosis without restoring the levels of other nonessential amino acids or TCA cycle intermediates. In complete medium, tumor cells exhibiting high rates of glutamine consumption underwent rapid apoptosis when glutamine-dependent asparagine synthesis was suppressed, and expression of asparagine synthetase was statistically correlated with poor prognosis in human tumors. Coupled with the success of L-asparaginase as a therapy for childhood leukemia, the data suggest that intracellular asparagine is a critical suppressor of apoptosis in many human tumors.
Voll, Lars Matthias; Horst, Robin Jonathan; Voitsik, Anna-Maria; Zajic, Doreen; Samans, Birgit; Pons-Kühnemann, Jörn; Doehlemann, Gunther; Münch, Steffen; Wahl, Ramon; Molitor, Alexandra; Hofmann, Jörg; Schmiedl, Alfred; Waller, Frank; Deising, Holger Bruno; Kahmann, Regine; Kämper, Jörg; Kogel, Karl-Heinz; Sonnewald, Uwe
2011-01-01
During compatible interactions with their host plants, biotrophic plant–pathogens subvert host metabolism to ensure the sustained provision of nutrient assimilates by the colonized host cells. To investigate, whether common motifs can be revealed in the response of primary carbon and nitrogen metabolism toward colonization with biotrophic fungi in cereal leaves, we have conducted a combined metabolome and transcriptome study of three quite divergent pathosystems, the barley powdery mildew fungus (Blumeria graminis f.sp. hordei), the corn smut fungus Ustilago maydis, and the maize anthracnose fungus Colletotrichum graminicola, the latter being a hemibiotroph that only exhibits an initial biotrophic phase during its establishment. Based on the analysis of 42 water-soluble metabolites, we were able to separate early biotrophic from late biotrophic interactions by hierarchical cluster analysis and principal component analysis, irrespective of the plant host. Interestingly, the corresponding transcriptome dataset could not discriminate between these stages of biotrophy, irrespective, of whether transcript data for genes of central metabolism or the entire transcriptome dataset was used. Strong differences in the transcriptional regulation of photosynthesis, glycolysis, the TCA cycle, lipid biosynthesis, and cell wall metabolism were observed between the pathosystems. However, increased contents of Gln, Asn, and glucose as well as diminished contents of PEP and 3-PGA were common to early post-penetration stages of all interactions. On the transcriptional level, genes of the TCA cycle, nucleotide energy metabolism and amino acid biosynthesis exhibited consistent trends among the compared biotrophic interactions, identifying the requirement for metabolic energy and the rearrangement of amino acid pools as common transcriptional motifs during early biotrophy. Both metabolome and transcript data were employed to generate models of leaf primary metabolism during early biotrophy for the three investigated interactions. PMID:22645534
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aklujkar, Muktak; Haveman, Shelley; DiDonatoJr, Raymond
2012-01-01
Background: The bacterium Pelobacter carbinolicus is able to grow by fermentation, syntrophic hydrogen/formate transfer, or electron transfer to sulfur from short-chain alcohols, hydrogen or formate; it does not oxidize acetate and is not known to ferment any sugars or grow autotrophically. The genome of P. carbinolicus was sequenced in order to understand its metabolic capabilities and physiological features in comparison with its relatives, acetate-oxidizing Geobacter species. Results: Pathways were predicted for catabolism of known substrates: 2,3-butanediol, acetoin, glycerol, 1,2-ethanediol, ethanolamine, choline and ethanol. Multiple isozymes of 2,3-butanediol dehydrogenase, ATP synthase and [FeFe]-hydrogenase were differentiated and assigned roles according to theirmore » structural properties and genomic contexts. The absence of asparagine synthetase and the presence of a mutant tRNA for asparagine encoded among RNA-active enzymes suggest that P. carbinolicus may make asparaginyl-tRNA in a novel way. Catabolic glutamate dehydrogenases were discovered, implying that the tricarboxylic acid (TCA) cycle can function catabolically. A phosphotransferase system for uptake of sugars was discovered, along with enzymes that function in 2,3-butanediol production. Pyruvate: ferredoxin/flavodoxin oxidoreductase was identified as a potential bottleneck in both the supply of oxaloacetate for oxidation of acetate by the TCA cycle and the connection of glycolysis to production of ethanol. The P. carbinolicus genome was found to encode autotransporters and various appendages, including three proteins with similarity to the geopilin of electroconductive nanowires. Conclusions: Several surprising metabolic capabilities and physiological features were predicted from the genome of P. carbinolicus, suggesting that it is more versatile than anticipated.« less
Lacking Ketohexokinase-A Exacerbates Renal Injury in Streptozotocin-induced Diabetic Mice.
Doke, Tomohito; Ishimoto, Takuji; Hayasaki, Takahiro; Ikeda, Satsuki; Hasebe, Masako; Hirayama, Akiyoshi; Soga, Tomoyoshi; Kato, Noritoshi; Kosugi, Tomoki; Tsuboi, Naotake; Lanaspa, Miguel A; Johnson, Richard J; Kadomatsu, Kenji; Maruyama, Shoichi
2018-03-28
Ketohexokinase (KHK), a primary enzyme in fructose metabolism, has two isoforms, namely, KHK-A and KHK-C. Previously, we reported that renal injury was reduced in streptozotocin-induced diabetic mice which lacked both isoforms. Although both isoforms express in kidney, it has not been elucidated whether each isoform plays distinct roles in the development of diabetic kidney disease (DKD). The aim of the study is to elucidate the role of KHK-A for DKD progression. Diabetes was induced by five consecutive daily intraperitoneal injections of streptozotocin (50 mg/kg) in C57BL/6 J wild-type mice, mice lacking KHK-A alone (KHK-A KO), and mice lacking both KHK-A and KHK-C (KHK-A/C KO). At 35 weeks, renal injury, inflammation, hypoxia, and oxidative stress were examined. Metabolomic analysis including polyol pathway, fructose metabolism, glycolysis, TCA (tricarboxylic acid) cycle, and NAD (nicotinamide adenine dinucleotide) metabolism in kidney and urine was done. Diabetic KHK-A KO mice developed severe renal injury compared to diabetic wild-type mice, and this was associated with further increases of intrarenal fructose, dihydroxyacetone phosphate (DHAP), TCA cycle intermediates levels, and severe inflammation. In contrast, renal injury was prevented in diabetic KHK-A/C KO mice compared to both wild-type and KHK-A KO diabetic mice. Further, diabetic KHK-A KO mice contained decreased renal NAD + level with the increase of renal hypoxia-inducible factor 1-alpha expression despite having increased renal nicotinamide (NAM) level. These results suggest that KHK-C might play a deleterious role in DKD progression through endogenous fructose metabolism, and that KHK-A plays a unique protective role against the development of DKD. Copyright © 2018. Published by Elsevier Inc.
Differential expression of glucose-metabolizing enzymes in multiple sclerosis lesions.
Nijland, Philip G; Molenaar, Remco J; van der Pol, Susanne M A; van der Valk, Paul; van Noorden, Cornelis J F; de Vries, Helga E; van Horssen, Jack
2015-12-04
Demyelinated axons in multiple sclerosis (MS) lesions have an increased energy demand in order to maintain conduction. However, oxidative stress-induced mitochondrial dysfunction likely alters glucose metabolism and consequently impairs neuronal function in MS. Imaging and pathological studies indicate that glucose metabolism is altered in MS, although the underlying mechanisms and its role in neurodegeneration remain elusive. We investigated expression patterns of key enzymes involved in glycolysis, tricarboxylic acid (TCA) cycle and lactate metabolism in well-characterized MS tissue to establish which regulators of glucose metabolism are involved in MS and to identify underlying mechanisms. Expression levels of glycolytic enzymes were increased in active and inactive MS lesions, whereas expression levels of enzymes involved in the TCA cycle were upregulated in active MS lesions, but not in inactive MS lesions. We observed reduced expression and production capacity of mitochondrial α-ketoglutarate dehydrogenase (αKGDH) in demyelinated axons, which correlated with signs of axonal dysfunction. In inactive lesions, increased expression of lactate-producing enzymes was observed in astrocytes, whereas lactate-catabolising enzymes were mainly detected in axons. Our results demonstrate that the expression of various enzymes involved in glucose metabolism is increased in both astrocytes and axons in active MS lesions. In inactive MS lesions, we provide evidence that astrocytes undergo a glycolytic shift resulting in enhanced astrocyte-axon lactate shuttling, which may be pivotal for the survival of demyelinated axons. In conclusion, we show that key enzymes involved in energy metabolism are differentially expressed in active and inactive MS lesions. Our findings imply that, in addition to reduced oxidative phosphorylation activity, other bioenergetic pathways are affected as well, which may contribute to ongoing axonal degeneration in MS.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tang, Yinjie J.; Sapra, Rajat; Joyner, Dominique
2009-01-20
A recently discovered thermophilic bacterium, Geobacillus thermoglucosidasius M10EXG, ferments a range of C5 (e.g., xylose) and C6 sugars (e.g., glucose) and istolerant to high ethanol concentrations (10percent, v/v). We have investigated the central metabolism of this bacterium using both in vitro enzyme assays and 13C-based flux analysis to provide insights into the physiological properties of this extremophile and explore its metabolism for bio-ethanol or other bioprocess applications. Our findings show that glucose metabolism in G. thermoglucosidasius M10EXG proceeds via glycolysis, the pentose phosphate pathway, and the TCA cycle; the Entner?Doudoroff pathway and transhydrogenase activity were not detected. Anaplerotic reactions (includingmore » the glyoxylate shunt, pyruvate carboxylase, and phosphoenolpyruvate carboxykinase) were active, but fluxes through those pathways could not be accuratelydetermined using amino acid labeling. When growth conditions were switched from aerobic to micro-aerobic conditions, fluxes (based on a normalized glucose uptake rate of 100 units (g DCW)-1 h-1) through the TCA cycle and oxidative pentose phosphate pathway were reduced from 64+-3 to 25+-2 and from 30+-2 to 19+-2, respectively. The carbon flux under micro-aerobic growth was directed formate. Under fully anerobic conditions, G. thermoglucosidasius M10EXG used a mixed acid fermentation process and exhibited a maximum ethanol yield of 0.38+-0.07 mol mol-1 glucose. In silico flux balance modeling demonstrates that lactate and acetate production from G. thermoglucosidasius M10EXG reduces the maximum ethanol yieldby approximately threefold, thus indicating that both pathways should be modified to maximize ethanol production.« less
2013-01-01
Background Understanding the process of amino acid fermentation as a comprehensive system is a challenging task. Previously, we developed a literature-based dynamic simulation model, which included transcriptional regulation, transcription, translation, and enzymatic reactions related to glycolysis, the pentose phosphate pathway, the tricarboxylic acid (TCA) cycle, and the anaplerotic pathway of Escherichia coli. During simulation, cell growth was defined such as to reproduce the experimental cell growth profile of fed-batch cultivation in jar fermenters. However, to confirm the biological appropriateness of our model, sensitivity analysis and experimental validation were required. Results We constructed an l-glutamic acid fermentation simulation model by removing sucAB, a gene encoding α-ketoglutarate dehydrogenase. We then performed systematic sensitivity analysis for l-glutamic acid production; the results of this process corresponded with previous experimental data regarding l-glutamic acid fermentation. Furthermore, it allowed us to predicted the possibility that accumulation of 3-phosphoglycerate in the cell would regulate the carbon flux into the TCA cycle and lead to an increase in the yield of l-glutamic acid via fermentation. We validated this hypothesis through a fermentation experiment involving a model l-glutamic acid-production strain, E. coli MG1655 ΔsucA in which the phosphoglycerate kinase gene had been amplified to cause accumulation of 3-phosphoglycerate. The observed increase in l-glutamic acid production verified the biologically meaningful predictive power of our dynamic metabolic simulation model. Conclusions In this study, dynamic simulation using a literature-based model was shown to be useful for elucidating the precise mechanisms involved in fermentation processes inside the cell. Further exhaustive sensitivity analysis will facilitate identification of novel factors involved in the metabolic regulation of amino acid fermentation. PMID:24053676
Nishio, Yousuke; Ogishima, Soichi; Ichikawa, Masao; Yamada, Yohei; Usuda, Yoshihiro; Masuda, Tadashi; Tanaka, Hiroshi
2013-09-22
Understanding the process of amino acid fermentation as a comprehensive system is a challenging task. Previously, we developed a literature-based dynamic simulation model, which included transcriptional regulation, transcription, translation, and enzymatic reactions related to glycolysis, the pentose phosphate pathway, the tricarboxylic acid (TCA) cycle, and the anaplerotic pathway of Escherichia coli. During simulation, cell growth was defined such as to reproduce the experimental cell growth profile of fed-batch cultivation in jar fermenters. However, to confirm the biological appropriateness of our model, sensitivity analysis and experimental validation were required. We constructed an L-glutamic acid fermentation simulation model by removing sucAB, a gene encoding α-ketoglutarate dehydrogenase. We then performed systematic sensitivity analysis for L-glutamic acid production; the results of this process corresponded with previous experimental data regarding L-glutamic acid fermentation. Furthermore, it allowed us to predicted the possibility that accumulation of 3-phosphoglycerate in the cell would regulate the carbon flux into the TCA cycle and lead to an increase in the yield of L-glutamic acid via fermentation. We validated this hypothesis through a fermentation experiment involving a model L-glutamic acid-production strain, E. coli MG1655 ΔsucA in which the phosphoglycerate kinase gene had been amplified to cause accumulation of 3-phosphoglycerate. The observed increase in L-glutamic acid production verified the biologically meaningful predictive power of our dynamic metabolic simulation model. In this study, dynamic simulation using a literature-based model was shown to be useful for elucidating the precise mechanisms involved in fermentation processes inside the cell. Further exhaustive sensitivity analysis will facilitate identification of novel factors involved in the metabolic regulation of amino acid fermentation.
Zhang, Tiantian; Bu, Pengli; Zeng, Joey; Vancura, Ales
2017-10-13
Regulation of mitochondrial biogenesis and respiration is a complex process that involves several signaling pathways and transcription factors as well as communication between the nuclear and mitochondrial genomes. Under aerobic conditions, the budding yeast Saccharomyces cerevisiae metabolizes glucose predominantly by glycolysis and fermentation. We have recently shown that altered chromatin structure in yeast induces respiration by a mechanism that requires transport and metabolism of pyruvate in mitochondria. However, how pyruvate controls the transcriptional responses underlying the metabolic switch from fermentation to respiration is unknown. Here, we report that this pyruvate effect involves heme. We found that heme induces transcription of HAP4 , the transcriptional activation subunit of the Hap2/3/4/5p complex, required for growth on nonfermentable carbon sources, in a Hap1p- and Hap2/3/4/5p-dependent manner. Increasing cellular heme levels by inactivating ROX1 , which encodes a repressor of many hypoxic genes, or by overexpressing HEM3 or HEM12 induced respiration and elevated ATP levels. Increased heme synthesis, even under conditions of glucose repression, activated Hap1p and the Hap2/3/4/5p complex and induced transcription of HAP4 and genes required for the tricarboxylic acid (TCA) cycle, electron transport chain, and oxidative phosphorylation, leading to a switch from fermentation to respiration. Conversely, inhibiting metabolic flux into the TCA cycle reduced cellular heme levels and HAP4 transcription. Together, our results indicate that the glucose-mediated repression of respiration in budding yeast is at least partly due to the low cellular heme level. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Weger, H G; Turpin, D H
1989-02-01
Mass spectrometric analysis shows that assimilation of inorganic nitrogen (NH(4) (+), NO(2) (-), NO(3) (-)) by N-limited cells of Selenastrum minutum (Naeg.) Collins results in a stimulation of tricarboxylic acid cycle (TCA cycle) CO(2) release in both the light and dark. In a previous study we have shown that TCA cycle reductant generated during NH(4) (+) assimilation is oxidized via the cytochrome electron transport chain, resulting in an increase in respiratory O(2) consumption during photosynthesis (HG Weger, DG Birch, IR Elrifi, DH Turpin [1988] Plant Physiol 86: 688-692). NO(3) (-) and NO(2) (-) assimilation resulted in a larger stimulation of TCA cycle CO(2) release than did NH(4) (+), but a much smaller stimulation of mitochondrial O(2) consumption. NH(4) (+) assimilation was the same in the light and dark and insensitive to DCMU, but was 82% inhibited by anaerobiosis in both the light and dark. NO(3) (-) and NO(2) (-) assimilation rates were maximal in the light, but assimilation could proceed at substantial rates in the light in the presence of DCMU and in the dark. Unlike NH(4) (+), NO(3) (-) and NO(2) (-) assimilation were relatively insensitive to anaerobiosis. These results indicated that operation of the mitochondrial electron transport chain was not required to maintain TCA cycle activity during NO(3) (-) and NO(2) (-) assimilation, suggesting an alternative sink for TCA cycle generated reductant. Evaluation of changes in gross O(2) consumption during NO(3) (-) and NO(2) (-) assimilation suggest that TCA cycle reductant was exported to the chloroplast during photosynthesis and used to support NO(3) (-) and NO(2) (-) reduction.
Mitochondrial Respiration Can Support NO3− and NO2− Reduction during Photosynthesis 1
Weger, Harold G.; Turpin, David H.
1989-01-01
Mass spectrometric analysis shows that assimilation of inorganic nitrogen (NH4+, NO2−, NO3−) by N-limited cells of Selenastrum minutum (Naeg.) Collins results in a stimulation of tricarboxylic acid cycle (TCA cycle) CO2 release in both the light and dark. In a previous study we have shown that TCA cycle reductant generated during NH4+ assimilation is oxidized via the cytochrome electron transport chain, resulting in an increase in respiratory O2 consumption during photosynthesis (HG Weger, DG Birch, IR Elrifi, DH Turpin [1988] Plant Physiol 86: 688-692). NO3− and NO2− assimilation resulted in a larger stimulation of TCA cycle CO2 release than did NH4+, but a much smaller stimulation of mitochondrial O2 consumption. NH4+ assimilation was the same in the light and dark and insensitive to DCMU, but was 82% inhibited by anaerobiosis in both the light and dark. NO3− and NO2− assimilation rates were maximal in the light, but assimilation could proceed at substantial rates in the light in the presence of DCMU and in the dark. Unlike NH4+, NO3− and NO2− assimilation were relatively insensitive to anaerobiosis. These results indicated that operation of the mitochondrial electron transport chain was not required to maintain TCA cycle activity during NO3− and NO2− assimilation, suggesting an alternative sink for TCA cycle generated reductant. Evaluation of changes in gross O2 consumption during NO3− and NO2− assimilation suggest that TCA cycle reductant was exported to the chloroplast during photosynthesis and used to support NO3− and NO2− reduction. PMID:16666557
Meringer, Markus; Cleaves, H James
2017-12-13
The reverse tricarboxylic acid (rTCA) cycle has been explored from various standpoints as an idealized primordial metabolic cycle. Its simplicity and apparent ubiquity in diverse organisms across the tree of life have been used to argue for its antiquity and its optimality. In 2000 it was proposed that chemoinformatics approaches support some of these views. Specifically, defined queries of the Beilstein database showed that the molecules of the rTCA are heavily represented in such compound databases. We explore here the chemical structure "space," e.g. the set of organic compounds which possesses some minimal set of defining characteristics, of the rTCA cycle's intermediates using an exhaustive structure generation method. The rTCA's chemical space as defined by the original criteria and explored by our method is some six to seven times larger than originally considered. Acknowledging that each assumption in what is a defining criterion making the rTCA cycle special limits possible generative outcomes, there are many unrealized compounds which fulfill these criteria. That these compounds are unrealized could be due to evolutionary frozen accidents or optimization, though this optimization may also be for systems-level reasons, e.g., the way the pathway and its elements interface with other aspects of metabolism.
Das, Gitishree; Patra, Jayanta Kumar; Lee, Sun-Young; Kim, Changgeon; Park, Jae Gyu
2017-01-01
Microbial cell performance in food biotechnological processes has become an important concern for improving human health worldwide. Lactobacillus plantarum, which is widely distributed in nature, is a lactic acid bacterium with many industrial applications for fermented foods or functional foods (e.g., probiotics). In the present study, using capillary electrophoresis time of flight mass spectrometry, the metabolomic profile of dried Orostachys japonicus A. Berger, a perennial medicinal herb with L. plantarum was compared with that of O. japonicus fermented with L. plantarum to elucidate the metabolomic changes induced by the fermentation process. The levels of several metabolites were changed by the fermentation process, indicating their involvement in microbial performance. For example, glycolysis, the pentose phosphate pathway, the TCA cycle, the urea cycle-related metabolism, nucleotide metabolism, and lipid and amino acid metabolism were altered significantly by the fermentation process. Although the fermented metabolites were not tested using in vivo studies to increase human health benefits, our findings provide an insight into the alteration of metabolites induced by fermentation, and indicated that the metabolomic analysis for the process should be accompanied by fermenting strains and conditions. PMID:28704842
Das, Gitishree; Patra, Jayanta Kumar; Lee, Sun-Young; Kim, Changgeon; Park, Jae Gyu; Baek, Kwang-Hyun
2017-01-01
Microbial cell performance in food biotechnological processes has become an important concern for improving human health worldwide. Lactobacillus plantarum, which is widely distributed in nature, is a lactic acid bacterium with many industrial applications for fermented foods or functional foods (e.g., probiotics). In the present study, using capillary electrophoresis time of flight mass spectrometry, the metabolomic profile of dried Orostachys japonicus A. Berger, a perennial medicinal herb with L. plantarum was compared with that of O. japonicus fermented with L. plantarum to elucidate the metabolomic changes induced by the fermentation process. The levels of several metabolites were changed by the fermentation process, indicating their involvement in microbial performance. For example, glycolysis, the pentose phosphate pathway, the TCA cycle, the urea cycle-related metabolism, nucleotide metabolism, and lipid and amino acid metabolism were altered significantly by the fermentation process. Although the fermented metabolites were not tested using in vivo studies to increase human health benefits, our findings provide an insight into the alteration of metabolites induced by fermentation, and indicated that the metabolomic analysis for the process should be accompanied by fermenting strains and conditions.
Zhang, Limin; Wang, Yulan; Xu, Yunxiang; Lei, Hehua; Zhao, Ying; Li, Huihui; Lin, Xiaosheng; Chen, Guizhen; Tang, Huiru
2014-01-01
Acupoint stimulations are effective in ameliorating symptoms of menopause which is an unavoidable ageing consequence for women. To understand the mechanistic aspects of such treatments, we systematically analyzed the effects of acupoint laser-irradiation and catgut-embedding on the ovariectomy-induced rat metabolic changes using NMR and GC-FID/MS methods. Results showed that ovariectomization (OVX) caused comprehensive metabolic changes in lipid peroxidation, glycolysis, TCA cycle, choline and amino acid metabolisms. Both acupoint laser-irradiation and catgut-embedding ameliorated the OVX-caused metabonomic changes more effectively than hormone replacement therapy (HRT) with nilestriol. Such effects of acupoint stimulations were highlighted in alleviating lipid peroxidation, restoring glucose homeostasis and partial reversion of the OVX-altered amino acid metabolism. These findings provided new insights into the menopause effects on mammalian biochemistry and beneficial effects of acupoint stimulations in comparison with HRT, demonstrating metabonomics as a powerful approach for potential applications in disease prognosis and developments of effective therapies. PMID:24407431
NASA Astrophysics Data System (ADS)
Zhang, Limin; Wang, Yulan; Xu, Yunxiang; Lei, Hehua; Zhao, Ying; Li, Huihui; Lin, Xiaosheng; Chen, Guizhen; Tang, Huiru
2014-01-01
Acupoint stimulations are effective in ameliorating symptoms of menopause which is an unavoidable ageing consequence for women. To understand the mechanistic aspects of such treatments, we systematically analyzed the effects of acupoint laser-irradiation and catgut-embedding on the ovariectomy-induced rat metabolic changes using NMR and GC-FID/MS methods. Results showed that ovariectomization (OVX) caused comprehensive metabolic changes in lipid peroxidation, glycolysis, TCA cycle, choline and amino acid metabolisms. Both acupoint laser-irradiation and catgut-embedding ameliorated the OVX-caused metabonomic changes more effectively than hormone replacement therapy (HRT) with nilestriol. Such effects of acupoint stimulations were highlighted in alleviating lipid peroxidation, restoring glucose homeostasis and partial reversion of the OVX-altered amino acid metabolism. These findings provided new insights into the menopause effects on mammalian biochemistry and beneficial effects of acupoint stimulations in comparison with HRT, demonstrating metabonomics as a powerful approach for potential applications in disease prognosis and developments of effective therapies.
Energy Metabolism Rewiring Precedes UVB-Induced Primary Skin Tumor Formation.
Hosseini, Mohsen; Dousset, Léa; Mahfouf, Walid; Serrano-Sanchez, Martin; Redonnet-Vernhet, Isabelle; Mesli, Samir; Kasraian, Zeinab; Obre, Emilie; Bonneu, Marc; Claverol, Stephane; Vlaski, Marija; Ivanovic, Zoran; Rachidi, Walid; Douki, Thierry; Taieb, Alain; Bouzier-Sore, Anne-Karine; Rossignol, Rodrigue; Rezvani, Hamid Reza
2018-06-19
Although growing evidence indicates that bioenergetic metabolism plays an important role in the progression of tumorigenesis, little information is available on the contribution of reprogramming of energy metabolism in cancer initiation. By applying a quantitative proteomic approach and targeted metabolomics, we find that specific metabolic modifications precede primary skin tumor formation. Using a multistage model of ultraviolet B (UVB) radiation-induced skin cancer, we show that glycolysis, tricarboxylic acid (TCA) cycle, and fatty acid β-oxidation are decreased at a very early stage of photocarcinogenesis, while the distal part of the electron transport chain (ETC) is upregulated. Reductive glutamine metabolism and the activity of dihydroorotate dehydrogenase (DHODH) are both necessary for maintaining high ETC. Mice with decreased DHODH activity or impaired ETC failed to develop pre-malignant and malignant lesions. DHODH activity represents a major link between DNA repair efficiency and bioenergetic patterning during skin carcinogenesis. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Tumor microenvironment derived exosomes pleiotropically modulate cancer cell metabolism.
Zhao, Hongyun; Yang, Lifeng; Baddour, Joelle; Achreja, Abhinav; Bernard, Vincent; Moss, Tyler; Marini, Juan C; Tudawe, Thavisha; Seviour, Elena G; San Lucas, F Anthony; Alvarez, Hector; Gupta, Sonal; Maiti, Sourindra N; Cooper, Laurence; Peehl, Donna; Ram, Prahlad T; Maitra, Anirban; Nagrath, Deepak
2016-02-27
Cancer-associated fibroblasts (CAFs) are a major cellular component of tumor microenvironment in most solid cancers. Altered cellular metabolism is a hallmark of cancer, and much of the published literature has focused on neoplastic cell-autonomous processes for these adaptations. We demonstrate that exosomes secreted by patient-derived CAFs can strikingly reprogram the metabolic machinery following their uptake by cancer cells. We find that CAF-derived exosomes (CDEs) inhibit mitochondrial oxidative phosphorylation, thereby increasing glycolysis and glutamine-dependent reductive carboxylation in cancer cells. Through 13C-labeled isotope labeling experiments we elucidate that exosomes supply amino acids to nutrient-deprived cancer cells in a mechanism similar to macropinocytosis, albeit without the previously described dependence on oncogenic-Kras signaling. Using intra-exosomal metabolomics, we provide compelling evidence that CDEs contain intact metabolites, including amino acids, lipids, and TCA-cycle intermediates that are avidly utilized by cancer cells for central carbon metabolism and promoting tumor growth under nutrient deprivation or nutrient stressed conditions.
Oppenheim, Rebecca D.; Limenitakis, Julien; Polonais, Valerie; Seeber, Frank; Barrett, Michael P.; Billker, Oliver; McConville, Malcolm J.; Soldati-Favre, Dominique
2014-01-01
While the apicomplexan parasites Plasmodium falciparum and Toxoplasma gondii are thought to primarily depend on glycolysis for ATP synthesis, recent studies have shown that they can fully catabolize glucose in a canonical TCA cycle. However, these parasites lack a mitochondrial isoform of pyruvate dehydrogenase and the identity of the enzyme that catalyses the conversion of pyruvate to acetyl-CoA remains enigmatic. Here we demonstrate that the mitochondrial branched chain ketoacid dehydrogenase (BCKDH) complex is the missing link, functionally replacing mitochondrial PDH in both T. gondii and P. berghei. Deletion of the E1a subunit of T. gondii and P. berghei BCKDH significantly impacted on intracellular growth and virulence of both parasites. Interestingly, disruption of the P. berghei E1a restricted parasite development to reticulocytes only and completely prevented maturation of oocysts during mosquito transmission. Overall this study highlights the importance of the molecular adaptation of BCKDH in this important class of pathogens. PMID:25032958
Tumor microenvironment derived exosomes pleiotropically modulate cancer cell metabolism
Zhao, Hongyun; Yang, Lifeng; Baddour, Joelle; Achreja, Abhinav; Bernard, Vincent; Moss, Tyler; Marini, Juan C; Tudawe, Thavisha; Seviour, Elena G; San Lucas, F Anthony; Alvarez, Hector; Gupta, Sonal; Maiti, Sourindra N; Cooper, Laurence; Peehl, Donna; Ram, Prahlad T; Maitra, Anirban; Nagrath, Deepak
2016-01-01
Cancer-associated fibroblasts (CAFs) are a major cellular component of tumor microenvironment in most solid cancers. Altered cellular metabolism is a hallmark of cancer, and much of the published literature has focused on neoplastic cell-autonomous processes for these adaptations. We demonstrate that exosomes secreted by patient-derived CAFs can strikingly reprogram the metabolic machinery following their uptake by cancer cells. We find that CAF-derived exosomes (CDEs) inhibit mitochondrial oxidative phosphorylation, thereby increasing glycolysis and glutamine-dependent reductive carboxylation in cancer cells. Through 13C-labeled isotope labeling experiments we elucidate that exosomes supply amino acids to nutrient-deprived cancer cells in a mechanism similar to macropinocytosis, albeit without the previously described dependence on oncogenic-Kras signaling. Using intra-exosomal metabolomics, we provide compelling evidence that CDEs contain intact metabolites, including amino acids, lipids, and TCA-cycle intermediates that are avidly utilized by cancer cells for central carbon metabolism and promoting tumor growth under nutrient deprivation or nutrient stressed conditions. DOI: http://dx.doi.org/10.7554/eLife.10250.001 PMID:26920219
ARTD1 (PARP1) activation and NAD+ in DNA repair and cell death
Fouquerel, Elise; Sobol, Robert W.
2014-01-01
Nicotinamide adenine dinucleotide, NAD+, is a small metabolite coenzyme that is essential for the progress of crucial cellular pathways including glycolysis, the tricarboxylic acid cycle (TCA) and mitochondrial respiration. These processes consume and produce both oxidative and reduced forms of NAD (NAD+ and NADH). NAD+ is also important for ADP(ribosyl)ation reactions mediated by the ADP-ribosyltransferase enzymes (ARTDs) or deacetylation reactions catalysed by the sirtuins (SIRTs) which use NAD+ as a substrate. In this review, we highlight the significance of NAD+ catabolism in DNA repair and cell death through its utilization by ARTDs and SIRTs. We summarize the current findings on the involvement of ARTD1 activity in DNA repair and most specifically its involvement in the trigger of cell death mediated by energy depletion. By sharing the same substrate, the activities of ARTDs and SIRTs are tightly linked and dependent on each other and are thereby involved in the same cellular processes that play an important role in cancer biology, inflammatory diseases and ischemia/reperfusion. PMID:25283336
Marden, James H
2013-12-01
Metabolic enzyme loci were some of the first genes accessible for molecular evolution and ecology research. New technologies now make the whole genome, transcriptome or proteome readily accessible, allowing unbiased scans for loci exhibiting significant differences in allele frequency or expression level and associated with phenotypes and/or responses to natural selection. With surprising frequency and in many cases in proportions greater than chance relative to other genes, glycolysis and TCA cycle enzyme loci appear among the genes with significant associations in these studies. Hence, there is an ongoing need to understand the basis for fitness effects of metabolic enzyme polymorphisms. Allele-specific effects on the binding affinity and catalytic rate of individual enzymes are well known, but often of uncertain significance because metabolic control theory and in vivo studies indicate that many individual metabolic enzymes do not affect pathway flux rate. I review research, so far little used in evolutionary biology, showing that metabolic enzyme substrates affect signalling pathways that regulate cell and organismal biology, and that these enzymes have moonlighting functions. To date there is little knowledge of how alleles in natural populations affect these phenotypes. I discuss an example in which alleles of a TCA enzyme locus associate with differences in a signalling pathway and development, organismal performance, and ecological dynamics. Ultimately, understanding how metabolic enzyme polymorphisms map to phenotypes and fitness remains a compelling and ongoing need for gaining robust knowledge of ecological and evolutionary processes. © 2013 John Wiley & Sons Ltd.
Tiwari, Vivek; Ambadipudi, Susmitha; Patel, Anant B
2013-10-01
The (13)C nuclear magnetic resonance (NMR) studies together with the infusion of (13)C-labeled substrates in rats and humans have provided important insight into brain energy metabolism. In the present study, we have extended a three-compartment metabolic model in mouse to investigate glutamatergic and GABAergic tricarboxylic acid (TCA) cycle and neurotransmitter cycle fluxes across different regions of the brain. The (13)C turnover of amino acids from [1,6-(13)C2]glucose was monitored ex vivo using (1)H-[(13)C]-NMR spectroscopy. The astroglial glutamate pool size, one of the important parameters of the model, was estimated by a short infusion of [2-(13)C]acetate. The ratio Vcyc/VTCA was calculated from the steady-state acetate experiment. The (13)C turnover curves of [4-(13)C]/[3-(13)C]glutamate, [4-(13)C]glutamine, [2-(13)C]/[3-(13)C]GABA, and [3-(13)C]aspartate from [1,6-(13)C2]glucose were analyzed using a three-compartment metabolic model to estimate the rates of the TCA cycle and neurotransmitter cycle associated with glutamatergic and GABAergic neurons. The glutamatergic TCA cycle rate was found to be highest in the cerebral cortex (0.91 ± 0.05 μmol/g per minute) and least in the hippocampal region (0.64 ± 0.07 μmol/g per minute) of the mouse brain. In contrast, the GABAergic TCA cycle flux was found to be highest in the thalamus-hypothalamus (0.28 ± 0.01 μmol/g per minute) and least in the cerebral cortex (0.24 ± 0.02 μmol/g per minute). These findings indicate that the energetics of excitatory and inhibitory function is distinct across the mouse brain.
Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase.
Selak, Mary A; Armour, Sean M; MacKenzie, Elaine D; Boulahbel, Houda; Watson, David G; Mansfield, Kyle D; Pan, Yi; Simon, M Celeste; Thompson, Craig B; Gottlieb, Eyal
2005-01-01
Several mitochondrial proteins are tumor suppressors. These include succinate dehydrogenase (SDH) and fumarate hydratase, both enzymes of the tricarboxylic acid (TCA) cycle. However, to date, the mechanisms by which defects in the TCA cycle contribute to tumor formation have not been elucidated. Here we describe a mitochondrion-to-cytosol signaling pathway that links mitochondrial dysfunction to oncogenic events: succinate, which accumulates as a result of SDH inhibition, inhibits HIF-alpha prolyl hydroxylases in the cytosol, leading to stabilization and activation of HIF-1alpha. These results suggest a mechanistic link between SDH mutations and HIF-1alpha induction, providing an explanation for the highly vascular tumors that develop in the absence of VHL mutations.
The Tricarboxylic Acid Cycle, an Ancient Metabolic Network with a Novel Twist
Mailloux, Ryan J.; Bériault, Robin; Lemire, Joseph; Singh, Ranji; Chénier, Daniel R.; Hamel, Robert D.; Appanna, Vasu D.
2007-01-01
The tricarboxylic acid (TCA) cycle is an essential metabolic network in all oxidative organisms and provides precursors for anabolic processes and reducing factors (NADH and FADH2) that drive the generation of energy. Here, we show that this metabolic network is also an integral part of the oxidative defence machinery in living organisms and α-ketoglutarate (KG) is a key participant in the detoxification of reactive oxygen species (ROS). Its utilization as an anti-oxidant can effectively diminish ROS and curtail the formation of NADH, a situation that further impedes the release of ROS via oxidative phosphorylation. Thus, the increased production of KG mediated by NADP-dependent isocitrate dehydrogenase (NADP-ICDH) and its decreased utilization via the TCA cycle confer a unique strategy to modulate the cellular redox environment. Activities of α-ketoglutarate dehydrogenase (KGDH), NAD-dependent isocitrate dehydrogenase (NAD-ICDH), and succinate dehydrogenase (SDH) were sharply diminished in the cellular systems exposed to conditions conducive to oxidative stress. These findings uncover an intricate link between TCA cycle and ROS homeostasis and may help explain the ineffective TCA cycle that characterizes various pathological conditions and ageing. PMID:17668068
Energy metabolism in the liver.
Rui, Liangyou
2014-01-01
The liver is an essential metabolic organ, and its metabolic function is controlled by insulin and other metabolic hormones. Glucose is converted into pyruvate through glycolysis in the cytoplasm, and pyruvate is subsequently oxidized in the mitochondria to generate ATP through the TCA cycle and oxidative phosphorylation. In the fed state, glycolytic products are used to synthesize fatty acids through de novo lipogenesis. Long-chain fatty acids are incorporated into triacylglycerol, phospholipids, and/or cholesterol esters in hepatocytes. These complex lipids are stored in lipid droplets and membrane structures, or secreted into the circulation as very low-density lipoprotein particles. In the fasted state, the liver secretes glucose through both glycogenolysis and gluconeogenesis. During pronged fasting, hepatic gluconeogenesis is the primary source for endogenous glucose production. Fasting also promotes lipolysis in adipose tissue, resulting in release of nonesterified fatty acids which are converted into ketone bodies in hepatic mitochondria though β-oxidation and ketogenesis. Ketone bodies provide a metabolic fuel for extrahepatic tissues. Liver energy metabolism is tightly regulated by neuronal and hormonal signals. The sympathetic system stimulates, whereas the parasympathetic system suppresses, hepatic gluconeogenesis. Insulin stimulates glycolysis and lipogenesis but suppresses gluconeogenesis, and glucagon counteracts insulin action. Numerous transcription factors and coactivators, including CREB, FOXO1, ChREBP, SREBP, PGC-1α, and CRTC2, control the expression of the enzymes which catalyze key steps of metabolic pathways, thus controlling liver energy metabolism. Aberrant energy metabolism in the liver promotes insulin resistance, diabetes, and nonalcoholic fatty liver diseases. © 2014 American Physiological Society.
Energy Metabolism in the Liver
Rui, Liangyou
2014-01-01
The liver is an essential metabolic organ, and its metabolic activity is tightly controlled by insulin and other metabolic hormones. Glucose is metabolized into pyruvate through glycolysis in the cytoplasm, and pyruvate is completely oxidized to generate ATP through the TCA cycle and oxidative phosphorylation in the mitochondria. In the fed state, glycolytic products are used to synthesize fatty acids through de novo lipogenesis. Long-chain fatty acids are incorporated into triacylglycerol, phospholipids, and cholesterol esters in hepatocytes, and these complex lipids are stored in lipid droplets and membrane structures, or secreted into the circulation as VLDL particles. In the fasted state, the liver secretes glucose through both breakdown of glycogen (glycogenolysis) and de novo glucose synthesis (gluconeogenesis). During pronged fasting, hepatic gluconeogenesis is the primary source of endogenous glucose production. Fasting also promotes lipolysis in adipose tissue to release nonesterified fatty acids which are converted into ketone bodies in the liver though mitochondrial β oxidation and ketogenesis. Ketone bodies provide a metabolic fuel for extrahepatic tissues. Liver metabolic processes are tightly regulated by neuronal and hormonal systems. The sympathetic system stimulates, whereas the parasympathetic system suppresses, hepatic gluconeogenesis. Insulin stimulates glycolysis and lipogenesis, but suppresses gluconeogenesis; glucagon counteracts insulin action. Numerous transcription factors and coactivators, including CREB, FOXO1, ChREBP, SREBP, PGC-1α, and CRTC2, control the expression of the enzymes which catalyze the rate-limiting steps of liver metabolic processes, thus controlling liver energy metabolism. Aberrant energy metabolism in the liver promotes insulin resistance, diabetes, and nonalcoholic fatty liver diseases (NAFLD). PMID:24692138
Eloqayli, Haytham; Qu, Hong; Unsgård, Geirmund; Sletvold, Olav; Hadidi, Hakam; Sonnewald, Ursula
2002-02-01
This study was performed to analyze the effects of glutamate and the epileptogenic agent pentylenetetrazole (PTZ) on neuronal glucose metabolism. Cerebellar granule neurons were incubated for 2 h in medium containing 3 mM [U-(13)C]glucose, with and without 0.25 mM glutamate and/or 10 mM PTZ. In the presence of PTZ, decreased glucose consumption with unchanged lactate release was observed, indicating decreased glucose oxidation. PTZ also slowed down tricarboxylic acid (TCA) cycle activity as evidenced by the decreased amounts of labeled aspartate and [1,2-(13)C]glutamate. When glutamate was present, glucose consumption was also decreased. However, the amount of glutamate, derived from [U-(13)C]glucose via the first turn of the TCA cycle, was increased. The decreased amount of [1,2-(13)C]glutamate, derived from the second turn in the TCA cycle, and increased amount of aspartate indicated the dilution of label due to the entrance of unlabeled glutamate into TCA cycle. In the presence of glutamate plus PTZ, the effect of PTZ was enhanced by glutamate. Labeled alanine was detected only in the presence of glutamate plus PTZ, which indicated that oxaloacetate was a better amino acid acceptor than pyruvate. Furthermore, there was also evidence for intracellular compartmentation of oxaloacetate metabolism. Glutamate and PTZ caused similar metabolic changes, however, via different mechanisms. Glutamate substituted for glucose as energy substrate in the TCA cycle, whereas, PTZ appeared to decrease mitochondrial activity.
Fu, Yanfen; Li, Yi; Lidstrom, Mary
2017-07-01
Methanotrophs are a group of bacteria that use methane as sole carbon and energy source. Type I methanotrophs are gamma-proteobacterial methanotrophs using the ribulose monophosphate cycle (RuMP) cycle for methane assimilation. In order to facilitate metabolic engineering in the industrially promising Type I methanotroph Methylomicrobium buryatense 5GB1, flux analysis of cellular metabolism is needed and 13 C tracer analysis is a foundational tool for such work. This biological system has a single-carbon input and a special network topology that together pose challenges to the current well-established methodology for 13 C tracer analysis using a multi-carbon input such as glucose, and to date, no 13 C tracer analysis of flux in a Type I methanotroph has been reported. In this study, we showed that by monitoring labeling patterns of several key intermediate metabolites in core metabolism, it is possible to quantitate the relative flux ratios for important branch points, such as the malate node. In addition, it is possible to assess the operation of the TCA cycle, which has been thought to be incomplete in Type I methanotrophs. Surprisingly, our analysis provides direct evidence of a complete, oxidative TCA cycle operating in M. buryatense 5GB1 using methane as sole carbon and energy substrate, contributing about 45% of the total flux for de novo malate production. Combined with mutant analysis, this method was able to identify fumA (METBUDRAFT_1453/MBURv2__60244) as the primary fumarase involved in the oxidative TCA cycle, among 2 predicted fumarases, supported by 13 C tracer analysis on both fumA and fumC single knockouts. Interrupting the oxidative TCA cycle leads to a severe growth defect, suggesting that the oxidative TCA cycle functions to not only provide precursors for de novo biomass synthesis, but also to provide reducing power to the system. This information provides new opportunities for metabolic engineering of M. buryatense for the production of industrially relevant products. Copyright © 2017 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
Genetic investigation of tricarboxylic acid metabolism during the Plasmodium falciparum life cycle.
Ke, Hangjun; Lewis, Ian A; Morrisey, Joanne M; McLean, Kyle J; Ganesan, Suresh M; Painter, Heather J; Mather, Michael W; Jacobs-Lorena, Marcelo; Llinás, Manuel; Vaidya, Akhil B
2015-04-07
New antimalarial drugs are urgently needed to control drug-resistant forms of the malaria parasite Plasmodium falciparum. Mitochondrial electron transport is the target of both existing and new antimalarials. Herein, we describe 11 genetic knockout (KO) lines that delete six of the eight mitochondrial tricarboxylic acid (TCA) cycle enzymes. Although all TCA KOs grew normally in asexual blood stages, these metabolic deficiencies halted life-cycle progression in later stages. Specifically, aconitase KO parasites arrested as late gametocytes, whereas α-ketoglutarate-dehydrogenase-deficient parasites failed to develop oocysts in the mosquitoes. Mass spectrometry analysis of (13)C-isotope-labeled TCA mutant parasites showed that P. falciparum has significant flexibility in TCA metabolism. This flexibility manifested itself through changes in pathway fluxes and through altered exchange of substrates between cytosolic and mitochondrial pools. Our findings suggest that mitochondrial metabolic plasticity is essential for parasite development. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Imaging Prostate Cancer (PCa) Phenotype and Evolution
2016-10-01
inhibit growth of some but not all cell lines. 2. Keywords: Deferiprone, aconitase, metabolism, tricarboxylic acid cycle , magnetic resonance 3...TRAMP C2 and MycCaP cell proliferation, migration, and invasiveness. Determine if knockdown of m-acon and Deferiprone inhibit TCA cycle activity...migration and inhibits TCA cycle (metabolism). Similarly in vivo (Aim 2), we 6 Fig. 2: Effect of DFP on in vivo growth of MycCaP (left) and TRAMP C2
Pyruvate cycle increases aminoglycoside efficacy and provides respiratory energy in bacteria.
Su, Yu-Bin; Peng, Bo; Li, Hui; Cheng, Zhi-Xue; Zhang, Tian-Tuo; Zhu, Jia-Xin; Li, Dan; Li, Min-Yi; Ye, Jin-Zhou; Du, Chao-Chao; Zhang, Song; Zhao, Xian-Liang; Yang, Man-Jun; Peng, Xuan-Xian
2018-02-13
The emergence and ongoing spread of multidrug-resistant bacteria puts humans and other species at risk for potentially lethal infections. Thus, novel antibiotics or alternative approaches are needed to target drug-resistant bacteria, and metabolic modulation has been documented to improve antibiotic efficacy, but the relevant metabolic mechanisms require more studies. Here, we show that glutamate potentiates aminoglycoside antibiotics, resulting in improved elimination of antibiotic-resistant pathogens. When exploring the metabolic flux of glutamate, it was found that the enzymes that link the phosphoenolpyruvate (PEP)-pyruvate-AcCoA pathway to the TCA cycle were key players in this increased efficacy. Together, the PEP-pyruvate-AcCoA pathway and TCA cycle can be considered the pyruvate cycle (P cycle). Our results show that inhibition or gene depletion of the enzymes in the P cycle shut down the TCA cycle even in the presence of excess carbon sources, and that the P cycle operates routinely as a general mechanism for energy production and regulation in Escherichia coli and Edwardsiella tarda These findings address metabolic mechanisms of metabolite-induced potentiation and fundamental questions about bacterial biochemistry and energy metabolism.
Nasri Nasrabadi, Mohammad Reza; Razavi, Seyed Hadi
2010-04-01
In this work, we applied statistical experimental design to a fed-batch process for optimization of tricarboxylic acid cycle (TCA) intermediates in order to achieve high-level production of canthaxanthin from Dietzia natronolimnaea HS-1 cultured in beet molasses. A fractional factorial design (screening test) was first conducted on five TCA cycle intermediates. Out of the five TCA cycle intermediates investigated via screening tests, alfaketoglutarate, oxaloacetate and succinate were selected based on their statistically significant (P<0.05) and positive effects on canthaxanthin production. These significant factors were optimized by means of response surface methodology (RSM) in order to achieve high-level production of canthaxanthin. The experimental results of the RSM were fitted with a second-order polynomial equation by means of a multiple regression technique to identify the relationship between canthaxanthin production and the three TCA cycle intermediates. By means of this statistical design under a fed-batch process, the optimum conditions required to achieve the highest level of canthaxanthin (13172 + or - 25 microg l(-1)) were determined as follows: alfaketoglutarate, 9.69 mM; oxaloacetate, 8.68 mM; succinate, 8.51 mM. Copyright 2009 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Sunny, Nishanth E; Kalavalapalli, Srilaxmi; Bril, Fernando; Garrett, Timothy J; Nautiyal, Manisha; Mathew, Justin T; Williams, Caroline M; Cusi, Kenneth
2015-08-15
Elevated plasma branched-chain amino acids (BCAA) in the setting of insulin resistance have been relevant in predicting type 2 diabetes mellitus (T2DM) onset, but their role in the etiology of hepatic insulin resistance remains uncertain. We determined the link between BCAA and dysfunctional hepatic tricarboxylic acid (TCA) cycle, which is a central feature of hepatic insulin resistance and nonalcoholic fatty liver disease (NAFLD). Plasma metabolites under basal fasting and euglycemic hyperinsulinemic clamps (insulin stimulation) were measured in 94 human subjects with varying degrees of insulin sensitivity to identify their relationships with insulin resistance. Furthermore, the impact of elevated BCAA on hepatic TCA cycle was determined in a diet-induced mouse model of NAFLD, utilizing targeted metabolomics and nuclear magnetic resonance (NMR)-based metabolic flux analysis. Insulin stimulation revealed robust relationships between human plasma BCAA and indices of insulin resistance, indicating chronic metabolic overload from BCAA. Human plasma BCAA and long-chain acylcarnitines also showed a positive correlation, suggesting modulation of mitochondrial metabolism by BCAA. Concurrently, mice with NAFLD failed to optimally induce hepatic mTORC1, plasma ketones, and hepatic long-chain acylcarnitines, following acute elevation of plasma BCAA. Furthermore, elevated BCAA failed to induce multiple fluxes through hepatic TCA cycle in mice with NAFLD. Our data suggest that BCAA are essential to mediate efficient channeling of carbon substrates for oxidation through mitochondrial TCA cycle. Impairment of BCAA-mediated upregulation of the TCA cycle could be a significant contributor to mitochondrial dysfunction in NAFLD.
Kalavalapalli, Srilaxmi; Bril, Fernando; Garrett, Timothy J.; Nautiyal, Manisha; Mathew, Justin T.; Williams, Caroline M.; Cusi, Kenneth
2015-01-01
Elevated plasma branched-chain amino acids (BCAA) in the setting of insulin resistance have been relevant in predicting type 2 diabetes mellitus (T2DM) onset, but their role in the etiology of hepatic insulin resistance remains uncertain. We determined the link between BCAA and dysfunctional hepatic tricarboxylic acid (TCA) cycle, which is a central feature of hepatic insulin resistance and nonalcoholic fatty liver disease (NAFLD). Plasma metabolites under basal fasting and euglycemic hyperinsulinemic clamps (insulin stimulation) were measured in 94 human subjects with varying degrees of insulin sensitivity to identify their relationships with insulin resistance. Furthermore, the impact of elevated BCAA on hepatic TCA cycle was determined in a diet-induced mouse model of NAFLD, utilizing targeted metabolomics and nuclear magnetic resonance (NMR)-based metabolic flux analysis. Insulin stimulation revealed robust relationships between human plasma BCAA and indices of insulin resistance, indicating chronic metabolic overload from BCAA. Human plasma BCAA and long-chain acylcarnitines also showed a positive correlation, suggesting modulation of mitochondrial metabolism by BCAA. Concurrently, mice with NAFLD failed to optimally induce hepatic mTORC1, plasma ketones, and hepatic long-chain acylcarnitines, following acute elevation of plasma BCAA. Furthermore, elevated BCAA failed to induce multiple fluxes through hepatic TCA cycle in mice with NAFLD. Our data suggest that BCAA are essential to mediate efficient channeling of carbon substrates for oxidation through mitochondrial TCA cycle. Impairment of BCAA-mediated upregulation of the TCA cycle could be a significant contributor to mitochondrial dysfunction in NAFLD. PMID:26058864
Browning, Jeffrey D.; Weis, Brian; Davis, Jeannie; Satapati, Santhosh; Merritt, Matthew; Malloy, Craig R.; Burgess, Shawn C.
2009-01-01
Carbohydrate-restriction is a common weight-loss approach that modifies hepatic metabolism by increasing gluconeogenesis and ketosis. Because little is known regarding the effect of carbohydrate-restriction on the origin of gluconeogenic precursors (gluconeogenesis from glycerol (GNGglycerol) and lactate/amino acids (GNGPEP)) or its consequence to hepatic energy homeostasis, we studied these parameters in a group of overweight/obese subjects undergoing weight-loss via dietary restriction. We used 2H and 13C tracers and nuclear magnetic resonance spectroscopy to measure the sources of hepatic glucose and TCA cycle flux in weight-stable subjects(n=7) and subjects following carbohydrate-(n=7) or calorie-restriction(n=7). The majority of hepatic glucose production in carbohydrate-restricted subjects came from GNGPEP. The contribution of glycerol to gluconeogenesis was similar in all groups despite evidence of increased fat oxidation in carbohydrate-restricted subjects. A strong correlation between TCA cycle flux and GNGPEP was found, though the reliance on TCA cycle energy production for gluconeogenesis was attenuated in subjects undergoing carbohydrate restriction. Together, these data imply that the TCA cycle is the energetic patron of gluconeogenesis. However, the relationship between these two pathways is modified by carbohydrate restriction, suggesting an increased reliance of the hepatocyte on energy generated outside of the TCA cycle when GNGPEP is maximal. In conclusion, carbohydrate-restriction modifies hepatic gluconeogenesis by increasing reliance on substrates like lactate or amino acids but not glycerol. This modification is associated with a reorganization of hepatic energy metabolism suggestive of enhanced hepatic β-oxidation. PMID:18925642
Cerebral glycolysis: a century of persistent misunderstanding and misconception
Schurr, Avital
2014-01-01
Since its discovery in 1780, lactate (lactic acid) has been blamed for almost any illness outcome in which its levels are elevated. Beginning in the mid-1980s, studies on both muscle and brain tissues, have suggested that lactate plays a role in bioenergetics. However, great skepticism and, at times, outright antagonism has been exhibited by many to any perceived role for this monocarboxylate in energy metabolism. The present review attempts to trace the negative attitudes about lactate to the first four or five decades of research on carbohydrate metabolism and its dogma according to which lactate is a useless anaerobic end-product of glycolysis. The main thrust here is the review of dozens of scientific publications, many by the leading scientists of their times, through the first half of the twentieth century. Consequently, it is concluded that there exists a barrier, described by Howard Margolis as “habit of mind,” that many scientists find impossible to cross. The term suggests “entrenched responses that ordinarily occur without conscious attention and that, even if noticed, are hard to change.” Habit of mind has undoubtedly played a major role in the above mentioned negative attitudes toward lactate. As early as the 1920s, scientists investigating brain carbohydrate metabolism had discovered that lactate can be oxidized by brain tissue preparations, yet their own habit of mind redirected them to believe that such an oxidation is simply a disposal mechanism of this “poisonous” compound. The last section of the review invites the reader to consider a postulated alternative glycolytic pathway in cerebral and, possibly, in most other tissues, where no distinction is being made between aerobic and anaerobic glycolysis; lactate is always the glycolytic end product. Aerobically, lactate is readily shuttled and transported into the mitochondrion, where it is converted to pyruvate via a mitochondrial lactate dehydrogenase (mLDH) and then is entered the tricarboxylic acid (TCA) cycle. PMID:25477776
Andreozzi, Stefano; Chakrabarti, Anirikh; Soh, Keng Cher; Burgard, Anthony; Yang, Tae Hoon; Van Dien, Stephen; Miskovic, Ljubisa; Hatzimanikatis, Vassily
2016-05-01
Rational metabolic engineering methods are increasingly employed in designing the commercially viable processes for the production of chemicals relevant to pharmaceutical, biotechnology, and food and beverage industries. With the growing availability of omics data and of methodologies capable to integrate the available data into models, mathematical modeling and computational analysis are becoming important in designing recombinant cellular organisms and optimizing cell performance with respect to desired criteria. In this contribution, we used the computational framework ORACLE (Optimization and Risk Analysis of Complex Living Entities) to analyze the physiology of recombinant Escherichia coli producing 1,4-butanediol (BDO) and to identify potential strategies for improved production of BDO. The framework allowed us to integrate data across multiple levels and to construct a population of large-scale kinetic models despite the lack of available information about kinetic properties of every enzyme in the metabolic pathways. We analyzed these models and we found that the enzymes that primarily control the fluxes leading to BDO production are part of central glycolysis, the lower branch of tricarboxylic acid (TCA) cycle and the novel BDO production route. Interestingly, among the enzymes between the glucose uptake and the BDO pathway, the enzymes belonging to the lower branch of TCA cycle have been identified as the most important for improving BDO production and yield. We also quantified the effects of changes of the target enzymes on other intracellular states like energy charge, cofactor levels, redox state, cellular growth, and byproduct formation. Independent earlier experiments on this strain confirmed that the computationally obtained conclusions are consistent with the experimentally tested designs, and the findings of the present studies can provide guidance for future work on strain improvement. Overall, these studies demonstrate the potential and effectiveness of ORACLE for the accelerated design of microbial cell factories. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kowalski, Greg M., E-mail: greg.kowalski@deakin.edu.au; De Souza, David P.; Burch, Micah L.
Rationale: Defects in muscle glucose metabolism are linked to type 2 diabetes. Mechanistic studies examining these defects rely on the use of high fat-fed rodent models and typically involve the determination of muscle glucose uptake under insulin-stimulated conditions. While insightful, they do not necessarily reflect the physiology of the postprandial state. In addition, most studies do not examine aspects of glucose metabolism beyond the uptake process. Here we present an approach to study rodent muscle glucose and intermediary metabolism under the dynamic and physiologically relevant setting of the oral glucose tolerance test (OGTT). Methods and results: In vivo muscle glucose andmore » intermediary metabolism was investigated following oral administration of [U-{sup 13}C] glucose. Quadriceps muscles were collected 15 and 60 min after glucose administration and metabolite flux profiling was determined by measuring {sup 13}C mass isotopomers in glycolytic and tricarboxylic acid (TCA) cycle intermediates via gas chromatography–mass spectrometry. While no dietary effects were noted in the glycolytic pathway, muscle from mice fed a high fat diet (HFD) exhibited a reduction in labelling in TCA intermediates. Interestingly, this appeared to be independent of alterations in flux through pyruvate dehydrogenase. In addition, our findings suggest that TCA cycle anaplerosis is negligible in muscle during an OGTT. Conclusions: Under the dynamic physiologically relevant conditions of the OGTT, skeletal muscle from HFD fed mice exhibits alterations in glucose metabolism at the level of the TCA cycle. - Highlights: • Dynamic metabolomics was used to investigate muscle glucose metabolism in vivo. • Mitochondrial TCA cycle metabolism is altered in muscle of HFD mice. • This defect was not pyruvate dehydrogenase mediated, as has been previously thought. • Mitochondrial TCA cycle anaplerosis in muscle is virtually absent during the OGTT.« less
Global transcriptomic response of Anoxybacillus sp. SK 3-4 to aluminum exposure.
Lim, Jia Chun; Thevarajoo, Suganthi; Selvaratnam, Chitra; Goh, Kian Mau; Shamsir, Mohd Shahir; Ibrahim, Zaharah; Chong, Chun Shiong
2017-02-01
Anoxybacillus sp. SK 3-4 is a Gram-positive, rod-shaped bacterium and a member of family Bacillaceae. We had previously reported that the strain is an aluminum resistant thermophilic bacterium. This is the first report to provide a detailed analysis of the global transcriptional response of Anoxybacillus when the cells were exposed to 600 mg L -1 of aluminum. The transcriptome was sequenced using Illumina MiSeq sequencer. Total of 708 genes were differentially expressed (fold change >2.00) with 316 genes were up-regulated while 347 genes were down-regulated, in comparing to control with no aluminum added in the culture. Based on Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, the majority of genes encoding for cell metabolism such as glycolysis, sulfur metabolism, cysteine and methionine metabolism were up-regulated; while most of the gene associated with tricarboxylic acid cycle (TCA cycle) and valine, leucine and isoleucine metabolism were down-regulated. In addition, a significant number of the genes encoding ABC transporters, metal ions transporters, and some stress response proteins were also differentially expressed following aluminum exposure. The findings provide further insight and help us to understand on the resistance of Anoxybacillus sp. SK 3-4 toward aluminium. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lu, Na; Chen, Jun-Hui; Wei, Dong; Chen, Feng; Chen, Gu
2016-05-10
In the present work, Chlamydomonas nivalis, a model species of snow algae, was used to illustrate the metabolic regulation mechanism of microalgae under nutrient deprivation stress. The seed culture was inoculated into the medium without nitrate or phosphate to reveal the cell responses by a metabolome profile analysis using gas chromatography time-of-flight mass spectrometry (GC/TOF-MS). One hundred and seventy-one of the identified metabolites clustered into five groups by the orthogonal partial least squares discriminant analysis (OPLS-DA) model. Among them, thirty of the metabolites in the nitrate-deprived group and thirty-nine of the metabolites in the phosphate-deprived group were selected and identified as "responding biomarkers" by this metabolomic approach. A significant change in the abundance of biomarkers indicated that the enhanced biosynthesis of carbohydrates and fatty acids coupled with the decreased biosynthesis of amino acids, N-compounds and organic acids in all the stress groups. The up- or down-regulation of these biomarkers in the metabolic network provides new insights into the global metabolic regulation and internal relationships within amino acid and fatty acid synthesis, glycolysis, the tricarboxylic acid cycle (TCA) and the Calvin cycle in the snow alga under nitrate or phosphate deprivation stress.
Peng, Chao; Zhao, Xinguo; Liu, Saixi; Shi, Wei; Han, Yu; Guo, Cheng; Jiang, Jingang; Wan, Haibo; Shen, Tiedong; Liu, Guangxu
2016-01-01
Anthropogenic sound has increased significantly in the past decade. However, only a few studies to date have investigated its effects on marine bivalves, with little known about the underlying physiological and molecular mechanisms. In the present study, the effects of different types, frequencies, and intensities of anthropogenic sounds on the digging behavior of razor clams (Sinonovacula constricta) were investigated. The results showed that variations in sound intensity induced deeper digging. Furthermore, anthropogenic sound exposure led to an alteration in the O:N ratios and the expression of ten metabolism-related genes from the glycolysis, fatty acid biosynthesis, tryptophan metabolism, and Tricarboxylic Acid Cycle (TCA cycle) pathways. Expression of all genes under investigation was induced upon exposure to anthropogenic sound at ~80 dB re 1 μPa and repressed at ~100 dB re 1 μPa sound. In addition, the activity of Ca2+/Mg2+-ATPase in the feet tissues, which is directly related to muscular contraction and subsequently to digging behavior, was also found to be affected by anthropogenic sound intensity. The findings suggest that sound may be perceived by bivalves as changes in the water particle motion and lead to the subsequent reactions detected in razor clams. PMID:27063002
Peng, Chao; Zhao, Xinguo; Liu, Saixi; Shi, Wei; Han, Yu; Guo, Cheng; Jiang, Jingang; Wan, Haibo; Shen, Tiedong; Liu, Guangxu
2016-04-11
Anthropogenic sound has increased significantly in the past decade. However, only a few studies to date have investigated its effects on marine bivalves, with little known about the underlying physiological and molecular mechanisms. In the present study, the effects of different types, frequencies, and intensities of anthropogenic sounds on the digging behavior of razor clams (Sinonovacula constricta) were investigated. The results showed that variations in sound intensity induced deeper digging. Furthermore, anthropogenic sound exposure led to an alteration in the O:N ratios and the expression of ten metabolism-related genes from the glycolysis, fatty acid biosynthesis, tryptophan metabolism, and Tricarboxylic Acid Cycle (TCA cycle) pathways. Expression of all genes under investigation was induced upon exposure to anthropogenic sound at ~80 dB re 1 μPa and repressed at ~100 dB re 1 μPa sound. In addition, the activity of Ca(2+)/Mg(2+)-ATPase in the feet tissues, which is directly related to muscular contraction and subsequently to digging behavior, was also found to be affected by anthropogenic sound intensity. The findings suggest that sound may be perceived by bivalves as changes in the water particle motion and lead to the subsequent reactions detected in razor clams.
NASA Astrophysics Data System (ADS)
Bomberg, Malin; Lamminmäki, Tiina; Itävaara, Merja
2016-11-01
The microbial diversity in oligotrophic isolated crystalline Fennoscandian Shield bedrock fracture groundwaters is high, but the core community has not been identified. Here we characterized the bacterial and archaeal communities in 12 water conductive fractures situated at depths between 296 and 798 m by high throughput amplicon sequencing using the Illumina HiSeq platform. Between 1.7 × 104 and 1.2 × 106 bacterial or archaeal sequence reads per sample were obtained. These sequences revealed that up to 95 and 99 % of the bacterial and archaeal sequences obtained from the 12 samples, respectively, belonged to only a few common species, i.e. the core microbiome. However, the remaining rare microbiome contained over 3- and 6-fold more bacterial and archaeal taxa. The metabolic properties of the microbial communities were predicted using PICRUSt. The approximate estimation showed that the metabolic pathways commonly included fermentation, fatty acid oxidation, glycolysis/gluconeogenesis, oxidative phosphorylation, and methanogenesis/anaerobic methane oxidation, but carbon fixation through the Calvin cycle, reductive TCA cycle, and the Wood-Ljungdahl pathway was also predicted. The rare microbiome is an unlimited source of genomic functionality in all ecosystems. It may consist of remnants of microbial communities prevailing in earlier environmental conditions, but could also be induced again if changes in their living conditions occur.
K.M. Jenkins; S.V. Diehl; C.A. Clausen; F. Green
2011-01-01
Brown-rot fungi produce oxalate in large amounts; however, levels of accumulation and function vary by species. Copper-tolerant fungi, like Antrodia radiculosa, produce and accumulate high levels of oxalate in response to copper. Oxalate biosynthesis in copper-tolerant fungi has been linked to the glyoxylate and tricarboxylic acid (TCA) cycles. Within these two cycles...
Choi, Sol; Kim, Hyun Uk; Kim, Tae Yong; Lee, Sang Yup
2016-11-01
To address climate change and environmental problems, it is becoming increasingly important to establish biorefineries for the production of chemicals from renewable non-food biomass. Here we report the development of Escherichia coli strains capable of overproducing a four-carbon platform chemical 4-hybroxybutyric acid (4-HB). Because 4-HB production is significantly affected by aeration level, genome-scale metabolic model-based engineering strategies were designed under aerobic and microaerobic conditions with emphasis on oxidative/reductive TCA branches and glyoxylate shunt. Several different metabolic engineering strategies were employed to develop strains suitable for fermentation both under aerobic and microaerobic conditions. It was found that microaerobic condition was more efficient than aerobic condition in achieving higher titer and productivity of 4-HB. The final engineered strain produced 103.4g/L of 4-HB by microaerobic fed-batch fermentation using glycerol. The aeration-dependent optimization strategy of TCA cycle will be useful for developing microbial strains producing other reduced derivative chemicals of TCA cycle intermediates. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
He, Lizhong; Li, Bin; Lu, Xiaomin; Yuan, Lingyun; Yang, Yanjuan; Yuan, Yinghui; Du, Jing; Guo, Shirong
2015-08-25
Hypoxia induces plant stress, particularly in cucumber plants under hydroponic culture. In plants, calcium is involved in stress signal transmission and growth. The ultimate goal of this study was to shed light on the mechanisms underlying the effects of exogenous calcium on the mitochondrial antioxidant system, the activity of respiratory metabolism enzymes, and ion transport in cucumber (Cucumis sativus L. cv. Jinchun No. 2) roots under hypoxic conditions. Our experiments revealed that exogenous calcium reduces the level of reactive oxygen species (ROS) and increases the activity of antioxidant enzymes in mitochondria under hypoxia. Exogenous calcium also enhances the accumulation of enzymes involved in glycolysis and the tricarboxylic acid (TCA) cycle. We utilized fluorescence and ultrastructural cytochemistry methods to observe that exogenous calcium increases the concentrations of Ca(2+) and K(+) in root cells by increasing the activity of plasma membrane (PM) H(+)-ATPase and tonoplast H(+)-ATPase and H(+)-PPase. Overall, our results suggest that hypoxic stress has an immediate and substantial effect on roots. Exogenous calcium improves metabolism and ion transport in cucumber roots, thereby increasing hypoxia tolerance in cucumber.
Sulfate radicals enable a non-enzymatic Krebs cycle precursor
Keller, Markus A.; Kampjut, Domen; Harrison, Stuart A.; Ralser, Markus
2017-01-01
The evolutionary origins of the tricarboxylic acid cycle (TCA), or Krebs cycle, are so far unclear. Despite a few years ago, the existence of a simple non-enzymatic Krebs-cycle catalyst has been dismissed ‘as an appeal to magic’, citrate and other intermediates have meanwhile been discovered on a carbonaceous meteorite and do interconvert non-enzymatically. To identify the non-enzymatic Krebs cycle catalyst, we used combinatorial, quantitative high-throughput metabolomics to systematically screen iron and sulfate reaction milieus that orient on Archean sediment constituents. TCA cycle intermediates are found stable in water and in the presence of most iron and sulfate species, including simple iron-sulfate minerals. However, we report that TCA intermediates undergo 24 interconversion reactions in the presence of sulfate radicals that form from peroxydisulfate. The non-enzymatic reactions critically cover a topology as present in the Krebs cycle, the glyoxylate shunt and the succinic semialdehyde pathways. Assembled in a chemical network, the reactions achieve more than ninety percent carbon recovery. Our results show that a non-enzymatic precursor for the Krebs cycle is biologically sensible, efficient, and forms spontaneously in the presence of sulfate radicals. PMID:28584880
Trivedi, Amit Kumar; Malik, Shalie; Rani, Sangeeta; Kumar, Vinod
2015-06-01
Eukaryotic cells produce chemical energy in the form of ATP by oxidative phosphorylation of metabolic fuels via a series of enzyme mediated biochemical reactions. We propose that the rates of these reactions are altered, as per energy needs of the seasonal metabolic states in avian migrants. To investigate this, blackheaded buntings were photoperiodically induced with non-migratory, premigratory, migratory and post-migratory phenotypes. High plasma levels of free fatty acids, citrate (an intermediate that begins the TCA cycle) and malate dehydrogenase (mdh, an enzyme involved at the end of the TCA cycle) confirmed increased availability of metabolic reserves and substrates to the TCA cycle during the premigratory and migratory states, respectively. Further, daily expression pattern of genes coding for enzymes involved in the oxidative decarboxylation of pyruvate to acetyl-CoA (pdc and pdk) and oxidative phosphorylation in the TCA cycle (cs, odgh, sdhd and mdh) was monitored in the hypothalamus and liver. Reciprocal relationship between pdc and pdk expressions conformed with the altered requirements of acetyl-CoA for the TCA cycle in different metabolic states. Except for pdk, all genes had a daily expression pattern, with high mRNA expression during the day in the premigratory/migratory phenotypes, and at night (cs, odhg, sdhd and mdh) in the nonmigratory phenotype. Differences in mRNA expression patterns of pdc, sdhd and mdh, but not of pdk, cs and odgh, between the hypothalamus and liver indicated a tissue dependent metabolism in buntings. These results suggest the adaptation of oxidative phosphorylation pathway(s) at gene levels to the seasonal alternations in metabolism in migratory songbirds. Copyright © 2015 Elsevier Inc. All rights reserved.
Verma, Mansi; Lal, Devi; Saxena, Anjali; Anand, Shailly; Kaur, Jasvinder; Kaur, Jaspreet; Lal, Rup
2013-12-01
Actinobacteria are known for their diverse metabolism and physiology. Some are dreadful human pathogens whereas some constitute the natural flora for human gut. Therefore, the understanding of metabolic pathways is a key feature for targeting the pathogenic bacteria without disturbing the symbiotic ones. A big challenge faced today is multiple drug resistance by Mycobacterium and other pathogens that utilize alternative fluxes/effluxes. With the availability of genome sequence, it is now feasible to conduct the comparative in silico analysis. Here we present a simplified approach to compare metabolic pathways so that the species specific enzyme may be traced and engineered for future therapeutics. The analyses of four key carbohydrate metabolic pathways, i.e., glycolysis, pyruvate metabolism, tri carboxylic acid cycle and pentose phosphate pathway suggest the presence of alternative fluxes. It was found that the upper pathway of glycolysis was highly variable in the actinobacterial genomes whereas lower glycolytic pathway was highly conserved. Likewise, pentose phosphate pathway was well conserved in contradiction to TCA cycle, which was found to be incomplete in majority of actinobacteria. The clustering based on presence and absence of genes of these metabolic pathways clearly revealed that members of different genera shared identical pathways and, therefore, provided an easy method to identify the metabolic similarities/differences between pathogenic and symbiotic organisms. The analyses could identify isoenzymes and some key enzymes that were found to be missing in some pathogenic actinobacteria. The present work defines a simple approach to explore the effluxes in four metabolic pathways within the phylum actinobacteria. The analysis clearly reflects that actinobacteria exhibit diverse routes for metabolizing substrates. The pathway comparison can help in finding the enzymes that can be used as drug targets for pathogens without effecting symbiotic organisms within the same host. This may help to prevail over the multiple drug resistance, for designing broad spectrum drugs, in food industries and other clinical research areas. © 2013.
Sanders, Edward; Diehl, Svenja
2015-01-01
Background Many cancers adopt a metabolism that is characterized by the well-known Warburg effect (aerobic glycolysis). Recently, numerous attempts have been made to treat cancer by targeting one or more gene products involved in this pathway without notable success. This work outlines a transcriptomic approach to identify genes that are highly perturbed in clear cell renal cell carcinoma (CCRCC). Methods We developed a model of the extended Warburg effect and outlined the model using Cytoscape. Following this, gene expression fold changes (FCs) for tumor and adjacent normal tissue from patients with CCRCC (GSE6344) were mapped on to the network. Gene expression values with FCs of greater than two were considered as potential targets for treatment of CCRCC. Results The Cytoscape network includes glycolysis, gluconeogenesis, the pentose phosphate pathway (PPP), the TCA cycle, the serine/glycine pathway, and partial glutaminolysis and fatty acid synthesis pathways. Gene expression FCs for nine of the 10 CCRCC patients in the GSE6344 data set were consistent with a shift to aerobic glycolysis. Genes involved in glycolysis and the synthesis and transport of lactate were over-expressed, as was the gene that codes for the kinase that inhibits the conversion of pyruvate to acetyl-CoA. Interestingly, genes that code for unique proteins involved in gluconeogenesis were strongly under-expressed as was also the case for the serine/glycine pathway. These latter two results suggest that the role attributed to the M2 isoform of pyruvate kinase (PKM2), frequently the principal isoform of PK present in cancer: i.e. causing a buildup of glucose metabolites that are shunted into branch pathways for synthesis of key biomolecules, may not be operative in CCRCC. The fact that there was no increase in the expression FC of any gene in the PPP is consistent with this hypothesis. Literature protein data generally support the transcriptomic findings. Conclusions A number of key genes have been identified that could serve as valid targets for anti-cancer pharmaceutical agents. Genes that are highly over-expressed include ENO2, HK2, PFKP, SLC2A3, PDK1, and SLC16A1. Genes that are highly under-expressed include ALDOB, PKLR, PFKFB2, G6PC, PCK1, FBP1, PC, and SUCLG1. PMID:25859558
Environment impacts the metabolic dependencies of Ras-driven non-small cell lung cancer
Davidson, Shawn M.; Papagiannakopoulos, Thales; Olenchock, Benjamin A.; Heyman, Julia E.; Keibler, Mark A.; Luengo, Alba; Bauer, Matthew R.; Jha, Abhishek K.; O’Brien, James P.; Pierce, Kerry A.; Gui, Dan Y.; Sullivan, Lucas B.; Wasylenko, Thomas M.; Subbaraj, Lakshmipriya; Chin, Christopher R.; Stephanopolous, Gregory; Mott, Bryan T.; Jacks, Tyler; Clish, Clary B.; Vander Heiden, Matthew G.
