Extended spectrum β-lactamases, carbapenemases and mobile genetic elements responsible for antibiotics resistance in Gram-negative bacteria.

PubMed

El Salabi, Allaaeddin; Walsh, Timothey R; Chouchani, Chedly

2013-05-01

Infectious diseases due to Gram-negative bacteria are a leading cause of morbidity and mortality worldwide. Antimicrobial agents represent one major therapeutic tools implicated to treat these infections. The misuse of antimicrobial agents has resulted in the emergence of resistant strains of Gram-negatives in particular Enterobacteriaceae and non-fermenters; they have an effect not only on a human but on the public health when bacteria use the resistance mechanisms to spread in the hospital environment and to the community outside the hospitals by means of mobile genetic elements. Gram-negative bacteria have become increasingly resistant to antimicrobial agents. They have developed several mechanisms by which they can withstand to antimicrobials, these mechanisms include the production of Extended-spectrum β-lactamases (ESBLs) and carbapenemases, furthermore, Gram-negative bacteria are now capable of spreading such resistance between members of the family Enterobacteriaceae and non-fermenters using mobile genetic elements as vehicles for such resistance mechanisms rendering antibiotics useless. Therefore, addressing the issue of mechanisms of antimicrobial resistance is considered one of most urgent priorities. This review will help to illustrate different resistance mechanisms; ESBLs, carbapenemases encoded by genes carried by mobile genetic elements, which are used by Gram-negative bacteria to escape antimicrobial effect.

Gram-negative, but not Gram-positive, bacteria elicit strong PGE2 production in human monocytes.

PubMed

Hessle, Christina C; Andersson, Bengt; Wold, Agnes E

2003-12-01

Gram-positive and Gram-negative bacteria induce different cytokine patterns in human mononuclear cells. We have seen that Gram-positives preferentially induce IL-12 and TNF-alpha, whereas Gram-negatives induce more IL-10, IL-6, and IL-8. In this study, we compared the capacity of these two groups of bacteria to induce PGE2. Monocytes stimulated with Gram-negative bacterial species induced much more PGE2 than did Gram-positive bacteria (5600 +/- 330 vs. 1700 +/- 670 pg/mL, p < 0.001). Blocking of COX-2 by NS398 abolished PGE2 production, but did not alter the cytokine patterns induced by Gram-positive and Gram-negative bacteria. We suggest that Gram-positive and Gram-negative bacteria may stimulate different innate effector functions; Gram-positive bacteria promoting cell-mediated effector functions whereas Gram-negative bacteria inducing mediators inhibiting the same.

In vitro growth inhibition of mastitis causing bacteria by phenolics and metal chelators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chew, B.P.; Tjoelker, L.W.; Tanaka, T.S.

1985-11-01

Antimicrobial activities of three phenolic compounds and four metal chelators were tested at 0, 250, 500, and 1000 ppm in vitro against four major mastitis-causing bacteria, Streptococcus agalactiae, Staphylococcus aureus, Klebsiella pnuemoniae, and Escherichia coli. Overall, butylated hydroxyanisole and tert-butylhydroquinone showed the greatest antimicrobial activity. These phenolics were bactericidal at 250 to 500 ppm against all four bacteria tested. The butylated hydroxytoluene was bactericidal against the gram-positive bacteria but was ineffective against the coliforms. At 250 ppm, disodium ethylenediaminetetraacetic acid was bactericidal against the gram-positive bacteria but much less effective against the gram-negatives. However, diethylene-triaminepentaacetic acid was more growth inhibitorymore » than ethylenediaminetetraacetic acid against the gram-negative bacteria and especially against Escherichia coli. All other compounds were generally much less effective or ineffective against all four microorganisms. Therefore, butylated hydroxyanisole, butylated hydroxytoluene, tert-butylhydroquinone, ethylenediaminetetraacetic acid, and diethylenetriaminepentaacetic acid may have practical implications in the prevention or treatment of bovine mastitis.« less

Management of post-neurosurgical meningitis: narrative review.

PubMed

Hussein, K; Bitterman, R; Shofty, B; Paul, M; Neuberger, A

2017-09-01

Infections complicating neurosurgery pose unacceptable mortality and morbidity. To summarize what is known about the epidemiology, diagnosis and treatment of post-neurosurgical meningitis (PNM). PubMed, references of identified studies and reviews, and personal experience when evidence was lacking. The incidence and pathogen distribution of PNM is highly variable. A shift towards Gram-negative bacteria has been observed with use of antibiotic prophylaxis and antibiotic-coated devices directed mainly against Gram-positive bacteria. However, knowledge of the local epidemiology is necessary to treat PNM. The diagnosis of PNM is difficult because, unlike community-acquired meningitis, symptoms are less specific; patients are ill at baseline and many neurosurgical conditions mimic meningitis and cause cerebrospinal fluid (CSF) abnormalities. Pivotal CSF findings for diagnosis of PNM are the CSF glucose, CSF lactate and Gram stain. CSF leucocyte counts are not specific in PNM. Current diagnostic capabilities leave a non-negligible category of patients with microbiologically negative, uncertain diagnosis of PNM. There is no high-quality evidence on several cardinal issues in PNM management, including the effectiveness of intraventricular or intrathecal (IV/IT) antibiotics, effectiveness of dual antibiotic therapy for multidrug-resistant Gram-negative bacteria; clinical benefit of routine therapeutic drug monitoring; and safest timing of shunt replacement. Some data point to a potential benefit of IV/IT antibiotic treatment, mainly for PNM caused by carbapenem-resistant Gram-negative bacteria. Carbapenem-colistin combination therapy is suggested for PNM caused by carbapenem-resistant Gram-negative bacteria with a carbapenem MIC ≤8 mg/L. Guiding the optimal management of PNM will necessitate collaborative multicentre efforts and unique study designs. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

A Product of Heme Catabolism Modulates Bacterial Function and Survival

PubMed Central

Nobles, Christopher L.; Green, Sabrina I.; Maresso, Anthony W.

2013-01-01

Bilirubin is the terminal metabolite in heme catabolism in mammals. After deposition into bile, bilirubin is released in large quantities into the mammalian gastrointestinal (GI) tract. We hypothesized that intestinal bilirubin may modulate the function of enteric bacteria. To test this hypothesis, we investigated the effect of bilirubin on two enteric pathogens; enterohemorrhagic E. coli (EHEC), a Gram-negative that causes life-threatening intestinal infections, and E. faecalis, a Gram-positive human commensal bacterium known to be an opportunistic pathogen with broad-spectrum antibiotic resistance. We demonstrate that bilirubin can protect EHEC from exogenous and host-generated reactive oxygen species (ROS) through the absorption of free radicals. In contrast, E. faecalis was highly susceptible to bilirubin, which causes significant membrane disruption and uncoupling of respiratory metabolism in this bacterium. Interestingly, similar results were observed for other Gram-positive bacteria, including B. cereus and S. aureus. A model is proposed whereby bilirubin places distinct selective pressure on enteric bacteria, with Gram-negative bacteria being protected from ROS (positive outcome) and Gram-positive bacteria being susceptible to membrane disruption (negative outcome). This work suggests bilirubin has differential but biologically relevant effects on bacteria and justifies additional efforts to determine the role of this neglected waste catabolite in disease processes, including animal models. PMID:23935485

Permeability barrier of Gram-negative cell envelopes and approaches to bypass it

DOE PAGES

Zgurskaya, Helen I.; López, Cesar A.; Gnanakaran, Sandrasegaram

2015-09-18

Gram-negative bacteria are intrinsically resistant to many antibiotics. Species that have acquired multidrug resistance and cause infections that are effectively untreatable present a serious threat to public health. The problem is broadly recognized and tackled at both the fundamental and applied levels. This article summarizes current advances in understanding the molecular bases of the low permeability barrier of Gram-negative pathogens, which is the major obstacle in discovery and development of antibiotics effective against such pathogens. Gaps in knowledge and specific strategies to break this barrier and to achieve potent activities against difficult Gram-negative bacteria are also discussed.

Permeability barrier of Gram-negative cell envelopes and approaches to bypass it

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zgurskaya, Helen I.; López, Cesar A.; Gnanakaran, Sandrasegaram

Gram-negative bacteria are intrinsically resistant to many antibiotics. Species that have acquired multidrug resistance and cause infections that are effectively untreatable present a serious threat to public health. The problem is broadly recognized and tackled at both the fundamental and applied levels. This article summarizes current advances in understanding the molecular bases of the low permeability barrier of Gram-negative pathogens, which is the major obstacle in discovery and development of antibiotics effective against such pathogens. Gaps in knowledge and specific strategies to break this barrier and to achieve potent activities against difficult Gram-negative bacteria are also discussed.

Catechol-Functional Chitosan/Silver Nanoparticle Composite as a Highly Effective Antibacterial Agent with Species-Specific Mechanisms.

PubMed

Huang, Xiaofei; Bao, Xiaojiong; Liu, Yalan; Wang, Zhengke; Hu, Qiaoling

2017-05-12

In this study, silver nanoparticles (Ag NPs) coated with catechol-conjugated chitosan (CSS) were prepared using green methods. Interestingly, we uncovered that CSS-coated Ag NPs (CSS-Ag NPs) exhibited a higher toxicity against gram-negative Escherichia coli (E. coli) bacteria than against gram-positive Staphylococcus aureus (S. aureus) bacteria. The differences revealed that the CSS-Ag NPs killed gram bacteria with distinct, species-specific mechanisms. The aim of this study is to further investigate these underlying mechanisms through a series of analyses. The ultrastructure and morphology of the bacteria before and after treatment with CSS-Ag NPs were observed. The results demonstrated the CSS-Ag NPs killed gram-positive bacteria through a disorganization of the cell wall and leakage of cytoplasmic content. In contrast, the primary mechanism of action on gram-negative bacteria was a change in membrane permeability, induced by adsorption of CSS-Ag NPs. The species-specific mechanisms are caused by structural differences in the cell walls of gram bacteria. Gram-positive bacteria are protected from CSS-Ag NPs by a thicker cell wall, while gram-negatives are more easily killed due to an interaction between a special outer membrane and the nanoparticles. Our study offers an in-depth understanding of the antibacterial behaviors of CSS-Ag NPs and provides insights into ultimately optimizing the design of Ag NPs for treatment of bacterial infections.

Burn-associated bloodstream infections in pediatric burn patients: Time distribution of etiologic agents.

PubMed

Devrim, İlker; Kara, Ahu; Düzgöl, Mine; Karkıner, Aytaç; Bayram, Nuri; Temir, Günyüz; Şencan, Arzu; Sorguç, Yelda; Gülfidan, Gamze; Hoşgör, Münevver

2017-02-01

Infections are the leading cause of morbidity and mortality in patients with burns in burn units. Bloodstream infections (BSIs) in patients with burns may result from burn wound infection, use of invasive devices such as central venous catheters, and translocation of the gastrointestinal flora. In this study, we investigated the distribution and antimicrobial drug resistance of causative pathogens in children with burns and the durational changes of microorganisms in the distribution of BSIs in children. This study was conducted at the Pediatric Burn Unit (PBU) of Dr. Behçet Uz Children Research and Training Hospital during the period of November 2008-April 2015. The study subjects were all the patients admitted to the PBU, in whom microorganisms were isolated at least from one of the cultures, including blood and catheter cultures. Gram-positive bacteria were the most common causative agents of BSI in patients with burns (66.4%), followed by gram-negative bacteria (22.1%) and fungi (11.5%). The median duration of development of BSIs caused by gram-positive bacteria from the time of burn was 5 days (ranging from 2 to 54 days of burn), which was significantly shorter than that of BSIs caused by gram-negative bacteria (12 days) and fungal pathogens (13 days). The etiologic agents of BSIs in children may differ from those in adults. Gram-negative drug-resistant bacteria such as multidrug-resistant Pseudomonas aeruginosa and Acinetobacter baumannii were important agents of BSI in patients with burns, especially in the long term; however, gram-positive bacteria should also be considered while deciding the antimicrobial therapy, especially in the early periods of burn. Copyright © 2016 Elsevier Ltd and ISBI. All rights reserved.

Gram-negative diabetic foot osteomyelitis: risk factors and clinical presentation.

PubMed

Aragón-Sánchez, Javier; Lipsky, Benjamin A; Lázaro-Martínez, Jose L

2013-03-01

Osteomyelitis frequently complicates infections in the feet of patients with diabetes. Gram-positive cocci, especially Staphylococcus aureus, are the most commonly isolated pathogens, but gram-negative bacteria also cause some cases of diabetic foot osteomyelitis (DFO). These gram-negatives require different antibiotic regimens than those commonly directed at gram-positives. There are, however, few data on factors related to their presence and how they influence the clinical picture. We conducted a retrospective study to determine the variables associated with the isolation of gram-negative bacteria from bone samples in cases of DFO and the clinical presentation of these infections. Among 341 cases of DFO, 150 had a gram-negative isolate (alone or combined with a gram-positive isolate) comprising 44.0% of all patients and 50.8% of those with a positive bone culture. Compared with gram-positive infections, wounds with gram-negative organisms more often had a fetid odor, necrotic tissue, signs of soft tissue infection accompanying osteomyelitis, and clinically severe infection. By multivariate analysis, the predictive variables related to an increased likelihood of isolating gram-negatives from bone samples were glycated hemoglobin <7% (odds ratio [OR] = 2.0, 95% confidence interval [CI] = 1.1-3.5) and a wound caused by traumatic injury (OR = 2.0, 95% CI = 1.0-3.9). Overall, patients whose bone samples contained gram-negatives had a statistically significantly higher prevalence of leukocytosis and higher white blood cell counts than those without gram-negatives. In conclusion, gram-negative organisms were isolated in nearly half of our cases of DFO and were associated with more severe infections, higher white blood cell counts, lower glycated hemoglobin levels, and wounds of traumatic etiology.

Innate immune system capabilities of the Asian citrus psyllid, Diaphorina citri.

PubMed

Arp, Alex P; Martini, Xavier; Pelz-Stelinski, Kirsten S

2017-09-01

Citrus production worldwide is currently threatened by Huanglongbing, or citrus greening disease. The associated pathogen, Candidatus Liberibacter asiaticus (CLas), is transmitted by the Asian citrus psyllid, Diaphorina citri. Annotation of the D. citri genome revealed a reduced innate immune system lacking a number of antimicrobial peptides and the Imd pathway associated with defense against Gram-negative bacteria. We characterized this apparent immune reduction in survival assays in which D. citri were exposed to Gram-negative or Gram-positive bacteria. D. citri experienced significant mortality when exposed to Serratia marcescens (Gram-negative) through oral ingestion or by septic injury. Escherichia coli (Gram-negative) also caused significant D. citri mortality, but only when inoculated at high concentrations through oral ingestion or by septic injury. Neither Micrococcus luteus (Gram-positive) or Bacillus subtilis (Gram-positive) caused significant mortality as compared to controls in any experiment. E. coli titers increased rapidly following exposure, while M. luteus titer remained stable for 72 h. We demonstrate that D. citri is capable of defending against E. coli, a Gram-negative bacterium, despite lacking the Imd defense pathway. The tolerance of D. citri to M. luteus infection, yet inability to effectively clear infections, presents questions to efficacy of D. citri immune response to effectively clear Gram-positive infections. Copyright © 2017. Published by Elsevier Inc.

Antibiotic resistance: What is so special about multidrug-resistant Gram-negative bacteria?

PubMed Central

Exner, Martin; Bhattacharya, Sanjay; Christiansen, Bärbel; Gebel, Jürgen; Goroncy-Bermes, Peter; Hartemann, Philippe; Heeg, Peter; Ilschner, Carola; Kramer, Axel; Larson, Elaine; Merkens, Wolfgang; Mielke, Martin; Oltmanns, Peter; Ross, Birgit; Rotter, Manfred; Schmithausen, Ricarda Maria; Sonntag, Hans-Günther; Trautmann, Matthias

2017-01-01

In the past years infections caused by multidrug-resistant Gram-negative bacteria have dramatically increased in all parts of the world. This consensus paper is based on presentations, subsequent discussions and an appraisal of current literature by a panel of international experts invited by the Rudolf Schülke Stiftung, Hamburg. It deals with the epidemiology and the inherent properties of Gram-negative bacteria, elucidating the patterns of the spread of antibiotic resistance, highlighting reservoirs as well as transmission pathways and risk factors for infection, mortality, treatment and prevention options as well as the consequences of their prevalence in livestock. Following a global, One Health approach and based on the evaluation of the existing knowledge about these pathogens, this paper gives recommendations for prevention and infection control measures as well as proposals for various target groups to tackle the threats posed by Gram-negative bacteria and prevent the spread and emergence of new antibiotic resistances. PMID:28451516

Micro-Raman spectroscopy for identification and classification of UTI bacteria

NASA Astrophysics Data System (ADS)

Yogesha, M.; Chawla, Kiran; Acharya, Mahendra; Chidangil, Santhosh; Bankapur, Aseefhali

2017-07-01

Urinary tract infection (UTI) is one of the major clinical problems known to mankind, especially among adult women. Conventional methods for identification of UTI causing bacteria are time consuming and expensive. Therefore, a rapid and cost-effective method is desired. In the present study, five bacteria (one Gram-positive and four Gram-negative), most commonly known to cause UTI, have been identified and classified using micro-Raman spectroscopy combined with principal component analysis (PCA).

Multidrug resistance in enteric and other gram-negative bacteria.

PubMed

George, A M

1996-05-15

In Gram-negative bacteria, multidrug resistance is a term that is used to describe mechanisms of resistance by chromosomal genes that are activated by induction or mutation caused by the stress of exposure to antibiotics in natural and clinical environments. Unlike plasmid-borne resistance genes, there is no alteration or degradation of drugs or need for genetic transfer. Exposure to a single drug leads to cross-resistance to many other structurally and functionally unrelated drugs. The only mechanism identified for multidrug resistance in bacteria is drug efflux by membrane transporters, even though many of these transporters remain to be identified. The enteric bacteria exhibit mostly complex multidrug resistance systems which are often regulated by operons or regulons. The purpose of this review is to survey molecular mechanisms of multidrug resistance in enteric and other Gram-negative bacteria, and to speculate on the origins and natural physiological functions of the genes involved.

Phthalocyanine-sulfonamide conjugates: Synthesis and photodynamic inactivation of Gram-negative and Gram-positive bacteria.

PubMed

da Silva, Raquel Nunes; Cunha, Ângela; Tomé, Augusto C

2018-06-25

Phthalocyanines bearing four or eight sulfonamide units were synthesized and their efficiency in the photodynamic inactivation of Gram-negative (Escherichia coli) and Gram-positive (Staphylococcus aureus) bacteria was evaluated. Conjugates with simpler sulfonamide units (N,N-diethylbenzenesulfonamide, N-isopropylbenzenesulfonamide and N-(4-methoxyphenyl)benzenesulfonamide) caused stronger inactivation than those with heterocyclic groups (N-(thiazol-2-yl)benzenesulfonamide) or long alkyl chains (N-dodecylbenzenesulfonamide) in both bacteria. Furthermore, the encapsulation of the phthalocyanine-sulfonamide conjugates within polyvinylpyrrolidone micelles, used as drug delivery vehicles, in general showed to enhance the inactivation efficiency. The results show that encapsulated phthalocyanine-sulfonamide conjugates are a promising class of photosensitizers to be used in photodynamic antimicrobial therapy. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Treatment of Gram-negative bacterial infections by potentiation of antibiotics.

PubMed

Zabawa, Thomas P; Pucci, Michael J; Parr, Thomas R; Lister, Troy

2016-10-01

Infections caused by antibiotic-resistant pathogens, particularly Gram-negative bacteria, represent significant treatment challenges for physicians resulting in high rates of morbidity and mortality. The outer membrane of Gram-negative bacteria acts as a permeability barrier to many compounds that would otherwise be effective antibacterial agents, including those effective against Gram-positive pathogens. Potentiator molecules disrupt this barrier allowing entry of otherwise impermeant molecules, thus providing a strategy to render multi-drug resistant pathogens susceptible to a broader range of antibiotics. Potentiator molecules are cationic and the mechanism of disruption involves interaction with the negatively charged outer membrane. This physical attribute, along with an often high degree of lipophilicity typically endears these molecules with unacceptable toxicity. Presented herein are examples of advanced potentiator molecules being evaluated for use in combination therapy for the treatment of resistant Gram-negative infections. Copyright © 2016 Elsevier Ltd. All rights reserved.

Intrinsic, adaptive and acquired antimicrobial resistance in Gram-negative bacteria.

PubMed

Arzanlou, Mohsen; Chai, Wern Chern; Venter, Henrietta

2017-02-28

Gram-negative bacteria are responsible for a large proportion of antimicrobial-resistant infections in humans and animals. Among this class of bacteria are also some of the most successful environmental organisms. Part of this success is their adaptability to a variety of different niches, their intrinsic resistance to antimicrobial drugs and their ability to rapidly acquire resistance mechanisms. These mechanisms of resistance are not exclusive and the interplay of several mechanisms causes high levels of resistance. In this review, we explore the molecular mechanisms underlying resistance in Gram-negative organisms and how these different mechanisms enable them to survive many different stress conditions. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Associations Between Enteral Colonization With Gram-Negative Bacteria and Intensive Care Unit-Acquired Infections and Colonization of the Respiratory Tract.

PubMed

Frencken, Jos F; Wittekamp, Bastiaan H J; Plantinga, Nienke L; Spitoni, Cristian; van de Groep, Kirsten; Cremer, Olaf L; Bonten, Marc J M

2018-02-01

Enteral and respiratory tract colonization with gram-negative bacteria may lead to subsequent infections in critically ill patients. We aimed to clarify the interdependence between gut and respiratory tract colonization and their associations with intensive care unit (ICU)-acquired infections in patients receiving selective digestive tract decontamination (SDD). Colonization status of the rectum and respiratory tract was determined using twice-weekly microbiological surveillance in mechanically ventilated subjects receiving SDD between May 2011 and June 2015 in a tertiary medical-surgical ICU in the Netherlands. Acquisition of infections was monitored daily by dedicated observers. Marginal structural models were used to determine the associations between gram-negative rectal colonization and respiratory tract colonization, ICU-acquired gram-negative infection, and ICU-acquired gram-negative bacteremia. Among 2066 ICU admissions, 1157 (56.0%) ever had documented gram-negative carriage in the rectum during ICU stay. Cumulative incidences of ICU-acquired gram-negative infection and bacteremia were 6.0% (n = 124) and 2.1% (n = 44), respectively. Rectal colonization was an independent risk factor for both respiratory tract colonization (cause-specific hazard ratio [CSHR], 2.93 [95% confidence interval {CI}, 2.02-4.23]) and new gram-negative infection in the ICU (CSHR, 3.04 [95% CI, 1.99-4.65]). Both rectal and respiratory tract colonization were associated with bacteremia (CSHR, 7.37 [95% CI, 3.25-16.68] and 2.56 [95% CI, 1.09-6.03], respectively). Similar associations were observed when Enterobacteriaceae and glucose nonfermenting gram-negative bacteria were analyzed separately. Gram-negative rectal colonization tends to be stronger associated with subsequent ICU-acquired gram-negative infections than gram-negative respiratory tract colonization. Gram-negative rectal colonization seems hardly associated with subsequent ICU-acquired gram-negative respiratory tract colonization. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Chemical Composition and Antibacterial Activity of Essential Oil of Cosmos bipinnatus Cav. Leaves from South Africa

PubMed Central

Olajuyigbe, Olufunmiso; Ashafa, Anofi

2014-01-01

The chemical composition of essential oils isolated from the leaves of Cosmos bipinnatus and its antibacterial activity were analyzed by GC-MS and microbroth dilution assay respectively. The essential oil extracted from this plant was predominantly composed of monoterpenes (69.62%) and sesquiterpenes (22.73%). The antibacterial assay showed that the oil had significant inhibitory effects against both Gram-negative and Gram-positive bacteria isolates. The MIC of Gram-positive strains ranged between 0.16 and 0.31 mg/mL while those of Gram-negative bacteria ranged between 0.31 and 0.63 mg/mL. The Gram-positive bacteria were more susceptible to the essential oil than the Gram-negative bacteria. Most of the major components of this oil in other plants have been reported for antimicrobial activities. The antibacterial activity can be attributed to effects of the combination of several components of the oil. The results indicate that the C. bipinnatus might be exploited as natural antibacterial agent and have application in the treatment of several infectious diseases caused by these bacteria. Since this species is endemic to the eastern Free State, the plant could be collected during its bloom and used efficiently in the management of bacterial infections in South Africa. PMID:25587332

Chemical Composition and Antibacterial Activity of Essential Oil of Cosmos bipinnatus Cav. Leaves from South Africa.

PubMed

Olajuyigbe, Olufunmiso; Ashafa, Anofi

2014-01-01

The chemical composition of essential oils isolated from the leaves of Cosmos bipinnatus and its antibacterial activity were analyzed by GC-MS and microbroth dilution assay respectively. The essential oil extracted from this plant was predominantly composed of monoterpenes (69.62%) and sesquiterpenes (22.73%). The antibacterial assay showed that the oil had significant inhibitory effects against both Gram-negative and Gram-positive bacteria isolates. The MIC of Gram-positive strains ranged between 0.16 and 0.31 mg/mL while those of Gram-negative bacteria ranged between 0.31 and 0.63 mg/mL. The Gram-positive bacteria were more susceptible to the essential oil than the Gram-negative bacteria. Most of the major components of this oil in other plants have been reported for antimicrobial activities. The antibacterial activity can be attributed to effects of the combination of several components of the oil. The results indicate that the C. bipinnatus might be exploited as natural antibacterial agent and have application in the treatment of several infectious diseases caused by these bacteria. Since this species is endemic to the eastern Free State, the plant could be collected during its bloom and used efficiently in the management of bacterial infections in South Africa.

How bacterial cell division might cheat turgor pressure - a unified mechanism of septal division in Gram-positive and Gram-negative bacteria.

PubMed

Erickson, Harold P

2017-08-01

An important question for bacterial cell division is how the invaginating septum can overcome the turgor force generated by the high osmolarity of the cytoplasm. I suggest that it may not need to. Several studies in Gram-negative bacteria have shown that the periplasm is isoosmolar with the cytoplasm. Indirect evidence suggests that this is also true for Gram-positive bacteria. In this case the invagination of the septum takes place within the uniformly high osmotic pressure environment, and does not have to fight turgor pressure. A related question is how the V-shaped constriction of Gram-negative bacteria relates to the plate-like septum of Gram-positive bacteria. I collected evidence that Gram-negative bacteria have a latent capability of forming plate-like septa, and present a model in which septal division is the basic mechanism in both Gram-positive and Gram-negative bacteria. © 2017 WILEY Periodicals, Inc.

The Growing Threat of Multidrug-Resistant Gram-Negative Infections in Patients with Hematologic Malignancies

PubMed Central

Baker, Thomas M.; Satlin, Michael J.

2016-01-01

Prolonged neutropenia and chemotherapy-induced mucositis render patients with hematologic malignancies highly vulnerable to Gram-negative bacteremia. Unfortunately, multidrug-resistant (MDR) Gram-negative bacteria are increasingly encountered globally, and current guidelines for empirical antibiotic coverage in these patients may not adequately treat these bacteria. This expansion of resistance, coupled with traditional culturing techniques requiring 2-4 days for bacterial identification and antimicrobial susceptibility results, have grave implications for these immunocompromised hosts. This review characterizes the epidemiology, risk factors, resistance mechanisms, recommended treatments, and outcomes of the MDR Gram-negative bacteria that commonly cause infections in patients with hematologic malignancies. We also examine infection prevention strategies in hematology patients, such as infection control practices, antimicrobial stewardship, and targeted decolonization. Finally, we assess strategies to improve outcomes of infected patients, including gastrointestinal screening to guide empirical antibiotic therapy, new rapid diagnostic tools for expeditious identification of MDR pathogens, and use of two new antimicrobial agents, ceftolozane/tazobactam and ceftazidime/avibactam. PMID:27339405

Antibacterial activities of β-glucan (laminaran) against gram-negative and gram-positive bacteria

NASA Astrophysics Data System (ADS)

Chamidah, A.; Hardoko, Prihanto, A. A.

2017-05-01

This study aimed to determine the antibacterial activity of β-Glucan (laminaran) of LAE and LME extracts from brown algae Sargassum crassifolium using HPMS and Ultrasonication against Gram-positive bacteria (Bacillus subtilis and Staphylococcus aureus) and Gram-negative bacteria (Salmonella typhimurium and Escherichia coli). The highest antibacterial activities of LME extract obtained using the HPMS method against Gram-positive bacteria (B. subtilis and S. aureus) were at 18:10 and 18.80 mm. The ultrasonication method showed a lower inhibition trend than the HPMS method, with MIC and MBC values of 250 mg/ml and 2-8 CFU/ml, respectively, in all Gram-negative and Gram-positive bacteria. The results showed that LME extract at a concentration of 250 mg/mL is bacteriostatic against Gram-positive and -negative bacteria.

Validation of the Zürich burn-biofilm model.

PubMed

Guggenheim, Merlin; Thurnheer, Thomas; Gmür, Rudolf; Giovanoli, Pietro; Guggenheim, Bernhard

2011-11-01

Despite advances in the use of topical and parenteral antimicrobial therapy and the practice of early tangential burn-wound excision, bacterial infection remains a major problem in the management of burn victims today. The purpose of this study was to design and evaluate a polyspecies biofilm model with bacteria known to cause severe infections in burn patients. The model is simple to prepare, maintain and analyse, and allows for short-term exposure to antimicrobials. Initial experiments showed that it was impossible to establish balanced polyspecies biofilms with an inoculum of Gram-positive and -negative bacteria. After 64.5 h of incubation, the Gram-negative bacteria (Escherichia coli and Pseudomonas aeruginosa) had suppressed the Gram-positives (Enterococcus faecalis, Staphylococcus aureus and Streptococcus intermedius). However, adding the Gram-negative bacteria after 41.5 h to an established biofilm of Gram-positives resulted in a balanced microbial consortium. After 64.5 h, all species were present in high numbers (10(7) to 10(8) colony forming units (CFU) per biofilm). Multiple repetitions showed high reproducibility of biofilm formation without significant differences between and within experiments. Combined fluorescence in situ hybridisation/confocal laser scanning microscopy (FISH/CLSM) analyses, for which biofilms had to be grown on a different non-flexible substrate (hydroxy apatite), revealed that, by 41.5 h, the biofilm consisted of an almost confluent layer of bacteria firmly adherent to the substratum. After 64.5 h (22 h after the addition of the Gram negatives), the biofilm consisted of a confluent mixture of single cells, an abundance of galaxies of bacteria with small lacunae and large amounts of extracellular matrix polysaccharides. The polyspecies biofilm model contains the most prevalent burn-associated Gram-positive and Gram-negative bacterial pathogens and mimics the Gram-negative shift observed in vivo. It shows excellent reproducibility. It should allow adaptation to the bacterial spectrum prevalent in different burn centres and lead to a much more reliable investigation of the efficiency of topical antimicrobial agents than models operating with planktonic bacteria. The experiments further open up the perspective to create an in vivo model using these biofilms as infectious agents. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

Dynamics of Gram-negative bacteria population density in a soil in the course of the succession initiated by chitin and cellulose

NASA Astrophysics Data System (ADS)

Konstantin, Ivanov; Lubov, Polyanskaya

2014-05-01

The functions of actinomycetes in polymer destruction in soil traditionally considered as the dominant, compare to another groups of bacteria. Gram-positive bacteria also have ecological functions in destruction of soil organic matter. The role of Gram-negative bacteria has been researched in the microbial succession in terms of polymers destruction, which are widely spreads in soils: chitin and cellulose. The method with nalidixic acid as an inhibitor of DNA division of Gram-negative bacteria was modified. By modified method microbial succession of Gram-negative bacteria in the different horizons of a chernozem under aerobic and anaerobic conditions was researched. Chitin and cellulose as the source of nutrients with moistening was used in experiments. The introduction of chitin had no positive effect on the population density of Gram-negative bacteria in a chernozem, but it advanced the date of their appearance in microbial succession: the maximum of Gram-negative bacteria population density was registered on the 3rd- 7th day of the experiment with adding chitin. Compare to the control, which one was without any nutrient adding this dynamics registered much earlier. Consequently, the introduction of chitin as an additional source of nutrition promoted revealing of the Gram-negative bacteria in soil already at the early stages of the succession. In the course of the succession, when the fungal mycelium begins to die off, the actinomycetic mycelium increases in length, i.e., Gram-negative bacteria are replaced at this stage with Gram-positive ones, the leading role among which belongs to actinomycetes. The growth rate of Gram-negative bacteria is higher than that of actinomycetes, so they start chitin utilization at the early stages of the succession, whereas actinomycetes dominate at the late stages. The population density of Gram-negative bacteria was lower under the anaerobic conditions as compared with that in the aerobic ones. The population density of Gram-negative bacteria in the lower layer of the A horizon of the chernozem and in the B horizon was slightly higher only in the case of the chitin introduction. When cellulose was introduced into the soil under aerobic conditions, the population density of Gram-negative bacteria in all the layers of the A horizon of the chernozem was maximal from the 14th to the 22nd day of the experiment. Simultaneously, an increase in the length of the actinomycetal mycelium was observed, as these organisms also perform cellulose hydrolysis in soils. The Gram-negative bacteria began to develop at the stage of the fungal mycelium destruction, which indirectly confirmed the chitinolytic activity of these bacteria.

Evaluation of the antibacterial potential of Petroselinum crispum and Rosmarinus officinalis against bacteria that cause urinary tract infections

PubMed Central

Petrolini, Fernanda Villas Boas; Lucarini, Rodrigo; de Souza, Maria Gorete Mendes; Pires, Regina Helena; Cunha, Wilson Roberto; Martins, Carlos Henrique Gomes

2013-01-01

In this study we evaluated the antibacterial activity of the crude hydroalcoholic extracts, fractions, and compounds of two plant species, namely Rosmarinus officinalis and Petroselinum crispum, against the bacteria that cause urinary tract infection. The microdilution method was used for determination of the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC). The crude hydroalcoholic extract of R. officinalis displayed in vitro activity against Gram-positive bacteria, with satisfactory MBC for the clinical isolate S. saprophyticus. The fractions and the pure compound rosmarinic acid did not furnish promising results for Gram-negative bacteria, whereas fractions 2, 3, and 4 gave encouraging results for Gram-positive bacteria and acted as bactericide against S. epidermidis as well as E. faecalis (ATCC 29212) and its clinical isolate. R. officinalis led to promising results in the case of Gram-positive bacteria, resulting in a considerable interest in the development of reliable alternatives for the treatment of urinary infections. PMID:24516424

Evaluation of the antibacterial potential of Petroselinum crispum and Rosmarinus officinalis against bacteria that cause urinary tract infections.

PubMed

Petrolini, Fernanda Villas Boas; Lucarini, Rodrigo; de Souza, Maria Gorete Mendes; Pires, Regina Helena; Cunha, Wilson Roberto; Martins, Carlos Henrique Gomes

2013-01-01

In this study we evaluated the antibacterial activity of the crude hydroalcoholic extracts, fractions, and compounds of two plant species, namely Rosmarinus officinalis and Petroselinum crispum, against the bacteria that cause urinary tract infection. The microdilution method was used for determination of the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC). The crude hydroalcoholic extract of R. officinalis displayed in vitro activity against Gram-positive bacteria, with satisfactory MBC for the clinical isolate S. saprophyticus. The fractions and the pure compound rosmarinic acid did not furnish promising results for Gram-negative bacteria, whereas fractions 2, 3, and 4 gave encouraging results for Gram-positive bacteria and acted as bactericide against S. epidermidis as well as E. faecalis (ATCC 29212) and its clinical isolate. R. officinalis led to promising results in the case of Gram-positive bacteria, resulting in a considerable interest in the development of reliable alternatives for the treatment of urinary infections.

Microbial skin flora of selected cancer patients and hospital personnel.

PubMed Central

McBride, M E; Duncan, W C; Bodey, G P; McBride, C M

1976-01-01

The bacterial flora of the skin from five anatomical sites on 10 leukemia patients, 10 patients with malignant melanoma, and a control group of 10 medical personnel was examined quantitatively and qualitatively. This was done to determine whether malignant disease results in changes in skin flora and to establish carrier rates of gram-negative bacteria on the skin of personnel in hospital environments. Gram-negative bacteria were isolated more frequently (74 isolates from 100 cultures) from the skin of leukemia patients than from either patients with malignant melanoma (8 isolates from 100 cultures) or the medical personnel (9 isolates from 100 cultures). Klebsiella pneumoniae and Pseudomonas aeruginosa were isolated exclusively from leukemia patients. Relative proportions of gram-negative bacteria in total populations were determined. The axilla was the only site with a uniformly high proportion of gram-negative bacteria. From all other sites cultured, gram-negative populations were low (1 to 5 bacteria/cm2 of skin), although a high proportion of gram-negative populations occurred randomly throughout all subject groups. It was concluded that leukemia patients tend to carry gram-negative bacteria on the skin. The factors permitting colonization of skin by gram-negative bacteria are discussed. PMID:943418

Fluctuations in the population density of Gram-negative bacteria in a chernozem in the course of a succession initiated by moistening and chitin and cellulose introduction

NASA Astrophysics Data System (ADS)

Polyanskaya, L. M.; Ivanov, K. E.; Zvyagintsev, D. G.

2012-10-01

The role has been studied of Gram-negative bacteria in the destruction of polymers widely spread in soils: chitin and cellulose. The introduction of chitin had no positive effect on the population density of Gram-negative bacteria, but it advanced the date of their appearance: the maximum population density of Gram-negative bacteria was recorded not on the 7th-15th day as in the control but much earlier, on the 3rd-7th day of the experiment. Consequently, the introduction of chitin as an additional source of nutrition promoted revealing of the Gram-negative bacteria already at the early stages of the succession. In the course of the succession, when the fungal mycelium begins to die off, the actinomycetic mycelium increases in length, i.e., Gram-negative bacteria are replaced at this stage with Gram-positive ones, the leading role among which belongs to actinomycetes. The growth rate of Gram-negative bacteria is higher than that of actinomycetes, so they start chitin utilization at the early stages of the succession, whereas actinomycetes dominate at the late stages. The population density of Gram-negative bacteria was lower under the anaerobic conditions as compared with that in the aerobic ones. The population density of Gram-negative bacteria in the lower layer of the A horizon and in the B horizon was slightly higher only in the case of the chitin introduction. When cellulose was introduced into the soil under aerobic conditions, the population density of Gram-negative bacteria in all the layers of the A horizon was maximal from the 14th to the 22nd day of the experiment. Cellulose was utilized in the soil mostly by fungi, and this was suggested by the increase of the length of the fungal mycelium. Simultaneously, an increase in the length of the actinomycetal mycelium was observed, as these organisms also perform cellulose hydrolysis in soils. The Gram-negative bacteria began to develop at the stage of the fungal mycelium destruction, which indirectly confirmed the chitinolytic activity of these bacteria.

TRIF Licenses Caspase-11-Dependent NLRP3 Inflammasome Activation by Gram-Negative Bacteria

PubMed Central

Rathinam, Vijay A.K.; Vanaja, Sivapriya Kailasan; Waggoner, Lisa; Sokolovska, Anna; Becker, Christine; Stuart, Lynda M.; Leong, John M.; Fitzgerald, Katherine A.

2013-01-01

SUMMARY Systemic infections with Gram-negative bacteria are characterized by high mortality rates due to the “sepsis syndrome,” a widespread and uncontrolled inflammatory response. Though it is well recognized that the immune response during Gram-negative bacterial infection is initiated after the recognition of endotoxin by Toll-like receptor 4, the molecular mechanisms underlying the detrimental inflammatory response during Gram-negative bacteremia remain poorly defined. Here, we identify a TRIF pathway that licenses NLRP3 inflammasome activation by all Gram-negative bacteria. By engaging TRIF, Gram-negative bacteria activate caspase-11. TRIF activates caspase-11 via type I IFN signaling, an event that is both necessary and sufficient for caspase-11 induction and autoactivation. Caspase-11 subsequently synergizes with the assembled NLRP3 inflammasome to regulate caspase-1 activation and leads to caspase-1-independent cell death. These events occur specifically during infection with Gram-negative, but not Gram-positive, bacteria. The identification of TRIF as a regulator of caspase-11 underscores the importance of TLRs as master regulators of inflammasomes during Gram-negative bacterial infection. PMID:22819539

Distinction of Gram-positive and -negative bacteria using a colorimetric microbial viability assay based on the reduction of water-soluble tetrazolium salts with a selection medium.

PubMed

Tsukatani, Tadayuki; Suenaga, Hikaru; Higuchi, Tomoko; Shiga, Masanobu; Noguchi, Katsuya; Matsumoto, Kiyoshi

2011-01-01

Bacteria are fundamentally divided into two groups: Gram-positive and Gram-negative. Although the Gram stain and other techniques can be used to differentiate these groups, some issues exist with traditional approaches. In this study, we developed a method for differentiating Gram-positive and -negative bacteria using a colorimetric microbial viability assay based on the reduction of the tetrazolium salt {2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt} (WST-8) via 2-methyl-1,4-napthoquinone with a selection medium. We optimized the composition of the selection medium to allow the growth of Gram-negative bacteria while inhibiting the growth of Gram-positive bacteria. When the colorimetric viability assay was carried out in a selection medium containing 0.5µg/ml crystal violet, 5.0 µg/ml daptomycin, and 5.0µg/ml vancomycin, the reduction in WST-8 by Gram-positive bacteria was inhibited. On the other hand, Gram-negative bacteria produced WST-8-formazan in the selection medium. The proposed method was also applied to determine the Gram staining characteristics of bacteria isolated from various foodstuffs. There was good agreement between the results obtained using the present method and those obtained using a conventional staining method. These results suggest that the WST-8 colorimetric assay with selection medium is a useful technique for accurately differentiating Gram-positive and -negative bacteria.

Effect of extremely low frequency electromagnetic fields on bacterial membrane.

PubMed

Oncul, Sule; Cuce, Esra M; Aksu, Burak; Inhan Garip, Ayse

2016-01-01

The effect of extremely low frequency electromagnetic fields (ELF-EMF) on bacteria has attracted attention due to its potential for beneficial uses. This research aimed to determine the effect of ELF-EMF on bacterial membrane namely the membrane potential, surface potential, hydrophobicity, respiratory activity and growth. Gram-positive Staphylococcus aureus and Gram-negative Escherichia coli were subjected to ELF-EMF, 50 Hz, 1 mT for 2 h. Membrane potential was determined by fluorescence spectroscopy with or without EDTA (Ethylenediaminetetraacetic acid) with DisC3(5) (3,3-dipropylthiacarbocyanine iodide), zeta potential measurements were performed by electrophoretic mobility, hydrophobicity of the membrane was measured with MATH (Microbial Adhesion to Hydrocarbons) test, respiratory activity was determined with CTC (5-Cyano-2,3-ditolyl tetrazolium chloride), colony forming unit (CFU) and DAPI (4',6-diamidino-2-phenylindole, dihydrochloride) was used for growth determinations. ELF-EMF caused changes in physicochemical properties of both Gram-positive and Gram-negative bacteria. Hyperpolarization was seen in S. aureus and EDTA-treated E. coli. Surface potential showed a positive shift in S. aureus contrariwise to the negative shift seen in EDTA-untreated E. coli. Respiratory activity increased in both bacteria. A slight decrease in growth was observed. These results show that ELF-EMF affects the crucial physicochemical processes in both Gram-positive and Gram-negative bacteria which need further research.

Epidemiology, susceptibility, and risk factors for acquisition of MDR/XDR Gram-negative bacteria among kidney transplant recipients with urinary tract infections.

PubMed

Yuan, Xiuhong; Liu, Taohua; Wu, Di; Wan, Qiquan

2018-01-01

Multiple drug resistant/extensively drug resistant (MDR/XDR) Gram-negative urinary tract infections (UTIs) represent a growing threat to kidney transplant recipients. This retrospective study aimed to assess the incidence and microbiological profile of MDR/XDR Gram-negative UTIs, to identify drug susceptibility of MDR/XDR bacteria, and to determine the potential risk factors for MDR/XDR UTIs in kidney recipients. During the study period, 1569 patients underwent consecutive kidney transplantation in two transplantation centers. We studied the demographics, clinical characteristics, and urine culture data from kidney recipients with MDR/XDR Gram-negative UTIs, and verified the risk factors associated with MDR/XDR infections. Eighty-one kidney recipients yielded 88 episodes of MDR/XDR Gram-negative UTIs with five patients (6.2%) succumbing to all-cause in-hospital mortality. The most frequently isolated bacterium was Escherichia coli (62.5%). Almost all MDR/XDR Gram-negative bacteria were resistant to first- and second-generation cephalosporin, and monocyclic beta-lactam. They were relatively sensitive to meropenem, amikacin, and tigecycline. As for the 12 XDR bacteria, all of them were resistant to meropenem and 25% of them were resistant to tigecycline. All XDR Acinetobacter baumannii and E. coli were susceptible to tigecycline. Nosocomial infection (odds ratio [OR] = 11.429, 95% CI = 1.311-99.625, P = 0.027) was the only independent predictor of MDR/XDR Gram-negative UTIs. Non-fermenting bacterial infection (OR = 20.161, 95% CI = 3.409-119.240, P = 0.001), polycystic kidney disease (OR = 39.871, 95% CI = 1.979-803.384, P = 0.016), and serum creatinine level > 1.5 mg/dL (OR = 8.688, 95% CI = 1.354-55.747, P = 0.023) were significantly different between XDR and MDR Gram-negative UTIs. Meropenem, amikacin, and/or tigecycline can be prescribed for MDR/XDR Gram-negative infections. Tigecycline can also be prescribed for XDR A. baumannii and E. coli . Nosocomial infection was a risk factor for MDR/XDR Gram-negative UTIs, while XDR UTIs were associated with non-fermenting bacterial infection, polycystic kidney disease, and impaired renal function.

Bactericidal catechins damage the lipid bilayer.

PubMed

Ikigai, H; Nakae, T; Hara, Y; Shimamura, T

1993-04-08

The mode of antibacterial action of, the green tea (Camellia sinensis) extracts, (-)-epigallocatechin gallate (EGCg) and (-)-epicatechin (EC) was investigated. Strong bactericidal EGCg caused leakage of 5,6-carboxyfluorescein from phosphatidylcholine liposomes (PC), but EC with very weak bactericidal activity caused little damage to the membrane. Phosphatidylserine and dicetyl phosphate partially protected the membrane from EGCg-mediated damage when reconstituted into the liposome membrane with PC. EGCg, but not EC, caused strong aggregation and NPN-fluorescence quenching of PC-liposomes and these actions were markedly lowered in the presence of negatively charged lipids. These results show that bactericidal catechins primarily act on and damage bacterial membranes. The observation that Gram-negative bacteria are more resistant to bactericidal catechins than Gram-positive bacteria can be explained to some extent by the presence of negatively charged lipopolysaccharide.

Synergistic antibacterial effect of silver and ebselen against multidrug-resistant Gram-negative bacterial infections.

PubMed

Zou, Lili; Lu, Jun; Wang, Jun; Ren, Xiaoyuan; Zhang, Lanlan; Gao, Yu; Rottenberg, Martin E; Holmgren, Arne

2017-08-01

Multidrug-resistant (MDR) Gram-negative bacteria account for a majority of fatal infections, and development of new antibiotic principles and drugs is therefore of outstanding importance. Here, we report that five most clinically difficult-to-treat MDR Gram-negative bacteria are highly sensitive to a synergistic combination of silver and ebselen. In contrast, silver has no synergistic toxicity with ebselen on mammalian cells. The silver and ebselen combination causes a rapid depletion of glutathione and inhibition of the thioredoxin system in bacteria. Silver ions were identified as strong inhibitors of Escherichia coli thioredoxin and thioredoxin reductase, which are required for ribonucleotide reductase and DNA synthesis and defense against oxidative stress. The bactericidal efficacy of silver and ebselen was further verified in the treatment of mild and acute MDR E. coli peritonitis in mice. These results demonstrate that thiol-dependent redox systems in bacteria can be targeted in the design of new antibacterial drugs. The silver and ebselen combination offers a proof of concept in targeting essential bacterial systems and might be developed for novel efficient treatments against MDR Gram-negative bacterial infections. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

Distribution of multi-resistant Gram-negative versus Gram-positive bacteria in the hospital inanimate environment.

PubMed

Lemmen, S W; Häfner, H; Zolldann, D; Stanzel, S; Lütticken, R

2004-03-01

We prospectively studied the difference in detection rates of multi-resistant Gram-positive and multi-resistant Gram-negative bacteria in the inanimate environment of patients harbouring these organisms. Up to 20 different locations around 190 patients were surveyed. Fifty-four patients were infected or colonized with methicillin-resistant Staphylococcus aureus (MRSA) or vancomycin-resistant enterococci (VRE) and 136 with multi-resistant Gram-negative bacteria. The environmental detection rate for MRSA or VRE was 24.7% (174/705 samples) compared with 4.9% (89/1827 samples) for multi-resistant Gram-negative bacteria (P<0.001). Gram-positive bacteria were isolated more frequently than Gram-negatives from the hands of patients (P<0.001) and hospital personnel (P=0.1145). Environmental contamination did not differ between the intensive care units (ICUs) and the general wards (GWs), which is noteworthy because our ICUs are routinely disinfected twice a day, whereas GWs are cleaned just once a day with detergent. Current guidelines for the prevention of spread of multi-resistant bacteria in the hospital setting do not distinguish between Gram-positive and Gram-negative isolates. Our results suggest that the inanimate environment serves as a secondary source for MRSA and VRE, but less so for Gram-negative bacteria. Thus, strict contact isolation in a single room with complete barrier precautions is recommended for MRSA or VRE; however, for multi-resistant Gram-negative bacteria, contact isolation with barrier precautions for close contact but without a single room seems sufficient. This benefits not only the patients, but also the hospital by removing some of the strain placed on already over-stretched resources.

Identification of key genes in Gram-positive and Gram-negative sepsis using stochastic perturbation

PubMed Central

Li, Zhenliang; Zhang, Ying; Liu, Yaling; Liu, Yanchun; Li, Youyi

2017-01-01

Sepsis is an inflammatory response to pathogens (such as Gram-positive and Gram-negative bacteria), which has high morbidity and mortality in critically ill patients. The present study aimed to identify the key genes in Gram-positive and Gram-negative sepsis. GSE6535 was downloaded from Gene Expression Omnibus, containing 17 control samples, 18 Gram-positive samples and 25 Gram-negative samples. Subsequently, the limma package in R was used to screen the differentially expressed genes (DEGs). Hierarchical clustering was conducted for the specific DEGs in Gram-negative and Gram-negative samples using cluster software and the TreeView software. To analyze the correlation of samples at the gene level, a similarity network was constructed using Cytoscape software. Functional and pathway enrichment analyses were conducted for the DEGs using DAVID. Finally, stochastic perturbation was used to determine the significantly differential functions between Gram-positive and Gram-negative samples. A total of 340 and 485 DEGs were obtained in Gram-positive and Gram-negative samples, respectively. Hierarchical clustering revealed that there were significant differences between control and sepsis samples. In Gram-positive and Gram-negative samples, myeloid cell leukemia sequence 1 was associated with apoptosis and programmed cell death. Additionally, NADH:ubiquinone oxidoreductase subunit S4 was associated with mitochondrial respiratory chain complex I assembly. Stochastic perturbation analysis revealed that NADH:ubiquinone oxidoreductase subunit B2 (NDUFB2), NDUFB8 and ubiquinol-cytochrome c reductase hinge protein (UQCRH) were associated with cellular respiration in Gram-negative samples, whereas large tumor suppressor kinase 2 (LATS2) was associated with G1/S transition of the mitotic cell cycle in Gram-positive samples. NDUFB2, NDUFB8 and UQCRH may be biomarkers for Gram-negative sepsis, whereas LATS2 may be a biomarker for Gram-positive sepsis. These findings may promote the therapies of sepsis caused by Gram-positive and Gram-negative bacteria. PMID:28714002

Bio-fabricated silver nanoparticles preferentially targets Gram positive depending on cell surface charge.

PubMed

Mandal, Debasis; Kumar Dash, Sandeep; Das, Balaram; Chattopadhyay, Sourav; Ghosh, Totan; Das, Debasis; Roy, Somenath

2016-10-01

Recently bio-inspired experimental processes for synthesis of nanoparticles are receiving significant attention in nanobiotechnology. Silver nanoparticles (Ag NPs) have been used very frequently in recent times to the wounds, burns and bacterial infections caused by drug-resistant microorganisms. Though, the antibacterial effects of Ag NPs on some multi drug-resistant bacteria specially against Gram positive bacteria has been established, but further investigation is needed to elicit its effectiveness against Gram negatives and to identify the probable mechanism of action. Thus, the present study was conducted to synthesize Ag NPs using Andrographis paniculata leaf extract and to investigate its antibacterial efficacy. After synthesis process the biosynthesized nanoparticles were purified and characterized with the help of various physical measurement techniques which raveled their purity, stability and small size range. The antimicrobial activity of Ag NPs was determined against both Gram-positive Enterococcus faecalis and Gram-negative Proteus vulgaris. Results showed comparatively higher antibacterial efficacy of Ag NPs against Gram positive Enterococcus faecalis strains. It was found that greater difference in zeta potential values between Gram positive bacteria and Ag NPs triggers better internalization of the particles. Thus the cell surface charge played vital role in cell killing which was confirmed by surface zeta potential study. Finally it may be concluded that green synthesized Ag NPs using Andrographis paniculata leaf extract can be very useful against both multi drug resistant Gram-positive and Gram-negative bacteria. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Small molecule inhibitor of lipoteichoic acid synthesis is an antibiotic for Gram-positive bacteria

PubMed Central

Richter, Stefan G.; Elli, Derek; Kim, Hwan Keun; Hendrickx, Antoni P. A.; Sorg, Joseph A.; Schneewind, Olaf; Missiakas, Dominique

2013-01-01

The current epidemic of infections caused by antibiotic-resistant Gram-positive bacteria requires the discovery of new drug targets and the development of new therapeutics. Lipoteichoic acid (LTA), a cell wall polymer of Gram-positive bacteria, consists of 1,3-polyglycerol-phosphate linked to glycolipid. LTA synthase (LtaS) polymerizes polyglycerol-phosphate from phosphatidylglycerol, a reaction that is essential for the growth of Gram-positive bacteria. We screened small molecule libraries for compounds inhibiting growth of Staphylococcus aureus but not of Gram-negative bacteria. Compound 1771 [2-oxo-2-(5-phenyl-1,3,4-oxadiazol-2-ylamino)ethyl 2-naphtho[2,1-b]furan-1-ylacetate] blocked phosphatidylglycerol binding to LtaS and inhibited LTA synthesis in S. aureus and in Escherichia coli expressing ltaS. Compound 1771 inhibited the growth of antibiotic-resistant Gram-positive bacteria and prolonged the survival of mice with lethal S. aureus challenge, validating LtaS as a target for the development of antibiotics. PMID:23401520

A new technique for Gram staining paraffin-embedded tissue.

PubMed Central

Engbaek, K; Johansen, K S; Jensen, M E

1979-01-01

Five techniques for Gram staining bacteria in paraffin sections were compared on serial sections of pulmonary tissues from eight bacteriological necropsies. Brown and Hopp's method was the most satisfactory for distinguishing Gram-positive and Gram-negative bacteria. However, this method cannot be recommended as the preparations were frequently overstained, and the Gram-negative bacteria were stained indistinctly. A modification of Brown and Hopps' method was developed which stains larger numbers of Gram-negative bacteria and differentiates well between different cell types and connective tissue, and there is no risk of overstaining. PMID:86548

Gram-negative bacteria that produce carbapenemases causing death attributed to recent foreign hospitalization.

PubMed

Ahmed-Bentley, Jasmine; Chandran, A Uma; Joffe, A Mark; French, Desiree; Peirano, Gisele; Pitout, Johann D D

2013-07-01

Overseas travel, as a risk factor for the acquisition of infections due to antimicrobial-resistant organisms, has recently been linked to carbapenemase-producing Gram-negative bacteria. Multiresistant Klebsiella pneumoniae, Escherichia coli, and Acinetobacter baumannii strains were isolated from a wound of a Canadian patient with a recent history of hospitalization in India. This resulted in the initiation of outbreak management that included surveillance cultures. Epidemiological and molecular investigations showed that NDM-1-producing K. pneumoniae ST16 and OXA-23-producing A. baumannii ST10 strains were transmitted to 5 other patients, resulting in the colonization of 4 patients and the death of 1 patient due to septic shock caused by the OXA-23-producing A. baumannii strain. The high rate of false positivity of the screening cultures resulted in additional workloads and increased costs for infection control and clinical laboratory work. We believe that this is the first report of an infection with carbapenemase-producing Gram-negative bacteria resulting in death attributed to a patient with recent foreign hospitalization. We recommend routine rectal and wound screening for colonization with multiresistant bacteria for patients who have recently been admitted to hospitals outside Canada.

Photoinactivation of Gram positive and Gram negative bacteria with the antimicrobial peptide (KLAKLAK)(2) conjugated to the hydrophilic photosensitizer eosin Y.

PubMed

Johnson, Gregory A; Muthukrishnan, Nandhini; Pellois, Jean-Philippe

2013-01-16

We test the hypothesis that the antimicrobial peptide (KLAKLAK)(2) enhances the photodynamic activity of the photosensitizer eosin Y upon conjugation. The conjugate eosin-(KLAKLAK)(2) was obtained by solid-phase peptide synthesis. Photoinactivation assays were performed against the Gram-negative bacteria Escherichia coli , Pseudomonas aeruginosa , and multidrug resistant Acinetobacter baumannii AYE, as well as the Gram-positive bacteria Staphylococcus aureus , and Staphylococcus epidermidis . Partitioning assays were performed with E. coli and S. aureus . Photohemolysis and photokilling assays were also performed to assess the photodynamic activity of the conjugate toward mammalian cells. Eosin-(KLAKLAK)(2) photoinactivates 99.999% of 10(8) CFU/mL of most bacteria tested at a concentration of 1 μM or below. In contrast, neither eosin Y nor (KLAKLAK)(2) cause any significant photoinactivation under similar conditions. The increase in photodynamic activity of the photosensitizer conferred by the antimicrobial peptide is in part due to the fact that (KLAKLAK)(2) promotes the association of eosin Y to bacteria. Eosin-(KLAKLAK)(2) does not significantly associate with red blood cells or the cultured mammalian cell lines HaCaT, COS-7, and COLO 316. Consequently, little photodamage or photokilling is observed with these cells under conditions for which bacterial photoinactivation is achieved. The peptide (KLAKLAK)(2) therefore significantly enhances the photodynamic activity of eosin Y toward both Gram-positive and Gram-negative bacteria while interacting minimally with human cells. Overall, our results suggest that antimicrobial peptides such as (KLAKLAK)(2) might serve as attractive agents that can target photosensitizers to bacteria specifically.

Aerobiological Stabilities of Different Species of Gram-Negative Bacteria, Including Well-Known Biothreat Simulants, in Single-Cell Particles and Cell Clusters of Different Compositions

PubMed Central

Skogan, Gunnar

2017-01-01

ABSTRACT The ability to perform controlled experiments with bioaerosols is a fundamental enabler of many bioaerosol research disciplines. A practical alternative to using hazardous biothreat agents, e.g., for detection equipment development and testing, involves using appropriate model organisms (simulants). Several species of Gram-negative bacteria have been used or proposed as biothreat simulants. However, the appropriateness of different bacterial genera, species, and strains as simulants is still debated. Here, we report aerobiological stability characteristics of four species of Gram-negative bacteria (Pantoea agglomerans, Serratia marcescens, Escherichia coli, and Xanthomonas arboricola) in single-cell particles and cell clusters produced using four spray liquids (H2O, phosphate-buffered saline[PBS], spent culture medium[SCM], and a SCM-PBS mixture). E. coli showed higher stability in cell clusters from all spray liquids than the other species, but it showed similar or lower stability in single-cell particles. The overall stability was higher in cell clusters than in single-cell particles. The highest overall stability was observed for bioaerosols produced using SCM-containing spray liquids. A key finding was the observation that stability differences caused by particle size or compositional changes frequently followed species-specific patterns. The results highlight how even moderate changes to one experimental parameter, e.g., bacterial species, spray liquid, or particle size, can strongly affect the aerobiological stability of Gram-negative bacteria. Taken together, the results highlight the importance of careful and informed selection of Gram-negative bacterial biothreat simulants and also the accompanying particle size and composition. The outcome of this work contributes to improved selection of simulants, spray liquids, and particle size for use in bioaerosol research. IMPORTANCE The outcome of this work contributes to improved selection of simulants, spray liquids, and particle size for use in bioaerosol research. Taken together, the results highlight the importance of careful and informed selection of Gram-negative bacterial biothreat simulants and also the accompanying particle size and composition. The results highlight how even moderate changes to one experimental parameter, e.g., bacterial species, spray liquid, or particle size, can strongly affect the aerobiological stability of Gram-negative bacteria. A key finding was the observation that stability differences caused by particle size or compositional changes frequently followed species-specific patterns. PMID:28687646

AFRRI reports. First Quarter, January-March 1991. Scientific report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1991-04-01

Ionizing radiation reduces the host's defenses to infection (1) and enhances its susceptibility to systemic infection due to endogenous and exogenous organisms. Klebsiella pneumoniae is one of the most frequent causes of gram-negative bacteremia, and is especially prevalent in immunocompromised patients. Therapy for severe systemic infection due to gram-negative bacteria generally involves the use of aminoglycosides in combination with beta lactam antibiotics. However, several recently developed quinolone compounds have exhibited high in vitro bactericidal activity against most gram negative bacteria. including K. pneumoniae. In this study, the authors evaluated the efficacy of oral therapy with several quinolones in a modelmore » of experimental septicemia due to orally ingested K pneumoniae in irradiated mice.« less

Drug-resistant gram-negative uropathogens: A review.

PubMed

Khoshnood, Saeed; Heidary, Mohsen; Mirnejad, Reza; Bahramian, Aghil; Sedighi, Mansour; Mirzaei, Habibollah

2017-10-01

Urinary tract infection(UTI) caused by Gram-negative bacteria is the second most common infectious presentation in community medical practice. Approximately 150 million people are diagnosed with UTI each year worldwide. Drug resistance in Gram-negative uropathogens is a major global concern which can lead to poor clinical outcomes including treatment failure, development of bacteremia, requirement for intravenous therapy, hospitalization, and extended length of hospital stay. The mechanisms of drug resistance in these bacteria are important due to they are often not identified by routine susceptibility tests and have an exceptional potential for outbreaks. Treatment of UTIs depends on the access to effective drugs, which is now threatened by antibiotic resistant Gram-negative uropathogens. Although several effective antibiotics with activity against highly resistant Gram-negatives are available, there is not a unique antibiotic with activity against the high variety of resistance. Therefore, antimicrobial susceptibility tests, correlation between clinicians and laboratories, development of more rapid diagnostic methods, and continuous monitoring of drug resistance are urgent priorities. In this review, we will discuss about the current global status of drug-resistant Gram-negative uropathogens and their mechanisms of drug resistance to provide new insights into their treatment options. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Brevundimonas spp: Emerging global opportunistic pathogens

PubMed Central

2018-01-01

ABSTRACT Non-fermenting Gram-negative bacteria are problematic in clinical locations, being one of the most prevalent causes of nosocomial infections. Many of these non-fermenting Gram-negative bacteria are opportunistic pathogens that affect patients that are suffering with underlying medical conditions and diseases. Brevundimonas spp., in particular Brevundimonas diminuta and Brevundimonas vesicularis, are a genus of non-fermenting Gram-negative bacteria considered of minor clinical importance. Forty-nine separate instances of infection relating to Brevundimonas spp were found in the scientific literature along with two pseudo-infections. The majority of these instances were infection with Brevundimonas vesicularis (thirty-five cases – 71%). The major condition associated with Brevundimonas spp infection was bacteraemia with seventeen individual cases/outbreaks (35%). This review identified forty-nine examples of Brevundimonas spp. infections have been discussed in the literature. These findings indicate that infection review programs should consider investigation of possible Brevundimonas spp outbreaks if these bacteria are clinically isolated in more than one patient. PMID:29484917

Type I and Type II mechanisms of antimicrobial photodynamic therapy: an in vitro study on gram-negative and gram-positive bacteria.

PubMed

Huang, Liyi; Xuan, Yi; Koide, Yuichiro; Zhiyentayev, Timur; Tanaka, Masamitsu; Hamblin, Michael R

2012-08-01

Antimicrobial photodynamic therapy (APDT) employs a non-toxic photosensitizer (PS) and visible light, which in the presence of oxygen produce reactive oxygen species (ROS), such as singlet oxygen ((1) O(2), produced via Type II mechanism) and hydroxyl radical (HO(.), produced via Type I mechanism). This study examined the relative contributions of (1) O(2) and HO(.) to APDT killing of Gram-positive and Gram-negative bacteria. Fluorescence probes, 3'-(p-hydroxyphenyl)-fluorescein (HPF) and singlet oxygen sensor green reagent (SOSG) were used to determine HO(.) and (1) O(2) produced by illumination of two PS: tris-cationic-buckminsterfullerene (BB6) and a conjugate between polyethylenimine and chlorin(e6) (PEI-ce6). Dimethylthiourea is a HO(.) scavenger, while sodium azide (NaN(3)) is a quencher of (1) O(2). Both APDT and killing by Fenton reaction (chemical generation of HO(.)) were carried out on Gram-positive bacteria (Staphylococcus aureus and Enterococcus faecalis) and Gram-negative bacteria (Escherichia coli, Proteus mirabilis, and Pseudomonas aeruginosa). Conjugate PEI-ce6 mainly produced (1) O(2) (quenched by NaN(3)), while BB6 produced HO(.) in addition to (1) O(2) when NaN(3) potentiated probe activation. NaN(3) also potentiated HPF activation by Fenton reagent. All bacteria were killed by Fenton reagent but Gram-positive bacteria needed a higher concentration than Gram-negatives. NaN(3) potentiated Fenton-mediated killing of all bacteria. The ratio of APDT killing between Gram-positive and Gram-negative bacteria was 2 or 4:1 for BB6 and 25:1 for conjugate PEI-ce6. There was a NaN(3) dose-dependent inhibition of APDT killing using both PEI-ce6 and BB6 against Gram-negative bacteria while NaN(3) almost failed to inhibit killing of Gram-positive bacteria. Azidyl radicals may be formed from NaN(3) and HO(.). It may be that Gram-negative bacteria are more susceptible to HO(.) while Gram-positive bacteria are more susceptible to (1) O(2). The differences in NaN(3) inhibition may reflect differences in the extent of PS binding to bacteria (microenvironment) or differences in penetration of NaN(3) into cell walls of bacteria. Copyright © 2012 Wiley Periodicals, Inc.

Type I and Type II mechanisms of antimicrobial photodynamic therapy: An in vitro study on Gram-negative and Gram-positive bacteria

PubMed Central

Huang, Liyi; Xuan, Yi; Koide, Yuichiro; Zhiyentayev, Timur; Tanaka, Masamitsu; Hamblin, Michael R.

2012-01-01

Background and Objectives Antimicrobial photodynamic therapy (APDT) employs a nontoxic photosensitizer (PS) and visible light, which in the presence of oxygen produce reactive oxygen species (ROS), such as singlet oxygen (1O2, produced via Type II mechanism) and hydroxyl radical (HO•, produced via Type I mechanism). This study examined the relative contributions of 1O2 and HO• to APDT killing of Gram-positive and Gram-negative bacteria. Study Design/Materials and Methods Fluorescence probes, 3'-(p-hydroxyphenyl)-fluorescein (HPF) and singlet oxygen sensor green reagent (SOSG) were used to determine HO• and 1O2 produced by illumination of two PS: tris-cationic-buckminsterfullerene (BB6) and a conjugate between polyethylenimine and chlorin(e6) (PEI–ce6). Dimethylthiourea is a HO• scavenger, while sodium azide (NaN3) is a quencher of 1O2. Both APDT and killing by Fenton reaction (chemical generation of HO•) were carried out on Gram-positive bacteria (Staphylococcus aureus and Enteroccoccus fecalis) and Gram-negative bacteria (Escherichia coli, Proteus mirabilis and Pseudomonas aeruginosa. Results Conjugate PEI-ce6 mainly produced 1O2 (quenched by NaN3), while BB6 produced HO• in addition to 1O2 when NaN3 potentiated probe activation. NaN3 also potentiated HPF activation by Fenton reagent. All bacteria were killed by Fenton reagent but Gram-positive bacteria needed a higher concentration than Gram-negatives. NaN3 potentiated Fenton-mediated killing of all bacteria. The ratio of APDT killing between Gram-positive and Gram-negative bacteria was 2 or 4:1 for BB6 and 25:1 for conjugate PEI-ce6. There was a NaN3 dose dependent inhibition of APDT killing using both PEI-ce6 and BB6 against Gram-negative bacteria while NaN3 almost failed to inhibit killing of Gram-positive bacteria. Conclusion Azidyl radicals may be formed from NaN3 and HO•. It may be that Gram-negative bacteria are more susceptible to HO• while Gram-positive bacteria are more susceptible to 1O2. The differences in NaN3 inhibition may reflect differences in the extent of PS binding to bacteria (microenvironment) or differences in penetration of NaN3 into cell walls of bacteria. PMID:22760848

Gram staining for the treatment of peritonsillar abscess.

PubMed

Takenaka, Yukinori; Takeda, Kazuya; Yoshii, Tadashi; Hashimoto, Michiko; Inohara, Hidenori

2012-01-01

Objective. To examine whether Gram staining can influence the choice of antibiotic for the treatment of peritonsillar abscess. Methods. Between 2005 and 2009, a total of 57 cases of peritonsillar abscess were analyzed with regard to cultured bacteria and Gram staining. Results. Only aerobes were cultured in 16% of cases, and only anaerobes were cultured in 51% of cases. Mixed growth of aerobes and anaerobes was observed in 21% of cases. The cultured bacteria were mainly aerobic Streptococcus, anaerobic Gram-positive cocci, and anaerobic Gram-negative rods. Phagocytosis of bacteria on Gram staining was observed in 9 cases. The bacteria cultured from these cases were aerobic Streptococcus, anaerobic Gram-positive cocci, and anaerobic Gram-negative rods. The sensitivity of Gram staining for the Gram-positive cocci and Gram-negative rods was 90% and 64%, respectively. The specificity of Gram staining for the Gram-positive cocci and Gram-negative rods was 62% and 76%, respectively. Most of the Gram-positive cocci were sensitive to penicillin, but some of anaerobic Gram-negative rods were resistant to penicillin. Conclusion. When Gram staining shows only Gram-positive cocci, penicillin is the treatment of choice. In other cases, antibiotics effective for the penicillin-resistant organisms should be used.

Rapid Discrimination of Gram-Positive and Gram-Negative Bacteria in Liquid Samples by Using NaOH-Sodium Dodecyl Sulfate Solution and Flow Cytometry

PubMed Central

Wada, Atsushi; Kono, Mari; Kawauchi, Sawako; Takagi, Yuri; Morikawa, Takashi; Funakoshi, Kunihiro

2012-01-01

Background For precise diagnosis of urinary tract infections (UTI), and selection of the appropriate prescriptions for their treatment, we explored a simple and rapid method of discriminating gram-positive and gram-negative bacteria in liquid samples. Methodology/Principal Findings We employed the NaOH-sodium dodecyl sulfate (SDS) solution conventionally used for plasmid extraction from Escherichia coli and the automated urine particle analyzer UF-1000i (Sysmex Corporation) for our novel method. The NaOH-SDS solution was used to determine differences in the cell wall structures between gram-positive and gram-negative bacteria, since the tolerance to such chemicals reflects the thickness and structural differences of bacterial cell walls. The UF-1000i instrument was used as a quantitative bacterial counter. We found that gram-negative bacteria, including E. coli, in liquid culture could easily be lysed by direct addition of equal volumes of NaOH-SDS solution. In contrast, Enterococcus faecalis, which is a gram-positive bacterium, could not be completely lysed by the solution. We then optimized the reaction time of the NaOH-SDS treatment at room temperature by using 3 gram-positive and 4 gram-negative bacterial strains and determined that the optimum reaction time was 5 min. Finally, in order to evaluate the generalizability of this method, we treated 8 gram-positive strains and 8 gram-negative strains, or 4 gram-positive and 4 gram-negative strains incubated in voluntary urine from healthy volunteers in the same way and demonstrated that all the gram-positive bacteria were discriminated quantitatively from gram negative bacteria using this method. Conclusions/Significance Using our new method, we could easily discriminate gram-positive and gram-negative bacteria in liquid culture media within 10 min. This simple and rapid method may be useful for determining the treatment course of patients with UTIs, especially for those without a prior history of UTIs. The method may be easily applied in order to obtain additional information for clinical prescriptions from bacteriuria. PMID:23077549

Antimicrobial Resistance in Hospital-Acquired Gram-Negative Bacterial Infections

PubMed Central

Mehrad, Borna; Clark, Nina M.; Zhanel, George G.

2015-01-01

Aerobic gram-negative bacilli, including the family of Enterobacteriaceae and non-lactose fermenting bacteria such as Pseudomonas and Acinetobacter species, are major causes of hospital-acquired infections. The rate of antibiotic resistance among these pathogens has accelerated dramatically in recent years and has reached pandemic scale. It is no longer uncommon to encounter gram-negative infections that are untreatable using conventional antibiotics in hospitalized patients. In this review, we provide a summary of the major classes of gram-negative bacilli and their key mechanisms of antimicrobial resistance, discuss approaches to the treatment of these difficult infections, and outline methods to slow the further spread of resistance mechanisms. PMID:25940252

[Bile-resistant Gram-negative bacteria effect of different kinds of root decoction pieces].

PubMed

Deng, Yan; Wang, Ya-Ke; Han, Xiao-Yu; Wang, Ya-Qi; Jiang, Zhen-Yu; Yu, Zhi-Jun; Deng, Hai-Ying

2017-11-01

To investigate the microbial contamination in Chinese herbal decoction pieces with different functional types by studying the total aerobic microbial count (TAMC), and total yeast and mould count (TYMC) in 40 samples of 8 types of root decoction pieces; further evaluate the contamination load of bile-resistant Gram-negative bacteria, and identify the Gram-negative bacteria by using biochemical identification system for Gram-negative bacteria. Our results showed that the TAMC value was more than 1 000 CFU•g⁻¹ in 85% (34/40) samples, and was more than 100 CFU•g⁻¹ in 30% (12/40) samples; the contamination of bile-resistant Gram-negative bacteria was detected in 45% (18/40) of the samples. The bile-resistant Gram-negative bacteria load of seven batches of samples was N>1 000 MPN•g⁻¹. Sixteen bacterium strains including Serratia plymouthensis, Cedecea neteri, Escherichia vulneris, Klebsiella oxytoca, Enterobacter amnigenus, E. cloacae, E. sakazakii, Proteus penneri and E. gergoviae were obtained and identified. E. cloacae was the predominant bacterium that was isolated from Salviae Miltiorrhizae Radix et Rhizoma, while E. amnigenus, Yersinia pseudotuberculosis was the typical bacterium of Ophiopogonis Radix and Codonopsis Radix, respectively. All these suggested that the contamination of bile-resistant Gram-negative bacteria was severe for the root decoction pieces in Wuhan city. Microbial species have certain selection specificity for medicinal ingredients, so the type and limit of control bacteria for detection should be formulated according to the pollution type and quantity of bile-resistant Gram-negative bacteria. Copyright© by the Chinese Pharmaceutical Association.

Biochemical characterization of Gram-positive and Gram-negative plant-associated bacteria with micro-Raman spectroscopy.

PubMed

Paret, Mathews L; Sharma, Shiv K; Green, Lisa M; Alvarez, Anne M

2010-04-01

Raman spectra of Gram-positive and Gram-negative plant bacteria have been measured with micro-Raman spectrometers equipped with 785 and 514.5 nm lasers. The Gram-positive bacteria Microbacterium testaceum, Paenibacillus validus, and Clavibacter michiganensis subsp. michiganensis have strong carotenoid bands in the regions 1155-1157 cm(-1) and 1516-1522 cm(-1) that differentiate them from other tested Gram-negative bacteria. In the Raman spectrum of Gram-positive bacteria Bacillus megaterium excited with 785 nm laser, the Raman bands at 1157 and 1521 cm(-1) are weak in intensity compared to other Gram-positive bacteria, and these bands did not show significant resonance Raman enhancement in the spectrum recorded with 514.5 nm laser excitation. The Gram-positive bacteria could be separated from each other based on the bands associated with the in-phase C=C (v(1)) vibrations of the polyene chain of carotenoids. None of the Gram-negative bacteria tested had carotenoid bands. The bacteria in the genus Xanthomonas have a carotenoid-like pigment, xanthomonadin, identified in Xanthomonas axonopodis pv. dieffenbachiae, and it is a unique Raman marker for the bacteria. The representative bands for xanthomonadin were the C-C stretching (v(2)) vibrations of the polyene chain at 1135-1136 cm(-1) and the in-phase C=C (v(1)) vibrations of the polyene chain at 1529-1531 cm(-1), which were distinct from the carotenoid bands of other tested bacteria. The tyrosine peak in the region 1170-1175 cm(-1) was the only other marker present in Gram-negative bacteria that was absent in all tested Gram-positives. A strong-intensity exopolysaccharide-associated marker at 1551 cm(-1) is a distinguishable feature of Enterobacter cloacae. The Gram-negative Agrobacterium rhizogenes and Ralstonia solanacearum were differentiated from each other and other tested bacteria on the basis of presence or absence and relative intensities of peaks. The principal components analysis (PCA) of the spectra excited with 785 nm laser differentiated the various strains of bacteria based on the unique pigments these bacteria do or do not possess. Raman spectroscopy of diverse plant bacteria that are pathogenic and non-pathogenic to plants, and isolated from plants and soil, indicates the possibilities of using the method in understanding plant-bacterial interactions at the cellular level.

A molecular gram stain using broad range PCR and pyrosequencing technology: a potentially useful tool for diagnosing orthopaedic infections.

