Science.gov

Sample records for gold

  1. Gold

    USGS Publications Warehouse

    Kirkemo, Harold; Newman, William L.; Ashley, Roger P.

    1998-01-01

    Through the ages, men and women have cherished gold, and many have had a compelling desire to amass great quantities of it -- so compelling a desire, in fact, that the frantic need to seek and hoard gold has been aptly named "gold fever." Gold was among the first metals to be mined because it commonly occurs in its native form -- that is, not combined with other elements -- because it is beautiful and imperishable, and because exquisite objects can be made from it.

  2. Gold Rush!

    ERIC Educational Resources Information Center

    Brahier, Daniel J.

    1997-01-01

    Describes a mathematical investigation of gold--how it is weighed, stored, used, and valued. For grades 3-4, children estimate the value of treasure chests filled with gold coins and explore the size and weight of gold bars. Children in grades 5-6 explore how gold is mined and used, and how the value of gold changes over time. (PVD)

  3. Gold Coating

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Epner Technology Inc. responded to a need from Goddard Space Flight Center for the ultimate in electroplated reflectivity needed for the Mars Global Surveyor Mars Orbiter Laser Altimeter (MOLA). Made of beryllium, the MOLA mirror was coated by Epner Technology Laser Gold process, specially improved for the project. Improved Laser Gold- coated reflectors have found use in an epitaxial reactor built for a large semiconductor manufacturer as well as the waveguide in Braun-Thermoscan tympanic thermometer and lasing cavities in various surgical instruments.

  4. Gold Nanoantennas

    SciTech Connect

    2012-01-01

    An array of gold nanoantennas laced into an artificial membrane enhances the fluorescence intensity of three different molecules when they pass through plasmonic hot spots in the array. Watch for the blue, green and red flashes. The photobleaching at the end of each fluorescence event (white flashes) is indicative of single molecule observations.

  5. Biomineralization of gold: biofilms on bacterioform gold.

    PubMed

    Reith, Frank; Rogers, Stephen L; McPhail, D C; Webb, Daryl

    2006-07-14

    Bacterial biofilms are associated with secondary gold grains from two sites in Australia. 16S ribosomal DNA clones of the genus Ralstonia that bear 99% similarity to the bacterium Ralstonia metallidurans-shown to precipitate gold from aqueous gold(III) tetrachloride-were present on all DNA-positive gold grains but were not detected in the surrounding soils. These results provide evidence for the bacterial contribution to the authigenic formation of secondary bacterioform gold grains and nuggets.

  6. Is It Real Gold?

    ERIC Educational Resources Information Center

    Harris, Harold H.

    1999-01-01

    Features acid tests for determining whether jewelry is "real" gold or simply gold-plated. Describes the carat system of denoting gold content and explains how alloys are used to create various shades of gold jewelry. Addresses the question of whether gold jewelry can turn a wearer's skin green by considering various oxidation reactions.…

  7. Is It Real Gold?

    ERIC Educational Resources Information Center

    Harris, Harold H.

    1999-01-01

    Features acid tests for determining whether jewelry is "real" gold or simply gold-plated. Describes the carat system of denoting gold content and explains how alloys are used to create various shades of gold jewelry. Addresses the question of whether gold jewelry can turn a wearer's skin green by considering various oxidation reactions.…

  8. The geomicrobiology of gold.

    PubMed

    Reith, Frank; Lengke, Maggy F; Falconer, Donna; Craw, David; Southam, Gordon

    2007-11-01

    Microorganisms capable of actively solubilizing and precipitating gold appear to play a larger role in the biogeochemical cycling of gold than previously believed. Recent research suggests that bacteria and archaea are involved in every step of the biogeochemical cycle of gold, from the formation of primary mineralization in hydrothermal and deep subsurface systems to its solubilization, dispersion and re-concentration as secondary gold under surface conditions. Enzymatically catalysed precipitation of gold has been observed in thermophilic and hyperthermophilic bacteria and archaea (for example, Thermotoga maritime, Pyrobaculum islandicum), and their activity led to the formation of gold- and silver-bearing sinters in New Zealand's hot spring systems. Sulphate-reducing bacteria (SRB), for example, Desulfovibrio sp., may be involved in the formation of gold-bearing sulphide minerals in deep subsurface environments; over geological timescales this may contribute to the formation of economic deposits. Iron- and sulphur-oxidizing bacteria (for example, Acidothiobacillus ferrooxidans, A. thiooxidans) are known to breakdown gold-hosting sulphide minerals in zones of primary mineralization, and release associated gold in the process. These and other bacteria (for example, actinobacteria) produce thiosulphate, which is known to oxidize gold and form stable, transportable complexes. Other microbial processes, for example, excretion of amino acids and cyanide, may control gold solubilization in auriferous top- and rhizosphere soils. A number of bacteria and archaea are capable of actively catalysing the precipitation of toxic gold(I/III) complexes. Reductive precipitation of these complexes may improve survival rates of bacterial populations that are capable of (1) detoxifying the immediate cell environment by detecting, excreting and reducing gold complexes, possibly using P-type ATPase efflux pumps as well as membrane vesicles (for example, Salmonella enterica

  9. GOLD PLATING PROCESS

    DOEpatents

    Seegmiller, R.

    1957-08-01

    An improved bath is reported for plating gold on other metals. The composition of the plating bath is as follows: Gold cyanide from about 15 to about 50 grams, potassium cyanide from about 70 to about 125 grams, and sulfonated castor oil from about 0.1 to about 10 cc. The gold plate produced from this bath is smooth, semi-hard, and nonporous.

  10. Magnetism in nanocrystalline gold.

    PubMed

    Tuboltsev, Vladimir; Savin, Alexander; Pirojenko, Alexandre; Räisänen, Jyrki

    2013-08-27

    While bulk gold is well known to be diamagnetic, there is a growing body of convincing experimental and theoretical work indicating that nanostructured gold can be imparted with unconventional magnetic properties. Bridging the current gap in experimental study of magnetism in bare gold nanomaterials, we report here on magnetism in gold nanocrystalline films produced by cluster deposition in the aggregate form that can be considered as a crossover state between a nanocluster and a continuous film. We demonstrate ferromagnetic-like hysteretic magnetization with temperature dependence indicative of spin-glass-like behavior and find this to be consistent with theoretical predictions, available in the literature, based on first-principles calculations.

  11. Chalcogenide centred gold complexes.

    PubMed

    Gimeno, M Concepción; Laguna, Antonio

    2008-09-01

    Chalcogenide-centred gold complexes are an important class of compounds in which a central chalcogen is surrounded by several gold atoms or gold and other metals. They have special characteristics such as unusual geometries, electron deficiency and properties such as luminescence or non-linear optical properties. The best known species are the trinuclear [E(AuPR3)3]+, 'oxonium' type species, that have high synthetic applicability, not only in other chalcogen-centred species, but in many other organometallic derivatives. The aurophilic interactions play an important role in the stability, preference for a particular geometry and luminescence properties in this type of derivatives (critical review, 117 references).

  12. Gold-bearing skarns

    USGS Publications Warehouse

    Theodore, Ted G.; Orris, Greta J.; Hammerstrom, Jane M.; Bliss, James D.

    1991-01-01

    In recent years, a significant proportion of the mining industry's interest has been centered on discovery of gold deposits; this includes discovery of additional deposits where gold occurs in skarn, such as at Fortitude, Nevada, and at Red Dome, Australia. Under the classification of Au-bearing skarns, we have modeled these and similar gold-rich deposits that have a gold grade of at least 1 g/t and exhibit distinctive skarn mineralogy. Two subtypes, Au-skarns and byproduct Au-skarns, can be recognized on the basis of gold, silver, and base-metal grades, although many other geological factors apparently are still undistinguishable largely because of a lack of detailed studies of the Au-skarns. Median grades and tonnage for 40 Au-skarn deposits are 8.6 g/t Au, 5.0 g/t Ag, and 213,000 t. Median grades and tonnage for 50 byproduct and Au-skarn deposits are 3.7 g/t Au, 37 g/t Ag, and 330,000 t. Gold-bearing skarns are generally calcic exoskarns associated with intense retrograde hydrosilicate alteration. These skarns may contain economic amounts of numerous other commodities (Cu, Fe, Pb, Zn, As, Bi, W, Sb, Co, Cd, and S) as well as gold and silver. Most Au-bearing skarns are found in Paleozoic and Cenozoic orogenic-belt and island-arc settings and are associated with felsic to intermediate intrusive rocks of Paleozoic to Tertiary age. Native gold, electru, pyrite, pyrrhotite, chalcopyrite, arsenopyrite, sphalerite, galena, bismuth minerals, and magnetite or hematite are the most common opaque minerals. Gangue minerals typically include garnet (andradite-grossular), pyroxene (diopside-hedenbergite), wollastonite, chlorite, epidote, quartz, actinolite-tremolite, and (or) calcite.

  13. Gold nanoprobes for theranostics

    PubMed Central

    Panchapakesan, Balaji; Book-Newell, Brittany; Sethu, Palaniappan; Rao, Madhusudhana; Irudayaraj, Joseph

    2011-01-01

    Gold nanoprobes have become attractive diagnostic and therapeutic agents in medicine and life sciences research owing to their reproducible synthesis with atomic level precision, unique physical and chemical properties, versatility of their morphologies, flexibility in functionalization, ease of targeting, efficiency in drug delivery and opportunities for multimodal therapy. This review highlights some of the recent advances and the potential for gold nanoprobes in theranostics. PMID:22122586

  14. Getting the Gold Treatment

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Epner Technology, Inc., worked with Goddard Space Center to apply gold coating to the Vegetation Canopy Lidar (VCL) mirror. This partnership resulted in new commercial applications for Epner's LaserGold(R) process in the automotive industry. Previously, the company did not have equipment large enough to handle the plating of the stainless steel panels cost effectively. Seeing a chance to renew this effort, Epner Technology and Goddard entered into an agreement by which NASA would fund the facility needed to do the gold-plating, and Epner Technology would cover all other costs as part of their internal research and development. The VCL mirror project proceeded successfully, fulfilling Goddard's needs and leaving Epner Technology with a new facility to provide LaserGold for the automotive industry. The new capability means increased power savings and improvements in both quality and production time for BMW Manufacturing Corporation of Spartanburg, South Carolina, and Cadillac of Detroit, Michigan, as well as other manufacturers who have implemented Epner Technology's LaserGold process. LaserGold(R) is a registered trademark of Epner Technology, Inc.

  15. Gold in minerals and the composition of native gold

    USGS Publications Warehouse

    Jones, Robert Sprague; Fleischer, Michael

    1969-01-01

    Gold occurs in nature mainly as the metal and as various alloys. It forms complete series of solid solutions with silver, copper, nickel, palladium, and platinum. In association with the platinum metals, gold occurs as free gold as well as in solid solution. The native elements contain the most gold, followed by the sulfide minerals. Several gold tellurides are known, but no gold selenides have been reported, and only one sulfide, the telluride-sulfide mineral nagyagite, is known. The nonmetallic minerals carry the least gold, and the light-colored minerals generally contain less gold than the dark minerals. Some conclusions in the literature are conflicting in regard to the relation of fineness of native gold to its position laterally and vertically within a lode, the nature of the country rocks, and the location and size of nuggets in a streambed, as well as to the variation of fineness within an individual nugget.

  16. Gold carbenes, gold-stabilized carbocations, and cationic intermediates relevant to gold-catalysed enyne cycloaddition.

    PubMed

    Harris, R J; Widenhoefer, R A

    2016-08-21

    Cationic gold complexes in which gold is bound to a formally divalent carbon atom, typically formulated as gold carbenes or α-metallocarbenium ions, have been widely invoked in a range of gold-catalyzed transformations, most notably in the gold-catalyzed cycloisomerization of 1,n-enynes. Although the existence of gold carbene complexes as intermediates in gold-catalyzed transformations is supported by a wealth of indirect experimental data and by computation, until recently no examples of cationic gold carbenes/α-metallocarbenium ions had been synthesized nor had any cationic intermediates generated via gold-catalyzed enyne cycloaddition been directly observed. Largely for this reason, there has been considerable debate regarding the electronic structure of these cationic complexes, in particular the relative contributions of the carbene (LAu(+)[double bond, length as m-dash]CR2) and α-metallocarbenium (LAu-CR2(+)) forms, which is intimately related to the extent of d → p backbonding from gold to the C1 carbon atom. However, over the past ∼ seven years, a number of cationic gold carbene complexes have been synthesized in solution and generated in the gas phase and cationic intermediates have been directly observed in the gold-catalyzed cycloaddition of enynes. Together, these advances provide insight into the nature and electronic structure of gold carbene/α-metallocarbenium complexes and the cationic intermediates generated via gold-catalyzed enyne cycloaddition. Herein we review recent advances in this area.

  17. In vivo liberation of gold ions from gold implants. Autometallographic tracing of gold in cells adjacent to metallic gold.

    PubMed

    Danscher, Gorm

    2002-05-01

    For some years, the implantation of small pieces of gold has been used as an unauthorised remedy for osteoarthritis and pain. The aim of the present study was to evaluate whether gold ions are released from gold implants. Pieces of pure gold were placed in the connective tissue of skin, bone and brains of anaesthetised animals. Ten days to several months later the animals were anaesthetised and killed by transcardial perfusion. Tissue blocks containing the gold pieces were cut, and the sections were silver-enhanced by autometallography. It was found that gold ions are released from the implanted gold and diffuse out into the surrounding tissue. The gold-containing cells in connective tissues were macrophages, mast cells and fibroblasts. In the brain, gold accumulated in astrocytes and neurons. Proton-induced X-ray emission spectroscopy analysis of the tissue surrounding gold implants confirmed that gold ions are liberated. The findings suggest that the gold implant technique, on a local scale, mimics systemic treatment with a gold-containing drug.

  18. Biorecovery of gold

    USGS Publications Warehouse

    Eisler, R.

    2003-01-01

    Recovery of ionic and metallic gold (Au) from a wide variety of solutions by selected species of bacteria, yeasts, fungi, algae, and higher plants is documented. Gold accumulations were up to 7.0 g/kg dry weight (DW) in various species of bacteria, 25.0 g/kg DW in freshwater algae, 84.0 g/kg DW in peat, and 100.0 g/kg DW in dried fungus mixed with keratinous material. Mechanisms of accumulation include oxidation, dissolution, reduction, leaching, and sorption. Uptake patterns are significantly modified by the physicochemical milieu. Crab exoskeletons accumulate up to 4.9 g Au/kg DW; however, gold accumulations in various tissues of living teleosts, decapod crustaceans, and bivalve molluscs are negligible.

  19. Gold-bismuth clusters.

    PubMed

    Martínez, Ana

    2014-08-07

    Metal clusters have interesting characteristics, such as the relationship between properties and size of the cluster. This is not always apparent, so theoretical studies can provide relevant information. In this report, optimized structures and electron donor-acceptor properties of AunBim clusters are reported (n + m = 2-7, 20). Density functional theory calculations were performed to obtain optimized structures. The ground states of gold clusters formed with up to seven atoms are planar. The presence of Bi modifies the structure, and the clusters become 3-D. Several optimized geometries have at least one Bi atom bonded to gold or bismuth atoms and form structures similar to NH3. This fragment is also present in clusters with 20 atoms, where the formation of Au3Bi stabilizes the structures. Bismuth clusters are better electron donors and worse electron acceptors than gold clusters. Mixed clusters fall in between these two extremes. The presence of Bi atoms in gold clusters modifies the electron donor-acceptor properties of the clusters, but there is no correlation between the number of Bi atoms present in the cluster and the capacity for donating electrons. The effect of planarity in Au19Bi clusters is the same as that in Au20 clusters. The properties of pure gold clusters are certainly interesting, but clusters formed by Bi and Au are more important because the introduction of different atoms modifies the geometry, the stability, and consequently the physical and chemical properties. Apparently, the presence of Bi may increase the reactivity of gold clusters, but further studies are necessary to corroborate this hypothesis.

  20. Chemistry for oncotheranostic gold nanoparticles.

    PubMed

    Trouiller, Anne Juliette; Hebié, Seydou; El Bahhaj, Fatima; Napporn, Teko W; Bertrand, Philippe

    2015-06-24

    This review presents in a comprehensive ways the chemical methods used to functionalize gold nanoparticles with focus on anti-cancer applications. The review covers the parameters required for the synthesis gold nanoparticles with defined shapes and sizes, method for targeted delivery in tumours, and selected examples of anti-cancers compounds delivered with gold nanoparticles. A short survey of bioassays for oncology based on gold nanoparticles is also presented.

  1. Derivatized gold clusters and antibody-gold cluster conjugates

    DOEpatents

    Hainfeld, James F.; Furuya, Frederic R.

    1994-11-01

    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be as small as 5.0 nm. Methods and reagents are disclosed in which antibodies, Fab' or F(ab').sub.2 fragments thereof are covalently bound to a stable cluster of gold atoms. The gold clusters may contain 6, 8, 9, 11, 13, 55 or 67 gold atoms in their inner core. The clusters may also contain radioactive gold. The antibody-cluster conjugates are useful in electron microscopy applications as well as in clinical applications that include imaging, diagnosis and therapy.

  2. Derivatized gold clusters and antibody-gold cluster conjugates

    DOEpatents

    Hainfeld, J.F.; Furuya, F.R.

    1994-11-01

    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be as small as 5.0 nm. Methods and reagents are disclosed in which antibodies, Fab' or F(ab')[sub 2] fragments are covalently bound to a stable cluster of gold atoms. The gold clusters may contain 6, 8, 9, 11, 13, 55 or 67 gold atoms in their inner core. The clusters may also contain radioactive gold. The antibody-cluster conjugates are useful in electron microscopy applications as well as in clinical applications that include imaging, diagnosis and therapy. 7 figs.

  3. Earth's continental crustal gold endowment

    NASA Astrophysics Data System (ADS)

    Frimmel, H. E.

    2008-03-01

    The analysis of the temporal distribution of gold deposits, combined with gold production data as well as reserve and resource estimates for different genetic types of gold deposit, revealed that the bulk of the gold known to be concentrated in ore bodies was added to the continental crust during a giant Mesoarchaean gold event at a time (3 Ga) when the mantle temperature reached a maximum and the dominant style of tectonic movement changed from vertical, plume-related to subhorizontal plate tectonic. A magmatic derivation of the first generation of crustal gold from a relatively hot mantle that was characterized by a high degree of partial melting is inferred from the gold chemistry, specifically high Os contents. While a large proportion of that gold is still present in only marginally modified palaeoplacer deposits of the Mesoarchaean Witwatersrand Basin in South Africa, accounting for about 40% of all known gold, the remainder has been recycled repeatedly on a lithospheric scale, predominantly by plate-tectonically induced magmatic and hydrothermal fluid circulation, to produce the current variety of gold deposit types. Post-Archaean juvenile gold addition to the continental crust has been limited, but a mantle contribution to some of the largest orogenic or intrusion-related gold deposits is indicated, notably for the Late Palaeozoic Tien Shan gold province. Magmatic fluids in active plate margins seem to be the most effective transport medium for gold mobilization, giving rise to a large proportion of volcanic-arc related gold deposits. Due to their generally shallow crustal level of formation, they have a low preservation potential. In contrast, those gold deposits that form at greater depth are more widespread also in older rocks. This explains the high proportion of orogenic (including intrusion-related) gold (32%) amongst all known gold deposits. The overall proportion of gold concentrated in known ore bodies is only 7 × 10- 7 of the estimated total

  4. Gold Nanoparticle Microwave Synthesis

    SciTech Connect

    Krantz, Kelsie E.; Christian, Jonathan H.; Coopersmith, Kaitlin; Washington, II, Aaron L.; Murph, Simona H.

    2016-07-27

    At the nanometer scale, numerous compounds display different properties than those found in bulk material that can prove useful in areas such as medicinal chemistry. Gold nanoparticles, for example, display promise in newly developed hyperthermia therapies for cancer treatment. Currently, gold nanoparticle synthesis is performed via the hot injection technique which has large variability in final particle size and a longer reaction time. One underdeveloped area by which these particles could be produced is through microwave synthesis. To initiate heating, microwaves agitate polar molecules creating a vibration that gives off the heat energy needed. Previous studies have used microwaves for gold nanoparticle synthesis; however, polar solvents were used that partially absorbed incident microwaves, leading to partial thermal heating of the sample rather than taking full advantage of the microwave to solely heat the gold nanoparticle precursors in a non-polar solution. Through this project, microwaves were utilized as the sole heat source, and non-polar solvents were used to explore the effects of microwave heating only as pertains to the precursor material. Our findings show that the use of non-polar solvents allows for more rapid heating as compared to polar solvents, and a reduction in reaction time from 10 minutes to 1 minute; this maximizes the efficiency of the reaction, and allows for reproducibility in the size/shape of the fabricated nanoparticles.

  5. 'Cascade Gold' raspberry

    USDA-ARS?s Scientific Manuscript database

    ‘Cascade Gold’ is a new gold fruited, floricane fruiting raspberry cultivar (Rubus idaeus L.) jointly released by Washington State University (WSU), Oregon State University (OSU) and the U.S. Department of Agriculture (USDA). It has been evaluated at Puyallup, Wash. in plantings from 1988 to 2008. ...

  6. Digging for Gold

    ERIC Educational Resources Information Center

    Waters, John K.

    2012-01-01

    In the case of higher education, the hills are more like mountains of data that "we're accumulating at a ferocious rate," according to Gerry McCartney, CIO of Purdue University (Indiana). "Every higher education institution has this data, but it just sits there like gold in the ground," complains McCartney. Big Data and the new tools people are…

  7. Digging for Gold

    ERIC Educational Resources Information Center

    Waters, John K.

    2012-01-01

    In the case of higher education, the hills are more like mountains of data that "we're accumulating at a ferocious rate," according to Gerry McCartney, CIO of Purdue University (Indiana). "Every higher education institution has this data, but it just sits there like gold in the ground," complains McCartney. Big Data and the new tools people are…

  8. GOLD PRESSURE VESSEL SEAL

    DOEpatents

    Smith, A.E.

    1963-11-26

    An improved seal between the piston and die member of a piston-cylinder type pressure vessel is presented. A layer of gold, of sufficient thickness to provide an interference fit between the piston and die member, is plated on the contacting surface of at least one of the members. (AEC)

  9. Gold and gold working in Late Bronze Age Northern Greece.

    PubMed

    Vavelidis, M; Andreou, S

    2008-04-01

    Numerous objects of gold displaying an impressive variety of types and manufacturing techniques are known from the Late Bronze Age (LBA) contexts of Mycenaean Greece, but very little is known about the origin and processing of gold during the second millennium B.C: . Ancient literature and recent research indicate that northern Greece is probably the richest gold-bearing region in Greece, and yet, very little evidence exists regarding the exploitation of its deposits and the production as well as use of gold in the area during prehistory. The unusual find of a group of small stone crucibles at the prehistoric settlement of Thessaloniki Toumba, one with visible traces of gold melting, proves local production and offers a rare opportunity to examine the process of on-site gold working. Furthermore, the comparison of the chemical composition of prehistoric artefacts from two settlements with those of gold deposits in their immediate areas supports the local extraction of gold and opens up the prospect for some of the Mycenaean gold to have originated in northern Greece. The scarcity of gold items in northern Greek LBA contexts may not represent the actual amount of gold produced and consumed, but could be a result of the local social attitudes towards the circulation and deposition of artefacts from precious metals.

  10. Gold and gold working in Late Bronze Age Northern Greece

    NASA Astrophysics Data System (ADS)

    Vavelidis, M.; Andreou, S.

    2008-04-01

    Numerous objects of gold displaying an impressive variety of types and manufacturing techniques are known from the Late Bronze Age (LBA) contexts of Mycenaean Greece, but very little is known about the origin and processing of gold during the second millennium b.c. Ancient literature and recent research indicate that northern Greece is probably the richest gold-bearing region in Greece, and yet, very little evidence exists regarding the exploitation of its deposits and the production as well as use of gold in the area during prehistory. The unusual find of a group of small stone crucibles at the prehistoric settlement of Thessaloniki Toumba, one with visible traces of gold melting, proves local production and offers a rare opportunity to examine the process of on-site gold working. Furthermore, the comparison of the chemical composition of prehistoric artefacts from two settlements with those of gold deposits in their immediate areas supports the local extraction of gold and opens up the prospect for some of the Mycenaean gold to have originated in northern Greece. The scarcity of gold items in northern Greek LBA contexts may not represent the actual amount of gold produced and consumed, but could be a result of the local social attitudes towards the circulation and deposition of artefacts from precious metals.

  11. Gold Nanoparticles Cytotoxicity

    NASA Astrophysics Data System (ADS)

    Mironava, Tatsiana

    Over the last two decades gold nanoparticles (AuNPs) have been used for many scientific applications and have attracted attention due to the specific chemical, electronic and optical size dependent properties that make them very promising agents in many fields such as medicine, imagine techniques and electronics. More specifically, biocompatible gold nanoparticles have a huge potential for use as the contrast augmentation agent in X-ray Computed Tomography and Photo Acoustic Tomography for early tumor diagnostic as well these nanoparticles are extensively researched for enhancing the targeted cancer treatment effectiveness such as photo-thermal and radiotherapy. In most biomedical applications biocompatible gold nanoparticles are labeled with specific tumor or other pathology targeting antibodies and used for site specific drug delivery. However, even though gold nanoparticles poses very high level of anti cancer properties, the question of their cytotoxicity ones they are released in normal tissue has to be researched. Moreover, the huge amount of industrially produced gold nanoparticles raises the question of these particles being a health hazard, since the penetration is fairly easy for the "nano" size substances. This study focuses on the effect of AuNPs on a human skin tissue, since it is fall in both categories -- the side effects for biomedical applications and industrial workers and users' exposure during production and handling. Therefore, in the present project, gold nanoparticles stabilized with the biocompatible agent citric acid were generated and characterized by Transmission Electron Microscopy (TEM) and Scanning Electron Microscopy (SEM). The cytotoxic effect of AuNPs release to healthy skin tissue was modeled on 3 different cell types: human keratinocytes, human dermal fibroblasts, and human adipose derived stromal (ADS) cells. The AuNPs localization inside the cell was found to be cell type dependent. Overall cytotoxicity was found to be dependent

  12. Spiky gold nanoshells.

    PubMed

    Sanchez-Gaytan, Brenda L; Park, So-Jung

    2010-12-21

    We report a high-yield synthetic method for a new type of metal nanostructure, spiky gold nanoshells, which combine the morphological characteristics of hollow metal nanoshells and nanorods. Our method utilizes block copolymer assemblies and polymer beads as templates for the growth of spiky nanoshells. Various shapes of spiky metal nanoshells were prepared in addition to spherical nanoshells by using block copolymer assemblies such as rod-like micelles, vesicles, and bilayers as templates. Furthermore, spiky gold shells encapsulating magnetic nanoparticles or quantum dots were prepared based on the ability of block copolymers to self-assemble with various types of nanoparticles and molecules. The capability to encapsulate other materials in the core, the shape tunability, and the highly structured surface of spiky nanoshells should benefit a range of imaging, sensing, and medical applications of metal nanostructures.

  13. 'Pot of Gold'

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This false-color image taken by the panoramic camera on the Mars Exploration Rover Spirit shows the rock dubbed 'Pot of Gold' (upper left), located near the base of the 'Columbia Hills' in Gusev Crater. The rock's nodules and layered appearance have inspired rover team members to investigate the rock's detailed chemistry in coming sols. This picture was taken on sol 158 (June 13, 2004).

  14. Radioactive gold ring dermatitis

    SciTech Connect

    Miller, R.A.; Aldrich, J.E. )

    1990-08-01

    A superficial squamous cell carcinoma developed in a woman who wore a radioactive gold ring for more than 30 years. Only part of the ring was radioactive. Radiation dose measurements indicated that the dose to basal skin layer was 2.4 Gy (240 rad) per week. If it is assumed that the woman continually wore her wedding ring for 37 years since purchase, she would have received a maximum dose of approximately 4600 Gy.

  15. 'Pot of Gold'

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This false-color image taken by the panoramic camera on the Mars Exploration Rover Spirit shows the rock dubbed 'Pot of Gold' (upper left), located near the base of the 'Columbia Hills' in Gusev Crater. The rock's nodules and layered appearance have inspired rover team members to investigate the rock's detailed chemistry in coming sols. This picture was taken on sol 158 (June 13, 2004).

  16. Gold-gold junction electrodes:the disconnection method.

    PubMed

    Dale, Sara E C; Vuorema, Anne; Ashmore, Ellen M Y; Kasprzyk-Horden, Barbara; Sillanpää, Mika; Denuault, Guy; Marken, Frank

    2012-02-01

    The formation of gold-gold junction electrodes for application in electroanalysis is described here based on electro-deposition from a non-cyanide gold plating bath. Converging growth of two hemispherical gold deposits on two adjacent platinum microelectrodes (both 100 µm diameter in glass, ca. 45 µm gap) followed by careful etching in aqueous chloride solution was employed. During growth both gold hemispheres "connect" and during etching "disconnection" is evident in a drop in current. Gold-gold junctions with sub-micron gaps are formed and applied for the electroanalytical detection of sub-micromolar concentrations of hydroquinone in 0.1 M phosphate buffer pH 7 (E(rev) = 0.04 V vs. SCE) and sub-micromolar concentration of dopamine in 0.1 M phosphate buffer pH 7 (E(rev) = 0.14 V vs. SCE). The potential future uses in analysis and limitations of gold-gold junction electrodes are discussed. Copyright © 2012 The Japan Chemical Journal Forum and Wiley Periodicals, Inc.

  17. 16 CFR Appendix to Part 23 - Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 16 Commercial Practices 1 2013-01-01 2013-01-01 false Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold Plate, Silver, and Platinum Industry...—Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold...

  18. 16 CFR Appendix to Part 23 - Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold Plate, Silver, and Platinum Industry...—Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold...

  19. 16 CFR Appendix to Part 23 - Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 16 Commercial Practices 1 2014-01-01 2014-01-01 false Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold Plate, Silver, and Platinum Industry...—Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold...

  20. 16 CFR Appendix to Part 23 - Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 16 Commercial Practices 1 2012-01-01 2012-01-01 false Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold Plate, Silver, and Platinum Industry...—Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold...

  1. 16 CFR Appendix to Part 23 - Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 16 Commercial Practices 1 2011-01-01 2011-01-01 false Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold Plate, Silver, and Platinum Industry...—Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold...

  2. Bats, cyanide, and gold mining

    USGS Publications Warehouse

    Clark, Donald R.

    1991-01-01

    Although the boom days of prospectors and gold nuggets are long gone, modern technology enables gold to continue to be extracted from ore. Unfortunately, the extraction method has often been disastrous for bats and other wildlife, an issue I first became aware of in early 1989. Phone calls from Drs. Merlin Tuttle and Elizabeth Pierson, a BCI member and bat researcher from Berkeley, California, alerted me that bats were dying from apparent cyanide poisoning at gold mines in the western United States.

  3. United States gold resource profile.

    USGS Publications Warehouse

    Cargill, S.M.

    1981-01-01

    After a brief background to US gold production, explains how this has a bearing on data used to estimate resources, and gives a resource profile. Concludes that the quantity of remaining gold resources that can be mined at grades that are now or soon will be economic could be sufficient to supply the US for the next 45yr, but reluctance to invest in new processes may mean a continuation of the 80% gold production deficit. -after Author

  4. Industry Forum Navy Gold Coast

    DTIC Science & Technology

    2014-08-13

    NAVFAC Southwest Lora E. Morrow Deputy for Small Business NAVFAC Southwest NAVFAC Southwest Industry Forum Navy Gold Coast August...REPORT DATE 13 AUG 2014 2. REPORT TYPE 3. DATES COVERED 00-00-2014 to 00-00-2014 4. TITLE AND SUBTITLE Industry Forum Navy Gold Coast 5a...S) 12. DISTRIBUTION/AVAILABILITY STATEMENT Approved for public release; distribution unlimited 13. SUPPLEMENTARY NOTES NDIA 27th Navy Gold Coast

  5. Gold granuloma after accidental implantation.

    PubMed Central

    Scott, F R; Dhillon, A P; Lewin, J F; Flavell, W; Laws, I M

    1995-01-01

    A case, in a 66 year old man, of a florid granulomatous reaction to gold dental alloy presenting about 20 years after accidental implantation in the oral mucosa of the lip is reported. Subsequent energy dispersive analysis confirmed the presence of a high nobility gold dental alloy. Florid granulomatosis has only rarely been reported in association with gold. Possible explanations for the delay in presentation include alteration of immune status or the development of hypersensitivity with components of the gold dental alloy acting as haptens. Images PMID:8543638

  6. Surface-stabilized gold nanocatalysts

    DOEpatents

    Dai, Sheng [Knoxville, TN; Yan, Wenfu [Oak Ridge, TN

    2009-12-08

    A surface-stabilized gold nanocatalyst includes a solid support having stabilizing surfaces for supporting gold nanoparticles, and a plurality of gold nanoparticles having an average particle size of less than 8 nm disposed on the stabilizing surfaces. The surface-stabilized gold nanocatalyst provides enhanced stability, such as at high temperature under oxygen containing environments. In one embodiment, the solid support is a multi-layer support comprising at least a first layer having a second layer providing the stabilizing surfaces disposed thereon, the first and second layer being chemically distinct.

  7. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance: Treasury 1 2011-07-01 2011-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  8. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance: Treasury 1 2013-07-01 2013-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  9. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Gold coin and gold certificates in... EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued before January 30, 1934, are exchangeable, as...

  10. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 1 2014-07-01 2014-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  11. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance: Treasury 1 2012-07-01 2012-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  12. Astronauts Congressional Gold Medal

    NASA Image and Video Library

    2009-07-20

    Apollo 11 Astronauts, from left, Michael Collins, Neil Armstrong, Buzz Aldrin and NASA Administrator Charles Bolden attend the U.S House of Representatives Committee on Science and Technology tribute to the Apollo 11 Astronauts at the Cannon House Office Building on Capitol Hill, Tuesday, July 21, 2009 in Washington. The committee presented the three Apollo 11 astronauts with a framed copy of House Resolution 607 honoring their achievement, and announced passage of legislation awarding them and John Glenn the Congressional Gold Medal. Photo Credit: (NASA/Bill Ingalls)

  13. Astronauts Congressional Gold Medal

    NASA Image and Video Library

    2009-07-20

    Apollo 11 Astronauts, from left, Michael Collins, Neil Armstrong, and Buzz Aldrin stand in recognition of Astronaut John Glenn during the U.S House of Representatives Committee on Science and Technology tribute to the Apollo 11 Astronauts at the Cannon House Office Building on Capitol Hill, Tuesday, July 21, 2009 in Washington. The committee presented the three Apollo 11 astronauts with a framed copy of House Resolution 607 honoring their achievement, and announced passage of legislation awarding them and John Glenn the Congressional Gold Medal. Photo Credit: (NASA/Bill Ingalls)

  14. Mineral resource of the month: gold

    USGS Publications Warehouse

    George, Micheal W.

    2009-01-01

    The article presents information on the valuable mineral called gold. It states that early civilizations valued gold because of its scarcity, durability and characteristics yellow color. By the late 20th century, gold was used as an industrial metal because of its unique physicochemical properties. The U.S. has several productive deposits of gold, including placer, gold-quartz lode, epithermal and Carlin-type gold deposits.

  15. Antibody-gold cluster conjugates

    DOEpatents

    Hainfeld, J.F.

    1988-06-28

    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be about 5.0 nm. Methods and reagents are disclosed in which antibodies or Fab' fragments thereof are covalently bound to a stable cluster of gold atoms. 2 figs.

  16. When cyclopropenes meet gold catalysts

    PubMed Central

    Miege, Frédéric

    2011-01-01

    Summary Cyclopropenes as substrates entered the field of gold catalysis in 2008 and have proven to be valuable partners in a variety of gold-catalyzed reactions. The different contributions in this growing research area are summarized in this review. PMID:21804867

  17. Synthesis of gold structures by gold-binding peptide governed by concentration of gold ion and peptide.

    PubMed

    Kim, Jungok; Kim, Dong-Hun; Lee, Sylvia J; Rheem, Youngwoo; Myung, Nosang V; Hur, Hor-Gil

    2016-08-01

    Although biological synthesis methods for the production of gold structures by microorganisms, plant extracts, proteins, and peptide have recently been introduced, there have been few reports pertaining to controlling their size and morphology. The gold ion and peptide concentrations affected on the size and uniformity of gold plates by a gold-binding peptide Midas-11. The higher concentration of gold ions produced a larger size of gold structures reached 125.5 μm, but an increased amount of Midas-11 produced a smaller size of gold platelets and increased the yield percentage of polygonal gold particles rather than platelets. The mechanisms governing factors controlling the production of gold structures were primarily related to nucleation and growth. These results indicate that the synthesis of gold architectures can be controlled by newly isolated and substituted peptides under different reaction conditions.

  18. Enhancement of gold recovery using bioleaching from gold concentrate

    NASA Astrophysics Data System (ADS)

    Choi, S. H.; Cho, K. H.; Kim, B. J.; Choi, N. C.; Park, C. Y.

    2012-04-01

    The gold in refractory ores is encapsulated as fine particles (sometimes at a molecular level) in the crystal structure of the sulfide (typically pyrite with or without arsenopyrite) matrix. This makes it impossible to extract a significant amount of refractory gold by cyanidation since the cyanide solution cannot penetrate the pyrite/arsenopyrite crystals and dissolve gold particles, even after fine grinding. To effectively extract gold from these ores, an oxidative pretreatment is necessary to break down the sulfide matrix. The most popular methods of pretreatment include nitric acid oxidation, roasting, pressure oxidation and biological oxidation by microorganisms. This study investigated the bioleaching efficiency of Au concentrate under batch experimental conditions (adaptation cycles and chemical composition adaptation) using the indigenous acidophilic bacteria collected from gold mine leachate in Sunsin gold mine, Korea. We conducted the batch experiments at two different chemical composition (CuSO4 and ZnSO4), two different adaptation cycles 1'st (3 weeks) and 2'nd (6 weeks). The results showed that the pH in the bacteria inoculating sample decreased than initial condition and Eh increased. In the chemical composition adaptation case, the leached accumulation content of Fe and Pb was exhibited in CuSO4 adaptation bacteria sample more than in ZnSO4 adaptation bacteria samples, possibly due to pre-adaptation effect on chalcopyrite (CuFeS2) in gold concentrate. And after 21 days on the CuSO4 adaptation cycles case, content of Fe and Pb was appeared at 1'st adaptation bacteria sample(Fe - 1.82 and Pb - 25.81 times per control sample) lower than at 2'nd adaptation bacteria sample(Fe - 2.87 and Pb - 62.05 times per control sample). This study indicates that adaptation chemical composition and adaptation cycles can play an important role in bioleaching of gold concentrate in eco-/economic metallurgy process.

  19. 20th-Century Gold Rush.

    ERIC Educational Resources Information Center

    Wargo, Joseph G.

    1992-01-01

    Presents Nevada's gold rush activities spurred by technological advancements in search methods. Describes the events that led to the twentieth-century gold rush, the techniques for finding deposits and the geological formation process of disseminated gold deposits. Vignettes present the gold extraction process, cross-section, and profile of a…

  20. 20th-Century Gold Rush.

    ERIC Educational Resources Information Center

    Wargo, Joseph G.

    1992-01-01

    Presents Nevada's gold rush activities spurred by technological advancements in search methods. Describes the events that led to the twentieth-century gold rush, the techniques for finding deposits and the geological formation process of disseminated gold deposits. Vignettes present the gold extraction process, cross-section, and profile of a…

  1. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 41 Public Contracts and Property Management 2 2014-07-01 2012-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  2. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 41 Public Contracts and Property Management 2 2013-07-01 2012-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  3. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 41 Public Contracts and Property Management 2 2012-07-01 2012-07-01 false Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  4. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 41 Public Contracts and Property Management 2 2011-07-01 2007-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  5. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  6. Gold, currencies and market efficiency

    NASA Astrophysics Data System (ADS)

    Kristoufek, Ladislav; Vosvrda, Miloslav

    2016-05-01

    Gold and currency markets form a unique pair with specific interactions and dynamics. We focus on the efficiency ranking of gold markets with respect to the currency of purchase. By utilizing the Efficiency Index (EI) based on fractal dimension, approximate entropy and long-term memory on a wide portfolio of 142 gold price series for different currencies, we construct the efficiency ranking based on the extended EI methodology we provide. Rather unexpected results are uncovered as the gold prices in major currencies lay among the least efficient ones whereas very minor currencies are among the most efficient ones. We argue that such counterintuitive results can be partly attributed to a unique period of examination (2011-2014) characteristic by quantitative easing and rather unorthodox monetary policies together with the investigated illegal collusion of major foreign exchange market participants, as well as some other factors discussed in some detail.

  7. Colloidal Synthesis of Gold Semishells

    PubMed Central

    Rodríguez-Fernández, Denis; Pérez-Juste, Jorge; Pastoriza-Santos, Isabel; Liz-Marzán, Luis M

    2012-01-01

    This work describes a novel and scalable colloid chemistry strategy to fabricate gold semishells based on the selective growth of gold on Janus silica particles (500 nm in diameter) partly functionalized with amino groups. The modulation of the geometry of the Janus silica particles allows us to tune the final morphology of the gold semishells. This method also provides a route to fabricating hollow gold semishells through etching of the silica cores with hydrofluoric acid. The optical properties were characterized by visible near-infrared (vis-NIR) spectroscopy and compared with simulations performed using the boundary element method (BEM). These revealed that the main optical features are located beyond the NIR region because of the large core size. PMID:24551496

  8. Gold, coal and oil.

    PubMed

    Dani, Sergio U

    2010-03-01

    Jared Diamond has hypothesized that guns, germs and steel account for the fate of human societies. Here I propose an extension of Diamond's hypothesis and put it in other terms and dimensions: gold, coal and oil account not only for the fate of human societies but also for the fate of mankind through the bodily accumulation of anthropogenic arsenic, an invisible weapon of mass extinction and evolutionary change. The background is clear; arsenic species fulfill seven criteria for a weapon of mass extinction and evolutionary change: (i) bioavailability to all living organisms; (ii) imperceptibility; (iii) acute toxicity; (iv) bioaccumulation and chronic toxicity; (v) adverse impact on reproductive fitness and reproductive outcomes and early-age development and growth in a wide range of microbial, plant and animal species including man; (vi) widespread geographical distribution, mobility and ecological persistence on a centennial to millennial basis and (vii) availability in necessary and sufficient amounts to exert evolutionarily meaningful effects. The proof is becoming increasingly feasible as human exploitation of gold, coal and oil deposits cause sustainable rises of arsenic concentrations in the biosphere. Paradoxically, humans are among the least arsenic-resistant organisms because humans are long-lived, encephalized and complex social metazoans. An arsenic accumulation model is presented here to describe how arsenic accumulates in the human body with increasing age and at different provisionally safe exposure levels. Arsenic accumulates in the human body even at daily exposure levels which are within the lowest possible WHO provisional tolerance limits, yielding bodily arsenic concentrations which are above WHO provisional limits. Ongoing consequences of global scale arsenic poisoning of mankind include age-specific rises in morbidity and mortality followed by adaptive changes. The potential rise of successful forms of inborn resistance to arsenic in humans

  9. GOLD: The Genomes Online Database

    DOE Data Explorer

    Kyrpides, Nikos; Liolios, Dinos; Chen, Amy; Tavernarakis, Nektarios; Hugenholtz, Philip; Markowitz, Victor; Bernal, Alex

    Since its inception in 1997, GOLD has continuously monitored genome sequencing projects worldwide and has provided the community with a unique centralized resource that integrates diverse information related to Archaea, Bacteria, Eukaryotic and more recently Metagenomic sequencing projects. As of September 2007, GOLD recorded 639 completed genome projects. These projects have their complete sequence deposited into the public archival sequence databases such as GenBank EMBL,and DDBJ. From the total of 639 complete and published genome projects as of 9/2007, 527 were bacterial, 47 were archaeal and 65 were eukaryotic. In addition to the complete projects, there were 2158 ongoing sequencing projects. 1328 of those were bacterial, 59 archaeal and 771 eukaryotic projects. Two types of metadata are provided by GOLD: (i) project metadata and (ii) organism/environment metadata. GOLD CARD pages for every project are available from the link of every GOLD_STAMP ID. The information in every one of these pages is organized into three tables: (a) Organism information, (b) Genome project information and (c) External links. [The Genomes On Line Database (GOLD) in 2007: Status of genomic and metagenomic projects and their associated metadata, Konstantinos Liolios, Konstantinos Mavromatis, Nektarios Tavernarakis and Nikos C. Kyrpides, Nucleic Acids Research Advance Access published online on November 2, 2007, Nucleic Acids Research, doi:10.1093/nar/gkm884]

    The basic tables in the GOLD database that can be browsed or searched include the following information:

    • Gold Stamp ID
    • Organism name
    • Domain
    • Links to information sources
    • Size and link to a map, when available
    • Chromosome number, Plas number, and GC content
    • A link for downloading the actual genome data
    • Institution that did the sequencing
    • Funding source
    • Database where information resides
    • Publication status and information

    • Sulphur adsorption on gold monolayer

      NASA Astrophysics Data System (ADS)

      Kaur, Damanpreet; Kaur, Sumandeep; Srivastava, Sunita

      2017-05-01

      We use Density Functional Theory to study the electronic and magnetic properties of two dimensional gold monolayer and investigate the effect of adsorption of sulphur atom on it. Of all the possible adsorption sites, hollow site was found to be the most favorable one for adsorption. On-top and bridge adsorption sites are found to exhibit net magnetic moment of adsorbed gold monolayer. This feature of small but non zero magnetic moment could find applications in building small molecular magnetic devices.

    • Gold-catalyzed domino reactions.

      PubMed

      Michelet, Véronique

      2015-01-01

      Gold-catalyzed reactions have appeared to be highly attractive tools for chemists to promote novel transformations to prepare elaborated structures from simple starting materials. This chapter presents selected and original examples of domino processes in the presence of gold catalysts, highlighting reports implying hydration, hydroxylation, and hydroamination as key starting point for cascade transformations. Domino processes implying 1,n-enynes, asymmetric domino transformations, and applications of all the presented processes in total synthesis are presented.

    • Gold nanoparticle (AuNPs) and gold nanopore (AuNPore) catalysts in organic synthesis.

      PubMed

      Takale, Balaram S; Bao, Ming; Yamamoto, Yoshinori

      2014-04-07

      Organic synthesis using gold has gained tremendous attention in last few years, especially heterogeneous gold catalysis based on gold nanoparticles has made its place in almost all organic reactions, because of the robust and green nature of gold catalysts. In this context, gold nanopore (AuNPore) with a 3D metal framework is giving a new dimension to heterogeneous gold catalysts. Interestingly, AuNPore chemistry is proving better than gold nanoparticles based chemistry. In this review, along with recent advances, major discoveries in heterogeneous gold catalysis are discussed.

    • Modeling of gold production in Malaysia

      NASA Astrophysics Data System (ADS)

      Muda, Nora; Ainuddeen, Nasihah Rasyiqah; Ismail, Hamizun; Umor, Mohd Rozi

      2013-04-01

      This study was conducted to identify the main factors that contribute to the gold production and hence determine the factors that affect to the development of the mining industry in Malaysia. An econometric approach was used by performing the cointegration analysis among the factors to determine the existence of long term relationship between the gold prices, the number of gold mines, the number of workers in gold mines and the gold production. The study continued with the Granger analysis to determine the relationship between factors and gold production. Results have found that there are long term relationship between price, gold production and number of employees. Granger causality analysis shows that there is only one way relationship between the number of employees with gold production in Malaysia and the number of gold mines in Malaysia.

    • Gold sulfide replacements of cyanide solutions

      SciTech Connect

      Worobey, W.; Norwood, D.; Rieger, D.

      1991-01-01

      At Sandia National Laboratories we have introduced a non-cyanide gold electroplating solution in the Solid State Circuit Processing Lab. This commercially available solution is based on gold sulfite salts. An evaluation of the plating bath and the deposited gold for use in microelectronic circuit fabrication was conducted. The tests included selective plating compatability, wire bonding, soldering, gold resistivity, adherence, and step coverage. The results were all favorable. Precision gold patterns with line widths as small as 2{mu}m and gold thickness over 4{mu}m were selectively plated using a positive photoresist as a plating mask. Also the gold sulfite solution was used to fabricate gold air bridge crossovers for GaAs circuits. The introduction of the non-hazardous sulfite solution for plating high purity gold films will lead to manufacturing processes which are safer to work with and less damaging to the environment.

    • Monoclonal antibody "gold rush".

      PubMed

      Maggon, Krishan

      2007-01-01

      The market, sales and regulatory approval of new human medicines, during the past few years, indicates increasing number and share of new biologics and emergence of new multibillion dollar molecules. The global sale of monoclonal antibodies in 2006 were $20.6 billion. Remicade had annual sales gain of $1 billion during the past 3 years and five brands had similar increase in 2006. Rituxan with 2006 sales of $4.7 billion was the best selling monoclonal antibody and biological product and the 6th among the top selling medicinal brand. It may be the first biologic and monoclonal antibody to reach $10 billion annual sales in the near future. The strong demand from cancer and arthritis patients has surpassed almost all commercial market research reports and sales forecast. Seven monoclonal antibody brands in 2006 had sales exceeding $1 billion. Humanized or fully human monoclonal antibodies with low immunogenicity, enhanced antigen binding and reduced cellular toxicity provide better clinical efficacy. The higher technical and clinical success rate, overcoming of technical hurdles in large scale manufacturing, low cost of market entry and IND filing, use of fully human and humanized monoclonal antibodies has attracted funds and resources towards R&D. Review of industry research pipeline and sales data during the past 3 years indicate a real paradigm shift in industrial R&D from pharmaceutical to biologics and monoclonal antibodies. The antibody bandwagon has been joined by 200 companies with hundreds of new projects and targets and has attracted billions of dollars in R&D investment, acquisitions and licensing deals leading to the current Monoclonal Antibody Gold Rush.

    • Goldschlager allergy in a gold allergic patient.

      PubMed

      Guenthner, T; Stork, C M; Cantor, R M

      1999-08-01

      We describe the case of gold allergy after ingestion of GOLDSCHLAGER, a gold-containing liquor, in a patient with a previous allergy to gold jewelry. The patient was not aware that genuine gold particles were contained in the schnapps liquor and that ingestion could result in a reaction similar to that experienced by individuals sensitive to gold jewelry. Clinicians should be familiar with the presence of gold particles in GOLDSCHLAGER liquor and the potential for allergic reactions to occur in those so predisposed.

    • Biomedical applications of gold nanoparticles.

      PubMed

      Cabuzu, Daniela; Cirja, Andreea; Puiu, Rebecca; Grumezescu, Alexandru Mihai

      2015-01-01

      Gold nanoparticles may be used in different domains, one of most important being the biomedical field. They have suitable properties for controlled drug delivery, cancer treatment, biomedical imaging, diagnosis and many others, due to their excellent compatibility with the human organism, low toxicity and tunable stability, small dimensions, and possibility to interact with a variety of substances. They also have optical properties, being able to absorb infrared light. Moreover, due to their large surface and the ability of being coated with a variety of therapeutic agents, gold nanoparticles have been showed a great potential to be used as drug delivery systems. Gold nanoparticles are intensively studied in biomedicine, and recent studies revealed the fact that they can cross the blood-brain barrier, may interact with the DNA and produce genotoxic effects. Because of their ability of producing heat, they can target and kill the tumors, being used very often in photodynamic therapy. Gold nanoparticles can be synthesized in many ways, but the most common are the biological and chemical methods, however the chemical method offers the advantage of better controlling the size and shape of the nanoparticles. In this review, we present the principal applications of gold nanoparticles in the biomedical field, like cancer treatment, amyloid-like fibrillogenesis inhibitors, transplacental treatment, the development of specific scaffolds and drug delivery systems.

    • Phage based green chemistry for gold ion reduction and gold retrieval.

      PubMed

      Setyawati, Magdiel I; Xie, Jianping; Leong, David T

      2014-01-22

      The gold mining industry has taken its toll on the environment, triggering the development of more environmentally benign processes to alleviate the waste load release. Here, we demonstrate the use of bacteriophages (phages) for biosorption and bioreduction of gold ions from aqueous solution, which potentially can be applied to remediate gold ions from gold mining waste effluent. Phage has shown a remarkably efficient sorption of gold ions with a maximum gold adsorption capacity of 571 mg gold/g dry weight phage. The product of this phage mediated process is gold nanocrystals with the size of 30-630 nm. Biosorption and bioreduction processes are mediated by the ionic and covalent interaction between gold ions and the reducing groups on the phage protein coat. The strategy offers a simple, ecofriendly and feasible option to recover of gold ions to form readily recoverable products of gold nanoparticles within 24 h.

    • Gold nanoparticles for photoacoustic imaging

      PubMed Central

      Li, Wanwan; Chen, Xiaoyuan

      2015-01-01

      Photoacoustic (PA) imaging is a biomedical imaging modality that provides functional information regarding the cellular and molecular signatures of tissue by using endogenous and exogenous contrast agents. There has been tremendous effort devoted to the development of PA imaging agents, and gold nanoparticles as exogenous contrast agents have great potential for PA imaging due to their inherent and geometrically induced optical properties. The gold-based nanoparticles that are most commonly employed for PA imaging include spheres, rods, shells, prisms, cages, stars and vesicles. This article provides an overview of the current state of research in utilizing these gold nanomaterials for PA imaging of cancer, atherosclerotic plaques, brain function and image-guided therapy. PMID:25600972

    • Economic geology: Gold buried by oxygen

      NASA Astrophysics Data System (ADS)

      Gaillard, Fabrice; Copard, Yoann

      2015-03-01

      The Witwatersrand Basin in South Africa contains extraordinary amounts of gold. Thermodynamic calculations suggest that the gold may have accumulated there in response to a perfect storm of conditions available only during the Archaean.

  1. Recent Developments in Australian Gold Extraction.

    ERIC Educational Resources Information Center

    Thiele, Rodney B.

    1995-01-01

    Describes new technologies that have greatly improved the extraction efficiency of gold ore, including: altering plant layout to promote efficiency, engaging Filiblast forced oxidation and bioxidation systems, and updating the electrowinning procedure at the gold recovery stage. (JRH)

  2. Formation, structure, and orientation of gold silicide on gold surfaces

    NASA Technical Reports Server (NTRS)

    Green, A. K.; Bauer, E.

    1976-01-01

    The formation of gold silicide on Au films evaporated onto Si(111) surfaces is studied by Auger electron spectroscopy (AES) and low-energy electron diffraction (LEED). Surface condition, film thickness, deposition temperature, annealing temperature, and heating rate during annealing are varied. Several oriented crystalline silicide layers are observed.