2016-01-01
SUMMARY Cultured cells convert glucose to lactate and glutamine is the major source of tricarboxylic acid (TCA) cycle carbon, but whether the same metabolic phenotype is found in tumors is less studied. We infused mice with lung cancers with isotope-labeled glucose or glutamine and compared the fate of these nutrients in tumor and normal tissue. As expected, lung tumors exhibit increased lactate production from glucose. However, glutamine utilization by both lung tumors and normal lung was minimal, with lung tumors showing increased glucose contribution to the TCA cycle relative to normal lung tissue. Deletion of enzymes involved in glucose oxidation demonstrates that glucose carbon contribution to the TCA cycle is required for tumor formation. These data suggest that understanding nutrient utilization by tumors can predict metabolic dependencies of cancers in vivo. Furthermore, these data argue that the in vivo environment is an important determinant of the metabolic phenotype of cancer cells. PMID:26853747
Origin of the Reductive Tricarboxylic Acid (rTCA) Cycle-Type CO2 Fixation: A Perspective
Fujishima, Kosuke
2017-01-01
The reductive tricarboxylic acid (rTCA) cycle is among the most plausible candidates for the first autotrophic metabolism in the earliest life. Extant enzymes fixing CO2 in this cycle contain cofactors at the catalytic centers, but it is unlikely that the protein/cofactor system emerged at once in a prebiotic process. Here, we discuss the feasibility of non-enzymatic cofactor-assisted drive of the rTCA reactions in the primitive Earth environments, particularly focusing on the acetyl-CoA conversion to pyruvate. Based on the energetic and mechanistic aspects of this reaction, we propose that the deep-sea hydrothermal vent environments with active electricity generation in the presence of various sulfide catalysts are a promising setting for it to progress. Our view supports the theory of an autotrophic origin of life from primordial carbon assimilation within a sulfide-rich hydrothermal vent.
Lipogenesis and Redox Balance in Nitrogen-Fixing Pea Bacteroids.
Terpolilli, Jason J; Masakapalli, Shyam K; Karunakaran, Ramakrishnan; Webb, Isabel U C; Green, Rob; Watmough, Nicholas J; Kruger, Nicholas J; Ratcliffe, R George; Poole, Philip S
2016-10-15
Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the tricarboxylic acid (TCA) cycle to generate NAD(P)H for reduction of N2 Metabolic flux analysis of laboratory-grown Rhizobium leguminosarum showed that the flux from [(13)C]succinate was consistent with respiration of an obligate aerobe growing on a TCA cycle intermediate as the sole carbon source. However, the instability of fragile pea bacteroids prevented their steady-state labeling under N2-fixing conditions. Therefore, comparative metabolomic profiling was used to compare free-living R. leguminosarum with pea bacteroids. While the TCA cycle was shown to be essential for maximal rates of N2 fixation, levels of pyruvate (5.5-fold reduced), acetyl coenzyme A (acetyl-CoA; 50-fold reduced), free coenzyme A (33-fold reduced), and citrate (4.5-fold reduced) were much lower in bacteroids. Instead of completely oxidizing acetyl-CoA, pea bacteroids channel it into both lipid and the lipid-like polymer poly-β-hydroxybutyrate (PHB), the latter via a type III PHB synthase that is active only in bacteroids. Lipogenesis may be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Direct reduction by NAD(P)H of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance the production of NAD(P)H from oxidation of acetyl-CoA in the TCA cycle with its storage in PHB and lipids. Biological nitrogen fixation by symbiotic bacteria (rhizobia) in legume root nodules is an energy-expensive process. Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the TCA cycle to generate NAD(P)H for reduction of N2 However, direct reduction of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance oxidation of plant-derived dicarboxylates in the TCA cycle with lipid synthesis. Pea bacteroids channel acetyl-CoA into both lipid and the lipid-like polymer poly-β-hydroxybutyrate, the latter via a type II PHB synthase. Lipogenesis is likely to be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Lipogenesis and Redox Balance in Nitrogen-Fixing Pea Bacteroids
Terpolilli, Jason J.; Masakapalli, Shyam K.; Karunakaran, Ramakrishnan; Webb, Isabel U. C.; Green, Rob; Watmough, Nicholas J.; Kruger, Nicholas J.; Ratcliffe, R. George
2016-01-01
ABSTRACT Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the tricarboxylic acid (TCA) cycle to generate NAD(P)H for reduction of N2. Metabolic flux analysis of laboratory-grown Rhizobium leguminosarum showed that the flux from [13C]succinate was consistent with respiration of an obligate aerobe growing on a TCA cycle intermediate as the sole carbon source. However, the instability of fragile pea bacteroids prevented their steady-state labeling under N2-fixing conditions. Therefore, comparative metabolomic profiling was used to compare free-living R. leguminosarum with pea bacteroids. While the TCA cycle was shown to be essential for maximal rates of N2 fixation, levels of pyruvate (5.5-fold reduced), acetyl coenzyme A (acetyl-CoA; 50-fold reduced), free coenzyme A (33-fold reduced), and citrate (4.5-fold reduced) were much lower in bacteroids. Instead of completely oxidizing acetyl-CoA, pea bacteroids channel it into both lipid and the lipid-like polymer poly-β-hydroxybutyrate (PHB), the latter via a type III PHB synthase that is active only in bacteroids. Lipogenesis may be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Direct reduction by NAD(P)H of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance the production of NAD(P)H from oxidation of acetyl-CoA in the TCA cycle with its storage in PHB and lipids. IMPORTANCE Biological nitrogen fixation by symbiotic bacteria (rhizobia) in legume root nodules is an energy-expensive process. Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the TCA cycle to generate NAD(P)H for reduction of N2. However, direct reduction of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance oxidation of plant-derived dicarboxylates in the TCA cycle with lipid synthesis. Pea bacteroids channel acetyl-CoA into both lipid and the lipid-like polymer poly-β-hydroxybutyrate, the latter via a type II PHB synthase. Lipogenesis is likely to be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. PMID:27501983
Gluconeogenesis from labeled carbon: estimating isotope dilution
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kelleher, J.K.
1986-03-01
To estimate the rate of gluconeogenesis from steady-state incorporation of labeled 3-carbon precursors into glucose, isotope dilution must be considered so that the rate of labeling of glucose can be quantitatively converted to the rate of gluconeogenesis. An expression for the value of this isotope dilution can be derived using mathematical techniques and a model of the tricarboxylic acid (TCA) cycle. The present investigation employs a more complex model than that used in previous studies. This model includes the following pathways that may affect the correction for isotope dilution: 1) flux of 3-carbon precursor to the oxaloacetate pool via acetyl-CoAmore » and the TCA cycle; 2) flux of 4- or 5-carbon compounds into the TCA cycle; 3) reversible flux between oxaloacetate (OAA) and pyruvate and between OAA and fumarate; 4) incomplete equilibrium between OAA pools; and 5) isotope dilution of 3-carbon tracers between the experimentally measured pool and the precursor for the TCA-cycle OAA pool. Experimental tests are outlined which investigators can use to determine whether these pathways are significant in a specific steady-state system. The study indicated that flux through these five pathways can significantly affect the correction for isotope dilution. To correct for the effects of these pathways an alternative method for calculating isotope dilution is proposed using citrate to relate the specific activities of acetyl-CoA and OAA.« less
Kim, Jin Yeong; Wu, Jingni; Kwon, Soon Jae; Oh, Haram; Lee, So Eui; Kim, Sang Gon; Wang, Yiming; Agrawal, Ganesh Kumar; Rakwal, Randeep; Kang, Kyu Young; Ahn, Il-Pyung; Kim, Beom-Gi; Kim, Sun Tae
2014-10-01
Necrotrophic fungal pathogen Cochliobolus miyabeanus causes brown spot disease in rice leaves upon infection, resulting in critical rice yield loss. To better understand the rice-C. miyabeanus interaction, we employed proteomic approaches to establish differential proteomes of total and secreted proteins from the inoculated leaves. The 2DE approach after PEG-fractionation of total proteins coupled with MS (MALDI-TOF/TOF and nESI-LC-MS/MS) analyses led to identification of 49 unique proteins out of 63 differential spots. SDS-PAGE in combination with nESI-LC-MS/MS shotgun approach was applied to identify secreted proteins in the leaf apoplast upon infection and resulted in cataloging of 501 unique proteins, of which 470 and 31 proteins were secreted from rice and C. miyabeanus, respectively. Proteins mapped onto metabolic pathways implied their reprogramming upon infection. The enzymes involved in Calvin cycle and glycolysis decreased in their protein abundance, whereas enzymes in the TCA cycle, amino acids, and ethylene biosynthesis increased. Differential proteomes also generated distribution of identified proteins in the intracellular and extracellular spaces, providing a better insight into defense responses of proteins in rice against C. miyabeanus. Established proteome of the rice-C. miyabeanus interaction serves not only as a good resource for the scientific community but also highlights its significance from biological aspects. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fraga, Carolina Miguel; da Costa, Tatiane Luiza; de Castro, Ana Maria; Reynoso-Ducoing, Olivia; Ambrosio, Javier; Hernández-Campos, Alicia; Castillo, Rafael; Vinaud, Marina Clare
2017-01-01
Human cysticercosis caused by Taenia crassiceps is unusual; however, it is an useful experimental model for cysticercosis studies. Benzimidazole derivatives are important antihelminthic drugs widely used against helminths. A novel compound 6-chloro-5-(1-naphthyloxy) -2-(trifluoromethyl)-1H-benzimidazole (RCB20) is a benzimidazole derivative less polar and more lipophilic. The aim of this study was to detect the effect of the RCB20 on the in vitro energetic metabolism of T. crassiceps cysticerci. For this, products of the metabolism both produced and secreted/excreted (S/E) by the parasite were detected through spectrophotometry and high performance liquid chromatography after exposure to 6.5 and 13 μM of RCB20 and albendazole sulfoxide (ABZSO). There was a gradual increase in the concentrations of glucose not uptaken by parasites exposed to both concentrations RCB20 and ABZSO. There was a higher concentration of all the organic acids related to the tricarboxilic acid cycle int the parasites exposed to RCB20. The structural differences between RCB20 and ABZSO result in different targets within the parasite and in a greater induction of the energetic pathways, such as the glycolysis and the TCA cycle. RCB20 is a good candidate as a substitute for anthelminthic benzimidazoles due to a differentiated site of action with similar outcome. Copyright © 2016 Elsevier Inc. All rights reserved.
Fumarate Reductase Activity Maintains an Energized Membrane in Anaerobic Mycobacterium tuberculosis
Watanabe, Shinya; Zimmermann, Michael; Goodwin, Michael B.; Sauer, Uwe; Barry, Clifton E.; Boshoff, Helena I.
2011-01-01
Oxygen depletion of Mycobacterium tuberculosis engages the DosR regulon that coordinates an overall down-regulation of metabolism while up-regulating specific genes involved in respiration and central metabolism. We have developed a chemostat model of M. tuberculosis where growth rate was a function of dissolved oxygen concentration to analyze metabolic adaptation to hypoxia. A drop in dissolved oxygen concentration from 50 mmHg to 0.42 mmHg led to a 2.3 fold decrease in intracellular ATP levels with an almost 70-fold increase in the ratio of NADH/NAD+. This suggests that re-oxidation of this co-factor becomes limiting in the absence of a terminal electron acceptor. Upon oxygen limitation genes involved in the reverse TCA cycle were upregulated and this upregulation was associated with a significant accumulation of succinate in the extracellular milieu. We confirmed that this succinate was produced by a reversal of the TCA cycle towards the non-oxidative direction with net CO2 incorporation by analysis of the isotopomers of secreted succinate after feeding stable isotope (13C) labeled precursors. This showed that the resulting succinate retained both carbons lost during oxidative operation of the TCA cycle. Metabolomic analyses of all glycolytic and TCA cycle intermediates from 13C-glucose fed cells under aerobic and anaerobic conditions showed a clear reversal of isotope labeling patterns accompanying the switch from normoxic to anoxic conditions. M. tuberculosis encodes three potential succinate-producing enzymes including a canonical fumarate reductase which was highly upregulated under hypoxia. Knockout of frd, however, failed to reduce succinate accumulation and gene expression studies revealed a compensatory upregulation of two homologous enzymes. These major realignments of central metabolism are consistent with a model of oxygen-induced stasis in which an energized membrane is maintained by coupling the reductive branch of the TCA cycle to succinate secretion. This fermentative process may offer unique targets for the treatment of latent tuberculosis. PMID:21998585
2012-01-01
Background Microbial engineering strategies that elicit global metabolic perturbations have the capacity to increase organism robustness for targeted metabolite production. In particular, perturbations to regulators of cellular systems that impact glycolysis and amino acid production while simultaneously decreasing fermentation by-products such as acetate and CO2 make ideal targets. Intriguingly, perturbation of the Carbon Storage Regulator (Csr) system has been previously implicated in large changes in central carbon metabolism in E. coli. Therefore, we hypothesized that perturbation of the Csr system through the CsrA-CsrB ribonucleoprotein complex might increase production of biofuels and their intermediates from heterologous pathways. Results We engaged the CsrA-CsrB ribonucleoprotein complex of E. coli via overexpression of CsrB. CsrB is a 350-nucleotide non-coding RNA that antagonizes CsrA, an RNA-binding protein that regulates translation of specific mRNA targets. By using shotgun proteomics and targeted metabolomics we established that elevation of CsrB levels leads to alterations in metabolite and protein levels in glycolysis, the TCA cycle and amino acid levels. Consequently, we show that such changes can be suitably applied to improve the production of desired compounds through the native fatty acid and heterologous n-butanol and isoprenoid pathways by up to two-fold. We also observed concomitant decreases in undesirable fermentation by-products such as acetate and CO2. Conclusions We have demonstrated that simple engineering of the RNA-based Csr global regulatory system constitutes a novel approach to obtaining pathway-independent improvements within engineered hosts. Additionally, since Csr is conserved across most prokaryotic species, this approach may also be amenable to a wide variety of production hosts. PMID:22694848
McKee, Adrienne E; Rutherford, Becky J; Chivian, Dylan C; Baidoo, Edward K; Juminaga, Darmawi; Kuo, Dwight; Benke, Peter I; Dietrich, Jeffrey A; Ma, Suzanne M; Arkin, Adam P; Petzold, Christopher J; Adams, Paul D; Keasling, Jay D; Chhabra, Swapnil R
2012-06-13
Microbial engineering strategies that elicit global metabolic perturbations have the capacity to increase organism robustness for targeted metabolite production. In particular, perturbations to regulators of cellular systems that impact glycolysis and amino acid production while simultaneously decreasing fermentation by-products such as acetate and CO(2) make ideal targets. Intriguingly, perturbation of the Carbon Storage Regulator (Csr) system has been previously implicated in large changes in central carbon metabolism in E. coli. Therefore, we hypothesized that perturbation of the Csr system through the CsrA-CsrB ribonucleoprotein complex might increase production of biofuels and their intermediates from heterologous pathways. We engaged the CsrA-CsrB ribonucleoprotein complex of E. coli via overexpression of CsrB. CsrB is a 350-nucleotide non-coding RNA that antagonizes CsrA, an RNA-binding protein that regulates translation of specific mRNA targets. By using shotgun proteomics and targeted metabolomics we established that elevation of CsrB levels leads to alterations in metabolite and protein levels in glycolysis, the TCA cycle and amino acid levels. Consequently, we show that such changes can be suitably applied to improve the production of desired compounds through the native fatty acid and heterologous n-butanol and isoprenoid pathways by up to two-fold. We also observed concomitant decreases in undesirable fermentation by-products such as acetate and CO(2). We have demonstrated that simple engineering of the RNA-based Csr global regulatory system constitutes a novel approach to obtaining pathway-independent improvements within engineered hosts. Additionally, since Csr is conserved across most prokaryotic species, this approach may also be amenable to a wide variety of production hosts.
Regulation of Mammary Tumor Formation and Lipid Biosynthesis by Spot14
2014-06-01
consistent with these terms, showing enrichment in glycolysis/ gluconeogenesis , the pentose phosphate pathway, and the cell cycle in PyMT/S14-/- versus PyMT...Enrichment Glycolysis / Gluconeogenesis 0.0018 6.66 Pentose phosphate pathway 0.0045 11.62 Cell cycle 0.0254 3.54 Starch and sucrose metabolism 0.0799
PEPCK Coordinates the Regulation of Central Carbon Metabolism to Promote Cancer Cell Growth.
Montal, Emily D; Dewi, Ruby; Bhalla, Kavita; Ou, Lihui; Hwang, Bor Jang; Ropell, Ashley E; Gordon, Chris; Liu, Wan-Ju; DeBerardinis, Ralph J; Sudderth, Jessica; Twaddel, William; Boros, Laszlo G; Shroyer, Kenneth R; Duraisamy, Sekhar; Drapkin, Ronny; Powers, R Scott; Rohde, Jason M; Boxer, Matthew B; Wong, Kwok-Kin; Girnun, Geoffrey D
2015-11-19
Phosphoenolpyruvate carboxykinase (PEPCK) is well known for its role in gluconeogenesis. However, PEPCK is also a key regulator of TCA cycle flux. The TCA cycle integrates glucose, amino acid, and lipid metabolism depending on cellular needs. In addition, biosynthetic pathways crucial to tumor growth require the TCA cycle for the processing of glucose and glutamine derived carbons. We show here an unexpected role for PEPCK in promoting cancer cell proliferation in vitro and in vivo by increasing glucose and glutamine utilization toward anabolic metabolism. Unexpectedly, PEPCK also increased the synthesis of ribose from non-carbohydrate sources, such as glutamine, a phenomenon not previously described. Finally, we show that the effects of PEPCK on glucose metabolism and cell proliferation are in part mediated via activation of mTORC1. Taken together, these data demonstrate a role for PEPCK that links metabolic flux and anabolic pathways to cancer cell proliferation. Copyright © 2015 Elsevier Inc. All rights reserved.
Glutamate and asparagine cataplerosis underlie glutamine addiction in melanoma
Ratnikov, Boris; Aza-Blanc, Pedro; Ronai, Ze'ev A.; Smith, Jeffrey W.; Osterman, Andrei L.; Scott, David A.
2015-01-01
Glutamine dependence is a prominent feature of cancer metabolism, and here we show that melanoma cells, irrespective of their oncogenic background, depend on glutamine for growth. A quantitative audit of how carbon from glutamine is used showed that TCA-cycle-derived glutamate is, in most melanoma cells, the major glutamine-derived cataplerotic output and product of glutaminolysis. In the absence of glutamine, TCA cycle metabolites were liable to depletion through aminotransferase-mediated α-ketoglutarate-to-glutamate conversion and glutamate secretion. Aspartate was an essential cataplerotic output, as melanoma cells demonstrated a limited capacity to salvage external aspartate. Also, the absence of asparagine increased the glutamine requirement, pointing to vulnerability in the aspartate-asparagine biosynthetic pathway within melanoma metabolism. In contrast to melanoma cells, melanocytes could grow in the absence of glutamine. Melanocytes use more glutamine for protein synthesis rather than secreting it as glutamate and are less prone to loss of glutamate and TCA cycle metabolites when starved of glutamine. PMID:25749035
Glucose-independent glutamine metabolism via TCA cycling for proliferation and survival in B-cells
Le, Anne; Lane, Andrew N.; Hamaker, Max; Bose, Sminu; Gouw, Arvin; Barbi, Joseph; Tsukamoto, Takashi; Rojas, Camilio J.; Slusher, Barbara S.; Zhang, Haixia; Zimmerman, Lisa J.; Liebler, Daniel C.; Slebos, Robbert J.C.; Lorkiewicz, Pawel K.; Higashi, Richard M.; Fan, Teresa W. M.; Dang, Chi V.
2012-01-01
Summary Because MYC plays a causal role in many human cancers, including those with hypoxic and nutrient-poor tumor microenvironments, we have determined the metabolic responses of a MYC-inducible human Burkitt lymphoma model P493 cell line to aerobic and hypoxic conditions, and to glucose deprivation, using Stable Isotope Resolved Metabolomics. Using [U-13C]-glucose as the tracer, both glucose consumption and lactate production were increased by MYC expression and hypoxia. Using [U-13C,15N]-glutamine as the tracer, glutamine import and metabolism through the TCA cycle persisted under hypoxia, and glutamine contributed significantly to citrate carbons. Under glucose deprivation, glutamine-derived fumarate, malate, and citrate were significantly increased. Their 13C labeling patterns demonstrate an alternative energy-generating glutaminolysis pathway involving a glucose-independent TCA cycle. The essential role of glutamine metabolism in cell survival and proliferation under hypoxia and glucose deficiency, makes them susceptible to the glutaminase inhibitor BPTES, and hence could be targeted for cancer therapy. PMID:22225880
De Palma, Sara; Leone, Roberta; Grumati, Paolo; Vasso, Michele; Polishchuk, Roman; Capitanio, Daniele; Braghetta, Paola; Bernardi, Paolo; Bonaldo, Paolo; Gelfi, Cecilia
2013-01-01
This study identifies metabolic and protein phenotypic alterations in gastrocnemius, tibialis anterior and diaphragm muscles of Col6a1−/− mice, a model of human collagen VI myopathies. All three muscles of Col6a1−/− mice show some common changes in proteins involved in metabolism, resulting in decreased glycolysis and in changes of the TCA cycle fluxes. These changes lead to a different fate of α-ketoglutarate, with production of anabolic substrates in gastrocnemius and tibialis anterior, and with lipotoxicity in diaphragm. The metabolic changes are associated with changes of proteins involved in mechanotransduction at the myotendineous junction/costameric/sarcomeric level (TN-C, FAK, ROCK1, troponin I fast) and in energy metabolism (aldolase, enolase 3, triose phosphate isomerase, creatine kinase, adenylate kinase 1, parvalbumin, IDH1 and FASN). Together, these change may explain Ca2+ deregulation, impaired force development, increased muscle-relaxation-time and fiber damage found in the mouse model as well as in patients. The severity of these changes differs in the three muscles (gastrocnemius
De Palma, Sara; Leone, Roberta; Grumati, Paolo; Vasso, Michele; Polishchuk, Roman; Capitanio, Daniele; Braghetta, Paola; Bernardi, Paolo; Bonaldo, Paolo; Gelfi, Cecilia
2013-01-01
This study identifies metabolic and protein phenotypic alterations in gastrocnemius, tibialis anterior and diaphragm muscles of Col6a1(-/-) mice, a model of human collagen VI myopathies. All three muscles of Col6a1(-/-) mice show some common changes in proteins involved in metabolism, resulting in decreased glycolysis and in changes of the TCA cycle fluxes. These changes lead to a different fate of α-ketoglutarate, with production of anabolic substrates in gastrocnemius and tibialis anterior, and with lipotoxicity in diaphragm. The metabolic changes are associated with changes of proteins involved in mechanotransduction at the myotendineous junction/costameric/sarcomeric level (TN-C, FAK, ROCK1, troponin I fast) and in energy metabolism (aldolase, enolase 3, triose phosphate isomerase, creatine kinase, adenylate kinase 1, parvalbumin, IDH1 and FASN). Together, these change may explain Ca(2+) deregulation, impaired force development, increased muscle-relaxation-time and fiber damage found in the mouse model as well as in patients. The severity of these changes differs in the three muscles (gastrocnemius
Metabolic traits of an uncultured archaeal lineage--MSBL1--from brine pools of the Red Sea.
Mwirichia, Romano; Alam, Intikhab; Rashid, Mamoon; Vinu, Manikandan; Ba-Alawi, Wail; Anthony Kamau, Allan; Kamanda Ngugi, David; Göker, Markus; Klenk, Hans-Peter; Bajic, Vladimir; Stingl, Ulrich
2016-01-13
The candidate Division MSBL1 (Mediterranean Sea Brine Lakes 1) comprises a monophyletic group of uncultured archaea found in different hypersaline environments. Previous studies propose methanogenesis as the main metabolism. Here, we describe a metabolic reconstruction of MSBL1 based on 32 single-cell amplified genomes from Brine Pools of the Red Sea (Atlantis II, Discovery, Nereus, Erba and Kebrit). Phylogeny based on rRNA genes as well as conserved single copy genes delineates the group as a putative novel lineage of archaea. Our analysis shows that MSBL1 may ferment glucose via the Embden-Meyerhof-Parnas pathway. However, in the absence of organic carbon, carbon dioxide may be fixed via the ribulose bisphosphate carboxylase, Wood-Ljungdahl pathway or reductive TCA cycle. Therefore, based on the occurrence of genes for glycolysis, absence of the core genes found in genomes of all sequenced methanogens and the phylogenetic position, we hypothesize that the MSBL1 are not methanogens, but probably sugar-fermenting organisms capable of autotrophic growth. Such a mixotrophic lifestyle would confer survival advantage (or possibly provide a unique narrow niche) when glucose and other fermentable sugars are not available.
Metabolic phenotyping of a model of adipocyte differentiation
Roberts, Lee D.; Virtue, Sam; Vidal-Puig, Antonio; Nicholls, Andrew W.
2009-01-01
The 3T3-L1 murine cell line is a robust and widely used model for the study of adipogenesis and processes occurring in mature adipocytes. The fibroblastic like cells can be induced by hormones to differentiate into mature adipocytes. In this study, the metabolic phenotype associated with differentiation of the 3T3-L1 cell line has been studied using gas chromatography-mass spectrometry, 1H nuclear magnetic resonance spectroscopy, liquid chromatography-mass spectrometry, direct infusion-mass spectrometry, and 13C substrate labeling in conjunction with multivariate statistics. The changes in metabolite concentrations at distinct periods during differentiation have been defined including alterations in the TCA cycle, glycolysis, the production of odd chain fatty acids by α-oxidation, fatty acid synthesis, fatty acid desaturation, polyamine biosynthesis, and trans-esterification to produce complex lipids. The metabolic changes induced during differentiation of the 3T3-L1 cell line were then compared with the metabolic differences between pre- and postdifferentiation primary adipocytes. These metabolic alterations reflect the changing role of the 3T3-L1 cells during differentiation, as well as possibly providing metabolic triggers to stimulate the processes which occur during differentiation. PMID:19602617
He, Lizhong; Li, Bin; Lu, Xiaomin; Yuan, Lingyun; Yang, Yanjuan; Yuan, Yinghui; Du, Jing; Guo, Shirong
2015-01-01
Hypoxia induces plant stress, particularly in cucumber plants under hydroponic culture. In plants, calcium is involved in stress signal transmission and growth. The ultimate goal of this study was to shed light on the mechanisms underlying the effects of exogenous calcium on the mitochondrial antioxidant system, the activity of respiratory metabolism enzymes, and ion transport in cucumber (Cucumis sativus L. cv. Jinchun No. 2) roots under hypoxic conditions. Our experiments revealed that exogenous calcium reduces the level of reactive oxygen species (ROS) and increases the activity of antioxidant enzymes in mitochondria under hypoxia. Exogenous calcium also enhances the accumulation of enzymes involved in glycolysis and the tricarboxylic acid (TCA) cycle. We utilized fluorescence and ultrastructural cytochemistry methods to observe that exogenous calcium increases the concentrations of Ca2+ and K+ in root cells by increasing the activity of plasma membrane (PM) H+-ATPase and tonoplast H+-ATPase and H+-PPase. Overall, our results suggest that hypoxic stress has an immediate and substantial effect on roots. Exogenous calcium improves metabolism and ion transport in cucumber roots, thereby increasing hypoxia tolerance in cucumber. PMID:26304855
A Quantitative Acetylomic Analysis of Early Seed Development in Rice (Oryza sativa L.).
Wang, Yifeng; Hou, Yuxuan; Qiu, Jiehua; Li, Zhiyong; Zhao, Juan; Tong, Xiaohong; Zhang, Jian
2017-06-27
PKA (protein lysine acetylation) is a critical post-translational modification that regulates various developmental processes, including seed development. However, the acetylation events and dynamics on a proteomic scale in this process remain largely unknown, especially in rice early seed development. We report the first quantitative acetylproteomic study focused on rice early seed development by employing a mass spectral-based (MS-based), label-free approach. A total of 1817 acetylsites on 1688 acetylpeptides from 972 acetylproteins were identified in pistils and seeds at three and seven days after pollination, including 268 acetyproteins differentially acetylated among the three stages. Motif-X analysis revealed that six significantly enriched motifs, such as (DxkK), (kH) and (kY) around the acetylsites of the identified rice seed acetylproteins. Differentially acetylated proteins among the three stages, including adenosine diphosphate (ADP) -glucose pyrophosphorylases (AGPs), PDIL1-1 (protein disulfide isomerase like 1-1), hexokinases, pyruvate dehydrogenase complex (PDC) and numerous other regulators that are extensively involved in the starch and sucrose metabolism, glycolysis/gluconeogenesis, tricarboxylic acid (TCA) cycle and photosynthesis pathways during early seed development. This study greatly expanded the rice acetylome dataset, and shed novel insight into the regulatory roles of PKA in rice early seed development.
Kanno, Nanako; Matsuura, Katsumi; Haruta, Shin
2018-03-29
Purple photosynthetic bacteria utilize light energy for growth. We previously demonstrated that light energy contributed to prolonging the survival of multiple purple bacteria under carbon-starved conditions. In order to clarify the effects of illumination on metabolic states under carbon-starved, non-growing conditions, we herein compared the metabolic profiles of starved cells in the light and dark using the purple bacterium, Rhodopseudomonas palustris. The metabolic profiles of starved cells in the light were markedly different from those in the dark. After starvation for 5 d in the light, cells showed increases in the amount of ATP and the NAD + /NADH ratio. Decreases in the amounts of most metabolites related to glycolysis and the TCA cycle in energy-rich starved cells suggest the active utilization of these metabolites for the modification of cellular components. Starvation in the dark induced the consumption of cellular compounds such as amino acids, indicating that the degradation of these cellular components produced ATP in order to maintain viability under energy-poor conditions. The present results suggest that intracellular energy levels alter survival strategies under carbon-starved conditions through metabolism.
Ketogenic diets, mitochondria, and neurological diseases
Gano, Lindsey B.; Patel, Manisha; Rho, Jong M.
2014-01-01
The ketogenic diet (KD) is a broad-spectrum therapy for medically intractable epilepsy and is receiving growing attention as a potential treatment for neurological disorders arising in part from bioenergetic dysregulation. The high-fat/low-carbohydrate “classic KD”, as well as dietary variations such as the medium-chain triglyceride diet, the modified Atkins diet, the low-glycemic index treatment, and caloric restriction, enhance cellular metabolic and mitochondrial function. Hence, the broad neuroprotective properties of such therapies may stem from improved cellular metabolism. Data from clinical and preclinical studies indicate that these diets restrict glycolysis and increase fatty acid oxidation, actions which result in ketosis, replenishment of the TCA cycle (i.e., anaplerosis), restoration of neurotransmitter and ion channel function, and enhanced mitochondrial respiration. Further, there is mounting evidence that the KD and its variants can impact key signaling pathways that evolved to sense the energetic state of the cell, and that help maintain cellular homeostasis. These pathways, which include PPARs, AMP-activated kinase, mammalian target of rapamycin, and the sirtuins, have all been recently implicated in the neuroprotective effects of the KD. Further research in this area may lead to future therapeutic strategies aimed at mimicking the pleiotropic neuroprotective effects of the KD. PMID:24847102
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Eric L.; Orsat, Valerie; Shah, Manesh B
2012-01-01
System biology and bioprocess technology can be better understood using shotgun proteomics as a monitoring system during the fermentation. We demonstrated a shotgun proteomic method to monitor the temporal yeast proteome in early, middle and late exponential phases. Our study identified a total of 1389 proteins combining all 2D-LC-MS/MS runs. The temporal Saccharomyces cerevisiae proteome was enriched with proteolysis, radical detoxification, translation, one-carbon metabolism, glycolysis and TCA cycle. Heat shock proteins and proteins associated with oxidative stress response were found throughout the exponential phase. The most abundant proteins observed were translation elongation factors, ribosomal proteins, chaperones and glycolytic enzymes. Themore » high abundance of the H-protein of the glycine decarboxylase complex (Gcv3p) indicated the availability of glycine in the environment. We observed differentially expressed proteins and the induced proteins at mid-exponential phase were involved in ribosome biogenesis, mitochondria DNA binding/replication and transcriptional activator. Induction of tryptophan synthase (Trp5p) indicated the abundance of tryptophan during the fermentation. As fermentation progressed toward late exponential phase, a decrease in cell proliferation was implied from the repression of ribosomal proteins, transcription coactivators, methionine aminopeptidase and translation-associated proteins.« less
Guo, Fuchuan; Zi, Tianqi; Liu, Liyan; Feng, Rennan; Sun, Changhao
2017-07-19
It has been demonstrated that mangiferin can ameliorate hypertriglyceridemia by modulating the expression levels of genes involved in lipid metabolism in animal experiments, but its effects on the serum metabolic fingerprinting of hyperlipidemia animal models have not been reported. Thus, a NMR-based metabolomics approach was conducted to explore the effects of mangiferin on hyperlipidemia hamsters and to gain a better understanding of the involved metabolic pathways. Hamsters fed with a high-fat diet were orally administered with mangiferin 150 mg per kg BW once a day for 8 weeks. Serum samples were analysed by 1 H NMR, and multivariate statistical analysis was applied to the data to identify potential biomarkers. In total, 20 discriminating metabolites were identified. It turned out that mangiferin administration can partly reverse the metabolism disorders induced by a high-fat diet and exerted a good anti-hypertriglyceridemia effect. Mangiferin ameliorated hyperlipidemia by intervening in some major metabolic pathways, involving glycolysis, the TCA cycle, synthesis of ketone bodies, and BCAAs as well as choline and lipid metabolism. These findings provided new essential information on the effects of mangiferin and demonstrated the great potential of this nutrimetabolomics approach.
The genomic potential of Marinobacter aquaeolei - A biogeochemical opportunotroph
NASA Astrophysics Data System (ADS)
Singer, E.; Webb, E.; Nelson, W.; Heidelberg, J.; Edwards, K. J.
2009-12-01
The family of Marinobacter is one of the most ubiquitous in the ocean. Members of this genus are found throughout the water column, in the deep sea, and are often associated with hydrothermal plume particles and marine snow. They are known to degrade hydrocarbons and show some extremophilic lifestyles, such as pyschrophily, oligotrophy and halotolerance. This study has determined the genomic potential of one particular strain - Marinobacter aquaeolei VT8, which relies on a very large set of survival strategies. Isolated from an oil well in Southern Vietnam, M. aquaeolei was known to be a facultative anaerobe with the ability to utilize various carbon sources. Fitting with these observations, genome annotation has revealed: four variations of the TCA cycle, complete pathways of glycolysis and the degradation of more complex hydrocarbons (including octane oxidation and cyclohexanol degradation), alternative phosphorous and nitrogen sources, genes for the use of nitrate and sulfate as electron acceptors as well as complete pathways for sulfite oxidation, denitrification and iron oxidation. The versatility and interrelatedness of these metabolic potentials coin the opportunistic character of M. aquaeolei and help to more completely define the biogeochemical niche of the genus.
Kalyanaraman, Balaraman; Cheng, Gang; Hardy, Micael; Ouari, Olivier; Lopez, Marcos; Joseph, Joy; Zielonka, Jacek; Dwinell, Michael B
2018-04-01
The present review is a sequel to the previous review on cancer metabolism published in this journal. This review focuses on the selective antiproliferative and cytotoxic effects of mitochondria-targeted therapeutics (MTTs) in cancer cells. Emerging research reveals a key role of mitochondrial respiration on tumor proliferation. Previously, a mitochondria-targeted nitroxide was shown to selectively inhibit colon cancer cell proliferation at submicromolar levels. This review is centered on the therapeutic use of MTTs and their bioenergetic profiling in cancer cells. Triphenylphosphonium cation conjugated to a parent molecule (e.g., vitamin-E or chromanol, ubiquinone, and metformin) via a linker alkyl chain is considered an MTT. MTTs selectively and potently inhibit proliferation of cancer cells and, in some cases, induce cytotoxicity. MTTs inhibit mitochondrial complex I activity and induce mitochondrial stress in cancer cells through generation of reactive oxygen species. MTTs in combination with glycolytic inhibitors synergistically inhibit tumor cell proliferation. This review discusses how signaling molecules traditionally linked to tumor cell proliferation affect tumor metabolism and bioenergetics (glycolysis, TCA cycle, and glutaminolysis). Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Ibogaine affects brain energy metabolism.
Paskulin, Roman; Jamnik, Polona; Zivin, Marko; Raspor, Peter; Strukelj, Borut
2006-12-15
Ibogaine is an indole alkaloid present in the root of the plant Tabernanthe iboga. It is known to attenuate abstinence syndrome in animal models of drug addiction. Since the anti-addiction effect lasts longer than the presence of ibogaine in the body, some profound metabolic changes are expected. The aim of this study was to investigate the effect of ibogaine on protein expression in rat brains. Rats were treated with ibogaine at 20 mg/kg body weight i.p. and subsequently examined at 24 and 72 h. Proteins were extracted from whole brain and separated by two-dimensional (2-D) electrophoresis. Individual proteins were identified by matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS). Enzymes of glycolysis and tricarboxylic acid (TCA) cycle namely glyceraldehyde-3-phosphate dehydrogenase, aldolase A, pyruvate kinase and malate dehydrogenase were induced. The results suggest that the remedial effect of ibogaine could be mediated by the change in energy availability. Since energy dissipating detoxification and reversion of tolerance to different drugs of abuse requires underlying functional and structural changes in the cell, higher metabolic turnover would be favourable. Understanding the pharmacodynamics of anti-addiction drugs highlights the subcellular aspects of addiction diseases, in addition to neurological and psychological perspectives.
Sanchez, Erica L.; Carroll, Patrick A.; Thalhofer, Angel B.; Lagunoff, Michael
2015-01-01
Kaposi’s Sarcoma-associated Herpesvirus (KSHV) is the etiologic agent of Kaposi’s Sarcoma (KS). KSHV establishes a predominantly latent infection in the main KS tumor cell type, the spindle cell, which is of endothelial cell origin. KSHV requires the induction of multiple metabolic pathways, including glycolysis and fatty acid synthesis, for the survival of latently infected endothelial cells. Here we demonstrate that latent KSHV infection leads to increased levels of intracellular glutamine and enhanced glutamine uptake. Depletion of glutamine from the culture media leads to a significant increase in apoptotic cell death in latently infected endothelial cells, but not in their mock-infected counterparts. In cancer cells, glutamine is often required for glutaminolysis to provide intermediates for the tri-carboxylic acid (TCA) cycle and support for the production of biosynthetic and bioenergetic precursors. In the absence of glutamine, the TCA cycle intermediates alpha-ketoglutarate (αKG) and pyruvate prevent the death of latently infected cells. Targeted drug inhibition of glutaminolysis also induces increased cell death in latently infected cells. KSHV infection of endothelial cells induces protein expression of the glutamine transporter, SLC1A5. Chemical inhibition of SLC1A5, or knockdown by siRNA, leads to similar cell death rates as glutamine deprivation and, similarly, can be rescued by αKG. KSHV also induces expression of the heterodimeric transcription factors c-Myc-Max and related heterodimer MondoA-Mlx. Knockdown of MondoA inhibits expression of both Mlx and SLC1A5 and induces a significant increase in cell death of only cells latently infected with KSHV, again, fully rescued by the supplementation of αKG. Therefore, during latent infection of endothelial cells, KSHV activates and requires the Myc/MondoA-network to upregulate the glutamine transporter, SLC1A5, leading to increased glutamine uptake for glutaminolysis. These findings expand our understanding of the required metabolic pathways that are activated during latent KSHV infection of endothelial cells, and demonstrate a novel role for the extended Myc-regulatory network, specifically MondoA, during latent KSHV infection. PMID:26197457
Springsteen, Greg; Yerabolu, Jayasudhan Reddy; Nelson, Julia; Rhea, Chandler Joel; Krishnamurthy, Ramanarayanan
2018-01-08
The development of metabolic approaches towards understanding the origins of life, which have focused mainly on the citric acid (TCA) cycle, have languished-primarily due to a lack of experimentally demonstrable and sustainable cycle(s) of reactions. We show here the existence of a protometabolic analog of the TCA involving two linked cycles, which convert glyoxylate into CO 2 and produce aspartic acid in the presence of ammonia. The reactions proceed from either pyruvate, oxaloacetate or malonate in the presence of glyoxylate as the carbon source and hydrogen peroxide as the oxidant under neutral aqueous conditions and at mild temperatures. The reaction pathway demonstrates turnover under controlled conditions. These results indicate that simpler versions of metabolic cycles could have emerged under potential prebiotic conditions, laying the foundation for the appearance of more sophisticated metabolic pathways once control by (polymeric) catalysts became available.
Davuluri, Gangarao; Allawy, Allawy; Thapaliya, Samjhana; Rennison, Julie H.; Singh, Dharmvir; Kumar, Avinash; Sandlers, Yana; Van Wagoner, David R.; Flask, Chris A.; Hoppel, Charles; Kasumov, Takhar
2016-01-01
Key points Hyperammonaemia occurs in hepatic, cardiac and pulmonary diseases with increased muscle concentration of ammonia.We found that ammonia results in reduced skeletal muscle mitochondrial respiration, electron transport chain complex I dysfunction, as well as lower NAD+/NADH ratio and ATP content.During hyperammonaemia, leak of electrons from complex III results in oxidative modification of proteins and lipids.Tricarboxylic acid cycle intermediates are decreased during hyperammonaemia, and providing a cell‐permeable ester of αKG reversed the lower TCA cycle intermediate concentrations and increased ATP content.Our observations have high clinical relevance given the potential for novel approaches to reverse skeletal muscle ammonia toxicity by targeting the TCA cycle intermediates and mitochondrial ROS. Abstract Ammonia is a cytotoxic metabolite that is removed primarily by hepatic ureagenesis in humans. Hyperammonaemia occurs in advanced hepatic, cardiac and pulmonary disease, and in urea cycle enzyme deficiencies. Increased skeletal muscle ammonia uptake and metabolism are the major mechanism of non‐hepatic ammonia disposal. Non‐hepatic ammonia disposal occurs in the mitochondria via glutamate synthesis from α‐ketoglutarate resulting in cataplerosis. We show skeletal muscle mitochondrial dysfunction during hyperammonaemia in a comprehensive array of human, rodent and cellular models. ATP synthesis, oxygen consumption, generation of reactive oxygen species with oxidative stress, and tricarboxylic acid (TCA) cycle intermediates were quantified. ATP content was lower in the skeletal muscle from cirrhotic patients, hyperammonaemic portacaval anastomosis rat, and C2C12 myotubes compared to appropriate controls. Hyperammonaemia in C2C12 myotubes resulted in impaired intact cell respiration, reduced complex I/NADH oxidase activity and electron leak occurring at complex III of the electron transport chain. Consistently, lower NAD+/NADH ratio was observed during hyperammonaemia with reduced TCA cycle intermediates compared to controls. Generation of reactive oxygen species resulted in increased content of skeletal muscle carbonylated proteins and thiobarbituric acid reactive substances during hyperammonaemia. A cell‐permeable ester of α‐ketoglutarate reversed the low TCA cycle intermediates and ATP content in myotubes during hyperammonaemia. However, the mitochondrial antioxidant MitoTEMPO did not reverse the lower ATP content during hyperammonaemia. We provide for the first time evidence that skeletal muscle hyperammonaemia results in mitochondrial dysfunction and oxidative stress. Use of anaplerotic substrates to reverse ammonia‐induced mitochondrial dysfunction is a novel therapeutic approach. PMID:27558544
Hinder, Lucy M; Vivekanandan-Giri, Anuradha; McLean, Lisa L; Pennathur, Subramaniam; Feldman, Eva L
2013-01-01
Diabetic neuropathy (DN) is the most common complication of diabetes and is characterized by distal-to-proximal loss of peripheral nerve axons. The idea of tissue-specific pathological alterations in energy metabolism in diabetic complications-prone tissues is emerging. Altered nerve metabolism in type 1 diabetes models is observed; however, therapeutic strategies based on these models offer limited efficacy to type 2 diabetic patients with DN. Therefore, understanding how peripheral nerves metabolically adapt to the unique type 2 diabetic environment is critical to develop disease-modifying treatments. In the current study, we utilized targeted liquid chromatography-tandem mass spectrometry (LC/MS/MS) to characterize the glycolytic and tricarboxylic acid (TCA) cycle metabolomes in sural nerve, sciatic nerve, and dorsal root ganglia (DRG) from male type 2 diabetic mice (BKS.Cg-m+/+Lepr(db); db/db) and controls (db/+). We report depletion of glycolytic intermediates in diabetic sural nerve and sciatic nerve (glucose-6-phosphate, fructose-6-phosphate, fructose-1,6-bisphosphate (sural nerve only), 3-phosphoglycerate, 2-phosphoglycerate, phosphoenolpyruvate, and lactate), with no significant changes in DRG. Citrate and isocitrate TCA cycle intermediates were decreased in sural nerve, sciatic nerve, and DRG from diabetic mice. Utilizing LC/electrospray ionization/MS/MS and HPLC methods, we also observed increased protein and lipid oxidation (nitrotyrosine; hydroxyoctadecadienoic acids) in db/db tissue, with a proximal-to-distal increase in oxidative stress, with associated decreased aconitase enzyme activity. We propose a preliminary model, whereby the greater change in metabolomic profile, increase in oxidative stress, and decrease in TCA cycle enzyme activity may cause distal peripheral nerves to rely on truncated TCA cycle metabolism in the type 2 diabetes environment.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wan, Ni; DeLorenzo, Drew M.; He, Lian
Synechocystis sp. strain PCC 6803 has been widely used as a photo-biorefinery chassis. Based on its genome annotation, this species contains a complete TCA cycle, an Embden-Meyerhof-Parnas pathway (EMPP), an oxidative pentose phosphate pathway (OPPP), and an Entner–Doudoroff pathway (EDP). To evaluate how Synechocystis 6803 catabolizes glucose under heterotrophic conditions, we performed 13C metabolic flux analysis, metabolite pool size analysis, gene knockouts, and heterologous expressions. The results revealed a cyclic mode of flux through the OPPP. Small, but non-zero, fluxes were observed through the TCA cycle and the malic shunt. Independent knockouts of 6-phosphogluconate dehydrogenase (gnd) and malic enzyme (me)more » corroborated these results, as neither mutant could grow under dark heterotrophic conditions. Our data also indicate that Synechocystis 6803 metabolism relies upon oxidative phosphorylation to generate ATP from NADPH under dark or insufficient light conditions. The pool sizes of intermediates in the TCA cycle, particularly acetyl-CoA, were found to be several fold lower in Synechocystis 6803 (compared to E. coli metabolite pool sizes), while its sugar phosphate intermediates were several-fold higher. Moreover, negligible flux was detected through the native, or heterologous, EDP in the wild type or Δgnd strains under heterotrophic conditions. Comparing photoautotrophic, photomixotrophic, and heterotrophic conditions, the Calvin cycle, OPPP, and EMPP in Synechocystis 6803 possess the ability to regulate their fluxes under various growth conditions (plastic), whereas its TCA cycle always maintains at low levels (rigid). This work also demonstrates how genetic profiles do not always reflect actual metabolic flux through native or heterologous pathways. Biotechnol. Bioeng. 2017;114: 1593–1602. © 2017 Wiley Periodicals, Inc.« less
USDA-ARS?s Scientific Manuscript database
The compositions of bovine and murine milk differ significantly with respect to the proportions of lactose, protein, and fat. To better understand the metabolic origins of this difference, we interrogated the crossroads of glycolysis and the Krebs cycle in the mammary gland of cows and mice using a ...
NASA Astrophysics Data System (ADS)
Lin, Jyun-Hao; Huang, Shyh-Jer; Su, Yan-Kuin
2014-01-01
A simple thermal cycle annealing (TCA) process was used to improve the quality of GaN grown on a Si substrate. The X-ray diffraction (XRD) and etch pit density (EPD) results revealed that using more process cycles, the defect density cannot be further reduced. However, the performance of GaN-based metal-semiconductor-metal (MSM) photodiodes (PDs) prepared on Si substrates showed significant improvement. With a two-cycle TCA process, it is found that the dark current of the device was only 1.46 × 10-11 A, and the photo-to-dark-current contrast ratio was about 1.33 × 105 at 5 V. Also, the UV/visible rejection ratios can reach as high as 1077.
Zhao, Yunxia; Hou, Ye; Zhao, Changzhi; Liu, Fei; Luan, Yu; Jing, Lu; Li, Xinyun; Zhu, Mengjin; Zhao, Shuhong
2016-01-01
Cis-natural antisense transcripts (cis-NATs) are a new class of RNAs identified in various species. However, the biological functions of cis-NATs are largely unknown. In this study, we investigated the transcriptional characteristics and functions of cis-NATs in the muscle tissue of lean Landrace and indigenous fatty Lantang pigs. In total, 3,306 cis-NATs of 2,469 annotated genes were identified in the muscle tissue of pigs. More than 1,300 cis-NATs correlated with their sense genes at the transcriptional level, and approximately 80% of them were co-expressed in the two breeds. Furthermore, over 1,200 differentially expressed cis-NATs were identified during muscle development. Function annotation showed that the cis-NATs participated in muscle development mainly by co-expressing with genes involved in energy metabolic pathways, including citrate cycle (TCA cycle), glycolysis or gluconeogenesis, mitochondrial activation and so on. Moreover, these cis-NATs and their sense genes abruptly increased at the transition from the late fetal stages to the early postnatal stages and then decreased along with muscle development. In conclusion, the cis-NATs in the muscle tissue of pigs were identified and determined to be mainly co-expressed with their sense genes. The co-expressed cis-NATs and their sense gene were primarily related to energy metabolic pathways during muscle development in pigs. Our results offered novel evidence on the roles of cis-NATs during the muscle development of pigs.
Bekele, Elias A; Beshir, Wasiye F; Hertog, Maarten L A T M; Nicolai, Bart M; Geeraerd, Annemie H
2015-11-01
Apples are predominantly stored in controlled atmosphere (CA) storage to delay ripening and prolong their storage life. Profiling the dynamics of metabolic changes during ripening and CA storage is vital for understanding the governing molecular mechanism. In this study, the dynamics of the primary metabolism of 'Jonagold' apples during ripening in regular air (RA) storage and initiation of CA storage was profiled. 1-Methylcyclopropene (1-MCP) was exploited to block ethylene receptors and to get insight into ethylene mediated metabolic changes during ripening of the fruit and in response to hypoxic stress. Metabolic changes were quantified in glycolysis, the tricarboxylic acid (TCA) cycle, the Yang cycle and synthesis of the main amino acids branching from these metabolic pathways. Partial least square discriminant analysis of the metabolic profiles of 1-MCP treated and control apples revealed a metabolic divergence in ethylene, organic acid, sugar and amino acid metabolism. During RA storage at 18°C, most amino acids were higher in 1-MCP treated apples, whereas 1-aminocyclopropane-1-carboxylic acid (ACC) was higher in the control apples. The initial response of the fruit to CA initiation was accompanied by an increase of alanine, succinate and glutamate, but a decline in aspartate. Furthermore, alanine and succinate accumulated to higher levels in control apples than 1-MCP treated apples. The observed metabolic changes in these interlinked metabolites may indicate a coordinated adaptive strategy to maximize energy production. © 2015 Scandinavian Plant Physiology Society.
Chen, Liwei; Lee, Jaslyn Jie Lin; Zhang, Jianhua; Chen, Wei Ning
2016-02-01
The engineered Saccharomyces cerevisiae strain △faa1△faa4 [Acot5s] was demonstrated to accumulate more free fatty acids (FFA) previously. Here, comparative proteomic analysis was performed to get a global overview of metabolic regulation in the strain. Over 500 proteins were identified, and 82 of those proteins were found to change significantly in the engineered strains. Proteins involved in glycolysis, acetate metabolism, fatty acid synthesis, TCA cycle, glyoxylate cycle, the pentose phosphate pathway, respiration, transportation, and stress response were found to be upregulated in △faa1△faa4 [Acot5s] as compared to the wild type. On the other hand, proteins involved in glycerol, ethanol, ergosterol, and cell wall synthesis were downregulated. Taken together with our metabolite analysis, our results showed that the disruption of Faa1 and Faa4 and expression of Acot5s in the engineered strain △faa1△faa4 [Acot5s] not only relieved the feedback inhibition of fatty acyl-CoAs on fatty acid synthesis, but also caused a major metabolic rearrangement. The rearrangement redirected carbon flux toward the pathways which generate the essential substrates and cofactors for fatty acid synthesis, such as acetyl-CoA, ATP, and NADPH. Therefore, our results help shed light on the mechanism for the increased production of fatty acids in the engineered strains, which is useful in providing information for future studies in biofuel production.
Shao, Yaping; Ye, Guozhu; Ren, Shancheng; Piao, Hai-Long; Zhao, Xinjie; Lu, Xin; Wang, Fubo; Ma, Wang; Li, Jia; Yin, Peiyuan; Xia, Tian; Xu, Chuanliang; Yu, Jane J; Sun, Yinghao; Xu, Guowang
2018-07-15
Genetic alterations drive metabolic reprograming to meet increased biosynthetic precursor and energy demands for cancer cell proliferation and survival in unfavorable environments. A systematic study of gene-metabolite regulatory networks and metabolic dysregulation should reveal the molecular mechanisms underlying prostate cancer (PCa) pathogenesis. Herein, we performed gas chromatography-mass spectrometry (GC-MS)-based metabolomics and RNA-seq analyses in prostate tumors and matched adjacent normal tissues (ANTs) to elucidate the molecular alterations and potential underlying regulatory mechanisms in PCa. Significant accumulation of metabolic intermediates and enrichment of genes in the tricarboxylic acid (TCA) cycle were observed in tumor tissues, indicating TCA cycle hyperactivation in PCa tissues. In addition, the levels of fumarate and malate were highly correlated with the Gleason score, tumor stage and expression of genes encoding related enzymes and were significantly related to the expression of genes involved in branched chain amino acid degradation. Using an integrated omics approach, we further revealed the potential anaplerotic routes from pyruvate, glutamine catabolism and branched chain amino acid (BCAA) degradation contributing to replenishing metabolites for TCA cycle. Integrated omics techniques enable the performance of network-based analyses to gain a comprehensive and in-depth understanding of PCa pathophysiology and may facilitate the development of new and effective therapeutic strategies. © 2018 UICC.
Bao, Yan; Mukai, Kuniaki; Hishiki, Takako; Kubo, Akiko; Ohmura, Mitsuyo; Sugiura, Yuki; Matsuura, Tomomi; Nagahata, Yoshiko; Hayakawa, Noriyo; Yamamoto, Takehiro; Fukuda, Ryo; Saya, Hideyuki; Suematsu, Makoto; Minamishima, Yoji Andrew
2013-09-01
Activation of aerobic glycolysis in cancer cells is well known as the Warburg effect, although its relation to cell- cycle progression remains unknown. In this study, human colon cancer cells were labeled with a cell-cycle phase-dependent fluorescent marker Fucci to distinguish cells in G1-phase and those in S + G2/M phases. Fucci-labeled cells served as splenic xenograft transplants in super-immunodeficient NOG mice and exhibited multiple metastases in the livers, frozen sections of which were analyzed by semiquantitative microscopic imaging mass spectrometry. Results showed that cells in G1-phase exhibited higher concentrations of ATP, NADH, and UDP-N-acetylglucosamine than those in S and G2-M phases, suggesting accelerated glycolysis in G1-phase cells in vivo. Quantitative determination of metabolites in cells synchronized in S, G2-M, and G1 phases suggested that efflux of lactate was elevated significantly in G1-phase. By contrast, ATP production in G2-M was highly dependent on mitochondrial respiration, whereas cells in S-phase mostly exhibited an intermediary energy metabolism between G1 and G2-M phases. Isogenic cells carrying a p53-null mutation appeared more active in glycolysis throughout the cell cycle than wild-type cells. Thus, as the cell cycle progressed from G2-M to G1 phases, the dependency of energy production on glycolysis was increased while the mitochondrial energy production was reciprocally decreased. These results shed light on distinct features of the phase-specific phenotypes of metabolic systems in cancer cells. ©2013 AACR.
Lamp, Jessica; Keyser, Britta; Koeller, David M; Ullrich, Kurt; Braulke, Thomas; Mühlhausen, Chris
2011-05-20
The inherited neurodegenerative disorder glutaric aciduria type 1 (GA1) results from mutations in the gene for the mitochondrial matrix enzyme glutaryl-CoA dehydrogenase (GCDH), which leads to elevations of the dicarboxylates glutaric acid (GA) and 3-hydroxyglutaric acid (3OHGA) in brain and blood. The characteristic clinical presentation of GA1 is a sudden onset of dystonia during catabolic situations, resulting from acute striatal injury. The underlying mechanisms are poorly understood, but the high levels of GA and 3OHGA that accumulate during catabolic illnesses are believed to play a primary role. Both GA and 3OHGA are known to be substrates for Na(+)-coupled dicarboxylate transporters, which are required for the anaplerotic transfer of the tricarboxylic acid cycle (TCA) intermediate succinate between astrocytes and neurons. We hypothesized that GA and 3OHGA inhibit the transfer of succinate from astrocytes to neurons, leading to reduced TCA cycle activity and cellular injury. Here, we show that both GA and 3OHGA inhibit the uptake of [(14)C]succinate by Na(+)-coupled dicarboxylate transporters in cultured astrocytic and neuronal cells of wild-type and Gcdh(-/-) mice. In addition, we demonstrate that the efflux of [(14)C]succinate from Gcdh(-/-) astrocytic cells mediated by a not yet identified transporter is strongly reduced. This is the first experimental evidence that GA and 3OHGA interfere with two essential anaplerotic transport processes: astrocytic efflux and neuronal uptake of TCA cycle intermediates, which occur between neurons and astrocytes. These results suggest that elevated levels of GA and 3OHGA may lead to neuronal injury and cell death via disruption of TCA cycle activity. © 2011 by The American Society for Biochemistry and Molecular Biology, Inc.
Temporal fluxomics reveals oscillations in TCA cycle flux throughout the mammalian cell cycle.
Ahn, Eunyong; Kumar, Praveen; Mukha, Dzmitry; Tzur, Amit; Shlomi, Tomer
2017-11-06
Cellular metabolic demands change throughout the cell cycle. Nevertheless, a characterization of how metabolic fluxes adapt to the changing demands throughout the cell cycle is lacking. Here, we developed a temporal-fluxomics approach to derive a comprehensive and quantitative view of alterations in metabolic fluxes throughout the mammalian cell cycle. This is achieved by combining pulse-chase LC-MS-based isotope tracing in synchronized cell populations with computational deconvolution and metabolic flux modeling. We find that TCA cycle fluxes are rewired as cells progress through the cell cycle with complementary oscillations of glucose versus glutamine-derived fluxes: Oxidation of glucose-derived flux peaks in late G1 phase, while oxidative and reductive glutamine metabolism dominates S phase. These complementary flux oscillations maintain a constant production rate of reducing equivalents and oxidative phosphorylation flux throughout the cell cycle. The shift from glucose to glutamine oxidation in S phase plays an important role in cell cycle progression and cell proliferation. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.
Kanetsuna, Fuminori; Carbonell, Luis M.
1966-01-01
Kanetsuna, Fuminori (Instituto Venezolano de Investigaciones Cientificas, Caracas, Venezuela), and Luis M. Carbonell. Enzymes in glycolysis and the citric acid cycle in the yeast and mycelial forms of Paracoccidioides brasiliensis. J. Bacteriol. 92:1315–1320. 1966.—Enzymatic activities in glycolysis, the hexose monophosphate shunt, and the citric acid cycle in cell-free extracts of the yeast and mycelial forms of Paracoccidioides brasiliensis were examined comparatively. Both forms have the enzymes of these pathways. Activities of glucose-6-phosphate dehydrogenase and malic dehydrogenase of the mycelial form were higher than those of the yeast form. Another 15 enzymatic activities of the mycelial form were lower than those of the yeast form. The activity of glyceraldehyde-3-phosphate dehydrogenase showed the most marked difference between the two forms, its activity in the mycelial form being about 20% of that in the yeast form. PMID:5924267
Metabolic Responses of Poplar to Apripona germari (Hope) as Revealed by Metabolite Profiling
Wang, Lijuan; Qu, Liangjian; Zhang, Liwei; Hu, Jianjun; Tang, Fang; Lu, Mengzhu
2016-01-01
Plants have developed biochemical responses to adapt to biotic stress. To characterize the resistance mechanisms in poplar tree against Apripona germari, comprehensive metabolomic changes of poplar bark and xylem in response to A. germari infection were examined by gas chromatography time-of-flight mass spectrometry (GC–TOF/MS). It was found that, four days after feeding (stage I), A. germari infection brought about changes in various metabolites, such as phenolics, amino acids and sugars in both bark and xylem. Quinic acid, epicatechin, epigallocatechin and salicin might play a role in resistance response in bark, while coniferyl alcohol, ferulic acid and salicin contribute resistance in xylem. At feeding stages II when the larvae fed for more than one month, fewer defensive metabolites were induced, but levels of many intermediates of glycolysis and the tricarboxylic acid (TCA) cycle were reduced, especially in xylem. These results suggested that the defense strategies against A. germari might depend mainly on the early defense responses in poplar. In addition, it was found that bark and xylem in infected trees accumulated higher levels of salicylic acid and 4-aminobutyric acid, respectively, these tissues displaying a direct and systemic reaction against A. germari. However, the actual role of the two metabolites in A. germari-induced defense in poplar requires further investigation. PMID:27331808
Effects of continuous hypoxia on energy metabolism in cultured cerebro-cortical neurons.
Malthankar-Phatak, Gauri H; Patel, Anant B; Xia, Ying; Hong, Soonsun; Chowdhury, Golam M I; Behar, Kevin L; Orina, Isaac A; Lai, James C K
2008-09-10
Mechanisms underlying hypoxia-induced neuronal adaptation have not been fully elucidated. In the present study we investigated glucose metabolism and the activities of glycolytic and TCA cycle enzymes in cerebro-cortical neurons exposed to hypoxia (3 days in 1% of O2) or normoxia (room air). Hypoxia led to increased activities of LDH (194%), PK (90%), and HK (24%) and decreased activities of CS (15%) and GDH (34%). Neurons were incubated with [1-(13)C]glucose for 45 and 120 min under normoxic or hypoxic (120 min only) conditions and 13C enrichment determined in the medium and cell extract using 1H-{13C}-NMR. In hypoxia-treated neurons [3-(13)C]lactate release into the medium was 428% greater than in normoxia-treated controls (45-min normoxic incubation) and total flux through lactate was increased by 425%. In contrast glucose oxidation was reduced significantly in hypoxia-treated neurons, even when expressed relative to total cellular protein, which correlated with the reduced activities of the measured mitochondrial enzymes. The results suggest that surviving neurons adapt to prolonged hypoxia by up-regulation of glycolysis and down-regulation of oxidative energy metabolism, similar to certain other cell types. The factors leading to adaptation and survival for some neurons but not others remain to be determined.
Oliveros, Alfredo; Starski, Phillip; Lindberg, Daniel; Choi, Sun; Heppelmann, Carrie J; Dasari, Surendra; Choi, Doo-Sup
2017-04-07
The neural circuit of the dorsal hippocampus (dHip) and nucleus accumbens (NAc) contributes to cue-induced learning and addictive behaviors, as demonstrated by the escalation of ethanol-seeking behaviors observed following deletion of the adenosine equilibrative nucleoside transporter 1 (ENT1 -/- ) in mice. Here we perform quantitative LC-MS/MS neuroproteomics in the dHip and NAc of ENT1 -/- mice. Using Ingenuity Pathway Analysis, we identified proteins associated with increased long-term potentiation, ARP2/3-mediated actin cytoskeleton signaling and protein expression patterns suggesting deficits in glutamate degradation, GABAergic signaling, as well as significant changes in bioenergetics and energy homeostasis (oxidative phosphorylation, TCA cycle, and glycolysis). These pathways are consistent with previously reported behavioral and biochemical phenotypes that typify mice lacking ENT1. Moreover, we validated decreased expression of the SNARE complex protein VAMP1 (synaptobrevin-1) in the dHip as well as decreased expression of pro-dynorphin (PDYN), neuroendocrine convertase (PCSK1), and Leu-Enkephalin (dynorphin-A) in the NAc. Taken together, our proteomic approach provides novel pathways indicating that ENT1-regulated signaling is essential for neurotransmitter release and neuropeptide processing, both of which underlie learning and reward-seeking behaviors.
Developmental Changes for the Hemolymph Metabolome of Silkworm (Bombyx moriL.)
Zhou, Lihong; Li, Huihui; Hao, Fuhua; Li, Ning; Liu, Xin; Wang, Guoliang; Wang, Yulan; Tang, Huiru
2015-01-01
Silkworm (Bombyx mori) is a lepidopteran-holometabolic model organism. To understand its developmental biochemistry, we characterized the larval hemolymph metabonome from the third instar to prepupa stage using 1H NMR spectroscopy whilst hemolymph fatty acid composition using GC-FID/MS. We unambiguously assigned more than 60 metabolites, among which tyrosine-o-β-glucuronide, mesaconate, homocarnosine, and picolinate were reported for the first time from the silkworm hemolymph. Phosphorylcholine was the most abundant metabolite in all developmental stages with exception for the periods before the third and fourth molting. We also found obvious developmental dependence for the hemolymph metabonome involving multiple pathways including protein biosyntheses, glycolysis, TCA cycle, the metabolisms of choline amino acids, fatty acids, purines, and pyrimidines. Most hemolymph amino acids had two elevations during the feeding period of the fourth instar and prepupa stage. Trehalose was the major blood sugar before day 8 of the fifth instar, whereas glucose became the major blood sugar after spinning. C16:0, C18:0 and its unsaturated forms were dominant fatty acids in hemolymph. The developmental changes of hemolymph metabonome were associated with dietary nutrient intakes, biosyntheses of cell membrane, pigments, proteins, and energy metabolism. These findings offered essential biochemistry information in terms of the dynamic metabolic changes during silkworm development. PMID:25825269
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schwender, Jorg; Konig, Christina; Klapperstuck, Matthias
An attempt has been made to define the extent to which metabolic flux in central plant metabolism is reflected by changes in the transcriptome and metabolome, based on an analysis of in vitro cultured immature embryos of two oilseed rape (Brassica napus) accessions which contrast for seed lipid accumulation. Metabolic flux analysis (MFA) was used to constrain a flux balance metabolic model which included 671 biochemical and transport reactions within the central metabolism. This highly confident flux information was eventually used for comparative analysis of flux vs. transcript (metabolite). Metabolite profiling succeeded in identifying 79 intermediates within the central metabolism,more » some of which differed quantitatively between the two accessions and displayed a significant shift corresponding to flux. An RNA-Seq based transcriptome analysis revealed a large number of genes which were differentially transcribed in the two accessions, including some enzymes/proteins active in major metabolic pathways. With a few exceptions, differential activity in the major pathways (glycolysis, TCA cycle, amino acid, and fatty acid synthesis) was not reflected in contrasting abundances of the relevant transcripts. The conclusion was that transcript abundance on its own cannot be used to infer metabolic activity/fluxes in central plant metabolism. Lastly, this limitation needs to be borne in mind in evaluating transcriptome data and designing metabolic engineering experiments.« less
Expression Comparison of Oil Biosynthesis Genes in Oil Palm Mesocarp Tissue Using Custom Array
Wong, Yick Ching; Kwong, Qi Bin; Lee, Heng Leng; Ong, Chuang Kee; Mayes, Sean; Chew, Fook Tim; Appleton, David R.; Kulaveerasingam, Harikrishna
2014-01-01
Gene expression changes that occur during mesocarp development are a major research focus in oil palm research due to the economic importance of this tissue and the relatively rapid increase in lipid content to very high levels at fruit ripeness. Here, we report the development of a transcriptome-based 105,000-probe oil palm mesocarp microarray. The expression of genes involved in fatty acid (FA) and triacylglycerol (TAG) assembly, along with the tricarboxylic acid cycle (TCA) and glycolysis pathway at 16 Weeks After Anthesis (WAA) exhibited significantly higher signals compared to those obtained from a cross-species hybridization to the Arabidopsis (p-value < 0.01), and rice (p-value < 0.01) arrays. The oil palm microarray data also showed comparable correlation of expression (r2 = 0.569, p < 0.01) throughout mesocarp development to transcriptome (RNA sequencing) data, and improved correlation over quantitative real-time PCR (qPCR) (r2 = 0.721, p < 0.01) of the same RNA samples. The results confirm the advantage of the custom microarray over commercially available arrays derived from model species. We demonstrate the utility of this custom microarray to gain a better understanding of gene expression patterns in the oil palm mesocarp that may lead to increasing future oil yield. PMID:27600348
Expression Comparison of Oil Biosynthesis Genes in Oil Palm Mesocarp Tissue Using Custom Array.
Wong, Yick Ching; Kwong, Qi Bin; Lee, Heng Leng; Ong, Chuang Kee; Mayes, Sean; Chew, Fook Tim; Appleton, David R; Kulaveerasingam, Harikrishna
2014-11-13
Gene expression changes that occur during mesocarp development are a major research focus in oil palm research due to the economic importance of this tissue and the relatively rapid increase in lipid content to very high levels at fruit ripeness. Here, we report the development of a transcriptome-based 105,000-probe oil palm mesocarp microarray. The expression of genes involved in fatty acid (FA) and triacylglycerol (TAG) assembly, along with the tricarboxylic acid cycle (TCA) and glycolysis pathway at 16 Weeks After Anthesis (WAA) exhibited significantly higher signals compared to those obtained from a cross-species hybridization to the Arabidopsis (p-value < 0.01), and rice (p-value < 0.01) arrays. The oil palm microarray data also showed comparable correlation of expression (r² = 0.569, p < 0.01) throughout mesocarp development to transcriptome (RNA sequencing) data, and improved correlation over quantitative real-time PCR (qPCR) (r² = 0.721, p < 0.01) of the same RNA samples. The results confirm the advantage of the custom microarray over commercially available arrays derived from model species. We demonstrate the utility of this custom microarray to gain a better understanding of gene expression patterns in the oil palm mesocarp that may lead to increasing future oil yield.
Reprogramming of Seed Metabolism Facilitates Pre-harvest Sprouting Resistance of Wheat.
Liu, Caixiang; Ding, Feng; Hao, Fuhua; Yu, Men; Lei, Hehua; Wu, Xiangyu; Zhao, Zhengxi; Guo, Hongxiang; Yin, Jun; Wang, Yulan; Tang, Huiru
2016-02-10
Pre-harvest sprouting (PHS) is a worldwide problem for wheat production and transgene antisense-thioredoxin-s (anti-trx-s) facilitates outstanding resistance. To understand the molecular details of PHS resistance, we analyzed the metabonomes of the transgenic and wild-type (control) wheat seeds at various stages using NMR and GC-FID/MS. 60 metabolites were dominant in these seeds including sugars, organic acids, amino acids, choline metabolites and fatty acids. At day-20 post-anthesis, only malate level in transgenic wheat differed significantly from that in controls whereas at day-30 post-anthesis, levels of amino acids and sucrose were significantly different between these two groups. For mature seeds, most metabolites in glycolysis, TCA cycle, choline metabolism, biosynthesis of proteins, nucleotides and fatty acids had significantly lower levels in transgenic seeds than in controls. After 30-days post-harvest ripening, most metabolites in transgenic seeds had higher levels than in controls including amino acids, sugars, organic acids, fatty acids, choline metabolites and NAD(+). These indicated that anti-trx-s lowered overall metabolic activities of mature seeds eliminating pre-harvest sprouting potential. Post-harvest ripening reactivated the metabolic activities of transgenic seeds to restore their germination vigor. These findings provided essential molecular phenomic information for PHS resistance of anti-trx-s and a credible strategy for future developing PHS resistant crops.
Metaproteomics Provides Functional Insight into Activated Sludge Wastewater Treatment
Wilmes, Paul; Wexler, Margaret; Bond, Philip L.
2008-01-01
Background Through identification of highly expressed proteins from a mixed culture activated sludge system this study provides functional evidence of microbial transformations important for enhanced biological phosphorus removal (EBPR). Methodology/Principal Findings A laboratory-scale sequencing batch reactor was successfully operated for different levels of EBPR, removing around 25, 40 and 55 mg/l P. The microbial communities were dominated by the uncultured polyphosphate-accumulating organism “Candidatus Accumulibacter phosphatis”. When EBPR failed, the sludge was dominated by tetrad-forming α-Proteobacteria. Representative and reproducible 2D gel protein separations were obtained for all sludge samples. 638 protein spots were matched across gels generated from the phosphate removing sludges. 111 of these were excised and 46 proteins were identified using recently available sludge metagenomic sequences. Many of these closely match proteins from “Candidatus Accumulibacter phosphatis” and could be directly linked to the EBPR process. They included enzymes involved in energy generation, polyhydroxyalkanoate synthesis, glycolysis, gluconeogenesis, glycogen synthesis, glyoxylate/TCA cycle, fatty acid β oxidation, fatty acid synthesis and phosphate transport. Several proteins involved in cellular stress response were detected. Conclusions/Significance Importantly, this study provides direct evidence linking the metabolic activities of “Accumulibacter” to the chemical transformations observed in EBPR. Finally, the results are discussed in relation to current EBPR metabolic models. PMID:18392150
Salanova, Michele; Gambara, Guido; Moriggi, Manuela; Vasso, Michele; Ungethuem, Ute; Belavý, Daniel L; Felsenberg, Dieter; Cerretelli, Paolo; Gelfi, Cecilia; Blottner, Dieter
2015-11-24
Disuse-induced muscle atrophy is a major concern in aging, in neuromuscular diseases, post-traumatic injury and in microgravity life sciences affecting health and fitness also of crew members in spaceflight. By using a laboratory analogue to body unloading we perform for the first time global gene expression profiling joined to specific proteomic analysis to map molecular adaptations in disused (60 days of bed rest) human soleus muscle (CTR) and in response to a resistive exercise (RE) countermeasure protocol without and with superimposed vibration mechanosignals (RVE). Adopting Affymetrix GeneChip technology we identified 235 differently transcribed genes in the CTR group (end- vs. pre-bed rest). RE comprised 206 differentially expressed genes, whereas only 51 changed gene transcripts were found in RVE. Most gene transcription and proteomic changes were linked to various key metabolic pathways (glycolysis, oxidative phosphorylation, tricarboxylic acid (TCA) cycle, lipid metabolism) and to functional contractile structures. Gene expression profiling in bed rest identified a novel set of genes explicitly responsive to vibration mechanosignals in human soleus. This new finding highlights the efficacy of RVE protocol in reducing key signs of disuse maladaptation and atrophy, and to maintain a close-to-normal skeletal muscle quality outcome following chronic disuse in bed rest.