PubMed

Kobayashi, Naomi; Bauer, Thomas W; Togawa, Daisuke; Lieberman, Isador H; Sakai, Hiroshige; Fujishiro, Takaaki; Tuohy, Marion J; Procop, Gary W

2005-06-01

The bacteria associated with orthopaedic infections are usually common gram-positive and gram-negative bacteria. This fundamental grouping of bacteria is a necessary first step in the selection of appropriate antibiotics. Since polymerase chain reaction (PCR) is more rapid and may be more sensitive than culture, we developed a postamplification pyrosequencing method to subcategorize bacteria based on a few nucleotide polymorphisms in the 16S rRNA gene. We validated this method using well-characterized strains of bacteria and applied it to specimens from spinal surgery cases with suspected infections. Lysates of 114 bacteria including 75 species were created following standard cultivation to obtain DNA. The DNA was amplified by a broad-range real-time PCR. The amplicons were evaluated by pyrosequencing and were classified as gram-positive, gram-negative, or acid-fast bacilli based on the first three to five nucleotides sequenced. In addition, clinical cases of suspected infection were obtained from spinal surgery. The results of the "molecular Gram stain" were compared with the results of traditional Gram stain and culture. The lysates of 107 (93.9%) of the bacteria extracts tested were appropriately categorized as gram-positive and gram-negative or as acid-fast bacilli on the basis of this assay. The sensitivity and specificity of this assay were 100% and 97.4% for gram-positive and 88.3% and 100% for gram-negative isolates. All of the five clinical samples were appropriately categorized as containing gram-positive or gram-negative bacteria with this assay. This study demonstrates that high sensitivity and specificity of a molecular gram stain may be achieved using broad-range real-time PCR and pyrosequencing.

Prevalence and risk factors for CTX-M gram-negative bacteria in hospitalized patients at a tertiary care hospital in Kilimanjaro, Tanzania.

PubMed

Sonda, Tolbert; Kumburu, Happiness; van Zwetselaar, Marco; Alifrangis, Michael; Mmbaga, Blandina T; Lund, Ole; Aarestrup, Frank M; Kibiki, Gibson

2018-05-01

Emergence and spread of extended spectrum beta-lactamase (ESBL)-producing gram-negative bacteria, mainly due to CTX-M, is a major global public health problem. Patients infected with ESBL-producing gram-negative bacteria have an increased risk of treatment failure and death. We investigated the prevalence and risk factors for CTX-M gram-negative bacteria isolated from clinical specimens of patients hospitalized at a tertiary care hospital in Kilimanjaro, Tanzania. Isolated gram-negative bacteria from inpatients admitted at Kilimanjaro Christian Medical Centre (KCMC) between August 2013 and August 2015 were fully genome sequenced. The prevalence of ESBL-producing gram-negative bacteria was determined based on the presence of bla CTX-M . The odds ratio (OR) and risk factors for ESBL-producing gram-negative bacteria due to CTX-M were assessed using logistic regression models. The overall CTX-M prevalence (95% CI) was 13.6% (10.1-18.1). Adjusted for other factors, the OR of CTX-M gram-negative bacteria for patients previously hospitalized was 0.26 (0.08-0.88), p = 0.031; the OR for patients currently on antibiotics was 4.02 (1.29-12.58), p = 0.017; the OR for patients currently on ceftriaxone was 0.14 (0.04-0.46), p = 0.001; and the OR for patients with wound infections was 0.24 (0.09-0.61), p = 0.003. The prevalence of ESBL-producing gram-negative bacteria due to CTX-M in this setting is relatively low compared to other previous reports in similar settings. However, to properly stop further spread in the hospital, we recommend setting up a hospital surveillance system that takes full advantage of the available next-generation sequencing facility to routinely screen for all types of bacterial resistance genes.

Antibiotics from Gram-negative bacteria: a comprehensive overview and selected biosynthetic highlights.

PubMed

Masschelein, J; Jenner, M; Challis, G L

2017-07-01

Covering: up to 2017The overwhelming majority of antibiotics in clinical use originate from Gram-positive Actinobacteria. In recent years, however, Gram-negative bacteria have become increasingly recognised as a rich yet underexplored source of novel antimicrobials, with the potential to combat the looming health threat posed by antibiotic resistance. In this article, we have compiled a comprehensive list of natural products with antimicrobial activity from Gram-negative bacteria, including information on their biosynthetic origin(s) and molecular target(s), where known. We also provide a detailed discussion of several unusual pathways for antibiotic biosynthesis in Gram-negative bacteria, serving to highlight the exceptional biocatalytic repertoire of this group of microorganisms.

Dietary Heme Alters Microbiota and Mucosa of Mouse Colon without Functional Changes in Host-Microbe Cross-Talk

PubMed Central

van Doorn, Gerdien M.; Rijnierse, Anneke; van den Bogert, Bartholomeus; Müller, Michael; Dekker, Jan; Kleerebezem, Michiel; van der Meer, Roelof

2012-01-01

Colon cancer is a major cause of cancer deaths in Western countries and is associated with diets high in red meat. Heme, the iron-porphyrin pigment of red meat, induces cytotoxicity of gut contents which injures surface cells leading to compensatory hyperproliferation of crypt cells. This hyperproliferation results in epithelial hyperplasia which increases the risk of colon cancer. In humans, a high red-meat diet increases Bacteroides spp in feces. Therefore, we simultaneously investigated the effects of dietary heme on colonic microbiota and on the host mucosa of mice. Whole genome microarrays showed that heme injured the colonic surface epithelium and induced hyperproliferation by changing the surface to crypt signaling. Using 16S rRNA phylogenetic microarrays, we investigated whether bacteria play a role in this changed signaling. Heme increased Bacteroidetes and decreased Firmicutes in colonic contents. This shift was most likely caused by a selective susceptibility of Gram-positive bacteria to heme cytotoxic fecal water, which is not observed for Gram-negative bacteria, allowing expansion of the Gram-negative community. The increased amount of Gram-negative bacteria most probably increased LPS exposure to colonocytes, however, there is no appreciable immune response detected in the heme-fed mice. There was no functional change in the sensing of the bacteria by the mucosa, as changes in inflammation pathways and Toll- like receptor signaling were not detected. This unaltered host-microbe cross-talk indicates that the changes in microbiota did not play a causal role in the observed hyperproliferation and hyperplasia. PMID:23239972

Isolation and in vitro evaluation of bacteriophages against MDR-bacterial isolates from septic wound infections.

PubMed

Pallavali, Roja Rani; Degati, Vijaya Lakshmi; Lomada, Dakshayani; Reddy, Madhava C; Durbaka, Vijaya Raghava Prasad

2017-01-01

Multi-drug resistance has become a major problem for the treatment of pathogenic bacterial infections. The use of bacteriophages is an attractive approach to overcome the problem of drug resistance in several pathogens that cause fatal diseases. Our study aimed to isolate multi drug resistant bacteria from patients with septic wounds and then isolate and apply bacteriophages in vitro as alternative therapeutic agents. Pus samples were aseptically collected from Rajiv Gandhi Institute of Medical Science (RIMS), Kadapa, A.P., and samples were analyzed by gram staining, evaluating morphological characteristics, and biochemical methods. MDR-bacterial strains were collected using the Kirby-Bauer disk diffusion method against a variety of antibiotics. Bacteriophages were collected and tested in vitro for lytic activity against MDR-bacterial isolates. Analysis of the pus swab samples revealed that the most of the isolates detected had Pseudomonas aeruginosa as the predominant bacterium, followed by Staphylococcus aureus, Klebsiella pneumoniae and Escherichia coli. Our results suggested that gram-negative bacteria were more predominant than gram-positive bacteria in septic wounds; most of these isolates were resistant to ampicillin, amoxicillin, penicillin, vancomycin and tetracycline. All the gram-positive isolates (100%) were multi-drug resistant, whereas 86% of the gram-negative isolates had a drug resistant nature. Further bacteriophages isolated from sewage demonstrated perfect lytic activity against the multi-drug resistant bacteria causing septic wounds. In vitro analysis of the isolated bacteriophages demonstrated perfect lysis against the corresponding MDR-bacteria, and these isolated phages may be promising as a first choice for prophylaxis against wound sepsis, Moreover, phage therapy does not enhance multi-drug resistance in bacteria and could work simultaneously on a wide variety of MDR-bacteria when used in a bacteriophage cocktail. Hence, our results suggest that these bacteriophages could be potential therapeutic options for treating septic wounds caused by P. aeruginosa, S. aureus, K. pneumoniae and E. coli.

Evolution of the Kdo2-lipid A Biosynthesis in Bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

S Opiyo; R Pardy; H Moriyama

BACKGROUND: Lipid A is the highly immunoreactive endotoxic center of lipopolysaccharide (LPS). It anchors the LPS into the outer membrane of most Gram-negative bacteria. Lipid A can be recognized by animal cells, triggers defense-related responses, and causes Gram-negative sepsis. The biosynthesis of Kdo2-lipid A, the LPS substructure, involves with nine enzymatic steps. RESULTS: In order to elucidate the evolutionary pathway of Kdo2-lipid A biosynthesis, we examined the distribution of genes encoding the nine enzymes across bacteria. We found that not all Gram-negative bacteria have all nine enzymes. Some Gram-negative bacteria have no genes encoding these enzymes and others have genesmore » only for the first four enzymes (LpxA, LpxC, LpxD, and LpxB). Among the nine enzymes, five appeared to have arisen from three independent gene duplication events. Two of such events happened within the Proteobacteria lineage, followed by functional specialization of the duplicated genes and pathway optimization in these bacteria. CONCLUSIONS: The nine-enzyme pathway, which was established based on the studies mainly in Escherichia coli K12, appears to be the most derived and optimized form. It is found only in E. coli and related Proteobacteria. Simpler and probably less efficient pathways are found in other bacterial groups, with Kdo2-lipid A variants as the likely end products. The Kdo2-lipid A biosynthetic pathway exemplifies extremely plastic evolution of bacterial genomes, especially those of Proteobacteria, and how these mainly pathogenic bacteria have adapted to their environment.« less

Multiplex identification of sepsis-causing Gram-negative pathogens from the plasma of infected blood.

PubMed

Chung, Boram; Park, Chulmin; Cho, Sung-Yeon; Shin, Juyoun; Shin, Sun; Yim, Seon-Hee; Lee, Dong-Gun; Chung, Yeun-Jung

2018-02-01

Early and accurate detection of bacterial pathogens in the blood is the most crucial step for sepsis management. Gram-negative bacteria are the most common organisms causing severe sepsis and responsible for high morbidity and mortality. We aimed to develop a method for rapid multiplex identification of clinically important Gram-negative pathogens and also validated whether our system can identify Gram-negative pathogens with the cell-free plasm DNA from infected blood. We designed five MLPA probe sets targeting the genes specific to major Gram-negative pathogens (uidA and lacY for E. coli, ompA for A. baumannii, phoE for K. pneumoniae, and ecfX for P. aeruginosa) and one set targeting the CTX-M group 1 to identify the ESBL producing Gram-negative pathogens. All six target-specific peaks were clearly separated without any non-specific peaks in a multiplex reaction condition. The minimum detection limit was 100 fg of pathogen DNA. When we tested 28 Gram-negative clinical isolates, all of them were successfully identified without any non-specific peaks. To evaluate the clinical applicability, we tested seven blood samples from febrile patients. Three blood culture positive cases showed E. coli specific peaks, while no peak was detected in the other four culture negative samples. This technology can be useful for detection of major sepsis-causing, drug-resistant Gram-negative pathogens and also the major ESBL producing Gram-negatives from the blood of sepsis patients in a clinical setting. This system can help early initiation of effective antimicrobial treatment against Gram-negative pathogens for sepsis patients, which is very crucial for better treatment outcomes. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

77 FR 68789 - Establishing a List of Qualifying Pathogens That Have the Potential To Pose a Serious Threat to...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-11-16

... or life-threatening infections caused by bacteria or fungi. For an application for a drug that is...) multi-drug resistant [G]ram[- ]negative bacteria, including Acinetobacter, Klebsiella, Pseudomonas, and...

Bacteriocins active against multi-resistant gram negative bacteria implicated in nosocomial infections.

PubMed

Ghodhbane, Hanen; Elaidi, Sabrine; Sabatier, Jean-Marc; Achour, Sami; Benhmida, Jeannette; Regaya, Imed

2015-01-01

Multiresistant Gram-negative bacteria are the prime mover of nosocomial infections. Some are naturally resistant to antibiotics, their genetic makes them insensitive to certain families of antibiotics and they transmit these resistors to their offspring. Moreover, when bacteria are subjected to antibiotics, they eventually develop resistance against drugs to which they were previously sensitive. In recent years, many bacteriocins active against gram-negative bacteria have been identified proving their efficacy in treating infections. While further investigation remains necessary before the possibilities for bacteriocins in clinical practice can be described more fully, this review provides an overview of bacteriocins acting on the most common infectious gram negative bacteria (Klebsiella, Acinetobacter, Pseudomonas aeruginosa and E. coli).

Antibiofilm effect of Nocardiopsis sp. GRG 1 (KT235640) compound against biofilm forming Gram negative bacteria on UTIs.

PubMed

Rajivgandhi, Govindan; Vijayan, Ramachandran; Maruthupandy, Muthuchamy; Vaseeharan, Baskaralingam; Manoharan, Natesan

2018-05-01

Urinary tract infections (UTIs) are diverse public health complication and caused by range of pathogens, however mostly Gram negative bacteria cause significant life threatening risks to different populations. The prevalence rate and antimicrobial resistance among the Gram negative uropathogens alarmed significantly heighten the economic burden of these infections. In this study, we investigated the antibiofilm efficiency of Pyrrolo [1,2-a] pyrazine-1,4-dione,hexahydro-3-(2-methylpropyl) extracted from endophytic actinomycetes Nocardiopsis sp. GRG 1 (KT235640) against P. mirabilis and E. coli. The extracted compound was characterized through TLC, HPLC, GC-MS, LC-MS and confocal laser scanning microscopy (CLSM), scanning electron microscopy (SEM). The compound, Pyrrolo [1,2-a] pyrazine-1, 4-dione, hexahydro-3-(2-methylpropyl) inhibits both bacterial biofilm formation as well as reduces the viability of preformed biofilms. Furthermore, CLSM image shows cell shrinkage, disorganized cell membrane and loss of viability. The SEM result also confirms the cell wall degradation in treated cells of the bacteria. Hence, the Pyrrolo [1,2-a]pyrazine-1,4-dione, hexahydro-3-(2-methylpropyl) is active against P. mirabilis and E. coli. Copyright © 2018 Elsevier Ltd. All rights reserved.

Bacteria causing bacteremia in pediatric cancer patients presenting with febrile neutropenia--species distribution and susceptibility patterns.

PubMed

Miedema, Karin G E; Winter, Rik H L J; Ammann, Roland A; Droz, Sara; Spanjaard, Lodewijk; de Bont, Eveline S J M; Kamps, Willem A; van de Wetering, Marianne D; Tissing, Wim J E

2013-09-01

Infections are a major cause of morbidity and mortality in pediatric cancer patients. The aim of this study was to establish the microbiological spectrum and the susceptibility patterns of bacteremia-causing bacteria in pediatric cancer patients with febrile neutropenia in relation to the use of prophylactic and empirical antibiotics. We analyzed positive blood cultures of pediatric cancer patients presenting with febrile neutropenia between 2004 and 2011 in Groningen and Amsterdam (the Netherlands) and in Bern (Switzerland), using different antibiotic prophylactic and empirical regimens. A total of 156 patients with 202 bacteremias, due to 248 bacteria species, were enrolled. The majority (73%) of bacteremias were caused by Gram-positive bacteria. Gram-negative bacteria, especially Pseudomonas aeruginosa, were observed significantly more often in Bern, where no fluoroquinolone prophylaxis was used. Ciprofloxacin-resistant bacteria were cultured more often from patients who did receive ciprofloxacin prophylaxis, compared to the patients who did not (57 versus 11%, p = 0.044). Gram-positive bacteria predominated in this study. We showed that the use of prophylactic antibiotics in pediatric cancer patients was associated with increased resistance rates, which needs further study. The strategy for empiric antimicrobial therapy for febrile neutropenia should be adapted to local antibiotic resistance patterns.

Bloodstream infections in patients with hematological malignancies: which is more fatal – cancer or resistant pathogens?

PubMed Central

Gedik, Habip; Şimşek, Funda; Kantürk, Arzu; Yildirmak, Taner; Arica, Deniz; Aydin, Demet; Demirel, Naciye; Yokuş, Osman

2014-01-01

Background The primary objective of this study was to report the incidence of bloodstream infections (BSIs) and clinically or microbiologically proven bacterial or fungal BSIs during neutropenic episodes in patients with hematological malignancies. Methods In this retrospective observational study, all patients in the hematology department older than 14 years who developed febrile neutropenia during chemotherapy for hematological cancers were evaluated. Patients were included if they had experienced at least one neutropenic episode between November 2010 and November 2012 due to chemotherapy in the hematology ward. Results During 282 febrile episodes in 126 patients, 66 (23%) episodes of bacteremia and 24 (8%) episodes of fungemia were recorded in 48 (38%) and 18 (14%) patients, respectively. Gram-negative bacteria caused 74% (n=49) of all bacteremic episodes. Carbapenem-resistant Gram-negative bacteria (n=6) caused 12% and 9% of Gram-negative bacteremia episodes and all bacteremia episodes, respectively. Carbapenem-resistant Gram-negative bacteria included Acinetobacter baumannii (n=4), Pseudomonas aeruginosa (n=1), and Serratia marcescens (n=1). Culture-proven invasive fungal infection occurred in 24 episodes in 18 cases during the study period, with 15 episodes in ten cases occurring in the first study year and nine episodes in eight cases in the second study year. In 13 of 18 cases (72%) with bloodstream yeast infections, previous azole exposure was recorded. Candida parapsilosis, C. glabrata, and C. albicans isolates were resistant to voriconazole and fluconazole. Conclusion BSIs that occur during febrile neutropenic episodes in hematology patients due to Gram-negative bacteria should be treated initially with non-carbapenem-based antipseudomonal therapy taking into consideration antimicrobial stewardship. Non-azole antifungal drugs, including caspofungin and liposomal amphotericin B, should be preferred as empirical antifungal therapy in the events of possible or probable invasive fungal infections with an absence of pulmonary findings due to increase azole resistance. PMID:25258539

Differential staining of bacteria: gram stain.

PubMed

Moyes, Rita B; Reynolds, Jackie; Breakwell, Donald P

2009-11-01

In 1884, Hans Christian Gram, a Danish doctor, developed a differential staining technique that is still the cornerstone of bacterial identification and taxonomic division. This multistep, sequential staining protocol separates bacteria into four groups based on cell morphology and cell wall structure: Gram-positive cocci, Gram-negative cocci, Gram-positive rods, and Gram-negative rods. The Gram stain is useful for assessing bacterial contamination of tissue culture samples or for examining the Gram stain status and morphological features of bacteria isolated from mixed or isolated bacterial cultures. (c) 2009 by John Wiley & Sons, Inc.

Caspase-11 cleaves gasdermin D for non-canonical inflammasome signalling.

PubMed

Kayagaki, Nobuhiko; Stowe, Irma B; Lee, Bettina L; O'Rourke, Karen; Anderson, Keith; Warming, Søren; Cuellar, Trinna; Haley, Benjamin; Roose-Girma, Merone; Phung, Qui T; Liu, Peter S; Lill, Jennie R; Li, Hong; Wu, Jiansheng; Kummerfeld, Sarah; Zhang, Juan; Lee, Wyne P; Snipas, Scott J; Salvesen, Guy S; Morris, Lucy X; Fitzgerald, Linda; Zhang, Yafei; Bertram, Edward M; Goodnow, Christopher C; Dixit, Vishva M

2015-10-29

Intracellular lipopolysaccharide from Gram-negative bacteria including Escherichia coli, Salmonella typhimurium, Shigella flexneri, and Burkholderia thailandensis activates mouse caspase-11, causing pyroptotic cell death, interleukin-1β processing, and lethal septic shock. How caspase-11 executes these downstream signalling events is largely unknown. Here we show that gasdermin D is essential for caspase-11-dependent pyroptosis and interleukin-1β maturation. A forward genetic screen with ethyl-N-nitrosourea-mutagenized mice links Gsdmd to the intracellular lipopolysaccharide response. Macrophages from Gsdmd(-/-) mice generated by gene targeting also exhibit defective pyroptosis and interleukin-1β secretion induced by cytoplasmic lipopolysaccharide or Gram-negative bacteria. In addition, Gsdmd(-/-) mice are protected from a lethal dose of lipopolysaccharide. Mechanistically, caspase-11 cleaves gasdermin D, and the resulting amino-terminal fragment promotes both pyroptosis and NLRP3-dependent activation of caspase-1 in a cell-intrinsic manner. Our data identify gasdermin D as a critical target of caspase-11 and a key mediator of the host response against Gram-negative bacteria.

The Importance of Mean Neutrophil Volume (MNV) Values in Differential Diagnosis of Bacterial Sepsis.

PubMed

Şafak, Birol; Baykan, Özgür; Kılınç, Osman; Özer Yıldırım, Diğdem

2017-01-01

Bloodstream infections are a significant cause of morbidity and mortality in hospitalized patients. Blood cultures and other laboratory tests are used for diagnosis. Among these tests, the mean neutrophil volume (MNV) value is reported as a potential indicator that supports the diagnosis of sepsis. Our study identified the MNV values of patients via microorganisms cultivated from blood cultures and examined the role of these MNV values in the early diagnosis of bloodstream infections. Our study surveyed retrospectively 148 adult patient blood culture samples that had been sent to our laboratory. BACTEC 9050 (Becton Dickinson, USA) and BACTEC FX 40 (Becton Dickinson, USA) devices were used in the blood culture isolation procedures. The average MNV value was found to be 159.0 (+11.3) in patients whose sepsis originated from Gram-negative bacteria, and the average MNV value was measured as 152.4 (+14.5) among patients whose sepsis originated from Gram-positive bacteria. When comparing groups of patients having Gram-negative bacteria and patients having Gram-positive bacteria, a statistically significant difference (p = 0.041) in the MNV values was observed. The MNV value was found to be statistically significant in discrimination of Gram-negative and Gram-positive sepsis. Considering these findings, measuring the MNV values can help initiate proper antibiotic treatment more quickly, and we think that this will help lower the mortality rate. However, these findings should be supported with further studies. Copyright © 2017 National Medical Association. Published by Elsevier Inc. All rights reserved.

Public health significance of antimicrobial-resistant gram-negative bacteria in raw bulk tank milk.

PubMed

Straley, B A; Donaldson, S C; Hedge, N V; Sawant, A A; Srinivasan, V; Oliver, S P; Jayarao, B M

2006-01-01

The dairy farm environment and animals on the farm serve as important reservoirs of pathogenic and commensal bacteria that could potentially gain access to milk in the bulk tank via several pathways. Pathogenic gram-negative bacteria can gain access to bulk tank milk from infected mammary glands, contaminated udders and milking machines, and/or from the dairy farm environment. Contaminated raw milk when consumed by humans or fed to animals on the farm can result in gastroenteric infections in humans and animals and also provide an opportunity for organisms to colonize the farm environment. This scenario becomes much more complicated when pathogenic bacteria such as Salmonella, Shiga toxin-producing Escherichia coli, and commensal gram-negative enteric bacteria encode for antimicrobial resistance determinants. In recent years, the role of commensal bacteria as reservoirs of genetic determinants for antimicrobial resistance has come under closer scrutiny. Commensal bacteria in bulk tank milk can be a significant reservoir of antimicrobial determinants. Raw milk consumption can result in exposure to antimicrobial-resistant commensal gram-negative bacteria. This paper examines the prevalence and role of commensal gram-negative enteric bacteria in bulk tank milk and their public health significance.

Growth-Inhibiting and morphostructural effects of constituents identified in Asarum heterotropoides root on human intestinal bacteria

PubMed Central

2013-01-01

Background The growth-inhibiting and morphostructural effects of seven constituents identified in Asarum heterotropoides root on 14 intestinal bacteria were compared with those of the fluoroquinolone antibiotic ciprofloxacin. Method A microtiter plate-based bioassay in sterile 96-well plates was used to evaluate the minimal inhibitory concentrations (MICs) of the test materials against the organisms. Results δ-3-Carene (5) exhibited the most potent growth inhibition of Gram-positive bacteria (Clostridium difficile ATCC 9689, Clostridium paraputrificum ATCC 25780, Clostridium perfringens ATCC 13124, and Staphylococcus aureus ATCC 12600) and Gram-negative bacteria (Escherichia coli ATCC 11775 and Bacteroides fragilis ATCC 25285) (minimal inhibitory concentrations (MIC), 0.18–0.70 mg/mL) except for Salmonella enterica serovar Typhimurium ATCC 13311 (MIC, 2.94 mg/mL). The MIC of methyleugenol (2), 1,8-cineole (3), α-asarone (4), (−)-asarinin (6), and pellitorine (7) was between 1.47 and 2.94 mg/mL against all test bacteria (except for compound 2 against C. difficile (0.70 mg/mL); compounds 1 (23.50 mg/mL) and 4 (5.80 mg/mL) against C. paraputricum; compounds 2 (5.80 mg/mL), 4 (12.0 mg/mL), and 7 (0.70 mg/mL) against C. perfringens); compound 1 against E. coli (7.20 mg/mL) and S. enterica serovar Typhimurium (12.0 mg/mL). Overall, all of the constituents were less potent at inhibiting microbial growth than ciprofloxacin (MIC, 0.063–0.25 mg/ mL). The lactic acid-producing bacteria (four bifidobacteria and two lactobacilli) and one acidulating bacterium Clostridium butyricum ATCC 25779 were less sensitive and more susceptible than the five harmful bacteria and two nonpathogenic bacteria (B. fragilis and E. coli) to the constituents and to ciprofloxacin, respectively. Beneficial Gram-positive bacteria and harmful and nonpathogenic Gram-negative bacteria were observed to have different degrees of antimicrobial susceptibility to the constituents, although the antimicrobial susceptibility of the harmful Gram-positive bacteria and the harmful and nonpathogenic Gram-negative bacteria was not observed. Scanning electron microscopy observations showed different degrees of physical damage and morphological alteration to both Gram-positive and Gram-negative bacteria treated with α-asarone, δ-3-carene, pellitorine, or ciprofloxacin, indicating that they do not share a common mode of action. Conclusion A. heterotropoides root-derived materials described merit further study as potential antibacterial products or lead molecules for the prevention or eradication from humans from diseases caused by harmful intestinal bacteria. PMID:24083511

Neonatal infections due to multi-resistant strains: Epidemiology, current treatment, emerging therapeutic approaches and prevention.

PubMed

Tzialla, Chryssoula; Borghesi, Alessandro; Pozzi, Margherita; Stronati, Mauro

2015-12-07

Severe infections represent the main cause of neonatal mortality accounting for more than one million neonatal deaths worldwide every year. Antibiotics are the most commonly prescribed medications in neonatal intensive care units. The benefits of antibiotic therapy when indicated are clearly enormous, but the continued and widespread use of antibiotics has generated over the years a strong selective pressure on microorganisms, favoring the emergence of resistant strains. Health agencies worldwide are galvanizing attention toward antibiotic resistance in gram-positive and gram-negative bacteria. Infections in neonatal units due to multidrug and extensively multidrug resistant bacteria are rising and are already seriously challenging antibiotic treatment options. While there is a growing choice of agents against multi-resistant gram-positive bacteria, new options for multi-resistant gram-negative bacteria in the clinical practice have decreased significantly in the last 20 years making the treatment of infections caused by multidrug-resistant pathogens challenging mostly in neonates. Treatment options are currently limited and will be some years before any new treatment for neonates become available for clinical use, if ever. The aim of the review is to highlight the current knowledge on antibiotic resistance in the neonatal population, the possible therapeutic choices, and the prevention strategies to adopt in order to reduce the emergency and spread of resistant strains. Copyright © 2015 Elsevier B.V. All rights reserved.

Microwave-accelerated cytochemical stains for the image analysis and the electron microscopic examination of light microscopy diagnostic slides.

PubMed

Hanker, J; Giammara, B

1993-01-01

Recent studies in our laboratories have shown how microwave (MW) irradiation can accelerate a number of tissue-processing techniques, especially staining, to aid in the preparation of single specimens on glass microscope slides or coverslips for examination by light microscopy (and electron microscopy, if required) for diagnostic purposes. Techniques have been developed, which give permanently stained preparations, that can be studied initially by light microscopy, their areas of interest mapped, and computer-automated image analysis performed to obtain quantitative information. This is readily performed after MW-accelerated staining with silver methenamine by the Giammara-Hanker PATS or PATS-TS reaction. This variation of the PAS reaction gives excellent markers for specific infectious agents such as lipopolysaccharides for gram-negative bacteria or mannans for fungi. It is also an excellent stain for glycogen and basement membranes and an excellent marker for type III collagen or reticulin in the endoneurium or perineurium of peripheral nerve or in the capillary walls. Our improved MW-accelerated Feulgen reaction with silver methenamine for nuclear DNA is useful to show the nuclei of bacteria and fungi as well as of cells they are infecting. Improved coating and penetration of tissue surfaces by thiocarbohydrazide bridging of ruthenium red, applied under MW-acceleration, render biologic specimens sufficiently conductive for SEM so that sputter coating with gold is unnecessary. The specimens treated with these highly visible electron-opaque stains can be screened with the light microscope after mounting in polyethylene glycol (PEG) and the structures or areas selected for EM study are mapped with a Micro-Locator slide. After removal of the water soluble PEG the specimens are remounted in the usual EM media for scanning electron microscopy (SEM) or transmission electron microscopy (TEM) study of the mapped areas. By comparing duplicate smears from areas of infection, such as two coverslips of buffy coat smears of blood from a patient with septicemia, the microorganisms responsible can occasionally be classified for antimicrobial therapy long before culture results are available; gram-negative bacteria are positive with the Giammara-Hanker PATS-TS stain, and gram-positive bacteria are positive with the SIGMA HT40 Gram stain. The gram-positive as well as gram-negative bacteria are both initially stained by the crystal violet component of the Gram stain. The crystal violet stain is readily removed from the gram-negative (but not the gram-positive) bacteria when the specimens are rinsed with alcohol/acetone. If this rinse step is omitted, the crystal violet remains attached to both gram-negative and gram-positive bacteria. It can then be rendered insoluble, electron-opaque, and conductive by treatment with silver methenamine solution under MW-irradiation. This metallized crystal violet is a more effective silver stain than the PATS-TS stain for a number of gram-negative spirochetes such as Treponema pallidum, the microbe that causes syphilis.

A bivalent cationic dye enabling selective photo-inactivation against Gram-negative bacteria.

PubMed

Li, Ke; Zhang, Yang-Yang; Jiang, Guo-Yu; Hou, Yuan-Jun; Zhang, Bao-Wen; Zhou, Qian-Xiong; Wang, Xue-Song

2015-05-07

A piperazine-modified Crystal Violet was found to be able to selectively inactivate Gram-negative bacteria upon visible light irradiation but left Gram-positive bacteria less damaged, which can serve as a blueprint for the development of novel narrow-spectrum agents to replenish the current arsenal of photodynamic antimicrobial chemotherapy (PACT).

Silver enhances antibiotic activity against gram-negative bacteria.

PubMed

Morones-Ramirez, J Ruben; Winkler, Jonathan A; Spina, Catherine S; Collins, James J

2013-06-19

A declining pipeline of clinically useful antibiotics has made it imperative to develop more effective antimicrobial therapies, particularly against difficult-to-treat Gram-negative pathogens. Silver has been used as an antimicrobial since antiquity, yet its mechanism of action remains unclear. We show that silver disrupts multiple bacterial cellular processes, including disulfide bond formation, metabolism, and iron homeostasis. These changes lead to increased production of reactive oxygen species and increased membrane permeability of Gram-negative bacteria that can potentiate the activity of a broad range of antibiotics against Gram-negative bacteria in different metabolic states, as well as restore antibiotic susceptibility to a resistant bacterial strain. We show both in vitro and in a mouse model of urinary tract infection that the ability of silver to induce oxidative stress can be harnessed to potentiate antibiotic activity. Additionally, we demonstrate in vitro and in two different mouse models of peritonitis that silver sensitizes Gram-negative bacteria to the Gram-positive-specific antibiotic vancomycin, thereby expanding the antibacterial spectrum of this drug. Finally, we used silver and antibiotic combinations in vitro to eradicate bacterial persister cells, and show both in vitro and in a mouse biofilm infection model that silver can enhance antibacterial action against bacteria that produce biofilms. This work shows that silver can be used to enhance the action of existing antibiotics against Gram-negative bacteria, thus strengthening the antibiotic arsenal for fighting bacterial infections.

[Clinical analysis for patients with continuous ambulatory peritoneal dialysis associated peritonitis].

PubMed

Liu, Jian; Huang, Xun; Liu, Yao; Xu, Hui; Gong, Rui'e; Li, Chunhui

2016-12-28

To analyze the clinical characteristics of continuous ambulatory peritoneal dialysis (CAPD) associated peritonitis in the tertiary hospitals and to discuss the preventive and therapeutic strategy.
 Methods: The clinical characteristics, pathogens, resistance and outcomes of 126 CAPD associated peritonitis in 104 patients from Jan, 2013 to June, 2016, were retrospectively analyzed.
 Results: Among the patients, the incidence rates of abdominal pain, fever, diarrhea and emesis were 104 (82.54%), 56 (44.44%), 49 (38.89%), and 31 (23.60%), respectively. Among them, 88 patients suffered peritonitis once, other 16 patients suffered multiple peritonitis or recurrent peritonitis for 38 times. Among the 38 times, the numbers for recurrent, repeated or catheter-associated peritonitis were 2, 2, or 3, respectively. Peritoneal fluids from 103 cases were cultured, and 64 cases were positive in bacteria, with a rate of 62.14%. A total of 70 strains of bacteria were separated, including 42 strains of gram-positive bacteria, 21 strains of gram-negative bacteria, and 7 strains of fungus. The most common gram-positive pathogens were Staphylococcus epidermidis, Enterococcus faecalis and Staphylococcus haemolyticus, while Escherichia coli, Klebsiella pneumoniae and Klebsiella pneumoniae were the most common gram-negative bacteria. Candida albicans was the major fungal pathogens. Gram-positive cocci showed resistance to gentamycin, levofloxacin, moxifloxacin, vancomycin and linezolid, with a rate at 20.00%, 36.11%, 5%, 0%, and 0%, respectively. The gram-negative bacilli were resistent to cefoperazone/sulbactam, gentamycin, cephazolin, and ceftazidime, with a rate at 6.25%, 10.53%, 64.29%, and 15.38%, respectively. There were no imipenem, amikacin, piperacillin/tazobactam-resistant strains were found.
 Conclusion: The most common pathogen causing CAPD associated peritonitis is gram-positive bacteria. It is crucial to take the anti-infection therapy for CAPD associated peritonitis early. The positive rates for bacterial culture need to be enhanced through improvement of methods. At the same time, doctors could improve the outcome of CAPD associated peritonitis by adjusting the medication according to the drug sensitivity results.

Synthesis, characterization, antimicrobial activity and theoretical studies of new thiophene-based tripodal ligands

NASA Astrophysics Data System (ADS)

Harit, Tarik; Bellaouchi, Reda; Asehraou, Abdeslam; Rahal, Mahmoud; Bouabdallah, Ibrahim; Malek, Fouad

2017-04-01

The synthesis of new thiophene-tripods with different side arms was reported. These compounds were obtained in good yields and their structures were confirmed by NMR spectroscopy, elemental analysis, infrared spectroscopy and mass spectrometry. The in vitro antibacterial and antifungal activities of these products were screened against Gram positive bacteria (Micrococcus luteus and Bacillus subtilis), Gram negative bacteria (Escherichia coli) and fungi (Candida pelliculosa). The obtained results showed that tripods containing a hydroxyl group in the side arm inhibited both Gram-positive and Gram-negative bacteria, while the tripod with an isopropyl side arm inhibited only the Gram-negative bacteria. DFT calculations with B3LYP/6-31G* level have been used to analyze the electronic and geometric characteristics. The molecular electrostatic potential surface (MEPS) indicated that the presence of electrophile site in the side arm could be responsible for activities against Gram-positive bacteria.

The comparison of pyrosequencing molecular Gram stain, culture, and conventional Gram stain for diagnosing orthopaedic infections.

PubMed

Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Lieberman, Isador H; Krebs, Viktor; Togawa, Daisuke; Fujishiro, Takaaki; Procop, Gary W

2006-08-01

We have developed a combined real-time PCR and pyrosequencing assay that successfully differentiated the vast majority of gram-positive and gram-negative bacteria when bacterial isolates were tested. The purpose of this study was to evaluate this assay on clinical specimens obtained from orthopedic surgeries, and to prospectively compare the results of "molecular Gram stain" with culture and conventional direct Gram stain. Forty-five surgical specimens were obtained from patients who underwent orthopedic surgery procedures. The DNA was extracted and a set of broad-range PCR primers that targeted a part of the 16S rDNA gene was used for pan-bacterial PCR. The amplicons were submitted for pyrosequencing and the resulting molecular Gram stain characteristics were recorded. Culture and direct Gram staining were performed using standard methods for all cases. Surgical specimens were reviewed histologically for all cases that had a discrepancy between culture and molecular results. There was an 86.7% (39/45) agreement between the traditional and molecular methods. In 12/14 (85.7%) culture-proven cases of bacterial infection, molecular Gram stain characteristics were in agreement with the culture results, while the conventional Gram stain result was in agreement only for five cases (35.7%). In the 31 culture negative cases, 27 cases were also PCR negative, whereas 4 were PCR positive. Three of these were characterized as gram negative and one as gram positive by this molecular method. Molecular determination of the Gram stain characteristics of bacteria that cause orthopedic infections may be achieved, in most instances, by this method. Further studies are necessary to understand the clinical importance of PCR-positive/culture-negative results.

Multidrug-resistant organisms in neonatal sepsis in two tertiary neonatal ICUs, Egypt.

PubMed

Awad, Hesham A; Mohamed, Maha H; Badran, Nabil F; Mohsen, Manal; Abd-Elrhman, Al-Sayed A

2016-03-01

Neonatal sepsis remains a serious problem in any neonatal intensive care unit (NICU). Bacterial organisms have developed increased resistance to commonly used antibiotics. Because not enough data are available from Egypt, the aim of the present study was to determine the causative bacteria and the level of their resistance to commonly used antibiotics in tertiary NICUs in Cairo, Egypt. A 3.5-year retrospective study was carried out at NICUs of the Children's Hospital of Ain Shams University and that of El-Hussein Hospital, Al-Azhar University, Egypt. Records of neonates were reviewed. All neonates with culture-proven sepsis were included in the study. Almost one-third of the admitted neonates (33.4%) were diagnosed as having neonatal sepsis, 32.25% of them culture-proven. Early/late onset sepsis was found in 35.4 and 64.6%, respectively. Gram-negative/gram-positive bacteria was found in 68 to 25.6%. Fungal infection was detected in 9% of the isolates. Escherichia coli was the main pathogen isolated in both early-onset sepsis (41.2%) and late-onset sepsis (24.5%). Overall, 77% of the isolates were multidrug-resistant (60% of gram-positive bacteria and 83.4% of gram-negative bacteria). Nearly 80% (79%) of mortality was caused by multidrug-resistant organisms. Gram-positive and gram-negative bacteria showed high resistance against commonly used antibiotics such as ampicillin, amoxicillin, cefotaxime, ceftriaxone, and gentamicin. There is an alarming increase in antibiotic resistance to the commonly used antibiotics. Continuous surveillance for antibiotic susceptibility is needed to ensure proper empirical therapy. Improvement of infection control practices, avoidance of irrational use of antibiotics, and revision of the protocols are mandatory in the prevention of neonatal sepsis.

Human bactericidal/permeability-increasing protein and a recombinant NH2-terminal fragment cause killing of serum-resistant gram-negative bacteria in whole blood and inhibit tumor necrosis factor release induced by the bacteria.

PubMed Central

Weiss, J; Elsbach, P; Shu, C; Castillo, J; Grinna, L; Horwitz, A; Theofan, G

1992-01-01

The bactericidal/permeability-increasing protein (BPI) of neutrophils and BPI fragments neutralize the effects of isolated Gram-negative bacterial lipopolysaccharides both in vitro and in vivo. Since endotoxin most commonly enters the host as constituents of invading Gram-negative bacteria, we raised the question: Can BPI and its bioactive fragments also protect against whole bacteria? To determine whether the bactericidal and endotoxin-neutralizing activities of BPI/fragments are expressed when Gram-negative bacteria are introduced to the complex environment of whole blood we examined the effects of added BPI and proteolytically prepared and recombinant NH2-terminal fragments on: (a) the fate of serum-resistant encapsulated Escherichia coli, Klebsiella pneumoniae, and Pseudomonas aeruginosa that survive the antibacterial actions of whole blood and (b) the ability of these bacteria to trigger cytokine release. Added BPI in nanomolar concentrations killed each of three encapsulated strains of E. coli and in closely parallel fashion inhibited tumor necrosis factor (TNF) release. Holo-BPI and its NH2-terminal fragment were equipotent toward a rough LPS chemotype K1-encapsulated strain, but the fragment was substantially more potent than holo-BPI toward two encapsulated smooth LPS chemotype strains. TNF release induced by K. pneumoniae and P. aeruginosa was also inhibited by both holo-BPI and fragment but, at the protein concentrations tested, P. aeruginosa was killed only by the fragment and K. pneumoniae was not killed by either protein. The bactericidal action of BPI/fragment toward E. coli is inhibited by C7-depleted serum, but accelerated by normal serum, indicating that BPI, acting in synergy with late complement components, enhances extracellular killing of serum-resistant bacteria. Thus, BPI and an even more potent NH2-terminal fragment may protect against Gram-negative bacteria in the host by blocking bacterial proliferation as well as endotoxin-mediated effects, not only as components of the intracellular antibacterial arsenal of the neutrophil, but also as potentially therapeutic extracellular agents. PMID:1522221

Human bactericidal/permeability-increasing protein and a recombinant NH2-terminal fragment cause killing of serum-resistant gram-negative bacteria in whole blood and inhibit tumor necrosis factor release induced by the bacteria.

PubMed

Weiss, J; Elsbach, P; Shu, C; Castillo, J; Grinna, L; Horwitz, A; Theofan, G

1992-09-01

The bactericidal/permeability-increasing protein (BPI) of neutrophils and BPI fragments neutralize the effects of isolated Gram-negative bacterial lipopolysaccharides both in vitro and in vivo. Since endotoxin most commonly enters the host as constituents of invading Gram-negative bacteria, we raised the question: Can BPI and its bioactive fragments also protect against whole bacteria? To determine whether the bactericidal and endotoxin-neutralizing activities of BPI/fragments are expressed when Gram-negative bacteria are introduced to the complex environment of whole blood we examined the effects of added BPI and proteolytically prepared and recombinant NH2-terminal fragments on: (a) the fate of serum-resistant encapsulated Escherichia coli, Klebsiella pneumoniae, and Pseudomonas aeruginosa that survive the antibacterial actions of whole blood and (b) the ability of these bacteria to trigger cytokine release. Added BPI in nanomolar concentrations killed each of three encapsulated strains of E. coli and in closely parallel fashion inhibited tumor necrosis factor (TNF) release. Holo-BPI and its NH2-terminal fragment were equipotent toward a rough LPS chemotype K1-encapsulated strain, but the fragment was substantially more potent than holo-BPI toward two encapsulated smooth LPS chemotype strains. TNF release induced by K. pneumoniae and P. aeruginosa was also inhibited by both holo-BPI and fragment but, at the protein concentrations tested, P. aeruginosa was killed only by the fragment and K. pneumoniae was not killed by either protein. The bactericidal action of BPI/fragment toward E. coli is inhibited by C7-depleted serum, but accelerated by normal serum, indicating that BPI, acting in synergy with late complement components, enhances extracellular killing of serum-resistant bacteria. Thus, BPI and an even more potent NH2-terminal fragment may protect against Gram-negative bacteria in the host by blocking bacterial proliferation as well as endotoxin-mediated effects, not only as components of the intracellular antibacterial arsenal of the neutrophil, but also as potentially therapeutic extracellular agents.

Frequency and antimicrobial susceptibility of gram-negative bacteria isolated from 2 hospitals in Makkah, Saudi Arabia.

PubMed

Asghar, Atif H; Faidah, Hani S

2009-08-01

To estimate the prevalence and antibiotic susceptibility of the gram-negative bacteria isolated from 2 hospitals in Makkah. This study was undertaken in 2 main tertiary care hospitals namely; Al-Noor Specialist Hospital, and Hera Hospital in Makkah, Kingdom of Saudi Arabia from October 2005 to March 2006. A total of 1137 gram-negative bacteria were identified in non-duplicate clinical specimens obtained from 965 patients of various body sites infections. Demographic data, identity of microorganisms, and antimicrobial susceptibilities were obtained from medical and laboratory records. The most prevalent gram-negative bacteria were Escherichia coli (31.6%), and Pseudomonas aeruginosa (31.2%), followed by Acinetobacter baumannii (10.8%), Klebsiella pneumoniae (8.3%), Klebsiella sp. (6.2%), Haemophilus influenzae (3.7%), Proteus sp. (3.3%), and Enterobacter sp. (1.9%). Results demonstrated that gram-negative bacteria have a high rate of resistance to commonly used antibiotics. Furthermore, multi-drug resistance was also common in this study. Our data showed a high rate of resistance among gram-negative pathogens in comparison with other countries in the world. The implementation of monitoring programs is an important part of the prevention strategy against the development of antibiotic resistance in hospitals.

Chemical modification of capuramycins to enhance antibacterial activity

PubMed Central

Bogatcheva, Elena; Dubuisson, Tia; Protopopova, Marina; Einck, Leo; Nacy, Carol A.; Reddy, Venkata M.

2011-01-01

Objectives To extend capuramycin spectrum of activity beyond mycobacteria and improve intracellular drug activity. Methods Three capuramycin analogues (SQ997, SQ922 and SQ641) were conjugated with different natural and unnatural amino acids or decanoic acid (DEC) through an ester bond at one or more available hydroxyl groups. In vitro activity of the modified compounds was determined against Mycobacterium spp. and representative Gram-positive and Gram-negative bacteria. Intracellular activity was evaluated in J774A.1 mouse macrophages infected with Mycobacterium tuberculosis (H37Rv). Results Acylation of SQ997 and SQ641 with amino undecanoic acid (AUA) improved in vitro activity against most of the bacteria tested. Conjugation of SQ922 with DEC, but not AUA, improved its activity against Gram-positive bacteria. In the presence of efflux pump inhibitor phenylalanine arginine β-naphthyl amide, MICs of SQ997-AUA, SQ641-AUA and SQ922-DEC compounds improved even further against drug-susceptible and drug-resistant Staphylococcus aureus. In Gram-negative bacteria, EDTA-mediated permeabilization caused 4- to 16-fold enhancement of the activity of AUA-conjugated SQ997, SQ922 and SQ641. Conjugation of all three capuramycin analogues with AUA improved intracellular killing of H37Rv in murine macrophages. Conclusions Conjugation of capuramycin analogues with AUA or DEC enhanced in vitro activity, extended the spectrum of activity in Gram-positive bacteria and increased intracellular activity against H37Rv. PMID:21186194

Phytochemical investigation and anti-microbial activity of Clausena anisata (Willd), Hook.

PubMed

Agyepong, Nicholas; Agyare, Christian; Adarkwa-Yiadom, Martin; Gbedema, Stephen Yao

2014-01-01

Clausena anisata belongs to the family Rutaceae, a shrub widely used in West Africa for the treatment of bacterial and fungal infections of the skin including boils, ringworm and eczema. The study was designed to evaluate the antimicrobial activity and phytochemical screening of ethanol leaf extract of C. anisata (CLE). Antimicrobial activity of CLE was investigated using agar well diffusion and micro-dilution methods against four Gram-positive bacteria (Bacillus substilis NCTC 10073, Staphylococcus aureus ATCC 25923, Enterococcus faecalis ATCC 29212, Bacillus thuringiensis ATCC 13838) and two Gram-negative bacteria (Pseudomonas aeruginosa ATCC 4853, Proteus vulgaris ATCC 4175) and a clinical isolate of Candida albicans. CLE was active against all test organisms with minimum inhibitory concentration (MIC), range of 0.5 to 7.0 mg/mL against Gram-positive bacteria, 2.5 to 1.0 mg/mL against Gram-negative bacteria and 5.5mg/mL against C. albicans. The MICs of the methanol fraction of CLE were 0.6 mg to 5.0/mL and 1.0 to 3.0 mg/mL for Gram-positive and Gram-negative bacteria respectively. Chloroform fraction had MIC of 3.0 to 7.5 mg/mL and 2.0 to 6.5 mg/mL for Gram-positive and Gram-negative bacteria, respectively and petroleum ether fraction had 4.5 to 8.0 mg/mL for Gram-positive and Gram-negative bacteria. The CLE exhibited static action against all test organisms within a range of 0.5 to 22.0 mg/mL. Phytochemical screening of C. anisata revealed the presence of tannins, flavonoids, steroids, saponins, glycosides and alkaloids. HPLC finger-printing of the CLE and its fractions were determined. These results may justify the medicinal uses of C. anisata for the treatment of microbial infections.

Bacterial Colonization of Disposable Soft Contact Lenses Is Greater during Corneal Infiltrative Events than during Asymptomatic Extended Lens Wear

PubMed Central

Sankaridurg, Padmaja R.; Sharma, Savitri; Willcox, Mark; Naduvilath, Thomas J.; Sweeney, Deborah F.; Holden, Brien A.; Rao, Gullapalli N.

2000-01-01

Microorganisms, especially gram-negative bacteria, are considered to play a role in the etiology of certain corneal infiltrative events (CIEs) observed during soft contact lens wear. This study explored the possibility of microbial colonization of soft contact lenses as a risk factor leading to CIEs. In a clinical trial conducted from March 1993 to January 1996, 330 subjects wore disposable soft contact lenses on a 6-night extended-wear and disposal schedule. During this period, 4,321 lenses (118 during CIEs; 4,203 during asymptomatic lens wear) were recovered aseptically and analyzed for microbial colonization. A greater percentage of lenses were free from microbial colonization during asymptomatic wear than during CIEs (42 versus 23%; P < 0.0001). The incidence of gram-positive bacteria, gram-negative bacteria and fungi was greater during CIEs than during asymptomatic lens wear (P < 0.05). During asymptomatic lens wear, gram-positive bacteria were isolated most frequently and were usually normal external ocular microbiota. Of the gram-positive bacteria, the incidence of Streptococcus pneumoniae was greater during CIE than during asymptomatic wear (7.6 versus 0.6%; P < 0.0001). While gram-negative bacteria were seen in few cases during asymptomatic wear, their incidence during CIE in comparison to asymptomatic wear was substantial and significant (23.7 versus 3.8%; P < 0.0001). Also, the level of colonization was high. Of CIEs, events of microbial keratitis, contact lens acute red eye, and asymptomatic infiltrative keratitis were associated with lens colonization with gram-negative bacteria or S. pneumoniae. Colonization of soft contact lenses with pathogenic bacteria, especially gram-negative bacteria and S. pneumoniae, appears to be a significant risk factor leading to CIE. PMID:11101574

Synthesis and structure-activity relationship of novel bisindole amidines active against MDR Gram-positive and Gram-negative bacteria.

PubMed

Liu, Yonghua; Hu, Xinxin; Wu, Yanbin; Zhang, Weixing; Chen, Xiaofang; You, Xuefu; Hu, Laixing

2018-04-25

A series of novel diamidines with N-substituents on an amidine N-atom were synthesized and evaluated for their cytotoxicity and in vitro antibacterial activity against a range of Gram-positive and Gram-negative bacterial strains. Based on structure-activity relationship, N-substituents with a branched chain and a shorter carbon chain on the amidine N-atom exhibited more promising activity against Gram-negative and MDR-Gram-positive bacteria; compounds 5c and 5i were the most powerful candidate compounds. Compound 5c showed greater efficacy than levofloxacin against most drug-resistant Gram-positive bacteria and exhibited broad-spectrum antibacterial activity against Gram-negative bacteria, with MIC values in the range of 2-16 μg/mL. Slightly more potent antibacterial activity against Klebsiella pneumoniae, Acinetobacter calcoaceticus, Enterobacter cloacae, and Proteus mirabilis was observed for 5i in comparison with 5c. Compound 5i also showed remarkable antibacterial activity against NDM-1-producing Gram-negative bacteria, with MIC values in the range of 2-4 μg/mL, and was superior to the reference drugs meropenem and levofloxacin. Effective antibacterial activity of 5i was also shown in vivo in a mouse model of Staphylococcus aureus MRSA strain, with an ED 50 values of 2.62 mg/kg. Copyright © 2018. Published by Elsevier Masson SAS.

An optimized staining technique for the detection of Gram positive and Gram negative bacteria within tissue.

PubMed

Becerra, Sandra C; Roy, Daniel C; Sanchez, Carlos J; Christy, Robert J; Burmeister, David M

2016-04-12

Bacterial infections are a common clinical problem in both acute and chronic wounds. With growing concerns over antibiotic resistance, treatment of bacterial infections should only occur after positive diagnosis. Currently, diagnosis is delayed due to lengthy culturing methods which may also fail to identify the presence of bacteria. While newer costly bacterial identification methods are being explored, a simple and inexpensive diagnostic tool would aid in immediate and accurate treatments for bacterial infections. Histologically, hematoxylin and eosin (H&E) and Gram stains have been employed, but are far from optimal when analyzing tissue samples due to non-specific staining. The goal of the current study was to develop a modification of the Gram stain that enhances the contrast between bacteria and host tissue. A modified Gram stain was developed and tested as an alternative to Gram stain that improves the contrast between Gram positive bacteria, Gram negative bacteria and host tissue. Initially, clinically relevant strains of Pseudomonas aeruginosa and Staphylococcus aureus were visualized in vitro and in biopsies of infected, porcine burns using routine Gram stain, and immunohistochemistry techniques involving bacterial strain-specific fluorescent antibodies as validation tools. H&E and Gram stain of serial biopsy sections were then compared to a modification of the Gram stain incorporating a counterstain that highlights collagen found in tissue. The modified Gram stain clearly identified both Gram positive and Gram negative bacteria, and when compared to H&E or Gram stain alone provided excellent contrast between bacteria and non-viable burn eschar. Moreover, when applied to surgical biopsies from patients that underwent burn debridement this technique was able to clearly detect bacterial morphology within host tissue. We describe a modification of the Gram stain that provides improved contrast of Gram positive and Gram negative microorganisms within host tissue. The samples used in this study demonstrate that this staining technique has laboratory and clinical applicability. This modification only adds minutes to traditional Gram stain with reusable reagents, and results in a cost- and time-efficient technique for identifying bacteria in any clinical biopsy containing connective tissue.

Antimicrobial effects of lysophosphatidylcholine on methicillin-resistant Staphylococcus aureus.

PubMed

Miyazaki, Haruko; Midorikawa, Naoko; Fujimoto, Saki; Miyoshi, Natsumi; Yoshida, Hideto; Matsumoto, Tetsuya

2017-07-01

Methicillin-resistant Staphylococcus aureus (MRSA) is an important health care-associated and community-associated pathogen and causes a large number of infections worldwide. For the purpose of application to topical treatment of MRSA infection, we examined the antimicrobial effects of lysophosphatidylcholine (LPC) on MRSA strains. We also investigated the combination effect of LPC and gentamicin on MRSA growth. The LPC minimum inhibitory concentrations (MIC) for Gram-positive ( S. aureus, Staphylococcus epidermidis , and Streptococcus pneumoniae ) and Gram-negative ( Escherichia coli, Enterobacter cloacae, Klebsiella pneumoniae , and Pseudomonas aeruginosa ) bacteria were measured by the broth microdilution method. The mechanism of LPC-mediated MRSA killing was investigated by membrane permeability analysis with DiSC3(5) fluorescence and growth curve analysis. Lastly, the effects of LPC on gentamicin-induced bactericidal activity were determined in combination treatment studies with 15 gentamicin-resistant MRSA isolates from the skin, nose, or ears. The LPC MIC for Gram-positive bacteria varied between 32 µg/ml and >2048 µg/ml, whereas that for all Gram-negative bacteria was >2048 µg/ml. Consistently, membrane permeability analysis showed that LPC was substantially more effective in inducing membrane permeability in Gram-positive bacteria than in Gram-negative counterparts. Growth curve analysis in cotreatment studies demonstrated that LPC has intrinsic bactericidal effects and can also potentiate gentamicin sensitivity in resistant MRSA strains. Our study demonstrates that LPC exhibits intrinsic antimicrobial effects and can enhance the antimicrobial effects of gentamicin for resistant MRSA strains, suggesting that LPC may be a beneficial additive in topical antibiotics for superficial skin infections.

Antimicrobial effects of lysophosphatidylcholine on methicillin-resistant Staphylococcus aureus

PubMed Central

Miyazaki, Haruko; Midorikawa, Naoko; Fujimoto, Saki; Miyoshi, Natsumi; Yoshida, Hideto; Matsumoto, Tetsuya

2017-01-01

Objectives: Methicillin-resistant Staphylococcus aureus (MRSA) is an important health care-associated and community-associated pathogen and causes a large number of infections worldwide. For the purpose of application to topical treatment of MRSA infection, we examined the antimicrobial effects of lysophosphatidylcholine (LPC) on MRSA strains. We also investigated the combination effect of LPC and gentamicin on MRSA growth. Methods: The LPC minimum inhibitory concentrations (MIC) for Gram-positive (S. aureus, Staphylococcus epidermidis, and Streptococcus pneumoniae) and Gram-negative (Escherichia coli, Enterobacter cloacae, Klebsiella pneumoniae, and Pseudomonas aeruginosa) bacteria were measured by the broth microdilution method. The mechanism of LPC-mediated MRSA killing was investigated by membrane permeability analysis with DiSC3(5) fluorescence and growth curve analysis. Lastly, the effects of LPC on gentamicin-induced bactericidal activity were determined in combination treatment studies with 15 gentamicin-resistant MRSA isolates from the skin, nose, or ears. Results: The LPC MIC for Gram-positive bacteria varied between 32 µg/ml and >2048 µg/ml, whereas that for all Gram-negative bacteria was >2048 µg/ml. Consistently, membrane permeability analysis showed that LPC was substantially more effective in inducing membrane permeability in Gram-positive bacteria than in Gram-negative counterparts. Growth curve analysis in cotreatment studies demonstrated that LPC has intrinsic bactericidal effects and can also potentiate gentamicin sensitivity in resistant MRSA strains. Conclusions: Our study demonstrates that LPC exhibits intrinsic antimicrobial effects and can enhance the antimicrobial effects of gentamicin for resistant MRSA strains, suggesting that LPC may be a beneficial additive in topical antibiotics for superficial skin infections. PMID:28748087

Dustborne and airborne gram-positive and gram-negative bacteria in high versus low ERMI homes

EPA Science Inventory

The study aimed at investigating Gram-positive and Gram-negative bacteria in moldy and non-moldy homes, as defined by the home's Environmental Relative Moldiness Index (ERMI) value. The ERMI values were determined from floor dust samples in 2010 and 2011 and homes were classified...

The role of guanosine-3',5'-bis-pyrophosphate in mediating antimicrobial activity of the antibiotic 3,5-dihydroxy-4-ethyl-trans-stilbene.

PubMed Central

Sundar, L; Chang, F N

1992-01-01

The mode of action of 3,5-dihydroxy-4-ethyl-trans-stilbene (ES), an antibiotic produced by Xenorhabdus luminescens symbiotically associated with an entomopathogenic nematode, was investigated. ES was active against gram-positive and a number of gram-negative bacteria. In susceptible bacteria this antibiotic caused the inhibition of total RNA synthesis and, to a lesser extent, protein synthesis. At or above MICs, ES triggered a substantial accumulation of an intracellular regulatory compound, guanosine-3',5'-bis-pyrophosphate (ppGpp). This response was also noticed in species of bacteria which have previously not been shown to use ppGpp as a regulatory molecule. The involvement of ppGpp in antibiotic action was confirmed by using an isogenic stringent and a relaxed pair of Escherichia coli strains. The fact that the accumulation of ppGpp was correlated with the susceptibility of various gram-positive and gram-negative bacteria to ES suggests that this nucleotide is involved in the regulation of RNA synthesis and growth in all these microorganisms. Thus, inhibition of RNA synthesis via an increase in ppGpp concentrations may represent a mechanism that is prevalent among most bacteria and one that could be exploited for achieving a rapid inhibition of bacterial growth. Images PMID:1282791

Evaluation of the in vitro growth of urinary tract infection-causing gram-negative and gram-positive bacteria in a proposed synthetic human urine (SHU) medium.

PubMed

Ipe, Deepak S; Ulett, Glen C

2016-08-01

Bacteriuria is a hallmark of urinary tract infection (UTI) and asymptomatic bacteriuria (ABU), which are among the most frequent infections in humans. A variety of gram-negative and gram-positive bacteria are associated with these infections but Escherichia coli contributes up to 80% of cases. Multiple bacterial species including E. coli can grow in human urine as a means to maintain colonization during infections. In vitro bacteriuria studies aimed at modeling microbial growth in urine have utilized various compositions of synthetic human urine (SHU) and a Composite SHU formulation was recently proposed. In this study, we sought to validate the recently proposed Composite SHU as a medium that supports the growth of several bacterial species that are known to grow in normal human urine and/or artificial urine. Comparative growth assays of gram-negative and gram-positive bacteria E. coli, Pseudomonas aeruginosa, Proteus mirabilis, Streptococcus agalactiae, Staphylococcus saprophyticus and Enterococcus faecalis were undertaken using viable bacterial count and optical density measurements over a 48h culture period. Three different SHU formulations were tested in various culture vessels, shaking conditions and volumes and showed that Composite SHU can support the robust growth of gram-negative bacteria but requires supplementation with 0.2% yeast extract to support the growth of gram-positive bacteria. Experiments are also presented that show an unexpected but major influence of P. mirabilis towards the ability to measure bacterial growth in generally accepted multiwell assays using absorbance readings, predicted to have a basis in the release of volatile organic compound(s) from P. mirabilis during growth in Composite SHU medium. This study represents an essential methodological validation of a more chemically defined type of synthetic urine that can be applied to study mechanisms of bacteriuria and we conclude will offer a useful in vitro model to investigate the basis of some of the most common infections of humans. Copyright © 2016 Elsevier B.V. All rights reserved.

Working across the veterinary and human health sectors.

PubMed

Garcia-Alvarez, Laura; Dawson, Susan; Cookson, Barry; Hawkey, Peter

2012-07-01

Antibiotics are widely used in human and veterinary medicine for the prevention and treatment of infectious diseases. This practice has led to the emergence of antimicrobial-resistant bacteria in both humans and animals. The potential role that animals, particularly livestock, might play as potential reservoirs of antibiotic resistance genes has been recognized, and it is currently a cause of public health concern. The impact of animal and human antibiotic usage on the emergence and persistence of resistant bacteria and the precise transfer pathways for resistance genes between humans and animals are not currently fully understood. As part of the remit of the UK Advisory Committee on Antimicrobial Resistance and Healthcare-Associated Infection (ARHAI), two main areas were addressed, namely methicillin-resistant Staphylococcus aureus (MRSA) and multidrug-resistant Gram-negative bacteria, where both the human and veterinary health sectors share interests. We review the current knowledge of MRSA and resistant Gram-negative bacteria, and provide guidance on occupational risks for veterinary healthcare workers relating to animals infected or colonized with MRSA. Findings and recommendations for further work across disciplines and future research in multidrug-resistant Gram-negative bacteria are also presented. Working collaboratively across disciplines is essential in order to better understand and challenge an important human and animal health problem: antimicrobial resistance.

Gramicidin A Mutants with Antibiotic Activity against Both Gram-Positive and Gram-Negative Bacteria.

PubMed

Zerfas, Breanna L; Joo, Yechaan; Gao, Jianmin

2016-03-17

Antimicrobial peptides (AMPs) have shown potential as alternatives to traditional antibiotics for fighting infections caused by antibiotic-resistant bacteria. One promising example of this is gramicidin A (gA). In its wild-type sequence, gA is active by permeating the plasma membrane of Gram-positive bacteria. However, gA is toxic to human red blood cells at similar concentrations to those required for it to exert its antimicrobial effects. Installing cationic side chains into gA has been shown to lower its hemolytic activity while maintaining the antimicrobial potency. In this study, we present the synthesis and the antibiotic activity of a new series of gA mutants that display cationic side chains. Specifically, by synthesizing alkylated lysine derivatives through reductive amination, we were able to create a broad selection of structures with varied activities towards Staphylococcus aureus and methicillin-resistant S. aureus (MRSA). Importantly, some of the new mutants were observed to have an unprecedented activity towards important Gram-negative pathogens, including Escherichia coli, Klebsiella pneumoniae and Psuedomonas aeruginosa. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Weakening effect of cell permeabilizers on gram-negative bacteria causing biodeterioration.

PubMed

Alakomi, H-L; Paananen, A; Suihko, M-L; Helander, I M; Saarela, M

2006-07-01

Gram-negative bacteria play an important role in the formation and stabilization of biofilm structures on stone surfaces. Therefore, the control of growth of gram-negative bacteria offers a way to diminish biodeterioration of stone materials. The effect of potential permeabilizers on the outer membrane (OM) properties of gram-negative bacteria was investigated and further characterized. In addition, efficacy of the agents in enhancing the activity of a biocide (benzalkonium chloride) was assessed. EDTA, polyethylenimine (PEI), and succimer (meso-2,3-dimercaptosuccinic) were shown to be efficient permeabilizers of the members of Pseudomonas and Stenotrophomonas genera, as indicated by an increase in the uptake of a hydrophobic probe (1-N-phenylnaphthylamine) and sensitization to hydrophobic antibiotics. Visualization of Pseudomonas cells treated with EDTA or PEI by atomic force microscopy revealed damage in the outer membrane structure. PEI especially increased the surface area and bulges of the cells. Topographic images of EDTA-treated cells were compatible with events assigned for the effect of EDTA on outer membranes, i.e., release of lipopolysaccharide and disintegration of OM structure. In addition, the effect of EDTA treatment was visualized in phase-contrast images as large areas with varying hydrophilicity on cell surfaces. In liquid culture tests, EDTA and PEI supplementation enhanced the activity of benzalkonium chloride toward the target strains. Use of permeabilizers in biocide formulations would enable the use of decreased concentrations of the active biocide ingredient, thereby providing environmentally friendlier products.

[Prevalence and features of pathogenic bacteria in the department of hematology without bone marrow transplantation in Peking Union Medical College Hospital from 2010 to 2012].

PubMed

Wnag, Lu; Yang, Chen; Zhang, Qian; Han, Bing; Zhuang, Jun-jing; Chen, Miao; Zou, Nong; Li, Jian; Duan, Ming-hui; Zhang, Wei; Zhu, Tie-nan; Xu, Ying; Wang, Shu-jie; Zhou, Dao-bin; Zhao, Yong-qiang; Zhang, Hui; Wang, Peng; Xu, Ying-chun

2014-08-01

To investigate the incidence, pathogens, and clinical features of infection in consecutive cases from 2010 to 2012 in Peking Union Medical College Hospital. The incidence, pathogen, treatment, and outcomes of patients with hematological diseases who had positive findings of bacterium in their samples from 2010 to 2012 were retrospectively analyzed. There were 449 positive samples (5.8%) from 4 890 patients during this period, among which 388 were proved to be with pathogenic bacteria. Samples separated from patients with community-aquired infections accounted for 8.4% of all positive samples. Most community-aquired infections were caused by Gram-negative bacteria (75%), although no multidrug-resistant bacteria was observed. Samples separated from patients with nosocomial infections accounted for 91.6% of all positive samples. Respiratory tract (49.4%) and peripheral blood (32.6%) were the most common samples with positive results. Skin soft tissues (10.4%), and urine (3.7%) were less common samples. Most of the pathogenic bacteria of the nosocomial infections were Gram-negative (66.9%). The most common Gram-negative bacteria included Escherichia coli (13.8%), Pseudomonas aeruginosa (12.1%), and Klebsiella pneumonia (12.1%), while Staphylococcus aureus (10.4%), Enterococcus faecium (7.0%), and Staphylococcus epidermidis (5.1%) were the most common Gram-positive bacteria. Gram-negative bacteria consisted of most of sputum samples and peripheral blood samples. Samples from the surface of skin wound and anal swab were composed largely by Gram-positive bacteria (63.8%). The detection rates of extended-spectrum beta-lactamase-producing Klebsiella pneumonia/Klebsiella oxytoca, Escherichia coli, and Proteus mirabilis were 24.0%, 87.9% and 38.4%, respectively. The resistance to Acinetobacter baumannii was serious. Multidrug-resistant, extensive drug resistant and pan drug resistant A. baumannii acountted for 74% of all A. Baumannii infections. Stenotrophomonas maltophilia showed low resistance to sulfamethoxazole/trimethoprim, levofloxacin and minocycline. Also, 22 methicillin-resistant Staphylococcus aureus and 9 methicillin-resistant Staphylococcus Epidermidis were detected, which were only sensitive to vancomycin, teicoplanin, and linezolid. All patients were treated in the haematology wards and most of them were under agranulocytosis or immunosuppression. Finally, 22 patients reached clinical recovery through anti-infective therapy, whereas 49 patients died. Among those deaths, 42 patients attributed to severe infections and infection-associated complications. Fourteen of all the deaths might be infected with drug-resistance bacteria. There were 61 samples proved to be bacteria colonization. Nonfermenters such as Acinetobacter baumannii and Stenotrophomonas maltophilia made up for a large amount of bacteria colonization. The pathogens of nosocomial infections in the hematology ward are mainly Gram-negative bacteria. The incidences and pathogens vary from different infection sites. Nosocomial infection still has a higher mortality rate. Once nonfermenters are detected positive, the pathogenic or colonial bacteria should be distinguished.

77 FR 11133 - Draft Guidance for Industry on Complicated Urinary Tract Infections: Developing Drugs for...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-24

... abnormalities of the urinary tract, but are also considered to be a subset of cUTI. Different types of bacteria can cause cUTI, but Gram-negative bacteria are most often associated with cUTI. This draft guidance..., based on resolution of clinical symptoms and eradication of bacteria from the urinary tract, was derived...

Recovery of metallo-tolerant and antibiotic resistant psychrophilic bacteria from Siachen glacier, Pakistan.

PubMed

Rafiq, Muhammad; Hayat, Muhammad; Anesio, Alexandre M; Jamil, Syed Umair Ullah; Hassan, Noor; Shah, Aamer Ali; Hasan, Fariha

2017-01-01

Cultureable bacterial diversity of previously unexplored Siachen glacier, Pakistan, was studied. Out of 50 isolates 33 (66%) were Gram negative and 17 (34%) Gram positive. About half of the isolates were pigment producers and were able to grow at 4-37°C. 16S rRNA gene sequences revealed Gram negative bacteria dominated by Proteobacteria (especially γ-proteobacteria and β-proteobacteria) and Flavobacteria. The genus Pseudomonas (51.51%, 17) was dominant among γ- proteobacteria. β-proteobacteria constituted 4 (12.12%) Alcaligenes and 4 (12.12%) Janthinobacterium strains. Among Gram positive bacteria, phylum Actinobacteria, Rhodococcus (23.52%, 4) and Arthrobacter (23.52%, 4) were the dominating genra. Other bacteria belonged to Phylum Firmicutes with representative genus Carnobacterium (11.76%, 2) and 4 isolates represented 4 genera Bacillus, Lysinibacillus, Staphylococcus and Planomicrobium. Most of the Gram negative bacteria were moderate halophiles, while most of the Gram positives were extreme halophiles and were able to grow up to 6.12 M of NaCl. More than 2/3 of the isolates showed antimicrobial activity against multidrug resistant S. aureus, E. coli, Klebsiella pneumonia, Enterococcus faecium, Candida albicans, Aspergillus flavus and Aspergillus fumigatus and ATCC strains. Gram positive bacteria (94.11%) were more resistant to heavy metals as compared to Gram negative (78.79%) and showed maximum tolerance against iron and least tolerance against mercury.

Recovery of metallo-tolerant and antibiotic resistant psychrophilic bacteria from Siachen glacier, Pakistan

PubMed Central

Rafiq, Muhammad; Hayat, Muhammad; Anesio, Alexandre M.; Jamil, Syed Umair Ullah; Hassan, Noor; Shah, Aamer Ali

2017-01-01

Cultureable bacterial diversity of previously unexplored Siachen glacier, Pakistan, was studied. Out of 50 isolates 33 (66%) were Gram negative and 17 (34%) Gram positive. About half of the isolates were pigment producers and were able to grow at 4–37°C. 16S rRNA gene sequences revealed Gram negative bacteria dominated by Proteobacteria (especially γ-proteobacteria and β-proteobacteria) and Flavobacteria. The genus Pseudomonas (51.51%, 17) was dominant among γ- proteobacteria. β-proteobacteria constituted 4 (12.12%) Alcaligenes and 4 (12.12%) Janthinobacterium strains. Among Gram positive bacteria, phylum Actinobacteria, Rhodococcus (23.52%, 4) and Arthrobacter (23.52%, 4) were the dominating genra. Other bacteria belonged to Phylum Firmicutes with representative genus Carnobacterium (11.76%, 2) and 4 isolates represented 4 genera Bacillus, Lysinibacillus, Staphylococcus and Planomicrobium. Most of the Gram negative bacteria were moderate halophiles, while most of the Gram positives were extreme halophiles and were able to grow up to 6.12 M of NaCl. More than 2/3 of the isolates showed antimicrobial activity against multidrug resistant S. aureus, E. coli, Klebsiella pneumonia, Enterococcus faecium, Candida albicans, Aspergillus flavus and Aspergillus fumigatus and ATCC strains. Gram positive bacteria (94.11%) were more resistant to heavy metals as compared to Gram negative (78.79%) and showed maximum tolerance against iron and least tolerance against mercury. PMID:28746396

Antibiotic susceptibility of isolates from paediatric intensive care units in Zagreb.

PubMed

Bedenić, Branka; Prahin, Esmina; Vranić-Ladavac, Mirna; Atalić, Vlasta; Sviben, Mario; Frančula-Zaninović, Sonja; Plečko, Vanda; Kalenić, Smilja

2014-02-01

Meropenem Yearly Susceptibility Test Information Collection (MYSTIC) Program is a longitudinal global surveillance study to monitor in vitro data on microbial susceptibility in centers that prescribe meropenem. Results of the six years period (2002-2007) for the antimicrobial efficacy of meropenem compared to other broad-spectrum agents against Gram-negative and Gram-positive isolates collected at pediatric intensive care units of the University Hospital Center Zagreb in Croatia were reported. A total of 110 Gram-negative and 43 Gram-positive pathogens from pediatric specimens were tested. The minimum-inhibitory concentrations (MICs) were determined by broth microdilution method according to CLSI. There was no resistance to either imipenem or meropenem observed for Escherichia coli, Klebsiella pneumoniae and Proteus mirabilis. High resistance rates of K. pneumoniae to ceftazidime and gentamicin (50%) are a raising concern. Pseudomonas aeruginosa was the most resistant Gram-negative species with two (12%) of the strains resistant to meropenem, three (18%) to imipenem, 10 (47%) to gentamicin and six (35%) to piperacillin/tazobactam and ciprofloxacin. According to our results meropenem remains an appropriate antibiotic for the treatment of severe infections caused by Gram-negative bacteria in pediatric population. The results indicate that meropenem has excellent potency and spectrum of activity despite being prescribed for a long time for the treatment of seriously ill patients, and still appears to be a reliable option for the initial empirical therapy of serious nosocomial infections in children. However, later studies have shown the emergence of carbapenem-resistant Gram-negative bacteria after 2008.

Plasmid-Mediated Antibiotic Resistance and Virulence in Gram-Negatives: the Klebsiella pneumoniae Paradigm.

PubMed

Ramirez, Maria S; Traglia, German M; Lin, David L; Tran, Tung; Tolmasky, Marcelo E

2014-10-01

Plasmids harbor genes coding for specific functions including virulence factors and antibiotic resistance that permit bacteria to survive the hostile environment found in the host and resist treatment. Together with other genetic elements such as integrons and transposons, and using a variety of mechanisms, plasmids participate in the dissemination of these traits, resulting in the virtual elimination of barriers among different kinds of bacteria. In this article we review the current information about the physiology of plasmids and their role in virulence and antibiotic resistance from the Gram-negative opportunistic pathogen Klebsiella pneumoniae. This bacterium has acquired multidrug resistance and is the causative agent of serious community- and hospital-acquired infections. It is also included in the recently defined ESKAPE group of bacteria that cause most U.S. hospital infections.

Plasmid-Mediated Antibiotic Resistance and Virulence in Gram-negatives: the Klebsiella pneumoniae Paradigm.

PubMed

Ramirez, Maria S; Traglia, German M; Lin, David L; Tran, Tung; Tolmasky, Marcelo E

Plasmids harbor genes coding for specific functions including virulence factors and antibiotic resistance that permit bacteria to survive the hostile environment found in the host and resist treatment. Together with other genetic elements such as integrons and transposons, and using a variety of mechanisms, plasmids participate in the dissemination of these traits resulting in the virtual elimination of barriers among different kinds of bacteria. In this article we review the current information about physiology and role in virulence and antibiotic resistance of plasmids from the gram-negative opportunistic pathogen Klebsiella pneumoniae . This bacterium has acquired multidrug resistance and is the causative agent of serious communityand hospital-acquired infections. It is also included in the recently defined ESKAPE group of bacteria that cause most of US hospital infections.

Rapid, highly sensitive detection of Gram-negative bacteria with lipopolysaccharide based disposable aptasensor.

PubMed

Zhang, Jian; Oueslati, Rania; Cheng, Cheng; Zhao, Ling; Chen, Jiangang; Almeida, Raul; Wu, Jayne

2018-07-30

Gram-negative bacteria are one of the most common microorganisms in the environment. Their differential detection and recognition from Gram-positive bacteria has been attracting much attention over the years. Using Escherichia coli (E. coli) as a model, we demonstrated on-site detection of Gram-negative bacteria by an AC electrokinetics-based capacitive sensing method using commercial microelectrodes functionalized with an aptamer specific to lipopolysaccharides. Dielectrophoresis effect was utilized to enrich viable bacteria to the microelectrodes rapidly, achieving a detection limit of 10 2 cells/mL within a 30 s' response time. The sensor showed a negligible response to Staphylococcus aureus (S. aureus), a Gram-positive species. The developed sensor showed significant advantages in sensitivity, selectivity, cost, operation simplicity, and response time. Therefore, this sensing method has shown great application potential for environmental monitoring, food safety, and real-time diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

Breaking barriers: expansion of the use of endolysins as novel antibacterials against Gram-negative bacteria.