  3. Formation, structure, and orientation of gold silicide on gold surfaces

    NASA Technical Reports Server (NTRS)

    Green, A. K.; Bauer, E.

    1976-01-01

    The formation of gold silicide on Au films evaporated onto Si(111) surfaces is studied by Auger electron spectroscopy (AES) and low-energy electron diffraction (LEED). Surface condition, film thickness, deposition temperature, annealing temperature, and heating rate during annealing are varied. Several oriented crystalline silicide layers are observed.

  4. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or the quantity or karat fineness of gold or gold alloy contained in the product, or the karat fineness, thickness, weight ratio, or manner of application of any gold or gold alloy plating, covering, or coating on...

  5. Single-crystalline gold nanoplates from a commercial gold plating solution.

    PubMed

    Li, Zhonghao; Lapeyre, Véronique; Ravaine, Valérie; Ravaine, Serge; Kuhn, Alexander

    2009-03-01

    A novel route was proposed to synthesize gold nanoplates using a commercial gold plating solution as the reactant. Single-crystalline gold nanoplates can be successfully synthesized by reacting gold plating solution with HCl. The as-prepared nanoplates are from several micrometers to tens of micrometers in size. The effects of reactant concentration and temperature on the morphology of the gold products were investigated. The size of the gold nanoplate increases with the decrease of the amount of gold plating solution, while irregular gold nanoparticles are formed as the HCl concentration becomes low. When the reaction temperature is as low as room temperature, nanoplates with a concavity form. Specifically, it is found that the Cl- plays an important role for the formation of these gold nanoplates. The formation mechanism of the gold nanoplates is studied in detail.

  6. Substituting gold for silver improves electrical connections

    NASA Technical Reports Server (NTRS)

    Loyd, J. R.; Pickard, R. F.

    1967-01-01

    In attaching external leads to thin film sensors of platinum ribbon, liquid gold is applied to each end of the ribbon and the leads are soldered to the cured gold. The cured and soldered liquid gold shows no tendency to migrate and retains initial resistance characteristics when exposed to elevated temperatures.

  7. Structural change from doping the gold cluster.

    PubMed

    Tang, Yiji; Wang, Shu-Guang; Li, Jia

    2011-05-01

    Doping gold clusters with a transition metal (M@Au(n)) causes structural change. To determine the mechanism by which these changes occur, the central gold atom of Au(5) was doped with its same row transition metals Pt, Ir, Os, Re, and W. Based on theoretical calculations, a similar trend was found in other gold clusters.

  8. Highly active thermally stable nanoporous gold catalyst

    SciTech Connect

    Biener, Juergen; Wittstock, Arne; Biener, Monika M.; Bagge-Hansen, Michael; Baeumer, Marcus; Wichmann, Andre; Neuman, Bjoern

    2016-12-20

    In one embodiment, a system includes a nanoporous gold structure and a plurality of oxide particles deposited on the nanoporous gold structure; the oxide particles are characterized by a crystalline phase. In another embodiment, a method includes depositing oxide nanoparticles on a nanoporous gold support to form an active structure and functionalizing the deposited oxide nanoparticles.

  9. Gold, Silver and Bronze Citations.

    ERIC Educational Resources Information Center

    American School & University, 2003

    2003-01-01

    Presents the gold, silver, and bronze winners of a competition, which judged the most outstanding learning environments at educational institutions nationwide. Jurors spent two days reviewing projects, focusing on concepts and ideas that made them exceptional. For each citation, the article offers information on the firm, client, total area, total…

  10. Gold, Silver and Bronze Citations.

    ERIC Educational Resources Information Center

    American School & University, 2003

    2003-01-01

    Presents the gold, silver, and bronze winners of a competition, which judged the most outstanding learning environments at educational institutions nationwide. Jurors spent two days reviewing projects, focusing on concepts and ideas that made them exceptional. For each citation, the article offers information on the firm, client, total area, total…

  11. In vitro liberation of charged gold atoms: autometallographic tracing of gold ions released by macrophages grown on metallic gold surfaces.

    PubMed

    Larsen, Agnete; Stoltenberg, Meredin; Danscher, Gorm

    2007-07-01

    The present study demonstrates that cultured macrophages are able to liberate gold ions from metallic gold surfaces, a process suggested to be called "dissolucytosis", in a way analogous to the release taking place when metallic implants are placed in a body. Using the ultra-sensitive autometallographic (AMG) technique, we demonstrate that murine macrophages grown on a surface of metallic gold liberate gold ions. Ultra-structural AMG reveals that the gold ions are located in an ultra-thin membrane-like structure, "the dissolution membrane", intervened between the macrophages and the metal surface. The presence of AMG silver enhanced gold nanoparticles in the dissolution membrane proves that the release of charged gold atoms takes place extracellularly. The dissolution membrane is most likely secreted and chemically controlled by the "dissolucytes", here macrophages, and the membrane is essential for the dissolution of metal implants and particles, which cannot be phagocytosed. Our findings support the notion that whenever a metallic gold surface is attacked by dissolucytes, gold ions are liberated and taken up by surrounding cells. As gold ions can suppress the inflammatory process, it is reasonable to expect that when dissolucytosis takes place in the living organism the liberated gold ions will cause local immunosuppression.

  12. Gold nephropathy in juvenile rheumatoid arthritis.

    PubMed

    Husserl, F E; Shuler, S E

    1979-01-01

    A 2-year-old girl was treated with gold salts for juvenile rheumatoid arthritis. Treatment had to be discontinued when persistent proteinuria was detected. As this case report indicates, close monitoring of the urine is mandatory during treatment with gold salts to detect early signs of toxicity: hematuria followed by casts and then proteinuria as therapy is continued. Histologic examination with electron microscopy will help to differentiate the different forms of gold toxicity. When the findings are consistent with gold-induced renal involvement, therapy should be discontinued. The gold nephropathy usually resolves in time, with no permanent renal damage.

  13. Bimodal porous gold opals for molecular sensing

    NASA Astrophysics Data System (ADS)

    Chae, Weon-Sik; Yu, Hyunung; Ham, Sung-Kyoung; Lee, Myung-Jin; Jung, Jin-Seung; Robinson, David B.

    2013-11-01

    We have fabricated bimodal porous gold skeletons by double-templating routes using poly(styrene) colloidal opals as templates. The fabricated gold skeletons show a bimodal pore-size distribution, with small pores within spheres and large pores between spheres. The templated bimodal porous gold skeletons were applied in Raman scattering experiments to study sensing efficiency for probe molecules. We found that the bimodal porous gold skeletons showed obvious enhancement of Raman scattering signals versus that of the unimodal porous gold which only has interstitial pores of several hundred nanometers.

  14. Gold recycling; a materials flow study

    USGS Publications Warehouse

    Amey, Earle B.

    2000-01-01

    This materials flow study includes a description of trends in consumption, loss, and recycling of gold-containing materials in the United States in 1998 in order to illustrate the extent to which gold is presently being recycled and to identify recycling trends. The quantity of gold recycled, as a percent of the apparent supply of gold, was estimated to be about 30 percent. Of the approximately 446 metric tons of gold refined in the United States in 1998, the fabricating and industrial use losses were 3 percent.

  15. Mammalian sensitivity to elemental gold (Au?)

    USGS Publications Warehouse

    Eisler, R.

    2004-01-01

    There is increasing documentation of allergic contact dermatitis and other effects from gold jewelry, gold dental restorations, and gold implants. These effects were especially pronounced among females wearing body-piercing gold objects. One estimate of the prevalence of gold allergy worldwide is 13%, as judged by patch tests with monovalent organogold salts. Eczema of the head and neck was the most common response of individuals hypersensitive to gold, and sensitivity can last for at least several years. Ingestion of beverages containing flake gold can result in allergic-type reactions similar to those seen in gold-allergic individuals exposed to gold through dermal contact and other routes. Studies with small laboratory mammals and injected doses of colloidal gold showed increased body temperatures, accumulations in reticular cells, and dose enhancement in tumor therapy; gold implants were associated with tissue injuries. It is proposed that Au? toxicity to mammals is associated, in part, with formation of the more reactive Au+ and Au3+ species.

  16. Dating native gold by noble gas analyses

    NASA Technical Reports Server (NTRS)

    Niedermann, S.; Eugster, O.; Hofmann, B.; Thalmann, CH.; Reimold, W. U.

    1993-01-01

    Our recent work on He, Ne, and Ar in Alpine gold samples has demonstrated that gold is extremely retentive for He and could thus, in principle, be used for U/Th-He-4 dating. For vein-type gold from Brusson, Northern Italy, we derived a U/Th-He-4 age of 36 Ma, in agreement with the K-Ar formation age of associated muscovites and biotites. However, in placer gold from the Napf area, Central Switzerland, we observed large excesses of both He-4 and radiogenic Ar-40 (Ar-40 sub rad, defined as Ar-40-295.5-Ar-.36). The gas release systematics indicate two distinct noble gas components, one of which is released below about 800 C and the other one at the melting point of gold (1064 C). We now present results of He and Xe measurements in a 1 g placer gold sample from the river Kruempelgraben, as well as He and Ar data for Brusson vein-type gold and for gold from the Lily Gold Mine, South Africa. We calculate reasonable U/Th-He-4 as well as U-Xe ages based on those gases which are released at approximately 800 C. Probably the low-temperature components represent in-situ-produced radiogenic He and fission Xe, whereas the gases evolving when gold melts have been trapped during gold formation. Therefore, only the low-temperature components are relevant for dating purposes.

  17. Dating native gold by noble gas analyses

    NASA Technical Reports Server (NTRS)

    Niedermann, S.; Eugster, O.; Hofmann, B.; Thalmann, CH.; Reimold, W. U.

    1993-01-01

    Our recent work on He, Ne, and Ar in Alpine gold samples has demonstrated that gold is extremely retentive for He and could thus, in principle, be used for U/Th-He-4 dating. For vein-type gold from Brusson, Northern Italy, we derived a U/Th-He-4 age of 36 Ma, in agreement with the K-Ar formation age of associated muscovites and biotites. However, in placer gold from the Napf area, Central Switzerland, we observed large excesses of both He-4 and radiogenic Ar-40 (Ar-40 sub rad, defined as Ar-40-295.5-Ar-.36). The gas release systematics indicate two distinct noble gas components, one of which is released below about 800 C and the other one at the melting point of gold (1064 C). We now present results of He and Xe measurements in a 1 g placer gold sample from the river Kruempelgraben, as well as He and Ar data for Brusson vein-type gold and for gold from the Lily Gold Mine, South Africa. We calculate reasonable U/Th-He-4 as well as U-Xe ages based on those gases which are released at approximately 800 C. Probably the low-temperature components represent in-situ-produced radiogenic He and fission Xe, whereas the gases evolving when gold melts have been trapped during gold formation. Therefore, only the low-temperature components are relevant for dating purposes.

  18. ``Gold corrosion'': red stains on a gold Austrian Ducat

    NASA Astrophysics Data System (ADS)

    Gusmano, G.; Montanari, R.; Kaciulis, S.; Montesperelli, G.; Denk, R.

    Stains of different colours have been observed on historic and modern gold coins in several countries. An Austrian Ducat at the Kunsthistorisches Museum in Vienna has developed some red spots on its surface over the years. The same defects have also been observed in modern coins of higher gold purity. The spots have been examined by OM, SEM, EDS, XPS and AES. Optical microscopy showed that ``red'' defects exhibit in fact a nuance of colours. The surface analysis put in evidence the presence in the stains, in addition to gold, of silver and sulphur. The values of the modified Auger parameter α' of silver correspond to those of Ag2S; thus, it can be assumed that the stains are composed of silver sulphide (Ag2S). It was not possible to determine whether the presence of silver on the surface is due to segregation towards the surface or to external particles of silver embedded in the matrix. Depth profiling performed on modern coins suffering from the same problem allowed us to demonstrate that the nuance of colours is due to the inhomogeneous thickness of the spots. Moreover, it was demonstrated that spots are formed by two layers: an outer layer of silver sulphide and an inner layer of silver.

  19. Bending Gold Nanorods with Light.

    PubMed

    Babynina, Anastasia; Fedoruk, Michael; Kühler, Paul; Meledin, Alexander; Döblinger, Markus; Lohmüller, Theobald

    2016-10-12

    V-shaped gold nanoantennas are the functional components of plasmonic metasurfaces, which are capable of manipulating light in unprecedented ways. Designing a metasurface requires the custom arrangement of individual antennas with controlled shape and orientation. Here, we show how highly crystalline gold nanorods in solution can be bent, one-by-one, into a V-shaped geometry and printed to the surface of a solid support through a combination of plasmonic heating and optical force. Significantly, we demonstrate that both the bending angle and the orientation of each rod-antenna can be adjusted independent from each other by tuning the laser intensity and polarization. This approach is applicable for the patterning of V-shaped plasmonic antennas on almost any substrate, which holds great potential for the fabrication of ultrathin optical components and devices.

  20. Biomolecular Assembly of Gold Nanocrystals

    SciTech Connect

    Micheel, Christine Marya

    2005-05-20

    Over the past ten years, methods have been developed to construct discrete nanostructures using nanocrystals and biomolecules. While these frequently consist of gold nanocrystals and DNA, semiconductor nanocrystals as well as antibodies and enzymes have also been used. One example of discrete nanostructures is dimers of gold nanocrystals linked together with complementary DNA. This type of nanostructure is also known as a nanocrystal molecule. Discrete nanostructures of this kind have a number of potential applications, from highly parallel self-assembly of electronics components and rapid read-out of DNA computations to biological imaging and a variety of bioassays. My research focused in three main areas. The first area, the refinement of electrophoresis as a purification and characterization method, included application of agarose gel electrophoresis to the purification of discrete gold nanocrystal/DNA conjugates and nanocrystal molecules, as well as development of a more detailed understanding of the hydrodynamic behavior of these materials in gels. The second area, the development of methods for quantitative analysis of transmission electron microscope data, used computer programs written to find pair correlations as well as higher order correlations. With these programs, it is possible to reliably locate and measure nanocrystal molecules in TEM images. The final area of research explored the use of DNA ligase in the formation of nanocrystal molecules. Synthesis of dimers of gold particles linked with a single strand of DNA possible through the use of DNA ligase opens the possibility for amplification of nanostructures in a manner similar to polymerase chain reaction. These three areas are discussed in the context of the work in the Alivisatos group, as well as the field as a whole.

  1. DNA-templated gold nanowires

    NASA Astrophysics Data System (ADS)

    Mohammadzadegan, Reza; Mohabatkar, Hassan; Sheikhi, Mohammad Hossein; Safavi, Afsaneh; Khajouee, Mahmood Barati

    2008-10-01

    We have developed simple methods of reproducibly creating deoxyribonucleic acid (DNA)-templated gold nanowires on silicon. First DNA nanowires were aligned on silicon surfaces. Briefly, modified silicon wafer was soaked in the DNA solution, and then the solution was removed using micropipettes; the surface tension at the moving air-solution interface is sufficient to align the DNA nanowires on the silicon wafer. In another attempt, an aqueous dispersion of sodium azide-stabilized gold nanoparticles was prepared. The nanoparticles aligned double-stranded λ-DNA to form a linear nanoparticle array. Continuous gold nanowires were obtained. The above nanowires were structurally characterized using scanning electron microscopy. The results of the characterizations show the wires to be 57-323 nm wide, to be continuous with a length of 2.8-9.5 μm. The use of DNA as a template for the self-assembly of conducting nanowires represents a potentially important approach in the fabrication of nanoscale interconnects.

  2. Distinguishing Between Legally and Illegally Produced Gold in South Africa.

    PubMed

    Roberts, Richard J; Dixon, Roger D; Merkle, Roland K W

    2016-01-01

    The identification of gold-bearing material is essential for combating the theft of gold in South Africa. Material seized in police operations is generally a mixture of gold from different mines, and as such cannot be traced back to a single location. ICP-OES analysis of material dissolved by acid dissolution provided a database of gold compositions comprising gold from South African mines, illegal gold stolen from the mines, and commercial gold alloys and jewelery. Discrimination between legal and illegal gold was possible due to the presence of Pb, As, Sb, Sn, Se, and Te in the stolen material, elements which are not present in legally produced gold. The presence of these elements is a quick and simple way to distinguish between gold alloys based on refined gold, such as in commercially manufactured jewelery, and gold alloys containing a proportion of unrefined and therefore illegally obtained gold.

  3. Physiological investigation of gold nanorods toward watermelon.

    PubMed

    Wan, Yujie; Li, Junli; Ren, Hongxuan; Huang, Jin; Yuan, Hong

    2014-08-01

    The objective of the present study was to evaluate the phytotoxicity and oxidant stress of the gold nanorods toward watermelon, and hence give a quantitative risk assessment of both seeds and plants phase. The seed germination, the activity of antioxidant enzymes, and the contents of soluble protein and malondialdehyde (MDA) have been measured while the plant roots were observed by transmission electron microscopy (TEM). It was found that the gold nanorods significantly promoted the root elongation. Furthermore, the results on the enzymes activities of plant indicated that oxidative stress happened in the plant treated with gold nanorods. However, the gold nanorods resulted in the phytotoxicity toward plant especially at high concentration. The TEM images of the plant roots with and without the treatment of gold nanorods showed the significant different size of starch granules. In conclusion, significant physiological changes of plant occurred after treatment with the gold nanorods.

  4. Application of Gold Nanoparticles to Paint Colorants

    NASA Astrophysics Data System (ADS)

    Ishibashi, Hideo

    Metal nanoparticles possess unique properties that they do not exhibit in their bulk states. One of these properties is the color due to surface plasmon resonance. Gold nanoparticles appear red. This color has been utilized in glass for a long long time. In recent years, highly concentrated pastes of gold and silver nanoparticles have been successfully produced by using a special type of protective polymer and a mild reductant. The paste of gold nanoparticles can be used for paint and other materials as red colorants. In this article,application examples of gold nanoparticles as colorant are introduced. Recently, methods for producing bimetal nanoparticles such as gold/silver and gold/copper have been developed. These nanoparticles allow colors from yellow to green to be created. These methods and colors they produce are also described in this article.

  5. High frequency of contact allergy to gold sodium thiosulfate. An indication of gold allergy?

    PubMed

    Björkner, B; Bruze, M; Möller, H

    1994-03-01

    When gold sodium thiosulfate was added to the patch test standard series, positive reactions were obtained in 8.6% of 823 consecutive patients with suspect contact allergy. The test reactions were clinically of an allergic type and, in several cases, long-lasting. There was no correlation with other allergens in the standard series. In a special study on 38 patients with contact allergy to gold sodium thiosulfate, the following principal findings were obtained: positive patch tests to the compound itself in dilute concentration; positive patch tests to potassium dicyanoaurate; negative patch tests to gold sodium thiomalate, sodium thiosulfate, and metallic gold; positive intradermal tests to gold sodium thiosulfate. Our findings make gold sodium thiosulfate the 2nd most common contact allergen after nickel sulfate. It is suggested that a positive skin test to gold sodium thiosulfate represents gold allergy.

  6. Template based synthesis of gold nanotubes using biologically synthesized gold nanoparticles.

    PubMed

    Ballabh, R; Nara, S

    2015-12-01

    Reliable experimental protocols using green technologies to synthesize metallic nanostructures widen their applications, both biological as well as biomedical. Here, we describe a method for synthesizing gold nanotubes using biologically synthesized gold nanoparticles in a template based approach. E. coli DH5α was used as bionanofactory to synthesize gold nanoparticles. These nanoparticles were then deposited on sodium sulfate (Na2SO4) nanowires which were employed as sacrificial template for gold nanotube (Au-NT) formation. The gold nanoparticles, sodium sulphate nanowires and gold nanotubes were appropriately characterized using transmission electron microscopy. The TEM results showed that the average diameter of gold nanotubes was 72 nm and length up to 4-7 μm. The method discussed herein is better than other reported conventional chemical synthesis approaches as it uses biologically synthesized gold nanoparticles, and does not employ any harsh conditions/solvents for template removal which makes it a clean and ecofriendly method.

  7. Glyco-gold nanoparticles: synthesis and applications

    PubMed Central

    Compostella, Federica; Pitirollo, Olimpia; Silvestri, Alessandro

    2017-01-01

    Glyco-gold nanoparticles combine in a single entity the peculiar properties of gold nanoparticles with the biological activity of carbohydrates. The result is an exciting nanosystem, able to mimic the natural multivalent presentation of saccharide moieties and to exploit the peculiar optical properties of the metallic core. In this review, we present recent advances on glyco-gold nanoparticle applications in different biological fields, highlighting the key parameters which inspire the glyco nanoparticle design. PMID:28684980

  8. Photoelectronic Sensor with Gold Nanoparticle Plasmon Antenna

    DTIC Science & Technology

    2016-07-20

    AFRL-AFOSR-JP-TR-2016-0081 Photoelectronic Sensor with Gold Nanoparticle Plasmon Antenna Yukiharu Uraoka NARA INSTITUTE OF SCIENCE AND TECHNOLOGY...REPORT TYPE Final 3. DATES COVERED (From - To) 17 Jul 2014 to 16 Jan 2016 4. TITLE AND SUBTITLE Photoelectronic Sensor with Gold Nanoparticle Plasmon...utilizing gold nanoparticles (GNPs), which are supposed to function not only as the Plasmon antenna but also as the sensing part. The photocurrent in the

  9. Electrochemical Assay of Gold-Plating Solutions

    NASA Technical Reports Server (NTRS)

    Chiodo, R.

    1982-01-01

    Gold content of plating solution is assayed by simple method that required only ordinary electrochemical laboratory equipment and materials. Technique involves electrodeposition of gold from solution onto electrode, the weight gain of which is measured. Suitable fast assay methods are economically and practically necessary in electronics and decorative-plating industries. If gold content in plating bath is too low, poor plating may result, with consequent economic loss to user.

  10. Electrochemical Assay of Gold-Plating Solutions

    NASA Technical Reports Server (NTRS)

    Chiodo, R.

    1982-01-01

    Gold content of plating solution is assayed by simple method that required only ordinary electrochemical laboratory equipment and materials. Technique involves electrodeposition of gold from solution onto electrode, the weight gain of which is measured. Suitable fast assay methods are economically and practically necessary in electronics and decorative-plating industries. If gold content in plating bath is too low, poor plating may result, with consequent economic loss to user.

  11. Formation of Gold(III) Alkyls from Gold Alkoxide Complexes

    PubMed Central

    2017-01-01

    The gold(III) methoxide complex (C∧N∧C)AuOMe (1) reacts with tris(p-tolyl)phosphine in benzene at room temperature under O abstraction to give the methylgold product (C∧N∧C)AuMe (2) together with O=P(p-tol)3 ((C∧N∧C) = [2,6-(C6H3tBu-4)2pyridine]2–). Calculations show that this reaction is energetically favorable (ΔG = −32.3 kcal mol–1). The side products in this reaction, the Au(II) complex [Au(C∧N∧C)]2 (3) and the phosphorane (p-tol)3P(OMe)2, suggest that at least two reaction pathways may operate, including one involving (C∧N∧C)Au• radicals. Attempts to model the reaction by DFT methods showed that PPh3 can approach 1 to give a near-linear Au–O–P arrangement, without phosphine coordination to gold. The analogous reaction of (C∧N∧C)AuOEt, on the other hand, gives exclusively a mixture of 3 and (p-tol)3P(OEt)2. Whereas the reaction of (C∧N∧C)AuOR (R = But, p-C6H4F) with P(p-tol)3 proceeds over a period of hours, compounds with R = CH2CF3, CH(CF3)2 react almost instantaneously, to give 3 and O=P(p-tol)3. In chlorinated solvents, treatment of the alkoxides (C∧N∧C)AuOR with phosphines generates [(C∧N∧C)Au(PR3)]Cl, via Cl abstraction from the solvent. Attempts to extend the synthesis of gold(III) alkoxides to allyl alcohols were unsuccessful; the reaction of (C∧N∧C)AuOH with an excess of CH2=CHCH2OH in toluene led instead to allyl alcohol isomerization to give a mixture of gold alkyls, (C∧N∧C)AuR′ (R′ = −CH2CH2CHO (10), −CH2CH(CH2OH)OCH2CH=CH2 (11)), while 2-methallyl alcohol affords R′ = CH2CH(Me)CHO (12). The crystal structure of 11 was determined. The formation of Au–C instead of the expected Au–O products is in line with the trend in metal–ligand bond dissociation energies for Au(III): M–H > M–C > M–O.

  12. CO oxidation on electrically charged gold nanotips.

    PubMed

    McEwen, J-S; Gaspard, P

    2006-12-07

    We report a study of the oxidation of CO on a gold nanotip in the presence of high electrostatic fields. With the binding energies obtained using density functional theory as a function of the electric field, a simple field-dependent kinetic model based on the Langmuir-Hinshelwood mechanism is set up. We show that the dissociative adsorption of oxygen on gold happens only below a negative critical value of the electric field while the binding of CO on gold is enhanced for positive values. We explain the propagation of a wave observed in field ion microscopy experiments and predict that the oxidation of CO occurs on negatively charged gold clusters.

  13. Native gold in Hawaiian alkalic magma

    USGS Publications Warehouse

    Sisson, T.W.

    2003-01-01

    Native gold found in fresh basanite glass from the early submarine phase of Kilauea volcano, Hawaii, may be the first documented case of the transport of gold as a distinct precious metal phase in a mantle-derived magma. The gold-bearing glass is a grain in bedded volcanic glass sandstone (Japan Marine Science and Technology Center (JAMSTEC) sample S508-R3) collected by the submersible Shinkai 6500 at 3879 m depth off Kilauea's south flank. Extensive outcrops there expose debris-flow breccias and sandstones containing submarine-erupted alkalic rock fragments and glasses from early Kilauea. Precipitation of an immiscible gold liquid resulted from resorption of magmatic sulfides during crystallization-differentiation, with consequent liberation of sulfide-hosted gold. Elevated whole-rock gold concentrations (to 36 ppb) for fresh lavas and clasts from early Kilauea further show that some magmas erupted at the beginning stages of Hawaiian shield volcanoes were distinctly gold rich, most likely owing to limited residual sulfide in their mantle source. Alkalic magmas at other ocean islands may also be gold rich, and oceanic hot-spot provinces may contain underappreciated gold resources.

  14. Gold ink coating of thermocouple sheaths

    DOEpatents

    Ruhl, H. Kenneth

    1992-01-01

    A method is provided for applying a gold ink coating to a thermocouple sheath which includes the steps of electropolishing and oxidizing the surface of the thermocouple sheath, then dipping the sheath into liquid gold ink, and finally heat curing the coating. The gold coating applied in this manner is highly reflective and does not degrade when used for an extended period of time in an environment having a temperature over 1000.degree. F. Depending on the application, a portion of the gold coating covering the tip of the thermocouple sheath is removed by abrasion.

  15. Texture of gold-palladium couples

    SciTech Connect

    Chung, Y.S.; Evans, K.; Glaunsinger, W.

    1997-07-01

    The crystal textures of polycrystalline films of gold-palladium couples on an oxidized silicon (100) substrates were investigated via x-ray diffraction (XRD) pole figures. Studies were performed on both as-deposited and thermally annealed films. Scanning electron microscopy (SEM) was used to examine the microstructures of the seed layer thin films as deposited. The {l{underscore}brace}111{r{underscore}brace} texture formation of gold-palladium thin film couples displayed a strong dependence on the nature of the underlying seed layer. Gold films deposited on a palladium seed layer revealed much less degree of {l{underscore}brace}111{r{underscore}brace} texture, than gold films deposited directly on a silicon dioxide surface. In contrast, palladium films deposited on polycrystalline gold films showed a higher degree of {l{underscore}brace}111{r{underscore}brace} texture, compared to palladium films deposited directly on silicon dioxide. The {l{underscore}brace}111{r{underscore}brace} texture of annealed gold-palladium alloy thin films was greater for palladium on gold than for gold on palladium. These results are interpreted in terms of the gold-palladium diffusion mechanism and the interaction of the condensing metals with the oxygens of the SiO{sub 2} substrate surface.

  16. Gold Fever! Seattle Outfits the Klondike Gold Rush. Teaching with Historic Places.

    ERIC Educational Resources Information Center

    Blackburn, Marc K.

    This lesson is based on the National Register of Historic Places registration file, "Pioneer Square Historic District," and other sources about Seattle (Washington) and the Klondike Gold Rush. The lesson helps students understand how Seattle exemplified the prosperity of the Klondike Gold Rush after 1897 when news of a gold strike in…

  17. Precision gold conductors for HMCs

    NASA Astrophysics Data System (ADS)

    Widmer, M. R.

    1994-08-01

    Ti/Pd/Au multiple code coded switch (MCCS) networks were built and compared to Cr/Au MCCS networks. The data showed no measurable difference between the two systems. Interface resistance of both types of networks was measured as a diagnostic aid to determine if hydrogen was affecting the Ti/Pd/Au MCCS networks. The data showed that although hydrogen does affect Ti/Pd/Au, the changes are not significant with respect to MCCS environments. An evaluation of several proprietary gold electroplating solutions for use in the production of Ti/Pd/Au conductors was performed. All the testing results were comparable to the current product requirements.

  18. Gold nanorod plasmonic upconversion microlaser.

    PubMed

    Shi, Ce; Soltani, Soheil; Armani, Andrea M

    2013-01-01

    Plasmonic-photonic interactions have stimulated significant interdisciplinary interest, leading to rapid innovations in solar design and biosensors. However, the development of an optically pumped plasmonic laser has failed to keep pace due to the difficulty of integrating a plasmonic gain material with a suitable pump source. In the present work, we develop a method for coating high quality factor toroidal optical cavities with gold nanorods, forming a photonic-plasmonic laser. By leveraging the two-photon upconversion capability of the nanorods, lasing at 581 nm with a 20 μW threshold is demonstrated.

  19. Laser irradiation effects on gold

    NASA Astrophysics Data System (ADS)

    Khaleeq-Ur-Rahman, M.; Bhatti, K. A.; Rafique, M. S.; Latif, A.; Lee, P.; Mahmood, S.

    2007-12-01

    Investigations on the laser irradiation effects on gold are explored in terms of plasma-plume dynamics and morphological and crystallographic changes. Annealed 4N gold samples were irradiated with a Q-switched Nd:YAG laser (53 mJ, 21 MW, 532 nm, and pulse width 6-8 ns) for plume dynamics using 10-ns gated fast photography. A Q-switched pulsed Nd:YAG laser (10 mJ, 1.1 MW, 1064 nm, and pulse width 9 ns) was used to irradiate the surface of the samples for morphological and crystallographic studies of laser-irradiated gold in a vacuum ˜10-3 Torr. The annealed samples were exposed to 50 shots of a Nd:YAG laser (10 mJ, 1.1 MW, 1064 nm, and pulse width 9 ns). The investigation on the plume was done by using an intensified charged-couple device ICCD-5760/IR-UV camera. The morphological investigation of the irradiated surface was carried out by analyzing micrographs obtained using an Hitachi S 3000 H scanning-electron microscope (SEM). The crystallographic studies of the irradiated samples were performed by analyzing the XRD patterns obtained using an X’ Pert Pro Pan Analytical X-ray diffractometer. The investigation on gated ICCD images of the plume reveal that, at very earlier times, the plasma-plume expansion has a linear trend, whereas, at later times, the plasma-plume expansion is nonuniform. SEM micrographs exhibit the primary mechanisms of pulsed-laser ablation (PLA), such as hydrodynamic sputtering, thermal sputtering, exfoliation sputtering, and splashing. The surface morphology was explained in terms of crater formation, swelling, burning, nucleation, grain growth, and nonsymmetric heat conduction. The nonuniform thermal expansion of gold due to thermal-energy transfer is also studied by SEM micrographs, which was supported by XRD analysis. The structural analysis on the basis of XRD shows that the composition of the irradiated samples is not disturbed even after laser irradiation. The grain sizes also changed due to laser irradiation.

  20. Switchable imbibition in nanoporous gold

    PubMed Central

    Xue, Yahui; Markmann, Jürgen; Duan, Huiling; Weissmüller, Jörg; Huber, Patrick

    2014-01-01

    Spontaneous imbibition enables the elegant propelling of nano-flows because of the dominance of capillarity at small length scales. The imbibition kinetics are, however, solely determined by the static host geometry, the capillarity, and the fluidity of the imbibed liquid. This makes active control particularly challenging. Here we show for aqueous electrolyte imbibition in nanoporous gold that the fluid flow can be reversibly switched on and off through electric potential control of the solid–liquid interfacial tension, that is, we can accelerate the imbibition front, stop it, and have it proceed at will. Simultaneous measurements of the mass flux and the electrical current allow us to document simple scaling laws for the imbibition kinetics, and to explore the charge transport in the metallic nanopores. Our findings demonstrate that the high electric conductivity along with the pathways for fluid/ionic transport render nanoporous gold a versatile, accurately controllable electrocapillary pump and flow sensor for minute amounts of liquids with exceptionally low operating voltages. PMID:24980062

  1. Ciprofloxacin-protected gold nanoparticles.

    PubMed

    Tom, Renjis T; Suryanarayanan, V; Reddy, P Ganapati; Baskaran, S; Pradeep, T

    2004-03-02

    The antibacterial drug ciprofloxacin (cfH) has been used to protect gold nanoparticles of two different mean diameters, 4 and 20 nm. The protection is complete with about 65 and 585 cfH molecules covering 4 and 15 nm particles, respectively. The nature of binding has been investigated by several analytical techniques. The nitrogen atom of the NH moiety of piperazine group binds on the gold surface, as revealed by voltammetric and spectroscopic studies. The cfH-adsorbed particles are stable in the dry state as well as at room temperature, and as a result, redispersion is possible. The rate of release of the drug molecule from the nanoparticles is more in the basic medium than in pure water, and the kinetics depend on the size of the particle; faster desorption is seen in smaller particles. The bound cfH is fluorescent, and this property could be used in biological investigations. This study shows that metal nanoparticles could be useful carriers for cfH and fluoroquinolone molecules. Most of the bound molecules could be released over an extended period of time.

  2. Gold emissivities for hydrocode applications

    NASA Astrophysics Data System (ADS)

    Bowen, C.; Wagon, F.; Galmiche, D.; Loiseau, P.; Dattolo, E.; Babonneau, D.

    2004-10-01

    The Radiom model [M. Busquet, Phys Fluids B 5, 4191 (1993)] is designed to provide a radiative-hydrodynamic code with non-local thermodynamic equilibrium (non-LTE) data efficiently by using LTE tables. Comparison with benchmark data [M. Klapisch and A. Bar-Shalom, J. Quant. Spectrosc. Radiat. Transf. 58, 687 (1997)] has shown Radiom to be inaccurate far from LTE and for heavy ions. In particular, the emissivity was found to be strongly underestimated. A recent algorithm, Gondor [C. Bowen and P. Kaiser, J. Quant. Spectrosc. Radiat. Transf. 81, 85 (2003)], was introduced to improve the gold non-LTE ionization and corresponding opacity. It relies on fitting the collisional ionization rate to reproduce benchmark data given by the Averroès superconfiguration code [O. Peyrusse, J. Phys. B 33, 4303 (2000)]. Gondor is extended here to gold emissivity calculations, with two simple modifications of the two-level atom line source function used by Radiom: (a) a larger collisional excitation rate and (b) the addition of a Planckian source term, fitted to spectrally integrated Averroès emissivity data. This approach improves the agreement between experiments and hydrodynamic simulations.

  3. Gold nanoparticle mediated cancer immunotherapy.

    PubMed

    Almeida, Joao Paulo Mattos; Figueroa, Elizabeth Raquel; Drezek, Rebekah Anna

    2014-04-01

    Significant progress has been made in the field of cancer immunotherapy, where the goal is to activate or modulate the body's immune response against cancer. However, current immunotherapy approaches exhibit limitations of safety and efficacy due to systemic delivery. In this context, the use of nanotechnology for the delivery of cancer vaccines and immune adjuvants presents a number of advantages such as targeted delivery to immune cells, enhanced therapeutic effect, and reduced adverse outcomes. Recently, gold nanoparticles (AuNP) have been explored as immunotherapy carriers, creating new AuNP applications that merit a critical overview. This review highlights recent advances in the development of AuNP mediated immunotherapies that harness AuNP biodistribution, optical properties and their ability to deliver macromolecules such as peptides and oligonucleotides. It has been demonstrated that the use of AuNP carriers can improve the delivery and safety of immunotherapy agents, and that AuNP immunotherapies are well suited for synergistic combination therapy with existing cancer therapies like photothermal ablation. Cancer immunotherapy approaches are rapidly evolving and are some of the most promising avenues to approach malignancies. This review summarizes the role of gold nanoparticles in immunotherapy agent delivery, and in the development of synergistic therapies such as photothermal ablation. © 2013.

  4. Gold-nickel-titanium brazing alloy

    DOEpatents

    Mizuhara, Howard

    1995-01-03

    A brazing alloy in accordance with this invention has the following composition, by weight: 91 to 99 gold, 0.5 to 7% nickel; 0.10 to 2% titanium. Alternatively, with palladium present, the composition is as follows, by weight: 83 to 96% gold; 3 to 10% palladium; 0.5 to 5% nickel; 0.10 to 2% titanium.

  5. Gold-nickel-titanium brazing alloy

    DOEpatents

    Mizuhara, Howard

    1990-07-03

    A brazing alloy in accordance with this invention has the following composition, by weight: 91 to 99% gold, 0.5 to 7% nickel; 0.10 to 2% titanium. Alternatively, with palladium present, the composition is as follows, by weight: 83 to 96% gold; 3 to 10% palladium; 0.5 to 5% nickel; 0.10 to 2% titanium.

  6. The Gold Mining Camp: A Simulation Game.

    ERIC Educational Resources Information Center

    Stoltman, Joseph P.; Keach, Everett T., Jr.

    This economics simulation game complements the third grade Gold Mining Unit developed by Project Social Studies at the University of Minnesota. The simulation is designed for three purposes: 1) to reinforce the prior learning which occurs in the gold mining camp unit; 2) to involve eight-year-olds in the process of solving simulated economic…

  7. Sesquicentennial: Gold Rush to Golden Statehood.

    ERIC Educational Resources Information Center

    Sabato, George

    1998-01-01

    Provides an annotated bibliography of educational resources that can be used to support instructional units on the Gold Rush or the sesquicentennial of California's statehood. The materials include workbooks, videos, teacher's guides, monographs, and magazines. Offers a brief history of the Gold Rush and a set of relevant discussion questions.…

  8. Cellulose-gold nanoparticle hybrid materials.

    PubMed

    Van Rie, Jonas; Thielemans, Wim

    2017-06-29

    Cellulose and gold nanoparticles have exciting characteristics and new combinations of both materials may lead to promising functional nanocomposites with unique properties. We have reviewed current research on cellulose-gold nanoparticle composite materials, and we present an overview of the preparation methods of cellulose-gold composite materials and discuss their applications. We start with the nanocomposite fabrication methods, covering in situ gold reduction, blending, and dip-coating methods to prepare gold-cellulose nanocomposite hybrids. We then move on to a discussion of the ensuing properties where the combination of gold nanoparticles with cellulose results in functional materials with specific catalytic, antimicrobial, sensing, antioxidant and Surface Enhanced Raman Scattering (SERS) performance. Studies have also been carried out on orientationally ordered composite materials and on the chiral nematic phase behaviour of these nanocomposites. To exert even more control over the structure formation and the resultant properties of these functional materials, fundamental studies on the physico-chemical interactions of cellulose and gold are necessary to understand better the driving forces and limitations towards structuring of gold-cellulose hybrid materials.

  9. Gold-nickel-titanium brazing alloy

    DOEpatents

    Mizuhara, Howard

    1995-01-03

    A brazing alloy in accordance with this invention has the following composition, by weight: 91 to 99 gold, 0.5 to 7% nickel; 0.10 to 2% titanium. Alternatively, with palladium present, the composition is as follows, by weight: 83 to 96% gold; 3 to 10% palladium; 0.5 to 5% nickel; 0.10 to 2% titanium.

  10. RF Sputtering of Gold Contacts On Niobium

    NASA Technical Reports Server (NTRS)

    Barr, D. W.

    1983-01-01

    Reliable gold contacts are deposited on niobium by combination of RF sputtering and photolithography. Process results in structures having gold only where desired for electrical contact. Contacts are stable under repeated cycling from room temperature to 4.2 K and show room-temperature contact resistance as much as 40 percent below indium contacts made by thermalcompression bonding.

  11. A Placer-Gold Evaluation Exercise.

    ERIC Educational Resources Information Center

    Tunley, A. Tom

    1984-01-01

    A laboratory exercise allowing students to use drillhole data to simulate the process of locating a placer gold paystreak is presented. As part of the activity students arithmetically compute the value of their gold, mining costs, and personal profits or losses, and decide on development plans for the claim. (BC)

  12. Gold-Collar Workers. ERIC Digest.

    ERIC Educational Resources Information Center

    Wonacott, Michael E.

    The gold-collar worker has problem-solving abilities, creativity, talent, and intelligence; performs non-repetitive and complex work difficult to evaluate; and prefers self management. Gold-collar information technology workers learn continually from experience; recognize the synergy of teams; can demonstrate leadership; and are strategic thinkers…

  13. Preparation of conductive gold nanowires in confined environment of gold-filled polymer nanotubes.

    PubMed

    Mitschang, Fabian; Langner, Markus; Vieker, Henning; Beyer, André; Greiner, Andreas

    2015-02-01

    Continuous conductive gold nanofibers are prepared via the "tubes by fiber templates" process. First, poly(l-lactide) (PLLA)-stabilized gold nanoparticles (AuNP) with over 60 wt% gold are synthesized and characterized, including gel permeation chromatography coupled with a diode array detector. Subsequent electrospinning of these AuNP with template PLLA results in composite nanofibers featuring a high gold content of 57 wt%. Highly homogeneous gold nanowires are obtained after chemical vapor deposition of 345 nm of poly(p-xylylene) (PPX) onto the composite fibers followed by pyrolysis of the polymers at 1050 °C. The corresponding heat-induced transition from continuous gold-loaded polymer tubes to smooth gold nanofibers is studied by transmission electron microscopy and helium ion microscopy using both secondary electrons and Rutherford backscattered ions.

  14. Gold of the Pharaohs 6000 years of gold mining in Egypt and Nubia

    NASA Astrophysics Data System (ADS)

    Klemm, Dietrich; Klemm, Rosemarie; Murr, Andreas

    2001-08-01

    The legendary wealth in gold of ancient Egypt seems to correspond with an unexpected high number of gold production sites in the Eastern Desert of Egypt and Nubia. This contribution introduces briefly the general geology of these vast regions and discusses the geology of the different varieties of the primary gold occurrences (always related to auriferous quartz mineralization in veins or shear zones) as well as the variable physico-chemical genesis of the gold concentrations. The development of gold mining over time, from Predynastic (ca. 3000 BC) until the end of Arab gold production times (about 1350 AD), including the spectacular Pharaonic periods is outlined, with examples of its remaining artefacts, settlements and mining sites in remote regions of the Eastern Desert of Egypt and Nubia. Finally, some estimates on the scale of gold production are presented.

  15. Ordering Gold Nanoparticles with DNA Origami Nanoflowers.

    PubMed

    Schreiber, Robert; Santiago, Ibon; Ardavan, Arzhang; Turberfield, Andrew J

    2016-08-23

    Nanostructured materials, including plasmonic metamaterials made from gold and silver nanoparticles, provide access to new materials properties. The assembly of nanoparticles into extended arrays can be controlled through surface functionalization and the use of increasingly sophisticated linkers. We present a versatile way to control the bonding symmetry of gold nanoparticles by wrapping them in flower-shaped DNA origami structures. These "nanoflowers" assemble into two-dimensonal gold nanoparticle lattices with symmetries that can be controlled through auxiliary DNA linker strands. Nanoflower lattices are true composites: interactions between the gold nanoparticles are mediated entirely by DNA, and the DNA origami will fold into its designed form only in the presence of the gold nanoparticles.

  16. Magnetically mediated vortexlike assembly of gold nanoshells.

    PubMed

    Sun, Jianfei; Dong, Jian; Sun, Dongke; Guo, Zhirui; Gu, Ning

    2012-04-24

    Gold nanoshells currently attract increasing research interests due to the important role in many subjects. For practical applications, random arrangement of the nanoparticles is often unfavored so that the assembly of gold nanoshells is becoming a central issue. We here proposed to utilize time-variant magnetic field to direct the assembly of gold nanoshells. It was discovered that the alternating magnetic field can mediate the vortex-like assembly of gold nanoshells. The mechanism was explored and thought to be relative with the electric field of induction which caused the thermal gradient on the substrate and the electric force. The vortexlike structure as well as the assembly mechanism will play an important role in research and application of gold nanomaterials.

  17. The interaction of gold with gallium arsenide

    NASA Technical Reports Server (NTRS)

    Weizer, Victor G.; Fatemi, Navid S.

    1988-01-01

    Gold and gold-based alloys, commonly used as solar-cell contact materials, are known to react readily with gallium arsenide. Experiments designed to identify the mechanisms involved in these GaAs-metal interactions have yielded several interesting results. It is shown that the reaction of GaAs with gold takes place via a dissociative diffusion process. It is shown further that the GaAs-metal reaction rate is controlled to a very great extent by the condition of the free surface of the contact metal, an interesting example of which is the previously unexplained increase in the reaction rate that has been observed for samples annealed in a vacuum environment as compared to those annealed in a gaseous ambient. A number of other hard-to-explain observations, such as the low-temperature formation of voids in the gold lattice and crystallite growth on the gold surface, are also explained by invoking this mechanism.

  18. Synthesis of camptothecin-loaded gold nanomaterials

    NASA Astrophysics Data System (ADS)

    Xing, Zhimin; Liu, Zhiguo; Zu, Yuangang; Fu, Yujie; Zhao, Chunjian; Zhao, Xiuhua; Meng, Ronghua; Tan, Shengnan

    2010-04-01

    Camptothecin-loaded gold nanomaterials have been synthesized by the sodium borohydride reduction method under a strong basic condition. The obtained gold nanomaterials have been characterized by transmission electron microscopy (TEM), atomic force microscopy (AFM) and UV-vis absorption spectroscopy. The camptothecin-loaded gold colloidal solution was very stable and can be stored for more than two months at room temperature without obvious changes. The color of the colloidal solution can change from wine red to purple and blue during the acidifying process. It was revealed that the release of camptothecin and the aggregation of gold nanoparticles can be controlled by tuning the solution pH. The present study implied that the gold nanomaterials can be used as the potential carrier for CPT delivery.

  19. COMPLICATIONS OF GOLD THERAPY AND THEIR MANAGEMENT

    PubMed Central

    Kuzell, William C.

    1949-01-01

    Early recognition of manifestations of gold intoxication is important to the treatment of such complications. Proper dosage schedules should be followed and blood and urine frequently examined. Most toxic manifestations subside, but those which become worse or which do not subside on withdrawal of the gold should be treated with BAL (2, 3-Dimercaptopropanol). BAL has a toxicity of its own and is painful on injection. Since BAL combines with gold, the therapeutic effect of the metal may be lost after such treatment. The beneficial effects of methionine and methionine plus BAL in treatment of experimentally induced gold intoxication of animals suggests such combined therapy in the treatment of clinical complications of gold poisoning. A schedule of combined antidotes is outlined. PMID:18134898

  20. Tailored nanoporous gold for ultrahigh fluorescence enhancement.

    PubMed

    Lang, X Y; Guan, P F; Fujita, T; Chen, M W

    2011-03-07

    We report molecular fluorescence enhancement of free-standing nanoporous gold in which the nanoporosity can be arbitrarily tailored by the combination of dealloying and electroless gold plating. The nanoporous gold fabricated by this facile method possesses unique porous structures with large gold ligaments and very small pores, and exhibits significant improvements in surface enhanced fluorescence as well as structure rigidity. It demonstrates that the confluence effect of improved quantum yield and excitation of fluorophores is responsible for the large fluorescence enhancement due to the near-field enhancement of nanoporous gold, which arises from the strong electromagnetic coupling between neighboring ligaments and the weakening of plasmon damping of the large ligaments because of the small pore size and large ligament size, respectively.

  1. Molecular Beam Optical Study of Gold Sulfide and Gold Oxide

    NASA Astrophysics Data System (ADS)

    Zhang, Ruohan; Yu, Yuanqin; Steimle, Timothy

    2016-06-01

    Gold-sulfur and gold-oxygen bonds are key components to numerous established and emerging technologies that have applications as far ranging as medical imaging, catalysis, electronics, and material science. A major theoretical challenge for describing this bonding is correctly accounting for the large relativistic and electron correlation effects. Such effects are best studied in diatomic, AuX, molecules. Recently, the observed AuS electronic state energy ordering was measured and compared to a simple molecular orbital diagram prediction. Here we more thoroughly investigate the nature of the electronic states of both AuS and AuO from the analysis of high-resolution (FWHM\\cong35MHz) optical Zeeman spectroscopy of the (0,0){B}2Σ--{X}2Π3/2 bands. The determined fine and hyperfine parameters for the {B}2Σ- state of AuO differ from those extracted from the analysis of a hot, Doppler-limited, spectrum. It is demonstrated that the nature of the {B}2Σ- states of AuO and AuS are radically different. The magnetic tuning of AuO and AuS indicates that the {B}2Σ- states are heavily contaminated. Supported by the National Science Foundation under Grant No.1265885. D. L. Kokkin, R. Zhang, T. C. Steimle, I. A. Wyse, B. W. Pearlman and T. D. Varberg, J. Phys. Chem. A., 119(48), 4412, 2015. L. C. O'Brien, B. A. Borchert, A. Farquhar, S. Shaji, J. J. O'Brien and R. W. Field, J. Mol. Spectrosc., 252(2), 136, 2008

  2. Gold's future role in fuel cell systems

    NASA Astrophysics Data System (ADS)

    Cameron, Don; Holliday, Richard; Thompson, David

    Innovative recent research has suggested that gold-based catalysts are potentially capable of being effectively employed in fuel cells and related hydrogen fuel processing. The justification for developing the gold catalyst technologies described, is not only based on their promising technical performance, but also the relatively low stable price and greater availability of gold compared with the platinum group metals. The employment of gold catalysts could therefore produce a welcome reduction in the capital cost of fuel cell installations. The most likely first use for gold catalysts is for the removal of carbon monoxide impurities from the hydrogen feedstock streams used for fuel cells. Such hydrogen is usually obtained from reforming reactions (from hydrocarbons or methanol) either from free-standing plant or from an on-board reformer in a vehicle in the case of transport applications. Absence of carbon monoxide would enable fuel cells to run at lower temperatures and with improved efficiency. Effectiveness of gold catalysts in this application has already been demonstrated. Preferential oxidation (PROX) of carbon monoxide in hydrogen-rich reformer gas is best effected by a gold catalyst (Au/α-Fe 2O 3) which is significantly more active at lower temperatures than the commercial PROX catalyst, i.e. Pt/γ-Al 2O 3 currently used for this purpose. Supported gold catalysts are also very active in the water gas shift reaction used for producing hydrogen from carbon monoxide and water. Research has shown that gold supported on iron oxide (Au/α-Fe 2O 3) catalyst is more active at lower temperatures than both the α-Fe 2O 3 support and the mixed copper/zinc oxide (CuO/ZnO) catalyst currently used commercially. Preparation of gold on iron oxide and gold on titania (Au/Fe 2O 3 and Au/TiO 2) by deposition-precipitation produces more active catalysts than by conventional co-precipitation. Other applications for gold in fuel cells are described and include its use as a

  3. Are GOLD ABCD groups better associated with health status and costs than GOLD 1234 grades? A cross-sectional study.

    PubMed

    Boland, Melinde R S; Tsiachristas, Apostolos; Kruis, Annemarije L; Chavannes, Niels H; Rutten-van Mölken, Maureen P M H

    2014-03-01

    To investigate the association of the GOLD ABCD groups classification with costs and health-related quality of life (HR-QoL) and to compare this with the GOLD 1234 grades classification that was primarily based on lung function only. In a cross-sectional study, we selected patients diagnosed with chronic obstructive pulmonary disease (COPD) from electronic medical records of general practices. Multi-level analysis was used with costs (medication, primary care, healthcare, societal), diseasespecific and generic HR-QoL as independent variables. Either the new or the old GOLD stages were included in the analysis together with several covariates (age, gender, living situation, co-morbidity, self-efficacy, smoking, education, employment). 611 patients from 28 general practices were categorised as GOLD-A (n=333), GOLD-B (n=110), GOLD-C (n=80) and GOLD-D (n=88). Patients in the GOLD-B and GOLD-D groups had the highest prevalence of co-morbidities and the lowest level of physical activity, self-efficacy, and employment. The models with GOLD ABCD groups were more strongly related to and explained more variance in costs and in disease-specific and generic HR-QoL than the models with GOLD 1234 grades. The mean Clinical COPD Questionnaire score worsened significantly, with scores 1.04 (GOLD-B), 0.4 (GOLD-C) and 1.21 (GOLD-D) worse than for patients in GOLD-A. Healthcare costs per patient were significantly higher in GOLD-B (72%), GOLD-C (74%) and GOLD-D (131%) patients than in GOLD-A patients. The GOLD ABCD groups classification is more closely associated with costs and HR-QoL than the GOLD 1234 grades classification. Furthermore, patients with GOLD-C had a better HR-QoL than those with GOLD-B but the costs of the two groups did not differ.

  4. Cancer theranostics with gold nanoshells.

    PubMed

    Zhao, Jun; Wallace, Michael; Melancon, Marites P

    2014-09-01

    Gold nanoshells (AuNSs) present a vivid example of integrating nanoscience in order to solve a biomedical problem. AuNSs exhibit tunable surface plasmon resonance, which can be tuned to the near-infrared region in order to realize optimal tissue penetration. The highly efficient light-to-heat transformation by AuNSs during laser irradiation causes thermal damage to the tumor without damaging healthy organs. Transient nanobubbles can form around AuNSs during laser treatment and induce mechanical stress specifically in tumor cells. AuNSs also serve as a versatile platform for the delivery of various diagnostic and therapeutic agents. In this article, we describe the physicochemical properties of AuNSs in the context of their design, preparation and application in cancer theranostics. Ultimately, we look beyond the current research on AuNSs and discussed future challenges to their successful translation into clinical use.