Moroz, Tracy; Banaji, Murad; Robertson, Nicola J; Cooper, Chris E; Tachtsidis, Ilias
2012-07-07
We describe a computational model to simulate measurements from near-infrared spectroscopy (NIRS) and magnetic resonance spectroscopy (MRS) in the piglet brain. Piglets are often subjected to anoxic, hypoxic and ischaemic insults, as experimental models for human neonates. The model aims to help interpret measurements and increase understanding of physiological processes occurring during such insults. It is an extension of a previous model of circulation and mitochondrial metabolism. This was developed to predict NIRS measurements in the brains of healthy adults i.e. concentration changes of oxyhaemoglobin and deoxyhaemoglobin and redox state changes of cytochrome c oxidase (CCO). We altered and enhanced the model to apply to the anaesthetized piglet brain. It now includes metabolites measured by (31)P-MRS, namely phosphocreatine, inorganic phosphate and adenosine triphosphate (ATP). It also includes simple descriptions of glycolysis, lactate dynamics and the tricarboxylic acid (TCA) cycle. The model is described, and its simulations compared with existing measurements from piglets during anoxia. The NIRS and MRS measurements are predicted well, although this requires a reduction in blood pressure autoregulation. Predictions of the cerebral metabolic rate of oxygen consumption (CMRO(2)) and lactate concentration, which were not measured, are given. Finally, the model is used to investigate hypotheses regarding changes in CCO redox state during anoxia.
Reprogramming of Seed Metabolism Facilitates Pre-harvest Sprouting Resistance of Wheat
NASA Astrophysics Data System (ADS)
Liu, Caixiang; Ding, Feng; Hao, Fuhua; Yu, Men; Lei, Hehua; Wu, Xiangyu; Zhao, Zhengxi; Guo, Hongxiang; Yin, Jun; Wang, Yulan; Tang, Huiru
2016-02-01
Pre-harvest sprouting (PHS) is a worldwide problem for wheat production and transgene antisense-thioredoxin-s (anti-trx-s) facilitates outstanding resistance. To understand the molecular details of PHS resistance, we analyzed the metabonomes of the transgenic and wild-type (control) wheat seeds at various stages using NMR and GC-FID/MS. 60 metabolites were dominant in these seeds including sugars, organic acids, amino acids, choline metabolites and fatty acids. At day-20 post-anthesis, only malate level in transgenic wheat differed significantly from that in controls whereas at day-30 post-anthesis, levels of amino acids and sucrose were significantly different between these two groups. For mature seeds, most metabolites in glycolysis, TCA cycle, choline metabolism, biosynthesis of proteins, nucleotides and fatty acids had significantly lower levels in transgenic seeds than in controls. After 30-days post-harvest ripening, most metabolites in transgenic seeds had higher levels than in controls including amino acids, sugars, organic acids, fatty acids, choline metabolites and NAD+. These indicated that anti-trx-s lowered overall metabolic activities of mature seeds eliminating pre-harvest sprouting potential. Post-harvest ripening reactivated the metabolic activities of transgenic seeds to restore their germination vigor. These findings provided essential molecular phenomic information for PHS resistance of anti-trx-s and a credible strategy for future developing PHS resistant crops.
Developmental Changes for the Hemolymph Metabolome of Silkworm (Bombyx mori L.).
Zhou, Lihong; Li, Huihui; Hao, Fuhua; Li, Ning; Liu, Xin; Wang, Guoliang; Wang, Yulan; Tang, Huiru
2015-05-01
Silkworm (Bombyx mori) is a lepidopteran-holometabolic model organism. To understand its developmental biochemistry, we characterized the larval hemolymph metabonome from the third instar to prepupa stage using (1)H NMR spectroscopy whilst hemolymph fatty acid composition using GC-FID/MS. We unambiguously assigned more than 60 metabolites, among which tyrosine-o-β-glucuronide, mesaconate, homocarnosine, and picolinate were reported for the first time from the silkworm hemolymph. Phosphorylcholine was the most abundant metabolite in all developmental stages with exception for the periods before the third and fourth molting. We also found obvious developmental dependence for the hemolymph metabonome involving multiple pathways including protein biosyntheses, glycolysis, TCA cycle, the metabolisms of choline amino acids, fatty acids, purines, and pyrimidines. Most hemolymph amino acids had two elevations during the feeding period of the fourth instar and prepupa stage. Trehalose was the major blood sugar before day 8 of the fifth instar, whereas glucose became the major blood sugar after spinning. C16:0, C18:0 and its unsaturated forms were dominant fatty acids in hemolymph. The developmental changes of hemolymph metabonome were associated with dietary nutrient intakes, biosyntheses of cell membrane, pigments, proteins, and energy metabolism. These findings offered essential biochemistry information in terms of the dynamic metabolic changes during silkworm development.
Ammonium Assimilation Requires Mitochondrial Respiration in the Light 1
Weger, Harold G.; Birch, Douglas G.; Elrifi, Ivor R.; Turpin, David H.
1988-01-01
Mass spectrometric analysis of O2 and CO2 exchange in the green alga Selenastrum minutum (Naeg. Collins) provides evidence for the occurrence of mitochondrial respiration in light. Stimulation of amino acid synthesis by the addition of NH4Cl resulted in nearly a 250% increase in the rate of TCA cycle CO2 efflux in both light and dark. Ammonium addition caused a similar increase in cyanide sensitive O2 consumption in both light and dark. Anaerobiosis inhibited the CO2 release caused by NH4Cl. These results indicated that the cytochrome pathway of the mitochondrial electron transport chain was operative and responsible for the oxidation of a large portion of the NADH generated during the ammonium induced increase in TCA cycle activity. In the presence of DCMU, ammonium addition also stimulated net O2 consumption in the light. This implied that the Mehler reaction did not play a significant role in O2 consumption under our conditions. These results show that both the TCA cycle and the mitochondrial electron transport chain are capable of operation in the light and that an important role of mitochondrial respiration in photosynthesizing cells is the provision of carbon skeletons for biosynthetic reactions. PMID:16665971
Capitanio, Daniele; Fania, Chiara; Torretta, Enrica; Viganò, Agnese; Moriggi, Manuela; Bravatà, Valentina; Caretti, Anna; Levett, Denny Z H; Grocott, Michael P W; Samaja, Michele; Cerretelli, Paolo; Gelfi, Cecilia
2017-08-29
In mammals, hypoxic stress management is under the control of the Hypoxia Inducible Factors, whose activity depends on the stabilization of their labile α subunit. In particular, the skeletal muscle appears to be able to react to changes in substrates and O 2 delivery by tuning its metabolism. The present study provides a comprehensive overview of skeletal muscle metabolic adaptation to hypoxia in mice and in human subjects exposed for 7/9 and 19 days to high altitude levels. The investigation was carried out combining proteomics, qRT-PCR mRNA transcripts analysis, and enzyme activities assessment in rodents, and protein detection by antigen antibody reactions in humans and rodents. Results indicate that the skeletal muscle react to a decreased O 2 delivery by rewiring the TCA cycle. The first TCA rewiring occurs in mice in 2-day hypoxia and is mediated by cytosolic malate whereas in 10-day hypoxia the rewiring is mediated by Idh1 and Fasn, supported by glutamine and HIF-2α increments. The combination of these specific anaplerotic steps can support energy demand despite HIFs degradation. These results were confirmed in human subjects, demonstrating that the TCA double rewiring represents an essential factor for the maintenance of muscle homeostasis during adaptation to hypoxia.
Yin, Xian; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Liu, Long; Chen, Jian
2015-11-01
Organic acids, which are chemically synthesized, are also natural intermediates in the metabolic pathways of microorganisms, among which the tricarboxylic acid (TCA) cycle is the most crucial route existing in almost all living organisms. Organic acids in the TCA cycle include citric acid, α-ketoglutaric acid, succinic acid, fumaric acid, l-malic acid, and oxaloacetate, which are building-block chemicals with wide applications and huge markets. In this review, we summarize the synthesis pathways of these organic acids and review recent advances in metabolic engineering strategies that enhance organic acid production. We also propose further improvements for the production of organic acids with systems and synthetic biology-guided metabolic engineering strategies. Copyright © 2015 Elsevier Inc. All rights reserved.
Wong, Yick Ching; Teh, Huey Fang; Mebus, Katharina; Ooi, Tony Eng Keong; Kwong, Qi Bin; Koo, Ka Loo; Ong, Chuang Kee; Mayes, Sean; Chew, Fook Tim; Appleton, David R; Kulaveerasingam, Harikrishna
2017-06-21
The oil yield trait of oil palm is expected to involve multiple genes, environmental influences and interactions. Many of the underlying mechanisms that contribute to oil yield are still poorly understood. In this study, we used a microarray approach to study the gene expression profiles of mesocarp tissue at different developmental stages, comparing genetically related high- and low- oil yielding palms to identify genes that contributed to the higher oil-yielding palm and might contribute to the wider genetic improvement of oil palm breeding populations. A total of 3412 (2001 annotated) gene candidates were found to be significantly differentially expressed between high- and low-yielding palms at at least one of the different stages of mesocarp development evaluated. Gene Ontologies (GO) enrichment analysis identified 28 significantly enriched GO terms, including regulation of transcription, fatty acid biosynthesis and metabolic processes. These differentially expressed genes comprise several transcription factors, such as, bHLH, Dof zinc finger proteins and MADS box proteins. Several genes involved in glycolysis, TCA, and fatty acid biosynthesis pathways were also found up-regulated in high-yielding oil palm, among them; pyruvate dehydrogenase E1 component Subunit Beta (PDH), ATP-citrate lyase, β- ketoacyl-ACP synthases I (KAS I), β- ketoacyl-ACP synthases III (KAS III) and ketoacyl-ACP reductase (KAR). Sucrose metabolism-related genes such as Invertase, Sucrose Synthase 2 and Sucrose Phosphatase 2 were found to be down-regulated in high-yielding oil palms, compared to the lower yield palms. Our findings indicate that a higher carbon flux (channeled through down-regulation of the Sucrose Synthase 2 pathway) was being utilized by up-regulated genes involved in glycolysis, TCA and fatty acid biosynthesis leading to enhanced oil production in the high-yielding oil palm. These findings are an important stepping stone to understand the processes that lead to production of high-yielding oil palms and have implications for breeding to maximize oil production.
PEPCK-M expression in mouse liver potentiates, not replaces, PEPCK-C mediated gluconeogenesis
Méndez-Lucas, Andrés; Duarte, João; Sunny, Nishanth E.; Satapati, Santhosh; He, TianTeng; Fu, Xiaorong; Bermúdez, Jordi; Burgess, Shawn C.; Perales, Jose C.
2013-01-01
Background & Aims Hepatic gluconeogenesis helps maintain systemic energy homeostasis by compensating for discontinuities in nutrient supply. Liver specific deletion of cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) abolishes gluconeogenesis from mitochondrial substrates, deregulates lipid metabolism and affects TCA cycle. While, mouse liver almost exclusively expresses PEPCK-C, humans equally present a mitochondrial isozyme (PEPCK-M). Despite clear relevance to human physiology, the role of PEPCK-M and its gluconeogenic potential remain unknown. Here, we test the significance of PEPCK-M in gluconeogenesis and TCA cycle function in liver-specific PEPCK-C knockout and WT mice. Methods The effects of the overexpression of PEPCK-M were examined by a combination of tracer studies and molecular biology techniques. Partial PEPCK-C re-expression was used as a positive control. Metabolic fluxes were evaluated in isolated livers by NMR using 2H and 13C tracers. Gluconeogenic potential, together with metabolic profiling, were investigated in vivo and in primary hepatocytes. Results PEPCK-M expression partially rescued defects in lipid metabolism, gluconeogenesis and TCA cycle function impaired by PEPCK-C deletion, while ~10% re-expression of PEPCK-C normalized most parameters. When PEPCK-M was expressed in the presence of PEPCK-C, the mitochondrial isozyme amplified total gluconeogenic capacity, suggesting autonomous regulation of oxaloacetate to phosphoenolpyruvate fluxes by the individual isoforms. Conclusions We conclude that PEPCK-M has gluconeogenic potential per se, and cooperates with PEPCK-C to adjust gluconeogenic/TCA flux to changes in substrate or energy availability, hinting at a role in the regulation of glucose and lipid metabolism in human liver. PMID:23466304
Inflammation and ER Stress Regulate Branched-Chain Amino Acid Uptake and Metabolism in Adipocytes
Burrill, Joel S.; Long, Eric K.; Reilly, Brian; Deng, Yingfeng; Armitage, Ian M.; Scherer, Philipp E.
2015-01-01
Inflammation plays a critical role in the pathology of obesity-linked insulin resistance and is mechanistically linked to the effects of macrophage-derived cytokines on adipocyte energy metabolism, particularly that of the mitochondrial branched-chain amino acid (BCAA) and tricarboxylic acid (TCA) pathways. To address the role of inflammation on energy metabolism in adipocytes, we used high fat-fed C57BL/6J mice and lean controls and measured the down-regulation of genes linked to BCAA and TCA cycle metabolism selectively in visceral but not in subcutaneous adipose tissue, brown fat, liver, or muscle. Using 3T3-L1 cells, TNFα, and other proinflammatory cytokine treatments reduced the expression of the genes linked to BCAA transport and oxidation. Consistent with this, [14C]-leucine uptake and conversion to triglycerides was markedly attenuated in TNFα-treated adipocytes, whereas the conversion to protein was relatively unaffected. Because inflammatory cytokines lead to the induction of endoplasmic reticulum stress, we evaluated the effects of tunicamycin or thapsigargin treatment of 3T3-L1 cells and measured a similar down-regulation in the BCAA/TCA cycle pathway. Moreover, transgenic mice overexpressing X-box binding protein 1 in adipocytes similarly down-regulated genes of BCAA and TCA metabolism in vivo. These results indicate that inflammation and endoplasmic reticulum stress attenuate lipogenesis in visceral adipose depots by down-regulating the BCAA/TCA metabolism pathway and are consistent with a model whereby the accumulation of serum BCAA in the obese insulin-resistant state is linked to adipose inflammation. PMID:25635940
Veyrat-Durebex, Charlotte; Corcia, Philippe; Piver, Eric; Devos, David; Dangoumau, Audrey; Gouel, Flore; Vourc'h, Patrick; Emond, Patrick; Laumonnier, Frédéric; Nadal-Desbarats, Lydie; Gordon, Paul H; Andres, Christian R; Blasco, Hélène
2016-12-01
This study aims to develop a cellular metabolomics model that reproduces the pathophysiological conditions found in amyotrophic lateral sclerosis in order to improve knowledge of disease physiology. We used a co-culture model combining the motor neuron-like cell line NSC-34 and the astrocyte clone C8-D1A, with each over-expressing wild-type or G93C mutant human SOD1, to examine amyotrophic lateral sclerosis (ALS) physiology. We focused on the effects of mutant human SOD1 as well as oxidative stress induced by menadione on intracellular metabolism using a metabolomics approach through gas chromatography coupled with mass spectrometry (GC-MS) analysis. Preliminary non-supervised analysis by Principal Component Analysis (PCA) revealed that cell type, genetic environment, and time of culture influenced the metabolomics profiles. Supervised analysis using orthogonal partial least squares discriminant analysis (OPLS-DA) on data from intracellular metabolomics profiles of SOD1 G93C co-cultures produced metabolites involved in glutamate metabolism and the tricarboxylic acid cycle (TCA) cycle. This study revealed the feasibility of using a metabolomics approach in a cellular model of ALS. We identified potential disruption of the TCA cycle and glutamate metabolism under oxidative stress, which is consistent with prior research in the disease. Analysis of metabolic alterations in an in vitro model is a novel approach to investigation of disease physiology.
Glial dysfunction in abstinent methamphetamine abusers
Sailasuta, Napapon; Abulseoud, Osama; Harris, Kent C; Ross, Brian D
2010-01-01
Persistent neurochemical abnormalities in frontal brain structures are believed to result from methamphetamine use. We developed a localized 13C magnetic resonance spectroscopy (MRS) assay on a conventional MR scanner, to quantify selectively glial metabolic flux rate in frontal brain of normal subjects and a cohort of recovering abstinent methamphetamine abusers. Steady-state bicarbonate concentrations were similar, between 11 and 15 mmol/L in mixed gray-white matter of frontal brain of normal volunteers and recovering methamphetamine-abusing subjects (P>0.1). However, glial 13C-bicarbonate production rate from [1-13C]acetate, equating with glial tricarboxylic acid (TCA) cycle rate, was significantly reduced in frontal brain of abstinent methamphetamine-addicted women (methamphetamine 0.04 μmol/g per min (N=5) versus controls 0.11 μmol/g per min (N=5), P=0.001). This is equivalent to 36% of the normal glial TCA cycle rate. Severe reduction in glial TCA cycle rate that normally comprises 10% of total cerebral metabolic rate may impact operation of the neuronal glial glutamate cycle and result in accumulation of frontal brain glutamate, as observed in these recovering methamphetamine abusers. Although these are the first studies to define directly an abnormality in glial metabolism in human methamphetamine abuse, sequential studies using analogous 13C MRS methods may determine ‘cause and effect' between glial failure and neuronal injury. PMID:20040926
Ragavan, Mukundan; Kirpich, Alexander; Fu, Xiaorong; Burgess, Shawn C; McIntyre, Lauren M; Merritt, Matthew E
2017-06-01
The heart oxidizes fatty acids, carbohydrates, and ketone bodies inside the tricarboxylic acid (TCA) cycle to generate the reducing equivalents needed for ATP production. Competition between these substrates makes it difficult to estimate the extent of pyruvate oxidation. Previously, hyperpolarized pyruvate detected propionate-mediated activation of carbohydrate oxidation, even in the presence of acetate. In this report, the optimal concentration of propionate for the activation of glucose oxidation was measured in mouse hearts perfused in Langendorff mode. This study was performed with a more physiologically relevant perfusate than the previous work. Increasing concentrations of propionate did not cause adverse effects on myocardial metabolism, as evidenced by unchanged O 2 consumption, TCA cycle flux, and developed pressures. Propionate at 1 mM was sufficient to achieve significant increases in pyruvate dehydrogenase flux (3×), and anaplerosis (6×), as measured by isotopomer analysis. These results further demonstrate the potential of propionate as an aid for the correct estimation of total carbohydrate oxidative capacity in the heart. However, liquid chromotography/mass spectroscopy-based metabolomics detected large changes (~30-fold) in malate and fumarate pool sizes. This observation leads to a key observation regarding mass balance in the TCA cycle; flux through a portion of the cycle can be drastically elevated without changing the O 2 consumption. Copyright © 2017 the American Physiological Society.
You, Le; Berla, Bert; He, Lian; Pakrasi, Himadri B; Tang, Yinjie J
2014-05-01
The central carbon metabolism of cyanobacteria is under debate. For over 50 years, the lack of α-ketoglutarate dehydrogenase has led to the belief that cyanobacteria have an incomplete TCA cycle. Recent in vitro enzymatic experiments suggest that this cycle may in fact be closed. The current study employed (13) C isotopomers to delineate pathways in the cyanobacterium Synechocystis sp. PCC 6803. By tracing the incorporation of supplemented glutamate into the downstream metabolites in the TCA cycle, we observed a direct in vivo transformation of α-ketoglutarate to succinate. Additionally, isotopic tracing of glyoxylate did not show a functional glyoxylate shunt and glyoxylate was used for glycine synthesis. The photomixotrophic carbon metabolism was then profiled with (13) C-MFA under light and carbon-sufficient conditions. We observed that: (i) the in vivo flux through the TCA cycle reactions (α-ketoglutarate → succinate) was minimal (<2%); (ii) the flux ratio of CO2 fixation was six times higher than that of glucose utilization; (iii) the relative flux through the oxidative pentose phosphate pathway was low (<2%); (iv) high flux through malic enzyme served as a main route for pyruvate synthesis. Our results improve the understanding of the versatile metabolism in cyanobacteria and shed light on their application for photo-biorefineries. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Energy Metabolism in Human Pluripotent Stem Cells and Their Differentiated Counterparts
Moura, Michelle B.; Momcilovic, Olga; Easley, Charles A.; Ramalho-Santos, João; Van Houten, Bennett; Schatten, Gerald
2011-01-01
Background Human pluripotent stem cells have the ability to generate all cell types present in the adult organism, therefore harboring great potential for the in vitro study of differentiation and for the development of cell-based therapies. Nonetheless their use may prove challenging as incomplete differentiation of these cells might lead to tumoregenicity. Interestingly, many cancer types have been reported to display metabolic modifications with features that might be similar to stem cells. Understanding the metabolic properties of human pluripotent stem cells when compared to their differentiated counterparts can thus be of crucial importance. Furthermore recent data has stressed distinct features of different human pluripotent cells lines, namely when comparing embryo-derived human embryonic stem cells (hESCs) and induced pluripotent stem cells (IPSCs) reprogrammed from somatic cells. Methodology/Principal Findings We compared the energy metabolism of hESCs, IPSCs, and their somatic counterparts. Focusing on mitochondria, we tracked organelle localization and morphology. Furthermore we performed gene expression analysis of several pathways related to the glucose metabolism, including glycolysis, the pentose phosphate pathway and the tricarboxylic acid (TCA) cycle. In addition we determined oxygen consumption rates (OCR) using a metabolic extracellular flux analyzer, as well as total intracellular ATP levels by high performance liquid chromatography (HPLC). Finally we explored the expression of key proteins involved in the regulation of glucose metabolism. Conclusions/Findings Our results demonstrate that, although the metabolic signature of IPSCs is not identical to that of hESCs, nonetheless they cluster with hESCs rather than with their somatic counterparts. ATP levels, lactate production and OCR revealed that human pluripotent cells rely mostly on glycolysis to meet their energy demands. Furthermore, our work points to some of the strategies which human pluripotent stem cells may use to maintain high glycolytic rates, such as high levels of hexokinase II and inactive pyruvate dehydrogenase (PDH). PMID:21698063
Matsuoka, Yu; Shimizu, Kazuyuki
2013-10-20
It is quite important to understand the basic principle embedded in the main metabolism for the interpretation of the fermentation data. For this, it may be useful to understand the regulation mechanism based on systems biology approach. In the present study, we considered the perturbation analysis together with computer simulation based on the models which include the effects of global regulators on the pathway activation for the main metabolism of Escherichia coli. Main focus is the acetate overflow metabolism and the co-fermentation of multiple carbon sources. The perturbation analysis was first made to understand the nature of the feed-forward loop formed by the activation of Pyk by FDP (F1,6BP), and the feed-back loop formed by the inhibition of Pfk by PEP in the glycolysis. Those together with the effect of transcription factor Cra caused by FDP level affected the glycolysis activity. The PTS (phosphotransferase system) acts as the feed-back system by repressing the glucose uptake rate for the increase in the glucose uptake rate. It was also shown that the increased PTS flux (or glucose consumption rate) causes PEP/PYR ratio to be decreased, and EIIA-P, Cya, cAMP-Crp decreased, where cAMP-Crp in turn repressed TCA cycle and more acetate is formed. This was further verified by the detailed computer simulation. In the case of multiple carbon sources such as glucose and xylose, it was shown that the sequential utilization of carbon sources was observed for wild type, while the co-consumption of multiple carbon sources with slow consumption rates were observed for the ptsG mutant by computer simulation, and this was verified by experiments. Moreover, the effect of a specific gene knockout such as Δpyk on the metabolic characteristics was also investigated based on the computer simulation. Copyright © 2013 Elsevier B.V. All rights reserved.
Ries, Laure Nicolas Annick; de Assis, Leandro José; Rodrigues, Fernando José Santos; Caldana, Camila; Rocha, Marina Campos; Malavazi, Iran; Bayram, Özgür; Goldman, Gustavo H
2018-05-24
The pyruvate dehydrogenase complex (PDH), that converts pyruvate to acetyl-coA, is regulated by pyruvate dehydrogenase kinases (PDHK) and phosphatases (PDHP) that have been shown to be important for morphology, pathogenicity and carbon source utilisation in different fungal species. The aim of this study was to investigate the role played by the three PDHKs PkpA, PkpB and PkpC in carbon source utilisation in the reference filamentous fungus Aspergillus nidulans , in order to unravel regulatory mechanisms which could prove useful for fungal biotechnological and biomedical applications. PkpA and PkpB were shown to be mitochondrial whereas PkpC localised to the mitochondria in a carbon source-dependent manner. Only PkpA was shown to regulate PDH activity. In the presence of glucose, deletion of pkpA and pkpC resulted in reduced glucose utilisation, which affected carbon catabolite repression (CCR) and hydrolytic enzyme secretion, due to de-regulated glycolysis and TCA cycle enzyme activities. Furthermore, PkpC was shown to be required for the correct metabolic utilisation of cellulose and acetate. PkpC negatively regulated the activity of the glyoxylate cycle enzyme isocitrate lyase (ICL), required for acetate metabolism. In summary, this study identified PDHKs important for the regulation of central carbon metabolism in the presence of different carbon sources, with effects on the secretion of biotechnologically important enzymes and carbon source-related growth. This work demonstrates how central carbon metabolism can affect a variety of fungal traits and lays a basis for further investigation into these characteristics with potential interest for different applications. Copyright © 2018, G3: Genes, Genomes, Genetics.
Phosphoketolase pathway contributes to carbon metabolism in cyanobacteria.
Xiong, Wei; Lee, Tai-Chi; Rommelfanger, Sarah; Gjersing, Erica; Cano, Melissa; Maness, Pin-Ching; Ghirardi, Maria; Yu, Jianping
2015-12-07
Central carbon metabolism in cyanobacteria comprises the Calvin-Benson-Bassham (CBB) cycle, glycolysis, the pentose phosphate (PP) pathway and the tricarboxylic acid (TCA) cycle. Redundancy in this complex metabolic network renders the rational engineering of cyanobacterial metabolism for the generation of biomass, biofuels and chemicals a challenge. Here we report the presence of a functional phosphoketolase pathway, which splits xylulose-5-phosphate (or fructose-6-phosphate) to acetate precursor acetyl phosphate, in an engineered strain of the model cyanobacterium Synechocystis (ΔglgC/xylAB), in which glycogen synthesis is blocked, and xylose catabolism enabled through the introduction of xylose isomerase and xylulokinase. We show that this mutant strain is able to metabolise xylose to acetate on nitrogen starvation. To see whether acetate production in the mutant is linked to the activity of phosphoketolase, we disrupted a putative phosphoketolase gene (slr0453) in the ΔglgC/xylAB strain, and monitored metabolic flux using (13)C labelling; acetate and 2-oxoglutarate production was reduced in the light. A metabolic flux analysis, based on isotopic data, suggests that the phosphoketolase pathway metabolises over 30% of the carbon consumed by ΔglgC/xylAB during photomixotrophic growth on xylose and CO2. Disruption of the putative phosphoketolase gene in wild-type Synechocystis also led to a deficiency in acetate production in the dark, indicative of a contribution of the phosphoketolase pathway to heterotrophic metabolism. We suggest that the phosphoketolase pathway, previously uncharacterized in photosynthetic organisms, confers flexibility in energy and carbon metabolism in cyanobacteria, and could be exploited to increase the efficiency of cyanobacterial carbon metabolism and photosynthetic productivity.
Weger, H G; Birch, D G; Elrifi, I R; Turpin, D H
1988-03-01
Mass spectrometric analysis of O(2) and CO(2) exchange in the green alga Selenastrum minutum (Naeg. Collins) provides evidence for the occurrence of mitochondrial respiration in light. Stimulation of amino acid synthesis by the addition of NH(4)Cl resulted in nearly a 250% increase in the rate of TCA cycle CO(2) efflux in both light and dark. Ammonium addition caused a similar increase in cyanide sensitive O(2) consumption in both light and dark. Anaerobiosis inhibited the CO(2) release caused by NH(4)Cl. These results indicated that the cytochrome pathway of the mitochondrial electron transport chain was operative and responsible for the oxidation of a large portion of the NADH generated during the ammonium induced increase in TCA cycle activity. In the presence of DCMU, ammonium addition also stimulated net O(2) consumption in the light. This implied that the Mehler reaction did not play a significant role in O(2) consumption under our conditions. These results show that both the TCA cycle and the mitochondrial electron transport chain are capable of operation in the light and that an important role of mitochondrial respiration in photosynthesizing cells is the provision of carbon skeletons for biosynthetic reactions.
An integrated model of cardiac mitochondrial energy metabolism and calcium dynamics.
Cortassa, Sonia; Aon, Miguel A; Marbán, Eduardo; Winslow, Raimond L; O'Rourke, Brian
2003-04-01
We present an integrated thermokinetic model describing control of cardiac mitochondrial bioenergetics. The model describes the tricarboxylic acid (TCA) cycle, oxidative phosphorylation, and mitochondrial Ca(2+) handling. The kinetic component of the model includes effectors of the TCA cycle enzymes regulating production of NADH and FADH(2), which in turn are used by the electron transport chain to establish a proton motive force (Delta mu(H)), driving the F(1)F(0)-ATPase. In addition, mitochondrial matrix Ca(2+), determined by Ca(2+) uniporter and Na(+)/Ca(2+) exchanger activities, regulates activity of the TCA cycle enzymes isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase. The model is described by twelve ordinary differential equations for the time rate of change of mitochondrial membrane potential (Delta Psi(m)), and matrix concentrations of Ca(2+), NADH, ADP, and TCA cycle intermediates. The model is used to predict the response of mitochondria to changes in substrate delivery, metabolic inhibition, the rate of adenine nucleotide exchange, and Ca(2+). The model is able to reproduce, qualitatively and semiquantitatively, experimental data concerning mitochondrial bioenergetics, Ca(2+) dynamics, and respiratory control. Significant increases in oxygen consumption (V(O(2))), proton efflux, NADH, and ATP synthesis, in response to an increase in cytoplasmic Ca(2+), are obtained when the Ca(2+)-sensitive dehydrogenases are the main rate-controlling steps of respiratory flux. These responses diminished when control is shifted downstream (e.g., the respiratory chain or adenine nucleotide translocator). The time-dependent behavior of the model, under conditions simulating an increase in workload, closely reproduces experimentally observed mitochondrial NADH dynamics in heart trabeculae subjected to changes in pacing frequency. The steady-state and time-dependent behavior of the model support the hypothesis that mitochondrial matrix Ca(2+) plays an important role in matching energy supply with demand in cardiac myocytes.
An Integrated Model of Cardiac Mitochondrial Energy Metabolism and Calcium Dynamics
Cortassa, Sonia; Aon, Miguel A.; Marbán, Eduardo; Winslow, Raimond L.; O'Rourke, Brian
2003-01-01
We present an integrated thermokinetic model describing control of cardiac mitochondrial bioenergetics. The model describes the tricarboxylic acid (TCA) cycle, oxidative phosphorylation, and mitochondrial Ca2+ handling. The kinetic component of the model includes effectors of the TCA cycle enzymes regulating production of NADH and FADH2, which in turn are used by the electron transport chain to establish a proton motive force (ΔμH), driving the F1F0-ATPase. In addition, mitochondrial matrix Ca2+, determined by Ca2+ uniporter and Na+/Ca2+ exchanger activities, regulates activity of the TCA cycle enzymes isocitrate dehydrogenase and α-ketoglutarate dehydrogenase. The model is described by twelve ordinary differential equations for the time rate of change of mitochondrial membrane potential (ΔΨm), and matrix concentrations of Ca2+, NADH, ADP, and TCA cycle intermediates. The model is used to predict the response of mitochondria to changes in substrate delivery, metabolic inhibition, the rate of adenine nucleotide exchange, and Ca2+. The model is able to reproduce, qualitatively and semiquantitatively, experimental data concerning mitochondrial bioenergetics, Ca2+ dynamics, and respiratory control. Significant increases in oxygen consumption (VO2), proton efflux, NADH, and ATP synthesis, in response to an increase in cytoplasmic Ca2+, are obtained when the Ca2+-sensitive dehydrogenases are the main rate-controlling steps of respiratory flux. These responses diminished when control is shifted downstream (e.g., the respiratory chain or adenine nucleotide translocator). The time-dependent behavior of the model, under conditions simulating an increase in workload, closely reproduces experimentally observed mitochondrial NADH dynamics in heart trabeculae subjected to changes in pacing frequency. The steady-state and time-dependent behavior of the model support the hypothesis that mitochondrial matrix Ca2+ plays an important role in matching energy supply with demand in cardiac myocytes. PMID:12668482
Metabolic profiles of exercise in patients with McArdle disease or mitochondrial myopathy
Sharma, Rohit; Tadvalkar, Laura; Clish, Clary B.; Haller, Ronald G.; Mootha, Vamsi K.
2017-01-01
McArdle disease and mitochondrial myopathy impair muscle oxidative phosphorylation (OXPHOS) by distinct mechanisms: the former by restricting oxidative substrate availability caused by blocked glycogen breakdown, the latter because of intrinsic respiratory chain defects. We applied metabolic profiling to systematically interrogate these disorders at rest, when muscle symptoms are typically minimal, and with exercise, when symptoms of premature fatigue and potential muscle injury are unmasked. At rest, patients with mitochondrial disease exhibit elevated lactate and reduced uridine; in McArdle disease purine nucleotide metabolites, including xanthine, hypoxanthine, and inosine are elevated. During exercise, glycolytic intermediates, TCA cycle intermediates, and pantothenate expand dramatically in both mitochondrial disease and control subjects. In contrast, in McArdle disease, these metabolites remain unchanged from rest; but urea cycle intermediates are increased, likely attributable to increased ammonia production as a result of exaggerated purine degradation. Our results establish skeletal muscle glycogen as the source of TCA cycle expansion that normally accompanies exercise and imply that impaired TCA cycle flux is a central mechanism of restricted oxidative capacity in this disorder. Finally, we report that resting levels of long-chain triacylglycerols in mitochondrial myopathy correlate with the severity of OXPHOS dysfunction, as indicated by the level of impaired O2 extraction from arterial blood during peak exercise. Our integrated analysis of exercise and metabolism provides unique insights into the biochemical basis of these muscle oxidative defects, with potential implications for their clinical management. PMID:28716914
Modelling urea-cycle disorder citrullinemia type 1 with disease-specific iPSCs.
Yoshitoshi-Uebayashi, Elena Yukie; Toyoda, Taro; Yasuda, Katsutaro; Kotaka, Maki; Nomoto, Keiko; Okita, Keisuke; Yasuchika, Kentaro; Okamoto, Shinya; Takubo, Noriyuki; Nishikubo, Toshiya; Soga, Tomoyoshi; Uemoto, Shinji; Osafune, Kenji
2017-05-06
Citrullinemia type 1 (CTLN1) is a urea cycle disorder (UCD) caused by mutations of the ASS1 gene, which is responsible for production of the enzyme argininosuccinate synthetase (ASS), and classically presented as life-threatening hyperammonemia in newborns. Therapeutic options are limited, and neurological sequelae may persist. To understand the pathophysiology and find novel treatments, induced pluripotent stem cells (iPSCs) were generated from a CTLN1 patient and differentiated into hepatocyte-like cells (HLCs). CTLN1-HLCs have lower ureagenesis, recapitulating part of the patient's phenotype. l-arginine, an amino acid clinically used for UCD treatment, improved this phenotype in vitro. Metabolome analysis revealed an increase in tricarboxylic acid (TCA) cycle metabolites in CTLN1, suggesting a connection between CTLN1 and the TCA cycle. This CTLN1-iPSC model improves the understanding of CTLN1 pathophysiology and can be used to pursue new therapeutic approaches. Copyright © 2017 Elsevier Inc. All rights reserved.
The sweet trap in tumors: aerobic glycolysis and potential targets for therapy
Wang, Liantang; Chen, Shangwu
2016-01-01
Metabolic change is one of the hallmarks of tumor, which has recently attracted a great of attention. One of main metabolic characteristics of tumor cells is the high level of glycolysis even in the presence of oxygen, known as aerobic glycolysis or the Warburg effect. The energy production is much less in glycolysis pathway than that in tricarboxylic acid cycle. The molecular mechanism of a high glycolytic flux in tumor cells remains unclear. A large amount of intermediates derived from glycolytic pathway could meet the biosynthetic requirements of the proliferating cells. Hypoxia-induced HIF-1α, PI3K-Akt-mTOR signaling pathway, and many other factors, such as oncogene activation and tumor suppressor inactivation, drive cancer cells to favor glycolysis over mitochondrial oxidation. Several small molecules targeting glycolytic pathway exhibit promising anticancer activity both in vitro and in vivo. In this review, we will focus on the latest progress in the regulation of aerobic glycolysis and discuss the potential targets for the tumor therapy. PMID:26918353
The sweet trap in tumors: aerobic glycolysis and potential targets for therapy.
Yu, Li; Chen, Xun; Wang, Liantang; Chen, Shangwu
2016-06-21
Metabolic change is one of the hallmarks of tumor, which has recently attracted a great of attention. One of main metabolic characteristics of tumor cells is the high level of glycolysis even in the presence of oxygen, known as aerobic glycolysis or the Warburg effect. The energy production is much less in glycolysis pathway than that in tricarboxylic acid cycle. The molecular mechanism of a high glycolytic flux in tumor cells remains unclear. A large amount of intermediates derived from glycolytic pathway could meet the biosynthetic requirements of the proliferating cells. Hypoxia-induced HIF-1α, PI3K-Akt-mTOR signaling pathway, and many other factors, such as oncogene activation and tumor suppressor inactivation, drive cancer cells to favor glycolysis over mitochondrial oxidation. Several small molecules targeting glycolytic pathway exhibit promising anticancer activity both in vitro and in vivo. In this review, we will focus on the latest progress in the regulation of aerobic glycolysis and discuss the potential targets for the tumor therapy.
Protein-protein interactions and metabolite channelling in the plant tricarboxylic acid cycle
Zhang, Youjun; Beard, Katherine F. M.; Swart, Corné; Bergmann, Susan; Krahnert, Ina; Nikoloski, Zoran; Graf, Alexander; Ratcliffe, R. George; Sweetlove, Lee J.; Fernie, Alisdair R.; Obata, Toshihiro
2017-01-01
Protein complexes of sequential metabolic enzymes, often termed metabolons, may permit direct channelling of metabolites between the enzymes, providing increased control over metabolic pathway fluxes. Experimental evidence supporting their existence in vivo remains fragmentary. In the present study, we test binary interactions of the proteins constituting the plant tricarboxylic acid (TCA) cycle. We integrate (semi-)quantitative results from affinity purification-mass spectrometry, split-luciferase and yeast-two-hybrid assays to generate a single reliability score for assessing protein–protein interactions. By this approach, we identify 158 interactions including those between catalytic subunits of sequential enzymes and between subunits of enzymes mediating non-adjacent reactions. We reveal channelling of citrate and fumarate in isolated potato mitochondria by isotope dilution experiments. These results provide evidence for a functional TCA cycle metabolon in plants, which we discuss in the context of contemporary understanding of this pathway in other kingdoms. PMID:28508886
Kuang, Ye; Han, Xiaoyun; Xu, Mu; Wang, Yue; Zhao, Yuxiang; Yang, Qing
2018-05-31
Chemical injury is partly due to free radical lipid peroxidation, which can induce oxidative stress and produce a large number of reactive oxygen species (ROS). Oxaloacetic acid is an important intermediary in the tricarboxylic acid cycle (TCA cycle) and participates in metabolism and energy production. In our study, we found that oxaloacetate (OA) effectively alleviated liver injury which was induced by hydrogen peroxide (H₂O₂) in vitro and carbon tetrachloride (CCl₄) in vivo. OA scavenged ROS, prevented oxidative damage and maintained the normal structure of mitochondria. We further confirmed that OA increased adenosine triphosphate (ATP) by promoting the TCA production cycle and oxidative phosphorylation (OXPHOS). Finally, OA inhibited the mitogen-activated protein kinase (MAPK) and apoptotic pathways by suppressing tumor necrosis factor-α (TNF-α). Our findings reveal a mechanism for OA ameliorating chemical liver injury and suggest a possible implementation for preventing the chemical liver injury.
Eoh, Hyungjin; Rhee, Kyu Y.
2014-01-01
Few mutations attenuate Mycobacterium tuberculosis (Mtb) more profoundly than deletion of its isocitrate lyases (ICLs). However, the basis for this attenuation remains incompletely defined. Mtb’s ICLs are catalytically bifunctional isocitrate and methylisocitrate lyases required for growth on even and odd chain fatty acids. Here, we report that Mtb’s ICLs are essential for survival on both acetate and propionate because of its methylisocitrate lyase (MCL) activity. Lack of MCL activity converts Mtb’s methylcitrate cycle into a “dead end” pathway that sequesters tricarboxylic acid (TCA) cycle intermediates into methylcitrate cycle intermediates, depletes gluconeogenic precursors, and results in defects of membrane potential and intrabacterial pH. Activation of an alternative vitamin B12-dependent pathway of propionate metabolism led to selective corrections of TCA cycle activity, membrane potential, and intrabacterial pH that specifically restored survival, but not growth, of ICL-deficient Mtb metabolizing acetate or propionate. These results thus resolve the biochemical basis of essentiality for Mtb’s ICLs and survival on fatty acids. PMID:24639517
The Krebs Uric Acid Cycle: A Forgotten Krebs Cycle.
Salway, Jack G
2018-05-25
Hans Kornberg wrote a paper entitled 'Krebs and his trinity of cycles' commenting that every school biology student knows of the Krebs cycle, but few know that Krebs discovered two other cycles. These are (i) the ornithine cycle (urea cycle), (ii) the citric acid cycle (tricarboxylic acid or TCA cycle), and (iii) the glyoxylate cycle that was described by Krebs and Kornberg. Ironically, Kornberg, codiscoverer of the 'glyoxylate cycle', overlooked a fourth Krebs cycle - (iv) the uric acid cycle. Copyright © 2018 Elsevier Ltd. All rights reserved.
Li, Qingye; Chang, Rong; Sun, Yijun; Li, Bosheng
2016-01-01
Low temperature (LT) is one of the most important abiotic stresses that can significantly reduce crop yield. To gain insight into how Spirulina responds to LT stress, comprehensive physiological and proteomic analyses were conducted in this study. Significant decreases in growth and pigment levels as well as excessive accumulation of compatible osmolytes were observed in response to LT stress. An isobaric tag for relative and absolute quantitation (iTRAQ)-based quantitative proteomics approach was used to identify changes in protein abundance in Spirulina under LT. A total of 3,782 proteins were identified, of which 1,062 showed differential expression. Bioinformatics analysis indicated that differentially expressed proteins that were enriched in photosynthesis, carbohydrate metabolism, amino acid biosynthesis, and translation are important for the maintenance of cellular homeostasis and metabolic balance in Spirulina when subjected to LT stress. The up-regulation of proteins involved in gluconeogenesis, starch and sucrose metabolism, and amino acid biosynthesis served as coping mechanisms of Spirulina in response to LT stress. Moreover, the down-regulated expression of proteins involved in glycolysis, TCA cycle, pentose phosphate pathway, photosynthesis, and translation were associated with reduced energy consumption. The findings of the present study allow a better understanding of the response of Spirulina to LT stress and may facilitate in the elucidation of mechanisms underlying LT tolerance. PMID:27902743
Lin, Qiong; Wang, Chengyang; Dong, Wencheng; Jiang, Qing; Wang, Dengliang; Li, Shaojia; Chen, Ming; Liu, Chunrong; Sun, Chongde; Chen, Kunsong
2015-01-01
Ponkan (Citrus reticulata Blanco cv. Ponkan) is an important mandarin citrus in China. However, the low ratio of sugars to organic acids makes it less acceptable for consumers. In this work, three stages (S120, early development stage; S195, commercial harvest stage; S205, delayed harvest stage) of Ponkan fruit were selected for study. Among 28 primary metabolites analyzed in fruit, sugars increased while organic acids in general decreased. RNA-Seq analysis was carried out and 19,504 genes were matched to the Citrus clementina genome, with 85 up-regulated and 59 down-regulated genes identified during fruit maturation. A sucrose phosphate synthase (SPS) gene was included in the up-regulated group, and this was supported by the transcript ratio distribution. Expression of two asparagine transferases (AST), and a specific ATP-citrate lyase (ACL) and glutamate decarboxylase (GAD) members increased during fruit maturation. It is suggested that SPS, AST, ACL and GAD coordinately contribute to sugar accumulation and organic acid degradation during Ponkan fruit maturation. Both the glycolysis pathway and TCA cycle were accelerated during later maturation, indicating the flux change from sucrose metabolism to organic acid metabolism was enhanced, with citrate degradation occurring mainly through the gamma-aminobutyric acid (GABA) and acetyl-CoA pathways. Copyright © 2014 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Feng, Jianghua; Zhao, Jing; Hao, Fuhua; Chen, Chang; Bhakoo, Kishore; Tang, Huiru
2011-05-01
The metabonomic changes in murine RAW264.7 macrophage-like cell line induced by ultrasmall superparamagnetic particles of iron oxides (USPIO) have been investigated, by analyzing both the cells and culture media, using high-resolution NMR in conjunction with multivariate statistical methods. Upon treatment with USPIO, macrophage cells showed a significant decrease in the levels of triglycerides, essential amino acids such as valine, isoleucine, and choline metabolites together with an increase of glycerophospholipids, tyrosine, phenylalanine, lysine, glycine, and glutamate. Such cellular responses to USPIO were also detectable in compositional changes of cell media, showing an obvious depletion of the primary nutrition molecules, such as glucose and amino acids and the production of end-products of glycolysis, such as pyruvate, acetate, and lactate and intermediates of TCA cycle such as succinate and citrate. At 48 h treatment, there was a differential response to incubation with USPIO in both cell metabonome and medium components, indicating that USPIO are phagocytosed and released by macrophages. Furthermore, information on cell membrane modification can be derived from the changes in choline-like metabolites. These results not only suggest that NMR-based metabonomic methods have sufficient sensitivity to identify the metabolic consequences of murine RAW264.7 macrophage-like cell line response to USPIO in vitro, but also provide useful information on the effects of USPIO on cellular metabolism.
Moroz, Tracy; Banaji, Murad; Robertson, Nicola J.; Cooper, Chris E.; Tachtsidis, Ilias
2012-01-01
We describe a computational model to simulate measurements from near-infrared spectroscopy (NIRS) and magnetic resonance spectroscopy (MRS) in the piglet brain. Piglets are often subjected to anoxic, hypoxic and ischaemic insults, as experimental models for human neonates. The model aims to help interpret measurements and increase understanding of physiological processes occurring during such insults. It is an extension of a previous model of circulation and mitochondrial metabolism. This was developed to predict NIRS measurements in the brains of healthy adults i.e. concentration changes of oxyhaemoglobin and deoxyhaemoglobin and redox state changes of cytochrome c oxidase (CCO). We altered and enhanced the model to apply to the anaesthetized piglet brain. It now includes metabolites measured by 31P-MRS, namely phosphocreatine, inorganic phosphate and adenosine triphosphate (ATP). It also includes simple descriptions of glycolysis, lactate dynamics and the tricarboxylic acid (TCA) cycle. The model is described, and its simulations compared with existing measurements from piglets during anoxia. The NIRS and MRS measurements are predicted well, although this requires a reduction in blood pressure autoregulation. Predictions of the cerebral metabolic rate of oxygen consumption (CMRO2) and lactate concentration, which were not measured, are given. Finally, the model is used to investigate hypotheses regarding changes in CCO redox state during anoxia. PMID:22279158
Wang, Yanjun; Liu, Xiangyang; Zhang, Chen; Wang, Zhengjun
2018-06-01
High salt induced renal disease is a condition resulting from the interactions of genetic and dietary factors causing multiple complications. To understand the metabolic alterations associated with renal disease, we comprehensively analyzed the metabonomic changes induced by high salt intake in Dahl salt-sensitive (SS) rats using GC-MS technology and biochemical analyses. Physiological features, serum chemistry, and histopathological data were obtained as complementary information. Our results showed that high salt (HS) intake for 16 weeks caused significant metabolic alterations in both the renal medulla and cortex involving a variety pathways involved in the metabolism of organic acids, amino acids, fatty acids, and purines. In addition, HS enhanced glycolysis (hexokinase, phosphofructokinase and pyruvate kinase) and amino acid metabolism and suppressed the TCA (citrate synthase and aconitase) cycle. Finally, HS intake caused up-regulation of the pentose phosphate pathway (glucose 6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase), the ratio of NADPH/NADP + , NADPH oxidase activity and ROS production, suggesting that increased oxidative stress was associated with an altered PPP pathway. The metabolic pathways identified may serve as potential targets for the treatment of renal damage. Our findings provide comprehensive biochemical details about the metabolic responses to a high salt diet, which may contribute to the understanding of renal disease and salt-induced hypertension in SS rats. Copyright © 2018. Published by Elsevier Inc.
Li, Qingye; Chang, Rong; Sun, Yijun; Li, Bosheng
2016-01-01
Low temperature (LT) is one of the most important abiotic stresses that can significantly reduce crop yield. To gain insight into how Spirulina responds to LT stress, comprehensive physiological and proteomic analyses were conducted in this study. Significant decreases in growth and pigment levels as well as excessive accumulation of compatible osmolytes were observed in response to LT stress. An isobaric tag for relative and absolute quantitation (iTRAQ)-based quantitative proteomics approach was used to identify changes in protein abundance in Spirulina under LT. A total of 3,782 proteins were identified, of which 1,062 showed differential expression. Bioinformatics analysis indicated that differentially expressed proteins that were enriched in photosynthesis, carbohydrate metabolism, amino acid biosynthesis, and translation are important for the maintenance of cellular homeostasis and metabolic balance in Spirulina when subjected to LT stress. The up-regulation of proteins involved in gluconeogenesis, starch and sucrose metabolism, and amino acid biosynthesis served as coping mechanisms of Spirulina in response to LT stress. Moreover, the down-regulated expression of proteins involved in glycolysis, TCA cycle, pentose phosphate pathway, photosynthesis, and translation were associated with reduced energy consumption. The findings of the present study allow a better understanding of the response of Spirulina to LT stress and may facilitate in the elucidation of mechanisms underlying LT tolerance.
Transcript abundance on its own cannot be used to infer fluxes in central metabolism
Schwender, Jorg; Konig, Christina; Klapperstuck, Matthias; ...
2014-11-28
An attempt has been made to define the extent to which metabolic flux in central plant metabolism is reflected by changes in the transcriptome and metabolome, based on an analysis of in vitro cultured immature embryos of two oilseed rape (Brassica napus) accessions which contrast for seed lipid accumulation. Metabolic flux analysis (MFA) was used to constrain a flux balance metabolic model which included 671 biochemical and transport reactions within the central metabolism. This highly confident flux information was eventually used for comparative analysis of flux vs. transcript (metabolite). Metabolite profiling succeeded in identifying 79 intermediates within the central metabolism,more » some of which differed quantitatively between the two accessions and displayed a significant shift corresponding to flux. An RNA-Seq based transcriptome analysis revealed a large number of genes which were differentially transcribed in the two accessions, including some enzymes/proteins active in major metabolic pathways. With a few exceptions, differential activity in the major pathways (glycolysis, TCA cycle, amino acid, and fatty acid synthesis) was not reflected in contrasting abundances of the relevant transcripts. The conclusion was that transcript abundance on its own cannot be used to infer metabolic activity/fluxes in central plant metabolism. Lastly, this limitation needs to be borne in mind in evaluating transcriptome data and designing metabolic engineering experiments.« less
Willenborg, Jörg; de Greeff, Astrid; Jarek, Michael; Valentin-Weigand, Peter; Goethe, Ralph
2014-04-01
Streptococcus suis (S. suis) is a neglected zoonotic streptococcus causing fatal diseases in humans and in pigs. The transcriptional regulator CcpA (catabolite control protein A) is involved in the metabolic adaptation to different carbohydrate sources and virulence of S. suis and other pathogenic streptococci. In this study, we determined the DNA binding characteristics of CcpA and identified the CcpA regulon during growth of S. suis. Electrophoretic mobility shift analyses showed promiscuous DNA binding of CcpA to cognate cre sites in vitro. In contrast, sequencing of immunoprecipitated chromatin revealed two specific consensus motifs, a pseudo-palindromic cre motif (WWGAAARCGYTTTCWW) and a novel cre2 motif (TTTTYHWDHHWWTTTY), within the regulatory elements of the genes directly controlled by CcpA. Via these elements CcpA regulates expression of genes involved in carbohydrate uptake and conversion, and in addition in important metabolic pathways of the central carbon metabolism, like glycolysis, mixed-acid fermentation, and the fragmentary TCA cycle. Furthermore, our analyses provide evidence that CcpA regulates the genes of the central carbon metabolism by binding either the pseudo-palindromic cre motif or the cre2 motif in a HPr(Ser)∼P independent conformation. © 2014 John Wiley & Sons Ltd.
Zanin, Laura; Venuti, Silvia; Tomasi, Nicola; Zamboni, Anita; De Brito Francisco, Rita M.; Varanini, Zeno; Pinton, Roberto
2016-01-01
To limit nitrogen (N) losses from the soil, it has been suggested to provide urea to crops in conjunction with the urease inhibitor N-(n-butyl) thiophosphoric triamide (NBPT). However, recent studies reported that NBPT affects urea uptake and urease activity in plants. To shed light on these latter aspects, the effects of NBPT were studied analysing transcriptomic and metabolic changes occurring in urea-fed maize seedlings after a short-term exposure to the inhibitor. We provide evidence that NBPT treatment led to a wide reprogramming of plant metabolism. NBPT inhibited the activity of endogenous urease limiting the release and assimilation of ureic-ammonium, with a simultaneous accumulation of urea in plant tissues. Furthermore, NBPT determined changes in the glutamine, glutamate, and asparagine contents. Microarray data indicate that NBPT affects ureic-N assimilation and primary metabolism, such as glycolysis, TCA cycle, and electron transport chain, while activates the phenylalanine/tyrosine-derivative pathway. Moreover, the expression of genes relating to the transport and complexation of divalent metals was strongly modulated by NBPT. Data here presented suggest that when NBPT is provided in conjunction with urea an imbalance between C and N compounds might occur in plant cells. Under this condition, root cells also seem to activate a response to maintain the homeostasis of some micronutrients. PMID:27446099
On-line metabolic pathway analysis based on metabolic signal flow diagram.
Shi, H; Shimizu, K
In this work, an integrated modeling approach based on a metabolic signal flow diagram and cellular energetics was used to model the metabolic pathway analysis for the cultivation of yeast on glucose. This approach enables us to make a clear analysis of the flow direction of the carbon fluxes in the metabolic pathways as well as of the degree of activation of a particular pathway for the synthesis of biomaterials for cell growth. The analyses demonstrate that the main metabolic pathways of Saccharomyces cerevisiae change significantly during batch culture. Carbon flow direction is toward glycolysis to satisfy the increase of requirement for precursors and energy. The enzymatic activation of TCA cycle seems to always be at normal level, which may result in the overflow of ethanol due to its limited capacity. The advantage of this approach is that it adopts both virtues of the metabolic signal flow diagram and the simple network analysis method, focusing on the investigation of the flow directions of carbon fluxes and the degree of activation of a particular pathway or reaction loop. All of the variables used in the model equations were determined on-line; the information obtained from the calculated metabolic coefficients may result in a better understanding of cell physiology and help to evaluate the state of the cell culture process. Copyright 1998 John Wiley & Sons, Inc.
Vernardis, Spyros I; Terzoudis, Konstantinos; Panoskaltsis, Nicki; Mantalaris, Athanasios
2017-02-06
Human pluripotent stem cells (hPSCs) are adhesion-dependent cells that require cultivation in colonies to maintain growth and pluripotency. Robust differentiation protocols necessitate single cell cultures that are achieved by use of ROCK (Rho kinase) inhibitors. ROCK inhibition enables maintenance of stem cell phenotype; its effects on metabolism are unknown. hPSCs were exposed to 10 μM ROCK inhibitor for varying exposure times. Pluripotency (TRA-1-81, SSEA3, OCT4, NANOG, SOX2) remained unaffected, until after prolonged exposure (96 hrs). Gas chromatography-mass spectrometry metabolomics analysis identified differences between ROCK-treated and untreated cells as early as 12 hrs. Exposure for 48 hours resulted in reduction in glycolysis, glutaminolysis, the citric acid (TCA) cycle as well as the amino acids pools, suggesting the adaptation of the cells to the new culture conditions, which was also reflected by the expression of the metabolic regulators, mTORC1 and tp53 and correlated with cellular proliferation status. While gene expression and protein levels did not reveal any changes in the physiology of the cells, metabolomics revealed the fluctuating state of the metabolism. The above highlight the usefulness of metabolomics in providing accurate and sensitive information on cellular physiological status, which could lead to the development of robust and optimal stem cell bioprocesses.
Krajewska, Joanna; Arent, Zbigniew; Zolkiewski, Michal; Kędzierska-Mieszkowska, Sabina
2018-04-18
Bacterial ClpB is an ATP-dependent Hsp100 chaperone that reactivates aggregated proteins in cooperation with the DnaK chaperone system and promotes survival of bacteria under stress conditions. A large number of publications also indicate that ClpB supports the virulence of bacteria, including a pathogenic spirochaete Leptospira interrogans responsible for leptospirosis in both animals and humans. However, the exact role of ClpB in bacterial pathogenicity remains poorly characterized. It can be assumed that ClpB, due to its role as the molecular chaperone, mediates refolding of essential bacterial proteins, including the known virulence factors, which may become prone to aggregation under infection-induced stresses. In this study, we identified putative substrates of ClpB from L. interrogans (ClpB Li ). For this purpose, we used a proteomic approach combining the ClpB-Trap affinity pull-down assays, Liquid chromatography-tandem mass spectrometry (LC-MS-MS/MS), and bioinformatics analyses. Most of the identified proteins were enzymes predominantly associated with major metabolic pathways like the tricarboxylic acid (TCA) cycle, glycolysis–gluconeogenesis and amino acid and fatty acid metabolism. Based on our proteomic study, we suggest that ClpB can support the virulence of L. interrogans by protecting the conformational integrity and catalytic activity of multiple metabolic enzymes, thus maintaining energy homeostasis in pathogen cells.
Vödisch, Martin; Scherlach, Kirstin; Winkler, Robert; Hertweck, Christian; Braun, Hans-Peter; Roth, Martin; Haas, Hubertus; Werner, Ernst R; Brakhage, Axel A; Kniemeyer, Olaf
2011-05-06
The mold Aspergillus fumigatus is the most important airborne fungal pathogen. Adaptation to hypoxia represents an important virulence attribute for A. fumigatus. Therefore, we aimed at obtaining a comprehensive overview about this process on the proteome level. To ensure highly reproducible growth conditions, an oxygen-controlled, glucose-limited chemostat cultivation was established. Two-dimensional gel electrophoresis analysis of mycelial and mitochondrial proteins as well as two-dimensional Blue Native/SDS-gel separation of mitochondrial membrane proteins led to the identification of 117 proteins with an altered abundance under hypoxic in comparison to normoxic conditions. Hypoxia induced an increased activity of glycolysis, the TCA-cycle, respiration, and amino acid metabolism. Consistently, the cellular contents in heme, iron, copper, and zinc increased. Furthermore, hypoxia induced biosynthesis of the secondary metabolite pseurotin A as demonstrated at proteomic, transcriptional, and metabolite levels. The observed and so far not reported stimulation of the biosynthesis of a secondary metabolite by oxygen depletion may also affect the survival of A. fumigatus in hypoxic niches of the human host. Among the proteins so far not implicated in hypoxia adaptation, an NO-detoxifying flavohemoprotein was one of the most highly up-regulated proteins which indicates a link between hypoxia and the generation of nitrosative stress in A. fumigatus.
Anticancer Targets in the Glycolytic Metabolism of Tumors: A Comprehensive Review
Porporato, Paolo E.; Dhup, Suveera; Dadhich, Rajesh K.; Copetti, Tamara; Sonveaux, Pierre
2011-01-01
Cancer is a metabolic disease and the solution of two metabolic equations: to produce energy with limited resources and to fulfill the biosynthetic needs of proliferating cells. Both equations are solved when glycolysis is uncoupled from oxidative phosphorylation in the tricarboxylic acid cycle, a process known as the glycolytic switch. This review addresses in a comprehensive manner the main molecular events accounting for high-rate glycolysis in cancer. It starts from modulation of the Pasteur Effect allowing short-term adaptation to hypoxia, highlights the key role exerted by the hypoxia-inducible transcription factor HIF-1 in long-term adaptation to hypoxia, and summarizes the current knowledge concerning the necessary involvement of aerobic glycolysis (the Warburg effect) in cancer cell proliferation. Based on the many observations positioning glycolysis as a central player in malignancy, the most advanced anticancer treatments targeting tumor glycolysis are briefly reviewed. PMID:21904528
Krznar, Petra; Hörl, Manuel; Ammar, Zeinab; Montessuit, Sylvie; Pierredon, Sandra; Zamboni, Nicola; Martinou, Jean-Claude
2016-01-01
Mitochondrial import of pyruvate by the mitochondrial pyruvate carrier (MPC) is a central step which links cytosolic and mitochondrial intermediary metabolism. To investigate the role of the MPC in mammalian physiology and development, we generated a mouse strain with complete loss of MPC1 expression. This resulted in embryonic lethality at around E13.5. Mouse embryonic fibroblasts (MEFs) derived from mutant mice displayed defective pyruvate-driven respiration as well as perturbed metabolic profiles, and both defects could be restored by reexpression of MPC1. Labeling experiments using 13C-labeled glucose and glutamine demonstrated that MPC deficiency causes increased glutaminolysis and reduced contribution of glucose-derived pyruvate to the TCA cycle. Morphological defects were observed in mutant embryonic brains, together with major alterations of their metabolome including lactic acidosis, diminished TCA cycle intermediates, energy deficit and a perturbed balance of neurotransmitters. Strikingly, these changes were reversed when the pregnant dams were fed a ketogenic diet, which provides acetyl-CoA directly to the TCA cycle and bypasses the need for a functional MPC. This allowed the normal gestation and development of MPC deficient pups, even though they all died within a few minutes post-delivery. This study establishes the MPC as a key player in regulating the metabolic state necessary for embryonic development, neurotransmitter balance and post-natal survival. PMID:27176894
Santos, Sónia Sá; Gibson, Gary E; Cooper, Arthur J L; Denton, Travis T; Thompson, Charles M; Bunik, Victoria I; Alves, Paula M; Sonnewald, Ursula
2006-02-15
Diminished activity of the alpha-ketoglutarate dehydrogenase complex (KGDHC), an important component of the tricarboxylic acid (TCA) cycle, occurs in several neurological diseases. The effect of specific KGDHC inhibitors [phosphonoethyl ester of succinyl phosphonate (PESP) and the carboxy ethyl ester of succinyl phosphonate (CESP)] on [1-13C]glucose and [U-13C]glutamate metabolism in intact cerebellar granule neurons was investigated. Both inhibitors decreased formation of [4-13C]glutamate from [1-13C]glucose, a reduction in label in glutamate derived from [1-13C]glucose/[U-13C]glutamate through a second turn of the TCA cycle and a decline in the amounts of gamma-aminobutyric acid (GABA), aspartate, and alanine. PESP decreased formation of [U-13C]aspartate and total glutathione, whereas CESP decreased concentrations of valine and leucine. The findings are consistent with decreased KGDHC activity; increased alpha-ketoglutarate formation; increased transamination of alpha-ketoglutarate with valine, leucine, and GABA; and new equilibrium position of the aspartate aminotransferase reaction. Overall, the findings also suggest that some carbon derived from alpha-ketoglutarate may bypass the block in the TCA cycle at KGDHC by means of the GABA shunt and/or conversion of valine to succinate. The results suggest the potential of succinyl phosphonate esters for modeling the biochemical and pathophysiological consequences of reduced KGDHC activity in brain diseases.
Falade, Titilayo D O; Chrysanthopoulos, Panagiotis K; Hodson, Mark P; Sultanbawa, Yasmina; Fletcher, Mary; Darnell, Ross; Korie, Sam; Fox, Glen
2018-05-07
Aflatoxin contamination is associated with the development of aflatoxigenic fungi such as Aspergillus flavus and A. parasiticus on food grains. This study was aimed at investigating metabolites produced during fungal development on maize and their correlation with aflatoxin levels. Maize cobs were harvested at R3 (milk), R4 (dough), and R5 (dent) stages of maturity. Individual kernels were inoculated in petri dishes with four doses of fungal spores. Fungal colonisation, metabolite profile, and aflatoxin levels were examined. Grain colonisation decreased with kernel maturity: milk-, dough-, and dent-stage kernels by approximately 100%, 60%, and 30% respectively. Aflatoxin levels increased with dose at dough and dent stages. Polar metabolites including alanine, proline, serine, valine, inositol, iso-leucine, sucrose, fructose, trehalose, turanose, mannitol, glycerol, arabitol, inositol, myo-inositol, and some intermediates of the tricarboxylic acid cycle (TCA—also known as citric acid or Krebs cycle) were important for dose classification. Important non-polar metabolites included arachidic, palmitic, stearic, 3,4-xylylic, and margaric acids. Aflatoxin levels correlated with levels of several polar metabolites. The strongest positive and negative correlations were with arabitol ( R = 0.48) and turanose and ( R = −0.53), respectively. Several metabolites were interconnected with the TCA; interconnections of the metabolites with the TCA cycle varied depending upon the grain maturity.
Araújo, Wagner L.; Nunes-Nesi, Adriano; Osorio, Sonia; Usadel, Björn; Fuentes, Daniela; Nagy, Réka; Balbo, Ilse; Lehmann, Martin; Studart-Witkowski, Claudia; Tohge, Takayuki; Martinoia, Enrico; Jordana, Xavier; DaMatta, Fábio M.; Fernie, Alisdair R.
2011-01-01
Transgenic tomato (Solanum lycopersicum) plants expressing a fragment of the Sl SDH2-2 gene encoding the iron sulfur subunit of the succinate dehydrogenase protein complex in the antisense orientation under the control of the 35S promoter exhibit an enhanced rate of photosynthesis. The rate of the tricarboxylic acid (TCA) cycle was reduced in these transformants, and there were changes in the levels of metabolites associated with the TCA cycle. Furthermore, in comparison to wild-type plants, carbon dioxide assimilation was enhanced by up to 25% in the transgenic plants under ambient conditions, and mature plants were characterized by an increased biomass. Analysis of additional photosynthetic parameters revealed that the rate of transpiration and stomatal conductance were markedly elevated in the transgenic plants. The transformants displayed a strongly enhanced assimilation rate under both ambient and suboptimal environmental conditions, as well as an elevated maximal stomatal aperture. By contrast, when the Sl SDH2-2 gene was repressed by antisense RNA in a guard cell–specific manner, changes in neither stomatal aperture nor photosynthesis were observed. The data obtained are discussed in the context of the role of TCA cycle intermediates both generally with respect to photosynthetic metabolism and specifically with respect to their role in the regulation of stomatal aperture. PMID:21307286
Muoio, Deborah M; Koves, Timothy R
2007-10-01
Dyslipidemia and intramuscular accumulation of fatty acid metabolites are increasingly recognized as core features of obesity and type 2 diabetes. Emerging evidence suggests that normal physiological adaptations to a heavy lipid load depend on the coordinated actions of broad transcriptional regulators such as the peroxisome proliferator activated receptors (PPARs) and PPAR gamma coactivator 1 alpha (PGC1 alpha). The application of transcriptomics and targeted metabolic profiling tools based on mass spectrometry has led to our finding that lipid-induced insulin resistance is a condition in which upregulation of PPAR-targeted genes and high rates of beta-oxidation are not supported by a commensurate upregulation of tricarboxylic acid (TCA) cycle activity. In contrast, exercise training enhances mitochondrial performance, favoring tighter coupling between beta-oxidation and the TCA cycle, and concomitantly restores insulin sensitivity in animals fed a chronic high-fat diet. The exercise-activated transcriptional coactivator, PGC1 alpha, plays a key role in coordinating metabolic flux through these 2 intersecting metabolic pathways, and its suppression by overfeeding may contribute to diet-induced mitochondrial dysfunction. Our emerging model predicts that muscle insulin resistance arises from a mitochondrial disconnect between beta-oxidation and TCA cycle activity. Understanding of this "disconnect" and its molecular basis may lead to new therapeutic approaches to combatting metabolic disease.
Protein-bound NAD(P)H Lifetime is Sensitive to Multiple Fates of Glucose Carbon.
Sharick, Joe T; Favreau, Peter F; Gillette, Amani A; Sdao, Sophia M; Merrins, Matthew J; Skala, Melissa C
2018-04-03
While NAD(P)H fluorescence lifetime imaging (FLIM) can detect changes in flux through the TCA cycle and electron transport chain (ETC), it remains unclear whether NAD(P)H FLIM is sensitive to other potential fates of glucose. Glucose carbon can be diverted from mitochondria by the pentose phosphate pathway (via glucose 6-phosphate dehydrogenase, G6PDH), lactate production (via lactate dehydrogenase, LDH), and rejection of carbon from the TCA cycle (via pyruvate dehydrogenase kinase, PDK), all of which can be upregulated in cancer cells. Here, we demonstrate that multiphoton NAD(P)H FLIM can be used to quantify the relative concentrations of recombinant LDH and malate dehydrogenase (MDH) in solution. In multiple epithelial cell lines, NAD(P)H FLIM was also sensitive to inhibition of LDH and PDK, as well as the directionality of LDH in cells forced to use pyruvate versus lactate as fuel sources. Among the parameters measurable by FLIM, only the lifetime of protein-bound NAD(P)H (τ 2 ) was sensitive to these changes, in contrast to the optical redox ratio, mean NAD(P)H lifetime, free NAD(P)H lifetime, or the relative amount of free and protein-bound NAD(P)H. NAD(P)H τ 2 offers the ability to non-invasively quantify diversions of carbon away from the TCA cycle/ETC, which may support mechanisms of drug resistance.
NASA Astrophysics Data System (ADS)
Guzman, Marcelo I.; Martin, Scot T.
2008-10-01
The carboxylic acids produced by the reductive tricarboxylic acid (rTCA) cycle are possibly a biosynthetic core of initial life, although several steps such as the reductive kinetics of oxaloacetate (OAA) to malate (MA) are problematic by conventional chemical routes. In this context, we studied the kinetics of this reaction as promoted by ZnS mineral photoelectrochemistry. The quantum efficiency φMA of MA production from the photoelectrochemical reduction of OAA followed φMA=0.13 [OAA] (2.1×10-3+[OAA])-1 and was independent of temperature (5 to 50°C). To evaluate the importance of this forward rate under a prebiotic scenario, we also studied the temperature-dependent rate of the backward thermal decarboxylation of OAA to pyruvate (PA), which followed an Arrhenius behavior as log (k-2)=11.74 4956/T, where k-2 is in units of s-1. These measured rates were employed in conjunction with the indirectly estimated carboxylation rate of PA to OAA to assess the possible importance of mineral photoelectrochemistry in the conversion of OAA to MA under several scenarios of prebiotic conditions on early Earth. As an example, our analysis shows that there is 90% efficiency with a forward velocity of 3 yr/cycle for the OAA→MA step of the rTCA cycle at 280 K. Efficiency and velocity both decrease for increasing temperature. These results suggest high viability for mineral photoelectrochemistry as an enzyme-free engine to drive the rTCA cycle through the early aeons of early Earth, at least for the investigated OAA→MA step.
Igamberdiev, Abir U.; Eprintsev, Alexander T.
2016-01-01
Organic acids are synthesized in plants as a result of the incomplete oxidation of photosynthetic products and represent the stored pools of fixed carbon accumulated due to different transient times of conversion of carbon compounds in metabolic pathways. When redox level in the cell increases, e.g., in conditions of active photosynthesis, the tricarboxylic acid (TCA) cycle in mitochondria is transformed to a partial cycle supplying citrate for the synthesis of 2-oxoglutarate and glutamate (citrate valve), while malate is accumulated and participates in the redox balance in different cell compartments (via malate valve). This results in malate and citrate frequently being the most accumulated acids in plants. However, the intensity of reactions linked to the conversion of these compounds can cause preferential accumulation of other organic acids, e.g., fumarate or isocitrate, in higher concentrations than malate and citrate. The secondary reactions, associated with the central metabolic pathways, in particularly with the TCA cycle, result in accumulation of other organic acids that are derived from the intermediates of the cycle. They form the additional pools of fixed carbon and stabilize the TCA cycle. Trans-aconitate is formed from citrate or cis-aconitate, accumulation of hydroxycitrate can be linked to metabolism of 2-oxoglutarate, while 4-hydroxy-2-oxoglutarate can be formed from pyruvate and glyoxylate. Glyoxylate, a product of either glycolate oxidase or isocitrate lyase, can be converted to oxalate. Malonate is accumulated at high concentrations in legume plants. Organic acids play a role in plants in providing redox equilibrium, supporting ionic gradients on membranes, and acidification of the extracellular medium. PMID:27471516
Yin, Zepeng; Ren, Jing; Zhou, Lijuan; Sun, Lina; Wang, Jiewan; Liu, Yulong; Song, Xingshun
2016-01-01
Drought (Water deficit, WD) poses a serious threat to extensively economic losses of trees throughout the world. Chinese dwarf cherry ( Cerasus humilis ) is a good perennial plant for studying the physiological and sophisticated molecular network under WD. The aim of this study is to identify the effect of WD on C. humilis through physiological and global proteomics analysis and improve understanding of the WD resistance of plants. Currently, physiological parameters were applied to investigate C. humilis response to WD. Moreover, we used two-dimensional gel electrophoresis (2DE) to identify differentially expressed proteins in C. humilis leaves subjected to WD (24 d). Furthermore, we also examined the correlation between protein and transcript levels. Several physiological parameters, including relative water content and Pn were reduced by WD. In addition, the malondialdehyde (MDA), relative electrolyte leakage (REL), total soluble sugar, and proline were increased in WD-treated C. humilis . Comparative proteomic analysis revealed 46 protein spots (representing 43 unique proteins) differentially expressed in C. humilis leaves under WD. These proteins were mainly involved in photosynthesis, ROS scavenging, carbohydrate metabolism, transcription, protein synthesis, protein processing, and nitrogen and amino acid metabolisms, respectively. WD promoted the CO 2 assimilation by increase light reaction and Calvin cycle, leading to the reprogramming of carbon metabolism. Moreover, the accumulation of osmolytes (i.e., proline and total soluble sugar) and enhancement of ascorbate-glutathione cycle and glutathione peroxidase/glutathione s-transferase pathway in leaves could minimize oxidative damage of membrane and other molecules under WD. Importantly, the regulation role of carbohydrate metabolisms (e. g. glycolysis, pentose phosphate pathways, and TCA) was enhanced. These findings provide key candidate proteins for genetic improvement of perennial plants metabolism under WD.