PubMed

Briers, Yves; Lavigne, Rob

2015-01-01

The emergence and spread of antibiotic-resistant bacteria drives the search for novel classes of antibiotics to replenish our armamentarium against bacterial infections. This is particularly critical for Gram-negative pathogens, which are intrinsically resistant to many existing classes of antibiotics due to the presence of a protective outer membrane. In addition, the antibiotics development pipeline is mainly oriented to Gram-positive pathogens such as methicillin-resistant Staphylococcus aureus. A promising novel class of antibacterials is endolysins. These enzymes encoded by bacterial viruses hydrolyze the peptidoglycan layer with high efficiency, resulting in abrupt osmotic lysis and cell death. Their potential as novel antibacterials to treat Gram-positive bacteria has been extensively demonstrated; however, the Gram-negative outer membrane has presented a formidable barrier for the use of endolysins against Gram-negatives until recently. This review reports on the most recent advances in the development of endolysins to kill Gram-negative species with a special focus on endolysin-engineered Artilysins(®).

An Automated Sample Preparation Instrument to Accelerate Positive Blood Cultures Microbial Identification by MALDI-TOF Mass Spectrometry (Vitek®MS).

PubMed

Broyer, Patrick; Perrot, Nadine; Rostaing, Hervé; Blaze, Jérome; Pinston, Frederic; Gervasi, Gaspard; Charles, Marie-Hélène; Dachaud, Fabien; Dachaud, Jacques; Moulin, Frederic; Cordier, Sylvain; Dauwalder, Olivier; Meugnier, Hélène; Vandenesch, Francois

2018-01-01

Sepsis is the leading cause of death among patients in intensive care units (ICUs) requiring an early diagnosis to introduce efficient therapeutic intervention. Rapid identification (ID) of a causative pathogen is key to guide directed antimicrobial selection and was recently shown to reduce hospitalization length in ICUs. Direct processing of positive blood cultures by MALDI-TOF MS technology is one of the several currently available tools used to generate rapid microbial ID. However, all recently published protocols are still manual and time consuming, requiring dedicated technician availability and specific strategies for batch processing. We present here a new prototype instrument for automated preparation of Vitek ® MS slides directly from positive blood culture broth based on an "all-in-one" extraction strip. This bench top instrument was evaluated on 111 and 22 organisms processed using artificially inoculated blood culture bottles in the BacT/ALERT ® 3D (SA/SN blood culture bottles) or the BacT/ALERT Virtuo TM system (FA/FN Plus bottles), respectively. Overall, this new preparation station provided reliable and accurate Vitek MS species-level identification of 87% (Gram-negative bacteria = 85%, Gram-positive bacteria = 88%, and yeast = 100%) when used with BacT/ALERT ® 3D and of 84% (Gram-negative bacteria = 86%, Gram-positive bacteria = 86%, and yeast = 75%) with Virtuo ® instruments, respectively. The prototype was then evaluated in a clinical microbiology laboratory on 102 clinical blood culture bottles and compared to routine laboratory ID procedures. Overall, the correlation of ID on monomicrobial bottles was 83% (Gram-negative bacteria = 89%, Gram-positive bacteria = 79%, and yeast = 78%), demonstrating roughly equivalent performance between manual and automatized extraction methods. This prototype instrument exhibited a high level of performance regardless of bottle type or BacT/ALERT system. Furthermore, blood culture workflow could potentially be improved by converting direct ID of positive blood cultures from a batch-based to real-time and "on-demand" process.

Microbiology of primary acquired nasolacrimal duct obstruction: simple epiphora, acute dacryocystitis, and chronic dacryocystitis

PubMed Central

Pornpanich, Kanograt; Luemsamran, Panitee; Leelaporn, Amornrut; Santisuk, Jiraporn; Tesavibul, Nattaporn; Lertsuwanroj, Buntitar; Vangveeravong, Sumalee

2016-01-01

Purpose The aim of this study was to determine the microbiology of primary acquired nasolacrimal duct obstruction (PANDO) and its antimicrobial susceptibilities. Methods Ninety-three patients (100 eyes) diagnosed with PANDO, categorized as acute, chronic dacryocystitis, or simple epiphora, were prospectively enrolled. Lacrimal sac contents were cultured for aerobic and anaerobic bacteria and fungi. Cultured organisms were identified, and antimicrobial susceptibility testing was performed for aerobic bacteria. Results Seventy-nine of the 100 samples were culture positive. One hundred twenty-seven organisms were isolated, and 29 different species were identified. Most microorganisms were Gram-positive bacteria (45 samples or 57.0% of all positive culture samples), whereas Gram-negative bacteria, anaerobic bacteria, and fungi were found in 39 (49.4%), 24 (30.4%), and four samples (5.1%), respectively. The most frequently isolated group was coagulase-negative staphylococci (27.8%), followed by nonspore-forming Gram-positive rods (anaerobe) (17.7%) and Pseudomonas aeruginosa (15.2%). Of the 100 samples, five, 45, and 50 samples were obtained from patients with acute dacryocystitis, chronic dacryocystitis, and simple epiphora, respectively. Subgroup analysis showed that Gram-negative organisms were isolated more frequently from the chronic dacryocystitis subgroup than from the simple epiphora subgroup (P=0.012). Antimicrobial susceptibility testing demonstrated that ciprofloxacin was the most effective drug against all Gram-positive and Gram-negative organisms. Conclusion Patients with PANDO, with or without clinical signs of lacrimal infection, were culture positive. Gram-negative organisms were frequently isolated, which were different from previous studies. Ciprofloxacin was the most effective agent against all Gram-positive and Gram-negative organisms. PMID:26955261

Performance of Gram staining on blood cultures flagged negative by an automated blood culture system.

PubMed

Peretz, A; Isakovich, N; Pastukh, N; Koifman, A; Glyatman, T; Brodsky, D

2015-08-01

Blood is one of the most important specimens sent to a microbiology laboratory for culture. Most blood cultures are incubated for 5-7 days, except in cases where there is a suspicion of infection caused by microorganisms that proliferate slowly, or infections expressed by a small number of bacteria in the bloodstream. Therefore, at the end of incubation, misidentification of positive cultures and false-negative results are a real possibility. The aim of this work was to perform a confirmation by Gram staining of the lack of any microorganisms in blood cultures that were identified as negative by the BACTEC™ FX system at the end of incubation. All bottles defined as negative by the BACTEC FX system were Gram-stained using an automatic device and inoculated on solid growth media. In our work, 15 cultures that were defined as negative by the BACTEC FX system at the end of the incubation were found to contain microorganisms when Gram-stained. The main characteristic of most bacteria and fungi growing in the culture bottles that were defined as negative was slow growth. This finding raises a problematic issue concerning the need to perform Gram staining of all blood cultures, which could overload the routine laboratory work, especially laboratories serving large medical centers and receiving a large number of blood cultures.

The impact of metabolic state on Cd adsorption onto bacterial cells

USGS Publications Warehouse

Johnson, K.J.; Ams, D.A.; Wedel, A.N.; Szymanowski, J.E.S.; Weber, D.L.; Schneegurt, M.A.; Fein, J.B.

2007-01-01

This study examines the effect of bacterial metabolism on the adsorption of Cd onto Gram-positive and Gram-negative bacterial cells. Metabolically active Gram-positive cells adsorbed significantly less Cd than non-metabolizing cells. Gram-negative cells, however, showed no systematic difference in Cd adsorption between metabolizing and non-metabolizing cells. The effect of metabolism on Cd adsorption to Gram-positive cells was likely due to an influx of protons in and around the cell wall from the metabolic proton motive force, promoting competition between Cd and protons for adsorption sites on the cell wall. The relative lack of a metabolic effect on Cd adsorption onto Gram-negative compared to Gram-positive cells suggests that Cd binding in Gram-negative cells is focused in a region of the cell wall that is not reached, or is unaffected by this proton flux. Thermodynamic modeling was used to estimate that proton pumping causes the pH in the cell wall of metabolizing Gram-positive bacteria to decrease from the bulk solution value of 7.0 to approximately 5.7. ?? 2007 The Authors.

Surveillance of multidrug resistant uropathogenic bacteria in hospitalized patients in Indian

PubMed Central

Mishra, Monali Priyadarsini; Debata, Nagen Kumar; Padhy, Rabindra Nath

2013-01-01

Objective To record surveillance, antibiotic resistance of uropathogens of hospitalized patients over a period of 18 months. Methods Urine samples from wards and cabins were used for isolating urinary tract infection (UTI)-causing bacteria that were cultured on suitable selective media and identified by biochemical tests; and their antibiograms were ascertained by Kirby-Bauer's disc diffusion method, in each 6-month interval of the study period, using 18 antibiotics of five different classes. Results From wards and cabins, 1 245 samples were collected, from which 996 strains of bacteria belonging to 11 species were isolated, during April 2011 to September 2012. Two Gram-positive, Staphylococcus aureus (S. aureus) and Enterococcus faecalis (E. faecalis), and nine Gram-negative bacteria, Acinetobacter baumannii, Citrobacter sp., Escherichia coli, Enterobacter aerogenes, Klebsiella pneumoniae, Klebsiella oxytoca, Proteus mirabilis, Proteus vulgaris and Pseudomonas aeruginosa were isolated. Both S. aureus and E. faecalis were vancomycin resistant, and resistant-strains of all pathogens increased in each 6-month period of study. Particularly, all Gram-negatives were resistant to nitrofurantoin and co-trimoxazole, the most preferred antibiotics of empiric therapy for UTI. Conclusions Antibiograms of 11 UTI-causing bacteria recorded in this study indicated moderately higher numbers of strains resistant to each antibiotic studied, generating the fear of precipitating fervent episodes in public health particularly with bacteria, Acinetobacter baumannii, Escherichia coli, Klebsiella pneumoniae and S. aureus. Moreover, vancomycin resistance in strains of S. aureus and E. faecalis is a matter of concern. PMID:23620859

The effect of protein-coated contact lenses on the adhesion and viability of gram negative bacteria.

PubMed

Williams, Timothy J; Schneider, Rene P; Willcox, Mark D P

2003-10-01

Gram negative bacterial adhesion to contact lenses can cause adverse responses. During contact lens wear, components of the tear film adsorb to the contact lens. This study aimed to investigate the effect of this conditioning film on the viability of bacteria. Bacteria adhered to contact lenses which were either unworn, worn for daily-, extended- or overnight-wear or coated with lactoferrin or lysozyme. Numbers of viable and total cells were estimated. The number of viable attached cells was found to be significantly lower than the total number of cells on worn (50% for strain Paer1 on daily-wear lenses) or lactoferrin-coated lenses (56% for strain Paer1). Lysozyme-coated lenses no statistically significant effect on adhesion. The conditioning film gained through wear may not inhibit bacterial adhesion, but may act adversely upon those bacteria that succeed in attaching.

Transient sensitivity to nisin in cold-shocked Gram negatives.

PubMed

Boziaris, I S; Adams, M R

2000-09-01

Rapid chilling in the presence of nisin caused a dose-dependent reduction in the populations of several Gram-negative bacteria, despite the fact that appreciable structural injury to the outer membrane was not detected. Pseudomonas aeruginosa was most affected, followed by Pseudomonas fragi, Salmonella enteritidis PT4, PT7 and Escherichia coli, respectively. Addition of nisin after the chilling treatment had no effect. The results are ascribed to a transient susceptibility caused by phase changes in the lipids associated with the outer membrane, which are rapidly reversed when the cells return to higher temperatures. Combinations of chilling shock, nisin and EDTA gave much lower reductions of Salmonella and Pseudomonas on chicken skin in comparison with broths. This is attributed to a buffering of the temperature shock experienced by adherent bacteria and binding of the nisin by food particles.

Effects of Hangeshashinto on Growth of Oral Microorganisms

PubMed Central

Fukamachi, Haruka; Matsumoto, Chinami; Omiya, Yuji; Arimoto, Takafumi; Kataoka, Hideo; Kadena, Miki; Funatsu, Takahiro; Fukutake, Masato; Kase, Yoshio; Kuwata, Hirotaka

2015-01-01

Oral mucositis (OM) in cancer patients induced by chemotherapy or radiotherapy has a significant impact on quality of life, and causes considerable morbidity. Oral microorganisms are likely to intensify the inflammatory process and aggravate the formation of ulcers. Hangeshashinto (HST), a Japanese kampo medicine, has been reported to be effective when used as a gargle for the treatment of OM. To clarify the effects of HST on oral microorganisms, we assessed its antimicrobial activity against 27 microbial species, including 19 oral bacteria and one fungus. HST extract inhibited the growth of Gram-negative bacteria, including Fusobacterium nucleatum, Porphyromonas gingivalis, Porphyromonas endodontalis, Prevotella intermedia, Prevotella melaninogenica, Tannerella forsythia, Treponema denticola, and Porphyromonas asaccharolytica, though inhibitory effects were less pronounced for Gram-positive bacteria and the fungal strain. We then investigated the effects of antibacterial activities on 15 purified ingredients of HST and determined that baicalein, berberine, coptisine, [6]-shogaol, and homogentisic acid actively inhibited the growth of these bacteria. These findings showed that HST inhibits the growth of specific Gram-negative periodontopathogenic bacteria, which are significant pathogens in OM, without disturbing the normal oral flora. Our data suggest that HST may be a useful treatment for OM in patients undergoing anticancer treatment. PMID:26170876

[Etiology of pathogen-induced changes between the toes in patients working under moist conditions].

PubMed

Gründer, K; Kroker, A; Heppner, M; Marre, R

1988-11-15

Referring to recent studies, we discuss the epidemiology of tinea pedis and its position within the range of polyetiological foot infections caused by microbial agents. 201 industrial workers used to wear rubber boots because of moist working conditions were examined with regard to their feet. 107 of them showed clinically altered toe web; in 45 cases, we found ringworm infection (22.4%), in correlation to increased daily wearing time of rubber boots. 85 workers showed colonization of pathogenic bacteria (42.4%), especially gram-negative species (25.8%). Frequently, mixed infections were found. The clinical picture not always allows definite conclusions as to the causal agents. The symptom "maceration" is seen in each of the 3 pathogenic groups of germs (fungi, gram-positive pathogenic cocci, gram-negative bacteria), frequently in bacterial foot infections, especially gram-negative infections. Marked clinical symptoms involve increased infection rates. The predisposing factors to foot infection such as interdigital maceration and the promoting role of rubber boots have been confirmed. The final diagnosis is to be reassured by cultural investigations, in order to set up a specific treatment.

Rapid and reliable identification of Gram-negative bacteria and Gram-positive cocci by deposition of bacteria harvested from blood cultures onto the MALDI-TOF plate.

PubMed

Barnini, Simona; Ghelardi, Emilia; Brucculeri, Veronica; Morici, Paola; Lupetti, Antonella

2015-06-18

Rapid identification of the causative agent(s) of bloodstream infections using the matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) methodology can lead to increased empirical antimicrobial therapy appropriateness. Herein, we aimed at establishing an easier and simpler method, further referred to as the direct method, using bacteria harvested by serum separator tubes from positive blood cultures and placed onto the polished steel target plate for rapid identification by MALDI-TOF. The results by the direct method were compared with those obtained by MALDI-TOF on bacteria isolated on solid media. Identification of Gram-negative bacilli was 100 % concordant using the direct method or MALDI-TOF on isolated bacteria (96 % with score > 2.0). These two methods were 90 % concordant on Gram-positive cocci (32 % with score > 2.0). Identification by the SepsiTyper method of Gram-positive cocci gave concordant results with MALDI-TOF on isolated bacteria in 87 % of cases (37 % with score > 2.0). The direct method herein developed allows rapid identification (within 30 min) of Gram-negative bacteria and Gram-positive cocci from positive blood cultures and can be used to rapidly report reliable and accurate results, without requiring skilled personnel or the use of expensive kits.

Chemical characterization, antioxidant and antimicrobial activity of propolis obtained from Melipona quadrifasciata quadrifasciata and Tetragonisca angustula stingless bees.

PubMed

Torres, A R; Sandjo, L P; Friedemann, M T; Tomazzoli, M M; Maraschin, M; Mello, C F; Santos, A R S

2018-01-01

In this study, we investigated the chemical composition, and antioxidant and antibacterial properties of ethanolic extracts of propolis (EEP) from Melipona quadrifasciata quadrifasciata and Tetragonisca angustula. Chemical composition of EEP was determined by colorimetry and chromatographic (HPLC-DAD and UPLC-Q/TOF-MS/MS) analysis. Antimicrobial activity of EEP was evaluated against gram-positive (S. aureus, methicillin-resistant S. aureus, E. faecalis) and gram-negative (E. coli and K. pneumoniae) bacteria by the minimal inhibitory concentration (MIC) test using the microdilution method. Furthermore, the growth curve and integrity of cell membrane of S. aureus and E. coli were investigated using standard microbiological methods. HPLC-DAD analysis showed that the EEP of M. quadrifasciata quadrifasciata has a more complex chemical composition than the EEP of T. angustula. Moreover, UPLC-MS analyses of M. quadrifasciata quadrifascita indicated flavonoids and terpenes as major constituents. The bactericidal activity of both EEPs was higher against gram-positive bacteria than for gram-negative bacteria. The EEP from M. quadrifasciata quadrifasciata presented MIC values lower than the EEP from T. angustula for all tested bacteria. The EEP from M. quadrifasciata quadrifasciata caused lysis of the bacterial wall and release of intracellular components from both E. coli and S. aureus. Our findings indicate that the chemical composition of propolis from stingless bees is complex and depends on the species. The extract from M. quadrifasciata quadrifascita was more effective against gram-positive than gram-negative strains, especially against S. aureus and methicillin-resistant S. aureus compared to T. angustula extract, by a mechanism that involves disturbance of the bacterial cell membrane integrity.

Use of magnetic beads for Gram staining of bacteria in aqueous suspension.

PubMed

Yazdankhah, S P; Sørum, H; Larsen, H J; Gogstad, G

2001-12-01

A Gram staining technique was developed using monodisperse magnetic beads in concentrating bacteria in suspension for downstream application. The technique does not require heat fixation of organisms, electrical power, or a microscope. Gram-negative and Gram-positive bacteria were identified macroscopically based on the colour of the suspension. The bacteria concentrated on magnetic beads may also be identified microscopically.

Application of fluorescent microscopy and cascade filtration methods for analysis of soil microbial community

NASA Astrophysics Data System (ADS)

Ivanov, Konstantin; Pinchuk, Irina; Gorodnichev, Roman; Polyanskaya, Lubov

2016-04-01

Methods establishment of soil microbial cells size estimation called from the importance of current needs of research in microbial ecology. Some of the methods need to be improved for more detailed view of changes happen in microbiome of terrestrial ecosystems. The combination of traditional microscopy methods, fluorescence and filtration in addition to cutting-edge DNA analysis gives a wide range of the approaches for soil microbial ecologists in their research questions. In the most of the cases the bacterial cells size is limited of the natural conditions such as lack of nutrients or stress factors due to heterogeneity of soil system. In the samples of soils, lakes and rivers sediments, snow and rain water the bacterial cells were detected minimally of 0.2 microns. We established the combination of the cascade filtration and fluorescent microscopy for complex analysis of different terrestrial ecosystems and various soil types. Our modification based on the use of successively filtered soil suspension for collection of microbes by the membrane pores decrease. Combination with fluorescence microscopy and DNA analysis via FISH method gave the presentation of microbial interactions and review of ecological strategies of soil microorganisms. Humus horizons of primitive arctic soil were the most favorable for bacterial growth. Quantified biomass of soil bacteria depends on the dominance of cells with specific dimensions caused of stress factors. The average bacterial size of different soil varied from 0.23 to 0.38 microns, however in humus horizons of arctic soil we detected the contrast dominance of the bigger bacterial cells sized of 1.85 microns. Fungi in this case contributed to increase the availability of organic matter for bacteria because the fungal mycelium forms the appreciable part of microbial biomass of primitive arctic soil. The dominant content of bigger bacterial cells in forest and fallow soil as well as the opposite situation in arable soils caused by the availability of nutrients (glucose) and the degree of agricultural anthropogenic stress. Various combinations of factors such as stressful conditions (anaerobiosis, acidity and temperature) influenced on bacterial size. The decrease of these stress factors resulted in return to the original bacterial cell size in soil. Furthermore the modification of gram-negative bacteria quantification was performed and combined with FISH method and DNA extraction. We established the methodological comparison of gram-negative bacteria groups in aerobic and anaerobic conditions. Due to absence of significant difference between the most frequent soil gram-negative bacteria groups we concluded the important ecological role of gram-negative bacteria as common group of microorganisms in natural polymer degradation. Depending on nutrient (glucose, cellulose, chitin) gram-negative bacteria competed with actinomyces for available nutrients at the different time, what explained by the ecological flexibility of this soil bacteria group. The experiments showed expressed faster chitinolytic activity of soil gram-negative bacteria compare to actinomyces. Thus our approaches to use the combination both traditional and cutting-edge methods, forms the unique basement for various research and mostly open the wide doors to design new scientific experiments in ecology of terrestrial ecosystems and especially in soil microbial ecology.

Bacterial Iron Uptake Pathways: Gates for the Import of Bactericide Compounds.

PubMed

Schalk, Isabelle J; Mislin, Gaëtan L A

2017-06-08

Bacterial resistance to most antibiotics in clinical use has reached alarming proportions. A challenge for modern medicine will be to discover new antibiotics or strategies to combat multidrug resistant bacteria, especially Gram-negative bacteria for which the situation is particularly critical. Vectorization of bactericide compounds by siderophores (iron chelators produced by bacteria) is a promising strategy able to considerably increase the efficacy of drugs. Such a Trojan horse strategy can also extend activity of specific Gram-positive antibiotics to Gram-negative bacteria.

Novel pharmacotherapy for the treatment of hospital-acquired and ventilator-associated pneumonia caused by resistant gram-negative bacteria.

PubMed

Kidd, James M; Kuti, Joseph L; Nicolau, David P

2018-03-01

Hospital-acquired and ventilator-associated bacterial pneumonia (HABP/VABP) are among the most prevalent infections in hospitalized patients, particularly those in the intensive care unit. Importantly, the frequency of multidrug resistant (MDR) Gram-negative (GN) bacteria as the bacteriologic cause of HABP/VABP is increasing. These include MDR Pseudomonas aeruginosa, Acinetobacter baumannii, and carbapenem resistant Enterobacteriaceae (CRE). Few antibiotics are currently available when such MDR Gram-negatives are encountered and older agents such as polymyxin B, colistin (polymyxin E), and tigecycline have typically performed poorly in HABP/VABP. Areas covered: In this review, the authors summarize novel antibiotics which have reached phase 3 clinical trials including patients with HABP/VABP. For each agent, the spectrum of activity, pertinent pharmacological characteristics, clinical trial data, and potential utility in the treatment of MDR-GN HABP/VABP is discussed. Expert opinion: Novel antibiotics currently available, and those soon to be, will expand opportunities to treat HABP/VABP caused by MDR-GN organisms and minimize the use of more toxic, less effective drugs. However, with sparse clinical data available, defining the appropriate role for each of the new agents is challenging. In order to maximize the utility of these antibiotics, combination therapy and the role of therapeutic drug monitoring should be investigated.

Antimicrobial susceptibility pattern in diabetic foot ulcer: a pilot study.

PubMed

Sekhar, Sm; Vyas, N; Unnikrishnan, Mk; Rodrigues, Gs; Mukhopadhyay, C

2014-09-01

Diabetic foot infections (DFIs) are major public health problems and knowledge of microbes that cause infections are helpful to determine proper antibiotic therapy. The aim was to investigate the antimicrobial susceptibility pattern of microbes in DFIs. A cross-sectional study was conducted for a period of 6 months at the Department of General Surgery, KMC hospital, Manipal University, Manipal, India. During this period, 108 patients having DFIs admitted in the general surgery wards were tracked from the hospital data management system. These patients' pus samples were examined as Gram-stained smear and cultured aerobically on blood agar and MacConkey agar plates. Antimicrobial susceptibility test was performed by disc diffusion techniques according to Clinical and Laboratory Standards Institute guidelines. Of the 108 specimens of the diabetic foot lesions, culture showed polymicrobial growth in 44.4% (48/108). Prevalence of Gram-negative organisms (56%, 84/150) was found to be more than Gram-positive organisms (44%, 66/150). However, Staphylococcus aureus was the most frequent pathogen (28%, 42/150). All Gram-positive aerobes were sensitive to doxycycline. All Gram-negative isolates, including extended spectrum beta lactamase producing strains of Proteus mirabilis and Klebsiella oxytoca except Acinetobacter were highly sensitive to amikacin, cefoperazone/sulbactam, and meropenem. Acinetobacter was completely resistant to all the common antibiotics tested. Prevalence showed Gram-negative bacteria was slightly more than Gram-positive bacteria in diabetic foot ulcers. This study recommends doxycycline should be empirical treatment of choice for Gram-positive isolates and amikacin, cefoperazone/sulbactam, and meropenem should be considered for most of the Gram-negatives aerobes.

Inactivation dynamics of 222 nm krypton-chlorine excilamp irradiation on Gram-positive and Gram-negative foodborne pathogenic bacteria.

PubMed

Kang, Jun-Won; Kim, Sang-Soon; Kang, Dong-Hyun

2018-07-01

The object of this study was to elucidate the bactericidal mechanism of a 222 nm Krypton Chlorine (KrCl) excilamp compared with that of a 254 nm Low Pressure mercury (LP Hg) lamp. The KrCl excilamp had higher bactericidal capacity against Gram-positive pathogenic bacteria (Staphylococcus aureus and L. monocytogenes) and Gram-negative pathogenic bacteria (S. Typhimurium and E. coli O157:H7) than did the LP Hg lamp when cell suspensions in PBS were irradiated with each type of UV lamp. It was found out that the KrCl excilamp induced cell membrane damage as a form of depolarization. From the study of respiratory chain dehydrogenase activity and the lipid peroxidation assay, it was revealed that cell membrane damage was attributed to inactivation of enzymes related to generation of membrane potential and occurrence of lipid peroxidation. Direct absorption of UV radiation which led to photoreaction through formation of an excited state was one of the causes inducing cell damage. Additionally, generation of ROS and thus occurrence of secondary damage can be another cause. The LP Hg lamp only induced damage to DNA but not to other components such as lipids or proteins. This difference was derived from differences of UV radiation absorption by cellular materials. Copyright © 2018 Elsevier Ltd. All rights reserved.

Widespread Fosfomycin Resistance in Gram-Negative Bacteria Attributable to the Chromosomal fosA Gene

PubMed Central

Ito, Ryota; Tomich, Adam D.; Callaghan, Jake D.; McElheny, Christi L.; Mettus, Roberta T.; Sluis-Cremer, Nicolas

2017-01-01

ABSTRACT Fosfomycin is a decades-old antibiotic which is being revisited because of its perceived activity against many extensively drug-resistant Gram-negative pathogens. FosA proteins are Mn2+ and K+-dependent glutathione S-transferases which confer fosfomycin resistance in Gram-negative bacteria by conjugation of glutathione to the antibiotic. Plasmid-borne fosA variants have been reported in fosfomycin-resistant Escherichia coli strains. However, the prevalence and distribution of fosA in other Gram-negative bacteria are not known. We systematically surveyed the presence of fosA in Gram-negative bacteria in over 18,000 published genomes from 18 Gram-negative species and investigated their contribution to fosfomycin resistance. We show that FosA homologues are present in the majority of genomes in some species (e.g., Klebsiella spp., Enterobacter spp., Serratia marcescens, and Pseudomonas aeruginosa), whereas they are largely absent in others (e.g., E. coli, Acinetobacter baumannii, and Burkholderia cepacia). FosA proteins in different bacterial pathogens are highly divergent, but key amino acid residues in the active site are conserved. Chromosomal fosA genes conferred high-level fosfomycin resistance when expressed in E. coli, and deletion of chromosomal fosA in S. marcescens eliminated fosfomycin resistance. Our results indicate that FosA is encoded by clinically relevant Gram-negative species and contributes to intrinsic fosfomycin resistance. PMID:28851843

[Estimation of activity of pharmakopeal disinfectants and antiseptics against Gram-negative and Gram-positive bacteria isolated from clinical specimens, drugs and environment].

PubMed

Grzybowska, Wanda; Młynarczyk, Grazyna; Młynarczyk, Andrzej; Bocian, Ewa; Luczak, Mirosław; Tyski, Stefan

2007-01-01

The MIC of nine different disinfectants and antiseptics were determined for the Gram-negative and Gram-positive bacteria. Strains originated from clinical specimens, drugs and environment. A sensitivity was determined against chlorhexidinum digluconate (Gram-negative: 0,625-80 mg/L, Gram-positive: 0,3-10 mg/L), benzalconium chloride (Gram-negative: 2,5-1280 mg/L, Gram-positive: 1,25-20 mg/L), salicilic acid (Gram-negative and Gram-positive: 400-1600 mg/L), benzoic acid (Gram-negative: 800-1600 mg/L, Gram-positive: 400-1 600 mg/L), boric acid (Gram-negative: 800-12 800 mg/L, Gram-positive: 1 600-6400 mg/L), chloramine B (Gram-negative: 1600-6400 mg/L, Gram-positive:800- 6400 mg/L), jodine (Gram-negative: 200-1600 mg/L, Gram-positive: 200-1600 mg/L), etacridine lactate (Gram-negative: 40 do > 20480 mg/L, Gram-positive: 40-1280 mg/L) and resorcine (Gram-negative: 1600-6400 mg/L, Gram-positive: 800-6400 mg/L). Diversified values of MIC for different strains were obtained, especially in the case of benzalconium chloride, etacridine lactate, chlorhexidinum digluconate, boric acid and iodine. Strains isolated from environment were usually more susceptible to examined compounds than clinical strains. The biggest diversification of sensitivity was observed among strains originated from drugs where besides sensitive appeared strains characterizing by very high MIC values of some substances, eg. boric acid.

Use of the gram stain in microbiology.

PubMed

Beveridge, T J

2001-05-01

The Gram stain differentiates bacteria into two fundamental varieties of cells. Bacteria that retain the initial crystal violet stain (purple) are said to be "gram-positive," whereas those that are decolorized and stain red with carbol fuchsin (or safranin) are said to be "gram-negative." This staining response is based on the chemical and structural makeup of the cell walls of both varieties of bacteria. Gram-positives have a thick, relatively impermeable wall that resists decolorization and is composed of peptidoglycan and secondary polymers. Gram-negatives have a thin peptidoglycan layer plus an overlying lipid-protein bilayer known as the outer membrane, which can be disrupted by decolorization. Some bacteria have walls of intermediate structure and, although they are officially classified as gram-positives because of their linage, they stain in a variable manner. One prokaryote domain, the Archaea, have such variability of wall structure that the Gram stain is not a useful differentiating tool.

[Influence of serious infections due to Gram-negative bacteria on the hospital economy].

PubMed

Martínez, B; Gómez, J; Gómez Vargas, J; Guerra, B; Ruiz Gómez, J; Simarro, E; Baños, V; Canteras, M; Valdes, M

2000-12-01

Nosocomial infections due to Gram-negative bacteria are very important since they are associated with high morbidity and high hospital costs. A prospective study of 250 inpatients was carried out, 200 of whom had Gram-negative bacterial infections. Patients were divided into groups of 50 according to the localization of the infection (urinary, surgical wound, respiratory tract and bacteremia), with a control group of 50 patients with similar characteristics but no infection. We calculated the cost for the different groups by multiplying the average length of hospital stay in days by the daily cost of the stay. Significant differences were observed in the average length of stay per patient according to the type of infection and how it was acquired. In terms of cost, nosocomial infection due to Gram-negative bacteria was 1,049,139 pesetas more expensive than community-acquired infection. The cost of the stay for patients with postsurgical infection due to Gram-negative bacteria was 1,108, 252 pesetas more expensive than for the group of control patients. Nosocomial infection due to Gram-negative bacteria is associated with a prolongation in hospital stay of 9 to 28 days, which is the factor that most reflects the cost that can be attributed to nosocomial infection. Consensual and protocolized measures which allow for better clinical management need to be developed.

Antibacterial Activity of Silver-Graphene Quantum Dots Nanocomposites Against Gram-Positive and Gram-Negative Bacteria

NASA Technical Reports Server (NTRS)

Makarov, Vladimir (Inventor); Habiba, Khaled (Inventor); Weiner, Brad R (Inventor); Morell, Gerardo (Inventor)

2018-01-01

The invention provides a composite of silver nanoparticles decorated with graphene quantum dots (Ag-GQDs) using pulsed laser synthesis. The nanocomposites were functionalized with polyethylene glycol (PEG). A concentration of 150 .mu.g/mL of Ag-GQDs, a non-toxic level for human cells, exhibits strong antibacterial activity against both Gram-Positive and Gram-Negative Bacteria.

Expanding the Use of a Fluorogenic Method to Determine Activity and Mode of Action of Bacillus thuringiensis Bacteriocins Against Gram-Positive and Gram-Negative Bacteria

PubMed Central

de la Fuente-Salcido, Norma M.; Barboza-Corona, J. Eleazar; Espino Monzón, A. N.; Pacheco Cano, R. D.; Balagurusamy, N.; Bideshi, Dennis K.; Salcedo-Hernández, Rubén

2012-01-01

Previously we described a rapid fluorogenic method to measure the activity of five bacteriocins produced by Mexican strains of Bacillus thuringiensis against B. cereus 183. Here we standardize this method to efficiently determine the activity of bacteriocins against both Gram-positive and Gram-negative bacteria. It was determined that the crucial parameter required to obtain reproducible results was the number of cells used in the assay, that is, ~4 × 108 cell/mL and ~7 × 108 cell/mL, respectively, for target Gram-positive and Gram-negative bacteria. Comparative analyses of the fluorogenic and traditional well-diffusion assays showed correlation coefficients of 0.88 to 0.99 and 0.83 to 0.99, respectively, for Gram-positive and Gram-negative bacteria. The fluorogenic method demonstrated that the five bacteriocins of B. thuringiensis have bacteriolytic and bacteriostatic activities against all microorganisms tested, including clinically significant bacteria such as Listeria monocytogenes, Proteus vulgaris, and Shigella flexneri reported previously to be resistant to the antimicrobials as determined using the well-diffusion protocol. These results demonstrate that the fluorogenic assay is a more sensitive, reliable, and rapid method when compared with the well-diffusion method and can easily be adapted in screening protocols for bacteriocin production by other microorganisms. PMID:22919330

Multi-resistant gram negative enteric bacteria causing urinary tract infection among malnourished underfives admitted at a tertiary hospital, northwestern, Tanzania.

PubMed

Ahmed, Maimuna; Moremi, Nyambura; Mirambo, Mariam M; Hokororo, Adolfine; Mushi, Martha F; Seni, Jeremiah; Kamugisha, Erasmus; Mshana, Stephen E

2015-06-19

Infections are common complications occurring in malnourished childrenas a result of impaired immunity. Urinary tract infections (UTI) have been found to be the commonest cause of fever in normal children in developing countries. However, data regarding UTI among malnourished children is limited because in most of time severe and moderately malnourished children are afebrile despite significant bacteriuria. A total of 402 malnourished underfives were enrolled. Demographic and other clinical characteristics were collected using standardized data collection tool. Urine specimens were cultured and interpreted according to standard operating procedures. Data were analyzed using STATA version 11. Out of 402 malnourished underfives, 229 (56.9 %) were male. The median age in months was 17 (IQR; 12-31). Of 402 malnourished underfives, 83 (20.3 %) had significant bacteriuria of gram negative enteric bacteria. Escherichia coli 35/84 and Klebsiella pneumonia 20/84 were predominant bacteria isolated. More than 37 % of isolates were resistant to third generation cephalosporins with all of them exhibiting extended spectrum beta lactamase (ESBL) phenotype. Rates of resistance to ampicillin, amoxillin/clavulanic acid, gentamicin and ciprofloxacin were 82/84 (98.7 %), 47/55 (85.4 %), 45/84 (57.8 %) and 9/84 (10.8 %) respectively. Decrease in age and increase in lymphocytes count were independent factors on multivariate logistic regression analysis found to predict UTI (p<0.05). Multi-resistant gram negative enteric bacteria are common cause of UTI among underfives. A significant number of severe and moderate malnourished children with bacteriuria had no fever. Therefore, routine testing for UTI is emphasized in all malnourished underfives so that appropriate treatment can be initiated.

Antibiotic Resistance in Burkholderia Species

PubMed Central

Rhodes, Katherine A.; Schweizer, Herbert P.

2016-01-01

The genus Burkholderia comprises metabolically diverse and adaptable Gram-negative bacteria, which thrive in often adversarial environments. A few members of the genus are prominent opportunistic pathogens. These include B. mallei and B. pseudomallei of the B. pseudomallei complex, which cause glanders and melioidosis, respectively. B. cenocepacia, B. multivorans, and B. vietnamiensis belong to the B. cepacia complex and affect mostly cystic fibrosis patients. Infections caused by these bacteria are difficult to treat because of significant antibiotic resistance. The first line of defense against antimicrobials in Burkholderia species is the outer membrane penetration barrier. Most Burkholderia contain a modified lipopolysaccharide that causes intrinsic polymyxin resistance. Contributing to reduced drug penetration are restrictive porin proteins. Efflux pumps of the resistance nodulation cell division family are major players in Burkholderia multidrug resistance. Third and fourth generation β-lactam antibiotics are seminal for treatment of Burkholderia infections, but therapeutic efficacy is compromised by expression of several β-lactamases and ceftazidime target mutations. Altered DNA gyrase and dihydrofolate reductase targets cause fluoroquinolone and trimethoprim resistance, respectively. Although antibiotic resistance hampers therapy of Burkholderia infections, the characterization of resistance mechanisms lags behind other non-enteric Gram-negative pathogens, especially ESKAPE bacteria such as Acinetobacter baumannii, Klebsiella pneumoniae and Pseudomonas aeruginosa. PMID:27620956

Discovery and Optimization of Indolyl-Containing 4-Hydroxy-2-Pyridone Type II DNA Topoisomerase Inhibitors Active against Multidrug Resistant Gram-negative Bacteria.

PubMed

Gerasyuto, Aleksey I; Arnold, Michael A; Wang, Jiashi; Chen, Guangming; Zhang, Xiaoyan; Smith, Sean; Woll, Matthew G; Baird, John; Zhang, Nanjing; Almstead, Neil G; Narasimhan, Jana; Peddi, Srinivasa; Dumble, Melissa; Sheedy, Josephine; Weetall, Marla; Branstrom, Arthur A; Prasad, J V N; Karp, Gary M

2018-05-14

There exists an urgent medical need to identify new chemical entities (NCEs) targeting multidrug resistant (MDR) bacterial infections, particularly those caused by Gram-negative pathogens. 4-Hydroxy-2-pyridones represent a novel class of nonfluoroquinolone inhibitors of bacterial type II topoisomerases active against MDR Gram-negative bacteria. Herein, we report on the discovery and structure-activity relationships of a series of fused indolyl-containing 4-hydroxy-2-pyridones with improved in vitro antibacterial activity against fluoroquinolone resistant strains. Compounds 6o and 6v are representative of this class, targeting both bacterial DNA gyrase and topoisomerase IV (Topo IV). In an abbreviated susceptibility screen, compounds 6o and 6v showed improved MIC 90 values against Escherichia coli (0.5-1 μg/mL) and Acinetobacter baumannii (8-16 μg/mL) compared to the precursor compounds. In a murine septicemia model, both compounds showed complete protection in mice infected with a lethal dose of E. coli.

Abnormal vaginal colonization by gram-negative bacteria is significantly higher in pregnancy conceived through infertility treatment compared to natural pregnancy.

PubMed

Kim, Ji Y; Sung, Ji-Hee; Chang, Kylie Hae-Jin; Choi, Suk-Joo; Oh, Soo-Young; Roh, Cheong-Rae; Kim, Jong-Hwa

2017-03-01

To compare abnormal vaginal colonization between natural pregnancy and pregnancy by infertility treatment in high-risk parturient women and to examine the association between abnormal vaginal colonization and early-onset neonatal sepsis (EONS). The clinical characteristics, vaginal culture result, and delivery outcome of patients who admitted to our high-risk unit between 2005 and 2014 were retrospectively reviewed and compared. We investigated the prevalence of EONS according to maternal vaginal colonization and examined the concordance between maternal vaginal bacteria and etiologic microorganism causing EONS. Among 1096 pregnancies, the rate of vaginal colonization by gram-negative bacteria, especially Escherichia coli was significantly higher in pregnancies by infertility treatment after adjustment of confounding variables (E. coli, OR [95% CI]: 2.47 [1.33-4.57], p = 0.004). The rate of EONS was significantly higher in neonates with maternal abnormal vaginal bacteria colonization (OR [95% CI]: 3.38 [1.44-7.93], p = 0.005) after adjusting for confounding variables. Notably, among microorganisms isolated from maternal vagina, E. coli and Staphylococcus aureus were consistent with the results from neonatal blood culture in EONS. Our data implicate a possible association between gram-negative bacteria colonization and infertility treatment and suggest that maternal vaginal colonization may be associated with EONS of neonates in high-risk pregnancy.

Quorum-Sensing Signal-Response Systems in Gram-Negative Bacteria

PubMed Central

Papenfort, Kai; Bassler, Bonnie

2016-01-01

Abstract / Preface Bacteria use quorum sensing to orchestrate gene expression programmes that underlie collective behaviours. Quorum sensing relies on the production, release, detection and group-level response to extracellular signalling molecules, which are called autoinducers. Recent work has discovered new autoinducers in Gram-negative bacteria, shown how these molecules are recognized by cognate receptors, revealed new regulatory components that are embedded in canonical signalling circuits and identified novel regulatory network designs. In this Review we examine how, together, these features of quorum sensing signal–response systems combine to control collective behaviours in Gram-negative bacteria and we discuss the implications for host–microbial associations and antibacterial therapy. PMID:27510864

Gram staining.

PubMed

Coico, Richard

2005-10-01

Named after Hans Christian Gram who developed the method in 1884, the Gram stain allows one to distinguish between Gram-positive and Gram-negative bacteria on the basis of differential staining with a crystal violet-iodine complex and a safranin counterstain. The cell walls of Gram-positive organisms retain this complex after treatment with alcohol and appear purple, whereas gram-negative organisms decolorize following such treatment and appear pink. The method described here is useful for assessing bacterial contamination of tissue culture samples or for examining the Gram stain status and morphological features of bacteria isolated from mixed or isolated bacterial cultures.

Gram staining.

PubMed

Coico, R

2001-05-01

Named after Hans Christian Gram who developed the method in 1884, the Gram stain allows one to distinguish between Gram-positive and Gram-negative bacteria on the basis of differential staining with a crystal violet-iodine complex and a safranin counterstain. The cell walls of Gram-positive organisms retain this complex after treatment with alcohol and appear purple, whereas gram-negative organisms decolorize following such treatment and appear pink. The method described here is useful for assessing bacterial contamination of tissue culture samples or for examining the Gram stain status and morphological features of bacteria isolated from mixed or isolated bacterial cultures.

Expression levels of the receptor activator of NF-κB ligand and osteoprotegerin and the number of gram-negative bacteria in symptomatic and asymptomatic periapical lesions.

PubMed

Carneiro, E; Parolin, A B; Wichnieski, C; Rosa, E A R; Silva Neto, U X; Westphalen, V P D; Fariniuk, L F; Johann, A C B R

2017-01-01

The study aimed to verify the potential correlation between the detected amount of gram-negative bacteria and the radiographic sizes of the lesions in patients with symptomatic and asymptomatic apical periodontitis. Furthermore, to evaluate whether the expression of receptor activator of NF-κB ligand (RANKL) and osteoprotegerin (OPG) and the RANKL/OPG ratio are differentially regulated in both groups. Twenty patients with periapical lesions were divided into two groups: symptomatic (SYM) n=10 and asymptomatic (ASYM) n=10. After periapical surgery, the lesions were collected and processed for histological examination, and immunohistochemistry. The percentage of RANKL- and OPG-immunopositive areas relative to the total area of the microscopic field was calculated. For gram staining, the number of gram-negative cells per microscopic field was assessed. The radiographs of each patient were processed and measured. The Student's t-test and the Pearson correlation coefficient were performed. The SYM group showed a significantly higher number of gram-negative cells (p=0.007) when compared to the ASYM group. A higher number of gram-negative bacteria occurred more frequently in larger periapical lesions and the SYM group (p=0.03). The expression for RANKL and OPG and the RANKL/OPG ratio were not significantly different between the groups. There was a significant positive correlation between the number of bacteria and OPG levels in the SYM group (p=0.01). The number of bacteria seems to influence the symptoms and the radiographic size of a periapical lesion. Gram-negative bacteria may play an important role in OPG activity in the SYM group. Copyright © 2016 Elsevier Ltd. All rights reserved.

Screening beneficial rhizobacteria from Spartina maritima for phytoremediation of metal polluted salt marshes: comparison of gram-positive and gram-negative strains.

PubMed

Paredes-Páliz, Karina I; Caviedes, Miguel A; Doukkali, Bouchra; Mateos-Naranjo, Enrique; Rodríguez-Llorente, Ignacio D; Pajuelo, Eloísa

2016-10-01

The aim of our work was the isolation and characterization of bacteria from the rhizosphere of Spartina maritima in the metal contaminated Odiel estuary (Huelva, SW Spain). From 25 strains, 84 % were identified as gram-positive, particularly Staphylococcus and Bacillus. Gram-negative bacteria were represented by Pantoea and Salmonella. Salt and heavy metal tolerance, metal bioabsorption, plant growth promoting (PGP) properties, and biofilm formation were investigated in the bacterial collection. Despite the higher abundance of gram-positive bacteria, gram-negative isolates displayed higher tolerance toward metal(loid)s (As, Cu, Zn, and Pb) and greater metal biosorption, as deduced from ICP-OES and SEM-EDX analyses. Besides, they exhibited better PGP properties, which were retained in the presence of metals and the ability to form biofilms. Gram-negative strains Pantoea agglomerans RSO6 and RSO7, together with gram-positive Bacillus aryabhattai RSO25, were selected for a bacterial consortium aimed to inoculate S. maritima plants in metal polluted estuaries for phytoremediation purposes.

[Antimicrobial susceptibility patterns of Gram-negative bacteria isolated in urinary tract infections in Venezuela: Results of the SMART study 2009-2012].

PubMed

Guevara, Napoleón; Guzmán, Manuel; Merentes, Altagracia; Rizzi, Adele; Papaptzikos, Juana; Rivero, Narlesky; Oranges, Carmela; Vlllarroel, Héctor; Limas, Yoxsivell

2015-12-01

Antimicrobial resistance of pathogens causing urinary tract infection (UTI) is a growing problem, which complicates their effective treatment. Surveillance is needed to guide appropriate empiric therapy. to describe the susceptibility patterns of Gram-negative bacteria isolated of patients with UTI to twelve antibiotics as part of the Study for Monitoring Antimicrobial Resistance Trends in Venezuela. Between 2009-2012 a total of 472 Gram-negative bacteria were isolated from hospitalized patients with UTI. The isolates were sent to Central Laboratory (Central Laboratory of International Health Management Associates) to confirm their identification, and to make susceptibility testing as recommended by the Clinical and Laboratory Standards Institute. Enterobacteriacea comprised 96.6% of the total, where Escherichia coli (76.9%) and Klebsiella pneumoniae (10.6%) were the most frequent. Extended-spectrum β-lactamases (ESBL) was detected in 21.6% of isolates. Top antimicrobial activity were ertapenem, imipenem, and amikacin (> 90.0%), slightly lower for amikacin (85.1%) in ESBL-producing strains. Resistance rates to fluoroquinolones and ampicillin/sulbactam were high (40 y 64%, respectively). These data suggest a necessary revision of the therapeutic regimens for the empirical treatment of UTI in Venezuela.

The cost and management of different types of clinical mastitis in dairy cows estimated by dynamic programming.

PubMed

Cha, E; Bar, D; Hertl, J A; Tauer, L W; Bennett, G; González, R N; Schukken, Y H; Welcome, F L; Gröhn, Y T

2011-09-01

The objective of this study was to estimate the cost of 3 different types of clinical mastitis (CM) (caused by gram-positive bacteria, gram-negative bacteria, and other organisms) at the individual cow level and thereby identify the economically optimal management decision for each type of mastitis. We made modifications to an existing dynamic optimization and simulation model, studying the effects of various factors (incidence of CM, milk loss, pregnancy rate, and treatment cost) on the cost of different types of CM. The average costs per case (US$) of gram-positive, gram-negative, and other CM were $133.73, $211.03, and $95.31, respectively. This model provided a more informed decision-making process in CM management for optimal economic profitability and determined that 93.1% of gram-positive CM cases, 93.1% of gram-negative CM cases, and 94.6% of other CM cases should be treated. The main contributor to the total cost per case was treatment cost for gram-positive CM (51.5% of the total cost per case), milk loss for gram-negative CM (72.4%), and treatment cost for other CM (49.2%). The model affords versatility as it allows for parameters such as production costs, economic values, and disease frequencies to be altered. Therefore, cost estimates are the direct outcome of the farm-specific parameters entered into the model. Thus, this model can provide farmers economically optimal guidelines specific to their individual cows suffering from different types of CM. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Antimicrobial Activities of Leaf Extracts of Guava (Psidium guajava L.) on Two Gram-Negative and Gram-Positive Bacteria

PubMed Central

Biswas, Bipul; Rogers, Kimberly; McLaughlin, Fredrick; Yadav, Anand

2013-01-01

Aim. To determine the antimicrobial potential of guava (Psidium guajava) leaf extracts against two gram-negative bacteria (Escherichia coli and Salmonella enteritidis) and two gram-positive bacteria (Staphylococcus aureus and Bacillus cereus) which are some of foodborne and spoilage bacteria. The guava leaves were extracted in four different solvents of increasing polarities (hexane, methanol, ethanol, and water). The efficacy of these extracts was tested against those bacteria through a well-diffusion method employing 50 μL leaf-extract solution per well. According to the findings of the antibacterial assay, the methanol and ethanol extracts of the guava leaves showed inhibitory activity against gram-positive bacteria, whereas the gram-negative bacteria were resistant to all the solvent extracts. The methanol extract had an antibacterial activity with mean zones of inhibition of 8.27 and 12.3 mm, and the ethanol extract had a mean zone of inhibition of 6.11 and 11.0 mm against B. cereus and S. aureus, respectively. On the basis of the present finding, guava leaf-extract might be a good candidate in the search for a natural antimicrobial agent. This study provides scientific understanding to further determine the antimicrobial values and investigate other pharmacological properties. PMID:24223039

[Identification of anaerobic gram-negative bacilli isolated from various clinical specimens and determination of antibiotic resistance profiles with E-test methods].

PubMed

Demir, Cengiz; Keşli, Recep

2018-01-01

The aim of this study was to identify gram-negative anaerobic bacilli isolated from various clinical specimens that were obtained from patients with suspected anaerobic infections and to determine the antibiotic resistance profiles by using the antibiotic concentration gradient method. The study was performed in Afyon Kocatepe University Ahmet Necdet Sezer Research and Practice Hospital, Medical Microbiology Laboratory between 1 November 2014 and 30 October 2015. Two hundred and seventyeight clinical specimens accepted for anaerobic culture were enrolled in the study. All the samples were cultivated anaerobically by using Schaedler agar with 5% defibrinated sheep blood and Schaedler broth. The isolated anaerobic gram-negative bacilli were identified by using both the conventional methods and automated identification system (VITEK 2, bioMerieux, France). Antibiotic susceptibility tests were performed with antibiotic concentration gradient method (E-test, bioMerieux, France); against penicillin G, clindamycin, cefoxitin, metronidazole, moxifloxacin, imipenem, meropenem, ertapenem and doripenem for each isolate. Of the 28 isolated anaerobic gram-negative bacilli; 14 were identified as Bacteroides fragilis group, 9 were Prevotella spp., and 5 were Fusobacterium spp. The highest resistance rate was found against penicillin (78.5%) and resistance rates against clindamycin and cefoxitin were found as 17.8% and 21.4%, respectively. No resistance was found against metronidazole, moxifloxacin, imipenem, meropenem, ertapenem and doripenem. As a result, isolation and identification of anaerobic bacteria are difficult, time-consuming and more expensive when compared with the cost of aerobic culture. The rate of anaerobic bacteria isolation may be increased by obtaining the appropriate clinical specimen and appropriate transportation of these specimens. We believe that the data obtained from the study in our center may offer benefits for the follow up and treatment of infections caused by anaerobic bacteria and may contribute to the current literature. Because of high resistance rate detected against penicillin, this antibiotic should not be used as a first choice in empirical treatment. Cefoxitin may be used in empirical antimicrobial treatment of anaerobic gram-negatives; but the rate of antibiotic resistance should be detected for more useful and proper treatment. The prior selection of the most effective antibiotic, may contribute to decrease the rate of high resistance. In our study, no resistance was observed against carbapenem group antibiotics and metronidazole; so these antibiotics should be reserved as treatment options in the future for infections caused by resistant gram-negative anaerobic bacteria.

A New Class of Quorum Quenching Molecules from Staphylococcus Species Affects Communication and Growth of Gram-Negative Bacteria

PubMed Central

Chu, Ya-Yun; Nega, Mulugeta; Wölfle, Martina; Plener, Laure; Grond, Stephanie; Jung, Kirsten; Götz, Friedrich

2013-01-01

The knowledge that many pathogens rely on cell-to-cell communication mechanisms known as quorum sensing, opens a new disease control strategy: quorum quenching. Here we report on one of the rare examples where Gram-positive bacteria, the ‘Staphylococcus intermedius group’ of zoonotic pathogens, excrete two compounds in millimolar concentrations that suppress the quorum sensing signaling and inhibit the growth of a broad spectrum of Gram-negative beta- and gamma-proteobacteria. These compounds were isolated from Staphylococcus delphini. They represent a new class of quorum quenchers with the chemical formula N-[2-(1H-indol-3-yl)ethyl]-urea and N-(2-phenethyl)-urea, which we named yayurea A and B, respectively. In vitro studies with the N-acyl homoserine lactone (AHL) responding receptor LuxN of V. harveyi indicated that both compounds caused opposite effects on phosphorylation to those caused by AHL. This explains the quorum quenching activity. Staphylococcal strains producing yayurea A and B clearly benefit from an increased competitiveness in a mixed community. PMID:24098134

Evaluation of Antimicrobial Activity of the Methanol Extracts from 8 Traditional Medicinal Plants

PubMed Central

Kang, Chang-Geun; Hah, Dae-Sik; Kim, Chung-Hui; Kim, Young-Hwan; Kim, Euikyung

2011-01-01

The methanol extract of 12 medicinal plants were evaluated for its antibacterial activity against Gram-positive (5 strains) and Gram-negative bacteria (10 strains) by assay for minimum inhibitory concentration (MIC) and minimum bacterial concentration (MBC) . The antibacterial activity was determined by an agar dilution method (according to the guidelines of Clinical and Laboratory Standard Institute) . All the compounds (12 extracts) of the 8 medicinal plants (leaf or root) were active against both Gram-negative and Gram-positive bacteria. Gram-negative showed a more potent action than Gram positive bacteria. The MIC concentrations were various ranged from 0.6 μg/ml to 5000 μg/ml. The lowest MIC (0.6 μg/ml) and MBC (1.22 μg/ml) values were obtained with extract on 4 and 3 of the 15 microorganisms tested, respectively. PMID:24278548

What is an "ideal" antibiotic? Discovery challenges and path forward.

PubMed

Singh, Sheo B; Young, Katherine; Silver, Lynn L

2017-06-01

An ideal antibiotic is an antibacterial agent that kills or inhibits the growth of all harmful bacteria in a host, regardless of site of infection without affecting beneficial gut microbes (gut flora) or causing undue toxicity to the host. Sadly, no such antibiotics exist. What exist are many effective Gram-positive antibacterial agents as well as broad-spectrum agents that provide treatment of certain Gram-negative bacteria but not holistic treatment of all bacteria. However effectiveness of all antibacterial agents is being rapidly eroded due to resistance. This viewpoint provides an overview of today's antibiotics, challenges and potential path forward of discovery and development of new (ideal) antibiotics. Copyright © 2017 Elsevier Inc. All rights reserved.

Comparison of bacteria populations in clean and recycled sand used for bedding in dairy facilities.

PubMed

Kristula, M A; Rogers, W; Hogan, J S; Sabo, M

2005-12-01

Bedding samples were collected twice from commercial dairy free-stall facilities that used recycled sand and clean sand in both the summer and winter. Collection began on the day sand was taken from the pile (d 0) and placed in the free stalls, and continued for 5 to 7 additional days. The number of colonies per gram of bedding of gram-negative bacteria, coliforms, Streptococcus spp., and Klebsiella spp. were estimated for each sand sample as well as amounts of dry and organic matter. Clean sand (CS) and recycled sand (RS) had the same bacterial counts when compared at any sampling time. The mean counts of bacterial populations did vary over the course of the study in both CS and RS. There was a significant increase in bacterial counts from d 0 to d 1 for gram-negative bacteria, coliforms, and Streptococcus spp. in both winter and summer. Counts of gram-negative bacteria, coliforms, Klebsiella spp., and Streptococcus spp. did not differ from d 1 to 7 in the winter. Total counts of gram-negative bacteria did not differ from d 1 to 7 in the summer. On d 1 in the summer, coliform counts were lower than at d 5 to 7, and Klebsiella spp. counts were lower than on d 3 to 7. Streptococcus spp. counts were high on d 1 and were constant through d 7 in both winter and summer trials. The number of coliform and Klebsiella spp. in both CS and RS was below the threshold thought to cause mastitis during the sampling times. The number of Streptococcus spp. was high in both CS and RS during the sampling periods. Other management factors need to be identified to decrease the number of Streptococcus spp. in bedding. Recycled sand had a higher organic matter and lower dry matter compared with CS in winter and summer. The results for this study were obtained from multiple herd comparisons, and herd was a significant effect suggesting that different management systems influence the number and types of bacteria in both CS and RS.

Application of Lactic Acid Bacteria (LAB) in freshness keeping of tilapia fillets as sashimi

NASA Astrophysics Data System (ADS)

Cao, Rong; Liu, Qi; Chen, Shengjun; Yang, Xianqing; Li, Laihao

2015-08-01

Aquatic products are extremely perishable food commodities. Developing methods to keep the freshness of fish represents a major task of the fishery processing industry. Application of Lactic Acid Bacteria (LAB) as food preservative is a novel approach. In the present study, the possibility of using lactic acid bacteria in freshness keeping of tilapia fillets as sashimi was examined. Fish fillets were dipped in Lactobacillus plantarum 1.19 (obtained from China General Microbiological Culture Collection Center) suspension as LAB-treated group. Changes in K-value, APC, sensory properties and microbial flora were analyzed. Results showed that LAB treatment slowed the increase of K-value and APC in the earlier storage, and caused a smooth decrease in sensory score. Gram-negative bacteria dominated during refrigerated storage, with Pseudomonas and Aeromonas being relatively abundant. Lactobacillus plantarum 1.19 had no obvious inhibitory effect against these Gram-negatives. However, Lactobacillus plantarum 1.19 changed the composition of Gram-positive bacteria. No Micrococcus were detected and the proportion of Staphylococcus decreased in the spoiled LAB-treated samples. The period that tilapia fillets could be used as sashimi material extended from 24 h to 48 h after LAB treatment. The potential of using LAB in sashimi processing was confirmed.

Synthesis, spectral characterization and in vitro antimicrobial activity of some new azopyridine derivatives

NASA Astrophysics Data System (ADS)

Abuo-Melha, Hanaa; Fadda, A. A.

2012-04-01

A series of arylpicolino and/or isonicotinohydrazonyl cyanide 2a-d and 4a-f were prepared by coupling the approprite aryl diazonium salt with 2-cyanomethyl and/or 4-cyanomethyl-pyridine, respectively. These compounds were characterized by analytical and spectral analyses and screened for their antibacterial activity against Gram-positive bacteria, Gram-negative bacteria and antifungal activity. Among the synthesized compounds, N'-(4-phenyldiazenyl)phenylisonicotinohydrazonyl cyanide 4f showed a significant activity toward both Gram-positive, Gram-negative bacteria and exhibit the most potent in vitro antifungal with MIC's (625 μg/mL) against Aspergillus nieger.

In Vitro Antibacterial Properties of Cefiderocol, a Novel Siderophore Cephalosporin, against Gram-Negative Bacteria

PubMed Central

Sato, Takafumi; Ota, Merime; Takemura, Miki; Nishikawa, Toru; Toba, Shinsuke; Kohira, Naoki; Miyagawa, Satoshi; Ishibashi, Naoki; Nakamura, Rio; Tsuji, Masakatsu; Yamano, Yoshinori

2017-01-01

ABSTRACT Cefiderocol (CFDC; S-649266), a novel parenteral siderophore cephalosporin conjugated with a catechol moiety, has a characteristic antibacterial spectrum with a potent activity against a broad range of aerobic Gram-negative bacterial species, including carbapenem-resistant strains of Enterobacteriaceae and nonfermenting bacteria such as Pseudomonas aeruginosa and Acinetobacter baumannii. Cefiderocol has affinity mainly for penicillin-binding protein 3 (PBP3) of Enterobacteriaceae and nonfermenting bacteria similar to that of ceftazidime. A deficiency of the iron transporter PiuA in P. aeruginosa or both CirA and Fiu in Escherichia coli caused 16-fold increases in cefiderocol MICs, suggesting that these iron transporters contribute to the permeation of cefiderocol across the outer membrane. The deficiency of OmpK35/36 in Klebsiella pneumoniae and the overproduction of efflux pump MexA-MexB-OprM in P. aeruginosa showed no significant impact on the activity of cefiderocol. PMID:29061741

In vitro transport activity of the fully assembled MexAB-OprM efflux pump from Pseudomonas aeruginosa

NASA Astrophysics Data System (ADS)

Verchère, Alice; Dezi, Manuela; Adrien, Vladimir; Broutin, Isabelle; Picard, Martin

2015-04-01

Antibiotic resistance is a major public health issue and many bacteria responsible for human infections have now developed a variety of antibiotic resistance mechanisms. For instance, Pseudomonas aeruginosa, a disease-causing Gram-negative bacteria, is now resistant to almost every class of antibiotics. Much of this resistance is attributable to multidrug efflux pumps, which are tripartite membrane protein complexes that span both membranes and actively expel antibiotics. Here we report an in vitro procedure to monitor transport by the tripartite MexAB-OprM pump. By combining proteoliposomes containing the MexAB and OprM portions of the complex, we are able to assay energy-dependent substrate translocation in a system that mimics the dual-membrane architecture of Gram-negative bacteria. This assay facilitates the study of pump transport dynamics and could be used to screen pump inhibitors with potential clinical use in restoring therapeutic activity of old antibiotics.

Simultaneous Fluorescent Gram Staining and Activity Assessment of Activated Sludge Bacteria

PubMed Central

Forster, Scott; Snape, Jason R.; Lappin-Scott, Hilary M.; Porter, Jonathan

2002-01-01

Wastewater treatment is one of the most important commercial biotechnological processes, and yet the component bacterial populations and their associated metabolic activities are poorly understood. The novel fluorescent dye hexidium iodide allows assessment of Gram status by differential absorption through bacterial cell walls. Differentiation between gram-positive and gram-negative wastewater bacteria was achieved after flow cytometric analysis. This study shows that the relative proportions of gram-positive and gram-negative bacterial cells identified by traditional microscopy and hexidium iodide staining were not significantly different. Dual staining of cells for Gram status and activity proved effective in analyzing mixtures of cultured bacteria and wastewater populations. Levels of highly active organisms at two wastewater treatment plants, both gram positive and gram negative, ranged from 1.5% in activated sludge flocs to 16% in the activated sludge fluid. Gram-positive organisms comprised <5% of the total bacterial numbers but accounted for 19 and 55% of the highly active organisms within flocs at the two plants. Assessment of Gram status and activity within activated sludge samples over a 4-day period showed significant differences over time. This method provides a rapid, quantitative measure of Gram status linked with in situ activity within wastewater systems. PMID:12324319

Simultaneous fluorescent gram staining and activity assessment of activated sludge bacteria.

PubMed

Forster, Scott; Snape, Jason R; Lappin-Scott, Hilary M; Porter, Jonathan

2002-10-01

Wastewater treatment is one of the most important commercial biotechnological processes, and yet the component bacterial populations and their associated metabolic activities are poorly understood. The novel fluorescent dye hexidium iodide allows assessment of Gram status by differential absorption through bacterial cell walls. Differentiation between gram-positive and gram-negative wastewater bacteria was achieved after flow cytometric analysis. This study shows that the relative proportions of gram-positive and gram-negative bacterial cells identified by traditional microscopy and hexidium iodide staining were not significantly different. Dual staining of cells for Gram status and activity proved effective in analyzing mixtures of cultured bacteria and wastewater populations. Levels of highly active organisms at two wastewater treatment plants, both gram positive and gram negative, ranged from 1.5% in activated sludge flocs to 16% in the activated sludge fluid. Gram-positive organisms comprised <5% of the total bacterial numbers but accounted for 19 and 55% of the highly active organisms within flocs at the two plants. Assessment of Gram status and activity within activated sludge samples over a 4-day period showed significant differences over time. This method provides a rapid, quantitative measure of Gram status linked with in situ activity within wastewater systems.

[Antibacterial activity of sulopenem, a new parenteral penem antibiotic].

PubMed

Inoue, E; Komoto, E; Taniyama, Y; Mitsuhashi, S

1996-04-01

Sulopenem, a new penem antibiotic, was compared with other antibiotics with regard to in vitro antibacterial and bactericidal activities, stabilization against beta-lactamases, and effect on the release of lipopolysaccharide from Gram-negative bacteria. The results are summarized as follows. 1. Sulopenem showed more potent activities than other antibiotics against both Gram-positive and Gram-negative bacteria except Pseudomonas aeruginosa. 2. Sulopenem showed potent bactericidal activities (MIC/MBC) against both Gram-positive and Gram-negative bacteria. Time kill studies against Staphylococcus aureus, Escherichia coli, Enterobacter cloacae and Citrobacter freundii showed potent bactericidal activities of sulopenem. 3. Sulopenem was found to possess a stronger activity than other antibiotics against beta-lactamase-producing strains except P. aeruginosa and Stenotrophomonas maltophilia. 4. In particular, sulopenem was found to be more stable to the hydrolysis by various beta-lactamases produced by Gram-negative bacteria than any other antibiotics tested. Vmax/Km values of sulopenem were smaller than those of cefotiam for all tested beta-lactamases, which reflected a broad antibacterial spectrum of sulopenem. 5. E. coli ML4707 exposed to sulopenem and imipenem released less endotoxin than did controls at all concentration ranges tested. In contrast, the strain exposed to ceftazidime at bacteriostatic concentrations released a large amount of endotoxin.

Gram-positive and gram-negative bacteria induce different patterns of cytokine production in human mononuclear cells irrespective of taxonomic relatedness.

PubMed

Skovbjerg, Susann; Martner, Anna; Hynsjö, Lars; Hessle, Christina; Olsen, Ingar; Dewhirst, Floyd E; Tham, Wilhelm; Wold, Agnes E

2010-01-01

Upon bacterial stimulation, tissue macrophages produce a variety of cytokines that orchestrate the immune response that clears the infection. We have shown that Gram-positives induce higher levels of interleukin-12 (IL-12), interferon-gamma (IFN-gamma), and tumor necrosis factor (TNF) from human peripheral blood mononuclear cells (PBMCs) than do Gram-negatives, which instead induce more of IL-6, IL-8, and IL-10. Here, we study whether these patterns follows or crosses taxonomic borders. PBMCs from blood donors were incubated with UV-inactivated bacteria representing 37 species from five phyla. IL-12, TNF, IL-1beta, IL-6, IL-8, and IL-10 were measured in the supernatants after 24 h and IFN-gamma after 5 days. Irrespective of phylogenetic position, Gram-positive bacteria induced much more IL-12 (nine times more on average) and IFN-gamma (seven times), more TNF (three times), and slightly more IL-1beta (1.5 times) than did Gram-negatives, which instead induced more IL-6 (1.5 times), IL-8 (1.9 times), and IL-10 (3.3 times) than did Gram-positives. A notable exception was the Gram-positive Listeria monocytogenes, which induced very little IL-12, IFN-gamma, and TNF. The results confirm the fundamental difference in innate immune responses to Gram-positive and Gram-negative bacteria, which crosses taxonomic borders and probably reflects differences in cell wall structure.

The antibiotic pipeline for multi-drug resistant gram negative bacteria: what can we expect?

PubMed

Falagas, Matthew E; Mavroudis, Andreas D; Vardakas, Konstantinos Z

2016-08-01

A real concern in the medical community is the increasing resistance of bacteria, especially that of Gram-negative types. New antibiotics are currently under clinical development, promising to tackle severe infections caused, especially, by multi-drug resistant (MDR) bacteria and broaden the armamentarium of clinicians. We searched PUBMED and GOOGLE databases. Combinations of already approved β-lactams or monobactams with new β-lactamase inhibitors [imipenem-cilastatin/MK-7655 (relebactam), meropenem/RPX7009 (vaborbactam), ceftaroline/avibactam, aztreonam/avibactam], new β-lactams (S-649266, BAL30072), aminoglycosides (plazomicin), quinolones (finafloxacin) and tetracyclines (eravacycline) were included in the review. Expert commentary: For the majority of the upcoming antibiotics the currently available data is limited to their microbiology and pharmacokinetics. Their effectiveness and safety against infections due to MDR bacteria remain to be proved. Significant issues are also the impact of these antibiotics on the human intestinal microbiota and their possible co-administration with already-known antimicrobial agents in difficult-to-treat-infections; further studies should be conducted for these objectives.

Photodynamic inactivation of antibiotic-resistant bacteria and biofilms by hematoporphyrin monomethyl ether.

PubMed

Liu, Chengcheng; Hu, Min; Ma, Dandan; Lei, Jin'e; Xu, Jiru

2016-02-01

The worldwide increase in bacterial antibiotic resistance has led to a search for alternative antibacterial therapies. A promising approach to killing antibiotic-resistant bacteria is photodynamic antimicrobial chemotherapy, which uses light in combination with a photosensitizer to induce a phototoxic reaction. We evaluated the photodynamic inactivation (PDI) efficiency of hematoporphyrin monomethyl ether (HMME) on antibiotic-resistant bacteria and biofilms. HMME exhibited no significant dark toxicity and provided dose-dependent inactivation of antibiotic-resistant bacteria and biofilms. After incubation with 100-μM HMME and irradiation with 72-J cm(-2) white light, 4.19-7.59 log10 reductions in survival were achieved in planktonic suspension. Antibiotic-resistant strains were as susceptible to PDI in biofilms as in planktonic suspensions, but the inactivation of bacterial cells in biofilms was attenuated. In addition, gram-positive bacterial strains and biofilms were more susceptible than gram-negative strains and biofilms to the PDI effect of HMME. Thus, HMME is a promising photosensitizer for the treatment of infectious diseases caused by antibiotic-resistant bacteria, especially gram-positive bacteria.

Electron microscopic examination of uncultured soil-dwelling bacteria.

PubMed

Amako, Kazunobu; Takade, Akemi; Taniai, Hiroaki; Yoshida, Shin-ichi

2008-05-01

Bacteria living in soil collected from a rice paddy in Fukuoka, Japan, were examined by electron microscopy using a freeze-substitution fixation method. Most of the observed bacteria could be categorized, based on the structure of the cell envelope and overall morphology, into one of five groups: (i) bacterial spore; (ii) Gram-positive type; (iii) Gram-negative type; (iv) Mycobacterium like; and (v) Archaea like. However, a few of the bacteria could not be readily categorized into one of these groups because they had unique cell wall structures, basically resembling those of Gram-negative bacteria, but with the layer corresponding to the peptidoglycan layer in Gram-negative bacteria being extremely thick, like that of the cortex of a bacterial spore. The characteristic morphological features found in many of these uncultured, soil-dwelling cells were the nucleoid being in a condensed state and the cytoplasm being shrunken. We were able to produce similar morphologies in vitro using a Salmonella sp. by culturing under low-temperature, low-nutrient conditions, similar to those found in some natural environments. These unusual morphologies are therefore hypothesized to be characteristic of bacteria in resting or dormant stages.

Alcohol, Intestinal Bacterial Growth, Intestinal Permeability to Endotoxin, and Medical Consequences

PubMed Central

Purohit, Vishnudutt; Bode, J. Christian; Bode, Christiane; Brenner, David A.; Choudhry, Mashkoor A.; Hamilton, Frank; Kang, Y. James; Keshavarzian, Ali; Rao, Radhakrishna; Sartor, R. Balfour; Swanson, Christine; Turner, Jerrold R.

2008-01-01

This report is a summary of the symposium on Alcohol, Intestinal Bacterial Growth, Intestinal Permeability to Endotoxin, and Medical Consequences, organized by National Institute on Alcohol Abuse and Alcoholism, Office of Dietary Supplements, and National Institute of Diabetes and Digestive and Kidney Diseases of National Institutes of Health in Rockville, Maryland, October 11, 2006. Alcohol exposure can promote the growth of Gram negative bacteria in the intestine which may result in accumulation of endotoxin. In addition, alcohol metabolism by Gram negative bacteria and intestinal epithelial cells can result in accumulation of acetaldehyde, which in turn can increase intestinal permeability to endotoxin by increasing tyrosine phosphorylation of tight junction and adherens junction proteins. Alcohol-induced generation of nitric oxide may also contribute to increased permeability to endotoxin by reacting with tubulin, which may cause damage to microtubule cytoskeleton and subsequent disruption of intestinal barrier function. Increased intestinal permeability can lead to increased transfer of endotoxin from the intestine to the liver and general circulation where endotoxin may trigger inflammatory changes in the liver and other organs. Alcohol may also increase intestinal permeability to peptidoglycan which can initiate inflammatory response in liver and other organs. In addition, acute alcohol exposure may potentiate the effect of burn injury on intestinal bacterial growth and permeability. Decreasing the number of Gram negative bacteria in the intestine can result in decreased production of endotoxin as well as acetaldehyde which is expected to decrease intestinal permeability to endotoxin. In addition, intestinal permeability may be preserved by administering epidermal growth factor, L-glutamine, oats supplementation, or zinc thereby preventing the transfer of endotoxin to the general circulation. Thus reducing the number of intestinal Gram negative bacteria and preserving intestinal permeability to endotoxin may attenuate alcoholic liver and other organ injuries. PMID:18504085

A resurgence of β-lactamase inhibitor combinations effective against multidrug-resistant Gram-negative pathogens.

PubMed

Bush, Karen

2015-11-01

β-Lactamase inhibitors (BLIs) have played an important role in combatting β-lactam resistance in Gram-negative bacteria, but their effectiveness has diminished with the evolution of diverse and deleterious varieties of β-lactamases. In this review, a new generation of BLIs and inhibitor combinations is presented, describing epidemiological information, pharmacodynamic studies, resistance identification and current clinical status. Novel serine BLIs of major interest include the non-β-lactams of the diazabicyclo[3.2.1]octanone (DBO) series. The DBOs avibactam, relebactam and RG6080 inhibit most class A and class C β-lactamases, with selected inhibition of class D enzymes by avibactam. The novel boronic acid inhibitor RPX7009 has a similar inhibitory profile. All of these inhibitors are being developed in combinations that are targeting primarily carbapenemase-producing Gram-negative pathogens. Two BLI combinations (ceftolozane/tazobactam and ceftazidime/avibactam) were recently approved by the US Food and Drug Administration (FDA) under the designation of a Qualified Infectious Disease Product (QIDP). Other inhibitor combinations that have at least completed phase 1 clinical trials are ceftaroline fosamil/avibactam, aztreonam/avibactam, imipenem/relebactam, meropenem/RPX7009 and cefepime/AAI101. Although effective inhibitor combinations are in development for the treatment of infections caused by Gram-negative bacteria with serine carbapenemases, better options are still necessary for pathogens that produce metallo-β-lactamases (MBLs). The aztreonam/avibactam combination demonstrates inhibitory activity against MBL-producing enteric bacteria owing to the stability of the monobactam to these enzymes, but resistance is still an issue for MBL-producing non-fermentative bacteria. Because all of the inhibitor combinations are being developed as parenteral drugs, an orally bioavailable combination would also be of interest. Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Antimicrobial Susceptibility as a Diagnostic Aid in the Identification of Nonfermenting Gram-Negative Bacteria

PubMed Central

Gilardi, G. L.

1971-01-01

Antimicrobial susceptibility data regarding nonfermentative, gram-negative bacteria (Pseudomonas, Alcaligenes, Acinetobacter, Moraxella, Flavobacterium) are presented showing that the antibiograms of most species examined can be used as an important auxillary aid in their differentiation. PMID:5132093

Antimicrobial Photodynamic Therapy to Kill Gram-negative Bacteria

PubMed Central

Sperandio, Felipe F; Huang, Ying-Ying; Hamblin, Michael R

2013-01-01

Antimicrobial photodynamic therapy (PDT) or photodynamic inactivation (PDI) is a new promising strategy to eradicate pathogenic microorganisms such as Gram-positive and Gram-negative bacteria, yeasts and fungi. The search for new approaches that can kill bacteria but do not induce the appearance of undesired drug-resistant strains suggests that PDT may have advantages over traditional antibiotic therapy. PDT is a non-thermal photochemical reaction that involves the simultaneous presence of visible light, oxygen and a dye or photosensitizer (PS). Several PS have been studied for their ability to bind to bacteria and efficiently generate reactive oxygen species (ROS) upon photostimulation. ROS are formed through type I or II mechanisms and may inactivate several classes of microbial cells including Gram-negative bacteria such as Pseudomonas aeruginosa, which are typically characterized by an impermeable outer cell membrane that contains endotoxins and blocks antibiotics, dyes, and detergents, protecting the sensitive inner membrane and cell wall. This review covers significant peer-reviewed articles together with US and World patents that were filed within the past few years and that relate to the eradication of Gram-negative bacteria via PDI or PDT. It is organized mainly according to the nature of the PS involved and includes natural or synthetic food dyes; cationic dyes such as methylene blue and toluidine blue; tetrapyrrole derivatives such as phthalocyanines, chlorins, porphyrins, chlorophyll and bacteriochlorophyll derivatives; functionalized fullerenes; nanoparticles combined with different PS; other formulations designed to target PS to bacteria; photoactive materials and surfaces; conjugates between PS and polycationic polymers or antibodies; and permeabilizing agents such as EDTA, PMNP and CaCl2. The present review also covers the different laboratory animal models normally used to treat Gram-negative bacterial infections with antimicrobial PDT. PMID:23550545

In-Vitro, Anti-Bacterial Activities of Aqueous Extracts of Acacia catechu (L.F.)Willd, Castanea sativa, Ephedra sinica stapf and shilajita mumiyo Against Gram Positive and Gram Negative Bacteria

PubMed Central

Dashtdar, Mehrab; Dashtdar, Mohammad Reza; Dashtdar, Babak; shirazi, Mohammad khabaz; Khan, Saeed Ahmad

2013-01-01

Objective: Evaluations of the in-vitro anti-bacterial activities of aqueous extracts of Acacia catechu (L.F.)Willd, Castanea sativa, Ephedra sinica stapf and Shilajita mumiyo against gram-positive bacteria (Staphylococcus aureus, Streptococcus pneumonia) and gram-negative bacteria (Escherichia coli, klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa) are reasonable since these ethnomedicinal plants have been used in Persian folk medicine for treating skin diseases, venereal diseases, respiratory problems and nervous disorders for ages. Methods: The well diffusion method (KB testing) with a concentration of 250 μg/disc was used for evaluating the minimal inhibitory concentrations (MIC). Maximum synergistic effects of different combinations of components were also observed. Results: A particular combination of Acacia catechu (L.F.) Willd, Castanea sativa, Ephedra sinica stapf and shilajita mumiyo extracts possesses an outstanding anti-bacterial activity. It's inhibiting effect on microorganisms is significant when compared to the control group (P< 0.05). Staphylococcus aureus was the most sensitive microorganism. The highest antibacterial activity against gram-positive bacteria (Staphylococcus aureus, Streptococcus pneumonia) or gram-negative bacteria (Escherichia coli, Klebsiella pneumonia, Proteus mirabilis and Pseudomonas aeruginosa) was exerted by formula number 2 (Table1). Conclusion: The results reveal the presence of antibacterial activities of Acacia catechu, Castanea sativa husk, Ephedra sp. and Mumiyo against gram-positive and gram-negative bacteria. Synergistic effects in a combined formula, especially in formula number 2 (ASLANⓇ) can lead to potential sources of new antiseptic agents for treatment of acute or chronic skin ulcers. These results considering the significant antibacterial effect of the present formulation, support ethno-pharmacological uses against diarrheal and venereal diseases and demonstrate use of these plants to treat infectious diseases. PMID:25780663

Isolation of the antibiotic pseudopyronine B and SAR evaluation of C3/C6 alkyl analogs.