  5. Citrate-Stabilized Gold Nanorods

    PubMed Central

    2015-01-01

    Stable aqueous dispersions of citrate-stabilized gold nanorods (cit-GNRs) have been prepared in scalable fashion by surfactant exchange from cetyltrimethylammonium bromide (CTAB)-stabilized GNRs, using polystyrenesulfonate (PSS) as a detergent. The surfactant exchange process was monitored by infrared spectroscopy, surface-enhanced Raman scattering (SERS), and X-ray photoelectron spectroscopy (XPS). The latter established the quantitative displacement of CTAB (by PSS) and of PSS (by citrate). The Cit-GNRs are indefinitely stable at low ionic strength, and are conducive to further ligand exchange without loss of dispersion stability. The reliability of the surface exchange process supports the systematic analysis of ligand structure on the hydrodynamic size of GNRs, as described in a companion paper. PMID:25254292

  6. Gold nanoparticles in cardiovascular imaging.

    PubMed

    Varna, Mariana; Xuan, Hoa V; Fort, Emmanuel

    2017-04-06

    Although originally applied in the field of oncology, recent results have illustrated the considerable potential of gold nanoparticles (GNPs) in the imaging of cardiovascular diseases (CVDs). CVDs represent the leading cause of mortality and disability in the world. The principal cause underpinning CVDs is atherosclerosis, which develops into mid and large blood vessels, often leading to severe complications. Thanks to their unique physicochemical properties, GNPs have drawn much attention from the research community in cardiovascular imaging. Thus, the optical properties of GNPs have led to their utilization as contrast agents for optical or X-ray imaging modalities allowing the detection of atherosclerotic plaques, intravascular thrombus, or fibrotic tissue. In this study, we detail the most promising preclinical scientific progresses based on the use of GNPs for imaging in cardiovascular field and their improvements for a potential clinical application. For further resources related to this article, please visit the WIREs website.

  7. Laser printing single gold nanoparticles.

    PubMed

    Urban, Alexander S; Lutich, Andrey A; Stefani, Fenando D; Feldmann, Jochen

    2010-12-08

    Current colloidal synthesis is able to produce an extensive spectrum of nanoparticles with unique optoelectronic, magnetic, and catalytic properties. In order to exploit them in nanoscale devices, flexible methods are needed for the controlled integration of nanoparticles on surfaces with few-nanometer precision. Current technologies usually involve a combination of molecular self-assembly with surface patterning by diverse lithographic methods like UV, dip-pen, or microcontact printing.(1,2) Here we demonstrate the direct laser printing of individual colloidal nanoparticles by using optical forces for positioning and the van der Waals attraction for binding them to the substrate. As a proof-of-concept, we print single spherical gold nanoparticles with a positioning precision of 50 nm. By analyzing the printing mechanism, we identify the key physical parameters controlling the method, which has the potential for the production of nanoscale devices and circuits with distinct nanoparticles.

  8. Gold-catalyzed naphthalene functionalization

    PubMed Central

    Rivilla, Iván

    2011-01-01

    Summary The complexes IPrMCl (IPr = 1,3-bis(diisopropylphenyl)imidazol-2-ylidene, M = Cu, 1a; M = Au, 1b), in the presence of one equiv of NaBAr'4 (Ar' = 3,5-bis(trifluoromethyl)phenyl), catalyze the transfer of carbene groups: C(R)CO2Et (R = H, Me) from N2C(R)CO2Et to afford products that depend on the nature of the metal center. The copper-based catalyst yields exclusively a cycloheptatriene derivative from the Buchner reaction, whereas the gold analog affords a mixture of products derived either from the formal insertion of the carbene unit into the aromatic C–H bond or from its addition to a double bond. In addition, no byproducts derived from carbene coupling were observed. PMID:21647320

  9. Exposure to metallic gold in patients with contact allergy to gold sodium thiosulfate.

    PubMed

    Ahnlide, I; Björkner, B; Bruze, M; Möller, H

    2000-12-01

    Gold allergy is common, with approximately 10% of patients patch tested because of eczematous disease being positive to gold sodium thiosulfate (GSTS). However, clinical relevance seems to be rare. The aim of this prospective double-blind study was to demonstrate the effects of exposure to metallic gold, in this case earrings, in gold-positive patients. 60 female patients with pierced earlobes test-positive to GSTS were included in the study. The patients were randomized into 2 groups, 30 patients receiving earrings with a surface layer consisting of 24-carat gold and 30 patients earrings with a surface layer of titanium nitride, virtually indistinguishable from gold. The patients wore the earrings for 8 weeks. During the study, any dermatitis on the earlobes, as well as on other body sites, was registered. The skin reactions observed were weak but, in total, 17 of the 60 patients had a skin reaction (local or remote) during the study, 12 of whom had received gold earrings and 5 titanium (p<0.05). 11 patients had a reaction on the earlobes, 7 of whom had received gold earrings and 4 titanium (NS). With these facts it is hard to exclude that exposure to gold jewelry can be clinically relevant in persons hypersensitive to gold.

  10. Origin of the transition voltage in gold-vacuum-gold atomic junctions.

    PubMed

    Wu, Kunlin; Bai, Meilin; Sanvito, Stefano; Hou, Shimin

    2013-01-18

    The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments.

  11. Alkanetelluroxide-protected gold nanoparticles.

    PubMed

    Li, Ying; Silverton, Latoya C; Haasch, Richard; Tong, Yu Ye

    2008-07-15

    The synthesis and characterization of the first air-stable tellurium-containing ligand-protected gold nanoparticles (NPs) are reported. Although the synthesis largely followed the well-known Brust two-phase approach, the starting ligand was dioctyl ditelluride rather than alkanetellurol, which is an analogue of the widely used alkanethiol. Dioctyl ditelluride was used because alkanetellurol is unstable. The 1H and 13C NMR spectra, as well as infrared spectra (IR) of the formed Au NPs, indicated that the Te-Te bond in the starting ligand was broken but the octyl group was intact. This was further corroborated by the solid-state 125Te NMR spectrum that displayed a very broad and significantly downfield-shifted peak, indicating that tellurium was directly bound to the Au core. Furthermore, the O 1s and Te 3d XPS spectra of the Au NPs indicated that the capping ligands were octanetelluroxide. An average particle size of 2.7 nm diameter as measured by transmission electron microscopy (TEM) corresponded to an Au607 core. A two-step weight loss of approximately 22.2% in total was observed in the thermogravimetric analysis, which indicated about 53% ligand monolayer coverage (i.e., Au607(Te(=O)C8H17)133). Additionally, dioctyl ditelluride demonstrated an intriguing reductive power that led to a more sophisticated chemistry of forming the air-stable octanetelluroxide-protected gold NPs. It has been found that (1) when the ratio of Au to Te was about 1.5 a colorless intermediate state similar to Au(I)-SR (the intermediate state widely accepted in the synthesis of thiolate-protected Au NPs) could be obtained and (2) this kind of intermediate state played a key role in the formation of stable Au NPs.

  12. Nature vs. nurture: gold perpetuates "stemness".

    PubMed

    Paul, Willi; Sharma, Chandra P; Deb, Kaushik Dilip

    2011-01-01

    Adult tissues contain quiescent reservoirs of multipotent somatic stem cells and pluripotent embryonic-like stem cells (ELSCs). Credited with regenerative properties gold is used across both -contemporary and -ancient medicines. Here, we show that gold exerted these effects by enhancing the pool of pluripotent ELSC while improving their stemness. We used hESCs as an in-vitro model to understand if gold could enhance self-renewal and pluripotency. Swarna-bhasma (SB), an ancient Indian gold microparticulate (41.1 nm), preparation, reduced spontaneous-differentiation, improved self-renewal, pluripotency and proliferation of hESCs. Colloidal gold-nanoparticles (GNP) (15.59 nm) were tested to confirm that the observations were attributable to nanoparticulate-gold. SB and GNP exposure: maintained -stemness, -karyotypic stability, enhanced pluripotency till day-12, increased average colony-sizes, and reduced the number of autonomously-derived differentiated FGFR1 positive fibroblast-niche-cells/colony. Particulate-gold induced upregulation of FGFR1 and IGF2 expression, and decrease in IGF1 secretion indicates IGF1/2 mediated support for enhanced pluripotency and self-renewal in hESCs.

  13. Gold nanoparticles produced in a microalga

    NASA Astrophysics Data System (ADS)

    Luangpipat, Tiyaporn; Beattie, Isabel R.; Chisti, Yusuf; Haverkamp, Richard G.

    2011-12-01

    An efficient biological route to production of gold nanoparticles which allows the nanoparticles to be easily recovered remains elusive. Live cells of the green microalga Chlorella vulgaris were incubated with a solution of gold chloride and harvested by centrifugation. Nanoparticles inside intact cells were identified by transmission electron microscopy and confirmed to be metallic gold by synchrotron based X-ray powder diffraction and X-ray absorption spectroscopy. These intracellular gold nanoparticles were 40-60 nm in diameter. At a concentration of 1.4% Au in the alga, a better than 97% recovery of the gold from solution was achieved. A maximum of 4.2% Au in the alga was obtained. Exposure of C. vulgaris to solutions containing dissolved salts of palladium, ruthenium, and rhodium also resulted in the production of the corresponding nanoparticles within the cells. These were surmised to be also metallic, but were produced at a much lower intracellular concentration than achieved with gold. Iridium was apparently toxic to the alga. No nanoparticles were observed using platinum solutions. C. vulgaris provides a possible route to large scale production of gold nanoparticles.

  14. Functionalization of gold nanoparticles as antidiabetic nanomaterial.

    PubMed

    Venkatachalam, M; Govindaraju, K; Mohamed Sadiq, A; Tamilselvan, S; Ganesh Kumar, V; Singaravelu, G

    2013-12-01

    In the present investigation, functionalization of gold nanoparticles synthesized using propanoic acid 2-(3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl) (PAT) an active biocomponent isolated from Cassia auriculata is studied in detail. On reaction of PAT with aqueous HAuCl4, rapid formation of stable gold nanoparticles was achieved. Formation of gold nanoparticles was confirmed by UV-vis spectroscopy, XRD, GC-MS,FTIR, TEM and SEM with EDAX. Gold nanoparticles mostly were monodisperse, spherical in shape and ranged in size 12-41 nm. Gold nanoparticles synthesised using PAT was administered to alloxan (150 mg/kg body weight) induced diabetic male albino rats at different doses (0.25, 0.5, 0.75 and 1.0mg/kg body weight) for 28 days. Plasma glucose level, cholesterol and triglyceride were significantly (p<0.001) reduced in experimental animals treated with gold nanoparticles at dosage of 0.5mg/kg body weight and plasma insulin increased significantly. The newly genre green gold nanoparticles exhibit remarkable protein tyrosine phosphatase 1B inhibitory activity.

  15. Functionalization of gold nanoparticles as antidiabetic nanomaterial

    NASA Astrophysics Data System (ADS)

    Venkatachalam, M.; Govindaraju, K.; Mohamed Sadiq, A.; Tamilselvan, S.; Ganesh Kumar, V.; Singaravelu, G.

    2013-12-01

    In the present investigation, functionalization of gold nanoparticles synthesized using propanoic acid 2-(3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl) (PAT) an active biocomponent isolated from Cassia auriculata is studied in detail. On reaction of PAT with aqueous HAuCl4, rapid formation of stable gold nanoparticles was achieved. Formation of gold nanoparticles was confirmed by UV-vis spectroscopy, XRD, GC-MS, FTIR, TEM and SEM with EDAX. Gold nanoparticles mostly were monodisperse, spherical in shape and ranged in size 12-41 nm. Gold nanoparticles synthesised using PAT was administered to alloxan (150 mg/kg body weight) induced diabetic male albino rats at different doses (0.25, 0.5, 0.75 and 1.0 mg/kg body weight) for 28 days. Plasma glucose level, cholesterol and triglyceride were significantly (p < 0.001) reduced in experimental animals treated with gold nanoparticles at dosage of 0.5 mg/kg body weight and plasma insulin increased significantly. The newly genre green gold nanoparticles exhibit remarkable protein tyrosine phosphatase 1B inhibitory activity.

  16. Annealing of gold nanostructures sputtered on polytetrafluoroethylene

    PubMed Central

    2011-01-01

    Gold nanolayers sputtered on polytetrafluoroethylene (PTFE) surface and their changes induced by post-deposition annealing at 100°C to 300°C are studied. Changes in surface morphology and roughness are examined by atomic force microscopy, electrical sheet resistance by two point technique, zeta potential by electrokinetic analysis and chemical composition by X-ray photoelectron spectroscopy (XPS) in dependence on the gold layer thickness. Transition from discontinuous to continuous gold coverage takes place at the layer thicknesses 10 to 15 nm and this threshold remains practically unchanged after the annealing at the temperatures below 200°C. The annealing at 300°C, however, leads to significant rearrangement of the gold layer and the transition threshold increases to 70 nm. Significant carbon contamination and the presence of oxidized structures on gold-coated samples are observed in XPS spectra. Gold coating leads to a decrease in the sample surface roughness. Annealing at 300°C of pristine PTFE and gold-coated PTFE results in significant increase of the sample surface roughness. PMID:22078024

  17. Gold metal liquid-like droplets.

    PubMed

    Smirnov, Evgeny; Scanlon, Micheál D; Momotenko, Dmitry; Vrubel, Heron; Méndez, Manuel A; Brevet, Pierre-Francois; Girault, Hubert H

    2014-09-23

    Simple methods to self-assemble coatings and films encompassing nanoparticles are highly desirable in many practical scenarios, yet scarcely any examples of simple, robust approaches to coat macroscopic droplets with continuous, thick (multilayer), reflective and stable liquid nanoparticle films exist. Here, we introduce a facile and rapid one-step route to form films of reflective liquid-like gold that encase macroscopic droplets, and we denote these as gold metal liquid-like droplets (MeLLDs). The present approach takes advantage of the inherent self-assembly of gold nanoparticles at liquid-liquid interfaces and the increase in rates of nanoparticle aggregate trapping at the interface during emulsification. The ease of displacement of the stabilizing citrate ligands by appropriate redox active molecules that act as a lubricating molecular glue is key. Specifically, the heterogeneous interaction of citrate stabilized aqueous gold nanoparticles with the lipophilic electron donor tetrathiafulvalene under emulsified conditions produces gold MeLLDs. This methodology relies exclusively on electrochemical reactions, i.e., the oxidation of tetrathiafulvalene to its radical cation by the gold nanoparticle, and electrostatic interactions between the radical cation and nanoparticles. The gold MeLLDs are reversibly deformable upon compression and decompression and kinetically stable for extended periods of time in excess of a year.

  18. Gold nano-particles fixed on glass

    NASA Astrophysics Data System (ADS)

    Worsch, Christian; Wisniewski, Wolfgang; Kracker, Michael; Rüssel, Christian

    2012-09-01

    A simple process for producing wear resistant gold nano-particle coatings on transparent substrates is proposed. Soda-lime-silica glasses were sputtered with gold and subsequently coated with SiO2 using a combustion chemical vapor deposition technique. Some samples were first coated with silica, sputtered with gold and then coated with a second layer of silica. The samples were annealed for 20 min at either 550 or 600 °C. This resulted in the formation of round, well separated gold nano-particles with sizes from 15 to 200 nm. The color of the coated glass was equivalent to that of gold-ruby glasses. Silica/gold/silica coatings annealed at 600 °C for 20 min were strongly adherent and scratch resistant. X-ray diffraction and electron backscatter diffraction (EBSD) were used to describe the crystal orientations of the embedded particles. The gold particles are preferably oriented with their (1 1 1) planes perpendicular to the surface.

  19. Gel Electrophoresis of Gold-DNA Nanoconjugates

    DOE PAGES

    Pellegrino, T.; Sperling, R. A.; Alivisatos, A. P.; ...

    2007-01-01

    Gold-DNA conjugates were investigated in detail by a comprehensive gel electrophoresis study based on 1200 gels. A controlled number of single-stranded DNA of different length was attached specifically via thiol-Au bonds to phosphine-stabilized colloidal gold nanoparticles. Alternatively, the surface of the gold particles was saturated with single stranded DNA of different length either specifically via thiol-Au bonds or by nonspecific adsorption. From the experimentally determined electrophoretic mobilities, estimates for the effective diameters of the gold-DNA conjugates were derived by applying two different data treatment approaches. The first method is based on making a calibration curve for the relation between effectivemore » diameters and mobilities with gold nanoparticles of known diameter. The second method is based on Ferguson analysis which uses gold nanoparticles of known diameter as reference database. Our study shows that effective diameters derived from gel electrophoresis measurements are affected with a high error bar as the determined values strongly depend on the method of evaluation, though relative changes in size upon binding of molecules can be detected with high precision. Furthermore, in this study, the specific attachment of DNA via gold-thiol bonds to Au nanoparticles is compared to nonspecific adsorption of DNA. Also, the maximum number of DNA molecules that can be bound per particle was determined.« less

  20. Gold nanoparticles extraction from dielectric scattering background

    NASA Astrophysics Data System (ADS)

    Hong, Xin; Wang, Jingxin

    2014-11-01

    The unique advantages such as brightness, non-photobleaching, good bio-compatibility make gold nanoparticles desirable labels and play important roles in biotech and related research and applications. Distinguishing gold nanoparticles from other dielectric scattering particles is of more importance, especially in bio-tracing and imaging. The enhancement image results from the localized surface plasmon resonance associated with gold nanopartilces makes themselves distinguishable from other dielectric particles, based on which, we propose a dual-wavelength detection method by employing a high sensitive cross-polarization microscopy.

  1. Colloidal-gold electrosensor measuring device

    DOEpatents

    Wegner, Steven; Harpold, Michael A.; McCaffrey, Terence M.; Morris, Susan E.; Wojciechowski, Marek; Zhao, Junguo; Henkens, Robert W.; Naser, Najih; O'Daly, John P.

    1995-01-01

    The present invention provides a new device for use in measuring lead levels in biological and environmental samples. Using square wave coulometry and colloidal gold particles impregnated on carbon electrodes, the present invention provides a rapid, reliable, portable and inexpensive means of detecting low lead levels. The colloidal gold modified electrodes have microelectrode array characteristics and produce significantly higher stripping detection signals for lead than are produced at bulk gold electrode surfaces. The method is effective in determining levels of lead down to at least 5 .mu.g/dL in blood samples as small as 10 .mu.L.

  2. Formation of tellurium-gold necklaces

    NASA Astrophysics Data System (ADS)

    Ramasamy, Radha Perumal

    2017-05-01

    In this article the reactivity of Tellurium Nanowires (Te NWs) with gold has been investigated. The reactivity of Tellurium Nanowires with HAuCl4 and NaOH was investigated. Characterization was made using TEM. It was observed that the morphology of the Te NWs depended upon NaOH used for reduction of gold. When no NaOH was added the tellurium rods were not affected in their shapes. However, inclusion of NaOH resulted in greater reduction of gold on Tellurium nanowires resulting in formation of necklace like structures.

  3. Designing Hollow Nano Gold Golf Balls

    PubMed Central

    2015-01-01

    Hollow/porous nanoparticles, including nanocarriers, nanoshells, and mesoporous materials have applications in catalysis, photonics, biosensing, and delivery of theranostic agents. Using a hierarchical template synthesis scheme, we have synthesized a nanocarrier mimicking a golf ball, consisting of (i) solid silica core with a pitted gold surface and (ii) a hollow/porous gold shell without silica. The template consisted of 100 nm polystyrene beads attached to a larger silica core. Selective gold plating of the core followed by removal of the polystyrene beads produced a golf ball-like nanostructure with 100 nm pits. Dissolution of the silica core produced a hollow/porous golf ball-like nanostructure. PMID:24937196

  4. Electrically Conductive Polyimide Films Containing Gold Surface

    NASA Technical Reports Server (NTRS)

    Caplan, Maggie L.; Stoakley, Diane M.; St. Clair, Anne K.

    1994-01-01

    Polyimide films exhibiting high thermo-oxidative stability and including electrically conductive surface layers containing gold made by casting process. Many variations of basic process conditions, ingredients, and sequence of operations possible, and not all resulting versions of process yield electrically conductive films. Gold-containing layer formed on film surface during cure. These metallic gold-containing polyimides used in film and coating applications requiring electrical conductivity, high reflectivity, exceptional thermal stability, and/or mechanical integrity. They also find commercial potential in areas ranging from thin films for satellite antennas to decorative coatings and packaging.

  5. Colloidal-gold electrosensor measuring device

    DOEpatents

    Wegner, S.; Harpold, M.A.; McCaffrey, T.M.; Morris, S.E.; Wojciechowski, M.; Zhao, J.; Henkens, R.W.; Naser, N.; O`Daly, J.P.

    1995-11-21

    The present invention provides a new device for use in measuring lead levels in biological and environmental samples. Using square wave coulometry and colloidal gold particles impregnated on carbon electrodes, the present invention provides a rapid, reliable, portable and inexpensive means of detecting low lead levels. The colloidal gold modified electrodes have microelectrode array characteristics and produce significantly higher stripping detection signals for lead than are produced at bulk gold electrode surfaces. The method is effective in determining levels of lead down to at least 5 {micro}g/dL in blood samples as small as 10 {micro}L. 9 figs.

  6. Biosynthesis of Gold Nanoparticles Using Pseudomonas Aeruginosa

    SciTech Connect

    Abd El-Aziz, M.; Badr, Y.; Mahmoud, M. A.

    2007-02-14

    Pseudomonas aeruginosa were used for extracellular biosynthesis of gold nanoparticles (Au NPs). Consequently, Au NPs were formed due to reduction of gold ion by bacterial cell supernatant of P. aeruginos ATCC 90271, P. aeruginos (2) and P. aeruginos (1). The UV-Vis. and fluorescence spectra of the bacterial as well as chemical prepared Au NPs were recorded. Transmission electron microscopy (TEM) micrograph showed the formation of well-dispersed gold nanoparticles in the range of 15-30 nm. The process of reduction being extracellular and may lead to the development of an easy bioprocess for synthesis of Au NPs.

  7. Designing hollow nano gold golf balls.

    PubMed

    Landon, Preston B; Mo, Alexander H; Zhang, Chen; Emerson, Chris D; Printz, Adam D; Gomez, Alan F; DeLaTorre, Christopher J; Colburn, David A M; Anzenberg, Paula; Eliceiri, Matthew; O'Connell, Connor; Lal, Ratnesh

    2014-07-09

    Hollow/porous nanoparticles, including nanocarriers, nanoshells, and mesoporous materials have applications in catalysis, photonics, biosensing, and delivery of theranostic agents. Using a hierarchical template synthesis scheme, we have synthesized a nanocarrier mimicking a golf ball, consisting of (i) solid silica core with a pitted gold surface and (ii) a hollow/porous gold shell without silica. The template consisted of 100 nm polystyrene beads attached to a larger silica core. Selective gold plating of the core followed by removal of the polystyrene beads produced a golf ball-like nanostructure with 100 nm pits. Dissolution of the silica core produced a hollow/porous golf ball-like nanostructure.

  8. Electrochemical control of creep in nanoporous gold

    SciTech Connect

    Ye, Xing-Long; Jin, Hai-Jun

    2013-11-11

    We have investigated the mechanical stability of nanoporous gold (npg) in an electrochemical environment, using in situ dilatometry and compression experiments. It is demonstrated that the gold nano-ligaments creep under the action of surface stress which leads to spontaneous volume contractions in macroscopic npg samples. The creep of npg, under or without external forces, can be controlled electrochemically. The creep rate increases with increasing potential in double-layer potential region, and deceases to almost zero when the gold surface is adsorbed with oxygen. Surprisingly, we also noticed a correlation between creep and surface diffusivity, which links the deformation of nanocrystals to mobility of surface atoms.

  9. Electrically Conductive Polyimide Films Containing Gold Surface

    NASA Technical Reports Server (NTRS)

    Caplan, Maggie L.; Stoakley, Diane M.; St. Clair, Anne K.

    1994-01-01

    Polyimide films exhibiting high thermo-oxidative stability and including electrically conductive surface layers containing gold made by casting process. Many variations of basic process conditions, ingredients, and sequence of operations possible, and not all resulting versions of process yield electrically conductive films. Gold-containing layer formed on film surface during cure. These metallic gold-containing polyimides used in film and coating applications requiring electrical conductivity, high reflectivity, exceptional thermal stability, and/or mechanical integrity. They also find commercial potential in areas ranging from thin films for satellite antennas to decorative coatings and packaging.

  10. Mechanical characterization of a single gold nanowire.

    PubMed

    Chang, Ming; Liu, Xiaojun; Chang, Feng-Cheng; Deka, Juti R

    2013-08-01

    Mechanical properties of gold nanowires were individually determined in this investigation using a multifunctional nanomanipulator inside a scanning electron microscope (SEM). Gold nanowires were synthesized by an electrochemical deposition technique. Three different characterization techniques including tensile, buckling and bending tests were adapted to quantitatively determine Young's modulus, yield stress and failure stress of the gold nanowires. The mechanical characterizations show that the nanowires were highly flexible in nature. The excellent resilience and the ability to store elastic energy in these nanowires confirm their potential applications in nano electromechanical devices.

  11. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  12. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  13. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  14. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  15. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  16. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is... covered with a base metal (such as nickel), which is covered with a thin wash of gold, unless there is a disclosure that the primary gold coating is covered with a base metal, which is gold washed. (7) Use of...

  17. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is... covered with a base metal (such as nickel), which is covered with a thin wash of gold, unless there is a disclosure that the primary gold coating is covered with a base metal, which is gold washed. (7) Use of...

  18. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is... covered with a base metal (such as nickel), which is covered with a thin wash of gold, unless there is a disclosure that the primary gold coating is covered with a base metal, which is gold washed. (7) Use of...

  19. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is... covered with a base metal (such as nickel), which is covered with a thin wash of gold, unless there is a disclosure that the primary gold coating is covered with a base metal, which is gold washed. (7) Use of...

  20. Gold deposit styles and placer gold characterisation in northern and east-central Madagascar

    USGS Publications Warehouse

    Pitfield, Peter E. J; Styles, Michael T.; Taylor, Cliff D.; Key, Roger M.; Bauer,; Ralison, A

    2009-01-01

    Microchemical characterisation of bedrock and placer gold grains from six gold districts within the Archaean domains and intervening Neoproterozoic Anaboriana-Manampotsy belt of northern and east-central Madagascar show few opaque inclusions (e.g pyrrhotite, Bi tellurides) but wide range of Ag contents (40wt%). Some districts exhibit multiple source populations of grains. The ‘greenstone belt’ terranes have an orogenic gold signature locally with an intrusion-related to epithermal overprint. Proterozoic metasediments with felsic to ultramafic bodies yield dominantly intrusion-related gold. A high proportion of secondary gold (<0.5wt% Ag) is related to recycling of paleoplacers and erosion of post-Gondwana planation surfaces and indicates that some mesothermal gold systems were already partially to wholly removed by erosion by the PermoTriassic.

  1. Coal-oil gold agglomeration assisted flotation to recover gold from refractory ore

    NASA Astrophysics Data System (ADS)

    Otsuki, A.; Yue, C.

    2017-07-01

    This study aimed to investigate the applicability of coal-oil gold agglomeration (CGA) assisted flotation to recover gold from a refractory ore. The ore with the grade of 2-5 g/t was tested with the CGA-flotation process in six different size fractions from 38 to 300 urn using different collector types and dosages. In addition, the flotation without CGA was performed under the same condition for comparison. The results showed that the higher gold grade and recovery were achieved by applying the CGA-flotation, compared with the flotation without CGA. More than 20-60 times grade increase from the head grade was obtained with CGA-flotation. The elemental analysis of gold and sulphur explained their relationship with gold recovery. The results well indicated the applicability of CGA to upgrade the refractory gold ore.

  2. Gold nanodumbbell-seeded growth of silver nanobars and nanobipyramids

    NASA Astrophysics Data System (ADS)

    Deng, Jin-Pei; Chen, Chih-Wei; Hsieh, Wei-Chi; Wang, Chao-Hsien; Hsu, Cheng-Yung; Lin, Jyun-Hao

    2014-03-01

    Gold nanodumbbells (NDs) are prepared by the reduction of gold ions in the presence of gold nanorods. Gold NDs are then employed for the synthesis of gold-silver core-shell nanoparticles (Au@Ag NPs). The quasi-ellipsoidal NPs could be found at room temperature, but Au@Ag bar and triangular bipyramid (TBP) NPs were obtained at 75 °C. Our results show that the long ends of gold NDs are in the position of the bar center and closely paralleled the shorter edge of TBP. Mechanisms in the growth of silver on gold NDs are proposed for the formations of these Au@Ag NPs.

  3. Single-step co-deposition of nanostructured tungsten oxide supported gold nanoparticles using a gold-phosphine cluster complex as the gold precursor

    NASA Astrophysics Data System (ADS)

    Molkenova, Anara; Sarip, Rozie; Sathasivam, Sanjay; Umek, Polona; Vallejos, Stella; Blackman, Chris; Hogarth, Graeme; Sankar, Gopinathan

    2014-12-01

    The use of a molecular gold organometallic cluster in chemical vapour deposition is reported, and it is utilized, together with a tungsten oxide precursor, for the single-step co-deposition of (nanostructured) tungsten oxide supported gold nanoparticles (NPs). The deposited gold-NP and tungsten oxide supported gold-NP are highly active catalysts for benzyl alcohol oxidation; both show higher activity than SiO2 supported gold-NP synthesized via a solution-phase method, and tungsten oxide supported gold-NP show excellent selectivity for conversion to benzaldehyde.

  4. Gold and gold-iron oxide magnetic glyconanoparticles: synthesis, characterization and magnetic properties.

    PubMed

    de la Fuente, Jesús M; Alcántara, David; Eaton, Peter; Crespo, Patricia; Rojas, Teresa C; Fernandez, Asunción; Hernando, Antonio; Penadés, Soledad

    2006-07-06

    The preparation, characterization and the magnetic properties of gold and gold-iron oxide glyconanoparticles (GNPs) are described. Glyconanoparticles were prepared in a single step procedure in the presence of aqueous solution of thiol functionalized neoglycoconjugates and either gold salts or both gold and iron salts. Neoglycoconjugates of lactose and maltose disaccharides with different linkers were used. Iron-free gold or gold-iron oxide GNPs with controlled gold-iron ratios were obtained. The average core-size diameters are in the range of 1.5-2.5 nm. The GNPs are fully characterized by (1)H NMR spectrometry, transmission electron microscopy (TEM), and UV-vis and X-ray absorption (XAS) spectroscopies. Inductive plasma-atomic emission spectrometry (ICP) and elemental analysis gave the average number of neoglycoconjugates per cluster. The magnetic properties were measured in a SQUID magnetometer. The most remarkable results was the observation of a permanent magnetism up to room temperature in the iron-free gold GNPs, that was not present in the corresponding gold-iron oxide GNPs.

  5. Structural controls on Carlin-type gold mineralization in the gold bar district, Eureka County, Nevada

    USGS Publications Warehouse

    Yigit, O.; Nelson, E.P.; Hitzman, M.W.; Hofstra, A.H.

    2003-01-01

    The Gold Bar district in the southern Roberts Mountains, 48 km northwest of Eureka, Nevada, contains one main deposit (Gold Bar), five satellite deposits, and other resources. Approximately 0.5 Moz of gold have been recovered from a resource of 1,639,000 oz of gold in Carlin-type gold deposits in lower plate, miogeoclinal carbonate rocks below the Roberts Mountains thrust. Host rocks are unit 2 of the Upper Member of the Devonian Denay Formation and the Bartine Member of the McColley Canyon Formation. Spatial and temporal relations between structures and gold mineralization indicate that both pre-Tertiary and Tertiary structures were important controls on gold mineralization. Gold mineralization occurs primarily along high-angle Tertiary normal faults, some of which are reactivated reverse faults of Paleozoic or Mesozoic age. Most deposits are localized at the intersection of northwest- and northeast-striking faults. Alteration includes decalcification, and to a lesser extent, silicification along high-angle faults. Jasperoid (pervasive silicification), which formed along most faults and in some strata-bound zones, accounts for a small portion of the ore in every deposit. In the Gold Canyon deposit, a high-grade jasperoid pipe formed along a Tertiary normal fault which was localized along a zone of overturned fault-propagation folds and thrust faults of Paleozoic or Mesozoic age.

  6. Aqueous Black Colloids of Reticular Nanostructured Gold

    NASA Astrophysics Data System (ADS)

    Stanca, S. E.; Fritzsche, W.; Dellith, J.; Froehlich, F.; Undisz, A.; Deckert, V.; Krafft, C.; Popp, J.

    2015-01-01

    Since ancient times, noble gold has continuously contributed to several aspects of life from medicine to electronics. It perpetually reveals its new features. We report the finding of a unique form of gold, reticular nanostructured gold (RNG), as an aqueous black colloid, for which we present a one-step synthesis. The reticules consist of gold crystals that interconnect to form compact strands. RNG exhibits high conductivity and low reflection, and these features, coupled with the high specific surface area of the material, could prove valuable for applications in electronics and catalysis. Due to high absorption throughout the visible and infrared domain, RNG has the potential to be applied in the construction of sensitive solar cells or as a substrate for Raman spectroscopy.

  7. Novel Catalysis by Gold: A Modern Alchemy

    NASA Astrophysics Data System (ADS)

    Haruta, Masatake

    Gold has long been neglected as a catalyst because of its chemical inertness. However, when gold is deposited as nanoparticles on carbon and polymer materials as well as on base metal oxides and hydroxides, it exhibits unique catalytic properties for many reactions such as CO oxidation at a temperature as low as 200 K, gas phase direct epoxidation of propylene, and aerobic oxidation of glucose to gluconic acid. The structure-catalytic activity correlations are discussed with emphasis on the contact structure, support selection, and the size control of gold particles. Gold clusters with diameters smaller than 2 nm are expected to exhibit novel properties in catalysis, optics, and electronics depending on the size (number of atoms), shape, and the electronic and chemical interaction with the support materials. The above achievements and attempts can be regarded as a modern alchemy that creates valuables by means of the noblest element with little practical use.

  8. Emergency Response to Gold King Mine Release

    EPA Pesticide Factsheets

    Description of August 5, 2015 release of contaminated waters from the Gold King Mine into Cement Creek and the Animas River, and the resulting emergency response remediation efforts, including monitoring of affected waterways.

  9. Anatomy of gold catalysts: facts and myths

    PubMed Central

    Ranieri, Beatrice; Escofet, Imma

    2015-01-01

    This review article covers the main types of gold(i) complexes used as precatalysts under homogeneous conditions in organic synthesis and discusses the different ways of catalyst activation as well as ligand, silver, and anion effects. PMID:26055272

  10. Aqueous black colloids of reticular nanostructured gold.

    PubMed

    Stanca, S E; Fritzsche, W; Dellith, J; Froehlich, F; Undisz, A; Deckert, V; Krafft, C; Popp, J

    2015-01-20

    Since ancient times, noble gold has continuously contributed to several aspects of life from medicine to electronics. It perpetually reveals its new features. We report the finding of a unique form of gold, reticular nanostructured gold (RNG), as an aqueous black colloid, for which we present a one-step synthesis. The reticules consist of gold crystals that interconnect to form compact strands. RNG exhibits high conductivity and low reflection, and these features, coupled with the high specific surface area of the material, could prove valuable for applications in electronics and catalysis. Due to high absorption throughout the visible and infrared domain, RNG has the potential to be applied in the construction of sensitive solar cells or as a substrate for Raman spectroscopy.

  11. Stabilizer-free nanosized gold sols.

    PubMed

    Andreescu, Daniel; Sau, Tapan Kumar; Goia, Dan V

    2006-06-15

    The paper describes a convenient, rapid, and reproducible method for the synthesis of stable dispersions of uniform gold nanoparticles at ambient temperatures by mixing aqueous solutions of tetrachloroauric acid and iso-ascorbic acid. The influence of the experimental conditions on the size of the gold particles and the stability of the final sols was monitored by dynamic light scattering and UV-vis spectrophotometry. It was found that the size of the resulting nanoparticles is affected by the concentration and the pH of gold solution, while the stability of the electrostatically stabilized final sols is strongly dependent on the excess of reductant in the system, the ionic strength, and the temperature of the precipitation. Since the preparation process does not require the addition of a dispersing agent, the surface of the resulting gold nanoparticles can be easily functionalized to make them suitable for applications in medicine, biology, and catalysis.

  12. Effective PEGylation of gold nanorods

    NASA Astrophysics Data System (ADS)

    Schulz, F.; Friedrich, W.; Hoppe, K.; Vossmeyer, T.; Weller, H.; Lange, H.

    2016-03-01

    Standard procedures to coat gold nanorods (AuNR) with poly(ethylene glycol) (PEG)-based ligands are not reliable and high PEG-grafting densities are not achieved. In this work, the ligand exchange of AuNR with PEGMUA, a tailored PEG-ligand bearing a C10 alkylene spacer, is studied. PEGMUA provides AuNR with very high stability against oxidative etching with cyanide. This etching reaction is utilized to study the ligand exchange in detail. Ligand exchange is faster, less ligand consuming and more reproducible with assisting chloroform extraction. Compared to PEG ligands commonly used, PEGMUA provides much higher colloidal and chemical stability. Further analyses based on NMR-, IR- and UV/Vis-spectroscopy reveal that significantly higher PEG-grafting densities, up to ~3 nm-2, are obtained with PEGMUA. This demonstrates how the molecular structure of the PEG ligand can be used to dramatically improve the ligand exchange and to synthesize PEGylated AuNR with high chemical and colloidal stability and high PEG grafting densities. Such AuNR are especially interesting for applications in nanomedicine.Standard procedures to coat gold nanorods (AuNR) with poly(ethylene glycol) (PEG)-based ligands are not reliable and high PEG-grafting densities are not achieved. In this work, the ligand exchange of AuNR with PEGMUA, a tailored PEG-ligand bearing a C10 alkylene spacer, is studied. PEGMUA provides AuNR with very high stability against oxidative etching with cyanide. This etching reaction is utilized to study the ligand exchange in detail. Ligand exchange is faster, less ligand consuming and more reproducible with assisting chloroform extraction. Compared to PEG ligands commonly used, PEGMUA provides much higher colloidal and chemical stability. Further analyses based on NMR-, IR- and UV/Vis-spectroscopy reveal that significantly higher PEG-grafting densities, up to ~3 nm-2, are obtained with PEGMUA. This demonstrates how the molecular structure of the PEG ligand can be used to

  13. Orientations of polyoxometalate anions on gold nanoparticles.

    PubMed

    Sharet, Shelly; Sandars, Ella; Wang, Yifeng; Zeiri, Offer; Neyman, Alevtina; Meshi, Louisa; Weinstock, Ira A

    2012-09-07

    Cryogenic transmission electron microscopy of polyoxometalate-protected gold nanoparticles reveals that the Preyssler ion, [NaP(5)W(30)O(110)](14-), lies "face down" with its C(5) axis perpendicular to the gold surface, while the Finke-Droege ion, [P(4)W(30)Zn(4)(H(2)O)(2)O(112)](16-), is "tilted", with its long axis close to 60° from the normal to the surface.

  14. U. S. GEOLOGICAL SURVEY ALASKAN GOLD PROJECT.

    USGS Publications Warehouse

    Antweiler, John C.; Cathrall, John; Tripp, Richard

    1984-01-01

    The United States Geological Survey has begun a state-wide study of Alaskan gold deposits. The immediate goals are to determine the relationship of gold in placer deposits to possible primary sources, to determine how nuggets form, to contribute to existing knowledge of principles for prospecting for placer deposits, and determine if minerals associated with placer deposits might suggest important deposits of other metals. The project started in 1982 with a study of placer mines in the Brooks Range.

  15. Nonlinear photoluminescence spectrum of single gold nanostructures.

    PubMed

    Knittel, Vanessa; Fischer, Marco P; de Roo, Tjaard; Mecking, Stefan; Leitenstorfer, Alfred; Brida, Daniele

    2015-01-27

    We investigate the multiphoton photoluminescence characteristics of gold nanoantennas fabricated from single crystals and polycrystalline films. By exciting these nanostructures with ultrashort pulses tunable in the near-infrared range, we observe distinct features in the broadband photoluminescence spectrum. By comparing antennas of different crystallinity and shape, we demonstrate that the nanoscopic geometry of plasmonic devices determines the shape of the emission spectra. Our findings rule out the contribution of the gold band structure in shaping the photoluminescence.

  16. Radiochemical separation of gold by amalgam exchange

    USGS Publications Warehouse

    Ruch, R.R.

    1970-01-01

    A rapid and simple method for the radiochemical separation of gold after neutron activation. The technique is based on treatment with a dilute indium-gold amalgam, both chemical reduction and isotopic exchange being involved. The counting efficiency for 198Au in small volumes of the amalgam is good. Few interferences occur and the method is applicable to clays, rocks, salts and metals. The possibility of determining silver, platinum and palladium by a similar method is mentioned. ?? 1970.

  17. Silver and gold-catalyzed multicomponent reactions

    PubMed Central

    Abbiati, Giorgio

    2014-01-01

    Summary Silver and gold salts and complexes mainly act as soft and carbophilic Lewis acids even if their use as σ-activators has been rarely reported. Recently, transformations involving Au(I)/Au(III)-redox catalytic systems have been reported in the literature. In this review we highlight all these aspects of silver and gold-mediated processes and their application in multicomponent reactions. PMID:24605168

  18. Low-Gold-Content Brazing Alloys

    NASA Technical Reports Server (NTRS)

    Brennan, A.; Mckown, R. D.

    1982-01-01

    Two new alloys for brazing at 1,760 degrees to 1,850 degrees F are stronger and have better gap-filling capability. Alloys have lower gold content than other gold brazes for their temperature range and therefore are far less expensive. They are produced in wire, foil, and powder and are excellent for brazing at temperatures where no suitable alloys existed--especially for step brazing copper.

  19. Optical Epitaxial Growth of Gold Nanoparticle Arrays.

    PubMed

    Huang, Ningfeng; Martínez, Luis Javier; Jaquay, Eric; Nakano, Aiichiro; Povinelli, Michelle L

    2015-09-09

    We use an optical analogue of epitaxial growth to assemble gold nanoparticles into 2D arrays. Particles are attracted to a growth template via optical forces and interact through optical binding. Competition between effects determines the final particle arrangements. We use a Monte Carlo model to design a template that favors growth of hexagonal particle arrays. We experimentally demonstrate growth of a highly stable array of 50 gold particles with 200 nm diameter, spaced by 1.1 μm.

  20. Gold mobility during Palaeoarchaean submarine alteration

    NASA Astrophysics Data System (ADS)

    Hofmann, Axel; Pitcairn, Iain; Wilson, Allan

    2017-03-01

    Seafloor alteration provides large amounts of solutes to the hydrosphere. In order to investigate gold mobility during water-rock interaction prior to 3-billion-years ago, low detection limit analysis of Au concentrations was carried out on rocks from marine alteration zones. Stratiform zones recording low-temperature (≤150 °C) seafloor alteration are a characteristic feature of greenstone belts older than 3.0 Ga. Hydrothermal processes were operating on, and immediately below, the seafloor, giving rise to extensive silicification of sub-seafloor volcanic rocks and silicification of seafloor sediments. In order to investigate gold mobility during silicification, unaltered and variably silicified volcanic rocks and associated cherts from Palaeoarchaean greenstone successions (c. 3.4 Ga) of South Africa were analyzed. Results show mobility of gold during silicification of mafic/ultramafic rocks and transfer to the Archaean ocean. Some gold was incorporated into carbonaceous marine sediments overlying the alteration zones. A combination of pervasive silicification, rarity of black shales, and low gold content in komatiites can explain the low mineralization potential of Palaeoarchaean greenstone belts for orogenic gold deposits.

  1. Acoustic vibrations of single suspended gold nanostructures

    NASA Astrophysics Data System (ADS)

    Major, Todd A.

    The acoustic vibrations for single gold nanowires and gold plates were studied using time-resolved ultrafast transient absorption. The objective of this work was to remove the contribution of the supporting substrate from the damping of the acoustic vibrations of the metal nano-objects. This was achieved by suspending the nano-objects across trenches created by photolithography and reactive ion etching. Transient absorption measurements for single suspended gold nanowires were initially completed in air and water environments. The acoustic vibrations for gold nanowires over the trench in air last typically for several nanoseconds, whereas gold nanowires in water are damped more quickly. Continuum mechanics models suggest that the acoustic impedance mismatch between air and water dominates the damping rate. Later transient absorption studies on single suspended gold nanowires were completed in glycerol and ethylene glycol environments. However, our continuum mechanical model suggests nearly complete damping in glycerol due to its high viscosity, but similar damping rates are seen between the two liquids. The continuum mechanics model thus incorrectly addresses high viscosity effects on the lifetimes of the acoustic vibrations, and more complicated viscoelastic interactions occur for the higher viscosity liquids. (Abstract shortened by UMI.).

  2. The gold rush 1925-35.

    PubMed

    Keers, R Y

    1980-12-01

    Although from the time of Koch onwards there had been desultory experiments with a variety of gold preparations in the management of pulmonary tuberculosis, gold as a recognised and accepted treatment did not emerge until 1925. In that year Holger Mollgaard of Copenhagen introduced sanocrysin, a double thiosulphate of gold and sodium, with which he had conducted an extensive series of animal experiments. The results of these were considered to justify its use in clinical practice and two physicians, Secher and Faber, undeterred by its toxicity, reported enthusiastically in its favour. Other Danish physicians followed but, alarmed by violent reactions, modified the dosage, an example followed by British workers. Encouraging results continued to be reported although each series contained a significant proportion of failures, and toxicity remained high. The first properly planned and fully controlled clinical trial took place in the United States and produced a report which was wholly adverse and which sounded the death knell of gold therapy throughout America. Until 1934-35 gold was used extensively in Europe but thereafter there was a sudden and largely universal cessation of interest and within a few years gold, introduced with such éclat and carrying so many high hopes, had vanished from the therapy of tuberculosis even though, at that point, no better alternative was available.

  3. Gold grade distribution within an epithermal quartz vein system, Kestanelik, NW Turkey: implications for gold exploration

    NASA Astrophysics Data System (ADS)

    Gulyuz, Nilay; Shipton, Zoe; Gulyuz, Erhan; Lord, Richard; Kaymakci, Nuretdin; Kuscu, İlkay

    2017-04-01

    Vein-hosted gold deposits contribute a large part to the global gold production. Discovery of these deposits mainly include drilling of hundreds of holes, collecting thousands of soil and rock samples and some geophysical surveys which are expensive and time consuming. Understanding the structures hosting the veins and the variations in gold concentrations within the veins is crucial to constrain a more economic exploration program. The main aim of this study is to investigate the gold grade distribution in the mineralized quartz veins of a well exposed epithermal gold deposit hosted by Paleozoic schist and Eocene quartz-feldspar-hornblende porphyry in Lapseki, NW Turkey. We have constructed 3D architecture of the vein surfaces by mapping their outcrop geometries using a highly sensitive Trimble GPS, collecting detailed field data, well-logs and geochemistry data from 396 drill holes (255 diamond cut and 141 reverse circulation holes). Modelling was performed in MOVE Structural Modelling and Analysis software granted by Midland Valley's Academic Software Initiative, and GIS application softwares Global Mapper and Esri-ArcGIS. We envisaged that while fluid entering the conduit ascents, a sudden thickness increase in the conduit would lead to a drop in the fluid pressure causing boiling (the most dominant gold precipitation mechanism) and associated gold precipitation. Regression analysis was performed between the orthogonal thickness values and gold grades of each vein, and statistical analyses were performed to see if the gold is concentrated at specific structural positions along dip. Gold grades in the alteration zones were compared to those in the adjacent veins to understand the degree of mineralization in alteration zones. A possible correlation was also examined between the host rock type and the gold grades in the veins. These studies indicated that gold grades are elevated in the adjacent alteration zones where high gold grades exist in the veins. Schist

  4. [Sunrise gold foil jacket crown].

    PubMed

    Lecardonnel, A

    1989-09-01

    This technique permits the preparation of ceramic jacket crowns made on Sunrise laminated precious metal alloy. The Sunrise foil is gold-colored, made of 99% of precious metals and is 50 microns thick. The die is prepared in order to display a moderate and regular undercut beyond the cervical limit. The margin will be underlined with a red pencil. The Sunrise foil is cut according to predetermined templates. Then the foil is applied without burnishing, according to the technique of jacket crowns on platinum foil only by finger pressure. The double folding on closure is preferably done distally or mesially. Then, the metal base is disinserted, sandblasted with 100 microns aluminum oxide, replaced on its die, and placed in a rubber casing before being placed in the isostatic press, to be subjected to a pressure of 2,000 TSI (14 kg par cm2). Sunrise's orange color reinforces rather subtetly the overall color, making these reconstructions particularly esthetic. The color of the Sunrise metal does not require, therefore a too thick opaque. Any ceramic intended to be fired on a metal base, may be used in respecting its firing protocol. Sunrise, as any other technique of this type, require a careful preparation with a shoulder that has a rounded gingivoaxial line angle. Bridges may be built on the "thimbles" crowns, fitted on Sunrise cores, the pontics being made as a ceramo-metal framework.

  5. Gold Nanoparticle Mediated Cancer Immunotherapy

    PubMed Central

    Almeida, Joao Paulo Mattos; Figueroa, Elizabeth Raquel; Drezek, Rebekah Anna

    2013-01-01

    Significant progress has been made in the field of cancer immunotherapy, where the goal is to activate or modulate the body’s immune response against cancer. However, current immunotherapy approaches exhibit limitations of safety and efficacy due to systemic delivery. In this context, the use of nanotechnology for the delivery of cancer vaccines and immune adjuvants presents a number of advantages such as targeted delivery to immune cells, enhanced therapeutic effect, and reduced adverse outcomes. Recently, gold nanoparticles (AuNP) have been explored as immunotherapy carriers, creating new AuNP applications that merit a critical overview. This review highlights recent advances in the development of AuNP mediated immunotherapies that harness AuNP biodistribution, optical properties and their ability to deliver macromolecules such as peptides and oligonucleotides. It has been demonstrated that the use of AuNP carriers can improve the delivery and safety of immunotherapy agents, and that AuNP immunotherapies are well suited for synergistic combination therapy with existing cancer therapies like photothermal ablation. PMID:24103304

  6. Curcumin: the Indian solid gold.

    PubMed

    Aggarwal, Bharat B; Sundaram, Chitra; Malani, Nikita; Ichikawa, Haruyo

    2007-01-01

    Turmeric, derived from the plant Curcuma longa, is a gold-colored spice commonly used in the Indian subcontinent, not only for health care but also for the preservation of food and as a yellow dye for textiles. Curcumin, which gives the yellow color to turmeric, was first isolated almost two centuries ago, and its structure as diferuloylmethane was determined in 1910. Since the time of Ayurveda (1900 Bc) numerous therapeutic activities have been assigned to turmeric for a wide variety of diseases and conditions, including those of the skin, pulmonary, and gastrointestinal systems, aches, pains, wounds, sprains, and liver disorders. Extensive research within the last half century has proven that most of these activities, once associated with turmeric, are due to curcumin. Curcumin has been shown to exhibit antioxidant, anti-inflammatory, antiviral, antibacterial, antifungal, and anticancer activities and thus has a potential against various malignant diseases, diabetes, allergies, arthritis, Alzheimer's disease, and other chronic illnesses. These effects are mediated through the regulation of various transcription factors, growth factors, inflammatory cytokines, protein kinases, and other enzymes. Curcumin exhibits activities similar to recently discovered tumor necrosis factor blockers (e.g., HUMIRA, REMICADE, and ENBREL), a vascular endothelial cell growth factor blocker (e.g., AVASTIN), human epidermal growth factor receptor blockers (e.g., ERBITUX, ERLOTINIB, and GEFTINIB), and a HER2 blocker (e.g., HERCEPTIN). Considering the recent scientific bandwagon that multitargeted therapy is better than monotargeted therapy for most diseases, curcumin can be considered an ideal "Spice for Life".

  7. Subchronic inhalation toxicity of gold nanoparticles.

    PubMed

    Sung, Jae Hyuck; Ji, Jun Ho; Park, Jung Duck; Song, Moon Yong; Song, Kyung Seuk; Ryu, Hyeon Ryol; Yoon, Jin Uk; Jeon, Ki Soo; Jeong, Jayoung; Han, Beom Seok; Chung, Yong Hyun; Chang, Hee Kyung; Lee, Ji Hyun; Kim, Dong Won; Kelman, Bruce J; Yu, Il Je

    2011-05-14

    Gold nanoparticles are widely used in consumer products, including cosmetics, food packaging, beverages, toothpaste, automobiles, and lubricants. With this increase in consumer products containing gold nanoparticles, the potential for worker exposure to gold nanoparticles will also increase. Only a few studies have produced data on the in vivo toxicology of gold nanoparticles, meaning that the absorption, distribution, metabolism, and excretion (ADME) of gold nanoparticles remain unclear. The toxicity of gold nanoparticles was studied in Sprague Dawley rats by inhalation. Seven-week-old rats, weighing approximately 200 g (males) and 145 g (females), were divided into 4 groups (10 rats in each group): fresh-air control, low-dose (2.36 × 104 particle/cm3, 0.04 μg/m3), middle-dose (2.36 × 105 particle/cm3, 0.38 μg/m3), and high-dose (1.85 × 106 particle/cm3, 20.02 μg/m3). The animals were exposed to gold nanoparticles (average diameter 4-5 nm) for 6 hours/day, 5 days/week, for 90-days in a whole-body inhalation chamber. In addition to mortality and clinical observations, body weight, food consumption, and lung function were recorded weekly. At the end of the study, the rats were subjected to a full necropsy, blood samples were collected for hematology and clinical chemistry tests, and organ weights were measured. Cellular differential counts and cytotoxicity measurements, such as albumin, lactate dehydrogenase (LDH), and total protein were also monitored in a cellular bronchoalveolar lavage (BAL) fluid. Among lung function test measurements, tidal volume and minute volume showed a tendency to decrease comparing control and dose groups during the 90-days of exposure. Although no statistically significant differences were found in cellular differential counts, histopathologic examination showed minimal alveoli, an inflammatory infiltrate with a mixed cell type, and increased macrophages in the high-dose rats. Tissue distribution of gold nanoparticles showed a dose

  8. Subchronic inhalation toxicity of gold nanoparticles

    PubMed Central

    2011-01-01

    Background Gold nanoparticles are widely used in consumer products, including cosmetics, food packaging, beverages, toothpaste, automobiles, and lubricants. With this increase in consumer products containing gold nanoparticles, the potential for worker exposure to gold nanoparticles will also increase. Only a few studies have produced data on the in vivo toxicology of gold nanoparticles, meaning that the absorption, distribution, metabolism, and excretion (ADME) of gold nanoparticles remain unclear. Results The toxicity of gold nanoparticles was studied in Sprague Dawley rats by inhalation. Seven-week-old rats, weighing approximately 200 g (males) and 145 g (females), were divided into 4 groups (10 rats in each group): fresh-air control, low-dose (2.36 × 104 particle/cm3, 0.04 μg/m3), middle-dose (2.36 × 105 particle/cm3, 0.38 μg/m3), and high-dose (1.85 × 106 particle/cm3, 20.02 μg/m3). The animals were exposed to gold nanoparticles (average diameter 4-5 nm) for 6 hours/day, 5 days/week, for 90-days in a whole-body inhalation chamber. In addition to mortality and clinical observations, body weight, food consumption, and lung function were recorded weekly. At the end of the study, the rats were subjected to a full necropsy, blood samples were collected for hematology and clinical chemistry tests, and organ weights were measured. Cellular differential counts and cytotoxicity measurements, such as albumin, lactate dehydrogenase (LDH), and total protein were also monitored in a cellular bronchoalveolar lavage (BAL) fluid. Among lung function test measurements, tidal volume and minute volume showed a tendency to decrease comparing control and dose groups during the 90-days of exposure. Although no statistically significant differences were found in cellular differential counts, histopathologic examination showed minimal alveoli, an inflammatory infiltrate with a mixed cell type, and increased macrophages in the high-dose rats. Tissue distribution of gold

  9. Tectonic setting of Late Cenozoic gold mineralization in the gold belt of Costa Rica

    SciTech Connect

    Deruyter, V.D.