Yang, Jhung-Ahn; Yang, Sung-Hyun; Kim, Junghee; Kwon, Kae Kyoung; Oh, Hyun-Myung
2017-07-01
Here we report the comparative genomic analysis of strain UJ101 with 15 strains from the family Flavobacteriaceae, using the CGExplorer program. Flavobacteriales bacterium strain UJ101 was isolated from a xanthid crab, Atergatis reticulatus, from the East Sea near Korea. The complete genome of strain UJ101 is a 3,074,209 bp, single, circular chromosome with 30.74% GC content. While the UJ101 genome contains a number of annotated genes for many metabolic pathways, such as the Embden-Meyerhof pathway, the pentose phosphate pathway, the tricarboxylic acid (TCA) cycle, and the glyoxylate cycle, genes for the Entner-Douddoroff pathway are not found in the UJ101 genome. Overall, carbon fixation processes were absent but nitrate reduction and denitrification pathways were conserved. The UJ101 genome was compared to genomes from other marine animals (three invertebrate strains and 5 fish strains) and other marine animal- derived genera. Notable results by genome comparisons showed that UJ101 is capable of denitrification and nitrate reduction, and that biotin-thiamine pathway participation varies among marine bacteria; fish-dwelling bacteria, freeliving bacteria, invertebrate-dwelling bacteria, and strain UJ101. Pan-genome analysis of the 16 strains in this study included 7,220 non-redundant genes that covered 62% of the pan-genome. A core-genome of 994 genes was present and consisted of 8% of the genes from the pan-genome. Strain UJ101 is a symbiotic hetero-organotroph isolated from xanthid crab, and is a metabolic generalist with nitrate-reducing abilities but without the ability to synthesize biotin. There is a general tendency of UJ101 and some fish pathogens to prefer thiamine-dependent glycolysis to gluconeogenesis. Biotin and thiamine auxotrophy or prototrophy may be used as important markers in microbial community studies.
NASA Astrophysics Data System (ADS)
Dijkstra, P.; Fairbanks, D.; Miller, E.; Salpas, E.; Hagerty, S.
2013-12-01
Understanding the mechanisms regulating C cycling is hindered by our inability to directly observe and measure the biochemical processes of glycolysis, pentose phosphate pathway, and TCA cycle in intact and complex microbial communities. Position-specific 13C labeled metabolic tracer probing is proposed as a new way to study microbial community energy production, biosynthesis, C use efficiency (the proportion of substrate incorporated into microbial biomass), and enables the quantification of C fluxes through the central C metabolic network processes (Dijkstra et al 2011a,b). We determined the 13CO2 production from U-13C, 1-13C, 2-13C, 3-13C, 4-13C, 5-13C, and 6-13C labeled glucose and 1-13C and 2,3-13C pyruvate in parallel incubations in three soils along an elevation gradient. Qualitative and quantitative interpretation of the results indicate a high pentose phosphate pathway activity in soils. Agreement between modeled and measured CO2 production rates for the six C-atoms of 13C-labeled glucose indicate that the metabolic model used is appropriate for soil community processes, but that improvements can be made. These labeling and modeling techniques may improve our ability to analyze the biochemistry and (eco)physiology of intact microbial communities. Dijkstra, P., Blankinship, J.C., Selmants, P.C., Hart, S.C., Koch, G.W., Schwartz, E., Hungate, B.A., 2011a. Probing C flux patterns of soil microbial metabolic networks using parallel position-specific tracer labeling. Soil Biology & Biochemistry 43, 126-132. Dijkstra, P., Dalder, J.J., Selmants, P.C., Hart, S.C., Koch, G.W., Schwartz, E., Hungate, B.A., 2011b. Modeling soil metabolic processes using isotopologue pairs of position-specific 13C-labeled glucose and pyruvate. Soil Biology & Biochemistry 43, 1848-1857.
Anti-bacterial activity of Achatina CRP and its mechanism of action.
Mukherjee, Sandip; Barman, Soma; Mandal, Narayan Chandra; Bhattacharya, Shelley
2014-07-01
The physiological role of C-reactive protein (CRP), the classical acute-phase protein, is not well documented, despite many reports on biological effects of CRP in vitro and in model systems in vivo. It has been suggested that CRP protects mice against lethal toxicity of bacterial infections by implementing immunological responses. In Achatina fulica CRP is a constitutive multifunctional protein in haemolymph and considered responsible for their survival in the environment for millions of years. The efficacy of Achatina CRP (ACRP) was tested against both Salmonella typhimurium and Bacillus subtilis infections in mice where endogenous CRP level is negligible even after inflammatory stimulus. Further, growth curves of the bacteria revealed that ACRP (50 microg/mL) is bacteriostatic against gram negative salmonellae and bactericidal against gram positive bacilli. ACRP induced energy crises in bacterial cells, inhibited key carbohydrate metabolic enzymes such as phosphofructokinase in glycolysis, isocitrate dehydrogenase in TCA cycle, isocitrate lyase in glyoxylate cycle and fructose-1,6-bisphosphatase in gluconeogenesis. ACRP disturbed the homeostasis of cellular redox potential as well as reduced glutathione status, which is accompanied by an enhanced rate of lipid peroxidation. Annexin V-Cy3/CFDA dual staining clearly showed ACRP induced apoptosis-like death in bacterial cell population. Moreover, immunoblot analyses also indicated apoptosis-like death in ACRP treated bacterial cells, where activation of poly (ADP-ribose) polymerase-1 (PARP) and caspase-3 was noteworthy. It is concluded that metabolic impairment by ACRP in bacterial cells is primarily due to generation of reactive oxygen species and ACRP induced anti-bacterial effect is mediated by metabolic impairment leading to apoptosis-like death in bacterial cells.
NASA Astrophysics Data System (ADS)
Bomberg, M.; Lamminmäki, T.; Itävaara, M.
2015-08-01
The microbial diversity in oligotrophic isolated crystalline Fennoscandian Shield bedrock fracture groundwaters is great but the core community has not been identified. Here we characterized the bacterial and archaeal communities in 12 water conductive fractures situated at depths between 296 and 798 m by high throughput amplicon sequencing using the Illumina HiSeq platform. The great sequencing depth revealed that up to 95 and 99 % of the bacterial and archaeal communities, respectively, were composed of only a few common species, i.e. the core microbiome. However, the remaining rare microbiome contained over 3 and 6 fold more bacterial and archaeal taxa. Several clusters of co-occurring rare taxa were identified, which correlated significantly with physicochemical parameters, such as salinity, concentration of inorganic or organic carbon, sulphur, pH and depth. The metabolic properties of the microbial communities were predicted using PICRUSt. The rough prediction showed that the metabolic pathways included commonly fermentation, fatty acid oxidation, glycolysis/gluconeogenesis, oxidative phosphorylation and methanogenesis/anaerobic methane oxidation, but carbon fixation through the Calvin cycle, reductive TCA cycle and the Wood-Ljungdahl pathway was also predicted. The rare microbiome is an unlimited source of genomic functionality in all ecosystems. It may consist of remnants of microbial communities prevailing in earlier conditions on Earth, but could also be induced again if changes in their living conditions occur. In this study only the rare taxa correlated with any physicochemical parameters. Thus these microorganisms can respond to environmental change caused by physical or biological factors that may lead to alterations in the diversity and function of the microbial communities in crystalline bedrock environments.
Xiang, Rong; Shi, Junqiong; Zhang, Hongbo; Dong, Congcong; Liu, Li; Fu, JunKe; He, Xinyu; Yan, Yanjun; Wu, Zhongxing
2018-05-09
Bisphenol A has attracted worldwide attention due to its harmful effects on humans, animals and plants. In this study, the toxicological effects of BPA on Cylindrospermopsis raciborskii were assessed based on chlorophyll a fluorescence and transcriptome analyses. The results showed that the growth of C. raciborskii was significantly inhibited when BPA exceeded 0.1 mg L -1 . A marked rise of phase J was observed at a concentration greater than 0.1 mg L -1 , while a K phase appeared at 20 mg L -1 . The chlorophyll a fluorescence parameters of RC/CS 0 , F 0 , φ P0 , φ E0 , and ψ 0 , underwent a significant decline under all treatments of BPA, whereas a significant increase in both V J and M 0 occurred under all concentrations of BPA. Additionally, ABS/RC and DIo/RC markedly increased at 10 mg L -1 and 20 mg L -1 . The transcriptome analysis revealed that the genes of photosynthesis, including psbA, psbB, psbC, psbD, apcA, apcB, cpcA, and cpcB, as well as those of chlorophyll and carotenoid biosynthesis, namely hemN, acsF, chlL, chlN, chlP, crtB, pds, were all down-regulated. Moreover, BPA also inhibited the oxidative phosphorylation, glycolysis/gluconeogenesis, citrate cycle (TCA cycle), and fatty acid metabolism in C. raciborskii. Taken together, these results suggest BPA can negatively affect the expression of multiple genes and the vital energy metabolism process to arrest the growth and photosynthesis of C. raciborskii. Copyright © 2018 Elsevier B.V. All rights reserved.
Dynamic changes in metabolic profiles of rats subchronically exposed to mequindox.
Jiang, Limiao; Zhao, Xiuju; Huang, Chongyang; Lei, Hehua; Tang, Huiru; Wang, Yulan
2014-11-01
Mequindox is widely used as an antibacterial veterinary drug and a feeding additive for farm animals in China. Although its toxicity has been widely studied, little is known regarding the metabolic effects of subchronic exposure to mequindox, which is vital for the health of meat producing livestock. Here, we characterized the dose- and time-dependent metabolic alterations in female Wistar rats subchronically exposed to mequindox through dietary supplementation at the level of 40, 110 and 280 mg kg(-1) for 13 weeks, employing a NMR based metabonomics approach with supplementary information from serum clinical chemistry. We found that urinary metabolic profiles were significantly affected in all dosed groups during the supplementation period; plasma and hepatic metabolic profiles were significantly affected only in rats dosed with moderate and high levels of mequindox. We also observed a return to control levels, for the profiles of urine and liver, at all dose levels after a two weeks washout period. However, this was not the case for the metabolic profiles of plasma from rats dosed at high levels. At the molecular level, we showed that subchronic exposure to mequindox resulted in tricarboxylic acid cycle (TCA cycle) stimulation, suppression of glycolysis, and promotion of gluconeogenesis and lipid oxidation in rats. In addition, subchronic exposure to mequindox induced oxidative stress in rats. Furthermore, a disturbance of gut microbiota, manifested by alterations in the urinary excretion of hippurate, phenylacetylglycine, 3-(3-hydroxyphenyl)propionate, p-cresol glucuronide, methylamine, dimethylamine, and formate, was associated with mequindox exposure. The present study provided important holistic metabolic information on the effects of subchronic dosage of mequindox on rats, which is useful for evaluating the safety of mequindox usage in meat producing animals.
The odd-carbon medium-chain fatty triglyceride triheptanoin does not reduce hepatic steatosis.
Comhair, Tine M; Garcia Caraballo, Sonia C; Dejong, Cornelis H C; Lamers, Wouter H; Koehler, S Eleonore
2017-02-01
Non-alcoholic fatty-liver disease (NAFLD) is the hepatic manifestation of the metabolic syndrome. Previously, we showed that a high-protein diet minimized diet-induced development of fatty liver and even reversed pre-existing steatosis. A high-protein diet leads to amino-acid catabolism, which in turn causes anaplerosis of the tricarboxylic-acid (TCA) cycle. Therefore, we hypothesized that anaplerosis of the TCA cycle could be responsible for the high-protein diet-induced improvement of NAFLD by channeling amino acids into the TCA cycle. Next we considered that an efficient anaplerotic agent, the odd-carbon medium-chain triglyceride triheptanoin (TH), might have similar beneficial effects. C57BL/6J mice were fed low-fat (8en%) or high-fat (42en%) oleate-containing diets with or without 15en% TH for 3 weeks. TH treatment enhanced the hepatic capacity for fatty-acid oxidation by a selective increase in hepatic Ppara, Acox, and Cd36 expression, and a decline in plasma acetyl-carnitines. It also induced pyruvate cycling through an increased hepatic PCK1 protein concentration and it increased thermogenesis reflected by an increased Ucp2 mRNA content. TH, however, did not reduce hepatic lipid content. The comparison of the present effects of dietary triheptanoin with a previous study by our group on protein supplementation shows that the beneficial effects of the high-protein diet are not mimicked by TH. This argues against anaplerosis as the sole explanatory mechanism for the anti-steatotic effect of a high-protein diet. Copyright © 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.
Genetic alterations in Krebs cycle and its impact on cancer pathogenesis.
Sajnani, Karishma; Islam, Farhadul; Smith, Robert Anthony; Gopalan, Vinod; Lam, Alfred King-Yin
2017-04-01
Cancer cells exhibit alterations in many cellular processes, including oxygen sensing and energy metabolism. Glycolysis in non-oxygen condition is the main energy production process in cancer rather than mitochondrial respiration as in benign cells. Genetic and epigenetic alterations of Krebs cycle enzymes favour the shift of cancer cells from oxidative phosphorylation to anaerobic glycolysis. Mutations in genes encoding aconitase, isocitrate dehydrogenase, succinate dehydrogenase, fumarate hydratase, and citrate synthase are noted in many cancers. Abnormalities of Krebs cycle enzymes cause ectopic production of Krebs cycle intermediates (oncometabolites) such as 2-hydroxyglutarate, and citrate. These oncometabolites stabilize hypoxia inducible factor 1 (HIF1), nuclear factor like 2 (Nrf2), inhibit p53 and prolyl hydroxylase 3 (PDH3) activities as well as regulate DNA/histone methylation, which in turn activate cell growth signalling. They also stimulate increased glutaminolysis, glycolysis and production of reactive oxygen species (ROS). Additionally, genetic alterations in Krebs cycle enzymes are involved with increased fatty acid β-oxidations and epithelial mesenchymal transition (EMT) induction. These altered phenomena in cancer could in turn promote carcinogenesis by stimulating cell proliferation and survival. Overall, epigenetic and genetic changes of Krebs cycle enzymes lead to the production of oncometabolite intermediates, which are important driving forces of cancer pathogenesis and progression. Understanding and applying the knowledge of these mechanisms opens new therapeutic options for patients with cancer. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
The rate of lactate production from glucose in hearts is not altered by per-deuteration of glucose
NASA Astrophysics Data System (ADS)
Funk, Alexander M.; Anderson, Brian L.; Wen, Xiaodong; Hever, Thomas; Khemtong, Chalermchai; Kovacs, Zoltan; Sherry, A. Dean; Malloy, Craig R.
2017-11-01
This study was designed to determine whether perdeuterated glucose experiences a kinetic isotope effect (KIE) as glucose passes through glycolysis and is further oxidized in the tricarboxylic acid (TCA) cycle. Metabolism of deuterated glucose was investigated in two groups of perfused rat hearts. The control group was supplied with a 1:1 mixture of [U-13C6]glucose and [1,6-13C2]glucose, while the experimental group received [U-13C6,U-2H7]glucose and [1,6-13C2]glucose. Tissue extracts were analyzed by 1H, 2H and proton-decoupled 13C NMR spectroscopy. Extensive 2H-13C scalar coupling plus chemical shift isotope effects were observed in the proton-decoupled 13C NMR spectra of lactate, alanine and glutamate. A small but measureable (∼8%) difference in the rate of conversion of [U-13C6]glucose vs. [1,6-13C2]glucose to lactate, likely reflecting rates of Csbnd C bond breakage in the aldolase reaction, but conversion of [U-13C6]glucose versus [U-13C6,U-2H7]glucose to lactate did not differ. This shows that the presence of deuterium in glucose does not alter glycolytic flux. However, there were two distinct effects of deuteration on metabolism of glucose to alanine and oxidation of glucose in the TCA. First, alanine undergoes extensive exchange of methyl deuterons with solvent protons in the alanine amino transferase reaction. Second, there is a substantial kinetic isotope effect in metabolism of [U-13C6,U-2H7]glucose to alanine and glutamate. In the presence of [U-13C6,U-2H7]glucose, alanine and lactate are not in rapid exchange with the same pool of pyruvate. These studies indicate that the appearance of hyperpolarized 13C-lactate from hyperpolarized [U-13C6,U-2H7]glucose is not substantially influenced by a deuterium kinetic isotope effect.
Chicken or the egg: Warburg effect and mitochondrial dysfunction
Senyilmaz, Deniz
2015-01-01
Compared with normal cells, cancer cells show alterations in many cellular processes, including energy metabolism. Studies on cancer metabolism started with Otto Warburg's observation at the beginning of the last century. According to Warburg, cancer cells rely on glycolysis more than mitochondrial respiration for energy production. Considering that glycolysis yields much less energy compared with mitochondrial respiration, Warburg hypothesized that mitochondria must be dysfunctional and this is the initiating factor for cancer formation. However, this hypothesis did not convince every scientist in the field. Some believed the opposite: the reduction in mitochondrial activity is a result of increased glycolysis. This discrepancy of opinions is ongoing. In this review, we will discuss the alterations in glycolysis, pyruvate metabolism, and the Krebs cycle in cancer cells and focus on cause and consequence. PMID:26097714
Moon, Eunjung; Park, Hye Min; Lee, Choong Hwan; Do, Seon-Gil; Park, Jong-Moon; Han, Na-Young; Do, Moon Ho; Lee, Jong Ha; Lee, Hookeun; Kim, Sun Yeou
2015-03-18
Photodamage is extrinsically induced by overexposure to ultraviolet (UV) radiation, and it increases the risk of various skin disorders. Therefore, discovery of novel biomarkers of photodamage is important. In this study, using LC-MS/MS analysis of epidermis from UVB-irradiated hairless mice, we identified 57 proteins whose levels changed after UVB exposure, and selected 7 proteins related to the tricarboxylic acid (TCA) cycle through pathway analysis. Dihydrolipoyl dehydrogenase (DLD) was the only TCA cycle-associated protein that showed a decreased expression after the UVB exposure. We also performed targeted analysis to detect intermediates and products of the TCA cycle using GC-TOF-MS. Interestingly, malic acid and fumaric acid levels significantly decreased in the UVB-treated group. Our results demonstrate that DLD and its associated metabolites, malic acid and fumaric acid, may be candidate biomarkers of UVB-induced skin photoaging. Additionally, we showed that Aloe vera, a natural skin moisturizer, regulated DLD, malic acid and fumaric acid levels in UVB-exposed epidermis. Our strategy to integrate the proteome and targeted metabolite to detect novel UVB targets will lead to a better understanding of skin photoaging and photodamage. Our study also supports that A. vera exerts significant anti-photodamage activity via regulation of DLD, a novel UVB target, in the epidermis. This study is the first example of an integration of proteomic and metabolite analysis techniques to find new biomarker candidates for the regulation of the UVB-induced skin photoaging. DLD, malic acid, and fumaric acid can be used for development of cosmeceuticals and nutraceuticals regulating the change of skin metabolism induced by the UVB overexposure. Moreover, this is also the first attempt to investigate the role of the TCA cycle in photodamaged epidermis. Our integration of the proteomic and targeted metabolite analyses will lead to a better understanding of the unidentified photobiological results from UVB-irradiated models and can elicit new diagnostic and treatment strategies based on altered metabolism. Copyright © 2015. Published by Elsevier B.V.
Stoichiometry of Reducing Equivalents and Splitting of Water in the Citric Acid Cycle.
ERIC Educational Resources Information Center
Madeira, Vitor M. C.
1988-01-01
Presents a solution to the problem of finding the source of extra reducing equivalents, and accomplishing the stoichiometry of glucose oxidation reactions. Discusses the citric acid cycle and glycolysis. (CW)
Lu, Qian; Zhao, Yue; Gao, Xintong; Wu, Junqiu; Zhou, Haixuan; Tang, Pengfei; Wei, Qingbin; Wei, Zimin
2018-05-01
Composting is an environment friendly method to recycling organic waste. However, with the increasing concern about greenhouse gases generated in global atmosphere, it is significant to reduce the emission of carbon dioxide (CO 2 ). This study analyzes tricarboxylic acid (TCA) cycle regulators on the effect of reducing CO 2 emission, and the relationship among organic component (OC) degradation and transformation and microorganism during composting. The results showed that adding adenosine tri-phosphate (ATP) and nicotinamide adenine dinucleotide (NADH) could enhance the transformation of OC and increase the diversity of microorganism community. Malonic acid (MA) as a competitive inhibitor could decrease the emission of CO 2 by inhibiting the TCA cycle. A structural equation model was established to explore effects of different OC and microorganism on humic acid (HA) concentration during composting. Furthermore, added MA provided an environmental benefit in reducing the greenhouse gas emission for manufacture sustainable products. Copyright © 2018 Elsevier Ltd. All rights reserved.
Wheatley, Carmen
2007-01-01
The up-regulation of transcobalamins [hitherto posited as indicating a central need for cobalamin (Cbl) in inflammation], whose expression, like inducible nitric oxide synthase (iNOS), is Sp1- and interferondependent, together with increased intracellular formation of glutathionylcobalamin (GSCbl), adenosylcobalamin (AdoCbl), methylcobalamin (MeCbl), may be essential for the timely promotion and later selective inhibition of iNOS and concordant regulation of endothelial and neuronal NOS (eNOS/nNOS.) Cbl may ensure controlled high output of nitric oxide (NO) and its safe deployment, because: (1) Cbl is ultimately responsible for the synthesis or availability of the NOS substrates and cofactors heme, arginine, BH4 flavin adenine dinucleotide/flavin mononucleotide (FAD/FMN) and NADPH, via the far-reaching effects of the two Cbl coenzymes, methionine synthase (MS) and methylmalonyl CoA mutase (MCoAM) in, or on, the folate, glutathione, tricarboxylic acid (TCA) and urea cycles, oxidative phosphorylation, glycolysis and the pentose phosphate pathway. Deficiency of any of theNOS substrates and cofactors results in ‘uncoupled’ NOS reactions, decreasedNO production and increased or excessive O2−, H2O2, ONOO− and other reactive oxygen species (ROS), reactive nitric oxide species (RNIS) leading to pathology. (2) Cbl is also the overlooked ultimate determinant of positive glutathione status, which favours the formation of more benign NO species, s-nitrosothiols, the predominant form in which NO is safely deployed. Cbl status may consequently act as a ‘back-up disc’ that ensures the active status of antioxidant systems, as well as reversing and modulating the effects of nitrosylation in cell signal transduction.New evidence shows that GSCbl can significantly promote iNOS/ eNOS NO synthesis in the early stages of inflammation, thus lowering high levels of tumour necrosis factor-a that normally result in pathology, while existing evidence shows that in extreme nitrosative and oxidative stress, GSCbl can regenerate the activity of enzymes important for eventual resolution, such as glucose 6 phosphate dehydrogenase, which ensures NADPH supply, lactate dehydrogenase, and more; with human clinical case studies of OHCbl for cyanide poisoning, suggesting Cbl may regenerate aconitase and cytochrome c oxidase in the TCA cycle and oxidative phosphorylation. Thus, Cbl may simultaneously promote a strong inflammatory response and the means to resolve it. PMID:18836533
Etienne, Audrey; Génard, Michel; Bugaud, Christophe
2015-01-01
Citrate is one of the most important organic acids in many fruits and its concentration plays a critical role in organoleptic properties. The regulation of citrate accumulation throughout fruit development, and the origins of the phenotypic variability of the citrate concentration within fruit species remain to be clarified. In the present study, we developed a process-based model of citrate accumulation based on a simplified representation of the TCA cycle to predict citrate concentration in fruit pulp during the pre- and post-harvest stages. Banana fruit was taken as a reference because it has the particularity of having post-harvest ripening, during which citrate concentration undergoes substantial changes. The model was calibrated and validated on the two stages, using data sets from three contrasting cultivars in terms of citrate accumulation, and incorporated different fruit load, potassium supply, and harvest dates. The model predicted the pre and post-harvest dynamics of citrate concentration with fairly good accuracy for the three cultivars. The model suggested major differences in TCA cycle functioning among cultivars during post-harvest ripening of banana, and pointed to a potential role for NAD-malic enzyme and mitochondrial malate carriers in the genotypic variability of citrate concentration. The sensitivity of citrate accumulation to growth parameters and temperature differed among cultivars during post-harvest ripening. Finally, the model can be used as a conceptual basis to study citrate accumulation in fleshy fruits and may be a powerful tool to improve our understanding of fruit acidity.
Lipid-induced metabolic dysfunction in skeletal muscle.
Muoio, Deborah M; Koves, Timothy R
2007-01-01
Insulin resistance is a hallmark of type 2 diabetes and commonly observed in other energy-stressed settings such as obesity, starvation, inactivity and ageing. Dyslipidaemia and 'lipotoxicity'--tissue accumulation of lipid metabolites-are increasingly recognized as important drivers of insulin resistant states. Mounting evidence suggests that lipid-induced metabolic dysfunction in skeletal muscle is mediated in large part by stress-activated serine kinases that interfere with insulin signal transduction. However, the metabolic and molecular events that connect lipid oversupply to stress kinase activation and glucose intolerance are as yet unclear. Application of transcriptomics and targeted mass spectrometry-based metabolomics tools has led to our finding that insulin resistance is a condition in which muscle mitochondria are persistently burdened with a heavy lipid load. As a result, high rates of beta-oxidation outpace metabolic flux through the TCA cycle, leading to accumulation of incompletely oxidized acyl-carnitine intermediates. In contrast, exercise training enhances mitochondrial performance, favouring tighter coupling between beta-oxidation and the TCA cycle, and concomitantly restores insulin sensitivity in animals fed a chronic high fat diet. The exercise-activated transcriptional co-activator, PGC1alpha, plays a key role in co-ordinating metabolic flux through these two intersecting metabolic pathways, and its suppression by overfeeding may contribute to obesity-associated mitochondrial dysfunction. Our emerging model predicts that muscle insulin resistance arises from mitochondrial lipid stress and a resultant disconnect between beta-oxidation and TCA cycle activity. Understanding this 'disconnect' and its molecular basis may lead to new therapeutic targets for combating metabolic disease.
Chowdhury, Golam M I; Patel, Anant B; Mason, Graeme F; Rothman, Douglas L; Behar, Kevin L
2007-12-01
The contribution of glutamatergic and gamma-aminobutyric acid (GABA)ergic neurons to oxidative energy metabolism and neurotransmission in the developing brain is not known. Glutamatergic and GABAergic fluxes were assessed in neocortex of postnatal day 10 (P10) and 30 (P30) urethane-anesthetized rats infused intravenously with [1,6-(13)C(2)]glucose for different time intervals (time course) or with [2-(13)C]acetate for 2 to 3 h (steady state). Amino acid levels and (13)C enrichments were determined in tissue extracts ex vivo using (1)H-[(13)C]-NMR spectroscopy. Metabolic fluxes were estimated from the best fits of a three-compartment metabolic model (glutamatergic neurons, GABAergic neurons, and astroglia) to the (13)C-enrichment time courses of amino acids from [1,6-(13)C(2)]glucose, constrained by the ratios of neurotransmitter cycling (V(cyc))-to-tricarboxylic acid (TCA) cycle flux (V(TCAn)) calculated from the steady-state [2-(13)C]acetate enrichment data. From P10 to P30 increases in total neuronal (glutamate plus GABA) TCA cycle flux (3 x ; 0.24+/-0.05 versus 0.71+/-0.07 micromol per g per min, P<0.0001) and total neurotransmitter cycling flux (3.1 to 5 x ; 0.07 to 0.11 (+/-0.03) versus 0.34+/-0.03 micromol per g per min, P<0.0001) were approximately proportional. Incremental changes in total cycling (DeltaV(cyc(tot))) and neuronal TCA cycle flux (DeltaV(TCAn(tot))) between P10 and P30 were 0.23 to 0.27 and 0.47 micromol per g per min, respectively, similar to the approximately 1:2 relationship previously reported for adult cortex. For the individual neurons, increases in V(TCAn) and V(cyc) were similar in magnitude (glutamatergic neurons, 2.7 x versus 2.8 to 4.6 x ; GABAergic neurons, approximately 5 x versus approximately 7 x), although GABAergic flux changes were larger. The findings show that glutamate and GABA neurons undergo large and approximately proportional increases in neurotransmitter cycling and oxidative energy metabolism during this major postnatal growth spurt.
Introduction to the molecular basis of cancer metabolism and the Warburg effect.
Ngo, Darleen C; Ververis, Katherine; Tortorella, Stephanie M; Karagiannis, Tom C
2015-04-01
In differentiated normal cells, the conventional route of glucose metabolism involves glycolysis, followed by the citric acid cycle and electron transport chain to generate usable energy in the form of adenosine triphosphate (ATP). This occurs in the presence of oxygen. In hypoxic conditions, normal cells undergo anaerobic glycolysis to yield significantly less energy producing lactate as a product. As first highlighted in the 1920s by Otto Warburg, the metabolism exhibited by tumor cells involves an increased rate of aerobic glycolysis, known as the Warburg effect. In aerobic glycolysis, pyruvate molecules yielded from glycolysis are converted into fewer molecules of ATP even in the presence of oxygen. Evidence indicates that the reasons as to why tumor cells undergo aerobic glycolysis include: (1) the shift in priority to accumulate biomass rather than energy production, (2) the evasion of apoptosis as fewer reactive oxygen species are released by the mitochondria and (3) the production of lactate to further fuel growth of tumors. In this mini-review we discuss emerging molecular aspects of cancer metabolism and the Warburg effect. Aspects of the Warburg effect are analyzed in the context of the established hallmarks of cancer including the role of oncogenes and tumor suppressor genes.
Çakιr, Tunahan; Alsan, Selma; Saybaşιlι, Hale; Akιn, Ata; Ülgen, Kutlu Ö
2007-01-01
Background It is a daunting task to identify all the metabolic pathways of brain energy metabolism and develop a dynamic simulation environment that will cover a time scale ranging from seconds to hours. To simplify this task and make it more practicable, we undertook stoichiometric modeling of brain energy metabolism with the major aim of including the main interacting pathways in and between astrocytes and neurons. Model The constructed model includes central metabolism (glycolysis, pentose phosphate pathway, TCA cycle), lipid metabolism, reactive oxygen species (ROS) detoxification, amino acid metabolism (synthesis and catabolism), the well-known glutamate-glutamine cycle, other coupling reactions between astrocytes and neurons, and neurotransmitter metabolism. This is, to our knowledge, the most comprehensive attempt at stoichiometric modeling of brain metabolism to date in terms of its coverage of a wide range of metabolic pathways. We then attempted to model the basal physiological behaviour and hypoxic behaviour of the brain cells where astrocytes and neurons are tightly coupled. Results The reconstructed stoichiometric reaction model included 217 reactions (184 internal, 33 exchange) and 216 metabolites (183 internal, 33 external) distributed in and between astrocytes and neurons. Flux balance analysis (FBA) techniques were applied to the reconstructed model to elucidate the underlying cellular principles of neuron-astrocyte coupling. Simulation of resting conditions under the constraints of maximization of glutamate/glutamine/GABA cycle fluxes between the two cell types with subsequent minimization of Euclidean norm of fluxes resulted in a flux distribution in accordance with literature-based findings. As a further validation of our model, the effect of oxygen deprivation (hypoxia) on fluxes was simulated using an FBA-derivative approach, known as minimization of metabolic adjustment (MOMA). The results show the power of the constructed model to simulate disease behaviour on the flux level, and its potential to analyze cellular metabolic behaviour in silico. Conclusion The predictive power of the constructed model for the key flux distributions, especially central carbon metabolism and glutamate-glutamine cycle fluxes, and its application to hypoxia is promising. The resultant acceptable predictions strengthen the power of such stoichiometric models in the analysis of mammalian cell metabolism. PMID:18070347
Welkie, David; Zhang, Xiaohui; Markillie, Meng Lye; Taylor, Ronald; Orr, Galya; Jacobs, Jon; Bhide, Ketaki; Thimmapuram, Jyothi; Gritsenko, Marina; Mitchell, Hugh; Smith, Richard D; Sherman, Louis A
2014-12-29
Cyanothece sp. PCC 7822 is an excellent cyanobacterial model organism with great potential to be applied as a biocatalyst for the production of high value compounds. Like other unicellular diazotrophic cyanobacterial species, it has a tightly regulated metabolism synchronized to the light-dark cycle. Utilizing transcriptomic and proteomic methods, we quantified the relationships between transcription and translation underlying central and secondary metabolism in response to nitrogen free, 12 hour light and 12 hour dark conditions. By combining mass-spectrometry based proteomics and RNA-sequencing transcriptomics, we quantitatively measured a total of 6766 mRNAs and 1322 proteins at four time points across a 24 hour light-dark cycle. Photosynthesis, nitrogen fixation, and carbon storage relevant genes were expressed during the preceding light or dark period, concurrent with measured nitrogenase activity in the late light period. We describe many instances of disparity in peak mRNA and protein abundances, and strong correlation of light dependent expression of both antisense and CRISPR-related gene expression. The proteins for nitrogenase and the pentose phosphate pathway were highest in the dark, whereas those for glycolysis and the TCA cycle were more prominent in the light. Interestingly, one copy of the psbA gene encoding the photosystem II (PSII) reaction center protein D1 (psbA4) was highly upregulated only in the dark. This protein likely cannot catalyze O2 evolution and so may be used by the cell to keep PSII intact during N2 fixation. The CRISPR elements were found exclusively at the ends of the large plasmid and we speculate that their presence is crucial to the maintenance of this plasmid. This investigation of parallel transcriptional and translational activity within Cyanothece sp. PCC 7822 provided quantitative information on expression levels of metabolic pathways relevant to engineering efforts. The identification of expression patterns for both mRNA and protein affords a basis for improving biofuel production in this strain and for further genetic manipulations. Expression analysis of the genes encoded on the 6 plasmids provided insight into the possible acquisition and maintenance of some of these extra-chromosomal elements.
Towards an Understanding of Energy Impairment in Huntington’s Disease Brain
Dubinsky, Janet M.
2017-01-01
This review systematically examines the evidence for shifts in flux through energy generating biochemical pathways in Huntington’s disease (HD) brains from humans and model systems. Compromise of the electron transport chain (ETC) appears not to be the primary or earliest metabolic change in HD pathogenesis. Rather, compromise of glucose uptake facilitates glucose flux through glycolysis and may possibly decrease flux through the pentose phosphate pathway (PPP), limiting subsequent NADPH and GSH production needed for antioxidant protection. As a result, oxidative damage to key glycolytic and tricarboxylic acid (TCA) cycle enzymes further restricts energy production so that while basal needs may be met through oxidative phosphorylation, those of excessive stimulation cannot. Energy production may also be compromised by deficits in mitochondrial biogenesis, dynamics or trafficking. Restrictions on energy production may be compensated for by glutamate oxidation and/or stimulation of fatty acid oxidation. Transcriptional dysregulation generated by mutant huntingtin also contributes to energetic disruption at specific enzymatic steps. Many of the alterations in metabolic substrates and enzymes may derive from normal regulatory feedback mechanisms and appear oscillatory. Fine temporal sequencing of the shifts in metabolic flux and transcriptional and expression changes associated with mutant huntingtin expression remain largely unexplored and may be model dependent. Differences in disease progression among HD model systems at the time of experimentation and their varying states of metabolic compensation may explain conflicting reports in the literature. Progressive shifts in metabolic flux represent homeostatic compensatory mechanisms that maintain the model organism through presymptomatic and symptomatic stages. PMID:29125492
Metabolic characterization of invaded cells of the pancreatic cancer cell line, PANC-1.
Fujita, Mayumi; Imadome, Kaori; Imai, Takashi
2017-05-01
We previously reported that about 0.4% of cells in the cultured human pancreatic cancer cell line, PANC-1, can invade matrigel during the transwell invasion assay, suggesting that these invaded PANC-1 cells may have specific characteristics to keep their invasive potential. To identify the metabolic characterization specific in the invaded PANC-1 cells, metabolome analysis of the invaded PANC-1 compared with the whole cultured PANC-1 was performed using CE-TOFMS, and concentrations of 110 metabolites were measured. In contrast to the whole cultured cells, the invaded PANC-1 was characterized as a population with reduced levels of amino acids and TCA cycle intermediates, and decreased and increased intermediates in glycolysis and nucleic acid metabolism. In particular, the ratio of both adenosine and guanosine energy charge was reduced in the invaded cells, revealing that the consumption of ATP and GTP was high in the invaded cells, and thus suggesting that ATP- or GTP-generating pathways are stimulated. In addition, the GSH/GSSG ratio was low in the invaded cells, but these cells had a higher surviving fraction after exposure to hydrogen peroxide. Thus, the invaded cells were the population resistant to oxidative stress. Furthermore, reduction in intracellular GSH content inhibited PANC-1 invasiveness, indicated that GSH has an important role in PANC-1 invasiveness. Overall, we propose the invaded cells have several unique metabolic profiles. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
Yu, Xin-Jun; Sun, Jie; Zheng, Jian-Yong; Sun, Ya-Qi; Wang, Zhao
2016-04-01
Phytohormones are chemical messengers that have a positive effect on biodiesel production of microalgae at low concentrations. However, the effect of phytohormone 6-benzylaminopurine on lipid and docosahexaenoic acid (DHA) production in marine DHA-producer Aurantiochytrium has never been reported. In this study, a GC-MS-based metabolomics method combined with a multivariate analysis is applied to reveal the metabolic mechanism of 6-benzylaminopurine enhancing production of lipid and DHA in Aurantiochytrium sp.YLH70. In total, 71 metabolites were identified by GC-MS. The PCA model revealed that 76.9% of metabolite variation was related to 6-benzylaminopurine treatment, and overall metabolomics profiles between the 6-benzylaminopurine and control groups were clearly discriminated. Forty-six metabolites identified by the PLS-DA model were responsible for responding to 6-benzylaminopurine. Metabolic analysis showed that 6-benzylaminopurine could accelerate the rate of utilization of glucose in Aurantiochytrium sp. YLH70, and the metabolic flux from glycolysis, TCA cycle and mevalonate pathway to fatty acids biosynthesis was promoted. Moreover, the anti-stress mechanism in Aurantiochytrium sp.YLH70 might be induced by 6-benzylaminopurine. Metabolomics is a suitable tool to discover the metabolic mechanism for improving lipid and DHA accumulation in a microorganism. 6-benzylaminopurine has the potential to stimulate lipid and DHA production of Aurantiochytrium sp.YLH70 for industrial purposes. © 2015 The Authors. Journal of Chemical Technology & Biotechnology published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.
Negri, Alfredo S.; Prinsi, Bhakti; Failla, Osvaldo; Scienza, Attilio; Espen, Luca
2015-01-01
The role of grape berry skin as a protective barrier against damage by physical injuries and pathogen attacks requires a metabolism able to sustain biosynthetic activities such as those relating to secondary compounds (i.e., flavonoids). In order to draw the attention on these biochemical processes, a proteomic and metabolomic comparative analysis was performed among Riesling Italico, Pinot Gris, Pinot Noir, and Croatina cultivars, which are known to accumulate anthocyanins to a different extent. The application of multivariate statistics on the dataset pointed out that the cultivars were distinguishable from each other and the order in which they were grouped mainly reflected their relative anthocyanin contents. Sorting the spots according to their significance 100 proteins were characterized by LC-ESI-MS/MS. Through GC-MS, performed in Selected Ion Monitoring (SIM) mode, 57 primary metabolites were analyzed and the differences in abundance of 16 of them resulted statistically significant to ANOVA test. Considering the functional distribution, the identified proteins were involved in many physiological processes such as stress, defense, carbon metabolism, energy conversion and secondary metabolism. The trends of some metabolites were related to those of the protein data. Taken together, the results permitted to highlight the relationships between the secondary compound pathways and the main metabolism (e.g., glycolysis and TCA cycle). Moreover, the trend of accumulation of many proteins involved in stress responses, reinforced the idea that they could play a role in the cultivar specific developmental plan. PMID:26300900
A Metabolomics Study of BPTES Altered Metabolism in Human Breast Cancer Cell Lines.
Nagana Gowda, G A; Barding, Gregory A; Dai, Jin; Gu, Haiwei; Margineantu, Daciana H; Hockenbery, David M; Raftery, Daniel
2018-01-01
The Warburg effect is a well-known phenomenon in cancer, but the glutamine addiction in which cancer cells utilize glutamine as an alternative source of energy is less well known. Recent efforts have focused on preventing cancer cell proliferation associated with glutamine addiction by targeting glutaminase using the inhibitor BPTES (bis-2-(5-phenylacetamido-1,3,4-thiadiazol-2-yl)ethyl sulfide). In the current study, an investigation of the BPTES induced changes in metabolism was made in two human breast cancer cell lines, MCF7 (an estrogen receptor dependent cell line) and MDA-MB231 (a triple negative cell line), relative to the non-cancerous cell line, MCF10A. NMR spectroscopy combined with a recently established smart-isotope tagging approach enabled quantitative analysis of 41 unique metabolites representing numerous metabolite classes including carbohydrates, amino acids, carboxylic acids and nucleotides. BPTES induced metabolism changes in the cancer cell lines were especially pronounced under hypoxic conditions with up to 1/3 of the metabolites altered significantly ( p < 0.05) relative to untreated cells. The BPTES induced changes were more pronounced for MCF7 cells, with 14 metabolites altered significantly ( p < 0.05) compared to seven for MDA-MB231. Analyses of the results indicate that BPTES affected numerous metabolic pathways including glycolysis, TCA cycle, nucleotide and amino acid metabolism in cancer. The distinct metabolic responses to BPTES treatment determined in the two breast cancer cell lines offer valuable metabolic information for the exploration of the therapeutic responses to breast cancer.
Liu, Tie Fu; Vachharajani, Vidula; Millet, Patrick; Bharadwaj, Manish S.; Molina, Anthony J.; McCall, Charles E.
2015-01-01
We reported that NAD+-dependent SIRT1, RELB, and SIRT6 nuclear proteins in monocytes regulate a switch from the glycolysis-dependent acute inflammatory response to fatty acid oxidation-dependent sepsis adaptation. We also found that disrupting SIRT1 activity during adaptation restores immunometabolic homeostasis and rescues septic mice from death. Here, we show that nuclear SIRT1 guides RELB to differentially induce SIRT3 expression and also increases mitochondrial biogenesis, which alters bioenergetics during sepsis adaptation. We constructed this concept using TLR4-stimulated THP1 human promonocytes, a model that mimics the initiation and adaptation stages of sepsis. Following increased expression, mitochondrial SIRT3 deacetylase activates the rate-limiting tricarboxylic acid cycle (TCA) isocitrate dehydrogenase 2 and superoxide dismutase 2, concomitant with increases in citrate synthase activity. Mitochondrial oxygen consumption rate increases early and decreases during adaptation, parallel with modifications to membrane depolarization, ATP generation, and production of mitochondrial superoxide and whole cell hydrogen peroxide. Evidence of SIRT1-RELB induction of mitochondrial biogenesis included increases in mitochondrial mass, mitochondrial-to-nuclear DNA ratios, and both nuclear and mitochondrial encoded proteins. We confirmed the SIRT-RELB-SIRT3 adaptation link to mitochondrial bioenergetics in both TLR4-stimulated normal and sepsis-adapted human blood monocytes and mouse splenocytes. We also found that SIRT1 inhibition ex vivo reversed the sepsis-induced changes in bioenergetics. PMID:25404738
Shafi, Ayesha A.; Putluri, Vasanta; Arnold, James M.; Tsouko, Efrosini; Maity, Suman; Roberts, Justin M.; Coarfa, Cristian; Frigo, Daniel E.; Putluri, Nagireddy; Sreekumar, Arun; Weigel, Nancy L.
2015-01-01
Metastatic prostate cancer (PCa) is primarily an androgen-dependent disease, which is treated with androgen deprivation therapy (ADT). Tumors usually develop resistance (castration-resistant PCa [CRPC]), but remain androgen receptor (AR) dependent. Numerous mechanisms for AR-dependent resistance have been identified including expression of constitutively active AR splice variants lacking the hormone-binding domain. Recent clinical studies show that expression of the best-characterized AR variant, AR-V7, correlates with resistance to ADT and poor outcome. Whether AR-V7 is simply a constitutively active substitute for AR or has novel gene targets that cause unique downstream changes is unresolved. Several studies have shown that AR activation alters cell metabolism. Using LNCaP cells with inducible expression of AR-V7 as a model system, we found that AR-V7 stimulated growth, migration, and glycolysis measured by ECAR (extracellular acidification rate) similar to AR. However, further analyses using metabolomics and metabolic flux assays revealed several differences. Whereas AR increased citrate levels, AR-V7 reduced citrate mirroring metabolic shifts observed in CRPC patients. Flux analyses indicate that the low citrate is a result of enhanced utilization rather than a failure to synthesize citrate. Moreover, flux assays suggested that compared to AR, AR-V7 exhibits increased dependence on glutaminolysis and reductive carboxylation to produce some of the TCA (tricarboxylic acid cycle) metabolites. These findings suggest that these unique actions represent potential therapeutic targets. PMID:26378018
Overexpression of hypoxia-inducible factor and metabolic pathways: possible targets of cancer.
Singh, Davinder; Arora, Rohit; Kaur, Pardeep; Singh, Balbir; Mannan, Rahul; Arora, Saroj
2017-01-01
Cancer, the main cause of human deaths in the modern world is a group of diseases. Anticancer drug discovery is a challenge for scientists because of involvement of multiple survival pathways of cancer cells. An extensive study on the regulation of each step of these pathways may help find a potential cancer target. Up-regulated HIF-1 expression and altered metabolic pathways are two classical characteristics of cancer. Oxygen-dependent (through pVHL, PHDs, calcium-mediated) and independent (through growth factor signaling pathway, mdm2 pathway, HSP90) regulation of HIF-1α leads to angiogenesis, metastasis, and cell survival. The two subunits of HIF-1 regulates in the same fashion through different mechanisms. HIF-1α translation upregulates via mammalian target of rapamycin and mitogen-activated protein kinase signaling pathways, whereas HIF-1β through calmodulin kinase. Further, the stabilized interactions of these two subunits are important for proper functioning. Also, metabolic pathways crucial for the formation of building blocks (pentose phosphate pathway) and energy generation (glycolysis, TCA cycle and catabolism of glutamine) are altered in cancer cells to protect them from oxidative stress and to meet the reduced oxygen and nutrient supply. Up-regulated anaerobic metabolism occurs through enhanced expression of hexokinase, phosphofructokinase, triosephosphate isomerase, glucose 6-phosphate dehydrogenase and down-regulation of aerobic metabolism via pyruvate dehydrogenase kinase and lactate dehydrogenase which compensate energy requirements along with high glucose intake. Controlled expression of these two pathways through their common intermediate may serve as potent cancer target in future.
Absence of Complex I Is Associated with Diminished Respiratory Chain Function in European Mistletoe.
Maclean, Andrew E; Hertle, Alexander P; Ligas, Joanna; Bock, Ralph; Balk, Janneke; Meyer, Etienne H
2018-05-21
Parasitism is a life history strategy found across all domains of life whereby nutrition is obtained from a host. It is often associated with reductive evolution of the genome, including loss of genes from the organellar genomes [1, 2]. In some unicellular parasites, the mitochondrial genome (mitogenome) has been lost entirely, with far-reaching consequences for the physiology of the organism [3, 4]. Recently, mitogenome sequences of several species of the hemiparasitic plant mistletoe (Viscum sp.) have been reported [5, 6], revealing a striking loss of genes not seen in any other multicellular eukaryotes. In particular, the nad genes encoding subunits of respiratory complex I are all absent and other protein-coding genes are also lost or highly diverged in sequence, raising the question what remains of the respiratory complexes and mitochondrial functions. Here we show that oxidative phosphorylation (OXPHOS) in European mistletoe, Viscum album, is highly diminished. Complex I activity and protein subunits of complex I could not be detected. The levels of complex IV and ATP synthase were at least 5-fold lower than in the non-parasitic model plant Arabidopsis thaliana, whereas alternative dehydrogenases and oxidases were higher in abundance. Carbon flux analysis indicates that cytosolic reactions including glycolysis are greater contributors to ATP synthesis than the mitochondrial tricarboxylic acid (TCA) cycle. Our results describe the extreme adjustments in mitochondrial functions of the first reported multicellular eukaryote without complex I. Copyright © 2018 Elsevier Ltd. All rights reserved.
Das, Aayudh; Rushton, Paul J.; Rohila, Jai S.
2017-01-01
Soybean is an important crop that is continually threatened by abiotic stresses, especially drought and heat stress. At molecular levels, reduced yields due to drought and heat stress can be seen as a result of alterations in metabolic homeostasis of vegetative tissues. At present an incomplete understanding of abiotic stress-associated metabolism and identification of associated metabolites remains a major gap in soybean stress research. A study with a goal to profile leaf metabolites under control conditions (28/24 °C), drought [28/24 °C, 10% volumetric water content (VWC)], and heat stress (43/35 °C) was conducted in a controlled environment. Analyses of non-targeted metabolomic data showed that in response to drought and heat stress, key metabolites (carbohydrates, amino acids, lipids, cofactors, nucleotides, peptides and secondary metabolites) were differentially accumulated in soybean leaves. The metabolites for various cellular processes, such as glycolysis, the tricarboxylic acid (TCA) cycle, the pentose phosphate pathway, and starch biosynthesis, that regulate carbohydrate metabolism, amino acid metabolism, peptide metabolism, and purine and pyrimidine biosynthesis, were found to be affected by drought as well as heat stress. Computationally based regulatory networks predicted additional compounds that address the possibility of other metabolites and metabolic pathways that could also be important for soybean under drought and heat stress conditions. Metabolomic profiling demonstrated that in soybeans, keeping up with sugar and nitrogen metabolism is of prime significance, along with phytochemical metabolism under drought and heat stress conditions. PMID:28587097
Du, Dan; Gu, Haiwei; Djukovic, Danijel; Bettcher, Lisa; Gong, Meng; Zheng, Wen; Hu, Liqiang; Zhang, Xinyu; Zhang, Renke; Wang, Dongfang; Raftery, Daniel
2018-06-01
Obesity is fast becoming a serious health problem worldwide. Of the many possible antiobesity strategies, one interesting approach focuses on blocking adipocyte differentiation and lipid accumulation to counteract the rise in fat storage. However, there is currently no drug available for the treatment of obesity that works by inhibiting adipocyte differentiation. Here we use a broad-based metabolomics approach to interrogate and better understand metabolic changes that occur during adipocyte differentiation. In particular, we focus on changes induced by the antiadipogenic diarylheptanoid, which was isolated from a traditional Chinese medicine Dioscorea zingiberensis and identified as (3 R,5 R)-3,5-dihydroxy-1-(3,4-dihydroxyphenyl)-7-(4-hydroxyphenyl)-heptane (1). Targeted aqueous metabolic profiling indicated that a total of 14 metabolites involved in the TCA cycle, glycolysis, amino acid metabolism, and purine catabolism participate in regulating energy metabolism, lipogenesis, and lipolysis in adipocyte differentiation and can be modulated by diarylheptanoid 1. As indicated by lipidomics analysis, diarylheptanoid 1 restored the quantity and degree of unsaturation of long-chain free fatty acids and restored the levels of 171 lipids mainly from 10 lipid classes in adipocytes. In addition, carbohydrate metabolism in diarylheptanoid-1-treated adipocytes further demonstrated the delayed differentiation process by flux analysis. Our results provide valuable information for further understanding the metabolic adjustment in adipocytes subjected to diarylheptanoid 1 treatment. Moreover, this study offers new insight into developing antiadipogenic leading compounds based on metabolomics.
Qi, Nathan R.
2018-01-01
High capacity and low capacity running rats, HCR and LCR respectively, have been bred to represent two extremes of running endurance and have recently demonstrated disparities in fuel usage during transient aerobic exercise. HCR rats can maintain fatty acid (FA) utilization throughout the course of transient aerobic exercise whereas LCR rats rely predominantly on glucose utilization. We hypothesized that the difference between HCR and LCR fuel utilization could be explained by a difference in mitochondrial density. To test this hypothesis and to investigate mechanisms of fuel selection, we used a constraint-based kinetic analysis of whole-body metabolism to analyze transient exercise data from these rats. Our model analysis used a thermodynamically constrained kinetic framework that accounts for glycolysis, the TCA cycle, and mitochondrial FA transport and oxidation. The model can effectively match the observed relative rates of oxidation of glucose versus FA, as a function of ATP demand. In searching for the minimal differences required to explain metabolic function in HCR versus LCR rats, it was determined that the whole-body metabolic phenotype of LCR, compared to the HCR, could be explained by a ~50% reduction in total mitochondrial activity with an additional 5-fold reduction in mitochondrial FA transport activity. Finally, we postulate that over sustained periods of exercise that LCR can partly overcome the initial deficit in FA catabolic activity by upregulating FA transport and/or oxidation processes. PMID:29474500
Zheng, Yangyang; Yuan, Qianqian; Yang, Xiaoyan; Ma, Hongwu
2017-11-01
Poly-(3-hydroxybutyrate) (P3HB) is a promising biodegradable plastic synthesized from acetyl-CoA. One important factor affecting the P3HB production cost is the P3HB yield. Through flux balance analysis of an extended genome-scale metabolic network of E. coli, we found that the introduction of non-oxidative glycolysis pathway (NOG), a previously reported pathway enabling complete carbon conservation, can increase the theoretical carbon yield from 67% to 89%, equivalent to the theoretical mass yield from 0.48g P3HB/g glucose to 0.64g P3HB/g glucose. Based on this analysis result, we introduced phosphoketolase and enhanced the NOG pathway in E. coli. The mass yield in the engineered strain was increased from 0.16g P3HB/g glucose to 0.24g P3HB/g glucose. We further overexpressed pntAB to enhance the NADPH availability and down-regulated TCA cycle to divert more acetyl-CoA toward P3HB. The final construct accumulated 5.7g/L P3HB and reached a carbon yield of 0.43 (a mass yield of 0.31g P3HB/g glucose) in shake flask cultures in shake flask cultures. The introduction of NOG pathway could also be useful for improving yields of many other biochemicals derived from acetyl-coA. Copyright © 2017 Elsevier Inc. All rights reserved.
The avian cell line AGE1.CR.pIX characterized by metabolic flux analysis
2014-01-01
Background In human vaccine manufacturing some pathogens such as Modified Vaccinia Virus Ankara, measles, mumps virus as well as influenza viruses are still produced on primary material derived from embryonated chicken eggs. Processes depending on primary cell culture, however, are difficult to adapt to modern vaccine production. Therefore, we derived previously a continuous suspension cell line, AGE1.CR.pIX, from muscovy duck and established chemically-defined media for virus propagation. Results To better understand vaccine production processes, we developed a stoichiometric model of the central metabolism of AGE1.CR.pIX cells and applied flux variability and metabolic flux analysis. Results were compared to literature dealing with mammalian and insect cell culture metabolism focusing on the question whether cultured avian cells differ in metabolism. Qualitatively, the observed flux distribution of this avian cell line was similar to distributions found for mammalian cell lines (e.g. CHO, MDCK cells). In particular, glucose was catabolized inefficiently and glycolysis and TCA cycle seem to be only weakly connected. Conclusions A distinguishing feature of the avian cell line is that glutaminolysis plays only a minor role in energy generation and production of precursors, resulting in low extracellular ammonia concentrations. This metabolic flux study is the first for a continuous avian cell line. It provides a basis for further metabolic analyses to exploit the biotechnological potential of avian and vertebrate cell lines and to develop specific optimized cell culture processes, e.g. vaccine production processes. PMID:25077436
The avian cell line AGE1.CR.pIX characterized by metabolic flux analysis.
Lohr, Verena; Hädicke, Oliver; Genzel, Yvonne; Jordan, Ingo; Büntemeyer, Heino; Klamt, Steffen; Reichl, Udo
2014-07-30
In human vaccine manufacturing some pathogens such as Modified Vaccinia Virus Ankara, measles, mumps virus as well as influenza viruses are still produced on primary material derived from embryonated chicken eggs. Processes depending on primary cell culture, however, are difficult to adapt to modern vaccine production. Therefore, we derived previously a continuous suspension cell line, AGE1.CR.pIX, from muscovy duck and established chemically-defined media for virus propagation. To better understand vaccine production processes, we developed a stoichiometric model of the central metabolism of AGE1.CR.pIX cells and applied flux variability and metabolic flux analysis. Results were compared to literature dealing with mammalian and insect cell culture metabolism focusing on the question whether cultured avian cells differ in metabolism. Qualitatively, the observed flux distribution of this avian cell line was similar to distributions found for mammalian cell lines (e.g. CHO, MDCK cells). In particular, glucose was catabolized inefficiently and glycolysis and TCA cycle seem to be only weakly connected. A distinguishing feature of the avian cell line is that glutaminolysis plays only a minor role in energy generation and production of precursors, resulting in low extracellular ammonia concentrations. This metabolic flux study is the first for a continuous avian cell line. It provides a basis for further metabolic analyses to exploit the biotechnological potential of avian and vertebrate cell lines and to develop specific optimized cell culture processes, e.g. vaccine production processes.
Keohane, Colleen E; Steele, Andrew D; Fetzer, Christian; Khowsathit, Jittasak; Van Tyne, Daria; Moynié, Lucile; Gilmore, Michael S; Karanicolas, John; Sieber, Stephan A; Wuest, William M
2018-02-07
Natural products have served as an inspiration to scientists both for their complex three-dimensional architecture and exquisite biological activity. Promysalin is one such Pseudomonad secondary metabolite that exhibits narrow-spectrum antibacterial activity, originally isolated from the rhizosphere. We herein utilize affinity-based protein profiling (AfBPP) to identify succinate dehydrogenase (Sdh) as the biological target of the natural product. The target was further validated in silico, in vitro, in vivo, and through the selection, and sequencing, of a resistant mutant. Succinate dehydrogenase plays an essential role in primary metabolism of Pseudomonas aeruginosa as the only enzyme that is involved both in the tricarboxylic acid cycle (TCA) and in respiration via the electron transport chain. These findings add credence to other studies that suggest that the TCA cycle is an understudied target in the development of novel therapeutics to combat P. aeruginosa, a significant pathogen in clinical settings.
[Metabolic flux analysis of L-serine synthesis by Corynebacterium glutamicum SYPS-062].
Zhang, Xiaomei; Dou, Wenfang; Xu, Hongyu; Xu, Zhenghong
2010-10-01
Corynebacterium glutamicum SYPS-062 was an L-serine producing strain stored at our lab and could produce L-serine directly from sugar. We studied the effects of cofactors in one carbon unit metabolism-folate and VB12 on the cell growth, sucrose consumption and L-serine production by SYPS-062. In the same time, the metabolic flux distribution was determined in different conditions. The supplementation of folate or VB12 enhanced the cell growth, energy synthesis, and finally increased the flux of pentose phosphate pathway (HMP), whereas the carbon flux to L-serine was decreased. The addition of VB12 not only increased the ratio of L-serine synthesis pathway on G3P joint, but also caused the insufficiency of tricarboxylic acid cycle (TCA) flux, which needed more anaplerotic reaction flux to replenish TCA cycle, that was an important limiting factor for the further increasing of the L-serine productivity.
SbnG, a Citrate Synthase in Staphylococcus aureus
Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.; Heinrichs, David E.; Murphy, Michael E. P.
2014-01-01
In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. We present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic gene clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. A structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production. PMID:25336653
Sonnay, Sarah; Poirot, Jordan; Just, Nathalie; Clerc, Anne-Catherine; Gruetter, Rolf; Rainer, Gregor; Duarte, João M N
2018-03-01
Astrocytes play an important role in glutamatergic neurotransmission, namely by clearing synaptic glutamate and converting it into glutamine that is transferred back to neurons. The rate of this glutamate-glutamine cycle (V NT ) has been proposed to couple to that of glucose utilization and of neuronal tricarboxylic acid (TCA) cycle. In this study, we tested the hypothesis that glutamatergic neurotransmission is also coupled to the TCA cycle rate in astrocytes. For that we investigated energy metabolism by means of magnetic resonance spectroscopy (MRS) in the primary visual cortex of tree shrews (Tupaia belangeri) under light isoflurane anesthesia at rest and during continuous visual stimulation. After identifying the activated cortical volume by blood oxygenation level-dependent functional magnetic resonance imaging, 1 H MRS was performed to measure stimulation-induced variations in metabolite concentrations. Relative to baseline, stimulation of cortical activity for 20 min caused a reduction of glucose concentration by -0.34 ± 0.09 µmol/g (p < 0.001), as well as a -9% ± 1% decrease of the ratio of phosphocreatine-to-creatine (p < 0.05). Then 13 C MRS during [1,6- 13 C]glucose infusion was employed to measure fluxes of energy metabolism. Stimulation of glutamatergic activity, as indicated by a 20% increase of V NT , resulted in increased TCA cycle rates in neurons by 12% ( VTCAn, p < 0.001) and in astrocytes by 24% ( VTCAg, p = 0.007). We further observed linear relationships between V NT and both VTCAn and VTCAg. Altogether, these results suggest that in the tree shrew primary visual cortex glutamatergic neurotransmission is linked to overall glucose oxidation and to mitochondrial metabolism in both neurons and astrocytes. © 2017 Wiley Periodicals, Inc.
Constant growth rate can be supported by decreasing energy flux and increasing aerobic glycolysis.
Slavov, Nikolai; Budnik, Bogdan A; Schwab, David; Airoldi, Edoardo M; van Oudenaarden, Alexander
2014-05-08
Fermenting glucose in the presence of enough oxygen to support respiration, known as aerobic glycolysis, is believed to maximize growth rate. We observed increasing aerobic glycolysis during exponential growth, suggesting additional physiological roles for aerobic glycolysis. We investigated such roles in yeast batch cultures by quantifying O2 consumption, CO2 production, amino acids, mRNAs, proteins, posttranslational modifications, and stress sensitivity in the course of nine doublings at constant rate. During this course, the cells support a constant biomass-production rate with decreasing rates of respiration and ATP production but also decrease their stress resistance. As the respiration rate decreases, so do the levels of enzymes catalyzing rate-determining reactions of the tricarboxylic-acid cycle (providing NADH for respiration) and of mitochondrial folate-mediated NADPH production (required for oxidative defense). The findings demonstrate that exponential growth can represent not a single metabolic/physiological state but a continuum of changing states and that aerobic glycolysis can reduce the energy demands associated with respiratory metabolism and stress survival. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Morris, E Matthew; Meers, Grace M E; Koch, Lauren G; Britton, Steven L; Fletcher, Justin A; Fu, Xiaorong; Shankar, Kartik; Burgess, Shawn C; Ibdah, Jamal A; Rector, R Scott; Thyfault, John P
2016-10-01
Rats selectively bred for high capacity running (HCR) or low capacity running (LCR) display divergence for intrinsic aerobic capacity and hepatic mitochondrial oxidative capacity, both factors associated with susceptibility for nonalcoholic fatty liver disease. Here, we tested if HCR and LCR rats display differences in susceptibility for hepatic steatosis after 16 wk of high-fat diets (HFD) with either 45% or 60% of kcals from fat. HCR rats were protected against HFD-induced hepatic steatosis, whereas only the 60% HFD induced steatosis in LCR rats, as marked by a doubling of liver triglycerides. Hepatic complete fatty acid oxidation (FAO) and mitochondrial respiratory capacity were all lower in LCR compared with HCR rats. LCR rats also displayed lower hepatic complete and incomplete FAO in the presence of etomoxir, suggesting a reduced role for noncarnitine palmitoyltransferase-1-mediated lipid catabolism in LCR versus HCR rats. Hepatic complete FAO and mitochondrial respiration were largely unaffected by either chronic HFD; however, 60% HFD feeding markedly reduced 2-pyruvate oxidation, a marker of tricarboxylic acid (TCA) cycle flux, and mitochondrial complete FAO only in LCR rats. LCR rats displayed lower levels of hepatic long-chain acylcarnitines than HCR rats but maintained similar levels of hepatic acetyl-carnitine levels, further supporting lower rates of β-oxidation, and TCA cycle flux in LCR than HCR rats. Finally, only LCR rats displayed early reductions in TCA cycle genes after the acute initiation of a HFD. In conclusion, intrinsically high aerobic capacity confers protection against HFD-induced hepatic steatosis through elevated hepatic mitochondrial oxidative capacity.
Morris, E. Matthew; Meers, Grace M. E.; Koch, Lauren G.; Britton, Steven L.; Fletcher, Justin A.; Fu, Xiaorong; Shankar, Kartik; Burgess, Shawn C.; Ibdah, Jamal A.; Rector, R. Scott
2016-01-01
Rats selectively bred for high capacity running (HCR) or low capacity running (LCR) display divergence for intrinsic aerobic capacity and hepatic mitochondrial oxidative capacity, both factors associated with susceptibility for nonalcoholic fatty liver disease. Here, we tested if HCR and LCR rats display differences in susceptibility for hepatic steatosis after 16 wk of high-fat diets (HFD) with either 45% or 60% of kcals from fat. HCR rats were protected against HFD-induced hepatic steatosis, whereas only the 60% HFD induced steatosis in LCR rats, as marked by a doubling of liver triglycerides. Hepatic complete fatty acid oxidation (FAO) and mitochondrial respiratory capacity were all lower in LCR compared with HCR rats. LCR rats also displayed lower hepatic complete and incomplete FAO in the presence of etomoxir, suggesting a reduced role for noncarnitine palmitoyltransferase-1-mediated lipid catabolism in LCR versus HCR rats. Hepatic complete FAO and mitochondrial respiration were largely unaffected by either chronic HFD; however, 60% HFD feeding markedly reduced 2-pyruvate oxidation, a marker of tricarboxylic acid (TCA) cycle flux, and mitochondrial complete FAO only in LCR rats. LCR rats displayed lower levels of hepatic long-chain acylcarnitines than HCR rats but maintained similar levels of hepatic acetyl-carnitine levels, further supporting lower rates of β-oxidation, and TCA cycle flux in LCR than HCR rats. Finally, only LCR rats displayed early reductions in TCA cycle genes after the acute initiation of a HFD. In conclusion, intrinsically high aerobic capacity confers protection against HFD-induced hepatic steatosis through elevated hepatic mitochondrial oxidative capacity. PMID:27600823
Li, Yong; Wang, Huixia; Dai, Futao; Li, Pei; Jin, Xin; Huang, Yan; Nie, Zhou; Yao, Shouzhuo
2016-12-15
Citrate synthase (CS) is one of the key metabolic enzymes in the Krebs tricarboxylic acid (TCA) cycle. It regulates energy generation in mitochondrial respiration by catalysing the reaction between oxaloacetic acid (OAA) and acetyl coenzyme A (Ac-CoA) to generate citrate and coenzyme A (CoA). CS has been shown to be a biomarker of neurological diseases and various kinds of cancers. Here, a label-free fluorescent assay has been developed for homogeneously detecting CS and its inhibitor based on the in situ generation of CoA-Au(I) co-ordination polymer (CP) and the fluorescence signal-on by SYBR Green II-stained CoA-Au(I) CP. Because of the unique property of the CoA-Au(I) CP, this CS activity assay method could achieve excellent selectivity and sensitivity, with a linear range from 0.0033 U/μL to 0.264 U/μL and a limit of detection to be 0.00165 U/μL. Meanwhile, this assay method has advantages of being facile and cost effective with quick detection. Moreover, based on this method, a biomimetic logic system was established by rationally exploiting the cascade enzymatic interactions in TCA cycle for chemical information processing. In the TCA cycle-derived logic system, an AND-AND-AND-cascaded gate was rigorously operated step by step in one pot, and is outputted by a label-free fluorescent signal with visualized readout. Copyright © 2016 Elsevier B.V. All rights reserved.
Lu, Wanlu; Lu, Libing; Feng, Yun; Chen, Jiao; Li, Yan; Kong, Xiangli; Chen, Sixiu; Li, Xiaoyu; Chen, Qianming; Zhang, Ping
2013-05-01
The association between inflammation and cancer provides a new target for tumor biotherapy. The inflammatory cells and molecules within the tumor microenvironment have decisive dual roles in antitumor immunity and immune evasion. In the present study, phytohemagglutinin (PHA) was used to stimulate peripheral blood mononuclear cells (PBMCs) to simulate the tumor inflammatory microenvironment. The effect of immune cells and inflammatory cytokines on the surface expression of programmed cell death-1 ligand 1 (PD-L1) and tumor immune evasion was investigated using flow cytometry (FCM) and an in vivo xenotransplantation model. Based on the data, PHA-activated, but not resting, immune cells were able to promote the surface expression of PD-L1 in Tca8113 oral squamous carcinoma cells via the secretion of inflammatory cytokines, but not by cell-cell contact. The majority of the inflammatory cytokines had no significant effect on the proliferation, cell cycle progression and apoptosis of the Tca8113 cells, although they each induced the expression of PD-L1 in a dose-dependent manner. In total, 99% of the Tca8113 cells expressed PD-L1 following treatment with the supernatant of PHA-stimulated PBMCs. The PHA-supernatant pretreated Tca8113 cells unusually induced Tca8113 antigen-specific CD8 + T cell apoptosis in vitro and the evasion of antigen-specific T cell attraction in a nude mouse tumor-bearing model. These results indicate a new mechanism for the promotion of tumor immune evasion by the tumor inflammatory microenvironment.
LU, WANLU; LU, LIBING; FENG, YUN; CHEN, JIAO; LI, YAN; KONG, XIANGLI; CHEN, SIXIU; LI, XIAOYU; CHEN, QIANMING; ZHANG, PING
2013-01-01
The association between inflammation and cancer provides a new target for tumor biotherapy. The inflammatory cells and molecules within the tumor microenvironment have decisive dual roles in antitumor immunity and immune evasion. In the present study, phytohemagglutinin (PHA) was used to stimulate peripheral blood mononuclear cells (PBMCs) to simulate the tumor inflammatory microenvironment. The effect of immune cells and inflammatory cytokines on the surface expression of programmed cell death-1 ligand 1 (PD-L1) and tumor immune evasion was investigated using flow cytometry (FCM) and an in vivo xenotransplantation model. Based on the data, PHA-activated, but not resting, immune cells were able to promote the surface expression of PD-L1 in Tca8113 oral squamous carcinoma cells via the secretion of inflammatory cytokines, but not by cell-cell contact. The majority of the inflammatory cytokines had no significant effect on the proliferation, cell cycle progression and apoptosis of the Tca8113 cells, although they each induced the expression of PD-L1 in a dose-dependent manner. In total, 99% of the Tca8113 cells expressed PD-L1 following treatment with the supernatant of PHA-stimulated PBMCs. The PHA-supernatant pretreated Tca8113 cells unusually induced Tca8113 antigen-specific CD8+ T cell apoptosis in vitro and the evasion of antigen-specific T cell attraction in a nude mouse tumor-bearing model. These results indicate a new mechanism for the promotion of tumor immune evasion by the tumor inflammatory microenvironment PMID:23761816
Elucidating the role of copper in CHO cell energy metabolism using (13)C metabolic flux analysis.
Nargund, Shilpa; Qiu, Jinshu; Goudar, Chetan T
2015-01-01
(13)C-metabolic flux analysis was used to understand copper deficiency-related restructuring of energy metabolism, which leads to excessive lactate production in recombinant protein-producing CHO cells. Stationary-phase labeling experiments with U-(13)C glucose were conducted on CHO cells grown under high and limiting copper in 3 L fed-batch bioreactors. The resultant labeling patterns of soluble metabolites were measured by GC-MS and used to estimate metabolic fluxes in the central carbon metabolism pathways using OpenFlux. Fluxes were evaluated 300 times from stoichiometrically feasible random guess values and their confidence intervals calculated by Monte Carlo simulations. Results from metabolic flux analysis exhibited significant carbon redistribution throughout the metabolic network in cells under Cu deficiency. Specifically, glycolytic fluxes increased (25%-79% relative to glucose uptake) whereas fluxes through the TCA and pentose phosphate pathway (PPP) were lower (15%-23% and 74%, respectively) compared with the Cu-containing condition. Furthermore, under Cu deficiency, 33% of the flux entering TCA via the pyruvate node was redirected to lactate and malate production. Based on these results, we hypothesize that Cu deficiency disrupts the electron transport chain causing ATP deficiency, redox imbalance, and oxidative stress, which in turn drive copper-deficient CHO cells to produce energy via aerobic glycolysis, which is associated with excessive lactate production, rather than the more efficient route of oxidative phosphorylation. © 2015 American Institute of Chemical Engineers.
USDA-ARS?s Scientific Manuscript database
This study aimed to determine the contribution of substrates to tricarboxylic acid (TCA) cycle fluxes in rumen epithelial (REC) and duodenal mucosal (DMC) cells isolated from bulls (n = 6) fed either a 75% forage (HF) or 75% concentrate (HC) diet. In separate incubations, [13C6]glucose, [13C5]glutam...
Mechanisms of Mitochondrial Defects in Gulf War Syndrome
2012-08-01
oxidized; POR: porin; TCA: Tricarboxylic acid cycle ( Kreb cycle ). Page 2 Body: YEAR 1 of research (10/13/2009-7/14/2010) (9 months): Human... mitochondria , fatigue, myalgias 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON...abnormalities in genes that are related to mitochondrial function. Hence, investigation of mitochondrial dysfunction in GWS is a priority. Mitochondria
Fang, B; Zhang, M; Ge, K S; Xing, H Z; Ren, F Z
2018-06-01
Previous studies have demonstrated that the anti-tumor α-lactalbumin-oleic acid complex (α-LA-OA) may target the glycolysis of tumor cells. However, few data are available regarding the effects of α-LA-OA on energy metabolism. In this study, we measured glycolysis and mitochondrial functions in HeLa cells in response to α-LA-OA using the XF flux analyzer (Seahorse Bioscience, North Billerica, MA). The gene expression of enzymes involved in glycolysis, tricarboxylic acid cycle, electron transfer chain, and ATP synthesis were also evaluated. Our results show that α-LA-OA significantly enhanced the basal glycolysis and glycolytic capacity. Mitochondrial oxidative phosphorylation, including the basal respiration, maximal respiration, spare respiratory capacity and ATP production were also improved in response to α-LA-OA. The enhanced mitochondrial functions maybe partly due to the increased capacity of utilizing fatty acids and glutamine as the substrate. However, the gene expressions of pyruvate kinase M2, lactate dehydrogenase A, aconitate hydratase, and isocitrate dehydrogenase 1 were inhibited, suggesting an insufficient ability for the glycolysis process and the tricarboxylic acid cycle. The increased expression of acetyl-coenzyme A acyltransferase 2, a central enzyme involved in the β-oxidation of fatty acids, would enhance the unbalance due to the decreased expression of electron transfer flavoprotein β subunit, which acts as the electron acceptor. These results indicated that α-LA-OA may induce oxidative stress due to conditions in which the ATP production is exceeding the energy demand. Our results may help clarify the mechanism of apoptosis induced by reactive oxygen species and mitochondrial destruction. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Concurrent planning and execution for a walking robot
NASA Astrophysics Data System (ADS)
Simmons, Reid
1990-07-01
The Planetary Rover project is developing the Ambler, a novel legged robot, and an autonomous software system for walking the Ambler over rough terrain. As part of the project, we have developed a system that integrates perception, planning, and real-time control to navigate a single leg of the robot through complex obstacle courses. The system is integrated using the Task Control Architecture (TCA), a general-purpose set of utilities for building and controlling distributed mobile robot systems. The walking system, as originally implemented, utilized a sequential sense-plan-act control cycle. This report describes efforts to improve the performance of the system by concurrently planning and executing steps. Concurrency was achieved by modifying the existing sequential system to utilize TCA features such as resource management, monitors, temporal constraints, and hierarchical task trees. Performance was increased in excess of 30 percent with only a relatively modest effort to convert and test the system. The results lend support to the utility of using TCA to develop complex mobile robot systems.