PubMed

Bouthillette, Leah M; Darcey, Catherine A; Handy, Tess E; Seaton, Sarah C; Wolfe, Amanda L

2017-06-15

Natural products are an abundant source of structurally diverse compounds with antibacterial activity that can be used to develop new and potent antibiotics. One such class of natural products is the pseudopyronines. Here we present the isolation of pseudopyronine B (2) from a Pseudomonas species found in garden soil in Western North Carolina, and SAR evaluation of C3 and C6 alkyl analogs of the natural product for antibacterial activity against Gram-positive and Gram-negative bacteria. We found a direct relationship between antibacterial activity and C3/C6 alkyl chain length. For inhibition of Gram-positive bacteria, alkyl chain lengths between 6 and 7 carbons were found to be the most active (IC 50 =0.04-3.8µg/mL) whereas short alkyl chain analogs showed modest activity against Gram-negative bacteria (IC 50 =223-304µg/mL). This demonstrates the potential for this class of natural products to be optimized for selective activity against either Gram-positive or Gram-negative bacteria. Copyright © 2017 Elsevier Ltd. All rights reserved.

Native valve endocarditis due to a novel strain of Legionella.

PubMed

Pearce, Meghan M; Theodoropoulos, Nicole; Noskin, Gary A; Flaherty, John P; Stemper, Mary E; Aspeslet, Teresa; Cianciotto, Nicholas P; Reed, Kurt D

2011-09-01

Legionellae are Gram-negative bacteria which are capable of causing disease, most commonly in the form of pneumonia. We describe a case of native valve endocarditis caused by a Legionella strain which by genotypic (16S rRNA and mip gene sequencing) and phenotypic analyses is unlike previously described strains of Legionella.

Endotoxin hitchhiking on polymer nanoparticles

NASA Astrophysics Data System (ADS)

Donnell, Mason L.; Lyon, Andrew J.; Mormile, Melanie R.; Barua, Sutapa

2016-07-01

The control of microbial infections is critical for the preparation of biological media including water to prevent lethal septic shock. Sepsis is one of the leading causes of death in the United States. More than half a million patients suffer from sepsis every year. Both gram-positive and gram-negative bacteria are responsible for septic infection by the most common organisms i.e., Escherichia coli and Pseuodomonas aeruginosa. The bacterial cell membrane releases negatively charged endotoxins upon death and enzymatic destruction, which stimulate antigenic response in humans to gram-negative infections. Several methods including distillation, ethylene oxide treatment, filtration and irradiation have been employed to remove endotoxins from contaminated samples, however, the reduction efficiency remains low, and presents a challenge. Polymer nanoparticles can be used to overcome the current inability to effectively sequester endotoxins from water. This process is termed endotoxin hitchhiking. The binding of endotoxin on polymer nanoparticles via electrostatic and hydrophobic interactions offers efficient removal from water. However, the effect of polymer nanoparticles and its surface areas has not been investigated for removal of endotoxins. Poly(ε-caprolactone) (PCL) polymer was tested for its ability to effectively bind and remove endotoxins from water. By employing a simple one-step phase separation technique, we were able to synthesize PCL nanoparticles of 398.3 ± 95.13 nm size and a polydispersity index of 0.2. PCL nanoparticles showed ∼78.8% endotoxin removal efficiency, the equivalent of 3.9 × 105 endotoxin units (EU) per ml. This is 8.34-fold more effective than that reported for commercially available membranes. Transmission electron microscopic images confirmed binding of multiple endotoxins to the nanoparticle surface. The concept of using nanoparticles may be applicable not only to eliminate gram-negative bacteria, but also for any gram-positive bacteria, fungi and parasites.

Emphysematous endocarditis caused by AmpC beta-lactamase-producing Escherichia coli: A case report.

PubMed

Kim, Chung-Jong; Yi, Jeong-Eun; Kim, Yookyung; Choi, Hee Jung

2018-02-01

Infective endocarditis (IE) is a life-threatening disease, mostly caused by gram-positive bacteria. Gram-negative bacteria were identified as a causative organism in relatively small number of cases. Although, antibiotic-resistant Escherichia coli is common cause of gram-negative endocarditis, AmpC beta-lactamase (BL)-harboring E coli is very rare cause of IE. Furthermore, emphysematous endocarditis is also a very rare manifestation of E coli infection. We report a case of 80-year-old female patient presenting with dizziness, fever, and altered mental status, who was finally diagnosed with emphysematous endocarditis caused by E coli harboring an AmpC BL gene. Her chest computed tomography revealed air bubbles surrounding the annulus of a mitral valve and a transesophageal echocardiogram revealed a hyperechogenic mass fixed on the posteromedial side of the mitral annulus with 2 eccentric mitral regurgitation jets. Blood cultures grew E coli which harbored the DHA-type AmpC BL. The organism belonged to a B2 phylogenic group, and multilocus sequence typing analyses revealed that the strains were of ST-95. She was treated with meropenem following the resistant profiles, and surgery was recommended by the healthcare professional, but denied by the patient's guardians. She was transferred to another hospital due to a refusal for further treatment. Emphysematous endocarditis is an uncommon complication of E coli bacteremia. Certain phylogenetic groups may be associated with development of E coli endocarditis.

Triclosan- resistant bacteria isolated from feedlot and residential soils

PubMed Central

WELSCH, TANNER T.; GILLOCK, ERIC T.

2014-01-01

Triclosan is an antimicrobial agent that is currently incorporated into hundreds of consumer and medical products. It can be either a bacteriostatic or bactericidal agent, depending on its formulation. It has activity against Gram-positive and Gram-negative bacteria, as well as some viruses and protists. The purpose of this study was to determine whether triclosan-resistant bacteria could be isolated from the soil. Soils from cattle feedlots and residential lawns were collected and assayed for the presence of these organisms by plating samples on growth media containing triclosan. Organisms were subsequently identified by partial 16S rRNA sequencing analysis. All the organisms isolated in this study were Gram-negative rods, with members of genus Pseudomonas being particularly well represented. This result may not be surprising because Gram-negative organisms are generally more resistant to triclosan, and since Pseudomonas bacteria are known to have numerous efflux mechanisms for dealing with harmful substances. PMID:21391038

Microcins from Enterobacteria: On the Edge Between Gram-Positive Bacteriocins and Colicins

NASA Astrophysics Data System (ADS)

Rebuffat, Sylvie

Most bacteria and archaea produce gene-encoded antimicrobial peptides/proteins called bacteriocins, which are secreted by the producing bacteria to compete against other microorganisms in a given niche. They are considered important mediators of intra- and interspecies interactions and therefore a factor in ­maintaining the microbial diversity and stability. They are ribosomally synthesized, and most of them are produced as inactive precursor proteins, which in some cases are further enzymatically modified. Bacteriocins generally exert potent antibacterial activities directed against bacterial species closely related to the producing bacteria. Bacteriocins are abundant and diverse in Gram-negative and Gram-positive bacteria. This chapter focuses on colicins and microcins from enterobacteria (mainly Escherichia coli) and on bacteriocins from lactic acid bacteria (LAB). Microcins are the lower-molecular-mass bacteriocins produced by Gram-negative bacteria with a repertoire of only 14 representatives. They form a very restricted family of bacteriocins, compared to the huge family of LAB bacteriocins that is constituted of several hundreds of peptides, with which microcins share common characteristics. Nevertheless, microcins also show similarities, particularly in their uptake mechanisms, with the higher-molecular-mass colicins, also produced by E. coli strains. On the edge between LAB bacteriocins and colicins, microcins appear to combine highly efficient strategies developed by both Gram-positive and Gram-negative bacteria at different levels, including uptake, translocation, killing of target cells, and immunity of the producing bacteria, making them important actors of bacterial competitions and fascinating models for novel concepts toward antimicrobial strategies and against resistance mechanisms.

Antibiotic resistance in Burkholderia species.

PubMed

Rhodes, Katherine A; Schweizer, Herbert P

2016-09-01

The genus Burkholderia comprises metabolically diverse and adaptable Gram-negative bacteria, which thrive in often adversarial environments. A few members of the genus are prominent opportunistic pathogens. These include Burkholderia mallei and Burkholderia pseudomallei of the B. pseudomallei complex, which cause glanders and melioidosis, respectively. Burkholderia cenocepacia, Burkholderia multivorans, and Burkholderia vietnamiensis belong to the Burkholderia cepacia complex and affect mostly cystic fibrosis patients. Infections caused by these bacteria are difficult to treat because of significant antibiotic resistance. The first line of defense against antimicrobials in Burkholderia species is the outer membrane penetration barrier. Most Burkholderia contain a modified lipopolysaccharide that causes intrinsic polymyxin resistance. Contributing to reduced drug penetration are restrictive porin proteins. Efflux pumps of the resistance nodulation cell division family are major players in Burkholderia multidrug resistance. Third and fourth generation β-lactam antibiotics are seminal for treatment of Burkholderia infections, but therapeutic efficacy is compromised by expression of several β-lactamases and ceftazidime target mutations. Altered DNA gyrase and dihydrofolate reductase targets cause fluoroquinolone and trimethoprim resistance, respectively. Although antibiotic resistance hampers therapy of Burkholderia infections, the characterization of resistance mechanisms lags behind other non-enteric Gram-negative pathogens, especially ESKAPE bacteria such as Acinetobacter baumannii, Klebsiella pneumoniae and Pseudomonas aeruginosa. Copyright © 2016 Elsevier Ltd. All rights reserved.

The Nimrod transmembrane receptor Eater is required for hemocyte attachment to the sessile compartment in Drosophila melanogaster

PubMed Central

Bretscher, Andrew J.; Honti, Viktor; Binggeli, Olivier; Burri, Olivier; Poidevin, Mickael; Kurucz, Éva; Zsámboki, János; Andó, István; Lemaitre, Bruno

2015-01-01

ABSTRACT Eater is an EGF-like repeat transmembrane receptor of the Nimrod family and is expressed in Drosophila hemocytes. Eater was initially identified for its role in phagocytosis of both Gram-positive and Gram-negative bacteria. We have deleted eater and show that it appears to be required for efficient phagocytosis of Gram-positive but not Gram-negative bacteria. However, the most striking phenotype of eater deficient larvae is the near absence of sessile hemocytes, both plasmatocyte and crystal cell types. The eater deletion is the first loss of function mutation identified that causes absence of the sessile hemocyte state. Our study shows that Eater is required cell-autonomously in plasmatocytes for sessility. However, the presence of crystal cells in the sessile compartment requires Eater in plasmatocytes. We also show that eater deficient hemocytes exhibit a cell adhesion defect. Collectively, our data uncovers a new requirement of Eater in enabling hemocyte attachment at the sessile compartment and points to a possible role of Nimrod family members in hemocyte adhesion. PMID:25681394

The Nimrod transmembrane receptor Eater is required for hemocyte attachment to the sessile compartment in Drosophila melanogaster.

PubMed

Bretscher, Andrew J; Honti, Viktor; Binggeli, Olivier; Burri, Olivier; Poidevin, Mickael; Kurucz, Éva; Zsámboki, János; Andó, István; Lemaitre, Bruno

2015-02-13

Eater is an EGF-like repeat transmembrane receptor of the Nimrod family and is expressed in Drosophila hemocytes. Eater was initially identified for its role in phagocytosis of both Gram-positive and Gram-negative bacteria. We have deleted eater and show that it appears to be required for efficient phagocytosis of Gram-positive but not Gram-negative bacteria. However, the most striking phenotype of eater deficient larvae is the near absence of sessile hemocytes, both plasmatocyte and crystal cell types. The eater deletion is the first loss of function mutation identified that causes absence of the sessile hemocyte state. Our study shows that Eater is required cell-autonomously in plasmatocytes for sessility. However, the presence of crystal cells in the sessile compartment requires Eater in plasmatocytes. We also show that eater deficient hemocytes exhibit a cell adhesion defect. Collectively, our data uncovers a new requirement of Eater in enabling hemocyte attachment at the sessile compartment and points to a possible role of Nimrod family members in hemocyte adhesion. © 2015. Published by The Company of Biologists Ltd.

77 FR 59928 - Draft Guidance for Industry on Complicated Intra-Abdominal Infections: Developing Drugs for...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-01

.... A wide variety of bacterial pathogens are responsible for cIAIs, including Gram-negative aerobic bacteria, Gram-positive bacteria, and anaerobic bacteria, and there are also mixed infections. This draft...

Prospects and challenges of developing new agents for tough Gram-negatives.

PubMed

Meyer, Annette L

2005-10-01

Historically, the medical profession has been successful in treating most bacterial infections in humans with synthetic second- and third-generation antibiotics. Recently, the prospects for continued success have dimmed with the increase in multidrug-resistant stains of bacteria. Infections caused by the Gram-negative bacteria Pseudomonas aeruginosa and Acinetobacter spp. in particular have increased in frequency and severity, and become progressively more difficult to treat. Contributors to disease severity include chronic infections due to mutator strains, persister cells and biofilms. The worst-case scenario of infections susceptible only to toxic polymixins is now a reality. The need to address the treatment of multidrug-resistant pathogens with innovative combination approaches and/or novel antibacterial agents is occurring in the context of reduced investment in antimicrobial drug discovery by the pharmaceutical industry.

Morning glory resin glycosides as modulators of antibiotic activity in multidrug-resistant gram-negative bacteria.

PubMed

Corona-Castañeda, Berenice; Pereda-Miranda, Rogelio

2012-01-01

Twenty-six microbiologically inactive (MIC > 512 µg/mL) convolvulaceous resin glycosides ( 1- 26) were tested for resistance modulatory activity in vitro against Escherichia coli Rosetta-gami and two nosocomial pathogens, Salmonella typhi and Shigella flexneri. These compounds exerted a potentiation effect of the clinically useful antibiotics tetracycline, kanamycin, and chloramphenicol against the tested gram-negative bacteria by increasing antibiotic susceptibility up to 32-fold at concentrations of 25 µg/mL. Therefore, the oligosaccharides from the morning glory family (Convolvulaceae) represent metabolites that reverse microbial resistance mechanisms, favoring an increase in the strength and effectiveness of current antibiotics that are not effective in the treatment of refractive infections caused by multidrug-resistant strains. © Georg Thieme Verlag KG Stuttgart · New York.

Physico-Chemical-Managed Killing of Penicillin-Resistant Static and Growing Gram-Positive and Gram-Negative Vegetative Bacteria

NASA Technical Reports Server (NTRS)

Schramm, Jr., Harry F. (Inventor); Farris, III, Alex F. (Inventor); Defalco, Francis G. (Inventor); Richmond, Robert Chaffee (Inventor)

2012-01-01

Systems and methods for the use of compounds from the Hofmeister series coupled with specific pH and temperature to provide rapid physico-chemical-managed killing of penicillin-resistant static and growing Gram-positive and Gram-negative vegetative bacteria. The systems and methods represent the more general physico-chemical enhancement of susceptibility for a wide range of pathological macromolecular targets to clinical management by establishing the reactivity of those targets to topically applied drugs or anti-toxins.

In vitro selection of RNA aptamer specific to Salmonella typhimurium.

PubMed

Han, Seung Ryul; Lee, Seong-Wook

2013-06-28

Salmonella is a major foodborne pathogen that causes a variety of human diseases. Development of ligands directly and specifically binding to the Salmonella will be crucial for the rapid detection of, and thus for efficient protection from, the virulent bacteria. In this study, we identified a RNA aptamer-based ligand that can specifically recognize Salmonella Typhimurium through SELEX technology. To this end, we isolated and characterized an RNase-resistant RNA aptamer that bound to the OmpC protein of Salmonella Typhimurium with high specificity and affinity (Kd ~ 20 nM). Of note, the selected aptamer was found to specifically bind to Salmonella Typhimurium, but neither to Gram-positive bacteria (Staphylococcus aureus) nor to other Gram-negative bacteria (Escherichia coli O157:H7). This was evinced by aptamer-immobilized ELISA and aptamer-linked precipitation experiments. This Salmonella species-specific aptamer could be useful as a diagnostic ligand against pathogen-caused foodborne sickness.

A study of the antibacterial activity of L-phenylalanine and L-tyrosine esters in relation to their CMCs and their interactions with 1,2-dipalmitoyl-sn-glycero-3-phosphocholine, DPPC as model membrane.

PubMed

Joondan, Nausheen; Jhaumeer-Laulloo, Sabina; Caumul, Prakashanand

2014-01-01

Cationic amino acid-based surfactants are known to interact with the lipid bilayer of cell membranes resulting in depolarization, lysis and cell death through a disruption of the membrane topology. A range of cationic surfactant analogues derived from L-Phenylalanine (C1-C20) and L-Tyrosine (C8-C14) esters have been synthesized and screened for their antibacterial activity. The esters were more active against gram positive than gram negative bacteria. The activity increased with increasing chain length, exhibiting a cut-off effect at C12 for gram positive and C8/C10 for gram negative bacteria. The cut-off effect for gram negative bacteria was observed at a lower alkyl chain length. The CMC was correlated with the MIC, inferring that micellar activity contribute to the cut-off effect in antibacterial activity. The interaction of the cationic surfactants with the phospholipid vesicles (1,2-dipalmitoyl-sn-glycero-3-phosphocholine, DPPC) in the presence of 1-anilino-8-naphthalene sulfonate (ANS) and 1,6-diphenyl-1,3,5-hexatriene (DPH) as fluorescence probes showed that an increase in ionic interaction causes an increase in antibacterial activity. Increase in hydrophobic interaction increases the antibacterial activity only to a certain chain length, attributing to the cut-off effect. Therefore, both electrostatic and hydrophobic interactions, involving the polar and nonpolar moieties are of paramount importance for the bactericidal properties. Copyright © 2014 Elsevier GmbH. All rights reserved.

Isolating "Unknown" Bacteria in the Introductory Microbiology Laboratory: A New Selective Medium for Gram-Positives.

ERIC Educational Resources Information Center

McKillip, John L.; Drake, MaryAnne

1999-01-01

Describes the development, preparation, and use of a medium that can select against a wide variety of Gram-negative bacteria while still allowing growth and differentiation of a wide range of Gram-positives. (WRM)

Predictive compound accumulation rules yield a broad-spectrum antibiotic

NASA Astrophysics Data System (ADS)

Richter, Michelle F.; Drown, Bryon S.; Riley, Andrew P.; Garcia, Alfredo; Shirai, Tomohiro; Svec, Riley L.; Hergenrother, Paul J.

2017-05-01

Most small molecules are unable to rapidly traverse the outer membrane of Gram-negative bacteria and accumulate inside these cells, making the discovery of much-needed drugs against these pathogens challenging. Current understanding of the physicochemical properties that dictate small-molecule accumulation in Gram-negative bacteria is largely based on retrospective analyses of antibacterial agents, which suggest that polarity and molecular weight are key factors. Here we assess the ability of over 180 diverse compounds to accumulate in Escherichia coli. Computational analysis of the results reveals major differences from the retrospective studies, namely that the small molecules that are most likely to accumulate contain an amine, are amphiphilic and rigid, and have low globularity. These guidelines were then applied to convert deoxynybomycin, a natural product that is active only against Gram-positive organisms, into an antibiotic with activity against a diverse panel of multi-drug-resistant Gram-negative pathogens. We anticipate that these findings will aid in the discovery and development of antibiotics against Gram-negative bacteria.

In vitro susceptibility of gram-negative bacterial isolates to chlorhexidine gluconate.

PubMed

Mengistu, Y; Erge, W; Bellete, B

1999-05-01

To investigate the susceptibility of clinical isolates of gram-negative bacteria to chlorhexidine gluconate. Prospective laboratory study. Tikur Anbessa Hospital, Addis Ababa, Ethiopia. Clinical specimens from 443 hospital patients. Significant number of gram negative bacteria were not inhibited by chlorhexidine gluconate (0.02-0.05%) used for antisepsis. Four hundred and forty three strains of gram-negative bacteria were isolated from Tikur Anbessa Hospital patients. Escherichia coli (31.6%) and Klebsiella pneumoniae (23%) were the most frequently isolated bacteria followed by Proteus species (13.3%), Pseudomonas species (9.2%), and Citrobacter species (6.1%). Each organism was tested to chlorhexidine gluconate (CHG), minimum inhibitory concentration (MIC) ranging from 0.0001% to 1%w/v. All Salmonella species and E. coli were inhibited by CHG, MIC < or = 0.01%. Twenty nine per cent of Acinetobacter, 28% of K. pneumoniae and Enterobacter species and 19-25% of Pseudomonas, Proteus and Providencia species were only inhibited at high concentrations of CHG (> or = 0.1%). Our results showed that a significant number of the gram-negative bacterial isolates were not inhibited by CHG at the concentration used for disinfection of wounds or instruments (MIC 0.02-0.05% w/v). It is therefore important to select appropriate concentration of this disinfectant and rationally use it for disinfection and hospital hygiene. Continuing follow up and surveillance is also needed to detect resistant bacteria to chlorhexidine or other disinfectants in time.

Combined effects of organic acids and salt depending on type of acids and pathogens in laboratory media and acidified pickle.

PubMed

Bae, Y-M; Lee, S-Y

2015-08-01

In this study, the effectiveness of combining each of seven types of acids with 3% salt as a treatment against pathogens was investigated in laboratory media and acidified food. When 0.5% malic, 0.5% tartaric, 0.5% citric or 0.25% phosphoric acid was combined with 3% salt, there was a higher reduction in Gram-negative bacteria (Escherichia coli O157:H7 and Salmonella Typhimurium) compared to when using acid alone. However, when 0.5% acetic, 0.5% propionic or 0.25% lactic acid was combined with 3% salt, the salt provided protection against the acid treatment. However, the antagonistic effects of acetic, propionic and lactic acid seen with Gram-negative bacteria were not observed in Listeria monocytogenes. Antagonistic effects were similarly observed when E. coli O157:H7 was treated with acetic acid and salt in food. These results show that the addition of salt increases the resistance of Gram-negative bacteria to acid treatments when using acetic, propionic and lactic acid. This study shows that antagonistic effects were observed when Gram-negative bacteria were treated with organic acids of simple structure. It may provide useful information for understanding the acid resistance mechanism of Gram-negative bacteria and developing methods for preserving acidified food. © 2015 The Society for Applied Microbiology.

Summary Report on Visit to Departamento de Investigation Centro Ramon Y Cajal Madrid, Spain.

DTIC Science & Technology

1984-10-30

Over one hundred colonies of Gram negative bacteria ( Lactobacillus acidophilus ) were cultured at 380 C in Petri dishes for 72 hours. The inoculum...within the various laboratories. He was particularly excited about studies using Lactobacillus bacteria and the work involving Drosophila melanogaster...therapy (0-40 Gauss) caUsed a 40 %reduction in the number of Lactobacillus colonies. ........................ . . .. . .. . .. . .. . . RAT MODEL TO

Escherichia coli and other Enterobacteriaceae: Food poisoning and health effects

USDA-ARS?s Scientific Manuscript database

The family Enterobactericeae consists of rod-shaped, Gram-negative, facultatively anaerobic, non-spore forming bacteria and also includes the food-borne pathogens, Cronobacter spp., Escherichia coli, Salmonella enterica, Shigella spp., and Yersinia spp. Illness caused by these pathogens is acquired...

Synergistic effects of Candida and Escherichia coli on gut barrier function.

PubMed

Diebel, L N; Liberati, D M; Diglio, C A; Dulchavsky, S A; Brown, W J

1999-12-01

Disruption of the indigenous gut microflora with overgrowth of gram-negative bacteria and Candida species is common in the critically ill patient. These organisms readily translocate in vitro, which may cause septic complications and organ failure. A synergistic effect between Escherichia coli and C. albicans in polymicrobial infections has been demonstrated. An interaction between these organisms at the mucosal barrier is unknown. Ca(CO2) monolayers were grown to confluence in a two compartment culture system. E. coli and C. albicans or E. coli alone were added to the apical chambers. Secretory immunoglobulin A was added to half of the apical chambers as well. Cell cultures were incubated for a total of 240 minutes. Basal media were sampled at timed intervals for quantitative culture. Monolayer integrity was confirmed by serial measurement of transepithelial electrical resistance. Secretory immunoglobulin A decreased bacterial translocation across Ca(CO2) monolayers challenged with E. coli alone. Transepithelial passage of E. coli was significantly increased by coculture of bacteria with C. albicans. Augmentation of bacterial translocation by Candida occurred even in the presence of secretory immunoglobulin A. Candida colonization of the GI tract may impair mucosal barrier defense against gram-negative bacteria. The clinical role of gut antifungal prophylaxis in protecting against gut derived gram-negative sepsis is speculative.

EXTENDED-SPECTRUM BETA-LACTAMASE PRODUCING GRAM NEGATIVE BACTERIA IN IRAN: A REVIEW

PubMed Central

Leylabadlo, Hamed Ebrahimzadeh; Pourlak, Tala; bialvaei, Abed Zahedi; Aghazadeh, Mohammad; Asgharzadeh, Mohammad; Kafil, Hossein Samadi

2017-01-01

Background: The emergence and spread of extended spectrum β-lactamase (ESBL)-producing Gram- negative bacteria (GNB), particularly in Enterobacteriaceae, Acinetobacter baumannii, and Pseudomonas aeruginosa, have increased all over the world. ESBLs are characterized by their ability to hydrolyze β-lactams, early cephalosporins, oxyimino-thiazolyl cephalosporins, and monobactams, but not cephamycins or carbapenems. The rate of nosocomial infections caused by ESBL-producing GNB in Asia Pacific has increased and several studies have identified their prevalence in the region. The aim of this study is to review the prevalence of ESBL-producing GNB in the West Asia and the Middle East with a particular focus on Iran. Materials and Methods: The available evidence from various studies (Microbia and clinical studies, retrieved from the PubMed, and Scopus databases) regarding the ESBL producing Gram negative bacteria in Iran were evaluated. Results: In almost all parts of the country, high resistance has been observed, especially in the central part of Iran. Up to 89.8% Escherichia coli, 72.1% Klebsiella pneumonia, 84.2% Acinetobacter baumannii, and 83.8% Pseudomonas aeruginosa isolates are ESBL positive. Conclusion: The present study showed the increasing prevalence of ESBLs in different regions of Iran, which could be useful to strategic policy towards reducing reduce their prevalence. PMID:28670639

The use of a differential fluorescent staining method to detect bacteriuria.

PubMed

Ciancaglini, Ettore; Fazii, Paolo; Sforza, Giuseppe Riario

2004-01-01

This report describes a differential staining method which distinguishes gram-positive from gram-negative bacteria in fluorescence. Gram-positive bacteria appear yellow and gram-negative bacteria appear green. The method is based on two fluorochromes, one acting in the wavelength of red, i.e. the acridine orange, and another acting in the wavelength of green, i.e. the fluorescein, which together form a red/ green system. In this report we compared the accuracy of the differential fluorescent staining method and the Gram stain in screening for bacteriuria, as detected by conventional cultures. A total of 1487 urine samples were tested. 289 cultures were positive. 237 specimens grew a single organism at 10(5) and 10(4) CFU/ml. 224 smears were detected by the differential fluorescent staining method and 162 were detected by Gram stain. 1198 samples failed to grow organisms at 10(5) and 10(4) CFU/ml. 107 smears were falsely positive by the fluorescent staining procedure and 289 were falsely positive by the Gram stain. On the basis of the culture results, the sensitivity of the differential fluorescent staining method was 94.5% and that of the Gram stain 68.3%. The specificity of the fluorescent staining procedure was 91.6% and that of the Gram stain 75.8%. The positive predictive value and the negative predictive value of the fluorescent staining method were 67.6% and 98.8%, respectively. Those of the Gram stain were 35.9% and 92.3%, respectively. A wide range of microbiological and chemical techniques are available to identify bacteria in urine. This fluorescent staining method represents a simple, rapid, reliable method with low-running costs. The main advantage of this technique is that it enables the microbiologist to exclude the presence of bacteria in the urine within a short time after specimen receipt and to eliminate a large number of specimens for culture with significant cost saving. Another advantage of the method is that it allows to distinguish gram-positive from gram-negative bacteria in positive slides on the same day the sample is obtained. The stained smears were easily interpreted, even when the bacterial counts in the specimen were low.

Cloning and sequencing of the histidine decarboxylase genes of gram-negative, histamine-producing bacteria and their application in detection and identification of these organisms in fish.

PubMed

Takahashi, Hajime; Kimura, Bon; Yoshikawa, Miwako; Fujii, Tateo

2003-05-01

The use of molecular tools for early and rapid detection of gram-negative histamine-producing bacteria is important for preventing the accumulation of histamine in fish products. To date, no molecular detection or identification system for gram-negative histamine-producing bacteria has been developed. A molecular method that allows the rapid detection of gram-negative histamine producers by PCR and simultaneous differentiation by single-strand conformation polymorphism (SSCP) analysis using the amplification product of the histidine decarboxylase genes (hdc) was developed. A collection of 37 strains of histamine-producing bacteria (8 reference strains from culture collections and 29 isolates from fish) and 470 strains of non-histamine-producing bacteria isolated from fish were tested. Histamine production of bacteria was determined by paper chromatography and confirmed by high-performance liquid chromatography. Among 37 strains of histamine-producing bacteria, all histidine-decarboxylating gram-negative bacteria produced a PCR product, except for a strain of Citrobacter braakii. In contrast, none of the non-histamine-producing strains (470 strains) produced an amplification product. Specificity of the amplification was further confirmed by sequencing the 0.7-kbp amplification product. A phylogenetic tree of the isolates constructed using newly determined sequences of partial hdc was similar to the phylogenetic tree generated from 16S ribosomal DNA sequences. Histamine accumulation occurred when PCR amplification of hdc was positive in all of fish samples tested and the presence of powerful histamine producers was confirmed by subsequent SSCP identification. The potential application of the PCR-SSCP method as a rapid monitoring tool is discussed.

Alternate gram staining technique using a fluorescent lectin.

PubMed Central

Sizemore, R K; Caldwell, J J; Kendrick, A S

1990-01-01

Fluorescence-labeled wheat germ agglutinin binds specifically to N-acetylglucosamine in the outer peptidoglycan layer of gram-positive bacteria. The peptidoglycan layer of gram-negative bacteria is covered by a membrane and is not labeled by the lectin. By exploiting this phenomenon, an alternative Gram staining technique has been developed. Images PMID:1697149

Peroxidasin contributes to lung host defense by direct binding and killing of gram-negative bacteria.

PubMed

Shi, Ruizheng; Cao, Zehong; Li, Hong; Graw, Jochen; Zhang, Guogang; Thannickal, Victor J; Cheng, Guangjie

2018-05-01

Innate immune recognition is classically mediated by the interaction of host pattern-recognition receptors and pathogen-associated molecular patterns; this triggers a series of downstream signaling events that facilitate killing and elimination of invading pathogens. In this report, we provide the first evidence that peroxidasin (PXDN; also known as vascular peroxidase-1) directly binds to gram-negative bacteria and mediates bactericidal activity, thus, contributing to lung host defense. PXDN contains five leucine-rich repeats and four immunoglobulin domains, which allows for its interaction with lipopolysaccharide, a membrane component of gram-negative bacteria. Bactericidal activity of PXDN is mediated via its capacity to generate hypohalous acids. Deficiency of PXDN results in a failure to eradicate Pseudomonas aeruginosa and increased mortality in a murine model of Pseudomonas lung infection. These observations indicate that PXDN mediates previously unrecognized host defense functions against gram-negative bacterial pathogens.

Evaluation of Verigene Blood Culture Test Systems for Rapid Identification of Positive Blood Cultures.

PubMed

Kim, Jae-Seok; Kang, Go-Eun; Kim, Han-Sung; Kim, Hyun Soo; Song, Wonkeun; Lee, Kyu Man

2016-01-01

The performance of molecular tests using the Verigene Gram-Positive and Gram-Negative Blood Culture nucleic acid tests (BC-GP and BC-GN, resp.; Naosphere, Northbrook, IL, USA) was evaluated for the identification of microorganisms detected from blood cultures. Ninety-nine blood cultures containing Gram-positive bacteria and 150 containing Gram-negative bacteria were analyzed using the BC-GP and BC-GN assays, respectively. Blood cultures were performed using the Bactec blood culture system (BD Diagnostic Systems, Franklin Lakes, NJ, USA) and conventional identification and antibiotic-susceptibility tests were performed using a MicroScan system (Siemens, West Sacramento, CA, USA). When a single strain of bacteria was isolated from the blood culture, Verigene assays correctly identified 97.9% (94/96) of Gram-positive bacteria and 93.8% (137/146) of Gram-negative bacteria. Resistance genes mecA and vanA were correctly detected by the BC-GP assay, while the extended-spectrum β-lactamase CTX-M and the carbapenemase OXA resistance gene were detected from 30 cases cultures by the BC-GN assay. The BC-GP and BC-GN assays showed high agreement with conventional identification and susceptibility tests. These tests are useful for rapid identification of microorganisms and the detection of clinically important resistance genes from positive Bactec blood cultures.

A Flow-Cytometric Gram-Staining Technique for Milk-Associated Bacteria

PubMed Central

Holm, Claus; Jespersen, Lene

2003-01-01

A Gram-staining technique combining staining with two fluorescent stains, Oregon Green-conjugated wheat germ agglutinin (WGA) and hexidium iodide (HI) followed by flow-cytometric detection is described. WGA stains gram-positive bacteria while HI binds to the DNA of all bacteria after permeabilization by EDTA and incubation at 50°C for 15 min. For WGA to bind to gram-positive bacteria, a 3 M potassium chloride solution was found to give the highest fluorescence intensity. A total of 12 strains representing some of the predominant bacterial species in bulk tank milk and mixtures of these were stained and analyzed by flow cytometry. Overall, the staining method showed a clear differentiation between gram-positive and gram-negative bacterial populations. For stationary-stage cultures of seven gram-positive bacteria and five gram-negative bacteria, an average of 99% of the cells were correctly interpreted. The method was only slightly influenced by the growth phase of the bacteria or conditions such as freezing at −18°C for 24 h. For any of these conditions, an average of at least 95% of the cells were correctly interpreted. When stationary-stage cultures were stored at 5°C for 14 days, an average of 86% of the cells were correctly interpreted. The Gram-staining technique was applied to the flow cytometry analysis of bulk tank milk inoculated with Staphylococcus aureus and Escherichia coli. These results demonstrate that the technique is suitable for analyzing milk samples without precultivation. PMID:12732558

A flow-cytometric gram-staining technique for milk-associated bacteria.

PubMed

Holm, Claus; Jespersen, Lene

2003-05-01

A Gram-staining technique combining staining with two fluorescent stains, Oregon Green-conjugated wheat germ agglutinin (WGA) and hexidium iodide (HI) followed by flow-cytometric detection is described. WGA stains gram-positive bacteria while HI binds to the DNA of all bacteria after permeabilization by EDTA and incubation at 50 degrees C for 15 min. For WGA to bind to gram-positive bacteria, a 3 M potassium chloride solution was found to give the highest fluorescence intensity. A total of 12 strains representing some of the predominant bacterial species in bulk tank milk and mixtures of these were stained and analyzed by flow cytometry. Overall, the staining method showed a clear differentiation between gram-positive and gram-negative bacterial populations. For stationary-stage cultures of seven gram-positive bacteria and five gram-negative bacteria, an average of 99% of the cells were correctly interpreted. The method was only slightly influenced by the growth phase of the bacteria or conditions such as freezing at -18 degrees C for 24 h. For any of these conditions, an average of at least 95% of the cells were correctly interpreted. When stationary-stage cultures were stored at 5 degrees C for 14 days, an average of 86% of the cells were correctly interpreted. The Gram-staining technique was applied to the flow cytometry analysis of bulk tank milk inoculated with Staphylococcus aureus and Escherichia coli. These results demonstrate that the technique is suitable for analyzing milk samples without precultivation.

Axinellamines as Broad-Spectrum Antibacterial Agents: Scalable Synthesis and Biology

PubMed Central

2015-01-01

Antibiotic-resistant bacteria present an ongoing challenge to both chemists and biologists as they seek novel compounds and modes of action to out-maneuver continually evolving resistance pathways, especially against Gram-negative strains. The dimeric pyrrole–imidazole alkaloids represent a unique marine natural product class with diverse primary biological activity and chemical architecture. This full account traces the strategy used to develop a second-generation route to key spirocycle 9, culminating in a practical synthesis of the axinellamines and enabling their discovery as broad-spectrum antibacterial agents, with promising activity against both Gram-positive and Gram-negative bacteria. While their detailed mode of antibacterial action remains unclear, the axinellamines appear to cause secondary membrane destabilization and impart an aberrant cellular morphology consistent with the inhibition of normal septum formation. This study serves as a rare example of a natural product initially reported to be devoid of biological activity surfacing as an active antibacterial agent with an intriguing mode of action. PMID:25328977

Native Valve Endocarditis Due to a Novel Strain of Legionella ▿

PubMed Central

Pearce, Meghan M.; Theodoropoulos, Nicole; Noskin, Gary A.; Flaherty, John P.; Stemper, Mary E.; Aspeslet, Teresa; Cianciotto, Nicholas P.; Reed, Kurt D.

2011-01-01

Legionellae are Gram-negative bacteria which are capable of causing disease, most commonly in the form of pneumonia. We describe a case of native valve endocarditis caused by a Legionella strain which by genotypic (16S rRNA and mip gene sequencing) and phenotypic analyses is unlike previously described strains of Legionella. PMID:21795511

Effects of nisin on growth of bacteria attached to meat.

PubMed Central

Chung, K T; Dickson, J S; Crouse, J D

1989-01-01

Nisin had an inhibitory effect on gram-positive bacteria (Listeria monocytogenes, Staphylococcus aureus, and Streptococcus lactis) but did not have an inhibitory effect on gram-negative bacteria (Serratia marcescens, Salmonella typhimurium, and Pseudomonas aeruginosa) attached to meat. Nisin delayed bacterial growth on meats which were artificially inoculated with L. monocytogenes or Staphylococcus aureus for at least 1 day at room temperature. If the incubation temperature was 5 degrees C, growth of L. monocytogenes was delayed for more than 2 weeks, and growth of Staphylococcus aureus did not occur. We also found that the extractable activity of nisin decreased rapidly when the meats were incubated at ambient temperatures and that this decrease was inversely related to the observed inhibitory effect. These findings disclosed that nisin delays the growth of some gram-positive bacteria attached to meat. However, nisin alone may not be sufficient to prevent meat spoilage because of the presence of gram-negative and other nisin-resistant gram-positive bacteria. PMID:2764559

Antibacterial activities of fluorescent nano assembled triphenylamine phosphonium ionic liquids.

PubMed

Brunel, Frédéric; Lautard, Christelle; Garzino, Frédéric; Giorgio, Suzanne; Raimundo, Jean M; Bolla, Jean M; Camplo, Michel

2016-08-01

Staphylococcus aureus, a Gram positive coccal bacterium is a major cause of nosocomial infection. We report the synthesis of new triphenylamine phosphonium ionic liquids which are able to self-assemble into multiwall nanoassemblies and to reveal a strong bactericidal activity (MIC=0.5mg/L) for Gram positive bacteria (including resistant strains) comparable to that of standard antibiotics. Time kill, metabolism and fluorescence confocal microscopy studies show a quasi-instantaneously penetration of the nanoassemblies inside the bacteria resulting of a rapid blocking (30min) of their proliferation. As confirmed by rezasurin reduction monitoring, these compounds strongly affect the bacterial metabolism and a Gram positive versus Gram negative selectivity is clearly observed. These fluorescent phosphonium ionic liquid might constitute a useful tool for both translocation studies and to tackle infectious diseases related to the field of implantology. Copyright © 2016 Elsevier Ltd. All rights reserved.

The Environment and the Microbial Ecology of Human Skin

PubMed Central

McBride, Mollie E.; Duncan, W. Christopher; Knox, J. M.

1977-01-01

Microbial flora of the skin of three human population groups representing different natural environments was examined quantitatively and qualitatively to determine whether environmental differences in temperature and humidity can influence the microbial flora of normal skin. Five anatomical skin sites - hands, back, axillae, groin, and feet - were sampled from 10 subjects working in a high-humidity, high-temperature environment, 10 subjects from a low-temperature, high-humidity environment, and 10 subjects working in a moderate-temperature and low-humidity environment. Bacterial populations were significantly larger from the back, axillae, and feet in individuals from the high-temperature and high-humidity environment as compared to the moderate-temperature, low-humidity environment. High humidity and low temperature had no significant effect on total populations, but this group showed a higher frequency of isolation of fungi, and gram-negative bacteria from the back and feet. Although there was an indication that increase in the environmental humidity could result in an increased frequency of isolation of gram-negative bacteria, there was no evidence that an increase in either temperature or humidity altered the relative proportions of gram-negative bacteria in the predominantly gram-positive microbial flora found on normal skin. It was concluded that, although climatic changes may cause fluctation in microbial populations from certain sites, they are not a major influence on the ecology of the microbial flora of normal skin in the natural environment. The variables introduced by studying individuals in their natural environment and the influence of these on the results are discussed. PMID:16345214

A field study evaluation of Petrifilm™ plates as a 24-h rapid diagnostic test for clinical mastitis on a dairy farm.

PubMed

Mansion-de Vries, Elisabeth Maria; Knorr, Nicole; Paduch, Jan-Hendrik; Zinke, Claudia; Hoedemaker, Martina; Krömker, Volker

2014-03-01

Clinical mastitis is one of the most common and expensive diseases of dairy cattle. To make an informed treatment decision, it is important to know the causative pathogen. However, no detection of bacterial growth can be made in approximately 30% of all clinical cases of mastitis. Before selecting the treatment regimen, it is important to know whether the mastitis-causing pathogen (MCP) is Gram-positive or Gram-negative. The aim of this field study was to investigate whether using two 3M Petrifilm™ products on-farm (which conveys a higher degree of sample freshness but also bears a higher risk for contamination than working in a lab) as 24-h rapid diagnostic of clinical mastitis achieved results that were comparable to the conventional microbiological diagnostic method. AerobicCount (AC)-Petrifilm™ and ColiformCount (CC)-Petrifilm™ were used to identify the total bacterial counts and Gram-negative bacteria in samples from clinical mastitis cases, respectively. Missing growth on both plates was classified as no bacterial detection. Growth only on the AC-Petrifilm™ was assessed as Gram-positive, and growth on both Petrifilm™ plates was assessed as Gram-negative bacterial growth. Additionally, milk samples were analysed by conventional microbiological diagnostic method on aesculin blood agar as a reference method. Overall, 616 samples from clinical mastitis cases were analysed. Using the reference method, Gram-positive and Gram-negative bacteria, mixed bacterial growth, contaminated samples and yeast were determined in 32.6%, 20.0%, 2.5%, 14.1% and 1.1% of the samples, respectively. In 29.7% of the samples, microbiological growth could not be identified. Using the Petrifilm™ concept, bacterial growth was detected in 59% of the culture-negative samples. The sensitivity of the Petrifilm™ for Gram-positive and Gram-negative MCP was 85.2% and 89.9%, respectively. The specificity was 75.4% for Gram-positive and 88.4% for Gram-negative MCP. For the culture-negative samples, sensitivity was 41.0% and specificity was 91.0%. The results indicate that the Petrifilm™ concept is suitable for therapeutic decision-making at the farm level or in veterinary practice. As this concept does not allow any statement about the genus or species of microorganisms, relevant MCP should be assessed periodically at the herd level with conventional microbiological diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

Gram positive and Gram negative bacteria differ in their sensitivity to cold plasma

NASA Astrophysics Data System (ADS)

Mai-Prochnow, Anne; Clauson, Maryse; Hong, Jungmi; Murphy, Anthony B.

2016-12-01

Cold atmospheric-pressure plasma (CAP) is a relatively new method being investigated for antimicrobial activity. However, the exact mode of action is still being explored. Here we report that CAP efficacy is directly correlated to bacterial cell wall thickness in several species. Biofilms of Gram positive Bacillus subtilis, possessing a 55.4 nm cell wall, showed the highest resistance to CAP, with less than one log10 reduction after 10 min treatment. In contrast, biofilms of Gram negative Pseudomonas aeruginosa, possessing only a 2.4 nm cell wall, were almost completely eradicated using the same treatment conditions. Planktonic cultures of Gram negative Pseudomonas libanensis also had a higher log10 reduction than Gram positive Staphylococcus epidermidis. Mixed species biofilms of P. aeruginosa and S. epidermidis showed a similar trend of Gram positive bacteria being more resistant to CAP treatment. However, when grown in co-culture, Gram negative P. aeruginosa was more resistant to CAP overall than as a mono-species biofilm. Emission spectra indicated OH and O, capable of structural cell wall bond breakage, were present in the plasma. This study indicates that cell wall thickness correlates with CAP inactivation times of bacteria, but cell membranes and biofilm matrix are also likely to play a role.

Bacteriocins from Gram-Negative Bacteria: A Classification?

NASA Astrophysics Data System (ADS)

Rebuffat, Sylvie

Bacteria produce an arsenal of toxic peptides and proteins, which are termed bacteriocins and play a role in mediating the dynamics of microbial populations and communities. Bacteriocins from Gram-negative bacteria arise mainly from Enterobacteriaceae. They assemble into two main families: high molecular mass modular proteins (30-80 kDa) termed colicins and low molecular mass peptides (between 1 and 10 kDa) termed microcins. The production of colicins is mediated by the SOS response regulon, which plays a role in the response of many bacteria to DNA damages. Microcins are highly stable hydrophobic peptides that are produced under stress conditions, particularly nutrient depletion. Colicins and microcins are found essentially in Escherichia coli, but several other Gram-negative species also produce bacteriocin-like substances. This chapter presents the basis of a classification of colicins and microcins.

Antibacterial activities of multi drug resistant Myroides odoratimimus bacteria isolated from adult flesh flies (Diptera: sarcophagidae) are independent of metallo beta-lactamase gene

PubMed Central

Dharne, M.S.; Gupta, A.K.; Rangrez, A.Y.; Ghate, H.V.; Patole, M.S.; Shouche, Y.S.

2008-01-01

Flesh flies (Diptera: Sarcophagidae) are well known cause of myiasis and their gut bacteria have never been studied for antimicrobial activity against bacteria. Antimicrobial studies of Myroides spp. are restricted to nosocomial strains. A Gram-negative bacterium, Myroides sp., was isolated from the gut of adult flesh flies (Sarcophaga sp.) and submitted to evaluation of nutritional parameters using Biolog GN, 16S rRNA gene sequencing, susceptibility to various antimicrobials by disc diffusion method and detection of metallo β-lactamase genes (TUS/MUS). The antagonistic effects were tested on Gram-negative and Gram-positive bacteria isolated from human clinical specimens, environmental samples and insect mid gut. Bacterial species included were Aeromonas hydrophila, A. culicicola, Morganella morganii subsp. sibonii, Ochrobactrum anthropi, Weissella confusa, Escherichia coli, Ochrobactrum sp., Serratia sp., Kestersia sp., Ignatzschineria sp., Bacillus sp. The Myroides sp. strain was resistant to penicillin-G, erythromycin, streptomycin, amikacin, kanamycin, gentamycin, ampicillin, trimethoprim and tobramycin. These strain showed antibacterial action against all bacterial strains except W. confusa, Ignatzschineria sp., A. hydrophila and M. morganii subsp. sibonii. The multidrug resistance of the strain was similar to the resistance of clinical isolates, inhibiting growth of bacteria from clinical, environmental and insect gut samples. The metallo β-lactamase (TUS/MUS) genes were absent, and resistance due to these genes was ruled out, indicating involvement of other secretion machinery. PMID:24031236

Novel Penicillin-Type Analogues Bearing a Variable Substituted 2-Azetidinone Ring at Position 6: Synthesis and Biological Evaluation.

PubMed

De Rosa, Margherita; Vigliotta, Giovanni; Palma, Giuseppe; Saturnino, Carmela; Soriente, Annunziata

2015-12-10

The synthesis and the biological activity of novel semi-synthetic β-lactam compounds containing an azetidinone moiety joined to the amino-nitrogen of the (+)-6-aminopenicillanic acid (6-APA) as new antibacterial agents is reported. The synthesized compounds were screened for their in vitro antimicrobial activity against a panel of Gram positive and Gram negative pathogens and environmental bacteria. Tested compounds displayed good antimicrobial activity against all tested Gram positive bacteria and for Staphylococcus aureus and Staphylococcus epidermidis antimicrobial activity resulted higher than that of the reference antibiotic. Additionally, in vitro cytotoxic screening was also carried out indicating that the compounds do not cause a cell vitality reduction effective at concentration next to and above those shown to be antimicrobial.

The abundance and diversity of heterotrophic bacteria as a function of harvesting frequency of duckweed (Lemna minor L.) in recirculating aquaculture systems.

PubMed

Ardiansyah, A; Fotedar, R

2016-07-01

Duckweed (Lemna minor L.) is a potential biofilter for nutrient removal and acts as a substrate for heterotrophic bacteria in recirculating aquaculture systems (RAS). Here, we determined the effects of harvesting frequency of duckweed on heterotrophic bacteria in RAS. Twelve independent RAS consisting of fish-rearing tank, biofilter tank and waste-collection tank were used to study the interactions between duckweed harvest frequencies up to 6 days and the composition, abundance and diversity of heterotrophic bacteria. After 36 days, heterotrophic bacteria in the biofilter tank were primarily Gram-negative cocci or ovoid, coccobacilli, Gram-negative bacilli and Gram-positive bacilli. Most bacterial genera were Bacillus and Pseudomonas while the least common was Acinetobacter. Duckweed harvested after every 2 days produced the highest specific growth rates (SGR) and total harvested biomass of duckweed, but harboured less abundant bacteria, whereas 6-day harvests had a higher growth index (GI) of duckweed than 2-day harvests, but caused a poor relationship between SGR and biomass harvest with the abundance and diversity of heterotrophic bacteria. Stronger correlations (R(2)  > 0·65) between duckweed SGR and biomass harvest with the heterotrophic bacteria diversity were observed at 4-day harvest frequency and the control. This study provides significant information on the interaction between the harvest frequency of duckweed and the composition, abundance and diversity of heterotrophic bacteria in recirculating aquaculture systems (RAS). Different harvest frequencies significantly influence the abundance and diversity of heterotrophic bacteria, which in turn may influence the nitrogen uptake efficiency of the system. The research is useful in improving the efficiency of removing nitrogenous metabolites in RAS directly by the duckweed and associated heterotrophic bacteria. © 2016 The Society for Applied Microbiology.

Proteomic changes in chicken plasma induced by Salmonella typhimurium lipopolysaccharides

USDA-ARS?s Scientific Manuscript database

Lipopolysaccharides (LPS) are cell wall components of gram-negative bacteria that cause inflammation and sickness through genetic and proteomic activation. The objective of our study was to identify the proteomic changes in plasma associated with inflammation induced by LPS treatment. Five-week-old ...

Interventional strategies and current clinical experience with carbapenemase-producing Gram-negative bacteria.

PubMed

Akova, M; Daikos, G L; Tzouvelekis, L; Carmeli, Y

2012-05-01

The wide dissemination of carbapenemase-producing Gram-negatives (CPGNs), including enterobacterial species and non-fermenters, has caused a public health crisis of global dimensions. These organisms cause serious infections in hospitalized patients, and are associated with increased mortality. Cross-transmission is common, and outbreaks may occur in healthcare facilities where the infection control practices are inadequate. CPGNs exhibit extensive drug-resistant phenotypes, complicate therapy, and limit treatment options. Systematic data on therapy are limited. However, regimens combining two or more active agents seem to be more efficacious than monotherapy in carbapenemase-producing Klebsiella pneumoniae infections. Strict infection control measures, including active surveillance for timely detection of colonized patients, separation of carriers from non-carriers, and contact precautions, are of utmost importance, and may be the only effective way of preventing the introduction and transmission of these bacteria in healthcare settings. © 2012 The Authors. Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.

Bactericidal Efficacy of Hydrogen Peroxide-Based Disinfectants Against Gram-Positive and Gram-Negative Bacteria on Stainless Steel Surfaces.

PubMed

Ríos-Castillo, Abel G; González-Rivas, Fabián; Rodríguez-Jerez, José J

2017-10-01

In order to develop disinfectant formulations that leverage the effectiveness of hydrogen peroxide (H 2 O 2 ), this study evaluated the bactericidal efficacy of hydrogen peroxide-based disinfectants against Gram-positive and Gram-negative bacteria on stainless steel surfaces. Low concentration of hydrogen peroxide as 0.5% with a cationic polymer, ethoxylated fatty alcohol, and ethyl alcohol had bactericidal efficacy (reductions ≥ 4 log 10 CFU/mL) against Escherichia coli, Staphylococcus aureus, Enterococcus hirae, and Pseudomonas aeruginosa. Hydrogen peroxide-based disinfectants were more effective against E. hirae and P. aeruginosa than to S. aureus. However, the efficacy of hydrogen peroxide against catalase positive bacteria such as S. aureus was increased when this compound was formulated with low concentrations of benzalkonium chloride or ethyl alcohol, lactic acid, sodium benzoate, cationic polymer, and salicylic acid. This study demonstrates that the use of hydrogen peroxide with other antimicrobial products, in adequate concentrations, had bactericidal efficacy in Gram-positive and Gram-negative bacteria on stainless steel surfaces, enabling to reduce the effective concentration of hydrogen peroxide. In the same way, the use of hydrogen peroxide-based disinfectants could reduce the concentrations of traditional disinfectants as quaternary ammonium compounds and therefore a reduction of their chemical residues in the environment after being used. The study of the bactericidal properties of environmentally nontoxic disinfectants such as hydrogen peroxide, sole or in formulations with other disinfectants against Gram-positive and Gram-negative bacteria can enhance the efficacy of various commonly used disinfectant formulations with the hygiene benefits that it entails. Also, the use of hydrogen peroxide formulations can reduce the concentration levels of products that generate environmental residues. © 2017 Institute of Food Technologists®.

Performance Evaluation of the Verigene Gram-Positive and Gram-Negative Blood Culture Test for Direct Identification of Bacteria and Their Resistance Determinants from Positive Blood Cultures in Hong Kong

PubMed Central

Siu, Gilman K. H.; Chen, Jonathan H. K.; Ng, T. K.; Lee, Rodney A.; Fung, Kitty S. C.; To, Sabrina W. C.; Wong, Barry K. C.; Cheung, Sherman; Wong, Ivan W. F.; Tam, Marble M. P.; Lee, Swing S. W.; Yam, W. C.

2015-01-01

Background A multicenter study was conducted to evaluate the diagnostic performance and the time to identifcation of the Verigene Blood Culture Test, the BC-GP and BC-GN assays, to identify both Gram-positive and Gram-negative bacteria and their drug resistance determinants directly from positive blood cultures collected in Hong Kong. Methods and Results A total of 364 blood cultures were prospectively collected from four public hospitals, in which 114 and 250 cultures yielded Gram-positive and Gram-negative bacteria, and were tested with the BC-GP and BC-GN assay respectively. The overall identification agreement for Gram-positive and Gram-negative bacteria were 89.6% and 90.5% in monomicrobial cultures and 62.5% and 53.6% in polymicrobial cultures, respectively. The sensitivities for most genus/species achieved at least 80% except Enterococcus spp. (60%), K.oxytoca (0%), K.pneumoniae (69.2%), whereas the specificities for all targets ranged from 98.9% to 100%. Of note, 50% (7/14) cultures containing K.pneumoniae that were missed by the BC-GN assay were subsequently identified as K.variicola. Approximately 5.5% (20/364) cultures contained non-target organisms, of which Aeromonas spp. accounted for 25% and are of particular concern. For drug resistance determination, the Verigene test showed 100% sensitivity for identification of MRSA, VRE and carbapenem resistant Acinetobacter, and 84.4% for ESBL-producing Enterobacteriaceae based on the positive detection of mecA, vanA, bla OXA and bla CTXM respectively. Conclusion Overall, the Verigene test provided acceptable accuracy for identification of bacteria and resistance markers with a range of turnaround time 40.5 to 99.2 h faster than conventional methods in our region. PMID:26431434

Lipoproteins of Gram-Positive Bacteria: Key Players in the Immune Response and Virulence

PubMed Central

Nguyen, Minh Thu

2016-01-01

SUMMARY Since the discovery in 1973 of the first of the bacterial lipoproteins (Lpp) in Escherichia coli, Braun's lipoprotein, the ever-increasing number of publications indicates the importance of these proteins. Bacterial Lpp belong to the class of lipid-anchored proteins that in Gram-negative bacteria are anchored in both the cytoplasmic and outer membranes and in Gram-positive bacteria are anchored only in the cytoplasmic membrane. In contrast to the case for Gram-negative bacteria, in Gram-positive bacteria lipoprotein maturation and processing are not vital. Physiologically, Lpp play an important role in nutrient and ion acquisition, allowing particularly pathogenic species to better survive in the host. Bacterial Lpp are recognized by Toll-like receptor 2 (TLR2) of the innate immune system. The important role of Lpp in Gram-positive bacteria, particularly in the phylum Firmicutes, as key players in the immune response and pathogenicity has emerged only in recent years. In this review, we address the role of Lpp in signaling and modulating the immune response, in inflammation, and in pathogenicity. We also address the potential of Lpp as promising vaccine candidates. PMID:27512100

Gut microbiota in alcoholic liver disease: pathogenetic role and therapeutic perspectives.

PubMed

Malaguarnera, Giulia; Giordano, Maria; Nunnari, Giuseppe; Bertino, Gaetano; Malaguarnera, Michele

2014-11-28

Alcoholic liver disease (ALD) is the commonest cause of cirrhosis in many Western countries and it has a high rate of morbidity and mortality. The pathogenesis is characterized by complex interactions between metabolic intermediates of alcohol. Bacterial intestinal flora is itself responsible for production of endogenous ethanol through the fermentation of carbohydrates. The intestinal metabolism of alcohol produces a high concentration of toxic acetaldehyde that modifies gut permeability and microbiota equilibrium. Furthermore it causes direct hepatocyte damage. In patients who consume alcohol over a long period, there is a modification of gut microbiota and, in particular, an increment of Gram negative bacteria. This causes endotoxemia and hyperactivation of the immune system. Endotoxin is a constituent of Gram negative bacteria cell walls. Two types of receptors, cluster of differentiation 14 and Toll-like receptors-4, present on Kupffer cells, recognize endotoxins. Several studies have demonstrated the importance of gut-liver axis and new treatments have been studied in recent years to reduce progression of ALD modifying gut microbiota. It has focused attention on antibiotics, prebiotics, probiotics and synbiotics.

Gut microbiota in alcoholic liver disease: Pathogenetic role and therapeutic perspectives

PubMed Central

Malaguarnera, Giulia; Giordano, Maria; Nunnari, Giuseppe; Bertino, Gaetano; Malaguarnera, Michele

2014-01-01

Alcoholic liver disease (ALD) is the commonest cause of cirrhosis in many Western countries and it has a high rate of morbidity and mortality. The pathogenesis is characterized by complex interactions between metabolic intermediates of alcohol. Bacterial intestinal flora is itself responsible for production of endogenous ethanol through the fermentation of carbohydrates. The intestinal metabolism of alcohol produces a high concentration of toxic acetaldehyde that modifies gut permeability and microbiota equilibrium. Furthermore it causes direct hepatocyte damage. In patients who consume alcohol over a long period, there is a modification of gut microbiota and, in particular, an increment of Gram negative bacteria. This causes endotoxemia and hyperactivation of the immune system. Endotoxin is a constituent of Gram negative bacteria cell walls. Two types of receptors, cluster of differentiation 14 and Toll-like receptors-4, present on Kupffer cells, recognize endotoxins. Several studies have demonstrated the importance of gut-liver axis and new treatments have been studied in recent years to reduce progression of ALD modifying gut microbiota. It has focused attention on antibiotics, prebiotics, probiotics and synbiotics. PMID:25469033

Evaluation of the role of Carnobacterium piscicola in spoilage of vacuum- and modified-atmosphere-packed cold-smoked salmon stored at 5 degrees C.

PubMed

Paludan-Müller, C; Dalgaard, P; Huss, H H; Gram, L

1998-02-17

The microflora on spoiled cold-smoked salmon often consists of a mixture of lactic acid bacteria (LAB) and Gram-negative bacteria. To elucidate the role of the different groups, a storage trial was carried out in which nisin and CO2 were used for the selective inhibition of the two bacterial groups. The shelf-life of vacuum-packed cold-smoked salmon, recorded by sensory evaluation, was four weeks at 5 degrees C and the microflora was composed of LAB (10(6)-10(7) cfu/g) with an associate Gram-negative flora in varying levels (10(5)-10(7) cfu/g). The addition of nisin and/or a CO2-atmosphere increased the shelf-life to five or six weeks and limited the level of LAB to about 10(4)-10(6), 10(3)-10(6) and 10(2)-10(4) cfu/g, respectively. CO2-atmosphere +/- nisin inhibited the growth of Gram-negative bacteria, whereas nisin had no effect on these in vacuum packages. The Gram-negative flora on vacuum-packed salmon was dominated by a Vibrio sp., resembling V. marinus, Enterobacteriaceae (Enterobacter agglomerans, Serratia liquefaciens and Rahnella aquatilis) and occasionally Aeromonas hydrophila. Irrespective of the addition of nisin and/or CO2-atmosphere, the LAB microflora was dominated by Carnobacterium piscicola, which was found to account for 87% of the 255 LAB isolates characterized. Whole-cell-protein patterns analysed by SDS-PAGE confirmed the Carnobacterium species identification. The spoilage potential of C. piscicola isolates was further studied by inoculation of approx. 10(6) cfu/g in cold-smoked salmon stored at 5 degrees C. The salmon did not spoil within 4 weeks of storage in vacuum- or CO2-atmosphere, and it is concluded that despite high levels (> 10(7) cfu/g) of C. piscicola, sensory rejection was caused by autolytic changes. This was supported by the development of soft texture and sour, rancid and bitter off-flavours at the point of spoilage, irrespective of the length of shelf-life and low or high total counts of LAB and Gram-negative bacteria.

Bacteremias in liver transplant recipients: shift toward gram-negative bacteria as predominant pathogens.

PubMed

Singh, Nina; Wagener, Marilyn M; Obman, Asia; Cacciarelli, Thomas V; de Vera, Michael E; Gayowski, Timothy

2004-07-01

During the 1990s, gram-positive bacteria emerged as major pathogens after liver transplantation. We sought to determine whether the pathogens associated with bacteremias in liver transplant recipients have changed. Patients included 233 liver transplant recipients transplanted between 1989 and 2003. The proportion of all infections due to bacteremias increased significantly over time (P <.0001). Of other major infections, a trend toward a decrease in fungal infections (P =.089) and a significant decrease in cytomegalovirus (CMV) disease (P =.0004) were documented. Whereas the proportion of bacteremias due to gram-negatives increased from 25% in the period of 1989-1993 to 51.8% in 1998-03, that of gram-positive bacteria decreased from 75% in the period of 1989-93 to 48.2% in the period of 1998-2003. Methicillin-resistant Staphylococcus aureus (MRSA), Klebsiella pneumoniae, and Pseudomonas aeruginosa were the most frequent pathogens in bacteremic patients. The incidence of bacteremias due to MRSA and Pseudomonas aeruginosa has remained unchanged (P <.20); however, that due to enteric gram-negative bacteria, particularly Klebsiella pneumoniae has increased (P =.02). Klebsiella pneumoniae isolates in the current quartile were not clonally related. In conclusion, bacteremias as a proportion of all infections in liver transplant recipients have increased significantly over time, due in part to a decline in infections due to other major pathogens, e.g., fungi, primarily Candida species, and CMV. Gram-negative bacteria have emerged as predominant pathogens in bacteremic liver transplant recipients.

The effect of adding selective mixed culture of alternative electricity production based on tempe wastewater on tubular microbial fuel cell

NASA Astrophysics Data System (ADS)

Mariana, Elisabeth, Utami, Tania Surya; Arbianti, Rita; Hermansyah, Heri

2017-05-01

Bacteria has long been known could produce electricity. MFC (Microbial Fuel Cell) is a technology that uses bacteria. MFC is potential as producer of alternative renewable energy through the conversion of waste by bacteria into electrical energy. However, this technology cannot reach the target value of the minimum voltage. This research is focused on reviewing the effect of the addition of gram positive and negative bacteria (selective mixed culture) contained in tempe wastewater as well as the optimal volume additions gram using a tubular single chamber membranless reactor. The result shows that the addition of selective mixed culture can increase voltage of MFC. Gram negative bacteria dominate tempe wastewater and has better ability to transfer electrons than gram-positive. The voltage increases with increasing amount of bacteria up to a certain maximum point. Addition of 1 mL gram-negative bacteria improve electrical output and provide the most optimal results of 0.0697 mW/m2 mV or 92.14% excalation against the initial control experiment with the average power density of 0.0702 mW1m2. Additions of most optimum variation also give good results on the use of industrial waste, with electrical voltage and power density high of 8.90 mV and 0.02 mW/m2.

Feasibility of quantitatively diagnosing cornea infection using Raman spectroscopy (Conference Presentation)

NASA Astrophysics Data System (ADS)

Bai, Yanru; Chen, Keren; Mishra, Arti; Beuerman, Roger; Liu, Quan

2017-02-01

Ocular infection is a serious eye disease that could lead to blindness without prompt and proper treatment. In pathology, ocular infection is caused by microorganisms such as bacteria, fungi or viruses. The essential prerequisite for the optimal treatment of ocular infection is to identify the microorganism causing infection early as each type of microorganism requires a different therapeutic approach. The clinical procedure for identifying the microorganism species causing ocular infection includes Gram staining (for bacteria)/microscopy (for fungi) and the culture of corneal surface scraping, or aqueous and vitreous smear samples taken from the surface of infected eyes. The culture procedure is labor intensive and expensive. Moreover, culturing is time consuming, which usually takes a few days or even weeks. Such a long delay in diagnosis could result in the exacerbation of patients' symptoms, the missing of the optimal time frame for initiating treatment and subsequently the rising cost for disease management. Raman spectroscopy has been shown highly effective for non-invasive identification of both fungi and bacteria qualitatively. In this study, we investigate the feasibility of identifying the microorganisms of ocular infection and quantifying the concentrations using Raman spectroscopy by measuring not only gram negative and gram positive bacteria but also infected cornea. By applying a modified orthogonal projection approach, the relative concentration of each bacteria species could be quantified. Our results indicate the great potential of Raman spectroscopy as an alternative tool for non-invasive diagnosis of ocular infection and could play a significantly role in future ophthalmology.

In vitro antibacterial and time-kill assessment of crude methanolic stem bark extract of Acacia mearnsii de wild against bacteria in shigellosis.

PubMed

Olajuyigbe, Olufunmiso Olusola; Afolayan, Anthony Jide

2012-02-21

Shigellosis is an important cause of worldwide morbidity and mortality among young children and old people for which treatment with antimicrobial agents is limited. Hence, the need for curative potentials obtainable from medicinal plants becomes inevitable. This study was carried out to assess the antibacterial potentials of crude methanolic extract of the stem bark of Acacia mearnsii against some selected bacteria of clinical importance in shigellosis. The bacteria were inhibited by the extract to produce concentration dependent inhibition zones. The extract exhibited a varied degree of antibacterial activity against all the tested isolates. The MIC values for Gram negative (0.0391-0.3125) mg/mL and those of Gram positive bacteria (0.0781-0.625) mg/mL indicated that the Gram negative bacteria were more inhibited by the extract than the Gram positive bacteria. Average log reduction in viable cell count in time-kill assay ranged between -2.456 Log₁₀ to 2.230 Log₁₀ cfu/mL after 4 h of interaction, and between -2.921 Log₁₀ and 1.447 Log₁₀ cfu/mL after 8 h interaction in 1× MIC and 2× MIC of the extract. The study provided scientific justification for the use of the crude methanolic extract from the stem bark of A. mearnsii in shigellosis. The degree of the antibacterial activity indicated that the crude extract is a potential source of bioactive compounds that could be useful for the development of new antimicrobial agents capable of decreasing the burden of drug resistance and cost of management of diseases of clinical and public health importance in South Africa.

Mechanisms of Antimicrobial Peptide Resistance in Gram-Negative Bacteria

PubMed Central

Band, Victor I.; Weiss, David S.

2014-01-01

Cationic antimicrobial peptides (CAMPs) are important innate immune defenses that inhibit colonization by pathogens and contribute to clearance of infections. Gram-negative bacterial pathogens are a major target, yet many of them have evolved mechanisms to resist these antimicrobials. These resistance mechanisms can be critical contributors to bacterial virulence and are often crucial for survival within the host. Here, we summarize methods used by Gram-negative bacteria to resist CAMPs. Understanding these mechanisms may lead to new therapeutic strategies against pathogens with extensive CAMP resistance. PMID:25927010

[Occupational exposure to airborne fungi and bacteria in a household recycled container sorting plant ].

PubMed

Solans, Xavier; Alonso, Rosa María; Constans, Angelina; Mansilla, Alfonso

2007-06-01

Several studies have showed an association between the work in waste treatment plants and occupational health problems such as irritation of skin, eyes and mucous membranes, pulmonary diseases, gastrointestinal problems and symptoms of organic dust toxic syndrome (ODTS). These symptoms have been related to bioaerosol exposure. The aim of this study was to investigate the occupational exposure to biological agents in a plant sorting source-separated packages (plastics materials, ferric and non-ferric metals) household waste. Airborne samples were collected with M Air T Millipore sampler. The concentration of total fungi and bacteria and gram-negative bacteria were determined and the most abundant genera were identified. The results shown that the predominant airborne microorganisms were fungi, with counts greater than 12,000 cfu/m(3) and gram-negative bacteria, with a environmental concentration between 1,395 and 5,280 cfu/m(3). In both cases, these concentrations were higher than levels obtained outside of the sorting plant. Among the fungi, the predominant genera were Penicillium and Cladosporium, whereas the predominant genera of gram-negative bacteria were Escherichia, Enterobacter, Klebsiella and Serratia. The present study shows that the workers at sorting source-separated packages (plastics materials, ferric and non-ferric metals) domestic waste plant may be exposed to airborne biological agents, especially fungi and gram-negative bacteria.

Small protein-mediated quorum sensing in a gram-negative bacterium: novel targets for control of infectious disease.

PubMed

Ronald, Pamela C

2011-12-01

Control of Gram-negative bacterial infections of plants and animals remains a major challenge because conventional approaches are often not sufficient to eradicate these infections. One major reason for their persistence seems to be the capability of the bacteria to grow within biofilms that protect them from adverse environmental factors. Quorum sensing (QS) plays an important role in the formation of biofilms. In QS, small molecules serve as signals to recognize bacterial cell population size, leading to changes in expression of specific genes when a signal has accumulated to some threshold concentration. The small protein Ax21 (Activator of XA21-mediated immunity), serves as a QS factor that regulates biofilm formation and virulence in the Gram-negative bacterium, Xanthomonas oryzae pv. oryzae. Knowledge of small protein-mediated QS in Gram-negative bacteria can be used to develop new methods to control persistent Gram-negative infections. © Discovery Medicine

In vitro evaluation of the potential for resistance development to ceragenin CSA-13

PubMed Central

Pollard, Jake E.; Snarr, Jason; Chaudhary, Vinod; Jennings, Jacob D.; Shaw, Hannah; Christiansen, Bobbie; Wright, Jonathan; Jia, Wenyi; Bishop, Russell E.; Savage, Paul B.

2012-01-01

Objectives Though most bacteria remain susceptible to endogenous antimicrobial peptides, specific resistance mechanisms are known. As mimics of antimicrobial peptides, ceragenins were expected to retain antibacterial activity against Gram-positive and -negative bacteria, even after prolonged exposure. Serial passaging of bacteria to a lead ceragenin, CSA-13, was performed with representative pathogenic bacteria. Ciprofloxacin, vancomycin and colistin were used as comparators. The mechanisms of resistance in Gram-negative bacteria were elucidated. Methods Susceptible strains of Staphylococcus aureus, Pseudomonas aeruginosa and Acinetobacter baumannii were serially exposed to CSA-13 and comparators for 30 passages. MIC values were monitored. Alterations in the Gram-negative bacterial membrane composition were characterized via mass spectrometry and the susceptibility of antimicrobial-peptide-resistant mutants to CSA-13 was evaluated. Results S. aureus became highly resistant to ciprofloxacin after <20 passages. After 30 passages, the MIC values of vancomycin and CSA-13 for S. aureus increased 9- and 3-fold, respectively. The Gram-negative organisms became highly resistant to ciprofloxacin after <20 passages. MIC values of colistin for P. aeruginosa and A. baumannii increased to ≥100 mg/L after 20 passages. MIC values of CSA-13 increased to ∼20–30 mg/L and plateaued over the course of the experiment. Bacteria resistant to CSA-13 displayed lipid A modifications that are found in organisms resistant to antimicrobial peptides. Conclusions CSA-13 retained potent antibacterial activity against S. aureus over the course of 30 serial passages. Resistance generated in Gram-negative bacteria correlates with modifications to the outer membranes of these organisms and was not stable outside of the presence of the antimicrobial. PMID:22899801

Development of Vaccines to Prevent Wound Infections due to Anaerobic Bacteria

DTIC Science & Technology

1980-08-01

organism from neutrophil killing. A series of experiments were designed in the model of intraabdominal sepsis to determine the cellular mechanisms of...abscess, intraabdominal sepsis , and infections of the female genital tract (1). When optimal bacteriologic techniques are used, anaerobic bacteria can... sepsis or bacteremia. Members of the genus Bacteroides were second only to Escherichia coli as a cause of gram-negative septicemia in patients at the

MALDI-TOF identification of Gram-negative bacteria directly from blood culture bottles containing charcoal: Sepsityper® kits versus centrifugation-filtration method.

PubMed

Riederer, Kathleen; Cruz, Kristian; Shemes, Stephen; Szpunar, Susan; Fishbain, Joel T

2015-06-01

Matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry has dramatically altered the way microbiology laboratories identify clinical isolates. Direct blood culture (BC) detection may be hampered, however, by the presence of charcoal in BC bottles currently in clinical use. This study evaluates an in-house process for extraction and MALDI-TOF identification of Gram-negative bacteria directly from BC bottles containing charcoal. Three hundred BC aliquots were extracted by a centrifugation-filtration method developed in our research laboratory with the first 96 samples processed in parallel using Sepsityper® kits. Controls were colonies from solid media with standard phenotypic and MALDI-TOF identification. The identification of Gram-negative bacteria was successful more often via the in-house method compared to Sepsityper® kits (94.7% versus 78.1%, P≤0.0001). Our in-house centrifugation-filtration method was further validated for isolation and identification of Gram-negative bacteria (95%; n=300) directly from BC bottles containing charcoal. Copyright © 2015 Elsevier Inc. All rights reserved.

The effects of antibiotic cycling and mixing on antibiotic resistance in intensive care units: a cluster-randomised crossover trial.

PubMed

van Duijn, Pleun Joppe; Verbrugghe, Walter; Jorens, Philippe Germaine; Spöhr, Fabian; Schedler, Dirk; Deja, Maria; Rothbart, Andreas; Annane, Djillali; Lawrence, Christine; Nguyen Van, Jean-Claude; Misset, Benoit; Jereb, Matjaz; Seme, Katja; Šifrer, Franc; Tomiç, Viktorija; Estevez, Francisco; Carneiro, Jandira; Harbarth, Stephan; Eijkemans, Marinus Johannes Cornelis; Bonten, Marc

2018-04-01

Whether antibiotic rotation strategies reduce prevalence of antibiotic-resistant, Gram-negative bacteria in intensive care units (ICUs) has not been accurately established. We aimed to assess whether cycling of antibiotics compared with a mixing strategy (changing antibiotic to an alternative class for each consecutive patient) would reduce the prevalence of antibiotic-resistant, Gram-negative bacteria in European intensive care units (ICUs). In a cluster-randomised crossover study, we randomly assigned ICUs to use one of three antibiotic groups (third-generation or fourth-generation cephalosporins, piperacillin-tazobactam, and carbapenems) as preferred empirical treatment during 6-week periods (cycling) or to change preference after every consecutively treated patient (mixing). Computer-based randomisation of intervention and rotated antibiotic sequence was done centrally. Cycling or mixing was applied for 9 months; then, following a washout period, the alternative strategy was implemented. We defined antibiotic-resistant, Gram-negative bacteria as Enterobacteriaceae with extended-spectrum β-lactamase production or piperacillin-tazobactam resistance, and Acinetobacter spp and Pseudomonas aeruginosa with piperacillin-tazobactam or carbapenem resistance. Data were collected for all admissions during the study. The primary endpoint was average, unit-wide, monthly point prevalence of antibiotic-resistant, Gram-negative bacteria in respiratory and perineal swabs with adjustment for potential confounders. This trial is registered with ClinicalTrials.gov, number NCT01293071. Eight ICUs (from Belgium, France, Germany, Portugal, and Slovenia) were randomly assigned and patients enrolled from June 27, 2011, to Feb 16, 2014. 4069 patients were admitted during the cycling periods in total and 4707 were admitted during the mixing periods. Of these, 745 patients during cycling and 853 patients during mixing were present during the monthly point-prevalence surveys, and were included in the main analysis. Mean prevalence of the composite primary endpoint was 23% (168/745) during cycling and 22% (184/853) during mixing (p=0·64), yielding an adjusted incidence rate ratio during mixing of 1·039 (95% CI 0·837-1·291; p=0·73). There was no difference in all-cause in-ICU mortality between intervention periods. Antibiotic cycling does not reduce the prevalence of carriage of antibiotic-resistant, Gram-negative bacteria in patients admitted to the ICU. European Union Seventh Framework Programme. Copyright © 2018 Elsevier Ltd. All rights reserved.