    1985-01-01

    The Gold Belt of Costa Rica is a northwest-elongated zone 15 km wide by 120 km long containing numerous auriferous quartz veins and pyritic silicified patterns upon which abundant small mines are developed. Gold veins are related principally to northeast-southwest and north-south striking, steeply dipping faults. Higher grade ore and thicker veins invariably occur at intersections of these fracture orientations, indicating simultaneous opening at the time of gold introduction. Restriction of gold veins to the northwest-trending arc of Miocene Aguacate Group andesite volcanic rocks, a product of Cocos Plate subduction, suggested approximately coeval formation, but recognition by the writer of the important role played by 2-5 m.y. old altered, gold mineralized rhyolite dikes intruded along north-south gold vein structures and intimately involved with high grade ores at the Esperanza Mine and Rio Chiquito prospect, for example, suggest a much younger period of fracturing and gold introduction. The rhyolite intrusions are more brittle and stockwork mineralized than andesite host rocks and form bulk tonnage gold targets. Initiation of right-lateral movement along the north-south Panama Fracture Zone at 5 m.y.a. within the pattern of northeastward Cocos Plate subduction may have tapped rhyolites from subvolcanic magma chambers into new faults.

  10. Synergistic extraction of gold from the refractory gold ore via ultrasound and chlorination-oxidation.

    PubMed

    Fu, Likang; Zhang, Libo; Wang, Shixing; Cui, Wei; Peng, Jinhui

    2017-07-01

    A synergistic extraction method for gold from the refractory gold ores via ultrasound and chlorination-oxidation was developed. The effects of solid-liquid ratio, extraction time, ultrasound power, NaClO concentration and NaOH concentration on the extraction rate of gold from the refractory gold ore were investigated. The optimum conditions were as follows: NaClO concentration of 1.5mol/L, NaOH concentration of 1.5mol/L, solid-liquid ratio of 5, ultrasound power of 200W and ultrasound time of 2h. Under the optimal conditions, 68.55% of gold was extracted. However, only 45.8% of gold was extracted after 6h without the ultrasound-assisted extraction. XRD and SEM were used to analyze the influence of ultrasound on the mineral properties and strengthening mechanism. The results showed that the interface layer was peeled, new surface was exposed, reaction resistance was reduced, the liquid-solid reaction was promoted and reaction speed was greatly improved under ultrasound. According to the results of range and variance analysis, the optimum leaching experiment with orthogonal design was almost identical with the optimum experiment of single factor. Among them, the ultrasound power was the most significant factors affecting leaching rate of gold. Compared with other extraction method, the synergistic extraction process decomposed completely sulfide and improved significantly the extraction rate of gold. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Gold(I) Carbenoids: On-Demand Access to Gold(I) Carbenes in Solution.

    PubMed

    Sarria Toro, Juan M; García-Morales, Cristina; Raducan, Mihai; Smirnova, Ekaterina S; Echavarren, Antonio M

    2017-02-06

    Chloromethylgold(I) complexes of phosphine, phosphite, and N-heterocyclic carbene ligands are easily synthesized by reaction of trimethylsilyldiazomethane with the corresponding gold chloride precursors. Activation of these gold(I) carbenoids with a variety of chloride scavengers promotes reactivity typical of metallocarbenes in solution, namely homocoupling to ethylene, olefin cyclopropanation, and Buchner ring expansion of benzene.

  12. Gold(I) Carbenoids: On‐Demand Access to Gold(I) Carbenes in Solution

    PubMed Central

    Sarria Toro, Juan M.; García‐Morales, Cristina; Raducan, Mihai; Smirnova, Ekaterina S.

    2017-01-01

    Abstract Chloromethylgold(I) complexes of phosphine, phosphite, and N‐heterocyclic carbene ligands are easily synthesized by reaction of trimethylsilyldiazomethane with the corresponding gold chloride precursors. Activation of these gold(I) carbenoids with a variety of chloride scavengers promotes reactivity typical of metallocarbenes in solution, namely homocoupling to ethylene, olefin cyclopropanation, and Buchner ring expansion of benzene. PMID:28090747

  13. Linking gold nanoparticles with conductive 1,4-phenylene diisocyanide-gold oligomers.

    PubMed

    Kestell, John; Abuflaha, Rasha; Boscoboinik, J Anibal; Bai, Yun; Bennett, Dennis W; Tysoe, Wilfred T

    2013-02-18

    It is demonstrated that 1,4-phenylene diisocyanide (PDI)-gold oligomers can spontaneously bridge between gold nanoparticles on mica, thereby providing a strategy for electrically interconnecting nanoelectrodes. The barrier height of the bridging oligomer is 0.10 ± 0.02 eV, within the range of previous single-molecule measurements of PDI.

  14. A porphyrin complex of Gold(I): (Phosphine)gold(I) azides as cation precursors

    PubMed Central

    Partyka, David V.; Robilotto, Thomas J.; Zeller, Matthias; Hunter, Allen D.; Gray, Thomas G.

    2008-01-01

    A silver- and Brönsted acid-free protocol for generating the (tricyclohexylphosphine)gold(I) cation from the corresponding azide complexes is disclosed. The gold(I) cations so liberated are trapped by complexation with octaethylporphyrin. The first structurally authenticated gold(I) porphyrin complex crystallizes with formula C72H112Au2F12N4P2Sb2, space group C2/c, a = 21.388 (4), b = 19.679 (4), c = 19.231 (3) Å; β = 111.030 (3)°. Solution spectroscopic studies indicate that the di-gold complex fragments on dissolution in organic solvents. Approximate density-functional theory calculations find an electrostatic origin for the binding of two gold(I) centers to the unprotonated nitrogen atoms, despite greater orbital density on the porphyrin meso carbons. PMID:18780788

  15. East asian gold: Deciphering the anomaly of phanerozoic gold in precambrian cratons

    USGS Publications Warehouse

    Goldfarb, R.J.; Hart, C.; Davis, G.; Groves, D.

    2007-01-01

    Early Cretaceous orogenic gold deposits in eastern Asia are globally unique in that large Phanerozoic lode gold deposits occur in Archean-Paleoproterozoic cratons. In the northern Pacific region, ca. 125 Ma orogenic gold deposits in the North China, Yangzte, and Siberian craton margins, as well as in young terranes in California, may ultimately relate to the giant Cretaceous mantle plume in the southern Pacific basin and the relatively rapid tectonic consequences along both continental margins from resulting Pacific plate reconfigurations. In eastern Asia, such consequences include reactivation of and fluid flow along major fault systems, with fluid focusing into simultaneously forming, isolated core complexes of uncertain genesis. Deposition of gold ores in previously devolatilized high-grade Precambrian metamorphic rocks requires an exotic source of ore fluid, most likely subducted Mesozoic oceanic crust and/or overlying sediment. An implication is that Phanerozoic metamorphic core complexes in other destabilized craton margins could host large gold resources. ?? 2007 by Economic Geology.

  16. Silver, gold, and alloyed silver-gold nanoparticles: characterization and comparative cell-biologic action

    NASA Astrophysics Data System (ADS)

    Mahl, Dirk; Diendorf, Jörg; Ristig, Simon; Greulich, Christina; Li, Zi-An; Farle, Michael; Köller, Manfred; Epple, Matthias

    2012-10-01

    Silver, gold, and silver-gold-alloy nanoparticles were prepared by citrate reduction modified by the addition of tannin during the synthesis, leading to a reduction in particle size by a factor of three. Nanoparticles can be prepared by this easy water-based synthesis and subsequently functionalized by the addition of either tris(3-sulfonatophenyl)phosphine or poly( N-vinylpyrrolidone). The resulting nanoparticles of silver (diameter 15-25 nm), gold (5-6 nm), and silver-gold (50:50; 10-12 nm) were easily dispersable in water and also in cell culture media (RPMI + 10 % fetal calf serum), as shown by nanoparticle tracking analysis and differential centrifugal sedimentation. High-resolution transmission electron microscopy showed a polycrystalline nature of all nanoparticles. EDX on single silver-gold nanoparticles indicated that the concentration of gold is higher inside a nanoparticle. The biologic action of the nanoparticles toward human mesenchymal stem cells (hMSC) was different: Silver nanoparticles showed a significant concentration-dependent influence on the viability of hMSC. Gold nanoparticles showed only a small effect on the viability of hMSC after 7 days. Surprisingly, silver-gold nanoparticles had no significant influence on the viability of hMSC despite the silver content. Silver nanoparticles and silver-gold nanoparticles in the concentration range of 5-20 μg mL-1 induced the activation of hMSC as indicated by the release of IL-8. In contrast, gold nanoparticles led to a reduction of the release of IL-6 and IL-8.

  17. Oxidation state of gold and arsenic in gold-bearing arsenian pyrite

    SciTech Connect

    Simon, G.; Huang, H.; Penner-Hahn, J.E.; Kesler, S.E.; Kao, L.S.

    1999-07-01

    XANES measurements on gold-bearing arsenian pyrite from the Twin Creeks Carlin-type gold deposits show that gold is present as both Au{sup 0} and Au{sup 1+} and arsenic is present as As{sup 1{minus}}. Au{sup 0} is attributed to sub-micrometer size inclusions of free gold, whereas Au{sup 1+} is attributed to gold in the lattice of the arsenian pyrite. STEM observations suggest that As{sup 1{minus}} is probably concentrated in angstrom-scale, randomly distributed layers with a marcasite or arsenopyrite structure. Ionic gold (Au{sup 1+}) could be concentrated in these layers as well, and is present in both twofold- and fourfold-coordinated forms, with fourfold-coordinated Au{sup 1+} more abundant. Twofold-coordinated Au{sup 1+} is similar to gold in Au{sub 2}S in which it is linearly coordinated to two sulfur atoms. The nature of fourfold-coordinated Au{sup 1+} is not well understood, although it might be present as an Au-As-S compound where gold is bonded in fourfold coordination to sulfur and arsenic atoms, or in vacancy positions on a cation site in the arsenian pyrite. Au{sup 1+} was probably incorporated into arsenian pyrite by adsorption onto pyrite surfaces during crystal growth. The most likely compound in the case of twofold-coordinated Au{sup 1+} was probably a tri-atomic surface complex such as S{sub pyrite}-Au{sup 1+}-S{sub bi-sulfide}H or Au{sup 1+}-S-Au{sup 1+}. The correlation between gold and arsenic might be related to the role of arsenic in enhancing the adsorption of gold complexes of this type on pyrite surfaces, possibly through semiconductor effects.

  18. Gold and silver catalysis: from organic transformation to bioconjugation.

    PubMed

    Lo, Vanessa Kar-Yan; Chan, Anna On-Yee; Che, Chi-Ming

    2015-06-28

    This review focuses on gold (including gold(I) and gold(III) complexes, and gold nanoparticles) and silver(I) catalysis, including aerobic oxidation, activation of C-H bonds and activation of C-C multiple bonds, and their applications in the modification of biomolecules, including oligosaccharides, peptides and polypeptides, reported since the year 2000. Because of the high carbophilicity of gold and silver compounds, gold or silver-catalysed/mediated organic transformations feature high functional group tolerance, excellent regio-, diastereo- or enantioselectivity and/or high product turnover numbers under mild reaction conditions.

  19. Precipitation of lamellar gold nanocrystals in molten polymers

    SciTech Connect

    Palomba, M.; Carotenuto, G.

    2016-05-18

    Non-aggregated lamellar gold crystals with regular shape (triangles, squares, pentagons, etc.) have been produced by thermal decomposition of gold chloride (AuCl) molecules in molten amorphous polymers (polystyrene and poly(methyl methacrylate)). Such covalent inorganic gold salt is high soluble into non-polar polymers and it thermally decomposes at temperatures compatible with the polymer thermal stability, producing gold atoms and chlorine radicals. At the end of the gold precipitation process, the polymer matrix resulted chemically modified because of the partial cross-linking process due to the gold atom formation reaction.

  20. Precipitation of lamellar gold nanocrystals in molten polymers

    NASA Astrophysics Data System (ADS)

    Palomba, M.; Carotenuto, G.

    2016-05-01

    Non-aggregated lamellar gold crystals with regular shape (triangles, squares, pentagons, etc.) have been produced by thermal decomposition of gold chloride (AuCl) molecules in molten amorphous polymers (polystyrene and poly(methyl methacrylate)). Such covalent inorganic gold salt is high soluble into non-polar polymers and it thermally decomposes at temperatures compatible with the polymer thermal stability, producing gold atoms and chlorine radicals. At the end of the gold precipitation process, the polymer matrix resulted chemically modified because of the partial cross-linking process due to the gold atom formation reaction.

  1. Radiofrequency Heating Pathways for Gold Nanoparticles

    PubMed Central

    Collins, C. B.; McCoy, R. S.; Ackerson, B. J.; Collins, G. J.

    2015-01-01

    This feature article reviews the thermal dissipation of nanoscopic gold under radiofrequency (RF) irradiation. It also presents previously unpublished data addressing obscure aspects of this phenomenon. While applications in biology motivated initial investigation of RF heating of gold nanoparticles, recent controversy concerning whether thermal effects can be attributed to nanoscopic gold highlight the need to understand the involved mechanism or mechanisms of heating. Both the nature of the particle and the nature of the RF field influence heating. Aspects of nanoparticle chemistry and physics, including the hydrodynamic diameter of the particle, the oxidation state and related magnetism of the core, and the chemical nature of the ligand shell may all strongly influence to what extent a nanoparticle heats in an RF field. Aspects of RF include: power, frequency and antenna designs that emphasize relative strength of magnetic or electric fields, and also influence the extent to which a gold nanoparticle heats in RF. These nanoparticle and RF properties are analysed in the context of three heating mechanisms proposed to explain gold nanoparticle heating in an RF field. This article also makes a critical analysis of the existing literature in the context of the nanoparticle preparations, RF structure, and suggested mechanisms in previously reported experiments. PMID:24962620

  2. Amplitude enhancement by a gold dimer

    NASA Astrophysics Data System (ADS)

    Hong, Xin; Wang, Jingxin; Jin, Zheng

    2016-10-01

    The unique optical properties such as brightness, non-bleaching, good bio-compatibility make gold particles ideal label candidates for molecular probes. Due to the strongly enhanced field, aggregation of gold nanoparticles finds themselves plenty of applications in bio-imaging. But limited by its small cross-section associated with nanometer sized particle, it is a big challenge to employ it in a single molecular detection. The field enhancement results from the effect of plasmonic coupling between two closely attached gold nanoparticle under the right excitation condition. With the aim to apply the gold dimer probe to find the molecules in our recently established optical detection method, we compared of the amplitude enhancement by the dimer relative to a single particle. The amplitude distribution under a highly focused illumination objective was calculated, whose results suggest that at the optimized excitation condition, the local field can be enhanced 190 fold. In consequence, experimental detection was carried out. Gold dimers were linked together by the hybridization of two single chain DNAs. Dimer and single particle probes were mixed together in one detection. Overwhelming contrast between these two kinds of probes were clearly exhibited in the experimental detection image. This method can provide a way to a high specific detection in early diagnosis.

  3. Gold nanoparticle hyperthermia reduces radiotherapy dose.

    PubMed

    Hainfeld, James F; Lin, Lynn; Slatkin, Daniel N; Avraham Dilmanian, F; Vadas, Timothy M; Smilowitz, Henry M

    2014-11-01

    Gold nanoparticles can absorb near infrared light, resulting in heating and ablation of tumors. Gold nanoparticles have also been used for enhancing the X-ray dose to tumors. The combination of hyperthermia and radiotherapy is synergistic, importantly allowing a reduction in X-ray dose with improved therapeutic results. Here we intratumorally infused small 15 nm gold nanoparticles engineered to be transformed from infrared-transparent to infrared-absorptive by the tumor, then heated by infrared followed by X-ray treatment. Synergy was studied using a very radioresistant subcutaneous squamous cell carcinoma (SCCVII) in mice. It was found that the dose required to control 50% of the tumors, normally 55 Gy, could be reduced to <15 Gy (a factor of >3.7). Gold nanoparticles therefore provide a method to combine hyperthermia and radiotherapy to drastically reduce the X-ray radiation needed, thus sparing normal tissue, reducing side effects, and making radiotherapy more effective. Gold nanoparticles are known to enhance the efficacy of X-ray in tumor irradiation resulting in tumor heating and ablation. They also absorb near infrared light. This dual property was studied using a very radioresistant subcutaneous squamous cell carcinoma in mice, demonstrating that the dose required to control 50% of the tumors could be reduced by a factor of > 3.7, paving the way to potential future clinical applications. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Therapeutic gold, silver, and platinum nanoparticles.

    PubMed

    Yamada, Miko; Foote, Matthew; Prow, Tarl W

    2015-01-01

    There are an abundance of nanoparticle technologies being developed for use as part of therapeutic strategies. This review focuses on a narrow class of metal nanoparticles that have therapeutic potential that is a consequence of elemental composition and size. The most widely known of these are gold nanoshells that have been developed over the last two decades for photothermal ablation in superficial cancers. The therapeutic effect is the outcome of the thickness and diameter of the gold shell that enables fine tuning of the plasmon resonance. When these metal nanoparticles are exposed to the relevant wavelength of light, their temperature rapidly increases. This in turn induces a localized photothermal ablation that kills the surrounding tumor tissue. Similarly, gold nanoparticles have been developed to enhance radiotherapy. The high-Z nature of gold dramatically increases the photoelectric cross-section. Thus, the photoelectric effects are significantly increased. The outcome of these interactions is enhanced tumor killing with lower doses of radiation, all while sparing tissue without gold nanoparticles. Silver nanoparticles have been used for their wound healing properties in addition to enhancing the tumor-killing effects of anticancer drugs. Finally, platinum nanoparticles are thought to serve as a reservoir for platinum ions that can induce DNA damage in cancer cells. The future is bright with the path to clinical trials is largely cleared for some of the less complex therapeutic metal nanoparticle systems.

  5. Engineered Gold Nanoparticles and Plant Adaptation Potential

    NASA Astrophysics Data System (ADS)

    Siddiqi, Khwaja Salahuddin; Husen, Azamal

    2016-09-01

    Use of metal nanoparticles in biological system has recently been recognised although little is known about their possible effects on plant growth and development. Nanoparticles accumulation, translocation, growth response and stress modulation in plant system is not well understood. Plants exposed to gold and gold nanoparticles have been demonstrated to exhibit both positive and negative effects. Their growth and yield vary from species to species. Cytoxicity of engineered gold nanoparticles depends on the concentration, particle size and shape. They exhibit increase in vegetative growth and yield of fruit/seed at lower concentration and decrease them at higher concentration. Studies have shown that the gold nanoparticles exposure has improved free radical scavenging potential and antioxidant enzymatic activities and alter micro RNAs expression that regulate different morphological, physiological and metabolic processes in plants. These modulations lead to improved plant growth and yields. Prior to the use of gold nanoparticles, it has been suggested that its cost may be calculated to see if it is economically feasible.

  6. Simple Fabrication of Gold Nanobelts and Patterns

    PubMed Central

    Zhang, Renyun; Hummelgård, Magnus; Olin, Håkan

    2012-01-01

    Gold nanobelts are of interest in several areas; however, there are only few methods available to produce these belts. We report here on a simple evaporation induced self-assembly (EISA) method to produce porous gold nanobelts with dimensions that scale across nanometer (thickness ∼80 nm) and micrometer (width ∼20 µm), to decimeter (length ∼0.15 m). The gold nanobelts are well packed on the beaker wall and can be easily made to float on the surface of the solution for depositing onto other substrates. Microscopy showed that gold nanobelts had a different structure on the two sides of the belt; the density of gold nanowires on one side was greater than on the other side. Electrical measurements showed that these nanobelts were sensitive to compressive or tensile forces, indicating a potential use as a strain sensor. The patterned nanobelts were further used as a template to grow ZnO nanowires for potential use in applications such as piezo-electronics. PMID:22291962

  7. Controlling Gold Nanoclusters by Diphospine Ligands

    SciTech Connect

    Chen, Jing; Zhang, Qianfan; Bonaccorso, Timary A.; Williard, Paul G.; Wang, Lai S.

    2014-01-08

    We report the synthesis and structure determination of a new Au22 nanocluster coordinated by six bidentate diphosphine ligands: 1,8-bis(diphenylphosphino) octane (L8 for short). Single crystal x-ray crystallography and electrospray ionization mass spectrometry show that the cluster assembly is neutral and can be formulated as Au22(L8)6. The Au22 core consists of two Au11 units clipped together by four L8 ligands, while the additional two ligands coordinate to each Au11 unit in a bidentate fashion. Eight gold atoms at the interface of the two Au11 units are not coordinated by any ligands. Four short gold-gold distances (2.64?2.65 Å) are observed at the interface of the two Au11 clusters as a result of the clamping force of the four clipping ligands and strong electronic interactions. The eight uncoordinated surface gold atoms in the Au22(L8)6 nanocluster are unprecedented in atom-precise gold nanoparticles and can be considered as potential in-situ active sites for catalysis.

  8. Gold Nanoparticle Labels Amplify Ellipsometric Signals

    NASA Technical Reports Server (NTRS)

    Venkatasubbarao, Srivatsa

    2008-01-01

    The ellipsometric method reported in the immediately preceding article was developed in conjunction with a method of using gold nanoparticles as labels on biomolecules that one seeks to detect. The purpose of the labeling is to exploit the optical properties of the gold nanoparticles in order to amplify the measurable ellipsometric effects and thereby to enable ultrasensitive detection of the labeled biomolecules without need to develop more-complex ellipsometric instrumentation. The colorimetric, polarization, light-scattering, and other optical properties of nanoparticles depend on their sizes and shapes. In the present method, these size-and-shape-dependent properties are used to magnify the polarization of scattered light and the diattenuation and retardance of signals derived from ellipsometry. The size-and-shape-dependent optical properties of the nanoparticles make it possible to interrogate the nanoparticles by use of light of various wavelengths, as appropriate, to optimally detect particles of a specific type at high sensitivity. Hence, by incorporating gold nanoparticles bound to biomolecules as primary or secondary labels, the performance of ellipsometry as a means of detecting the biomolecules can be improved. The use of gold nanoparticles as labels in ellipsometry has been found to afford sensitivity that equals or exceeds the sensitivity achieved by use of fluorescence-based methods. Potential applications for ellipsometric detection of gold nanoparticle-labeled biomolecules include monitoring molecules of interest in biological samples, in-vitro diagnostics, process monitoring, general environmental monitoring, and detection of biohazards.

  9. Gold grade variation and particle microchemistry in exploration pits of the Batouri gold district, SE Cameroon

    NASA Astrophysics Data System (ADS)

    Vishiti, A.; Suh, C. E.; Lehmann, B.; Egbe, J. A.; Shemang, E. M.

    2015-11-01

    The Batouri area hosts lode-gold mineralization under several-m-thick lateritic cover. Pitting to bed rock on a geochemical Au anomaly defined from previous reconnaissance soil sampling identified five horizons ranging from saprock at the base to laterite at the top. Analysis of bulk samples from each horizon by fire assay shows that most of the horizons are barren although 119 ppb and 48 ppb Au values were obtained from one laterite horizon and one saprolite horizon, respectively, from two separate pits. All the horizons were panned and particulate gold was also recovered only from these two horizons. The gold grains from both horizons are morphologically and compositionally indistinguishable with rare quartz, pyrite and galena inclusions. The grains have irregular, sub-rounded, bean to elongated shapes and they show a remarkable core-rim zonation. Electron microprobe analysis of the grains recorded high gold content in the rims (86.3-100 wt%) and along fissures within the grains (95.1-100 wt%). The cores are relatively Ag rich (11.8-14 wt% Ag) while the rims (0.63-13.7 wt% Ag, most of the values fall within the lower limit of this range) and fissures (0.03-5.02 wt% Ag) are poor in Ag. The low Ag concentration in the rims and along fissures is attributed to preferential leaching of Ag; a process recognized in gold grains and platiniferous alloys from alluvia. The core composition of the grains is similar to that of primary gold composition in the bedrock. These results show that gold in the soil is relic particulate gold derived from the primary source with no evidence of secondary gold precipitation in the weathering cycle. In all the pits no horizon was systematically enriched in gold suggesting there has been no chemical remobilization of gold in this environment. Rather the dispersion of gold here is in the particulate form. Therefore combining particulate gold features with assay data is relevant to exploration in such tropical environments.

  10. Luminescent gold nanoparticles for bioimaging

    NASA Astrophysics Data System (ADS)

    Zhou, Chen

    Inorganic nanoparticles (NPs) with tunable and diverse material properties hold great potential as contrast agents for better disease management. Over the past decades, luminescent gold nanoparticles (AuNPs) with intrinsic emissions ranging from the visible to the near infrared have been synthesized and emerge as a new class of fluorophores for bioimaging. This dissertation aims to fundamentally understand the structure-property relationships in luminescent AuNPs and apply them as contrast agents to address some critical challenges in bioimaging at both the in vitro and in vivo level. In Chapter 2, we described the synthesized ~20 nm polycrystalline AuNPs (pAuNPs), which successfully integrated and enhanced plasmonic and fluorescence properties into a single AuNP through the grain size effect. The combination of these properties in one NP enabled AuNPs to serve as a multimodal contrast agent for in vitro optical microscopic imaging, making it possible to develop correlative microscopic imaging techniques. In Chapters 3-5, we proposed a feasible approach to optimize the in vivo kinetics and clearance profile of nanoprobes for multimodality in vivo bioimaging applications by using straightforward surface chemistry with luminescent AuNPs as a model. Luminescent glutathione-coated AuNPs of ~2 nm were synthesized. Investigation of the biodistribution showed that these glutathione-coated AuNPs (GS-AuNPs) exhibit stealthiness to the reticuloendothelial system (RES) organs and efficient renal clearance, with only 3.7+/-1.9% and 0.3+/-0.1% accumulating in the liver and spleen, and over 65% of the injection dose cleared out via the urine within the first 72 hours. In addition, ~2.5 nm NIR-emitting radioactive glutathione-coated [198Au]AuNPs (GS-[198Au]AuNPs) were synthesized for further evaluation of the pharmacokinetic profile of GS-AuNPs and potential multimodal imaging. The results showed that the GS-[198Au]AuNPs behave like small-molecule contrast agents in

  11. Gold nanocrystals with DNA-directed morphologies

    PubMed Central

    Ma, Xingyi; Huh, June; Park, Wounjhang; Lee, Luke P.; Kwon, Young Jik; Sim, Sang Jun

    2016-01-01

    Precise control over the structure of metal nanomaterials is important for developing advanced nanobiotechnology. Assembly methods of nanoparticles into structured blocks have been widely demonstrated recently. However, synthesis of nanocrystals with controlled, three-dimensional structures remains challenging. Here we show a directed crystallization of gold by a single DNA molecular regulator in a sequence-independent manner and its applications in three-dimensional topological controls of crystalline nanostructures. We anchor DNA onto gold nanoseed with various alignments to form gold nanocrystals with defined topologies. Some topologies are asymmetric including pushpin-, star- and biconcave disk-like structures, as well as more complex jellyfish- and flower-like structures. The approach of employing DNA enables the solution-based synthesis of nanocrystals with controlled, three-dimensional structures in a desired direction, and expands the current tools available for designing and synthesizing feature-rich nanomaterials for future translational biotechnology. PMID:27633935

  12. Catalysis by unsupported skeletal gold catalysts.

    PubMed

    Wittstock, Arne; Bäumer, Marcus

    2014-03-18

    Catalysis is one of the key technologies for the 21st century for achieving the required sustainability of chemical processes. Critical improvements are based on the development of new catalysts and catalytic concepts. In this context, gold holds great promise because it is more active and selective than other precious metal catalysts at low temperatures. However, gold becomes only chemically and catalytically active when it is nanostructured. Since the 1970s and 1980s, the first type of gold catalysts that chemists studied were small nanoparticles on oxidic supports. With the later onset of nanotechnology, a variety of nanostructured materials not requiring a support or organic stabilizers became available within about the last 10 years. Among these are gold nanofoams generated by combustion of gold compounds, nanotube membranes prepared by electroless deposition of gold inside a template, and corrosion-derived nanoporous gold. Even though these materials are macroscopic in their geometric dimensions (e.g., disks, cubes, and membranes with dimensions of millimeters), they are comprised of gold nanostructures, for example, in the form of ligaments as small as 15 nm in diameter (nanoporous gold, npAu). The nanostructure brings about a high surface to volume ratio and a large fraction of low coordinated surface atoms. In this Account, we discuss how unsupported materials are active catalysts for aerobic oxidation reaction in gas phase (oxidation of CO and primary alcohols), as well as liquid phase oxidation and reduction reactions. It turns out that the bonding and activation of molecular oxygen for gas phase oxidations strongly profits from trace amounts of an ad-metal residue such as silver. It is noteworthy that these catalysts still exhibit the special gold type chemistry, characterized by activity at very low temperatures and high selectivity for partial oxidations. For example, we can oxidize CO over these unsupported catalysts (npAu, nanotubes, and powder) at

  13. Ultrasonic-aided fabrication of gold nanofluids.

    PubMed

    Chen, Hui-Jiuan; Wen, Dongsheng

    2011-03-07

    A novel ultrasonic-aided one-step method for the fabrication of gold nanofluids is proposed in this study. Both spherical- and plate-shaped gold nanoparticles (GNPs) in the size range of 10-300 nm are synthesized. Subsequent purification produces well-controlled nanofluids with known solid and liquid contents. The morphology and properties of the nanoparticle and nanofluids are characterized by transmission electron microscopy, scanning electron microscope, energy dispersive X-ray spectroscope, X-ray diffraction spectroscopy, and dynamic light scattering, as well as effective thermal conductivities. The ultrasonication technique is found to be a very powerful tool in engineering the size and shape of GNPs. Subsequent property measurement shows that both particle size and particle shape play significant roles in determining the effective thermal conductivity. A large increase in effective thermal conductivity can be achieved (approximately 65%) for gold nanofluids using plate-shaped particles under low particle concentrations (i.e.764 μM/L).

  14. Gold Veins near Great Falls, Maryland

    USGS Publications Warehouse

    Reed, John Calvin; Reed, John C.

    1969-01-01

    Small deposits of native gold are present along an anastomosing system of quartz veins and shear zones just east of Great Falls, Montgomery County, Md. The deposits were discovered in 1861 and were worked sporadically until 1951, yielding more than 5,000 ounces of gold. The vein system and the principal veins within it strike a few degrees west of north, at an appreciable angle to foliation and fold axial planes in enclosing rocks of the Wissahickon Formation of late Precambrian (?) age. The veins cut granitic rocks of Devonian or pre-Devonian age and may be as young as Triassic. Further development of the deposits is unlikely under present economic conditions because of their generally low gold content and because much of the vein system lies on park property, but study of the Great Falls vein system may be useful in the search for similar deposits elsewhere in the Appalachian Piedmont.

  15. Gold nanocrystals with DNA-directed morphologies

    NASA Astrophysics Data System (ADS)

    Ma, Xingyi; Huh, June; Park, Wounjhang; Lee, Luke P.; Kwon, Young Jik; Sim, Sang Jun

    2016-09-01

    Precise control over the structure of metal nanomaterials is important for developing advanced nanobiotechnology. Assembly methods of nanoparticles into structured blocks have been widely demonstrated recently. However, synthesis of nanocrystals with controlled, three-dimensional structures remains challenging. Here we show a directed crystallization of gold by a single DNA molecular regulator in a sequence-independent manner and its applications in three-dimensional topological controls of crystalline nanostructures. We anchor DNA onto gold nanoseed with various alignments to form gold nanocrystals with defined topologies. Some topologies are asymmetric including pushpin-, star- and biconcave disk-like structures, as well as more complex jellyfish- and flower-like structures. The approach of employing DNA enables the solution-based synthesis of nanocrystals with controlled, three-dimensional structures in a desired direction, and expands the current tools available for designing and synthesizing feature-rich nanomaterials for future translational biotechnology.

  16. Surface Plasmon Polariton Interference in Gold Nanoplates.

    PubMed

    Beane, Gary; Yu, Kuai; Devkota, Tuphan; Johns, Paul; Brown, Brendan; Wang, Guo Ping; Hartland, Gregory

    2017-10-05

    Transient absorption microscopy (TAM) measurements have been used to study the optical properties of surface plasmon polariton (SPP) modes in gold nanoplates on a glass substrate. For thin gold nanoplates, the TAM images show an oscillation in the signal across the plate due to interference between the "bound" and "leaky" SPP modes. The wavelength of the interference pattern is given by λ = 2π/Δk, where Δk is the difference between the wavevectors for the bound and leaky modes and is sensitive to the dielectric constant of the material above the gold nanoplate. Back focal plane imaging was also used to measure the wavevector of the leaky mode, which, in combination with the Δk information from the TAM images, enabled the bound mode wavevector to be determined. These experiments represent the first far-field optical measurement of the wavevector for the bound mode in metal nanostructures.

  17. Cancer Nanotechnology: Emerging Role of Gold Nanoconjugates

    PubMed Central

    Kudgus, Rachel A.; Bhattacharya, Resham; Mukherjee, Priyabrata

    2014-01-01

    Over the last few decades, the study of nanotechnology has grown exponentially. Nanotechnology bridges science, engineering and technology; it continues to expand in definition as well as practice. One sub-set of nanotechnology is bionanotechnology, this will be the focus of this review. Currently, bionanotechnology is being studied and exploited for utility within medicinal imaging, diagnosis and therapy in regard to cancer. Cancer is a world-wide health problem and the implication rate as well as the death rate increase year to year. However promising work is being done with gold nanoparticles for detection, diagnosis and targeted drug delivery therapy. Gold nanoparticles can be synthesized in various shapes and sizes, which directly correlates to the color; they can also be manipulated to carry various antibody, protein, plasmid, DNA or small molecule drug. Herein we summarize some of the very influential research being done in the field of Cancer Nanotechnology with an emphasis on gold nanoparticles. PMID:21864234

  18. Gold(III) complexes in medicinal chemistry.

    PubMed

    Maia, Pedro Ivo da Silva; Deflon, Victor M; Abram, Ulrich

    2014-09-01

    A number of gold(III) compounds has been designed with the objective of overcoming the disadvantages associated with the platinum-based drugs for cancer treatment. Compounds of a remarkable structural manifold show significant antiproliferative effects in vitro against a number of cancer cells, including cisplatin resistant ones. The target of most of them is, unlike that of cisplatin, not the DNA. Although the mechanisms of action displayed by the gold compounds in biological media are still under investigation, many studies show evidence that the cellular targets are mitochondria-based. Recent advances in gold(III) medicinal chemistry also recommend such compounds for other pharmacological applications such as the treatment of viral or parasitic diseases. The radioactive isotopes (198)Au and (199)Au present potential in radiotherapy.

  19. Layering-induced Superlubricity: Gold on Graphite

    NASA Astrophysics Data System (ADS)

    Vanossi, Andrea; Guerra, Roberto; Tosatti, Erio; Nanofriction Group Sissa Team

    2015-03-01

    By means of realistic MD simulations, we explore the static friction trend as a function of the true contact area and the model dimensionality for 2D gold nanoislands and 3D gold nanoclusters deposited on graphite, interesting tribological systems whose slow and fast dynamics have been previously investigated. For increasing island size, because of the relative gold-graphite lattice mismatch, the interface stress energy has the chance to pile up by forming frustrated unmatched (i.e., incommensurate) regions and to develop a continuous solitonic pathway, foreshadowing a possible condition for the occurrence of ultra-low friction regimes. The significant reduction of the depinning threshold, towards superlubricity, with the system dimensionality can be ascribed to a layering-induced effective stiffness of the interface contact, favoring the natural Au-C lattice incommensurability. Partly sponsored under SNSF Sinergia Grant CRSII2 136287/1, EU ERC Grant No. 320796 MODPHYSFRICT, EU COST Action MP1303.

  20. Galvanic gold plating for fixed dental prosthesis.

    PubMed

    Ozcelik, Tuncer Burak; Yilmaz, Burak

    2013-07-01

    Metal ceramic partial fixed dental prostheses have been commonly used for the replacement of missing teeth for many years. Because of an increase in the price of gold, base metal alloys have been the choice of alloy for the fabrication of metal ceramic restorations in many dental clinics. Some major disadvantages of base metals are their corrosion and the dark coloration they may cause at the crown margins. This article describes a galvanic gold-plating technique, which is used to minimize corrosion and improve the esthetics of metal ceramic restorations fabricated with Cr-Co base metal alloys. This technique involves the deposition of a 6 μm to 8 μm 24 K gold layer directly onto the Cr-Co cast prosthesis framework. The technique improves metal surface properties, making them more biocompatible and usable, however, requires additional equipment and experienced laboratory technicians. Clinical studies should be performed to corroborate the long term success of this technique.

  1. OCT imaging enhancement of ovarian cancer using gold and gold/silver nanorods

    NASA Astrophysics Data System (ADS)

    Shi, Yiwen; Fan, Shanhui; Chen, Shuohui; Jiang, Xia; Zhao, Qingliang; Ren, Qiushi; Cui, Daxiang; Zhou, Chuanqing

    2014-11-01

    For OCT imaging, enhancing contrast efficiency will lead to significant improvements in the detection limits in cancer. Recently, noble metal nanoparticles are considered to be better contrast agents than traditional ones, especially for gold and silver. Silver nanoparticles have more attractive optical properties than gold nanoparticles. But they are employed far less because of its poor chemical stability. In this paper, we introduced our recent progress on a new application of using gold/silver alloy nanoparticles as OCT contrast agents in the detection of ovarian cancer. The scattering properties and sensitivity of silver were investigated. By means of tuning LSPR wavelengths of the nanoparticles, they were able to match the central wavelength of light used in OCT. Before carrying out animal experiments, we evaluated the different performances of alloy nanoparticles and gold nanorods in vitro. It has been sufficiently demonstrated that the alloy nanoparticles revealed stronger OCT signals than gold nanorods because of the better scattering properties. Then in vivo study, we compared the contrast enhancement of gold/silver alloy nanoparticles and gold nanorods on the ovarian cancer model mice. This study contributes a new kind of contrast agent in OCT imaging, which has a profound effect on drug delivery and further therapeutic action.

  2. Gold and gold-copper nanoparticles in 2-propanol: A radiation chemical study

    NASA Astrophysics Data System (ADS)

    Dey, G. R.

    2011-11-01

    The studies on the reduction of Au 3+ to gold nanoparticles in presence and absence of Cu 2+ under deoxygenated conditions in 2-propanol by radiolytic method have been carried out. On γ-radiolysis, preliminary yellow colored solution of Au 3+ changed to purple color owing to gold nanoparticles formation, which exhibits an absorption peak at around 540 nm. In the presence of Cu 2+, absorption of gold-copper nanoparticles, which was also produced during γ-radiolysis, was red shifted in contrast to the system containing no Cu 2+. Under DLS studies the sizes of gold nanoparticles in the absence and the presence of Cu 2+ were found to be larger (>400 nm). However, in presence of polyethylene glycol, a stabilizer the nanoparticle sizes became smaller, sizes measured for gold and gold-copper nanoparticles are 40 and 140 nm, respectively. Moreover, the change in UV-vis spectra in the Cu 2+ and Au 3+ mixed system highlights the formation of gold-copper nanoparticles in core-shell type arrangement.

  3. Major brazilian gold deposits - 1982 to 1999

    USGS Publications Warehouse

    Thorman, C.H.; Dewitt, E.; Maron, M.A.; Ladeira, E.A.

    2001-01-01

    Brazil has been a major but intermittent producer of gold since its discovery in 1500. Brazil led the world in gold production during the 18th and early 19th centuries. From the late 19th century to the late 20th century, total mining company and garimpeiro production was small and relatively constant at about 5 to 8 t/year. The discovery of alluvial deposits in the Amazon by garimpeiros in the 1970s and the opening of eight mines by mining companies from 1983 to 1990 fueled a major boom in Brazil's gold production, exceeding 100 t/year in 1988 and 1989. However, garimpeiro alluvial production decreased 'rapidly in the 1990s, to about 10 t/year by 1999. Company production increased about tenfold from about 4 t/year in 1982 to 40 t in 1992. Production from 1992 to the present remained relatively stable, even though several mines were closed or were in the process of closing and no new major mines were put into production during that period. Based on their production history from 1982-1999, 17 gold mines are ranked as major (> 20 t) and minor (3-8 t) mines. From 1982-1999, deposits hosted in Archean rocks produced 66% of the gold in Brazil, whereas deposits in Paleoproterozoic and Neoproterozoic rocks accounted for 19% and 15%, respectively. Deposits in metamorphosed sedimentary rocks, especially carbonate-rich rocks and carbonate iron-formation, yielded the great bulk of the gold. Deposits in igneous rocks were of much less importance. The Archean and Paleoproterozoic terranes of Brazil largely lack base-metal-rich volcanogenic massive sulfide deposits, porphyry deposits, and polymetallic veins and sedimentary exhalative deposits. An exception to this is in the Caraja??s Mineral Province.

  4. Gold and gold-palladium coated polypropylene grafts in a S. epidermidis wound infection model.

    PubMed

    Saygun, Oral; Agalar, Canan; Aydinuraz, Kuzey; Agalar, Fatih; Daphan, Cagatay; Saygun, Meral; Ceken, Sabahat; Akkus, Abdullah; Denkbas, Emir Baki

    2006-03-01

    The use of non-absorbable mesh grafts in both abdominal wall defects and inguinal hernias are impossible in the presence of contamination. This study was conducted for evaluation of the efficiencies of polypropylene mesh grafts coated with gold and palladium-gold. Ten piece of 1 x 2 cm of polypropylene mesh grafts were used in each group of naïve, gold-coated, and palladium-gold-coated. The grafts were incubated in physiological saline buffered and 0.5 McFarland slime positive Staphylococcus epidermidis for 24 h. At intervals of 6, 12, 24, 48, 72 h grafts were washed with saline and vortexed for 2 min in 2 ml of physiological saline. There were 100 microl of samples of vortexed material incubated in blood agar and 24 h later, colony numbers were assessed. In the second part of study, the grafts were implanted below the musculoaponeurotic layer at inguinal region of rats following the same procedure of incubation and washing. On the 8th day, the rats were examined for infection rate and their wound cultures were obtained. The least amount of bacterial growth was detected in the samples obtained from gold-palladium coated grafts; whereas the highest rate of growth was found in samples of naive grafts. The superficial surgical site infection rate was 0% in gold-palladium coated, 30% in gold-coated and 100% in naïve polypropylene group. The bacterial growth rate from wound cultures confirmed the superficial surgical site infection rates in all groups. Prosthetic graft infection with S. epidermidis can be prevented by coating the graft with gold-palladium or gold.

  5. Nanoporous Gold: Fabrication, Characterization, and Applications

    PubMed Central

    Seker, Erkin; Reed, Michael L.; Begley, Matthew R.

    2009-01-01

    Nanoporous gold (np-Au) has intriguing material properties that offer potential benefits for many applications due to its high specific surface area, well-characterized thiol-gold surface chemistry, high electrical conductivity, and reduced stiffness. The research on np-Au has taken place on various fronts, including advanced microfabrication and characterization techniques to probe unusual nanoscale properties and applications spanning from fuel cells to electrochemical sensors. Here, we provide a review of the recent advances in np-Au research, with special emphasis on microfabrication and characterization techniques. We conclude the paper with a brief outline of challenges to overcome in the study of nanoporous metals.

  6. Functionalized Gold Nanoparticles and Their Biomedical Applications

    PubMed Central

    Tiwari, Pooja M.; Vig, Komal; Dennis, Vida A.; Singh, Shree R.

    2011-01-01

    Metal nanoparticles are being extensively used in various biomedical applications due to their small size to volume ratio and extensive thermal stability. Gold nanoparticles (GNPs) are an obvious choice due to their amenability of synthesis and functionalization, less toxicity and ease of detection. The present review focuses on various methods of functionalization of GNPs and their applications in biomedical research. Functionalization facilitates targeted delivery of these nanoparticles to various cell types, bioimaging, gene delivery, drug delivery and other therapeutic and diagnostic applications. This review is an amalgamation of recent advances in the field of functionalization of gold nanoparticles and their potential applications in the field of medicine and biology.

  7. Current methods for synthesis of gold nanoparticles.

    PubMed

    Herizchi, Roya; Abbasi, Elham; Milani, Morteza; Akbarzadeh, Abolfazl

    2016-01-01

    Metal nanoparticles, such as nanoparticles synthesized using gold, have numerous uncommon chemical and physical properties due to the effects of their quantum size and their large surface area, in comparison with other metal atoms or bulk metal. Gold nanoparticles (GNPs), in particular, are very attractive because of their size and shape-dependent properties. Metal nanoparticles have gathered extensive attention due to their uncommon properties and promising applications in photonics, electronics, biochemical sensing, and imaging. This review covers recent advances in the synthesis of GNPs.

  8. Plasmonics of Gold Nanorods. Considerations for Biosensing

    NASA Astrophysics Data System (ADS)

    Liz-Marzán, Luis M.; Pérez-Juste, Jorge; Pastoriza-Santos, Isabel

    In this chapter, we explore the sensitivity of gold nanorods toward changes in the dielectric constant of the surrounding medium. Experimental data for pure and silica-coated nanorods with varying shell thickness are compared to calculations based on the boundary element method (BEM). They indicate that anisotropy and sharp tips make nanoparticles more environmentally sensitive. We also find that sensitivity decreases as silica shell thickness increases, as expected from a dielectric screening effect. Even when coated with thin shells, gold nanorods are found to be excellent candidates for biosensing applications.

  9. Nanosecond laser ablation of gold nanoparticle films

    SciTech Connect

    Ko, Seung H.; Choi, Yeonho; Hwang, David J.; Grigoropoulos, Costas P.; Chung, Jaewon; Poulikakos, Dimos

    2006-10-02

    Ablation of self-assembled monolayer protected gold nanoparticle films on polyimide was explored using a nanosecond laser. When the nanoparticle film was ablated and subsequently thermally sintered to a continuous film, the elevated rim structure by the expulsion of molten pool could be avoided and the ablation threshold fluence was reduced to a value at least ten times lower than the reported threshold for the gold film. This could be explained by the unusual properties of nanoparticle film such as low melting temperature, weak bonding between nanoparticles, efficient laser energy deposition, and reduced heat loss. Finally, submicron lines were demonstrated.

  10. Crack injection in silver gold alloys

    NASA Astrophysics Data System (ADS)

    Chen, Xiying

    Stress corrosion cracking (SCC) is a materials degradation phenomena resulting from a combination of stress and a corrosive environment. Among the alphabet soup of proposed mechanism of SCC the most important are film-rupture, film-induced cleavage and hydrogen embrittlement. This work examines various aspects of film-induced cleavage in gold alloys for which the operation of hydrogen embrittlement processes can be strictly ruled out on thermodynamic grounds. This is so because in such alloys SCC occurs under electrochemical conditions within which water is stable to hydrogen gas evolution. The alloy system examined in this work is AgAu since the corrosion processes in this system occur by a dealloying mechanism that results in the formation of nanoporous gold. The physics behind the dealloying process as well as the resulting formation of nanoporous gold is today well understood. Two important aspects of the film-induced cleavage mechanism are examined in this work: dynamic fracture in monolithic nanoporous gold and crack injection. In crack injection there is a finite thickness dealloyed layer formed on a AgAu alloy sample and the question of whether or not a crack that nucleates within this layer can travel for some finite distance into the un-corroded parent phase alloy is addressed. Dynamic fracture tests were performed on single edge-notched monolithic nanoporous gold samples as well as "infinite strip" sample configurations for which the stress intensity remains constant over a significant portion of the crack length. High-speed photography was used to measure the crack velocity. In the dynamic fracture experiments cracks were observed to travel at speeds as large as 270 m/s corresponding to about 68% of the Raleigh wave velocity. Crack injection experiments were performed on single crystal Ag77Au23, polycrystalline Ag72Au28 and pure gold, all of which had thin nanoporous gold layers on the surface of samples. Through-thickness fracture was seen in both the

  11. Rheumatoid arthritis, gold therapy, contact allergy and blood cytokines

    PubMed Central

    Svensson, Åke; Möller, Halvor; Björkner, Bert; Bruze, Magnus; Leden, Ido; Theander, Jan; Ohlsson, Kjell; Linder, Carina

    2002-01-01

    Objective To study the clinical and biochemical effects of a low starting dose for gold therapy in rheumatoid arthritis patients with a contact allergy to gold. Methods Serum cytokines were assayed before and 24 h after the first injection of gold sodium thiomalate (GSTM). Results Contact allergy to gold was found in 4 of 19 patients. Compared to gold-negative patients (starting dose: 10 mg GSTM), there was a larger increase in serum TNFalpha (p < 0.05), sTNF-R1 (NS), and IL-1 ra (p < 0.05) in gold-allergic patients. Conclusions Cytokines are released in blood by GSTM in RA patients with gold allergy. To minimize the risk of acute adverse reactions the starting dose of GSTM should be lowered to 5 mg. Alternatively, patients should be patch-tested before gold therapy; in test-positive cases, 5 mg is recommended as the first dose. PMID:11860615

  12. Effect of gold oxide in measurements of colloidal force.

    PubMed

    Tabor, Rico F; Morfa, Anthony J; Grieser, Franz; Chan, Derek Y C; Dagastine, Raymond R

    2011-05-17

    Atomic force microscopy, contact-angle, and spectroscopic ellipsometry measurements were employed to investigate the presence and properties of gold oxide on the surface of gold metal. It was found that, in agreement with available literature, unoxidized gold surfaces were hydrophobic, whereas oxidation rendered the surface highly hydrophilic. The oxide could be removed with ethanol or base but appeared to be stable over long periods in water or salt solutions between pH 3 and 7. After oxidation, the oxide layer thickness, determined using ellipsometry, was consistent with an approximate monolayer of Au-O bonds at the gold surface. The presence of gold oxide was found to alter significantly the electrical double-layer characteristics of the gold surface below pH 6 and may explain the apparent inconsistencies in observed force behavior where gold is employed as well as aiding in design of future microfluidic systems which incorporate gold as a coating.

  13. 14. BALD MOUNTAIN MILL, INTERIOR SHOWING GOLD TANKS FROM WEST, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. BALD MOUNTAIN MILL, INTERIOR SHOWING GOLD TANKS FROM WEST, c. 1937. DATE BASED ON USE IN PUBLICATION. CREDIT WR. - Bald Mountain Gold Mill, Nevada Gulch at head of False Bottom Creek, Lead, Lawrence County, SD

  14. OVERVIEW OF GOLD HILL MILL, ROAD, AND WARM SPRINGS CAMP ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    OVERVIEW OF GOLD HILL MILL, ROAD, AND WARM SPRINGS CAMP BUILDINGS, LOOKING SOUTH SOUTHEAST. THE FUNCTION OF THE FLAT AREA AT CENTER RIGHT IS UNKNOWN. - Gold Hill Mill, Warm Spring Canyon Road, Death Valley Junction, Inyo County, CA

  15. Synergistic Gold and Iron Dual Catalysis: Preferred Radical Addition toward Vinyl-Gold Intermediate over Alkene.

    PubMed

    Peng, Haihui; Akhmedov, Novruz G; Liang, Yu-Feng; Jiao, Ning; Shi, Xiaodong

    2015-07-22

    A dual catalytic approach enlisting gold and iron synergy is described. This method offers readily access to substituted heterocycle aldehydes via oxygen radical addition to vinyl-gold intermediates under Fe catalyst assistance. This system shows good functional group compatibility for the generation of substituted oxazole, indole, and benzofuran aldehydes. Mechanistic evidence greatly supports selective radical addition to an activated vinyl-Au double bond over alkene. This unique discovery offers a new avenue with great potential to further extend the synthetic power and versatility of gold catalysis.

  16. Shape-controlled Synthesis of Gold Nanoparticles from Gold(III)-chelates of β-diketones

    NASA Astrophysics Data System (ADS)

    Kundu, Subrata; Pal, Anjali; Ghosh, Sujit Kumar; Nath, Sudip; Panigrahi, Sudipa; Praharaj, Snigdhamayee; Basu, Soumen; Pal, Tarasankar

    2005-12-01

    Chelating ligands with β-diketone skeleton have been employed for the first time as reductant to produce ligand stabilized gold nanoparticles of different shapes out of aqueous HAuCl4 solutions. Evolution of stable gold nanoparticles happens to be first order with respect to gold particles having rate constants ˜ ˜10-2 min-1 and subsequent chlorine insertion in the β-diketone skeleton is reported as a general feature. Spherical or triangular or hexagonal particle evolution goes selectively under the influence of different β-diketones in terms of capping and reducing capabilities of the reductants.

  17. Self-assembly of 4-ferrocene thiophenol capped electroactive gold nanoparticles onto gold electrode

    NASA Astrophysics Data System (ADS)

    Li, Di; Li, Jinghong

    2003-01-01

    Gold nanoparticles capped by 4-ferrocene thiophenol with an average core size of 2.5 nm and surface plasmon absorbance at 522 nm were place-exchanged with 1,8-octanedithiol, and then self-assembled onto the gold electrode via tail SH group. The self-assembly was characterized by X-ray photoelectron spectroscopy. Cyclic voltammograms examined the coverage fraction of the self-assembled monolayers of the electroactive gold nanoparticles and the formal potential of the indicated SAMs. Further experiments exhibited that the electrode process was controlled by surface confined faradic reactions.