Bromke, Mariusz A.; Giavalisco, Patrick; Willmitzer, Lothar; Hesse, Holger
2013-01-01
This report describes the metabolic and lipidomic profiling of 97 low-molecular weight compounds from the primary metabolism and 124 lipid compounds of the diatom Thalassiosira pseudonana. The metabolic profiles were created for diatoms perturbed for 24 hours with four different treatments: (I) removal of nitrogen, (II) lower iron concentration, (III) addition of sea salt, (IV) addition of carbonate to their growth media. Our results show that as early as 24 hours after nitrogen depletion significant qualitative and quantitative change in lipid composition as well as in the primary metabolism of Thalassiosira pseudonana occurs. So we can observe the accumulation of several storage lipids, namely triacylglycerides, and TCA cycle intermediates, of which citric acid increases more than 10-fold. These changes are positively correlated with expression of TCA enzymes genes. Next to the TCA cycle intermediates and storage lipid changes, we have observed decrease in N-containing lipids and primary metabolites such as amino acids. As a measure of counteracting nitrogen starvation, we have observed elevated expression levels of nitrogen uptake and amino acid biosynthetic genes. This indicates that diatoms can fast and efficiently adapt to changing environment by altering the metabolic fluxes and metabolite abundances. Especially, the accumulation of proline and the decrease of dimethylsulfoniopropionate suggest that the proline is the main osmoprotectant for the diatom in nitrogen rich conditions. PMID:23799147
Lu, Ming; Zhu, Xiao-Hong; Zhang, Yi; Mateescu, Gheorghe; Chen, Wei
2017-11-01
Quantitative assessment of cerebral glucose consumption rate (CMR glc ) and tricarboxylic acid cycle flux (V TCA ) is crucial for understanding neuroenergetics under physiopathological conditions. In this study, we report a novel in vivo Deuterium ( 2 H) MRS (DMRS) approach for simultaneously measuring and quantifying CMR glc and V TCA in rat brains at 16.4 Tesla. Following a brief infusion of deuterated glucose, dynamic changes of isotope-labeled glucose, glutamate/glutamine (Glx) and water contents in the brain can be robustly monitored from their well-resolved 2 H resonances. Dynamic DMRS glucose and Glx data were employed to determine CMR glc and V TCA concurrently. To test the sensitivity of this method in response to altered glucose metabolism, two brain conditions with different anesthetics were investigated. Increased CMR glc (0.46 vs. 0.28 µmol/g/min) and V TCA (0.96 vs. 0.6 µmol/g/min) were found in rats under morphine as compared to deeper anesthesia using 2% isoflurane. This study demonstrates the feasibility and new utility of the in vivo DMRS approach to assess cerebral glucose metabolic rates at high/ultrahigh field. It provides an alternative MRS tool for in vivo study of metabolic coupling relationship between aerobic and anaerobic glucose metabolisms in brain under physiopathological states.
Li, Qun; Degano, Alicia L.; Penati, Judith; Zhuo, Justin; Roe, Charles R.; Ronnett, Gabriele V.
2014-01-01
Rett syndrome (RTT) is an autism spectrum disorder (ASD) caused by mutations in the X-linked MECP2 gene that encodes methyl-CpG binding protein 2 (MeCP2). Symptoms range in severity and include psychomotor disabilities, seizures, ataxia, and intellectual disability. Symptom onset is between 6-18 months of age, a critical period of brain development that is highly energy-dependent. Notably, patients with RTT have evidence of mitochondrial dysfunction, as well as abnormal levels of the adipokines leptin and adiponectin, suggesting overall metabolic imbalance. We hypothesized that one contributor to RTT symptoms is energy deficiency due to defective nutrient substrate utilization by the TCA cycle. This energy deficit would lead to a metabolic imbalance, but would be treatable by providing anaplerotic substrates to the TCA cycle to enhance energy production. We show that dietary therapy with triheptanoin significantly increased longevity and improved motor function and social interaction in male mice hemizygous for Mecp2 knockout. Anaplerotic therapy in Mecp2 knockout mice also improved indicators of impaired substrate utilization, decreased adiposity, increased glucose tolerance and insulin sensitivity, decreased serum leptin and insulin, and improved mitochondrial morphology in skeletal muscle. Untargeted metabolomics of liver and skeletal muscle revealed increases in levels of TCA cycle intermediates with triheptanoin diet, as well as normalizations of glucose and fatty acid biochemical pathways consistent with the improved metabolic phenotype in Mecp2 knockout mice on triheptanoin. These results suggest that an approach using dietary supplementation with anaplerotic substrate is effective in improving symptoms and metabolic health in RTT. PMID:25299635
Zhang, Huiqing; Guo, Xu; Dai, Jingyao; Wu, Yousheng; Ge, Naijian; Yang, Yefa; Ji, Jiansong; Zhang, Hongxin
2014-11-01
Metabolic reprogramming is an important hallmark of cancer cells, including the alterations of activity and expression in tricarboxylic acid (TCA) cycle key enzymes. Previous studies have reported the associations between tumor formation and three core enzymes involved in the TCA cycle. However, the association between functional single nucleotide polymorphisms (SNPs) in one of TCA cycle key gene isocitrate dehydrogenase (IDH) and the overall survival of hepatocellular carcinoma (HCC) patients treated with transcatheter arterial chemoembolization (TACE) has never been investigated. Five functional SNPs in IDH1 and IDH2 genes were genotyped using the Sequenom iPLEX genotyping system in a cohort of 419 unresectable Chinese HCC patients treated with TACE. Multivariate Cox proportional hazards model and Kaplan-Meier curve were used for the prognosis analysis. We found that SNPs rs12478635 in IDH1 and rs11632348 in IDH2 gene exhibited significant associations with death risk in HCC patients in the dominant model (HR 1.33; 95 % CI 1.02-1.73; P = 0.037) and in recessive model (HR 1.87; 95 % CI 1.27-2.75; P = 0.001), respectively. Moreover, we observed a cumulative effect of these two SNPs on HCC overall survival, indicating a significant trend of death risk increase with increasing number of unfavorable genotypes (P for trend = 0.001). Additionally, our data suggest that unfavorable genotypes of two SNPs may be used as an independent prognostic marker in those with advanced stage and patients with serum AFP <200 μg/L. Our results for the first time suggest that IDH gene polymorphisms may serve as an independent prognostic marker for HCC patients treated with TACE.
Alteri, Christopher J.; Himpsl, Stephanie D.; Engstrom, Michael D.; Mobley, Harry L. T.
2012-01-01
ABSTRACT Proteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components. PMID:23111869
Yano, Takanori; Yoshida, Nobuyuki; Yu, Fujio; Wakamatsu, Miki; Takagi, Hiroshi
2015-07-01
Rhodococcus erythropolis N9T-4 shows extremely oligotrophic growth requiring atmospheric CO2 and forms its colonies on an inorganic basal medium (BM) without any additional carbon source. Screening of a random mutation library constructed by a unique genome deletion method that we established indicated that the aceA, aceB, and pckG genes encoding isocitrate lyase, malate synthase, and phosphoenolpyruvate carboxykinase, respectively, were requisite for survival on BM plates. The aceA- and aceB deletion mutants and the pckG deletion mutant grew well on BM plates containing L-malate and D-glucose, respectively, suggesting that the glyoxylate (GO) shunt and gluconeogenesis are essential for the oligotrophic growth of N9T-4. Interestingly, most of the enzyme activities in the TCA cycle were observed in the cell-free extract of N9T-4, with perhaps the most important exception being α-ketoglutarate dehydrogenase (KGDH) activity. Instead of the KGDH activity, we detected a remarkable level of α-ketoglutarate decarboxylase (KGD) activity, which is the activity exhibited by the E1 component of the KGDH complex in Mycobacterium tuberculosis. The recombinant KGD of N9T-4 catalyzed the decarboxylation of α-ketoglutarate to form succinic semialdehyde (SSA) in a time-dependent manner. Since N9T-4 also showed a detectable SSA dehydrogenase activity, we concluded that N9T-4 possesses a variant TCA cycle, which uses SSA rather than succinyl-CoA. These results suggest that oligotrophic N9T-4 cells utilize the GO shunt to avoid the loss of carbons as CO2 and to conserve CoA units in the TCA cycle.
Liu, Miao; Yang, Xiao-Ning; Zhu, Hui-Xia; Jia, Yuan-Yuan; Jia, Shi-Ru; Piergiovanni, Luciano
2014-01-01
A better understanding of metabolic fluxes is important for manipulating microbial metabolism toward desired end products, or away from undesirable by-products. A mutant strain, Gluconacetobacter xylinus AX2-16, was obtained by combined chemical mutation of the parent strain (G. xylinus CGMCC 2955) using DEC (diethyl sulfate) and LiCl. The highest bacterial cellulose production for this mutant was obtained at about 11.75 g/L, which was an increase of 62% compared with that by the parent strain. In contrast, gluconic acid (the main byproduct) concentration was only 5.71 g/L for mutant strain, which was 55.7% lower than that of parent strain. Metabolic flux analysis indicated that 40.1% of the carbon source was transformed to bacterial cellulose in mutant strain, compared with 24.2% for parent strain. Only 32.7% and 4.0% of the carbon source were converted into gluconic acid and acetic acid in mutant strain, compared with 58.5% and 9.5% of that in parent strain. In addition, a higher flux of tricarboxylic acid (TCA) cycle was obtained in mutant strain (57.0%) compared with parent strain (17.0%). It was also indicated from the flux analysis that more ATP was produced in mutant strain from pentose phosphate pathway (PPP) and TCA cycle. The enzymatic activity of succinate dehydrogenase (SDH), which is one of the key enzymes in TCA cycle, was 1.65-fold higher in mutant strain than that in parent strain at the end of culture. It was further validated by the measurement of ATPase that 3.53–6.41 fold higher enzymatic activity was obtained from mutant strain compared with parent strain. PMID:24901455
The TCA cycle is not required for selection or survival of multidrug-resistant Salmonella
Ricci, Vito; Loman, Nick; Pallen, Mark; Ivens, Alasdair; Fookes, Maria; Langridge, Gemma C.; Wain, John; Piddock, Laura J. V.
2012-01-01
Objectives The initial aim of this study was to use a systems biology approach to analyse a ciprofloxacin-selected multidrug-resistant (MDR) Salmonella enterica serotype Typhimurium, L664. Methods The whole genome sequence and transcriptome of L664 were analysed. Site-directed mutagenesis to recreate each mutation was carried out, followed by phenotypic characterization and mutation frequency analysis. As a mutation in the TCA cycle was detected we tested the controversial hypothesis regarding the bacterial response to bactericidal antibiotics, put forward by Kohanski et al. (Cell 2007; 130: 797–810 and Mol Cell 2010; 37: 311–20), that exposure of bacteria to agents such as ciprofloxacin produces reactive oxygen species (ROS), which transiently increase the mutation rate giving rise to MDR bacteria. Results L664 contained a mutation in ramR that conferred MDR. A mutation in tctA affected the TCA cycle and conferred the inability to grow on minimal agar. The virulence of L664 was not attenuated. Ciprofloxacin exposure produced ROS in L664 and SL1344 (tctA::aph), but it was reduced and occurred later. There were no significant differences in the rates of killing or mutations per generation to antibiotic resistance between the strains. Conclusions Whilst we confirm production of ROS in response to ciprofloxacin, we have no data to support the hypothesis that this leads to selection of MDR strains. Our results indicate that the mutations in tctA and glgA were random as they did not pre-exist in the parental strain, and that the mutation in tctA did not provide a survival advantage or disadvantage in the presence of antibiotic. PMID:22186876
Rezaei, Mohammad N; Aslankoohi, Elham; Verstrepen, Kevin J; Courtin, Christophe M
2015-07-02
Succinic acid produced by yeast during bread dough fermentation can significantly affect the rheological properties of the dough. By introducing mutations in the model S288C yeast strain, we show that the oxidative pathway of the TCA cycle and the glyoxylate shunt contribute significantly to succinic acid production during dough fermentation. More specifically, deletion of ACO1 and double deletion of ACO1 and ICL1 resulted in a 36 and 77% decrease in succinic acid levels in fermented dough, respectively. Similarly, double deletion of IDH1 and IDP1 decreased succinic acid production by 85%, while also affecting the fermentation rate. By contrast, double deletion of SDH1 and SDH2 resulted in a two-fold higher succinic acid accumulation compared to the wild-type. Deletion of fumarate reductase activity (FRD1 and OSM1) in the reductive pathway of the TCA cycle did not affect the fermentation rate and succinic acid production. The changes in the levels of succinic acid produced by mutants Δidh1Δidp1 (low level) and Δsdh1Δsdh2 (high level) in fermented dough only resulted in small pH differences, reflecting the buffering capacity of dough at a pH of around 5.1. Moreover, Rheofermentometer analysis using these mutants revealed no difference in maximum dough height and gas retention capacity with the dough prepared with S288C. The impact of the changed succinic acid profile on the organoleptic or antimicrobial properties of bread remains to be demonstrated. Copyright © 2015 Elsevier B.V. All rights reserved.
Comparative Analysis of the Mitochondrial Physiology of Pancreatic β Cells
Kim, Chul; Patel, Pinal; Gouvin, Lindsey M.; Brown, Melissa L.; Khalil, Ahmed; Henchey, Elizabeth M; Heuck, Alejandro P.; Yadava, Nagendra
2014-01-01
The mitochondrial metabolism of β cells is thought to be highly specialized. Its direct comparison with other cells using isolated mitochondria is limited by the availability of islets/β cells in sufficient quantity. In this study, we have compared mitochondrial metabolism of INS1E/β cells with other cells in intact and permeabilized states. To selectively permeabilize the plasma membrane, we have evaluated the use of perfringolysin-O (PFO) in conjunction with microplate-based respirometry. PFO is a protein that binds membranes based on a threshold level of active cholesterol. Therefore, unless active cholesterol reaches a threshold level in mitochondria, they are expected to remain untouched by PFO. Cytochrome c sensitivity tests showed that in PFO-permeabilized cells, the mitochondrial integrity was completely preserved. Our data show that a time-dependent decline of the oligomycin-insensitive respiration observed in INS1E cells was due to a limitation in substrate supply to the respiratory chain. We predict that it is linked with the β cell-specific metabolism involving metabolites shuttling between the cytoplasm and mitochondria. In permeabilized β cells, the Complex l-dependent respiration was either transient or absent because of the inefficient TCA cycle. The TCA cycle insufficiency was confirmed by analysis of the CO2 evolution. This may be linked with lower levels of NAD+, which is required as a co-factor for CO2 producing reactions of the TCA cycle. β cells showed comparable OxPhos and respiratory capacities that were not affected by the inorganic phosphate (Pi) levels in the respiration medium. They showed lower ADP-stimulation of the respiration on different substrates. We believe that this study will significantly enhance our understanding of the β cell mitochondrial metabolism. PMID:25309834
Thomas, Dennis G; Jaramillo-Riveri, Sebastian; Baxter, Douglas J; Cannon, William R
2014-12-26
We have applied a new stochastic simulation approach to predict the metabolite levels, material flux, and thermodynamic profiles of the oxidative TCA cycles found in E. coli and Synechococcus sp. PCC 7002, and in the reductive TCA cycle typical of chemolithoautotrophs and phototrophic green sulfur bacteria such as Chlorobaculum tepidum. The simulation approach is based on modeling states using statistical thermodynamics and employs an assumption similar to that used in transition state theory. The ability to evaluate the thermodynamics of metabolic pathways allows one to understand the relationship between coupling of energy and material gradients in the environment and the self-organization of stable biological systems, and it is shown that each cycle operates in the direction expected due to its environmental niche. The simulations predict changes in metabolite levels and flux in response to changes in cofactor concentrations that would be hard to predict without an elaborate model based on the law of mass action. In fact, we show that a thermodynamically unfavorable reaction can still have flux in the forward direction when it is part of a reaction network. The ability to predict metabolite levels, energy flow, and material flux should be significant for understanding the dynamics of natural systems and for understanding principles for engineering organisms for production of specialty chemicals.
The polyamines of Xanthium strumarium and their response to photoperiod.
Hamasaki, N; Galston, A W
1990-01-01
Flowering plants of Xanthium strumarium L., grown in 8 h photoperiods, were analysed for polyamines. Putrescine, spermidine and spermine were found throughout the plant in three forms: (a) as free polyamines; (b) conjugates soluble in 5% trichloracetic acid (TCA); and (c) bound to the TCA-insoluble precipitate. On a fresh weight basis, total polyamines are most abundant in young leaves and buds, especially flower buds. Spermidine predominates in the free polyamine fractions, while spermine is dominant in the conjugated fraction. Transfer of vegetative plants from 16 h photoperiods to 1, 2, 3, or 4 inductive cycles (8 h light + 16 h uninterrupted dark) caused rapid and marked changes in the polyamine titer of the leaves and ultimately, floral initiation. The titer of free putrescine per mg protein declined progressively with induction in all leaf sizes, while the titers of free spermidine and spermine rose during days 2 and 3 in small and expanding leaves. Conjugated putrescine, spermidine and spermine rose sharply after only 1 inductive cycle, especially in small and expanding leaves, and maintained the higher level for at least several cycles. In plants given 4 inductive cycles, buds harvested after 4 additional days had sharply elevated levels of conjugated polyamines, especially spermine, on a protein basis.
Rink, Cameron; Gnyawali, Surya; Stewart, Richard; Teplitsky, Seth; Harris, Hallie; Roy, Sashwati; Sen, Chandan K.; Khanna, Savita
2017-01-01
Ischemic stroke results in excessive release of glutamate, which contributes to neuronal cell death. Here, we test the hypothesis that otherwise neurotoxic glutamate can be productively metabolized by glutamate oxaloacetate transaminase (GOT) to maintain cellular energetics and protect the brain from ischemic stroke injury. The GOT-dependent metabolism of glutamate was studied in primary neural cells and in stroke-affected C57-BL6 mice using magnetic resonance spectroscopy and GC-MS. Extracellular Glu sustained cell viability under hypoglycemic conditions and increased GOT-mediated metabolism in vitro. Correction of stroke-induced hypoxia using supplemental oxygen in vivo lowered Glu levels as measured by 1H magnetic resonance spectroscopy. GOT knockdown abrogated this effect and caused ATP loss in the stroke-affected brain. GOT overexpression increased anaplerotic refilling of tricarboxylic acid cycle intermediates in mouse brain during ischemic stroke. Furthermore, GOT overexpression not only reduced ischemic stroke lesion volume but also attenuated neurodegeneration and improved poststroke sensorimotor function. Taken together, our results show that GOT enables metabolism of otherwise neurotoxic extracellular Glu through a truncated tricarboxylic acid cycle under hypoglycemic conditions.—Rink, C., Gnyawali, S., Stewart, R., Teplitsky, S., Harris, H., Roy, S., Sen, C. K., Khanna, S. Glutamate oxaloacetate transaminase enables anaplerotic refilling of TCA cycle intermediates in stroke-affected brain. PMID:28096234
Tiwari, Vivek; Veeraiah, Pandichelvam; Subramaniam, Vaidyanathan; Patel, Anant Bahadur
2014-03-01
This study investigates the effects of ethanol on neuronal and astroglial metabolism using (1)H-[(13)C]-NMR spectroscopy in conjunction with infusion of [1,6-(13)C2]/[1-(13)C]glucose or [2-(13)C]acetate, respectively. A three-compartment metabolic model was fitted to the (13)C turnover of GluC3 , GluC4, GABAC 2, GABAC 3, AspC3 , and GlnC4 from [1,6-(13)C2 ]glucose to determine the rates of tricarboxylic acid (TCA) and neurotransmitter cycle associated with glutamatergic and GABAergic neurons. The ratio of neurotransmitter cycle to TCA cycle fluxes for glutamatergic and GABAegic neurons was obtained from the steady-state [2-(13)C]acetate experiment and used as constraints during the metabolic model fitting. (1)H MRS measurement suggests that depletion of ethanol from cerebral cortex follows zero order kinetics with rate 0.18 ± 0.04 μmol/g/min. Acute exposure of ethanol reduces the level of glutamate and aspartate in cortical region. GlnC4 labeling was found to be unchanged from a 15 min infusion of [2-(13)C]acetate suggesting that acute ethanol exposure does not affect astroglial metabolism in naive mice. Rates of TCA and neurotransmitter cycle associated with glutamatergic and GABAergic neurons were found to be significantly reduced in cortical and subcortical regions. Acute exposure of ethanol perturbs the level of neurometabolites and decreases the excitatory and inhibitory activity differentially across the regions of brain. Depletion of ethanol and its effect on brain functions were measured using (1)H and (1)H-[(13)C]-NMR spectroscopy in conjunction with infusion of (13)C-labeled substrates. Ethanol depletion from brain follows zero order kinetics. Ethanol perturbs level of glutamate, and the excitatory and inhibitory activity in mice brain. © 2013 International Society for Neurochemistry.
ERIC Educational Resources Information Center
Voige, William H.
1981-01-01
Two new packages designed to aid students in typical undergraduate biochemistry courses are described. These packages deal with alcoholic fermentation and the reversal of glycolysis and the reactions of the citric cycle. (MP)
Butyrate induces apoptosis by activating PDC and inhibiting complex I through SIRT3 inactivation.
Xu, Sha; Liu, Cai-Xia; Xu, Wei; Huang, Lei; Zhao, Jian-Yuan; Zhao, Shi-Min
2017-01-01
The underlying anticancer effects of butyrate, an end-product of the intestinal microbial fermentation of dietary fiber, remain elusive. Here, we report that butyrate promotes cancer cell apoptosis by acting as a SIRT3 inhibitor. Butyrate inhibits SIRT3 both in cultured cells and in vitro . Butyrate-induced PDHA1 hyperacetylation relieves the inhibitory phosphorylation of PDHA1 at serine 293, thereby activating an influx of glycolytic intermediates into the tricarboxylic acid (TCA) cycle and reversing the Warburg effect. Meanwhile, butyrate-induced hyperacetylation inactivates complex I of the electron transfer chain and prevents the utilization of TCA cycle intermediates. These metabolic stresses promote apoptosis in hyperglycolytic cancer cells, such as HCT116 p53 -/- cells. SIRT3 deacetylates both PDHA1 and complex I. Genetic ablation of Sirt3 in mouse hepatocytes abrogated the ability of butyrate to induce apoptosis. Our results identify a butyrate-mediated anti-tumor mechanism and indicate that the combined activation of PDC and inhibition of complex I is a novel tumor treatment strategy.
Yang, Chendong; Ko, Bookyung; Hensley, Christopher T; Jiang, Lei; Wasti, Ajla T; Kim, Jiyeon; Sudderth, Jessica; Calvaruso, Maria Antonietta; Lumata, Lloyd; Mitsche, Matthew; Rutter, Jared; Merritt, Matthew E; DeBerardinis, Ralph J
2014-11-06
Alternative modes of metabolism enable cells to resist metabolic stress. Inhibiting these compensatory pathways may produce synthetic lethality. We previously demonstrated that glucose deprivation stimulated a pathway in which acetyl-CoA was formed from glutamine downstream of glutamate dehydrogenase (GDH). Here we show that import of pyruvate into the mitochondria suppresses GDH and glutamine-dependent acetyl-CoA formation. Inhibiting the mitochondrial pyruvate carrier (MPC) activates GDH and reroutes glutamine metabolism to generate both oxaloacetate and acetyl-CoA, enabling persistent tricarboxylic acid (TCA) cycle function. Pharmacological blockade of GDH elicited largely cytostatic effects in culture, but these effects became cytotoxic when combined with MPC inhibition. Concomitant administration of MPC and GDH inhibitors significantly impaired tumor growth compared to either inhibitor used as a single agent. Together, the data define a mechanism to induce glutaminolysis and uncover a survival pathway engaged during compromised supply of pyruvate to the mitochondria. Copyright © 2014 Elsevier Inc. All rights reserved.
Yang, Chendong; Ko, Bookyung; Hensley, Christopher T.; Jiang, Lei; Wasti, Ajla T.; Kim, Jiyeon; Sudderth, Jessica; Calvaruso, Maria Antonietta; Lumata, Lloyd; Mitsche, Matthew; Rutter, Jared; Merritt, Matthew E.; DeBerardinis, Ralph J.
2014-01-01
Summary Alternative modes of metabolism enable cells to resist metabolic stress. Inhibiting these compensatory pathways may produce synthetic lethality. We previously demonstrated that glucose deprivation stimulated a pathway in which acetyl-CoA was formed from glutamine downstream of glutamate dehydrogenase (GDH). Here we show that import of pyruvate into the mitochondria suppresses GDH and glutamine-dependent acetyl-CoA formation. Inhibiting the mitochondrial pyruvate carrier (MPC) activates GDH and re-routes glutamine metabolism to generate both oxaloacetate and acetyl-CoA, enabling persistent tricarboxylic acid (TCA) cycle function. Pharmacological blockade of GDH elicited largely cytostatic effects in culture, but these effects became cytotoxic when combined with MPC inhibition. Concomitant administration of MPC and GDH inhibitors significantly impaired tumor growth compared to either inhibitor used as a single agent. Together, the data define a mechanism to induce glutaminolysis and uncover a survival pathway engaged during compromised supply of pyruvate to the mitochondria. PMID:25458842
SbnG, a citrate synthase in Staphylococcus aureus: A new fold on an old enzyme
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.
In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. In this paper, we present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic genemore » clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. Finally, a structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production.« less
Index markers of chronic fatigue syndrome with dysfunction of TCA and urea cycles
Yamano, Emi; Sugimoto, Masahiro; Hirayama, Akiyoshi; Kume, Satoshi; Yamato, Masanori; Jin, Guanghua; Tajima, Seiki; Goda, Nobuhito; Iwai, Kazuhiro; Fukuda, Sanae; Yamaguti, Kouzi; Kuratsune, Hirohiko; Soga, Tomoyoshi; Watanabe, Yasuyoshi; Kataoka, Yosky
2016-01-01
Chronic fatigue syndrome (CFS) is a persistent and unexplained pathological state characterized by exertional and severely debilitating fatigue, with/without infectious or neuropsychiatric symptoms, lasting at least 6 consecutive months. Its pathogenesis remains incompletely understood. Here, we performed comprehensive metabolomic analyses of 133 plasma samples obtained from CFS patients and healthy controls to establish an objective diagnosis of CFS. CFS patients exhibited significant differences in intermediate metabolite concentrations in the tricarboxylic acid (TCA) and urea cycles. The combination of ornithine/citrulline and pyruvate/isocitrate ratios discriminated CFS patients from healthy controls, yielding area under the receiver operating characteristic curve values of 0.801 (95% confidential interval [CI]: 0.711–0.890, P < 0.0001) and 0.750 (95% CI: 0.584–0.916, P = 0.0069) for training (n = 93) and validation (n = 40) datasets, respectively. These findings provide compelling evidence that a clinical diagnostic tool could be developed for CFS based on the ratios of metabolites in plasma. PMID:27725700
Biochemical consequences of alginate encapsulation: a NMR study of insulin-secreting cells.
Simpson, Nicholas E; Grant, Samuel C; Gustavsson, Lenita; Peltonen, Vilje-Mia; Blackband, Stephen J; Constantinidis, Ioannis
2006-04-01
In this study we explore the biochemical consequences of alginate encapsulation on betaTC3 cells. (13)C NMR spectroscopy and isotopomer analysis were used to investigate the effects of encapsulation on several enzymatic processes associated with the TCA cycle. Our data show statistically significant differences in various enzymatic fluxes related to the TCA cycle and insulin secretion between monolayer and alginate-encapsulated cultures. The principal cause for these effects was the process of trypsinization. Embedding the trypsinized cells in alginate beads did not have a compounded effect on the enzymatic fluxes of entrapped cells. However, an additional small but statistically significant decrease in insulin secretion was measured in encapsulated cells. Finally, differences in either enzymatic fluxes or glucose consumption as a function of bead diameter were not observed. However, differences in T(2), assessed by (1)H NMR microimaging, were observed as a function of bead diameter, suggesting that smaller beads became more organized with time in culture, while larger beads displayed a looser organization.
Sunny, Nishanth E.; Parks, Elizabeth J.; Browning, Jeffrey D.; Burgess, Shawn C.
2013-01-01
Summary Approximately one-third of the U.S. population has nonalcoholic fatty liver disease (NAFLD), a condition closely associated with insulin resistance and increased risk of liver injury. Dysregulated mitochondrial metabolism is central in these disorders, but the manner and degree of dysregulation are disputed. This study tested whether humans with NAFLD have abnormal in vivo hepatic mitochondrial metabolism. Subjects with low (3.0%) and high (17%) intrahepatic triglyceride (IHTG) were studied using 2H and 13C tracers to evaluate systemic lipolysis, hepatic glucose production, and mitochondrial pathways (TCA cycle, anaplerosis, and ketogenesis). Individuals with NAFLD had 50% higher rates of lipolysis and 30% higher rates of gluconeogenesis. There was a positive correlation between IHTG content and both mitochondrial oxidative and anaplerotic fluxes. These data indicate that mitochondrial oxidative metabolism is ∼2-fold greater in those with NAFLD, providing a potential link between IHTG content, oxidative stress, and liver damage. PMID:22152305
SbnG, a citrate synthase in Staphylococcus aureus: A new fold on an old enzyme
Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.; ...
2014-10-21
In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. In this paper, we present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic genemore » clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. Finally, a structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production.« less
SbnG, a citrate synthase in Staphylococcus aureus: a new fold on an old enzyme.
Kobylarz, Marek J; Grigg, Jason C; Sheldon, Jessica R; Heinrichs, David E; Murphy, Michael E P
2014-12-05
In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. We present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic gene clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. A structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Qiu, Jian-Hua; Li, You-Wei; Xie, Hong-Li; Li, Qing; Dong, Hai-Bo; Sun, Ming-Ju; Gao, Wei-Qiang; Tan, Jing-He
2016-08-01
Although great efforts were made to prolong the fertility of liquid-stored semen, limited improvements have been achieved in different species. Although it is expected that energy supply and the redox potential will play an essential role in sperm function, there are few reports on the impact of specific energy substrates on spermatozoa during liquid semen storage. Furthermore, although it is accepted that glucose metabolism through glycolysis provides energy, roles of pentose phosphate pathway (PPP) and tricarboxylic acid cycle remain to be unequivocally found in spermatozoa. We have studied the pathways by which spermatozoa metabolize glucose during long-term liquid storage of goat semen. The results indicated that among the substrates tested, glucose and pyruvate were better than lactate in maintaining goat sperm motility. Although both glycolysis and PPP were essential, PPP was more important than glycolysis to maintain sperm motility. Pentose phosphate pathway reduced oxidative stress and provided glycolysis with more intermediate products such as fructose-6-phosphate. Pyruvate entered goat spermatozoa through monocarboxylate transporters and was oxidized by the tricarboxylic acid cycle and electron transfer to sustain sperm motility. Long-term liquid semen storage can be used as a good model to study sperm glucose metabolism. The data are important for an optimal control of sperm survival during semen handling and preservation not only in the goat but also in other species. Copyright © 2016 Elsevier Inc. All rights reserved.
2015-01-01
Parkinson’s disease (PD) is a multifactorial disorder with a complex etiology including genetic risk factors, environmental exposures, and aging. While energy failure and oxidative stress have largely been associated with the loss of dopaminergic cells in PD and the toxicity induced by mitochondrial/environmental toxins, very little is known regarding the alterations in energy metabolism associated with mitochondrial dysfunction and their causative role in cell death progression. In this study, we investigated the alterations in the energy/redox-metabolome in dopaminergic cells exposed to environmental/mitochondrial toxins (paraquat, rotenone, 1-methyl-4-phenylpyridinium [MPP+], and 6-hydroxydopamine [6-OHDA]) in order to identify common and/or different mechanisms of toxicity. A combined metabolomics approach using nuclear magnetic resonance (NMR) and direct-infusion electrospray ionization mass spectrometry (DI-ESI-MS) was used to identify unique metabolic profile changes in response to these neurotoxins. Paraquat exposure induced the most profound alterations in the pentose phosphate pathway (PPP) metabolome. 13C-glucose flux analysis corroborated that PPP metabolites such as glucose-6-phosphate, fructose-6-phosphate, glucono-1,5-lactone, and erythrose-4-phosphate were increased by paraquat treatment, which was paralleled by inhibition of glycolysis and the TCA cycle. Proteomic analysis also found an increase in the expression of glucose-6-phosphate dehydrogenase (G6PD), which supplies reducing equivalents by regenerating nicotinamide adenine dinucleotide phosphate (NADPH) levels. Overexpression of G6PD selectively increased paraquat toxicity, while its inhibition with 6-aminonicotinamide inhibited paraquat-induced oxidative stress and cell death. These results suggest that paraquat “hijacks” the PPP to increase NADPH reducing equivalents and stimulate paraquat redox cycling, oxidative stress, and cell death. Our study clearly demonstrates that alterations in energy metabolism, which are specific for distinct mitochondiral/environmental toxins, are not bystanders to energy failure but also contribute significant to cell death progression. PMID:24937102
Sun, Chongchong; Chen, Si; Jin, Yujian; Song, Hao; Ruan, Songlin; Fu, Zhengwei; Asad, Muhammad Asad Ullah; Qian, Haifeng
2016-06-08
Photosynthesis is a very important metabolic pathway for plant growth and crop yield. This report investigated the effect of the herbicide imazethapyr on photosynthesis in the Arabidopsis thaliana pnsB3 mutant (a defect in the NDH pathway) and pgr5 mutant (a defect in the PGR5 pathway) to determine which cyclic electron transport chain (CET) of the NDH and PGR5 pathways is more important for protecting the photosynthetic system under herbicide stress. The results showed that 20 μg/L imazethapyr markedly inhibited the growth of the three ecotypes of A. thaliana and produced more anthocyanins and reactive oxygen species (ROS), particularly in the pgr5 mutant. The chlorophyll fluorescence results showed that PSII was severely damaged in the pgr5 mutant. Additionally, the CET was significantly stimulated to protect the photosynthetic system from light damage in Wt and the pnsB3 mutant but not the pgr5 mutant. The real-time PCR analysis indicated that imazethapyr treatment considerably decreased the transcript levels of most photosynthesis-related genes in the three treated groups. Several genes in the PGR5 pathway were significantly induced in the pnsB3 mutant, but no genes in the NDH pathway were induced in the pgr5 mutant. The gene transcription analysis showed that the pgr5 mutant cannot compensate for the deficit in the PGR5 pathway by stimulating the NDH pathway, whereas the pnsB3 mutant can compensate for the deficit in the CET cycle by regulating the PGR5 pathway. The iTRAQ analyses also showed that the photosynthesis system, glycolysis, and TCA cycle suffered the most severe damage in the pgr5 mutant. All of these results showed that the PGR5 pathway is more critical for electron transfer around PSI than the NDH pathway to resist herbicide stress.
Yu, Xin‐Jun; Sun, Jie; Zheng, Jian‐Yong; Sun, Ya‐Qi
2016-01-01
Abstract BACKGROUND Phytohormones are chemical messengers that have a positive effect on biodiesel production of microalgae at low concentrations. However, the effect of phytohormone 6‐benzylaminopurine on lipid and docosahexaenoic acid (DHA) production in marine DHA‐producer Aurantiochytrium has never been reported. In this study, a GC‐MS‐based metabolomics method combined with a multivariate analysis is applied to reveal the metabolic mechanism of 6‐benzylaminopurine enhancing production of lipid and DHA in Aurantiochytrium sp.YLH70. RESULTS In total, 71 metabolites were identified by GC‐MS. The PCA model revealed that 76.9% of metabolite variation was related to 6‐benzylaminopurine treatment, and overall metabolomics profiles between the 6‐benzylaminopurine and control groups were clearly discriminated. Forty‐six metabolites identified by the PLS‐DA model were responsible for responding to 6‐benzylaminopurine. Metabolic analysis showed that 6‐benzylaminopurine could accelerate the rate of utilization of glucose in Aurantiochytrium sp. YLH70, and the metabolic flux from glycolysis, TCA cycle and mevalonate pathway to fatty acids biosynthesis was promoted. Moreover, the anti‐stress mechanism in Aurantiochytrium sp.YLH70 might be induced by 6‐benzylaminopurine. CONCLUSION Metabolomics is a suitable tool to discover the metabolic mechanism for improving lipid and DHA accumulation in a microorganism. 6‐benzylaminopurine has the potential to stimulate lipid and DHA production of Aurantiochytrium sp.YLH70 for industrial purposes. © 2015 The Authors. Journal of Chemical Technology & Biotechnology published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry. PMID:27065509
Molecular Characterization and Transcriptional Regulation Analysis of the Bovine PDHB Gene.
Li, Anning; Zhang, Yaran; Zhao, Zhidong; Wang, Mingming; Zan, Linsen
2016-01-01
The pyruvate dehydrogenase beta subunit (PDHB) is a subunit of pyruvate dehydrogenase (E1), which catalyzes pyruvate into acetyl-CoA and provides a linkage between the tricarboxylic acid cycle (TCA) and the glycolysis pathway. Previous studies demonstrated PDHB to be positively related to the intramuscular fat (IMF) content. However, the transcriptional regulation of PDHB remains unclear. In our present study, the cDNA of bovine PDHB was cloned and the genomic structure was analyzed. The phylogenetic tree showed bovine PDHB to be closely related to goat and sheep, and least related to chicken. Spatial expression pattern analysis revealed the products of bovine PDHB to be widely expressed with the highest level in the fat of testis. To understand the transcriptional regulation of bovine PDHB, 1899 base pairs (bp) of the 5'-regulatory region was cloned. Sequence analysis neither found consensus TATA-box nor CCAAT-box in the 5'-flanking region of bovine PDHB. However, a CpG island was predicted from nucleotides -284 to +117. Serial deletion constructs of the 5'-flanking region, evaluated in dual-luciferase reporter assay, revealed the core promoter to be located 490bp upstream from the transcription initiation site (+1). Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP) in combination with asite-directed mutation experiment indicated both myogenin (MYOG) and the CCAAT/enhancer-binding protein beta (C/EBPß) to be important transcription factors for bovine PDHB in skeletal muscle cells and adipocytes. Our results provide an important basis for further investigation of the bovine PDHB function and regulation in cattle.
Drabovich, Andrei P.; Pavlou, Maria P.; Dimitromanolakis, Apostolos; Diamandis, Eleftherios P.
2012-01-01
To investigate the quantitative response of energy metabolic pathways in human MCF-7 breast cancer cells to hypoxia, glucose deprivation, and estradiol stimulation, we developed a targeted proteomics assay for accurate quantification of protein expression in glycolysis/gluconeogenesis, TCA cycle, and pentose phosphate pathways. Cell growth conditions were selected to roughly mimic the exposure of cells in the cancer tissue to the intermittent hypoxia, glucose deprivation, and hormonal stimulation. Targeted proteomics assay allowed for reproducible quantification of 76 proteins in four different growth conditions after 24 and 48 h of perturbation. Differential expression of a number of control and metabolic pathway proteins in response to the change of growth conditions was found. Elevated expression of the majority of glycolytic enzymes was observed in hypoxia. Cancer cells, as opposed to near-normal MCF-10A cells, exhibited significantly increased expression of key energy metabolic pathway enzymes (FBP1, IDH2, and G6PD) that are known to redirect cellular metabolism and increase carbon flux through the pentose phosphate pathway. Our quantitative proteomic protocol is based on a mass spectrometry-compatible acid-labile detergent and is described in detail. Optimized parameters of a multiplex selected reaction monitoring (SRM) assay for 76 proteins, 134 proteotypic peptides, and 401 transitions are included and can be downloaded and used with any SRM-compatible mass spectrometer. The presented workflow is an integrated tool for hypothesis-driven studies of mammalian cells as well as functional studies of proteins, and can greatly complement experimental methods in systems biology, metabolic engineering, and metabolic transformation of cancer cells. PMID:22535206
Tolstikov, Vladimir; Nikolayev, Alexander; Dong, Sucai; Zhao, Genshi; Kuo, Ming-Shang
2014-01-01
Nicotinamide phosphoribosyltransferase (NAMPT) plays an important role in cellular bioenergetics. It is responsible for converting nicotinamide to nicotinamide adenine dinucleotide, an essential molecule in cellular metabolism. NAMPT has been extensively studied over the past decade due to its role as a key regulator of nicotinamide adenine dinucleotide–consuming enzymes. NAMPT is also known as a potential target for therapeutic intervention due to its involvement in disease. In the current study, we used a global mass spectrometry–based metabolomic approach to investigate the effects of FK866, a small molecule inhibitor of NAMPT currently in clinical trials, on metabolic perturbations in human cancer cells. We treated A2780 (ovarian cancer) and HCT-116 (colorectal cancer) cell lines with FK866 in the presence and absence of nicotinic acid. Significant changes were observed in the amino acids metabolism and the purine and pyrimidine metabolism. We also observed metabolic alterations in glycolysis, the citric acid cycle (TCA), and the pentose phosphate pathway. To expand the range of the detected polar metabolites and improve data confidence, we applied a global metabolomics profiling platform by using both non-targeted and targeted hydrophilic (HILIC)-LC-MS and GC-MS analysis. We used Ingenuity Knowledge Base to facilitate the projection of metabolomics data onto metabolic pathways. Several metabolic pathways showed differential responses to FK866 based on several matches to the list of annotated metabolites. This study suggests that global metabolomics can be a useful tool in pharmacological studies of the mechanism of action of drugs at a cellular level. PMID:25486521
Effect of Aluminum Treatment on Proteomes of Radicles of Seeds Derived from Al-Treated Tomato Plants
Okekeogbu, Ikenna; Ye, Zhujia; Sangireddy, Sasikiran Reddy; Li, Hui; Bhatti, Sarabjit; Hui, Dafeng; Zhou, Suping; Howe, Kevin J.; Fish, Tara; Yang, Yong; Thannhauser, Theodore W.
2014-01-01
Aluminum (Al) toxicity is a major constraint to plant growth and crop yield in acid soils. Tomato cultivars are especially susceptible to excessive Al3+ accumulated in the root zone. In this study, tomato plants were grown in a hydroponic culture system supplemented with 50 µM AlK(SO4)2. Seeds harvested from Al-treated plants contained a significantly higher Al content than those grown in the control hydroponic solution. In this study, these Al-enriched tomato seeds (harvested from Al-treated tomato plants) were germinated in 50 µM AlK(SO4)2 solution in a homopiperazine-1,4-bis(2-ethanesulfonic acid) buffer (pH 4.0), and the control solution which contained the buffer only. Proteomes of radicles were analyzed quantitatively by mass spectrometry employing isobaric tags for relative and absolute quantitation (iTRAQ®). The proteins identified were assigned to molecular functional groups and cellular metabolic pathways using MapMan. Among the proteins whose abundance levels changed significantly were: a number of transcription factors; proteins regulating gene silencing and programmed cell death; proteins in primary and secondary signaling pathways, including phytohormone signaling and proteins for enhancing tolerance to abiotic and biotic stress. Among the metabolic pathways, enzymes in glycolysis and fermentation and sucrolytic pathways were repressed. Secondary metabolic pathways including the mevalonate pathway and lignin biosynthesis were induced. Biological reactions in mitochondria seem to be induced due to an increase in the abundance level of mitochondrial ribosomes and enzymes in the TCA cycle, electron transport chains and ATP synthesis. PMID:28250376
A Proteomic Analysis of the Upper and Lower Flanks of the Base of Rice Shoot in the Gravitropism
NASA Astrophysics Data System (ADS)
Hu, Liwei; Chen, Haiying; Dou, Xianying; Jin, Jing; Sun, Weining; Cai, Weiming
2015-11-01
Due to gravitational stimulation, the lower part of a shoot base grows faster than the upper part, leading the shoot to curve upward. Though much research has been done on the mechanism of plant gravitropism, it still requires extensive elucidation. Recently, functional genomic strategies have been applied to study this mechanism in plants. The present study carried out a proteomic analysis to gain a better understanding of gravity stimulation in rice. Three-week-old rice seedlings were gravitropically stimulated and samples were harvested at 4 different time points: 0.5, 3, 6, and 9 h. Then, the total crude proteins were extracted from the lower and upper parts of the shoot base, separated by 2-DE, and silver stained. At each time point, proteins in the lower and upper parts were compared, and the differently expressed proteins were identified using MALDI TOF or ESI-MS/MS. After gravity stimulation, proteins involved in nine different functional categories were either up-regulated or down-regulated. Sugar metabolism, glycolysis, the tricarboxylic acid (TCA/citric) cycle, pyruvate metabolism, and transcription regulation-related proteins were regulated. Although the initiation of defense reactions mainly occurred in roots, some different defense mechanisms were also evoked in the aerial tissues. Interestingly, the abundance of some proteins changed drastically at only 0.5 h after reorientation: inosine monophosphate dehydrogenase (up to 6.49-fold higher in lower flanks at 0.5 h), ATP synthase D (4.25-fold), and ribulose-1,5 -bisphosphate carboxylase oxygenase (3.62-fold). These findings may aid in understanding the mechanism of the gravitropism.
Alteri, Christopher J.; Himpsl, Stephanie D.; Mobley, Harry L. T.
2015-01-01
The human genitourinary tract is a common anatomical niche for polymicrobial infection and a leading site for the development of bacteremia and sepsis. Most uncomplicated, community-acquired urinary tract infections (UTI) are caused by Escherichia coli, while another bacterium, Proteus mirabilis, is more often associated with complicated UTI. Here, we report that uropathogenic E. coli and P. mirabilis have divergent requirements for specific central pathways in vivo despite colonizing and occupying the same host environment. Using mutants of specific central metabolism enzymes, we determined glycolysis mutants lacking pgi, tpiA, pfkA, or pykA all have fitness defects in vivo for P. mirabilis but do not affect colonization of E. coli during UTI. Similarly, the oxidative pentose phosphate pathway is required only for P. mirabilis in vivo. In contrast, gluconeogenesis is required only for E. coli fitness in vivo. The remarkable difference in central pathway utilization between E. coli and P. mirabilis during experimental UTI was also observed for TCA cycle mutants in sdhB, fumC, and frdA. The distinct in vivo requirements between these pathogens suggest E. coli and P. mirabilis are not direct competitors within host urinary tract nutritional niche. In support of this, we found that co-infection with E. coli and P. mirabilis wild-type strains enhanced bacterial colonization and persistence of both pathogens during UTI. Our results reveal that complementary utilization of central carbon metabolism facilitates polymicrobial disease and suggests microbial activity in vivo alters the host urinary tract nutritional niche. PMID:25568946
Molecular Characterization and Transcriptional Regulation Analysis of the Bovine PDHB Gene
Li, Anning; Zhang, Yaran; Zhao, Zhidong; Wang, Mingming; Zan, Linsen
2016-01-01
The pyruvate dehydrogenase beta subunit (PDHB) is a subunit of pyruvate dehydrogenase (E1), which catalyzes pyruvate into acetyl-CoA and provides a linkage between the tricarboxylic acid cycle (TCA) and the glycolysis pathway. Previous studies demonstrated PDHB to be positively related to the intramuscular fat (IMF) content. However, the transcriptional regulation of PDHB remains unclear. In our present study, the cDNA of bovine PDHB was cloned and the genomic structure was analyzed. The phylogenetic tree showed bovine PDHB to be closely related to goat and sheep, and least related to chicken. Spatial expression pattern analysis revealed the products of bovine PDHB to be widely expressed with the highest level in the fat of testis. To understand the transcriptional regulation of bovine PDHB, 1899 base pairs (bp) of the 5’-regulatory region was cloned. Sequence analysis neither found consensus TATA-box nor CCAAT-box in the 5’-flanking region of bovine PDHB. However, a CpG island was predicted from nucleotides -284 to +117. Serial deletion constructs of the 5’-flanking region, evaluated in dual-luciferase reporter assay, revealed the core promoter to be located 490bp upstream from the transcription initiation site (+1). Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP) in combination with asite-directed mutation experiment indicated both myogenin (MYOG) and the CCAAT/enhancer-binding protein beta (C/EBPß) to be important transcription factors for bovine PDHB in skeletal muscle cells and adipocytes. Our results provide an important basis for further investigation of the bovine PDHB function and regulation in cattle. PMID:27379520
Wang, Chao; Wang, Zhenyao; Luo, Fei; Li, Yuqin
2017-08-01
The lipid productivity controlled by both of biomass and lipid content was really crucial for economic-feasibility of microalgae-based biofuels production. This study attempted at augmenting lipid productivity in an emerging oleaginous model alga Coccomyxa subellipsoidea by different nitrogen manipulation including one-stage continuous N-sufficiency (OCNS), N-deprivation (OCND), N-limitation (OCNL), and also two-stage batch N-starvation (TBNS). Amongst four tested nitrogen manipulation strategies, OCNS performed remarkable promoting effect on cell metabolic growth and the maximum biomass was achieved by 7.39 g/L. Whereas TBNS regime induced the highest lipid content (over 50.5%). Only OCNL treatment augmented the lipid productivity by 232.37 mg/L/day, representing 1.25-fold more than TBNS and even as much as 5.06-fold more than that of OCND strategy. OCNL also strengthened the proportions of saturated (C16:0 and C18:0) and monounsaturated fatty acid (C18:1) which were inclined to high-quality biofuels-making. This might be due to that most part of energy and metabolic flux (e.g. acetyl-CoA) derived from TCA cycle and glycolysis flowed into fatty acids biosynthesis pathway (especially C18:1) response to OCNL manipulation. This study represented a pioneering work of utilizing OCNL for lipids production by C. subellipsoidea and clearly implied that OCNL might be a feasible way for algal lipid production on a commercial scale and also promoted the potential of C. subellipsoidea as an ideal biodiesel feedstock.
Genome-wide microarray analysis of tomato roots showed defined responses to iron deficiency
2012-01-01
Background Plants react to iron deficiency stress adopting different kind of adaptive responses. Tomato, a Strategy I plant, improves iron uptake through acidification of rhizosphere, reduction of Fe3+ to Fe2+ and transport of Fe2+ into the cells. Large-scale transcriptional analyses of roots under iron deficiency are only available for a very limited number of plant species with particular emphasis for Arabidopsis thaliana. Regarding tomato, an interesting model species for Strategy I plants and an economically important crop, physiological responses to Fe-deficiency have been thoroughly described and molecular analyses have provided evidence for genes involved in iron uptake mechanisms and their regulation. However, no detailed transcriptome analysis has been described so far. Results A genome-wide transcriptional analysis, performed with a chip that allows to monitor the expression of more than 25,000 tomato transcripts, identified 97 differentially expressed transcripts by comparing roots of Fe-deficient and Fe-sufficient tomato plants. These transcripts are related to the physiological responses of tomato roots to the nutrient stress resulting in an improved iron uptake, including regulatory aspects, translocation, root morphological modification and adaptation in primary metabolic pathways, such as glycolysis and TCA cycle. Other genes play a role in flavonoid biosynthesis and hormonal metabolism. Conclusions The transcriptional characterization confirmed the presence of the previously described mechanisms to adapt to iron starvation in tomato, but also allowed to identify other genes potentially playing a role in this process, thus opening new research perspectives to improve the knowledge on the tomato root response to the nutrient deficiency. PMID:22433273
Antico Arciuch, Valeria G; Russo, Marika A; Kang, Kristy S; Di Cristofano, Antonio
2013-09-01
Rapidly proliferating and neoplastically transformed cells generate the energy required to support rapid cell division by increasing glycolysis and decreasing flux through the oxidative phosphorylation (OXPHOS) pathway, usually without alterations in mitochondrial function. In contrast, little is known of the metabolic alterations, if any, which occur in cells harboring mutations that prime their neoplastic transformation. To address this question, we used a Pten-deficient mouse model to examine thyroid cells where a mild hyperplasia progresses slowly to follicular thyroid carcinoma. Using this model, we report that constitutive phosphoinositide 3-kinase (PI3K) activation caused by PTEN deficiency in nontransformed thyrocytes results in a global downregulation of Krebs cycle and OXPHOS gene expression, defective mitochondria, reduced respiration, and an enhancement in compensatory glycolysis. We found that this process does not involve any of the pathways classically associated with the Warburg effect. Moreover, this process was independent of proliferation but contributed directly to thyroid hyperplasia. Our findings define a novel metabolic switch to glycolysis driven by PI3K-dependent AMPK inactivation with a consequent repression in the expression of key metabolic transcription regulators. ©2013 AACR.
The Role of Mitochondrial TCA Cycle Enzymes in Determining Prostate Cancer Chemosensitivity
2012-03-01
mitochondrial OAA measurement is performed by a commercial kit from Biovision . Briefly, whole cell lysates or mitochondria fraction were obtained from... Biovision based on the manufacturer protocols. 2) Cellular oxygen consumption and reactive oxygen (ROS) production. One of the metabolic consequences of
Nitzsche, Richard; Günay-Esiyok, Özlem; Tischer, Maximilian; Zagoriy, Vyacheslav; Gupta, Nishith
2017-09-15
Toxoplasma gondii is considered to be one of the most successful intracellular pathogens, because it can reproduce in varied nutritional milieus, encountered in diverse host cell types of essentially any warm-blooded organism. Our earlier work demonstrated that the acute (tachyzoite) stage of T. gondii depends on cooperativity of glucose and glutamine catabolism to meet biosynthetic demands. Either of these two nutrients can sustain the parasite survival; however, what determines the metabolic plasticity has not yet been resolved. Here, we reveal two discrete phosphoenolpyruvate carboxykinase (PEPCK) enzymes in the parasite, one of which resides in the m i t ochondrion ( Tg PEPCK mt ), whereas the other protein is n ot e xpressed in t achyzoites ( Tg PEPCK net ). Parasites with an intact glycolysis can tolerate genetic deletions of Tg PEPCK mt as well as of Tg PEPCK net , indicating their nonessential roles for tachyzoite survival. Tg PEPCK net can also be ablated in a glycolysis-deficient mutant, while Tg PEPCK mt is refractory to deletion. Consistent with this, the lytic cycle of a conditional mutant of Tg PEPCK mt in the glycolysis-impaired strain was aborted upon induced repression of the mitochondrial isoform, demonstrating its essential role for the glucose-independent survival of parasites. Isotope-resolved metabolomics of the conditional mutant revealed defective flux of glutamine-derived carbon into RNA-bound ribose sugar as well as metabolites associated with gluconeogenesis, entailing a critical nodal role of PEPCK mt in linking catabolism of glucose and glutamine with anabolic pathways. Our data also suggest a homeostatic function of Tg PEPCK mt in cohesive operation of glycolysis and the tricarboxylic acid cycle in a normal glucose-replete milieu. Conversely, we found that the otherwise integrative enzyme pyruvate carboxylase ( Tg PyC) is dispensable not only in glycolysis-competent but also in glycolysis-deficient tachyzoites despite a mitochondrial localization. Last but not least, the observed physiology of T. gondii tachyzoites appears to phenocopy cancer cells, which holds promise for developing common therapeutics against both threats. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
A model of yeast glycolysis based on a consistent kinetic characterisation of all its enzymes
Smallbone, Kieran; Messiha, Hanan L.; Carroll, Kathleen M.; Winder, Catherine L.; Malys, Naglis; Dunn, Warwick B.; Murabito, Ettore; Swainston, Neil; Dada, Joseph O.; Khan, Farid; Pir, Pınar; Simeonidis, Evangelos; Spasić, Irena; Wishart, Jill; Weichart, Dieter; Hayes, Neil W.; Jameson, Daniel; Broomhead, David S.; Oliver, Stephen G.; Gaskell, Simon J.; McCarthy, John E.G.; Paton, Norman W.; Westerhoff, Hans V.; Kell, Douglas B.; Mendes, Pedro
2013-01-01
We present an experimental and computational pipeline for the generation of kinetic models of metabolism, and demonstrate its application to glycolysis in Saccharomyces cerevisiae. Starting from an approximate mathematical model, we employ a “cycle of knowledge” strategy, identifying the steps with most control over flux. Kinetic parameters of the individual isoenzymes within these steps are measured experimentally under a standardised set of conditions. Experimental strategies are applied to establish a set of in vivo concentrations for isoenzymes and metabolites. The data are integrated into a mathematical model that is used to predict a new set of metabolite concentrations and reevaluate the control properties of the system. This bottom-up modelling study reveals that control over the metabolic network most directly involved in yeast glycolysis is more widely distributed than previously thought. PMID:23831062
Dengue virus induces and requires glycolysis for optimal replication.
Fontaine, Krystal A; Sanchez, Erica L; Camarda, Roman; Lagunoff, Michael
2015-02-01
Viruses rely on host cellular metabolism to provide the energy and biosynthetic building blocks required for their replication. Dengue virus (DENV), a member of the Flaviviridae family, is one of the most important arthropod-borne human pathogens worldwide. We analyzed global intracellular metabolic changes associated with DENV infection of primary human cells. Our metabolic profiling data suggested that central carbon metabolism, particularly glycolysis, is strikingly altered during a time course of DENV infection. Glucose consumption is increased during DENV infection and depriving DENV-infected cells of exogenous glucose had a pronounced impact on viral replication. Furthermore, the expression of both glucose transporter 1 and hexokinase 2, the first enzyme of glycolysis, is upregulated in DENV-infected cells. Pharmacologically inhibiting the glycolytic pathway dramatically reduced DENV RNA synthesis and infectious virion production, revealing a requirement for glycolysis during DENV infection. Thus, these experiments suggest that DENV induces the glycolytic pathway to support efficient viral replication. This study raises the possibility that metabolic inhibitors, such as those that target glycolysis, could be used to treat DENV infection in the future. Approximately 400 million people are infected with dengue virus (DENV) annually, and more than one-third of the global population is at risk of infection. As there are currently no effective vaccines or specific antiviral therapies for DENV, we investigated the impact DENV has on the host cellular metabolome to identify metabolic pathways that are critical for the virus life cycle. We report an essential role for glycolysis during DENV infection. DENV activates the glycolytic pathway, and inhibition of glycolysis significantly blocks infectious DENV production. This study provides further evidence that viral metabolomic analyses can lead to the discovery of novel therapeutic targets to block the replication of medically important human pathogens. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Feizi, Sepehr; Delfazayebaher, Siamak; Ownagh, Vahid; Sadeghpour, Fatemeh
To evaluate the agreement between total corneal astigmatism calculated by vector summation of anterior and posterior corneal astigmatism (TCA Vec ) and total corneal astigmatism measured by ray tracing (TCA Ray ). This study enrolled a total of 204 right eyes of 204 normal subjects. The eyes were measured using a Galilei double Scheimpflug analyzer. The measured parameters included simulated keratometric astigmatism using the keratometric index, anterior corneal astigmatism using the corneal refractive index, posterior corneal astigmatism, and TCA Ray . TCA Vec was derived by vector summation of the astigmatism on the anterior and posterior corneal surfaces. The magnitudes and axes of TCA Vec and TCA Ray were compared. The Pearson correlation coefficient and Bland-Altman plots were used to assess the relationship and agreement between TCA Vec and TCA Ray , respectively. The mean TCA Vec and TCA Ray magnitudes were 0.76±0.57D and 1.00±0.78D, respectively (P<0.001). The mean axis orientations were 85.12±30.26° and 89.67±36.76°, respectively (P=0.02). Strong correlations were found between the TCA Vec and TCA Ray magnitudes (r=0.96, P<0.001). Moderate associations were observed between the TCA Vec and TCA Ray axes (r=0.75, P<0.001). Bland-Altman plots produced the 95% limits of agreement for the TCA Vec and TCA Ray magnitudes from -0.33 to 0.82D. The 95% limits of agreement between the TCA Vec and TCA Ray axes was -43.0 to 52.1°. The magnitudes and axes of astigmatisms measured by the vector summation and ray tracing methods cannot be used interchangeably. There was a systematic error between the TCA Vec and TCA Ray magnitudes. Copyright © 2017 Spanish General Council of Optometry. Published by Elsevier España, S.L.U. All rights reserved.
NASA Technical Reports Server (NTRS)
Frakes, P.
2016-01-01
Question was raised: are we seeing more late-notice events in recent months? Two definitions oflate-notice used to compare data: Event has at least one data point between TCA-4 days and TCA-2 days where the Pcwas below 1E-7, OR there were no data points in that timeframe. Event has at least one data point between TCA-2days and TCA where the Pc was at least 1E-4Event has at least one data point between TCA-4 days and TCA-2 dayswhere the Pc was below 1E-5, OR there were no data points in that timeframe. Event has at least one data pointbetween TCA-2 days and TCA where the Pc was at least 1E-4. The case studies that were examined all fall within criteriafor both definitions Terra vs 38192; TCA 24 JUN 2015Aura vs 89477; TCA 29 AUG 2015Terra vs 37131; TCA 19 DEC2015GPM vs 28685; TCA 5 SEP 2015.
Simulating Metabolism with Statistical Thermodynamics
Cannon, William R.
2014-01-01
New methods are needed for large scale modeling of metabolism that predict metabolite levels and characterize the thermodynamics of individual reactions and pathways. Current approaches use either kinetic simulations, which are difficult to extend to large networks of reactions because of the need for rate constants, or flux-based methods, which have a large number of feasible solutions because they are unconstrained by the law of mass action. This report presents an alternative modeling approach based on statistical thermodynamics. The principles of this approach are demonstrated using a simple set of coupled reactions, and then the system is characterized with respect to the changes in energy, entropy, free energy, and entropy production. Finally, the physical and biochemical insights that this approach can provide for metabolism are demonstrated by application to the tricarboxylic acid (TCA) cycle of Escherichia coli. The reaction and pathway thermodynamics are evaluated and predictions are made regarding changes in concentration of TCA cycle intermediates due to 10- and 100-fold changes in the ratio of NAD+:NADH concentrations. Finally, the assumptions and caveats regarding the use of statistical thermodynamics to model non-equilibrium reactions are discussed. PMID:25089525
Simulating metabolism with statistical thermodynamics.
Cannon, William R
2014-01-01
New methods are needed for large scale modeling of metabolism that predict metabolite levels and characterize the thermodynamics of individual reactions and pathways. Current approaches use either kinetic simulations, which are difficult to extend to large networks of reactions because of the need for rate constants, or flux-based methods, which have a large number of feasible solutions because they are unconstrained by the law of mass action. This report presents an alternative modeling approach based on statistical thermodynamics. The principles of this approach are demonstrated using a simple set of coupled reactions, and then the system is characterized with respect to the changes in energy, entropy, free energy, and entropy production. Finally, the physical and biochemical insights that this approach can provide for metabolism are demonstrated by application to the tricarboxylic acid (TCA) cycle of Escherichia coli. The reaction and pathway thermodynamics are evaluated and predictions are made regarding changes in concentration of TCA cycle intermediates due to 10- and 100-fold changes in the ratio of NAD+:NADH concentrations. Finally, the assumptions and caveats regarding the use of statistical thermodynamics to model non-equilibrium reactions are discussed.
Fumarate hydratase is a critical metabolic regulator of hematopoietic stem cell functions.
Guitart, Amelie V; Panagopoulou, Theano I; Villacreces, Arnaud; Vukovic, Milica; Sepulveda, Catarina; Allen, Lewis; Carter, Roderick N; van de Lagemaat, Louie N; Morgan, Marcos; Giles, Peter; Sas, Zuzanna; Gonzalez, Marta Vila; Lawson, Hannah; Paris, Jasmin; Edwards-Hicks, Joy; Schaak, Katrin; Subramani, Chithra; Gezer, Deniz; Armesilla-Diaz, Alejandro; Wills, Jimi; Easterbrook, Aaron; Coman, David; So, Chi Wai Eric; O'Carroll, Donal; Vernimmen, Douglas; Rodrigues, Neil P; Pollard, Patrick J; Morton, Nicholas M; Finch, Andrew; Kranc, Kamil R
2017-03-06
Strict regulation of stem cell metabolism is essential for tissue functions and tumor suppression. In this study, we investigated the role of fumarate hydratase (Fh1), a key component of the mitochondrial tricarboxylic acid (TCA) cycle and cytosolic fumarate metabolism, in normal and leukemic hematopoiesis. Hematopoiesis-specific Fh1 deletion (resulting in endogenous fumarate accumulation and a genetic TCA cycle block reflected by decreased maximal mitochondrial respiration) caused lethal fetal liver hematopoietic defects and hematopoietic stem cell (HSC) failure. Reexpression of extramitochondrial Fh1 (which normalized fumarate levels but not maximal mitochondrial respiration) rescued these phenotypes, indicating the causal role of cellular fumarate accumulation. However, HSCs lacking mitochondrial Fh1 (which had normal fumarate levels but defective maximal mitochondrial respiration) failed to self-renew and displayed lymphoid differentiation defects. In contrast, leukemia-initiating cells lacking mitochondrial Fh1 efficiently propagated Meis1 / Hoxa9 -driven leukemia. Thus, we identify novel roles for fumarate metabolism in HSC maintenance and hematopoietic differentiation and reveal a differential requirement for mitochondrial Fh1 in normal hematopoiesis and leukemia propagation. © 2017 Guitart et al.
Chheda, Anuj H; Vernekar, Madhavi R
2015-10-01
Epsilon poly-L-lysine (ε-PL) is a homo-biopolymer with approximately 25-30 L-lysine residues. It is a promising natural biopolymer widely used in food and pharmaceutical industry. The present work reports enhanced production of ε-PL with a novel producer Bacillus cereus using amino acids and TCA cycle intermediates in the fermentation medium. Among the various amino acids and TCA cycle intermediates tested 2 mM L-aspartic acid and 5 mM citric acid gave ε-PL yield of 145.5 and 230 mg/L, respectively. A combination of citric acid after 24 h and L-aspartic acid after 36 h improved ε-PL yield from 85 mg/L (control) to 335 mg/L. Glucose feeding strategy along with metabolic precursors was employed which further enhanced ε-PL yield to 565 mg/L. Thus, more than sixfold increase in ε-PL yield was achieved suggesting the potential of Bacillus cereus as a novel ε-PL producer.
NASA Astrophysics Data System (ADS)
Vergara, Fredd; Kikuchi, Jun; Breuer, Christian
2016-05-01
Autopolyploidy is a process whereby the chromosome set is multiplied and it is a common phenomenon in angiosperms. Autopolyploidy is thought to be an important evolutionary force that has led to the formation of new plant species. Despite its relevance, the consequences of autopolyploidy in plant metabolism are poorly understood. This study compares the metabolic profiles of natural diploids and artificial autotetraploids of Arabidopsis thaliana Col-0. Different physiological parameters are compared between diploids and autotetraploids using nuclear magnetic resonance (NMR), elemental analysis (carbon:nitrogen balance) and quantitative real-time PCR (qRT-PCR). The main difference between diploid and autotetraploid A. thaliana Col-0 is observed in the concentration of metabolites related to the tricarboxylic acid cycle (TCA) and γ-amino butyric acid (GABA) shunt, as shown by multivariate statistical analysis of NMR spectra. qRT-PCR shows that genes related to the TCA and GABA shunt are also differentially expressed between diploids and autotetraploids following similar trends as their corresponding metabolites. Solid evidence is presented to demonstrate that autopolyploidy influences core plant metabolic processes.
Kobayashi, Keiichi; Hattori, Takasumi; Hayashi, Rie; Kirimura, Kohtaro
2014-01-01
In the tricarboxylic acid (TCA) cycle, NADP(+)-specific isocitrate dehydrogenase (NADP(+)-ICDH) catalyzes oxidative decarboxylation of isocitric acid to form α-ketoglutaric acid with NADP(+) as a cofactor. We constructed an NADP(+)-ICDH gene (icdA)-overexpressing strain (OPI-1) using Aspergillus niger WU-2223L as a host and examined the effects of increase in NADP(+)-ICDH activity on citric acid production. Under citric acid-producing conditions with glucose as the carbon source, the amounts of citric acid produced and glucose consumed by OPI-1 for the 12-d cultivation period decreased by 18.7 and 10.5%, respectively, compared with those by WU-2223L. These results indicate that the amount of citric acid produced by A. niger can be altered with the NADP(+)-ICDH activity. Therefore, NADP(+)-ICDH is an important regulator of citric acid production in the TCA cycle of A. niger. Thus, we propose that the icdA gene is a potentially valuable tool for modulating citric acid production by metabolic engineering.
Cigarette smoke induces mitochondrial metabolic reprogramming in lung cells.
Solanki, Hitendra S; Babu, Niraj; Jain, Ankit P; Bhat, Mohd Younis; Puttamallesh, Vinuth N; Advani, Jayshree; Raja, Remya; Mangalaparthi, Kiran K; Kumar, Mahesh M; Prasad, T S Keshava; Mathur, Premendu Prakash; Sidransky, David; Gowda, Harsha; Chatterjee, Aditi
2018-05-01
Cellular transformation owing to cigarette smoking is due to chronic exposure and not acute. However, systematic studies to understand the molecular alterations in lung cells due to cigarette smoke are lacking. To understand these molecular alterations induced by chronic cigarette smoke exposure, we carried out tandem mass tag (TMT) based temporal proteomic profiling of lung cells exposed to cigarette smoke for upto 12months. We identified 2620 proteins in total, of which 671 proteins were differentially expressed (1.5-fold) after 12months of exposure. Prolonged exposure of lung cells to smoke for 12months revealed dysregulation of oxidative phosphorylation and overexpression of enzymes involved in TCA cycle. In addition, we also observed overexpression of enzymes involved in glutamine metabolism, fatty acid degradation and lactate synthesis. This could possibly explain the availability of alternative source of carbon to TCA cycle apart from glycolytic pyruvate. Our data indicates that chronic exposure to cigarette smoke induces mitochondrial metabolic reprogramming in cells to support growth and survival. Copyright © 2017 Elsevier B.V. and Mitochondria Research Society. All rights reserved.
Wang, Li; Cheung, Man Kit; Liu, Rulong; Wong, Chong Kim; Kwan, Hoi Shan; Hwang, Jiang-Shiou
2017-04-01
Shallow-water hydrothermal vents (HTVs) are an ecologically important habitat with a geographic origin similar to that of deep-sea HTVs. Studies on shallow-water HTVs have not only facilitated understanding of the influences of vents on local ecosystems but also helped to extend the knowledge on deep-sea vents. In this study, the diversity of bacterial communities in the sediments of shallow-water HTVs off Kueishan Island, Taiwan, was investigated by examining the 16S ribosomal RNA gene as well as key functional genes involved in chemoautotrophic carbon fixation (aclB, cbbL and cbbM). In the vent area, Sulfurovum and Sulfurimonas of Epsilonproteobacteria appeared to dominate the benthic bacterial community. Results of aclB gene analysis also suggested involvement of these bacteria in carbon fixation using the reductive tricarboxylic acid (rTCA) cycle. Analysis of the cbbM gene showed that Alphaproteobacterial members such as the purple non-sulfur bacteria were the major chemoautotrophic bacteria involving in carbon fixation via the Calvin-Benson-Bassham (CBB) cycle. However, they only accounted for <2% of the total bacterial community in the vent area. These findings suggest that the rTCA cycle is the major chemoautotrophic carbon fixation pathway in sediments of the shallow-water HTVs off Kueishan Island.
NASA Astrophysics Data System (ADS)
Pan, Fu-shih; Chen, Stephen; Mintzer, Robert A.; Chen, Chin-Tu; Schumacker, Paul
1991-03-01
It is of fundamental importance for biological scientists to assess cellular energetics. Under aerobic conditions, the tricarboxylic acid cycle (TCA cycle) is coupled with the mitochondrial electron cascade pathway to provide the cell with energy. The nicotinamide adenine dinucleotide-conjugated pair (NAD and NADH) is the coenzyme in numerous important biomedical reactions which include several important dehydrogenase reactions in the TCA cycle. Based on Le Chatelier's principle, NADH will accumulate when this energy production mechanism is impaired. The relative amounts of NAD and NADH in a cell are defined as the redox state of the cell (Williamson et.al. 1967) which provides a valuable index of cellular energetics. The sum of the amounts of NAD and NADH in a cell may be assumed to be constant during a finite time; therefore, a reliable means of measuring the NADH concentration would provide us with a useful indicator of tissue viability. Traditionally, the quantities of NADH and NAD may be measured by chemical assay methods. We can avoid these tediois analyses by exploiting the significant difference between the ultraviolet absorption spectra of this redox pair. However, because of the opacity of biological samples and the interference of other biochemicals that also absorb ultraviolet radiation, measurement of NADH and NAD+ concentrations in vivo by absorption spectroscopy is not feasible.
Sadykov, Marat R; Ahn, Jong-Sam; Widhelm, Todd J; Eckrich, Valerie M; Endres, Jennifer L; Driks, Adam; Rutkowski, Gregory E; Wingerd, Kevin L; Bayles, Kenneth W
2017-06-01
Numerous bacteria accumulate poly(3-hydroxybutyrate) (PHB) as an intracellular reservoir of carbon and energy in response to imbalanced nutritional conditions. In Bacillus spp., where PHB biosynthesis precedes the formation of the dormant cell type called the spore (sporulation), the direct link between PHB accumulation and efficiency of sporulation was observed in multiple studies. Although the idea of PHB as an intracellular carbon and energy source fueling sporulation was proposed several decades ago, the mechanisms underlying PHB contribution to sporulation have not been defined. Here, we demonstrate that PHB deficiency impairs Bacillus anthracis sporulation through diminishing the energy status of the cells and by reducing carbon flux into the tricarboxylic acid (TCA) cycle and de novo lipid biosynthesis. Consequently, this metabolic imbalance decreased biosynthesis of the critical components required for spore integrity and resistance, such as dipicolinic acid (DPA) and the spore's inner membrane. Supplementation of the PHB deficient mutant with exogenous fatty acids overcame these sporulation defects, highlighting the importance of the TCA cycle and lipid biosynthesis during sporulation. Combined, the results of this work reveal the molecular mechanisms of PHB contribution to B. anthracis sporulation and provide valuable insight into the metabolic requirements for this developmental process in Bacillus species. © 2017 John Wiley & Sons Ltd.