Imaging Enterobacteriaceae infection in vivo with 18F-fluorodeoxysorbitol positron emission tomography

PubMed Central

Weinstein, Edward A.; Ordonez, Alvaro A.; DeMarco, Vincent P.; Murawski, Allison M.; Pokkali, Supriya; MacDonald, Elizabeth M.; Klunk, Mariah; Mease, Ronnie C.; Pomper, Martin G.; Jain, Sanjay K.

2015-01-01

The Enterobacteriaceae are a family of rod-shaped Gram-negative bacteria that normally inhabit the gastrointestinal tract and are the most common cause of Gram-negative bacterial infections in humans. In addition to causing serious multidrug-resistant, hospital-acquired infections, a number of Enterobacteriaceae species are also recognized as biothreat pathogens. As a consequence, new tools are urgently needed to specifically identify and localize infections due to Enterobacteriaceae and to monitor antimicrobial efficacy. In this report, we used commercially available 2-[18F]-fluorodeoxyglucose (18F-FDG) to produce 2-[18F]-fluorodeoxysorbitol (18F-FDS), a radioactive probe for Enterobacteriaceae, in 30 min. 18F-FDS selectively accumulated in Enterobacteriaceae, but not in Gram-positive bacteria or healthy mammalian or cancer cells in vitro. In a murine myositis model, 18F-FDS positron emission tomography (PET) rapidly differentiated true infection from sterile inflammation with a limit of detection of 6.2 ± 0.2 log10 colony-forming units (CFU) for Escherichia coli. Our findings were extended to models of mixed Gram-positive and Gram-negative thigh co-infections, brain infection, Klebsiella pneumonia, and mice undergoing immunosuppressive chemotherapy. This technique rapidly and specifically localized infections due to Enterobacteriaceae, providing a three-dimensional holistic view within the animal. Last, 18F-FDS PET monitored the efficacy of antimicrobial treatment, demonstrating a PET signal proportionate to the bacterial burden. Therapeutic failures associated with multidrug-resistant, extended-spectrum β-lactamase (ESBL)–producing E. coli infections were detected in real time. Together, these data show that 18F-FDS is a candidate imaging probe for translation to human clinical cases of known or suspected infections owing to Enterobacteriaceae. PMID:25338757

A polyalanine peptide derived from polar fish with anti-infectious activities

NASA Astrophysics Data System (ADS)

Cardoso, Marlon H.; Ribeiro, Suzana M.; Nolasco, Diego O.; de La Fuente-Núñez, César; Felício, Mário R.; Gonçalves, Sónia; Matos, Carolina O.; Liao, Luciano M.; Santos, Nuno C.; Hancock, Robert E. W.; Franco, Octávio L.; Migliolo, Ludovico

2016-02-01

Due to the growing concern about antibiotic-resistant microbial infections, increasing support has been given to new drug discovery programs. A promising alternative to counter bacterial infections includes the antimicrobial peptides (AMPs), which have emerged as model molecules for rational design strategies. Here we focused on the study of Pa-MAP 1.9, a rationally designed AMP derived from the polar fish Pleuronectes americanus. Pa-MAP 1.9 was active against Gram-negative planktonic bacteria and biofilms, without being cytotoxic to mammalian cells. By using AFM, leakage assays, CD spectroscopy and in silico tools, we found that Pa-MAP 1.9 may be acting both on intracellular targets and on the bacterial surface, also being more efficient at interacting with anionic LUVs mimicking Gram-negative bacterial surface, where this peptide adopts α-helical conformations, than cholesterol-enriched LUVs mimicking mammalian cells. Thus, as bacteria present varied physiological features that favor antibiotic-resistance, Pa-MAP 1.9 could be a promising candidate in the development of tools against infections caused by pathogenic bacteria.

Non-thermal plasma mills bacteria: Scanning electron microscopy observations

NASA Astrophysics Data System (ADS)

Lunov, O.; Churpita, O.; Zablotskii, V.; Deyneka, I. G.; Meshkovskii, I. K.; Jäger, A.; Syková, E.; Kubinová, Š.; Dejneka, A.

2015-02-01

Non-thermal plasmas hold great promise for a variety of biomedical applications. To ensure safe clinical application of plasma, a rigorous analysis of plasma-induced effects on cell functions is required. Yet mechanisms of bacteria deactivation by non-thermal plasma remain largely unknown. We therefore analyzed the influence of low-temperature atmospheric plasma on Gram-positive and Gram-negative bacteria. Using scanning electron microscopy, we demonstrate that both Gram-positive and Gram-negative bacteria strains in a minute were completely destroyed by helium plasma. In contrast, mesenchymal stem cells (MSCs) were not affected by the same treatment. Furthermore, histopathological analysis of hematoxylin and eosin-stained rat skin sections from plasma-treated animals did not reveal any abnormalities in comparison to control ones. We discuss possible physical mechanisms leading to the shred of bacteria under non-thermal plasma irradiation. Our findings disclose how helium plasma destroys bacteria and demonstrates the safe use of plasma treatment for MSCs and skin cells, highlighting the favorability of plasma applications for chronic wound therapy.

Non-thermal plasma mills bacteria: Scanning electron microscopy observations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lunov, O., E-mail: lunov@fzu.cz; Churpita, O.; Zablotskii, V.

2015-02-02

Non-thermal plasmas hold great promise for a variety of biomedical applications. To ensure safe clinical application of plasma, a rigorous analysis of plasma-induced effects on cell functions is required. Yet mechanisms of bacteria deactivation by non-thermal plasma remain largely unknown. We therefore analyzed the influence of low-temperature atmospheric plasma on Gram-positive and Gram-negative bacteria. Using scanning electron microscopy, we demonstrate that both Gram-positive and Gram-negative bacteria strains in a minute were completely destroyed by helium plasma. In contrast, mesenchymal stem cells (MSCs) were not affected by the same treatment. Furthermore, histopathological analysis of hematoxylin and eosin–stained rat skin sections frommore » plasma–treated animals did not reveal any abnormalities in comparison to control ones. We discuss possible physical mechanisms leading to the shred of bacteria under non-thermal plasma irradiation. Our findings disclose how helium plasma destroys bacteria and demonstrates the safe use of plasma treatment for MSCs and skin cells, highlighting the favorability of plasma applications for chronic wound therapy.« less

Inactivation of Lactobacillus plantarum in apple cider using radio frequency electric fields

USDA-ARS?s Scientific Manuscript database

Radio frequency electric fields (RFEF) processing is effective at inactivating Gram negative bacteria in fruit juices at moderately low temperatures, but has yet to be shown to be effective at reducing Gram positive bacteria. Lactobacillus plantarum ATCC 49445, a Gram positive bacterium, was inocula...

Peritonitis Due to Roseomonas fauriae in a Patient Undergoing Continuous Ambulatory Peritoneal Dialysis

PubMed Central

Bibashi, Evangelia; Sofianou, Danai; Kontopoulou, Konstantina; Mitsopoulos, Efstathios; Kokolina, Elisabeth

2000-01-01

Roseomonas is a newly described genus of pink-pigmented, nonfermentative, gram-negative bacteria that have been recognized as a cause of human infections. Roseomonas fauriae is a species rarely isolated from clinical specimens. We report the first known case of peritonitis caused by R. fauriae in a patient receiving continuous ambulatory peritoneal dialysis. PMID:10618142

Biofilm formation in an ice cream plant.

PubMed

Gunduz, Gulten Tiryaki; Tuncel, Gunnur

2006-01-01

The sites of biofilm formation in an ice cream plant were investigated by sampling both the production line and the environment. Experiments were carried out twice within a 20-day period. First, stainless steel coupons were fixed to surfaces adjacent to food contact surfaces, the floor drains and the doormat. They were taken for the analysis of biofilm at three different production stages. Then, biofilm forming bacteria were enumerated and also presence of Listeria monocytogenes was monitored. Biofilm forming isolates were selected on the basis of colony morphology and Gram's reaction; Gram negative cocci and rod, Gram positive cocci and spore forming isolates were identified. Most of the biofilm formations were seen on the conveyor belt of a packaging machine 8 h after the beginning of the production, 6.5 x 10(3) cfu cm(-2). Most of the Gram negative bacteria identified belong to Enterobacteriaceae family such as Proteus, Enterobacter, Citrobacter, Shigella, Escherichia, Edwardsiella. The other Gram negative microflora included Aeromonas, Plesiomonas, Moraxella, Pseudomonas or Alcaligenes spp. were also isolated. Gram positive microflora of the ice cream plant included Staphyloccus, Bacillus, Listeria and lactic acid bacteria such as Streptococcus, Leuconostoc or Pediococcus spp. The results from this study highlighted the problems of spread of pathogens like Listeria and Shigella and spoilage bacteria. In the development of cleaning and disinfection procedures in ice cream plants, an awareness of these biofilm-forming bacteria is essential for the ice cream plants.

A Synthetic Dual Drug Sideromycin Induces Gram-Negative Bacteria To Commit Suicide with a Gram-Positive Antibiotic.

PubMed

Liu, Rui; Miller, Patricia A; Vakulenko, Sergei B; Stewart, Nichole K; Boggess, William C; Miller, Marvin J

2018-05-10

Many antibiotics lack activity against Gram-negative bacteria because they cannot permeate the outer membrane or suffer from efflux and, in the case of β-lactams, are degraded by β-lactamases. Herein, we describe the synthesis and studies of a dual drug conjugate (1) of a siderophore linked to a cephalosporin with an attached oxazolidinone. The cephalosporin component of 1 is rapidly hydrolyzed by purified ADC-1 β-lactamase to release the oxazolidinone. Conjugate 1 is active against clinical isolates of Acinetobacter baumannii as well as strains producing large amounts of ADC-1 β-lactamase. Overall, the results are consistent with siderophore-mediated active uptake, inherent activity of the delivered dual drug, and in the presence of β-lactamases, intracellular release of the oxazolidinone upon cleavage of the cephalosporin to allow the freed oxazolidinone to inactivate its target. The ultimate result demonstrates that Gram-positive oxazolidinone antibiotics can be made to be effective against Gram-negative bacteria by β-lactamase triggered release.

ClubSub-P: Cluster-Based Subcellular Localization Prediction for Gram-Negative Bacteria and Archaea

PubMed Central

Paramasivam, Nagarajan; Linke, Dirk

2011-01-01

The subcellular localization (SCL) of proteins provides important clues to their function in a cell. In our efforts to predict useful vaccine targets against Gram-negative bacteria, we noticed that misannotated start codons frequently lead to wrongly assigned SCLs. This and other problems in SCL prediction, such as the relatively high false-positive and false-negative rates of some tools, can be avoided by applying multiple prediction tools to groups of homologous proteins. Here we present ClubSub-P, an online database that combines existing SCL prediction tools into a consensus pipeline from more than 600 proteomes of fully sequenced microorganisms. On top of the consensus prediction at the level of single sequences, the tool uses clusters of homologous proteins from Gram-negative bacteria and from Archaea to eliminate false-positive and false-negative predictions. ClubSub-P can assign the SCL of proteins from Gram-negative bacteria and Archaea with high precision. The database is searchable, and can easily be expanded using either new bacterial genomes or new prediction tools as they become available. This will further improve the performance of the SCL prediction, as well as the detection of misannotated start codons and other annotation errors. ClubSub-P is available online at http://toolkit.tuebingen.mpg.de/clubsubp/ PMID:22073040

Bacterial Prevalence and Antibiotic Resistance in Clinical Isolates of Diabetic Foot Ulcers in the Northeast of Tamaulipas, Mexico.

PubMed

Sánchez-Sánchez, Mario; Cruz-Pulido, Wendy Lizeth; Bladinieres-Cámara, Eduardo; Alcalá-Durán, Rodrigo; Rivera-Sánchez, Gildardo; Bocanegra-García, Virgilio

2017-06-01

Diabetic foot ulcers (DFUs) are a serious and common problem in patients with diabetes mellitus and constitute one of the major causes of lower extremity amputation. The microbiological profile of DFUs depends on the acute or chronic character of the wound. Aerobic gram-positive cocci are the predominant organisms isolated from DFUs. Diabetic foot biopsies from patients admitted to the Angiology and Vascular Surgery Hospital of the Northeast, in Reynosa, Tamaulipas from December 2011 to April 2016 were analyzed. The samples were processed using standard microbiology techniques. Antimicrobial susceptibility testing was carried out according to the protocol established by the Clinical & Laboratory Standards Institute (CLSI). We obtained 246 bacterial isolates, based on the results of phenotypic resistance. The least effective antibiotics for gram-positive bacteria were penicillin and dicloxacillin; for gram-negative bacteria, cefalotin and penicillin were the least effective. Levofloxacin, cefalotin, and amikacin were the most effective antibiotics for gram-positive and negative bacteria, respectively. Enterobacter genus was significantly associated with muscle biopsies ( P = .011) and samples without growth were significantly associated with specimens of pyogenic origin ( P = .000). In 215 DFU samples, we found that Staphylococcus aureus was the most commonly isolated pathogen followed by Enterobacter sp. This is consistent with previous reports. Enterobacter species may play an important role in the colonization/infection of certain tissues; however, further studies are needed in this regard.

Direct identification from positive blood broth culture by matrix-assisted laser desorption-ionization time-of-flight mass spectrometry (MALDI-TOF MS).

PubMed

Barberino, Maria Goreth; Silva, Marcio de Oliveira; Arraes, Ana Carolina Palmeiras; Correia, Luís Cláudio; Mendes, Ana Verena

Bloodstream infections (BSIs) are among the most concerning bacterial infections. They are one of the leading causes of morbidity and mortality, and occur in 30-70% of critical care patients. The prompt identification of the causative microorganism can help choosing the appropriate antimicrobial therapy that will lead to better clinical outcomes. Blood culture is one of the most relevant tests for microbiological diagnosis of bacterial infections. The introduction of the MALDI-TOF microbiological diagnosis significantly decreased the time of identifying microorganisms. However, it depends on the growth on solid culture medium. In this study, 538 bottles of positive blood cultures were evaluated to test the accuracy of an in house modified protocol. The study sample consisted of 198 Gram-negative and 350 Gram-positive bacteria. In all, 460 (83.94%) species were identified based on the direct plate findings. The protocol allowed the identification of 185/198 (93.43%) of the Gram-negative bacteria, including aerobes, anaerobes, and non-fermenters, and 275/350 (78.85%) of the Gram-positive bacteria. The proposed method has the potential to provide accurate results in comparison to the traditional method with the potential to reduce the turnaround time for the results and optimize antimicrobial therapy in BSI. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

Enzymatic polymerization of natural anacardic acid and antibiofouling effects of polyanacardic acid coatings.

PubMed

Chelikani, Rahul; Kim, Yong Hwan; Yoon, Do-Young; Kim, Dong-Shik

2009-05-01

Anacardic acid, separated from cashew nut shell liquid, is well known for its strong antibiotic and antioxidant activities. Recent findings indicate that phenolic compounds from plant sources have an effect on Gram-negative bacteria biofilm formation. In this work, a polyphenolic coating was prepared from anacardic acid using enzymatic synthesis and tested for its effects on biofilm formation of both Gram-negative and Gram-positive bacteria. Natural anacardic acid was enzymatically polymerized using soybean peroxidase. Hydrogen peroxide and phenothiazine-10-propionic acid were used as an oxidizing agent and redox mediator, respectively. Nuclear magnetic resonance and Fourier transform infrared (FTIR) analyses showed the formation of oxyphenylene and phenylene units through the phenol rings. No linkage through the alkyl chain was observed, which proved a high chemo-selectivity of the enzyme. Aqueous solvents turned out to play an important role in the polymer production yield and molecular weight. With 2-propanol, the highest production yield (61%) of polymer (molecular weight = 3,900) was observed, and with methanol, higher-molecular-weight polymers (5,000) were produced with lower production yields (43%). The resulting polyanacardic acid was cross-linked on a solid surface to form a permanent natural polymer coating. The FTIR analysis indicates that the cross-linking between the polymers took place through the unsaturated alkyl side chains. The polyanacardic acid coating was then tested for its antibiofouling effect against Gram-negative and Gram-positive bacteria and compared with the antibiofouling effects of polycardanol coatings reported in the literature. The polyanacardic acid coating showed more reduction in biofilm formation on its surface than polycardanol coatings in the case of Gram-positive bacteria, while in the case of Gram-negative bacteria, it showed a similar reduction in biofilm formation as polycardanol.

Bacterial discrimination by Dictyostelid amoebae reveals the complexity of ancient interspecies interactions

PubMed Central

Nasser, Waleed; Santhanam, Balaji; Miranda, Edward Roshan; Parikh, Anup; Juneja, Kavina; Rot, Gregor; Dinh, Chris; Chen, Rui; Zupan, Blaz; Shaulsky, Gad; Kuspa, Adam

2014-01-01

Background Amoebae and bacteria interact within predator/prey and host/pathogen relationships, but the general response of amoeba to bacteria is not well understood. The amoeba Dictyostelium discoideum feeds on, and is colonized by diverse bacterial species including Gram-positive [Gram(+)] and Gram-negative [Gram(−)] bacteria, two major groups of bacteria that differ in structure and macromolecular composition. Results Transcriptional profiling of D. discoideum revealed sets of genes whose expression is enriched in amoebae interacting with different species of bacteria, including sets that appear specific to amoebae interacting with Gram(+), or with Gram(−) bacteria. In a genetic screen utilizing the growth of mutant amoebae on a variety of bacteria as a phenotypic readout, we identified amoebal genes that are only required for growth on Gram(+) bacteria, including one that encodes the cell surface protein gp130, as well as several genes that are only required for growth on Gram(−) bacteria including one that encodes a putative lysozyme, AlyL. These genes are required for parts of the transcriptional response of wild-type amoebae, and this allowed their classification into potential response pathways. Conclusions We have defined genes that are critical for amoebal survival during feeding on Gram(+), or Gram(−), bacteria which we propose form part of a regulatory network that allows D. discoideum to elicit specific cellular responses to different species of bacteria in order to optimize survival. PMID:23664307

Nanoscale structure-activity relationships, mode of action, and biocompatibility of gold nanoparticle antibiotics.

PubMed

Bresee, Jamee; Bond, Constance M; Worthington, Roberta J; Smith, Candice A; Gifford, Jennifer C; Simpson, Carrie A; Carter, Carly J; Wang, Guankui; Hartman, Jesse; Osbaugh, Niki A; Shoemaker, Richard K; Melander, Christian; Feldheim, Daniel L

2014-04-09

The emergence of resistance to multiple antimicrobial agents by pathogenic bacteria has become a significant global public health threat. Multi-drug-resistant (MDR) Gram-negative bacteria have become particularly problematic, as no new classes of small-molecule antibiotics for Gram-negative bacteria have emerged in over two decades. We have developed a combinatorial screening process for identifying mixed ligand monolayer/gold nanoparticle conjugates (2.4 nm diameter) with antibiotic activity. The method previously led to the discovery of several conjugates with potent activity against the Gram-negative bacterium Escherichia coli. Here we show that these conjugates are also active against MDR E. coli and MDR Klebsiella pneumoniae. Moreover, we have shown that resistance to these nanoparticles develops significantly more slowly than to a commercial small-molecule drug. These results, combined with their relatively low toxicity to mammalian cells and biocompatibility in vivo, suggest that gold nanoparticles may be viable new candidates for the treatment of MDR Gram-negative bacterial infections.

New Potent Membrane-Targeting Antibacterial Peptides from Viral Capsid Proteins

PubMed Central

Dias, Susana A.; Freire, João M.; Pérez-Peinado, Clara; Domingues, Marco M.; Gaspar, Diana; Vale, Nuno; Gomes, Paula; Andreu, David; Henriques, Sónia T.; Castanho, Miguel A. R. B.; Veiga, Ana S.

2017-01-01

The increasing prevalence of multidrug-resistant bacteria urges the development of new antibacterial agents. With a broad spectrum activity, antimicrobial peptides have been considered potential antibacterial drug leads. Using bioinformatic tools we have previously shown that viral structural proteins are a rich source for new bioactive peptide sequences, namely antimicrobial and cell-penetrating peptides. Here, we test the efficacy and mechanism of action of the most promising peptides among those previously identified against both Gram-positive and Gram-negative bacteria. Two cell-penetrating peptides, vCPP 0769 and vCPP 2319, have high antibacterial activity against Staphylococcus aureus, MRSA, Escherichia coli, and Pseudomonas aeruginosa, being thus multifunctional. The antibacterial mechanism of action of the two most active viral protein-derived peptides, vAMP 059 and vCPP 2319, was studied in detail. Both peptides act on both Gram-positive S. aureus and Gram-negative P. aeruginosa, with bacterial cell death occurring within minutes. Also, these peptides cause bacterial membrane permeabilization and damage of the bacterial envelope of P. aeruginosa cells. Overall, the results show that structural viral proteins are an abundant source for membrane-active peptides sequences with strong antibacterial properties. PMID:28522994

Comprehensive bactericidal activity of an ethanol-based hand gel in 15 seconds.

PubMed

Kampf, Günter; Hollingsworth, Angela

2008-01-22

Some studies indicate that the commonly recommended 30 s application time for the post contamination treatment of hands may not be necessary as the same effect may be achieved with some formulations in a shorter application time such as 15 s. We evaluated the bactericidal activity of an ethanol-based hand gel (Sterillium Comfort Gel) within 15 s in a time-kill-test against 11 Gram-positive, 16 Gram-negative bacteria and 11 emerging bacterial pathogens. Each strain was evaluated in quadruplicate. The hand gel (85% ethanol, w/w) was found to reduce all 11 Gram-positive and all 16 Gram-negative bacteria by more than 5 log10 steps within 15 s, not only against the ATCC test strains but also against corresponding clinical isolates. In addition, a log10 reduction > 5 was observed against all tested emerging bacterial pathogens. The ethanol-based hand gel was found to have a broad spectrum of bactericidal activity in only 15 s which includes the most common species causing nosocomial infections and the relevant emerging pathogens. Future research will hopefully help to find out if a shorter application time for the post contamination treatment of hands provides more benefits or more risks.

Bacterial communications in implant infections: a target for an intelligence war.

PubMed

Costerton, J W; Montanaro, L; Arciola, C R

2007-09-01

The status of population density is communicated among bacteria by specific secreted molecules, called pheromones or autoinducers, and the control mechanism is called "quorum-sensing". Quorum-sensing systems regulate the expression of a panel of genes, allowing bacteria to adapt to modified environmental conditions at a high density of population. The two known different quorum systems are described as the LuxR-LuxI system in gram-negative bacteria, which uses an N-acyl-homoserine lactone (AHL) as signal, and the agr system in gram-positive bacteria, which uses a peptide-tiolactone as signal and the RNAIII as effector molecules. Both in gram-negative and in gram-positive bacteria, quorum-sensing systems regulate the expression of adhesion mechanisms (biofilm and adhesins) and virulence factors (toxins and exoenzymes) depending on population cell density. In gram-negative Pseudomonas aeruginosa, analogs of signaling molecules such as furanone analogs, are effective in attenuating bacterial virulence and controlling bacterial infections. In grampositive Staphylococcus aureus, the quorum-sensing RNAIII-inhibiting peptide (RIP), tested in vitro and in animal infection models, has been proved to inhibit virulence and prevent infections. Attenuation of bacterial virulence by quorum-sensing inhibitors, rather than by bactericidal or bacteriostatic drugs, is a highly attractive concept because these antibacterial agents are less likely to induce the development of bacterial resistance.

A Trojan-Horse Strategy Including a Bacterial Suicide Action for the Efficient Use of a Specific Gram-Positive Antibiotic on Gram-Negative Bacteria.

PubMed

Schalk, Isabelle J

2018-05-10

In the alarming context of rising bacterial antibiotic resistance, there is an urgent need to discover new antibiotics or increase and/or enlarge the activity of those currently in use. The need for new antibiotics is even more urgent in the case of Gram-negative bacteria, such as Acinetobacter, Pseudomonas, and Enterobacteria, which have become resistant to many antibiotics and have an outer membrane with very low permeability to drugs. Vectorization of antibiotics using siderophores may be a solution to bypass such a bacterial wall: the drugs use the iron transporters of the outer membrane as gates to enter bacteria in a Trojan-horse strategy. Designing siderophore-antibiotics that can cross outer membranes has become almost routine, but their transport across the inner membrane is still a limiting step, as well as a strategy that allows dissociation of the antibiotic from the siderophore once inside the bacteria. Liu et al. ( J. Med. Chem. 2018 , DOI: 10.1021/acs.jmedchem.8b00218 ) report the synthesis of a siderophore-cephalosporin compound and demonstrate that β-lactams, such as cephalosporins, can serve as β-lactamase-triggered releasable linkers to allow intracellular delivery of Gram-positive antibiotics to Gram-negative bacteria.

Cationized Magnetoferritin Enables Rapid Labeling and Concentration of Gram-Positive and Gram-Negative Bacteria in Magnetic Cell Separation Columns

PubMed Central

Spencer, J.; Schwarzacher, W.

2016-01-01

ABSTRACT In order to identify pathogens rapidly and reliably, bacterial capture and concentration from large sample volumes into smaller ones are often required. Magnetic labeling and capture of bacteria using a magnetic field hold great promise for achieving this goal, but the current protocols have poor capture efficiency. Here, we present a rapid and highly efficient approach to magnetic labeling and capture of both Gram-negative (Escherichia coli) and Gram-positive (Staphylococcus aureus) bacteria using cationized magnetoferritin (cat-MF). Magnetic labeling was achieved within a 1-min incubation period with cat-MF, and 99.97% of the labeled bacteria were immobilized in commercially available magnetic cell separation (MACS) columns. Longer incubation times led to more efficient capture, with S. aureus being immobilized to a greater extent than E. coli. Finally, low numbers of magnetically labeled E. coli bacteria (<100 CFU per ml) were immobilized with 100% efficiency and concentrated 7-fold within 15 min. Therefore, our study provides a novel protocol for rapid and highly efficient magnetic labeling, capture, and concentration of both Gram-positive and Gram-negative bacteria. IMPORTANCE Antimicrobial resistance (AMR) is a significant global challenge. Rapid identification of pathogens will retard the spread of AMR by enabling targeted treatment with suitable agents and by reducing inappropriate antimicrobial use. Rapid detection methods based on microfluidic devices require that bacteria are concentrated from large volumes into much smaller ones. Concentration of bacteria is also important to detect low numbers of pathogens with confidence. Here, we demonstrate that magnetic separation columns capture small amounts of bacteria with 100% efficiency. Rapid magnetization was achieved by exposing bacteria to cationic magnetic nanoparticles, and magnetized bacteria were concentrated 7-fold inside the column. Thus, bacterial capture and concentration were achieved within 15 min. This approach could be extended to encompass the capture and concentration of specific pathogens, for example, by functionalizing magnetic nanoparticles with antibodies or small molecule probes. PMID:27060124

Cationized Magnetoferritin Enables Rapid Labeling and Concentration of Gram-Positive and Gram-Negative Bacteria in Magnetic Cell Separation Columns.

PubMed

Correia Carreira, S; Spencer, J; Schwarzacher, W; Seddon, A M

2016-06-15

In order to identify pathogens rapidly and reliably, bacterial capture and concentration from large sample volumes into smaller ones are often required. Magnetic labeling and capture of bacteria using a magnetic field hold great promise for achieving this goal, but the current protocols have poor capture efficiency. Here, we present a rapid and highly efficient approach to magnetic labeling and capture of both Gram-negative (Escherichia coli) and Gram-positive (Staphylococcus aureus) bacteria using cationized magnetoferritin (cat-MF). Magnetic labeling was achieved within a 1-min incubation period with cat-MF, and 99.97% of the labeled bacteria were immobilized in commercially available magnetic cell separation (MACS) columns. Longer incubation times led to more efficient capture, with S. aureus being immobilized to a greater extent than E. coli Finally, low numbers of magnetically labeled E. coli bacteria (<100 CFU per ml) were immobilized with 100% efficiency and concentrated 7-fold within 15 min. Therefore, our study provides a novel protocol for rapid and highly efficient magnetic labeling, capture, and concentration of both Gram-positive and Gram-negative bacteria. Antimicrobial resistance (AMR) is a significant global challenge. Rapid identification of pathogens will retard the spread of AMR by enabling targeted treatment with suitable agents and by reducing inappropriate antimicrobial use. Rapid detection methods based on microfluidic devices require that bacteria are concentrated from large volumes into much smaller ones. Concentration of bacteria is also important to detect low numbers of pathogens with confidence. Here, we demonstrate that magnetic separation columns capture small amounts of bacteria with 100% efficiency. Rapid magnetization was achieved by exposing bacteria to cationic magnetic nanoparticles, and magnetized bacteria were concentrated 7-fold inside the column. Thus, bacterial capture and concentration were achieved within 15 min. This approach could be extended to encompass the capture and concentration of specific pathogens, for example, by functionalizing magnetic nanoparticles with antibodies or small molecule probes. Copyright © 2016 Correia Carreira et al.

Microbiology of Drycleaning

PubMed Central

Banville, Robert R.; McNeil, Ethel

1966-01-01

An appreciable number of bacteria on contaminated fabric survived modern drycleaning procedures. Various stages in the process, especially steam pressing, reduced the total number of bacteria, but viable organisms were found on certain areas of garments even after pressing. A significant number of bacteria were redeposited on clean fabric during the washing of ordinary soiled garments in drycleaning units. These bacteria included gram-positive cocci, diphtheroid bacilli, and gram-positive sporeformers. Gram-negative bacilli were seldom found, although some gram-negative bacilli survived drycleaning. The redeposited organisms apparently came mainly from other garments in the same loads, as few bacteria were isolated from the filtered solvent used for washing. The number of bacteria in the drycleaning washwheel was highest shortly after the beginning of the wash, and decreased, with the exchange of solvent in the wheel, to a low level at the end. Although it appears that in most cases several factors combine to reduce to a low level the numbers of bacteria on articles cleaned in a well-operated drycleaning plant, it would seem that under certain conditions pathogenic microorganisms could be disseminated by drycleaning. Images Fig. 2 PMID:4958148

Antibacterial Potential of Northeastern Portugal Wild Plant Extracts and Respective Phenolic Compounds

PubMed Central

Ferreira, Isabel C. F. R.; Barros, Lillian; Carvalho, Ana Maria; Soares, Graça; Henriques, Mariana

2014-01-01

The present work aims to assess the antibacterial potential of phenolic extracts, recovered from plants obtained on the North East of Portugal, and of their phenolic compounds (ellagic, caffeic, and gallic acids, quercetin, kaempferol, and rutin), against bacteria commonly found on skin infections. The disk diffusion and the susceptibility assays were used to identify the most active extracts and phenolic compounds. The effect of selected phenolic compounds on animal cells was assessed by determination of cellular metabolic activity. Gallic acid had a higher activity, against gram-positive (S. epidermidis and S. aureus) and gram-negative bacteria (K. pneumoniae) at lower concentrations, than the other compounds. The caffeic acid, also, showed good antibacterial activity against the 3 bacteria used. The gallic acid was effective against the 3 bacteria without causing harm to the animal cells. Gallic and caffeic acid showed a promising applicability as antibacterial agents for the treatment of infected wounds. PMID:24804249

Shape-dependent bactericidal activity of copper oxide nanoparticle mediated by DNA and membrane damage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Laha, Dipranjan; Pramanik, Arindam; Laskar, Aparna

Highlights: • Spherical and sheet shaped copper oxide nanoparticles were synthesized. • Physical characterizations of these nanoparticles were done by TEM, DLS, XRD, FTIR. • They showed shape dependent antibacterial activity on different bacterial strain. • They induced both membrane damage and ROS mediated DNA damage in bacteria. - Abstract: In this work, we synthesized spherical and sheet shaped copper oxide nanoparticles and their physical characterizations were done by the X-ray diffraction, fourier transform infrared spectroscopy, transmission electron microscopy and dynamic light scattering. The antibacterial activity of these nanoparticles was determined on both gram positive and gram negative bacterial. Sphericalmore » shaped copper oxide nanoparticles showed more antibacterial property on gram positive bacteria where as sheet shaped copper oxide nanoparticles are more active on gram negative bacteria. We also demonstrated that copper oxide nanoparticles produced reactive oxygen species in both gram negative and gram positive bacteria. Furthermore, they induced membrane damage as determined by atomic force microscopy and scanning electron microscopy. Thus production of and membrane damage are major mechanisms of the bactericidal activity of these copper oxide nanoparticles. Finally it was concluded that antibacterial activity of nanoparticles depend on physicochemical properties of copper oxide nanoparticles and bacterial strain.« less

Functional synergy of α-helical antimicrobial peptides and traditional antibiotics against Gram-negative and Gram-positive bacteria in vitro and in vivo.

PubMed

Feng, Q; Huang, Y; Chen, M; Li, G; Chen, Y

2015-01-01

In this study, the antimicrobial activities based on the synergistic effects of traditional antibiotics (imipenem, cefepime, levofloxacin hydrochloride and vancomycin) and antimicrobial peptides (AMPs; PL-5, PL-31, PL-32, PL-18, PL-29 and PL-26), alone or in combination, against three Gram-positive bacteria (Staphylococcus aureus, Streptococcus pneumoniae and Staphylococcus epidermidis) and three Gram-negative bacteria (Pseudomonas aeruginosa, Escherichia coli and Klebsiella pneumoniae) were investigated. In addition, the antimicrobial activity that was based on the synergistic effects of levofloxacin hydrochloride and PL-5 against Staphylococcus aureus in vivo was explored in a mouse infection model. Traditional antibiotics and AMPs showed significant synergistic effects on the antibacterial activities against the different Gram-positive and Gram-negative bacteria in vitro. A strong synergistic effect in the PL-5 and levofloxacin hydrochloride combination against Staphylococcus aureus was observed in the mouse infection model in vivo. The mechanism of synergistic action was due to the different targets of AMPs and traditional antibiotics. The combination of AMPs and traditional antibiotics can dramatically enhance antimicrobial activity and may help prevent or delay the emergence of antibiotic resistance. Thus, this combination therapy could be a promising approach to treat bacterial infections, particularly mixed infections and multi-antibiotic-resistant infections, in the clinics.

Gram-negative and -positive bacteria differentiation in blood culture samples by headspace volatile compound analysis.

PubMed

Dolch, Michael E; Janitza, Silke; Boulesteix, Anne-Laure; Graßmann-Lichtenauer, Carola; Praun, Siegfried; Denzer, Wolfgang; Schelling, Gustav; Schubert, Sören

2016-12-01

Identification of microorganisms in positive blood cultures still relies on standard techniques such as Gram staining followed by culturing with definite microorganism identification. Alternatively, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry or the analysis of headspace volatile compound (VC) composition produced by cultures can help to differentiate between microorganisms under experimental conditions. This study assessed the efficacy of volatile compound based microorganism differentiation into Gram-negatives and -positives in unselected positive blood culture samples from patients. Headspace gas samples of positive blood culture samples were transferred to sterilized, sealed, and evacuated 20 ml glass vials and stored at -30 °C until batch analysis. Headspace gas VC content analysis was carried out via an auto sampler connected to an ion-molecule reaction mass spectrometer (IMR-MS). Measurements covered a mass range from 16 to 135 u including CO2, H2, N2, and O2. Prediction rules for microorganism identification based on VC composition were derived using a training data set and evaluated using a validation data set within a random split validation procedure. One-hundred-fifty-two aerobic samples growing 27 Gram-negatives, 106 Gram-positives, and 19 fungi and 130 anaerobic samples growing 37 Gram-negatives, 91 Gram-positives, and two fungi were analysed. In anaerobic samples, ten discriminators were identified by the random forest method allowing for bacteria differentiation into Gram-negative and -positive (error rate: 16.7 % in validation data set). For aerobic samples the error rate was not better than random. In anaerobic blood culture samples of patients IMR-MS based headspace VC composition analysis facilitates bacteria differentiation into Gram-negative and -positive.

Aetiology of Neonatal Septicaemia in Qatif, Saudi Arabia.

ERIC Educational Resources Information Center

Elbashier, Ali M.; And Others

1994-01-01

Of the 1,797 babies admitted to a hospital in Saudi Arabia over a 3-year period, 8% were documented as having NNS. Identified several gram-positive bacteria, several gram-negative bacteria, and candida albicans as etiological agents in the cases of NNS. Determined the antibiotic susceptibility of the bacteria. (BC)

The effect of nutrient media water purity on LIBS based identification of bacteria

USDA-ARS?s Scientific Manuscript database

Single pulse laser induced breakdown spectroscopy (LIBS) is used as the basis for discrimination between 3 genera of Gram-negative bacteria and 2 genera of gram-positive bacteria representing pathogenic threats commonly found in poultry processing rinse waters. Because LIBS-based discrimination reli...

Antibacterial resistance leadership group: open for business.

PubMed

Chambers, Henry F; Bartlett, John G; Bonomo, Robert A; Chiou, Christine; Cosgrove, Sara E; Cross, Heather R; Daum, Robert S; Downing, Michele; Evans, Scott R; Knisely, Jane; Kreiswirth, Barry N; Lautenbach, Ebbing; Mickley, Brenda S; Patel, Robin; Pettigrew, Melinda M; Rodvold, Keith A; Spellberg, Brad; Fowler, Vance G

2014-06-01

Funded by the National Institute of Allergy and Infectious Diseases, the Antibacterial Resistance Leadership Group (ARLG) is tasked with developing a clinical research agenda and conducting clinical studies to address the growing public health threat of antibacterial resistance. The ARLG has identified 4 high-priority areas of research: infections caused by gram-negative bacteria, infections caused by gram-positive bacteria, antimicrobial stewardship and infection prevention, and diagnostics. The ARLG will be accepting proposals from the scientific community for clinical research that addresses 1 or more of these high-priority areas. These studies should have the potential to transform medical practice and be unlikely to occur without ARLG support. The purpose of this article is to make interested parties aware of clinical research opportunities made available by ARLG and to encourage submission of clinical research proposals that address the problem of antibacterial resistance.

An eight-year review of blood culture and susceptibility among sepsis cases in an emergency department in Northeastern Malaysia.

PubMed

Hashairi, F; Hasan, H; Azlan, K; Deris, Z Z

2011-12-01

An understanding of common pathogens and their antibiotic sensitivity patterns is critical for proper management of sepsis in Emergency Department (ED). The goal of the study was to identify common organisms isolated from blood cultures of patients attended to ED and their antimicrobial susceptibility. Beginning from 2002, all cases of positive blood culture collected by the ED, Hospital Universiti Sains Malaysia (HUSM) were recorded and analysed. Over the period of eight years, we documented 995 cases of positive blood cultures. Of these samples, 549 (55.2%) were Gram-negative bacteria; 419 (42.1%) were Gram-positive bacteria; 10 (1.0%) were anaerobic organisms; 10 (1.0%) were fungus; and 7 (0.7%) cases were mixed organisms. Gram-negative bacteria were observed to develop more resistance to antimicrobial agents, especially those commonly used in an outpatient setting with less than 80% sensitivity to ampicillin, cotrimoxazole and ciprofloxacin. By contrast, there has been no marked change in the sensitivity trends of Gram-positive bacteria over the same period. In conclusion, ED physicians are more equipped to initiate empirical antimicrobial therapy especially when dealing with possibility of Gram-negative sepsis.

Identification of gram-negative and gram-positive bacteria by fluorescence studies

NASA Astrophysics Data System (ADS)

Demchak, Jonathan; Calabrese, Joseph; Tzolov, Marian

2011-03-01

Several type strains of bacteria including Vibrio fischeri, Azotobacter vinelandii, Enterobacter cloacae, and Corynebacterium xerosis, were cultured in the laboratory following standard diagnostic protocol based on their individual metabolic strategies. The bacterial cultures were not further treated and they were studied in their pristine state (pure culture - axenic). The fluorescent studies were applied using a continuous wave and a pulsed excitation light sources. Emission and excitation spectra were recorded for the continuous wave excitation and they all show similar spectral features with the exception of the gram positive bacteria showing vibronic structures. The vibrational modes involved in these vibronic bands have energy typical for carbon-carbon vibrations. The fluorescence is quenched in addition of water, even a very thin layer, which confirms that the observed spectral features originate from the outer parts of the bacteria. These results allow to conclude that the fluorescence spectroscopy can be used as a method for studying the membranes of the bacteria and eventually to discriminate between gram positive and gram negative bacteria. The pulsed experiments show that the fluorescence lifetime is in the sub-microsecond range. The results indicate that the observed spectra are superposition of the emission with different lifetimes.

White shrimp (Litopenaeus vannamei) recombinant lysozyme has antibacterial activity against Gram negative bacteria: Vibrio alginolyticus, Vibrio parahemolyticus and Vibrio cholerae.

PubMed

de-la-Re-Vega, Enrique; García-Galaz, Alfonso; Díaz-Cinco, Martha E; Sotelo-Mundo, Rogerio R

2006-03-01

C-type lysozyme has been described as an antibacterial component of the shrimp innate defence system. We determined quantitatively the antibacterial activity of white shrimp (Litopenaeus vannamei) recombinant lysozyme against three Gram negative bacteria: Vibrio alginolyticus, Vibrio parahemolyticus and Vibrio cholerae, using a turbidimetric assay with live bacteria and differential bacterial viable count after interaction with the protein. In conclusion, the antibacterial activity of recombinant shrimp lysozyme against Vibrio sp. is at least equal to the values against the Gram positive M. luteus and more active against the shrimp pathogens V. alginolyticus and V. parahemolyticus.

Injectable bioadhesive hydrogels with innate antibacterial properties

NASA Astrophysics Data System (ADS)

Giano, Michael C.; Ibrahim, Zuhaib; Medina, Scott H.; Sarhane, Karim A.; Christensen, Joani M.; Yamada, Yuji; Brandacher, Gerald; Schneider, Joel P.

2014-06-01

Surgical site infections cause significant postoperative morbidity and increased healthcare costs. Bioadhesives used to fill surgical voids and support wound healing are typically devoid of antibacterial activity. Here we report novel syringe-injectable bioadhesive hydrogels with inherent antibacterial properties prepared from mixing polydextran aldehyde and branched polyethylenimine. These adhesives kill both Gram-negative and Gram-positive bacteria, while sparing human erythrocytes. An optimal composition of 2.5 wt% oxidized dextran and 6.9 wt% polyethylenimine sets within seconds forming a mechanically rigid (~\

Multidrug Efflux Pumps from Enterobacteriaceae, Vibrio cholerae and Staphylococcus aureus Bacterial Food Pathogens

PubMed Central

Andersen, Jody L.; He, Gui-Xin; Kakarla, Prathusha; KC, Ranjana; Kumar, Sanath; Lakra, Wazir Singh; Mukherjee, Mun Mun; Ranaweera, Indrika; Shrestha, Ugina; Tran, Thuy; Varela, Manuel F.

2015-01-01

Foodborne illnesses caused by bacterial microorganisms are common worldwide and constitute a serious public health concern. In particular, microorganisms belonging to the Enterobacteriaceae and Vibrionaceae families of Gram-negative bacteria, and to the Staphylococcus genus of Gram-positive bacteria are important causative agents of food poisoning and infection in the gastrointestinal tract of humans. Recently, variants of these bacteria have developed resistance to medically important chemotherapeutic agents. Multidrug resistant Escherichia coli, Salmonella enterica, Vibrio cholerae, Enterobacter spp., and Staphylococcus aureus are becoming increasingly recalcitrant to clinical treatment in human patients. Of the various bacterial resistance mechanisms against antimicrobial agents, multidrug efflux pumps comprise a major cause of multiple drug resistance. These multidrug efflux pump systems reside in the biological membrane of the bacteria and actively extrude antimicrobial agents from bacterial cells. This review article summarizes the evolution of these bacterial drug efflux pump systems from a molecular biological standpoint and provides a framework for future work aimed at reducing the conditions that foster dissemination of these multidrug resistant causative agents through human populations. PMID:25635914

Multidrug efflux pumps from Enterobacteriaceae, Vibrio cholerae and Staphylococcus aureus bacterial food pathogens.

PubMed

Andersen, Jody L; He, Gui-Xin; Kakarla, Prathusha; K C, Ranjana; Kumar, Sanath; Lakra, Wazir Singh; Mukherjee, Mun Mun; Ranaweera, Indrika; Shrestha, Ugina; Tran, Thuy; Varela, Manuel F

2015-01-28

Foodborne illnesses caused by bacterial microorganisms are common worldwide and constitute a serious public health concern. In particular, microorganisms belonging to the Enterobacteriaceae and Vibrionaceae families of Gram-negative bacteria, and to the Staphylococcus genus of Gram-positive bacteria are important causative agents of food poisoning and infection in the gastrointestinal tract of humans. Recently, variants of these bacteria have developed resistance to medically important chemotherapeutic agents. Multidrug resistant Escherichia coli, Salmonella enterica, Vibrio cholerae, Enterobacter spp., and Staphylococcus aureus are becoming increasingly recalcitrant to clinical treatment in human patients. Of the various bacterial resistance mechanisms against antimicrobial agents, multidrug efflux pumps comprise a major cause of multiple drug resistance. These multidrug efflux pump systems reside in the biological membrane of the bacteria and actively extrude antimicrobial agents from bacterial cells. This review article summarizes the evolution of these bacterial drug efflux pump systems from a molecular biological standpoint and provides a framework for future work aimed at reducing the conditions that foster dissemination of these multidrug resistant causative agents through human populations.

Inactivation of Gram-negative and Gram-positive bacteria in red cell concentrates using INACTINE PEN110 chemistry.

PubMed

Zavizion, B; Serebryanik, D; Chapman, J; Alford, B; Purmal, A

2004-10-01

The risk of transfusion-transmitted bacterial infections as a result of the presence of bacteria in blood is one of the major concerns in transfusion medicine. The purpose of this study was to investigate whether bacteria inoculated into red blood cell concentrates can be inactivated by the INACTINE PEN110 pathogen-reduction process. Four bacterial species were chosen for the study: anaerobic Gram-positive Clostridium perfringens and Propionibacterium acnes, known to be transfusion-transmitted; and two Gram-negative species, Acinetobacter johnsonii and Acinetobacter lwoffii, recently reported to be a common cause of transfusion-associated infections in Europe. Identical units of leucoreduced red cell concentrates were inoculated with A. johnsonii, A. lwoffii, C. perfringens, or P. acnes. The 4 degrees C control units were put on storage immediately after receiving the spike. The test units were subjected to PEN110 treatment and then stored. The bacterial titre in all units was monitored during a 6-week storage period. The PEN110 inactivation of all tested bacterial strains was time- and titre-dependent. For A. johnsonii and A. lwoffii, no viable bacteria were detected in the units spiked with up to 10(4) colony-forming units (CFU)/ml and treated with PEN110. For red cell units spiked with 10(4)-10(5) CFU/ml of C. perfringens and P. acnes, no viable bacteria were detected in the units treated with PEN110. In control units, there was a gradual decrease in A. johnsonii, A. lwoffii and C. perfringens titres during cold storage, while P. acnes titres remained stable. The PEN110 pathogen-reduction process was demonstrated to inactivate high titres of A. johnsonii, A. lwoffii, C. perfringens and P. acnes in red cell concentrates.

Identification and antimicrobial resistance of pathogens in neonatal septicemia in China-A meta-analysis.

PubMed

Li, Jing-Yang; Chen, Shang-Qin; Yan, Yan-Yan; Hu, Ying-Ying; Wei, Jia; Wu, Qiu-Ping; Lin, Zhen-Lang; Lin, Jing

2018-06-01

The purpose of this study was to analyze the distribution and antimicrobial resistance of common bacterial pathogens causing neonatal septicemia based on a systematic review of published studies in China. Articles on neonatal sepsis published in the Chinese literature from 2009 to 2014 were identified according to the inclusion and exclusion criteria. Data were extracted and analyzed using Comprehensive Meta-Analysis software. A total of 71 studies were included, in which a total of 8080 bacterial species were isolated from culture-positive blood samples. The pooled distribution rates of common bacterial pathogens were as follows: Staphylococcus 67.1% (95% confidence interval (CI) 63.3-70.6%), Enterococcus 4.1% (95% CI 3.5-4.8%), Streptococcus 2.3% (95% CI 1.6-3.2%), Escherichia coli 7.4% (95% CI 6.4-8.7%), Klebsiella 6.5% (95% CI 5.2-8.2%), Enterobacterium 2.3% (95% CI 1.9-2.8%), Acinetobacter 1.6% (95% CI 1.3-2.0%), Pseudomonas 1.7% (95% CI 1.3-2.2%). Among the Staphylococcus aureus strains isolated, more than 60% were methicillin-resistant (MRSA). In addition, over 50% of the Gram-negative isolates, including Escherichia and Klebsiella, were resistant to the commonly used third-generation cephalosporins. Most of the Gram-positive and Gram-negative bacteria isolated were sensitive to aminoglycosides, especially amikacin. It is concluded that Staphylococcus, especially coagulase-negative Staphylococcus, continues to be the principal organism responsible for neonatal septicemia in China; Enterobacteriaceae are common among the Gram-negative isolates. Significant numbers of MRSA and multidrug-resistant Gram-negative bacteria are being isolated as pathogens responsible for neonatal septicemia in China. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Brain angiogenesis inhibitor 1 (BAI1) is a pattern recognition receptor that mediates macrophage binding and engulfment of Gram-negative bacteria

PubMed Central

Das, Soumita; Owen, Katherine A.; Ly, Kim T.; Park, Daeho; Black, Steven G.; Wilson, Jeffrey M.; Sifri, Costi D.; Ravichandran, Kodi S.; Ernst, Peter B.; Casanova, James E.

2011-01-01

Bacterial recognition by host cells is essential for initiation of infection and the host response. Bacteria interact with host cells via multiple pattern recognition receptors that recognize microbial products or pathogen-associated molecular patterns. In response to this interaction, host cell signaling cascades are activated that lead to inflammatory responses and/or phagocytic clearance of attached bacteria. Brain angiogenesis inhibitor 1 (BAI1) is a receptor that recognizes apoptotic cells through its conserved type I thrombospondin repeats and triggers their engulfment through an ELMO1/Dock/Rac1 signaling module. Because thrombospondin repeats in other proteins have been shown to bind bacterial surface components, we hypothesized that BAI1 may also mediate the recognition and clearance of pathogenic bacteria. We found that preincubation of bacteria with recombinant soluble BAI1 ectodomain or knockdown of endogenous BAI1 in primary macrophages significantly reduced binding and internalization of the Gram-negative pathogen Salmonella typhimurium. Conversely, overexpression of BAI1 enhanced attachment and engulfment of Salmonella in macrophages and in heterologous nonphagocytic cells. Bacterial uptake is triggered by the BAI1-mediated activation of Rac through an ELMO/Dock-dependent mechanism, and inhibition of the BAI1/ELMO1 interaction prevents both Rac activation and bacterial uptake. Moreover, inhibition of ELMO1 or Rac function significantly impairs the proinflammatory response to infection. Finally, we show that BAI1 interacts with a variety of Gram-negative, but not Gram-positive, bacteria through recognition of their surface lipopolysaccharide. Together these findings identify BAI1 as a pattern recognition receptor that mediates nonopsonic phagocytosis of Gram-negative bacteria by macrophages and directly affects the host response to infection. PMID:21245295

The Susceptibility of Bacterial Endophthalmitis Isolates to Vancomycin, Ceftazidime, and Amikacin: a 23 Year-Review.

PubMed

Kodati, Shilpa; Eller, Andrew W; Kowalski, Regis P

2017-01-01

To investigate the in vitro susceptibility of Gram-positive and Gram-negative endophthalmitis bacterial isolates to vancomycin, amikacin, and ceftazidime over a 23-year period. Retrospective non-comparative laboratory case series. Endophthalmitis patients that were culture positive for bacteria. Laboratory records of bacteria isolated from endophthalmitis specimens collected from January 1 st 1993 to December 31 st 2015 were reviewed for incidence and standard susceptibility testing. The in vitro susceptibilities of bacteria cultured from endophthalmitis to vancomycin (VAN), amikacin (AMK), and ceftazidime (CEF). Patients with endophthalmitis were culture positive for bacteria in 665 cases.. Coagulase negative Staphylococci (CoNS) were the most common bacteria (54.6%), followed by Streptococci (Strep) species (20.8%), Staphylococcus aureus (SA) (10.2%), other Gram-positive (other-GP) bacteria (7.4%) and Gram-negative (GN) bacteria (7.1%). All Gram-positive organisms were susceptible to VAN, with the exception of 2 isolates. The in vitro susceptibilities of bacteria to AMK were: CoNS (95.3%), SA (75.0%), Strep (8.0%), GN (95.7%), and other-GP (81.1%). The in vitro susceptibilities of bacteria to CEF were: CoNS (58.5%), SA (54.4%), Strep (84.1%), GN (93.6.%), and other-GP (52.8%). There was no difference between AMK (95.7%) and CEF (93.6%) for GN coverage. AMK provided better coverage than CEF for CoNS, SA, and other-GP bacteria respectively (p<0.05, Fisher's exact), however, CEF appeared to provide better coverage (p<0.001, Fisher's exact) for Strep than AMK. Based on standard in vitro susceptibility testing, vancomycin remains an optimal antibiotic choice for the treatment of Gram-positive endophthalmitis. AMK and CEF appear to provide equal GN coverage, but AMK appears to provide better coverage for CoNS, SA, and other-GP, but not Strep.

ESCMID guidelines for the management of the infection control measures to reduce transmission of multidrug-resistant Gram-negative bacteria in hospitalized patients.

PubMed

Tacconelli, E; Cataldo, M A; Dancer, S J; De Angelis, G; Falcone, M; Frank, U; Kahlmeter, G; Pan, A; Petrosillo, N; Rodríguez-Baño, J; Singh, N; Venditti, M; Yokoe, D S; Cookson, B

2014-01-01

Healthcare-associated infections due to multidrug-resistant Gram-negative bacteria (MDR-GNB) are a leading cause of morbidity and mortality worldwide. These evidence-based guidelines have been produced after a systematic review of published studies on infection prevention and control interventions aimed at reducing the transmission of MDR-GNB. The recommendations are stratified by type of infection prevention and control intervention and species of MDR-GNB and are presented in the form of 'basic' practices, recommended for all acute care facilities, and 'additional special approaches' to be considered when there is still clinical and/or epidemiological and/or molecular evidence of ongoing transmission, despite the application of the basic measures. The level of evidence for and strength of each recommendation, were defined according to the GRADE approach. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

Confirmation and Identification of Salmonella spp., Cronobacter spp., and Other Gram-Negative Organisms by the Bruker MALDI Biotyper Method: Collaborative Study, First Action 2017.09.

PubMed

Bastin, Benjamin; Bird, Patrick; Benzinger, M Joseph; Crowley, Erin; Agin, James; Goins, David; Sohier, Daniele; Timke, Markus; Shi, Gongyi; Kostrzewa, Markus

2018-04-27

The Bruker MALDI Biotyper ® method utilizes matrix-assisted laser desorption/ionizationtime-of-flight (MALDI-TOF) MS for the rapid and accurate identification and confirmation of Gram-negative bacteria from select media types. The alternative method was evaluated using nonselective and selective agars to identify Cronobacter spp., Salmonella spp., and select Gram-negative bacteria. Results obtained by the Bruker MALDI Biotyper were compared to the traditional biochemical methods as prescribed in the appropriate reference methods. Two collaborative studies were organized, one in the United States focusing on Cronobacter spp. and other Gram-negative bacteria, and one in Europe focusing on Salmonella spp. and other Gram-negative bacteria. Fourteen collaborators from seven laboratories located within the United States participated in the first collaborative study for Cronobacter spp. Fifteen collaborators from 15 service laboratories located within Europe participated in the second collaborative study for Salmonella spp. For each target organism (either Salmonella spp. or Cronobacter spp.), a total of 24 blind-coded isolates were evaluated. In each set of 24 organisms, there were 16 inclusivity organisms ( Cronobacter spp. or Salmonella spp.) and 8 exclusivity organisms (closely related non- Cronobacter spp. and non- Salmonella spp. Gram-negative organisms). After testing was completed, the total percentage of correct identifications from each agar type for each strain was determined at a percentage of 100.0% to the genus level for the Cronobacter study and a percentage of 100.0% to the genus level for the Salmonella study. For both non- Cronobacter and non- Salmonella organisms, a percentage of 100.0% was correctly identified. The results indicated that the alternative method produced equivalent results when compared to the confirmatory procedures specified by each reference method.

Direct bacterial identification from positive blood cultures using matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry: A systematic review and meta-analysis.

PubMed

Ruiz-Aragón, Jesús; Ballestero-Téllez, Mónica; Gutiérrez-Gutiérrez, Belén; de Cueto, Marina; Rodríguez-Baño, Jesús; Pascual, Álvaro

2017-10-27

The rapid identification of bacteraemia-causing pathogens could assist clinicians in the timely prescription of targeted therapy, thereby reducing the morbidity and mortality of this infection. In recent years, numerous techniques that rapidly and directly identify positive blood cultures have been marketed, with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) being one of the most commonly used. The aim of this systematic review and meta-analysis was to evaluate the accuracy of MALDI-TOF (Bruker ® ) for the direct identification of positive blood culture bottles. A meta-analysis was performed to summarize the results of the 32 studies evaluated. The overall quality of the studies was moderate. For Gram-positive bacteria, overall rates of correct identification of the species ranged from 0.17 to 0.98, with a cumulative rate (random-effects model) of 0.72 (95% CI: 0.64-0.80). For Gram-negative bacteria, correct identification rates ranged from 0.66 to 1.00, with a cumulative effect of 0.92 (95% CI: 0.88-0.95). For Enterobacteriaceae, the rate was 0.96 (95% CI: 0.94-0.97). MALDI-TOF mass spectrometry shows high accuracy for the correct identification of Gram-negative bacteria, particularly Enterobacteriaceae, directly from positive blood culture bottles, and moderate accuracy for the identification of Gram-positive bacteria (low for some species). Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

Antimicrobial activity of flavonoids extracted from bergamot (Citrus bergamia Risso) peel, a byproduct of the essential oil industry.

PubMed

Mandalari, G; Bennett, R N; Bisignano, G; Trombetta, D; Saija, A; Faulds, C B; Gasson, M J; Narbad, A

2007-12-01

To evaluate the antimicrobial properties of flavonoid-rich fractions derived from bergamot peel, a byproduct from the Citrus fruit processing industry and the influence of enzymatic deglycosylation on their activity against different bacteria and yeast. Bergamot ethanolic fractions were tested against Gram-negative bacteria (Escherichia coli, Pseudomonas putida, Salmonella enterica), Gram-positive bacteria (Listeria innocua, Bacillus subtilis, Staphylococcus aureus, Lactococcus lactis) and the yeast Saccharomyces cerevisiae. Bergamot fractions were found to be active against all the Gram-negative bacteria tested, and their antimicrobial potency increased after enzymatic deglycosylation. The minimum inhibitory concentrations of the fractions and the pure flavonoids, neohesperidin, hesperetin (aglycone), neoeriocitrin, eriodictyol (aglycone), naringin and naringenin (aglycone), were found to be in the range 200 to 800 microg ml(-1). The interactions between three bergamot flavonoids were also evaluated. The enzyme preparation Pectinase 62L efficiently converted common glycosides into their aglycones from bergamot extracts, and this deglycosylation increased the antimicrobial potency of Citrus flavonoids. Pairwise combinations of eriodictyol, naringenin and hesperetin showed both synergistic and indifferent interactions that were dependent on the test indicator organism. Bergamot peel is a potential source of natural antimicrobials that are active against Gram-negative bacteria.

Bee Venom (Apis Mellifera) an Effective Potential Alternative to Gentamicin for Specific Bacteria Strains: Bee Venom an Effective Potential for Bacteria.

PubMed

Zolfagharian, Hossein; Mohajeri, Mohammad; Babaie, Mahdi

2016-09-01

Mellitine, a major component of bee venom (BV, Apis mellifera ), is more active against gram positive than gram negative bacteria. Moreover, BV has been reported to have multiple effects, including antibacterial, antivirus, and anti-inflammation effects, in various types of cells. In addition, wasp venom has been reported to have antibacterial properties. The aim of this study was to evaluate the antibacterial activity of BV against selected gram positive and gram negative bacterial strains of medical importance. This investigation was set up to evaluate the antibacterial activity of BV against six grams positive and gram negative bacteria, including Staphylococcus aureus ( S. aureus ), Salmonella typhimurium , Escherichia coli ( E. coli ) O157:H7, Pseudomonas aeruginosa , Burkholderia mallei and Burkholderia pseudomallei. Three concentrations of crude BV and standard antibiotic (gentamicin) disks as positive controls were tested by using the disc diffusion method. BV was found to have a significant antibacterial effect against E. coli , S. aureus , and Salmonella typhyimurium in all three concentrations tested. However, BV had no noticeable effect on other tested bacteria for any of the three doses tested. The results of the current study indicate that BV inhibits the growth and survival of bacterial strains and that BV can be used as a complementary antimicrobial agent against pathogenic bacteria. BV lacked the effective proteins necessary for it to exhibit antibacterial activity for some specific strains while being very effective against other specific strains. Thus, one may conclude, that Apis mellifera venom may have a specific mechanism that allows it to have an antibacterial effect on certain susceptible bacteria, but that mechanism is not well understood.

Interfacial charge transfer between CdTe quantum dots and Gram negative vs. Gram positive bacteria.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dumas, E.; Gao, C.; Suffern, D.

Oxidative toxicity of semiconductor and metal nanomaterials to cells has been well established. However, it may result from many different mechanisms, some requiring direct cell contact and others resulting from the diffusion of reactive species in solution. Published results are contradictory due to differences in particle preparation, bacterial strain, and experimental conditions. It has been recently found that C{sub 60} nanoparticles can cause direct oxidative damage to bacterial proteins and membranes, including causing a loss of cell membrane potential (depolarization). However, this did not correlate with toxicity. In this study we perform a similar analysis using fluorescent CdTe quantum dots,more » adapting our tools to make use of the particles fluorescence. We find that two Gram positive strains show direct electron transfer to CdTe, resulting in changes in CdTe fluorescence lifetimes. These two strains also show changes in membrane potential upon nanoparticle binding. Two Gram negative strains do not show these effects - nevertheless, they are over 10-fold more sensitive to CdTe than the Gram positives. We find subtoxic levels of Cd{sup 2+} release from the particles upon irradiation of the particles, but significant production of hydroxyl radicals, suggesting that the latter is a major source of toxicity. These results help establish mechanisms of toxicity and also provide caveats for use of certain reporter dyes with fluorescent nanoparticles which will be of use to anyone performing these assays. The findings also suggest future avenues of inquiry into electron transfer processes between nanomaterials and bacteria.« less

Food-grade antimicrobials potentiate the antibacterial activity of 1,2-hexanediol.

PubMed

Yogiara; Hwang, S J; Park, S; Hwang, J-K; Pan, J-G

2015-05-01

Preservative agents determining the shelf life of cosmetic products must have effective antimicrobial activity while meeting safety requirements for topical use. In this study, we determined the antimicrobial activity of 1,2-hexanediol against several Gram-positive and Gram-negative bacteria. Antimicrobial susceptibility tests have shown that 1,2-hexanediol exhibits broad-spectrum activity against Gram-positive and Gram-negative bacteria with MICs of 0·5-2% (v/v). The bactericidal concentration of 1,2-hexanediol was ranging from 1 to 2 × MIC as demonstrated by time-kill curve assay. A membrane depolarization assay showed that 1,2-hexanediol disrupted the cytoplasmic membrane potential. A checkerboard assay indicated that the effective concentration of 1,2-hexanediol was reduced up to 0·25-0·5 × MIC when combined with macelignan and octyl gallate against Gram-positive bacteria. However, this combination was not effective against Gram-negative bacteria. A turbidity reduction assay demonstrated that the combination of a high concentration of 1,2-hexanediol with food-grade antimicrobial compounds could trigger lytic activity towards Bacillus cereus cells. The remaining cell turbidity was 24·6 and 22·2% when 2% of 1,2-hexanediol was combined with 8 mg l(-1) octyl gallate or with 32 mg l(-1) macelignan respectively. This study showed that food-grade antimicrobial compounds may be used in combination with 1,2-hexanediol to increase its efficacy as a preservative agent in cosmetics. The antimicrobial activity of 1,2-hexanediol against Gram-positive and Gram-negative bacteria was potentiated with food-grade antimicrobials including xanthorrhizol, macelignan, panduratin A and octyl gallate, which have already been reported to display anti-inflammatory and other beneficial activities related to cosmetics. Therefore, the combination of 1,2-hexanediol and these food-grade antimicrobial agents would have benefits not only for increasing the antimicrobial activity but also in cosmetics use. © 2015 The Society for Applied Microbiology.

[Distribution and drug resistance of the pathogenic bacteria from sputum specimens of 1 125 children with tracheo bronchial foreign bodies].

PubMed

Wen, Xin; Su, Jinzhu; Cui, Li; Wang, Juan; Zuo, Lujie

2015-02-01

To analyze the distribution and drug susceptibility of the pathogenic bacteria in the airway secretions in children with tracheobronchial foreign bodies so as to assist physicians in clinical prescription. Sputum specimens of 1 125 children with tracheobronchial foreign bodies were collected in removal of the foreign bodies by rigid bronchoscope, and the drug susceptibility test was performed. Pathogenic bacteria were detected in 218 (19.4%) of 1 125 sputum specimens. Among the pathogenic bacteria, 126 (57.79%) strains were gram-negative bacilli, consisting of 76 (34.86%) strains of Haemophilus influenzae, 10 (4.59%) strains of Escherichia coli, 7 (3.21%) strains of Sewer enterobacter, 7 (3.21%) strains of Pseudomonas aeruginosa, and 6 (2.75%) strains of Klebsiella bacillus; and 92 (42.21%) strains were gram-positive bacilli, consisting of 80 (36.69%) strains of Streptococcus pneumonia and 10 (4.59%) strains of Escherichia coli. Most of detected gram-negative bacilli were highly sensitive to cefepime, ceftazidine, imipenem and amikacin, no strains were resistant to meropenem and ciprofloxacin. None of the detected gram-positive bacilli were resistant to cefepime, vancomycin, levofloxacin and teicoplanin. The Haemophilus influenzae of gram-negative bacilli and the Streptococcus pneumonia of gram-positive bacilli are the main pathogenic bacteria existing in the airway secretions of children with tracheobronchial foreign bodies. The Haemophilus influenzae were highly sensitive to cephalosporin, imipenem and amikacin, and the Streptococcus pneumonia to cefepime, vancomycin, levofloxacin and teicoplanin.

Infections Complicating the Care of Combat Casualties During Operations Iraqi Freedom and Enduring Freedom

DTIC Science & Technology

2011-07-01

nos 75 510 Empyema with fistula 3 510.9 Empyema w/o fistula 10 513 Abscess of lung 2 V46.1 Dependence on respirator 1 Other 041.89 Infection bacteria...recorded deaths (16 with infections). Infections were commonly gram-negative bacteria (47.6%) involving skin/wound infections (26.7%), and lung infections...trauma is primarily associated with gram-negative bacteria typically involving infections of wounds or other skin structures and lung infections such

A novel antimicrobial peptide derived from modified N-terminal domain of bovine lactoferrin: design, synthesis, activity against multidrug-resistant bacteria and Candida.

PubMed

Mishra, Biswajit; Leishangthem, Geeta Devi; Gill, Kamaldeep; Singh, Abhay K; Das, Swagata; Singh, Kusum; Xess, Immaculata; Dinda, Amit; Kapil, Arti; Patro, Ishan K; Dey, Sharmistha

2013-02-01

Lactoferrin (LF) is believed to contribute to the host's defense against microbial infections. This work focuses on the antibacterial and antifungal activities of a designed peptide, L10 (WFRKQLKW) by modifying the first eight N-terminal residues of bovine LF by selective homologous substitution of amino acids on the basis of hydrophobicity, L10 has shown potent antibacterial and antifungal properties against clinically isolated extended spectrum beta lactamases (ESBL), producing gram-negative bacteria as well as Candida strains with minimal inhibitory concentrations (MIC) ranging from 1 to 8 μg/mL and 6.5 μg/mL, respectively. The peptide was found to be least hemolytic at a concentration of 800 μg/mL. Interaction with lipopolysaccharide (LPS) and lipid A (LA) suggests that the peptide targets the membrane of gram-negative bacteria. The membrane interactive nature of the peptide, both antibacterial and antifungal, was further confirmed by visual observations employing electron microscopy. Further analyses, by means of propidium iodide based flow cytometry, also supported the membrane permeabilization of Candida cells. The peptide was also found to possess anti-inflammatory properties, by virtue of its ability to inhibit cyclooxygenase-2 (COX-2). L10 therefore emerges as a potential therapeutic remedial solution for infections caused by ESBL positive, gram-negative bacteria and multidrug-resistant (MDR) fungal strains, on account of its multifunctional activities. This study may open up new approach to develop and design novel antimicrobials. Copyright © 2012 Elsevier B.V. All rights reserved.

The target of daptomycin is absent from Escherichia coli and other gram-negative pathogens.

PubMed

Randall, Christopher P; Mariner, Katherine R; Chopra, Ian; O'Neill, Alex J

2013-01-01

Antistaphylococcal agents commonly lack activity against Gram-negative bacteria like Escherichia coli owing to the permeability barrier presented by the outer membrane and/or the action of efflux transporters. When these intrinsic resistance mechanisms are artificially compromised, such agents almost invariably demonstrate antibacterial activity against Gram negatives. Here we show that this is not the case for the antibiotic daptomycin, whose target appears to be absent from E. coli and other Gram-negative pathogens.

Field Studies Measuring the Aerosolization of Endotoxin During the Land Application of Class B Biosolids

EPA Science Inventory

Endotoxin is a component of the cell walls of Gram-negative bacteria and is known to be present in biosolids. Endotoxins have been shown to be a potent stimulator of the innate immune response causing airway irritation and shortness of breath. Class B biosolids are routinely ap...

Resistance of Nile tilapia (Oreochromis niloticus) to Streptococcus iniae and S. agalactiae Ib is heritable but not correlated

USDA-ARS?s Scientific Manuscript database

Tilapia (Oreochromis sp.) are an important source of protein with an economic value approaching US $8 billion yearly. Streptococcal disease, caused by Streptococcus iniae and S. agalactiae (both Gram positive bacteria), is an emerging or re-emerging disease negatively affecting tilapia aquaculture w...

Supercritical fluid chromatography-tandem mass spectrometry for the analysis of lipid A

USDA-ARS?s Scientific Manuscript database

Food safety and defense applications require the availability of methods of detection for a variety of toxic compounds in foods. One compound of concern is lipid A, an endotoxin from Gram-negative bacteria, which can cause human illness if it is present at acutely toxic levels in food. The chosen ...

Resistance of Nile tilapia (Oreochromis niloticus) to Streptococcus iniae and S. agalatiae Ib is heritable but not correlated

USDA-ARS?s Scientific Manuscript database

Tilapia (Oreochromis sp.) are an important source of protein with an ecomonic value approaching US $8 billion yearly. Streptococcal disease, caused by Streptococcus iniae and S. agalactiae (both Gram positive bacteria), is an emerging or re-emerging disease negatively affecting tilapia aquaculture w...

Type IV Pili in Gram-Positive Bacteria

PubMed Central

Craig, Lisa

2013-01-01

SUMMARY Type IV pili (T4P) are surface-exposed fibers that mediate many functions in bacteria, including locomotion, adherence to host cells, DNA uptake (competence), and protein secretion and that can act as nanowires carrying electric current. T4P are composed of a polymerized protein, pilin, and their assembly apparatuses share protein homologs with type II secretion systems in eubacteria and the flagella of archaea. T4P are found throughout Gram-negative bacterial families and have been studied most extensively in certain model Gram-negative species. Recently, it was discovered that T4P systems are also widespread among Gram-positive species, in particular the clostridia. Since Gram-positive and Gram-negative bacteria have many differences in cell wall architecture and other features, it is remarkable how similar the T4P core proteins are between these organisms, yet there are many key and interesting differences to be found as well. In this review, we compare the two T4P systems and identify and discuss the features they have in common and where they differ to provide a very broad-based view of T4P systems across all eubacterial species. PMID:24006467

Clinical factors associated with shock in bacteremic UTI.

PubMed

Shigemura, Katsumi; Tanaka, Kazushi; Osawa, Kayo; Arakawa, Sochi; Miyake, Hideaki; Fujisawa, Masato

2013-06-01

Urinary tract infection (UTI) often causes bacteremia, resulting in shock. The purpose of this study is to investigate urological bacteremia and bacteremia shock cases and seek for the clinical factors associated with urological bacteremic shock. Seventy consecutive cases with bacteremia caused by UTI from the Department of Urology, Kobe University Hospital were studied. These cases were diagnosed from 2000 to 2010 and had full data available for analysis. We investigated the potential clinical factors associated with bacteremic shock (systolic blood pressure ≤ 90 mmHg with UTI), including: (1) the number of basal general diseases (such as diabetes, malignancy, immune diseases, heart diseases, liver diseases, and kidney diseases), (2) causative bacteria, (3) antibiotics and therapeutic intervention, (4) gram-negative bacteria, (5) resistance to imipenem (which is often used in this infection), and (6) serum white blood cell counts and C-reactive protein (CRP) at the time of diagnosis of bacteremic UTI. A total of 81 causative bacteria were isolated: 42 cases were gram-negative and 39 were gram-positive bacteria. In detail, Escherichia coli was the most common, followed by Methicillin-resistant Staphylococcus aureus. The comparison data revealed that urological bacteremic shock cases had significantly increased CRP (p < 0.001). Our univariate analyses showed indwelling urinary tract catheters (p = 0.02) as a significant clinical factor associated with urological bacteremic shock and multivariate analyses showed that the presence of indwelling urinary tract catheters before UTI was a significant clinical factor associated with urological bacteremic shock (p = 0.04). Indwelling urinary catheters before UTI and high CRP were clinical factors associated with urological bacteremic shock. This result should be considered during decision-making for UTI treatments in high risk cases or urological bacteremia cases.

Photocatalytic degradation of methylene blue and inactivation of gram-negative bacteria by TiO2 nanoparticles in aqueous suspension

USDA-ARS?s Scientific Manuscript database

The photocatalytic degradation of methylene blue (MB) and inactivation of Gram-negative bacteria E. coli K12 and P. aeruginosa by TiO2 nanoparticles in aqueous suspension were studied. TiO2 resulted in significant reduction in MB absorption and a shift of MB absorption peak from 664 nm to 658 nm aft...

Dialysate bacterial endotoxin as a prognostic indicator of peritoneal dialysis related peritonitis.

PubMed

Szeto, Cheuk-Chun; Lai, Ka-Bik; Chow, Kai-Ming; Kwan, Bonnie Ching-Ha; Law, Man-Ching; Pang, Wing-Fai; Ma, Terry King-Wing; Leung, Chi-Bon; Li, Philip Kam-Tao

2016-12-01

Peritonitis is the major complication of peritoneal dialysis (PD). The aim of our present study is to explore the prognostic value of endotoxin level in PD effluent for the prediction of treatment failure in PD-related peritonitis. We studied 325 peritonitis episodes in 223 patients. PD effluent (PDE) was collected every 5 days for endotoxin level and leukocyte count. Patients were followed for relapsing or recurrent peritonitis. We found 20 episodes (6.2%) had primary treatment failure; 41 (12.6%) developed relapsing, 19 (5.8%) had recurrent, and 22 (6.8%) had repeat episodes. Endotoxin was detectable in the PDE of 19 episodes (24.4%) caused by Gram negative organisms, 4 episodes (6.8%) of mixed bacterial growth, and none of the culture negative episodes or those by Gram positive organisms. For episodes caused by Gram negative bacteria, a detectable endotoxin level in PDE on day 5 had a sensitivity and specificity of 66.7% and 83.3%, respectively, for predicting primary treatment failure. In contrast, PDE leukocyte count > 1000 per mm3 on day 5 had a sensitivity and specificity of 88.9% and 89.1%, respectively; the addition of PDE endotoxin assay did not improve the sensitivity or specificity. We conclude that detectable endotoxin in PDE 5 days after antibiotic therapy might predict primary treatment failure in peritonitis episodes caused by Gram negative organisms. However, the sensitivity and specificity of PDE endotoxin assay was inferior to PDE leukocyte count. © 2016 Asian Pacific Society of Nephrology.