  18. Fractionation of gold in a differentiated tholeiitic dolerite

    USGS Publications Warehouse

    Rowe, J.J.

    1969-01-01

    Gold content was determined, by neutron-activation analysis, in samples from a drill core through the Great Lake sheet, Tasmania, a differentiated tholeiitic dolerite. The gold content of parts of the core seems to be related to the mafic index. The variation of gold content with depth and mafic index is similar to that of copper, indicating that gold and copper may have been concomitantly crystallized from the magma. ?? 1969.

  19. Early Yellowstone hotspot magmatism and gold metallogeny

    NASA Astrophysics Data System (ADS)

    Hames, Willis; Unger, Derick; Saunders, James; Kamenov, George

    2009-11-01

    High-grade epithermal gold deposits in the Northern Great Basin have long been associated with regional Miocene basaltic to rhyolitic volcanism. Previous models for the low-sulfidation epithermal gold ores in this region have generally portrayed the bimodal magmas as a source of heat to drive large-scale convection of meteoritic water that leached gold from crustal sources and deposited it in hydrothermal vein systems, or required that the gold evolve from fractionated silicic magmas. New data of the present study indicate a more direct genetic link to the plume-related basaltic magmas of the region. Laser 40Ar/ 39Ar incremental heating plateau ages for single crystals of adularia from several of these low-sulfidation epithermal gold deposits range from 16.6 Ma to 15.5 Ma. Adularia from the Jumbo deposit yields three concordant plateau ages with a combined statistical result of 16.54 ± 0.04 Ma (95% confidence level, MSWD = 0.23). Plateau ages for adularia from other deposits in the region, and from gold-bearing veins in the Owyhee Mountains of southwestern Idaho, yield similar ages up to ~16.5 Ma, however some veins are as young as ca. 15.5 Ma and the grain-to-grain ages for a given sample can vary by up to ca. 0.5 Ma. Observed variations in age among the adularia crystals of a given rock sample indicate varying amounts of extraneous argon, and also loss of radiogenic 40Ar, among the population of grains for a particular sample. The single-crystal results are interpreted to indicate a 16.5-15.5 Ma interval for formation of gold-bearing adularia veins in the region. The initiation and duration of this gold-forming event appears contemporaneous (within uncertainties) with the basaltic volcanism at the Steens Mountain section and an ensuing one-million-year episode of basaltic volcanism from multiple centers in the region ( Brueseke et al., 2007). Trace amounts of lead are alloyed with gold in the deposits studied. The isotopic compositions of this lead are not

  20. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  1. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  2. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  3. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  4. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  5. Link between ridge subduction and gold mineralization in southern Alaska

    USGS Publications Warehouse

    Haeussler, Peter J.; Bradley, Dwight C.; Goldfarb, Richard; Snee, Lawrence W.; Taylor, Cliff D.

    1995-01-01

    40Ar/39Ar geochronology reveals that turbidite-hosted gold deposits in the southern Alaska accretionary prism are the same age as nearby near-trench plutons. These early Tertiary plutons and gold lodes formed above a slab window during subduction of an oceanic spreading center. Ridge subduction is a previously unrecognized tectonic process for the generation of lode gold.

  6. Gold-coated nanoparticles for use in biotechnology applications

    DOEpatents

    Berning, Douglas E.; Kraus, Jr., Robert H.; Atcher, Robert W.; Schmidt, Jurgen G.

    2009-07-07

    A process of preparing gold-coated magnetic nanoparticles is disclosed and includes forming a suspension of magnetic nanoparticles within a suitable liquid, adding an amount of a reducible gold compound and a reducing agent to the suspension, and, maintaining the suspension for time sufficient to form gold-coated magnetic nanoparticles.

  7. Gold-coated nanoparticles for use in biotechnology applications

    DOEpatents

    Berning, Douglas E.; Kraus, Jr., Robert H.; Atcher, Robert W.; Schmidt, Jurgen G.

    2007-06-05

    A process of preparing gold-coated magnetic nanoparticles is disclosed and includes forming a suspension of magnetic nanoparticles within a suitable liquid, adding an amount of a reducible gold compound and a reducing agent to the suspension, and, maintaining the suspension for time sufficient to form gold-coated magnetic nanoparticles.

  8. Gold-coated nanoparticles for use in biotechnology applications

    DOEpatents

    Berning, Douglas E.; Kraus, Jr., Robert H.; Atcher; Robert W.; Schmidt, Jurgen G.

    2009-07-07

    A process of preparing gold-coated magnetic nanoparticles is disclosed and includes forming a suspension of magnetic nanoparticles within a suitable liquid, adding an amount of a reducible gold compound and a reducing agent to the suspension, and, maintaining the suspension for time sufficient to form gold-coated magnetic nanoparticles.

  9. Gold nanoparticles: preparation, functionalisation and applications in biochemistry and immunochemistry

    NASA Astrophysics Data System (ADS)

    Dykman, Lev A.; Bogatyrev, Vladimir A.

    2007-02-01

    The review summarises data on the synthesis and functionalisation of gold nanoparticles and their applications in biological investigations. Particular attention is given to applications of colloidal gold in solid-phase assays, immunoassay and studies of biologically active compounds by vibrational spectroscopy. A special section deals with the use of gold nanoparticles as antigen carriers in immunisation.

  10. Gold in meteorites and in the earth's crust

    USGS Publications Warehouse

    Jones, Robert Sprague

    1968-01-01

    The reported gold contents of meteorites range from 0.0003 to 8.74 parts per million. Gold is siderophilic, and the greatest amounts in meteorites are in the iron phases. Estimates ,of the gold content of the earth's crust are in the range of 0.001 to 0.006 parts per million.

  11. 75 FR 60283 - Gold Star Mother's and Families' Day, 2010

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-29

    ... Documents#0;#0; ] Proclamation 8569 of September 24, 2010 Gold Star Mother's and Families' Day, 2010 By the... those who share in that ultimate sacrifice: America's Gold Star Mothers and Families. For those in our... exceptional spirit of service dwells in the pride of Gold Star parents, who instilled the values that led...

  12. 77 FR 60279 - Gold Star Mother's and Family's Day, 2012

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-03

    ... Documents#0;#0; ] Proclamation 8872 of September 28, 2012 Gold Star Mother's and Family's Day, 2012 By the... upholding the sacred trust we share with our Gold Star families and the heroes we have laid to rest. Let us... designated the last Sunday in September as ``Gold Star Mother's Day.'' NOW, THEREFORE, I, BARACK OBAMA...

  13. 78 FR 60179 - Gold Star Mother's and Family's Day, 2013

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-01

    ... Documents#0;#0; ] Proclamation 9025 of September 26, 2013 Gold Star Mother's and Family's Day, 2013 By the... their example. On this day, we remember our commitment to the Gold Star mothers and families who carry... is over, we will continue to give our military and Gold Star families the care and support they...

  14. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 50 Wildlife and Fisheries 13 2013-10-01 2013-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  15. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 50 Wildlife and Fisheries 13 2014-10-01 2014-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  16. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 50 Wildlife and Fisheries 11 2011-10-01 2011-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  17. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  18. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 50 Wildlife and Fisheries 11 2011-10-01 2011-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  19. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 50 Wildlife and Fisheries 13 2014-10-01 2014-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  20. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 50 Wildlife and Fisheries 13 2013-10-01 2013-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  1. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  2. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  3. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  4. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 50 Wildlife and Fisheries 13 2012-10-01 2012-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  5. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  6. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 50 Wildlife and Fisheries 13 2012-10-01 2012-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  7. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  8. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  9. Investigating the specificity of adsorption of onto gold by gold-binding peptides using molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Vila Verde, Ana; Maranas, Janna

    2007-03-01

    It is possible to engineer artificial peptide sequences showing high specificity of adsorption for surfaces like gold, platinum or other solid materials. However, the reasons behind that high specificity are not clear. We investigate the adsorption of a genetically engineered peptide with high gold specificity using all-atom molecular dynamics simulations. Accurate Lennard-Jones parameters describing the interactions of gold with both water and amino acids are not currently available, so thus we discuss assignment of appropriate values. Two sets of simulations are presented: one using peptides made of a gold-binding motif (MHGKTQATSGTIQS) and another using peptides made of a non gold-binding motif (AIRRDVNCIGASMH). Adsorption onto the (111) and the (100) crystalline faces of gold is investigated. We discuss our results in light of the features of the peptide (sequence, charge, structure, nature of the amino acids) that may be responsible for the specificity of the gold-binding motif for gold.

  10. Noble gases, K, U, Th, and Pb in native gold

    NASA Astrophysics Data System (ADS)

    Engster, O.; Niedermann, S.; Thalmann, C.; Frei, R.; Kramers, J.; KräHenbühl, U.; Liu, Y. Z.; Hofmann, B.; Boer, R. H.; Reimold, W. U.; Bruno, L.

    1995-12-01

    We present determinations of the noble gas and Pb isotopic abundances and of K, Th, and U concentrations of native gold. Our results demonstrate that gold is an excellent carrier for crustal volatiles, but direct dating of gold using the U, Th-4He, 40K-40Ar, and U fission Xe methods was not successful for various reasons. The main significance of this work is the great sensitivity of gold for trapped gases as well as for gases that were produced in situ which gives the prospects of using gold and its fluid and solid inclusions for the study of paleogas composition. Numerous nuclear effects characterize the noble gas inventory of placer gold from Switzerland and Italy, vein gold from Italy, South Africa, and Venezuela, and lode gold from South Africa. The degassing patterns obtained by mass spectrometry show a low-temperature release of volatiles around 500°C from fluid inclusions mainly in vein gold and a high-temperature release from solid inclusions and the gold itself. The low-temperature volatiles represent species that were trapped when the gold crystallized. We investigated the following trapped species: the isotopes of He, Ne, Ar, Kr, Xe, and Pb, and the abundances of K, U, Th, H2O, and CO2. The crustal gases trapped by gold comprise 3He from 6Li(n,α)3H → β- → 3He, 4He and 40Ar from the U, Th, and K decay, and Xe from 238U fission. We observe 4He/40Ar = 3.9 for the radiogenic trapped gases of tertiary gold and a ratio of 1.4 for Archean gold. These ratios are consistent with the production ratios from U and K at the respective times and demonstrate that gold can be used as a sampler of ancient atmospheric gases. The concentrations of U and Th range from a few parts per billion to a few parts per million, and those of K and Pb range up to some tens of parts per million. The antiquity of trapped Pb is indicated by the Pb-Pb model age of about 3000 Ma for the lead extracted from vein gold and quartz of the Lily gold mine (South Africa). Gold also

  11. Gold-Catalyzed Reactions via Cyclopropyl Gold Carbene-like Intermediates.

    PubMed

    Dorel, Ruth; Echavarren, Antonio M

    2015-08-07

    Cycloisomerizations of 1,n-enynes catalyzed by gold(I) proceed via electrophilic species with a highly distorted cyclopropyl gold(I) carbene-like structure, which can react with different nucleophiles to form a wide variety of products by attack at the cyclopropane or the carbene carbons. Particularly important are reactions in which the gold(I) carbene reacts with alkenes to form cyclopropanes either intra- or intermolecularly. In the absence of nucleophiles, 1,n-enynes lead to a variety of cycloisomerized products including those resulting from skeletal rearrangements. Reactions proceeding through cyclopropyl gold(I) carbene-like intermediates are ideally suited for the bioinspired synthesis of terpenoid natural products by the selective activation of the alkyne in highly functionalized enynes or polyenynes.

  12. Gold-Catalyzed Reactions via Cyclopropyl Gold Carbene-like Intermediates

    PubMed Central

    2015-01-01

    Cycloisomerizations of 1,n-enynes catalyzed by gold(I) proceed via electrophilic species with a highly distorted cyclopropyl gold(I) carbene-like structure, which can react with different nucleophiles to form a wide variety of products by attack at the cyclopropane or the carbene carbons. Particularly important are reactions in which the gold(I) carbene reacts with alkenes to form cyclopropanes either intra- or intermolecularly. In the absence of nucleophiles, 1,n-enynes lead to a variety of cycloisomerized products including those resulting from skeletal rearrangements. Reactions proceeding through cyclopropyl gold(I) carbene-like intermediates are ideally suited for the bioinspired synthesis of terpenoid natural products by the selective activation of the alkyne in highly functionalized enynes or polyenynes. PMID:26061916

  13. Near Infrared Resonant Gold / Gold Sulfide Nanoparticles as a Photothermal Cancer Therapeutic Agent

    PubMed Central

    Gobin, André M.; Watkins, Emily M.; Quevedo, Elizabeth; Colvin, Vicki L.; West, Jennifer L.

    2010-01-01

    The development and optimization of near-infrared (nIR) absorbing nanoparticles for use as photothermal cancer therapeutic agents has been ongoing. We have previously reported on larger layered gold / silica nanoshells (~140 nm) for combined therapy and imaging applications. This work exploits the properties of smaller gold / gold sulfide (GGS) nIR absorbing nanoparticles (~35–55 nm) that provide higher absorption (98% absorption & 2% scattering for GGS versus 70% absorption & 30% scattering for gold/silica nanoshells) as well as potentially better tumor penetration. In this work we demonstrate ability to ablate tumor cells in vitro, and efficacy for photothermal cancer therapy, where in an in vivo model we show significantly increased long-term, tumor-free survival. Further, enhanced circulation and bio-distribution is observed in vivo. This class of nIR absorbing nanoparticles has potential to improve upon photothermal tumor ablation for cancer therapy. PMID:20183810

  14. Demonstration of enhancement of x-ray flux with foam gold compared to solid gold

    NASA Astrophysics Data System (ADS)

    Zhang, Lu; Ding, Yongkun; Lin, Zhiwei; Li, Hang; Jing, Longfei; Yuan, Zheng; Yang, Zhiwen; Tan, Xiulan; Kuang, Longyu; Zhang, Wenhai; Li, Liling; Li, Ping; Yuan, Guanghui; Jiang, Shaoen; Zhang, Baohan

    2016-03-01

    Experiments have been conducted to compare the re-emission from foam gold with a 0.3 g cc-1 density and solid gold in a SGIII prototype laser facility. Measurements of the re-emission x-ray flux demonstrate that emission is enhanced by the low density foam gold compared to the solid gold under the same conditions. The emission fraction increases with time and is concentrated on soft x-ray flux between 0.1-1 keV. The simulation results with Multi 1D agree with the experimental results. There are potential advantages to using foam walls for improving the emission and soft x-ray flux in hohlraums.

  15. Infrared light-absorbing gold/gold sulfide nanoparticles induce cell death in esophageal adenocarcinoma

    PubMed Central

    Li, Yan; Gobin, Andre M; Dryden, Gerald W; Kang, Xinqin; Xiao, Deyi; Li, Su Ping; Zhang, Guandong; Martin, Robert CG

    2013-01-01

    Gold nanoparticles and near infrared-absorbing light are each innocuous to tissue but when combined can destroy malignant tissue while leaving healthy tissue unharmed. This study investigated the feasibility of photothermal ablation therapy for esophageal adenocarcinoma using chitosan-coated gold/gold sulfide (CS-GGS) nanoparticles. A rat esophagoduodenal anastomosis model was used for the in vivo ablation study, and three human esophageal cell lines were used to study the response of cancer cells and benign cells to near infrared light after treatment with CS-GGS. The results indicate that both cancerous tissue and cancer cells took up more gold nanoparticles and were completely ablated after exposure to near infrared light. The benign tissue and noncancerous cells showed less uptake of these nanoparticles, and remained viable after exposure to near infrared light. CS-GGS nanoparticles could provide an optimal endoluminal therapeutic option for near infrared light ablation of esophageal cancer. PMID:23818775

  16. Radiofrequency heating pathways for gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Collins, C. B.; McCoy, R. S.; Ackerson, B. J.; Collins, G. J.; Ackerson, C. J.

    2014-07-01

    This feature article reviews the thermal dissipation of nanoscopic gold under radiofrequency (RF) irradiation. It also presents previously unpublished data addressing obscure aspects of this phenomenon. While applications in biology motivated initial investigation of RF heating of gold nanoparticles, recent controversy concerning whether thermal effects can be attributed to nanoscopic gold highlight the need to understand the involved mechanism or mechanisms of heating. Both the nature of the particle and the nature of the RF field influence heating. Aspects of nanoparticle chemistry which may affect thermal dissipation include the hydrodynamic diameter of the particle, the oxidation state and related magnetism of the core, and the chemical nature of the ligand shell. Aspects of RF which may affect thermal dissipation include power, frequency and antenna designs that emphasize relative strength of magnetic or electric fields. These nanoparticle and RF properties are analysed in the context of three heating mechanisms proposed to explain gold nanoparticle heating in an RF field. This article also makes a critical analysis of the existing literature in the context of the nanoparticle preparations, RF structure, and suggested mechanisms in previously reported experiments.

  17. Docking of ubiquitin to gold nanoparticles.

    PubMed

    Brancolini, Giorgia; Kokh, Daria B; Calzolai, Luigi; Wade, Rebecca C; Corni, Stefano

    2012-11-27

    Protein-nanoparticle associations have important applications in nanoscience and nanotechnology such as targeted drug delivery and theranostics. However, the mechanisms by which proteins recognize nanoparticles and the determinants of specificity are still poorly understood at the microscopic level. Gold is a promising material in nanoparticles for nanobiotechnology applications because of the ease of its functionalization and its tunable optical properties. Ubiquitin is a small, cysteine-free protein (ubiquitous in eukaryotes) whose binding to gold nanoparticles has been characterized recently by nuclear magnetic resonance (NMR). To reveal the molecular basis of these protein-nanoparticle interactions, we performed simulations at multiple levels (ab initio quantum mechanics, classical molecular dynamics and Brownian dynamics) and compared the results with experimental data (circular dichroism and NMR). The results provide a model of the ensemble of structures constituting the ubiquitin-gold surface complex, and insights into the driving forces for the binding of ubiquitin to gold nanoparticles, the role of nanoparticle surfactants (citrate) in the association process, and the origin of the perturbations in the NMR chemical shifts.

  18. Radiofrequency heating pathways for gold nanoparticles.

    PubMed

    Collins, C B; McCoy, R S; Ackerson, B J; Collins, G J; Ackerson, C J

    2014-08-07

    This feature article reviews the thermal dissipation of nanoscopic gold under radiofrequency (RF) irradiation. It also presents previously unpublished data addressing obscure aspects of this phenomenon. While applications in biology motivated initial investigation of RF heating of gold nanoparticles, recent controversy concerning whether thermal effects can be attributed to nanoscopic gold highlight the need to understand the involved mechanism or mechanisms of heating. Both the nature of the particle and the nature of the RF field influence heating. Aspects of nanoparticle chemistry which may affect thermal dissipation include the hydrodynamic diameter of the particle, the oxidation state and related magnetism of the core, and the chemical nature of the ligand shell. Aspects of RF which may affect thermal dissipation include power, frequency and antenna designs that emphasize relative strength of magnetic or electric fields. These nanoparticle and RF properties are analysed in the context of three heating mechanisms proposed to explain gold nanoparticle heating in an RF field. This article also makes a critical analysis of the existing literature in the context of the nanoparticle preparations, RF structure, and suggested mechanisms in previously reported experiments.

  19. Gold Creek: Preserving an Environmental Studies Center.

    ERIC Educational Resources Information Center

    Brooks, Suzanne

    In response to a Board of Trustees request for information and recommendations concerning the future use of the Gold Creek property owned by the Los Angeles Community College District, this report emphasizes that the use of this site for instructional field experiences enhances the quality of environmental education for the district's diverse…

  20. The golden age: gold nanoparticles for biomedicine.

    PubMed

    Dreaden, Erik C; Alkilany, Alaaldin M; Huang, Xiaohua; Murphy, Catherine J; El-Sayed, Mostafa A

    2012-04-07

    Gold nanoparticles have been used in biomedical applications since their first colloidal syntheses more than three centuries ago. However, over the past two decades, their beautiful colors and unique electronic properties have also attracted tremendous attention due to their historical applications in art and ancient medicine and current applications in enhanced optoelectronics and photovoltaics. In spite of their modest alchemical beginnings, gold nanoparticles exhibit physical properties that are truly different from both small molecules and bulk materials, as well as from other nanoscale particles. Their unique combination of properties is just beginning to be fully realized in range of medical diagnostic and therapeutic applications. This critical review will provide insights into the design, synthesis, functionalization, and applications of these artificial molecules in biomedicine and discuss their tailored interactions with biological systems to achieve improved patient health. Further, we provide a survey of the rapidly expanding body of literature on this topic and argue that gold nanotechnology-enabled biomedicine is not simply an act of 'gilding the (nanomedicinal) lily', but that a new 'Golden Age' of biomedical nanotechnology is truly upon us. Moving forward, the most challenging nanoscience ahead of us will be to find new chemical and physical methods of functionalizing gold nanoparticles with compounds that can promote efficient binding, clearance, and biocompatibility and to assess their safety to other biological systems and their long-term term effects on human health and reproduction (472 references).

  1. Hydroquinone Based Synthesis of Gold Nanorods.

    PubMed

    Picciolini, Silvia; Mehn, Dora; Ojea-Jiménez, Isaac; Gramatica, Furio; Morasso, Carlo

    2016-08-10

    Gold nanorods are an important kind of nanoparticles characterized by peculiar plasmonic properties. Despite their widespread use in nanotechnology, the synthetic methods for the preparation of gold nanorods are still not fully optimized. In this paper we describe a new, highly efficient, two-step protocol based on the use of hydroquinone as a mild reducing agent. Our approach allows the preparation of nanorods with a good control of size and aspect ratio (AR) simply by varying the amount of hexadecyl trimethylammonium bromide (CTAB) and silver ions (Ag(+)) present in the "growth solution". By using this method, it is possible to markedly reduce the amount of CTAB, an expensive and cytotoxic reagent, necessary to obtain the elongated shape. Gold nanorods with an aspect ratio of about 3 can be obtained in the presence of just 50 mM of CTAB (versus 100 mM used in the standard protocol based on the use of ascorbic acid), while shorter gold nanorods are obtained using a concentration as low as 10 mM.

  2. Superfluorinated and NIR-luminescent gold nanoclusters.

    PubMed

    Dichiarante, V; Tirotta, I; Catalano, L; Terraneo, G; Raffaini, G; Chierotti, M R; Gobetto, R; Baldelli Bombelli, F; Metrangolo, P

    2017-01-03

    A novel class of superfluorinated and NIR-luminescent gold nanoclusters were obtained starting from a branched thiol, bearing 27 equivalent (19)F atoms per molecule. These unprecedented clusters combine in a unique nanosystem both NIR photoluminescence and (19)F NMR properties, thus representing a promising multimodal platform for bioimaging applications.

  3. Gold Nanoparticle Hyperthermia Reduces Radiotherapy Dose

    PubMed Central

    Lin, Lynn; Slatkin, Daniel N.; Dilmanian, F. Avraham; Vadas, Timothy M.; Smilowitz, Henry M.

    2014-01-01

    Gold nanoparticles can absorb near infrared light, resulting in heating and ablation of tumors. Gold nanoparticles have also been used for enhancing the dose of X-rays in tumors during radiotherapy. The combination of hyperthermia and radiotherapy is synergistic, importantly allowing a reduction in X-ray dose with improved therapeutic results. Here we intratumorally infused small 15 nm gold nanoparticles engineered to be transformed from infrared-transparent to infrared-absorptive by the tumor, which were then heated by infrared followed by X-ray treatment. Synergy was studied using a very radioresistant subcutaneous squamous cell carcinoma (SCCVII) in mice. It was found that the dose required to control 50% of the tumors, normally 55 Gy, could be reduced to <15 Gy (a factor of >3.7). Gold nanoparticles therefore provide a method to combine hyperthermia and radiotherapy to drastically reduce the X-ray radiation needed, thus sparing normal tissue, reducing the side effects, and making radiotherapy more effective. PMID:24990355

  4. Gold(III)-Catalyzed Hydration of Phenylacetylene

    ERIC Educational Resources Information Center

    Leslie, J. Michelle; Tzeel, Benjamin A.

    2016-01-01

    A guided inquiry-based experiment exploring the regioselectivity of the hydration of phenylacetylene is described. The experiment uses an acidic gold(III) catalyst in a benign methanol/water solvent system to introduce students to alkyne chemistry and key principles of green chemistry. The experiment can be easily completed in approximately 2 h,…

  5. Gold Creek: An Environmental Studies Center.

    ERIC Educational Resources Information Center

    Woodley, Laurel

    A description is provided of the Gold Creek Ecological Reserve, 240 acres of undisturbed land in Northeast Los Angeles County, which serves the Los Angeles Community College District (LACCD) as an outdoor laboratory for students and faculty in numerous disciplines. Section I provides introductory information on the reserve and its features, which…

  6. Crystalline and amorphous gold in chrysiasis.

    PubMed

    Benn, H P; von Gaudecker, B; Czank, M; Loeffler, H

    1990-01-01

    Skin biopsy specimens from five patients (three females and two males) treated parenterally with gold were investigated using transmission electron microscopy. X-ray microanalysis and electron diffraction were used to determine the dermal heavy metal content. Additional sections were stained for light microscopic examination. The amount of elemental gold administered to the patients over a period of years to alleviate rheumatoid arthritis lay between a minimum of 4.0 g and a maximum of 10.0 g. In one and the same patient dermal histiocytic gold aggregations in sun-exposed areas of skin displayed a different pattern and divergent physiochemical states from the gold deposits in non-UV-exposed skin, where aurosome-like amorphous formations are found in the cells of the upper dermis. Additional spherical particles are associated predominantly with phagolysosomes in melanophages beneath solar-irradiated epidermis. Convergent beam electron diffraction proves the crystalline nature of the spherical auriferous deposits. The occurrence of skin rash was not related to different physicochemical states of the precious metal.

  7. The Smallest Thiolated Gold Superatom Complexes

    SciTech Connect

    Jiang, Deen; Whetten, Robert L; Luo, Weidong; Dai, Sheng

    2009-01-01

    The superatom concept of metallic cluster valence is based on the electron-shell model as first proposed to explain the special stability of certain metal-atom clusters generated in the gas phase. It accounts for the magic-number series 2, 8, 18, 34, 58,... by shell-closing of the superatom orbitals 1S, 1P, 1D,.... Recently, the superatom-complex concept has been introduced to explain the compositions of high-yield gold-cluster compounds, especially Au{sub 25}(SR){sub 18}{sup -} and Au{sub 102}(SR){sub 44} (with -SR being a thiolate group), corresponding to the magic numbers of 8 and 58, respectively. Surprisingly, no thiolated gold cluster accounting for the first closing (electron count 2) has yet been determined. Structure-bonding considerations lead us to propose Au{sub 12}(SR){sub 9}{sup +} as the superior candidate for the smallest thiolated gold superatom. This cluster features an octahedron core covered by three RS(AuSR){sub 2} motifs. It has a unique C{sub 3} axis, is chiral, and possesses ideal aurophilic interactions and, therefore, should exist in nature. The folding of thiol-rich biomolecules may help us to realize this complex, which may also be prepared from available phosphine-ligated gold clusters.

  8. Applications of gold nanoparticles in cancer nanotechnology

    PubMed Central

    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao

    2008-01-01

    It has been almost 4 decades since the “war on cancer” was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a “magic gold bullet” against cancer. PMID:24198458

  9. Applications of gold nanoparticles in cancer nanotechnology

    PubMed Central

    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao

    2013-01-01

    It has been almost 4 decades since the “war on cancer” was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a “magic gold bullet” against cancer. PMID:24163578

  10. Surface interactions between gold nanoparticles and biochar

    USDA-ARS?s Scientific Manuscript database

    Engineered nanomaterials are directly applied to agricultural soils as a part of pesticide/fertilize formulations and sludge/manure amendments. Yet, no prior reports are available on the extent and reversibility of gold nanoparticles (nAu) retention by soil components including charcoal black carbo...

  11. Gold(III)-Catalyzed Hydration of Phenylacetylene

    ERIC Educational Resources Information Center

    Leslie, J. Michelle; Tzeel, Benjamin A.

    2016-01-01

    A guided inquiry-based experiment exploring the regioselectivity of the hydration of phenylacetylene is described. The experiment uses an acidic gold(III) catalyst in a benign methanol/water solvent system to introduce students to alkyne chemistry and key principles of green chemistry. The experiment can be easily completed in approximately 2 h,…

  12. Functionalized gold nanorods for molecular optoacoustic imaging

    NASA Astrophysics Data System (ADS)

    Eghtedari, Mohammad; Oraevsky, Alexander; Conjusteau, Andre; Copland, John A.; Kotov, Nicholas A.; Motamedi, Massoud

    2007-02-01

    The development of gold nanoparticles for molecular optoacoustic imaging is a very promising area of research and development. Enhancement of optoacoustic imaging for molecular detection of tumors requires the engineering of nanoparticles with geometrical and molecular features that can enhance selective targeting of malignant cells while optimizing the sensitivity of optoacoustic detection. In this article, cylindrical gold nanoparticles (i.e. gold nanorods) were fabricated with a plasmon resonance frequency in the near infra-red region of the spectrum, where deep irradiation of tissue is possible using an Alexandrite laser. Gold nanorods (Au-NRs) were functionalized by covalent attachment of Poly(ethylene glycol) to enhance their biocompatibility. These particles were further functionalized with the aim of targeting breast cancer cells using monoclonal antibodies that binds to Her2/neu receptors, which are over expressed on the surface of breast cancer cells. A custom Laser Optoacoustic Imaging System (LOIS) was designed and employed to image nanoparticle-targeted cancer cells in a phantom and PEGylated Au-NRs that were injected subcutaneously into a nude mouse. The results of our experiments show that functionalized Au-NRs with a plasmon resonance frequency at near infra-red region of the spectrum can be detected and imaged in vivo using laser optoacoustic imaging system.

  13. Atmospheric Turbulence Statistics from GOLD Experiments

    NASA Technical Reports Server (NTRS)

    Jeganathan, Muthu; Wilson, Keith; Lesh, Jim

    1996-01-01

    Ground-Orbiter Lasercomm Demonstration (GOLD) includes the following: (1) Optical communication experiments between Table Mountain Observatory (TMF) and Japanese Engineering Test Satellite (ETS-VI); (2) International cooperative effort between NASA, NASDA, CRL and JPL; and (3) Phase 1 transmissions from October 1995 to January 1996 and Phase 2 transmissions from March 1996 to May 1996.

  14. Applications of gold nanoparticles in cancer nanotechnology.

    PubMed

    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao

    2008-09-19

    It has been almost 4 decades since the "war on cancer" was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a "magic gold bullet" against cancer.

  15. Applications of gold nanoparticles in cancer nanotechnology.

    PubMed

    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao

    2008-09-01

    It has been almost 4 decades since the "war on cancer" was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a "magic gold bullet" against cancer.

  16. Gold Creek: An Environmental Studies Center.

    ERIC Educational Resources Information Center

    Woodley, Laurel

    A description is provided of the Gold Creek Ecological Reserve, 240 acres of undisturbed land in Northeast Los Angeles County, which serves the Los Angeles Community College District (LACCD) as an outdoor laboratory for students and faculty in numerous disciplines. Section I provides introductory information on the reserve and its features, which…

  17. Understanding gold nanoisland formation using transport measurement

    NASA Astrophysics Data System (ADS)

    Joshi, Toyanath

    Novel metal nano-clusters are always being an interest of scientists and researchers because of their unique optical and chemical properties. This thesis studies the formation mechanism of gold nanoisland film by studying transport properties. We used layer-by-layer self-assembled multilayer gold samples and annealed them at the temperature ranging from room temperature to 625°C. Transport properties, particularly the resistance and capacitance, were measured in situ during annealing and compared with the surface morphology and UV-vis studies. Five films of the 8-layer gold and one film of the 5-layer silver and 5-layer gold nanoparticle sequentially self-assembled samples were measured. Temperature dependent resistance curves were plotted and analyzed. From the resistance curves, we were able to identify the actual temperature for polymer evaporation and nanoisland formation. These data were re-verified by comparing them with the temperature dependent studies of surface morphology and UV-vis spectroscopy. The effect of measuring condition, like heating rate and pre-annealing time factor, was also analyzed. Particularly, the slow heating and long pre-annealing time effected nanoisland growth mechanism.

  18. WILLIAM GOLDING'S NOVEL--THE BACKWARD LOOK.

    ERIC Educational Resources Information Center

    PECK, CAROL FAULKNER

    THE "SURPRISE ENDINGS" IN EACH OF WILLIAM GOLDING'S FIRST FOUR NOVELS OCCUR WHEN THE POINT OF VIEW SHIFTS FROM THE LIMITED WORLD OF THE NOVEL TO THE UNLIMITED WORLD OF REALITY. THE BOYS' RESCUE BY THE UNCOMPREHENDING OFFICER IN "LORD OF THE FLIES," REFOCUSES AND REINFORCES ALL THAT PRECEDES IT, AND THE FABLE, SUPERIMPOSED UPON REAL LIFE, BECOMES…

  19. Shape-Controlled Gold Nanoparticle Synthesis

    DTIC Science & Technology

    2013-09-01

    shaped nanoparticles were produced. Liu and Guyot -Sionnest (9) showed through high-resolution transmission electron microscopy (TEM) that citrate-capped...14317. 9. Liu, M.; Guyot -Sionnest, P. Mechanism of Silver (I)-Assisted Growth of Gold Nanorods and Bipyramids. The Journal of Physical Chemistry B

  20. Atmospheric Turbulence Statistics from GOLD Experiments

    NASA Technical Reports Server (NTRS)

    Jeganathan, Muthu; Wilson, Keith; Lesh, Jim

    1996-01-01

    Ground-Orbiter Lasercomm Demonstration (GOLD) includes the following: (1) Optical communication experiments between Table Mountain Observatory (TMF) and Japanese Engineering Test Satellite (ETS-VI); (2) International cooperative effort between NASA, NASDA, CRL and JPL; and (3) Phase 1 transmissions from October 1995 to January 1996 and Phase 2 transmissions from March 1996 to May 1996.

  1. X-ray laser driven gold targets

    SciTech Connect

    Petrova, Tz. B. Whitney, K. G.; Davis, J.

    2014-03-15

    The femtosecond population dynamics of gold irradiated by a coherent high-intensity (>10{sup 17} W/cm{sup 2}) x-ray laser pulse is investigated theoretically. There are two aspects to the assembled model. One is the construction of a detailed model of platinum-like gold inclusive of all inner-shell states that are created by photoionization of atomic gold and decay either by radiative or Auger processes. Second is the computation of the population dynamics that ensues when an x-ray pulse is absorbed in gold. The hole state generation depends on the intensity and wavelength of the driving x-ray pulse. The excited state populations reached during a few femtosecond timescales are high enough to generate population inversions, whose gain coefficients are calculated. These amplified lines in the emitted x-ray spectrum provide important diagnostics of the radiation dynamics and also suggest a nonlinear way to increase the frequency of the coherent output x-ray pulses relative to the frequency of the driver input x-ray pulse.

  2. Catalysis of Gold and Gold-Silver Alloy Nanoparticles Supported on Mesoporous Silica

    DTIC Science & Technology

    2009-11-26

    catalysts greatly and an acidic silica support may solve this problem. Our purpose here is to develop stable gold-based nanocatalysts for the...Discussion: (1) Au system: We first demonstrate the use of pure gold nanocatalyst in catalysis of CO oxidation. While there are a large number of recent...studies of Au nanocatalysts supported on metal oxides, low-temperature CO oxidation under an acidic environment has not yet been accomplished. Over

  3. Gold-Catalyzed Rearrangements and Beyond

    PubMed Central

    2013-01-01

    Cycloisomerizations of enynes are probably the most representative carbon–carbon bond forming reactions catalyzed by electrophilic metal complexes. These transformations are synthetically useful because chemists can use them to build complex architectures under mild conditions from readily assembled starting materials. However, these transformations can have complex mechanisms. In general, gold(I) activates alkynes in the presence of any other unsaturated functional group by forming an (η2-alkyne)–gold complex. This species reacts readily with nucleophiles, including electron-rich alkenes. In this case, the reaction forms cyclopropyl gold(I) carbene-like intermediates. These can come from different pathways depending on the substitution pattern of the alkyne and the alkene. In the absence of external nucleophiles, 1,n-enynes can form products of skeletal rearrangement in fully intramolecular reactions, which are mechanistically very different from metathesis reactions initiated by the [2 + 2] cycloaddition of a Grubbs-type carbene or other related metal carbenes. In this Account, we discuss how cycloisomerization and addition reactions of substituted enynes, as well as intermolecular reactions between alkynes and alkenes, are best interpreted as proceeding through discrete cationic intermediates in which gold(I) plays a significant role in the stabilization of the positive charge. The most important intermediates are highly delocalized cationic species that some chemists describe as cyclopropyl gold(I) carbenes or gold(I)-stabilized cyclopropylmethyl/cyclobutyl/homoallyl carbocations. However, we prefer the cyclopropyl gold(I) carbene formulation for its simplicity and mnemonic value, highlighting the tendency of these intermediates to undergo cyclopropanation reactions with alkenes. We can add a variety of hetero- and carbonucleophiles to the enynes in the presence of gold(I) in intra- or intermolecular reactions, leading to the corresponding adducts with

  4. Analysis of gold(I/III)-complexes by HPLC-ICP-MS demonstrates gold(III) stability in surface waters.

    PubMed

    Ta, Christine; Reith, Frank; Brugger, Joël; Pring, Allan; Lenehan, Claire E

    2014-05-20

    Understanding the form in which gold is transported in surface- and groundwaters underpins our understanding of gold dispersion and (bio)geochemical cycling. Yet, to date, there are no direct techniques capable of identifying the oxidation state and complexation of gold in natural waters. We present a reversed phase ion-pairing HPLC-ICP-MS method for the separation and determination of aqueous gold(III)-chloro-hydroxyl, gold(III)-bromo-hydroxyl, gold(I)-thiosulfate, and gold(I)-cyanide complexes. Detection limits for the gold species range from 0.05 to 0.30 μg L(-1). The [Au(CN)2](-) gold cyanide complex was detected in five of six waters from tailings and adjacent monitoring bores of working gold mines. Contrary to thermodynamic predictions, evidence was obtained for the existence of Au(III)-complexes in circumneutral, hypersaline waters of a natural lake overlying a gold deposit in Western Australia. This first direct evidence for the existence and stability of Au(III)-complexes in natural surface waters suggests that Au(III)-complexes may be important for the transport and biogeochemical cycling of gold in surface environments. Overall, these results show that near-μg L(-1) enrichments of Au in environmental waters result from metastable ligands (e.g., CN(-)) as well as kinetically controlled redox processes leading to the stability of highly soluble Au(III)-complexes.

  5. Bioaccumulation of gold by sulfate-reducing bacteria cultured in the presence of gold(I)-thiosulfate complex

    NASA Astrophysics Data System (ADS)

    Lengke, Maggy; Southam, Gordon

    2006-07-01

    A sulfate-reducing bacterial (SRB) enrichment, from the Driefontein Consolidated Gold Mine, Witwatersrand Basin, Republic of South Africa, was able to destabilize gold(I)-thiosulfate complex (Au(SO)23-) and precipitate elemental gold. The precipitation of gold was observed in the presence of active (live) SRB due to the formation and release of hydrogen sulfide as an end-product of metabolism, and occurred by three possible mechanisms involving iron sulfide, localized reducing conditions, and metabolism. The presence of biogenic iron sulfide caused significant removal of gold from solutions by adsorption and reduction processes on the iron sulfide surfaces. The presence of gold nanoparticles within and immediately surrounding the bacterial cell envelope highlights the presence of localized reducing conditions produced by the bacterial electron transport chain via energy generating reactions within the cell. Specifically, the decrease in redox conditions caused by the release of hydrogen sulfide from the bacterial cells destabilized the Au(SO)23- solutions. The presence of gold as nanoparticles (<10 nm) inside a sub-population of SRB suggests that the reduction of gold was a part of metabolic process. In late stationary phase or death phase, gold nanoparticles that were initially precipitated inside the bacterial cells, were released from the cells and deposited in the bulk solution as addition of gold nanoparticles that already precipitated in the solution. Ultimately, the formation of micrometer-scale sub-octahedral and octahedral gold and spherical aggregates containing octahedral gold was observed.

  6. A halogen-free synthesis of gold nanoparticles using gold(III) oxide

    NASA Astrophysics Data System (ADS)

    Sashuk, Volodymyr; Rogaczewski, Konrad

    2016-09-01

    Gold nanoparticles are one of the most used nanomaterials. They are usually synthesized by the reduction of gold(III) chloride. However, the presence of halide ions in the reaction mixture is not always welcome. In some cases, these ions have detrimental influence on the morphology and structure of resulting nanoparticles. Here, we present a simple and halogen-free procedure to prepare gold nanoparticles by reduction of gold(III) oxide in neat oleylamine. The method provides the particles with an average size below 10 nm and dispersity of tens of percent. The process of nanoparticle formation was monitored using UV-Vis spectroscopy. The structure and chemical composition of the nanoparticles was determined by SEM, XPS and EDX. We also proposed the mechanism of reduction of gold(III) oxide based on MS, IR and NMR data. Importantly, the synthetic protocol is general and applicable for the preparation of other coinage metal nanoparticles from the corresponding metal oxides. For instance, we demonstrated that the absence of halogen enables efficient alloying of metals when preparing gold-silver bimetallic nanoparticles.

  7. Gold surface with gold nitride-a surface enhanced Raman scattering active substrate

    NASA Astrophysics Data System (ADS)

    Brieva, A. C.; Alves, L.; Krishnamurthy, S.; Šiller, L.

    2009-03-01

    The nitration of gold surfaces is a nonpolluting method, which can lead to large scale production of substrates with remarkable properties and applications. We present a topographical study of the nanoscale structure of the gold nitride surfaces produced by radio frequency (rf) nitrogen plasma etching of thin gold films. Atomic force microscopy images taken after rf etching reveal the striking appearance of the cluster assembly with large clusters surrounded by small clusters (7.9±1.4 and 2.3±0.9 nm, respectively) appearing to exhibit an attractive interaction. We discuss the possible mechanism for this attraction based on a colloid model by Messina et al. [Phys. Rev. Lett. 85, 872 (2000)]. This surface exhibits a notable surface enhanced Raman scattering effect demonstrated with L-alanine and rhodamine-6G. The significance of this work is that we found that this SERS active gold nitride surface can be prepared in just one step: by nitrogen plasma etching a thin gold film. Until now most SERS active gold cluster covered surfaces have been prepared in several steps very often requiring complex lithography.

  8. Magnetic resonance investigation of gold-doped and gold-hydrogen-doped silicon

    NASA Astrophysics Data System (ADS)

    Huy, P. T.; Ammerlaan, C. A.

    2002-10-01

    Three paramagnetic centers related to gold have been observed in gold-doped and gold-doped hydrogenated silicon by magnetic resonance. One spectrum, labeled Si-NL62, corresponding to a center with monoclinic-I symmetry, presents fourfold splitting due to the hyperfine interaction with one gold atom and further hyperfine interaction with two silicon nearest-neighbor atoms. After being diffused with hydrogen in a wet atmosphere of water vapor at 1300 °C for about 30 min, a second electron paramagnetic resonance spectrum, labeled Si-NL63, is detected, also of the monoclinic-I symmetry. The spectrum of the center is characterized by a complex hyperfine structure, in which, depending on magnetic field orientation, a sevenfold splitting with the intensities 1:2:3:4:3:2:1, a fourfold splitting 4:4:4:4, and other more arbitrary structures are observed. Extra small splitting is observed in the sample diffused with deuterium, indicating hydrogen involvement in the microscopic structure of the Si-NL63 center. Under band gap illumination the third center of a one-gold-two-hydrogen complex is observed. The center, labeled Si-NL64, has low triclinic symmetry and features the hyperfine interactions with one gold and two nearly equivalent hydrogen atoms. This results in a (1:2:1):(1:2:1):(1:2:1):(1:2:1) structure of each group of spectral lines. Spin-Hamiltonian parameters for the three spectra are determined and microscopic models are discussed.

  9. Detailed energy distributions in laser-produced plasmas of solid gold and foam gold planar targets

    SciTech Connect

    Dong, Yunsong; Zhang, Lu; Yang, Jiamin; Shang, Wanli

    2013-12-15

    Foam gold was proposed to increase the laser to x-ray conversion efficiency due to its important applications. To understand the mechanism of x-ray enhancement, the detailed energy distributions and plasma profiles for laser-irradiated solid gold and foam gold targets were studied comparatively by hydrodynamic simulations using the code Multi-1D. It is confirmed that the radiation heat wave is subsonic for the normal solid gold target, while supersonic for the foam gold target. The shock wave, which is behind the supersonic radiation heat wave for the foam gold target, generates a plasma temperature gradient with high temperature near the shock wave front to produce an additional net outward radiation for enhancement of the x-ray emission. Much larger inward plasma velocity is also driven by the shock wave as an initial plasma velocity for the laser deposition and electron thermal conduct zone, which decreases the expanding plasma kinetic energy loss and helps to increase the x-ray radiation.

  10. Simulated GOLD Observations of Atmospheric Waves

    NASA Astrophysics Data System (ADS)

    Correira, J.; Evans, J. S.; Lumpe, J. D.; Rusch, D. W.; Chandran, A.; Eastes, R.; Codrescu, M.

    2016-12-01

    The Global-scale Observations of the Limb and Disk (GOLD) mission will measure structures in the Earth's airglow layer due to dynamical forcing by vertically and horizontally propagating waves. These measurements focus on global-scale structures, including compositional and temperature responses resulting from dynamical forcing. Daytime observations of far-UV emissions by GOLD will be used to generate two-dimensional maps of the ratio of atomic oxygen and molecular nitrogen column densities (ΣO/N2 ) as well as neutral temperature that provide signatures of large-scale spatial structure. In this presentation, we use simulations to demonstrate GOLD's capability to deduce periodicities and spatial dimensions of large-scale waves from the spatial and temporal evolution observed in composition and temperature maps. Our simulations include sophisticated forward modeling of the upper atmospheric airglow that properly accounts for anisotropy in neutral and ion composition, temperature, and solar illumination. Neutral densities and temperatures used in the simulations are obtained from global circulation and climatology models that have been perturbed by propagating waves with a range of amplitudes, periods, and sources of excitation. Modeling of airglow emission and predictions of ΣO/N2 and neutral temperatures are performed with the Atmospheric Ultraviolet Radiance Integrated Code (AURIC) and associated derived product algorithms. Predicted structure in ΣO/N2 and neutral temperature due to dynamical forcing by propagating waves is compared to existing observations. Realistic GOLD Level 2 data products are generated from simulated airglow emission using algorithm code that will be implemented operationally at the GOLD Science Data Center.

  11. Polymer decorated gold nanoparticles in nanomedicine conjugates.

    PubMed

    Capek, Ignác

    2017-02-15

    Noble metal, especially gold nanoparticles and their conjugates with biopolymers have immense potential for disease diagnosis and therapy on account of their surface plasmon resonance (SPR) enhanced light scattering and absorption. Conjugation of noble metal nanoparticles to ligands specifically targeted to biomarkers on diseased cells allows molecular-specific imaging and detection of disease. The development of smart gold nanoparticles (AuNPs) that can deliver therapeutics at a sustained rate directly to cancer cells may provide better efficacy and lower toxicity for treating cancer tumors. We highlight some of the promising classes of targeting systems that are under development for the delivery of gold nanoparticles. Nanoparticles designed for biomedical applications are often coated with polymers containing reactive functional groups to conjugate targeting ligands, cell receptors or drugs. Using targeted nanoparticles to deliver chemotherapeutic agents in cancer therapy offers many advantages to improve drug/gene delivery and to overcome many problems associated with conventional radiotherapy and chemotherapy. The targeted nanoparticles were found to be effective in killing cancer cells which were studied using various anticancer assays. Cell morphological analysis shows the changes occurred in cancer cells during the treatment with AuNPs. The results determine the influence of particle size and concentration of AuNPs on their absorption, accumulation, and cytotoxicity in model normal and cancer cells. As the mean particle diameter of the AuNPs decreased, their rate of absorption by the intestinal epithelium cells increased. These results provide important insights into the relationship between the dimensions of AuNPs and their gastrointestinal uptake and potential cytotoxicity. Furthermore gold nanoparticles efficiently convert the absorbed light into localized heat, which can be exploited for the selective laser photothermal therapy of cancer. We also review

  12. Synchrotron X-Ray Synthesized Gold Nanoparticles for Tumor Therapy

    SciTech Connect

    Chien, C. C.; Wang, C. H.; Tseng, P. Y.; Yang, T. Y.; Hua, T. E.; Hwu, Y.; Chen, Y. J.; Chung, K. H.; Je, J. H.; Margaritondo, G.

    2007-01-19

    Highly concentrated gold nanoparticles (20 {+-} 5 nm) were produced by an x-ray irradiation method. The particles were then examined for the interactions between gold and tumor cells under x-ray radiation conditions. The biological effects of gold nanoparticles were investigated in terms of the internalization, cytotoxicity and capability to enhance x-ray radiotherapy. The results of this investigation indicated that x-ray derived gold nanoparticles were nontoxic to CT-26 cell line and immobilized within cytoplasm. The irradiation experiments provided further evidence that gold nanoparticles were capable of enhancing the efficiency of radiotherapy.

  13. Formation of gold mineralization in ultramafic alkalic magmatic complexes

    NASA Astrophysics Data System (ADS)

    Ryabchikov, I. D.; Kogarko, L. N.; Sazonov, A. M.; Kononkova, N. N.

    2016-06-01

    Study of mineral inclusions within alluvial gold particles of the Guli Complex (East Siberia) and findings of lode gold in rocks of the same intrusion have demonstrated that gold mineralization occurs in interstitions of both early high-magnesium rocks (dunite) and later alkalic and carbonatite rocks. In dunite the native gold occurs in association with Fe-Ni sulfides (monosulfide solid solution, pentlandite, and heazlewoodite). Formation of the gold-bearing alloys took place under a low oxygen potential over a broad range of temperatures: from those close to 600°C down to below 400°C.

  14. RAPID COMMUNICATION: Surface vertical deposition for gold nanoparticle film

    NASA Astrophysics Data System (ADS)

    Diao, J. J.; Qiu, F. S.; Chen, G. D.; Reeves, M. E.

    2003-02-01

    In this rapid communication, we present the surface vertical deposition (SVD) method to synthesize the gold nanoparticle films. Under conditions where the surface of the gold nanoparticle suspension descends slowly by evaporation, the gold nanoparticles in the solid-liquid-gas junction of the suspension aggregate together on the substrate by the force of solid and liquid interface. When the surface properties of the substrate and colloidal nanoparticle suspension define for the SVD, the density of gold nanoparticles in the thin film made by SVD only depends on the descending velocity of the suspension surface and on the concentration of the gold nanoparticle suspension.

  15. Radicals Are Required for Thiol Etching of Gold Particles.

    PubMed

    Dreier, Timothy A; Ackerson, Christopher J

    2015-08-03

    Etching of gold with an excess of thiol ligand is used in both synthesis and analysis of gold particles. Mechanistically, the process of etching gold with excess thiol is unclear. Previous studies have obliquely considered the role of oxygen in thiolate etching of gold. Herein, we show that oxygen or a radical initiator is a necessary component for efficient etching of gold by thiolates. Attenuation of the etching process by radical scavengers in the presence of oxygen, and the restoration of activity by radical initiators under inert atmosphere, strongly implicate the oxygen radical. These data led us to propose an atomistic mechanism in which the oxygen radical initiates the etching process.

  16. Preparation and characterization of gold-decorated graphite nanosheet composites.

    PubMed

    Kim, Jungsoo; Nam, Dae Geun; Oh, Weon Tae

    2013-05-01

    Some composites of gold nanoparticles and graphite nanosheets were prepared by electrostatic interaction, and structurally and electrochemically characterized using X-ray diffraction, X-ray photoelectron spectroscopy, UVNis spectroscopy, transmission electron microscopy, and cyclic-voltammetry. Pristine graphite was chemically treated using aqueous acid solution, and dispersed inpoly(diallyldimethylammonium) chloride aqueous solution to prepare positively charged graphite nanosheets. The gold nanoparticles (GNPs) in this work were stabilized by sodium dodecyl sulfate, poly(sodium 4-styrene sulfonate), or poly(vinylpyrrolidone). Gold nanoparticles and graphite nanosheet composites with gold nanoparticles showed the characteristic surface plasmon band at -530 nm. The electrochemical properties of the graphite nanosheet composites with gold nanoparticles were studied by cyclic voltammetry, in which reduction potential and reduction current of gold nanoparticles were strongly dependent on the gold-wrapped stabilizer in the composites.

  17. Laser-induced silver nanojoining of gold nanoparticles.

    PubMed

    Son, Myounghee; Kim, Seol Ji; Kim, Jong-Yeob; Jang, Du-Jeon

    2013-08-01

    Gold nanoparticles have been silver-joined to fabricate nanowires by irradiating gold nanospheres of 25 nm in diameter and silver nanospheres of 8 nm in diameter held together on a carbon-coated copper grid with a 30 ps laser pulse of 532 nm for 20 min at a fluence of 3.0 mJ/cm2. Laser-induced nanojoining of silver nanoparticles as well as that of gold nanoparticles has also been carried out by varying the wavelength and fluence of irradiation laser pulses. Irradiation at an optimum condition of laser fluence is essential for the proper silver nanojoining of gold nanospheres to produce gold@silver core-shell composite nanowires. The excitation of the surface plasmon resonances of the base-metallic gold nanospheres rather than the filler-metallic silver nanospheres paves the way for the silver nanojoining of gold nanoparticles.

  18. The gold-sulfur interface at the nanoscale

    NASA Astrophysics Data System (ADS)

    Häkkinen, Hannu

    2012-06-01

    Thiolate-protected gold surfaces and interfaces, relevant for self-assembled monolayers of organic molecules on gold, for passivated gold nanoclusters and for molecule-gold junctions, are archetypal systems in various fields of current nanoscience research, materials science, inorganic chemistry and surface science. Understanding this interface at the nanometre scale is essential for a wide range of potential applications for site-specific bioconjugate labelling and sensing, drug delivery and medical therapy, functionalization of gold surfaces for sensing, molecular recognition and molecular electronics, and gold nanoparticle catalysis. During the past five years, considerable experimental and theoretical advances have furthered our understanding of the molecular structure of the gold-sulfur interface in these systems. This Review discusses the recent progress from the viewpoint of theory and computations, with connections to relevant experiments.