Janzer, Andreas; German, Natalie J.; Gonzalez-Herrera, Karina N.; Asara, John M.; Haigis, Marcia C.; Struhl, Kevin
2014-01-01
Metformin, a first-line diabetes drug linked to cancer prevention in retrospective clinical analyses, inhibits cellular transformation and selectively kills breast cancer stem cells (CSCs). Although a few metabolic effects of metformin and the related biguanide phenformin have been investigated in established cancer cell lines, the global metabolic impact of biguanides during the process of neoplastic transformation and in CSCs is unknown. Here, we use LC/MS/MS metabolomics (>200 metabolites) to assess metabolic changes induced by metformin and phenformin in an Src-inducible model of cellular transformation and in mammosphere-derived breast CSCs. Although phenformin is the more potent biguanide in both systems, the metabolic profiles of these drugs are remarkably similar, although not identical. During the process of cellular transformation, biguanide treatment prevents the boost in glycolytic intermediates at a specific stage of the pathway and coordinately decreases tricarboxylic acid (TCA) cycle intermediates. In contrast, in breast CSCs, biguanides have a modest effect on glycolytic and TCA cycle intermediates, but they strongly deplete nucleotide triphosphates and may impede nucleotide synthesis. These metabolic profiles are consistent with the idea that biguanides inhibit mitochondrial complex 1, but they indicate that their metabolic effects differ depending on the stage of cellular transformation. PMID:25002509
Janzer, Andreas; German, Natalie J; Gonzalez-Herrera, Karina N; Asara, John M; Haigis, Marcia C; Struhl, Kevin
2014-07-22
Metformin, a first-line diabetes drug linked to cancer prevention in retrospective clinical analyses, inhibits cellular transformation and selectively kills breast cancer stem cells (CSCs). Although a few metabolic effects of metformin and the related biguanide phenformin have been investigated in established cancer cell lines, the global metabolic impact of biguanides during the process of neoplastic transformation and in CSCs is unknown. Here, we use LC/MS/MS metabolomics (>200 metabolites) to assess metabolic changes induced by metformin and phenformin in an Src-inducible model of cellular transformation and in mammosphere-derived breast CSCs. Although phenformin is the more potent biguanide in both systems, the metabolic profiles of these drugs are remarkably similar, although not identical. During the process of cellular transformation, biguanide treatment prevents the boost in glycolytic intermediates at a specific stage of the pathway and coordinately decreases tricarboxylic acid (TCA) cycle intermediates. In contrast, in breast CSCs, biguanides have a modest effect on glycolytic and TCA cycle intermediates, but they strongly deplete nucleotide triphosphates and may impede nucleotide synthesis. These metabolic profiles are consistent with the idea that biguanides inhibit mitochondrial complex 1, but they indicate that their metabolic effects differ depending on the stage of cellular transformation.
Hyder, F; Renken, R; Rothman, D L
1999-12-01
A method for in vivo carbon-edited detection with proton echo-planar spectroscopic imaging (ICED PEPSI) is described. This method is composed of an echo-planar based acquisition implemented with (13)C-(1)H J editing spectroscopy and is intended for high temporal and spatial resolution in vivo spectroscopic imaging of (13)C turnover, from D-[1,6-(13)C]glucose to glutamate and glutamine, in the brain. At a static magnetic field strength of 7 T, both in vitro and in vivo chemical shift imaging data are presented with a spatial resolution of 8 microL (i.e., 1.25 x 1.25 x 5.00 mm(3)) and a maximum spectral bandwidth of 5.2 ppm in (1)H. Chemical shift imaging data acquired every 11 minutes allowed detection of regional [4-(13)CH(2)]glutamate turnover in rat brain. The [4-(13)CH(2)]glutamate turnover curves, which can be converted to tricarboxylic acid cycle fluxes, showed that the tricarboxylic acid cycle flux (V(TCA)) in pure gray and white matter can range from 1.2 +/- 0.2 to 0.5 +/- 0.1 micromol/g/min, respectively, for morphine-anesthetized rats. The mean cortical V(TCA) from 32 voxels of 1.0 +/- 0.3 micromol/g/min (N = 3) is in excellent agreement with previous localized measurements that have demonstrated that V(TCA) can range from 0.9-1.1 micromol/g/min under identical anesthetized conditions. Magn Reson Med 42:997-1003, 1999. Copyright 1999 Wiley-Liss, Inc.
Shepel'ova, I A; Derkach, Ie A; Mel'nykova, N M
2007-01-01
The influence of cadmium sulfate on concentration of glucose, lactate, piruvate, alpha-ketoglutarate, malate, oxaloacetate in blood of 3-, 6- and 18-month-old poisoned rats was established the results of our researches. It was found, that poisoning of rats by cadmium sulfate causes the rise of concentration of glucose, metabolites of citric acid cycle and glycolysis in blood of animals of all age groups explored. The research results prove that in blood of 3-month-old poisoned rats the level of glycolysis and citric acid cycle activation is considerably higher in comparison with that of 6- and 18-month-old animals. As a result, a comparison of age-specific dynamics of changes of carbohydrate metabolism indices in the blood of rats, poisoned by cadmium showed that the organism of 3-month-old rats is more sensitive to toxic influence of cadmium.
Seifert, Erin L; Fiehn, Oliver; Bezaire, Véronic; Bickel, David R; Wohlgemuth, Gert; Adams, Sean H; Harper, Mary-Ellen
2010-03-24
Incomplete or limited long-chain fatty acid (LCFA) combustion in skeletal muscle has been associated with insulin resistance. Signals that are responsive to shifts in LCFA beta-oxidation rate or degree of intramitochondrial catabolism are hypothesized to regulate second messenger systems downstream of the insulin receptor. Recent evidence supports a causal link between mitochondrial LCFA combustion in skeletal muscle and insulin resistance. We have used unbiased metabolite profiling of mouse muscle mitochondria with the aim of identifying candidate metabolites within or effluxed from mitochondria and that are shifted with LCFA combustion rate. Large-scale unbiased metabolomics analysis was performed using GC/TOF-MS on buffer and mitochondrial matrix fractions obtained prior to and after 20 min of palmitate catabolism (n = 7 mice/condition). Three palmitate concentrations (2, 9 and 19 microM; corresponding to low, intermediate and high oxidation rates) and 9 microM palmitate plus tricarboxylic acid (TCA) cycle and electron transport chain inhibitors were each tested and compared to zero palmitate control incubations. Paired comparisons of the 0 and 20 min samples were made by Student's t-test. False discovery rate were estimated and Type I error rates assigned. Major metabolite groups were organic acids, amines and amino acids, free fatty acids and sugar phosphates. Palmitate oxidation was associated with unique profiles of metabolites, a subset of which correlated to palmitate oxidation rate. In particular, palmitate oxidation rate was associated with distinct changes in the levels of TCA cycle intermediates within and effluxed from mitochondria. This proof-of-principle study establishes that large-scale metabolomics methods can be applied to organelle-level models to discover metabolite patterns reflective of LCFA combustion, which may lead to identification of molecules linking muscle fat metabolism and insulin signaling. Our results suggest that future studies should focus on the fate of effluxed TCA cycle intermediates and on mechanisms ensuring their replenishment during LCFA metabolism in skeletal muscle.
Seifert, Erin L.; Fiehn, Oliver; Bezaire, Véronic; Bickel, David R.; Wohlgemuth, Gert; Adams, Sean H.; Harper, Mary-Ellen
2010-01-01
Background/Aim Incomplete or limited long-chain fatty acid (LCFA) combustion in skeletal muscle has been associated with insulin resistance. Signals that are responsive to shifts in LCFA β-oxidation rate or degree of intramitochondrial catabolism are hypothesized to regulate second messenger systems downstream of the insulin receptor. Recent evidence supports a causal link between mitochondrial LCFA combustion in skeletal muscle and insulin resistance. We have used unbiased metabolite profiling of mouse muscle mitochondria with the aim of identifying candidate metabolites within or effluxed from mitochondria and that are shifted with LCFA combustion rate. Methodology/Principal Findings Large-scale unbiased metabolomics analysis was performed using GC/TOF-MS on buffer and mitochondrial matrix fractions obtained prior to and after 20 min of palmitate catabolism (n = 7 mice/condition). Three palmitate concentrations (2, 9 and 19 µM; corresponding to low, intermediate and high oxidation rates) and 9 µM palmitate plus tricarboxylic acid (TCA) cycle and electron transport chain inhibitors were each tested and compared to zero palmitate control incubations. Paired comparisons of the 0 and 20 min samples were made by Student's t-test. False discovery rate were estimated and Type I error rates assigned. Major metabolite groups were organic acids, amines and amino acids, free fatty acids and sugar phosphates. Palmitate oxidation was associated with unique profiles of metabolites, a subset of which correlated to palmitate oxidation rate. In particular, palmitate oxidation rate was associated with distinct changes in the levels of TCA cycle intermediates within and effluxed from mitochondria. Conclusions/Significance This proof-of-principle study establishes that large-scale metabolomics methods can be applied to organelle-level models to discover metabolite patterns reflective of LCFA combustion, which may lead to identification of molecules linking muscle fat metabolism and insulin signaling. Our results suggest that future studies should focus on the fate of effluxed TCA cycle intermediates and on mechanisms ensuring their replenishment during LCFA metabolism in skeletal muscle. PMID:20352092
Shi, Kaixiang; Wang, Qian; Fan, Xia; Wang, Gejiao
2018-04-01
A heterotrophic arsenite [As(III)]-oxidizing bacterium Agrobacterium tumefaciens GW4 isolated from As(III)-rich groundwater sediment showed high As(III) resistance and could oxidize As(III) to As(V). The As(III) oxidation could generate energy and enhance growth, and AioR was the regulator for As(III) oxidase. To determine the related metabolic pathways mediated by As(III) oxidation and whether AioR regulated other cellular responses to As(III), isobaric tags for relative and absolute quantitation (iTRAQ) was performed in four treatments, GW4 (+AsIII)/GW4 (-AsIII), GW4-ΔaioR (+AsIII)/GW4-ΔaioR (-AsIII), GW4-ΔaioR (-AsIII)/GW4 (-AsIII) and GW4-ΔaioR (+AsIII)/GW4 (+AsIII). A total of 41, 71, 82 and 168 differentially expressed proteins were identified, respectively. Using electrophoretic mobility shift assay (EMSA) and qRT-PCR, 12 genes/operons were found to interact with AioR. These results indicate that As(III) oxidation alters several cellular processes related to arsenite, such as As resistance (ars operon), phosphate (Pi) metabolism (pst/pho system), TCA cycle, cell wall/membrane, amino acid metabolism and motility/chemotaxis. In the wild type with As(III), TCA cycle flow is perturbed, and As(III) oxidation and fermentation are the main energy resources. However, when strain GW4-ΔaioR lost the ability of As(III) oxidation, the TCA cycle is the main way to generate energy. A regulatory cellular network controlled by AioR is constructed and shows that AioR is the main regulator for As(III) oxidation, besides, several other functions related to As(III) are regulated by AioR in parallel. Copyright © 2018 Elsevier Ltd. All rights reserved.
Park, Hee-Sook; Lee, So Min; Jeong, Nam-Joo; Kim, Soon-Hee; Lee, Kyoung-Won; Lee, Ju-A
2017-01-01
Shaofu Zhuyu decoction (SFZYD, also known as Sobokchugeo-tang), a classical prescription drug in traditional East Asian medicine, has been used to treat blood stasis syndrome (BSS). Hepatic steatosis is the result of excess caloric intake, and its pathogenesis involves internal retention of phlegm and dampness, blood stasis, and liver Qi stagnation. To evaluate the effects of treatment with SFZYD on obesity-induced inflammation and hepatic steatosis, we fed male C57BL/6N mice a high fat diet (HFD) for 8 weeks and then treated them with SFZYD by oral gavage for an additional 4 weeks. The results of histological and biochemical examinations indicated that SFZYD treatment ameliorates systemic inflammation and hepatic steatosis. A partial least squares-discriminant analysis (PLS-DA) scores plot of serum metabolites showed that HFD mice began to produce metabolites similar to those of normal chow (NC) mice after SFZYD administration. We noted significant alterations in the levels of twenty-seven metabolites, alterations indicating that SFZYD regulates the TCA cycle, the pentose phosphate pathway and aromatic amino acid metabolism. Increases in the levels of TCA cycle intermediate metabolites, such as 2-oxoglutaric acid, isocitric acid, and malic acid, in the serum of obese mice were significantly reversed after SFZYD treatment. In addition to inducing changes in the above metabolites, treatment with SFZYD also recovered the expression of genes related to hepatic mitochondrial dysfunction, including Ucp2, Cpt1α, and Ppargc1α, as well as the expression of genes involved in lipid metabolism and inflammation, without affecting glucose uptake or insulin signaling. Taken together, these findings suggest that treatment with SFZYD ameliorated obesity-induced systemic inflammation and hepatic steatosis by regulating inflammatory cytokine and adipokine levels in the circulation and various tissues. Moreover, treatment with SFZYD also reversed alterations in the levels of metabolites of the TCA cycle, the pentose phosphate pathway and aromatic amino acid metabolism. PMID:28570676
Effects of visceral adiposity on glycerol pathways in gluconeogenesis.
Neeland, Ian J; Hughes, Connor; Ayers, Colby R; Malloy, Craig R; Jin, Eunsook S
2017-02-01
To determine the feasibility of using oral 13 C labeled glycerol to assess effects of visceral adiposity on gluconeogenic pathways in obese humans. Obese (BMI ≥30kg/m 2 ) participants without type 2 diabetes underwent visceral adipose tissue (VAT) assessment and stratification by median VAT into high VAT-fasting (n=3), low VAT-fasting (n=4), and high VAT-refed (n=2) groups. Participants ingested [U- 13 C 3 ] glycerol and blood samples were subsequently analyzed at multiple time points over 3h by NMR spectroscopy. The fractions of plasma glucose (enrichment) derived from [U- 13 C 3 ] glycerol via hepatic gluconeogenesis, pentose phosphate pathway (PPP), and tricarboxylic acid (TCA) cycle were assessed using 13 C NMR analysis of glucose. Mixed linear models were used to compare 13 C enrichment in glucose between groups. Mean age, BMI, and baseline glucose were 49years, 40.1kg/m 2 , and 98mg/dl, respectively. Up to 20% of glycerol was metabolized in the TCA cycle prior to gluconeogenesis and PPP activity was minor (<1% of total glucose) in all participants. There was a 21% decrease in 13 C enrichment in plasma glucose in the high VAT-fasting compared with low VAT-fasting group (p=0.03), suggesting dilution by endogenous glycerol. High VAT-refed participants had 37% less 13 C enrichment in glucose compared with high VAT-fasting (p=0.02). There was a trend toward lower [1,2- 13 C 2 ] (via PPP) and [5,6- 13 C 2 ]/[4,5,6- 13 C 3 ] (via TCA cycle) glucose in high VAT versus low VAT groups. We applied a simple method to detect gluconeogenesis from glycerol in obese humans. Our findings provide preliminary evidence that excess visceral fat disrupts multiple pathways in hepatic gluconeogenesis from glycerol. Copyright © 2016 Elsevier Inc. All rights reserved.
Effects of Visceral Adiposity on Glycerol Pathways in Gluconeogenesis
Neeland, Ian J.; Hughes, Connor; Ayers, Colby R.; Malloy, Craig R.; Jin, Eunsook S.
2016-01-01
Objective To determine the feasibility of using oral 13C labeled glycerol at assess effects of visceral adiposity on gluconeogenic pathways in obese humans. Research Design and Methods Obese (BMI ≥30 kg/m2) participants without type 2 diabetes underwent visceral adipose tissue (VAT) assessment and stratification by median VAT into high VAT-fasting (n=3), low VAT-fasting (n=4), and high VAT-refed (n=2) groups. Participants ingested [U-13C3] glycerol and blood samples were subsequently analyzed at multiple time points over 3 hours by NMR spectroscopy. The fractions of plasma glucose (enrichment) derived from [U-13C3] glycerol via hepatic gluconeogenesis, pentose phosphate pathway (PPP), and tricarboxylic acid (TCA) cycle were assessed using 13C NMR analysis of glucose. Mixed linear models were used to compare 13C enrichment in glucose between groups. Results Mean age, BMI, and baseline glucose were 49 years, 40.1 kg/m2, and 98 mg/dl, respectively. Up to 20% of glycerol was metabolized in the TCA cycle prior to gluconeogenesis and PPP activity was minor (<1% of total glucose) in all participants. There was a 21% decrease in 13C enrichment in plasma glucose in the high VAT-fasting compared with low VAT-fasting group (p=0.03), suggesting dilution by endogenous glycerol. High VAT-refed participants had 37% less 13C enrichment in glucose compared with high VAT-fasting (p=0.02). There was a trend toward lower [1,2-13C2] (via PPP) and [5,6-13C2]/[4,5,6-13C3] (via TCA cycle) glucose in high VAT versus low VAT groups. Conclusions We applied a simple method to detect gluconeogenesis from glycerol in obese humans. Our findings provide preliminary evidence that excess visceral fat disrupts multiple pathways in hepatic gluconeogenesis from glycerol. PMID:28081781
Watsuji, Tomo-o; Takaya, Naoki; Nakamura, Akira; Shoun, Hirofumi
2003-05-01
The denitrifying fungus Cylindrocarpon tonkinense contains two isozymes of cytochrome P450nor. One isozyme, P450nor1, uses NADH specifically as its electron donor whereas the other isozyme P450nor2 prefers NADPH to NADH. Here we show that P450nor1 is localized in both cytosol and mitochondria, like P450nor of Fusarium oxysporum, while P450nor2 is exclusively in cytosol. We also found that the addition of glucose as a carbon source to the culture media leads to the production of much more P450nor2 in the fungal cells than a non-fermentable substrate (glycerol or acetate) does. These results suggest that the NADP-dependent pentose phosphate cycle acts predominantly in C. tonkinense as the glycolysis pathway under the denitrifying conditions, which was confirmed by the observation that glucose induced enzyme activities involved in the cycle. These results showed that P450nor2 should act as the electron sink under anaerobic, denitrifying conditions to regenerate NADP+ for the pentose phosphate cycle.
Champagne, Cory D; Houser, Dorian S; Fowler, Melinda A; Costa, Daniel P; Crocker, Daniel E
2012-08-01
Animals that endure prolonged periods of food deprivation preserve vital organ function by sparing protein from catabolism. Much of this protein sparing is achieved by reducing metabolic rate and suppressing gluconeogenesis while fasting. Northern elephant seals (Mirounga angustirostris) endure prolonged fasts of up to 3 mo at multiple life stages. During these fasts, elephant seals maintain high levels of activity and energy expenditure associated with breeding, reproduction, lactation, and development while maintaining rates of glucose production typical of a postabsorptive mammal. Therefore, we investigated how fasting elephant seals meet the requirements of glucose-dependent tissues while suppressing protein catabolism by measuring the contribution of glycogenolysis, glycerol, and phosphoenolpyruvate (PEP) to endogenous glucose production (EGP) during their natural 2-mo postweaning fast. Additionally, pathway flux rates associated with the tricarboxylic acid (TCA) cycle were measured specifically, flux through phosphoenolpyruvate carboxykinase (PEPCK) and pyruvate cycling. The rate of glucose production decreased during the fast (F(1,13) = 5.7, P = 0.04) but remained similar to that of postabsorptive mammals. The fractional contributions of glycogen, glycerol, and PEP did not change with fasting; PEP was the primary gluconeogenic precursor and accounted for ∼95% of EGP. This large contribution of PEP to glucose production occurred without substantial protein loss. Fluxes through the TCA cycle, PEPCK, and pyruvate cycling were higher than reported in other species and were the most energetically costly component of hepatic carbohydrate metabolism. The active pyruvate recycling fluxes detected in elephant seals may serve to rectify gluconeogeneic PEP production during restricted anaplerotic inflow in these fasting-adapted animals.
Gollapalli, Kishore; Ghantasala, Saicharan; Atak, Apurva; Rapole, Srikanth; Moiyadi, Aliasgar; Epari, Sridhar; Srivastava, Sanjeeva
2017-05-01
Gliomas are heterogeneous and most commonly occurring brain tumors. Blood-brain barrier restricts the entry of brain tumor proteins into blood stream thus limiting the usage of serum or plasma for proteomic analysis. Our study aimed at understanding the molecular basis of aggressiveness of various grades of brain tumors using isobaric tagging for relative and absolute quantification (iTRAQ) based mass spectrometry. Tissue proteomic analysis of various grades of gliomas was performed using four-plex iTRAQ. We labeled five sets (each set consists of control, grade-II, III, and IV tumor samples) of individual glioma patients using iTRAQ reagents. Significantly altered proteins were subjected to bioinformatics analysis using Database for Annotation, Visualization and Integrated Discovery (DAVID). Various metabolic pathways like glycolysis, TCA-cycle, electron transport chain, lactate metabolism, and blood coagulation pathways were majorly observed to be perturbed in gliomas. Most of the identified proteins involved in redox reactions, protein folding, pre-messenger RNA (mRNA) processing, antiapoptosis, and blood coagulation were found to be upregulated in gliomas. Transcriptomics data of glioblastoma multiforme (GBM), low-grade gliomas (LGGs), and controls were downloaded from The Cancer Genome Atlas (TCGA) data portal and further analyzed using BRB-Array tools. Expression levels of a few significantly altered proteins like lactate dehydrogenase, alpha-1 antitrypsin, fibrinogen alpha chain, nucleophosmin, annexin A5, thioredoxin, ferritin light chain, thymosin beta-4-like protein 3, superoxide dismutase-2, and peroxiredoxin-1 and 6 showed a positive correlation with increasing grade of gliomas thereby offering an insight into molecular basis behind their aggressive nature. Several proteins identified in different grades of gliomas are potential grade-specific markers, and perturbed pathways provide comprehensive overview of molecular cues involved in glioma pathogenesis.
Yadav, Saveg; Pandey, Shrish Kumar; Singh, Vinay Kumar; Goel, Yugal; Kumar, Ajay
2017-01-01
Altered metabolism is an emerging hallmark of cancer, as malignant cells display a mammoth up-regulation of enzymes responsible for steering their bioenergetic and biosynthetic machinery. Thus, the recent anticancer therapeutic strategies focus on the targeting of metabolic enzymes, which has led to the identification of specific metabolic inhibitors. One of such inhibitors is 3-bromopyruvate (3-BP), with broad spectrum of anticancer activity due to its ability to inhibit multiple metabolic enzymes. However, the molecular characterization of its binding to the wide spectrum of target enzymes remains largely elusive. Therefore, in the present study we undertook in silico investigations to decipher the molecular nature of the docking of 3-BP with key target enzymes of glycolysis and TCA cycle by PatchDock and YASARA docking tools. Additionally, derivatives of 3-BP, dibromopyruvate (DBPA) and propionic acid (PA), with reported biological activity, were also investigated for docking to important target metabolic enzymes of 3-BP, in order to predict their therapeutic efficacy versus that of 3-BP. A comparison of the docking scores with respect to 3-BP indicated that both of these derivatives display a better binding strength to metabolic enzymes. Further, analysis of the drug likeness of 3-BP, DBPA and PA by Lipinski filter, admetSAR and FAF Drug3 indicated that all of these agents showed desirable drug-like criteria. The outcome of this investigation sheds light on the molecular characteristics of the binding of 3-BP and its derivatives with metabolic enzymes and thus may significantly contribute in designing and optimizing therapeutic strategies against cancer by using these agents. PMID:28463978
Yadav, Saveg; Pandey, Shrish Kumar; Singh, Vinay Kumar; Goel, Yugal; Kumar, Ajay; Singh, Sukh Mahendra
2017-01-01
Altered metabolism is an emerging hallmark of cancer, as malignant cells display a mammoth up-regulation of enzymes responsible for steering their bioenergetic and biosynthetic machinery. Thus, the recent anticancer therapeutic strategies focus on the targeting of metabolic enzymes, which has led to the identification of specific metabolic inhibitors. One of such inhibitors is 3-bromopyruvate (3-BP), with broad spectrum of anticancer activity due to its ability to inhibit multiple metabolic enzymes. However, the molecular characterization of its binding to the wide spectrum of target enzymes remains largely elusive. Therefore, in the present study we undertook in silico investigations to decipher the molecular nature of the docking of 3-BP with key target enzymes of glycolysis and TCA cycle by PatchDock and YASARA docking tools. Additionally, derivatives of 3-BP, dibromopyruvate (DBPA) and propionic acid (PA), with reported biological activity, were also investigated for docking to important target metabolic enzymes of 3-BP, in order to predict their therapeutic efficacy versus that of 3-BP. A comparison of the docking scores with respect to 3-BP indicated that both of these derivatives display a better binding strength to metabolic enzymes. Further, analysis of the drug likeness of 3-BP, DBPA and PA by Lipinski filter, admetSAR and FAF Drug3 indicated that all of these agents showed desirable drug-like criteria. The outcome of this investigation sheds light on the molecular characteristics of the binding of 3-BP and its derivatives with metabolic enzymes and thus may significantly contribute in designing and optimizing therapeutic strategies against cancer by using these agents.
Targeted Proteomics to Assess the Response to Anti-Angiogenic Treatment in Human Glioblastoma (GBM).
Demeure, Kevin; Fack, Fred; Duriez, Elodie; Tiemann, Katja; Bernard, Amandine; Golebiewska, Anna; Bougnaud, Sébastien; Bjerkvig, Rolf; Domon, Bruno; Niclou, Simone P
2016-02-01
Glioblastoma (GBM) is a highly aggressive primary brain tumor with dismal outcome for affected patients. Because of the significant neo-angiogenesis exhibited by GBMs, anti-angiogenic therapies have been intensively evaluated during the past years. Recent clinical studies were however disappointing, although a subpopulation of patients may benefit from such treatment. We have previously shown that anti-angiogenic targeting in GBM increases hypoxia and leads to a metabolic adaptation toward glycolysis, suggesting that combination treatments also targeting the glycolytic phenotype may be effective in GBM patients. The aim of this study was to identify marker proteins that are altered by treatment and may serve as a short term readout of anti-angiogenic therapy. Ultimately such proteins could be tested as markers of efficacy able to identify patient subpopulations responsive to the treatment. We applied a proteomics approach based on selected reaction monitoring (SRM) to precisely quantify targeted protein candidates, selected from pathways related to metabolism, apoptosis and angiogenesis. The workflow was developed in the context of patient-derived intracranial GBM xenografts developed in rodents and ensured the specific identification of human tumor versus rodent stroma-derived proteins. Quality control experiments were applied to assess sample heterogeneity and reproducibility of SRM assays at different levels. The data demonstrate that tumor specific proteins can be precisely quantified within complex biological samples, reliably identifying small concentration differences induced by the treatment. In line with previous work, we identified decreased levels of TCA cycle enzymes, including isocitrate dehydrogenase, whereas malectin, calnexin, and lactate dehydrogenase A were augmented after treatment. We propose the most responsive proteins of our subset as potential novel biomarkers to assess treatment response after anti-angiogenic therapy that warrant future analysis in clinical GBM samples. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Soma, Yuki; Yamaji, Taiki; Matsuda, Fumio; Hanai, Taizo
2017-05-01
Almost all synthetic pathways for biofuel production are designed to require endogenous metabolites in glycolysis, such as phosphoenolpyruvate, pyruvate, and acetyl-CoA. However, such metabolites are also required for bacterial cell growth. To reduce the metabolic imbalance between cell growth and target chemical production, we previously constructed a metabolic toggle switch (MTS) as a conditional flux redirection tool controlling metabolic flux of TCA cycle toward isopropanol production. This approach succeeded to improve the isopropanol production titer and yield while ensuring sufficient cell growth. However, excess accumulation of pyruvate, the precursor for acetyl-CoA synthesis, was also observed. In this study, for efficient conversation of pyruvate to acetyl-CoA (pyruvate oxidation), we designed a synthetic metabolic bypass composed of poxB and acs with the MTS for acetyl-CoA supply from the excess pyruvate. When this designed bypass was expressed at the appropriate expression level associated with the conditional metabolic flux redirection, pyruvate accumulation was prevented, and the isopropanol production titer and yield were improved. Final isopropanol production titer of strain harboring MTS with the synthetic metabolic bypass improved 4.4-fold compared with strain without metabolic flux regulation, and it was 1.3-fold higher than that of strain harboring the conventional MTS alone. Additionally, glucose consumption was also improved 1.7-fold compared with strain without metabolic flux regulation. On the other hand, introduction of the synthetic metabolic bypass alone showed no improvement in isopropanol production and glucose consumption. These results showed that the improvement in bio-production process caused by synergy between the MTS and the synthetic metabolic bypass. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Ivanova, Anastasia A; Wegner, Carl-Eric; Kim, Yongkyu; Liesack, Werner; Dedysh, Svetlana N
2016-10-01
Northern peatlands play a crucial role in the global carbon balance, serving as a persistent sink for atmospheric CO2 and a global carbon store. Their most extensive type, Sphagnum-dominated acidic peatlands, is inhabited by microorganisms with poorly understood degradation capabilities. Here, we applied a combination of barcoded pyrosequencing of SSU rRNA genes and Illumina RNA-Seq of total RNA (metatranscriptomics) to identify microbial populations and enzymes involved in degrading the major components of Sphagnum-derived litter and exoskeletons of peat-inhabiting arthropods: cellulose, xylan, pectin and chitin. Biopolymer addition to peat induced a threefold to fivefold increase in bacterial cell numbers. Functional community profiles of assembled mRNA differed between experimental treatments. In particular, pectin and xylan triggered increased transcript abundance of genes involved in energy metabolism and central carbon metabolism, such as glycolysis and TCA cycle. Concurrently, the substrate-induced activity of bacteria on these two biopolymers stimulated grazing of peat-inhabiting protozoa. Alveolata (ciliates) was the most responsive protozoa group as confirmed by analysis of both SSU rRNA genes and SSU rRNA. A stimulation of alphaproteobacterial methanotrophs on pectin was consistently shown by rRNA and mRNA data. Most likely, their significant enrichment was due to the utilization of methanol released during the degradation of pectin. Analysis of SSU rRNA and total mRNA revealed a specific response of Acidobacteria and Actinobacteria to chitin and pectin, respectively. Relatives of Telmatobacter bradus were most responsive among the Acidobacteria, while the actinobacterial response was primarily affiliated with Frankiales and Propionibacteriales. The expression of a wide repertoire of carbohydrate-active enzymes (CAZymes) corresponded well to the detection of a highly diverse peat-inhabiting microbial community, which is dominated by yet uncultivated bacteria. © 2016 John Wiley & Sons Ltd.
Zhang, Chao; Peng, Xi; Guo, Xiaofeng; Tang, Gaijuan; Sun, Fengli; Liu, Shudong; Xi, Yajun
2018-01-01
Switchgrass ( Panicum virgatum L.) is a model biofuel plant because of its high biomass, cellulose-richness, easy degradation to ethanol, and the availability of extensive genomic information. However, a little is currently known about the molecular responses of switchgrass plants to dehydration stress, especially multiple dehydration stresses. Studies on the transcriptional profiles of 35-day-old tissue culture plants revealed 741 dehydration memory genes. Gene Ontology and pathway analysis showed that these genes were enriched in phenylpropanoid biosynthesis, starch and sucrose metabolism, and plant hormone signal transduction. Further analysis of specific pathways combined with physiological data suggested that switchgrass improved its dehydration resistance by changing various aspects of its responses to secondary dehydration stress (D2), including the regulation of abscisic acid (ABA) and jasmonic acid (JA) biosynthesis and signal transduction, the biosynthesis of osmolytes (l-proline, stachyose and trehalose), energy metabolism (i.e., metabolic process relating to photosynthetic systems, glycolysis, and the TCA cycle), and lignin biosynthesis. The transcriptional data and chemical substance assays showed that ABA was significantly accumulated during both primary (D1) and secondary (D2) dehydration stresses, whereas JA accumulated during D1 but became significantly less abundant during D2. This suggests the existence of a complicated signaling network of plant hormones in response to repeated dehydration stresses. A homology analysis focusing on switchgrass, maize, and Arabidopsis revealed the conservation and species-specific distribution of dehydration memory genes. The molecular responses of switchgrass plants to successive dehydration stresses have been systematically characterized, revealing a previously unknown transcriptional memory behavior. These results provide new insights into the mechanisms of dehydration stress responses in plants. The genes and pathways identified in this study will be useful for the genetic improvement of switchgrass and other crops.
Wang, Yan-Feng; Tian, Juan; Ji, Zhi-Hua; Song, Mao-Yong; Li, Hao
2016-09-01
During the fermentation process, Clostridium acetobutylicum cells are often inhibited by the accumulated butanol. However, the mechanism underlying response of C. acetobutylicum to butanol stress remains poorly understood. This study was performed to clarify such mechanism through investigating the butanol stress-associated intracellular biochemical changes at acidogenesis phase (i.e., middle exponential phase) and solventogenesis phase (i.e., early stationary phase) by a gas chromatography-mass spectrometry-based metabolomics strategy. With the aid of partial least-squares-discriminant analysis, a pairwise discrimination between control group and butanol-treated groups was revealed, and 27 metabolites with variable importance in the projection value greater than 1 were identified. Under butanol stress, the glycolysis might be inhibited while TCA cycle might be promoted. Moreover, changes of lipids and fatty acids compositions, amino acid metabolism and osmoregulator concentrations might be the key factors involved in C. acetobutylicum metabolic response to butanol stress. It was suggested that C. acetobutylicum cells might change the levels of long acyl chain saturated fatty acids and branched-chain amino acids to maintain the integrity of cell membrane through adjusting membrane fluidity under butanol stress. The increased level of glycerol was considered to be correlated with osmoregulation and regulating redox balance. In addition, increased levels of some amino acids (i.e., threonine, glycine, alanine, phenylalanine, tyrosine, tryptophan, aspartate and glutamate) might also confer butanol tolerance to C. acetobutylicum. These results highlighted our knowledge about the response or adaptation of C. acetobutylicum to butanol stress, and would contribute to the construction of feasible butanologenic strains with higher butanol tolerance. Copyright © 2016 Elsevier Ltd. All rights reserved.
Targeted Proteomics to Assess the Response to Anti-Angiogenic Treatment in Human Glioblastoma (GBM)*
Demeure, Kevin; Fack, Fred; Duriez, Elodie; Tiemann, Katja; Bernard, Amandine; Golebiewska, Anna; Bougnaud, Sébastien; Bjerkvig, Rolf; Domon, Bruno; Niclou, Simone P.
2016-01-01
Glioblastoma (GBM) is a highly aggressive primary brain tumor with dismal outcome for affected patients. Because of the significant neo-angiogenesis exhibited by GBMs, anti-angiogenic therapies have been intensively evaluated during the past years. Recent clinical studies were however disappointing, although a subpopulation of patients may benefit from such treatment. We have previously shown that anti-angiogenic targeting in GBM increases hypoxia and leads to a metabolic adaptation toward glycolysis, suggesting that combination treatments also targeting the glycolytic phenotype may be effective in GBM patients. The aim of this study was to identify marker proteins that are altered by treatment and may serve as a short term readout of anti-angiogenic therapy. Ultimately such proteins could be tested as markers of efficacy able to identify patient subpopulations responsive to the treatment. We applied a proteomics approach based on selected reaction monitoring (SRM) to precisely quantify targeted protein candidates, selected from pathways related to metabolism, apoptosis and angiogenesis. The workflow was developed in the context of patient-derived intracranial GBM xenografts developed in rodents and ensured the specific identification of human tumor versus rodent stroma-derived proteins. Quality control experiments were applied to assess sample heterogeneity and reproducibility of SRM assays at different levels. The data demonstrate that tumor specific proteins can be precisely quantified within complex biological samples, reliably identifying small concentration differences induced by the treatment. In line with previous work, we identified decreased levels of TCA cycle enzymes, including isocitrate dehydrogenase, whereas malectin, calnexin, and lactate dehydrogenase A were augmented after treatment. We propose the most responsive proteins of our subset as potential novel biomarkers to assess treatment response after anti-angiogenic therapy that warrant future analysis in clinical GBM samples. PMID:26243272
Metabolomic and proteomic analysis of a clonal insulin-producing beta-cell line (INS-1 832/13).
Fernandez, Céline; Fransson, Ulrika; Hallgard, Elna; Spégel, Peter; Holm, Cecilia; Krogh, Morten; Wårell, Kristofer; James, Peter; Mulder, Hindrik
2008-01-01
Metabolites generated from fuel metabolism in pancreatic beta-cells control exocytosis of insulin, a process which fails in type 2 diabetes. To identify and quantify these metabolites, global and unbiased analysis of cellular metabolism is required. To this end, polar metabolites, extracted from the clonal 832/13 beta-cell line cultured at 2.8 and 16.7 mM glucose for 48 h, were derivatized followed by identification and quantification, using gas chromatography (GC) and mass spectrometry (MS). After culture at 16.7 mM glucose for 48 h, 832/13 beta-cells exhibited a phenotype reminiscent of glucotoxicity with decreased content and secretion of insulin. The metabolomic analysis revealed alterations in the levels of 7 metabolites derived from glycolysis, the TCA cycle and pentose phosphate shunt, and 4 amino acids. Principal component analysis of the metabolite data showed two clusters, corresponding to the cells cultured at 2.8 and 16.7 mM glucose, respectively. Concurrent changes in protein expression were analyzed by 2-D gel electrophoresis followed by LC-MS/MS. The identities of 86 spots corresponding to 75 unique proteins that were significantly different in 832/13 beta-cells cultured at 16.7 mM glucose were established. Only 5 of these were found to be metabolic enzymes that could be involved in the metabolomic alterations observed. Anticipated changes in metabolite levels in cells exposed to increased glucose were observed, while changes in enzyme levels were much less profound. This suggests that substrate availability, allosteric regulation, and/or post-translational modifications are more important determinants of metabolite levels than enzyme expression at the protein level.
Zhang, Weiruo; Bouchard, Gina; Yu, Alice; Shafiq, Majid; Jamali, Mehran; Shrager, Joseph B; Ayers, Kelsey; Bakr, Shaimaa; Gentles, Andrew J; Diehn, Maximilian; Quon, Andrew; West, Robert B; Nair, Viswam; van de Rijn, Matt; Napel, Sandy; Plevritis, Sylvia K
2018-05-14
Metabolic reprogramming of the tumor microenvironment is recognized as a cancer hallmark. To identify new molecular processes associated with tumor metabolism, we analyzed the transcriptome of bulk and flow-sorted human primary non-small cell lung cancer (NSCLC) together with 18FDG-positron emission tomography scans, which provide a clinical measure of glucose uptake. Tumors with higher glucose uptake were functionally enriched for molecular processes associated with invasion in adenocarcinoma (AD) and cell growth in squamous cell carcinoma (SCC). Next, we identified genes correlated to glucose uptake that were predominately overexpressed in a single cell-type comprising the tumor microenvironment. For SCC, most of these genes were expressed by malignant cells, whereas in AD they were predominately expressed by stromal cells, particularly cancer-associated fibroblasts (CAFs). Among these AD genes correlated to glucose uptake, we focused on Glutamine-Fructose-6-Phosphate Transaminase 2 (GFPT2), which codes for the Glutamine-Fructose-6-Phosphate Aminotransferase 2 (GFAT2), a rate-limiting enzyme of the hexosamine biosynthesis pathway (HBP), which is responsible for glycosylation. GFPT2 was predictive of glucose uptake independent of GLUT1, the primary glucose transporter, and was prognostically significant at both gene and protein level. We confirmed that normal fibroblasts transformed to CAF-like cells, following TGF-β treatment, upregulated HBP genes, including GFPT2, with less change in genes driving glycolysis, pentose phosphate pathway and TCA cycle. Our work provides new evidence of histology-specific tumor-stromal properties associated with glucose uptake in NSCLC and identifies GFPT2 as a critical regulator of tumor metabolic reprogramming in AD. Copyright ©2018, American Association for Cancer Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Su, Dian; Shukla, Anil K.; Chen, Baowei
2013-04-01
S-nitrosylation (SNO) is an important reversible thiol oxidation event that has been increasingly recognized for its role in cell signaling. While many proteins susceptible to S-nitrosylation have been reported, site-specific identification of physiologically relevant SNO modifications remains an analytical challenge due to the low-abundance and labile nature of the modification. Herein we present further improvement and optimization of the recently reported, resin-assisted cysteinyl peptide enrichment protocol for SNO identification and the extension of this application to mouse skeletal muscle to identify specific sites sensitive to S-nitrosylation by quantitative reactivity profiling. The results of our data indicate that the protein- andmore » peptide-level enrichment protocols provide comparable specificity and coverage of SNO-peptide identifications. S-nitrosylation reactivity profiling was performed by quantitatively comparing the site-specific SNO modification levels in samples treated with S-nitrosoglutathione (GSNO), an NO donor, at two different physiologically relevant concentrations (i.e., 10 μM and 100 μM). The reactivity profiling experiments overall identified 489 SNO-modified cysteine sites from 197 proteins with the specificity of 95.2% at the unique-peptide-level based on the percentage of Cys-peptides. Among these sites, 260 sites from 135 proteins were observed with relatively high reactivity to S-nitrosylation; such SNO-sensitive sites are more likely to be physiologically relevant. Many of the SNO-sensitive proteins are preferentially localized in mitochondria, contractile fiber and actin cytoskeleton, suggesting the susceptibility of these subcellular compartments to redox regulation. Moreover, the SNO-sensitive proteins seem to be primarily involved in metabolic pathways, including TCA cycle, glycolysis/gluconeogenesis, glutathione metabolism, and fatty acid metabolism, suggesting the importance of redox regulation in muscle metabolism and insulin action.« less
Sugiyama, Kazuo; Ebinuma, Hirotoshi; Nakamoto, Nobuhiro; Sakasegawa, Noriko; Murakami, Yuko; Chu, Po-sung; Usui, Shingo; Ishibashi, Yuka; Wakayama, Yuko; Taniki, Nobuhito; Murata, Hiroko; Saito, Yoshimasa; Fukasawa, Masayoshi; Saito, Kyoko; Yamagishi, Yoshiyuki; Wakita, Takaji; Takaku, Hiroshi; Hibi, Toshifumi; Saito, Hidetsugu; Kanai, Takanori
2014-01-01
Most of experiments for HCV infection have been done using lytic infection systems, in which HCV-infected cells inevitably die. Here, to elucidate metabolic alteration in HCV-infected cells in a more stable condition, we established an HCV-persistently-infected cell line, designated as HPI cells. This cell line has displayed prominent steatosis and supported HCV infection for more than 2 years, which is the longest ever reported. It enabled us to analyze metabolism in the HCV-infected cells integrally combining metabolomics and expression arrays. It revealed that rate-limiting enzymes for biosynthesis of cholesterol and fatty acids were up-regulated with actual increase in cholesterol, desmosterol (cholesterol precursor) and pool of fatty acids. Notably, the pentose phosphate pathway was facilitated with marked up-regulation of glucose-6-phosphate dehydrogenase, a rete-limiting enzyme, with actual increase in NADPH. In its downstream, enzymes for purine synthesis were also up-regulated resulting in increase of purine. Contrary to common cancers, the TCA cycle was preferentially facilitated comparing to glycolysis pathway with a marked increase of most of amino acids. Interestingly, some genes controlled by nuclear factor (erythroid-derived 2)-like 2 (Nrf2), a master regulator of antioxidation and metabolism, were constitutively up-regulated in HPI cells. Knockdown of Nrf2 markedly reduced steatosis and HCV infection, indicating that Nrf2 and its target genes play important roles in metabolic alteration and HCV infection. In conclusion, HPI cell is a bona fide HCV-persistently-infected cell line supporting HCV infection for years. This cell line sustained prominent steatosis in a hypermetabolic status producing various metabolites. Therefore, HPI cell is a potent research tool not only for persistent HCV infection but also for liver metabolism, overcoming drawbacks of the lytic infection systems. PMID:24718268
Cabezas-Cruz, Alejandro; Alberdi, Pilar; Valdés, James J; Villar, Margarita; de la Fuente, José
2017-01-01
The obligate intracellular pathogen, Anaplasma phagocytophilum , is the causative agent of human, equine, and canine granulocytic anaplasmosis and tick-borne fever (TBF) in ruminants. A. phagocytophilum has become an emerging tick-borne pathogen in the United States, Europe, Africa, and Asia, with increasing numbers of infected people and animals every year. It has been recognized that intracellular pathogens manipulate host cell metabolic pathways to increase infection and transmission in both vertebrate and invertebrate hosts. However, our current knowledge on how A. phagocytophilum affect these processes in the tick vector, Ixodes scapularis is limited. In this study, a genome-wide search for components of major carbohydrate metabolic pathways was performed in I. scapularis ticks for which the genome was recently published. The enzymes involved in the seven major carbohydrate metabolic pathways glycolysis, gluconeogenesis, pentose phosphate, tricarboxylic acid cycle (TCA), glyceroneogenesis, and mitochondrial oxidative phosphorylation and β-oxidation were identified. Then, the available transcriptomics and proteomics data was used to characterize the mRNA and protein levels of I. scapularis major carbohydrate metabolic pathway components in response to A. phagocytophilum infection of tick tissues and cultured cells. The results showed that major carbohydrate metabolic pathways are conserved in ticks. A. phagocytophilum infection inhibits gluconeogenesis and mitochondrial metabolism, but increases the expression of glycolytic genes. A model was proposed to explain how A. phagocytophilum could simultaneously control tick cell glucose metabolism and cytoskeleton organization, which may be achieved in part by up-regulating and stabilizing hypoxia inducible factor 1 alpha in a hypoxia-independent manner. The present work provides a more comprehensive view of the major carbohydrate metabolic pathways involved in the response to A. phagocytophilum infection in ticks, and provides the basis for further studies to develop novel strategies for the control of granulocytic anaplasmosis.
Feng, Xin; Xu, Jian; Liang, Yu; Chen, Guo-Li; Fan, Xian-Wei; Li, You-Zhi
2017-08-01
Filamentous fungi-copper (Cu) interactions are very important in the formation of natural ecosystems and the bioremediation of heavy metal pollution. However, important issues at the proteome level remain unclear. We compared six proteomes from Cu-resistant wild-type (WT) Penicillium janthinellum strain GXCR and a Cu-sensitive mutant (EC-6) under 0, 0.5, and 3 mmol/L Cu treatments using iTRAQ. A total of 495 known proteins were identified, and the following conclusions were drawn from the results: Cu tolerance depends on ATP generation and supply, which is relevant to glycolysis pathway activity; oxidative phosphorylation, the TCA cycle, gluconeogenesis, fatty acid synthesis, and metabolism are also affected by Cu; high Cu sensitivity is primarily due to an ATP energy deficit; among ATP generation pathways, Cu-sensitive and Cu-insensitive metabolic steps exist; gluconeogenesis pathway is crucial to the survival of fungi in Cu-containing and sugar-scarce environments; fungi change their proteomes via two routes (from ATP, ATP-dependent RNA helicases (ADRHs), and ribosome biogenesis to proteasomes and from ATP, ADRHs to spliceosomes and/or stress-adapted RNA degradosomes) to cope with changes in Cu concentrations; and unique routes exist through which fungi respond to high environmental Cu. Further, a general diagram of Cu-responsive paths and a model theory of high Cu are proposed at the proteome level. Our work not only provides the potential protein biomarkers that indicate Cu pollution and targets metabolic steps for engineering Cu-tolerant fungi during bioremediation but also presents clues for further insight into the heavy metal tolerance mechanisms of other eukaryotes. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.
Pyruvate dehydrogenase deficiency and epilepsy.
Prasad, Chitra; Rupar, Tony; Prasad, Asuri N
2011-11-01
The pyruvate dehydrogenase complex (PDHc) is a mitochondrial matrix multienzyme complex that provides the link between glycolysis and the tricarboxylic acid (TCA) cycle by catalyzing the conversion of pyruvate into acetyl-CoA. PDHc deficiency is one of the commoner metabolic disorders of lactic acidosis presenting with neurological phenotypes that vary with age and gender. In this mini-review, we postulate mechanisms of epilepsy in the setting of PDHc deficiency using two illustrative cases (one with pyruvate dehydrogenase complex E1-alpha polypeptide (PDHA1) deficiency and the second one with pyruvate dehydrogenase complex E1-beta subunit (PDHB) deficiency (a rare subtype of PDHc deficiency)) and a selected review of published case series. PDHc plays a critical role in the pathway of carbohydrate metabolism and energy production. In severe deficiency states the resulting energy deficit impacts on brain development in utero resulting in structural brain anomalies and epilepsy. Milder deficiency states present with variable manifestations that include cognitive delay, ataxia, and seizures. Epileptogenesis in PDHc deficiency is linked to energy failure, development of structural brain anomalies and abnormal neurotransmitter metabolism. The use of the ketogenic diet bypasses the metabolic block, by providing a direct source of acetyl-CoA, leading to amelioration of some symptoms. Genetic counseling is essential as PDHA1 deficiency (commonest defect) is X-linked although females can be affected due to unfavorable lyonization, while PDHB and PDH phosphatase (PDP) deficiencies (much rarer defects) are of autosomal recessive inheritance. Research is in progress for looking into animal models to better understand pathogenesis and management of this challenging disorder. Copyright © 2011 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.
Vera, L M; Metochis, C; Taylor, J F; Clarkson, M; Skjærven, K H; Migaud, H; Tocher, D R
2017-11-17
To ensure sustainability of aquaculture, plant-based ingredients are being used in feeds to replace marine-derived products. However, plants contain secondary metabolites which can affect food intake and nutrient utilisation of fish. The application of nutritional stimuli during early development can induce long-term changes in animal physiology. Recently, we successfully used this approach to improve the utilisation of plant-based diets in diploid and triploid Atlantic salmon. In the present study we explored the molecular mechanisms occurring in the liver of salmon when challenged with a plant-based diet in order to determine the metabolic processes affected, and the effect of ploidy. Microarray analysis revealed that nutritional history had a major impact on the expression of genes. Key pathways of intermediary metabolism were up-regulated, including oxidative phosphorylation, pyruvate metabolism, TCA cycle, glycolysis and fatty acid metabolism. Other differentially expressed pathways affected by diet included protein processing in endoplasmic reticulum, RNA transport, endocytosis and purine metabolism. The interaction between diet and ploidy also had an effect on the hepatic transcriptome of salmon. The biological pathways with the highest number of genes affected by this interaction were related to gene transcription and translation, and cell processes such as proliferation, differentiation, communication and membrane trafficking. The present study revealed that nutritional programming induced changes in a large number of metabolic processes in Atlantic salmon, which may be associated with the improved fish performance and nutrient utilisation demonstrated previously. In addition, differences between diploid and triploid salmon were found, supporting recent data that indicate nutritional requirements of triploid salmon may differ from those of their diploid counterparts.
Effect of anti-glycolytic agents on tumour cells in vitro
NASA Astrophysics Data System (ADS)
Korshunov, D. A.; Kondakova, I. V.
2016-08-01
A metabolic change is one of the tumour hallmarks, which has recently attracted a great amount of attention. One of the main metabolic characteristics of tumour cells is a high level of glycolysis even in the presence of oxygen, known as aerobic glycolysis or the Warburg effect. The energy production is much less in a glycolysis pathway than that in a tricarboxylic acid cycle. The Warburg effect constitutes a fundamental adaptation of tumour cells to a relatively hostile environment, and supports the evolution of aggressive and metastatic phenotypes. As a result, tumour glycolysis may become an attractive target for cancer therapy. Here, we research the effect of potential anticancer agents on tumour cells in vitro. In our study, we found a high sensitivity of tumour cells to anti-glycolityc drugs. In addition, tumour cells are more resistant to the agents studied in comparison with normal cells. We also observed an atypical cooperative interaction of tumour cells in the median lethal dose of drugs. They formed the specific morphological structure of the surviving cells. This behavior is not natural for the culture of tumour cells. Perhaps this is one of the mechanisms of cells' adaptation to the aggressive environment.
Lee, Ji Eun; Oney, McKenna; Frizzell, Kimberly; Phadnis, Nitin; Hollien, Julie
2015-01-01
Endoplasmic reticulum (ER) stress results from an imbalance between the load of proteins entering the secretory pathway and the ability of the ER to fold and process them. The response to ER stress is mediated by a collection of signaling pathways termed the unfolded protein response, which plays important roles in development and disease. Here we show that in Drosophila melanogaster S2 cells, ER stress induces a coordinated change in the expression of genes involved in carbon metabolism. Genes encoding enzymes that carry out glycolysis were up-regulated, whereas genes encoding proteins in the tricarboxylic acid cycle and respiratory chain complexes were down-regulated. The unfolded protein response transcription factor Atf4 was necessary for the up-regulation of glycolytic enzymes and Lactate dehydrogenase (Ldh). Furthermore, Atf4 binding motifs in promoters for these genes could partially account for their regulation during ER stress. Finally, flies up-regulated Ldh and produced more lactate when subjected to ER stress. Together, these results suggest that Atf4 mediates a shift from a metabolism based on oxidative phosphorylation to one more heavily reliant on glycolysis, reminiscent of aerobic glycolysis or the Warburg effect observed in cancer and other proliferative cells. PMID:25681259
USDA-ARS?s Scientific Manuscript database
To elucidate the cause of reported pyruvate accumulation in chilled stored cucumbers (Cucumis sativus L.) cv. ‘Toppugurin’, we have examined differences in the extent of incorporation of acetate-1,2-14C into the tricarboxylic acid (TCA) cycle and the specific activity of the enzyme citrate synthase ...
2012-01-01
Background Aspergillus fumigatus is a mold responsible for the majority of cases of aspergillosis in humans. To survive in the human body, A. fumigatus must adapt to microenvironments that are often characterized by low nutrient and oxygen availability. Recent research suggests that the ability of A. fumigatus and other pathogenic fungi to adapt to hypoxia contributes to their virulence. However, molecular mechanisms of A. fumigatus hypoxia adaptation are poorly understood. Thus, to better understand how A. fumigatus adapts to hypoxic microenvironments found in vivo during human fungal pathogenesis, the dynamic changes of the fungal transcriptome and proteome in hypoxia were investigated over a period of 24 hours utilizing an oxygen-controlled fermenter system. Results Significant increases in transcripts associated with iron and sterol metabolism, the cell wall, the GABA shunt, and transcriptional regulators were observed in response to hypoxia. A concomitant reduction in transcripts was observed with ribosome and terpenoid backbone biosynthesis, TCA cycle, amino acid metabolism and RNA degradation. Analysis of changes in transcription factor mRNA abundance shows that hypoxia induces significant positive and negative changes that may be important for regulating the hypoxia response in this pathogenic mold. Growth in hypoxia resulted in changes in the protein levels of several glycolytic enzymes, but these changes were not always reflected by the corresponding transcriptional profiling data. However, a good correlation overall (R2 = 0.2, p < 0.05) existed between the transcriptomic and proteomics datasets for all time points. The lack of correlation between some transcript levels and their subsequent protein levels suggests another regulatory layer of the hypoxia response in A. fumigatus. Conclusions Taken together, our data suggest a robust cellular response that is likely regulated both at the transcriptional and post-transcriptional level in response to hypoxia by the human pathogenic mold A. fumigatus. As with other pathogenic fungi, the induction of glycolysis and transcriptional down-regulation of the TCA cycle and oxidative phosphorylation appear to major components of the hypoxia response in this pathogenic mold. In addition, a significant induction of the transcripts involved in ergosterol biosynthesis is consistent with previous observations in the pathogenic yeasts Candida albicans and Cryptococcus neoformans indicating conservation of this response to hypoxia in pathogenic fungi. Because ergosterol biosynthesis enzymes also require iron as a co-factor, the increase in iron uptake transcripts is consistent with an increased need for iron under hypoxia. However, unlike C. albicans and C. neoformans, the GABA shunt appears to play an important role in reducing NADH levels in response to hypoxia in A. fumigatus and it will be intriguing to determine whether this is critical for fungal virulence. Overall, regulatory mechanisms of the A. fumigatus hypoxia response appear to involve both transcriptional and post-transcriptional control of transcript and protein levels and thus provide candidate genes for future analysis of their role in hypoxia adaptation and fungal virulence. PMID:22309491
2013-01-01
Background Most normal cells in the presence of oxygen utilize glucose for mitochondrial oxidative phosphorylation. In contrast, many cancer cells rapidly convert glucose to lactate in the cytosol, a process termed aerobic glycolysis. This glycolytic phenotype is enabled by lactate dehydrogenase (LDH), which catalyzes the inter-conversion of pyruvate and lactate. The purpose of this study was to identify and characterize potent and selective inhibitors of LDHA. Methods High throughput screening and lead optimization were used to generate inhibitors of LDHA enzymatic activity. Effects of these inhibitors on metabolism were evaluated using cell-based lactate production, oxygen consumption, and 13C NMR spectroscopy assays. Changes in comprehensive metabolic profile, cell proliferation, and apoptosis were assessed upon compound treatment. Results 3-((3-carbamoyl-7-(3,5-dimethylisoxazol-4-yl)-6-methoxyquinolin-4-yl) amino) benzoic acid was identified as an NADH-competitive LDHA inhibitor. Lead optimization yielded molecules with LDHA inhibitory potencies as low as 2 nM and 10 to 80-fold selectivity over LDHB. Molecules in this family rapidly and profoundly inhibited lactate production rates in multiple cancer cell lines including hepatocellular and breast carcinomas. Consistent with selective inhibition of LDHA, the most sensitive breast cancer cell lines to lactate inhibition in hypoxic conditions were cells with low expression of LDHB. Our inhibitors increased rates of oxygen consumption in hepatocellular carcinoma cells at doses up to 3 microM, while higher concentrations directly inhibited mitochondrial function. Analysis of more than 500 metabolites upon LDHA inhibition in Snu398 cells revealed that intracellular concentrations of glycolysis and citric acid cycle intermediates were increased, consistent with enhanced Krebs cycle activity and blockage of cytosolic glycolysis. Treatment with these compounds also potentiated PKM2 activity and promoted apoptosis in Snu398 cells. Conclusions Rapid chemical inhibition of LDHA by these quinoline 3-sulfonamids led to profound metabolic alterations and impaired cell survival in carcinoma cells making it a compelling strategy for treating solid tumors that rely on aerobic glycolysis for survival. PMID:24280423
Glucose metabolism and astrocyte-neuron interactions in the neonatal brain.
Brekke, Eva; Morken, Tora Sund; Sonnewald, Ursula
2015-03-01
Glucose is essentially the sole fuel for the adult brain and the mapping of its metabolism has been extensive in the adult but not in the neonatal brain, which is believed to rely mainly on ketone bodies for energy supply. However, glucose is absolutely indispensable for normal development and recent studies have shed light on glycolysis, the pentose phosphate pathway and metabolic interactions between astrocytes and neurons in the 7-day-old rat brain. Appropriately (13)C labeled glucose was used to distinguish between glycolysis and the pentose phosphate pathway during development. Experiments using (13)C labeled acetate provided insight into the GABA-glutamate-glutamine cycle between astrocytes and neurons. It could be shown that in the neonatal brain the part of this cycle that transfers glutamine from astrocytes to neurons is operating efficiently while, in contrast, little glutamate is shuttled from neurons to astrocytes. This lack of glutamate for glutamine synthesis is compensated for by anaplerosis via increased pyruvate carboxylation relative to that in the adult brain. Furthermore, compared to adults, relatively more glucose is prioritized to the pentose phosphate pathway than glycolysis and pyruvate dehydrogenase activity. The reported developmental differences in glucose metabolism and neurotransmitter synthesis may determine the ability of the brain at various ages to resist excitotoxic insults such as hypoxia-ischemia. Copyright © 2015 Elsevier Ltd. All rights reserved.
Li, Lin-feng; Zhai, Fang; Shang, Lu-qing; Yin, Zheng; Yuan, Ying-jin
2014-01-01
Identification of efficient key enzymes in biosynthesis pathway and optimization of the fitness between functional modules and chassis are important for improving the production of target compounds. In this study, the taxadiene biosynthesis pathway was firstly constructed in yeast by transforming ts gene and overexpressing erg20 and thmgr. Then, the catalytic capabilities of six different geranylgeranyl diphosphate synthases (GGPPS), the key enzyme in mevalonic acid (MVA) pathway catalyzing famesyl diphosphate (FPP) to geranylgeranyl diphosphate (GGPP), were predicted using enzyme-substrate docking strategy. GGPPSs from Taxus baccata x Taxus cuspidate (GGPPSbc), Erwinia herbicola (GGPPSeh), and S. cerevisiae (GGPPSsc) which ranked 1st, 4th and 6th in docking with FPP were selected for construction. The experimental results were consistent with the computer prediction that the engineered yeast with GGPPSbc exhibited the highest production. In addition, two chassis YSG50 and W303-1A were chosen, and the titer of taxadiene reached 72.8 mg/L in chassis YSG50 with GGPPSbc. Metabolomic study revealed that the contents of tricarboxylic acid cycle (TCA) intermediates and their precursor amino acids in chassis YSG50 was lower than those in W303-1A, indicating less carbon flux was divided into TCA cycle. Furthermore, the levels of TCA intermediates in the taxadiene producing yeasts were lower than those in chassis YSG50. Thus, it may result in more carbon flux in MVA pathway in chassis YSG50, which suggested that YSG50 was more suitable for engineering the taxadiene producing yeast. These results indicated that computer-aided protein modeling directed isoenzyme selection strategy and metabolomic study could guide the rational design of terpenes biosynthetic cells. PMID:25295588
Targeting MUC1-Mediated Tumor-Stromal Metabolic Interactions in Triple-Negative Breast Cancer
2015-09-01
exhibit increased dependence on glycolysis, resulting in abundant export of lactic acid . Lactic acid is mainly transported by two H+/lactate symporters...and ammonia recycling were most significantly altered in MDA-MB468 closely followed by citric acid cycle pathway. Mitochondrial electron transport...chain and citric acid cycle pathways were most significantly altered in BT20. Furthermore, relative comparison of the fold change in individual
Metabolite profiling of human colon carcinoma--deregulation of TCA cycle and amino acid turnover.
Denkert, Carsten; Budczies, Jan; Weichert, Wilko; Wohlgemuth, Gert; Scholz, Martin; Kind, Tobias; Niesporek, Silvia; Noske, Aurelia; Buckendahl, Anna; Dietel, Manfred; Fiehn, Oliver
2008-09-18
Apart from genetic alterations, development and progression of colorectal cancer has been linked to influences from nutritional intake, hyperalimentation, and cellular metabolic changes that may be the basis for new diagnostic and therapeutic approaches. However, in contrast to genomics and proteomics, comprehensive metabolomic investigations of alterations in malignant tumors have rarely been conducted. In this study we investigated a set of paired samples of normal colon tissue and colorectal cancer tissue with gas-chromatography time-of-flight mass-spectrometry, which resulted in robust detection of a total of 206 metabolites. Metabolic phenotypes of colon cancer and normal tissues were different at a Bonferroni corrected significance level of p=0.00170 and p=0.00005 for the first two components of an unsupervised PCA analysis. Subsequent supervised analysis found 82 metabolites to be significantly different at p<0.01. Metabolites were connected to abnormalities in metabolic pathways by a new approach that calculates the distance of each pair of metabolites in the KEGG database interaction lattice. Intermediates of the TCA cycle and lipids were found down-regulated in cancer, whereas urea cycle metabolites, purines, pyrimidines and amino acids were generally found at higher levels compared to normal colon mucosa. This study demonstrates that metabolic profiling facilitates biochemical phenotyping of normal and neoplastic colon tissue at high significance levels and points to GC-TOF-based metabolomics as a new method for molecular pathology investigations.
Chrysanthopoulos, Panagiotis K.; Hodson, Mark P.; Darnell, Ross; Korie, Sam
2018-01-01
Aflatoxin contamination is associated with the development of aflatoxigenic fungi such as Aspergillus flavus and A. parasiticus on food grains. This study was aimed at investigating metabolites produced during fungal development on maize and their correlation with aflatoxin levels. Maize cobs were harvested at R3 (milk), R4 (dough), and R5 (dent) stages of maturity. Individual kernels were inoculated in petri dishes with four doses of fungal spores. Fungal colonisation, metabolite profile, and aflatoxin levels were examined. Grain colonisation decreased with kernel maturity: milk-, dough-, and dent-stage kernels by approximately 100%, 60%, and 30% respectively. Aflatoxin levels increased with dose at dough and dent stages. Polar metabolites including alanine, proline, serine, valine, inositol, iso-leucine, sucrose, fructose, trehalose, turanose, mannitol, glycerol, arabitol, inositol, myo-inositol, and some intermediates of the tricarboxylic acid cycle (TCA—also known as citric acid or Krebs cycle) were important for dose classification. Important non-polar metabolites included arachidic, palmitic, stearic, 3,4-xylylic, and margaric acids. Aflatoxin levels correlated with levels of several polar metabolites. The strongest positive and negative correlations were with arabitol (R = 0.48) and turanose and (R = −0.53), respectively. Several metabolites were interconnected with the TCA; interconnections of the metabolites with the TCA cycle varied depending upon the grain maturity. PMID:29735944
2015-01-01
Whey protein intake is associated with the modulation of energy metabolism and altered body composition both in human subjects and in animals, but the underlying mechanisms are not yet elucidated. We fed obesity-prone C57BL/6J mice high-fat diets with either casein (HF casein) or whey (HF whey) for 6 weeks. At equal energy intake and apparent fat and nitrogen digestibility, mice fed HF whey stored less energy as lipids, evident both as lower white adipose tissue mass and as reduced liver lipids, compared with HF-casein-fed mice. Explorative analyses of 48 h urine, both by 1H NMR and LC–MS metabolomic platforms, demonstrated higher urinary excretion of tricarboxylic acid (TCA) cycle intermediates citric acid and succinic acid (identified by both platforms), and cis-aconitic acid and isocitric acid (identified by LC–MS platform) in the HF whey, relative to in the HF-casein-fed mice. Targeted LC–MS analyses revealed higher citric acid and cis-aconitic acid concentrations in fed state plasma, but not in liver of HF-whey-fed mice. We propose that enhanced urinary loss of TCA cycle metabolites drain available substrates for anabolic processes, such as lipogenesis, thereby leading to reduced lipid accretion in HF-whey-fed compared to HF-casein-fed mice. PMID:24702026
Lakhter, Alexander J.; Hamilton, James; Dagher, Pierre C.; Mukkamala, Suresh; Hato, Takashi; Dong, X. Charlie; Mayo, Lindsey D.; Harris, Robert A.; Shekhar, Anantha; Ivan, Mircea; Brustovetsky, Nickolay; Naidu, Samisubbu R.
2014-01-01
Reliance on glycolysis is a characteristic of malignancy, yet the development of resistance to BRAF inhibitors in melanoma is associated with gain of mitochondrial function. Concurrent attenuation of oxidative phosphorylation and HIF-1α/PKM2-dependent glycolysis promotes a non-apoptotic, iron- and oxygen-dependent cell death that we term ferroxitosis. The redox cycling agent menadione causes a robust increase in oxygen consumption, accompanied by significant loss of intracellular ATP and rapid cell death. Conversely, either hypoxic adaptation or iron chelation prevents menadione-induced ferroxitosis. Ectopic expression of K213Q HIF-1α mutant blunts the effects of menadione. However, knockdown of HIF-1α or PKM2 restores menadione-induced cytotoxicity in hypoxia. Similarly, exposure of melanoma cells to shikonin, a menadione analog and a potential PKM2 inhibitor, is sufficient to induce ferroxitosis under hypoxic conditions. Collectively, our findings reveal that ferroxitosis curtails metabolic plasticity in melanoma. PMID:25587028
Renewable Bio-Solar Hydrogen Production: The Second Generation (Part B)
2015-03-20
SUBJECT TERMS Biohydrogen, biofuels, cyanobacteria, photosynthesis, fermentation , transcription profiling, metabolic engineering, TCA cycle... fermentation in the cyanobacterium Arthrospira (Spirulina) maxima CS-328. Appl. Environ. Microbiol., 77: 7185-7194. 5. Zhang, S. and Bryant, D. A...glycogen is the preferred substrate during auto- fermentation . J. Biotech. 166: 65-75. 10. Kumaraswamy, G. K., Guerra, T., Qian, X., Zhang, S., Bryant
Ghosh, Arpan C.; O’Connor, Michael B.
2014-01-01
The ability to maintain cellular and physiological metabolic homeostasis is key for the survival of multicellular organisms in changing environmental conditions. However, our understanding of extracellular signaling pathways that modulate metabolic processes remains limited. In this study we show that the Activin-like ligand Dawdle (Daw) is a major regulator of systemic metabolic homeostasis and cellular metabolism in Drosophila. We find that loss of canonical Smad signaling downstream of Daw leads to defects in sugar and systemic pH homeostasis. Although Daw regulates sugar homeostasis by positively influencing insulin release, we find that the effect of Daw on pH balance is independent of its role in insulin signaling and is caused by accumulation of organic acids that are primarily tricarboxylic acid (TCA) cycle intermediates. RNA sequencing reveals that a number of TCA cycle enzymes and nuclear-encoded mitochondrial genes including genes involved in oxidative phosphorylation and β-oxidation are up-regulated in the daw mutants, indicating either a direct or indirect role of Daw in regulating these genes. These findings establish Activin signaling as a major metabolic regulator and uncover a functional link between TGF-β signaling, insulin signaling, and metabolism in Drosophila. PMID:24706779
Meshitsuka, Shunsuke; Aremu, David A
2008-02-01
Citrate has been identified as a major tricarboxylic acid (TCA) cycle constituent preferentially released by astrocytes. We undertook the present study to examine further the nature of metabolic compartmentation in central nervous system tissues using (13)C-labeled glucose and to provide new information on the influence of aluminum on the metabolic interaction between neurons and astrocytes. Metabolites released into the culture medium from astrocytes and neuron-astrocyte coculture, as well as the perchloric acid extracts of the cells were analyzed using 2D (1)H and (13)C NMR spectroscopy. Astrocytes released citrate into the culture medium and the released citrate was consumed by neurons in coculture. Citrate release by astrocytes was blocked in the presence of aluminum, with progressive accumulation of citrate within the cells. We propose citrate supply is a more efficient energy source than lactate for neurons to produce ATP, especially in the hypoglycemic state on account of it being a direct component of the TCA cycle. Astrocytes may be the cellular compartment for aluminum accumulation as a citrate complex in the brain.
Ramirez-Malule, Howard; Junne, Stefan; Nicolás Cruz-Bournazou, Mariano; Neubauer, Peter; Ríos-Estepa, Rigoberto
2018-05-01
Clavulanic acid (CA) is produced by Streptomyces clavuligerus (S. clavuligerus) as a secondary metabolite. Knowledge about the carbon flux distribution along the various routes that supply CA precursors would certainly provide insights about metabolic performance. In order to evaluate metabolic patterns and the possible accumulation of tricarboxylic acid (TCA) cycle intermediates during CA biosynthesis, batch and subsequent continuous cultures with steadily declining feed rates were performed with glycerol as the main substrate. The data were used to in silico explore the metabolic capabilities and the accumulation of metabolic intermediates in S. clavuligerus. While clavulanic acid accumulated at glycerol excess, it steadily decreased at declining dilution rates; CA synthesis stopped when glycerol became the limiting substrate. A strong association of succinate, oxaloacetate, malate, and acetate accumulation with CA production in S. clavuligerus was observed, and flux balance analysis (FBA) was used to describe the carbon flux distribution in the network. This combined experimental and numerical approach also identified bottlenecks during the synthesis of CA in a batch and subsequent continuous cultivation and demonstrated the importance of this type of methodologies for a more advanced understanding of metabolism; this potentially derives valuable insights for future successful metabolic engineering studies in S. clavuligerus.
(13)C-metabolic flux analysis in S-adenosyl-L-methionine production by Saccharomyces cerevisiae.
Hayakawa, Kenshi; Kajihata, Shuichi; Matsuda, Fumio; Shimizu, Hiroshi
2015-11-01
S-Adenosyl-L-methionine (SAM) is a major biological methyl group donor, and is used as a nutritional supplement and prescription drug. Yeast is used for the industrial production of SAM owing to its high intracellular SAM concentrations. To determine the regulation mechanisms responsible for such high SAM production, (13)C-metabolic flux analysis ((13)C-MFA) was conducted to compare the flux distributions in the central metabolism between Kyokai no. 6 (high SAM-producing) and S288C (control) strains. (13)C-MFA showed that the levels of tricarboxylic acid (TCA) cycle flux in SAM-overproducing strain were considerably increased compared to those in the S228C strain. Analysis of ATP balance also showed that a larger amount of excess ATP was produced in the Kyokai 6 strain because of increased oxidative phosphorylation. These results suggest that high SAM production in Kyokai 6 strains could be attributed to enhanced ATP regeneration with high TCA cycle fluxes and respiration activity. Thus, maintaining high respiration efficiency during cultivation is important for improving SAM production. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Upregulation of Krebs cycle and anaerobic glycolysis activity early after onset of liver ischemia.
Chan, Tom S; Cassim, Shamir; Raymond, Valérie-Ann; Gottschalk, Sven; Merlen, Grégory; Zwingmann, Claudia; Lapierre, Pascal; Darby, Peter; Mazer, Cyril David; Bilodeau, Marc
2018-01-01
The liver is a highly vascularized organ receiving a dual input of oxygenated blood from the hepatic artery and portal vein. The impact of decreased blood flow on glucose metabolism and how hepatocytes could adapt to this restrictive environment are still unclear. Using the left portal vein ligation (LPVL) rat model, we found that cellular injury was delayed after the onset of liver ischemia. We hypothesized that a metabolic adaptation by hepatocytes to maintain energy homeostasis could account for this lag phase. Liver glucose metabolism was characterized by 13C- and 1H-NMR spectroscopy and analysis of high-energy metabolites. ALT levels and caspase 3 activity in LPVL animals remained normal during the first 12 h following surgery (P<0.05). Ischemia rapidly led to decreased intrahepatic tissue oxygen tension and blood flow (P<0.05) and increased expression of Hypoxia-inducible factor 1-alpha. Intrahepatic glucose uptake, ATP/ADP ratio and energy charge level remained stable for up to 12 h after ligation. Entry of glucose in the Krebs cycle was impaired with lowered incorporation of 13C from [U-13C]glucose into glutamate and succinate from 0.25 to 12 h after LPVL. However, total hepatic succinate and glutamate increased 6 and 12 h after ischemia (P<0.05). Glycolysis was initially reduced (P<0.05) but reached maximum 13C-lactate (P<0.001) and 13C-alanine (P<0.01) enrichments 12 h after LPVL. In conclusion, early liver homeostasis stems from an inherent ability of ischemic hepatocytes to metabolically adapt through increased Krebs cycle and glycolysis activity to preserve bioenergetics and cell viability. This metabolic plasticity of hepatocytes could be harnessed to develop novel metabolic strategies to prevent ischemic liver damage.
Mitophagy-driven mitochondrial rejuvenation regulates stem cell fate
Vazquez-Martin, Alejandro; Van den Haute, Chris; Cufí, Sílvia; Corominas-Faja, Bruna; Cuyàs, Elisabet; Lopez-Bonet, Eugeni; Rodriguez-Gallego, Esther; Fernández-Arroyo, Salvador; Joven, Jorge; Baekelandt, Veerle; Menendez, Javier A.