Modulation of the Substitution Pattern of 5-Aryl-2-Aminoimidazoles Allows Fine-Tuning of Their Antibiofilm Activity Spectrum and Toxicity

PubMed Central

Peeters, Elien; Hooyberghs, Geert; Robijns, Stijn; Waldrant, Kai; De Weerdt, Ami; Delattin, Nicolas; Liebens, Veerle; Kucharíková, Soňa; Tournu, Hélène; Verstraeten, Natalie; Dovgan, Barbara; Girandon, Lenart; Fröhlich, Mirjam; De Brucker, Katrijn; Michiels, Jan; Cammue, Bruno P. A.; Thevissen, Karin; Vanderleyden, Jozef; Van der Eycken, Erik

2016-01-01

We previously synthesized several series of compounds, based on the 5-aryl-2-aminoimidazole scaffold, that showed activity preventing the formation of Salmonella enterica serovar Typhimurium and Pseudomonas aeruginosa biofilms. Here, we further studied the activity spectrum of a number of the most active N1- and 2N-substituted 5-aryl-2-aminoimidazoles against a broad panel of biofilms formed by monospecies and mixed species of bacteria and fungi. An N1-substituted compound showed very strong activity against the biofilms formed by Gram-negative and Gram-positive bacteria and the fungus Candida albicans but was previously shown to be toxic against various eukaryotic cell lines. In contrast, 2N-substituted compounds were nontoxic and active against biofilms formed by Gram-negative bacteria and C. albicans but had reduced activity against biofilms formed by Gram-positive bacteria. In an attempt to develop nontoxic compounds with potent activity against biofilms formed by Gram-positive bacteria for application in antibiofilm coatings for medical implants, we synthesized novel compounds with substituents at both the N1 and 2N positions and tested these compounds for antibiofilm activity and toxicity. Interestingly, most of these N1-,2N-disubstituted 5-aryl-2-aminoimidazoles showed very strong activity against biofilms formed by Gram-positive bacteria and C. albicans in various setups with biofilms formed by monospecies and mixed species but lost activity against biofilms formed by Gram-negative bacteria. In light of application of these compounds as anti-infective coatings on orthopedic implants, toxicity against two bone cell lines and the functionality of these cells were tested. The N1-,2N-disubstituted 5-aryl-2-aminoimidazoles in general did not affect the viability of bone cells and even induced calcium deposition. This indicates that modulating the substitution pattern on positions N1 and 2N of the 5-aryl-2-aminoimidazole scaffold allows fine-tuning of both the antibiofilm activity spectrum and toxicity. PMID:27550355

Development of silver and zinc oxide decorated nanoclay containing polymeric composites for water disinfection applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Motshekga, Sarah C.; Department of Chemical, Metallurgical and Materials Engineering, Tshwane University of Technology, Pretoria, 0001; Ray, Suprakas Sinha

Contaminated drinking water has serious implications to the human health that could lead to death. The rapid growth of bacterial contamination in drinking water is alarming, and yet a robust and cost effective method with less limitation has not been developed. The current study is aimed at evaluating the performance of nanoclay composites dispersed in chitosan biopolymer as an antibacterial material. The performances of the composites were evaluated using the batch kinetic studies. Three composites of Ag-CtsB, ZnO-CtsB and Ag/ZnO-CtsB were prepared and evaluated against gram negative Escherichia coli and gram positive Enterococcus faecalis bacteria. The composites were characterized bymore » powder X-ray diffraction, scanning electron microscope, energy dispersive spectroscopy and BET surface area measurements. Antibacterial activity results showed that the composites can be a potent bactericide material for water disinfection as they are highly effective against both gram negative and gram positive bacteria tested. Whereas both Ag-CtsB and ZnO-CtsB composites showed good antibacterial activity against bacteria with removal efficiency from 51%, best antibacterial activity was observed with Ag/ZnO-CtsB composite with removal efficiency from 78%. The results revealed that Ag/ZnO-CtsB composite is a promising bactericide that is highly effective against both gram negative and gram positive bacteria tested.« less

Development of silver and zinc oxide decorated nanoclay containing polymeric composites for water disinfection applications

NASA Astrophysics Data System (ADS)

Motshekga, Sarah C.; Ray, Suprakas Sinha; Onyango, Maurice S.; Momba, Maggie N. B.

2015-05-01

Contaminated drinking water has serious implications to the human health that could lead to death. The rapid growth of bacterial contamination in drinking water is alarming, and yet a robust and cost effective method with less limitation has not been developed. The current study is aimed at evaluating the performance of nanoclay composites dispersed in chitosan biopolymer as an antibacterial material. The performances of the composites were evaluated using the batch kinetic studies. Three composites of Ag-CtsB, ZnO-CtsB and Ag/ZnO-CtsB were prepared and evaluated against gram negative Escherichia coli and gram positive Enterococcus faecalis bacteria. The composites were characterized by powder X-ray diffraction, scanning electron microscope, energy dispersive spectroscopy and BET surface area measurements. Antibacterial activity results showed that the composites can be a potent bactericide material for water disinfection as they are highly effective against both gram negative and gram positive bacteria tested. Whereas both Ag-CtsB and ZnO-CtsB composites showed good antibacterial activity against bacteria with removal efficiency from 51%, best antibacterial activity was observed with Ag/ZnO-CtsB composite with removal efficiency from 78%. The results revealed that Ag/ZnO-CtsB composite is a promising bactericide that is highly effective against both gram negative and gram positive bacteria tested.

Structural Analysis of the Hg(II)-Regulatory Protein Tn501 MerR from Pseudomonas aeruginosa

NASA Astrophysics Data System (ADS)

Wang, Dan; Huang, Shanqing; Liu, Pingying; Liu, Xichun; He, Yafeng; Chen, Weizhong; Hu, Qingyuan; Wei, Tianbiao; Gan, Jianhua; Ma, Jing; Chen, Hao

2016-09-01

The metalloprotein MerR is a mercury(II)-dependent transcriptional repressor-activator that responds to mercury(II) with extraordinary sensitivity and selectivity. It’s widely distributed in both Gram-negative and Gram-positive bacteria but with barely detectable sequence identities between the two sources. To provide structural basis for the considerable biochemical and biophysical experiments previously performed on Tn501 and Tn21 MerR from Gram-negative bacteria, we analyzed the crystal structure of mercury(II)-bound Tn501 MerR. The structure in the metal-binding domain provides Tn501 MerR with a high affinity for mercury(II) and the ability to distinguish mercury(II) from other metals with its unique planar trigonal coordination geometry, which is adopted by both Gram-negative and Gram-positive bacteria. The mercury(II) coordination state in the C-terminal metal-binding domain is transmitted through the allosteric network across the dimer interface to the N-terminal DNA-binding domain. Together with the previous mutagenesis analyses, the present data indicate that the residues in the allosteric pathway have a central role in maintaining the functions of Tn501 MerR. In addition, the complex structure exhibits significant differences in tertiary and quaternary structural arrangements compared to those of Bacillus MerR from Gram-positive bacteria, which probably enable them to function with specific promoter DNA with different spacers between -35 and -10 elements.

Chromophore-enhanced bacterial photothermolysis

NASA Astrophysics Data System (ADS)

Huckleby, Jana K.; Morton, Rebecca J.; Bartels, Kenneth E.

1999-06-01

The use of chromophore dyes to enhance the bactericidal effect of laser energy was studied as a means to optimize laser treatment for the decontamination of wound. Using an in vitro study, various concentrations of indocyanine green (ICG), carbon black, and fluorescein were mixed with a suspension of bacteria and plated on tryptic soy agar. Plates were exposed to a laser beam of 10-15 watts for times ranging from 0 to 180 seconds, incubated overnight, and colony counts were performed. Bacteria not mixed with chromophore were used as controls. Six bacterial strains encompassing a range of bacterial types were used: Staphylococcus aureau, Streptococcus pyogenes, Escherichia coli, Pseudomonas aeruginosa, Bacillus cereus spore suspensions, and Clostridium perfringens. Laser treatment alone had no effect on any of the bacteria. Significant killing of gram-positive bacteria, including spores of Bacillus cereus, was observed only with the use of ICG and diode laser energy. No effect was observed using any of the chromophores on the gram-negative bacteria. The results of this study indicate that successful killing of gram-positive bacteria can be achieved using ICG combined with appropriate laser energy and wavelength. Efforts to enhance the susceptibility of gram-negative bacteria to photothermolysis by laser energy were unsuccessful.

Of Men Not Mice: Bactericidal/Permeability-Increasing Protein Expressed in Human Macrophages Acts as a Phagocytic Receptor and Modulates Entry and Replication of Gram-Negative Bacteria

PubMed Central

Balakrishnan, Arjun; Schnare, Markus; Chakravortty, Dipshikha

2016-01-01

Macrophages as immune cells prevent the spreading of pathogens by means of active phagocytosis and killing. We report here the presence of an antimicrobial protein, bactericidal/permeability-increasing protein (BPI) in human macrophages, which actively participates in engulfment and killing of Gram-negative pathogens. Our studies revealed increased expression of BPI in human macrophages during bacterial infection and upon stimulation with various pathogen-associated molecular patterns, viz., LPS and flagellin. Furthermore, during the course of an infection, BPI interacted with Gram-negative bacteria, resulting in enhanced phagocytosis and subsequent control of the bacterial replication. However, it was observed that bacteria which can maintain an active replicating niche (Salmonella Typhimurium) avoid the interaction with BPI during later stages of infection. On the other hand, Salmonella mutants, which cannot maintain a replicating niche, as well as Shigella flexneri, which quit the endosomal vesicle, showed interaction with BPI. These results propose an active role of BPI in Gram-negative bacterial clearance by human macrophages. PMID:27822215

Macrophage migration inhibitory factor deficiency is associated with impaired killing of gram-negative bacteria by macrophages and increased susceptibility to Klebsiella pneumoniae sepsis.

PubMed

Roger, Thierry; Delaloye, Julie; Chanson, Anne-Laure; Giddey, Marlyse; Le Roy, Didier; Calandra, Thierry

2013-01-15

The cytokine macrophage migration inhibitory factor (MIF) is an important component of the early proinflammatory response of the innate immune system. However, the antimicrobial defense mechanisms mediated by MIF remain fairly mysterious. In the present study, we examined whether MIF controls bacterial uptake and clearance by professional phagocytes, using wild-type and MIF-deficient macrophages. MIF deficiency did not affect bacterial phagocytosis, but it strongly impaired the killing of gram-negative bacteria by macrophages and host defenses against gram-negative bacterial infection, as shown by increased mortality in a Klebsiella pneumonia model. Consistent with MIF's regulatory role of Toll-like 4 expression in macrophages, MIF-deficient cells stimulated with lipopolysaccharide or Escherichia coli exhibited reduced nuclear factor κB activity and tumor necrosis factor (TNF) production. Addition of recombinant MIF or TNF corrected the killing defect of MIF-deficient macrophages. Together, these data show that MIF is a key mediator of host responses against gram-negative bacteria, acting in part via a modulation of bacterial killing by macrophages.

Rationalizing the permeation of polar antibiotics into Gram-negative bacteria.

PubMed

Scorciapino, Mariano Andrea; Acosta-Gutierrez, Silvia; Benkerrou, Dehbia; D'Agostino, Tommaso; Malloci, Giuliano; Samanta, Susruta; Bodrenko, Igor; Ceccarelli, Matteo

2017-03-22

The increasing level of antibiotic resistance in Gram-negative bacteria, together with the lack of new potential drug scaffolds in the pipeline, make the problem of infectious diseases a global challenge for modern medicine. The main reason that Gram-negative bacteria are particularly challenging is the presence of an outer cell-protecting membrane, which is not present in Gram-positive species. Such an asymmetric bilayer is a highly effective barrier for polar molecules. Several protein systems are expressed in the outer membrane to control the internal concentration of both nutrients and noxious species, in particular: (i) water-filled channels that modulate the permeation of polar molecules and ions according to concentration gradients, and (ii) efflux pumps to actively expel toxic compounds. Thus, besides expressing specific enzymes for drugs degradation, Gram-negative bacteria can also resist by modulating the influx and efflux of antibiotics, keeping the internal concentration low. However, there are no direct and robust experimental methods capable of measuring the permeability of small molecules, thus severely limiting our knowledge of the molecular mechanisms that ultimately control the permeation of antibiotics through the outer membrane. This is the innovation gap to be filled for Gram-negative bacteria. This review is focused on the permeation of small molecules through porins, considered the main path for the entry of polar antibiotics into Gram-negative bacteria. A fundamental understanding of how these proteins are able to filter small molecules is a prerequisite to design/optimize antibacterials with improved permeation. The level of sophistication of modern molecular modeling algorithms and the advances in new computer hardware has made the simulation of such complex processes possible at the molecular level. In this work we aim to share our experience and perspectives in the context of a multidisciplinary extended collaboration within the IMI-Translocation consortium. The synergistic combination of structural data, in vitro assays and computer simulations has proven to give new insights towards the identification and description of physico-chemical properties modulating permeation. Once similar general rules are identified, we believe that the use of virtual screening techniques will be very helpful in searching for new molecular scaffolds with enhanced permeation, and that molecular modeling will be of fundamental assistance to the optimization stage.

Rationalizing the permeation of polar antibiotics into Gram-negative bacteria

NASA Astrophysics Data System (ADS)

Scorciapino, Mariano Andrea; Acosta-Gutierrez, Silvia; Benkerrou, Dehbia; D'Agostino, Tommaso; Malloci, Giuliano; Samanta, Susruta; Bodrenko, Igor; Ceccarelli, Matteo

2017-03-01

The increasing level of antibiotic resistance in Gram-negative bacteria, together with the lack of new potential drug scaffolds in the pipeline, make the problem of infectious diseases a global challenge for modern medicine. The main reason that Gram-negative bacteria are particularly challenging is the presence of an outer cell-protecting membrane, which is not present in Gram-positive species. Such an asymmetric bilayer is a highly effective barrier for polar molecules. Several protein systems are expressed in the outer membrane to control the internal concentration of both nutrients and noxious species, in particular: (i) water-filled channels that modulate the permeation of polar molecules and ions according to concentration gradients, and (ii) efflux pumps to actively expel toxic compounds. Thus, besides expressing specific enzymes for drugs degradation, Gram-negative bacteria can also resist by modulating the influx and efflux of antibiotics, keeping the internal concentration low. However, there are no direct and robust experimental methods capable of measuring the permeability of small molecules, thus severely limiting our knowledge of the molecular mechanisms that ultimately control the permeation of antibiotics through the outer membrane. This is the innovation gap to be filled for Gram-negative bacteria. This review is focused on the permeation of small molecules through porins, considered the main path for the entry of polar antibiotics into Gram-negative bacteria. A fundamental understanding of how these proteins are able to filter small molecules is a prerequisite to design/optimize antibacterials with improved permeation. The level of sophistication of modern molecular modeling algorithms and the advances in new computer hardware has made the simulation of such complex processes possible at the molecular level. In this work we aim to share our experience and perspectives in the context of a multidisciplinary extended collaboration within the IMI-Translocation consortium. The synergistic combination of structural data, in vitro assays and computer simulations has proven to give new insights towards the identification and description of physico-chemical properties modulating permeation. Once similar general rules are identified, we believe that the use of virtual screening techniques will be very helpful in searching for new molecular scaffolds with enhanced permeation, and that molecular modeling will be of fundamental assistance to the optimization stage.

Cytotoxicity of Ultrasmall Gold Nanoparticles on Planktonic and Biofilm Encapsulated Gram-Positive Staphylococci.

PubMed

Boda, Sunil Kumar; Broda, Janine; Schiefer, Frank; Weber-Heynemann, Josefine; Hoss, Mareike; Simon, Ulrich; Basu, Bikramjit; Jahnen-Dechent, Willi

2015-07-01

The emergence of multidrug resistant bacteria, especially biofilm-associated Staphylococci, urgently requires novel antimicrobial agents. The antibacterial activity of ultrasmall gold nanoparticles (AuNPs) is tested against two gram positive: S. aureus and S. epidermidis and two gram negative: Escherichia coli and Pseudomonas aeruginosa strains. Ultrasmall AuNPs with core diameters of 0.8 and 1.4 nm and a triphenylphosphine-monosulfonate shell (Au0.8MS and Au1.4MS) both have minimum inhibitory concentration (MIC) and minimum bactericidal concentration of 25 × 10(-6) m [Au]. Disc agar diffusion test demonstrates greater bactericidal activity of the Au0.8MS nanoparticles over Au1.4MS. In contrast, thiol-stabilized AuNPs with a diameter of 1.9 nm (AuroVist) cause no significant toxicity in any of the bacterial strains. Ultrasmall AuNPs cause a near 5 log bacterial growth reduction in the first 5 h of exposure, and incomplete recovery after 21 h. Bacteria show marked membrane blebbing and lysis in biofilm-associated bacteria treated with ultrasmall AuNP. Importantly, a twofold MIC dosage of Au0.8MS and Au1.4MS each cause around 80%-90% reduction in the viability of Staphylococci enveloped in biofilms. Altogether, this study demonstrates potential therapeutic activity of ultrasmall AuNPs as an effective treatment option against staphylococcal infections. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Direct identification of bacteria from positive BacT/ALERT blood culture bottles using matrix-assisted laser desorption ionization-time-of-flight mass spectrometry.

PubMed

Mestas, Javier; Felsenstein, Susanna; Bard, Jennifer Dien

2014-11-01

Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry is a fast and robust method for the identification of bacteria. In this study, we evaluate the performance of a laboratory-developed lysis method (LDT) for the rapid identification of bacteria from positive BacT/ALERT blood culture bottles. Of the 168 positive bottles tested, 159 were monomicrobial, the majority of which were Gram-positive organisms (61.0% versus 39.0%). Using a cut-off score of ≥1.7, 80.4% of the organisms were correctly identified to the species level, and the identification rate of Gram-negative organisms (90.3%) was found to be significantly greater than that of Gram-positive organisms (78.4%). The simplicity and cost-effectiveness of the LDT enable it to be fully integrated into the routine workflow of the clinical microbiology laboratory, allowing for rapid identification of Gram-positive and Gram-negative bacteria within an hour of blood culture positivity. Copyright © 2014 Elsevier Inc. All rights reserved.

Interplay of the Quality of Ciprofloxacin and Antibiotic Resistance in Developing Countries

PubMed Central

Sharma, Deepali; Patel, Rahul P.; Zaidi, Syed Tabish R.; Sarker, Md. Moklesur Rahman; Lean, Qi Ying; Ming, Long C.

2017-01-01

Ciprofloxacin, a second generation broad spectrum fluoroquinolone, is active against both Gram-positive and Gram-negative bacteria. Ciprofloxacin has a high oral bioavailability and a large volume of distribution. It is used for the treatment of a wide range of infections including urinary tract infections caused by susceptible bacteria. However, the availability and use of substandard and spurious quality of oral ciprofloxacin formulations in the developing countries has been thought to have contributed toward increased risk of treatment failure and bacterial resistance. Therefore, quality control and bioequivalence studies of the commercially available oral ciprofloxacin formulations should be monitored. Appropriate actions should be taken against offending manufacturers in order to prevent the sale of substandard and spurious quality of ciprofloxacin formulations. PMID:28871228

Potential strategies for the eradication of multidrug-resistant Gram-negative bacterial infections.

PubMed

Huwaitat, Rawan; McCloskey, Alice P; Gilmore, Brendan F; Laverty, Garry

2016-07-01

Antimicrobial resistance is one of the leading threats to society. The increasing burden of multidrug-resistant Gram-negative infection is particularly concerning as such bacteria are demonstrating resistance to nearly all currently licensed therapies. Various strategies have been hypothesized to treat multidrug-resistant Gram-negative infections including: targeting the Gram-negative outer membrane; neutralization of lipopolysaccharide; inhibition of bacterial efflux pumps and prevention of protein folding. Silver and silver nanoparticles, fusogenic liposomes and nanotubes are potential strategies for extending the activity of licensed, Gram-positive selective, antibiotics to Gram-negatives. This may serve as a strategy to fill the current void in pharmaceutical development in the short term. This review outlines the most promising strategies that could be implemented to solve the threat of multidrug-resistant Gram-negative infections.

Combinatorial events of insertion sequences and ICE in Gram-negative bacteria.

PubMed

Toleman, Mark A; Walsh, Timothy R

2011-09-01

The emergence of antibiotic and antimicrobial resistance in Gram-negative bacteria is incremental and linked to genetic elements that function in a so-called 'one-ended transposition' manner, including ISEcp1, ISCR elements and Tn3-like transposons. The power of these elements lies in their inability to consistently recognize one of their own terminal sequences, while recognizing more genetically distant surrogate sequences. This has the effect of mobilizing the DNA sequence found adjacent to their initial location. In general, resistance in Gram-negatives is closely linked to a few one-off events. These include the capture of the class 1 integron by a Tn5090-like transposon; the formation of the 3' conserved segment (3'-CS); and the fusion of the ISCR1 element to the 3'-CS. The structures formed by these rare events have been massively amplified and disseminated in Gram-negative bacteria, but hitherto, are rarely found in Gram-positives. Such events dominate current resistance gene acquisition and are instrumental in the construction of large resistance gene islands on chromosomes and plasmids. Similar combinatorial events appear to have occurred between conjugative plasmids and phages constructing hybrid elements called integrative and conjugative elements or conjugative transposons. These elements are beginning to be closely linked to some of the more powerful resistance mechanisms such as the extended spectrum β-lactamases, metallo- and AmpC type β-lactamases. Antibiotic resistance in Gram-negative bacteria is dominated by unusual combinatorial mistakes of Insertion sequences and gene fusions which have been selected and amplified by antibiotic pressure enabling the formation of extended resistance islands. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Sepsis associated with hematological malignancies: prophylaxis of Pseudomonas aeruginosa sepsis.

PubMed

Sakamoto, M; Saruta, K; Nakazawa, Y; Shindo, N; Maezawa, H; Yoshikawa, K; Yoshida, M; Shiba, K; Sakai, O; Saito, A

1996-02-01

Underlying diseases, pathogenic bacteria, clinical background and outcome were studied during 91 febrile episodes complicated by sepsis in 55 patients with hematological malignancies, who had been admitted to our hospital (Jikei University Kashiwa Hospital) between January 1990 and December 1994. Particularly in patients with P. aeruginosa sepsis, we compared the prophylactic effect of ciprofloxacin (CPFX) alone with that of the combination of polymyxin B (PL-B) plus kanamycin (KM). The major underlying diseases were acute myelocytic leukemia and malignant lymphoma, followed by myelodysplastic syndrome, acute lymphocytic leukemia and chronic myelocytic leukemia. Nearly two-thirds of the pathogenic microorganisms isolated were gram-positive bacteria (including coagulase-negative staphylococci and Staphylococcus aureus); approximately one-quarter were gram-negative bacteria (such as Pseudomonas aeruginosa), and the remainder were fungi. These microorganisms usually induced sepsis when granulocyte counts were decreased. Sepsis was a direct cause of death in about 60% of the patients and P. aeruginosa sepsis had the worst outcome. Oral administration of CPFX was more effective than PL-B plus KM in preventing P. aeruginosa sepsis. The difference in effectiveness might depend on the absorption profile of the drugs.

Comparison of clinico-microbiological profile and treatment outcome of in-house and referred post cataract surgery endophthalmitis in a tertiary care center in South India.

PubMed

Ambiya, Vikas; Das, Taraprasad; Sharma, Savitri; Chhablani, Jay; Dave, Vivek; Jalali, Subhadra; Narayanan, Raja; Joseph, Joveeta

2016-12-01

The purpose of the study is to compare the clinico-microbiological profile and treatment outcome of in-house vs referred cases of post cataract surgery endophthalmitis in a tertiary eye care facility in South India. The clinical records of 50 culture-positive cases each of in-house (group A) and referred (group B) post cataract surgery endophthalmitis were analyzed. The management protocol was similar in both groups. The time to report to the institute was longer in group B (group B 13.63 [±11.67; 95% CI, 9.95-17.31] days; group A 6.83 [±7.61; 95% CI, 4.57-9.09] days; P = 0.002). The average inflammatory scores in presentation were comparable (group A 17.85 ± 5.83; group B 18.18 ± 7.35; P = 0.243). The final visual outcome was clinically superior in group A (≥20/200-group A 60.42% and group B 44%, P = 0.11; ≤20/400-group A 37.5% and group B 52%, P = 0.62), but statistically not significant. There were more gram-positive organisms in group A (62% vs 38%; P = 0.027) and more gram-negative organisms in group B (52% vs 24%; P = 0.007). Gram-positive bacteria were mostly sensitive to vancomycin (95.24% to 96.67%), but gram-negative bacteria were partly sensitive to ceftazidime (58.33% to 64%). One could suspect gram-negative infection more often in the referred cases of endophthalmitis. While vancomycin could continue to be the antibiotic of choice in gram-positive bacteria, specific antibiotic following due sensitivity for gram-negative bacteria should replace the empiric use of ceftazidime.

Predictive rules for compound accumulation yield a broad-spectrum antibiotic

PubMed Central

Richter, Michelle F.; Drown, Bryon S.; Riley, Andrew P.; Garcia, Alfredo; Shirai, Tomohiro; Svec, Riley L.; Hergenrother, Paul J.

2017-01-01

Most small molecules are unable to rapidly traverse the outer membrane of Gram-negative bacteria and accumulate inside these cells, making the discovery of much-needed drugs for these pathogens very challenging. Current understanding of the physicochemical properties that dictate small-molecule accumulation in Gram-negatives is largely based on retrospective analyses of antibacterials that suggest polarity and molecular weight as key factors. Here we assess the ability of over 180 diverse compounds to accumulate in Escherichia coli. Computational analysis of the results reveals major differences from the retrospective studies, namely that the small molecules that are most likely to accumulate contain an amine, are amphiphilic and rigid, and have low globularity. These guidelines were then applied to convert deoxynybomycin, a natural product that is active only against Gram-positive organisms, into an antibiotic with activity against a diverse panel of multi-drug-resistant Gram-negative pathogens. We anticipate these findings will aid in the discovery and development of antibiotics effective against Gram-negative bacteria. PMID:28489819

Listeria monocytogenes strains show large variations in competitive growth in mixed culture biofilms and suspensions with bacteria from food processing environments.

PubMed

Heir, Even; Møretrø, Trond; Simensen, Andreas; Langsrud, Solveig

2018-06-20

Interactions and competition between resident bacteria in food processing environments could affect their ability to survive, grow and persist in microhabitats and niches in the food industry. In this study, the competitive ability of L. monocytogenes strains grown together in separate culture mixes with other L. monocytogenes (L. mono mix), L. innocua (Listeria mix), Gram-negative bacteria (Gram- mix) and with a multigenera mix (Listeria + Gram- mix) was investigated in biofilms on stainless steel and in suspensions at 12 °C. The mixed cultures included resident bacteria from processing surfaces in meat and salmon industry represented by L. monocytogenes (n = 6), L. innocua (n = 5) and Gram-negative bacteria (n = 6; Acinetobacter sp., Pseudomonas fragi, Pseudomonas fluorescens, Serratia liquefaciens, Stenotrophomonas maltophilia). Despite hampered in growth in mixed cultures, L. monocytogenes established in biofilms with counts at day nine between 7.3 and 9.0 log per coupon with the lowest counts in the Listeria + G- mix that was dominated by Pseudomonas. Specific L. innocua inhibited growth of L. monocytogenes strains differently; inhibition that was further enhanced by the background Gram-negative microbiota. In these multispecies and multibacteria cultures, the growth competitive effects lead to the dominance of a strong competitor L. monocytogenes strain that was only slightly inhibited by L. innocua and showed strong competitive abilities in mixed cultures with resident Gram-negative bacteria. The results indicates complex patterns of bacterial interactions and L. monocytogenes inhibition in the multibacteria cultures that only partially depend on cell contact and likely involve various antagonistic and bacterial tolerance mechanisms. The study indicates large variations among L. monocytogenes in their competitiveness under multibacterial culture conditions that should be considered in further studies towards understanding of L. monocytogenes persistence in food processing facilities. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

A broad-host range dual-fluorescence reporter system for gene expression analysis in Gram-negative bacteria.

PubMed

Hennessy, Rosanna C; Christiansen, Line; Olsson, Stefan; Stougaard, Peter

2018-01-01

Fluorescence-based reporter systems are valuable tools for studying gene expression dynamics in living cells. Here we describe a dual-fluorescence reporter system carrying the red fluorescent marker mCherry and the blue fluorescent protein EBFP2 enabling the simultaneous analysis of two promoters in broad-host range autofluorescent Gram-negative bacteria. Copyright © 2017 Elsevier B.V. All rights reserved.

Extensive Antibody Cross-reactivity among Infectious Gram-negative Bacteria Revealed by Proteome Microarray Analysis

DTIC Science & Technology

2009-08-27

aeruginosa, Salmonella ty- phimurium, Shigella flexneri, and Escherichia coli, all pathogenic Gram-negative bacteria. These antibodies en- abled detection of...w .m cponline.org D ow nloaded from broad range of O and H strains), Shigella flexneri (recognizing Shigella dysenteriae, Shigella boydii, and S...treated with antibiotics. In addition, sera were also obtained from rhesus monkeys vaccinated with the anthrax vaccine B. anthracis recombinant

A practical molecular identification of nonfermenting Gram-negative bacteria from cystic fibrosis.

PubMed

Capizzani, Carolina Paulino da Costa; Caçador, Natália Candido; Marques, Elizabeth Andrade; Levy, Carlos Emílio; Tonani, Ludmilla; Torres, Lidia Alice Gomes Monteiro Marin; Darini, Ana Lúcia da Costa

Identification of nonfermenting Gram-negative bacteria (NFGNB) of cystic fibrosis patients is hard and misidentification could affect clinical outcome. This study aimed to propose a scheme using polymerase chain reaction to identify NFGNB. This scheme leads to reliable identification within 3 days in an economically viable manner when compared to other methods. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Predatory prokaryotes: predation and primary consumption evolved in bacteria

NASA Technical Reports Server (NTRS)

Guerrero, R.; Pedros-Alio, C.; Esteve, I.; Mas, J.; Chase, D.; Margulis, L.

1986-01-01

Two kinds of predatory bacteria have been observed and characterized by light and electron microscopy in samples from freshwater sulfurous lakes in northeastern Spain. The first bacterium, named Vampirococcus, is Gram-negative and ovoidal (0.6 micrometer wide). An anaerobic epibiont, it adheres to the surface of phototrophic bacteria (Chromatium spp.) by specific attachment structures and, as it grows and divides by fission, destroys its prey. An important in situ predatory role can be inferred for Vampirococcus from direct counts in natural samples. The second bacterium, named Daptobacter, is a Gram-negative, facultatively anaerobic straight rod (0.5 x 1.5 micrometers) with a single polar flagellum, which collides, penetrates, and grows inside the cytoplasm of its prey (several genera of Chromatiaceae). Considering also the well-known case of Bdellovibrio, a Gram-negative, aerobic curved rod that penetrates and divides in the periplasmic space of many chemotrophic Gram-negative bacteria, there are three types of predatory prokaryotes presently known (epibiotic, cytoplasmic, and periplasmic). Thus, we conclude that antagonistic relationships such as primary consumption, predation, and scavenging had already evolved in microbial ecosystems prior to the appearance of eukaryotes. Furthermore, because they represent methods by which prokaryotes can penetrate other prokaryotes in the absence of phagocytosis, these associations can be considered preadaptation for the origin of intracellular organelles.

Differential Pd-nanocrystal facets demonstrate distinct antibacterial activity against Gram-positive and Gram-negative bacteria.

PubMed

Fang, Ge; Li, Weifeng; Shen, Xiaomei; Perez-Aguilar, Jose Manuel; Chong, Yu; Gao, Xingfa; Chai, Zhifang; Chen, Chunying; Ge, Cuicui; Zhou, Ruhong

2018-01-09

Noble metal-based nanomaterials have shown promise as potential enzyme mimetics, but the facet effect and underlying molecular mechanisms are largely unknown. Herein, with a combined experimental and theoretical approach, we unveil that palladium (Pd) nanocrystals exhibit facet-dependent oxidase and peroxidase-like activities that endow them with excellent antibacterial properties via generation of reactive oxygen species. The antibacterial efficiency of Pd nanocrystals against Gram-positive bacteria is consistent with the extent of their enzyme-like activity, that is {100}-faceted Pd cubes with higher activities kill bacteria more effectively than {111}-faceted Pd octahedrons. Surprisingly, a reverse trend of antibacterial activity is observed against Gram-negative bacteria, with Pd octahedrons displaying stronger penetration into bacterial membranes than Pd nanocubes, thereby exerting higher antibacterial activity than the latter. Our findings provide a deeper understanding of facet-dependent enzyme-like activities and might advance the development of noble metal-based nanomaterials with both enhanced and targeted antibacterial activities.

Synthesis and Antimicrobial Activity of Some Novel Cross-Linked Chitosan Hydrogels

PubMed Central

Mohamed, Nadia Ahmed; Fahmy, Mona Mohamed

2012-01-01

Four novel hydrogels based on chitosan were synthesized via a cross-linking reaction of chitosan with different concentrations of oxalyl bis 4-(2,5-dioxo-2H-pyrrol- 1(5H)-yl)benzamide. Their structures were confirmed by fourier transform infrared X-ray (FTIR), scanning electron microscopy (SEM) and X-ray diffraction. The antimicrobial activities of the hydrogels against two crop-threatening pathogenic fungi namely: Aspergillus fumigatus (A. fumigatus, RCMBA 06002), and Aspergillus niger (A. niger, RCMBA 06106), and five bacterial species namely: Bacillis subtilis (B. subtilis, RCMBA 6005), Staphylococcus aureus (S. aureus, RCMBA 2004), Streptococcus pneumoniae (S. pneumonia, RCMB 000101) as Gram positive bacteria, and Salmonella typhimurium (S. typhimurium, RCMB 000104), and Escherichia coli (E. coli, RCMBA 5003) as Gram negative bacteria have been investigated. The prepared hydrogels showed much higher antimicrobial activities than that of the parent chitosan. The hydrogels were more potent in case of Gram-positive bacteria than Gram-negative bacteria. Increasing the degree of cross-linking in the hydrogels resulted in a weaker antimicrobial activity. PMID:23109847

Effect of haylage and monensin supplementation on ruminal bacterial communities of feedlot cattle.

PubMed

Kim, Minseok; Felix, Tara L; Loerch, Steve C; Yu, Zhongtang

2014-08-01

The objective of this study was to investigate the ruminal bacterial communities as affected by monensin, haylage, and their interaction of feedlot cattle fed 60 % dried distillers grains with solubles in a replicated 4 × 4 Latin square design. Pyrosequencing analysis of the V1-V3 region (about 500 bp) of 16S rRNA gene from the four dietary treatments (3 treatment plus one control diets) collectively revealed 51 genera of bacteria within 11 phyla. Firmicutes and Bacteroidetes were the first and the second most predominant phyla, respectively, irrespective of the dietary treatments. Monensin supplementation decreased the proportion of Gram-positive Firmicutes while increasing that of Gram-negative Bacteroidetes. However, the monensin supplementation did not reduce the proportion of all genera of Gram-positive bacteria placed within Firmicutes and lowered that of some genera of Gram-negative bacteria placed within Bacteroidetes. Haylage supplementation appeared to attenuate inhibition of monensin on some genera of bacteria. Factors other than monensin and haylage could affect ruminal bacterial communities.

Effect of guar gum conjugation on functional, antioxidant and antimicrobial activity of egg white lysozyme.

PubMed

Hamdani, Afshan Mumtaz; Wani, Idrees Ahmed; Bhat, Naseer Ahmad; Siddiqi, Raushid Ahmad

2018-02-01

This study was undertaken to analyze the effect of conjugation of egg-white lysozyme with guar gum. Lysozyme is an antimicrobial polypeptide that can be used for food preservation. Its antibacterial activity is limited to gram positive bacteria. Conjugation with polysaccharides like guar gum may broaden its activity against gram negatives. Conjugate was developed through Maillard reaction. Assays carried out included sugar estimation, SDS-PAGE, GPC, color, FT-IR, DSC, thermal stability, solubility, emulsifying, foaming and antioxidant activity. In addition, antimicrobial activity of the conjugate was determined against two gram positive (Staphyllococcus aureus and Enterococcus) and two gram negative pathogens (E. coli and Salmonella). Results showed higher functional properties of lysozyme-guar gum conjugate. The antioxidant properties increased from 2.02-35.80% (Inhibition of DPPH) and 1.65-4.93AAE/g (reducing power) upon guar gum conjugation. Conjugate significantly inhibited gram negative bacteria and the antibacterial activity also increased significantly against gram positive pathogens. Copyright © 2017 Elsevier Ltd. All rights reserved.

Sonorensin: A new bacteriocin with potential of an anti-biofilm agent and a food biopreservative

PubMed Central

Chopra, Lipsy; Singh, Gurdeep; Kumar Jena, Kautilya; Sahoo, Debendra K.

2015-01-01

The emergence of antibiotic resistant bacteria has led to exploration of alternative therapeutic agents such as ribosomally synthesized bacterial peptides known as bacteriocins. Biofilms, which are microbial communities that cause serious chronic infections, form environments that enhance antimicrobial resistance. Bacteria in biofilm can be upto thousand times more resistant to antibiotics than the same bacteria circulating in a planktonic state. In this study, sonorensin, predicted to belong to the heterocycloanthracin subfamily of bacteriocins, was found to be effectively killing active and non-multiplying cells of both Gram-positive and Gram-negative bacteria. Sonorensin showed marked inhibition activity against biofilm of Staphylococcus aureus. Fluorescence and electron microscopy suggested that growth inhibition occurred because of increased membrane permeability. Low density polyethylene film coated with sonorensin was found to effectively control the growth of food spoilage bacteria like Listeria monocytogenes and S. aureus. The biopreservative effect of sonorensin coated film showing growth inhibition of spoilage bacteria in chicken meat and tomato samples demonstrated the potential of sonorensin as an alternative to current antibiotics/ preservatives. PMID:26292786

Antioxidant Potential and Antibacterial Efficiency of Caffeic Acid-Functionalized ZnO Nanoparticles

PubMed Central

Choi, Kyong-Hoon; Nam, Ki Chang; Lee, Sang-Yoon; Cho, Guangsup; Jung, Jin-Seung; Kim, Ho-Joong; Park, Bong Joo

2017-01-01

We report a novel zinc oxide (ZnO) nanoparticle with antioxidant properties, prepared by immobilizing the antioxidant 3-(3,4-dihydroxyphenyl)-2-propenoic acid (caffeic acid, CA) on the surfaces of micro-dielectric barrier discharge (DBD) plasma-treated ZnO nanoparticles. The microstructure and physical properties of ZnO@CA nanoparticles were characterized by field emission scanning electron microscopy (FESEM), transmission electron microscopy (TEM), infrared spectroscopy, and steady state spectroscopic methods. The antioxidant activity of ZnO@CA nanoparticles was evaluated using an ABTS (3-ethyl-benzothiazoline-6-sulfonic acid) radical cation decolorization assay. ZnO@CA nanoparticles exhibited robust antioxidant activity. Moreover, ZnO@CA nanoparticles showed strong antibacterial activity against Gram-positive bacteria (Staphylococcus aureus) including resistant bacteria such as methicillin-resistant S. aureus and against Gram-negative bacteria (Escherichia coli). Although Gram-negative bacteria appeared to be more resistant to ZnO@CA nanoparticles than Gram-positive bacteria, the antibacterial activity of ZnO@CA nanoparticles was dependent on particle concentration. The antioxidant and antibacterial activity of ZnO@CA may be useful for various biomedical and nanoindustrial applications. PMID:28621707

Antifungal and antibacterial activity of marine microorganisms.

PubMed

El Amraoui, B; El Amraoui, M; Cohen, N; Fassouane, A

2014-03-01

In order to explore marine microorganisms with pharmaceutical potential, marine bacteria, collected from different coastal areas of the Moroccan Atlantic Ocean, were previously isolated from seawater, sediment, marine invertebrates and seaweeds. The antimicrobial activities of these microorganisms were investigated against the pathogens involved in human pathologies. Whole cultures of 34 marine microorganisms were screened for antimicrobial activities using the method of agar diffusion against three Gram-positive bacteria, two Gram-negative bacteria, and against yeast. The results showed that among the 34 isolates studied, 28 (82%) strains have antimicrobial activity against at least one pathogen studied, 11 (32%) strains have antifungal activity and 24 (76%) strains are active against Gram-positive bacteria, while 21 (62%) strains are active against Gram-negative bacteria. Among isolates having antimicrobial activity, 14 were identified and were assigned to the genera Acinetobacter, Aeromonas, Alcaligenes, Bacillus, Chromobacterium, Enterococcus, Pantoea and Pseudomonas. Due to a competitive role for space and nutrient, the marine microorganisms can produce antibiotic substance; therefore, these marine microorganisms were expected to be potential resources of natural antibiotic products. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Antibacterial clay against gram-negative antibiotic resistant bacteria.

PubMed

Zarate-Reyes, Luis; Lopez-Pacheco, Cynthia; Nieto-Camacho, Antonio; Palacios, Eduardo; Gómez-Vidales, Virginia; Kaufhold, Stephan; Ufer, Kristian; García Zepeda, Eduardo; Cervini-Silva, Javiera

2018-01-15

Antibiotic resistant bacteria persist throughout the world because they have evolved the ability to express various defense mechanisms to cope with antibiotics and the immune system; thus, low-cost strategies for the treatment of these bacteria are needed, such as the usage of environmental minerals. This paper reports the antimicrobial properties of a clay collected from Brunnenberg, Germany, that is composed of ferroan saponite with admixtures of quartz, feldspar and calcite as well as exposed or hidden (layered at inner regions) nano Fe(0). Based on the growth curves (log phase) of six antibiotic resistant bacteria (4 gram-negative and 2 gram-positive), we concluded that the clay acted as a bacteriostat; however, the clay was only active against the gram-negative bacteria (except for resilient Klebsiella pneumonia). The bacteriostatic mode of action was evidenced by the initial lack of Colony Forming Units on agar plates with growth registered afterward, certainly after 24h, and can be explained because interactions between membrane lipopolysaccharides and the siloxane surfaces of the clay. Labile or bioavailable Fe in the clay (extracted by EDTA or DFO-B) induced the quantitative production of HO as well as oxidative stress, which, nevertheless, did not account for by its bacteriostatic activity. Copyright © 2017 Elsevier B.V. All rights reserved.

Surface microbial consortia from Livarot, a French smear-ripened cheese.

PubMed

Larpin-Laborde, Sandra; Imran, Muhammad; Bonaïti, Catherine; Bora, Nagamani; Gelsomino, Roberto; Goerges, Stefanie; Irlinger, Françoise; Goodfellow, Michael; Ward, Alan C; Vancanneyt, Marc; Swings, Jean; Scherer, Siegfried; Guéguen, Micheline; Desmasures, Nathalie

2011-08-01

The surface microflora (902 isolates) of Livarot cheeses from three dairies was investigated during ripening. Yeasts were mainly identified by Fourier transform infrared spectroscopy. Geotrichum candidum was the dominating yeast among 10 species. Bacteria were identified using Biotype 100 strips, dereplicated by repetitive extragenic palindromic PCR (rep-PCR); 156 representative strains were identified by either BOX-PCR or (GTG)(5)-PCR, and when appropriate by 16S rDNA sequencing and SDS-PAGE analysis. Gram-positive bacteria accounted for 65% of the isolates and were mainly assigned to the genera Arthrobacter , Brevibacterium , Corynebacterium , and Staphylococcus . New taxa related to the genera Agrococcus and Leucobacter were found. Yeast and Gram-positive bacteria strains deliberately added as smearing agents were sometimes undetected during ripening. Thirty-two percent of the isolates were Gram-negative bacteria, which showed a high level of diversity and mainly included members of the genera Alcaligenes , Hafnia , Proteus , Pseudomonas , and Psychrobacter . Whatever the milk used (pasteurized or unpasteurized), similar levels of biodiversity were observed in the three dairies, all of which had efficient cleaning procedures and good manufacturing practices. It appears that some of the Gram-negative bacteria identified should now be regarded as potentially useful in some cheese technologies. The assessment of their positive versus negative role should be objectively examined.

Broad Specificity Efflux pumps and Their Role in Multidrug Resistance of Gram Negative Bacteria

PubMed Central

Nikaido, Hiroshi; Pagès, Jean-Marie

2013-01-01

Antibiotic resistance mechanisms reported in Gram-negative bacteria are producing a worldwide health problem. The continuous dissemination of «multi-drug resistant» (MDR) bacteria drastically reduces the efficacy of our antibiotic “arsenal” and consequently increases the frequency of therapeutic failure. In MDR bacteria, the over-expression of efflux pumps that expel structurally-unrelated drugs contributes to the reduced susceptibility by decreasing the intracellular concentration of antibiotics. During the last decade, several clinical data indicate an increasing involvement of efflux pumps in the emergence and dissemination of resistant Gram-negative bacteria. It is necessary to clearly define the molecular, functional and genetic bases of the efflux pump in order to understand the translocation of antibiotic molecules through the efflux transporter. The recent investigation on the efflux pump AcrB at its structural and physiological level, including the identification of drug affinity sites and kinetic parameters for various antibiotics, may open the way to rationally develop an improved new generation of antibacterial agents as well as efflux inhibitors in order to efficiently combat efflux-based resistance mechanisms. PMID:21707670

[Detection of endotoxins of Gram-negative bacteria on the basis of electromagnetic radiation frequency spectrum].

PubMed

Likhoded, V G; Kuleshova, N V; Sergieva, N V; Konev, Iu V; Trubnikova, I A; Sudzhian, E V

2007-01-01

Method of Gram-negative bacteria endotoxins detection on the basis of their own spectrum of electromagnetic radiation frequency was developed. Frequency spectrum typical for chemotype Re glycolipid, which is a part of lypopolysaccharides in the majority of Gram-negative bacteria, was used. Two devices--"Mini- Expert-DT" (manufactured by IMEDIS, Moscow) and "Bicom" (manufactured by Regumed, Germany)--were used as generators of electromagnetic radiation. Detection of endotoxin using these devices was performed by electropuncture vegetative resonance test. Immunoenzyme reaction with antibodies to chemotype Re glycolipid was used during analysis of preparations for assessment of resonance-frequency method specificity. The study showed that resonance-frequency method can detect lypopolysaccharides of different enterobacteria in quantities up to 0.1 pg as well as bacteria which contain lypopolysaccharides. At the same time, this method does not detect such bacteria as Staphylococcus aureus, Bifidobacterium spp., Lactobacillus spp., and Candida albicans. The method does not require preliminary processing of blood samples and can be used for diagnostics of endotoxinemia, and detection of endotoxins in blood samples or injection solutions.

Different Use of Cell Surface Glycosaminoglycans As Adherence Receptors to Corneal Cells by Gram Positive and Gram Negative Pathogens

PubMed Central

García, Beatriz; Merayo-Lloves, Jesús; Rodríguez, David; Alcalde, Ignacio; García-Suárez, Olivia; Alfonso, José F.; Baamonde, Begoña; Fernández-Vega, Andrés; Vazquez, Fernando; Quirós, Luis M.

2016-01-01

The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive, and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies. PMID:27965938

Branimycins B and C, Antibiotics Produced by the Abyssal Actinobacterium Pseudonocardia carboxydivorans M-227.

PubMed

Braña, Alfredo F; Sarmiento-Vizcaíno, Aida; Pérez-Victoria, Ignacio; Otero, Luis; Fernández, Jonathan; Palacios, Juan José; Martín, Jesús; de la Cruz, Mercedes; Díaz, Caridad; Vicente, Francisca; Reyes, Fernando; García, Luis A; Blanco, Gloria

2017-02-24

Two new antibiotics, branimycins B (2) and C (3), were produced by fermentation of the abyssal actinobacterium Pseudonocardia carboxydivorans M-227, isolated from deep seawater of the Avilés submarine Canyon. Their structures were elucidated by HRMS and NMR analyses. These compounds exhibit antibacterial activities against a panel of Gram-positive bacteria, including Corynebacterium urealyticum, Clostridium perfringens, and Micrococcus luteus, and against the Gram-negative bacterium Neisseria meningitidis. Additionally, branimycin B displayed moderate antibacterial activity against other Gram-negative bacteria such as Bacteroides fragilis, Haemophilus influenzae, and Escherichia coli, and branimycin C against the Gram-positive Enterococcus faecalis and methicillin-sensitive and methicillin-resistant Staphylococcus aureus.

A novel antimicrobial peptide against dental-caries-associated bacteria.

PubMed

Chen, Long; Jia, Lili; Zhang, Qiang; Zhou, Xirui; Liu, Zhuqing; Li, Bingjie; Zhu, Zhentai; Wang, Fenwei; Yu, Changyuan; Zhang, Qian; Chen, Feng; Luo, Shi-Zhong

2017-10-01

Dental caries, a highly prevalent oral disease, is primarily caused by pathogenic bacteria infection, and most of them are anaerobic. Herein, we investigated the activity of a designed antimicrobial peptide ZXR-2, and found it showed broad-spectrum activity against a variety of Gram-positive and Gram-negative oral bacteria, particularly the caries-related taxa Streptococcus mutans. Time-course killing assays indicated that ZXR-2 killed most bacterial cells within 5 min at 4 × MIC. The mechanism of ZXR-2 involved disruption of cell membranes, as observed by scanning electron microscopy. Moreover, ZXR-2 inhibited the formation of S. mutans biofilm, but showed limited hemolytic effect. Based on its potent antimicrobial activity, rapid killing, and inhibition of S. mutans biofilm formation, ZXR-2 represents a potential therapeutic for the prevention and treatment of dental caries. Copyright © 2017 Elsevier Ltd. All rights reserved.

Size-dependent antimicrobial properties of sugar-encapsulated gold nanoparticles synthesized by a green method

PubMed Central

2012-01-01

The antimicrobial properties of dextrose-encapsulated gold nanoparticles (dGNPs) with average diameters of 25, 60, and 120 nm (± 5) and synthesized by green chemistry principles were investigated against both Gram-negative and Gram-positive bacteria. Studies were performed involving the effect of dGNPs on the growth, morphology, and ultrastructural properties of bacteria. dGNPs were found to have significant dose-dependent antibacterial activity which was also proportional to their size. Experiments revealed the dGNPs to be bacteriostatic as well as bactericidal. The dGNPs exhibited their bactericidal action by disrupting the bacterial cell membrane which leads to the leakage of cytoplasmic content. The overall outcome of this study suggests that green-synthesized dGNPs hold promise as a potent antibacterial agent against a wide range of disease-causing bacteria by preventing and controlling possible infections or diseases. PMID:23146145

Modeling the effect of Rose Bengal on growth and decay patterns of Pseudomonas aeruginosa, Escherichia coli and Staphylococcus aureus

NASA Astrophysics Data System (ADS)

Al-Akhras, M.-Ali H.; Shorman, Mohammad Al; Masadeh, Majed M.; Aljarrah, Khaled; Ababneh, Zaid

2018-02-01

Most infections caused by (Pseudomonas aeruginosa, Escherichia coli and Staphylococcus aureus) are hospital and community acquired infections in patients. Bacterial growths incorporated with photosensitizing material (Rose Bengal) with and without light were investigated. The results demonstrated that the viable counts are increasing in absence of light (in dark) for all samples incorporated with Rose Bengal. Variation in growth phases were noticed as expected, but there is no significant change in decay phases. Convenient and adequate mathematical modeling is in very good agreement with the experimental results and showed to be a very good approach of characterization the growth behaviors of the bacteria. Bandwidths are independent of bacteria group (gram-positive or gram-negative) but it seems totally dependent on the oxygen requirements; an anaerobic bacterium takes broader bandwidths than aerobic bacteria. This concludes that the growth and lethal rates of anaerobic are much greater than aerobic.

Effect of cloacal plugging on microbial recovery from partially processed broilers.

PubMed

Musgrove, M T; Cason, J A; Fletcher, D L; Stern, N J; Cox, N A; Bailey, J S

1997-03-01

Experiments were performed to test the contribution of bacteria contained in the intestinal tract of broilers at the beginning of processing to counts on the exterior of modified New York-dressed carcasses. Thirty-two birds were processed for each of seven replications. Within each replication, batches of four birds were electrocuted, scalded, and picked, with batches alternating between treatment and control groups. Treated birds were cloacally plugged with rayon fiber tampons prior to electrocution to prevent escape of intestinal contents during scalding and picking. Control birds were processed in the same manner, except that cloacal plugs were inserted immediately after defeathering to reduce escape of intestinal contents during sampling. Gram-negative enteric bacteria and Campylobacter spp. were enumerated on carcasses by whole carcass rinse procedure and in cecal contents. Counts were converted to log10 and subjected to analysis of variance. Cecal levels of Gram-negative enterics were significantly higher for plugged birds, but there was not a significant difference between levels of cecal Campylobacter spp. between treatment groups. Plugging before electrocution resulted in significantly lower levels (2.5 vs 3.0 log10 cfu/mL) of Campylobacter spp. and Gram-negative enteric bacteria (3.0 vs 3.4 log10 cfu/mL) in carcass rinses of treatment birds than in those of controls. All carcasses were positive for Gram-negative enterics. Cloacal plugging resulted in significantly lower incidence of Campylobacter spp. carcass contamination as determined by chi-square. Intestinal carriage of both campylobacters and Gram-negative enteric bacteria appears to influence the microbial quality of the carcass during processing.

Screening of nursing home residents for colonization with carbapenem-resistant Enterobacteriaceae admitted to acute care hospitals: Incidence and risk factors.

PubMed

Cunha, Cheston B; Kassakian, Steven Z; Chan, Ryan; Tenover, Fred C; Ziakas, Panos; Chapin, Kimberle C; Mermel, Leonard A

2016-02-01

There are increasing reports of multidrug-resistant gram-negative bacilli in nursing homes and acute care hospitals. We performed a point prevalence survey to detect fecal carriage of gram-negative bacteria carrying carbapenem resistance genes or which were otherwise resistant to carbapenem antibiotics among 500 consecutive admissions from local nursing homes to 2 hospitals in Providence, Rhode Island. We performed a case-control study to identify risk factors associated with carriage of carbapenem-resistant Enterobacteriaceae (CRE). There were 404 patients with 500 hospital admissions during which they had rectal swab samples cultured. Fecal carriage of any carbapenem-resistant or carbapenemase- producing gram-negative bacteria was found in 23 (4.6%) of the 500 hospital admissions, including 7 CRE (1.4%), 2 (0.4%) of which were Klebsiella pneumoniae carbapenemase (ie, blaKPC) producing (CPE) Citrobacter freundii, 1 of which was carbapenem susceptible by standard testing methods. Use of a gastrostomy tube was associated with CRE carriage (P = .04). We demonstrated fecal carriage of carbapenem-resistant or carbapenemase-producing gram-negative bacteria in 4.6% of nursing home patients admitted to 2 acute care hospitals, but only 0.4% of such admissions were patients with fecal carriage of CPE. Use of gastrostomy tubes was associated with fecal carriage of gram-negative bacteria with detectable carbapenem resistance. CRE fecal carriage is uncommon in our hospital admissions from nursing homes. Copyright © 2016 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Combined effect of enterocin and lipase from Enterococcus faecium NCIM5363 against food borne pathogens: mode of action studies.

PubMed

Ramakrishnan, Vrinda; Narayan, Bhaskar; Halami, Prakash M

2012-08-01

Food borne diseases have a major impact on public health whose epidemiology is rapidly changing. The whole cells of pathogens involved or their toxins/metabolites affect the human health apart from spoiling sensory properties of the food products finally affecting the food industry as well as consumer health. With pathogens developing mechanisms of antibiotic resistance, there has been an increased need to replace antibiotics as well as chemical additives with naturally occurring bacteriocins. Bacteriocins are known to act mainly against Gram-positive pathogens and with little or no effect towards Gram-negative enteric bacteria. In the present study, combination effect of lipase and bacteriocin produced by Enterococcus faecium NCIM5363, a highly lipolytic lactic acid bacterium against various food pathogens was assessed. The lipase in combination with enterocin exhibited a lethal effect against Gram-negative pathogens. Scanning electron microscopy studies carried out to ascertain the constitutive mode of action of lipase and enterocin revealed that the lipase degrades the cell wall of Gram-negative bacteria and creates a pore through which enterocin enters thereby resulting in cell death. The novelty of this work is the fact that this is the first report revealing the synergistic effect of lipase with enterocin against Gram-negative bacteria.

Chemical composition and antimicrobial activity of the essential oil of apricot seed.

PubMed

Lee, Hyun-Hee; Ahn, Jeong-Hyun; Kwon, Ae-Ran; Lee, Eun Sook; Kwak, Jin-Hwan; Min, Yu-Hong

2014-12-01

In traditional oriental medicine, apricot (Prunus armeniaca L.) seed has been used to treat skin diseases such as furuncle, acne vulgaris and dandruff, as well as coughing, asthma and constipation. This study describes the phytochemical profile and antimicrobial potential of the essential oil obtained from apricot seeds (Armeniacae Semen). The essential oil isolated by hydrodistillation was analysed by gas chromatography-mass spectroscopy. Benzaldehyde (90.6%), mandelonitrile (5.2%) and benzoic acid (4.1%) were identified. Disc diffusion, agar dilution and gaseous contact methods were performed to determine the antimicrobial activity against 16 bacteria and two yeast species. The minimum inhibitory concentrations ranged from 250 to 4000, 500 to 2000 and 250 to 1000 µg/mL for Gram-positive bacteria, Gram-negative bacteria and yeast strains, respectively. The minimum inhibitory doses by gaseous contact ranged from 12.5 to 50, 12.5 to 50 and 3.13 to 12.5 mg/L air for Gram-positive bacteria, Gram-negative bacteria and yeast strains, respectively. The essential oil exhibited a variable degree of antimicrobial activity against a range of bacteria and yeasts tested. Copyright © 2014 John Wiley & Sons, Ltd.

Inhibition of various gram-positive and gram- negative bacteria growth on selenium nanoparticle coated paper towels

PubMed Central

Wang, Qi; Larese-Casanova, Philip; Webster, Thomas J

2015-01-01

There are wide spread bacterial contamination issues on various paper products, such as paper towels hanging in sink splash zones or those used to clean surfaces, filter papers used in water and air purifying systems, and wrappings used in the food industry; such contamination may lead to the potential spread of bacteria and consequent severe health concerns. In this study, selenium nanoparticles were coated on normal paper towel surfaces through a quick precipitation method, introducing antibacterial properties to the paper towels in a healthy way. Their effectiveness at preventing biofilm formation was tested in bacterial assays involving Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, and Staphylococcus epidermidis. The results showed significant and continuous bacteria inhibition with about a 90% reduction from 24 to 72 hours for gram-positive bacteria including S. aureus and S. epidermidis. The selenium coated paper towels also showed significant inhibition of gram-negative bacteria like P. aeruginosa and E. coli growth at about 57% and 84%, respectively, after 72 hours of treatment. Therefore, this study established a promising selenium-based antibacterial strategy to prevent bacterial growth on paper products, which may lead to the avoidance of bacteria spreading and consequent severe health concerns. PMID:25926733

Inhibition of various gram-positive and gram-negative bacteria growth on selenium nanoparticle coated paper towels.

PubMed

Wang, Qi; Larese-Casanova, Philip; Webster, Thomas J

2015-01-01

There are wide spread bacterial contamination issues on various paper products, such as paper towels hanging in sink splash zones or those used to clean surfaces, filter papers used in water and air purifying systems, and wrappings used in the food industry; such contamination may lead to the potential spread of bacteria and consequent severe health concerns. In this study, selenium nanoparticles were coated on normal paper towel surfaces through a quick precipitation method, introducing antibacterial properties to the paper towels in a healthy way. Their effectiveness at preventing biofilm formation was tested in bacterial assays involving Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, and Staphylococcus epidermidis. The results showed significant and continuous bacteria inhibition with about a 90% reduction from 24 to 72 hours for gram-positive bacteria including S. aureus and S. epidermidis. The selenium coated paper towels also showed significant inhibition of gram-negative bacteria like P. aeruginosa and E. coli growth at about 57% and 84%, respectively, after 72 hours of treatment. Therefore, this study established a promising selenium-based antibacterial strategy to prevent bacterial growth on paper products, which may lead to the avoidance of bacteria spreading and consequent severe health concerns.

Chronic obstructive pulmonary disease and asthma-associated Proteobacteria, but not commensal Prevotella spp., promote Toll-like receptor 2-independent lung inflammation and pathology.

PubMed

Larsen, Jeppe M; Musavian, Hanieh S; Butt, Tariq M; Ingvorsen, Camilla; Thysen, Anna H; Brix, Susanne

2015-02-01

Recent studies of healthy human airways have revealed colonization by a distinct commensal bacterial microbiota containing Gram-negative Prevotella spp. However, the immunological properties of these bacteria in the respiratory system remain unknown. Here we compare the innate respiratory immune response to three Gram-negative commensal Prevotella strains (Prevotella melaninogenica, Prevotella nanceiensis and Prevotella salivae) and three Gram-negative pathogenic Proteobacteria known to colonize lungs of patients with chronic obstructive pulmonary disease (COPD) and asthma (Haemophilus influenzae B, non-typeable Haemophilus influenzae and Moraxella catarrhalis). The commensal Prevotella spp. and pathogenic Proteobacteria were found to exhibit intrinsic differences in innate inflammatory capacities on murine lung cells in vitro. In vivo in mice, non-typeable H. influenzae induced severe Toll-like receptor 2 (TLR2)-independent COPD-like inflammation characterized by predominant airway neutrophilia, expression of a neutrophilic cytokine/chemokine profile in lung tissue, and lung immunopathology. In comparison, P. nanceiensis induced a diminished neutrophilic airway inflammation and no detectable lung pathology. Interestingly, the inflammatory airway response to the Gram-negative bacteria P. nanceiensis was completely TLR2-dependent. These findings demonstrate weak inflammatory properties of Gram-negative airway commensal Prevotella spp. that may make colonization by these bacteria tolerable by the respiratory immune system. © 2014 John Wiley & Sons Ltd.

Chronic obstructive pulmonary disease and asthma-associated Proteobacteria, but not commensal Prevotella spp., promote Toll-like receptor 2-independent lung inflammation and pathology

PubMed Central

Larsen, Jeppe M; Musavian, Hanieh S; Butt, Tariq M; Ingvorsen, Camilla; Thysen, Anna H; Brix, Susanne

2015-01-01

Recent studies of healthy human airways have revealed colonization by a distinct commensal bacterial microbiota containing Gram-negative Prevotella spp. However, the immunological properties of these bacteria in the respiratory system remain unknown. Here we compare the innate respiratory immune response to three Gram-negative commensal Prevotella strains (Prevotella melaninogenica, Prevotella nanceiensis and Prevotella salivae) and three Gram-negative pathogenic Proteobacteria known to colonize lungs of patients with chronic obstructive pulmonary disease (COPD) and asthma (Haemophilus influenzae B, non-typeable Haemophilus influenzae and Moraxella catarrhalis). The commensal Prevotella spp. and pathogenic Proteobacteria were found to exhibit intrinsic differences in innate inflammatory capacities on murine lung cells in vitro. In vivo in mice, non-typeable H. influenzae induced severe Toll-like receptor 2 (TLR2)-independent COPD-like inflammation characterized by predominant airway neutrophilia, expression of a neutrophilic cytokine/chemokine profile in lung tissue, and lung immunopathology. In comparison, P. nanceiensis induced a diminished neutrophilic airway inflammation and no detectable lung pathology. Interestingly, the inflammatory airway response to the Gram-negative bacteria P. nanceiensis was completely TLR2-dependent. These findings demonstrate weak inflammatory properties of Gram-negative airway commensal Prevotella spp. that may make colonization by these bacteria tolerable by the respiratory immune system. PMID:25179236

Residual risk of bacterial contamination of platelets: six years of experience with sterility testing.

PubMed

Ramirez-Arcos, Sandra; DiFranco, Caesar; McIntyre, Terri; Goldman, Mindy

2017-09-01

Canadian Blood Services screens 100% of platelet concentrates (PCs) for bacterial contamination with the BacT/ALERT system. Quality-control sterility testing of 1% (≥10 units) of outdated PCs is performed monthly. Data from routine screening, quality-control testing, and septic reactions obtained from 2010 to 2016 are presented herein. In total, 601,988 buffy coat PC pools and 186,737 apheresis PCs were routinely screened with aerobic cultures over 6 years. Outdate quality-control testing of 8535 buffy coat and 8498 apheresis PCs was performed using aerobic and anaerobic cultures during the same period. Results were classified as "true-positives" when the same bacterium was isolated in initial and confirmatory cultures or "false-negatives" when bacteria were missed in early screening and were captured during quality-control sterility testing or through investigation of sepsis cases. During routine screening, the true-positive rates between buffy coat (0.94 per 10,000) and apheresis (0.96 per 10,000) PCs were similar (p = 0.9473). Seventy-five bacteria isolated during PC screening included Gram-positive and Gram-negative organisms. Six false-negative septic reactions were reported that implicated coagulase-negative staphylococci (n = 3) and Staphylococcus aureus (n = 3) for approximate rates of 1 per 100,000 transfusion reactions and 1 per 500,000 fatalities. During quality-control testing, the false-negative rates between buffy coat (8 per 10,000) and apheresis (9 per 10,000) PCs were similar (p = 0.7897). All 15 quality-control isolates were Gram-positive bacteria. The current bacterial screening protocol is efficacious for identifying Gram-negative bacteria. However, the high proportion of Gram-positive organisms detected on outdate quality-control testing and septic transfusion events demonstrates a residual safety risk that merits further intervention. © 2017 AABB.

Hyperspectral microscope imaging methods to classify gram-positive and gram-negative foodborne pathogenic bacteria

USDA-ARS?s Scientific Manuscript database

An acousto-optic tunable filter-based hyperspectral microscope imaging method has potential for identification of foodborne pathogenic bacteria from microcolony rapidly with a single cell level. We have successfully developed the method to acquire quality hyperspectral microscopic images from variou...

Classification of gram-positive and gram-negative foodborne pathogenic bacteria with hyperspectral microscope imaging

USDA-ARS?s Scientific Manuscript database

Optical method with hyperspectral microscope imaging (HMI) has potential for identification of foodborne pathogenic bacteria from microcolonies rapidly with a cell level. A HMI system that provides both spatial and spectral information could be an effective tool for analyzing spectral characteristic...

Photocatalytic disinfection of spoilage bacteria Pseudomonas fluorescens and Macrococcus caseolyticus by nano-TiO2

USDA-ARS?s Scientific Manuscript database

Photocatalytic disinfection of spoilage bacteria gram-negative (G-) P. fluorescens and gram-positive (G+) M. caseolyticus by nano-TiO2 under different experimental conditions and the disinfection mechanism were investigated. The experimental conditions included the initial bacterial populations, nan...

A new rapid method for direct antimicrobial susceptibility testing of bacteria from positive blood cultures.

PubMed

Barnini, Simona; Brucculeri, Veronica; Morici, Paola; Ghelardi, Emilia; Florio, Walter; Lupetti, Antonella

2016-08-12

Rapid identification and antimicrobial susceptibility testing (AST) of the causative agent(s) of bloodstream infections can lead to prompt appropriate antimicrobial therapy. To shorten species identification, in this study bacteria were recovered from monomicrobial blood cultures by serum separator tubes and spotted onto the target plate for direct MALDI-TOF MS identification. Proper antibiotics were selected for direct AST based on species identification. In order to obtain rapid AST results, bacteria were recovered from positive blood cultures by two different protocols: by serum separator tubes (further referred to as PR1), or after a short-term subculture in liquid medium (further referred to as PR2). The results were compared with those obtained by the method currently used in our laboratory consisting in identification by MALDI-TOF and AST by Vitek 2 or Sensititre on isolated colonies. The direct MALDI-TOF method concordantly identified with the current method 97.5 % of the Gram-negative bacteria and 96.1 % of the Gram-positive cocci contained in monomicrobial blood cultures. The direct AST by PR1 and PR2 for all isolate/antimicrobial agent combinations was concordant/correct with the current method for 87.8 and 90.5 % of Gram-negative bacteria and for 93.1 and 93.8 % of Gram-positive cocci, respectively. In particular, 100 % categorical agreement was found with levofloxacin for Enterobacteriaceae by both PR1 and PR2, and 99.0 and 100 % categorical agreement was observed with linezolid for Gram-positive cocci by PR1 and PR2, respectively. There was no significant difference in accuracy between PR1 and PR2 for Gram-negative bacteria and Gram-positive cocci. This newly described method seems promising for providing accurate AST results. Most importantly, these results would be available in a few hours from blood culture positivity, which would help clinicians to promptly confirm or streamline an effective antibiotic therapy in patients with bloodstream infections.

Examining the safety of respiratory and intravenous inoculation of Bdellovibrio bacteriovorus and Micavibrio aeruginosavorus in a mouse model.

PubMed

Shatzkes, Kenneth; Chae, Richard; Tang, Chi; Ramirez, Gregory C; Mukherjee, Somdatta; Tsenova, Liana; Connell, Nancy D; Kadouri, Daniel E

2015-08-07

Bdellovibrio spp. and Micavibrio spp. are Gram-negative predators that feed on other Gram-negative bacteria, making predatory bacteria potential alternatives to antibiotics for treating multi-drug resistant infections. While the ability of predatory bacteria to control bacterial infections in vitro is well documented, the in vivo effect of predators on a living host has yet to be extensively examined. In this study, respiratory and intravenous inoculations were used to determine the effects of predatory bacteria in mice. We found no reduction in mouse viability after intranasal or intravenous inoculation of B. bacteriovorus 109J, HD100 or M. aeruginosavorus. Introducing predators into the respiratory tract of mice provoked a modest inflammatory response at 1 hour post-exposure, but was not sustained at 24 hours, as measured by RT-qPCR and ELISA. Intravenous injection caused an increase of IL-6 in the kidney and spleen, TNF in the liver and CXCL-1/KC in the blood at 3 hours post-exposure, returning to baseline levels by 18 hours. Histological analysis of tissues showed no pathological changes due to predatory bacteria. Furthermore, qPCR detected predators were cleared from the host quickly and efficiently. This work addresses some of the safety concerns regarding the potential use of predatory bacteria as a live antibiotic.

Antimycobacterial, antimicrobial, and biocompatibility properties of para-aminosalicylic acid with zinc layered hydroxide and Zn/Al layered double hydroxide nanocomposites

PubMed Central

Saifullah, Bullo; El Zowalaty, Mohamed E; Arulselvan, Palanisamy; Fakurazi, Sharida; Webster, Thomas J; Geilich, Benjamin M; Hussein, Mohd Zobir

2014-01-01

The treatment of tuberculosis by chemotherapy is complicated due to multiple drug prescriptions, long treatment duration, and adverse side effects. We report here for the first time an in vitro therapeutic effect of nanocomposites based on para-aminosalicylic acid with zinc layered hydroxide (PAS-ZLH) and zinc-aluminum layered double hydroxides (PAS-Zn/Al LDH), against mycobacteria, Gram-positive bacteria, and Gram-negative bacteria. The nanocomposites demonstrated good antimycobacterial activity and were found to be effective in killing Gram-positive and Gram-negative bacteria. A biocompatibility study revealed good biocompatibility of the PAS-ZLH nanocomposites against normal human MRC-5 lung cells. The para-aminosalicylic acid loading was quantified with high-performance liquid chromatography analysis. In summary, the present preliminary in vitro studies are highly encouraging for further in vivo studies of PAS-ZLH and PAS-Zn/Al LDH nanocomposites to treat tuberculosis. PMID:25114509

Discrimination of selected species of pathogenic bacteria using near-infrared Raman spectroscopy and principal components analysis

NASA Astrophysics Data System (ADS)

de Siqueira e Oliveira, Fernanda S.; Giana, Hector E.; Silveira, Landulfo, Jr.

2012-03-01

It has been proposed a method based on Raman spectroscopy for identification of different microorganisms involved in bacterial urinary tract infections. Spectra were collected from different bacterial colonies (Gram negative: E. coli, K. pneumoniae, P. mirabilis, P. aeruginosa, E. cloacae and Gram positive: S. aureus and Enterococcus sp.), grown in culture medium (Agar), using a Raman spectrometer with a fiber Raman probe (830 nm). Colonies were scraped from Agar surface placed in an aluminum foil for Raman measurements. After pre-processing, spectra were submitted to a Principal Component Analysis and Mahalanobis distance (PCA/MD) discrimination algorithm. It has been found that the mean Raman spectra of different bacterial species show similar bands, being the S. aureus well characterized by strong bands related to carotenoids. PCA/MD could discriminate Gram positive bacteria with sensitivity and specificity of 100% and Gram negative bacteria with good sensitivity and high specificity.

Chemical composition and antibacterial activity of selected essential oils and some of their main compounds.

PubMed

Wanner, Juergen; Schmidt, Erich; Bail, Stefanie; Jirovetz, Leopold; Buchbauer, Gerhard; Gochev, Velizar; Girova, Tanya; Atanasova, Teodora; Stoyanova, Albena

2010-09-01

The chemical composition of essential oils of cabreuva (Myrocarpus fastigiatus Allemao, Fabaceae) from Brazil, cedarwood (Juniperus ashei, Cupressaceae) from Texas, Juniper berries (Juniperus communis L., Cupressaceae) and myrrh (Commiphora myrrha (Nees) Engl., Burseraceae) were analyzed using GC/FID and GC/MS. The antimicrobial activity of these essential oils and some of their main compounds were tested against eleven different strains of Gram-positive and Gram-negative bacteria by using agar diffusion and agar serial dilution methods. Animal and plant pathogens, food poisoning and spoilage bacteria were selected. The volatile oils exhibited considerable inhibitory effects against all tested organisms, except Pseudomonas, using both test methods. Higher activity was observed against Gram-positive strains in comparison with Gram-negative bacteria. Cabreuva oil from Brazil showed similar results, but in comparison with the other oils tested, only when higher concentrations of oil were used.

Characterizing the Catalytic Potential of Deinococcus, Arthrobacter and other Robust Bacteria in Contaminated Subsurface Environments of the Hanford Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daly, Michael J.

2006-05-01

Ionizing Radiation (IR) Resistance in Bacteria. Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR) and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus & Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella & Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny,more » where very high and very low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR.« less

Preparation, characterization and antibacterial activity of oxidized κ-carrageenan.

PubMed

Zhu, Mingjin; Ge, Liming; Lyu, Yongbo; Zi, Yaxin; Li, Xinying; Li, Defu; Mu, Changdao

2017-10-15

The oxidized κ-carrageenans with different oxidation levels were prepared through the hydrogen peroxide and copper sulfate redox system. The oxidation level of oxidized κ-carrageenan was successfully controlled by adjusting the dosage of hydrogen peroxide. The results showed that the microtopography of oxidized κ-carrageenan changed from rough granules to smooth flakes, mainly resulting from the easily melting property of oxidized κ-carrageenan induced by introduced carboxyl and aldehyde groups. Especially, the antibacterial activity of oxidized κ-carrageenans against Gram-positive bacteria (Staphylococcus aureus and Listeria monocytogenes) and Gram-negative bacteria (Escherichia coli and Pseudomonas aeruginosa) was systematically investigated. The results showed that the oxidized κ-carrageenan could damage the bacterial cell wall and cytoplasmic membrane and suppress the growth of both Gram-positive and Gram-negative bacteria. The oxidized κ-carrageenan possessed broad-spectrum antibacterial activity, which may be used as a new antibacterial agent. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identification of an amphioxus intelectin homolog that preferably agglutinates gram-positive over gram-negative bacteria likely due to different binding capacity to LPS and PGN.

PubMed

Yan, Jie; Wang, Jianfeng; Zhao, Yaqi; Zhang, Jingye; Bai, Changcun; Zhang, Changqing; Zhang, Chao; Li, Kailin; Zhang, Haiqing; Du, Xiumin; Feng, Lijun

2012-07-01

Intelectin is a recently described galactofuranose-binding lectin that plays a role in innate immunity in vertebrates. Little is known about intelectin in invertebrates, including amphioxus, the transitional form between vertebrates and invertebrates. We cloned an amphioxus intelectin homolog, AmphiITLN-like, coding 302 amino acids with a conserved fibrinogen-related domain (FReD) in the N-terminus and an Intelectin domain in the C-terminus. In situ hybridization in adult amphioxus showed that AmphiITLN-like transcripts were highly expressed in the digestive tract and the skin. Quantitative real-time PCR revealed that AmphiITLN-like is significantly up-regulated in response to Staphylococcus aureus challenge, but only modestly to Escherichia coli. In addition, recombinant AmphiITLN-like expressed in E. coli agglutinates Gram-negative and Gram-positive bacteria to different degrees in a calcium dependent manner. Recombinant AmphiITLN-like could bind lipopolysaccharide (LPS) and peptidoglycan (PGN), the major cell wall components of Gram-negative and Gram-positive bacteria, respectively, with a higher affinity to PGN. Our work identified and characterized for the first time an amphioxus intelectin homolog, and provided insight into the evolution and function of the intelectin family. Copyright © 2012 Elsevier Ltd. All rights reserved.

Restriction of cephalosporins and control of extended spectrum beta-lactamase producing gram negative bacteria in a neonatal intensive care unit.

PubMed

Murki, Srinivas; Jonnala, Sravanthi; Mohammed, Faheemuddin; Reddy, Anupama

2010-09-01

This interventional study with historical controls was conducted to study the effect of cephalosporin restriction on the incidence of extended spectrum beta-lactamase (ESBL) gram negative infections in neonates admitted to intensive care unit. All gram negative isolates from the blood were evaluated for beta lactamase production. The incidence of ESBL production was compared before (year 2007) and after cephalosporin restriction (year 2008). Thirty two neonates (3% of NICU admissions) in the year 2007 and fifty six (5.2%) in the year 2008, had gram negative septicemia. The incidence of ESBL gram negatives decreased by 22% (47% to 25%, P=0.03). Restriction of all class of cephalosporins significantly decreased the incidence of ESBL gram negative infections.

Incidence of multiple antibiotic resistant Gram-negative bacteria isolated from surface and underground water sources in south western region of Nigeria.

PubMed

Oluyege, J O; Dada, A C; Odeyemi, A T

2009-01-01

In most rural and urban settlements, particularly in Nigeria, wells, spring, streams or rivers and lakes serves as major sources of water supply for drinking and other domestic purposes. Unfortunately, many of the available water sources are not potable without some form of treatment which is seldom available in most settings. The use of untreated surface water sources for drinking and for domestic purposes remains a major threat to public health as these could serve as reservoirs the for transfer of antibiotic resistant pathogens. The incidence of resistant bacteria isolated from surface and underground water in six rural settlements in Ekiti State Nigeria was thus investigated. Gram-negative bacteria were isolated from wells, streams and boreholes in six rural settlements in Ekiti State Nigeria between January and April, 2006 and the prevalence of organisms exhibiting multiple antibiotic resistance to tetracycline, amoxicillin, cotrimoxazole, nitofurantoin, gentamicin, nalidixic acid and ofloxacin was observed. Gram-negative bacterial isolates comprised Escherichia coli (22.7%), Enterobacter aerogenes (2.5%), Salmonella spp. (13.3%), Shigella spp. (19.3%), Proteus spp. (18.5%), Klebsiella spp. (19.3%) and Pseudomonas aeruginosa (4.2%). Over 10% of the bacteria were resistant to four or more antibiotic. Antibiotic resistance was highest in members of the genera Enterobacter, Pseudomonas, and Proteus. Given the prevalence of appalling sanitary facilities and inappropriate public antibiotic use, the possibility of antibiotic resistance selection, faecal dissemination and subsequent contamination of local water sources available for rural residents of the developing world is highlighted. The implication for clinical practice of infections caused by antibiotic resistant strains especially among immunodeficient individuals is also discussed.