  19. In vitro cytotoxicity of gold nanorods in A549 cells.

    PubMed

    Tang, Ying; Shen, Yafeng; Huang, Libin; Lv, Gaojian; Lei, Changhai; Fan, Xiaoyan; Lin, Fangxing; Zhang, Yuxia; Wu, Lihui; Yang, Yongji

    2015-03-01

    Gold nanoparticles, which have unique physicochemical characteristics, are being used for an increasingly wide range of applications in biomedical research. In this study, gold nanorods (width of 25 nm, length of 52 nm) were found to be internalized by A549 cells and were primarily localized in the lysosomes and membranous vesicles. The integrity of the membranes of A549 cells exposed to gold nanorods for 4h was damaged, as indicated by laser scanning confocal microscopy (LSCM). Increased lactate dehydrogenase (LDH) leakage and decreased cell viability further indicated the concentration-dependent cytotoxicity of the gold nanorods to the A549 cells. Reactive oxygen species (ROS) production was induced in the A549 cells by the gold nanorods, and this effect was positively correlated with the concentration of the gold nanorods. The results of this study indicated that exposure to gold nanorods caused dose-dependent cytotoxicity in A549 cells and that oxidative stress may be the main factor causing cytotoxicity.

  20. The gold-sulfur interface at the nanoscale.

    PubMed

    Häkkinen, Hannu

    2012-05-22

    Thiolate-protected gold surfaces and interfaces, relevant for self-assembled monolayers of organic molecules on gold, for passivated gold nanoclusters and for molecule-gold junctions, are archetypal systems in various fields of current nanoscience research, materials science, inorganic chemistry and surface science. Understanding this interface at the nanometre scale is essential for a wide range of potential applications for site-specific bioconjugate labelling and sensing, drug delivery and medical therapy, functionalization of gold surfaces for sensing, molecular recognition and molecular electronics, and gold nanoparticle catalysis. During the past five years, considerable experimental and theoretical advances have furthered our understanding of the molecular structure of the gold-sulfur interface in these systems. This Review discusses the recent progress from the viewpoint of theory and computations, with connections to relevant experiments.

  1. Chirality in thiolate-protected gold clusters.

    PubMed

    Knoppe, Stefan; Bürgi, Thomas

    2014-04-15

    Over recent years, research on thiolate-protected gold clusters Au(m)(SR)n has gained significant interest. Milestones were the successful determination of a series of crystal structures (Au102(SR)44, Au25(SR)18, Au38(SR)24, Au36(SR)24, and Au28(SR)20). For Au102(SR)44, Au38(SR)24, and Au28(SR)20, intrinsic chirality was found. Strong Cotton effects (circular dichroism, CD) of gold clusters protected by chiral ligands have been reported a long time ago, indicating the transfer of chiral information from the ligand into the cluster core. Our lab has done extensive studies on chiral thiolate-protected gold clusters, including those protected with chiral ligands. We demonstrated that vibrational circular dichroism can serve as a useful tool for the determination of conformation of the ligand on the surface of the cluster. The first reports on crystal structures of Au102(SR)44 and Au38(SR)24 revealed the intrinsic chirality of these clusters. Their chirality mainly arises from the arrangement of the ligands on the surface of the cluster cores. As achiral ligands are used to stabilize the clusters, racemic mixtures are obtained. However, the separation of the enantiomers by HPLC was demonstrated which enabled the measurement of their CD spectra. Thermally induced inversion allows determination of the activation parameters for their racemization. The inversion demonstrates that the gold-thiolate interface is anything but fixed; in contrast, it is rather flexible. This result is of fundamental interest and needs to be considered in future applications. A second line of our research is the selective introduction of chiral, bidentate ligands into the ligand layer of intrinsically chiral gold clusters. The ligand exchange reaction is highly diastereoselective. The bidentate ligand connects two of the protecting units on the cluster surface and thus effectively stabilizes the cluster against thermally induced inversion. A minor (but significant) influence of chiral ligands to

  2. STM observation of thia[1 1]heterohelicene on gold( 1 1 1 ) and gold(1 1 0) surface

    NASA Astrophysics Data System (ADS)

    Taniguchi, Masahiro; Nakagawa, Hiroko; Yamagishi, Akihiko; Yamada, Kohichi

    2002-06-01

    Monolayers of helically shaped aromatic compound, hexathia[1 1]heterohelicene ([1 1]TH), which consists of five benzene rings and six thiophene rings were prepared on gold(1 1 1) and gold(1 1 0) surface under UHV condition. LEED and STM were used for the structural study focused on the molecular chirality. [1 1]TH monolayer on gold(1 1 1) substrate showed the same structure as on (1 1 1) analogue of polycrystalline surface. [1 1]TH evaporated on gold(1 1 0) showed loosely packed molecular chains. The results were compared with the results on gold polycrystalline surface and the bulk structural analysis.

  3. Antifungal activity of gold nanoparticles prepared by solvothermal method

    SciTech Connect

    Ahmad, Tokeer; Wani, Irshad A.; Lone, Irfan H.; Ganguly, Aparna; Manzoor, Nikhat; Ahmad, Aijaz; Ahmed, Jahangeer; Al-Shihri, Ayed S.

    2013-01-15

    Graphical abstract: Gold nanoparticles (7 and 15 nm) of very high surface area (329 and 269 m{sup 2}/g) have been successfully synthesized through solvothermal method by using tin chloride and sodium borohydride as reducing agents. As-prepared gold nanoparticles shows very excellent antifungal activity against Candida isolates and activity increases with decrease in the particle size. Display Omitted Highlights: ► Effect of reducing agents on the morphology of gold nanoparticles. ► Highly uniform and monodisperse gold nanoparticles (7 nm). ► Highest surface area of gold nanoparticles (329 m{sup 2/}g). ► Excellent antifungal activity of gold nanoparticles against Candida strains. -- Abstract: Gold nanoparticles have been successfully synthesized by solvothermal method using SnCl{sub 2} and NaBH{sub 4} as reducing agents. X-ray diffraction studies show highly crystalline and monophasic nature of the gold nanoparticles with face centred cubic structure. The transmission electron microscopic studies show the formation of nearly spherical gold nanoparticles of average size of 15 nm using SnCl{sub 2}, however, NaBH{sub 4} produced highly uniform, monodispersed and spherical gold nanoparticles of average grain size of 7 nm. A high surface area of 329 m{sup 2}/g for 7 nm and 269 m{sup 2}/g for 15 nm gold nanoparticles was observed. UV–vis studies assert the excitations over the visible region due to transverse and longitudinal surface plasmon modes. The gold nanoparticles exhibit excellent size dependant antifungal activity and greater biocidal action against Candida isolates for 7 nm sized gold nanoparticles restricting the transmembrane H{sup +} efflux of the Candida species than 15 nm sized gold nanoparticles.

  4. CHANGES IN GRADE, VOLUME AND CONTAINED GOLD DURING THE MINING LIFE-CYCLE OF GOLD PLACER DEPOSITS.

    USGS Publications Warehouse

    Bliss, J.D.; Orris, G.J.; Menzie, W.D.

    1987-01-01

    Analysis of gold placer data throughout the world suggests that gold grades and volumes cannot be used to distinguish between most types of gold placers. Only the alluvial plain and fan placers are significantly different among the types of gold placers considered. Gold grades and volumes change when working placers go from small-volume methods to large-volume methods. The odds that a placer will be dominantly worked using small-volume methods at the surface are about 5:3. Once small-volume mining has occurred, the odds against subsequent large-volume mining are about 4:1. If a deposit is suitable for large-volume mining and the amount of gold produced from small-volume mining was reported, an estimate of the remaining gold (log//1//0kg) can be made using an equation.

  5. Gold resource modeling using pod indicator kriging

    NASA Astrophysics Data System (ADS)

    Bargawa, Waterman Sulistyana; Rauf, Abdul; Amri, Nur Ali

    2016-02-01

    This paper describes an implementation of the pod indicator kriging method used to gold resource modeling. Method such as ordinary kriging estimate the mean grade of a block that is fairly large. The usual outcome is that large blocks rarely turn out to be all ore or all waste, thus making reserve estimates an incorrect estimate of what will be mined. Pod indicator kriging offers a solution to this problem by estimating the distribution of grade values within a large block, rather than just estimating the mean grade of the block. Knowing the distribution of grade value within the block, it is then easy to calculate the proportion of the block that is above cutoff grade and the grade of the ore above cutoff grade. This research shows that the pod indicator kriging model is quite applicable and reliable in gold resourcemodeling.

  6. Prospecting for gold in the United States

    USGS Publications Warehouse

    ,

    1967-01-01

    Prospecting for gold is something that probably everyone dreams of trying at least once. To the person who is mainly concerned with this activity as a vacation diversion, prospecting offers a special excitement. There is a constant hope that the next pan of sediment may be "pay dirt," and no other thrill can compare with that experienced when one sees even a few tiny flecks of gold glittering in the black sand at the bottom of his pan. The search itself is its own reward for the efforts expended by the vacation prospector. The would-be prospector hoping for financial gain, however, should carefully consider all the facts of the situation before deciding to set out on a prospecting expedition.

  7. Interconnecting Gold Islands with DNA Origami Nanotubes

    PubMed Central

    Ding, Baoquan; Wu, Hao; Xu, Wei; Zhao, Zhao; Liu, Yan; Yu, Hongbin; Yan, Hao

    2012-01-01

    Scaffolded DNA origami has recently emerged as a versatile, programmable method to fold DNA into arbitrarily shaped nanostructures that are spatially addressable, with sub-10 nm resolution. Toward functional DNA nanotechnology, one of the key challenges is to integrate the bottom up self-assembly of DNA origami with the top-down lithographic methods used to generate surface patterning. In this report we demonstrate that fixed length DNA origami nanotubes, modified with multiple thiol groups near both ends, can be used to connect surface patterned gold islands (tens of nanometers in diameter) fabricated by electron beam lithography (EBL). Atomic force microscopic imaging verified that the DNA origami nanotubes can be efficiently aligned between gold islands with various inter-island distances and relative locations. This development represents progress toward the goal of bridging bottom up and top down assembly approaches. PMID:21070012

  8. Gold Nanoparticles for Neural Prosthetics Devices

    PubMed Central

    Zhang, Huanan; Shih, Jimmy; Zhu, Jian; Kotov, Nicholas A.

    2012-01-01

    Treatments of neurological diseases and the realization of brain-computer interfaces require ultrasmall electrodes which are “invisible” to resident immune cells. Functional electrodes smaller than 50μm are impossible to produce with traditional materials due to high interfacial impedance at the characteristic frequency of neural activity and insufficient charge storage capacity. The problem can be resolved by using gold nanoparticle nanocomposites. Careful comparison indicates that layer-by-layer assembled films from Au NPs provide more than threefold improvement in interfacial impedance and one order of magnitude increase in charge storage capacity. Prototypes of microelectrodes could be made using traditional photolithography. Integration of unique nanocomposite materials with microfabrication techniques opens the door for practical realization of the ultrasmall implantable electrodes. Further improvement of electrical properties is expected when using special shapes of gold nanoparticles. PMID:22734673

  9. Biological synthesis of triangular gold nanoprisms

    NASA Astrophysics Data System (ADS)

    Shankar, S. Shiv; Rai, Akhilesh; Ankamwar, Balaprasad; Singh, Amit; Ahmad, Absar; Sastry, Murali

    2004-07-01

    The optoelectronic and physicochemical properties of nanoscale matter are a strong function of particle size. Nanoparticle shape also contributes significantly to modulating their electronic properties. Several shapes ranging from rods to wires to plates to teardrop structures may be obtained by chemical methods; triangular nanoparticles have been synthesized by using a seeded growth process. Here, we report the discovery that the extract from the lemongrass plant, when reacted with aqueous chloroaurate ions, yields a high percentage of thin, flat, single-crystalline gold nanotriangles. The nanotriangles seem to grow by a process involving rapid reduction, assembly and room-temperature sintering of 'liquid-like' spherical gold nanoparticles. The anisotropy in nanoparticle shape results in large near-infrared absorption by the particles, and highly anisotropic electron transport in films of the nanotriangles.

  10. Synthesis and spectroscopic characterization of gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Philip, Daizy

    2008-11-01

    Photoluminescent nanoparticles of gold with size 3, 4, 6, and 9 nm are prepared by borohydride/citrate reduction in presence of polyethylene glycol (PEG)/tannic acid. The prepared nanomaterials are characterized by UV-vis spectroscopy and dynamic light scattering (DLS) technique. Intense photoluminescence (PL) is observed in nanoparticles prepared by fast reduction with borohydride in presence of PEG. A red shift of PL emission from 408 to 456 nm is observed for the change of size from 4 to 6 nm. Increase in PL intensity is observed for all the nanoparticles on the addition of KCl. Citrate reduced gold colloid which consists of large particles of size ˜35 nm with anisotropic shapes showing two plasmon peaks is also prepared. The anisotropy is confirmed by TEM measurement. SERS activity of this colloid is tested using glutamic acid as an adsorbate probe. Assignment of the observed bands is given.

  11. Tamper indicating gold nanocup plasmonic films

    NASA Astrophysics Data System (ADS)

    DeVetter, Brent M.; Bernacki, Bruce E.; Bennett, Wendy D.; Schemer-Kohrn, Alan; Alvine, Kyle J.

    2017-02-01

    The spectral signatures of nanoplasmonic films are both robust and tailorable with optical responses ranging from the visible to the near-infrared. We present the development of flexible, elastomeric nanoplasmonic films consisting of periodic arrays of gold nanocups as tamper indicating films. Gold nanocups have polarization-sensitive optical properties that may be manufactured into films that offer unique advantages for tamper indication. These flexible films can be made quickly and at low-cost using the commercially available monodisperse polystyrene nanospheres through self-assembly followed by plasma etching, metal deposition, and lift-off from a sacrificial substrate. The polarization- and angle-dependent optical spectroscopic measurements were performed to characterize the fabricated films. Using polarization-sensitive hyperspectral imaging, we demonstrate how these films can be applied to tamper indication and counterfeit resistance applications.

  12. Ordered arrays of nanoporous gold nanoparticles

    PubMed Central

    Ji, Ran; Albrecht, Arne

    2012-01-01

    Summary A combination of a “top-down” approach (substrate-conformal imprint lithography) and two “bottom-up” approaches (dewetting and dealloying) enables fabrication of perfectly ordered 2-dimensional arrays of nanoporous gold nanoparticles. The dewetting of Au/Ag bilayers on the periodically prepatterned substrates leads to the interdiffusion of Au and Ag and the formation of an array of Au–Ag alloy nanoparticles. The array of alloy nanoparticles is transformed into an array of nanoporous gold nanoparticles by a following dealloying step. Large areas of this new type of material arrangement can be realized with this technique. In addition, this technique allows for the control of particle size, particle spacing, and ligament size (or pore size) by varying the period of the structure, total metal layer thickness, and the thickness ratio of the as-deposited bilayers. PMID:23019561

  13. A 'Pot of Gold' Rich with Nuggets

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This close-up image taken by the Mars Exploration Rover Spirit highlights the nodular nuggets that cover the rock dubbed 'Pot of Gold.' These nuggets appear to stand on the end of stalk-like features. The surface of the rock is dotted with fine-scale pits. Data from the rover's scientific instruments have shown that Pot of Gold contains the mineral hematite, which can be formed with or without water.

    Scientists are planning further observations of this rock, which they hope will yield more insight into the hematite's origins as well as how the enigmatic nuggets formed.

    This image was taken by Spirit's microscopic imager on sol 162 (June 17, 2004). The observed area is 3 centimeters by 3 centimeters (1.2 inches by 1.2 inches)

  14. Topological states on the gold surface

    PubMed Central

    Yan, Binghai; Stadtmüller, Benjamin; Haag, Norman; Jakobs, Sebastian; Seidel, Johannes; Jungkenn, Dominik; Mathias, Stefan; Cinchetti, Mirko; Aeschlimann, Martin; Felser, Claudia

    2015-01-01

    Gold surfaces host special electronic states that have been understood as a prototype of Shockley surface states. These surface states are commonly employed to benchmark the capability of angle-resolved photoemission spectroscopy (ARPES) and scanning tunnelling spectroscopy. Here we show that these Shockley surface states can be reinterpreted as topologically derived surface states (TDSSs) of a topological insulator (TI), a recently discovered quantum state. Based on band structure calculations, the Z2-type invariants of gold can be well-defined to characterize a TI. Further, our ARPES measurement validates TDSSs by detecting the dispersion of unoccupied surface states. The same TDSSs are also recognized on surfaces of other well-known noble metals (for example, silver, copper, platinum and palladium), which shines a new light on these long-known surface states. PMID:26658826

  15. Gold nanoparticles for in vivo cell tracking.

    PubMed

    Meir, Rinat; Motiei, Menachem; Popovtzer, Rachela

    2014-09-01

    Cell-based therapy offers a promising solution for the treatment of diseases and injuries that conventional medicines and therapies cannot cure effectively, and thus comprises an encouraging arena for future medical breakthroughs. The development of an accurate and quantitative noninvasive cell tracking technique is a highly challenging task that could help in evaluating the effectiveness of treatments. Moreover, cell tracking could provide essential knowledge regarding the fundamental trafficking patterns and poorly understood mechanisms underlying the success or failure of cell therapy. This article focuses on gold nanoparticles, which provide cells with 'visibility' in a variety of imaging modalities for stem cell therapy, immune cell therapy and cancer treatment. Current challenges and future prospects relating to the use of gold nanoparticles in such roles are discussed.

  16. Topological states on the gold surface.

    PubMed

    Yan, Binghai; Stadtmüller, Benjamin; Haag, Norman; Jakobs, Sebastian; Seidel, Johannes; Jungkenn, Dominik; Mathias, Stefan; Cinchetti, Mirko; Aeschlimann, Martin; Felser, Claudia

    2015-12-14

    Gold surfaces host special electronic states that have been understood as a prototype of Shockley surface states. These surface states are commonly employed to benchmark the capability of angle-resolved photoemission spectroscopy (ARPES) and scanning tunnelling spectroscopy. Here we show that these Shockley surface states can be reinterpreted as topologically derived surface states (TDSSs) of a topological insulator (TI), a recently discovered quantum state. Based on band structure calculations, the Z2-type invariants of gold can be well-defined to characterize a TI. Further, our ARPES measurement validates TDSSs by detecting the dispersion of unoccupied surface states. The same TDSSs are also recognized on surfaces of other well-known noble metals (for example, silver, copper, platinum and palladium), which shines a new light on these long-known surface states.

  17. Biological synthesis of triangular gold nanoprisms.

    PubMed

    Shankar, S Shiv; Rai, Akhilesh; Ankamwar, Balaprasad; Singh, Amit; Ahmad, Absar; Sastry, Murali

    2004-07-01

    The optoelectronic and physicochemical properties of nanoscale matter are a strong function of particle size. Nanoparticle shape also contributes significantly to modulating their electronic properties. Several shapes ranging from rods to wires to plates to teardrop structures may be obtained by chemical methods; triangular nanoparticles have been synthesized by using a seeded growth process. Here, we report the discovery that the extract from the lemongrass plant, when reacted with aqueous chloroaurate ions, yields a high percentage of thin, flat, single-crystalline gold nanotriangles. The nanotriangles seem to grow by a process involving rapid reduction, assembly and room-temperature sintering of 'liquid-like' spherical gold nanoparticles. The anisotropy in nanoparticle shape results in large near-infrared absorption by the particles, and highly anisotropic electron transport in films of the nanotriangles.

  18. Vibrational and electronic excitations in gold nanocrystals

    NASA Astrophysics Data System (ADS)

    Bayle, Maxime; Combe, Nicolas; Sangeetha, Neralagatta M.; Viau, Guillaume; Carles, Robert

    2014-07-01

    An experimental analysis of all elementary excitations - phonons and electron-holes - in gold nanocrystals has been performed using plasmon resonance Raman scattering. Assemblies of monodisperse, single-crystalline gold nanoparticles, specific substrates and specific experimental configurations have been used. Three types of excitations are successively analyzed: collective quasi-acoustical vibrations of the particles (Lamb's modes), electron-hole excitations (creating the so-called ``background'' in surface-enhanced Raman scattering) and ensembles of atomic vibrations (``bulk'' phonons). The experimental vibrational density of states extracted from the latter contribution is successfully compared with theoretical estimations performed using atomic simulations. The dominant role of surface atoms over the core ones on lattice dynamics is clearly demonstrated. Consequences on the thermodynamic properties of nanocrystals such as the decrease of the characteristic Debye temperature are also considered.

  19. Ultraviolet imaging detectors for the GOLD mission

    NASA Astrophysics Data System (ADS)

    Siegmund, O. H. W.; McPhate, J.; Curtis, T.; Jelinsky, S.; Vallerga, J. V.; Hull, J.; Tedesco, J.

    2016-07-01

    The GOLD mission is a NASA Explorer class ultraviolet Earth observing spectroscopy instrument that will be flown on a telecommunications satellite in geostationary orbit in 2018. Microchannel plate detectors operating in the 132 nm to 162 nm FUV bandpass with 2D imaging cross delay line readouts and electronics have been built for each of the two spectrometer channels for GOLD. The detectors are "open face" with CsI photocathodes, providing 30% efficiency at 130.4 nm and 15% efficiency at 160.8 nm. These detectors with their position encoding electronics provide 600 x 500 FWHM resolution elements and are photon counting, with event handling rates of > 200 KHz. The operational details of the detectors and their performance are discussed.

  20. Gold nanodisk array surface plasmon resonance sensor

    NASA Astrophysics Data System (ADS)

    Tian, Xueli

    Surface plasmon resonances in periodic metal nanostructures have been investigated for sensing applications over the last decade. The resonance wavelengths of the nanostructures are usually measured in the transmission or reflection spectrum for chemical and biological sensing. In this thesis, I introduce a nanoscale gap mediated surface plasmon resonance nanodisk array for displacement sensing and a super-period gold nanodisk grating enabled surface plasmon resonance spectrometer sensor. The super-period gold nanodisk grating has a small subwavelength period and a large diffraction grating period. Surface plasmon resonance spectra are measured in the first order diffraction spatial profiles captured by a charge-coupled device (CCD). A surface plasmon resonance sensor for the bovine serum albumin (BSA) protein nanolayer bonding is demonstrated by measuring the surface plasmon resonance shift in the first order diffraction spatial intensity profiles captured by the CCD.

  1. Atomic Diffusion within Individual Gold Nanocrystal

    PubMed Central

    Xiong, Gang; Clark, Jesse N.; Nicklin, Chris; Rawle, Jonathan; Robinson, Ian K.

    2014-01-01

    Due to their excess surface free energy and structural instabilities, nanoparticles exhibit interesting physical and chemical properties. There has been an ever-growing interest in investigating these properties, driven by the desire to further miniaturize electronic devices, develop new functional materials and catalysts. Here, the intriguing question of how diffusion evolves in a single nanoparticle is investigated by measuring the spatial and temporal variations of the diffracted coherent X-ray intensity during copper diffusion into a gold nanocrystal. Dislocation loops formed from the insertion of single layer of extra atoms between neighbouring gold host lattice planes are detected. Au-Cu alloy channels are found to penetrate the nanocrystal due to the differential diffusion rate along different directions. With the advent of higher brilliance sources and free-electron-lasers, Bragg Coherent X-ray Diffraction Imaging can play an important role in unveiling atomic behaviours in three dimensions for nanomaterials during various fundamental processes. PMID:25341377

  2. Superlubricity of graphene nanoribbons on gold surfaces.

    PubMed

    Kawai, Shigeki; Benassi, Andrea; Gnecco, Enrico; Söde, Hajo; Pawlak, Rémy; Feng, Xinliang; Müllen, Klaus; Passerone, Daniele; Pignedoli, Carlo A; Ruffieux, Pascal; Fasel, Roman; Meyer, Ernst

    2016-02-26

    The state of vanishing friction known as superlubricity has important applications for energy saving and increasing the lifetime of devices. Superlubricity, as detected with atomic force microscopy, appears when sliding large graphite flakes or gold nanoclusters across surfaces, for example. However, the origin of the behavior is poorly understood because of the lack of a controllable nanocontact. We demonstrated the superlubricity of graphene nanoribbons when sliding on gold with a joint experimental and computational approach. The atomically well-defined contact allows us to trace the origin of superlubricity, unraveling the role played by ribbon size and elasticity, as well as by surface reconstruction. Our results pave the way to the scale-up of superlubricity and thus to the realization of frictionless coatings.

  3. A 'Pot of Gold' Rich with Nuggets

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This close-up image taken by the Mars Exploration Rover Spirit highlights the nodular nuggets that cover the rock dubbed 'Pot of Gold.' These nuggets appear to stand on the end of stalk-like features. The surface of the rock is dotted with fine-scale pits. Data from the rover's scientific instruments have shown that Pot of Gold contains the mineral hematite, which can be formed with or without water.

    Scientists are planning further observations of this rock, which they hope will yield more insight into the hematite's origins as well as how the enigmatic nuggets formed.

    This image was taken by Spirit's microscopic imager on sol 162 (June 17, 2004). The observed area is 3 centimeters by 3 centimeters (1.2 inches by 1.2 inches)

  4. Silver- and gold-mediated nucleobase bonding.

    PubMed

    Acioli, Paulo H; Srinivas, Sudha

    2014-08-01

    We report the results of a density functional theory investigation of the bonding of nucleobases mediated by silver and gold atoms in the gas phase. Our calculations use the Becke exchange and Perdew-Wang correlation functional (BPW91) combined with the Stuttgart effective core potentials to represent the valence electrons of gold, silver, and platinum, and the all-electron DGTZVP basis set for C, H, N, and O. This combination was chosen based on tests on the metal atoms and tautomers of adenine, cytosine, and guanine. To establish a benchmark to understand the metal-mediated bonding, we calculated the binding energy of each of the base pairs in their canonical forms. Our calculations show rather strong bonds between the Watson-Crick base pairs when compared with typical values for N-H-N and N-H-O hydrogen bonds. The neutral metal atoms tend to bond near the nitrogen atoms. The effect of the metal atoms on the bonding of nucleobases differs depending on whether or not the metal atoms bond to one of the hydrogen-bonding sites. When the silver or gold atoms bond to a non-hydrogen-bonding site, the effect is a slight enhancement of the cytosine-guanine bonding, but there is almost no effect on the adenine-thymine pairing. The metal atoms can block one of the hydrogen-bonding sites, thus preventing the normal cytosine-guanine and adenine-thymine pairings. We also find that both silver and gold can bond to consecutive guanines in a similar fashion to platinum, albeit with a significantly lower binding energy.

  5. Optical Trapping of Gold Nanoparticles in Air.

    PubMed

    Jauffred, Liselotte; Taheri, S Mohammad-Reza; Schmitt, Regina; Linke, Heiner; Oddershede, Lene B

    2015-07-08

    Most progress on optical nanoparticle control has been in liquids, while optical control in air has proven more challenging. By utilizing an air chamber designed to have a minimum of turbulence and a single laser beam with a minimum of aberration, we trapped individual 200 to 80 nm gold nanoparticles in air and quantified the corresponding trapping strengths. These results pave the way for construction of metallic nanostructures in air away from surfaces.

  6. 'Pot of Gold' Close-up

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This false-color image taken by the panoramic camera on the Mars Exploration Rover Spirit shows a close-up of the rock dubbed 'Pot of Gold' (left), which is located near the base of the 'Columbia Hills' in Gusev Crater. Scientists are intrigued by this unusual-looking, nodule-covered rock and plan to investigate its detailed chemistry in coming sols. This picture was taken on sol 159 (June 14, 2004).

  7. Optical Limiting Materials Based on Gold Nanoparticles

    DTIC Science & Technology

    2014-04-30

    AFRL-OSR-VA-TR-2014-0104 OPTICAL LIMITING MATERIALS BASED ON GOLD NANOPARTICLES John Dawson SOUTH CAROLINA RESEARCH FOUNDATION Final Report 04/30...2009; therefore, the award was modified so that her former department chair, John Dawson, became the PI of the award, with Murphy as a subcontract at...Mediated Synthesis to Nanoscale Sculpting,” Curr. Opin. Colloid. Interfac. Sci. 2011, 16, 128-134. • Sivapalan, S. T.; Vella, J. H.; Yang, T. K.; Dalton

  8. 'Pot of Gold' Close-up

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This false-color image taken by the panoramic camera on the Mars Exploration Rover Spirit shows a close-up of the rock dubbed 'Pot of Gold' (left), which is located near the base of the 'Columbia Hills' in Gusev Crater. Scientists are intrigued by this unusual-looking, nodule-covered rock and plan to investigate its detailed chemistry in coming sols. This picture was taken on sol 159 (June 14, 2004).

  9. Differential interferences with clinical chemistry assays by gold nanorods, and gold and silica nanospheres.

    PubMed

    Hinkley, Georgia K; Carpinone, Paul L; Munson, John W; Powers, Kevin W; Roberts, Stephen M

    2015-02-01

    Nanomaterials are known to cause interference with several standard toxicological assays. As part of an in vivo study of PEG-coated gold nanorods in mice, nanorods were added to reference serum, and results for standard clinical chemistry parameters were compared with serum analyzed without nanorods. PEG-coated gold nanorods produced several concentration-dependent interferences. Comparisons were then made with PEG-coated gold and silica nanospheres. Interferences were observed for both materials that differed from gold nanorods. Removal of the particles from serum by centrifugation prior to analysis resolved most, but not all of the interferences. Additional clinical chemistry analyzers were used to further investigate trends in assay interference. We conclude that PEG-coated gold and silica nanoparticles can interfere with standard clinical chemistry tests in ways that vary depending upon material, shape, and specific assay methodology employed. Assay interferences by nanomaterials cannot always be predicted, underscoring the need to verify that nanomaterials under study do not interfere with methods used to evaluate potential biological effects.

  10. A novel 'Gold on Gold' biosensing scheme for an on-fiber immunoassay

    NASA Astrophysics Data System (ADS)

    Punjabi, N.; Satija, J.; Mukherji, S.

    2015-05-01

    In this paper, we propose a novel „gold on gold‟ biosensing scheme for absorbance based fiber-optic biosensor. First, a self-assembled monolayer of gold nanoparticles is formed at the sensing region of the fiber-optic probe by incubating an amino-silanized probe in a colloidal gold solution. Thereafter, the receptor moieties, i.e. Human immunoglobulin G (HIgG) were immobilized by using standard alkanethiol and classic carbodiimide coupling chemistry. Finally, biosensing experiments were performed with different concentrations of gold nanoparticle-tagged analyte, i.e. Goat anti- Human immunoglobulin G (Nanogold-GaHIgG). The sensor response was observed to be more than five-fold compared to the control bioassay, in which the sensor matrix was devoid of gold nanoparticle film. Also, the response was found to be ~10 times higher compared to the FITC-tagged scheme and ~14.5 times better compared to untagged scheme. This novel scheme also demonstrated the potential in improving the limit of detection for the fiber-optic biosensors.

  11. Reprotoxicity of gold, silver, and gold-silver alloy nanoparticles on mammalian gametes.

    PubMed

    Tiedemann, Daniela; Taylor, Ulrike; Rehbock, Christoph; Jakobi, Jurij; Klein, Sabine; Kues, Wilfried A; Barcikowski, Stephan; Rath, Detlef

    2014-03-07

    Metal and alloy nanoparticles are increasingly developed for biomedical applications, while a firm understanding of their biocompatibility is still missing. Various properties have been reported to influence the toxic potential of nanoparticles. This study aimed to assess the impact of nanoparticle size, surface ligands and chemical composition of gold, silver or gold-silver alloy nanoparticles on mammalian gametes. An in vitro assay for porcine gametes was developed, since these are delicate primary cells, for which well-established culture systems exist and functional parameters are defined. During coincubation with oocytes for 46 h neither any of the tested gold nanoparticles nor the gold-silver alloy particles with a silver molar fraction of up to 50% showed any impact on oocyte maturation. Alloy nanoparticles with 80% silver molar fraction and pure silver nanoparticles inhibited cumulus-oocyte maturation. Confocal microscopy revealed a selective uptake of gold nanoparticles by oocytes, while silver and alloy particles mainly accumulated in the cumulus cell layer surrounding the oocyte. Interestingly sperm vitality parameters (motility, membrane integrity and morphology) were not affected by any of the tested nanoparticles. Only sporadic association of nanoparticles with the sperm plasma membrane was found by transmission electron microscopy. In conclusion, mammalian oocytes were sensitive to silver containing nanoparticles. Likely, the delicate process of completing meiosis in maternal gametes features high vulnerability towards nanomaterial derived toxicity. The results imply that released Ag(+)-ions are responsible for the observed toxicity, but the compounding into an alloy seemed to alleviate the toxic effects to a certain extent.

  12. Diazonium-derived aryl films on gold nanoparticles: evidence for a carbon-gold covalent bond.

    PubMed

    Laurentius, Lars; Stoyanov, Stanislav R; Gusarov, Sergey; Kovalenko, Andriy; Du, Rongbing; Lopinski, Gregory P; McDermott, Mark T

    2011-05-24

    Tailoring the surface chemistry of metallic nanoparticles is generally a key step for their use in a wide range of applications. There are few examples of organic films covalently bound to metal nanoparticles. We demonstrate here that aryl films are formed on gold nanoparticles from the spontaneous reduction of diazonium salts. The structure and the bonding of the film is probed with surface-enhanced Raman scattering (SERS). Extinction spectroscopy and SERS show that a nitrobenzene film forms on gold nanoparticles from the corresponding diazonium salt. Comparison of the SERS spectrum with spectra computed from density functional theory models reveals a band characteristic of a Au-C stretch. The observation of this stretch is direct evidence of a covalent bond. A similar band is observed in high-resolution electron energy loss spectra of nitrobenzene layers on planar gold. The bonding of these types of films through a covalent interaction on gold is consistent with their enhanced stability observed in other studies. These findings provide motivation for the use of diazonium-derived films on gold and other metals in applications where high stability and/or strong adsorbate-substrate coupling are required.

  13. Preparation of gold patterns on polyimide coating via layer-by-layer deposition of gold nanoparticles.

    PubMed

    Basarir, Fevzihan; Yoon, Tae-Ho

    2010-12-01

    Gold patterns were prepared via the microcontact printing (MCP) of 3-aminopropyltriethoxysilane (γ-APS) on plasma etched polyimide films, followed by the layer-by-layer (LBL) deposition of gold nanoparticles (GNPs), O(2) plasma etching, and sintering. First, the polyimide film on silicon wafer was modified via water plasma etching, followed by the MCP of γ-APS using a flat polydimethylsiloxane (PDMS) stamp. Next, the multilayer of GNPs was formed on the γ-APS layer by the LBL deposition of citrate-capped GNPs and poly(ethyleneimine) (PEI). Then, the samples were subjected to O(2) plasma etching to remove PEI and citrates, and then sintering to produce metallic gold. Finally, gold patterns were prepared with a patterned PDMS stamp (line width of 10μm). The GNP multilayer was characterized by UV-vis/near-IR spectrometer, atomic force microscopy (AFM), optical microscopy (OM), alpha-step and electrical conductivity measurement by two-point probe method. Very clean gold patterns with electrical conductivity of 4.1×10(4)Ω(-1)cm(-1) (20-layer GNP) were obtained. Copyright © 2010 Elsevier Inc. All rights reserved.

  14. Irradiation stability and cytotoxicity of gold nanoparticles for radiotherapy

    PubMed Central

    Zhang, Xiao-Dong; Guo, Mei-Li; Wu, Hong-Ying; Sun, Yuan-Ming; Ding, Yan-Qiu; Feng, Xin; Zhang, Liang-An

    2009-01-01

    Gold nanoparticles are promising as a kind of novel radiosensitizer in radiotherapy. If gold nanoparticles are shown to have good irradiation stability and biocompatibility, they would play an important role in radiotherapy. In this work, we investigated irradiation effects of gold nanoparticles under 2–10 kR gamma irradiation and cytotoxicity of gold nanoparticles with human K562 cells by using Cell Titre-Glo™ luminescent cell viability assay. The results revealed that gamma irradiation had not induced any obvious instability and size variations in gold nanoparticles. We found that gold nanoparticles showed excellent radiation hardness with an absorbed dose conversation factor of 9.491 rad/R. Meanwhile, the surface plasmon resonance of gold nanoparticles was enhanced obviously after 2–10 kR gamma irradiation. Subsequently, cytotoxicity tests indicated that the extremely high concentration of gold nanoparticles could cause a sharp decrease in K562 cell viability, while the low concentration of gold nanoparticles had no obvious influence on the cell viability. Our results revealed that gold nanoparticles were stable under high-energy ray irradiation and showed concentration-dependent cytotoxicity. PMID:19774115

  15. Gold fingerprinting by laser ablation inductively coupled plasma mass spectrometry

    NASA Astrophysics Data System (ADS)

    Watling, R. John; Herbert, Hugh K.; Delev, Dianne; Abell, Ian D.

    1994-02-01

    Laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) has been applied to the characterization of the trace element composition "fingerprint" of selected gold samples from Western Australia and South Africa. By comparison of the elemental associations it is possible to relate gold to a specific mineralizing event, mine or bullion sample. This methodology facilitates identification of the provenance of stolen gold or gold used in salting activities. In this latter case, it is common for gold from a number of sources to be used in the salting process. Consequently, gold in the prospect being salted will not come from a single source and identification of multiple sources for this gold will establish that salting has occurred. Preliminary results also indicate that specific elemental associations could be used to identify the country of origin of gold. The technique has already been applied in 17 cases involving gold theft in Western Australia, where it is estimated that up to 2% of gold production is "relocated" each year as a result of criminal activities.

  16. Local density variation of gold nanoparticles in aquatic environments

    NASA Astrophysics Data System (ADS)

    Hosseinzadeh, F.; Shirazian, F.; Shahsavari, R.; Khoei, A. R.

    2016-10-01

    Gold (Au) nanoparticles are widely used in diagnosing cancer, imaging, and identification of therapeutic methods due to their particular quantum characteristics. This research presents different types of aqueous models and potentials used in TIP3P, to study the effect of the particle size and density of Au clusters in aquatic environments; so it can be useful to facilitate future investigation of the interaction of proteins with Au nanoparticles. The EAM potential is used to model the structure of gold clusters. It is observed that in the systems with identical gold/water density and different cluster radii, gold particles are distributed in aqueous environment almost identically. Thus, Au particles have identical local densities, and the root mean square displacement (RMSD) increases with a constant slope. However in systems with constant cluster radii and different gold/water densities, Au particle dispersion increases with density; as a result, the local density decreases and the RMSD increases with a larger slope. In such systems, the larger densities result in more blunted second peaks in gold-gold radial distribution functions, owing to more intermixing of the clusters and less FCC crystalline features at longer range, a mechanism that is mediated by the competing effects of gold-water and gold-gold interactions.

  17. Role of CO2 in the formation of gold deposits.

    PubMed

    Phillips, G N; Evans, K A

    2004-06-24

    Much of global gold production has come from deposits with uneconomic concentrations of base metals, such as copper, lead and zinc. These 'gold-only' deposits are thought to have formed from hot, aqueous fluids rich in carbon dioxide, but only minor significance has been attached to the role of the CO2 in the process of gold transport. This is because chemical bonding between gold ions and CO2 species is not strong, and so it is unlikely that CO2 has a direct role in gold transport. An alternative indirect role for CO2 as a weak acid that buffers pH has also appeared unlikely, because previously inferred pH values for such gold-bearing fluids are variable. Here we show that such calculated pH values are unlikely to record conditions of gold transport, and propose that CO2 may play a critical role during gold transport by buffering the fluid in a pH range where elevated gold concentration can be maintained by complexation with reduced sulphur. Our conclusions, which are supported by geochemical modelling, may provide a platform for new gold exploration methods.

  18. Irradiation stability and cytotoxicity of gold nanoparticles for radiotherapy.

    PubMed

    Zhang, Xiao-Dong; Guo, Mei-Li; Wu, Hong-Ying; Sun, Yuan-Ming; Ding, Yan-Qiu; Feng, Xin; Zhang, Liang-An

    2009-01-01

    Gold nanoparticles are promising as a kind of novel radiosensitizer in radiotherapy. If gold nanoparticles are shown to have good irradiation stability and biocompatibility, they would play an important role in radiotherapy. In this work, we investigated irradiation effects of gold nanoparticles under 2-10 kR gamma irradiation and cytotoxicity of gold nanoparticles with human K562 cells by using Cell Titre-Glo luminescent cell viability assay. The results revealed that gamma irradiation had not induced any obvious instability and size variations in gold nanoparticles. We found that gold nanoparticles showed excellent radiation hardness with an absorbed dose conversation factor of 9.491 rad/R. Meanwhile, the surface plasmon resonance of gold nanoparticles was enhanced obviously after 2-10 kR gamma irradiation. Subsequently, cytotoxicity tests indicated that the extremely high concentration of gold nanoparticles could cause a sharp decrease in K562 cell viability, while the low concentration of gold nanoparticles had no obvious influence on the cell viability. Our results revealed that gold nanoparticles were stable under high-energy ray irradiation and showed concentration-dependent cytotoxicity.

  19. Effects of gold coating on experimental implant fixation

    PubMed Central

    Zainali, Kasra; Danscher, Gorm; Jakobsen, Thomas; Jakobsen, Stig S.; Baas, Jørgen; Møller, Per; Bechtold, Joan E.; Soballe, Kjeld

    2013-01-01

    Insertions of orthopedic implants are traumatic procedures that trigger an inflammatory response. Macrophages have been shown to liberate gold ions from metallic gold. Gold ions are known to act in an antiinflammatory manner by inhibiting cellular NF-κB–DNA binding and suppressing I-κ B-kinase activation. The present study investigated whether gilding implant surfaces augmented early implant osseointegration and implant fixation by its modulatory effect on the local inflammatory response. Ion release was traced by autometallographic silver enhancement. Gold-coated cylindrical porous coated Ti6Al4V implants were inserted press-fit in the proximal part of tibiae in nine canines and control implants without gold inserted contralateral. Observation time was 4 weeks. Biomechanical push-out tests showed that implants with gold coating had ~50% decrease in mechanical strength and stiffness. Histomorphometrical analyses showed gold-coated implants had a decrease in overall total bone-to-implant contact of 35%. Autometallographic analysis revealed few cells loaded with gold close to the gilded implant surface. The findings demonstrate that gilding of implants negatively affects mechanical strength and osseointegration because of a significant effect of the released gold ions on the local inflammatory process around the implant. The possibility that a partial metallic gold coating could prolong the period of satisfactory mechanical strength, however, cannot be excluded. PMID:18335533

  20. Assembly of functional gold nanoparticle on silica microsphere.

    PubMed

    Wang, Hsuan-Lan; Lee, Fu-Cheng; Tang, Tse-Yu; Zhou, Chenguang; Tsai, De-Hao

    2016-05-01

    We demonstrate a controlled synthesis of silica microsphere with the surface-decorated functional gold nanoparticles. Surface of silica microsphere was modified by 3-aminopropypltriethoxysilane and 3-aminopropyldimethylethoxysilane to generate a positive electric field, by which the gold nanoparticles with the negative charges (unconjugated, thiolated polyethylene glycol functionalized with the traceable packing density and conformation) were able to be attracted to the silica microsphere. Results show that both the molecular conjugation on gold nanoparticle and the uniformity in the amino-silanization of silica microsphere influenced the loading and the homogeneity of gold nanoparticles on silica microsphere. The 3-aminopropyldimethylethoxysilane-functionalized silica microsphere provided an uniform field to attract gold nanoparticles. Increasing the ethanol content in aminosilane solution significantly improved the homogeneity and the loading of gold nanoparticles on the surface of silica microsphere. For the gold nanoparticle, increasing the molecular mass of polyethylene glycol yielded a greater homogeneity but a lower loading on silica microsphere. Bovine serum albumin induced the desorption of gold nanoparticles from silica microsphere, where the extent of desorption was suppressed by the presence of high-molecular mass polyethylene glycol on gold nanoparticles. This work provides the fundamental understanding for the synthesis of gold nanoparticle-silica microsphere constructs useful to the applications in chemo-radioactive therapeutics.

  1. Ion beam analysis of gold jewelry

    NASA Astrophysics Data System (ADS)

    Demortier, Guy

    1992-02-01

    PIXE milliprobe in a nonvacuum assembly has been proven to be a very rapid and accurate method for the elemental analysis of gold jewelry artefacts. Using protons whose energy is lower than 3 MeV, it is possible to obtain, in a few minutes, the actual composition (copper, iron, gold, silver, etc.) of narrow parts of artefacts, without any sampling, even at microscopic level. Most of the studies of our group in this field concern solders on these jewelry items. Narrow regions of gold artefacts have also been studied with a PIXE microprobe. They were then irradiated in vacuum. Nuclear reaction analyses induced by 2 MeV deuterons are also performed to identify the presence of light elements and, particularly O, N and S. Traces of these elements are of primary importance to characterize the origin of the ores used in various workmanships. Interferences of X-ray lines of Au with those of traces of Cu and Zn are solved using a method of selective excitation of X-rays of these elements. Analytical results have been interpreted in order to understand the workmanship of goldsmiths from the Antiquity. Fakes and repairs (or ornaments added to original artefacts) may also be identified. The ancient recipes are improved to give new soldering procedures at low temperature.

  2. Titration of gold nanoparticles in phase extraction.

    PubMed

    Cheng, Han-Wen; Schadt, Mark J; Zhong, Chuan-Jian

    2015-12-07

    In the organic-aqueous phase transfer process of gold nanoparticles, there are two types of distinctive interfaces involving hydrophilic and hydrophobic ligands, the understanding of which is important for the design of functional nanomaterials for analytical/bioanalytical applications and the control over the nanoparticles' nanoactivity and nanotoxicity in different phases. This report describes new findings of an investigation of the quantitative aspect of ligand ion pairing at the capping monolayer structure that drives the phase extraction of gold nanoparticles. Alkanethiolate-capped gold nanoparticles of 8 nm diameter with high size monodispersity (RSD ∼ 5%) were first derivatized by a ligand place exchange reaction with 11-mercaptoundecanoic acid to form a mixed monolayer shell consisting of both hydrophobic (-CH3) and hydrophilic (-COOH) groups. It was followed by quantitative titration of the resulting nanoparticles with a cationic species (-NR4(+)) in a toluene phase, yielding ion pairing of -NR4(+) and -COO(-) on part of the capping monolayer. Analysis of the phase extraction allowed a quantitative determination of the percentage of ion pairing and structural changes in the capping monolayer on the nanoparticles. The results, along with morphological characterization, are discussed in terms of the interfacial structural changes and their implications on the rational design of surface-functionalized nanoparticles and fine tuning of the interfacial reactivity.

  3. Optically pumped gold nanorod plasmonic microlaser

    NASA Astrophysics Data System (ADS)

    Shi, Ce; Soltani, Soheil; Armani, Andrea

    2014-03-01

    High optical field intensities build up inside microtoroids owing to its ultra-high quality factor, making them an ideal platform for plasmonic-photonic interactions with noble metals and a suitable pump source for microlaser. In this work, a microlaser based on hybrid silica microtoroids coated with gold nanorods is theoretically modeled and experimentally demonstrated. Theoretically, we used 3-D Comsol Multiphysics and modeled the interaction between the optical mode of the microtoroids and the surface plasmonic resonance of gold nanorods, both on and off resonance. To thoroughly study the role that the polymer layer plays in the plasmonic laser system, we perform a series of finite element method simulations in which the polymer layer thickness and refractive index is varied, and its effect on the plasmonic resonance is quantified. Experimentally, we demonstrated a visible laser at 575nm from hybrid microtoroids with a 30μWthreshold and an approximately 1nm linewidth. We have also varied the gold nanorod concentration on the microtoroids surface, and studied its effect on the Quality factor and the threshold power in order to get the optimum concentration for lasing.

  4. Biosynthesis of gold nanoparticles: A green approach.

    PubMed

    Ahmed, Shakeel; Annu; Ikram, Saiqa; Yudha S, Salprima

    2016-08-01

    Nanotechnology is an immensely developing field due to its extensive range of applications in different areas of technology and science. Different types of methods are employed for synthesis of nanoparticles due to their wide applications. The conventional chemical methods have certain limitations with them either in the form of chemical contaminations during their syntheses procedures or in later applications and use of higher energy. During the last decade research have been focussed on developing simple, clean, non-toxic, cost effective and eco-friendly protocols for synthesis of nanoparticles. In order to get this objective, biosynthesis methods have been developed in order to fill this gap. The biosynthesis of nanoparticles is simple, single step, eco-friendly and a green approach. The biochemical processes in biological agents reduce the dissolved metal ions into nano metals. The various biological agents like plant tissues, fungi, bacteria, etc. are used for biosynthesis for metal nanoparticles. In this review article, we summarised recent literature on biosynthesis of gold nanoparticles which have revolutionised technique of synthesis for their applications in different fields. Due to biocompatibility of gold nanoparticles, it has find its applications in biomedical applications. The protocol and mechanism of biosynthesis of gold nanoparticles along with various applications have also been discussed.

  5. X-ray optics of gold nanoparticles.

    PubMed

    Letfullin, Renat R; Rice, Colin E W; George, Thomas F

    2014-11-01

    Gold nanoparticles have been investigated as contrast agents for traditional x-ray medical procedures, utilizing the strong absorption characteristics of the nanoparticles to enhance the contrast of the detected x-ray image. Here we use the Kramers-Kronig relation for complex atomic scattering factors to find the real and imaginary parts of the index of refraction for the medium composed of single-element materials or compounds in the x-ray range of the spectrum. These complex index of refraction values are then plugged into a Lorenz-Mie theory to calculate the absorption efficiency of various size gold nanoparticles for photon energies in the 1-100 keV range. Since the output from most medical diagnostic x-ray devices follows a wide and filtered spectrum of photon energies, we introduce and compute the effective intensity-absorption-efficiency values for gold nanoparticles of radii varying from 5 to 50 nm, where we use the TASMIP model to integrate over all spectral energies generated by typical tungsten anode x-ray tubes with kilovolt potentials ranging from 50 to 150 kVp.

  6. Near-threshold laser sputting of gold

    NASA Astrophysics Data System (ADS)

    Bennett, Ted D.; Grigoropoulos, Costas P.; Krajnovich, Douglas J.

    1995-01-01

    This work characterizes the laser sputtering of gold by 248 nm laser pulses at near-threshold fluences (material removal rates equal to or less than 10 A/pulse) using time-of-flight plume diagnostics, scanning electron microscope analysis of the surface topography, and thermal analysis of the transient near surface conditions. Pulsed laser irradiation leads to development of surface topography characterized by droplet and ridge formations, and to the liberation of micrometer-sized droplets into the plume. The development of surface topography has been identified with a hydrodynamic response to phase change occuring at the surface of the target. Drawing upon a Rayleigh-Taylor instability description of the melt surface, the readily observable approx. 5 micrometers periodicity in topography formation can be theoretically predicted. Additionally, the preferential formation and liberation of approx. 1 micrometer diameter droplets at the target surface is observed. Nevertheless, the majority of sputtered mass flux is not comprised of droplets, but of neutral gold atoms with almost perfect Bolzmann translational energy distribution. The mean translational energy of the gold atoms, however, is much too high to reconcile with a simple thermal vaporization model. The yield, translational energy, and angular characteristics of the plume are strongly influenced by the surface topography. Local variations in the light absorption and heat transfer explain the qualitative trends in the experimental results.

  7. Identification of Paracoccidioides brasiliensis by gold nanoprobes

    NASA Astrophysics Data System (ADS)

    Martins, Jaciara F. S.; Castilho, Maiara L.; Cardoso, Maria A. G.; Carreiro, Andrea P.; Martin, Airton A.; Raniero, Leandro

    2012-01-01

    Paracoccidioides brasiliensis (P. brasiliensis) is a thermal dimorphic fungus and causal agent of paracoccidioidomycosis. Epidemiological data shows that it is mainly concentrated in Central and South America countries, with most registered cases in Colombia, Brazil, and Venezuela. The histopathological similarity with others fungal infection makes the diagnosis of P. brasiliensis more complicated. Therefore, the aim of this work was to find a positive and negative test for P. brasiliensis using gold nanoprobes as a new tool for P. brasiliensis detection. Gold nanoparticles were synthesized by reduction of gold chloride with sodium citrate. The results of this procedure is a wine-red solution with a maximum absorption in the range of ~520-530nm. A specific P. brasiliensis sequence of oligonucleotide was bonded to the nanoparticles, which maintained the wine-red color. The color changes from red to blue for negative diagnostic and is unchanged for a positive test. The H-bond interaction of DNA with the complementary DNA keeps strands together and forms double helical structure, maintaining the colloid stability. However, for non-complimentary DNA sequence the nanoprobes merge into a cluster, changing the light absorption.

  8. Backhoe 3D "gold standard" image

    NASA Astrophysics Data System (ADS)

    Gorham, LeRoy; Naidu, Kiranmai D.; Majumder, Uttam; Minardi, Michael A.

    2005-05-01

    ViSUAl-D (VIsual Sar Using ALl Dimensions), a 2004 DARPA/IXO seedling effort, is developing a capability for reliable high confidence ID from standoff ranges. Recent conflicts have demonstrated that the warfighter would greatly benefit from the ability to ID targets beyond visual and electro-optical ranges[1]. Forming optical-quality SAR images while exploiting full polarization, wide angles, and large bandwidth would be key evidence such a capability is achievable. Using data generated by the Xpatch EM scattering code, ViSUAl-D investigates all degrees of freedom available to the radar designer, including 6 GHz bandwidth, full polarization and angle sampling over 2π steradians (upper hemisphere), in order to produce a "literal" image or representation of the target. This effort includes the generation of a "Gold Standard" image that can be produced at X-band utilizing all available target data. This "Gold Standard" image of the backhoe will serve as a test bed for future more relevant military targets and their image development. The seedling team produced a public release data which was released at the 2004 SPIE conference, as well as a 3D "Gold Standard" backhoe image using a 3D image formation algorithm. This paper describes the full backhoe data set, the image formation algorithm, the visualization process and the resulting image.

  9. Photoswitchable NIR-Emitting Gold Nanoparticles.

    PubMed

    Bonacchi, Sara; Cantelli, Andrea; Battistelli, Giulia; Guidetti, Gloria; Calvaresi, Matteo; Manzi, Jeannette; Gabrielli, Luca; Ramadori, Federico; Gambarin, Alessandro; Mancin, Fabrizio; Montalti, Marco

    2016-09-05

    Photo-switching of the NIR emission of gold nanoparticles (GNP) upon photo-isomerization of azobenzene ligands, bound to the surface, is demonstrated. Photophysical results confirm the occurrence of an excitation energy transfer process from the ligands to the GNP that produces sensitized NIR emission. Because of this process, the excitation efficiency of the gold core, upon excitation of the ligands, is much higher for the trans form than for the cis one, and t→c photo-isomerization causes a relevant decrease of the GNP NIR emission. As a consequence, photo-isomerization can be monitored by ratiometric detection of the NIR emission upon dual excitation. The photo-isomerization process was followed in real-time through the simultaneous detection of absorbance and luminescence changes using a dedicated setup. Surprisingly, the photo-isomerization rate of the ligands, bound to the GNP surface, was the same as measured for the chromophores in solution. This outcome demonstrated that excitation energy transfer to gold assists photo-isomerization, rather than competing with it. These results pave the road to the development of new, NIR-emitting, stimuli-responsive nanomaterials for theranostics.