2016-01-01
Our understanding on how selective mitochondrial autophagy, or mitophagy, can sustain the archetypal properties of stem cells is incomplete. PTEN-induced putative kinase 1 (PINK1) plays a key role in the maintenance of mitochondrial morphology and function and in the selective degradation of damaged mitochondria by mitophagy. Here, using embryonic fibroblasts from PINK1 gene-knockout (KO) mice, we evaluated whether mitophagy is a causal mechanism for the control of cell-fate plasticity and maintenance of pluripotency. Loss of PINK1-dependent mitophagy was sufficient to dramatically decrease the speed and efficiency of induced pluripotent stem cell (iPSC) reprogramming. Mitophagy-deficient iPSC colonies, which were characterized by a mixture of mature and immature mitochondria, seemed unstable, with a strong tendency to spontaneously differentiate and form heterogeneous populations of cells. Although mitophagy-deficient iPSC colonies normally expressed pluripotent markers, functional monitoring of cellular bioenergetics revealed an attenuated glycolysis in mitophagy-deficient iPSC cells. Targeted metabolomics showed a notable alteration in numerous glycolysis- and TCA-related metabolites in mitophagy-deficient iPSC cells, including a significant decrease in the intracellular levels of α-ketoglutarate -a key suppressor of the differentiation path in stem cells. Mitophagy-deficient iPSC colonies exhibited a notably reduced teratoma-initiating capacity, but fully retained their pluripotency and multi-germ layer differentiation capacity in vivo. PINK1-dependent mitophagy pathway is an important mitochondrial switch that determines the efficiency and quality of somatic reprogramming. Mitophagy-driven mitochondrial rejuvenation might contribute to the ability of iPSCs to suppress differentiation by directing bioenergetic transition and metabolome remodeling traits. These findings provide new insights into how mitophagy might influence the stem cell decisions to retain pluripotency or differentiate in tissue regeneration and aging, tumor growth, and regenerative medicine. PMID:27295498
Bai, Xiuzhi; Zhang, Ting; Qu, Zhipeng; Li, Haipu; Yang, Zhaoguang
2017-09-01
In this study, the distribution of 2,4,6-trichloroanisole (2,4,6-TCA) in two water supply reservoirs and four associated drinking water treatment plants (DWTPs) were investigated. The 2,4,6-TCA concentrations were in the range of 1.53-2.36 ng L -1 in water supply reservoirs and 0.76-6.58 ng L -1 at DWTPs. To determine the contribution of filamentous fungi to 2,4,6-TCA in a full-scale treatment process, the concentrations of 2,4,6-TCA in raw water, settled water, post-filtration water, and finished water were measured. The results showed that 2,4,6-TCA levels continuously increased until chlorination, suggesting that 2,4,6-TCA could form without a chlorination reaction and fungi might be the major contributor to the 2,4,6-TCA formation. Meanwhile, twenty-nine fungal strains were isolated and identified by morphological and molecular biological methods. Of the seventeen isolated fungal species, eleven showed the capability to convert 2,4,6-trichlorophenol (2,4,6-TCP) to 2,4,6-TCA. The highest level of 2,4,6-TCA formation was carried out by Aspergillus versicolor voucher BJ1-3: 40.5% of the original 2,4,6-TCP was converted to 2,4,6-TCA. There was a significant variation in the capability of different species to generate 2,4,6-TCA. The results from the proportions of cell-free, cell-attached, and cell-bound 2,4,6-TCA suggested that 2,4,6-TCA generated by fungi was mainly distributed in their extracellular environment. In addition to 2,4,6-TCA, five putative volatile by-products were also identified by gas chromatography and mass spectrometry. These findings increase our understanding on the mechanisms involved in the formation of 2,4,6-TCA and provide insights into managing and controlling 2,4,6-TCA-related problems in drinking water. Copyright © 2017 Elsevier Ltd. All rights reserved.
Lee, Ji Eun; Oney, McKenna; Frizzell, Kimberly; Phadnis, Nitin; Hollien, Julie
2015-02-13
Endoplasmic reticulum (ER) stress results from an imbalance between the load of proteins entering the secretory pathway and the ability of the ER to fold and process them. The response to ER stress is mediated by a collection of signaling pathways termed the unfolded protein response, which plays important roles in development and disease. Here we show that in Drosophila melanogaster S2 cells, ER stress induces a coordinated change in the expression of genes involved in carbon metabolism. Genes encoding enzymes that carry out glycolysis were up-regulated, whereas genes encoding proteins in the tricarboxylic acid cycle and respiratory chain complexes were down-regulated. The unfolded protein response transcription factor Atf4 was necessary for the up-regulation of glycolytic enzymes and Lactate dehydrogenase (Ldh). Furthermore, Atf4 binding motifs in promoters for these genes could partially account for their regulation during ER stress. Finally, flies up-regulated Ldh and produced more lactate when subjected to ER stress. Together, these results suggest that Atf4 mediates a shift from a metabolism based on oxidative phosphorylation to one more heavily reliant on glycolysis, reminiscent of aerobic glycolysis or the Warburg effect observed in cancer and other proliferative cells. Copyright © 2015 Lee et al.
Weekes, M. P.; Antrobus, R.; Rorbach, J.; van Haute, L.; Umrania, Y.; Smith, D. L.; Minczuk, M.; Lehner, P. J.; Sinclair, J. H.
2016-01-01
ABSTRACT Infection with human cytomegalovirus (HCMV) profoundly affects cellular metabolism. Like in tumor cells, HCMV infection increases glycolysis, and glucose carbon is shifted from the mitochondrial tricarboxylic acid cycle to the biosynthesis of fatty acids. However, unlike in many tumor cells, where aerobic glycolysis is accompanied by suppression of mitochondrial oxidative phosphorylation, HCMV induces mitochondrial biogenesis and respiration. Here, we affinity purified mitochondria and used quantitative mass spectrometry to determine how the mitochondrial proteome changes upon HCMV infection. We found that the mitochondrial transcription and translation systems are induced early during the viral replication cycle. Specifically, proteins involved in biogenesis of the mitochondrial ribosome were highly upregulated by HCMV infection. Inhibition of mitochondrial translation with chloramphenicol or knockdown of HCMV-induced ribosome biogenesis factor MRM3 abolished the HCMV-mediated increase in mitochondrially encoded proteins and significantly impaired viral growth under bioenergetically restricting conditions. Our findings demonstrate how HCMV manipulates mitochondrial biogenesis to support its replication. PMID:27025248
2010-01-01
Background Plants grown under iron deficiency show different morphological, biochemical and physiological changes. These changes include, among others, the elicitation of different strategies to improve the acquisition of Fe from the rhizosphere, the adjustment of Fe homeostasis processes and a reorganization of carbohydrate metabolism. The application of modern techniques that allow the simultaneous and untargeted analysis of multiple proteins and metabolites can provide insight into multiple processes taking place in plants under Fe deficiency. The objective of this study was to characterize the changes induced in the root tip proteome and metabolome of sugar beet plants in response to Fe deficiency and resupply. Results Root tip extract proteome maps were obtained by 2-D isoelectric focusing polyacrylamide gel electrophoresis, and approximately 140 spots were detected. Iron deficiency resulted in changes in the relative amounts of 61 polypeptides, and 22 of them were identified by mass spectrometry (MS). Metabolites in root tip extracts were analyzed by gas chromatography-MS, and more than 300 metabolites were resolved. Out of 77 identified metabolites, 26 changed significantly with Fe deficiency. Iron deficiency induced increases in the relative amounts of proteins and metabolites associated to glycolysis, tri-carboxylic acid cycle and anaerobic respiration, confirming previous studies. Furthermore, a protein not present in Fe-sufficient roots, dimethyl-8-ribityllumazine (DMRL) synthase, was present in high amounts in root tips from Fe-deficient sugar beet plants and gene transcript levels were higher in Fe-deficient root tips. Also, a marked increase in the relative amounts of the raffinose family of oligosaccharides (RFOs) was observed in Fe-deficient plants, and a further increase in these compounds occurred upon short term Fe resupply. Conclusions The increases in DMRL synthase and in RFO sugars were the major changes induced by Fe deficiency and resupply in root tips of sugar beet plants. Flavin synthesis could be involved in Fe uptake, whereas RFO sugars could be involved in the alleviation of oxidative stress, C trafficking or cell signalling. Our data also confirm the increase in proteins and metabolites related to carbohydrate metabolism and TCA cycle pathways. PMID:20565974
Takahashi, Shoko; Saito, Kenji; Jia, Huijuan; Kato, Hisanori
2014-01-01
Many epidemiological studies have indicated that coffee consumption may reduce the risks of developing obesity and diabetes, but the underlying mechanisms of these effects are poorly understood. Our previous study revealed the changes on gene expression profiles in the livers of C57BL/6J mice fed a high-fat diet containing three types of coffee (caffeinated, decaffeinated and green unroasted coffee), using DNA microarrays. The results revealed remarkable alterations in lipid metabolism-related molecules which may be involved in the anti-obesity effects of coffee. We conducted the present study to further elucidate the metabolic alterations underlying the effects of coffee consumption through comprehensive proteomic and metabolomic analyses. Proteomics revealed an up-regulation of isocitrate dehydrogenase (a key enzyme in the TCA cycle) and its related proteins, suggesting increased energy generation. The metabolomics showed an up-regulation of metabolites involved in the urea cycle, with which the transcriptome data were highly consistent, indicating accelerated energy expenditure. The TCA cycle and the urea cycle are likely be accelerated in a concerted manner, since they are directly connected by mutually providing each other's intermediates. The up-regulation of these pathways might result in a metabolic shift causing increased ATP turnover, which is related to the alterations of lipid metabolism. This mechanism may play an important part in the suppressive effects of coffee consumption on obesity, inflammation, and hepatosteatosis. This study newly revealed global metabolic alterations induced by coffee intake, providing significant insights into the association between coffee intake and the prevention of type 2 diabetes, utilizing the benefits of multi-omics analyses. PMID:24618914
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cline, Gary W., E-mail: gary.cline@yale.edu; Department of Surgery, University of Minnesota-Twin Cities, Minneapolis, MN 55455; Pongratz, Rebecca L.
Highlights: Black-Right-Pointing-Pointer We studied media effects on mechanisms of insulin secretion of INS-1 cells. Black-Right-Pointing-Pointer Insulin secretion was higher in DMEM than KRB despite identical ATP synthesis rates. Black-Right-Pointing-Pointer Insulin secretion rates correlated with rates of anaplerosis and TCA cycle. Black-Right-Pointing-Pointer Mitochondria metabolism and substrate cycles augment secretion signal of ATP. -- Abstract: Mechanistic models of glucose stimulated insulin secretion (GSIS) established in minimal media in vitro, may not accurately describe the complexity of coupling metabolism with insulin secretion that occurs in vivo. As a first approximation, we have evaluated metabolic pathways in a typical growth media, DMEM as amore » surrogate in vivo medium, for comparison to metabolic fluxes observed under the typical experimental conditions using the simple salt-buffer of KRB. Changes in metabolism in response to glucose and amino acids and coupling to insulin secretion were measured in INS-1 832/13 cells. Media effects on mitochondrial function and the coupling efficiency of oxidative phosphorylation were determined by fluorometrically measured oxygen consumption rates (OCRs) combined with {sup 31}P NMR measured rates of ATP synthesis. Substrate preferences and pathways into the TCA cycle, and the synthesis of mitochondrial 2nd messengers by anaplerosis were determined by {sup 13}C NMR isotopomer analysis of the fate of [U-{sup 13}C] glucose metabolism. Despite similar incremental increases in insulin secretion, the changes of OCR in response to increasing glucose from 2.5 to 15 mM were blunted in DMEM relative to KRB. Basal and stimulated rates of insulin secretion rates were consistently higher in DMEM, while ATP synthesis rates were identical in both DMEM and KRB, suggesting greater mitochondrial uncoupling in DMEM. The relative rates of anaplerosis, and hence synthesis and export of 2nd messengers from the mitochondria were found to be similar in DMEM to those in KRB. And, the correlation of total PC flux with insulin secretion rates in DMEM was found to be congruous with the correlation in KRB. Together, these results suggest that signaling mechanisms associated with both TCA cycle flux and with anaplerotic flux, but not ATP production, may be responsible for the enhanced rates of insulin secretion in more complex, and physiologically-relevant media.« less
BNIP3 contributes to the glutamine-driven aggressive behavior of melanoma cells.
Vara-Perez, Monica; Maes, Hannelore; Van Dingenen, Sarah; Agostinis, Patrizia
2018-06-01
Aerobic glycolysis (Warburg effect) is used by cancer cells to fuel tumor growth. Interestingly, metastatic melanoma cells rely on glutaminolysis rather than aerobic glycolysis for their bioenergetic needs through the tricarboxylic acid cycle. Here, we compared the effects of glucose or glutamine on melanoma cell proliferation, migration and oxidative phosphorylation in vitro. We found that glutamine-driven melanoma cell's aggressive traits positively correlated with increased expression of HIF1α and its pro-autophagic target BNIP3. BNIP3 silencing reduced glutamine-mediated effects on melanoma cell growth, migration and bioenergetics. Hence, BNIP3 is a vital component of the mitochondria quality control required for glutamine-driven melanoma aggressiveness.
TCA High Lift Preliminary Assessment
NASA Technical Reports Server (NTRS)
Wyatt, G. H.; Polito, R. C.; Yeh, D. T.; Elzey, M. E.; Tran, J. T.; Meredith, Paul T.
1999-01-01
This paper presents a TCA (Technology Concept Airplane) High lift Preliminary Assessment. The topics discussed are: 1) Model Description; 2) Data Repeatability; 3) Effect of Inboard L.E. (Leading Edge) Flap Span; 4) Comparison of 14'x22' TCA-1 With NTF (National Transonic Facility) Modified Ref. H; 5) Comparison of 14'x22' and NTF Ref. H Results; 6) Effect of Outboard Sealed Slat on TCA; 7) TCA Full Scale Build-ups; 8) Full Scale L/D Comparisons; 9) TCA Full Scale; and 10) Touchdown Lift Curves. This paper is in viewgraph form.
USDA-ARS?s Scientific Manuscript database
Tropospheric ozone (O3) is a pollutant that is generated by volatile organic compounds, nitrogen oxides and sunlight. When plants take in O3 through stomata, harmful reactive oxygen species (ROS) are produced that induce the production of ROS scavenging antioxidants. Climate change predictions indic...
U.S. Army Research Laboratory Annual Review 2011
2011-12-01
pioneered a defect reduction process using thermal cycle annealing (TCA) for improving mercury cadmium telluride ( MCT ) grown on scalable silicon (Si...substrates. Currently, the use of MCT -- a mainstay material for Army infrared (IR) systems -- is limited due to high levels of dislocations when...grown on scalable substrates such as Si (an inexpensive substrate material). These dislocations increase pixel noise and limit IR focal plane array
Barkl-Luke, Mallory E.; Ngo, Shyuan T.; Thomas, Nicola K.; McDonald, Tanya S.; Borges, Karin
2016-01-01
There is increasing evidence that energy metabolism is disturbed in Amyotrophic Lateral Sclerosis (ALS) patients and animal models. Treatment with triheptanoin, the triglyceride of heptanoate, is a promising approach to provide alternative fuel to improve oxidative phosphorylation and aid ATP generation. Heptanoate can be metabolized to propionyl-CoA, which after carboxylation can produce succinyl-CoA and thereby re-fill the tricarboxylic acid (TCA) cycle (anaplerosis). Here we tested the hypothesis that treatment with triheptanoin prevents motor neuron loss and delays the onset of disease symptoms in female mice overexpressing the mutant human SOD1G93A (hSOD1G93A) gene. When oral triheptanoin (35% of caloric content) was initiated at P35, motor neuron loss at 70 days of age was attenuated by 33%. In untreated hSOD1G93A mice, the loss of hind limb grip strength began at 16.7 weeks. Triheptanoin maintained hind limb grip strength for 2.8 weeks longer (p<0.01). Loss of balance on the rotarod and reduction of body weight were delayed by 13 and 11 days respectively (both p<0.01). Improved motor function occurred in parallel with alterations in the expression of genes associated with muscle metabolism. In gastrocnemius muscles, the mRNA levels of pyruvate, 2-oxoglutarate and succinate dehydrogenases and methyl-malonyl mutase were reduced by 24–33% in 10 week old hSOD1G93A mice when compared to wild-type mice, suggesting that TCA cycling in skeletal muscle may be slowed in this ALS mouse model at a stage when muscle strength is still normal. At 25 weeks of age, mRNA levels of succinate dehydrogenases, glutamic pyruvic transaminase 2 and the propionyl carboxylase β subunit were reduced by 69–84% in control, but not in triheptanoin treated hSOD1G93A animals. Taken together, our results suggest that triheptanoin slows motor neuron loss and the onset of motor symptoms in ALS mice by improving TCA cycling. PMID:27564703
Tian, Cihui; Asghar, Sajid; Wu, Yifan; Chen, Zhipeng; Jin, Xin; Yin, Lining; Huang, Lin; Ping, Qineng; Xiao, Yanyu
2017-01-01
The expression of multiple receptors on intestinal epithelial cells enables an actively targeted carrier to significantly enhance the oral delivery of payloads. Conjugating the receptors' ligands on the surfaces of a particulate-delivery system allows site-specific targeting. Here, we used taurocholic acid (TCA) as a ligand for uptake of nanostructured lipid carriers (NLCs) mediated by a bile-acid transporter to improve oral bioavailability of curcumin (Cur). First, synthesis of TCA-polyethylene glycol 100-monostearate (S100-TCA) was carried out. Then, the physical and chemical properties of S100-TCA-modified Cur-loaded NLCs (Cur-TCA NLCs) with varying levels of S100-TCA modifications were investigated. Small particle size (<150 nm), high drug encapsulation (>90%), drug loading (about 3%), negative ζ-potential (-7 to -3 mV), and sustained release were obtained. In situ intestinal perfusion studies demonstrated improved absorption rate and permeability coefficient of Cur-TCA NLCs. Depending on the degree of modification, Cur-TCA NLCs displayed about a five- to 15-fold higher area under the curve in rats after oral administration than unmodified Cur NLCs, which established that the addition of S100-TCA to the NLCs boosted absorption of Cur. Further investigations of TCA NLCs might reveal a bright future for effective oral delivery of poorly bioavailable drugs.
Kaku, Yoshio; Ookawara, Susumu; Miyazawa, Haruhisa; Ito, Kiyonori; Ueda, Yuichirou; Hirai, Keiji; Hoshino, Taro; Mori, Honami; Yoshida, Izumi; Morishita, Yoshiyuki; Tabei, Kaoru
2016-02-01
The following conventional calcium correction formula (Payne) is broadly applied for serum calcium estimation: corrected total calcium (TCa) (mg/dL) = TCa (mg/dL) + (4 - albumin (g/dL)); however, it is inapplicable to chronic kidney disease (CKD) patients. A total of 2503 venous samples were collected from 942 all-stage CKD patients, and levels of TCa (mg/dL), ionized calcium ([iCa(2+) ] mmol/L), phosphate (mg/dL), albumin (g/dL), and pH, and other clinical parameters were measured. We assumed corrected TCa (the gold standard) to be equal to eight times the iCa(2+) value (measured corrected TCa). Then, we performed stepwise multiple linear regression analysis by using the clinical parameters and derived a simple formula for corrected TCa approximation. The following formula was devised from multiple linear regression analysis: Approximated corrected TCa (mg/dL) = TCa + 0.25 × (4 - albumin) + 4 × (7.4 - p H) + 0.1 × (6 - phosphate) + 0.3. Receiver operating characteristic curves analysis illustrated that area under the curve of approximated corrected TCa for detection of measured corrected TCa ≥ 8.4 mg/dL and ≤ 10.4 mg/dL were 0.994 and 0.919, respectively. The intraclass correlation coefficient demonstrated superior agreement using this new formula compared to other formulas (new formula: 0.826, Payne: 0.537, Jain: 0.312, Portale: 0.582, Ferrari: 0.362). In CKD patients, TCa correction should include not only albumin but also pH and phosphate. The approximated corrected TCa from this formula demonstrates superior agreement with the measured corrected TCa in comparison to other formulas. © 2016 International Society for Apheresis, Japanese Society for Apheresis, and Japanese Society for Dialysis Therapy.
Regulation of Mammary Tumor Formation and Lipid Biosynthesis by Spot 14
2013-10-01
1 Introduction: THRSP/Spot14/S14 is a small cytoplasmic protein that is highly expressed in tissues that synthesize fatty acids de novo...cycle regulation and also with various metabolic pathways, including glycolysis /gluconeogenesis and the pentose phosphate pathway (Table 1). The
ERIC Educational Resources Information Center
Caccavo, Frank, Jr.; Clegern, William; Miller, Isaac; Montoya, Crystal
2003-01-01
Metabolism, the sum of all chemical reactions within a living organism, is one of the most fundamental concepts presented in introductory microbiology courses. However, it is often difficult for instructors to effectively translate perfunctory diagrams of glycolysis, the Krebs cycle, and the electron transport chain in a way that is meaningful to…
Tonic-Clonic Activity at Subarachnoid Hemorrhage Onset: Impact on Complications and Outcome
De Marchis, Gian Marco; Pugin, Deborah; Lantigua, Hector; Zammit, Christopher; Tadi, Prasanna; Schmidt, J. Michael; Falo, M. Cristina; Agarwal, Sachin; Mayer, Stephan A.; Claassen, Jan
2013-01-01
Objective Tonic-clonic activity (TCA) at onset complicates 3% to 21% of cases of subarachnoid hemorrhage (SAH). The impact of onset TCA on in-hospital complications, including seizures, remains unclear. One study associated onset TCA with poor clinical outcome at 6 weeks after SAH, but to our knowledge no other studies have confirmed this relationship. This study aims to assess the impact of onset TCA on in-hospital complications, poor functional outcome, mortality, and epilepsy at 3 months. Methods Analysis of a prospective study cohort of 1479 SAH patients admitted to Columbia University Medical Center between 1996 and 2012. TCA within 6 hours of hemorrhage onset was identified based on accounts of emergency care providers or family witnesses. Results TCA at onset was described in 170 patients (11%). Patients with onset TCA were younger (P = 0.002), presented more often with poor clinical grade (55% vs. 26%, P<0.001) and had larger amounts of cisternal, intraventricular, and intracerebral blood than those without onset TCA (all, P<0.001). After adjusting for known confounders, onset TCA was significantly associated with in-hospital seizures (OR 3.80, 95%-CI: 2.43–5.96, P<0.001), in-hospital pneumonia (OR 1.56, 95%-CI: 1.06–2.31, p = 0.02), and delayed cerebral ischemia (OR 1.77, 95%-CI: 1.21–2.58, P = 0.003). At 3 months, however, onset TCA was not associated with poor functional outcome, mortality, and epilepsy after adjusting for age, admission clinical grade, and cisternal blood volume. Conclusions Onset TCA is not a rare event as it complicates 11% of cases of SAH. New and clinically relevant findings are the association of onset TCA with in-hospital seizures, pneumonia and delayed cerebral ischemia. Despite the increased risk of in-hospital complications, onset TCA is not associated with disability, mortality, and epilepsy at 3 months. PMID:23951155
Prak, Sina; Gunata, Ziya; Guiraud, Joseph-Pierre; Schorr-Galindo, Sabine
2007-05-01
Cork taint is mainly due to 2,4,6-trichloroanisole (TCA) produced through the activity of undesirable fungal strains. We observed that CFU mould number in TCA-containing stoppers was not quantitatively different to that of the stoppers not containing TCA (ca. 10(5)CFU/g). In contrast more fungi diversity was observed in TCA-containing stoppers. Penicillium spp (Penicillium chrysogenum, Penicillium glabrum), Aspergillus spp (Aspergillus niger and Aspergillus oryzae), Chrysonilia sitophila, Mucor racemosus, Paecilomyces sp. and Trichoderma viride were found in TCA-containing stoppers, while C. sitophila and Penicillium sp. were the main fungi in the stoppers devoid of TCA. Conidia were numerous close to the lenticels and present from the lateral surface through to the centre of the stoppers. Strains of Aspergillus, Mucor, Paecilomyces, Penicillium and Trichoderma isolated from TCA-containing stoppers were able to convert 2,4,6-trichlorophenol (TCP) in TCA in resting cell or growing conditions. The best yields of conversion were obtained by green fungi Paecilomyces sp. and P. chrysogenum, 17% and 20%, respectively. Chysonilia sitophila and Penicillium sp. did not produce TCA from TCP in our conditions.
Pinho, Andreia V; Mawson, Amanda; Gill, Anthony; Arshi, Mehreen; Warmerdam, Max; Giry-Laterriere, Marc; Eling, Nils; Lie, Triyana; Kuster, Evelyne; Camargo, Simone; Biankin, Andrew V; Wu, Jianmin; Rooman, Ilse
2016-11-15
Metabolic reprogramming is a feature of neoplasia and tumor growth. Sirtuin 1 (SIRT1) is a lysine deacetylase of multiple targets including metabolic regulators such as p53. SIRT1 regulates metaplasia in the pancreas. Nevertheless, it is unclear if SIRT1 affects the development of neoplastic lesions and whether metabolic gene expression is altered.To assess neoplastic lesion development, mice with a pancreas-specific loss of Sirt1 (Pdx1-Cre;Sirt1-lox) were bred into a KrasG12D mutant background (KC) that predisposes to the development of pancreatic intra-epithelial neoplasia (PanIN) and ductal adenocarcinoma (PDAC). Similar grade PanIN lesions developed in KC and KC;Sirt1-lox mice but specifically early mucinous PanINs occupied 40% less area in the KC;Sirt1-lox line, attributed to reduced proliferation. This was accompanied by reduced expression of proteins in the glycolysis pathway, such as GLUT1 and GAPDH.The stimulatory effect of SIRT1 on proliferation and glycolysis gene expression was confirmed in a human PDAC cell line. In resected PDAC samples, higher proliferation and expression of glycolysis genes correlated with poor patient survival. SIRT1 expression per se was not prognostic but low expression of Cell Cycle and Apoptosis Regulator 2 (CCAR2), a reported SIRT1 inhibitor, corresponded to poor patient survival.These findings open perspectives for novel targeted therapies in pancreatic cancer.
Yang, Mingfeng; Li, Xuefeng; Bu, Chunya; Wang, Hui; Shi, Guanglu; Yang, Xiushan; Hu, Yong; Wang, Xiaoqin
2014-11-01
Pyruvate decarboxylase and alcohol dehydrogenase are efficient enzymes for ethanol production in Zymomonas mobilis. These two enzymes were over-expressed in Escherichia coli, a promising candidate for industrial ethanol production, resulting in high ethanol production in the engineered E. coli. To investigate the intracellular changes to the enzyme overexpression for homoethanol production, 2-DE and LC-MS/MS were performed. More than 1,000 protein spots were reproducibly detected in the gel by image analysis. Compared to the wild-type, 99 protein spots showed significant changes in abundance in the recombinant E. coli, in which 46 were down-regulated and 53 were up-regulated. Most proteins related to tricarboxylic acid cycle, glycerol metabolism and other energy metabolism were up-regulated, whereas proteins involved in glycolysis and glyoxylate pathway were down-regulated, indicating the rewired metabolism in the engineered E. coli. As glycolysis is the main pathway for ethanol production, and it was inhibited significantly in engineered E. coli, further efforts should be directed at minimizing the repression of glycolysis to optimize metabolism network for higher yields of ethanol production.
Glaubitz, Ulrike; Li, Xia; Schaedel, Sandra; Erban, Alexander; Sulpice, Ronan; Kopka, Joachim; Hincha, Dirk K; Zuther, Ellen
2017-01-01
Transcript and metabolite profiling were performed on leaves from six rice cultivars under high night temperature (HNT) condition. Six genes were identified as central for HNT response encoding proteins involved in transcription regulation, signal transduction, protein-protein interactions, jasmonate response and the biosynthesis of secondary metabolites. Sensitive cultivars showed specific changes in transcript abundance including abiotic stress responses, changes of cell wall-related genes, of ABA signaling and secondary metabolism. Additionally, metabolite profiles revealed a highly activated TCA cycle under HNT and concomitantly increased levels in pathways branching off that could be corroborated by enzyme activity measurements. Integrated data analysis using clustering based on one-dimensional self-organizing maps identified two profiles highly correlated with HNT sensitivity. The sensitivity profile included genes of the functional bins abiotic stress, hormone metabolism, cell wall, signaling, redox state, transcription factors, secondary metabolites and defence genes. In the tolerance profile, similar bins were affected with slight differences in hormone metabolism and transcription factor responses. Metabolites of the two profiles revealed involvement of GABA signaling, thus providing a link to the TCA cycle status in sensitive cultivars and of myo-inositol as precursor for inositol phosphates linking jasmonate signaling to the HNT response specifically in tolerant cultivars. © 2016 John Wiley & Sons Ltd.
Yang, Liu; Yu, Qing-Tao; Ge, Ya-Zhong; Zhang, Wen-Song; Fan, Yong; Ma, Chung-Wah; Liu, Qun; Qi, Lian-Wen
2016-01-01
Ginseng occupies a prominent position in the list of best-selling natural products worldwide. Asian ginseng (Panax ginseng) and American ginseng (Panax quinquefolius) show different properties and medicinal applications in pharmacology, even though the main active constituents of them are both thought to be ginsenosides. Metabolomics is a promising method to profile entire endogenous metabolites and monitor their fluctuations related to exogenous stimulus. Herein, an untargeted metabolomics approach was applied to study the overall urine metabolic differences between Asian ginseng and American ginseng in mice. Metabolomics analyses were performed using gas chromatography-mass spectrometry (GC-MS) together with multivariate statistical data analysis. A total of 21 metabolites related to D-glutamine and D-glutamate metabolism, glutathione metabolism, TCA cycle and glyoxylate and dicarboxylate metabolism, differed significantly under the Asian ginseng treatment; 34 metabolites mainly associated with glyoxylate and dicarboxylate metabolism, TCA cycle and taurine and hypotaurine metabolism, were significantly altered after American ginseng treatment. Urinary metabolomics reveal that Asian ginseng and American ginseng can benefit organism physiological and biological functions via regulating multiple metabolic pathways. The important pathways identified from Asian ginseng and American ginseng can also help to explore new therapeutic effects or action targets so as to broad application of these two ginsengs. PMID:27991533
Periyasamy, Kuppusamy; Sivabalan, Venkatachalam; Baskaran, Kuppusamy; Kasthuri, Kannayiram; Sakthisekaran, Dhanapal
2016-03-01
Breast cancer is the leading cause of death among women worldwide. Chemoprevention and chemotherapy play beneficial roles in reducing the incidence and mortality of cancer. Epidemiological and experimental studies showed that naturally-occurring antioxidants present in the diet may act as anticancer agents. Identifying the abnormalities of cellular energy metabolism facilitates early detection and management of breast cancer. The present study evaluated the effect of tangeretin on cellular metabolic energy fluxes in 7,12-dimethylbenz(a) anthracene (DMBA)-induced proliferative breast cancer. The results showed that the activities of glycolytic enzymes significantly increased in mammary tissues of DMBA-induced breast cancer bearing rats. The gluconeogenic tricarboxylic acid (TCA) cycle and respiratory chain enzyme activities significantly decreased in breast cancer-bearing rats. In addition, proliferating cell nuclear antigen (PCNA) was highly expressed in breast cancer tissues. However, the activities of glycolytic enzymes were significantly normalized in the tangeretin pre- and post-treated rats and the TCA cycle and respiratory chain enzyme activities were significantly increased in tangeretin treated rats. Furthermore, tangeretin down-regulated PCNA expression on breast cancer-bearing rats. Our study demonstrates that tangeretin specifically regulates cellular metabolic energy fluxes in DMBA-induced breast cancer-bearing rats. © 2016 by the Journal of Biomedical Research. All rights reserved.
Li, Xiaofei; Nong, Qingjiao; Mao, Baoyu; Pan, Xue
2017-01-01
This study aimed to determine the metabolic profile of non-toxic cadmium (Cd)-induced dysfunctional endothelial cells using human umbilical vein endothelial cells (HUVECs). HUVECs (n = 6 per group) were treated with 0, 1, 5, or 10 μM cadmium chloride (CdCl2) for 48 h. Cell phenotypes, including nitric oxide (NO) production, the inflammatory response, and oxidative stress, were evaluated in Cd-exposed and control HUVECs. Cd-exposed and control HUVECs were analysed using gas chromatography time-of-flight/mass spectrometry. Compared to control HUVECs, Cd-exposed HUVECs were dysfunctional, exhibiting decreased NO production, a proinflammatory state, and non-significant oxidative stress. Further metabolic profiling revealed 24 significantly-altered metabolites in the dysfunctional endothelial cells. The significantly-altered metabolites were involved in the impaired tricarboxylic acid (TCA) cycle, activated pyruvate metabolism, up-regulated glucogenic amino acid metabolism, and increased pyrimidine metabolism. The current metabolic findings further suggest that the metabolic changes linked to TCA cycle dysfunction, glycosylation of the hexosamine biosynthesis pathway (HBP), and compensatory responses to genomic instability and energy deficiency may be generally associated with dysfunctional phenotypes, characterized by decreased NO production, a proinflammatory state, and non-significant oxidative stress, in endothelial cells following non-toxic Cd exposure. PMID:28872622
Metabolic flux analysis of the halophilic archaeon Haladaptatus paucihalophilus.
Liu, Guangxiu; Zhang, Manxiao; Mo, Tianlu; He, Lian; Zhang, Wei; Yu, Yi; Zhang, Qi; Ding, Wei
2015-11-27
This work reports the (13)C-assisted metabolic flux analysis of Haladaptatus paucihalophilus, a halophilic archaeon possessing an intriguing osmoadaption mechanism. We showed that the carbon flow is through the oxidative tricarboxylic acid (TCA) cycle whereas the reductive TCA cycle is not operative in H. paucihalophilus. In addition, both threonine and the citramalate pathways contribute to isoleucine biosynthesis, whereas lysine is synthesized through the diaminopimelate pathway and not through the α-aminoadipate pathway. Unexpected, the labeling patterns of glycine from the cells grown on [1-(13)C]pyruvate and [2-(13)C]pyruvate suggest that, unlike all the organisms investigated so far, in which glycine is produced exclusively from the serine hydroxymethyltransferase (SHMT) pathway, glycine biosynthesis in H. paucihalophilus involves different pathways including SHMT, threonine aldolase (TA) and the reverse reaction of glycine cleavage system (GCS), demonstrating for the first time that other pathways instead of SHMT can also make a significant contribution to the cellular glycine pool. Transcriptional analysis confirmed that both TA and GCS genes were transcribed in H. paucihalophilus, and the transcriptional level is independent of salt concentrations in the culture media. This study expands our understanding of amino acid biosynthesis and provides valuable insights into the metabolism of halophilic archaea. Copyright © 2015 Elsevier Inc. All rights reserved.
Cortex and hippocampus DNA epigenetic response to a long-term arsenic exposure via drinking water.
Du, Xiaoyan; Tian, Meiping; Wang, Xiaoxue; Zhang, Jie; Huang, Qingyu; Liu, Liangpo; Shen, Heqing
2018-03-01
The neurotoxicity of arsenic is a serious health problem, especially for children. DNA epigenetic change may be an important pathogenic mechanism, but the molecular pathway remains obscure. In this study, the weaned male Sprague-Dawly (SD) rats were treated with arsenic trioxide via drinking water for 6 months, simulating real developmental exposure situation of children. Arsenic exposure impaired the cognitive abilities, and altered the expression of neuronal activity-regulated genes. Total arsenic concentrations of cortex and hippocampus tissues were significantly increased in a dose-dependent manner. The reduction in 5-methylcytosine (5 mC) and 5-hydroxymethylcytosine (5hmC) levels as well as the down-regulation of DNA methyltransferases (DNMTs) and ten-eleven translocations (TETs) expression suggested that DNA methylation/demethylation processes were significantly suppressed in brain tissues. S-adenosylmethionine (SAM) level wasn't changed, but the expression of the important indicators of oxidative/anti-oxidative balance and tricarboxylic acid (TCA) cycle was significantly deregulated. Overall, arsenic can disrupt oxidative/anti-oxidative balance, further inhibit TETs expression through TCA cycle and alpha-ketoglutarate (α-KG) pathway, and consequently cause DNA methylation/demethylation disruption. The present study implies oxidative stress but not SAM depletion may lead to DNA epigenetic alteration and arsenic neurotoxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Bazylinski, D. A.; Williams, T. J.; Zhang, C. L.; Scott, J. H.
2005-12-01
All cultured, marine, magnetite-producing, magnetotactic bacteria (MB) are capable of chemolithoautotrophy and use a number of electron donors to support this mode of growth including reduced sulfur compounds. Several vibrioid strains are known to rely on the Calvin-Benson-Bassham (CBB) cycle for autotrophy. An obligately microaerophilic, magnetite-producing, coccoid strain (MC-1) grew with sulfide and thiosulfate as electron donors and 14C-labelling experiments showed that virtually all cell C was derived from H14CO3-/14CO2 confirming autotrophy in this strain. Cell-free extracts of strain MC-1 did not exhibit ribulose-1,5-bisphosphate carboxylase-oxygenase (RubisCO) activity and nor were RubisCO genes found in the draft genome of the organism. Cell extracts also did not exhibit carbon monoxide dehydrogenase activity indicating that the acetyl-CoA pathway also does not function in strain MC-1. The 13C content of whole cells of strain MC-1 relative to the 13C content of the H14CO3-/14CO2 used for growth (Δδ13C) was -11.4 ppt. Cellular fatty acids showed enrichment of 13C relative to biomass. Activities for three key enzymes of the reverse or reductive tricarboxylic acid (rTCA) cycle were demonstrated for MC-1: fumarate reductase, pyruvate: acceptor oxidoreductase and 2-oxoglutarate: acceptor oxidoreductase. Although ATP citrate lyase (another key enzyme of the rTCA cycle) activity was not detected in cell-free extracts of strain MC-1 using commonly used assays for this enzyme, cell-free extract was found to rapidly cleave citrate, and the reaction was dependent upon the presence of ATP, coenzyme A and NADH. Thus, we infer the presence of an ATP-dependent citrate-cleaving enzyme or enzymes. The Δδ13C value and results from enzyme studies are consistent with the operation of the rTCA cycle for autotrophy in strain MC-1. Strain MC-1 appears to be the first known member of the alpha-Proteobacteria to assimilate CO2 during autotrophic growth using the rTCA cycle. Based on the type of chemolithoautotrophy described above, it is clear why marine magnetite-producing MB occupy a precise location, the oxic-anoxic interface, in vertical chemical gradients within chemically-stratified coastal environments: they must have an electron donor, sulfide and perhaps others, and an electron acceptor, O2. The presumed function of magnetosomes is that the magnetic dipole resulting from the magnetosomes aids the cell in locating and maintaining an optimal position within vertical chemical gradients. MB process large amounts of Fe in the biomineralization of magnetosomes: cells consist of 1-3% Fe (dry wt). Because of this, and the fact that many chemolithoautotrophic, non-magnetotactic bacteria occupy a similar niche, we have been investigating possible physiological reasons for the production of magnetosomes and the processing of such large amounts of Fe. We have found that some marine vibrioid strains grow in O2-gradient medium with Fe(II) as the electron donor. Cells appear to oxidize the Fe(II) and produce a layer of Fe oxyhydroxides within the gradient suggesting that cells obtain energy from the oxidation of Fe(II).
Catabolic regulation analysis of Escherichia coli and its crp, mlc, mgsA, pgi and ptsG mutants
2011-01-01
Background Most bacteria can use various compounds as carbon sources. These carbon sources can be either co-metabolized or sequentially metabolized, where the latter phenomenon typically occurs as catabolite repression. From the practical application point of view of utilizing lignocellulose for the production of biofuels etc., it is strongly desirable to ferment all sugars obtained by hydrolysis from lignocellulosic materials, where simultaneous consumption of sugars would benefit the formation of bioproducts. However, most organisms consume glucose prior to consumption of other carbon sources, and exhibit diauxic growth. It has been shown by fermentation experiments that simultaneous consumption of sugars can be attained by ptsG, mgsA mutants etc., but its mechanism has not been well understood. It is strongly desirable to understand the mechanism of metabolic regulation for catabolite regulation to improve the performance of fermentation. Results In order to make clear the catabolic regulation mechanism, several continuous cultures were conducted at different dilution rates of 0.2, 0.4, 0.6 and 0.7 h-1 using wild type Escherichia coli. The result indicates that the transcript levels of global regulators such as crp, cra, mlc and rpoS decreased, while those of fadR, iclR, soxR/S increased as the dilution rate increased. These affected the metabolic pathway genes, which in turn affected fermentation result where the specific glucose uptake rate, the specific acetate formation rate, and the specific CO2 evolution rate (CER) were increased as the dilution rate was increased. This was confirmed by the 13C-flux analysis. In order to make clear the catabolite regulation, the effect of crp gene knockout (Δcrp) and crp enhancement (crp+) as well as mlc, mgsA, pgi and ptsG gene knockout on the metabolism was then investigated by the continuous culture at the dilution rate of 0.2 h-1 and by some batch cultures. In the case of Δcrp (and also Δmlc) mutant, TCA cycle and glyoxylate were repressed, which caused acetate accumulation. In the case of crp+ mutant, glycolysis, TCA cycle, and gluconeogenesis were activated, and simultaneous consumption of multiple carbon sources can be attained, but the glucose consumption rate became less due to repression of ptsG and ptsH by the activation of Mlc. Simultaneous consumption of multiple carbon sources could be attained by mgsA, pgi, and ptsG mutants due to increase in crp as well as cyaA, while glucose consumption rate became lower. Conclusions The transcriptional catabolite regulation mechanism was made clear for the wild type E. coli, and its crp, mlc, ptsG, pgi, and mgsA gene knockout mutants. The results indicate that catabolite repression can be relaxed and crp as well as cyaA can be increased by crp+, mgsA, pgi, and ptsG mutants, and thus simultaneous consumption of multiple carbon sources including glucose can be made, whereas the glucose uptake rate became lower as compared to wild type due to inactivation of ptsG in all the mutants considered. PMID:21831320
Effects of tretinoin pretreatment on TCA chemical peel in guinea pig skin.
Kim, I. H.; Kim, H. K.; Kye, Y. C.
1996-01-01
This study was done to characterize the structural changes in the tretinoin pretreatment on trichloroacetic acid(TCA) chemical peel. In guinea pigs, the right halves pretreated with tretinoin and the left halves treated nothing were compared in their structural changes after TCA chemical peel. Epidermal thickness in the tretinoin pretreated group was almost the same in the first and second week. But epidermis of the TCA group increased continuously. In the first week, mitotic figures in the epidermis were more increased in the TCA group, but those in hair follicles were more increased in the tretinoin pretreated group. In the second week, mitotic figures in the epidermis were almost same in both group, but in hair follicles of the tretinoin pretreated group, mitotic figures were much more increased. In alcian blue staining, glycosaminoglycan was stained much more strongly in dermis of the TCA group in first week, but was more strongly stained in the tretinoin pretreated group in second week. On electron microscopic findings, the fibroblasts in upper dermis were larger and had plentier cytoplasm with more organelles in the tretinoin pretreated group. Conclusively, tretinoin pretreatment on TCA chemical peel sustained the effects of TCA longer and showed synergistic effects of TCA and induced enhanced wound healing. PMID:8878803
Vestner, Jochen; Fritsch, Stefanie; Rauhut, Doris
2010-02-15
The aim of this research work was focused on the replacement of the time-consuming soaking of cork stoppers which is mainly used as screening method for cork lots in connection with sensory analysis and/or analytical methods to detect releasable 2,4,6-trichloroanisole (TCA) of natural cork stoppers. Releasable TCA from whole cork stoppers was analysed with the application of a microwave assisted extraction method (MAE) in combination with stir bar sorptive extraction (SBSE). The soaking of corks (SOAK) was used as a reference method to optimise MAE parameters. Cork lots of different quality and TCA contamination levels were used to adapt MAE. Pre-tests indicated that an MAE at 40 degrees C for 120 min with 90 min of cooling time are suitable conditions to avoid an over-extraction of TCA of low and medium tainted cork stoppers in comparison to SOAK. These MAE parameters allow the measuring of almost the same amounts of releasable TCA as with the application of the soaking procedure in the relevant range (<25 ng L(-1) releasable TCA from one cork) to evaluate the TCA level of cork stoppers. Stable isotope dilution assay (SIDA) was applied to optimise quantification of the released TCA with deuterium-labelled TCA (TCA-d(5)) using a time-saving GC-MS technique in single ion monitoring (SIM) mode. The developed MAE method allows the measuring of releasable TCA from the whole cork stopper under improved conditions and in connection with a low use of solvent and a higher sample throughput. Copyright 2009 Elsevier B.V. All rights reserved.
Increasing Conceptual Understanding of Glycolysis & the Krebs Cycle Using Role-Play
ERIC Educational Resources Information Center
Ross, Pauline M.; Tronson, Deidre A.; Ritchie, Raymond J.
2008-01-01
Cellular respiration and metabolism are topics that are reportedly poorly understood by students and judged to be difficult by many teachers. Although these topics may not be required learning areas in some high school biology curricula, a grasp of fundamental concepts of cellular metabolic processes is advantageous for students undertaking (or…
Blask, David E; Dauchy, Robert T; Dauchy, Erin M; Mao, Lulu; Hill, Steven M; Greene, Michael W; Belancio, Victoria P; Sauer, Leonard A; Davidson, Leslie
2014-01-01
The central circadian clock within the suprachiasmatic nucleus (SCN) plays an important role in temporally organizing and coordinating many of the processes governing cancer cell proliferation and tumor growth in synchrony with the daily light/dark cycle which may contribute to endogenous cancer prevention. Bioenergetic substrates and molecular intermediates required for building tumor biomass each day are derived from both aerobic glycolysis (Warburg effect) and lipid metabolism. Using tissue-isolated human breast cancer xenografts grown in nude rats, we determined that circulating systemic factors in the host and the Warburg effect, linoleic acid uptake/metabolism and growth signaling activities in the tumor are dynamically regulated, coordinated and integrated within circadian time structure over a 24-hour light/dark cycle by SCN-driven nocturnal pineal production of the anticancer hormone melatonin. Dim light at night (LAN)-induced melatonin suppression disrupts this circadian-regulated host/cancer balance among several important cancer preventative signaling mechanisms, leading to hyperglycemia and hyperinsulinemia in the host and runaway aerobic glycolysis, lipid signaling and proliferative activity in the tumor.
Simulation of the pentose cycle in lactating rat mammary gland
Haut, Michael J.; London, Jack W.; Garfinkel, David
1974-01-01
A computer model representing the pentose cycle, the tricarboxylic acid cycle and glycolysis in slices of lactating rat mammary glands has been constructed. This model is based primarily on the studies, with radioactive chemicals, of Abraham & Chaikoff (1959) [although some of the discrepant data of Katz & Wals (1972) could be accommodated by changing one enzyme activity]. Data obtained by using [1-14C]-, [6-14C]- and [3,4-14C]-glucose were simulated, as well as data obtained by using unlabelled glucose (for which some new experimental data are presented). Much past work on the pentose cycle has been mainly concerned with the division of glucose flow between the pentose cycle and glycolysis, and has relied on the assumption that the system is in steady state (both labelled and unlabelled). This assumption may not apply to lactating rat mammary glands, since the model shows that the percentage flow through the shunt progressively decreased for the first 2h of a 3h experiment, and we were unable to construct a completely steady-state model. The model allows examination of many quantitative features of the system, especially the amount of material passing through key enzymes, some of which appear to be regulated by NADP+ concentrations as proposed by McLean (1960). Supplementary information for this paper has been deposited as Supplementary Publication SUP 50023 at the British Museum (Lending Division) (formerly the National Lending Library for Science and Technology), Boston Spa, Yorks. LS23 7BQ, U.K., from whom copies can be obtained on the terms indicated in Biochem. J. (1973) 131, 5. PMID:4154746
NASA Astrophysics Data System (ADS)
Farrell, Stuart Bennett
Mercury Cadmium Telluride (HgCdTe) is a material of great importance for infrared focal plane array applications. In order to produce large format detector arrays this material needs to be grown on a large area substrate, with silicon being the most mature substrate, it is the optimal choice for large format arrays. To help mitigate the effect of the lattice mismatch between the two materials, cadmium telluride (CdTe) is used as a buffer layer. The CdTe itself has nearly the same lattice mismatch (19.3%) to silicon, but due to the technological advantages it offers and compatibility with HgCdTe, it is the best buffer layer choice. The lattice mismatch between HgCdTe/CdTe and the silicon substrate leads to the formation of dislocations at densities in the mid 106 to low 107 cm-2 range in the epilayers. Such a high dislocation density greatly effects detector device performance quantities such as operability and sensitivity. Hence, the dislocation density should be brought down by at least an order of magnitude by adopting novel in situ and ex situ material processing techniques. In this work, in situ and ex situ thermal cycle annealing (TCA) methods have been used to decrease dislocation density in CdTe and HgCdTe. During the molecular beam epitaxial (MBE) growth of the CdTe buffer layer, the growth was interrupted and the layer was subjected to an annealing cycle within the growth chamber under tellurium overpressure. During the annealing cycle the temperature is raised to beyond the growth temperature (290 → 550 °C) and then allowed to cool before resuming growth again. This process was repeated several times during the growth. After growth, a portion of the material was subjected to a dislocation decoration etch in order to count the etch pit density (EPD) which has a direct correspondence with the dislocation density in the crystal. The crystalline quality was also characterized by x-ray diffraction rocking curves and photoluminescence. The in situ TCA resulted in almost a two order of magnitude reduction in the dislocation density, and factor of two reduction in the full width at half maximum of the x-ray rocking curves. Photoluminescence also suggested a decrease in the number of dislocations present in the material. This decrease is attributed to the movement of the dislocations during the annealing cycles and their subsequent interaction and annihilation. To decrease the dislocation density in HgCdTe layers grown on CdTe/Si composite substrates, ex situ TCA has been performed in a sealed quartz ampoule under a mercury overpressure in a conventional clam-shell furnace. The reduction in the dislocation density has been studied as a function of growth/annealing parameters such as the initial (as grown) dislocation density, buffer layer quality, Hg overpressure, annealing temperature, annealing duration, and the number of annealing cycles. It was found that the primary parameters that affect dislocation density reduction are the annealing temperature and the number of annealing cycles. Some secondary affects were observed by varying the duration spent at the maximum annealing temperature. Parameters such as the initial dislocation density and buffer layer quality did not play a significant role in dislocation reduction. Though no correlation between Hg overpressure and dislocation density was found, it did play a vital role in maintaining the quality of the surface. By using the ex situ TCA, a dislocation density of 1 x 106 cm-2 could be reliably and consistently achieved in HgCdTe layers that had a starting density ranging from 0.5 -- 3 x 107 cm-2. Examination of the annealing parameters revealed an exponential decay in the dislocation density as a function of increasing number of annealing cycles. In addition, a similar exponential decay was observed between the dislocation density and the annealing temperature. The decrease in the dislocation density is once again attributed to moving dislocations that interact and annihilate. This behavior was modeled using a second order reaction equation. It was found that the results of the model closely agreed with the experimental values for a wide range of annealing temperatures and number of annealing cycles.
Rowlands, Benjamin D; Lau, Chew Ling; Ryall, James G; Thomas, Donald S; Klugmann, Matthias; Beart, Philip M; Rae, Caroline D
2015-07-01
Silent information regulators (SIRTs) have been shown to deacetylate a range of metabolic enzymes, including those in glycolysis and the Krebs cycle, and thus alter their activity. SIRTs require NAD(+) for their activity, linking cellular energy status to enzyme activity. To examine the impact of SIRT1 modulation on oxidative metabolism, this study tests the effect of ligands that are either SIRT-activating compounds (resveratrol and SRT1720) or SIRT inhibitors (EX527) on the metabolism of (13)C-enriched substrates by guinea pig brain cortical tissue slices with (13)C and (1)H nuclear magnetic resonance spectroscopy. Resveratrol increased lactate labeling but decreased incorporation of (13)C into Krebs cycle intermediates, consistent with effects on AMPK and inhibition of the F0/F1-ATPase. By testing with resveratrol that was directly applied to astrocytes with a Seahorse analyzer, increased glycolytic shift and increased mitochondrial proton leak resulting from interactions of resveratrol with the mitochondrial electron transport chain were revealed. SRT1720, by contrast, stimulated incorporation of (13)C into Krebs cycle intermediates and reduced incorporation into lactate, although the inhibitor EX527 paradoxically also increased Krebs cycle (13)C incorporation. In summary, the various SIRT1 modulators show distinct acute effects on oxidative metabolism. The strong effects of resveratrol on the mitochondrial respiratory chain and on glycolysis suggest that caution should be used in attempts to increase bioavailability of this compound in the CNS. © 2015 Wiley Periodicals, Inc.
Zheng, Shiju; Jing, Guoxing; Wang, Xiao; Ouyang, Qiuli; Jia, Lei; Tao, Nengguo
2015-07-01
This work investigated the effect of citral on the mitochondrial morphology and function of Penicillium digitatum. Citral at concentrations of 2.0 or 4.0 μL/mL strongly damaged mitochondria of test pathogen by causing the loss of matrix and increase of irregular mitochondria. The deformation extent of the mitochondria of P. digitatum enhanced with increasing concentrations of citral, as evidenced by a decrease in intracellular ATP content and an increase in extracellular ATP content of P. digitatum cells. Oxygen consumption showed that citral resulted in an inhibition in the tricarboxylic acid cycle (TCA) pathway of P. digitatum cells, induced a decrease in activities of citrate synthetase, isocitrate dehydrogenase, α-ketoglutarate dehydrogenase, succinodehydrogenase and the content of citric acid, while enhancing the activity of malic dehydrogenase in P. digitatum cells. Our present results indicated that citral could damage the mitochondrial membrane permeability and disrupt the TCA pathway of P. digitatum. Copyright © 2015 Elsevier Ltd. All rights reserved.
Mercado-Lubo, Regino; Leatham, Mary P; Conway, Tyrrell; Cohen, Paul S
2009-04-01
Previously, we showed that the Salmonella enterica serovar Typhimurium SR-11 tricarboxylic acid (TCA) cycle must operate as a complete cycle for full virulence after oral infection of BALB/c mice (M. Tchawa Yimga, M. P. Leatham, J. H. Allen, D. C. Laux, T. Conway, and P. S. Cohen, Infect. Immun. 74:1130-1140, 2006). In the same study, we showed that for full virulence, malate must be converted to both oxaloacetate and pyruvate. Moreover, it was recently demonstrated that blocking conversion of succinyl-coenzyme A to succinate attenuates serovar Typhimurium SR-11 but does not make it avirulent; however, blocking conversion of succinate to fumarate renders it completely avirulent and protective against subsequent oral infection with the virulent serovar Typhimurium SR-11 wild-type strain (R. Mercado-Lubo, E. J. Gauger, M. P. Leatham, T. Conway, and P. S. Cohen, Infect. Immun. 76:1128-1134, 2008). Furthermore, the ability to convert succinate to fumarate appeared to be required only after serovar Typhimurium SR-11 became systemic. In the present study, evidence is presented that serovar Typhimurium SR-11 mutants that cannot convert fumarate to malate or that cannot convert malate to both oxaloacetate and pyruvate are also avirulent and protective in BALB/c mice. These results suggest that in BALB/c mice, the malate that is removed from the TCA cycle in serovar Typhimurium SR-11 for conversion to pyruvate must be replenished by succinate or one of its precursors, e.g., arginine or ornithine, which might be available in mouse phagocytes.
WANG, TING-AN; ZHANG, XIAO-DONG; GUO, XING-YU; XIAN, SHU-LIN; LU, YUN-FEI
2016-01-01
Glycolysis is the primary method utilized by cancer cells to produce the energy (adenosine triphosphate, ATP) required for cell proliferation. Therefore, inhibition of glycolysis may inhibit tumor growth. We previously found that both 3-bromopyruvate (3-BrPA) and sodium citrate (SCT) can inhibit glycolysis in vitro; however, the underlying inhibitory mechanisms remain unclear. In the present study, we used a human gastric cancer cell line (SGC-7901) and an orthotopic transplantation tumor model in nude mice to explore the specific mechanisms of 3-BrPA and SCT. We found that both 3-BrPA and SCT effectively suppressed cancer cell proliferation, arrested the cell cycle, induced apoptosis, and decreased the production of lactate and ATP. 3-BrPA significantly reduced the glycolytic enzyme hexokinase activity, while SCT selectively inhibited phosphofructokinase-1 activity. Furthermore, 3-BrPA and SCT upregulated the expression of pro-apoptotic proteins (Bax, cytochrome c, and cleaved caspase-3) and downregulated the expression of anti-apoptotic proteins (Bcl-2 and survivin). Finally, our animal model of gastric cancer indicated that intraperitoneal injection of 3-BrPA and SCT suppressed orthotopic transplantation tumor growth and induced tumor apoptosis. Taken together, these results suggest that 3-BrPA and SCT selectively suppress glycolytic enzymes, decrease ATP production, induce mitochondrial-mediated apoptosis, downregulate survivin, and inhibit tumor growth. Moreover, an intraperitoneal injection is an effective form of administration of 3-BrPA and SCT. PMID:26708213
Wang, Ting-An; Zhang, Xiao-Dong; Guo, Xing-Yu; Xian, Shu-Lin; Lu, Yun-Fei
2016-03-01
Glycolysis is the primary method utilized by cancer cells to produce the energy (adenosine triphosphate, ATP) required for cell proliferation. Therefore, inhibition of glycolysis may inhibit tumor growth. We previously found that both 3-bromopyruvate (3-BrPA) and sodium citrate (SCT) can inhibit glycolysis in vitro; however, the underlying inhibitory mechanisms remain unclear. In the present study, we used a human gastric cancer cell line (SGC-7901) and an orthotopic transplantation tumor model in nude mice to explore the specific mechanisms of 3-BrPA and SCT. We found that both 3-BrPA and SCT effectively suppressed cancer cell proliferation, arrested the cell cycle, induced apoptosis, and decreased the production of lactate and ATP. 3-BrPA significantly reduced the glycolytic enzyme hexokinase activity, while SCT selectively inhibited phosphofructokinase-1 activity. Furthermore, 3-BrPA and SCT upregulated the expression of pro-apoptotic proteins (Bax, cytochrome c, and cleaved caspase-3) and downregulated the expression of anti-apoptotic proteins (Bcl-2 and survivin). Finally, our animal model of gastric cancer indicated that intraperitoneal injection of 3-BrPA and SCT suppressed orthotopic transplantation tumor growth and induced tumor apoptosis. Taken together, these results suggest that 3-BrPA and SCT selectively suppress glycolytic enzymes, decrease ATP production, induce mitochondrial-mediated apoptosis, downregulate survivin, and inhibit tumor growth. Moreover, an intraperitoneal injection is an effective form of administration of 3-BrPA and SCT.
Effects of ocular transverse chromatic aberration on peripheral word identification.
Yang, Shun-Nan; Tai, Yu-chi; Laukkanen, Hannu; Sheedy, James E
2011-11-01
Transverse chromatic aberration (TCA) smears the retinal image of peripheral stimuli. We previously found that TCA significantly reduces the ability to recognize letters presented in the near fovea by degrading image quality and exacerbating crowding effect from adjacent letters. The present study examined whether TCA has a significant effect on near foveal and peripheral word identification, and whether within-word orthographic facilitation interacts with TCA effect to affect word identification. Subjects were briefly presented a 6- to 7-letter word of high or low frequency in each trial. Target words were generated with weak or strong horizontal color fringe to attenuate the TCA in the right periphery and exacerbate it in the left. The center of the target word was 1°, 2°, 4°, and 6° to the left or right of a fixation point. Subject's eye position was monitored with an eye-tracker to ensure proper fixation before target presentation. They were required to report the identity of the target word as soon and accurately as possible. Results show significant effect of color fringe on the latency and accuracy of word recognition, indicating existing TCA effect. Observed TCA effect was more salient in the right periphery, and was affected by word frequency more there. Individuals' subjective preference of color-fringed text was correlated to the TCA effect in the near periphery. Our results suggest that TCA significantly affects peripheral word identification, especially when it is located in the right periphery. Contextual facilitation such as word frequency interacts with TCA to influence the accuracy and latency of word recognition. Copyright © 2011 Elsevier Ltd. All rights reserved.
Yao, Ruilian; Pan, Keli; Peng, Huasong; Feng, Lei; Hu, Hongbo; Zhang, Xuehong
2018-01-01
Glycerol, an inevitable byproduct of biodiesel, has become an attractive feedstock for the production of value-added chemicals due to its availability and low price. Pseudomonas chlororaphis HT66 can use glycerol to synthesize phenazine-1-carboxamide (PCN), a phenazine derivative, which is strongly antagonistic to fungal phytopathogens. A systematic understanding of underlying mechanisms for the PCN overproduction will be important for the further improvement and industrialization. We constructed a PCN-overproducing strain (HT66LSP) through knocking out three negative regulatory genes, lon , parS , and prsA in HT66. The strain HT66LSP produced 4.10 g/L of PCN with a yield of 0.23 (g/g) from glycerol, which was of the highest titer and the yield obtained among PCN-producing strains. We studied gene expression, metabolomics, and dynamic 13 C tracer in HT66 and HT66LSP. In response to the phenotype changes, the transcript levels of phz biosynthetic genes, which are responsible for PCN biosynthesis, were all upregulated in HT66LSP. Central carbon was rerouted to the shikimate pathway, which was shown by the modulation of specific genes involved in the lower glycolysis, the TCA cycle, and the shikimate pathway, as well as changes in abundances of intracellular metabolites and flux distribution to increase the precursor availability for PCN biosynthesis. Moreover, dynamic 13 C-labeling experiments revealed that the presence of metabolite channeling of 3-phosphoglyceric acid to phosphoenolpyruvate and shikimate to trans-2,3-dihydro-3-hydroxyanthranilic acid in HT66LSP could enable high-yielding synthesis of PCN. The integrated analysis of gene expression, metabolomics, and dynamic 13 C tracer enabled us to gain a more in-depth insight into complex mechanisms for the PCN overproduction. This study provides important basis for further engineering P . chlororaphis for high PCN production and efficient glycerol conversion.
Hirshfield, Irvin
2016-01-01
Small colony variants (SCVs) can be defined as a naturally occurring sub-population of bacteria characterized by their reduced colony size and distinct biochemical properties. SCVs of Staphylococcus aureus have been studied extensively over the past two decades due to their role in recurrent human infections. However, little work has been done on SCVs of Escherichia coli, and this work has focused on the physiology and morphology that define these colonies of E. coli, such as small size and slow growth. E. coli strain JW0623, has a null lipA mutation in the lipoic acid synthase gene (lipA), and is a lipoic acid auxotroph. When the mutant was grown in LB medium to log phase, it showed remarkable resistance to acid (pH 3), hydrogen peroxide, heat and osmotic stress compared to its parent BW25113. Using RT-PCR and real time RT-PCR, the expression of certain genes was compared in the two strains in an attempt to create a molecular profile of Escherichia coli SCVs. These include genes involved in glycolysis, TCA cycle, electron transport, iron acquisition, biofilm formation and cyclopropane fatty acid synthesis. It was also demonstrated that the addition of 5 μg/ml of lipoic acid to LB medium allows for the phenotypic rescue of the mutant; reversing its slow growth, its resistance characteristics, and elevated gene expression. These results indicate that the mutation in lipA leads to an E. coli SCV that resembles an electron transport defective SCV of S. aureus These strains are typically auxotrophs, and are phenotypically rescued by adding the missing metabolite to rich medium. There are global shifts in gene expression which are reversible and depend on whether the auxotrophic molecule is absent or present. Looking at the E. coli SCV from an evolutionary point of view, it becomes evident that its path to survival is to express genes that confer stress resistance. PMID:27310825
Yassin, Atteyet F; Langenberg, Stefan; Huntemann, Marcel; Clum, Alicia; Pillay, Manoj; Palaniappan, Krishnaveni; Varghese, Neha; Mikhailova, Natalia; Mukherjee, Supratim; Reddy, T B K; Daum, Chris; Shapiro, Nicole; Ivanova, Natalia; Woyke, Tanja; Kyrpides, Nikos C
2017-01-01
The permanent draft genome sequence of Actinotignum schaalii DSM 15541T is presented. The annotated genome includes 2,130,987 bp, with 1777 protein-coding and 58 rRNA-coding genes. Genome sequence analysis revealed absence of genes encoding for: components of the PTS systems, enzymes of the TCA cycle, glyoxylate shunt and gluconeogensis. Genomic data revealed that A. schaalii is able to oxidize carbohydrates via glycolysis, the nonoxidative pentose phosphate and the Entner-Doudoroff pathways. Besides, the genome harbors genes encoding for enzymes involved in the conversion of pyruvate to lactate, acetate and ethanol, which are found to be the end products of carbohydrate fermentation. The genome contained the gene encoding Type I fatty acid synthase required for de novo FAS biosynthesis. The plsY and plsX genes encoding the acyltransferases necessary for phosphatidic acid biosynthesis were absent from the genome. The genome harbors genes encoding enzymes responsible for isoprene biosynthesis via the mevalonate (MVA) pathway. Genes encoding enzymes that confer resistance to reactive oxygen species (ROS) were identified. In addition, A. schaalii harbors genes that protect the genome against viral infections. These include restriction-modification (RM) systems, type II toxin-antitoxin (TA), CRISPR-Cas and abortive infection system. A. schaalii genome also encodes several virulence factors that contribute to adhesion and internalization of this pathogen such as the tad genes encoding proteins required for pili assembly, the nanI gene encoding exo-alpha-sialidase, genes encoding heat shock proteins and genes encoding type VII secretion system. These features are consistent with anaerobic and pathogenic lifestyles. Finally, resistance to ciprofloxacin occurs by mutation in chromosomal genes that encode the subunits of DNA-gyrase (GyrA) and topisomerase IV (ParC) enzymes, while resistant to metronidazole was due to the frxA gene, which encodes NADPH-flavin oxidoreductase.
Exploring traditional aus-type rice for metabolites conferring drought tolerance.
Casartelli, Alberto; Riewe, David; Hubberten, Hans Michael; Altmann, Thomas; Hoefgen, Rainer; Heuer, Sigrid
2018-01-25
Traditional varieties and landraces belonging to the aus-type group of rice (Oryza sativa L.) are known to be highly tolerant to environmental stresses, such as drought and heat, and are therefore recognized as a valuable genetic resource for crop improvement. Using two aus-type (Dular, N22) and two drought intolerant irrigated varieties (IR64, IR74) an untargeted metabolomics analysis was conducted to identify drought-responsive metabolites associated with tolerance. The superior drought tolerance of Dular and N22 compared with the irrigated varieties was confirmed by phenotyping plants grown to maturity after imposing severe drought stress in a dry-down treatment. Dular and N22 did not show a significant reduction in grain yield compared to well-watered control plants, whereas the intolerant varieties showed a significant reduction in both, total spikelet number and grain yield. The metabolomics analysis was conducted with shoot and root samples of plants at the tillering stage at the end of the dry-down treatment. The data revealed an overall higher accumulation of N-rich metabolites (amino acids and nucleotide-related metabolites allantoin and uridine) in shoots of the tolerant varieties. In roots, the aus-type varieties were characterised by a higher reduction of metabolites representative of glycolysis and the TCA cycle, such as malate, glyceric acid and glyceric acid-3-phosphate. On the other hand, the oligosaccharide raffinose showed a higher fold increase in both, shoots and roots of the sensitive genotypes. The data further showed that, for certain drought-responsive metabolites, differences between the contrasting rice varieties were already evident under well-watered control conditions. The drought tolerance-related metabolites identified in the aus-type varieties provide a valuable set of protective compounds and an entry point for assessing genetic diversity in the underlying pathways for developing drought tolerant rice and other crops.
Jungandreas, Anne; Schellenberger Costa, Benjamin; Jakob, Torsten; von Bergen, Martin; Baumann, Sven; Wilhelm, Christian
2014-01-01
Diatoms are major contributors to the aquatic primary productivity and show an efficient acclimation ability to changing light intensities. Here, we investigated the acclimation of Phaeodactylum tricornutum to different light quality with respect to growth rate, photosynthesis rate, macromolecular composition and the metabolic profile by shifting the light quality from red light (RL) to blue light (BL) and vice versa. Our results show that cultures pre-acclimated to BL and RL exhibited similar growth performance, photosynthesis rates and metabolite profiles. However, light shift experiments revealed rapid and severe changes in the metabolite profile within 15 min as the initial reaction of light acclimation. Thus, during the shift from RL to BL, increased concentrations of amino acids and TCA cycle intermediates were observed whereas during the BL to RL shift the levels of amino acids were decreased and intermediates of glycolysis accumulated. Accordingly, on the time scale of hours the RL to BL shift led to a redirection of carbon into the synthesis of proteins, whereas during the BL to RL shift an accumulation of carbohydrates occurred. Thus, a vast metabolic reorganization of the cells was observed as the initial reaction to changes in light quality. The results are discussed with respect to a putative direct regulation of cellular enzymes by light quality and by transcriptional regulation. Interestingly, the short-term changes in the metabolome were accompanied by changes in the degree of reduction of the plastoquinone pool. Surprisingly, the RL to BL shift led to a severe inhibition of growth within the first 48 h which was not observed during the BL to RL shift. Furthermore, during the phase of growth arrest the photosynthetic performance did not change. We propose arguments that the growth arrest could have been caused by the reorganization of intracellular carbon partitioning. PMID:25111046
Wang, Fang; Dong, YuXiu; Li, XingGuo; Zhang, Xian Sheng
2014-01-01
It is difficult to derive all qualitative proteomic and metabolomic experimental data in male (pollen tube) and female (pistil) reproductive tissues during pollination because of the limited sensitivity of current technology. In this study, genome-scale enzyme correlation network models for plants (Arabidopsis/maize) were constructed by analyzing the enzymes and metabolic routes from a global perspective. Then, we developed a data-driven computational pipeline using the “guilt by association” principle to analyze the transcriptional coexpression profiles of enzymatic genes in the consecutive steps for metabolic routes in the fast-growing pollen tube and stigma during pollination. The analysis identified an inferred pattern of pollen tube-stigma ethanol coupling. When the pollen tube elongates in the transmitting tissue (TT) of the pistil, this elongation triggers the mobilization of energy from glycolysis in the TT cells of the pistil. Energy-rich metabolites (ethanol) are secreted that can be taken up by the pollen tube, where these metabolites are incorporated into the pollen tube's tricarboxylic acid (TCA) cycle, which leads to enhanced ATP production for facilitating pollen tube growth. In addition, our analysis also provided evidence for the cooperation of kaempferol, dTDP-alpha-L-rhamnose and cell-wall-related proteins; phosphatidic-acid-mediated Ca2+ oscillations and cytoskeleton; and glutamate degradation IV for γ-aminobutyric acid (GABA) signaling activation in Arabidopsis and maize stigmas to provide the signals and materials required for pollen tube tip growth. In particular, the “guilt by association” computational pipeline and the genome-scale enzyme correlation network models (GECN) developed in this study was initiated with experimental “omics” data, followed by data analysis and data integration to determine correlations, and could provide a new platform to assist inachieving a deeper understanding of the co-regulation and inter-regulation model in plant research. PMID:25215523
Cerium oxide nanozyme modulate the ‘exercise’ redox biology of skeletal muscle
NASA Astrophysics Data System (ADS)
Arya, Aditya; Sethy, Niroj Kumar; Gangwar, Anamika; Bhargava, Neelima; Dubey, Amarish; Roy, Manas; Srivastava, Gaurav; Singh, Sushil Kumar; Das, Mainak; Bhargava, Kalpana
2017-05-01
‘Exercise’ is a double-edged sword for the skeletal muscle. Small amount of ROS generated during mild exercise, is essential for normal force generation; whereas large quantity of ROS generated during intense exercise, may cause contractile dysfunction, resulting in muscle weakness and fatigue. One of the key question in skeletal muscle physiology is ‘could antioxidant therapy improve the skeletal muscle endurance? A question, which has resulted in contradictory experimental findings till this date. This work has addressed this ‘very question’ using a synthetic, inorganic, antioxidant nano-material viz., ‘cerium oxide nanozyme’ (CON). It has been introduced in the rat by intramuscular injection, and the skeletal muscle endurance has been evaluated. Intramuscular injections of CON, concurrent with exercise, enhanced muscle mass, glycogen and ATP content, type I fiber ratio, thus resulting in significantly higher muscle endurance. Electron microscope studies confirmed the presence of CON in the vicinity of muscle mitochondria. There was an increase in the number and size of the muscle mitochondria in the CON treated muscle, following exercise, as compared to the untreated group with only exercised muscle. Quantitative proteomics data and subsequent biological network analysis studies, identified higher levels of oxidative phosphorylation, TCA cycle output and glycolysis in CON supplemented exercised muscle over only exercised muscle. This was further associated with significant increase in the mitochondrial respiratory capacity and muscle contraction, primarily due to higher levels of electron transport chain proteins like NDUFA9, SDHA, ATP5B and ATP5D, which were validated by real-time PCR and western blotting. Along with this, persistence of CON in muscle was evaluated with ICP-MS analysis, which revealed clearance of the particles after 90 d, without exhibiting any inflammation or adverse affects on the health of the experimental animals. Thus a higher physiological endurance of the CON supplemented exercised muscle’ opens new avenues in skeletal muscle therapeutic, space and sports medicine.
Metabolomic Profiling of Plasma Samples from Women with Recurrent Spontaneous Abortion.
Li, XiaoCui; Yin, MingHong; Gu, JinPing; Hou, YanYan; Tian, FuJu; Sun, Feng
2018-06-13
BACKGROUND Gas chromatography coupled with mass spectrometry (GC-MS) and liquid chromatography coupled with mass spectrometry (LC-MS) metabolomics have been deployed to detect novel differential metabolites in cases with recurrent spontaneous abortion (RSA). MATERIAL AND METHODS Fifty patients who had recurrent spontaneous abortions (RSAs) and 51 control patients (age, gestational age, and body mass index (BMI) match) were enrolled in this study. Untargeted GC-MS and targeted LC-MS were combined to discover and validate the different metabolomic profiles between groups. Score plots of orthogonal partial least-squares discriminant analysis (OPLS-DA) clearly separated the RSA group from the control group. The variable importance in projection (VIP) generated in OPLS-DA processing represented the contribution to the discrimination of each metabolite ion between groups. Variables with a VIP >1 and P<0.05 were considered to be different variables. We also used MetaboAnalyst 3.0 to analyze the pathway impact of potential metabolite biomarkers. RESULTS Fifty-four metabolites were significantly different between the two groups, as indicated by a VIP >1 and P<0.05. The metabolic pathways involving glycine, serine, threonine (P=0.00529, impact=0.26), beta-alanine (P=0.0284, impact=0.27), and phenylalanine metabolism (P=0.0217, impact=0.17), along with the tricarboxylic acid (TCA) cycle (P=0.0113, impact=0.19) and the glycolysis pathway (P=0.037, impact=0.1) are obviously related to RSA. Verification by LC-MS showed that the concentration of lactic acid in RSA was higher than that in the control group (P<0.05), while the concentration of 5-methoxytryptamine was significantly lower in the RSA group (P<0.05). CONCLUSIONS In our study, untargeted GC-MS was used to detect disturbance of metabolism occurs in RSA and targeted LC-MS further was used to show that plasma concentrations of two metabolites (lactic acid and 5-methoxytryptamine) were different in the RSA compared to the control group.
de Oliveira Dal'Molin, Cristiana G; Orellana, Camila; Gebbie, Leigh; Steen, Jennifer; Hodson, Mark P; Chrysanthopoulos, Panagiotis; Plan, Manuel R; McQualter, Richard; Palfreyman, Robin W; Nielsen, Lars K
2016-01-01
The urgent need for major gains in industrial crops productivity and in biofuel production from bioenergy grasses have reinforced attention on understanding C4 photosynthesis. Systems biology studies of C4 model plants may reveal important features of C4 metabolism. Here we chose foxtail millet (Setaria italica), as a C4 model plant and developed protocols to perform systems biology studies. As part of the systems approach, we have developed and used a genome-scale metabolic reconstruction in combination with the use of multi-omics technologies to gain more insights into the metabolism of S. italica. mRNA, protein, and metabolite abundances, were measured in mature and immature stem/leaf phytomers, and the multi-omics data were integrated into the metabolic reconstruction framework to capture key metabolic features in different developmental stages of the plant. RNA-Seq reads were mapped to the S. italica resulting for 83% coverage of the protein coding genes of S. italica. Besides revealing similarities and differences in central metabolism of mature and immature tissues, transcriptome analysis indicates significant gene expression of two malic enzyme isoforms (NADP- ME and NAD-ME). Although much greater expression levels of NADP-ME genes are observed and confirmed by the correspondent protein abundances in the samples, the expression of multiple genes combined to the significant abundance of metabolites that participates in C4 metabolism of NAD-ME and NADP-ME subtypes suggest that S. italica may use mixed decarboxylation modes of C4 photosynthetic pathways under different plant developmental stages. The overall analysis also indicates different levels of regulation in mature and immature tissues in carbon fixation, glycolysis, TCA cycle, amino acids, fatty acids, lignin, and cellulose syntheses. Altogether, the multi-omics analysis reveals different biological entities and their interrelation and regulation over plant development. With this study, we demonstrated that this systems approach is powerful enough to complement the functional metabolic annotation of bioenergy grasses.
de Oliveira Dal'Molin, Cristiana G.; Orellana, Camila; Gebbie, Leigh; Steen, Jennifer; Hodson, Mark P.; Chrysanthopoulos, Panagiotis; Plan, Manuel R.; McQualter, Richard; Palfreyman, Robin W.; Nielsen, Lars K.