Distribution and Antimicrobial Susceptibility Pattern of Bacterial Pathogens Causing Urinary Tract Infection in Urban Community of Meerut City, India

PubMed Central

Prakash, Devanand; Saxena, Ramchandra Sahai

2013-01-01

Urinary tract infection is one of the common infections in the Indian community. Distribution and susceptibility of UTI-causing pathogens change according to time and place. This study was conducted to determine the distribution and antimicrobial susceptibility of uropathogens in the Indian community as well as to determine the effect of gender and age on the etiology of bacterial uropathogens. Clean catch midstream urine samples were collected from 288 patients of the age ranging from 15 to ≥48 years. Antimicrobial susceptibility was performed on all isolated bacteria by Kirby Bauer's disc diffusion method. The multiple antibiotic resistance (MAR) index of each antibiotic was calculated. The UTI prevalence was 53.82% in patients; however, the prevalence was significantly higher in females than in males (females: 73.57%; males: 35.14%; P = 0.000). Females within the age group of 26–36 years and elderly males of ≥48 years showed higher prevalence of UTI. Gram negative bacteria (90.32%) were found in high prevalence than Gram positive (9.68%). Escherichia coli (42.58%) was the most prevalent gram negative isolate. Nitrofurantoin (78.71%) was found the most resistant drug among all uropathogens. Tested carbapenems were found the most susceptible drug against isolated uropathogens which showed 92.26% and 84.52% susceptibility, respectively. PMID:24288649

Multicenter validation of the VITEK MS v2.0 MALDI-TOF mass spectrometry system for the identification of fastidious gram-negative bacteria.

PubMed

Branda, John A; Rychert, Jenna; Burnham, Carey-Ann D; Bythrow, Maureen; Garner, Omai B; Ginocchio, Christine C; Jennemann, Rebecca; Lewinski, Michael A; Manji, Ryhana; Mochon, A Brian; Procop, Gary W; Richter, Sandra S; Sercia, Linda F; Westblade, Lars F; Ferraro, Mary Jane

2014-02-01

The VITEK MS v2.0 MALDI-TOF mass spectrometry system's performance in identifying fastidious gram-negative bacteria was evaluated in a multicenter study. Compared with the reference method (DNA sequencing), the VITEK MS system provided an accurate, species-level identification for 96% of 226 isolates; an additional 1% were accurately identified to the genus level. © 2013.

The proline-rich domain of TonB possesses an extended polyproline II-like conformation of sufficient length to span the periplasm of Gram-negative bacteria

PubMed Central

Köhler, Silvia Domingo; Weber, Annemarie; Howard, S Peter; Welte, Wolfram; Drescher, Malte

2010-01-01

TonB from Escherichia coli and its homologues are critical for the uptake of siderophores through the outer membrane of Gram-negative bacteria using chemiosmotic energy. When different models for the mechanism of TonB mediated energy transfer from the inner to the outer membrane are discussed, one of the key questions is whether TonB spans the periplasm. In this article, we use long range distance measurements by spin-label pulsed EPR (Double Electron–Electron Resonance, DEER) and CD spectroscopy to show that the proline-rich segment of TonB exists in a PPII-like conformation. The result implies that the proline-rich segment of TonB possesses a length of more than 15 nm, sufficient to span the periplasm of Gram-negative bacteria. PMID:20095050

Structural Analysis of the Hg(II)-Regulatory Protein Tn501 MerR from Pseudomonas aeruginosa

PubMed Central

Wang, Dan; Huang, Shanqing; Liu, Pingying; Liu, Xichun; He, Yafeng; Chen, Weizhong; Hu, Qingyuan; Wei, Tianbiao; Gan, Jianhua; Ma, Jing; Chen, Hao

2016-01-01

The metalloprotein MerR is a mercury(II)-dependent transcriptional repressor-activator that responds to mercury(II) with extraordinary sensitivity and selectivity. It’s widely distributed in both Gram-negative and Gram-positive bacteria but with barely detectable sequence identities between the two sources. To provide structural basis for the considerable biochemical and biophysical experiments previously performed on Tn501 and Tn21 MerR from Gram-negative bacteria, we analyzed the crystal structure of mercury(II)-bound Tn501 MerR. The structure in the metal-binding domain provides Tn501 MerR with a high affinity for mercury(II) and the ability to distinguish mercury(II) from other metals with its unique planar trigonal coordination geometry, which is adopted by both Gram-negative and Gram-positive bacteria. The mercury(II) coordination state in the C-terminal metal-binding domain is transmitted through the allosteric network across the dimer interface to the N-terminal DNA-binding domain. Together with the previous mutagenesis analyses, the present data indicate that the residues in the allosteric pathway have a central role in maintaining the functions of Tn501 MerR. In addition, the complex structure exhibits significant differences in tertiary and quaternary structural arrangements compared to those of Bacillus MerR from Gram-positive bacteria, which probably enable them to function with specific promoter DNA with different spacers between −35 and −10 elements. PMID:27641146

Thiol-Capped Gold Nanoparticles Swell-Encapsulated into Polyurethane as Powerful Antibacterial Surfaces Under Dark and Light Conditions

PubMed Central

Macdonald, Thomas J.; Wu, Ke; Sehmi, Sandeep K.; Noimark, Sacha; Peveler, William J.; du Toit, Hendrik; Voelcker, Nicolas H.; Allan, Elaine; MacRobert, Alexander J.; Gavriilidis, Asterios; Parkin, Ivan P.

2016-01-01

A simple procedure to develop antibacterial surfaces using thiol-capped gold nanoparticles (AuNPs) is shown, which effectively kill bacteria under dark and light conditions. The effect of AuNP size and concentration on photo-activated antibacterial surfaces is reported and we show significant size effects, as well as bactericidal activity with crystal violet (CV) coated polyurethane. These materials have been proven to be powerful antibacterial surfaces against both Gram-positive and Gram-negative bacteria. AuNPs of 2, 3 or 5 nm diameter were swell-encapsulated into PU before a coating of CV was applied (known as PU-AuNPs-CV). The antibacterial activity of PU-AuNPs-CV samples was tested against Staphylococcus aureus and Escherichia coli as representative Gram-positive and Gram-negative bacteria under dark and light conditions. All light conditions in this study simulated a typical white-light hospital environment. This work demonstrates that the antibacterial activity of PU-AuNPs-CV samples and the synergistic enhancement of photoactivity of triarylmethane type dyes is highly dependent on nanoparticle size and concentration. The most powerful PU-AuNPs-CV antibacterial surfaces were achieved using 1.0 mg mL−1 swell encapsulation concentrations of 2 nm AuNPs. After two hours, Gram-positive and Gram-negative bacteria were reduced to below the detection limit (>4 log) under dark and light conditions. PMID:27982122

Identification of bacteria in blood culture broths using matrix-assisted laser desorption-ionization Sepsityper™ and time of flight mass spectrometry.

PubMed

Kok, Jen; Thomas, Lee C; Olma, Thomas; Chen, Sharon C A; Iredell, Jonathan R

2011-01-01

Matrix-assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF MS) is a novel method for the direct identification of bacteria from blood culture broths. We evaluate for the first time, the performance of the MALDI Sepsityper™ Kit and MS for the identification of bacteria compared to standard phenotypic methods using the manufacturer's specified bacterial identification criteria (spectral scores ≥1.700-1.999 and ≥2.000 indicated identification to genus and species level, respectively). Five hundred and seven positive blood culture broths were prospectively examined, of which 379 (74.8%; 358 monomicrobial, 21 polymicrobial) were identified by MALDI-TOF MS; 195 (100%) and 132 (67.7%) of 195 gram-positive; and 163 (100%) and 149 (91.4%) of 163 gram-negative organisms from monomicrobial blood cultures were correctly identified to genus and species level, respectively. Spectral scores <1.700 (no identification) were obtained in 128/507 (25.2%) positive blood culture broths, including 31.6% and 32.3% of gram-positive and polymicrobial blood cultures, respectively. Significantly more gram-negative organisms were identified compared to gram-positive organisms at species level (p<0.0001). Five blood cultures were misidentified, but at species level only; including four monomicrobial blood cultures with Streptococcus oralis/mitis that were misidentified as Streptococcus pneumoniae. Positive predictive values for the direct identification of both gram-positive and gram-negative bacteria from monomicrobial blood culture broths to genus level were 100%. A diagnostic algorithm for positive blood culture broths that incorporates gram staining and MALDI-TOF MS should identify the majority of pathogens, particularly to genus level.

Fluorescence High-Throughput Screening for Inhibitors of TonB Action.

PubMed

Nairn, Brittany L; Eliasson, Olivia S; Hyder, Dallas R; Long, Noah J; Majumdar, Aritri; Chakravorty, Somnath; McDonald, Peter; Roy, Anuradha; Newton, Salete M; Klebba, Phillip E

2017-05-15

Gram-negative bacteria acquire ferric siderophores through TonB-dependent outer membrane transporters (TBDT). By fluorescence spectroscopic hgh-throughput screening (FLHTS), we identified inhibitors of TonB-dependent ferric enterobactin (FeEnt) uptake through Escherichia coli FepA (EcoFepA). Among 165 inhibitors found in a primary screen of 17,441 compounds, we evaluated 20 in secondary tests: TonB-dependent ferric siderophore uptake and colicin killing and proton motive force-dependent lactose transport. Six of 20 primary hits inhibited TonB-dependent activity in all tests. Comparison of their effects on [ 59 Fe]Ent and [ 14 C]lactose accumulation suggested several as proton ionophores, but two chemicals, ebselen and ST0082990, are likely not proton ionophores and may inhibit TonB-ExbBD. The facility of FLHTS against E. coli led us to adapt it to Acinetobacter baumannii We identified its FepA ortholog (AbaFepA), deleted and cloned its structural gene, genetically engineered 8 Cys substitutions in its surface loops, labeled them with fluorescein, and made fluorescence spectroscopic observations of FeEnt uptake in A. baumannii Several Cys substitutions in AbaFepA (S279C, T562C, and S665C) were readily fluoresceinated and then suitable as sensors of FeEnt transport. As in E. coli , the test monitored TonB-dependent FeEnt uptake by AbaFepA. In microtiter format with A. baumannii , FLHTS produced Z' factors 0.6 to 0.8. These data validated the FLHTS strategy against even distantly related Gram-negative bacterial pathogens. Overall, it discovered agents that block TonB-dependent transport and showed the potential to find compounds that act against Gram-negative CRE (carbapenem-resistant Enterobacteriaceae) /ESKAPE ( Enterococcus faecium , Staphylococcus aureus , Klebsiella pneumoniae , Acinetobacter baumannii , Pseudomonas aeruginosa , and Enterobacter species) pathogens. Our results suggest that hundreds of such chemicals may exist in larger compound libraries. IMPORTANCE Antibiotic resistance in Gram-negative bacteria has spurred efforts to find novel compounds against new targets. The CRE/ESKAPE pathogens are resistant bacteria that include Acinetobacter baumannii , a common cause of ventilator-associated pneumonia and sepsis. We performed fluorescence high-throughput screening (FLHTS) against Escherichia coli to find inhibitors of TonB-dependent iron transport, tested them against A. baumannii , and then adapted the FLHTS technology to allow direct screening against A. baumannii This methodology is expandable to other drug-resistant Gram-negative pathogens. Compounds that block TonB action may interfere with iron acquisition from eukaryotic hosts and thereby constitute bacteriostatic antibiotics that prevent microbial colonization of human and animals. The FLHTS method may identify both species-specific and broad-spectrum agents against Gram-negative bacteria. Copyright © 2017 American Society for Microbiology.

Gram-negative urinary tract infections and increasing isolation of ESBL-producing or ceftazidime-resistant strains in children: results from a single-centre survey.

PubMed

Giardino, Stefano; Bandettini, Roberto; Perotti, Maddalena; Piaggio, Giorgio; Degl'Innocenti, Ludovica; Sacco, Rosanna; Ciucci, Antonella; Caviglia, Ilaria; Barabino, Paola; Ginocchio, Francesca; Losurdo, Giuseppe; Haupt, Riccardo; Castagnola, Elio

2013-03-01

Urinary tract infections (UTIs) are an important cause of morbidity in paediatrics, especially related to urinary tract malformation and neurogenic bladder dysfunction. The infection control team of Istituto Giannina Gaslini, Genova, Italy, performs a prospective survey on the epidemiology of UTI in children admitted in the hospital, and data are expressed as episodes/1000 days of hospital admission. From 2007 to 2011 there was an increase in the rate of Gram-negative UTIs, especially in the Nephrology Unit (from 11.63 to 27.48, r-coefficient 0.95, P minor 0.05), associated with an increase in infections due to ESBL-producing strains (from 0.54 to 2.55, r-coefficient 0.89, P 0.05). This study indicates that there is an increase in the rate of Gram-negative UTIs, also due to resistant strains. The cause may be multifactorial, but it is noteworthy that it has been mainly observed in a ward where low-dose, long-term administration of antibacterial prophylaxis in children with urinary malformations or neurogenic bladder dysfunction is routine. This phenomenon gives cause for concern and should be monitored carefully to avoid the risk of selecting resistant bacteria that have no therapeutic options.

Effect of biofilm and selective mixed culture on microbial fuel cell for the treatment of tempeh industrial wastewater

NASA Astrophysics Data System (ADS)

Arbianti, Rita; Surya Utami, Tania; Leondo, Vifki; Elisabeth; Andyah Putri, Syafira; Hermansyah, Heri

2018-03-01

Microbial Fuel Cell (MFC) provides a new alternative in the treatment of organic waste. MFC produces 50-90% less sludge to be disposed than other methods. MFC technology can utilize existing microorganisms in the waste as a catalyst to generate electricity and simultaneously also serves as a wastewater treatment unit itself. Tempeh wastewater is one of the abundant industrial wastewater which can be processed using MFC. Research using the selective mixed culture is very likely to do due to the good result on COD removals by adding mixed culture. Microorganisms in tempeh wastewater consist of bacteria gram positive and gram negative. This study focused on the aspects of waste treatment which is determined by decreased levels of COD and BOD. Variations in this study are the formation time of biofilm and the addition of selective gram. MFC operated for 50 hours. For a variation of biofilm formation, experiments were performed after incubation by replacing incubation substrates used in the formation of biofilms. Biofilm formation time in this study was 3 days, 5 days, 7 days and 14 days. Gram positive and gram negative bacteria were used in selective mixed culture experiments. Selective mixed culture added to the reactor by 1 mL and 5 mL. Selection of gram-positive or gram-negative bacteria carried by growing mixed culture on selective media. COD and BOD levels were measured in the wastewater before and after the experiment conducted in each variation. Biofilm formation optimum time is 7 days which decrease COD and BOD levels by 18.2% and 35.9%. The addition of gram negative bacteria decreases COD and BOD levels by 29.32% and 51.32%. Further research is needed in order to get a better result on decreasing levels of COD and BOD.

Ultrastructural localization of succinate dehydrogenase in some bacteria, after treatment with Lubrol W1.

PubMed

Cherepova, N; Spasova, D; Radoevska, S

2001-01-01

The localization of succinate dehydrogenase in some gram-negative and gram-positive bacteria (Salmonella typhimurium, Pseudomonas pseudomallei, Pseudomonas aeruginosa and Listeria monocytogenes) treated with the surface membrane active agent, Lubrol W1, was studied by a cytochemical method combined with electron microscopy.

Combined physico-chemical treatments based on enterocin AS-48 for inactivation of Gram-negative bacteria in soybean sprouts.

PubMed

Cobo Molinos, Antonio; Abriouel, Hikmate; López, Rosario Lucas; Valdivia, Eva; Omar, Nabil Ben; Gálvez, Antonio

2008-08-01

Enterocin AS-48 was tested for decontamination of soybean sprouts against Gram-negative bacteria. Although treatment with bacteriocin alone had no effect on Salmonella enterica, a synergistic antimicrobial effect was detected at pH 9.0 and in combination with moderate heat treatment. Greatest inactivation was achieved for sprouts heated for 5 min at 65 degrees C in an alkaline (pH 9.0) enterocin AS-48 solution of 25 microg/ml. Bactericidal activity against S. enterica increased greatly when enterocin AS-48 was used in washing solutions in combination with several chemical compounds: EDTA, lactic acid, peracetic acid, polyphosphoric acid, sodium hypochlorite, hexadecylpyridinium chloride, propyl-p-hydroxybenzoate, and hydrocinnamic acid. The combined treatment of enterocin AS-48 and polyphosphoric acid was tested against several other Gram-negative bacteria inoculated on sprouts. The bacteria tested showed great differences in sensitivity to polyphosphoric acid, but synergism with enterocin AS-48 was confirmed in all cases. Combinations of enterocin AS-48 (25 microg/ml) and polyphosphoric acid in a concentration range of 0.1 to 2.0% significantly reduced or inhibited growth of the populations of S. enterica, Escherichia coli O157:H7, Shigella spp., Enterobacter aerogenes, Yersinia enterocolitica, Aeromonas hydrophila and Pseudomonas fluorescens in sprout samples stored at 6 degrees C and 15 degrees C. The combined treatment could therefore be applied to reduce the risks of Gram-negative pathogenic as well as spoilage bacteria on sprouts.

Antimicrobial susceptibility profiles of gram-negative bacteria causing infections collected across India during 2014-2016: Study for monitoring antimicrobial resistance trend report.

PubMed

Veeraraghavan, Balaji; Jesudason, Mark Ranjan; Prakasah, John Antony Jude; Anandan, Shalini; Sahni, Rani Diana; Pragasam, Agila Kumari; Bakthavatchalam, Yamuna Devi; Selvakumar, Rajesh Joseph; Dhole, T N; Rodrigues, Camilla; Roy, Indranil; Joshi, Sangeetha; Chaudhuri, Bhaskar Narayan; Chitnis, D S

2018-01-01

The emergence of antibiotic resistance among bacterial pathogens in the hospital and community has increased the concern to the health-care providers due to the limited treatment options. Surveillance of antimicrobial resistance (AMR) in frequently isolated bacterial pathogens causing severe infections is of great importance. The data generated will be useful for the clinicians to decide empiric therapy on the local epidemiological resistance profile of the antimicrobial agents. This study aims to monitor the distribution of bacterial pathogen and their susceptibility pattern to the commonly used antimicrobial agents. This study includes Gram-negative bacilli collected from intra-abdominal, urinary tract and respiratory tract infections during 2014-2016. Isolates were collected from seven hospitals across India. All the study isolates were characterised up to species level, and minimum inhibitory concentration was determined for a wide range of antimicrobials included in the study panel. The test results were interpreted as per standard Clinical Laboratory Standards Institute guidelines. A total of 2731 isolates of gram-negative bacteria were tested during study period. The most frequently isolated pathogens were 44% of Escherichia coli (n = 1205) followed by 25% of Klebsiella pneumoniae (n = 676) and 11% of Pseudomonas aeruginosa (n = 308). Among the antimicrobials tested, carbapenems were the most active, followed by amikacin and piperacillin/tazobactam. The rate of extended-spectrum beta-lactamase (ESBL)-positive isolates were ranged from 66%-77% in E. coli to 61%-72% in K. pneumoniae, respectively. Overall, colistin retains its activity in > 90% of the isolates tested and appear promising. Increasing rates of ESBL producers have been noted, which is alarming. Further, carbapenem resistance was also gradually increasing, which needs much attention. Overall, this study data show that carbapenems, amikacin and colistin continue to be the best agents available to treat drug-resistant infections. Thus continuous monitoring of susceptibility profile of the clinically important Gram-negative pathogens is of great importance to guide effective antimicrobial therapy.

Photometric Application of the Gram Stain Method To Characterize Natural Bacterial Populations in Aquatic Environments

PubMed Central

Saida, H.; Ytow, N.; Seki, H.

1998-01-01

The Gram stain method was applied to the photometric characterization of aquatic bacterial populations with a charge-coupled device camera and an image analyzer. Escherichia coli and Bacillus subtilis were used as standards of typical gram-negative and gram-positive bacteria, respectively. A mounting agent to obtain clear images of Gram-stained bacteria on Nuclepore membrane filters was developed. The bacterial stainability by the Gram stain was indicated by the Gram stain index (GSI), which was applicable not only to the dichotomous classification of bacteria but also to the characterization of cell wall structure. The GSI spectra of natural bacterial populations in water with various levels of eutrophication showed a distinct profile, suggesting possible staining specificity that indicates the presence of a particular bacterial population in the aquatic environment. PMID:9464416

Examination of key intermediates in the catalytic cycle of aspartate-beta-semialdehyde dehydrogenase from a gram-positive infectious bacteria.

PubMed

Faehnle, Christopher R; Le Coq, Johanne; Liu, Xuying; Viola, Ronald E

2006-10-13

Aspartate-beta-semialdehyde dehydrogenase (ASADH) catalyzes a critical branch point transformation in amino acid bio-synthesis. The products of the aspartate pathway are essential in microorganisms, and this entire pathway is absent in mammals, making this enzyme an attractive target for antibiotic development. The first structure of an ASADH from a Gram-positive bacterium, Streptococcus pneumoniae, has now been determined. The overall structure of the apoenzyme has a similar fold to those of the Gram-negative and archaeal ASADHs but contains some interesting structural variations that can be exploited for inhibitor design. Binding of the coenzyme NADP, as well as a truncated nucleotide analogue, into an alternative conformation from that observed in Gram-negative ASADHs causes an enzyme domain closure that precedes catalysis. The covalent acyl-enzyme intermediate was trapped by soaking the substrate into crystals of the coenzyme complex, and the structure of this elusive intermediate provides detailed insights into the catalytic mechanism.

Resurrecting Inactive Antimicrobial Peptides from the Lipopolysaccharide Trap

PubMed Central

Mohanram, Harini

2014-01-01

Host defense antimicrobial peptides (AMPs) are a promising source of antibiotics for the treatment of multiple-drug-resistant pathogens. Lipopolysaccharide (LPS), the major component of the outer leaflet of the outer membrane of Gram-negative bacteria, functions as a permeability barrier against a variety of molecules, including AMPs. Further, LPS or endotoxin is the causative agent of sepsis killing 100,000 people per year in the United States alone. LPS can restrict the activity of AMPs inducing aggregations at the outer membrane, as observed for frog AMPs, temporins, and also in model AMPs. Aggregated AMPs, “trapped” by the outer membrane, are unable to traverse the cell wall, causing their inactivation. In this work, we show that these inactive AMPs can overcome LPS-induced aggregations while conjugated with a short LPS binding β-boomerang peptide motif and become highly bactericidal. The generated hybrid peptides exhibit activity against Gram-negative and Gram-positive bacteria in high-salt conditions and detoxify endotoxin. Structural and biophysical studies establish the mechanism of action of these peptides in LPS outer membrane. Most importantly, this study provides a new concept for the development of a potent broad-spectrum antibiotic with efficient outer membrane disruption as the mode of action. PMID:24419338

Versatile plasmid-based expression systems for Gram-negative bacteria--General essentials exemplified with the bacterium Ralstonia eutropha H16.

PubMed

Gruber, Steffen; Schwab, Helmut; Koefinger, Petra

2015-12-25

The Gram-negative bacterium Escherichia coli is currently the most efficient and widely used prokaryotic host for recombinant protein and metabolite production. However, due to some limitations and to various interesting features of other Gram-negative bacteria efficient vector systems applicable to a broad range are desired. Basic building blocks for plasmid-based vectors include besides the need for a suitable selection marker in the first line a proper replication and maintenance system. In addition to these basic requirements, further elements are needed for Gram-negative bacteria beyond E. coli, such as Pseudomonas pudita, Ralstonia eutropha, Burkholderia glumae or Acinetobacter sp.. Established building blocks have to be adapted and new building blocks providing the desired functions need to be identified and exploited. This minireview addresses so far described and used genetic elements for broad host range replication, efficient plasmid maintenance, and conjugative plasmid transfer as well as expression elements and protein secretion signals. The industrially important bacterium R. eutropha H16 was chosen as a model organism to provide specific data on the effectivity and utility of building blocks based on such genetic elements. Copyright © 2015 Elsevier B.V. All rights reserved.

Phenyl thiazolyl urea and carbamate derivatives as new inhibitors of bacterial cell-wall biosynthesis.

PubMed

Francisco, Gerardo D; Li, Zhong; Albright, J Donald; Eudy, Nancy H; Katz, Alan H; Petersen, Peter J; Labthavikul, Pornpen; Singh, Guy; Yang, Youjun; Rasmussen, Beth A; Lin, Yang-I; Mansour, Tarek S

2004-01-05

Over 50 phenyl thiazolyl urea and carbamate derivatives were synthesized for evaluation as new inhibitors of bacterial cell-wall biosynthesis. Many of them demonstrated good activity against MurA and MurB and gram-positive bacteria including MRSA, VRE and PRSP. 3,4-Difluorophenyl 5-cyanothiazolylurea (3p) with clog P of 2.64 demonstrated antibacterial activity against both gram-positive and gram-negative bacteria.

Urinary tract infections following radical cystectomy and urinary diversion: a review of 1133 patients.

PubMed

Clifford, Thomas G; Katebian, Behrod; Van Horn, Christine M; Bazargani, Soroush T; Cai, Jie; Miranda, Gus; Daneshmand, Siamak; Djaladat, Hooman

2018-05-01

To investigate the incidence and microbiology of urinary tract infection (UTI) within 90 days following radical cystectomy (RC) and urinary diversion. We reviewed 1133 patients who underwent RC for bladder cancer at our institution between 2003 and 2013; 815 patients (72%) underwent orthotopic diversion, 274 (24%) ileal conduit, and 44 (4%) continent cutaneous diversion. 90-day postoperative UTI incidence, culture results, antibiotic sensitivity/resistance and treatment were recorded through retrospective review. Fisher's exact test, Kruskal-Wallis test, and multivariable analysis were performed. A total of 151 urinary tract infections were recorded in 123 patients (11%) during the first 90 days postoperatively. 21/123 (17%) had multiple infections and 25 (20%) had urosepsis in this time span. Gram-negative rods were the most common etiology (54% of positive cultures). 52% of UTI episodes led to readmission. There was no significant difference in UTI rate, etiologic microbiology (Gram-negative rods, Gram-positive cocci, fungi), or antibiotic sensitivity and resistance patterns between diversion groups. Resistance to quinolones was evident in 87.5% of Gram-positive and 35% of Gram-negative bacteria. In multivariable analysis, Charlson Comorbidity Index > 2 was associated with higher 90-day UTI rate (OR = 1.8, 95% CI 1.1-2.9, p = 0.05) and Candida UTI (OR 5.6, 95% CI 1.6-26.5, p = 0.04). UTI is a common complication and cause of readmission following radical cystectomy and urinary diversion. These infections are commonly caused by Gram-negative rods. High comorbidity index is an independent risk factor for postoperative UTI, but diversion type is not.

Synthesis, micellisation and interaction of novel quaternary ammonium compounds derived from l-Phenylalanine with 1,2-dipalmitoyl-sn-glycero-3-phosphocholine as model membrane in relation to their antibacterial activity, and their selectivity over human red blood cells.

PubMed

Joondan, Nausheen; Caumul, Prakashanand; Akerman, Matthew; Jhaumeer-Laulloo, Sabina

2015-02-01

A series of quaternary ammonium compounds (QUATS) derived from l-Phenylalanine have been synthesized and their antibacterial efficiencies were determined against various strains of Gram-positive and Gram-negative bacteria. The antibacterial activity increased with increasing chain length, exhibiting a cut-off effect at C14 for Gram-positive and C12 for Gram-negative bacteria. The l-Phenylalanine QUATS displayed enhanced antibacterial properties with a higher cut-off point compared to their corresponding l-Phenylalanine ester hydrochlorides. The CMC was correlated with the MIC, inferring that micellar activity contributes to the cut-off effect in antibacterial activity. The hemolytic activities (HC50) of the QUATS against human red blood cells were also determined to illustrate the selectivity of these QUATS for bacterial over mammalian cells. In general, the MIC was lower than the HC50, and assessment of the micellar contribution to the antibacterial and hemolytic evaluation in TBS as a common medium confirmed that these QUATS can act as antibacterial, yet non-toxic molecules at their monomer concentrations. The interaction of the QUATS with the phospholipid vesicles (1,2-dipalmitoyl-sn-glycero-3-phosphocholine, DPPC) in the presence of 1-anilino-8-naphthalene sulfonate (ANS) and 1,6-diphenyl-1,3,5-hexatriene (DPH) as fluorescence probes showed that the presence of the quaternary ammonium moiety causes an increase in hydrophobic interactions, thus causing an increase in antibacterial activity. Copyright © 2015 Elsevier Inc. All rights reserved.

VIP as a potential therapeutic agent in gram negative sepsis.

PubMed

Ibrahim, Hiba; Barrow, Paul; Foster, Neil

2012-12-01

Gram negative sepsis remains a high cause of mortality and places a great burden on public health finance in both the developed and developing world. Treatment of sepsis, using antibiotics, is often ineffective since pathology associated with the disease occurs due to dysregulation of the immune system (failure to return to steady state conditions) which continues after the bacteria, which induced the immune response, have been cleared. Immune modulation is therefore a rational approach to the treatment of sepsis but to date no drug has been developed which is highly effective, cheap and completely safe to use. One potential therapeutic agent is VIP, which is a natural peptide and is highly homologous in all vertebrates. In this review we will discuss the effect of VIP on components of the immune system, relevant to gram negative sepsis, and present data from animal models. Furthermore we will hypothesise on how these studies could be improved in future and speculate on the possible different ways in which VIP could be used in clinical medicine.

Understanding the properties of chitosan aryl substituted thioureas in their role and potential as antibacterial agents

NASA Astrophysics Data System (ADS)

Khairul, Wan M.; Daud, Adibah Izzati; Ismail, Noraznawati

2018-02-01

In this study, the effort was to design and synthesize a series of thiourea-chitosan derivatives featuring five aryl substituted members namely N-chitosan-N'-(4-nitrobenzoyl) thiourea (1), N-chitosan-N'-(4-chlorobenzoyl) thiourea (2), N-chitosan-N'-(4-methylbenzoyl) thiourea (3), N-chitosan-N'-(2-iodobenzoyl) thiourea (4), and N-chitosan-N'-(2-methylbenzoyl) thiourea (5) via SN2 reaction pathway having different donating and withdrawing groups. Their molecular structures were then characterised by FT-IR, UV-Vis, and thermogravimetric analysis (TGA). The antimicrobial activities of these derivatives against four species bacteria Bacillus cereus, Staphylococcus aureus, Salmonella typhi, and Escherichia coli of both Gram-positive and Gram-negative type bacteria at minimum concentration 6mg/ml were carried out to investigate their potential as antibacterial agents. Compound 1 exhibited specific activity as it can only inhibit Gram-positive bacteria while other compounds 2-5 showed broad range spectrum activity as they were able to inhibit both Gram-positive and Gram-negative bacteria. Therefore, 1-5 showed good antibacterial activity and have high potential to be further developed as active materials in pharmaceutical interests.

Evaluation of White Blood Cell Count, Neutrophil Percentage, and Elevated Temperature as Predictors of Bloodstream Infection in Burn Patients

DTIC Science & Technology

2007-07-01

Table 2). Three cultures were mixed with gram-positive and gram- negative bacteria, and 3 cultures produced yeasts (Can- dida albicans [n=2] and Candida ...that were gram positive, 3 that were mixed gram positive/gram nega- tive, and 3 yeasts . Although white blood cell count and neutrophil percentage at the...negative [but not mixed], or yeast ) because of small numbers. Statistical significance was set at P .01. RESULTS During the study period, 223 patients were

Unraveling the B. pseudomallei Heptokinase WcbL: From Structure to Drug Discovery

PubMed Central

Vivoli, Mirella; Isupov, Michail N.; Nicholas, Rebecca; Hill, Andrew; Scott, Andrew E.; Kosma, Paul; Prior, Joann L.; Harmer, Nicholas J.

2015-01-01

Summary Gram-negative bacteria utilize heptoses as part of their repertoire of extracellular polysaccharide virulence determinants. Disruption of heptose biosynthesis offers an attractive target for novel antimicrobials. A critical step in the synthesis of heptoses is their 1-O phosphorylation, mediated by kinases such as HldE or WcbL. Here, we present the structure of WcbL from Burkholderia pseudomallei. We report that WcbL operates through a sequential ordered Bi-Bi mechanism, loading the heptose first and then ATP. We show that dimeric WcbL binds ATP anti-cooperatively in the absence of heptose, and cooperatively in its presence. Modeling of WcbL suggests that heptose binding causes an elegant switch in the hydrogen-bonding network, facilitating the binding of a second ATP molecule. Finally, we screened a library of drug-like fragments, identifying hits that potently inhibit WcbL. Our results provide a novel mechanism for control of substrate binding and emphasize WcbL as an attractive anti-microbial target for Gram-negative bacteria. PMID:26687481

Helicobacter pylori induces activation of human peripheral γδ+ T lymphocytes.

PubMed

Romi, Benedetta; Soldaini, Elisabetta; Pancotto, Laura; Castellino, Flora; Del Giudice, Giuseppe; Schiavetti, Francesca

2011-04-29

Helicobacter pylori is a gram-negative bacterium that causes gastric and duodenal diseases in humans. Despite a robust antibody and cellular immune response, H. pylori infection persists chronically. To understand if and how H. pylori could modulate T cell activation, in the present study we investigated in vitro the interaction between H. pylori and human T lymphocytes freshly isolated from peripheral blood of H. pylori-negative donors. A direct interaction of live, but not killed bacteria with purified CD3+ T lymphocytes was observed by microscopy and confirmed by flow cytometry. Live H. pylori activated CD3+ T lymphocytes and predominantly γδ+ T cells bearing the TCR chain Vδ2. Upon interaction with H. pylori, these cells up-regulated the activation molecule CD69 and produced cytokines (such as TNFα, IFNγ) and chemokines (such as MIP-1β, RANTES) in a non-antigen-specific manner. This activation required viable H. pylori and was not exhibited by other gram-negative bacteria. The cytotoxin-associated antigen-A (CagA), was at least partially responsible of this activation. Our results suggest that H. pylori can directly interact with T cells and modulate the response of γδ+ T cells, thereby favouring an inflammatory environment which can contribute to the chronic persistence of the bacteria and eventually to the gastric pathology.

Genomic and functional characterization of three new venom peptides from the scorpion Heterometrus spinifer.

PubMed

Wu, Shifen; Nie, Yao; Zeng, Xian-Chun; Cao, Hanjun; Zhang, Lei; Zhou, Lingli; Yang, Ye; Luo, Xuesong; Liu, Yichen

2014-03-01

Three new cysteine-free venom peptides, which are referred to as Heterin-1, Heterin-2 and Spiniferin, respectively, were identified from the scorpion Heterometrus spinifer. Heterin-1, Heterin-2 and Spiniferin contain 43, 24 and 13 amino acid residues, respectively. Genomic analysis showed that the genomic organizations of the three peptides are consistent with those of the known Na(+), K(+) or Cl(-)-channel specific toxins from scorpions; this suggests that the genes of the cysteine-free and cysteine-rich peptides from scorpions were derived from a common ancestor. Antimicrobial assay demonstrated that Heterin-1 possesses potent activities against both Gram-positive and Gram-negative bacteria. Among the tested bacterial species, Heterin-1 is the most active against Bacillus megaterium and Micrococcus luteus with MICs of 4.0 μM and 4.0 μM, respectively. Heterin-2 is able to potently inhibit the growth of Gram-positive bacteria with MICs from 5.6 μM to 30.0 μM; however, it has weaker activities against the tested Gram-negative bacteria. It is interesting to see that deletion of the C-terminal random coiled tail (KKD) in Heterin-2 markedly changed the antimicrobial specificity and activity of the peptide. Spiniferin has very weak antimicrobial activities against both Gram-positive and Gram-negative bacteria. We found that introducing three net charges into the polar face of Spiniferin significantly increased its antimicrobial activity against the majority of the tested bacteria; however, in some instances, net charge on the polar face is not important for the antimicrobial activity of the peptide. These studies have expanded our understanding of the diversity, evolution and structure/function relationships of the cysteine-free peptides from scorpions. Copyright © 2013 Elsevier Inc. All rights reserved.

[The range of antagonistic effects of Lactobacillus bacterial strains on etiologic agents of bacterial vaginosis].

PubMed

Strus, M; Malinowska, M

1999-01-01

Bacterial vaginosis is caused by uncontrolled sequential overgrowth of some anaerobic bacteria: Gardnerella vaginalis, Prevotella bivia, Bacteroides spp., Peptostreptococcus spp., Mobiluncus sp. usually occurring in stable numbers in the bacterial flora of healthy women. On the other hand, different species of bacteria belonging to the genus Lactobacillus, most frequently L. plantarum, L. rhamnosus and L. acidophilus, form a group of aerobic bacteria dominating in the same environment. The diversity and density of their populations depend on the age and health conditions. Thanks to their antagonistic and adherence properties bacteria of the genus Lactobacillus can maintain a positive balance role in this ecosystem. The aim of this study was to assess the antagonistic properties of Lactobacillus strains isolated from the vagina of healthy women against most common agents of bacterial vaginosis. It was found that nearly all of the tested Lactobacillus strains exerted distinct antagonistic activity against anaerobic bacteria: Gardnerella vaginalis, Prevotella bivia and Peptostreptococcus anaerobius and quite a number also against Gram-negative rods, while only some of them were able to inhibit Gram-positive aerobic cocci as Enterococcus faecalis or Staphylococcus aureus.

A new multiplex real-time polymerase chain reaction assay for the diagnosis of periprosthetic joint infection.

PubMed

Kawamura, Masaki; Kobayashi, Naomi; Inaba, Yutaka; Choe, Hyonmin; Tezuka, Taro; Kubota, So; Saito, Tomoyuki

2017-11-01

A new multiplex real-time polymerase chain reaction (PCR) assay was developed to detect methicillin-resistant Staphylococcus (MRS) and to distinguish between gram-positive and gram-negative bacteria. In this study, we validated the sensitivity and specificity of this assay with periprosthetic joint infections (PJIs) and evaluated the utility of PCR for culture-negative PJI. Forty-five samples from 23 infectious PJI cases and 106 samples from 64 non-infectious control cases were analyzed by real-time PCR using a LightCycler Nano ® system. Twenty-eight clinical samples, comprising bacteria of known species isolated consecutively in the microbiological laboratory of our hospital, were used to determine the spectrum of bacterial species that could be detected using the new multiplex primers and probes. The sensitivity and specificity of the MRS- and universal-PCR assays were 92% and 99%, and 91% and 88%, respectively. Twenty-eight species of clinically isolated bacteria were detected using this method and the concordance rate for the identification of gram-positive or gram-negative organisms was 96%. Eight samples were identified as PCR-positive despite a culture-negative result. This novel multiplex real-time PCR system has acceptable sensitivity and specificity and several advantages; therefore, it has potential use for the diagnosis of PJIs, particularly in culture-negative cases.

Public health risk of antimicrobial resistance transfer from companion animals.

PubMed

Pomba, Constança; Rantala, Merja; Greko, Christina; Baptiste, Keith Edward; Catry, Boudewijn; van Duijkeren, Engeline; Mateus, Ana; Moreno, Miguel A; Pyörälä, Satu; Ružauskas, Modestas; Sanders, Pascal; Teale, Christopher; Threlfall, E John; Kunsagi, Zoltan; Torren-Edo, Jordi; Jukes, Helen; Törneke, Karolina

2017-04-01

Antimicrobials are important tools for the therapy of infectious bacterial diseases in companion animals. Loss of efficacy of antimicrobial substances can seriously compromise animal health and welfare. A need for the development of new antimicrobials for the therapy of multiresistant infections, particularly those caused by Gram-negative bacteria, has been acknowledged in human medicine and a future corresponding need in veterinary medicine is expected. A unique aspect related to antimicrobial resistance and risk of resistance transfer in companion animals is their close contact with humans. This creates opportunities for interspecies transmission of resistant bacteria. Yet, the current knowledge of this field is limited and no risk assessment is performed when approving new veterinary antimicrobials. The objective of this review is to summarize the current knowledge on the use and indications for antimicrobials in companion animals, drug-resistant bacteria of concern among companion animals, risk factors for colonization of companion animals with resistant bacteria and transmission of antimicrobial resistance (bacteria and/or resistance determinants) between animals and humans. The major antimicrobial resistance microbiological hazards originating from companion animals that directly or indirectly may cause adverse health effects in humans are MRSA, methicillin-resistant Staphylococcus pseudintermedius, VRE, ESBL- or carbapenemase-producing Enterobacteriaceae and Gram-negative bacteria. In the face of the previously recognized microbiological hazards, a risk assessment tool could be applied in applications for marketing authorization for medicinal products for companion animals. This would allow the approval of new veterinary medicinal antimicrobials for which risk levels are estimated as acceptable for public health. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Investigational drugs for the treatment of infections caused by multidrug-resistant Gram-negative bacteria.

PubMed

Avery, Lindsay M; Nicolau, David P

2018-04-01

Infections caused by multidrug-resistant Gram-negative bacteria (MDR-GNB) are associated with significant mortality and costs. New drugs in development to combat these difficult-to-treat infections primarily target carbapenem-resistant Enterobacteriaceae, MDR Pseudomonas aeruginosa, and MDR Acinetobacter baumannii. Areas covered: The authors summarize in vitro and in vivo efficacy studies, as well as available clinical trial findings, for new agents in development for treatment of infection caused by MDR-GNB. Information regarding dosage regimens utilized in clinical trials and key pharmacokinetic and pharmacodynamic considerations are provided if available. A summary of recently approved agents, delafloxacin and meropenem/vaborbactam, is also included. Expert opinion: The development of multiple novel agents to fight MDR-GNB is promising to help save the lives of patients who acquire infection, and judicious use of these agents is imperative once they come to market to prevent the development of resistance. The other component paramount to this field of research is implementation of effective infection control policies and carbapenem-resistant Enterobacteriaceae (CRE) carrier screening protocols to mitigate the worldwide spread of MDR-GNB. Further investigation of anti-infective synergistic combinations will also be important, as well as support for economic research to reveal the true cost-benefit of utilization of the new agents discussed herein.

Microbicidal effects of plain soap vs triclocarban-based antibacterial soap.

PubMed

Kim, S A; Rhee, M S

2016-11-01

The aim of this study was to determine the bactericidal effects of plain and antibacterial soap. The bactericidal effects of plain and antibacterial soap containing 0.3% triclocarban were examined against 10 Gram-positive and 10 Gram-negative bacterial strains after exposure at 22°C and 40°C for 20 s. Gram-negative bacteria were more susceptible to both soaps than Gram-positive bacteria. However, with one exception (Enterococcus faecalis ATCC 19433 at 40°C), there was no significant difference between the effects of medicated and non-medicated soap at either temperature. Triclocarban in soap does not lead to a meaningful reduction in bacterial levels during use. Copyright © 2016 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

[Effect of Gram-negative bacteria on fatty acids].

PubMed

Vuillemin, N; Dupeyron, C; Leluan, G; Bory, J

1981-01-01

The gram-negative bacteria investigated exert various effects on fatty acids. P. aeruginosa and A. calcoaceticus catabolize any of the fatty acids tested. S. marcescens is effective upon all fatty acids excepting butyric acid. The long chain fatty acids only are degraded by E. coli, meanwhile the other fatty acids present a bacteriostatic or bactericidal activity on it. The authors propose a simple and original method for testing the capability of degradation of fatty acids by some bacterial species.

Structure-Activity and Lipophilicity Relationships of Selected Antibacterial Natural Flavones and Flavanones of Chilean Flora.

PubMed

Echeverría, Javier; Opazo, Julia; Mendoza, Leonora; Urzúa, Alejandro; Wilkens, Marcela

2017-04-10

In this study, we tested eight naturally-occurring flavonoids-three flavanones and five flavones-for their possible antibacterial properties against four Gram-positive and four Gram-negative bacteria. Flavonoids are known for their antimicrobial properties, and due their structural diversity; these plant-derived compounds are a good model to study potential novel antibacterial mechanisms. The lipophilicity and the interaction of antibacterial compounds with the cell membrane define the success or failure to access its target. Therefore, through the determination of partition coefficients in a non-polar/aqueous phase, lipophilicity estimation and the quantification of the antibacterial activity of different flavonoids, flavanones, and flavones, a relationship between these parameters was assessed. Active flavonoids presented diffusion coefficients between 9.4 × 10 -10 and 12.3 × 10 -10 m²/s and lipophilicity range between 2.0 to 3.3. Active flavonoids against Gram-negative bacteria showed a narrower range of lipophilicity values, compared to active flavonoids against Gram-positive bacteria, which showed a wide range of lipophilicity and cell lysis. Galangin was the most active flavonoid, whose structural features are the presence of two hydroxyl groups located strategically on ring A and the absence of polar groups on ring B. Methylation of one hydroxyl group decreases the activity in 3- O -methylgalangin, and methylation of both hydroxyl groups caused inactivation, as shown for 3,7- O -dimethylgalangin. In conclusion, the amphipathic features of flavonoids play a crucial role in the antibacterial activity. In these compounds, hydrophilic and hydrophobic moieties must be present and could be predicted by lipophilicity analysis.

A Randomized Trial of the Amikacin Fosfomycin Inhalation System for the Adjunctive Therapy of Gram-Negative Ventilator-Associated Pneumonia: IASIS Trial.

PubMed

Kollef, Marin H; Ricard, Jean-Damien; Roux, Damien; Francois, Bruno; Ischaki, Eleni; Rozgonyi, Zsolt; Boulain, Thierry; Ivanyi, Zsolt; János, Gál; Garot, Denis; Koura, Firas; Zakynthinos, Epaminondas; Dimopoulos, George; Torres, Antonio; Danker, Wayne; Montgomery, A Bruce

2017-06-01

Clinical failures in ventilator-associated pneumonia (VAP) caused by gram-negative bacteria are common and associated with substantial morbidity, mortality, and resource utilization. We assessed the safety and efficacy of the amikacin fosfomycin inhalation system (AFIS) for the treatment of gram-negative bacterial VAP in a randomized double-blind, placebo-controlled, parallel group, phase 2 study between May 2013 and March 2016. We compared standard of care in each arm plus 300 mg amikacin/120 mg fosfomycin or placebo (saline), delivered by aerosol twice daily for 10 days (or to extubation if < 10 days) via the investigational eFlow Inline System (PARI GmbH). The primary efficacy end point was change from baseline in the Clinical Pulmonary Infection Score (CPIS) during the randomized course of AFIS/placebo, using the subset of patients with microbiologically proven baseline infections with gram-negative bacteria. There were 143 patients randomized: 71 to the AFIS group, and 72 to the placebo group. Comparison of CPIS change from baseline between treatment groups was not different (P = .70). The secondary hierarchical end point of no mortality and clinical cure at day 14 or earlier was also not significant (P = .68) nor was the hierarchical end point of no mortality and ventilator-free days (P = .06). The number of deaths in the AFIS group was 17 (24%) and 12 (17%) in the placebo group (P = .32). The AFIS group had significantly fewer positive tracheal cultures on days 3 and 7 than placebo. In this trial of adjunctive aerosol therapy compared with standard of care IV antibiotics in patients with gram-negative VAP, the AFIS was ineffective in improving clinical outcomes despite reducing bacterial burden. ClinicalTrials.gov; No.: NCT01969799; URL: www.clinicaltrials.gov. Copyright © 2016 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.

[Antimicrobial effect on some zoonotic bacteria, of the cell-free fermentation fluid and purified peptide fraction of the entomopathogenic bacterium, Xenorhabdus budapestensis].

PubMed

Burgettiné Böszörményi, Erzsébet; Barcs, István; Domján, Gyula; Bélafiné Bakó, Katalin; Fodor, András; Makrai, László; Vozik, Dávid

2015-11-01

Many multi-resistant patogens appear continuously resulting in a permanent need for the development of novel antibiotics. A large number of antibiotics introduced in clinical and veterinary practices are not effective. Antibacterial peptides with unusual mode of action may represent a promising option against multi-resistant pathogens. The entomopathogenic Xenorhabdus budapestensis bacteria produce several different antimicrobial peptides compounds such as bicornutin-A and fabclavin. The aim of the authors was to evaluate the in vitro antibacterial effect of Xenorhabdus budapestensis using zoonotic patogen bacteria. Cell-free conditioned media and purified peptide fractions of Xenorhabdus budapestensis were tested on Gram-positive (Rhodococcus equi, Erysipelothrix rhusiopathia, Staphylococcus aureus, Streptococcus equi, Corynebacterium pseudotuberculosis, Listeria monocytagenes) and Gram-negative bacteria (Salmonella gallinarum, Salmonella derbi, Bordatella bronchoseptica, Escherichia coli, Pasteurella multocida, Aeromonas hydrophila) using agar diffusion test on blood agar plates. It was found that Xenorhabdus budapestensis bacteria produced compounds with strong and dose-dependent effects on the tested organisms. Purified peptid fraction exerted a more marked effect than cell free conditioned media. Gram-positive bacteria were more sensitive to this antibacterial effect than Gram-negative bacteria. Antibacterial peptide compound from Xenorhabdus budapestensis exert marked antibacterial effect on zoonotic patogen bacteria and they should be further evaluated in future for their potential use in the control or prevention of zoonoses.

Differential fluorescent staining method for detection of bacteria in blood cultures, cerebrospinal fluid and other clinical specimens.

PubMed

Fazii, P; Ciancaglini, E; Riario Sforza, G

2002-05-01

The aim of this study was to evaluate a differential staining method to distinguish gram-positive from gram-negative bacteria in fluorescence. The method is based on two fluorochromes, one acting in the wavelength of red, i.e. the acridine orange, and another acting in the wavelength of green, i.e. the fluorescein. With this method, gram-positive bacteria appear yellow and gram-negative bacteria appear green. In view of the importance of a rapid aetiological diagnosis in cases of septicaemia, the differential staining method in fluorescence was compared with Gram stain for the detection of bacteria in blood. Of 5,820 blood cultures entered into the study and identified by the Bactec 9120 fluorescent series instrument (Becton Dickinson Europe, France), 774 were positive. Of the 774 positive cultures, 689 yielded only a single organism. The differential staining method in fluorescence detected 626 of the 689 cultures, while Gram stain detected 468. On the basis of these results, the sensitivity of the differential staining method in fluorescence was 90.9%, while that of Gram stain was 67.9%. The difference between the two methods was statistically significant ( P<0.001). The differential fluorescent staining method was more sensitive than Gram stain in the detection of bacteria in blood cultures during the incubation period. This technique provides a rapid, simple and highly sensitive staining method that can be used in conjunction with subculture methods. Whereas subculture requires an incubation period of 18-24 h, the fluorescent staining technique can detect bacteria on the same day that smears are prepared and examined. The differential fluorescent staining method was also evaluated for its ability to detect microorganisms in cerebrospinal fluid and other clinical specimens. The microorganisms were easily detected, even when bacterial counts in the specimens were low.

Enhanced antibacterial and anti-biofilm activities of silver nanoparticles against Gram-negative and Gram-positive bacteria

NASA Astrophysics Data System (ADS)

Gurunathan, Sangiliyandi; Han, Jae Woong; Kwon, Deug-Nam; Kim, Jin-Hoi

2014-07-01

Silver nanoparticles (AgNPs) have been used as antibacterial, antifungal, antiviral, anti-inflammtory, and antiangiogenic due to its unique properties such as physical, chemical, and biological properties. The present study was aimed to investigate antibacterial and anti-biofilm activities of silver nanoparticles alone and in combination with conventional antibiotics against various human pathogenic bacteria. Here, we show that a simple, reliable, cost effective and green method for the synthesis of AgNPs by treating silver ions with leaf extract of Allophylus cobbe. The A. cobbe-mediated synthesis of AgNPs (AgNPs) was characterized by ultraviolet-visible absorption spectroscopy, X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), X-ray photoelectron spectroscopy (XPS), dynamic light scattering (DLS), and transmission electron microscopy (TEM). Furthermore, the antibacterial and anti-biofilm activity of antibiotics or AgNPs, or combinations of AgNPs with an antibiotic was evaluated using a series of assays: such as in vitro killing assay, disc diffusion assay, biofilm inhibition, and reactive oxygen species generation in Pseudomonas aeruginosa, Shigella flexneri, Staphylococcus aureus, and Streptococcus pneumonia. The results suggest that, in combination with antibiotics, there were significant antimicrobial and anti-biofilm effects at lowest concentration of AgNPs using a novel plant extract of A. cobbe, otherwise sublethal concentrations of the antibiotics. The significant enhancing effects were observed for ampicillin and vancomycin against Gram-negative and Gram-positive bacteria, respectively. These data suggest that combining antibiotics and biogenic AgNPs can be used therapeutically for the treatment of infectious diseases caused by bacteria. This study presented evidence of antibacterial and anti-biofilm effects of A. cobbe-mediated synthesis of AgNPs and their enhanced capacity against various human pathogenic bacteria. These results suggest that AgNPs could be used as an adjuvant for the treatment of infectious diseases.

Actinomycetes in Karstic caves of northern Spain (Altamira and Tito Bustillo).

PubMed

Groth, I; Vettermann, R; Schuetze, B; Schumann, P; Saiz-Jimenez, C

1999-05-01

A variety of isolation procedures were carried out to study the involvement of bacteria in the colonisation and biodeterioration of Spanish caves with paleolithic rock art (Altamira and Tito Bustillo). The applied techniques mainly aimed to isolate heterotrophic bacteria such as streptomycetes, nocardioform and coryneform actinomycetes, and other gram-positive and gram-negative bacteria. The results demonstrated that actinomycetes were the most abundant gram-positive bacteria in the caves. Actinomycetes revealed a great taxonomic diversity with the predominant isolates belonging to the genus Streptomyces. Members of the genera Nocardia, Rhodococcus, Nocardioides, Amycolatopsis, Saccharothrix, Brevibacterium, Microbacterium, and coccoid actinomycetes (family Micrococcaceae) were also found.

[Application of anaerobic bacteria detection in oral and maxillofacial infection].

PubMed

Bao, Zhen-ying; Lin, Qin; Meng, Yan-hong; He, Chun; Su, Jia-zeng; Peng, Xin

2016-02-18

To investigate the distribution and drug resistance of anaerobic bacteria in the patients with oral and maxillofacial infection. Aerobic and anaerobic bacteria cultures from 61 specimens of pus from the patients with oral and maxillofacial infection in the Department of Oral and Maxillofacial Surgery, Peking University School of Stomatology were identified. The culture type was evaluated by API 20A kit and drug resistance test was performed by Etest method. The clinical data and antibacterial agents for the treatment of the 61 cases were collected, and the final outcomes were recorded. The bacteria cultures were isolated from all the specimens, with aerobic bacteria only in 6 cases (9.8%), anaerobic bacteria only in 7 cases (11.5%), and both aerobic and anaerobic bacteria in 48 cases (78.7%). There were 55 infected cases (90.2%) with anaerobic bacteria, and 81 anaerobic bacteria stains were isolated. The highest bacteria isolation rate of Gram positive anaerobic bacteria could be found in Peptostreptococcus, Bifidobacterium and Pemphigus propionibacterium. No cefoxitin, amoxicillin/carat acid resistant strain was detected in the above three Gram positive anaerobic bacteria. The highest bacteria isolation rate of Gram negative anaerobic bacteria could be detected in Porphyromonas and Prevotella. No metronidazole, cefoxitin, amoxicillin/carat acid resistant strain was found in the two Gram negative anaerobic bacteria. In the study, 48 patients with oral and maxillofacial infection were treated according to the results of drug resistance testing, and the clinical cure rate was 81.3%. Mixed aerobic and anaerobic bacteria cultures are very common in most oral and maxillofacial infection patients. Anaerobic bacteria culture and drug resistance testing play an important role in clinical treatment.

More than meets the eye: associations of vaginal bacteria with gram stain morphotypes using molecular phylogenetic analysis.

PubMed

Srinivasan, Sujatha; Morgan, Martin T; Liu, Congzhou; Matsen, Frederick A; Hoffman, Noah G; Fiedler, Tina L; Agnew, Kathy J; Marrazzo, Jeanne M; Fredricks, David N

2013-01-01

Bacterial vaginosis (BV) is a highly prevalent condition associated with adverse health outcomes. Gram stain analysis of vaginal fluid is the standard for confirming the diagnosis of BV, wherein abundances of key bacterial morphotypes are assessed. These Lactobacillus, Gardnerella, Bacteroides, and Mobiluncus morphotypes were originally linked to particular bacterial species through cultivation studies, but no studies have systematically investigated associations between uncultivated bacteria detected by molecular methods and Gram stain findings. In this study, 16S-rRNA PCR/pyrosequencing was used to examine associations between vaginal bacteria and bacterial morphotypes in 220 women with and without BV. Species-specific quantitative PCR (qPCR) and fluorescence in Situ hybridization (FISH) methods were used to document concentrations of two bacteria with curved rod morphologies: Mobiluncus and the fastidious BV-associated bacterium-1 (BVAB1). Rank abundance of vaginal bacteria in samples with evidence of curved gram-negative rods showed that BVAB1 was dominant (26.1%), while Mobiluncus was rare (0.2% of sequence reads). BVAB1 sequence reads were associated with Mobiluncus morphotypes (p<0.001). Among women with curved rods, mean concentration of BVAB1 DNA was 2 log units greater than Mobiluncus (p<0.001) using species-specific quantitative PCR. FISH analyses revealed that mean number of BVAB1 cells was 2 log units greater than Mobiluncus cells in women with highest Nugent score (p<0.001). Prevotella and Porphyromonas spp. were significantly associated with the "Bacteroides morphotype," whereas Bacteroides species were rare. Gram-negative rods designated Mobiluncus morphotypes on Gram stain are more likely BVAB1. These findings provide a clearer picture of the bacteria associated with morphotypes on vaginal Gram stain.

Synergistic Antibacterial and Anti-Inflammatory Activity of Temporin A and Modified Temporin B In Vivo

PubMed Central

Capparelli, Rosanna; Romanelli, Alessandra; Iannaccone, Marco; Nocerino, Nunzia; Ripa, Raffaella; Pensato, Soccorsa; Pedone, Carlo; Iannelli, Domenico

2009-01-01

Temporins are antimicrobial peptides secreted by the granular glands of the European red frog (Rana temporaria). They are 10–14 amino acid long polypeptides active prevalently against gram positive bacteria. This study shows that a synthetic temporin B analogue (TB-YK), acquires the capacity to act in synergism with temporin A and to exert antimicrobial and anti-inflammatory activity in vivo against gram positive and gram negative bacteria. Administration of 3.4 mg/Kg of temporin A (TA)+1.6 mg/Kg TB-YK, given to individual mice concurrently with a lethal dose of bacteria (gram positive or negative), rescued 100% of the animals. More importantly, the same doses of temporins, administered one week after experimental infection with a sub lethal dose of bacteria, sterilized 100% of the animals within 3–6 days. Also, it is described an animal model based on the use of sub lethal doses of bacteria, which closely mimics bacterial infection in humans. The model offers the possibility to test in a preclinical setting the true potential of TA and TB-YK in combination as antimicrobial and anti-inflammatory agents. PMID:19784377

Chemical composition, antimicrobial and antioxidant potential of the essential oil of Guarea kunthiana A. Juss.

PubMed

Pandini, J A; Pinto, F G S; Scur, M C; Santana, C B; Costa, W F; Temponi, L G

2018-02-01

The essential oils are extracted from plant compounds and can present activities antimicrobial and antioxidant properties. The goals of the present study were: (a) to determine the chemical composition of the essential oil of Guarea kunthiana A. Juss using the method of gas chromatography coupled to mass spectrometry (GC-MS); (b) to evaluate the antimicrobial potential of this oil using the broth microdilution method against different microorganisms: five Gram-negative bacteria, four Gram-positive bacteria and a yeast and (c) to determine the antioxidant activity of the oil using the DPPH (2,2-diphenyl-1-picrylhydrazyl) free radical assay. The GC-MS analyses allowed identifying 13 constituents, representing 96.52% of the essencial oil composition. The main compounds identified were α-zingiberene (34.48%), β-sesquiphellandrene (22.90%), and α-curcumene (16.17%). With respect to the antimicrobial activity, the essential oil was effective against all the microorganisms tested, except for the bacteria E. coli and K. pneumoniae, which were resistant to the action of the oil. From a general point of view, Gram-positive bacteria were more susceptible to the action of the essential oil than Gram-negative bacteria. The essential oil exhibited antioxidant potential.

Antibacterial activity of head-to-head bis-benzimidazoles.

PubMed

Moreira, Joao B; Mann, John; Neidle, Stephen; McHugh, Timothy D; Taylor, Peter W

2013-10-01

Symmetric bis-benzimidazole (BBZ) conjugates were profiled for activity against a range of Gram-positive and Gram-negative bacteria. para-Substituted ethoxy, amino and methoxy derivatives displayed potent bacteriostatic activity against meticillin-resistant Staphylococcus aureus, vancomycin-resistant enterococci, streptococci and Listeria monocytogenes. Moderate to good activity was also found against mycobacteria; two compounds were strongly active against logarithmic phase and hypoxia-induced latent Mycobacterium tuberculosis. No compound displayed significant activity towards Gram-negative bacteria. Only high concentrations of antibacterial BBZs showed cytotoxic effects towards fibroblasts, and the most active compound was well tolerated by zebrafish embryos. Copyright © 2013 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Effect of sample preparation on the discrimination of bacterial isolates cultured in liquid nutrient media using laser induced breakdown spectroscopy

USDA-ARS?s Scientific Manuscript database

Laser induced breakdown spectroscopy (LIBS) is used as the basis for discrimination between 2 genera of gram-negative bacteria and 2 genera of gram-positive bacteria representing pathogenic threats commonly found in poultry processing rinse waters. Because LIBS-based discrimination relies primarily ...

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Co-occurrence of anaerobic bacteria in colorectal carcinomas.

PubMed

Warren, René L; Freeman, Douglas J; Pleasance, Stephen; Watson, Peter; Moore, Richard A; Cochrane, Kyla; Allen-Vercoe, Emma; Holt, Robert A

2013-05-15

Numerous cancers have been linked to microorganisms. Given that colorectal cancer is a leading cause of cancer deaths and the colon is continuously exposed to a high diversity of microbes, the relationship between gut mucosal microbiome and colorectal cancer needs to be explored. Metagenomic studies have shown an association between Fusobacterium species and colorectal carcinoma. Here, we have extended these studies with deeper sequencing of a much larger number (n = 130) of colorectal carcinoma and matched normal control tissues. We analyzed these data using co-occurrence networks in order to identify microbe-microbe and host-microbe associations specific to tumors. We confirmed tumor over-representation of Fusobacterium species and observed significant co-occurrence within individual tumors of Fusobacterium, Leptotrichia and Campylobacter species. This polymicrobial signature was associated with over-expression of numerous host genes, including the gene encoding the pro-inflammatory chemokine Interleukin-8. The tumor-associated bacteria we have identified are all Gram-negative anaerobes, recognized previously as constituents of the oral microbiome, which are capable of causing infection. We isolated a novel strain of Campylobacter showae from a colorectal tumor specimen. This strain is substantially diverged from a previously sequenced oral Campylobacter showae isolate, carries potential virulence genes, and aggregates with a previously isolated tumor strain of Fusobacterium nucleatum. A polymicrobial signature of Gram-negative anaerobic bacteria is associated with colorectal carcinoma tissue.

Nanoparticle targeting of Gram-positive and Gram-negative bacteria for magnetic-based separations of bacterial pathogens

NASA Astrophysics Data System (ADS)

Lu, Hoang D.; Yang, Shirley S.; Wilson, Brian K.; McManus, Simon A.; Chen, Christopher V. H.-H.; Prud'homme, Robert K.

2017-04-01

Antimicrobial resistance is a healthcare problem of increasing significance, and there is increasing interest in developing new tools to address bacterial infections. Bacteria-targeting nanoparticles hold promise to improve drug efficacy, compliance, and safety. In addition, nanoparticles can also be used for novel applications, such as bacterial imaging or bioseperations. We here present the use of a scalable block-copolymer-directed self-assembly process, Flash NanoPrecipitation, to form zinc(II)-bis(dipicolylamine) modified nanoparticles that bind to both Gram-positive and Gram-negative bacteria with specificity. Particles have tunable surface ligand densities that change particle avidity and binding efficacy. A variety of materials can be encapsulated into the core of the particles, such as optical dyes or iron oxide colloids, to produce imageable and magnetically active bacterial targeting constructs. As a proof-of-concept, these particles are used to bind and separate bacteria from solution in a magnetic column. Magnetic manipulation and separation would translate to a platform for pathogen identification or removal. These magnetic and targeted nanoparticles enable new methods to address bacterial infections.

Diversity analysis of diazotrophic bacteria associated with the roots of tea (Camellia sinensis (L.) O. Kuntze).

PubMed

Gulati, Arvind; Sood, Swati; Rahi, Praveen; Thakur, Rishu; Chauhan, Sunita; Chawla, Isha

2011-06-01

The diversity elucidation by amplified ribosomal DNA restriction analysis and 16S rDNA sequencing of 96 associative diazotrophs, isolated from the feeder roots of tea on enriched nitrogen-free semisolid media, revealed the predominance of Gram-positive over Gram-negative bacteria within the Kangra valley in Himachal Pradesh, India. The Gram-positive bacteria observed belong to two taxonomic groupings; Firmicutes, including the genera Bacillus and Paenibacillus; and Actinobacteria, represented by the genus Microbacterium. The Gram-negative bacteria included alpha-Proteobacteria genera Brevundimonas, Rhizobium, and Mesorhizobium; gamma-Proteobacteria genera Pseudomonas and Stenotrophomonas; and beta-Proteobacteria genera Azospira, Burkholderia, Delftia, Herbaspirillum and Ralstonia. The low level of similarity of two isolates, with the type strains Paenibacillus xinjiangensis and Mesorhizobium albiziae, suggests the possibility of raising species novum. The bacterial strains of different phylogenetic groups exhibited distinct carbon-source utilization patterns and fatty acid methyl ester profiles. The strains differed in their nitrogenase activities with relatively high activity seen in the Gramnegative strains exhibiting the highest similarity to Azospira oryzae, Delftia lacustris and Herbaspirillum huttiense.

The Impact of Efflux Pump Inhibitors on the Activity of Selected Non-Antibiotic Medicinal Products against Gram-Negative Bacteria.

PubMed

Laudy, Agnieszka E; Kulińska, Ewa; Tyski, Stefan

2017-01-11

The potential role of non-antibiotic medicinal products in the treatment of multidrug-resistant Gram-negative bacteria has recently been investigated. It is highly likely that the presence of efflux pumps may be one of the reasons for the weak activity of non-antibiotics, as in the case of some non-steroidal anti-inflammatory drugs (NSAIDs), against Gram-negative rods. The activity of eight drugs of potential non-antibiotic activity, active substance standards, and relevant medicinal products were analysed with and without of efflux pump inhibitors against 180 strains of five Gram-negative rod species by minimum inhibitory concentration (MIC) value determination in the presence of 1 mM MgSO₄. Furthermore, the influence of non-antibiotics on the susceptibility of clinical strains to quinolones with or without PAβN (Phe-Arg-β-naphthylamide) was investigated. The impacts of PAβN on the susceptibility of bacteria to non-antibiotics suggests that amitriptyline, alendronate, nicergoline, and ticlopidine are substrates of efflux pumps in Gram-negative rods. Amitriptyline/Amitriptylinum showed the highest direct antibacterial activity, with MICs ranging 100-800 mg/L against all studied species. Significant decreases in the MIC values of other active substances (acyclovir, atorvastatin, and famotidine) tested with pump inhibitors were not observed. The investigated non-antibiotic medicinal products did not alter the MICs of quinolones in the absence and in the presence of PAβN to the studied clinical strains of five groups of species.

Development of a Multiplexed Microsphere PCR for Culture-Free Detection and Gram-Typing of Bacteria in Human Blood Samples.

PubMed

Liang, Fang; Browne, Daniel J; Gray, Megan J; Gartlan, Kate H; Smith, David D; Barnard, Ross T; Hill, Geoffrey R; Corrie, Simon R; Markey, Kate A

2018-05-11

Bloodstream infection is a significant clinical problem, particularly in vulnerable patient groups such as those undergoing chemotherapy and bone marrow transplantation. Clinical diagnostics for suspected bloodstream infection remain centered around blood culture (highly variable timing, in the order of hours to days to become positive), and empiric use of broad-spectrum antibiotics is therefore employed for patients presenting with febrile neutropenia. Gram-typing provides the first opportunity to target therapy (e.g., combinations containing vancomycin or teicoplanin for Gram-positives; piperacillin-tazobactam or a carbapenem for Gram-negatives); however, current approaches require blood culture. In this study, we describe a multiplexed microsphere-PCR assay with flow cytometry readout, which can distinguish Gram-positive from Gram-negative bacterial DNA in a 3.5 h time period. The combination of a simple assay design (amplicon-dependent release of Gram-type specific Cy3-labeled oligonucleotides) and the Luminex-based readout (for quantifying each specific Cy3-labeled sequence) opens opportunities for further multiplexing. We demonstrate the feasibility of detecting common Gram-positive and Gram-negative organisms after spiking whole bacteria into healthy human blood prior to DNA extraction. Further development of DNA extraction methods is required to reach detection limits comparable to blood culture.

Use of Tigecycline in Pediatric Patients With Infections Predominantly Due to Extensively Drug-Resistant Gram-Negative Bacteria.

PubMed

Iosifidis, Elias; Violaki, Asimenia; Michalopoulou, Evangelia; Volakli, Elena; Diamanti, Elisavet; Koliouskas, Dimitrios; Antachopoulos, Charalampos; Drossou-Agakidou, Vasiliki; Sdougka, Maria; Roilides, Emmanuel

2017-06-01

Emergence of extensively drug-resistant (XDR) bacteria has forced clinicians to use off-label antimicrobial agents such as tigecycline. We present our experience on salvage use of tigecycline for the treatment of infections caused by XDR Gram-negative bacteria in critically ill children and review published cases. We conducted a retrospective chart review in pediatric departments of a tertiary level hospital from January 2009 to May 2014. Patients were identified using pharmacy database. For the literature review, relevant articles were identified from PubMed. In our case series, 13 children (7 males) with a median age of 8 years (range, 2.5 months-14 years) received tigecycline for ≥2 days as treatment for healthcare-associated infections including 5 bacteremias, 6 lower respiratory tract infections, and 3 other infections. Isolated pathogens were XDR Gram-negative bacteria except 1. A loading dose (range, 1.8-6.5 mg/kg) was given in all except 2 cases. Maintenance dose was given at 1-3.2 mg/kg q12 h. Other antimicrobials including colistin and aminoglycosides (85% and 62%, respectively) were coadministered to all patients. No serious adverse events were detected in these very ill children. Twenty cases of children treated with tigecycline were previously published, mostly for multidrug-resistant/XDR bacteria. An episode of acute pancreatitis and neutrophil engraftment delay in 2 cases were reported during tigecycline treatment. Analyzing reported and all our cases together, mortality in bloodstream infections was 86%, whereas in nonbacteremic cases it was 24% (P = .009). Tigecycline, given at the range of administered doses as salvage therapy and in combination with other antimicrobial agents, seemed to be well tolerated in a series of mainly critically ill pediatric patients and demonstrated relatively good clinical response in nonbacteremic patients. © The Author 2016. Published by Oxford University Press on behalf of The Journal of the Pediatric Infectious Diseases Society. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Quantitative and Qualitative Analysis of Bacteria in Er(III) Solution by Thin-Film Magnetopheresis

PubMed Central

Zborowski, Maciej; Tada, Yoko; Malchesky, Paul S.; Hall, Geraldine S.

1993-01-01

Magnetic deposition, quantitation, and identification of bacteria reacting with the paramagnetic trivalent lanthanide ion, Er3+, was evaluated. The magnetic deposition method was dubbed thin-film magnetopheresis. The optimization of the magnetic deposition protocol was accomplished with Escherichia coli as a model organism in 150 mM NaCl and 5 mM ErCl3 solution. Three gram-positive bacteria, Staphylococcus epidermidis, Staphylococcus saprophyticus, and Enterococcus faecalis, and four gram-negative bacteria, E. coli, Pseudomonas aeruginosa, Proteus mirabilis, and Klebsiella pneumoniae, were subsequently investigated. Quantitative analysis consisted of the microscopic cell count and a scattered-light scanning of the magnetically deposited material aided by the computer data acquisition system. Qualitative analysis consisted of Gram stain differentiation and fluorescein isothiocyanate staining in combination with selected antisera against specific types of bacteria on the solid substrate. The magnetic deposition protocol allowed quantitative detection of E. coli down to the concentration of 105 CFU ml-1, significant in clinical diagnosis applications such as urinary tract infections. Er3+ did not interfere with the typical appearance of the Gram-stained bacteria nor with the antigen recognition by the antibody in the immunohistological evaluations. Indirect antiserum-fluorescein isothiocyanate labelling correctly revealed the presence of E. faecalis and P. aeruginosa in the magnetically deposited material obtained from the mixture of these two bacterial species. On average, the reaction of gram-positive organisms was significantly stronger to the magnetic field in the presence of Er3+ than the reaction of gram-negative organisms. The thin-film magnetophoresis offers promise as a rapid method for quantitative and qualitative analysis of bacteria in solutions such as urine or environmental water. Images PMID:16348916

Antibacterial effect and proposed mechanism of action of a topical surgical adhesive.

PubMed

Prince, Daniel; Solanki, Zankhna; Varughese, Remy; Mastej, Jozef; Prince, Derek

2018-01-01

Medical adhesives effectively hold closed approximated skin edges of wounds from surgical incisions, including punctures from minimally invasive surgery. In addition, they have been reported to be antibacterial against gram-positive bacteria. Using membrane filtration to capture all organisms after contact with 2-octyl cyanoacrylate product for 3 minutes, we quantified the number of survivors. Controls were performed to rule out that the noted level of kill was caused by carryover product in the test system. We found that the product kills >7 logs of gram-positive and gram-negative bacteria. The mechanism of action for the antibacterial effect is described as a function of very low water content. As an antibacterial agent, the risk of nosocomial infection is greatly diminished, and an uneventful clinical result is facilitated. Bacterial growth cannot occur in the formulation and on contact death rapidly ensues as cellular water diffuses from the cell into the product. Copyright © 2018 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Corky root of lettuce caused by strains of a gram-negative bacterium from muck soils of Florida, new york, and wisconsin.

PubMed

van Bruggen, A H; Brown, P R; Jochimsen, K N

1989-10-01

Slow-growing bacteria similar to the bacterium causing lettuce corky root (CR) in California (strain CA1) were isolated from muck soils of Florida, New York, and Wisconsin, using lettuce seedlings as bait. All strains were tested for reaction with polyclonal antibodies produced against strain CA1 and for pathogenicity on CR-susceptible (Salinas) and CR-resistant (Green Lake) lettuce cultivars in a greenhouse. Five strains from Florida, three from New York, and three from Wisconsin induced severe CR symptoms on Salinas and mild symptoms on Green Lake. All strains were gram-negative, aerobic, oxidase positive, and catalase positive and reduced nitrate to ammonia. Whole-cell fatty acid compositions were similar for all strains and resembled that of Pseudomonas paucimobilis. Since this fatty acid pattern is unique, it is suggested that CR of lettuce is caused by strains of the same bacterium in Florida, New York, Wisconsin, and California.

Corky Root of Lettuce Caused by Strains of a Gram-Negative Bacterium from Muck Soils of Florida, New York, and Wisconsin

PubMed Central

van Bruggen, Ariena H. C.; Brown, Philip R.; Jochimsen, Kenneth N.

1989-01-01

Slow-growing bacteria similar to the bacterium causing lettuce corky root (CR) in California (strain CA1) were isolated from muck soils of Florida, New York, and Wisconsin, using lettuce seedlings as bait. All strains were tested for reaction with polyclonal antibodies produced against strain CA1 and for pathogenicity on CR-susceptible (Salinas) and CR-resistant (Green Lake) lettuce cultivars in a greenhouse. Five strains from Florida, three from New York, and three from Wisconsin induced severe CR symptoms on Salinas and mild symptoms on Green Lake. All strains were gram-negative, aerobic, oxidase positive, and catalase positive and reduced nitrate to ammonia. Whole-cell fatty acid compositions were similar for all strains and resembled that of Pseudomonas paucimobilis. Since this fatty acid pattern is unique, it is suggested that CR of lettuce is caused by strains of the same bacterium in Florida, New York, Wisconsin, and California. Images PMID:16348032

Comparison of methods to detect the in vitro activity of silver nanoparticles (AgNP) against multidrug resistant bacteria.

PubMed

Cavassin, Emerson Danguy; de Figueiredo, Luiz Francisco Poli; Otoch, José Pinhata; Seckler, Marcelo Martins; de Oliveira, Roberto Angelo; Franco, Fabiane Fantinelli; Marangoni, Valeria Spolon; Zucolotto, Valtencir; Levin, Anna Sara Shafferman; Costa, Silvia Figueiredo

2015-10-05

Multidrug resistant microorganisms are a growing challenge and new substances that can be useful to treat infections due to these microorganisms are needed. Silver nanoparticle may be a future option for treatment of these infections, however, the methods described in vitro to evaluate the inhibitory effect are controversial. This study evaluated the in vitro activity of silver nanoparticles against 36 susceptible and 54 multidrug resistant Gram-positive and Gram-negative bacteria from clinical sources. The multidrug resistant bacteria were oxacilin-resistant Staphylococcus aureus, vancomycin-resistant Enterococcus spp., carbapenem- and polymyxin B-resistant A. baumannii, carbapenem-resistant P. aeruginosa and carbapenem-resistant Enterobacteriaceae. We analyzed silver nanoparticles stabilized with citrate, chitosan and polyvinyl alcohol and commercial silver nanoparticle. Silver sulfadiazine and silver nitrate were used as control. Different methods were used: agar diffusion, minimum inhibitory concentration, minimum bactericidal concentration and time-kill. The activity of AgNPs using diffusion in solid media and the MIC methods showed similar effect against MDR and antimicrobial-susceptible isolates, with a higher effect against Gram-negative isolates. The better results were achieved with citrate and chitosan silver nanoparticle, both with MIC90 of 6.75 μg mL(-1), which can be due the lower stability of these particles and, consequently, release of Ag(+) ions as revealed by X-ray diffraction (XRD). The bactericidal effect was higher against antimicrobial-susceptible bacteria. It seems that agar diffusion method can be used as screening test, minimum inhibitory concentration/minimum bactericidal concentration and time kill showed to be useful methods. The activity of commercial silver nanoparticle and silver controls did not exceed the activity of the citrate and chitosan silver nanoparticles. The in vitro inhibitory effect was stronger against Gram-negative than Gram-positive, and similar against multidrug resistant and susceptible bacteria, with best result achieved using citrate and chitosan silver nanoparticles. The bactericidal effect of silver nanoparticle may, in the future, be translated into important therapeutic and clinical options, especially considering the shortage of new antimicrobials against the emerging antimicrobial resistant microorganisms, in particular against Gram-negative bacteria.

Distinct Mechanisms Underlie Boosted Polysaccharide-Specific IgG Responses Following Secondary Challenge with Intact Gram-Negative versus Gram-Positive Extracellular Bacteria.