  10. Electrically induced bonding of DNA to gold.

    PubMed

    Erdmann, Matthias; David, Ralf; Fornof, Ann R; Gaub, Hermann E

    2010-09-01

    The development of single-molecule techniques has afforded many new methods for the observation and assembly of supramolecular structures and biomolecular networks. We previously reported a method, known as the single-molecule cut-and-paste approach, to pick up and deposit individual DNA strands on a surface. This, however, required pre-functionalization of the surface with DNA strands complementary to those that were to be picked up and then deposited. Here we show that single molecules of double-stranded DNA, bound to the tip of an atomic force microscope, can be deposited on a bare gold electrode using an electrical trigger (surface potential cycling). The interactions between the DNA and the electrode were investigated and we found that double-stranded DNA chemisorbs to the gold electrode exclusively at its end through primary amine groups. We corroborated this finding in experiments in which only a single adenosine nucleotide on a polyethylene glycol spacer was 'electrosorbed' to the gold electrode.

  11. Electrically induced bonding of DNA to gold

    NASA Astrophysics Data System (ADS)

    Erdmann, Matthias; David, Ralf; Fornof, Ann R.; Gaub, Hermann E.

    2010-09-01

    The development of single-molecule techniques has afforded many new methods for the observation and assembly of supramolecular structures and biomolecular networks. We previously reported a method, known as the single-molecule cut-and-paste approach, to pick up and deposit individual DNA strands on a surface. This, however, required pre-functionalization of the surface with DNA strands complementary to those that were to be picked up and then deposited. Here we show that single molecules of double-stranded DNA, bound to the tip of an atomic force microscope, can be deposited on a bare gold electrode using an electrical trigger (surface potential cycling). The interactions between the DNA and the electrode were investigated and we found that double-stranded DNA chemisorbs to the gold electrode exclusively at its end through primary amine groups. We corroborated this finding in experiments in which only a single adenosine nucleotide on a polyethylene glycol spacer was `electrosorbed' to the gold electrode.

  12. Hollow gold nanoparticles encapsulating horseradish peroxidase.

    PubMed

    Kumar, Rajiv; Maitra, A N; Patanjali, P K; Sharma, Parvesh

    2005-11-01

    Hollow nanoshells of gold entrapping an enzyme, horseradish peroxidase (HRP), in the cavity of the nanoshell have been prepared in the reverse micelles by leaching out silver chloride (AgCl) from Au(shell)AgCl(core) nanoparticles with dilute ammonia solution. The particles have been characterised by dynamic laser light scattering (DLS), transmission electron microscopy (TEM), X-ray diffraction (XRD), and electron diffraction. The particle size is below 100 nm diameter, depending upon the size of the aqueous core of reverse micelles in which these particles have been prepared. This soft-chemical method for the preparation of such particles allows the entrapped enzyme to remain active inside the hollow gold nanoparticles. Small substrate molecules such as o-dianisidine can easily enter through the pores of the nanoshell and can undergo enzymatic oxidation by H2O2. The enzyme kinetics follows Michaelis-Menten mechanism. When the substrate is chemically conjugated with dextran molecule (10 kDa), the enzymatic reaction is practically completely prevented perhaps by the inability of dextran-o-dianisidine conjugate to penetrate the pores of the nanoshells. However, HRP did not show any activity when trapped inside solid gold nanoparticles.

  13. Gold nanorods: contrast agents for photoacoustic imaging?

    NASA Astrophysics Data System (ADS)

    Ungureanu, C.; Gopal, R. Raja; van Leeuwen, T. G.; Manohar, S.

    2007-07-01

    Gold nanorods are seen as possible contrast agents for photoacoustic imaging since they have strong absorption peaks at near-infrared wavelengths. Also they are easy to conjugate with various proteins. If these particles can be conjugated with cancer affinity proteins then these particles can accumulate specifically at a tumor site. By detecting the presence of accumulation of gold nanorods inside the tissue the indirect detection of tumor can be realized. When these particles are irradiated with light pulses of appropriate temporal properties and energy the temperature around these particles can be high enough to induce apoptosis or necrosis in the surrounding cells. In order to use these particles at their full potential we must determine precisely their optical properties. We simulated the optical properties of gold nanorods synthesized by us using the DDSCAT code. The simulated spectra agree qualitatively with the spectra determined using spectrometry and also determined using photoacoustic spectroscopy. Further the values of molar extinction coefficient derived from the simulations were similar to the data measured experimentally by other groups. These results validated qualitatively the model used in the simulations. During simulations we found that the choice of the dielectric function used in simulations plays an important role in the results.

  14. Galvanic gold plating for fixed dental prosthesis

    PubMed Central

    Ozcelik, Tuncer Burak; Yilmaz, Burak

    2013-01-01

    Metal ceramic partial fixed dental prostheses have been commonly used for the replacement of missing teeth for many years. Because of an increase in the price of gold, base metal alloys have been the choice of alloy for the fabrication of metal ceramic restorations in many dental clinics. Some major disadvantages of base metals are their corrosion and the dark coloration they may cause at the crown margins. This article describes a galvanic gold-plating technique, which is used to minimize corrosion and improve the esthetics of metal ceramic restorations fabricated with Cr-Co base metal alloys. This technique involves the deposition of a 6 μm to 8 μm 24 K gold layer directly onto the Cr-Co cast prosthesis framework. The technique improves metal surface properties, making them more biocompatible and usable, however, requires additional equipment and experienced laboratory technicians. Clinical studies should be performed to corroborate the long term success of this technique. PMID:24926220

  15. Ultrafast electron dynamics in gold nanoshells

    NASA Astrophysics Data System (ADS)

    Westcott, Sarah Linda

    2001-10-01

    In metallic nanostructures, the interaction of excited electrons with the nanostructure surface may result in electron relaxation dynamics that are significantly different than those predicted by electron-lattice coupling. These ultrafast electron dynamics were monitored by pump-probe measurements of the time-resolved change in transmission. Using femtosecond pulses from a cavity-dumped titanium-doped sapphire laser, two types of nanoparticles with a core-shell geometry were studied. Nanoshells are nanoparticles with a dielectric core surrounded by a continuous thin metal shell. For nanoshells, the plasmon resonance wavelength is tunable by changing the core and shell dimensions. For nanoshells with a gold sulfide core and a gold shell, two conditions were observed under which electron relaxation was different than predicted by electron-phonon coupling. First, electron relaxation occurred more rapidly for gold-gold sulfide nanoshells embedded in polymer films than for nanoshells dispersed in water, with lifetimes of 1.6 ps and 3 to 5 ps, respectively. Second, for nanoshells dispersed in water, the electron relaxation lifetime decreased with adsorption of p-aminobenzoic acid (to 1.7 ps) or aniline (to 1.9 ps) on the nanoshells. With adsorbed n-propylamine or p-mercaptobenzoic acid, electron relaxation transpired in 2.8 ps or 2.4 ps, respectively. Density functional theory calculations indicated that the molecules leading to the fastest electron relaxation possessed the largest induced dipole moments near a metal surface. Semicontinuous gold films grown around a silica nanoparticle core exhibited spectral and dynamical optical signatures of the percolation threshold. Compared to continuous shells, the electron dynamics in the semicontinuous shell layer were dramatically different as additional induced bleaching was observed in the first 500 fs. The observed dynamics are consistent with a rate equation model in which the electrons are initially excited in localized

  16. Lithologically controlled invisible gold, Yukon, Canada

    NASA Astrophysics Data System (ADS)

    MacKenzie, Doug; Craw, Dave; Finnigan, Craig

    2015-02-01

    The newly discovered Cretaceous Coffee orogenic gold deposit (>4 Moz resource) consists of an extensive oxidised zone developed on primary sulphidic rock. The primary mineralised rock is characterised by invisible gold in arsenian pyrite that has replaced biotite in selected host rocks. The deposit has a cryptic surface expression and is an example of an extremely subtle exploration target. Hydrothermal emplacement was controlled by extensional fractures, with breccias, but most mineralisation was focused on biotite-bearing granitic gneiss, metasedimentary gneisses, and younger biotite granite. Fine-grained (<0.1 mm) arsenian pyrite replaced biotite along mineral cleavage planes and followed biotite-rich metamorphic and post-metamorphic structural fabrics. Arsenian pyrite also formed overgrowths on earlier coarse-grained (up to 2 mm) barren hydrothermal pyrite. Arsenian pyrite is concentrically zoned on the 1-10-μm scale with respect to As, Sb, and Au contents and typically contains ˜5 wt% As, ˜500 mg/kg Sb, and ˜500 mg/kg Au, in solid solution. Biotite replacement was accompanied by sericitisation, silicification, and ankerite impregnation. Hydrothermal alteration involved dilution and localised depletion of K, Na, and Al in silicified host rocks, but most Ca, Mg, and Fe concentrations remained broadly constant. Magnesium-rich ultramafic host rocks were only weakly mineralised with auriferous arsenian pyrite and have fuchsite and magnesite alteration. Near-surface oxidation has liberated nanoparticulate and microparticulate supergene gold, which remains essentially invisible. Varying degrees of oxidation extend as deep as 250 m below the present subdued topographic surface, well beyond the present vadose zone, and this deep oxidation may have occurred during post-mineralisation uplift and erosion in the Cretaceous. Oxidation has leached some As from the surficial mineralised rocks, decreasing the geochemical signal, which is also obscured by the localised

  17. Plasmonic phototherapy using gold nanospheres and gold nanorods irradiated with light-emitting diodes

    NASA Astrophysics Data System (ADS)

    Poorani, Gananathan; Rao, Aruna Prakasa; Singaravelu, Ganesan; Manickam, Elanchezhiyan

    2016-04-01

    Gold nanoparticles (GNPs) provide different modes of therapeutic responses in cells depending on their size and shape. We have studied two modifications of GNPs exhibiting surface plasmon resonances (SPRs) with phototherapeutic effects in nonmalignant Vero and malignant HeLa cell lines. The cells were treated with 30-nm-size gold nanospheres (GNSs) (having SPR at a wavelength of 530 nm) and with gold nanorods (GNRs) (having SPR at 630 nm). The plasmonic phototherapy effect in cells was provided by irradiating them with green and red light-emitting diodes (LEDs). The cytotoxicities of GNPs were determined by MTT assay. Both the GNSs and GNRs were found to be biocompatible and have efficient phototherapeutic activity with LEDs.

  18. Electron-Impurity Interactions in the Relaxation of Hot Electrons in Gold-Gold Sulfide Nanoshells

    NASA Astrophysics Data System (ADS)

    Westcott, Sarah; Wolfgang, John; Nordlander, Peter; Halas, Naomi

    2000-10-01

    Hot electron dynamics can be modified in metallic nanostructures compared to bulk metals. In this experiment, ultrafast pump-probe spectroscopy permits observation of the effects of the local environment on hot electron relaxation in gold nanoshell particles. These nanoparticles consist of spherical (40 nm diameter) gold sulfide cores surrounded by ultrathin (5 nm) gold shells and possess a structure-dependent plasmon resonance.^1 Following excitation by a pump pulse at the plasmon resonance, the relaxation of the hot electrons in the nanoparticle's shell layer was observed. When molecules were adsorbed onto the nanoshell surface, increased electronic relaxation rates were observed for those molecular species with the greatest induced dipole moments near the nanoparticle surface. The effect of impurity adsorbates on the nanoparticle's electron dynamics is attributed to a perturbation in the electronic potential in the metal by the presence of the nearby impurities. ^1 R. D. Averitt, D. Sarkar, and N. J. Halas, Phys. Rev. Lett. 78, 4217 (1997).

  19. Manganese oxides supported on gold nanoparticles: new findings and current controversies for the role of gold.

    PubMed

    Najafpour, Mohammad Mahdi; Hosseini, Seyedeh Maedeh; Hołyńska, Małgorzata; Tomo, Tatsuya; Allakhverdiev, Suleyman I

    2015-12-01

    We synthesized manganese oxides supported on gold nanoparticles (diameter <100 nm) by the reaction of KMnO4 with gold nanoparticles under hydrothermal conditions. In this green method Mn oxide is deposited on the gold nanoparticles. The compounds were characterized by scanning electron microscopy, energy-dispersive spectrometry, high-resolution transmission electron microscopy, X-ray diffraction, UV-Vis spectroscopy, Fourier transform infrared spectroscopy, and atomic absorption spectroscopy. In the next step, the water-oxidizing activities of these compounds in the presence of cerium(IV) ammonium nitrate as a non-oxo transfer oxidant were studied. The results show that these compounds are good catalysts toward water oxidation with a turnover frequency of 1.0 ± 0.1 (mmol O2/(mol Mn·s)). A comparison with other previously reported Mn oxides and important factors influencing the water-oxidizing activities of Mn oxides is also discussed.

  20. Determination of the concentration and the average number of gold atoms in a gold nanoparticle by osmotic pressure.

    PubMed

    Lu, Yan; Wang, Lixia; Chen, Dejun; Wang, Gongke

    2012-06-26

    For an ideal solution, an analytical expression for the macromolecule concentration, electrolyte concentration, and solution osmotic pressure is obtained on the basis of the van't Hoff equation and the Donnan equilibrium. The expression was further applied to a colloid solution of about 3 nm glutathione-stabilized gold nanoparticles. The concentration of the colloid solution and the average net ion charge number for each gold nanoparticle were determined with the measured osmotic pressure data. Meanwhile, the gold contents of the solutions were analyzed by means of atomic absorption spectrophotometry, and the results were combined with the determined concentration of gold nanoparticle colloids to determine that the average number of gold atoms per 3 nm gold nanoparticle is 479, which is 1/1.7 times the number of atoms in bulk metallic gold of the same size. The same proportion also occurred in the 2 nm 4-mercaptobenzoic acid monolayer-protected gold nanoparticles prepared by Ackerson et al., who utilized the quantitative high-angle annular dark-field scanning transmission electron microscope to determine the average number of gold atoms per nanoparticle (Ackerson, C. J.; Jadzinsky, P. D.; Sexton J. Z.; Bushnell, D. A.; Kornberg, R. D. Synthesis and Bioconjugation of 2 and 3 nm-Diameter Gold Nanoparticles. Bioconjugate Chem. 2010, 21, 214-218).

  1. Constraints of mineralogical characterization of gold ore: Implication for genesis, controls and evolution of gold from Kundarkocha gold deposit, eastern India

    NASA Astrophysics Data System (ADS)

    Sahoo, P. R.; Venkatesh, A. S.

    2015-01-01

    Gold mineralization in Kundarkocha gold deposit occurs in the eastern Indian Craton that is hosted by sheared quartz-carbonate-sulfide veins emplaced within the graphitic schist, carbonaceous phyllite and talc-chlorite-serpentine schist belongs to Gorumahisani-Badampahar schist belt of Iron Ore Group. Gold mineralization exhibits both lithological and structural controls in the study area, albeit the stratigraphic control is more ubiquitously observed. Detailed mineralogical characterization coupled with electron probe microanalysis of the sulfide phases reveal the occurrences of gold in three distinct forms (i) as lattice-bound form within sulfides especially enriched in arsenopyrite, loellingite, pyrite, pyrrhotite and chalcopyrite in decreasing order of abundance; (ii) as micro inclusions or nano-scale gold inclusions within pyrite and arsenopyrite especially along the growth zones and micro-fractures as substrates and (iii) as free milling nugget gold grains either along the grain boundaries of sulfides or within the host rocks. Three generations of pyrite (Py-I, Py-II and Py-III) and arsenopyrite (Asp-I, Asp-II, Asp-III) have been identified based on textural, morphological characteristics and mineral chemistry. The lattice-bound gold content in pyrite and arsenopyrite varies from 600 to 2700 ppm and 900 to 3600 ppm respectively and increase in concentration of such refractory gold is seen in the order of chalcopyrite > pyrrhotite > pyrite > loellingite/arsenopyrite. The evolutionary stages of different forms of gold include remobilization of the lattice-bound grains in pyrite and arsenopyrite (Py-I and Asp-I) and re-concentration along the zoned-pyrite and arsenopyrite (Py-II and Asp-II) and ultimately as native gold/nuggets surrounding the sulfides as well as within the main mineralized zone. Lattice-bound gold distribution could have resulted due to metamorphic devolatilization reactions which are further aided by the influx of hydrothermal fluids. These

  2. Polarization characteristics of gold-coated microdisk resonators

    NASA Astrophysics Data System (ADS)

    Yin, Yiheng; Niu, Yanxiong; Dai, Lingling; Ding, Ming

    2017-09-01

    The transmission properties and electric-field distribution characteristics of crescent-shaped and fully gold-coated silica microdisk resonators are studied under different polarizations. The transmissivity of the crescent-shaped gold-coated microresonator under TE polarization shows a shift in resonance wavelength relative to that of the resonator without a gold coating, whereas the weakening and elimination of resonance are observed under TM polarization. For the microresonators with a full gold coating, the transmissivity under TE polarization demonstrates a nearly horizontal line and the spectrum under TM polarization displays a stronger resonance. Additionally, the electric-field distributions display properties of both types of structure: the resonance for the TE polarization shows the electric-field confinement, while the hybrid dielectric-surface plasmon polaritons modes are observed for TM polarization. Furthermore, the slow propagation effect observed in the crescent-shaped gold-coated microresonator is discussed and the dependence of transmission on gold thickness is investigated.

  3. Establishment of gold-quartz standard GQS-1

    USGS Publications Warehouse

    Millard, Hugh T.; Marinenko, John; McLane, John E.

    1969-01-01

    A homogeneous gold-quartz standard, GQS-1, was prepared from a heterogeneous gold-bearing quartz by chemical treatment. The concentration of gold in GQS-1 was determined by both instrumental neutron activation analysis and radioisotope dilution analysis to be 2.61?0.10 parts per million. Analysis of 10 samples of the standard by both instrumental neutron activation analysis and radioisotope dilution analysis failed to reveal heterogeneity within the standard. The precision of the analytical methods, expressed as standard error, was approximately 0.1 part per million. The analytical data were also used to estimate the average size of gold particles. The chemical treatment apparently reduced the average diameter of the gold particles by at least an order of magnitude and increased the concentration of gold grains by a factor of at least 4,000.

  4. Annealing of gold nanostructures sputtered on glass substrate

    NASA Astrophysics Data System (ADS)

    Švorčík, V.; Siegel, J.; Šutta, P.; Mistrík, J.; Janíček, P.; Worsch, P.; Kolská, Z.

    2011-03-01

    The effects of annealing at 300 °C on gold nanostructures sputtered onto glass substrate were studied using XRD, SAXSees, the Van der Pauw method and ellipsometry. As-sputtered and annealed samples exhibit a different dependence of the gold lattice parameter on the sputtering time. With increasing sputtering time the average thickness of the layer and the size of gold crystallites increased. Another rapid enlargement of the crystallites is observed after annealing. The volume resistivity decreases rapidly with the increasing sputtering time for both, as-deposited and annealed structures. With increasing sputtering time initially discontinuous gold coverage changes gradually in a continuous one. Electrically continuous gold coverage on the as-sputtered and annealed samples exhibits the same concentration of free charge carriers and Hall mobility. Optical constants of as-deposited and annealed gold films determined by ellipsometry support resistivity measurements and clearly manifest the presence of plasmons in discontinuous films.

  5. Detection of squamous carcinoma cells using gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Dai, Wei-Yun; Lee, Sze-tsen; Hsu, Yih-Chih

    2015-03-01

    The goal of this study is to use gold nanoparticle as a diagnostic agent to detect human squamous carcinoma cells. Gold nanoparticles were synthesized and the gold nanoparticle size was 34.3 ± 6.2 nm. Based on the over-expression of epidermal growth factor receptor (EGFR) biomarkers in squamous carcinoma cells, we hypothesized that EGFR could be a feasible biomarker with a target moiety for detection. We further modified polyclonal antibodies of EGFR on the surface of gold nanoparticles. We found selected squamous carcinoma cells can be selectively detected using EGFR antibody-modified gold nanoparticles via receptor-mediated endocytosis. Cell death was also examined to determine the survival status of squamous carcinoma cells with respect to gold nanoparticle treatment and EGFR polyclonal antibody modification.

  6. Microbial synthesis of gold nanoparticles: current status and future prospects.

    PubMed

    Shedbalkar, Utkarsha; Singh, Richa; Wadhwani, Sweety; Gaidhani, Sharvari; Chopade, B A

    2014-07-01

    Gold nanoparticles have been employed in biomedicine since the last decade because of their unique optical, electrical and photothermal properties. Present review discusses the microbial synthesis, properties and biomedical applications of gold nanoparticles. Different microbial synthesis strategies used so far for obtaining better yield and stability have been described. It also includes different methods used for the characterization and analysis of gold nanoparticles, viz. UV-visible spectroscopy, Fourier transform infrared spectroscopy, X ray diffraction spectroscopy, scanning electron microscopy, ransmission electron microscopy, atomic force microscopy, electron dispersive X ray, X ray photoelectron spectroscopy and cyclic voltametry. The different mechanisms involved in microbial synthesis of gold nanoparticles have been discussed. The information related to applications of microbially synthesized gold nanoparticles and patents on microbial synthesis of gold nanoparticles has been summarized. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  8. Enhanced Mechanical Stability of Gold Nanotips through Carbon Nanocone Encapsulation

    PubMed Central

    Cano-Marquez, Abraham G.; Schmidt, Wesller G.; Ribeiro-Soares, Jenaina; Gustavo Cançado, Luiz; Rodrigues, Wagner N.; Santos, Adelina P.; Furtado, Clascidia A.; Autreto, Pedro A.S.; Paupitz, Ricardo; Galvão, Douglas S.; Jorio, Ado

    2015-01-01

    Gold is a noble metal that, in comparison with silver and copper, has the advantage of corrosion resistance. Despite its high conductivity, chemical stability and biocompatibility, gold exhibits high plasticity, which limits its applications in some nanodevices. Here, we report an experimental and theoretical study on how to attain enhanced mechanical stability of gold nanotips. The gold tips were fabricated by chemical etching and further encapsulated with carbon nanocones via nanomanipulation. Atomic force microscopy experiments were carried out to test their mechanical stability. Molecular dynamics simulations show that the encapsulated nanocone changes the strain release mechanisms at the nanoscale by blocking gold atomic sliding, redistributing the strain along the whole nanostructure. The carbon nanocones are conducting and can induce magnetism, thus opening new avenues on the exploitation of transport, mechanical and magnetic properties of gold covered by sp2 carbon at the nanoscale. PMID:26083864

  9. Stabilization of 4H hexagonal phase in gold nanoribbons

    PubMed Central

    Fan, Zhanxi; Bosman, Michel; Huang, Xiao; Huang, Ding; Yu, Yi; Ong, Khuong P.; Akimov, Yuriy A.; Wu, Lin; Li, Bing; Wu, Jumiati; Huang, Ying; Liu, Qing; Eng Png, Ching; Lip Gan, Chee; Yang, Peidong; Zhang, Hua

    2015-01-01

    Gold, silver, platinum and palladium typically crystallize with the face-centred cubic structure. Here we report the high-yield solution synthesis of gold nanoribbons in the 4H hexagonal polytype, a previously unreported metastable phase of gold. These gold nanoribbons undergo a phase transition from the original 4H hexagonal to face-centred cubic structure on ligand exchange under ambient conditions. Using monochromated electron energy-loss spectroscopy, the strong infrared plasmon absorption of single 4H gold nanoribbons is observed. Furthermore, the 4H hexagonal phases of silver, palladium and platinum can be readily stabilized through direct epitaxial growth of these metals on the 4H gold nanoribbon surface. Our findings may open up new strategies for the crystal phase-controlled synthesis of advanced noble metal nanomaterials. PMID:26216712

  10. Aggregation effect on absorbance spectrum of laser ablated gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Isnaeni; Irmaniar; Herbani, Y.

    2017-04-01

    Plasmon of gold nanoparticles is one of the hot topics nowadays due to various possible applications. The application is determined by plasmon peak in absorbance spectrum. We have fabricated gold nanoparticles using laser ablation technique and studied the influence of CTAB (Cetyl trimethylammonium bromide) effect on the optical characterization of fabricated gold nanoparticles. We ablated a gold plate using NdYAG pulsed laser at 1064 nm wavelength, 10 Hz pulse frequency at low energy density. We found there are two distinctive plasmon peaks, i.e., primary and secondary peaks, where the secondary peak is the main interests of this work. Our simulation results have revealed that the secondary plasmon peak is affected by random aggregation of gold nanoparticles. Our research leads to good techniques on fabrication of colloidal gold nanoparticles in aqueous solution using laser ablation technique.

  11. Model studies of heterogeneous catalytic hydrogenation reactions with gold.

    PubMed

    Pan, Ming; Brush, Adrian J; Pozun, Zachary D; Ham, Hyung Chul; Yu, Wen-Yueh; Henkelman, Graeme; Hwang, Gyeong S; Mullins, C Buddie

    2013-06-21

    Supported gold nanoparticles have recently been shown to possess intriguing catalytic activity for hydrogenation reactions, particularly for selective hydrogenation reactions. However, fundamental studies that can provide insight into the reaction mechanisms responsible for this activity have been largely lacking. In this tutorial review, we highlight several recent model experiments and theoretical calculations on a well-structured gold surface that provide some insights. In addition to the behavior of hydrogen on a model gold surface, we review the reactivity of hydrogen on a model gold surface in regards to NO2 reduction, chemoselective C=O bond hydrogenation, ether formation, and O-H bond dissociation in water and alcohols. Those studies indicate that atomic hydrogen has a weak interaction with gold surfaces which likely plays a key role in the unique hydrogenative chemistry of classical gold catalysts.

  12. SERS decoding of micro gold shells moving in microfluidic systems.

    PubMed

    Lee, Saram; Joo, Segyeong; Park, Sejin; Kim, Soyoun; Kim, Hee Chan; Chung, Taek Dong

    2010-05-01

    In this study, in situ surface-enhanced Raman scattering (SERS) decoding was demonstrated in microfluidic chips using novel thin micro gold shells modified with Raman tags. The micro gold shells were fabricated using electroless gold plating on PMMA beads with diameter of 15 microm. These shells were sophisticatedly optimized to produce the maximum SERS intensity, which minimized the exposure time for quick and safe decoding. The shell surfaces produced well-defined SERS spectra even at an extremely short exposure time, 1 ms, for a single micro gold shell combined with Raman tags such as 2-naphthalenethiol and benzenethiol. The consecutive SERS spectra from a variety of combinations of Raman tags were successfully acquired from the micro gold shells moving in 25 microm deep and 75 microm wide channels on a glass microfluidic chip. The proposed functionalized micro gold shells exhibited the potential of an on-chip microfluidic SERS decoding strategy for micro suspension array.

  13. Gold over Branched Palladium Nanostructures for Photothermal Cancer Therapy.

    PubMed

    McGrath, Andrew J; Chien, Yi-Hsin; Cheong, Soshan; Herman, David A J; Watt, John; Henning, Anna M; Gloag, Lucy; Yeh, Chen-Sheng; Tilley, Richard D

    2015-12-22

    Bimetallic nanostructures show exciting potential as materials for effective photothermal hyperthermia therapy. We report the seed-mediated synthesis of palladium-gold (Pd-Au) nanostructures containing multiple gold nanocrystals on highly branched palladium seeds. The nanostructures were synthesized via the addition of a gold precursor to a palladium seed solution in the presence of oleylamine, which acts as both a reducing and a stabilizing agent. The interaction and the electronic coupling between gold nanocrystals and between palladium and gold broadened and red-shifted the localized surface plasmon resonance absorption maximum of the gold nanocrystals into the near-infrared region, to give enhanced suitability for photothermal hyperthermia therapy. Pd-Au heterostructures irradiated with an 808 nm laser light caused destruction of HeLa cancer cells in vitro, as well as complete destruction of tumor xenographs in mouse models in vivo for effective photothermal hyperthermia.

  14. Solution-based metal enhanced fluorescence with gold and gold/silver core-shell nanorods

    NASA Astrophysics Data System (ADS)

    Ren, Zebin; Li, Xiaoyi; Guo, Jingxia; Wang, Ruibo; Wu, Yanni; Zhang, Mingdi; Li, Caixia; Han, Qingyan; Dong, Jun; Zheng, Hairong

    2015-12-01

    Metal enhanced fluorescence of Oxazine720 fluorophore with gold and gold/silver core-shell nanorods is investigated experimentally in aqueous solution system. Metallic nanorods are synthesized for providing proper localized surface plasmon resonance and necessary enhancement to the fluorophore molecule. The experimental observation shows that the fluorescence enhancement increases firstly and then decreases when the concentration of metallic nanorods increases, which is resulted by the competition between enhanced emission and inner-filtering effect. Further investigation with different amounts of metallic nanorods shows that the relationship between metal enhanced fluorescence and spectral correlation strongly depends on the concentration of metallic nanorods.

  15. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  16. 40 CFR 440.140 - Applicability; description of the gold placer mine subcategory.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 31 2012-07-01 2012-07-01 false Applicability; description of the gold... CATEGORY Gold Placer Mine Subcategory § 440.140 Applicability; description of the gold placer mine... that produce gold or gold bearing ores from placer deposits; and (2) The beneficiation processes...

  17. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance:Treasury 2 2013-07-01 2013-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  18. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  19. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance:Treasury 2 2011-07-01 2011-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  20. 40 CFR 440.140 - Applicability; description of the gold placer mine subcategory.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 30 2014-07-01 2014-07-01 false Applicability; description of the gold... CATEGORY Gold Placer Mine Subcategory § 440.140 Applicability; description of the gold placer mine... that produce gold or gold bearing ores from placer deposits; and (2) The beneficiation processes...

  1. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 2 2014-07-01 2014-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  2. 40 CFR 440.140 - Applicability; description of the gold placer mine subcategory.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 31 2013-07-01 2013-07-01 false Applicability; description of the gold... CATEGORY Gold Placer Mine Subcategory § 440.140 Applicability; description of the gold placer mine... that produce gold or gold bearing ores from placer deposits; and (2) The beneficiation processes...

  3. Synthesis of porous gold nanoshells by controlled transmetallation reaction

    SciTech Connect

    Pattabi, Manjunatha M, Krishnaprabha

    2015-06-24

    Aqueous synthesis of porous gold nanoshells in one step is carried out through controlled transmetallation (TM) reaction using a naturally available egg shell membrane (ESM) as a barrier between the sacrificial silver particles (AgNPs) and the gold precursor solution (HAuCl{sub 4}). The formation of porous gold nanoshells via TM reaction is inferred from UV-Vis spectroscopy and the scanning electron microscopic (SEM) studies.

  4. Synthesis of porous gold nanoshells by controlled transmetallation reaction

    NASA Astrophysics Data System (ADS)

    Pattabi, Manjunatha; M, Krishnaprabha

    2015-06-01

    Aqueous synthesis of porous gold nanoshells in one step is carried out through controlled transmetallation (TM) reaction using a naturally available egg shell membrane (ESM) as a barrier between the sacrificial silver particles (AgNPs) and the gold precursor solution (HAuCl4). The formation of porous gold nanoshells via TM reaction is inferred from UV-Vis spectroscopy and the scanning electron microscopic (SEM) studies.

  5. Novel Organo-Soluble Optically Tunable Chiral Hybrid Gold Nanorods

    DTIC Science & Technology

    2014-12-04

    download paper, and highlights in Chemical Technology). 31. C. Xue and Q. Li, “ Gold Nanorods” in Encyclopedia of Surface and Colloid Science, second...Wiley & Sons, 2011. The invited author of the entry entitled “ Gold Nanorods” in Encyclopedia of Surface and Colloid Science, second edition, Taylor...AFRL-OSR-VA-TR-2014-0334 NOVEL ORGANO-SOLUBLE OPTICALLY TUNABLE CHIRAL HYBRID GOLD NANORODS Quan Li KENT STATE UNIV OH Final Report 12/04/2014

  6. Site-Specific Biomolecule Labeling with Gold Clusters

    PubMed Central

    Ackerson, Christopher J.; Powell, Richard D.; Hainfeld, James F.

    2013-01-01

    Site-specific labeling of biomolecules in vitro with gold clusters can enhance the information content of electron cryomicroscopy experiments. This chapter provides a practical overview of well-established techniques for forming biomolecule/gold cluster conjugates. Three bioconjugation chemistries are covered: Linker-mediated bioconjugation, direct gold–biomolecule bonding, and coordination-mediated bonding of nickel(II) nitrilotriacetic acid (NTA)-derivatized gold clusters to polyhistidine (His)-tagged proteins. PMID:20887859

  7. Fungal Biorecovery of Gold From E-waste.

    PubMed

    Bindschedler, Saskia; Vu Bouquet, Thi Quynh Trang; Job, Daniel; Joseph, Edith; Junier, Pilar

    2017-01-01

    Waste electric and electronic devices (e-waste) represent a source of valuable raw materials of great interest, and in the case of metals, e-waste might become a prized alternative source. Regarding gold, natural ores are difficult to mine due to their refractory nature and the richest ores have almost all been exploited. Additionally, some gold mining areas are present in geopolitically unstable regions. Finally, the gold mining industry produces toxic compounds, such as cyanides. As a result, the gold present in e-waste represents a nonnegligible resource (urban mining). Extraction methods of gold from natural ores (pyro- and hydrometallurgy) have been adapted to this particular type of matrix. However, to propose novel approaches with a lower environmental footprint, biotechnological methods using microorganisms are being developed (biometallurgy). These processes use the extensive metabolic potential of microbes (algae, bacteria, and fungi) to mobilize and immobilize gold from urban and industrial sources. In this review, we focus on the use of fungi for gold biomining. Fungi interact with gold by mobilizing it through mechanical attack as well as through biochemical leaching by the production of cyanides. Moreover, fungi are also able to release Au through the degradation of cyanide from aurocyanide complexes. Finally, fungi immobilize gold through biosorption, bioaccumulation, and biomineralization, in particular, as gold nanoparticles. Overall, the diversity of mechanisms of gold recycling using fungi combined with their filamentous lifestyle, which allows them to thrive in heterogeneous and solid environments such as e-waste, makes fungi an important bioresource to be harnessed for the biorecovery of gold. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Gold nanoparticles as novel agents for cancer therapy

    PubMed Central

    Jain, S; Hirst, D G; O'Sullivan, J M

    2012-01-01

    Gold nanoparticles are emerging as promising agents for cancer therapy and are being investigated as drug carriers, photothermal agents, contrast agents and radiosensitisers. This review introduces the field of nanotechnology with a focus on recent gold nanoparticle research which has led to early-phase clinical trials. In particular, the pre-clinical evidence for gold nanoparticles as sensitisers with ionising radiation in vitro and in vivo at kilovoltage and megavoltage energies is discussed. PMID:22010024

  9. New Gold Nanostructures for Sensor Applications: A Review

    PubMed Central

    Zhang, Yuanchao; Chu, Wendy; Foroushani, Alireza Dibaji; Wang, Hongbin; Li, Da; Liu, Jingquan; Barrow, Colin J.; Wang, Xin; Yang, Wenrong

    2014-01-01

    Gold based structures such as nanoparticles (NPs) and nanowires (NWs) have widely been used as building blocks for sensing devices in chemistry and biochemistry fields because of their unusual optical, electrical and mechanical properties. This article gives a detailed review of the new properties and fabrication methods for gold nanostructures, especially gold nanowires (GNWs), and recent developments for their use in optical and electrochemical sensing tools, such as surface enhanced Raman spectroscopy (SERS). PMID:28788124

  10. Gold Ion-Angiotensin Peptide Interaction by Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Lee, Jenny; Jayathilaka, Lasanthi P.; Gupta, Shalini; Huang, Jin-Sheng; Lee, Bao-Shiang

    2012-05-01

    Stimulated by the interest in developing gold compounds for treating cancer, gold ion-angiotensin peptide interactions are investigated by mass spectrometry. Under the experimental conditions used, the majority of gold ion-angiotensin peptide complexes contain gold in the oxidation states I and III. Both ESI-MS and MALDI-TOF MS detect singly/multiply charged ions for mononuclear/multinuclear gold-attached peptides, which are represented as [peptide + a Au(I) + b Au(III) + (e - a -3b) H]e+, where a,b ≥ 0 and e is charge. ESI-MS data shows singly/multiply charged ions of Au(I)-peptide and Au(III)-peptide complexes. This study reveals that MALDI-TOF MS mainly detects singly charged Au(I)-peptide complexes, presumably due to the ionization process. The electrons in the MALDI plume seem to efficiently reduce Au(III) to Au(I). MALDI also tends to enhance the higher polymeric forms of gold-peptide complexes regardless of the laser power used. Collision-induced dissociation experiments of the mononuclear and dinuclear gold-attached peptide ions for angiotensin peptides show that the gold ion (a soft acid) binding sites are in the vicinity of Cys (a soft ligand), His (a major anchor of peptide for metal ion chelation), and the basic residue Arg. Data also suggests that the abundance of gold-attached peptides increases with higher gold concentration until saturation, after which an increase in gold ion concentration leads to the aggregation and/or precipitation of gold-bound peptides.

  11. Gold Carbene or Carbenoid: Is There a Difference?

    PubMed Central

    Wang, Yahui; Muratore, Michael E; Echavarren, Antonio M

    2015-01-01

    By reviewing the recent progress on the elucidation of the structure of gold carbenes and the definitions of metal carbenes and carbenoids, we recommend to use the term gold carbene to describe gold carbene-like intermediates, regardless of whether the carbene or carbocation extreme resonance dominates. Gold carbenes, because of the weak metal-to-carbene π-back-donation and their strongly electrophilic reactivity, could be classified into the broader family of Fischer carbenes, although their behavior and properties are very specific. PMID:25786384

  12. Thiosulfate leaching of gold from waste mobile phones.

    PubMed

    Ha, Vinh Hung; Lee, Jae-chun; Jeong, Jinki; Hai, Huynh Trung; Jha, Manis K

    2010-06-15

    The present communication deals with the leaching of gold from the printed circuit boards (PCBs) of waste mobile phones using an effective and less hazardous system, i.e., a copper-ammonia-thiosulfate solution, as an alternative to the conventional and toxic cyanide leaching of gold. The influence of thiosulfate, ammonia and copper sulfate concentrations on the leaching of gold from PCBs of waste mobile phones was investigated. Gold extraction was found to be enhanced with solutions containing 15-20 mM cupric, 0.1-0.14 M thiosulfate, and 0.2-0.3 M ammonia. Similar trends were obtained for the leaching of gold from two different types of scraps and PCBs of waste mobile phones. From the scrap samples, 98% of the gold was leached out using a solution containing 20 mM copper, 0.12 M thiosulfate and 0.2 M ammonia. Similarly, the leaching of gold from the PCBs samples was also found to be good, but it was lower than that of scrap samples in similar experimental conditions. In this case, only 90% of the gold was leached, even with a contact time of 10h. The obtained data will be useful for the development of processes for the recycling of gold from waste mobile phones. Copyright 2010 Elsevier B.V. All rights reserved.

  13. The graphene-gold interface and its implications for nanoelectronics.

    PubMed

    Sundaram, Ravi S; Steiner, Mathias; Chiu, Hsin-Ying; Engel, Michael; Bol, Ageeth A; Krupke, Ralph; Burghard, Marko; Kern, Klaus; Avouris, Phaedon

    2011-09-14

    We combine optical microspectroscopy and electronic measurements to study how gold deposition affects the physical properties of graphene. We find that the electronic structure, the electron-phonon coupling, and the doping level in gold-plated graphene are largely preserved. The transfer lengths for electrons and holes at the graphene-gold contact have values as high as 1.6 μm. However, the interfacial coupling of graphene and gold causes local temperature drops of up to 500 K in operating electronic devices.

  14. Methanobactin-mediated one-step synthesis of gold nanoparticles.

    PubMed

    Xin, Jia-ying; Cheng, Dan-dan; Zhang, Lan-xuan; Lin, Kai; Fan, Hong-chen; Wang, Yan; Xia, Chun-gu

    2013-11-01

    Preparation of gold nanoparticles with a narrow size distribution has enormous importance in nanotechnology. Methanobactin (Mb) is a copper-binding small peptide that appears to function as an agent for copper sequestration and uptake in methanotrophs. Mb can also bind and catalytically reduce Au (III) to Au (0). In this study, we demonstrate a facile Mb-mediated one-step synthetic route to prepare monodispersed gold nanoparticles. Continuous reduction of Au (III) by Mb can be achieved by using hydroquinone as the reducing agent. The gold nanoparticles have been characterized by UV-visible spectroscopy. The formation and the surface plasmon resonance properties of the gold nanoparticles are highly dependent on the ratio of Au (III) to Mb in solution. X-ray photoelectron spectroscopy (XPS), fluorescence spectra and Fourier transform-infrared spectroscopy (FT-IR) spectra suggest that Mb molecules catalytically reduce Au (III) to Au (0) with the concomitant production of gold nanoparticles, and then, Mb statically adsorbed onto the surface of gold nanoparticles to form an Mb-gold nanoparticles assembly. This avoids secondary nucleation. The formed gold nanoparticles have been demonstrated to be monodispersed and uniform by transmission electron microscopy (TEM) images. Analysis of these particles shows an average size of 14.9 nm with a standard deviation of 1.1 nm. The gold nanoparticles are extremely stable and can resist aggregation, even after several months.

  15. Methanobactin-Mediated One-Step Synthesis of Gold Nanoparticles

    PubMed Central

    Xin, Jia-ying; Cheng, Dan-dan; Zhang, Lan-xuan; Lin, Kai; Fan, Hong-chen; Wang, Yan; Xia, Chun-gu

    2013-01-01

    Preparation of gold nanoparticles with a narrow size distribution has enormous importance in nanotechnology. Methanobactin (Mb) is a copper-binding small peptide that appears to function as an agent for copper sequestration and uptake in methanotrophs. Mb can also bind and catalytically reduce Au (III) to Au (0). In this study, we demonstrate a facile Mb-mediated one-step synthetic route to prepare monodispersed gold nanoparticles. Continuous reduction of Au (III) by Mb can be achieved by using hydroquinone as the reducing agent. The gold nanoparticles have been characterized by UV-visible spectroscopy. The formation and the surface plasmon resonance properties of the gold nanoparticles are highly dependent on the ratio of Au (III) to Mb in solution. X-ray photoelectron spectroscopy (XPS), fluorescence spectra and Fourier transform-infrared spectroscopy (FT-IR) spectra suggest that Mb molecules catalytically reduce Au (III) to Au (0) with the concomitant production of gold nanoparticles, and then, Mb statically adsorbed onto the surface of gold nanoparticles to form an Mb-gold nanoparticles assembly. This avoids secondary nucleation. The formed gold nanoparticles have been demonstrated to be monodispersed and uniform by transmission electron microscopy (TEM) images. Analysis of these particles shows an average size of 14.9 nm with a standard deviation of 1.1 nm. The gold nanoparticles are extremely stable and can resist aggregation, even after several months. PMID:24189217

  16. GOLD NANOPARTICLES: A REVIVAL IN PRECIOUS METAL ADMINISTRATION TO PATIENTS

    PubMed Central

    Thakor, AS; Jokerst, J; Zaveleta, C; Massoud, TF; Gambhir, SS

    2011-01-01

    Gold has been used as a therapeutic agent to treat a wide variety of rheumatic diseases including psoriatic arthritis, juvenile arthritis and discoid lupus erythematosus. Although the use of gold has been largely superseded by newer drugs, gold nanoparticles are being used effectively in laboratory based clinical diagnostic methods whilst concurrently showing great promise in vivo either as a diagnostic imaging agent or a therapeutic agent. For these reasons, gold nanoparticles are therefore well placed to enter mainstream clinical practice in the near future. Hence, the present review summarizes the chemistry, pharmacokinetics, bio-distribution, metabolism and toxicity of bulk gold in humans based on decades of clinical observation and experiments in which gold was used to treat patients with rheumatoid arthritis. The beneficial attributes of gold nanoparticles, such as their ease of synthesis, functionalization and shape control are also highlighted demonstrating why gold nanoparticles are an attractive target for further development and optimization. The importance of controlling the size and shape of gold nanoparticles to minimize any potential toxic side effects is also discussed. PMID:21846107

  17. Reflectance spectroscopy of gold nanoshells: computational predictions and experimental measurements

    NASA Astrophysics Data System (ADS)

    Lin, Alex W. H.; Lewinski, Nastassja A.; Lee, Min-Ho; Drezek, Rebekah A.

    2006-10-01

    Gold nanoshells are concentric spherical constructs that possess highly desirable optical responses in the near infrared. Gold nanoshells consist of a thin outer gold shell and a silica core and can be used for both diagnostic and therapeutic purposes by tuning the optical response through changing the core-shell ratio as well as the overall size. Although optical properties of gold nanoshells have already been well documented, the reflectance characteristics are not well understood and have not yet been elucidated by experimental measurements. Yet, in order to use gold nanoshells as an optical contrast agent for scattering-based optical methods such as reflectance spectroscopy, it is critical to characterize the reflectance behavior. With this in mind, we used a fiber-optic-based spectrometer to measure diffuse reflectance of gold nanoshell suspensions from 500 nm to 900 nm. Experimental results show that gold nanoshells cause a significant increase in the measured reflectance. Spectral features associated with scattering from large angles ( 180°) were observed at low nanoshell concentrations. Monte Carlo modeling of gold nanoshells reflectance demonstrated the efficacy of using such methods to predict diffuse reflectance. Our studies suggest that gold nanoshells are an excellent candidate as optical contrast agents and that Monte Carlo methods are a useful tool for optimizing nanoshells best suited for scattering-based optical methods.

  18. Mercury contamination from historical gold mining in California

    USGS Publications Warehouse

    Alpers, Charles N.; Hunerlach, Michael P.; May, Jason T.; Hothem, Roger L.

    2005-01-01

    Mercury contamination from historical gold mines represents a potential risk to human health and the environment. This fact sheet provides background information on the use of mercury in historical gold mining and processing operations in California, with emphasis on historical hydraulic mining areas. It also describes results of recent USGS projects that address the potential risks associated with mercury contamination. Miners used mercury (quicksilver) to recover gold throughout the western United States. Gold deposits were either hardrock (lode, gold-quartz veins) or placer (alluvial, unconsolidated gravels). Underground methods (adits and shafts) were used to mine hardrock gold deposits. Hydraulic, drift, or dredging methods were used to mine the placer gold deposits. Mercury was used to enhance gold recovery in all the various types of mining operations; historical records indicate that more mercury was used and lost at hydraulic mines than at other types of mines. On the basis of USGS studies and other recent work, a better understanding is emerging of mercury distribution, ongoing transport, transformation processes, and the extent of biological uptake in areas affected by historical gold mining. This information has been used extensively by federal, state, and local agencies responsible for resource management and public health in California.

  19. Preparation and characterization of graphene oxide encapsulated gold nanoparticles.

    PubMed

    Yun, Yong Ju; Song, Ki-Bong

    2013-11-01

    We present a simple approach for the fabrication of graphene oxide-encapsulated gold nanoparticles using graphene oxide sheet-wrapping via electrostatic self-assembly. By mixing bovine serum albumin molecule-functionalized gold nanoparticles with graphene oxide dispersion, positively charged bovine serum albumin/gold nanoparticles easily assembled with negatively charged graphene oxide sheets through electrostatic interaction. Transmittance electron microscopy, scanning electron microscopy, atomic force microscopy, and Raman spectroscopy were used to confirm the encapsulation of graphene oxide on gold nanoparticles. Interestingly, graphene oxide sheets wrapping mainly occurs along the main body of single or a few gold nanoparticles. Additionally, by measuring the ultraviolet-visible spectroscopy spectrum, we found that the surface plasmon resonances band of the graphene oxide-encapsulated gold nanoparticles was found to become red-shifted compared to that of pristine gold nanoparticles, whereas similar to that of bovine serum albumin-coated gold nanoparticles. These results indicating that most of graphene oxide-encapsulated gold nanoparticles have good monodispersity and spherical shape. These resulting materials may potentially serve as a platform for plasmon resonance electron transfer spectroscopy or a probe for low level biosensing.

  20. Multiple gold-dimer detection from large scattering background

    NASA Astrophysics Data System (ADS)

    Hong, Xin; Jin, Zheng

    2016-10-01

    Gold nanoparticles exhibit unique plasmonic optical properties in visible to near infrared band. Especially the coupling effect existing at the gap between a closely linked particle pair can make the local field strongly enhanced. These properties make gold particles more attractive to be employed as molecular probes in biomedical related fundamental and clinical researches. However in the bio-system exist many large molecules or groups, whose optical signals can strongly depress the gold particles without detectable. In this paper, we proposed a method to extract the targets which are labelled by gold dimer pairs from large scattering background.

  1. Site-directed delivery of ferritin-encapsulated gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Zheng, B.; Yamashita, I.; Uenuma, M.; Iwahori, K.; Kobayashi, M.; Uraoka, Y.

    2010-01-01

    Newly designed porter proteins, which catch gold nanoparticles and deliver the nanoparticles selectively to a silicon dioxide (SiO2) surface under the specific conditions were reported. Recombinant apoferritin subunits, each of which has gold-binding peptide and titanium-binding peptide at the C- and N-terminus, respectively, can efficiently encapsulate a gold nanoparticle. The bio-conjugate, a nanogold and surrounding mutant protein subunits, had a property which can deliver itself to the SiO2 surface through the interaction. In theory, our genetically manipulated apoferritin subunits can encapsulate gold nanoparticles of various sizes, which is a promising property for applications involving surface plasmon resonance.

  2. Porous Gold Films—A Short Review on Recent Progress

    PubMed Central

    Zhang, Renyun; Olin, Håkan

    2014-01-01

    Porous gold films have attracted increasing interest over the last ten years due to the unique properties of high specific surface area and electrical conductivity combined with chemical stability and ability to alter the surface chemistry. Several methods have been developed to synthesize porous gold films such as de-alloying, templating, electrochemical, and self-assembling. These porous gold films are used in diverse fields, for example, as electrochemical and Raman sensors or for chemical catalysis. Here, we provide a short review on the progress of porous gold films over the past ten years, including the synthesis and applications of such films. PMID:28788652

  3. Immobilization of gold nanoparticles on cell culture surfaces for safe and enhanced gold nanoparticle-mediated laser transfection

    NASA Astrophysics Data System (ADS)

    Kalies, Stefan; Heinemann, Dag; Schomaker, Markus; Gentemann, Lara; Meyer, Heiko; Ripken, Tammo

    2014-07-01

    In comparison to standard transfection methods, gold nanoparticle-mediated laser transfection has proven to be a versatile alternative. This is based on its minor influence on cell viability and its high efficiency, especially for the delivery of small molecules like small interfering RNA. However, in order to transfer it to routine usage, a safety aspect is of major concern: The avoidance of nanoparticle uptake by the cells is desired. The immobilization of the gold nanoparticles on cell culture surfaces can address this issue. In this study, we achieved this by silanization of the appropriate surfaces and the binding of gold nanoparticles to them. Comparable perforation efficiencies to the previous approaches of gold nanoparticle-mediated laser transfection with free gold nanoparticles are demonstrated. The uptake of the immobilized particles by the cells is unlikely. Consequently, these investigations offer the possibility of bringing gold nanoparticle-mediated laser transfection closer to routine usage.

  4. Immobilization of gold nanoparticles on cell culture surfaces for safe and enhanced gold nanoparticle-mediated laser transfection.

    PubMed

    Kalies, Stefan; Heinemann, Dag; Schomaker, Markus; Gentemann, Lara; Meyer, Heiko; Ripken, Tammo

    2014-01-01

    In comparison to standard transfection methods, gold nanoparticle-mediated laser transfection has proven to be a versatile alternative. This is based on its minor influence on cell viability and its high efficiency, especially for the delivery of small molecules like small interfering RNA. However, in order to transfer it to routine usage, a safety aspect is of major concern: The avoidance of nanoparticle uptake by the cells is desired. The immobilization of the gold nanoparticles on cell culture surfaces can address this issue. In this study, we achieved this by silanization of the appropriate surfaces and the binding of gold nanoparticles to them. Comparable perforation efficiencies to the previous approaches of gold nanoparticle-mediated laser transfection with free gold nanoparticles are demonstrated. The uptake of the immobilized particles by the cells is unlikely. Consequently, these investigations offer the possibility of bringing gold nanoparticle-mediated laser transfection closer to routine usage.

  5. Ligand-Assisted Gold-Catalyzed Cross-Coupling with Aryldiazonium Salts: Redox Gold Catalysis without an External Oxidant.

    PubMed

    Cai, Rong; Lu, Mei; Aguilera, Ellen Y; Xi, Yumeng; Akhmedov, Novruz G; Petersen, Jeffrey L; Chen, Hao; Shi, Xiaodong

    2015-07-20

    Gold-catalyzed C(sp)-C(sp(2)) and C(sp(2))-C(sp(2)) cross-coupling reactions are accomplished with aryldiazonium salts as the coupling partner. With the assistance of bpy ligand, gold(I) species were oxidized to gold(III) by diazonium without any external oxidants. Monitoring the reaction with NMR and ESI-MS provided strong evidence for the nitrogen extrusion followed by Au(III) reductive elimination as the key step.

  6. Gold in the oceans through time

    NASA Astrophysics Data System (ADS)

    Large, Ross R.; Gregory, Daniel D.; Steadman, Jeffrey A.; Tomkins, Andrew G.; Lounejeva, Elena; Danyushevsky, Leonid V.; Halpin, Jacqueline A.; Maslennikov, Valeriy; Sack, Patrick J.; Mukherjee, Indrani; Berry, Ron; Hickman, Arthur

    2015-10-01

    During sedimentation and diagenesis of carbonaceous shales in marine continental margin settings, Au is adsorbed from seawater and organic matter and becomes incorporated into sedimentary pyrite. LA-ICPMS analysis of over 4000 sedimentary pyrite grains in 308 samples from 33 locations around the world, grouped over 123 determined ages, has enabled us to track, in a first order sense, the Au content of the ocean over the last 3.5 billion years. Gold was enriched in the Meso- and Neoarchean oceans, several times above present values, then dropped by an order of magnitude from the first Great Oxidation Event (GOE1) through the Paleoproterozoic to reach a minimum value around 1600 Ma. Gold content of the oceans then rose, with perturbations, through the Meso- and Neoproterozoic, showing a steady rise at the end of the Proterozoic (800 to 520 Ma), which most likely represents the effects of the second Great Oxidation Event (GOE2). Gold in the oceans was at a maximum at 520 Ma, when oxygen in the oceans rose to match current maximum values. In the Archean and Proterozoic, the Au content of seawater correlates with the time distribution of high-Mg greenstone belts, black shales and banded iron formations, suggesting that increases in atmospheric oxygen and marine bio-productivity, combined with the higher background of Au in komatiitic and Mg-rich basalts were the first order causes of the pattern of Au enrichment in seawater. We suggest the lack of major Au deposits from 1800 to 800 Ma, is explained by the low levels of Au in the oceans during this period.