2016-01-01
The urgent need for major gains in industrial crops productivity and in biofuel production from bioenergy grasses have reinforced attention on understanding C4 photosynthesis. Systems biology studies of C4 model plants may reveal important features of C4 metabolism. Here we chose foxtail millet (Setaria italica), as a C4 model plant and developed protocols to perform systems biology studies. As part of the systems approach, we have developed and used a genome-scale metabolic reconstruction in combination with the use of multi-omics technologies to gain more insights into the metabolism of S. italica. mRNA, protein, and metabolite abundances, were measured in mature and immature stem/leaf phytomers, and the multi-omics data were integrated into the metabolic reconstruction framework to capture key metabolic features in different developmental stages of the plant. RNA-Seq reads were mapped to the S. italica resulting for 83% coverage of the protein coding genes of S. italica. Besides revealing similarities and differences in central metabolism of mature and immature tissues, transcriptome analysis indicates significant gene expression of two malic enzyme isoforms (NADP- ME and NAD-ME). Although much greater expression levels of NADP-ME genes are observed and confirmed by the correspondent protein abundances in the samples, the expression of multiple genes combined to the significant abundance of metabolites that participates in C4 metabolism of NAD-ME and NADP-ME subtypes suggest that S. italica may use mixed decarboxylation modes of C4 photosynthetic pathways under different plant developmental stages. The overall analysis also indicates different levels of regulation in mature and immature tissues in carbon fixation, glycolysis, TCA cycle, amino acids, fatty acids, lignin, and cellulose syntheses. Altogether, the multi-omics analysis reveals different biological entities and their interrelation and regulation over plant development. With this study, we demonstrated that this systems approach is powerful enough to complement the functional metabolic annotation of bioenergy grasses. PMID:27559337
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kowalski, Greg M., E-mail: greg.kowalski@deakin.edu.au; De Souza, David P.; Risis, Steve
Rationale: Cardiac metabolism is thought to be altered in insulin resistance and type 2 diabetes (T2D). Our understanding of the regulation of cardiac substrate metabolism and insulin sensitivity has largely been derived from ex vivo preparations which are not subject to the same metabolic regulation as in the intact heart in vivo. Studies are therefore required to examine in vivo cardiac glucose metabolism under physiologically relevant conditions. Objective: To determine the temporal pattern of the development of cardiac insulin resistance and to compare with dynamic approaches to interrogate cardiac glucose and intermediary metabolism in vivo. Methods and results: Studies were conducted to determine themore » evolution of cardiac insulin resistance in C57Bl/6 mice fed a high-fat diet (HFD) for between 1 and 16 weeks. Dynamic in vivo cardiac glucose metabolism was determined following oral administration of [U-{sup 13}C] glucose. Hearts were collected after 15 and 60 min and flux profiling was determined by measuring {sup 13}C mass isotopomers in glycolytic and tricarboxylic acid (TCA) cycle intermediates. Cardiac insulin resistance, determined by euglycemic–hyperinsulinemic clamp, was evident after 3 weeks of HFD. Despite the presence of insulin resistance, in vivo cardiac glucose metabolism following oral glucose administration was not compromised in HFD mice. This contrasts our recent findings in skeletal muscle, where TCA cycle activity was reduced in mice fed a HFD. Similar to our report in muscle, glucose derived pyruvate entry into the TCA cycle in the heart was almost exclusively via pyruvate dehydrogenase, with pyruvate carboxylase mediated anaplerosis being negligible after oral glucose administration. Conclusions: Under experimental conditions which closely mimic the postprandial state, the insulin resistant mouse heart retains the ability to stimulate glucose metabolism. - Highlights: • Insulin clamp was used to determine the evolution of cardiac insulin resistance. • Clamp measures were compared to a dynamic metabolomics approach. • The clamp revealed the presence of cardiac insulin resistance after 3 weeks of HFD. • Cardiac glucose metabolism was not affected by HFD during an oral glucose challenge.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hollinshead, Whitney D.; Rodriguez, Sarah; Martin, Hector Garcia
Background: Glycolysis breakdowns glucose into essential building blocks and ATP/NAD(P)H for the cell, occupying a central role in its growth and bio-production. Among glycolytic pathways, the Entner Doudoroff pathway (EDP) is a more thermodynamically favorable pathway with fewer enzymatic steps than either the Embden-Meyerhof-Parnas pathway (EMPP) or the oxidative pentose phosphate pathway (OPPP). However, Escherichia coli do not use their native EDP for glucose metabolism. Results: Overexpression of edd and eda in E. coli to enhance EDP activity resulted in only a small shift in the flux directed through the EDP (~20 % of glycolysis flux). Disrupting the EMPP bymore » phosphofructokinase I (pfkA) knockout increased flux through OPPP (~60 % of glycolysis flux) and the native EDP (~14 % of glycolysis flux), while overexpressing edd and eda in this ΔpfkA mutant directed ~70 % of glycolytic flux through the EDP. The downregulation of EMPP via the pfkA deletion significantly decreased the growth rate, while EDP overexpression in the ΔpfkA mutant failed to improve its growth rates due to metabolic burden. However, the reorganization of E. coli glycolytic strategies did reduce glucose catabolite repression. The ΔpfkA mutant in glucose medium was able to cometabolize acetate via the citric acid cycle and gluconeogenesis, while EDP overexpression in the ΔpfkA mutant repressed acetate flux toward gluconeogenesis. Moreover, 13C-pulse experiments in the ΔpfkA mutants showed unsequential labeling dynamics in glycolysis intermediates, possibly suggesting metabolite channeling (metabolites in glycolysis are pass from enzyme to enzyme without fully equilibrating within the cytosol medium). Conclusions: We engineered E. coli to redistribute its native glycolytic flux. The replacement of EMPP by EDP did not improve E. coli glucose utilization or biomass growth, but alleviated catabolite repression. More importantly, our results supported the hypothesis of channeling in the glycolytic pathways, a potentially overlooked mechanism for regulating glucose catabolism and coutilization of other substrates. The presence of channeling in native pathways, if proven true, would affect synthetic biology applications and metabolic modeling.« less
Exogenous pyruvate accelerates glycolysis and promotes capacitation in human spermatozoa.
Hereng, T H; Elgstøen, K B P; Cederkvist, F H; Eide, L; Jahnsen, T; Skålhegg, B S; Rosendal, K R
2011-12-01
There has been an ongoing debate in the reproductive field about whether mammalian spermatozoa rely on glycolysis, oxidative phosphorylation or both for their energy production. Recent studies have proposed that human spermatozoa depend mainly on glucose for motility and fertilization but the mechanism behind an efficient glycolysis in human spermatozoa is not well understood. Here, we demonstrate how human spermatozoa utilize exogenous pyruvate to enhance glycolytic ATP production, motility, hyperactivation and capacitation, events that are crucial for male fertility. Purified human spermatozoa from healthy donors were incubated under capacitating conditions (including albumin, bicarbonate and glucose) and tested for changes in ATP levels, motility, hyperactivation and tyrosine phosphorylation after treatment with pyruvate. The experiments were repeated in the presence of sodium cyanide in order to assess the contribution from mitochondrial respiration. The metabolism of (13)C labeled glucose and pyruvate was traced by a combination of liquid chromatography and mass spectrometry. The treatment of human spermatozoa with exogenous pyruvate increased intracellular ATP levels, progressive motility and hyperactivation by 56, 21 and 130%, respectively. In addition, added pyruvate induced a significant increase in tyrosine phosphorylation levels. Blocking of the electron transport chain did not markedly affect the results, indicating that the mechanism is independent of oxidative phosphorylation. However, the observed effects could be counteracted by oxamate, an inhibitor of lactate dehydrogenase (LDH). Metabolic tracing experiments revealed that the observed rise in ATP concentration resulted from an enhanced glycolytic flux, which was increased by more than 50% in the presence of exogenous pyruvate. Moreover, all consumed (13)C labeled pyruvate added was converted to lactate rather than oxidized in the tricarboxylic acid cycle. Human spermatozoa seem to rely mainly, if not entirely, on glycolysis as the source of ATP fueling the energy-demanding processes of motility and capacitation. The efficient glycolysis is dependent on exogenous pyruvate, which indirectly feeds the accelerated glycolysis with NAD(+) through the LDH-mediated conversion of pyruvate to lactate. Pyruvate is present in the human female reproductive tract at concentrations in accordance with our results. As seen in other mammals, the motility and fertility of human spermatozoa seem to be dictated by the available energy substrates present in the conspecific female.
Hollinshead, Whitney D.; Rodriguez, Sarah; Martin, Hector Garcia; ...
2016-10-10
Background: Glycolysis breakdowns glucose into essential building blocks and ATP/NAD(P)H for the cell, occupying a central role in its growth and bio-production. Among glycolytic pathways, the Entner Doudoroff pathway (EDP) is a more thermodynamically favorable pathway with fewer enzymatic steps than either the Embden-Meyerhof-Parnas pathway (EMPP) or the oxidative pentose phosphate pathway (OPPP). However, Escherichia coli do not use their native EDP for glucose metabolism. Results: Overexpression of edd and eda in E. coli to enhance EDP activity resulted in only a small shift in the flux directed through the EDP (~20 % of glycolysis flux). Disrupting the EMPP bymore » phosphofructokinase I (pfkA) knockout increased flux through OPPP (~60 % of glycolysis flux) and the native EDP (~14 % of glycolysis flux), while overexpressing edd and eda in this ΔpfkA mutant directed ~70 % of glycolytic flux through the EDP. The downregulation of EMPP via the pfkA deletion significantly decreased the growth rate, while EDP overexpression in the ΔpfkA mutant failed to improve its growth rates due to metabolic burden. However, the reorganization of E. coli glycolytic strategies did reduce glucose catabolite repression. The ΔpfkA mutant in glucose medium was able to cometabolize acetate via the citric acid cycle and gluconeogenesis, while EDP overexpression in the ΔpfkA mutant repressed acetate flux toward gluconeogenesis. Moreover, 13C-pulse experiments in the ΔpfkA mutants showed unsequential labeling dynamics in glycolysis intermediates, possibly suggesting metabolite channeling (metabolites in glycolysis are pass from enzyme to enzyme without fully equilibrating within the cytosol medium). Conclusions: We engineered E. coli to redistribute its native glycolytic flux. The replacement of EMPP by EDP did not improve E. coli glucose utilization or biomass growth, but alleviated catabolite repression. More importantly, our results supported the hypothesis of channeling in the glycolytic pathways, a potentially overlooked mechanism for regulating glucose catabolism and coutilization of other substrates. The presence of channeling in native pathways, if proven true, would affect synthetic biology applications and metabolic modeling.« less
NASA Astrophysics Data System (ADS)
Fei, Fan; Lee, Keith M.; McCarry, Brian E.; Bowdish, Dawn M. E.
2016-03-01
Macrophages are major contributors to age-associated inflammation. Metabolic processes such as oxidative phosphorylation, glycolysis and the urea cycle regulate inflammatory responses by macrophages. Metabolic profiles changes with age; therefore, we hypothesized that dysregulation of metabolic processes could contribute to macrophage hyporesponsiveness to LPS. We examined the intracellular metabolome of bone marrow-derived macrophages from young (6-8 wk) and old (18-22 mo) mice following lipopolysaccharide (LPS) stimulation and tolerance. We discovered known and novel metabolites that were associated with the LPS response of macrophages from young mice, which were not inducible in macrophages from old mice. Macrophages from old mice were largely non-responsive towards LPS stimulation, and we did not observe a shift from oxidative phosphorylation to glycolysis. The critical regulatory metabolites succinate, γ-aminobutyric acid, arginine, ornithine and adenosine were increased in LPS-stimulated macrophages from young mice, but not macrophages from old mice. A shift between glycolysis and oxidative phosphorylation was not observed during LPS tolerance in macrophages from either young or old mice. Metabolic bottlenecks may be one of the mechanisms that contribute to the dysregulation of LPS responses with age.
Lis, Paweł; Jurkiewicz, Paweł; Cal-Bąkowska, Magdalena; Ko, Young H; Pedersen, Peter L; Goffeau, Andre; Ułaszewski, Stanisław
2016-03-01
In this study the detailed characteristic of the anti-cancer agent 3-bromopyruvate (3-BP) activity in the yeast Saccharomyces cerevisiae model is described, with the emphasis on its influence on energetic metabolism of the cell. It shows that 3-BP toxicity in yeast is strain-dependent and influenced by the glucose-repression system. Its toxic effect is mainly due to the rapid depletion of intracellular ATP. Moreover, lack of the Whi2p phosphatase results in strongly increased sensitivity of yeast cells to 3-BP, possibly due to the non-functional system of mitophagy of damaged mitochondria through the Ras-cAMP-PKA pathway. Single deletions of genes encoding glycolytic enzymes, the TCA cycle enzymes and mitochondrial carriers result in multiple effects after 3-BP treatment. However, it can be concluded that activity of the pentose phosphate pathway is necessary to prevent the toxicity of 3-BP, probably due to the fact that large amounts of NADPH are produced by this pathway, ensuring the reducing force needed for glutathione reduction, crucial to cope with the oxidative stress. Moreover, single deletions of genes encoding the TCA cycle enzymes and mitochondrial carriers generally cause sensitivity to 3-BP, while totally inactive mitochondrial respiration in the rho0 mutant resulted in increased resistance to 3-BP.
Gao, Shu-Hong; Fan, Lu; Peng, Lai; Guo, Jianhua; Agulló-Barceló, Míriam; Yuan, Zhiguo; Bond, Philip L
2016-05-17
Free nitrous acid (FNA) has recently been demonstrated as an antimicrobial agent on a range of micro-organisms, especially in wastewater-treatment systems. However, the antimicrobial mechanism of FNA is largely unknown. Here, we report that the antimicrobial effects of FNA are multitargeted. The response of a model denitrifier, Pseudomnas aeruginosa PAO1 (PAO1), common in wastewater treatment, was investigated in the absence and presence of inhibitory level of FNA (0.1 mg N/L) under anaerobic denitrifying conditions. This was achieved through coupling gene expression analysis, by RNA sequencing, and with a suite of physiological analyses. Various transcripts exhibited significant changes in abundance in the presence of FNA. Respiration was likely inhibited because denitrification activity was severely depleted, and decreased transcript levels of most denitrification genes occurred. As a consequence, the tricarboxylic acid (TCA) cycle was inhibited due to the lowered cellular redox state in the FNA-exposed cultures. Meanwhile, during FNA exposure, PAO1 rerouted its carbon metabolic pathway from the TCA cycle to pyruvate fermentation with acetate as the end product as a possible survival mechanism. Additionally, protein synthesis was significantly decreased, and ribosome preservation was evident. These findings improve our understanding of PAO1 in response to FNA and contribute toward the potential application for use of FNA as an antimicrobial agent.
Baker, Peter R; Boyle, Kristen E; Koves, Timothy R; Ilkayeva, Olga R; Muoio, Deborah M; Houmard, Joseph A; Friedman, Jacob E
2015-05-01
Investigate the effects of obesity and high-fat diet (HFD) exposure on fatty acid oxidation and TCA cycle intermediates and amino acids in skeletal muscle to better characterize energy metabolism. Plasma and skeletal muscle metabolomic profiles were measured from lean and obese males before and after a 5-day HFD in the 4 h postprandial condition. At both time points, plasma short-chain acylcarnitine species (SCAC) were higher in the obese subjects, while the amino acids glycine, histidine, methionine, and citrulline were lower in skeletal muscle of obese subjects. Skeletal muscle medium-chain acylcarnitines (MCAC) C6, C8, C10:2, C10:1, C10, and C12:1 increased in obese subjects, but decreased in lean subjects, from pre- to post-HFD. Plasma content of C10:1 was also decreased in the lean but increased in the obese subjects from pre- to post-HFD. CD36 increased from pre- to post-HFD in obese but not lean subjects. Lower skeletal muscle amino acid content and accumulation of plasma SCAC in obese subjects could reflect increased anaplerosis for TCA cycle intermediates, while accumulation of MCAC suggests limitations in β-oxidation. These measures may be important markers of or contributors to dysregulated metabolism observed in skeletal muscle of obese humans. © 2015 The Obesity Society.
Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko
2018-05-24
Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sadler, Natalie C.; Angel, Thomas E.; Lewis, Michael P.
High-fat diet (HFD) induced obesity and concomitant development of insulin resistance (IR) and type 2 diabetes mellitus have been linked to mitochondrial dysfunction. However, it is not clear whether mitochondrial dysfunction is a direct effect of a HFD or if the mitochondrial function is reduced with increased HFD duration. We hypothesized that the function of mitochondrial oxidative and lipid metabolism functions in skeletal muscle mitochondria for HFD mice are similar or elevated relative to standard diet (SD) mice, thereby IR is neither cause nor consequence of mitochondrial dysfunction. We applied a chemical probe approach to identify functionally reactive ATPases andmore » nucleotide-binding proteins in mitochondria isolated from skeletal muscle of C57Bl/6J mice fed HFD or SD chow for 2-, 8-, or 16-weeks; feeding time points known to induce IR. A total of 293 probe-labeled proteins were identified by mass spectrometry-based proteomics, of which 54 differed in abundance between HFD and SD mice. We found proteins associated with the TCA cycle, oxidative phosphorylation (OXPHOS), and lipid metabolism were altered in function when comparing SD to HFD fed mice at 2-weeks, however by 16-weeks HFD mice had TCA cycle, β-oxidation, and respiratory chain function at levels similar to or higher than SD mice.« less
Glucose enhances tilapia against Edwardsiella tarda infection through metabolome reprogramming.
Zeng, Zao-hai; Du, Chao-Chao; Liu, Shi-Rao; Li, Hui; Peng, Xuan-Xian; Peng, Bo
2017-02-01
We have recently reported that the survival of tilapia, Oreochromis niloticus, during Edwardsiella tarda infection is tightly associated with their metabolome, where the survived O. niloticus has distinct metabolomic profile to dying O. niloticus. Glucose is the key metabolite to distinguish the survival- and dying-metabolome. More importantly, exogenous administration of glucose to the fish greatly enhances their survival for the infection, indicating the functional roles of glucose in metabolome repurposing, known as reprogramming metabolomics. However, the underlying information for the reprogramming is not yet available. Here, GC/MS based metabolomics is used to understand the mechanisms by which how exogenous glucose elevates O. niloticus, anti-infectious ability to E. tarda. Results showed that exogenous glucose promotes stearic acid and palmitic acid biosynthesis but attenuates TCA cycle to potentiate O. niloticus against bacterial infection, which is confirmed by the fact that exogenous stearic acid increases immune protection in O. niloticus against E. tarda infection in a manner of Mx protein. These results indicate that exogenous glucose reprograms O. niloticus anti-infective metabolome that characterizes elevation of stearic acid and palmitic acid and attenuation of the TCA cycle. Therefore, our results proposed a novel mechanism that glucose promotes unsaturated fatty acid biosynthesis to cope with infection, thereby highlighting a potential way of enhancing fish immunity in aquaculture. Copyright © 2016 Elsevier Ltd. All rights reserved.
Lis, Paweł; Jurkiewicz, Paweł; Cal-Bąkowska, Magdalena; Ko, Young H.; Pedersen, Peter L.; Goffeau, Andre; Ułaszewski, Stanisław
2016-01-01
In this study the detailed characteristic of the anti-cancer agent 3-bromopyruvate (3-BP) activity in the yeast Saccharomyces cerevisiae model is described, with the emphasis on its influence on energetic metabolism of the cell. It shows that 3-BP toxicity in yeast is strain-dependent and influenced by the glucose-repression system. Its toxic effect is mainly due to the rapid depletion of intracellular ATP. Moreover, lack of the Whi2p phosphatase results in strongly increased sensitivity of yeast cells to 3-BP, possibly due to the non-functional system of mitophagy of damaged mitochondria through the Ras-cAMP-PKA pathway. Single deletions of genes encoding glycolytic enzymes, the TCA cycle enzymes and mitochondrial carriers result in multiple effects after 3-BP treatment. However, it can be concluded that activity of the pentose phosphate pathway is necessary to prevent the toxicity of 3-BP, probably due to the fact that large amounts of NADPH are produced by this pathway, ensuring the reducing force needed for glutathione reduction, crucial to cope with the oxidative stress. Moreover, single deletions of genes encoding the TCA cycle enzymes and mitochondrial carriers generally cause sensitivity to 3-BP, while totally inactive mitochondrial respiration in the rho0 mutant resulted in increased resistance to 3-BP. PMID:26862728
Egnatchik, Robert A; Brittain, Evan L; Shah, Amy T; Fares, Wassim H; Ford, H James; Monahan, Ken; Kang, Christie J; Kocurek, Emily G; Zhu, Shijun; Luong, Thong; Nguyen, Thuy T; Hysinger, Erik; Austin, Eric D; Skala, Melissa C; Young, Jamey D; Roberts, L Jackson; Hemnes, Anna R; West, James; Fessel, Joshua P
2017-03-01
Pulmonary arterial hypertension (PAH) is increasingly recognized as a systemic disease driven by alteration in the normal functioning of multiple metabolic pathways affecting all of the major carbon substrates, including amino acids. We found that human pulmonary hypertension patients (WHO Group I, PAH) exhibit systemic and pulmonary-specific alterations in glutamine metabolism, with the diseased pulmonary vasculature taking up significantly more glutamine than that of controls. Using cell culture models and transgenic mice expressing PAH-causing BMPR2 mutations, we found that the pulmonary endothelium in PAH shunts significantly more glutamine carbon into the tricarboxylic acid (TCA) cycle than wild-type endothelium. Increased glutamine metabolism through the TCA cycle is required by the endothelium in PAH to survive, to sustain normal energetics, and to manifest the hyperproliferative phenotype characteristic of disease. The strict requirement for glutamine is driven by loss of sirtuin-3 (SIRT3) activity through covalent modification by reactive products of lipid peroxidation. Using 2-hydroxybenzylamine, a scavenger of reactive lipid peroxidation products, we were able to preserve SIRT3 function, to normalize glutamine metabolism, and to prevent the development of PAH in BMPR2 mutant mice. In PAH, targeting glutamine metabolism and the mechanisms that underlie glutamine-driven metabolic reprogramming represent a viable novel avenue for the development of potentially disease-modifying therapeutics that could be rapidly translated to human studies.
Mycobacterium avium Genes Associated with the Ability To Form a Biofilm
Yamazaki, Yoshitaka; Danelishvili, Lia; Wu, Martin; MacNab, Molly; Bermudez, Luiz E.
2006-01-01
Mycobacterium avium is widely distributed in the environment, and it is chiefly found in water and soil. M. avium, as well as Mycobacterium smegmatis, has been recognized to produce a biofilm or biofilm-like structure. We screened an M. avium green fluorescent protein (GFP) promoter library in M. smegmatis for genes involved in biofilm formation on polyvinyl chloride (PVC) plates. Clones associated with increased GFP expression ≥2.0-fold over the baseline were sequenced. Seventeen genes, most encoding proteins of the tricarboxylic acid (TCA) cycle and GDP-mannose and fatty acid biosynthesis, were identified. Their regulation in M. avium was confirmed by examining the expression of a set of genes by real-time PCR after incubation on PVC plates. In addition, screening of 2,000 clones of a transposon mutant bank constructed using M. avium strain A5, a mycobacterial strain with the ability to produce large amounts of biofilm, revealed four mutants with an impaired ability to form biofilm. Genes interrupted by transposons were homologues of M. tuberculosis 6-oxodehydrogenase (sucA), enzymes of the TCA cycle, protein synthetase (pstB), enzymes of glycopeptidolipid (GPL) synthesis, and Rv1565c (a hypothetical membrane protein). In conclusion, it appears that GPL biosynthesis, including the GDP-mannose biosynthesis pathway, is the most important pathway involved in the production of M. avium biofilm. PMID:16391123
Pires, Marcel V; Pereira Júnior, Adilson A; Medeiros, David B; Daloso, Danilo M; Pham, Phuong Anh; Barros, Kallyne A; Engqvist, Martin K M; Florian, Alexandra; Krahnert, Ina; Maurino, Veronica G; Araújo, Wagner L; Fernie, Alisdair R
2016-06-01
During dark-induced senescence isovaleryl-CoA dehydrogenase (IVDH) and D-2-hydroxyglutarate dehydrogenase (D-2HGDH) act as alternate electron donors to the ubiquinol pool via the electron-transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase (ETF/ETFQO) pathway. However, the role of this pathway in response to other stresses still remains unclear. Here, we demonstrated that this alternative pathway is associated with tolerance to drought in Arabidopsis. In comparison with wild type (WT) and lines overexpressing D-2GHDH, loss-of-function etfqo-1, d2hgdh-2 and ivdh-1 mutants displayed compromised respiration rates and were more sensitive to drought. Our results demonstrated that an operational ETF/ETFQO pathway is associated with plants' ability to withstand drought and to recover growth once water becomes replete. Drought-induced metabolic reprogramming resulted in an increase in tricarboxylic acid (TCA) cycle intermediates and total amino acid levels, as well as decreases in protein, starch and nitrate contents. The enhanced levels of the branched-chain amino acids in loss-of-function mutants appear to be related to their increased utilization as substrates for the TCA cycle under water stress. Our results thus show that mitochondrial metabolism is highly active during drought stress responses and provide support for a role of alternative respiratory pathways within this response. © 2015 John Wiley & Sons Ltd.
Biotin deficiency inhibits heme synthesis and impairs mitochondria in human lung fibroblasts.
Atamna, Hani; Newberry, Justin; Erlitzki, Ronit; Schultz, Carla S; Ames, Bruce N
2007-01-01
Four of the 5 biotin-dependent carboxylases (BDC) are in the mitochondria. BDC replace intermediates in the Krebs [tricarboxylic acid (TCA)] cycle that are regularly removed for the synthesis of key metabolites such as heme or amino acids. Heme, unlike amino acids, is not recycled to regenerate these intermediates, is not utilized from the diet, and must be synthesized in situ. We studied whether biotin deficiency (BD) lowers heme synthesis and whether mitochondria would be disrupted. Biotin-deficient medium was prepared by using bovine serum stripped of biotin with charcoal/dextran or avidin. Biotin-deficient primary human lung fibroblasts (IMR90) lost their BDC and senesced before biotin-sufficient cells. BD caused heme deficiency; there was a decrease in heme content and heme synthesis, and biotin-deficient cells selectively lost mitochondrial complex IV, which contains heme-a. Loss of complex IV, which is part of the electron transport chain, triggered oxidant release and oxidative damage, hallmarks of heme deficiency. Restoring biotin to the biotin-deficient medium prevented the above changes. Old cells were more susceptible to biotin shortage than young cells. These findings highlight the biochemical connection among biotin, heme, and iron metabolism, and the mitochondria, due to the role of biotin in maintaining the biochemical integrity of the TCA cycle. The findings are discussed in relation to aging and birth defects in humans.
Smeland, Olav B; Hadera, Mussie G; McDonald, Tanya S; Sonnewald, Ursula; Borges, Karin
2013-01-01
Although certain metabolic characteristics such as interictal glucose hypometabolism are well established for temporal lobe epilepsy (TLE), its pathogenesis still remains unclear. Here, we performed a comprehensive study of brain metabolism in a mouse model of TLE, induced by pilocarpine–status epilepticus (SE). To investigate glucose metabolism, we injected mice 3.5–4 weeks after SE with [1,2-13C]glucose before microwave fixation of the head. Using 1H and 13C nuclear magnetic resonance spectroscopy, gas chromatography—mass spectrometry and high-pressure liquid chromatography, we quantified metabolites and 13C labeling in extracts of cortex and hippocampal formation (HF). Hippocampal levels of glutamate, glutathione and alanine were decreased in pilocarpine–SE mice compared with controls. Moreover, the contents of N-acetyl aspartate, succinate and reduced nicotinamide adenine dinucleotide (phosphate) NAD(P)H were decreased in HF indicating impairment of mitochondrial function. In addition, the reduction in 13C enrichment of hippocampal citrate and malate suggests decreased tricarboxylic acid (TCA) cycle turnover in this region. In cortex, we found reduced 13C labeling of glutamate, glutamine and aspartate via the pyruvate carboxylation and pyruvate dehydrogenation pathways, suggesting slower turnover of these amino acids and/or the TCA cycle. In conclusion, mitochondrial metabolic dysfunction and altered amino-acid metabolism is found in both cortex and HF in this epilepsy model. PMID:23611869
Nutrient Dependence of RNase E Essentiality in Escherichia coli
Tamura, Masaru; Moore, Christopher J.
2013-01-01
Escherichia coli cells normally require RNase E activity to form colonies (colony-forming ability [CFA]). The CFA-defective phenotype of cells lacking RNase E is partly reversed by overexpression of the related endoribonuclease RNase G or by mutation of the gene encoding the RNA helicase DeaD. We found that the carbon source utilization by rne deaD doubly mutant bacteria differs from that of rne+ cells and from that of cells mutated in deaD alone and that the loss of rne function in these bacteria limits conversion of the glycolytic pathway product phosphoenolpyruvate to the tricarboxylic acid (TCA) cycle intermediate oxaloacetic acid. We show that the mechanism underlying this effect is reduced production of the enzyme phosphoenolpyruvate carboxylase (PPC) and that adventitious overexpression of PPC, which facilitates phosphoenolpyruvate utilization and connects the glycolytic pathway with the TCA cycle, restored CFA to rne deaD mutant bacteria cultured on carbon sources that otherwise were unable to sustain growth. We further show that bacteria producing full-length RNase E, which allows formation of degradosomes, have nutritional requirements different from those of cells supplied with only the N-terminal catalytic region of RNase E and that mitigation of RNase E deficiency by overexpression of a related RNase, RNase G, is also affected by carbon source. Our results reveal previously unsuspected effects of RNase E deficiency and degradosome formation on nutrient utilization by E. coli cells. PMID:23275245
Gonsalves, Wilson I.; Hitosugi, Taro; Ghosh, Toshi; Jevremovic, Dragan; Petterson, Xuan-Mai; Wellik, Linda; Kumar, Shaji K.; Nair, K. Sreekumaran
2018-01-01
The production of the oncometabolite 2-hydroxyglutarate (2-HG) has been associated with c-MYC overexpression. c-MYC also regulates glutamine metabolism and drives progression of asymptomatic precursor plasma cell (PC) malignancies to symptomatic multiple myeloma (MM). However, the presence of 2-HG and its clinical significance in PC malignancies is unknown. By performing 13C stable isotope resolved metabolomics (SIRM) using U[13C6]Glucose and U[13C5]Glutamine in human myeloma cell lines (HMCLs), we show that 2-HG is produced in clonal PCs and is derived predominantly from glutamine anaplerosis into the TCA cycle. Furthermore, the 13C SIRM studies in HMCLs also demonstrate that glutamine is preferentially utilized by the TCA cycle compared with glucose. Finally, measuring the levels of 2-HG in the BM supernatant and peripheral blood plasma from patients with precursor PC malignancies such as smoldering MM (SMM) demonstrates that relatively elevated levels of 2-HG are associated with higher levels of c-MYC expression in the BM clonal PCs and with a subsequent shorter time to progression (TTP) to MM. Thus, measuring 2-HG levels in BM supernatant or peripheral blood plasma of SMM patients offers potential early identification of those patients at high risk of progression to MM, who could benefit from early therapeutic intervention. PMID:29321378
Characterization of HgCdTe and Related Materials For Third Generation Infrared Detectors
NASA Astrophysics Data System (ADS)
Vaghayenegar, Majid
Hg1-xCdxTe (MCT) has historically been the primary material used for infrared detectors. Recently, alternative substrates for MCT growth such as Si, as well as alternative infrared materials such as Hg1-xCdxSe, have been explored. This dissertation involves characterization of Hg-based infrared materials for third generation infrared detectors using a wide range of transmission electron microscopy (TEM) techniques. A microstructural study on HgCdTe/CdTe heterostructures grown by MBE on Si (211) substrates showed a thin ZnTe layer grown between CdTe and Si to mediate the large lattice mismatch of 19.5%. Observations showed large dislocation densities at the CdTe/ZnTe/Si (211) interfaces, which dropped off rapidly away from the interface. Growth of a thin HgTe buffer layer between HgCdTe and CdTe layers seemed to improve the HgCdTe layer quality by blocking some defects. A second study investigated the correlation of etch pits and dislocations in as-grown and thermal-cycle-annealed (TCA) HgCdTe (211) films. For as-grown samples, pits with triangular and fish-eye shapes were associated with Frank partial and perfect dislocations, respectively. Skew pits were determined to have a more complex nature. TCA reduced the etch-pit density by 72%. Although TCA processing eliminated the fish-eye pits, dislocations reappeared in shorter segments in the TCA samples. Large pits were observed in both as-grown and TCA samples, but the nature of any defects associated with these pits in the as-grown samples is unclear. Microstructural studies of HgCdSe revealed large dislocation density at ZnTe/Si(211) interfaces, which dropped off markedly with ZnTe thickness. Atomic-resolution STEM images showed that the large lattice mismatch at the ZnTe/Si interface was accommodated through {111}-type stacking faults. A detailed analysis showed that the stacking faults were inclined at angles of 19.5 and 90 degrees at both ZnTe/Si and HgCdSe/ZnTe interfaces. These stacking faults were associated with Shockley and Frank partial dislocations, respectively. Initial attempts to delineate individual dislocations by chemical etching revealed that while the etchants successfully attacked defective areas, many defects in close proximity to the pits were unaffected.
Nitzsche, Richard; Zagoriy, Vyacheslav; Lucius, Richard; Gupta, Nishith
2016-01-01
Toxoplasma gondii is a widespread protozoan parasite infecting nearly all warm-blooded organisms. Asexual reproduction of the parasite within its host cells is achieved by consecutive lytic cycles, which necessitates biogenesis of significant energy and biomass. Here we show that glucose and glutamine are the two major physiologically important nutrients used for the synthesis of macromolecules (ATP, nucleic acid, proteins, and lipids) in T. gondii, and either of them is sufficient to ensure the parasite survival. The parasite can counteract genetic ablation of its glucose transporter by increasing the flux of glutamine-derived carbon through the tricarboxylic acid cycle and by concurrently activating gluconeogenesis, which guarantee a continued biogenesis of ATP and biomass for host-cell invasion and parasite replication, respectively. In accord, a pharmacological inhibition of glutaminolysis or oxidative phosphorylation arrests the lytic cycle of the glycolysis-deficient mutant, which is primarily a consequence of impaired invasion due to depletion of ATP. Unexpectedly, however, intracellular parasites continue to proliferate, albeit slower, notwithstanding a simultaneous deprivation of glucose and glutamine. A growth defect in the glycolysis-impaired mutant is caused by a compromised synthesis of lipids, which cannot be counterbalanced by glutamine but can be restored by acetate. Consistently, supplementation of parasite cultures with exogenous acetate can amend the lytic cycle of the glucose transport mutant. Such plasticity in the parasite's carbon flux enables a growth-and-survival trade-off in assorted nutrient milieus, which may underlie the promiscuous survival of T. gondii tachyzoites in diverse host cells. Our results also indicate a convergence of parasite metabolism with cancer cells. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Nitzsche, Richard; Zagoriy, Vyacheslav; Lucius, Richard; Gupta, Nishith
2016-01-01
Toxoplasma gondii is a widespread protozoan parasite infecting nearly all warm-blooded organisms. Asexual reproduction of the parasite within its host cells is achieved by consecutive lytic cycles, which necessitates biogenesis of significant energy and biomass. Here we show that glucose and glutamine are the two major physiologically important nutrients used for the synthesis of macromolecules (ATP, nucleic acid, proteins, and lipids) in T. gondii, and either of them is sufficient to ensure the parasite survival. The parasite can counteract genetic ablation of its glucose transporter by increasing the flux of glutamine-derived carbon through the tricarboxylic acid cycle and by concurrently activating gluconeogenesis, which guarantee a continued biogenesis of ATP and biomass for host-cell invasion and parasite replication, respectively. In accord, a pharmacological inhibition of glutaminolysis or oxidative phosphorylation arrests the lytic cycle of the glycolysis-deficient mutant, which is primarily a consequence of impaired invasion due to depletion of ATP. Unexpectedly, however, intracellular parasites continue to proliferate, albeit slower, notwithstanding a simultaneous deprivation of glucose and glutamine. A growth defect in the glycolysis-impaired mutant is caused by a compromised synthesis of lipids, which cannot be counterbalanced by glutamine but can be restored by acetate. Consistently, supplementation of parasite cultures with exogenous acetate can amend the lytic cycle of the glucose transport mutant. Such plasticity in the parasite's carbon flux enables a growth-and-survival trade-off in assorted nutrient milieus, which may underlie the promiscuous survival of T. gondii tachyzoites in diverse host cells. Our results also indicate a convergence of parasite metabolism with cancer cells. PMID:26518878
Muskens, Ivo S; Briceno, Vanessa; Ouwehand, Tom L; Castlen, Joseph P; Gormley, William B; Aglio, Linda S; Zamanipoor Najafabadi, Amir H; van Furth, Wouter R; Smith, Timothy R; Mekary, Rania A; Broekman, Marike L D
2018-01-01
In the past decade, the endonasal transsphenoidal approach (eTSA) has become an alternative to the microsurgical transcranial approach (mTCA) for tuberculum sellae meningiomas (TSMs) and olfactory groove meningiomas (OGMs). The aim of this meta-analysis was to evaluate which approach offered the best surgical outcomes. A systematic review of the literature from 2004 and meta-analysis were conducted in accordance with the PRISMA guidelines. Pooled incidence was calculated for gross total resection (GTR), visual improvement, cerebrospinal fluid (CSF) leak, intraoperative arterial injury, and mortality, comparing eTSA and mTCA, with p-interaction values. Of 1684 studies, 64 case series were included in the meta-analysis. Using the fixed-effects model, the GTR rate was significantly higher among mTCA patients for OGM (eTSA: 70.9% vs. mTCA: 88.5%, p-interaction < 0.01), but not significantly higher for TSM (eTSA: 83.0% vs. mTCA: 85.8%, p-interaction = 0.34). Despite considerable heterogeneity, visual improvement was higher for eTSA than mTCA for TSM (p-interaction < 0.01), but not for OGM (p-interaction = 0.33). CSF leak was significantly higher among eTSA patients for both OGM (eTSA: 25.1% vs. mTCA: 10.5%, p-interaction < 0.01) and TSM (eTSA: 19.3%, vs. mTCA: 5.81%, p-interaction < 0.01). Intraoperative arterial injury was higher among eTSA (4.89%) than mTCA patients (1.86%) for TSM (p-interaction = 0.03), but not for OGM resection (p-interaction = 0.10). Mortality was not significantly different between eTSA and mTCA patients for both TSM (p-interaction = 0.14) and OGM resection (p-interaction = 0.88). Random-effect models yielded similar results. In this meta-analysis, eTSA was not shown to be superior to mTCA for resection of both OGMs and TSMs.
The reductive degradation of 1,1,1-trichloroethane by Fe(0) in a soil slurry system.
Wu, Xiaoliang; Lu, Shuguang; Qiu, Zhaofu; Sui, Qian; Lin, Kuangfei; Du, Xiaoming; Luo, Qishi
2014-01-01
Most studies on the treatment of chlorinated contaminants by Fe(0) focus on aqueous system tests. However, few is known about the effectiveness of these tests for degrading chlorinated contaminants such as 1,1,1-trichloroethane (TCA) in soil. In this work, the reductive degradation performance of 1,1,1-TCA by Fe(0) was thoroughly investigated in a soil slurry system. The effects of various factors including acid-washed iron, the initial 1,1,1-TCA concentration, Fe(0) dosage, slurry pH, and common constituents in groundwater and soil such as Cl(-), HCO3 (-), SO4 (2-), and NO3 (-) anions and humic acid (HA) were evaluated. The experimental results showed that 1,1,1-TCA could be effectively degraded in 12 h for an initial Fe(0) dosage of 10 g L(-1) and a soil/water mass ratio of 1:5. The soil slurry experiments showed two-stage degradation kinetics: a slow reaction in the first stage and a fast reductive degradation of 1,1,1-TCA in the second stage. The reductive degradation of 1,1,1-TCA was expedited as the mass concentration of Fe(0) increased. In addition, high pHs adversely affected the degradation of 1,1,1-TCA over a pH range of 5.4-8.0 and the reductive degradation efficiency decreased with increasing slurry pH. The initial 1,1,1-TCA concentration and the presence of Cl(-) and SO4(2-) anions had negligible effects. HCO3(-) anions had a accelerative effect on 1,1,1-TCA removal, and both NO3(-) and HA had inhibitory effects. A Cl(-) mass balance showed that the amount of Cl(-) ions released into the soil slurry system during the 1,1,1-TCA degradation increased with increasing reaction time, suggesting that the main degradation mechanism of 1,1,1-TCA by Fe(0) in a soil slurry system was reductive dechlorination with 1,1-DCA as the main intermediate. In conclusion, this study provides a theoretical basis for the practical application of the remediation of contaminated sites containing chlorinated solvent.
Bringaud, F; Ebikeme, C; Boshart, M
2010-08-01
Parasites that often grow anaerobically in their hosts have adopted a fermentative strategy relying on the production of partially oxidized end products, including lactate, glycerol, ethanol, succinate and acetate. This review focuses on recent progress in understanding acetate production in protist parasites, such as amoebae, diplomonads, trichomonads, trypanosomatids and in the metazoan parasites helminths, as well as the succinate production pathway(s) present in some of them. We also describe the unconventional organisation of the tricarboxylic acid cycle associated with the fermentative strategy adopted by the procyclic trypanosomes, which may resemble the probable structure of the primordial TCA cycle in prokaryotes.
ERIC Educational Resources Information Center
Arinze, Ifeanyi J.
2005-01-01
Some metabolic processes such as glycolysis, gluconeogenesis, and lipogenesis are readily understood because they are circumscribed in metabolic pathways that have clearly identifiable beginning points, end products, and other features. Other metabolic pathways that do not appear to be straightforward pose difficulties for students. In part I of…
Abdel Meguid, Azza Mahfouz; Elaziz Ahmed Attallah, Dalia Abd; Omar, Howida
2015-12-01
Treatment options for acne include chemical peeling. Trichloroacetic acid (TCA) has been used for treating acne. The ability of TCA to diminish corneocyte cohesion and keratinocyte plugging addresses this mode of treatment. Salicylic acid is an excellent keratolytic agent. It is believed to function through solubilization of intercellular cement, thereby reducing corneocyte adhesion. Comparing the therapeutic efficacy of TCA 25% peels with those of salicylic acid 30% in patients with acne vulgaris. Twenty patients, Fitzpatrick skin Types III to V with facial acne, were enrolled. Twenty-five percent of TCA was applied to the right half of the face and 30% salicylic acid to the left half at 2-week interval for 2 months. Total improvement was more frequent with salicylic acid peeling (95%) versus (85%) with TCA. Total comedones improvement was more frequent with TCA peeling (80%) versus (70%) with salicylic acid. Improvement of inflammatory lesions was more frequent among the side treated with salicylic acid (85%) versus (80%) with TCA peeling. However, the results did not reach the statistical significance level. Trichloroacetic acid is more superior in treating comedonal lesions, whereas salicylic is more superior in treating inflammatory lesions, without significant different between their results.
Papinutto, N.; Schlaeger, R.; Panara, V.; Caverzasi, E.; Ahn, S.; Johnson, K.J.; Zhu, A.H.; Stern, W.A.; Laub, G.; Hauser, S.L.; Henry, R.G.
2018-01-01
PURPOSE In-vivo assessment of spinal cord gray matter (GM) and white matter (WM) could become pivotal to study various neurological diseases, but it is challenging because of insufficient GM/WM contrast provided by conventional MRI. Here we present and assess a procedure for measurement of spinal cord total cross-sectional area (TCA) and GM areas based on phase sensitive inversion recovery imaging (PSIR). MATERIALS AND METHODS We acquired 2D PSIR images at 3T at each disc level of the spinal axis on 10 healthy subjects and measured TCA, cord diameters, WM and GM area, and GM area/TCA ratio. We secondly investigated 32 healthy subjects at 4 selected levels (C2–C3, C3–C4, T8–T9, T9–T10, total acquisition time <8 minutes) and generated normative reference values of TCA and GM areas. We assessed test-retest, intra- and inter-operator reliability of the acquisition strategy and measurement steps. RESULTS The measurement procedure based on 2D PSIR imaging allowed TCA and GM area assessments along the entire spinal cord axis. The tests we performed revealed high test-retest/intra-operator reliability (mean coefficient of variation (COV) at C2–C3: TCA=0.41%, GM area=2.75%) and inter-operator reliability of the measurements (mean COV on the 4 levels: TCA=0.44%, GM area= 4.20%; mean intra-class correlation coefficient: TCA=0.998, GM area=0.906). CONCLUSION 2D PSIR allows reliable in-vivo assessment of spinal cord TCA, GM and WM areas in clinically feasible acquisition times. The area measurements presented here are in agreement with previous MRI and post-mortem studies. PMID:25483607
Wen, Li-Lian; Chen, Jia-Xian; Fang, Jia-Yi; Li, Ang; Zhao, He-Ping
2017-01-01
Chlorinated compounds were generally present in the environment due to widespread use in the industry. A short-term study was performed to evaluate the effects of 1,1,1- trichloroethane (TCA) and triclocarban (TCC) on trichloroethene (TCE) removal in a reactor fed with lactate as the sole electron donor. Both TCA and TCC inhibited TCE reduction, but the TCC had a more pronounced effect compared to TCA. The TCE-reducing culture, which had never been exposed to TCA before, reductively dechlorinated TCA to 1,1-dichloroethane (DCA). Below 15 μM, TCA had little effect on the transformation of TCE to cis -dichloroethene (DCE); however, the reduction of cis -DCE and vinyl chloride (VC) were more sensitive to TCA, and ethene production was completely inhibited when the concentration of TCA was above 15 μM. In cultures amended with TCC, the reduction of TCE was severely affected, even at concentrations as low as 0.3 μM; all the cultures stalled at VC, and no ethene was detected. The cultures that fully transformed TCE to ethene contained 5.2-8.1% Dehalococcoides . Geobacter and Desulfovibrio , the bacteria capable of partially reducing TCE to DCE, were detected in all cultures, but both represented a larger proportion of the community in TCC-amended cultures. All cultures were dominated by Clostridium _sensu_stricto_7, a genus that belongs to Firmicutes with proportions ranging from 40.9% (in a high TCC (15 μM) culture) to 88.2%. Methanobacteria was detected at levels of 1.1-12.7%, except in cultures added with 15 and 30 μM TCA, in which they only accounted for ∼0.4%. This study implies further environmental factors needed to be considered in the successful bioremediation of TCE in contaminated sites.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tabita, F. Robert
2008-12-04
During the past years of this project we have made progress relative to the two major goals of the proposal: (1) to study the biochemistry and regulation of the reductive TCA cycle of CO 2 fixation and (2) to probe the physiological role of a RubisCO-like protein (RLP). Both studies primarily employ the green sulfur bacterium Chlorobium tepidum as well as other photosynthetic bacteria including Rhodospirillum rubrum and Rhodopseudomonas palustris.
Synthesis of the 1-Monoester of 2-Ketoalkanedioic Acids, e.g., Octyl α-Ketoglutarate
Jung, Michael E.; Deng, Gang
2012-01-01
Oxidative cleavage of cycloalkene-1-carboxylates, made from the corresponding carboxylic acids, and subsequent oxidation of the resulting ketoaldehyde afforded the important 1-monoesters of 2-ketoalkanedioic acids. Thus ozonolysis of octyl cyclobutene-1-carboxylate followed by sodium chlorite oxidation afforded the 1-monooctyl 2-ketoglutarate. This is a cell-permeable prodrug form of α-ketoglutarate, an important intermediate in the tricarboxylic acid (TCA, Krebs) cycle and a promising therapeutic agent in its own right. PMID:23163977
The Role of Mitochondrial TCA Cycle Enzymes in Determining Prostate Cancer Chemosensitivity
2014-03-01
phosphorylation, Nat Rev Genet 2, 342-352. 17. Higgins , L. H., Withers, H. G., Garbens, A., Love, H. D., Magnoni, L., Hayward, S. W., and Moyes, C. D. (2009...MalateDehydrogenase 2ConfersDocetaxel Resistancevia Regulations of JNKSignaling andOxidativeMetabolism Qiong Liu, Chris T. Harvey, Hao Geng, Changhui...1036 Liuet al. The Prostate 40. Higgins LH, Withers HG, Garbens A, Love HD, Magnoni L, Hayward SW, Moyes CD. Hypoxia and the metabolic pheno- type of
MacGregor, Barbara J; Biddle, Jennifer F; Harbort, Christopher; Matthysse, Ann G; Teske, Andreas
2013-09-01
A near-complete draft genome has been obtained for a single vacuolated orange Beggiatoa (Cand. Maribeggiatoa) filament from a Guaymas Basin seafloor microbial mat, the third relatively complete sequence for the Beggiatoaceae. Possible pathways for sulfide oxidation; nitrate respiration; inorganic carbon fixation by both Type II RuBisCO and the reductive tricarboxylic acid cycle; acetate and possibly formate uptake; and energy-generating electron transport via both oxidative phosphorylation and the Rnf complex are discussed here. A role in nitrite reduction is suggested for an abundant orange cytochrome produced by the Guaymas strain; this has a possible homolog in Beggiatoa (Cand. Isobeggiatoa) sp. PS, isolated from marine harbor sediment, but not Beggiatoa alba B18LD, isolated from a freshwater rice field ditch. Inferred phylogenies for the Calvin-Benson-Bassham (CBB) cycle and the reductive (rTCA) and oxidative (TCA) tricarboxylic acid cycles suggest that genes encoding succinate dehydrogenase and enzymes for carboxylation and/or decarboxylation steps (including RuBisCO) may have been introduced to (or exported from) one or more of the three genomes by horizontal transfer, sometimes by different routes. Sequences from the two marine strains are generally more similar to each other than to sequences from the freshwater strain, except in the case of RuBisCO: only the Guaymas strain encodes a Type II enzyme, which (where studied) discriminates less against oxygen than do Type I RuBisCOs. Genes subject to horizontal transfer may represent key steps for adaptation to factors such as oxygen and carbon dioxide concentration, organic carbon availability, and environmental variability. © 2013.
Green, Laura S.; Li, Youzhong; Emerich, David W.; Bergersen, Fraser J.; Day, David A.
2000-01-01
A complete tricarboxylic acid (TCA) cycle is generally considered necessary for energy production from the dicarboxylic acid substrates malate, succinate, and fumarate. However, a Bradyrhizobium japonicum sucA mutant that is missing α-ketoglutarate dehydrogenase is able to grow on malate as its sole source of carbon. This mutant also fixes nitrogen in symbiosis with soybean, where dicarboxylic acids are its principal carbon substrate. Using a flow chamber system to make direct measurements of oxygen consumption and ammonium excretion, we confirmed that bacteroids formed by the sucA mutant displayed wild-type rates of respiration and nitrogen fixation. Despite the absence of α-ketoglutarate dehydrogenase activity, whole cells of the mutant were able to decarboxylate α-[U-14C]ketoglutarate and [U-14C]glutamate at rates similar to those of wild-type B. japonicum, indicating that there was an alternative route for α-ketoglutarate catabolism. Because cell extracts from B. japonicum decarboxylated [U-14C]glutamate very slowly, the γ-aminobutyrate shunt is unlikely to be the pathway responsible for α-ketoglutarate catabolism in the mutant. In contrast, cell extracts from both the wild type and mutant showed a coenzyme A (CoA)-independent α-ketoglutarate decarboxylation activity. This activity was independent of pyridine nucleotides and was stimulated by thiamine PPi. Thin-layer chromatography showed that the product of α-ketoglutarate decarboxylation was succinic semialdehyde. The CoA-independent α-ketoglutarate decarboxylase, along with succinate semialdehyde dehydrogenase, may form an alternative pathway for α-ketoglutarate catabolism, and this pathway may enhance TCA cycle function during symbiotic nitrogen fixation. PMID:10781553
Durieux, P O; Schütz, P; Brun, R; Köhler, P
1991-03-01
A rapid switch from a fermentative to a primarily oxidative type of glucose utilization was observed during in vitro differentiation of Trypanosoma brucei STIB348 and EATRO1244 bloodstream to procyclic trypomastigotes. In accordance with previously published reports bloodstream populations produced pyruvate as the major end product of glucose catabolism, together with very small amounts of CO2, succinate and glycerol. During differentiation pyruvate excretion decreased within 48 h to the low levels produced by 28-day procyclic stages. Concomitant with the decline in pyruvate formation, acetate appeared as a new product and the rates of respiratory CO2 increased considerably. The amount of carbon released with these compounds could account for nearly all of the glucose carbon consumed. Rates of glucose utilization and formation of acetate and CO2 in cells differentiated for 48 h were essentially the same as those found in 28-day procyclics. Succinate and glycerol excretion remained low during the entire transformation process, and no significant difference in the pattern and quantities of end products were found between the two trypanosome strains. During trypanosome differentiation the changes in metabolism were associated with marked alterations in enzyme activity levels. Activities of the tricarboxylic acid (TCA) cycle enzymes citrate synthase, isocitrate dehydrogenase (NAD+), succinate dehydrogenase and fumarase were not detectable in bloodstream trypomastigotes but appeared upon differentiation for 24 h. An exception was citrate synthase whose activity was not demonstrable until 48 h postinoculation into culture. After 48 h the majority of the TCA cycle enzyme activities continued to increase steadily until day 28. Pyruvate kinase activity decreased in differentiating cells after 48 h to about 25% of the level found in bloodstream trypomastigotes.(ABSTRACT TRUNCATED AT 250 WORDS)
Sugden, M C; Lall, H S; Harris, R A; Holness, M J
2000-11-01
The pyruvate dehydrogenase kinases (PDK1-4) regulate glucose oxidation through inhibitory phosphorylation of the pyruvate dehydrogenase complex (PDC). Immunoblot analysis with antibodies raised against recombinant PDK isoforms demonstrated changes in PDK isoform expression in response to experimental hyperthyroidism (100 microg/100 g body weight; 3 days) that was selective for fast-twitch vs slow-twitch skeletal muscle in that PDK2 expression was increased in the fast-twitch skeletal muscle (the anterior tibialis) (by 1. 6-fold; P<0.05) but not in the slow-twitch muscle (the soleus). PDK4 protein expression was increased by experimental hyperthyroidism in both muscle types, there being a greater response in the anterior tibialis (4.2-fold increase; P<0.05) than in the soleus (3.2-fold increase; P<0.05). The hyperthyroidism-associated up-regulation of PDK4 expression was observed in conjunction with suppression of skeletal-muscle PDC activity, but not suppression of glucose uptake/phosphorylation, as measured in vivo in conscious unrestrained rats (using the 2-[(3)H]deoxyglucose technique). We propose that increased PDK isoform expression contributes to the pathology of hyperthyroidism and to PDC inactivation by facilitating the operation of the glucose --> lactate --> glucose (Cori) and glucose --> alanine --> glucose cycles. We also propose that enhanced relative expression of the pyruvate-insensitive PDK isoform (PDK4) in skeletal muscle in hyperthyroidism uncouples glycolytic flux from pyruvate oxidation, sparing pyruvate for non-oxidative entry into the tricarboxylic acid (TCA) cycle, and thereby supporting entry of acetyl-CoA (derived from fatty acid oxidation) into the TCA cycle.
The Role of TCA Cycle Anaplerosis in Ketosis and Fatty Liver in Periparturient Dairy Cows
White, Heather M.
2015-01-01
The transition to lactation period in dairy cattle is characterized by metabolic challenges, negative energy balance, and adipose tissue mobilization. Metabolism of mobilized adipose tissue is part of the adaptive response to negative energy balance in dairy cattle; however, the capacity of the liver to completely oxidize nonesterified fatty acids may be limited and is reflective of oxaloacetate pool, the carbon carrier of the tricarboxylic acid cycle. Alternative metabolic fates of acetyl-CoA from nonesterified fatty acids include esterification to triacylglycerides and ketogenesis, and when excessive, these pathways lead to fatty liver and ketosis. Examination of the anaplerotic and cataplerotic pull of oxaloacetate by the tricarboxylic acid cycle and gluconeogenesis may provide insight into the balance of oxidation and esterification of acetyl-CoA within the liver of periparturient dairy cows. PMID:26479386
The Role of TCA Cycle Anaplerosis in Ketosis and Fatty Liver in Periparturient Dairy Cows.
White, Heather M
2015-08-18
The transition to lactation period in dairy cattle is characterized by metabolic challenges, negative energy balance, and adipose tissue mobilization. Metabolism of mobilized adipose tissue is part of the adaptive response to negative energy balance in dairy cattle; however, the capacity of the liver to completely oxidize nonesterified fatty acids may be limited and is reflective of oxaloacetate pool, the carbon carrier of the tricarboxylic acid cycle. Alternative metabolic fates of acetyl-CoA from nonesterified fatty acids include esterification to triacylglycerides and ketogenesis, and when excessive, these pathways lead to fatty liver and ketosis. Examination of the anaplerotic and cataplerotic pull of oxaloacetate by the tricarboxylic acid cycle and gluconeogenesis may provide insight into the balance of oxidation and esterification of acetyl-CoA within the liver of periparturient dairy cows.
Transcriptional response to petiole heat girdling in cassava.
Zhang, Yang; Ding, Zehong; Ma, Fangfang; Chauhan, Raj Deepika; Allen, Doug K; Brutnell, Thomas P; Wang, Wenquan; Peng, Ming; Li, Pinghua
2015-02-12
To examine the interactions of starch and sugar metabolism on photosynthesis in cassava, a heat-girdling treatment was applied to petioles of cassava leaves at the end of the light cycle to inhibit starch remobilization during the night. The inhibition of starch remobilization caused significant starch accumulation at the beginning of the light cycle, inhibited photosynthesis, and affected intracellular sugar levels. RNA-seq analysis of heat-treated and control plants revealed significantly decreased expression of genes related to photosynthesis, as well as N-metabolism and chlorophyll biosynthesis. However, expression of genes encoding TCA cycle enzymes and mitochondria electron transport components, and flavonoid biosynthetic pathway enzymes were induced. These studies reveal a dynamic transcriptional response to perturbation of sink demand in a single leaf, and provide useful information for understanding the regulations of cassava under sink or source limitation.
Transcriptional response to petiole heat girdling in cassava
Zhang, Yang; Ding, Zehong; Ma, Fangfang; Chauhan, Raj Deepika; Allen, Doug K.; Brutnell, Thomas P.; Wang, Wenquan; Peng, Ming; Li, Pinghua
2015-01-01
To examine the interactions of starch and sugar metabolism on photosynthesis in cassava, a heat-girdling treatment was applied to petioles of cassava leaves at the end of the light cycle to inhibit starch remobilization during the night. The inhibition of starch remobilization caused significant starch accumulation at the beginning of the light cycle, inhibited photosynthesis, and affected intracellular sugar levels. RNA-seq analysis of heat-treated and control plants revealed significantly decreased expression of genes related to photosynthesis, as well as N-metabolism and chlorophyll biosynthesis. However, expression of genes encoding TCA cycle enzymes and mitochondria electron transport components, and flavonoid biosynthetic pathway enzymes were induced. These studies reveal a dynamic transcriptional response to perturbation of sink demand in a single leaf, and provide useful information for understanding the regulations of cassava under sink or source limitation. PMID:25672661
Trichloroacetic acid in the environment.
McCulloch, A
2002-05-01
Suppositions that the trichloroacetic acid (TCA, CCl3C(O)OH) found in nature was a consequence solely of the use of chlorinated hydrocarbon solvents prompted this critical review of the literature on its environmental fluxes and occurrences. TCA is widely distributed in forest soils (where it was rarely used as an herbicide) and measurements suggest a soil flux of 160 000 tonnes yr(-1) in European forests alone. TCA is also produced during oxidative water treatment and the global flux could amount to 55 000 tonnes yr(-1) (from pulp and paper manufacture, potable water and cooling water treatments). By contrast, the yields of TCA from chlorinated hydrocarbon solvents are small: from tetrachloroethene 13 600 tonnes yr(-1) and from 1,1,1-trichloroethane 4300 tonnes yr(-1) on a global basis, at the atmospheric burdens and removal rates typical of the late 1990s. TCA is ubiquitous in rainwater and snow. Its concentrations are highly variable and the variations cannot be connected with location or date. However, there is no significant difference between the concentrations found in Chile and in eastern Canada (by the same analysts), or between Malawi and western Canada, or between Antarctica and Switzerland, nor any significant difference globally between the concentrations in cloud, rain and snow (although local enhancement in fog water has been shown). TCA is present in old ice and firn. At the deepest levels, the firn was deposited early in the 19th century, well before the possibility of contamination by industrial production of reactive chlorine, implying a non-industrial background. This proposition is supported by plume measurements from pulp mills in Finland. TCA is ubiquitous in soils; concentrations are very variable but there are some indications that soils under coniferous trees contain higher amounts. The concentrations of TCA found in plant tissue are region-specific and may also be plant-specific, to the extent that conifers seem to contain more than other species. TCA is removed from the environment naturally. There is abundant evidence that soil microorganisms dehalogenate TCA and it is lost from within spruce needles with a half-life of 10 days. There is also recent evidence of an abiotic aqueous decarboxylation mechanism with a half-life of 22 days. The supposedly widespread effects of TCA in conifer needles are not shown in controlled experiments. At concentrations in the needles of Scots pine similar to those observed in needles in forest trees, changes consequent on TCA treatment of field laboratory specimens were almost all insignificant.
Greseth, Matthew D.; Traktman, Paula
2014-01-01
The poxvirus life cycle, although physically autonomous from the host nucleus, is nevertheless dependent upon cellular functions. A requirement for de novo fatty acid biosynthesis was implied by our previous demonstration that cerulenin, a fatty acid synthase inhibitor, impaired vaccinia virus production. Here we show that additional inhibitors of this pathway, TOFA and C75, reduce viral yield significantly, with partial rescue provided by exogenous palmitate, the pathway's end-product. Palmitate's major role during infection is not for phospholipid synthesis or protein palmitoylation. Instead, the mitochondrial import and β-oxidation of palmitate are essential, as shown by the impact of etomoxir and trimetazidine, which target these two processes respectively. Moreover, the impact of these inhibitors is exacerbated in the absence of exogenous glucose, which is otherwise dispensable for infection. In contrast to glucose, glutamine is essential for productive viral infection, providing intermediates that sustain the TCA cycle (anaplerosis). Cumulatively, these data suggest that productive infection requires the mitochondrial β-oxidation of palmitate which drives the TCA cycle and energy production. Additionally, infection causes a significant rise in the cellular oxygen consumption rate (ATP synthesis) that is ablated by etomoxir. The biochemical progression of the vaccinia life cycle is not impaired in the presence of TOFA, C75, or etomoxir, although the levels of viral DNA and proteins synthesized are somewhat diminished. However, by reversibly arresting infections at the onset of morphogenesis, and then monitoring virus production after release of the block, we determined that virion assembly is highly sensitive to TOFA and C75. Electron microscopic analysis of cells released into C75 revealed fragmented aggregates of viroplasm which failed to be enclosed by developing virion membranes. Taken together, these data indicate that vaccinia infection, and in particular virion assembly, relies on the synthesis and mitochondrial import of fatty acids, where their β-oxidation drives robust ATP production. PMID:24651651
Greseth, Matthew D; Traktman, Paula
2014-03-01
The poxvirus life cycle, although physically autonomous from the host nucleus, is nevertheless dependent upon cellular functions. A requirement for de novo fatty acid biosynthesis was implied by our previous demonstration that cerulenin, a fatty acid synthase inhibitor, impaired vaccinia virus production. Here we show that additional inhibitors of this pathway, TOFA and C75, reduce viral yield significantly, with partial rescue provided by exogenous palmitate, the pathway's end-product. Palmitate's major role during infection is not for phospholipid synthesis or protein palmitoylation. Instead, the mitochondrial import and β-oxidation of palmitate are essential, as shown by the impact of etomoxir and trimetazidine, which target these two processes respectively. Moreover, the impact of these inhibitors is exacerbated in the absence of exogenous glucose, which is otherwise dispensable for infection. In contrast to glucose, glutamine is essential for productive viral infection, providing intermediates that sustain the TCA cycle (anaplerosis). Cumulatively, these data suggest that productive infection requires the mitochondrial β-oxidation of palmitate which drives the TCA cycle and energy production. Additionally, infection causes a significant rise in the cellular oxygen consumption rate (ATP synthesis) that is ablated by etomoxir. The biochemical progression of the vaccinia life cycle is not impaired in the presence of TOFA, C75, or etomoxir, although the levels of viral DNA and proteins synthesized are somewhat diminished. However, by reversibly arresting infections at the onset of morphogenesis, and then monitoring virus production after release of the block, we determined that virion assembly is highly sensitive to TOFA and C75. Electron microscopic analysis of cells released into C75 revealed fragmented aggregates of viroplasm which failed to be enclosed by developing virion membranes. Taken together, these data indicate that vaccinia infection, and in particular virion assembly, relies on the synthesis and mitochondrial import of fatty acids, where their β-oxidation drives robust ATP production.
2013-08-01
CCT G-30; KLK2 F: 50- TGG CTG TGT ACA GTC ATG GA-30; KLK2 R: 50- CCT GTG TCT TCA GGC TCA AA-30; TMPRSS2 F: 50-AGG TGC ATC CGG CTC AGT A-30; TMPRSS2 R...50-GGG TCA AGG TGA TGC ACA GT-30; PCDH11 F: 50-GCG TTT CTG ACT GTG GCT ATC-30; PCDH11 R: 50-GGA AGG GGA ATG GAA TTT TG-30; UGT2B15 F: 50-TCA AATc-Jun...GAPDH F: 50-CTG ACT TCA ACA GCG ACA CC-30; GAPDH R: 50-CCC TGT TGC TGT AGC CAA AT-30; AR F: 50- GTG GAA GCT GCA AGG TCT TC-30; AR R 50-CGA AGA CGA
Qi, Fei; Xu, Bingbing; Chen, Zhonglin; Ma, Jun; Sun, Dezhi; Zhang, Liqiu; Wu, Fengchang
2009-08-30
A kind of inexpensive and environmental friendly mineral, the raw bauxite has been used successfully as a catalyst combined with ozonation in the degradation of 2,4,6-trichloroanisole (TCA). The catalyst was characterized by using various analytical techniques. X-ray powder diffraction (XRD) characterization showed that the raw bauxite containing boehmite (gamma-AlOOH), kaolinite (Al(2)Si(2)O(5)(OH)(4)) and quartz (SiO(2)), and gamma-AlOOH was the major composition. The catalytic ozonation removal effectiveness of TCA was investigated under various physicochemical conditions. Both the adsorption and the single ozonation were not effective for the degradation of TCA, and the presence of the raw bauxite in ozonation enhanced the TCA removal effectiveness. Both the hydroxyl radicals (OH) scavenging experiment and R(ct) characterization confirmed that the generation of OH was accounted for the enhancement of the degradation of TCA. The generation of OH was inhibited faintly by the presence of both natural organic matters (NOMs) and alkalinity in the natural water during catalyzed ozonation with the raw bauxite. The increasing of both the bauxite dosage and the ozone dosage enhanced the removal effectiveness of TCA. The raw bauxite was an efficient green catalyst for TCA degradation in drinking water.
A novel rapid access testicular cancer clinic: prospective evaluation after one year.
Carey, K; Davis, N F; Elamin, S; Ahern, P; Brady, C M; Sweeney, P
2016-02-01
Our institution has recently developed a rapid access outpatient clinic to investigate men with testicular lumps and/or pain suspicious for testicular cancer (TCa). To present our experience after 12 months. All referrals to the rapid access testicular clinic (RATC) clinic were prospectively analysed from 01/01/2013 to 01/01/2014. The primary outcome variable was incidence of TCa in the referred patient cohort. Secondary outcome variables were waiting times prior to clinical review and waiting times prior to radical orchidectomy in patients diagnosed with TCa. Seventy-four new patients were referred to the RATC during the 1-year period and the mean age was 34 (range 15-81 years). TCa was the most common diagnosis and was found in 18 (25 %) patients. Patients diagnosed with TCa underwent radical orchidectomy, a median of 3 (range 1-5) days after their initial GP referral. Patients requiring surgical intervention for benign scrotal pathology underwent their procedure a median of 32 (range 3-61) days after their initial referral. Of the 18 patients diagnosed with TCa, 9 (50 %) were diagnosed with a seminomatous germ cell tumour on histopathology. The RATC is a new initiative in Ireland that provides expedient and definitive treatment of patients with newly diagnosed TCa. Early treatment will ultimately improve long-term prognosis in this patient cohort.
The metabolism of galactose in the human gastric mucous membrane.
Kopacz-Jodczyk, T; Zwierz, K; Gałasiński, W
1984-12-01
After incubating pieces of human gastric mucous membrane with radioactive galactose, labeled metabolites of glycolysis (FDP,PEP,pyruvate):hexose and hexosamine intermediates in glycoconjugate biosynthesis (gal-1P, UDP-gal,acetylated hexosamines, and their phosphate esters), amino acids (glycine, alanine, and serine), and oxoglutarate as a metabolite of the citric acid cycle were isolated from the acid-soluble fraction. These results suggest that galactose in the human gastric mucous membrane is epimerized to glucose and metabolized in the glycolytic pathway together with oxidation in the citric acid cycle and in the direction of glycoconjugate biosynthesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Heart, Emma; Palo, Meridith; Womack, Trayce
Pancreatic β-cells release insulin in response to elevation of glucose from basal (4–7 mM) to stimulatory (8–16 mM) levels. Metabolism of glucose by the β-cell results in the production of low levels of reactive oxygen intermediates (ROI), such as hydrogen peroxide (H{sub 2}O{sub 2}), a newly recognized coupling factor linking glucose metabolism to insulin secretion. However, high and toxic levels of H{sub 2}O{sub 2} inhibit insulin secretion. Menadione, which produces H{sub 2}O{sub 2} via redox cycling mechanism in a dose-dependent manner, was investigated for its effect on β-cell metabolism and insulin secretion in INS-1 832/13, a rat β-cell insulinoma cellmore » line, and primary rodent islets. Menadione-dependent redox cycling and resulting H{sub 2}O{sub 2} production under stimulatory glucose exceeded several-fold those reached at basal glucose. This was paralleled by a differential effect of menadione (0.1–10 μM) on insulin secretion, which was enhanced at basal, but inhibited at stimulatory glucose. Redox cycling of menadione and H{sub 2}O{sub 2} formation was dependent on glycolytically-derived NADH, as inhibition of glycolysis and application of non-glycogenic insulin secretagogues did not support redox cycling. In addition, activity of plasma membrane electron transport, a system dependent in part on glycolytically-derived NADH, was also inhibited by menadione. Menadione-dependent redox cycling was sensitive to the NQO1 inhibitor dicoumarol and the flavoprotein inhibitor diphenylene iodonium, suggesting a role for NQO1 and other oxidoreductases in this process. These data may explain the apparent dichotomy between the stimulatory and inhibitory effects of H{sub 2}O{sub 2} and menadione on insulin secretion. -- Highlights: ► Menadione stimulation or inhibition of insulin secretion is dependent upon applied glucose levels. ► Menadione-dependent H{sub 2}O{sub 2} production is proportional to applied glucose levels. ► Quinone-mediated redox cycling is dependent on glycolysis.« less
Jeong, J; Bong, J; Kim, G D; Joo, S T; Lee, H-J; Baik, M
2013-10-01
Castration increases intramuscular fat (IMF) deposition, improving beef quality in cattle. The present study was performed to determine the global transcriptome changes following castration of bulls and to identify genes associated with IMF deposition in the longissimus dorsi (LM) of Korean cattle. A customized bovine CombiMatrix oligonucleotide microarray was constructed, and transcriptome changes following castration were determined by microarray hybridization. Transcriptome comparison between bulls and steers indicated that 428 of 8,407 genes were differentially expressed in the LM by greater than two fold (P < 0.05). Gene expression profiling indicated alterations in several pathways, including adipogenesis, fatty acid oxidation, tricarboxylic acid (TCA) cycle, and oxidative phosphorylation (OP), following castration. Castration upregulated transcription of adipogenic perilipin 2 (PLIN2) and visfatin, lipogenic fatty acid synthase, fatty acid esterification 1-acylglycerol-3-phosphate O-acyltransferase 5, and many fatty acid oxidation-related genes. Many TCA cycle and OP genes were also transcriptionally upregulated. Correlation analysis indicated that the IMF content in the LM was highly correlated with mRNA levels of PLIN2 (r = 0.70, P < 0.001), adenosine triphosphatase (ATPase), H(+)-transporting, lysosomal 42 kDa, V1 subunit C1 (ATP6V1C1: r = 0.66, P < 0.001), and cytochrome c oxidase assembly homolog 11 (COX11: r = 0.72, P < 0.001) genes in a pooled animal group of steers plus bulls, and significant correlations in the steer-alone group were maintained in the 3 genes, PLIN2 (r = 0.47, P < 0.05), ATP6V1C1 (r = 0.50, P < 0.05), and COX11 (r = 0.60, P < 0.01). In conclusion, our study provided evidence that castration shifts transcription of lipid metabolism genes, favoring IMF deposition by increasing adipogenesis, lipogenesis, and triglyceride synthesis. This study also indicated that castration increases transcription of genes involved in fatty acid oxidation and subsequent energy production (TCA and OP genes). Our microarray analysis provided novel information that castration alters the transcriptome associated with lipid/energy metabolism, favoring IMF deposition in the LM.