  7. Electronic transport in arrays of gold nanocrystals

    NASA Astrophysics Data System (ADS)

    Parthasarathy, Raghuveer

    We examine electronic transport through two-dimensional arrays of gold nanocrystals. Recently developed techniques of particle synthesis and array self-assembly provide ordered (and disordered) monolayers of six-nanometer diameter gold nanocrystals on substrates with in-plane electrodes. These well-characterized superlattices allow investigation of basic questions about electronic conduction in metal quantum dot assemblies, answers to which have previously remained elusive. We first address the relation between current and voltage. Central to transport is the Coulomb blockade, the energetic cost of adding a single electron to a nanocrystal. Theoretical studies suggest power-law scaling of current beyond a threshold voltage in Coulomb blockade dominated systems. In ordered arrays, our data follow a power-law form, but with a scaling exponent significantly higher than the theoretical prediction. In disordered arrays, power-law scaling is violated; we explain that disorder disturbs the branching of current-carrying paths responsible for power-law conduction. Second, we examine the effect of temperature on transport. We find a large low-temperature regime (up to about 100 K) in which thermal energy acts only to linearly suppress the threshold voltage, leaving the current scale unaffected. We provide a simple, analytic model of thermally assisted tunneling which quantitatively describes the data. Third, we develop a simple and novel technique to tune the interparticle electronic couplings of the arrays---deposition of small amounts of germanium on the monolayers. The germanium dopant lowers the voltage threshold, and also increases conductivity. It also increases the temperature dependence of transport, suggesting the introduction of trapped states between the gold nanocrystal cores.

  8. Fugitive Mercury Emissions From Nevada Gold Mines

    NASA Astrophysics Data System (ADS)

    Miller, M. B.; Eckley, C. S.; Gustin, M.; Marsik, F.

    2008-12-01

    Mercury (Hg) can be released from point sources at gold mines (e.g. stacks associated with ore processing facilities) as well as from diffuse fugitive sources (e.g. waste rock dumps, heap leaches, etc). Fugitive Hg emissions have not been quantified for active gold mines and as such a large knowledge gap exists concerning the magnitude of total emissions from this source type. This study measured fugitive Hg emissions from two active gold mines in Northern Nevada. To contextualize the magnitude of the mine emissions with respect to those associated with natural surfaces, data were collected from undisturbed areas near the mines that are of similar geologic character. The initial results from this project have shown that there is a large range in surface Hg concentrations and associated emissions to the atmosphere from different surface types within a mine as well as between the two mines. At both mines, the lowest surface Hg concentrations and emissions were associated with the alluvium/overburden waste rock dumps. Surface Hg concentrations and emissions at nearby undisturbed sites were of similar magnitude. Surface concentrations and emissions were substantially higher from active heap leaches. In addition to the difference in fluxes for specific materials, measured emissions must be put within the context of material spatial extent and temporal variability. Here we compare Hg emission contributions from mining and undisturbed materials as a function of space and time (diel and seasonal), and illustrate the need for collection of these types of data in order to reduce uncertainties in understanding air-surface Hg exchange.

  9. Viral detection using DNA functionalized gold filaments†

    PubMed Central

    Perez, Jonas W.; Haselton, Frederick R.

    2010-01-01

    Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5′ [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3′ covalently attached to a 5 cm length of a 100 μm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 μm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 μL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was ~200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting. PMID:20448919

  10. Modulation of Fano resonances in symmetry-broken gold-SiO2-gold nanotube dimers

    NASA Astrophysics Data System (ADS)

    Wu, DaJian; Yu, HaiQun; Jiang, ShuMin; Wu, XueWei; Liu, XiaoJun

    2014-06-01

    Fano resonances in the symmetry-broken gold-SiO2-gold (BGSG) nanotubes and the associated dimers have been investigated based on the finite element method. In the BGSG nanotube, the symmetry breaking induced the interactions of the inner gold core and outer gold nanoshell plasmons of all multipolar orders and hence the red-shifts of the plasmon resonance modes and the enhanced quadrupole mode peaks were observed. The interference of the quadrupole mode peak with the subradiant dipole mode caused a Fano-dip in the scattering spectrum. By increasing the core offset-value in the BGSG nanotube, the Fano dip with low energy showed a red-shift and became deeper. Unexpectedly the plasmon coupling between a GSG nanotube and a BGSG nanotube can lead to two strong Fano dips in the scattering spectra of the dimer. It was further noted that the thin side of the BGSG nanotube located at two sides of the dimer gap can lead to the strong near-field coupling between two BGSG nanotubes and hence a deeper and broader Fano dip.

  11. Where Are the Facts? "Jason's Gold" Gives Meaning to the Yukon Gold Rush

    ERIC Educational Resources Information Center

    Wasta, Stephanie; Lott, Carolyn

    2006-01-01

    This article discusses how fictional works can give a purposeful context and an appropriate venue for developing essential social studies concepts in middle-school students. The author uses the example of a National Council for the Social Studies (NCSS) notable book, "Jason's Gold" that blends history with story to become historical…

  12. Turning Plastic into Gold: An Analogy to Demonstrate The Rutherford Gold Foil Experiment

    ERIC Educational Resources Information Center

    Gregory, Robert B.

    2007-01-01

    The Rutherford-Geiger-Marsden gold foil experiment is demonstrated to give students a useful mental image of the concept or principle of chemistry. The experiment shows students that in a short time one unexpected result can change the way science looks at the world.

  13. Where Are the Facts? "Jason's Gold" Gives Meaning to the Yukon Gold Rush

    ERIC Educational Resources Information Center

    Wasta, Stephanie; Lott, Carolyn

    2006-01-01

    This article discusses how fictional works can give a purposeful context and an appropriate venue for developing essential social studies concepts in middle-school students. The author uses the example of a National Council for the Social Studies (NCSS) notable book, "Jason's Gold" that blends history with story to become historical…

  14. Nanomanufacturing of gold nanoparticle superstructures from the "bottom-up"

    NASA Astrophysics Data System (ADS)

    Rao, Tingling

    Gold nanoparticles that can generate surface plasmons under appropriate conditions have attracted significant interest for their potential in optics, photonics, data storage and biological sensors. Developing high fidelity fabrication methods that yield gold nanoparticles with well-defined size, shape, composition and self-assembly allows manipulation of surface plasmonic properties for novel applications as well as revealing new aspects of the underlying science. This dissertation demonstrates multiple techniques that describe cost-effective bottom-up" fabrication methods that yield gold nano-superstructures. In my initial work, I outline the solution conditions for fabricating Janus nanoparticles composed of one gold nanoparticle per micelle. Poly(ethylene oxide)-b-polystyrene (PEO-b-PS) was synthesized and processed into spherical micelles, which served as the template to induce gold nanoparticles growth within the PEO corona in situ. Organic-inorganic hybrid nanoparticle formation was controlled kinetically by manipulating the concentration of both the micelle and reducing agent (HEPES). We also found that under certain condition, PEO-b-PS yielded micelles with pearl-like morphology, which possessed concentrated PEO domains at the interface between two adjacent PS cores. Careful manipulation of reaction conditions afforded gold nanoparticles that grew from the core-shell interface to form 1-dimensional (1-D) periodical gold nanoparticle chains. Based on similar principles, gold-gold dimers were synthesized by growing a second gold nanoparticle from a gold nanoparticle template surface-functionalized with PEO ligands. Gold dimers fabricated with this method exhibited strong enhancement properties via surface-enhanced Raman scattering (SERS). Instead of kinetic control, the number of newly grown gold nanoparticles on each particle template heavily relied on the PEO density on the nanoparticle template. As the size of the particle template increased from 10 nm to

  15. Effect of gold ion concentration on size and properties of gold nanoparticles in TritonX-100 based inverse microemulsions

    NASA Astrophysics Data System (ADS)

    Ahmad, Tokeer; Wani, Irshad A.; Ahmed, Jahangeer; Al-Hartomy, Omar A.

    2014-04-01

    Gold nanoparticles have been prepared successfully using TritonX-100 inverse microemulsion at different concentrations of HAuCl4 (0.1, 0.05, 0.04, 0.03, 0.02 and 0.01 M). We have studied the effect of gold ion concentration on the particle size, morphology, surface area and optical properties of the gold nanoparticles. The gold nanoparticles were characterized by X-ray diffraction, transmission electron microscopy, UV-Visible spectroscopy and Brunauer-Emmett-Teller surface area analysis. X-ray diffraction studies show the monophasic nature of the gold nanoparticles. TritonX-100 stabilized gold nanoparticles were appeared to be agglomerated at higher concentrations (0.1 and 0.05 M) of Au3+ with an average grain size of 60 and 50 nm, respectively. Monodisperse and uniform gold nanoparticles with well-defined morphologies of an average grain size of 15 and 25 nm were obtained at lower concentrations (0.01 and 0.02 M). UV-Visible spectroscopy shows the characteristic surface plasmon resonance peak ~540 nm along with the peaks at shorter and longer wavelengths may be due to the higher order plasmon resonance of the gold nanoparticles. The surface areas of the gold nanoparticles were found to be in the range of 5.8-107 m2/g which were well in agreement with the electron microscopic studies.

  16. Effect of gold ion concentration on size and properties of gold nanoparticles in TritonX-100 based inverse microemulsions

    NASA Astrophysics Data System (ADS)

    Ahmad, Tokeer; Wani, Irshad A.; Ahmed, Jahangeer; Al-Hartomy, Omar A.

    2013-04-01

    Gold nanoparticles have been prepared successfully using TritonX-100 inverse microemulsion at different concentrations of HAuCl4 (0.1, 0.05, 0.04, 0.03, 0.02 and 0.01 M). We have studied the effect of gold ion concentration on the particle size, morphology, surface area and optical properties of the gold nanoparticles. The gold nanoparticles were characterized by X-ray diffraction, transmission electron microscopy, UV-Visible spectroscopy and Brunauer-Emmett-Teller surface area analysis. X-ray diffraction studies show the monophasic nature of the gold nanoparticles. TritonX-100 stabilized gold nanoparticles were appeared to be agglomerated at higher concentrations (0.1 and 0.05 M) of Au3+ with an average grain size of 60 and 50 nm, respectively. Monodisperse and uniform gold nanoparticles with well-defined morphologies of an average grain size of 15 and 25 nm were obtained at lower concentrations (0.01 and 0.02 M). UV-Visible spectroscopy shows the characteristic surface plasmon resonance peak ~540 nm along with the peaks at shorter and longer wavelengths may be due to the higher order plasmon resonance of the gold nanoparticles. The surface areas of the gold nanoparticles were found to be in the range of 5.8-107 m2/g which were well in agreement with the electron microscopic studies.

  17. Galvanic Synthesis of Hollow Gold Nanoshells

    DTIC Science & Technology

    2015-02-01

    materials’ core–shell ratio. 15. SUBJECT TERMS nanotechnology, gold nanoshell galvanic replacement reaction, tuned absorption 16. SECURITY... absorption maxima of the former can be adjusted from the visible to the NIR by varying the diameter and shell thickness, while the solid Au and Ag surface...solution of 50 mL of silver nitrate (0.2 mM) and sodium citrate (0.5 mM) at 60 °C, the solution turned dark yellow. There was an absorption peak at

  18. Monolayer coated gold nanoparticles for delivery applications

    PubMed Central

    Rana, Subinoy; Bajaj, Avinash; Mout, Rubul; Rotello, Vincent M.

    2011-01-01

    Gold nanoparticles (AuNPs) provide attractive vehicles for delivery of drugs, genetic materials, proteins, and small molecules. AuNPs feature low core toxicity coupled with the ability to parametrically control particle size and surface properties. In this review, we focus on engineering of the AuNP surface monolayer, highlighting recent advances in tuning monolayer structures for efficient delivery of drugs and biomolecules. This review covers two broad categories of particle functionalization, organic monolayers and biomolecule coatings, and discusses their applications in drug, DNA/RNA, protein and small molecule delivery. PMID:21925556

  19. Simultaneous growths of gold colloidal crystals.

    PubMed

    Goubet, Nicolas; Portalès, Hervé; Yan, Cong; Arfaoui, Imad; Albouy, Pierre-Antoine; Mermet, Alain; Pileni, Marie-Paule

    2012-02-29

    Natural systems give the route to design periodic arrangements with mesoscopic architecture using individual nanocrystals as building blocks forming colloidal crystals or supracrystals. The collective properties of such supracrystals are one of the main driving forces in materials research for the 21st century with potential applications in electronics or biomedical environments. Here we describe two simultaneous supracrystal growth processes from gold nanocrystal suspension, taking place in solution and at the air-liquid interface. Furthermore, the growth processes involve the crystallinity selection of nanocrystals and induce marked changes in the supracrystal mechanical properties. © 2012 American Chemical Society

  20. Gold strip gratings with binary supercell.

    PubMed

    Magno, Giovanni; Marrocco, Valeria; Grande, Marco; D'Orazio, Antonella

    2013-08-01

    In this Letter, the study of a periodic structure composed of gold strips arranged in double-period unit cells, in a symmetric and asymmetric environment, is reported. The spectral maps show that the formation of the plasmonic bandgap and the extraordinary optical transmission are subjected to the proportion between the strip widths. Moreover, when the asymmetric environment is considered, high-transmittance and high-absorbance states arise. Hence, by controlling the geometrical parameters of the binary-periodic structure, it is possible to tailor the spectral response of the grating enhancing the desired features and exploiting them for different applications.

  1. Structural and plasmonic properties of gold nanocrystals

    NASA Astrophysics Data System (ADS)

    Sivapalan, Sean T.

    The design of gold nanoparticles for surface-enhanced Raman scattering (SERS) and plasmonic enhanced fluorescence are more involved than simply maximizing the local field enhancement. The enhancement is a function of the excitation wavelength relative to the plasmon resonance as well as the distance of the reporter molecules from the nanoparticles' surface. For suspension based measurements, additional considerations must also be made regarding absorption and scattering effects as light propagates through the sample. These effects are in addition to the other more commonly observed effects such as nanocrystal shape. With such a wide number of variables in play, a series of studies breaking down each of these components and their contribution to the observed enhancement is warranted. In this thesis, a series of experiments were undertaken using a platform based on polyelectrolyte coating of gold nanoparticles by layer-by-layer deposition. The reporter molecules are bound onto the surface of polyelectrolyte coated nanoparticles before trap coating them with an additional oppositely charged polyelectrolyte layer. By etching away the gold nanoparticle using potassium cyanide, we are then able to quantify the number of reporter molecule per nanoparticle using mass spectrometry. With this quantitative approach, we can the directly compare the effects of the aforementioned enhancement mechanisms on the observed signal intensity. This method overcomes some of the disparities in literature between reported values of enhancement due to assumption in the number of reporter molecules contribution to the signal intensity. Using our group's expertise, we synthesized gold nanoparticle libraries of nanorods, cubes, trisoctahedra and spheres of different sizes. Each geometric configuration was characterized using a recently developed TEM technique---nano-beam coherent area diffraction. The as-synthesized were exposed to a coherent electron beam with probe size similar to that of

  2. Mortality of white South African gold miners.

    PubMed Central

    Reid, P J; Sluis-Cremer, G K

    1996-01-01

    OBJECTIVES--This two part study aimed to determine whether there was an excess mortality generally or for some diseases among middle aged white South African gold miners on the Witwatersrand and whether the underground dust exposure of these miners contributed to the development of lung cancer, chronic obstructive pulmonary disease (COPD), or ischaemic heart disease (IHD). METHODS--A cohort of 4925 white miners in South Africa, born between 1 January 1916 and 31 December 1930 who were alive and working in the vicinity of Johannesburg on 1 January 1970, then aged between 39 and 54, was followed up for 20 years by which time 2032 had died. Most were gold miners (about 87% had worked 85% or more of their shifts in gold mines). Standardised mortality ratios (SMRs) were calculated as percentages of the number of deaths observed in the cohort for a condition as stated on the death certificate divided by the number expected on the basis of concurrent mortality in the reference population (the total age specific white male population of South Africa). A case-control analysis was performed for three diseases (lung cancer, COPD, and IHD), the results of which are presented for those miners in the cohort who had spent at least 85% of their service on gold mines and had worked at least 15% of their shifts underground. RESULTS--The SMR for all causes of death was 129.6%, raised because of excess mortality due to the following causes: lung cancer (SMR = 139.8%), IHD (124.1%), COPD (189%) and cirrhosis of the liver (155.3%). Smoking was confirmed to be the main risk factor for lung cancer and COPD although cumulative dust exposure was found to increase the risk of COPD in conjunction with smoking. No significant risk of lung cancer resulted from exposure to dust. High blood pressure and smoking were found to increase the risk of IHD, but no association between IHD and the quetelet index (weight/height2) was found. CONCLUSIONS--The most significant and unexpected finding was the

  3. Application of gold nanoparticles in cancer therapy.

    PubMed

    Zhao, Chuan-tong; Liu, Zhen-bao

    2014-06-01

    With their unique physicochemical properties including excellent stability and biocompatibility, large specific surface area, and easy surface modification, gold nanoparticles (AuNPs) can be used as delivery vectors for drugs, genes, proteins, etc. In addition, AuNPs have excellent photothermal effects and radiosensitization characteristics, and therefore can be widely applied in the photothermal therapy and radiotherapy of cancers. This article reviews the construction, cellular uptake, and drug release of AuNPs drug-delivery systems and their applications in the treatment of tumors.

  4. Precision gold conductors for HMCs. Final report

    SciTech Connect

    Widmer, M.R.

    1994-08-01

    Ti/Pd/Au multiple code coded switch (MCCS) networks were built and compared to Cr/Au MCCS networks. The data showed no measurable difference between the two systems. Interface resistance of both types of networks was measured as a diagnostic aid to determine if hydrogen was affecting the Ti/Pd/Au MCCS networks. The data showed that although hydrogen does affect Ti/Pd/Au, the changes are not significant with respect to MCCS environments. An evaluation of several proprietary gold electroplating solutions for use in the production of Ti/Pd/Au conductors was performed. All the testing results were comparable to the current product requirements.

  5. Gold(I) Fluorohalides: Theory and Experiment.

    PubMed

    Baya, Miguel; Pérez-Bitrián, Alberto; Martínez-Salvador, Sonia; Casas, José M; Menjón, Babil; Orduna, Jesús

    2017-01-31

    The anionic trifluoromethylgold(I) derivatives [CF3 AuX](-) , which have been prepared and isolated as their [PPh4 ](+) salts in good yield, undergo thermally induced difluorocarbene extrusion in the gas phase, giving rise to the mixed gold(I) fluorohalide complexes [F-Au-X](-) (X=Cl, Br, I). These triatomic species have been detected by tandem mass spectrometry (MS2) experiments and their properties have been analyzed by DFT methods. The CF2 extrusion mechanism from the Au-CF3 moiety serves as a model for the CF2 insertion into the Au-F bond, since both reactivity channels are connected by the microreversibility principle.

  6. X-Ray Spectroscopy of Gold Nanoparticles

    NASA Astrophysics Data System (ADS)

    Nahar, Sultana N.; Montenegro, M.; Pradhan, A. K.; Pitzer, R.

    2009-06-01

    Inner shell transitions, such as 1s-2p, in heavy elements can absorb or produce hard X-rays, and hence are widely used in nanoparticles. Bio-medical research for cancer treatment has been using heavy element nanoparticles, embeded in malignant tumor, for efficient absorption of irradiated X-rays and leading emission of hard X-rays and energetic electrons to kill the surrounding cells. Ejection of a 1s electron during ionization of the element by absorption of a X-ray photon initiates the Auger cascades of emission of photons and electrons. We have investigated gold nanoparticles for the optimal energy range, below the K-edge (1s) ionization threshold, that corresponds to resonant absorption of X-rays with large attenuation coefficients, orders of magnitude higher over the background as well as to that at K-edge threshold. We applied these attenuation coefficients in Monte Carlo simulation to study the intensities of emission of photons and electrons by Auger cascades. The numerical experiments were carried out in a phantom of water cube with a thin layer, 0.1mm/g, of gold nanoparticles 10 cm inside from the surface using the well-known code Geant4. We will present results on photon and electron emission spectra from passing monochromatic X-ray beams at 67 keV, which is the resonant energy for resonant K_{α} lines, at 82 keV, the K-shell ionization threshold, and at 2 MeV where the resonant effect is non-existent. Our findings show a high peak in the gold nanoparticle absorption curve indicating complete absorption of radiation within the gold layer. The photon and electron emission spectra show resonant features. Acknowledgement: Partially supported by a Large Interdisciplinary Grant award of the Ohio State University and NASA APRA program (SNN). The computational work was carried out on the Cray X1 and Itanium 4 cluster at the Ohio Supercomputer Center, Columbus Ohio. "Resonant X-ray Irradiation of High-Z Nanoparticles For Cancer Theranostics" (refereed

  7. Solidification of gold nanoparticles in carbon nanotubes.

    PubMed

    Arcidiacono, S; Walther, J H; Poulikakos, D; Passerone, D; Koumoutsakos, P

    2005-03-18

    The structure and the solidification of gold nanoparticles in a carbon nanotube are investigated using molecular dynamics simulations. The simulations indicate that the predicted solidification temperature of the enclosed particle is lower than its bulk counterpart, but higher than that observed for clusters placed in vacuum. A comparison with a phenomenological model indicates that, in the considered range of tube radii (R(CNT)) of 0.5 < R(CNT) < 1.6 nm, the solidification temperature depends mainly on the length of the particle with a minor dependence on R(CNT).

  8. Overgrowth of Rhodium on Gold Nanorods

    PubMed Central

    2012-01-01

    This study focuses on the deposition and growth mode of rhodium (Rh) on gold (Au) seed nanorods (NRs). Using a combination of scanning transmission electron microscopy imaging, energy-dispersive X-ray spectroscopy, and UV–visible absorption spectroscopy, we show that Rh deposition results in an uneven overlayer morphology on the Au NR seeds, with a tendency for Rh deposition to occur preferentially on the Au NR ends. The results suggest that complex and kinetically driven metal–metal interactions take place in this system. PMID:22582111

  9. Nanoindentation of gold nanoparticles functionalized with proteins.

    PubMed

    Wampler, Heeyeon P; Ivanisevic, Albena

    2009-06-01

    The hardness and Young's modulus of 10 and 20 nm gold nanoparticles (Au NPs) modified with bovine serum albumin and streptavidin were measured using a nanoindenter. The Au NPs were immobilized on a semiconductor surface through organic self-assembled monolayers. Changes in mechanical properties occurred when the Au NPs were immobilized on the surface. The hardness and Young's modulus were dependent on the size of the NPs, and the proteins on the particles showed highly plastic and elastic behavior compared to flat surfaces modified with self-assembled monolayers.

  10. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD... value of the gold seized by the Secret Service exceeds $2,500, the seizing officer shall furnish...

  11. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD... value of the gold seized by the Secret Service exceeds $2,500, the seizing officer shall furnish...

  12. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD... value of the gold seized by the Secret Service exceeds $2,500, the seizing officer shall furnish...

  13. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD... value of the gold seized by the Secret Service exceeds $2,500, the seizing officer shall furnish...

  14. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD... value of the gold seized by the Secret Service exceeds $2,500, the seizing officer shall furnish...

  15. Controlled adsorption of cytochrome c to nanostructured gold surfaces

    NASA Astrophysics Data System (ADS)

    Gomes, Inês; Feio, Maria J.; Santos, Nuno C.; Eaton, Peter; Serro, Ana Paula; Saramago, Benilde; Pereira, Eulália; Franco, Ricardo

    2012-12-01

    Controlled electrostatic physisorption of horse heart cytochrome c (Cyt c) onto nanostructured gold surfaces was investigated using Quartz-Crystal Microbalance measurements in planar gold surfaces with or without functionalization using a self-assembled monolayer (SAM) of the alkanethiol mercaptoundecanoic acid (MUA). MUA is a useful functionalization ligand for gold surfaces, shedding adsorbed biomolecules from the excessive electron density of the metal. A parallel analysis was conducted in the corresponding curved surfaces of 15 nm gold nanoparticles (AuNPs), using zeta-potential and UV- visible spectroscopy. Atomic Force Microscopy of both types of functionalized gold surfaces with a MUA SAM, allowed for visualization of Cyt c deposits on the nanostructured gold surface. The amount of Cyt c adsorbed onto the gold surface could be controlled by the solution pH. For the assays conducted at pH 4.5, when MUA SAM- functionalized planar gold surfaces are positive or neutral, and Cyt c has a positive net charge, only 13 % of the planar gold surface area was coated with protein. In contrast, at pH 7.4, when MUA SAM-functionalized planar gold surfaces and Cyt c have opposite charges, a protein coverage of 28 % could be observed implying an adsorption process strongly governed by electrostatic forces. Cyt c adsorption on planar and curved gold surfaces are found to be greatly favored by the presence of a MUA-capping layer. In particular, on the AuNPs, the binding constant is three times larger than the binding constant obtained for the original citrate-capped AuNPs.

  16. Encapsulation of gold nanoparticles into self-assembling protein nanoparticles.

    PubMed

    Yang, Yongkun; Burkhard, Peter

    2012-10-31

    Gold nanoparticles are useful tools for biological applications due to their attractive physical and chemical properties. Their applications can be further expanded when they are functionalized with biological molecules. The biological molecules not only provide the interfaces for interactions between nanoparticles and biological environment, but also contribute their biological functions to the nanoparticles. Therefore, we used self-assembling protein nanoparticles (SAPNs) to encapsulate gold nanoparticles. The protein nanoparticles are formed upon self-assembly of a protein chain that is composed of a pentameric coiled-coil domain at the N-terminus and trimeric coiled-coil domain at the C-terminus. The self-assembling protein nanoparticles form a central cavity of about 10 nm in size, which is ideal for the encapsulation of gold nanoparticles with similar sizes. We have used SAPNs to encapsulate several commercially available gold nanoparticles. The hydrodynamic size and the surface coating of gold nanoparticles are two important factors influencing successful encapsulation by the SAPNs. Gold nanoparticles with a hydrodynamic size of less than 15 nm can successfully be encapsulated. Gold nanoparticles with citrate coating appear to have stronger interactions with the proteins, which can interfere with the formation of regular protein nanoparticles. Upon encapsulation gold nanoparticles with polymer coating interfere less strongly with the ability of the SAPNs to assemble into nanoparticles. Although the central cavity of the SAPNs carries an overall charge, the electrostatic interaction appears to be less critical for the efficient encapsulation of gold nanoparticles into the protein nanoparticles. The SAPNs can be used to encapsulate gold nanoparticles. The SAPNs can be further functionalized by engineering functional peptides or proteins to either their N- or C-termini. Therefore encapsulation of gold nanoparticles into SAPNs can provide a useful platform to

  17. Encapsulation of gold nanoparticles into self-assembling protein nanoparticles

    PubMed Central

    2012-01-01

    Background Gold nanoparticles are useful tools for biological applications due to their attractive physical and chemical properties. Their applications can be further expanded when they are functionalized with biological molecules. The biological molecules not only provide the interfaces for interactions between nanoparticles and biological environment, but also contribute their biological functions to the nanoparticles. Therefore, we used self-assembling protein nanoparticles (SAPNs) to encapsulate gold nanoparticles. The protein nanoparticles are formed upon self-assembly of a protein chain that is composed of a pentameric coiled-coil domain at the N-terminus and trimeric coiled-coil domain at the C-terminus. The self-assembling protein nanoparticles form a central cavity of about 10 nm in size, which is ideal for the encapsulation of gold nanoparticles with similar sizes. Results We have used SAPNs to encapsulate several commercially available gold nanoparticles. The hydrodynamic size and the surface coating of gold nanoparticles are two important factors influencing successful encapsulation by the SAPNs. Gold nanoparticles with a hydrodynamic size of less than 15 nm can successfully be encapsulated. Gold nanoparticles with citrate coating appear to have stronger interactions with the proteins, which can interfere with the formation of regular protein nanoparticles. Upon encapsulation gold nanoparticles with polymer coating interfere less strongly with the ability of the SAPNs to assemble into nanoparticles. Although the central cavity of the SAPNs carries an overall charge, the electrostatic interaction appears to be less critical for the efficient encapsulation of gold nanoparticles into the protein nanoparticles. Conclusions The SAPNs can be used to encapsulate gold nanoparticles. The SAPNs can be further functionalized by engineering functional peptides or proteins to either their N- or C-termini. Therefore encapsulation of gold nanoparticles into SAPNs can

  18. Adsorption of cellulose derivatives on flat gold surfaces and on spherical gold particles.

    PubMed

    Amirkhani, Masoud; Volden, Sondre; Zhu, Kaizheng; Glomm, Wilhelm R; Nyström, Bo

    2008-12-01

    The adsorption of hydroxyethylcellulose (HEC), ethyl(hydroxyethyl)cellulose (EHEC), and their hydrophobically modified counterparts HM-HEC and HM-EHEC has been studied on planar gold and citrate-covered gold surfaces by means of quartz crystal microbalance with dissipation monitoring (QCM-D), and on citrate-covered gold particles with the aid of dynamic light scattering (DLS). The QCM-D results indicate that larger amounts of polymer are adsorbed from aqueous solutions of HM-HEC and HM-EHEC on both substrates than from solutions of their unmodified analogues. The adsorption affinity for all the polymers, except EHEC, is higher on the citrate-covered surfaces than on the bare gold substrate. This indicates that more adsorption sites are activated in the presence of the citrate layer. The experimental adsorption data for all the polymers can be described fairly well by the Langmuir adsorption isotherm. However, at very low polymer concentrations significant deviations from the model are observed. The value of the hydrodynamic thickness of the adsorbed polymer layer (delta h), determined from DLS, rises with increasing polymer concentration for all the cellulose derivatives; a Langmuir type of isotherm can be used to roughly describe the adsorption behavior. Because of good solvent conditions for HEC the chains extend far out in the bulk at higher concentrations and the value of delta h is much higher than that of HM-HEC. The adsorption of EHEC and HM-EHEC onto gold particles discloses that the values of delta h are considerably higher for the hydrophobically modified cellulose derivative, and this finding is compatible with the trend in layer thickness estimated from the QCM-D measurements.

  19. Gold nanoparticles generated by thermolysis of "all-in-one" gold(I) carboxylate complexes.

    PubMed

    Tuchscherer, A; Schaarschmidt, D; Schulze, S; Hietschold, M; Lang, H

    2012-03-07

    Consecutive synthesis methodologies for the preparation of the gold(I) carboxylates [(Ph(3)P)AuO(2)CCH(2)(OCH(2)CH(2))(n)OCH(3)] (n = 0-6) (6a-g) are reported, whereby selective mono-alkylation of diols HO(CH(2)CH(2)O)(n)H (n = 0-6), Williamson ether synthesis and metal carboxylate (Ag, Au) formation are the key steps. Single crystal X-ray diffraction studies of 6a (n = 0) and 6b (n = 1) were carried out showing that the P-Au-O unit is essentially linear. These compounds were applied in the formation of gold nanoparticles (NP) by a thermally induced decomposition process and hence the addition of any further stabilizing and reducing reagents, respectively, is not required. The ethylene glycol functionalities, providing multiple donating capabilities, are able to stabilise the encapsulated gold colloids. The dependency of concentration, generation time and ethylene glycol chain lengths on the NP size and size distribution is discussed. Characterisation of the gold colloids was performed by TEM, UV/Vis spectroscopy and electron diffraction studies revealing that Au NP are formed with a size of 3.3 (±0.6) to 6.5 (±0.9) nm in p-xylene with a sharp size distribution. Additionally, a decomposition mechanism determined by TG-MS coupling experiments of the gold(i) precursors is reported showing that 1(st) decarboxylation occurs followed by the cleavage of the Au-PPh(3) bond and finally release of ethylene glycol fragments to give Au-NP and the appropriate organics.

  20. Shape and surface effects on the cytotoxicity of nanoparticles: Gold nanospheres versus gold nanostars.

    PubMed

    Favi, Pelagie Marlene; Gao, Ming; Johana Sepúlveda Arango, Liuda; Ospina, Sandra Patricia; Morales, Mariana; Pavon, Juan Jose; Webster, Thomas Jay

    2015-11-01

    Gold nanoparticles are materials with unique optical properties that have made them very attractive for numerous biomedical applications. With the increasing discovery of techniques to synthesize novel nanoparticles such as star-shaped gold nanoparticles for biomedical applications, the safety and performance of these new nanomaterials must be systematically assessed before use. In this study, gold nanostars (AuNSTs) with multibranched surface structures were synthesized, and their influence on the cytotoxicity of human skin fibroblasts and rat fat pad endothelial cells (RFPECs) were assessed and compared with that of gold nanospheres (AuNSPs) with unbranched surfaces. Results showed that the AuNSPs with diameters of approximately 61.46 nm showed greater toxicity with fibroblast cells and RFPECs compared with the synthesized AuNSTs with diameters of approximately 33.69 nm. The AuNSPs were lethal at concentrations of 40 μg/mL for both cell lines, whereas the AuNSTs were less toxic at higher concentrations (400 μg/mL). The calculated IC50 (50% inhibitory concentration) values of the AuNSPs exposed to fibroblast cells were greater at 1 and 4 days of culture (26.4 and 27.7 μg/mL, respectively) compared with the RFPECs (13.6 and 13.8 μg/mL, respectively), indicating that the AuNSPs have a greater toxicity to endothelial cells. It was proposed that possible factors that could be promoting the reduced toxicity effects of the AuNSTs to fibroblast cells and RFPECs, compared with the AuNSPs may be size, surface chemistry, and shape of the gold nanoparticles. The reduced cell toxicity observed with the AuNSTs suggests that AuNSTs may be a promising material for use in biomedical applications.

  1. Method for aqueous gold thiosulfate extraction using copper-cyanide pretreated carbon adsorption

    SciTech Connect

    Young, Courtney; Melashvili, Mariam; Gow, Nicholas V

    2013-08-06

    A gold thiosulfate leaching process uses carbon to remove gold from the leach liquor. The activated carbon is pretreated with copper cyanide. A copper (on the carbon) to gold (in solution) ratio of at least 1.5 optimizes gold recovery from solution. To recover the gold from the carbon, conventional elution technology works but is dependent on the copper to gold ratio on the carbon.

  2. Gold nanostructure materials in diabetes management

    NASA Astrophysics Data System (ADS)

    Si, Satyabrata; Pal, Arttatrana; Mohanta, Jagdeep; Sagar Satapathy, Smith

    2017-04-01

    Diabetes mellitus is a group of metabolic diseases characterized by hyperglycemia, and is now one of the most non-communicable diseases globally and can be lethal if not properly controlled. Prolonged exposure to chronic hyperglycemia, without proper management, can lead to various vascular complications and represents the main cause of morbidity and mortality in diabetes patients. Studies have indicated that major long-term complications of diabetes arise from persistent oxidative-nitrosative stress and dysregulation in multiple metabolic pathways. Presently, the main focus for diabetes management is to optimize the available techniques to ensure adequate blood sugar level, blood pressure and lipid profile, thereby minimizing the diabetes complications. In this regard, nanomedicine utilizing gold nanostructures has great potential and seems to be a promising option. The present review highlights the basic concepts and up-to-date literature survey of gold nanostructure materials in management of diabetes in several ways, which include sensing, imaging, drug delivery and therapy. The work can be of interest to various researchers working on basic and applied sciences including nanosciences.

  3. The halogen analogs of thiolated gold nanoclusters

    SciTech Connect

    Jiang, Deen; Walter, Michael

    2012-01-01

    Is it possible to replace all the thiolates in a thiolated gold nanocluster with halogens while still maintaining the geometry and the electronic structure? In this work, we show from density functional theory that such halogen analogs of thiolated gold nanoclusters are highly likely. Using Au{sub 25}X{sub 18}{sup -} as an example, where X = F, Cl, Br, or I replaces -SR, we find that Au{sub 25}Cl{sub 18}{sup -} demonstrates a high similarity to Au{sub 25}(SR){sub 18}{sup -} by showing Au-Cl distances, Cl-Au-Cl angles, band gap, and frontier orbitals similar to those in Au{sub 25}(SR){sub 18}{sup -}. DFT-based global minimization also indicates the energetic preference of staple formation for the Au{sub 25}Cl{sub 18}{sup -} cluster. The similarity between Au{sub m}(SR){sub n} and Au{sub m}X{sub n} could be exploited to make viable Au{sub m}X{sub n} clusters and to predict structures for Au{sub m}(SR){sub n}.

  4. Photoinduced spectral changes of photoluminescent gold nanoclusters.

    PubMed

    Matulionytė, Marija; Marcinonytė, Raminta; Rotomskis, Ričardas

    2015-05-01

    Ultrasmall photoluminescent gold nanoclusters (Au NCs), composed of several atoms with sizes up to a few nanometers, have recently stimulated extensive interest. Unique molecule-like behaviors, low toxicity, and facile synthesis make photoluminescent Au NCs a very promising alternative to organic fluorophores and semiconductor quantum dots (QDs) in broad ranges of biomedical applications. However, using gold nanoparticles (Au NPs) for bioimaging might cause their degradation under continuous excitation with UV light, which might result in toxicity. We report spectral changes of photoluminescent 2-(N-morpholino) ethanesulfonic acid (MES)-coated (Au-MES) NCs under irradiation with UV/blue light. Photoluminescent water soluble Au- MES NCs with a photoluminescence (PL) band maximum at 476 nm (λex = 420 nm) were synthesized. Under irradiation with 402 nm wavelength light the size of photoluminescent Au-MES NCs decreased (λem = 430 nm). Irradiating the sample solution with 330 nm wavelength light, nonluminescent Au NPs were disrupted, and photoluminescent Au NCs (λem = 476 nm) were formed. Irradiation with 330 nm wavelength light did not directly affect photoluminescent Au-MES NCs, however, increase in PL intensity indicated the formation of photoluminescent Au NCs from the disrupted nonluminescent Au NPs. This study gives a good insight into the photostability of MES-coated Au NPs under continuous excitation with UV/blue light.

  5. Photoinduced spectral changes of photoluminescent gold nanoclusters

    NASA Astrophysics Data System (ADS)

    Matulionytė, Marija; Marcinonytė, Raminta; Rotomskis, Ričardas

    2015-05-01

    Ultrasmall photoluminescent gold nanoclusters (Au NCs), composed of several atoms with sizes up to a few nanometers, have recently stimulated extensive interest. Unique molecule-like behaviors, low toxicity, and facile synthesis make photoluminescent Au NCs a very promising alternative to organic fluorophores and semiconductor quantum dots (QDs) in broad ranges of biomedical applications. However, using gold nanoparticles (Au NPs) for bioimaging might cause their degradation under continuous excitation with UV light, which might result in toxicity. We report spectral changes of photoluminescent 2-(N-morpholino) ethanesulfonic acid (MES)-coated (Au-MES) NCs under irradiation with UV/blue light. Photoluminescent water soluble Au-MES NCs with a photoluminescence (PL) band maximum at 476 nm (λex=420 nm) were synthesized. Under irradiation with 402 nm wavelength light the size of photoluminescent Au-MES NCs decreased (λem=430 nm). Irradiating the sample solution with 330 nm wavelength light, nonluminescent Au NPs were disrupted, and photoluminescent Au NCs (λem=476 nm) were formed. Irradiation with 330 nm wavelength light did not directly affect photoluminescent Au-MES NCs, however, increase in PL intensity indicated the formation of photoluminescent Au NCs from the disrupted nonluminescent Au NPs. This study gives a good insight into the photostability of MES-coated Au NPs under continuous excitation with UV/blue light.

  6. Unidirectional molecular motor on a gold surface

    NASA Astrophysics Data System (ADS)

    van Delden, Richard A.; Ter Wiel, Matthijs K. J.; Pollard, Michael M.; Vicario, Javier; Koumura, Nagatoshi; Feringa, Ben L.

    2005-10-01

    Molecules capable of mimicking the function of a wide range of mechanical devices have been fabricated, with motors that can induce mechanical movement attracting particular attention. Such molecular motors convert light or chemical energy into directional rotary or linear motion, and are usually prepared and operated in solution. But if they are to be used as nanomachines that can do useful work, it seems essential to construct systems that can function on a surface, like a recently reported linear artificial muscle. Surface-mounted rotors have been realized and limited directionality in their motion predicted. Here we demonstrate that a light-driven molecular motor capable of repetitive unidirectional rotation can be mounted on the surface of gold nanoparticles. The motor design uses a chiral helical alkene with an upper half that serves as a propeller and is connected through a carbon-carbon double bond (the rotation axis) to a lower half that serves as a stator. The stator carries two thiol-functionalized `legs', which then bind the entire motor molecule to a gold surface. NMR spectroscopy reveals that two photo-induced cis-trans isomerizations of the central double bond, each followed by a thermal helix inversion to prevent reverse rotation, induce a full and unidirectional 360° rotation of the propeller with respect to the surface-mounted lower half of the system.

  7. Surface plasmons in porous gold films

    NASA Astrophysics Data System (ADS)

    Rudenko, S. P.; Stetsenko, M. O.; Krishchenko, I. M.; Maksimenko, L. S.; Kaganovich, E. B.; Serdega, B. K.

    2016-04-01

    The surface plasmon resonance effects in porous gold (por-Au) films—nanocomposite porous films containing an ensemble of disordered gold nanoparticles—have been investigated by modulation-polarization spectroscopy. Por-Au films have been obtained by pulsed laser deposition (using a direct particle flow from an erosion torch formed by a YAG:Nd3+ laser in argon). The spectral and angular dependences of the polarization difference ρ(λ, θ) of internal-reflection coefficients of s- and p-polarized radiation in the Kretschmann geometry and the spectral dependences of isotropic reflection angles at ρ(θ) = 0 are measured. Two types of surface plasmon resonance are found: one occurs on isolated nanoparticles (dipole and multipole modes), and the other is due to the dipole-dipole interaction of neighboring nanoparticles. The frequency of electron plasma oscillations for the nanoparticle ensemble and the frequencies and decay parameters of resonances are determined. Dispersion relations for the radiative and nonradiative modes are presented. The negative sign of the dispersion branch of nonradiative modes of dipole-dipole interaction is explained by the spatial dispersion of permittivity. The relationships between the formation conditions of the films, their structure, and established resonance parameters (determining the resonant-optical properties of films) are discussed.

  8. Stability of gold bead tissue markers.

    PubMed

    Miller, Joel M; Rossi, Ethan A; Wiesmair, Martin; Alexander, Danielle E; Gallo, Orazio

    2006-04-27

    Significant soft tissue features in the orbit and elsewhere are not resolved by MRI or any other imaging method. We describe a new method that uses tiny ( approximately 0.1 mm diameter) gold beads as markers to visualize movements of such tissues with high spatial resolution ( approximately 100 microm) and moderate temporal resolution ( approximately 100 ms). We describe bead fabrication, implantation, imaging, and image processing to extract three-dimensional bead coordinates. We then present results of an experiment to determine the stability of gold bead tissue markers (GBTMs) over time in normally moving orbital tissues. Most beads (76%) implanted in sclera, muscle, tendon, and connective tissue were highly stable over the 6-month measurement period. Beads that were judged unstable drifted only a few 100 microm. Bead flows with gaze suggested that posterior Tenon's capsule moves with the globe, that the lateral rectus belly may sideslip, producing "bridle forces," and that the posterior medial rectus pulley sling moves freely anteriorly and posteriorly, but hardly vertically, as required by the "coordinated active pulley" hypothesis. The GBTM method seems applicable to study such short time course phenomena as extraocular muscle (EOM) and connective tissue movement as a function of gaze and such long time course phenomena as myopic eye growth.

  9. Facile gold nanorod purification by fractionated precipitation

    NASA Astrophysics Data System (ADS)

    Thai, T.; Zheng, Y.; Ng, S. H.; Ohshima, H.; Altissimo, M.; Bach, U.

    2014-05-01

    An efficient and facile size- and shape-selective separation of gold nanorod (GNR) solutions is developed using a fractionated precipitation strategy. This convenient method has the benefit of eliminating nanoparticulate side products that can substantially deteriorate the quality of self-assembled nanostructures. The fabrication of advanced plasmonic metamaterials crucially depends on the capacity to supply feedstocks of high-purity building blocks.An efficient and facile size- and shape-selective separation of gold nanorod (GNR) solutions is developed using a fractionated precipitation strategy. This convenient method has the benefit of eliminating nanoparticulate side products that can substantially deteriorate the quality of self-assembled nanostructures. The fabrication of advanced plasmonic metamaterials crucially depends on the capacity to supply feedstocks of high-purity building blocks. Electronic supplementary information (ESI) available: Materials and chemicals, methods and Fig. S1-S8 including AFM cross-section analysis, UV-Vis studies and additional SEM images. See DOI: 10.1039/c4nr01592d

  10. Scattering Spectra of Single Gold Nanoshells

    NASA Astrophysics Data System (ADS)

    Hafner, Jason H.; Nehl, Colleen L.; Goodrich, Glenn P.; Tam, Felicia; Halas, Naomi J.

    2004-03-01

    Gold nanoshells are metal coated silica nanoparticles whose plasmon resonances vary from the visible to IR depending on their core to shell thickness ratio. Monodisperse nanoshell solutions can be synthesized such that their absorbance spectra match the calculated extinction spectra for the corresponding nanoshell structure. Using transmitted light dark field illumination and high numerical aperture optics, we have studied the scattering spectra of single gold nanoshells supported on ITO substrates in an optically homogeneous medium. With the aid of alignment marks, the same nanoshell can then be structurally characterized by electron microscopy. We have used this system to investigate the lineshape of single nanoshell scattering spectra to further elucidate the relative contributions of retardation, electron-interface scattering, and structural inhomogeneity. [1] Single particle measurements also facilitate the observation subtle interparticle and particle-substrate hybridization effects. [2] [1] S. L. Westcott, J. B. Jackson, C. Radloff, N. J. Halas, Phys. Rev. B 66, 155431 (2002). [2] E. Prodan, C. Radloff, N. J. Halas, P. Nordlander, Science 302, 419-422 (2003).

  11. Gold nanoparticles: Opportunities and Challenges in Nanomedicine

    PubMed Central

    Arvizo, Rochelle; Bhattacharya, Resham; Mukherjee, Priyabrata

    2010-01-01

    Importance of the field Site-specific drug delivery is an important area of research that is anticipated to increase the efficacy of the drug and reduce potential side effects. Due to this, substantial work has been done developing non-invasive and targeted tumor treatment with nano-scale metallic particles. Areas covered in this review This review focuses on the work done in the last several years developing gold nanoparticles as cancer therapeutics and diagnostic agents. However, there are challenges in using gold nanoparticles as drug delivery systems such as biodistribution, pharmacokinetics, and possible toxicity. Approaches to limit these issues are proposed. What the reader will gain Different approaches from several different disciplines are discussed. Potential clinical applications of these engineered nanoparticles is also presented. Take home message Because of their unique size-dependent physico-chemical and optical properties, adaptability, sub-cellular size, and bio-compatibility, these nanosized carriers offer an apt means of transporting small molecules as well as biomacromoleculs to diseased cells/ tissues. PMID:20408736

  12. Grafting single molecule magnets on gold nanoparticles.

    PubMed

    Perfetti, Mauro; Pineider, Francesco; Poggini, Lorenzo; Otero, Edwige; Mannini, Matteo; Sorace, Lorenzo; Sangregorio, Claudio; Cornia, Andrea; Sessoli, Roberta

    2014-01-29

    The chemical synthesis and characterization of the first hybrid material composed by gold nanoparticles and single molecule magnets (SMMs) are described. Gold nanoparticles are functionalized via ligand exchange using a tetrairon(III) SMM containing two 1,2-dithiolane end groups. The grafting is evidenced by the shift of the plasmon resonance peak recorded with a UV-vis spectrometer, by the suppression of nuclear magnetic resonance signals, by X-ray photoemission spectroscopy peaks, and by transmission electron microscopy images. The latter evidence the formation of aggregates of nanoparticles as a consequence of the cross-linking ability of Fe4 through the two 1,2-dithiolane rings located on opposite sides of the metal core. The presence of intact Fe4 molecules is directly proven by synchrotron-based X-ray absorption spectroscopy and X-ray magnetic circular dichroism spectroscopy, while a detailed magnetic characterization, obtained using electron paramagnetic resonance and alternating-current susceptibility, confirms the persistence of SMM behavior in this new hybrid nanostructure.

  13. Radiotracer investigation in gold leaching tanks.

    PubMed

    Dagadu, C P K; Akaho, E H K; Danso, K A; Stegowski, Z; Furman, L

    2012-01-01

    Measurement and analysis of residence time distribution (RTD) is a classical method to investigate performance of chemical reactors. In the present investigation, the radioactive tracer technique was used to measure the RTD of aqueous phase in a series of gold leaching tanks at the Damang gold processing plant in Ghana. The objective of the investigation was to measure the effective volume of each tank and validate the design data after recent process intensification or revamping of the plant. I-131 was used as a radioactive tracer and was instantaneously injected into the feed stream of the first tank and monitored at the outlet of different tanks. Both sampling and online measurement methods were used to monitor the tracer concentration. The results of measurements indicated that both the methods provided identical RTD curves. The mean residence time (MRT) and effective volume of each tank was estimated. The tanks-in-series model with exchange between active and stagnant volume was used and found suitable to describe the flow structure of aqueous phase in the tanks. The estimated effective volume of the tanks and high degree of mixing in tanks could validate the design data and confirmed the expectation of the plant engineer after intensification of the process.

  14. Synthesis of gold nanostructures using fruit extract of Garcinia Indica

    NASA Astrophysics Data System (ADS)

    Krishnaprabha, M.; Pattabi, Manjunatha

    2016-05-01

    Gold nanoparticles having different shapes are synthesized using extract of fresh fruit rinds of Garcinia Indica. The onset of growth and formation of gold nanostructures is confirmed from UV-Vis spectroscopy. Morphological studies are done using FESEM. Size dependent catalytic activity is evaluated with the model reduction reaction of 4-nitrophenol to 4-aminophenol.

  15. Why Gold and Copper Are Colored but Silver Is Not.

    ERIC Educational Resources Information Center

    Guerrero, Ariel H.; Fasoli, Hector J.; Costa, Jose Luis

    1999-01-01

    Explains why silver, which has the same external electronic configuration as copper and gold, does not appear yellow: white light reflects on most metals without color absorption or change to the naked eye; however, copper and gold appear yellow because they absorb "blue" and "red" photons during electron transitions between…

  16. Undergraduate Laboratory Experiment Modules for Probing Gold Nanoparticle Interfacial Phenomena

    ERIC Educational Resources Information Center

    Karunanayake, Akila G.; Gunatilake, Sameera R.; Ameer, Fathima S.; Gadogbe, Manuel; Smith, Laura; Mlsna, Deb; Zhang, Dongmao

    2015-01-01

    Three gold-nanoparticle (AuNP) undergraduate experiment modules that are focused on nanoparticles interfacial phenomena have been developed. Modules 1 and 2 explore the synthesis and characterization of AuNPs of different sizes but with the same total gold mass. These experiments enable students to determine how particle size affects the AuNP…

  17. Polymer and biopolymer mediated self-assembly of gold nanoparticles.

    PubMed

    Ofir, Yuval; Samanta, Bappaditya; Rotello, Vincent M

    2008-09-01

    Gold nanoparticle-polymer composites are versatile and diverse functional materials, with applications in optical, electronic and sensing devices. This tutorial review focuses on the use of polymers to control the assembly of gold nanoparticles. Examples of synthetic polymers and biopolymers are provided, as well as applications of the composite materials in sensing and memory devices.

  18. Gold-silica quantum rattles for multimodal imaging and therapy.

    PubMed

    Hembury, Mathew; Chiappini, Ciro; Bertazzo, Sergio; Kalber, Tammy L; Drisko, Glenna L; Ogunlade, Olumide; Walker-Samuel, Simon; Krishna, Katla Sai; Jumeaux, Coline; Beard, Paul; Kumar, Challa S S R; Porter, Alexandra E; Lythgoe, Mark F; Boissière, Cédric; Sanchez, Clément; Stevens, Molly M

    2015-02-17

    Gold quantum dots exhibit distinctive optical and magnetic behaviors compared with larger gold nanoparticles. However, their unfavorable interaction with living systems and lack of stability in aqueous solvents has so far prevented their adoption in biology and medicine. Here, a simple synthetic pathway integrates gold quantum dots within a mesoporous silica shell, alongside larger gold nanoparticles within the shell's central cavity. This "quantum rattle" structure is stable in aqueous solutions, does not elicit cell toxicity, preserves the attractive near-infrared photonics and paramagnetism of gold quantum dots, and enhances the drug-carrier performance of the silica shell. In vivo, the quantum rattles reduced tumor burden in a single course of photothermal therapy while coupling three complementary imaging modalities: near-infrared fluorescence, photoacoustic, and magnetic resonance imaging. The incorporation of gold within the quantum rattles significantly enhanced the drug-carrier performance of the silica shell. This innovative material design based on the mutually beneficial interaction of gold and silica introduces the use of gold quantum dots for imaging and therapeutic applications.

  19. Intriguing mechanistic labyrinths in gold(i) catalysis

    PubMed Central

    Obradors, Carla

    2014-01-01

    Many mechanistically intriguing reactions have been developed in the last decade using gold(i) as catalyst. Here we review the main mechanistic proposals in gold-catalysed activation of alkynes and allenes, in which this metal plays a central role by stabilising a variety of complex cationic intermediates. PMID:24176910

  20. The Late Start and Amazing Upswing in Gold Chemistry

    ERIC Educational Resources Information Center

    Raubenheimer, Helgard G.; Schmidbaur, Hubert

    2014-01-01

    Probably owing to the prejudice that gold is a metal too noble to be used much in chemistry, the chemistry of this element has developed much later than that of its congeners and neighbors in the periodic table. In fact, before and after the time of alchemists, and up to the 20th century, all chemistry of gold was mainly performed in attempts to…