PubMed

Kar, Swagata; Arjunaraja, Swadhinya; Akkoyunlu, Mustafa; Pier, Gerald B; Snapper, Clifford M

2016-06-01

Priming of mice with intact, heat-killed cells of Gram-negative Neisseria meningitidis, capsular serogroup C (MenC) or Gram-positive group B Streptococcus, capsular type III (GBS-III) bacteria resulted in augmented serum polysaccharide (PS)-specific IgG titers following booster immunization. Induction of memory required CD4(+) T cells during primary immunization. We determined whether PS-specific memory for IgG production was contained within the B cell and/or T cell populations, and whether augmented IgG responses following booster immunization were also dependent on CD4(+) T cells. Adoptive transfer of purified B cells from MenC- or GBS-III-primed, but not naive mice resulted in augmented PS-specific IgG responses following booster immunization. Similar responses were observed when cotransferred CD4(+) T cells were from primed or naive mice. Similarly, primary immunization with unencapsulated MenC or GBS-III, to potentially prime CD4(+) T cells, failed to enhance PS-specific IgG responses following booster immunization with their encapsulated isogenic partners. Furthermore, in contrast to GBS-III, depletion of CD4(+) T cells during secondary immunization with MenC or another Gram-negative bacteria, Acinetobacter baumannii, did not inhibit augmented PS-specific IgG booster responses of mice primed with heat-killed cells. Also, in contrast with GBS-III, booster immunization of MenC-primed mice with isolated MenC-PS, a TI Ag, or a conjugate of MenC-PS and tetanus toxoid elicited an augmented PS-specific IgG response similar to booster immunization with intact MenC. These data demonstrate that memory for augmented PS-specific IgG booster responses to Gram-negative and Gram-positive bacteria is contained solely within the B cell compartment, with a differential requirement for CD4(+) T cells for augmented IgG responses following booster immunization. Copyright © 2016 by The American Association of Immunologists, Inc.

Comparative Study of Hydroalcoholic Extracts of Momordica charantia L. against Foodborne Pathogens

PubMed Central

Rakholiya, Kalpna; Vaghela, P.; Rathod, T.; Chanda, Sumitra

2014-01-01

The antimicrobial effect of 24 different hydroalcoholic extracts (100, 75, 50 and 25% methanol and water) obtained from four parts (leaf+stem (aerial), peel, pulp and seed) of Momordica charantia L. were investigated against five Gram-positive, six Gram-negative and four fungal strains. The extraction was done by individual cold percolation method using hexane, different hydroalcoholic solvent (100, 75, 50 and 25% methanol) and water. The antimicrobial activity was done by agar well diffusion assay. The extracts, which showed >15 mm zone of inhibition, were further screened to determine minimum inhibitory concentration and minimum bactericidal concentration using a broth dilution method performed in 96-well microtitre plate. The extractive yield was highest in aqueous extracts of all the four parts closely followed by 25% methanol. Micrococcus flavus was the most susceptible Gram-positive bacteria and Pseudomonas testosteroni was the most susceptible Gram-negative bacteria. The highest antibacterial activity was shown by 100% methanol. The Gram-negative Pseudomonas spp. was more susceptible towards all the extracts than the Gram-positive bacteria or fungal strains investigated. One hundred percent and 50% methanol extracts of seed showed lowest minimum inhibitory concentration and minimum bactericidal concentration values, that is <39 and 625 μg/ml, respectively, against Pseudomonas pictorum. Therefore, these extracts would be of interest in the control of Pseudomonas spp. in food industry as well as used for therapeutic purposes. PMID:24843188

Bacterial infection profiles in lung cancer patients with febrile neutropenia

PubMed Central

2011-01-01

Background The chemotherapy used to treat lung cancer causes febrile neutropenia in 10 to 40% of patients. Although most episodes are of undetermined origin, an infectious etiology can be suspected in 30% of cases. In view of the scarcity of data on lung cancer patients with febrile neutropenia, we performed a retrospective study of the microbiological characteristics of cases recorded in three medical centers in the Picardy region of northern France. Methods We analyzed the medical records of lung cancer patients with neutropenia (neutrophil count < 500/mm3) and fever (temperature > 38.3°C). Results The study included 87 lung cancer patients with febrile neutropenia (mean age: 64.2). Two thirds of the patients had metastases and half had poor performance status. Thirty-three of the 87 cases were microbiologically documented. Gram-negative bacteria (mainly enterobacteriaceae from the urinary and digestive tracts) were identified in 59% of these cases. Staphylococcus species (mainly S. aureus) accounted for a high proportion of the identified Gram-positive bacteria. Bacteremia accounted for 60% of the microbiologically documented cases of fever. 23% of the blood cultures were positive. 14% of the infections were probably hospital-acquired and 14% were caused by multidrug-resistant strains. The overall mortality rate at day 30 was 33% and the infection-related mortality rate was 16.1%. Treatment with antibiotics was successful in 82.8% of cases. In a multivariate analysis, predictive factors for treatment failure were age >60 and thrombocytopenia < 20000/mm3. Conclusion Gram-negative species were the most frequently identified bacteria in lung cancer patients with febrile neutropenia. Despite the success of antibiotic treatment and a low-risk neutropenic patient group, mortality is high in this particular population. PMID:21707992

Bacterial infection profiles in lung cancer patients with febrile neutropenia.

PubMed

Lanoix, Jean-Philippe; Pluquet, Emilie; Lescure, Francois Xavier; Bentayeb, Houcine; Lecuyer, Emmanuelle; Boutemy, Marie; Dumont, Patrick; Jounieaux, Vincent; Schmit, Jean Luc; Dayen, Charles; Douadi, Youcef

2011-06-27

The chemotherapy used to treat lung cancer causes febrile neutropenia in 10 to 40% of patients. Although most episodes are of undetermined origin, an infectious etiology can be suspected in 30% of cases. In view of the scarcity of data on lung cancer patients with febrile neutropenia, we performed a retrospective study of the microbiological characteristics of cases recorded in three medical centers in the Picardy region of northern France. We analyzed the medical records of lung cancer patients with neutropenia (neutrophil count < 500/mm(3)) and fever (temperature > 38.3°C). The study included 87 lung cancer patients with febrile neutropenia (mean age: 64.2). Two thirds of the patients had metastases and half had poor performance status. Thirty-three of the 87 cases were microbiologically documented. Gram-negative bacteria (mainly enterobacteriaceae from the urinary and digestive tracts) were identified in 59% of these cases. Staphylococcus species (mainly S. aureus) accounted for a high proportion of the identified Gram-positive bacteria. Bacteremia accounted for 60% of the microbiologically documented cases of fever. 23% of the blood cultures were positive. 14% of the infections were probably hospital-acquired and 14% were caused by multidrug-resistant strains. The overall mortality rate at day 30 was 33% and the infection-related mortality rate was 16.1%. Treatment with antibiotics was successful in 82.8% of cases. In a multivariate analysis, predictive factors for treatment failure were age >60 and thrombocytopenia < 20000/mm(3). Gram-negative species were the most frequently identified bacteria in lung cancer patients with febrile neutropenia. Despite the success of antibiotic treatment and a low-risk neutropenic patient group, mortality is high in this particular population.

Techniques for controlling variability in gram staining of obligate anaerobes.

PubMed Central

Johnson, M J; Thatcher, E; Cox, M E

1995-01-01

Identification of anaerobes recovered from clinical samples is complicated by the fact that certain gram-positive anaerobes routinely stain gram negative; Peptostreptococcus asaccharolyticus, Eubacterium plautii, Clostridium ramosum, Clostridium symbiosum, and Clostridium clostridiiforme are among the nonconformists with regard to conventional Gram-staining procedures. Accurate Gram staining of American Type Culture Collection strains of these anaerobic bacteria is possible by implementing fixing and staining techniques within a gloveless anaerobic chamber. Under anaerobic conditions, gram-positive staining occurred in all test organisms with "quick" fixing techniques with both absolute methanol and formalin. The results support the hypothesis that, when anaerobic bacteria are exposed to oxygen, a breakdown of the physical integrity of the cell wall occurs, introducing Gram stain variability in gram-positive anaerobes. PMID:7538512

Antimicrobial activities of Streptomyces pulcher, S. canescens and S. citreofluorescens against fungal and bacterial pathogens of tomato in vitro.

PubMed

el-Abyad, M S; el-Sayed, M A; el-Shanshoury, A R; el-Sabbagh, S M

1996-01-01

Thirty-seven actinomycete species isolated from fertile cultivated soils in Egypt were screened for the production of antimicrobial compounds against a variety of test organisms. Most of the isolates exhibited antimicrobial activities against Gram-positive, Gram-negative, and acid-fast bacteria, yeasts and filamentous fungi, with special attention to fungal and bacterial pathogens of tomato. On starch-nitrate agar, 14 strains were active against Fusarium oxysporum f.sp. lycopersici (the cause of Fusarium wilt), 18 against Verticillium albo-atrum (the cause of Verticillium wilt), and 18 against Alternaria solani (the cause of early blight). In liquid media, 14 isolates antagonized Pseudomonas solanacearum (the cause of bacterial wilt) and 20 antagonized Clavibacter michiganensis ssp. michiganensis (the cause of bacterial canker). The most active antagonists of the pathogenic microorganisms studied were found to be Streptomyces pulcher, S. canescens (syn. S. albidoflavus) and S. citreofluorescens (syn. S. anulatus). The antagonistic activities of S. pulcher and S. canescens against pathogenic fungi were assessed on solid media, and those of S. pulcher and S. citreofluorescens against pathogenic bacteria in liquid media under shaking conditions. The optimum culture conditions were determined.

Prevalence of potentially pathogenic bacteria as genital pathogens in dairy cattle.

PubMed

Petit, T; Spergser, J; Rosengarten, R; Aurich, J

2009-02-01

Bacteria on the genital mucosa have been studied less in healthy, non-puerperal cows than in cows with puerperal endometritis. We have thus analysed bacteria in swabs from the vagina and cervix of post-puerperal cattle (n = 644). Out of the animals, 6.8% had aborted within the last 12 months, 2.6% and 11.6% showed signs of vaginitis and endometritis, respectively. In 17.2% of cervical swabs pathogenic gram-positive and in 11.5% pathogenic gram-negative bacteria were found. Arcanobacterium pyogenes was isolated from 41.3% of cows with endometritis and from 3.5% without endometritis (p < 0.05). From 12.5% of cows with abortion but from no cow without abortion, Staphylococcus aureus was recovered (p < 0.05). Out of 383 vaginal swabs, 88.3% were positive. In 3.4% of swabs pathogenic gram-positive and in 16.7% pathogenic gram-negative microorganisms were found. The percentage of positive vaginal swabs did not differ between pregnant and non-pregnant animals. In the genital tract, the percentage of swabs positive for normal mucosal bacteria decreased from caudally to cranially (p < 0.05). Pathogenic bacteria were found more often in cervical than in vaginal swabs (p < 0.05). In conclusion, bacteria on the vaginal and cervical mucosa in cattle involve a wide range of species. In animals without endometritis or vaginitis, colonization of the mucosa rather than infection has to be assumed.

Aerobic Bacteria in the Diaphragmatic Portion of Stethoscope of Medical Professionals of Tertiary Care Hospital.

PubMed

Bham, G; Bhandari, J; Neupane, M R; Dawadi, R; Pradhan, P

2015-01-01

Hospital environment is a reservoir of wide varieties of microorganisms which are frequently reported colonizing in medical equipment. Stethoscopes are essential tools and of universal use in the medical profession, which might be a source of spreading nosocomial infections. This research project was conducted with an aim to assess the presence of aerobic bacteria in the stethoscope of the medical doctors working at Patan Hospital and students of Patan Academy of Health Sciences. It is a cross sectional study based on structured questionnaire and sample assessment from the stethoscope of doctors and students of Patan Hospital and Patan Academy of Health Sciences. The stethescopes used by the doctors of five major departments of Patan Hospital and students of clinical years were included in this study. Total of 99 stethoscope owned by different level of professionals (positions) and different departments were examined for bacterial contamination. Out of them, 36 were found to be considerably contaminated. Single strain of bacteria was grown from a single stethoscope. Among them 34 were Gram positive and remaining were Gram negative. Out of 34 gram postive bacteria, 29 were identified as Staphylococcus aureus, six were identified as Coagulase Negative Staphylococcus and remaining were Gram positive bacilli. There is presence of aerobic bacteria in diaphragmatic portion of stethoscope of medical professional of which the gram positives were the commonest.

Rapid spot test for the determination of esculin hydrolysis.

PubMed

Edberg, S C; Gam, K; Bottenbley, C J; Singer, J M

1976-08-01

Esculin hydrolysis is a useful test in the differentiation of both gram-positive and gram-negative bacteria covering a wide spectrum of aerobes, facultative anaerobes, and anaerobes. Commonly utilized methods require a minimum of 18 h of incubation in broth or agar medium and utilize the production of a brown-black compound, due to the combination of ferric ions with the hydrolysis product esculetin, as indicator. A procedure is presented that requires 15 to 30 min for completion and utilizes fluorescence loss as the indicator of hydrolysis. Esculin fluoresces at 366 nm, whereas the hydrolysis product esculetin does not. Over 1,400 strains of gram-positive and gram-negative bacteria were tested. There was 98.4% of correlation between the spot test and esculin broth and 97% correlation with the bile-esculin agar.

Isolation, morphological identification and in vitro antibacterial activity of endophytic bacteria isolated from Azadirachta indica (neem) leaves

PubMed Central

Singh, Ankit Kumar; Sharma, Rajesh Kumar; Sharma, Varsha; Singh, Tanmay; Kumar, Rajesh; Kumari, Dimple

2017-01-01

Aim: The objective of this study was to isolate endophytic bacteria from Azadirachta indica (neem) leaves, their identification and investigate their antibacterial activity against three Gram-positive bacteria, Staphylococcus aureus, Streptococcus pyogenes and Bacillus cereus and Gram-negative bacteria Escherichia coli, Salmonella Typhimurium and Klebsiella pneumoniae. Materials and Methods: Fresh leaves of A. indica (neem) was procured from the Department of Botany, JNKVV, Jabalpur. Five samples were taken, and each sample was divided into five subsamples and separated for further isolation of endophytic bacteria. For sterilization leaves were treated with double distilled water, 0.1% sodium hypochlorite, 0.01% bavistin, 0.05% and 70% ethanol. Sterilized leaves of the plants were embedded in Kings B (KB) petri plates and incubated at 37°C for 24 h. Characterization of the bacteria was done according to its morphology and by Gram-staining. After that, a single colony was transferred into brain heart infusion (BHI) broth and incubated at 37°C for 24 h. The antibacterial effect was studied by the disk diffusion method with known antibiotic ciprofloxacin (Ci) as standard. Results: A total of 25 bacterial isolates from A. indica (neem) were obtained and identified morphologically. Most of the samples on KB media depicted irregular shape, flat elevation, undulated, rough, opaque, and white in color. Most of the samples on blood agar showed irregular, raise elevation, undulated, smooth, opaque and all the isolates were nonhemolytic and nonchromogenic. The growth of endophytic bacteria in BHI broth were all isolates showed turbidity. The microscopic examination revealed that maximum isolates were Gram-positive and rod shaped. Good antibacterial activity was observed against S. aureus, Streptococcus pyogenes, E. coli, Salmonella Typhimurium, and K. pneumoniae. Conclusions: Endophytic bacteria are present in leaves of A. indica (neem) and it possesses antibacterial activity against few Gram-positive and Gram-negative bacteria. PMID:28620254

Chemical composition and in vitro antimicrobial activity of the essential oil of the flowers of Tridax procumbens.

PubMed

Joshi, Rajesh K; Badakar, Vijaylaxmi

2012-07-01

The essential oil of the flowers of Tridax procumbens L. was obtained by hydro-distillation and analyzed by gas chromatography equipped with a flame ionization detector (GC-FID) and gas chromatography coupled with mass spectrometry (GC/MS). Twenty-six compounds were identified, which comprised 90.6% of the total constituents. The most abundant compound was (Z)-falcarinol (25.9%), followed by alpha-selinene (15.3%), limonene (8.3%) and zerumbone (4.3%). Antimicrobial activity was tested against six Gram-positive and eight Gram-negative bacteria, and three fungi. The oil was active against the tested Gram-positive bacteria at a concentration range of 0.14 +/- 0.03 - 0.57 +/- 0.05 mg/mL, while 0.67 +/- 0.12 - 4.58 +/- 0.41 mg/mL was effective against the studied Gram-negative bacteria. Remarkable antifungal activity was found against the tested fungi at a concentration range of 0.06 +/- 0.008 - 0.10 +/- 0.01 mg/mL.

Discrimination of selected species of pathogenic bacteria using near-infrared Raman spectroscopy and principal components analysis

NASA Astrophysics Data System (ADS)

de Siqueira e Oliveira, Fernanda SantAna; Giana, Hector Enrique; Silveira, Landulfo

2012-10-01

A method, based on Raman spectroscopy, for identification of different microorganisms involved in bacterial urinary tract infections has been proposed. Spectra were collected from different bacterial colonies (Gram-negative: Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa and Enterobacter cloacae, and Gram-positive: Staphylococcus aureus and Enterococcus spp.), grown on culture medium (agar), using a Raman spectrometer with a fiber Raman probe (830 nm). Colonies were scraped from the agar surface and placed on an aluminum foil for Raman measurements. After preprocessing, spectra were submitted to a principal component analysis and Mahalanobis distance (PCA/MD) discrimination algorithm. We found that the mean Raman spectra of different bacterial species show similar bands, and S. aureus was well characterized by strong bands related to carotenoids. PCA/MD could discriminate Gram-positive bacteria with sensitivity and specificity of 100% and Gram-negative bacteria with sensitivity ranging from 58 to 88% and specificity ranging from 87% to 99%.

Essential oils against foodborne pathogens and spoilage bacteria in minced meat.

PubMed

Barbosa, Lidiane Nunes; Rall, Vera Lucia Mores; Fernandes, Ana Angélica Henrique; Ushimaru, Priscila Ikeda; da Silva Probst, Isabella; Fernandes, Ary

2009-01-01

The antimicrobial activity of essential oils of oregano, thyme, basil, marjoram, lemongrass, ginger, and clove was investigated in vitro by agar dilution method and minimal inhibitory concentration (MIC) determination against Gram-positive (Staphylococcus aureus and Listeria monocytogenes) and Gram-negative strains (Escherichia coli and Salmonella Enteritidis). MIC(90%) values were tested against bacterial strains inoculated experimentally in irradiated minced meat and against natural microbiota (aerobic or facultative, mesophilic, and psychrotrophic bacteria) found in minced meat samples. MIC(90%) values ranged from 0.05%v/v (lemongrass oil) to 0.46%v/v (marjoram oil) to Gram-positive bacteria and from 0.10%v/v (clove oil) to 0.56%v/v (ginger oil) to Gram-negative strains. However, the MIC(90%) assessed on minced meat inoculated experimentally with foodborne pathogen strains and against natural microbiota of meat did not show the same effectiveness, and 1.3 and 1.0 were the highest log CFU/g reduction values obtained against tested microorganisms.

In-vitro activity of solithromycin against anaerobic bacteria from the normal intestinal microbiota.

PubMed

Weintraub, Andrej; Rashid, Mamun-Ur; Nord, Carl Erik

2016-12-01

Solithromycin is a novel fluoroketolide with high activity against bacteria associated with community-acquired respiratory tract infections as well as gonorrhea. However, data on the activity of solithromycin against anaerobic bacteria from the normal intestinal microbiota are scarce. In this study, 1024 Gram-positive and Gram-negative anaerobic isolates from the normal intestinal microbiota were analyzed for in-vitro susceptibility against solithromycin and compared to azithromycin, amoxicillin/clavulanic acid, ceftriaxone, metronidazole and levofloxacin by determining the minimum inhibitory concentration (MIC). Solithromycin was active against Bifidobacteria (MIC 50 , 0.008 mg/L) and Lactobacilli (MIC 50 , 0.008 mg/L). The MIC 50 for Clostridia, Bacteroides, Prevotella and Veillonella were 0.5, 0.5, 0.125 and 0.016 mg/L, respectively. Gram-positive anaerobes were more susceptible to solithromycin as compared to the other antimicrobials tested. The activity of solithromycin against Gram-negative anaerobes was equal or higher as compared to other tested agents. Copyright © 2016 Elsevier Ltd. All rights reserved.

Essential Oils Against Foodborne Pathogens and Spoilage Bacteria in Minced Meat

PubMed Central

Barbosa, Lidiane Nunes; Rall, Vera Lucia Mores; Fernandes, Ana Angélica Henrique; Ushimaru, Priscila Ikeda; da Silva Probst, Isabella

2009-01-01

Abstract The antimicrobial activity of essential oils of oregano, thyme, basil, marjoram, lemongrass, ginger, and clove was investigated in vitro by agar dilution method and minimal inhibitory concentration (MIC) determination against Gram-positive (Staphylococcus aureus and Listeria monocytogenes) and Gram-negative strains (Escherichia coli and Salmonella Enteritidis). MIC90% values were tested against bacterial strains inoculated experimentally in irradiated minced meat and against natural microbiota (aerobic or facultative, mesophilic, and psychrotrophic bacteria) found in minced meat samples. MIC90% values ranged from 0.05%v/v (lemongrass oil) to 0.46%v/v (marjoram oil) to Gram-positive bacteria and from 0.10%v/v (clove oil) to 0.56%v/v (ginger oil) to Gram-negative strains. However, the MIC90% assessed on minced meat inoculated experimentally with foodborne pathogen strains and against natural microbiota of meat did not show the same effectiveness, and 1.3 and 1.0 were the highest log CFU/g reduction values obtained against tested microorganisms. PMID:19580445

Cyclic diguanylate signaling in Gram-positive bacteria

PubMed Central

Purcell, Erin B.; Tamayo, Rita

2016-01-01

The nucleotide second messenger 3′-5′ cyclic diguanylate monophosphate (c-di-GMP) is a central regulator of the transition between motile and non-motile lifestyles in bacteria, favoring sessility. Most research investigating the functions of c-di-GMP has focused on Gram-negative species, especially pathogens. Recent work in Gram-positive species has revealed that c-di-GMP plays similar roles in Gram-positives, though the precise targets and mechanisms of regulation may differ. The majority of bacterial life exists in a surface-associated state, with motility allowing bacteria to disseminate and colonize new environments. c-di-GMP signaling regulates flagellum biosynthesis and production of adherence factors and appears to be a primary mechanism by which bacteria sense and respond to surfaces. Ultimately, c-di-GMP influences the ability of a bacterium to alter its transcriptional program, physiology and behavior upon surface contact. This review discusses how bacteria are able to sense a surface via flagella and type IV pili, and the role of c-di-GMP in regulating the response to surfaces, with emphasis on studies of Gram-positive bacteria. PMID:27354347

Bioenergetics and the role of soluble cytochromes C for alkaline adaptation in gram-negative alkaliphilic Pseudomonas.

PubMed

Matsuno, T; Yumoto, I

2015-01-01

Very few studies have been conducted on alkaline adaptation of Gram-negative alkaliphiles. The reversed difference of H(+) concentration across the membrane will make energy production considerably difficult for Gram-negative as well as Gram-positive bacteria. Cells of the alkaliphilic Gram-negative bacterium Pseudomonas alcaliphila AL15-21(T) grown at pH 10 under low-aeration intensity have a soluble cytochrome c content that is 3.6-fold higher than that of the cells grown at pH 7 under high-aeration intensity. Cytochrome c-552 content was higher (64% in all soluble cytochromes c) than those of cytochrome c-554 and cytochrome c-551. In the cytochrome c-552-dificient mutant grown at pH 10 under low-aeration intensity showed a marked decrease in μ max⁡ [h(-1)] (40%) and maximum cell turbidity (25%) relative to those of the wild type. Considering the high electron-retaining abilities of the three soluble cytochromes c, the deteriorations in the growth of the cytochrome c-552-deficient mutant could be caused by the soluble cytochromes c acting as electron storages in the periplasmic space of the bacterium. These electron-retaining cytochromes c may play a role as electron and H(+) condenser, which facilitate terminal oxidation at high pH under air-limited conditions, which is difficult to respire owing to less oxygen and less H(+).

Bioenergetics and the Role of Soluble Cytochromes c for Alkaline Adaptation in Gram-Negative Alkaliphilic Pseudomonas

PubMed Central

Matsuno, T.; Yumoto, I.

2015-01-01

Very few studies have been conducted on alkaline adaptation of Gram-negative alkaliphiles. The reversed difference of H+ concentration across the membrane will make energy production considerably difficult for Gram-negative as well as Gram-positive bacteria. Cells of the alkaliphilic Gram-negative bacterium Pseudomonas alcaliphila AL15-21T grown at pH 10 under low-aeration intensity have a soluble cytochrome c content that is 3.6-fold higher than that of the cells grown at pH 7 under high-aeration intensity. Cytochrome c-552 content was higher (64% in all soluble cytochromes c) than those of cytochrome c-554 and cytochrome c-551. In the cytochrome c-552-dificient mutant grown at pH 10 under low-aeration intensity showed a marked decrease in μ max⁡ [h−1] (40%) and maximum cell turbidity (25%) relative to those of the wild type. Considering the high electron-retaining abilities of the three soluble cytochromes c, the deteriorations in the growth of the cytochrome c-552-deficient mutant could be caused by the soluble cytochromes c acting as electron storages in the periplasmic space of the bacterium. These electron-retaining cytochromes c may play a role as electron and H+ condenser, which facilitate terminal oxidation at high pH under air-limited conditions, which is difficult to respire owing to less oxygen and less H+. PMID:25705691

Efflux Pumps Are Involved in the Defense of Gram-Negative Bacteria against the Natural Products Isobavachalcone and Diospyrone ▿

PubMed Central

Kuete, Victor; Ngameni, Bathélémy; Tangmouo, Jean G.; Bolla, Jean-Michel; Alibert-Franco, Sandrine; Ngadjui, Bonaventure T.; Pagès, Jean-Marie

2010-01-01

The activities of two naturally occurring compounds, isobavachalcone and diospyrone, against documented strains and multidrug-resistant (MDR) Gram-negative bacterial isolates were evaluated. The results indicated that the two compounds exhibited intrinsic antibacterial activity against several Gram-negative bacteria, and their activities were significantly improved in the presence of an efflux pump inhibitor (MIC values decreased to below 10 μg/ml). In addition, the activities of isobavachalcone and diospyrone against various strains exhibiting deletions of the major efflux pump components (AcrAB, TolC) were significantly increased. The overall results indicate that isobavachalcone and diospyrone could be candidates for the development of new drugs against MDR strains and that their use in combination with efflux pump inhibitors reinforces their activity. PMID:20160051

Twelve-year analysis of microbial keratitis trends at a UK tertiary hospital.

PubMed

Tan, S Z; Walkden, A; Au, L; Fullwood, C; Hamilton, A; Qamruddin, A; Armstrong, M; Brahma, A K; Carley, F

2017-08-01

PurposeTo investigate the frequencies, trends, and in vitro drug susceptibilities of the causative pathogens in microbial keratitis in Manchester Royal Eye Hospital.Patients and methodsCorneal scrape results recorded by the microbiology service between 2004 and 2015 were extracted from an established database. A total of 4229 corneal scrape specimens were identified from an established database. First-line antibiotic treatment in our centre during the study period was ofloxacin and second line was cefuroxime and gentamicin.ResultsMean age was 45.9±21.0. A total of 1379 samples (32.6%) were culture positive. One hundred forty-eight (10.7%) specimens cultured multiple organisms. Of the 1539 organisms identified, 63.3% were Gram-positive bacteria, 27.3% Gram-negative bacteria, 7.1% fungi, and 2.3% Acanthamoebae. A decreasing trend in Gram-positive isolates was found together with a stable trend in Gram negatives and an increasing trend in Acanthamoeba and fungi. There appeared to be a significant increasing trend of Moraxella infection (P=0.001). In all, 83.1 and 90.8% of Gram-positive and -negative isolates tested were susceptible to ofloxacin, respectively. Cefuroxime covered 86.6% of Gram-positive and 61.4% of Gram-negative isolates, whereas gentamicin covered 88.8 and 96.5% of Gram-positive and -negative isolates, respectively.ConclusionWe found a change in the type of Gram-negative organisms isolated over time, with the Moraxella species on the rise. Reassuringly, no significant increase in resistance was observed in vitro for any of the commonly used antibiotics. Ofloxacin remains a good first-line antibiotic treatment but duo-therapy does have broader coverage and should be considered in non-responsive cases.

[Analysis of pathogenic bacteria and drug resistance in neonatal purulent meningitis].

PubMed

Zhu, Minli; Hu, Qianhong; Mai, Jingyun; Lin, Zhenlang

2015-01-01

To study the clinical characteristics, pathogenic bacteria, and antibiotics resistance of neonatal purulent meningitis in order to provide the guide for early diagnosis and appropriate treatment. A retrospective review was performed and a total of 112 cases of neonatal purulent meningitis (male 64, female 58) were identified in the neonatal intensive care unit of Yuying Children's Hospital of Wenzhou Medical University seen from January 1, 2004 to December 31, 2013. The clinical information including pathogenic bacterial distribution, drug sensitivity, head imageology and therapeutic outcome were analyzed. Numeration data were shown in ratio and chi square test was applied for group comparison. Among 112 cases, 46 were admitted from 2004 to 2008 and 66 from 2009 to 2013, 23 patients were preterm and 89 were term, 20 were early onset (occurring within 3 days of life) and 92 were late onset meningitis (occurring after 3 days of life). In 62 (55.4%) cases the pathogens were Gram-positive bacteria and in 50 (44.6%) were Gram-negative bacteria. The five most frequently isolated pathogens were Escherichia coli (32 cases, 28.6%), coagulase-negative staphylococcus (CNS, 20 cases, 17.9%), Streptococcus (18 cases, 16.1%, Streptococcus agalactiae 15 cases), Enterococci (13 cases, 11.6%), Staphylococcus aureus (9 cases, 8.0%). Comparison of pathogenic bacterial distribution between 2004-2008 and 2009-2013 showed that Gram-positive bacteria accounted for more than 50% in both period. Escherichia coli was the most common bacterium, followed by Streptococcus in last five years which was higher than the first five years (22.7% (15/66) vs. 6.5% (3/46), χ(2) = 5.278, P < 0.05). Klebsiella pneumoniae was more common isolate in preterm infants than in term infants (13.0% (3/23) vs. 1.1% (1/89), χ(2) = 7.540, P < 0.05). Streptococcus (most were Streptococcus agalactiae) was the most common bacteria in early onset meningitis and higher than those in late onset meningitis (35.0% (7/20) vs. 12.0% (11/92), χ(2) = 4.872, P < 0.05). Drug sensitivity tests showed that all the Gram-positive bacterial isolates were sensitive to linezolid. Staphylococci were resistant to penicillin, and most of them were resistant to erythromycin, oxacillin and cefazolin; 77.8%of CNS isolates were methicillin-resistant staphylococcus. No Streptococcus and Enterococcus faecalis was resistant to penicillin. None of enterococci was resistant to vancomycin. Among the Gram-negative bacterial isolates, more than 40% of Escherichia coli were resistant to commonly used cephalosporins such as cefuroxime, cefotaxime and ceftazidime, and all of them were sensitive to amikacin, cefoperazone sulbactam and imipenem. Isolates of Klebsiella pneumoniae were all resistant to ampicillin, cefuroxime, cefotaxime and ceftazidime, but none of them was resistant to piperacillin tazobactam and imipenem. Of the 112 patients, 69 were cured, 23 improved, 9 uncured and 11 died. There were 47 cases (42.0%) with poor prognosis, they had abnormal head imageology, severe complications and some cases died, 13 of 18 (72.2%) patients with meningitis caused by Streptococcus died. Escherichia coli, CNS and Streptococcus are the predominant pathogens responsible for neonatal purulent meningitis over the past ten years. There were increasing numbers of cases with Streptococcus meningitis which are more common in early onset meningitis with adverse outcome, therefore careful attention should be paid in clinic. Linezolid should be used as a new choice in intractable neonatal purulent meningitis cases caused by gram positive bacteria.

The Effect of Bacteriophage Preparations on Intracellular Killing of Bacteria by Phagocytes

PubMed Central

Jończyk-Matysiak, Ewa; Łusiak-Szelachowska, Marzanna; Kłak, Marlena; Bubak, Barbara; Międzybrodzki, Ryszard; Weber-Dąbrowska, Beata; Żaczek, Maciej; Fortuna, Wojciech; Rogóż, Paweł; Letkiewicz, Sławomir; Szufnarowski, Krzysztof; Górski, Andrzej

2015-01-01

Intracellular killing of bacteria is one of the fundamental mechanisms against invading pathogens. Impaired intracellular killing of bacteria by phagocytes may be the reason of chronic infections and may be caused by antibiotics or substances that can be produced by some bacteria. Therefore, it was of great practical importance to examine whether phage preparations may influence the process of phagocyte intracellular killing of bacteria. It may be important especially in the case of patients qualified for experimental phage therapy (approximately half of the patients with chronic bacterial infections have their immunity impaired). Our analysis included 51 patients with chronic Gram-negative and Gram-positive bacterial infections treated with phage preparations at the Phage Therapy Unit in Wroclaw. The aim of the study was to investigate the effect of experimental phage therapy on intracellular killing of bacteria by patients' peripheral blood monocytes and polymorphonuclear neutrophils. We observed that phage therapy does not reduce patients' phagocytes' ability to kill bacteria, and it does not affect the activity of phagocytes in patients with initially reduced ability to kill bacteria intracellularly. Our results suggest that experimental phage therapy has no significant adverse effects on the bactericidal properties of phagocytes, which confirms the safety of the therapy. PMID:26783541

Gut Microbiota-Induced Immunoglobulin G Controls Systemic Infection by Symbiotic Bacteria and Pathogens

PubMed Central

Zeng, Melody Y.; Cisalpino, Daniel; Varadarajan, Saranyaraajan; Hellman, Judith; Warren, H. Shaw; Cascalho, Marilia; Inohara, Naohiro; Núñez, Gabriel

2016-01-01

The gut microbiota is compartmentalized in the intestinal lumen and induces local immune responses, but it remains unknown whether the gut microbiota can induce systemic response and contribute to systemic immunity. We report that selective gut symbiotic gram-negative bacteria were able to disseminate systemically to induce immunoglobulin G (IgG) response, which primarily targeted gram-negative bacterial antigens and conferred protection against systemic infections by E. coli and Salmonella by directly coating bacteria to promote killing by phagocytes. T cells and Toll-like receptor 4 on B cells were important in the generation of microbiota-specific IgG. We identified murein lipoprotein (MLP), a highly conserved gram-negative outer membrane protein, as a major antigen that induced systemic IgG homeostatically in both mice and humans. Administration of anti-MLP IgG conferred crucial protection against systemic Salmonella infection. Thus, our findings reveal an important function for the gut microbiota in combating systemic infection through the induction of protective IgG. PMID:26944199

Antimicrobial Peptide Potency is Facilitated by Greater Conformational Flexibility when Binding to Gram-negative Bacterial Inner Membranes

NASA Astrophysics Data System (ADS)

Amos, Sarah-Beth T. A.; Vermeer, Louic S.; Ferguson, Philip M.; Kozlowska, Justyna; Davy, Matthew; Bui, Tam T.; Drake, Alex F.; Lorenz, Christian D.; Mason, A. James

2016-11-01

The interaction of antimicrobial peptides (AMPs) with the inner membrane of Gram-negative bacteria is a key determinant of their abilities to exert diverse bactericidal effects. Here we present a molecular level understanding of the initial target membrane interaction for two cationic α-helical AMPs that share structural similarities but have a ten-fold difference in antibacterial potency towards Gram-negative bacteria. The binding and insertion from solution of pleurocidin or magainin 2 to membranes representing the inner membrane of Gram-negative bacteria, comprising a mixture of 128 anionic and 384 zwitterionic lipids, is monitored over 100 ns in all atom molecular dynamics simulations. The effects of the membrane interaction on both the peptide and lipid constituents are considered and compared with new and published experimental data obtained in the steady state. While both magainin 2 and pleurocidin are capable of disrupting bacterial membranes, the greater potency of pleurocidin is linked to its ability to penetrate within the bacterial cell. We show that pleurocidin displays much greater conformational flexibility when compared with magainin 2, resists self-association at the membrane surface and penetrates further into the hydrophobic core of the lipid bilayer. Conformational flexibility is therefore revealed as a key feature required of apparently α-helical cationic AMPs for enhanced antibacterial potency.

Outer-membrane vesicles from Gram-negative bacteria: biogenesis and functions

PubMed Central

Schwechheimer, Carmen; Kuehn, Meta J.

2017-01-01

Outer-membrane vesicles (OMVs) are spherical buds of the outer membrane filled with periplasmic content and are commonly produced by Gram-negative bacteria. The production of OMVs allows bacteria to interact with their environment, and OMVs have been found to mediate diverse functions, including promoting pathogenesis, enabling bacterial survival during stress conditions and regulating microbial interactions within bacterial communities. Additionally, because of this functional versatility, researchers have begun to explore OMVs as a platform for bioengineering applications. In this Review, we discuss recent advances in the study of OMVs, focusing on new insights into the mechanisms of biogenesis and the functions of these vesicles. PMID:26373371

Toxicity of Pseudomonas fluorescens strain Pf-5 to Drosophila larvae is due to downstream gene targets of the GacA/GacS signal transduction system

USDA-ARS?s Scientific Manuscript database

Given the vast number of microorganisms in the environment, surprisingly, only a few are lethal or cause morbidity to host organisms. Pseudomonas spp are a diverse genus of Gram-negative bacteria commonly found in soil, water, or in association with plants and animals. Pseudomonas fluorescens has be...

Gold Nanoparticles: An Efficient Antimicrobial Agent against Enteric Bacterial Human Pathogen

PubMed Central

Shamaila, Shahzadi; Zafar, Noshin; Riaz, Saira; Sharif, Rehana; Nazir, Jawad; Naseem, Shahzad

2016-01-01

Enteric bacterial human pathogens, i.e., Escherichia coli, Staphylococcus aureus, Bacillus subtilis and Klebsiella pneumoniae, are the major cause of diarrheal infections in children and adults. Their structure badly affects the human immune system. It is important to explore new antibacterial agents instead of antibiotics for treatment. This project is an attempt to explain how gold nanoparticles affect these bacteria. We investigated the important role of the mean particle size, and the inhibition of a bacterium is dose-dependent. Ultra Violet (UV)-visible spectroscopy revealed the size of chemically synthesized gold nanoparticle as 6–40 nm. Atomic force microscopy (AFM) analysis confirmed the size and X-ray diffractometry (XRD) analysis determined the polycrystalline nature of gold nanoparticles. The present findings explained how gold nanoparticles lyse Gram-negative and Gram-positive bacteria. PMID:28335198

Bloodstream Infections in Hospitalized Children: Epidemiology and Antimicrobial Susceptibilities.

PubMed

Larru, Beatriz; Gong, Wu; Vendetti, Neika; Sullivan, Kaede V; Localio, Russell; Zaoutis, Theoklis E; Gerber, Jeffrey S

2016-05-01

Bloodstream infection is a major cause of morbidity and mortality. Much of our understanding of the epidemiology and resistance patterns of bloodstream infections comes from studies of hospitalized adults. We evaluated the epidemiology and antimicrobial resistance of bloodstream infections occurring during an 11-year period in a large, tertiary care children's hospital in the US. All positive blood cultures were identified retrospectively from clinical microbiology laboratory records. We excluded repeat positive cultures with the same organism from the same patient within 30 days and polymicrobial infections. We identified 8196 unique episodes of monomicrobial bacteremia in 5508 patients. Overall, 46% were community onset, 72% were Gram-positive bacteria, 22% Gram-negative bacteria and 5% Candida spp. Coagulase negative Staphylococcus was the most common isolated organism. ESKAPE pathogens (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter spp.) accounted for 20% of episodes. No S. aureus isolate was resistant to vancomycin or linezolid, and no increase in vancomycin minimum inhibitory concentration among methicillin-resistant S. aureus was observed during the study period. Clinically significant increases in vancomycin-resistant Enterococcus, ceftazidime-resistant P. aeruginosa or carbapenem-resistant Enterobacteriaceae were not observed during the study period; however, rates of methicillin-resistant S. aureus increased over time (P < 0.01). Gram-positive and ESKAPE organisms are leading causes of bacteremia in hospitalized children. Although antimicrobial resistance patterns were favorable compared with prior reports of hospitalized adults, multicenter studies with continuous surveillance are needed to identify trends in the emergence of antimicrobial resistance in this setting.

Investigation into the susceptibility of Burkholderia cepacia complex isolates to photodynamic antimicrobial chemotherapy (PACT)

NASA Astrophysics Data System (ADS)

Cassidy, C. M.; Watters, A. L.; Donnelly, R. F.; Tunney, M. M.

2009-06-01

The main cause of morbidity and mortality in cystic fibrosis (CF) sufferers is progressive pulmonary damage caused by recurrent and often unremitting respiratory tract infection. Causative organisms include Pseudomonas aeruginosa and Haemophilus influenzae, but in recent years the Burkholderia cepacia complex has come to the fore. This group of highly drug-resistant Gram-negative bacteria are associated with a rapid decline in lung function and the often fatal cepacia syndrome, with treatment limited to patient segregation and marginally effective antibacterial regimens. Thus, development of an effective treatment is of the upmost importance. PACT, a non-target specific therapy, has proven successful in killing both Gram-positive and Gram-negative bacteria. In this study, planktonic cultures of six strains of the B. cepacia complex were irradiated (635 nm, 200 J cm-2,10 minutes irradiation) following 30 seconds incubation with methylene blue (MB) or meso-tetra (N-methyl-4-pyridyl) porphine tetra tosylate (TMP). Rates of kill of > 99 % were achieved with MB- and TMP-PACT. A MB concentration of 50 μg ml-1 and TMP concentration of 500 μg ml-1 were associated with highest percentage kills for each photosensitizer. PACT is an attractive option for treatment of B.cepacia complex infection. Further study, involving biofilm culture susceptibility, delivery of light to the target and in vivo testing will be necessary before it PACT becomes a viable treatment option for CF patients who are colonised or infected with B. cepacia complex.

Comparing the Antibacterial and Functional Properties of Cameroonian and Manuka Honeys for Potential Wound Healing-Have We Come Full Cycle in Dealing with Antibiotic Resistance?

PubMed

Boateng, Joshua; Diunase, Keshu Nso

2015-09-02

The increased incidence of bacterial resistance to antibiotics has generated renewed interest in "traditional" antimicrobials, such as honey. This paper reports on a study comparing physico-chemical, antioxidant and antibacterial characteristics (that potentially contribute in part, to the functional wound healing activity) of Cameroonian honeys with those of Manuka honey. Agar well diffusion was used to generate zones of inhibition against Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus while broth dilutions were used to study the minimum inhibitory concentrations (MICs). Non-peroxide activity was investigated by catalase for hydrogen peroxide reduction. The Cameroonian honeys demonstrated functional properties similar to Manuka honey, with strong correlations between the antioxidant activity and total phenol content of each honey. They were also as effective as Manuka honey in reducing bacteria load with an MIC of 10% w/v against all three bacteria and exhibited non-peroxide antimicrobial activity. These Cameroon honeys have potential therapeutic activity and may contain compounds with activity against Gram positive and Gram negative bacteria. Antibacterial agents from such natural sources present a potential affordable treatment of wound infections caused by antibiotic resistant bacteria, which are a leading cause of amputations and deaths in many African countries.

Ants as vectors of pathogenic microorganisms in a hospital in São Paulo county, Brazil.

PubMed

Máximo, Heros J; Felizatti, Henrique L; Ceccato, Marcela; Cintra-Socolowski, Priscila; Beretta, Ana Laura R Zeni

2014-08-20

The present study aimed to identify and characterize the presence of bacteria carried by ants, and check the distribution of these ants in the physical confines of a medium-sized hospital in São Paulo county, Brazil. The ants were collected from March 2012 to February 2013. Attractive non-toxic baits were used to catch the ants, and the sectors considered for the study were medical wards, outdoor areas, obstetric unit, reception area, kitchen, surgical centres, paediatric clinic and intensive care unit. Captured ants were classified using taxonomic keys and subsequently immersed in Brain Heart Infusion broth. Paratrechina spp. and Monomorium floricola ants were found most frequently in the hospital. Ants had a high capacity for carrying bacteria, and the isolates comprised 68.8% Gram-positive, spore-producing bacilli (Bacillus spp. and Listeria spp.); 14.7% Gram-negative bacilli (Pseudomonas aeruginosa and Klebsiella spp.); and 16.4% Gram-positive cocci (Streptococcus spp. and Staphylococcus aureus). Among the areas being evaluated, the medical wards had the largest number of ants captured, and therefore the most bacteria. Ants in hospitals may carry both Gram-positive and Gram-negative bacteria, and methods of controlling urban ants should be adopted and strictly adhered to, to minimize the risk of infection in hospital patients.

Phytochemical screening and antibacterial activity of Cyclamen persicum Mill tuber extracts.

PubMed

Alkowni, Raed; Jodeh, Shehdeh; Hussein, Fatima; Jaradat, Nidal

2018-01-01

The emerging drug resistance bacteria increased the demand on the discovery of antibiotics from natural sources. This research was aimed to study the antibacterial reactivity; as well as the phytochemicals, of the wild type of Cyclamen persicum, using nine different extraction methods where four solvents (Methanol, Ethanol, Hexane; and Water) were involved with varied extraction periods ranged from 2 up to 10 hours. The antibacterial activity of crude methanol extract (CME) was found as the best method of extraction, with particular emphasis on the method with prolonged extraction time of (10 hrs). The antibacterial activities of produced CME were determined by using agar diffusion method against two of gram-positive bacteria and two gram-negative ones. The CME treated Mueller-Hinton-Agar plates, were exhibited antibacterial effects against the gram-positive bacteria (Staphylococcus aureus and Bacillus subtilis) by showing of inhibition zone after overnight incubation, while nothing was noticed on those of gram negative ones (Pseudomonas aeruginosa and Escherichia coli). These results that proved the antibacterial activity of the Cyclamen persicum tubers were positively tested the Saponin glycosides from plant. In addition to that, methanol solvent could be the useful method for extractions of Cyclamen and can be used in any developing drugs against pathogenic gram positive bacteria.

Analysis on the infections change and measures for the multiple drug-resistant bacteria of neurology.

PubMed

Zang, Wenju

2016-05-01

To analyze the bacterial infection situations and the separation situations of multiple drug-resistant bacteria of the neurology of Zhengzhou People's hospital from Feb. 2012 to Dec. 2014. The patients data of neurology were retrieved by means of the doctor workstation system. The infection sites, the classification and drug-resistant feature of bacteria were classified and summarized in Excel. Finally, Compared with the infection sites, the classification and drug-resistant feature of bacteria at different year. The data obtained use SPSS 19.0 software to do statistical analysis. The infection rate of bacteria in neurology from Year 2012 to 2014 declined from 4.99% to 3.41%. But the constitution of the infection sites of bacteria had no significant changes. Staphylococcus aureus still was the majority in the infections of gram-positive bacteria, and Escherichia coli was the majority in the infections of gram-negative bacteria, and there were no significant changes in the ranking of the past three years. The separation rate of Acihetobacter baumanii and Pseudomonas aeruginosa in gram-negative bacteria gradually escalated. There were definite efficiencies in the prevention and control of the bacterial infections in neurology in the past three years. But the situation of prevention and control was still severe at the same time.

Dynamics of mono- and dual-species biofilm formation and interactions between Staphylococcus aureus and Gram-negative bacteria.

PubMed

Makovcova, Jitka; Babak, Vladimir; Kulich, Pavel; Masek, Josef; Slany, Michal; Cincarova, Lenka

2017-07-01

Microorganisms are not commonly found in the planktonic state but predominantly form dual- and multispecies biofilms in almost all natural environments. Bacteria in multispecies biofilms cooperate, compete or have neutral interactions according to the involved species. Here, the development of mono- and dual-species biofilms formed by Staphylococcus aureus and other foodborne pathogens such as Salmonella enterica subsp. enterica serovar Enteritidis, potentially pathogenic Raoultella planticola and non-pathogenic Escherichia coli over the course of 24, 48 and 72 h was studied. Biofilm formation was evaluated by the crystal violet assay (CV), enumeration of colony-forming units (CFU cm -2 ) and visualization using confocal laser scanning microscopy (CLSM) and scanning electron microscopy (SEM). In general, Gram-negative bacterial species and S. aureus interacted in a competitive manner. The tested Gram-negative bacteria grew better in mixed dual-species biofilms than in their mono-species biofilms as determined using the CV assay, CFU ml -2 enumeration, and CLSM and SEM visualization. In contrast, the growth of S. aureus biofilms was reduced when cultured in dual-species biofilms. CLSM images revealed grape-like clusters of S. aureus and monolayers of Gram-negative bacteria in both mono- and dual-species biofilms. S. aureus clusters in dual-species biofilms were significantly smaller than clusters in S. aureus mono-species biofilms. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

The determination and arrangement of a combination of enzyme lactate dehydrogenase of bacteria Acinetobacter sp. as a device the identity important bacteria agent composts

NASA Astrophysics Data System (ADS)

Sukmawati, D.; Puspitaningrum, R.; Muzajjanah

2017-07-01

The number of garbage generated by the industry or society is a usual problem encountered by almost all urban centers, especially large cities such as Jakarta. Waste prevention strategy required quickly and accurately. One strategy for tackling the Junk was getting lactic acid-producing bacteria. It has been shown that lactic acid can increase the acceleration of organic matter such as an overhaul of lignin and cellulose as well as out causing toxic compounds arising from decay. This research will be conducted on the determination and characterization of the enzyme-producing compost bacteria LDH lactate dehydrogenase LDH - which in isolation from the garbage Landfill Rawasari. Methodology: Research carried out consists: isolation of lactic acid-producing bacteria; identification of microscopic, macroscopic and staining Gram; cellulose assay, and optimization of PCR conditions LDH enzymes producing bacteria. Isolation is performed by dilution method and the direct method. As many as 5-point sampling. Each stage is conducted from 10 grams of soil from the top surface of the compost. Isolation results obtained 100 isolate the bacteria. Base on the characteristic of macroscopic and microscopic observations retrieved 14 isolates of bacteria have shaped rods and brought forth a negative kind of Gram positive staining. Bacterial isolates with codes (BK1; BK3; BK4; BK5; BK6; BK7; BK8; BK9; BK10; BK11: BK12; BK 13). The potential bacteria with ability produce lactate dehydrogenase was BK1 and BK3. Base for analysis phylogenetic there was identification bacteria bak1 and bak3 where Acinetobacter sp.

[Antimicrobial activity of fosfomycin under various conditions against standard strains, beta-lactam resistant strains, and multidrug efflux system mutants].

PubMed

Mikuniya, Takeshi; Hiraishi, Toru; Maebashi, Kazunori; Ida, Takashi; Takata, Toshihiko; Hikida, Muneo; Yamada, Sakuo; Gotoh, Naomasa; Nishino, Takeshi

2005-04-01

The purpose of this study was to evaluate the possible benefit of fosfomycin (FOM) as prophylactic antibiotic in terms of antimicrobial activity and the potential of inducibility of beta-lactamase, compared with cefazolin, cefotiam, cefmetazole, and piperacillin that are commonly used as perioperative agents. The in vitro activity of FOM against aerobic Gram-negative bacteria using Mueller-Hinton agar or nutrient agar supplemented with glucose-6-phosphate (G6P) as tested medium increased within a range from 2 to 256 times the activity in the medium without G6P. However, the susceptibility of Gram-positive bacteria to FOM remained largely unchanged with or without G6P. There was no aerobic- or anaerobic-bacteria which changed susceptibility against beta-lactam antibiotics under various tested medium conditions. FOM demonstrated strong bactericidal activity against Escherichia coli and Pseudomonas aeruginosa in a dose dependent manner, and decreased viable cell counts of Staphylococcus aureus. In the case of P. aeruginosa, transmission electron micrographs study revealed that numerous lysed cells were present 2 hours after treatment with FOM at four times the MIC. First and second generation cephalosporins induced AmpC-type beta-lactamase in a dose dependent manner among beta-lactamase inducible strains of P. aeruginosa and Enterobacter cloacae. On the other hand, inducible activity of FOM on beta-lactamase production was less than 1/25 to 1/65 compared with those of cephalosporins. In addition, FOM maintained strong antimicrobial activity for over then 20 years after marketing, because of the excellent stability against various types of beta-lactamase produced by plasmid-carrying bacteria and clinical isolates. FOM was not extruded by four types of efflux systems, such as MexAB-OprM, MexCD-OprJ, MexXY/ OprM and MexEF-OprN, however beta-lactam antibiotics were substrates of MexAB-OprM and MexCD-OprJ. In conclusion, FOM provides adequate coverage for both aerobic Gram-positive and Gram-negative bacteria causing postoperative infections. Further, FOM would not select/concentrate beta-lactamase producing bacteria in the clinical fields and would not be a substrate for multidrug efflux system of P. aeruginosa.

Integrating rapid diagnostics and antimicrobial stewardship improves outcomes in patients with antibiotic-resistant Gram-negative bacteremia.

PubMed

Perez, Katherine K; Olsen, Randall J; Musick, William L; Cernoch, Patricia L; Davis, James R; Peterson, Leif E; Musser, James M

2014-09-01

An intervention for Gram-negative bloodstream infections that integrated mass spectrometry technology for rapid diagnosis with antimicrobial stewardship oversight significantly improved patient outcomes and reduced hospital costs. As antibiotic resistance rates continue to grow at an alarming speed, the current study was undertaken to assess the impact of this intervention in a challenging patient population with bloodstream infections caused by antibiotic-resistant Gram-negative bacteria. A total of 153 patients with antibiotic-resistant Gram-negative bacteremia hospitalized prior to the study intervention were compared to 112 patients treated post-implementation. Outcomes assessed included time to optimal antibiotic therapy, time to active treatment when inactive, hospital and intensive care unit length of stay, all-cause 30-day mortality, and total hospital expenditures. Integrating rapid diagnostics with antimicrobial stewardship improved time to optimal antibiotic therapy (80.9 h in the pre-intervention period versus 23.2 h in the intervention period, P < 0.001) and effective antibiotic therapy (89.7 h versus 32 h, P < 0.001). Patients in the pre-intervention period had increased duration of hospitalization compared to those in the intervention period (23.3 days versus 15.3 days, P = 0.0001) and longer intensive care unit length of stay (16 days versus 10.7 days, P = 0.008). Mortality among patients during the intervention period was lower (21% versus 8.9%, P = 0.01) and our study intervention remained a significant predictor of survival (OR, 0.3; 95% confidence interval [CI], 0.12-0.79) after multivariate logistic regression. Mean hospital costs for each inpatient survivor were reduced $26,298 in the intervention cohort resulting in an estimated annual cost savings of $2.4 million (P = 0.002). Integration of rapid identification and susceptibility techniques with antimicrobial stewardship resulted in significant improvements in clinical and financial outcomes for patients with bloodstream infections caused by antibiotic-resistant Gram-negatives. The intervention decreased hospital and intensive care unit length of stay, total hospital costs, and reduced all-cause 30-day mortality. Copyright © 2014. Published by Elsevier Ltd.

Hib Photos

MedlinePlus

... fluid culture positive for Haemophilus influenzae , type b (Gram stain) www.vaccineinformation.org/photos/hib_aap001.jpg Copyright American Academy of Pediatrics Haemophilus influenzae type b. ... gram-negative Haemophilus influenzae bacteria www.vaccineinformation.org/photos/ ...

Antimicrobial role of human meibomian lipids at the ocular surface.

PubMed

Mudgil, Poonam

2014-10-14

Human meibomian lipids form the outermost lipid layer of the tear film and serve many important functions to maintain its integrity. Although not investigated earlier, these lipids may have antimicrobial properties that help in strengthening the innate host defense of tears at the ocular surface. The aim of this study was to investigate the antimicrobial role of human meibomian lipids. Ocular pathogenic bacteria, Staphylococcus aureus 31, Pseudomonas aeruginosa 19, Pseudomonas aeruginosa 20, and Serratia marcescens 35, were grown in the presence and absence of human meibomian lipids in an artificial tear solution at the physiological temperature. Viable counts were obtained to note the number of bacteria surviving the treatment with meibomian lipids. Bacterial cells were imaged using scanning electron microscopy to observe the damages caused by meibomian lipids. Viable count results showed that in the presence of meibomian lipids, growth of all bacteria was considerably lower. Scanning electron microscopy showed that meibomian lipids caused extensive cellular damage to bacteria as manifested in smaller size, loss of aggregation, abnormal phenotype, cellular distortion, damaged cell wall, and cell lysis. This is the first-ever report of the antimicrobial role of human meibomian lipids. These lipids possess antimicrobial properties against both Gram-positive and Gram-negative bacteria and are involved in the innate host defense of tears in protecting the ocular surface against microbial pathogens. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

Rare occurrence of heart lesions in Pacific oysters Crassostrea gigas caused by an unknown bacterial infection.

PubMed

Meyer, Gary R; Lowe, Geoffrey J; Bower, Susan M

2017-09-20

On rare occasions, small cream-coloured cysts have been observed in the heart and pericardial cavity of Pacific oysters Crassostrea gigas from British Columbia, Canada. Histopathology revealed the presence of large colonies of bacteria (up to 800 µm in diameter) causing significant host response and hypertrophy of the heart epithelium. The causative bacteria were characterized as follows: Gram-negative, coccoid to small rod-shaped, typically <1.5 µm in size, cell walls highly endowed with surface fimbriae and division via binary fission. Although these bacteria shared some morphological characteristics with the order Rickettsiales, they did not require an intracellular existence for multiplication. Unfortunately, a cultured isolate was not available, and a retrospective attempt to further characterize the bacteria using DNA sequence analysis of a fragment from the 16S rDNA region proved to be uninformative.

Treatment performance and microorganism community structure of integrated vertical-flow constructed wetland plots for domestic wastewater.

PubMed

Wu, Su-qing; Chang, Jun-jun; Dai, Yanran; Wu, Zhen-bin; Liang, Wei

2013-06-01

In order to investigate the treatment performance and microorganism mechanism of IVCW for domestic wastewater in central of China, two parallel pilot-scale IVCW systems were built to evaluate purification efficiencies, microbial community structure and enzyme activities. The results showed that mean removal efficiencies were 81.03 % for COD, 51.66 % for total nitrogen (TN), 42.50 % for NH4 (+)-N, and 68.01 % for TP. Significant positive correlations between nitrate reductase activities and TN and NH4 (+)-N removal efficiencies, along with a significant correlation between substrate enzyme activity and operation time, were observed. Redundancy analysis demonstrated gram-negative bacteria were mainly responsible for urease and phosphatase activities, and also played a major role in dehydrogenase and nitrate reductase activities. Meanwhile, anaerobic bacteria, gram-negative bacteria, and saturated FA groups, gram-positive bacteria exhibited good correlations with the removal of COD (p=0.388), N (p=0.236), and TP (p=0.074), respectively. The IVCW system can be used to treat domestic wastewater effectively.

Improved antimicrobial activities of synthetic-hybrid bacteriocins designed from enterocin E50-52 and pediocin PA-1.

PubMed

Tiwari, Santosh Kumar; Sutyak Noll, Katia; Cavera, Veronica L; Chikindas, Michael L

2015-03-01

Two hybrid bacteriocins, enterocin E50-52/pediocin PA-1 (EP) and pediocin PA-1/enterocin E50-52 (PE), were designed by combining the N terminus of enterocin E50-52 and the C terminus of pediocin PA-1 and by combining the C terminus of pediocin PA-1 and the N terminus of enterocin E50-52, respectively. Both hybrid bacteriocins showed reduced MICs compared to those of their natural counterparts. The MICs of hybrid PE and EP were 64- and 32-fold lower, respectively, than the MIC of pediocin PA-1 and 8- and 4-fold lower, respectively, than the MIC of enterocin E50-52. In this study, the effect of hybrid as well as wild-type (WT) bacteriocins on the transmembrane electrical potential (ΔΨ) and their ability to induce the efflux of intracellular ATP were investigated. Enterocin E50-52, pediocin PA-1, and hybrid bacteriocin PE were able to dissipate ΔΨ, but EP was unable to deplete this component. Both hybrid bacteriocins caused a loss of the intracellular concentration of ATP. EP, however, caused a faster efflux than PE and enterocin E50-52. Enterocin E50-52 and hybrids PE and EP were active against the Gram-positive and Gram-negative bacteria tested, such as Micrococcus luteus, Salmonella enterica serovar Enteritidis 20E1090, and Escherichia coli O157:H7. The hybrid bacteriocins designed and described herein are antimicrobial peptides with MICs lower those of their natural counterparts. Both hybrid peptides induce the loss of intracellular ATP and are capable of inhibiting Gram-negative bacteria, and PE dissipates the electrical potential. In this study, the MIC of hybrid bacteriocin PE decreased 64-fold compared to the MIC of its natural peptide counterpart, pediocin PA-1. Inhibition of Gram-negative pathogens confers an additional advantage for the application of these peptides in therapeutics. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Improved Antimicrobial Activities of Synthetic-Hybrid Bacteriocins Designed from Enterocin E50-52 and Pediocin PA-1

PubMed Central

Tiwari, Santosh Kumar; Sutyak Noll, Katia; Cavera, Veronica L.

2014-01-01

Two hybrid bacteriocins, enterocin E50-52/pediocin PA-1 (EP) and pediocin PA-1/enterocin E50-52 (PE), were designed by combining the N terminus of enterocin E50-52 and the C terminus of pediocin PA-1 and by combining the C terminus of pediocin PA-1 and the N terminus of enterocin E50-52, respectively. Both hybrid bacteriocins showed reduced MICs compared to those of their natural counterparts. The MICs of hybrid PE and EP were 64- and 32-fold lower, respectively, than the MIC of pediocin PA-1 and 8- and 4-fold lower, respectively, than the MIC of enterocin E50-52. In this study, the effect of hybrid as well as wild-type (WT) bacteriocins on the transmembrane electrical potential (ΔΨ) and their ability to induce the efflux of intracellular ATP were investigated. Enterocin E50-52, pediocin PA-1, and hybrid bacteriocin PE were able to dissipate ΔΨ, but EP was unable to deplete this component. Both hybrid bacteriocins caused a loss of the intracellular concentration of ATP. EP, however, caused a faster efflux than PE and enterocin E50-52. Enterocin E50-52 and hybrids PE and EP were active against the Gram-positive and Gram-negative bacteria tested, such as Micrococcus luteus, Salmonella enterica serovar Enteritidis 20E1090, and Escherichia coli O157:H7. The hybrid bacteriocins designed and described herein are antimicrobial peptides with MICs lower those of their natural counterparts. Both hybrid peptides induce the loss of intracellular ATP and are capable of inhibiting Gram-negative bacteria, and PE dissipates the electrical potential. In this study, the MIC of hybrid bacteriocin PE decreased 64-fold compared to the MIC of its natural peptide counterpart, pediocin PA-1. Inhibition of Gram-negative pathogens confers an additional advantage for the application of these peptides in therapeutics. PMID:25527560

Bacterial and fungal microflora on the external genitalia of male donkeys (Equus asinus).

PubMed

Carleton, Carla L; Donahue, J Michael; Marteniuk, Judith V; Sells, Stephen F; Timoney, Peter J

2015-02-01

This study was undertaken to investigate the bacterial and fungal microflora on the external genitalia of a population of healthy male donkeys in the state of Michigan, USA. The aim was to identify and determine the frequency of occurrence of these microorganisms using seven different isolation media and standard microbiological procedures. The sites (urethral fossa [fossa glandis], dorsal diverticulum of the urethral sinus, distal urethra, and penile surface) in the distal reproductive tract were cultured and each isolated microorganism identified. Ten different genera of gram-positive bacteria, eight different genera of gram-negative bacteria, and two genera of fungi were isolated from the external genitalia of the 43 donkeys in this study. All 43 donkeys yielded gram-positive bacteria (2-8 species) from all four sites sampled. Arcanobacterium spp., Corynebacterium spp., and Bacillus spp. were the most frequently isolated gram-positive bacteria. Gram-negative bacteria were cultured from 16 (37.2%) of the 43 donkeys, with Acinetobacterlwoffii (16.3%), Oligella urethralis (11.6%), and Taylorellaasinigenitalis (9.3%), the most frequently isolated. Fungi were cultured from only 5 (11.6%) of the 43 donkeys, with Rhizopus spp. isolated from 3 (7.0%) and Cladosporium spp. from 2 (4.7%) individuals. The testes and epididymides collected from 40 donkeys at time of castration were culture negative. Few differences were found in the bacterial flora between prepubertal and mature intact and castrated donkeys. Of notable interest was the scarcity of known equine pathogens across the population tested and isolation of T. asinigenitalis from normal donkeys, especially prepubertal individuals and previously castrated males. Copyright © 2014 Elsevier B.V. All rights reserved.

Influenza-induced type I interferon enhances susceptibility to gram-negative and gram-positive bacterial pneumonia in mice.

PubMed

Lee, Benjamin; Robinson, Keven M; McHugh, Kevin J; Scheller, Erich V; Mandalapu, Sivanarayana; Chen, Chen; Di, Y Peter; Clay, Michelle E; Enelow, Richard I; Dubin, Patricia J; Alcorn, John F

2015-07-15

Suppression of type 17 immunity by type I interferon (IFN) during influenza A infection has been shown to enhance susceptibility to secondary bacterial pneumonia. Although this mechanism has been described in coinfection with gram-positive bacteria, it is unclear whether similar mechanisms may impair lung defense against gram-negative infections. Furthermore, precise delineation of the duration of type I IFN-associated susceptibility to bacterial infection remains underexplored. Therefore, we investigated the effects of preceding influenza A virus infection on subsequent challenge with the gram-negative bacteria Escherichia coli or Pseudomonas aeruginosa and the temporal association between IFN expression with susceptibility to Staphylococcus aureus challenge in a mouse model of influenza and bacterial coinfection. Here we demonstrate that preceding influenza A virus led to increased lung E. coli and P. aeruginosa bacterial burden, which was associated with suppression of type 17 immunity and attenuation of antimicrobial peptide expression. Enhanced susceptibility to S. aureus coinfection ceased at day 14 of influenza infection, when influenza-associated type I IFN levels had returned to baseline levels, further suggesting a key role for type I IFN in coinfection pathogenesis. These findings further implicate type I IFN-associated suppression of type 17 immunity and antimicrobial peptide production as a conserved mechanism for enhanced susceptibility to both gram-positive and gram-negative bacterial coinfection during influenza infection. Copyright © 2015 the American Physiological Society.

Development of novel antibacterial drugs to combat multiple resistant organisms.

PubMed

Bassetti, Matteo; Righi, Elda

2015-02-01

Infections due to multidrug-resistant (MDR) bacteria are increasing both in hospitals and in the community and are characterized by high mortality rates. New molecules are in development to face the need of active compounds toward resistant gram-positive and gram-negative pathogens. In particular, the Infectious Diseases Society of America (IDSA) has supported the initiative to develop ten new antibacterials within 2020. Principal targets are the so-called ESKAPE pathogens (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumanii, Pseudomonas aeruginosa, and Enterobacteriaceae). To review the characteristics and the status of development of new antimicrobials including new cephalosporins, carbapenems, beta-lactamase inhibitors, aminoglycosides, quinolones, oxazolidones, glycopeptides, and tetracyclines. While numerous new compounds target resistant gram-positive pathogens and have been approved for clinical use, very few new molecules are active against MDR gram-negative pathogens, especially carbapenemase producers. New glycopeptides and oxazolidinones are highly efficient against methicillin-resistant S. aureus (MRSA), and new cephalosporins and carbapenems also display activity toward MDR gram-positive bacteria. Although new cephalosporins and carbapenems have acquired activity against MRSA, they offer few advantages against difficult-to-treat gram-negatives. Among agents that are potentially active against MDR gram-negatives are ceftozolane/tazobactam, new carbapenems, the combination of avibactam with ceftazidime, and plazomicin. Since a relevant number of promising antibiotics is currently in development, regulatory approvals over the next 5 years are crucial to face the growing threat of multidrug resistance.

Prevalence and Antibiotic Resistance of Gram-Negative Pathogenic Bacteria Species Isolated from Periplaneta americana and Blattella germanica in Varanasi, India

PubMed Central

Wannigama, D Leshan; Dwivedi, Rishabh; Zahraei-Ramazani, Alireza

2014-01-01

Background Cockroaches are among the medically important pests found within the human habitations that cause serious public health problems. They may harbor a number of pathogenic bacteria on the external surface with antibiotic resistance. Hence, they are regarded as major microbial vectors. This study investigates the prevalence and antibiotic resistance of Gram-negative pathogenic bacteria species isolated from Periplaneta americana and Blattella germanica in Varanasi, India. Methods: Totally, 203 adult cockroaches were collected form 44 households and 52 food-handling establishments by trapping. Bacteriological examination of external surfaces of Pe. americana and Bl. germanica were carried out using standard method and antibiotics susceptibility profiles of the isolates were determined using Kirby-Bauer disc diffusion methods. Results: Among the places, we found that 54% had cockroache infestation in households and 77% in food- handling establishments. There was no significant different between the overall bacteria load of the external surface in Pe. americana (64.04%) and Bl. germanica (35.96%). However the predominant bacteria on cockroaches were Klebsiella pneumonia, Escherichia coli, Enterobacter aerogenes, and Pseudomonas aeruginosa. However, Kl. pneumoniae and Ps. aeruginosa were the most prevalent, drug-resistant strains were isolated from the cockroaches with 100% resistance to sulfamethoxazole/trimethoprim and ampicillin. For individual strains of bacteria, Escherichia coli was found to have multi-resistance to four antibiotic tested, Citrobacter freundii four, Enterobacter aerogenes and Proteus mirabilis to three. Conclusion: Cockroaches are uniformly distributed in domestic environment, which can be a possible vector for transmission of drug-resistant bacteria and food-borne diseases. PMID:25629061

Developing of a novel antibacterial agent by functionalization of graphene oxide with guanidine polymer with enhanced antibacterial activity

NASA Astrophysics Data System (ADS)

Li, Ping; Sun, Shiyu; Dong, Alideertu; Hao, Yanping; Shi, Shuangqiang; Sun, Zijia; Gao, Ge; Chen, Yuxin

2015-11-01

New materials with excellent antibacterial activity attract numerous research interests. Herein, a facile synthetic method of polyethylene glycol (PEG) and polyhexamethylene guanidine hydrochloride (PHGC) dual-polymer-functionalized graphene oxide (GO) (GO-PEG-PHGC), a novel antibacterial material, was reported. The as-prepared products were characterized by scanning electron microscopy (SEM), Fourier transform infrared (FTIR), thermogravimetric analysis (TGA), X-ray pattern (XRD) and elemental analysis. The antibacterial effect on the bacterial strain was investigated by incubating both Gram-negative bacteria (Escherichia coli) and Gram-positive bacteria (Staphylococcus aureus). The results show that GO-PEG-PHGC has enhanced antibacterial activity when compared to GO, GO-PEG or GO-PHGC alone. The improved antibacterial activity was described to be related to a better dispersion of GO-PEG-PHGC in the presence of PEG. This better dispersion leads to a greater contact between the bacteria membrane and nanomaterials, therefore leading to greater cell damage. Not only Gram-negative bacteria but also Gram-positive bacteria are greatly inhibited by this antibacterial agent. With the powerful antibacterial activity as well as its low cost and facile preparation, the GO-PEG-PHGC as a novel antibacterial agent can find potential application in the areas of healthcare and environmental engineering.

Antimicrobial peptide gene induction, involvement of Toll and IMD pathways and defense against bacteria in the red flour beetle, Tribolium castaneum.

PubMed

Yokoi, Kakeru; Koyama, Hiroaki; Minakuchi, Chieka; Tanaka, Toshiharu; Miura, Ken

2012-01-01

Using Tribolium castaneum, we quantitatively investigated the induction of nine antimicrobial peptide (AMP) genes by live gram-negative bacteria (Escherichia coli and Enterobacter cloacae), gram-positive bacteria (Micrococcus luteus and Bacillus subtilis) and the budding yeast (Saccharomyces cerevisiae). Then, five representative AMP genes were selected, and the involvement of the Toll and IMD pathways in their induction by E. coli, M. luteus and S. cerevisiae was examined by utilizing RNA interference of either MyD88 or IMD. Results indicated: Robust and acute induction of three genes by the two bacterial species was mediated mainly by the IMD pathway; slow and sustained induction of one gene by the two bacteria was mediated mainly by the Toll pathway; induction of the remaining one gene by the two bacteria was mediated by both pathways; induction of the five genes by the yeast was mediated by the Toll and/or IMD pathways depending on respective genes. These results suggest that more promiscuous activation and usage of the two pathways may occur in T. castaneum than in Drosophila melanogaster. In addition, the IMD pathway was revealed to dominantly contribute to defense against two bacterial species, gram-negative E. cloacae and gram-positive B. subtilis that possesses DAP-type peptidoglycan.

Automated single-slide staining device

NASA Technical Reports Server (NTRS)

Wilkins, J. R.; Mills, S. M. (Inventor)

1977-01-01

A simple apparatus and method is disclosed for making individual single Gram stains on bacteria inoculated slides to assist in classifying bacteria in the laboratory as Gram-positive or Gram-negative. The apparatus involves positioning a single inoculated slide in a stationary position and thereafter automatically and sequentially flooding the slide with increments of a primary stain, a mordant, a decolorizer, a counterstain and a wash solution in a sequential manner without the individual lab technician touching the slide and with minimum danger of contamination thereof from other slides.

Potentiation by potassium iodide using TPPS4 for antimicrobial photodynamic inactivation

NASA Astrophysics Data System (ADS)

Huang, Liyi; Hamblin, Michael R.

2018-02-01

Potassium iodide can potentiate antimicrobial photodynamic inactivation (aPDI) of a broad-spectrum of microorganisms, producing many extra logs of killing. We compared two charged porphyrins, TPPS4 (thought to be anionic and not able to bind to Gram-negative bacteria) and TMPyP4 (considered cationic and well able to bind to bacteria). As expected TPPS4 + light did not kill Gram-negative Escherichia coli, but surprisingly when 100 mM KI was added, it was highly effective at mediating aPDI (eradication at 200 nM + 10 J/cm2 of 415 nm light). TPPS4 was more effective than TMPyP4 in eradicating the Gram-positive bacteria, methicillin-resistant Staphylococcus aureus and the fungal yeast Candida albicans (regardless of KI). TPPS4 was also highly active against E. coli after a centrifugation step when KI was added, suggesting that the supposedly anionic porphyrin bound to bacteria and Candida. We conclude that TPPS4 behaves as if it has some cationic character in the presence of bacteria, which may be related to its supply from vendors in the form of a dihydrochloride salt.

Application of air ions for bacterial de-colonization in air filters contaminated by aerosolized bacteria.

PubMed

Kim, Yang Seon; Yoon, Ki Young; Park, Jae Hong; Hwang, Jungho

2011-01-15

We aerosolized the Escherichia coli (E. coli) and Staphylococcus epidermidis (S. epidermidis) bacteria and collected them on membrane filters. Then we generated air ions by applying a high voltage to a carbon fiber tip and applied them to the contaminated filters. The antibacterial efficiency was not significantly affected by the bacteria being Gram-positive or Gram-negative, however, negative ions showed a lower antibacterial efficiency than positive ions to both E. coli and S. epidermidis, even though the concentration of negative air ions was much higher than that of positive air ions. With a field emission scanning electron microscope (FE-SEM) images and fluorescence microscopy images using a LIVE/DEAD BacLight Bacterial Viability Kit, electrostatic disruption of the bacteria was found to be the dominant antibacterial effect. Copyright © 2010 Elsevier B.V. All rights reserved.

[Successful Prophylactic Minocycline Treatment for Recurrent Helicobacter Cinaedi Sepsis during Chemotherapy in a Patient with Follicular Lymphoma].

PubMed

Aota, Yasuo; Gotoh, Akihiko; Nakamura, Itaru; Motoya, Kazuki; Okuda, Yuko; Hanyu, Naofumi; Honma, Toshihiro; Udou, Ryutaro; Yokoyama, Tomohisa; Kitagawa, Naoyuki; Komatsu, Norio

2017-05-01

A 63-year-old man with follicular lymphoma was administered standard R-CHOP chemotherapy. Six days after the second course of chemotherapy, the patient developed fever and chills. Blood cultures yielded rod-shaped gram-negative bacteria, but no further identification was obtained. High fever and chills returned on the fifth and sixth days after the third and fourth courses of R-CHOP, respectively. These blood cultures were also positive. Since we detected spiral-shaped gram-negative rods, we performed a prolonged culture during the febrile period after the fourth course of R-CHOP. This revealed the formation of characteristic film-like colonies, and Helicobacter cinaedi(H. cinaedi)bacteria was identified. After final identification, the patient was administered prophylactic minocycline treatment. Subsequent blood cultures were negative, fever did not recur, and we were able to complete 6 courses of R-CHOP. Although H. cinaedi has been reported to be a cause of sepsis in immunocompromised patients, standard correlation has not been established. Our case suggests that H. cinaedi should be considered when recurrent fever is observed after chemotherapy. Prophylactic antibiotic treatment with minocycline may prevent sepsis, as observed in our case.

Potential sources of bacteria that are isolated from contact lenses during wear.

PubMed

Willcox, M D; Power, K N; Stapleton, F; Leitch, C; Harmis, N; Sweeney, D F

1997-12-01

The aim of this paper was to determine the possible contamination sources of contact lenses during wear. Potential sources of the microbiota that colonized hydrogel contact lenses during wear were examined. The microorganisms that colonize contact lenses were grown, identified, and compared to those microorganisms that colonized the lower lid margins, upper bulbar conjunctiva, hands, and contact lens cases of contact lens wearers. In addition, the incidence of contamination of the domestic water supply in the Sydney area was obtained, and this was compared to the incidence of colonization of contact lenses by microorganisms in general and gram-negative bacteria in particular. There was a wide diversity of bacteria that were isolated from each site sampled. Coagulase-negative staphylococci and Propionibacterium spp. were the most common isolates from all ocular sites examined, and constituted the normal ocular microbiota. Other bacteria, including members of the families Enterobacteriaceae and Pseudomonadaceae, were isolated infrequently from all sites, but most frequently from contact lens cases. Statistical analysis revealed that there was a correlation between the isolation of bacteria from the contact lens and the lower lid margin (p < 0.001). Analysis of this correlation revealed that this was true for the normal microbiota. A correlation was also noted between the colonization of contact lenses by gram-negative bacteria and contamination of the domestic water supply. This study has demonstrated that the likely route for the normal ocular microbiota colonizing contact lenses is via the lid margins, whereas colonization by gram-negative bacteria, including potential agents of microbial keratitis, is likely to be from the domestic water supply.

Microbiological Spoilage of Dairy Products

NASA Astrophysics Data System (ADS)

Ledenbach, Loralyn H.; Marshall, Robert T.

The wide array of available dairy foods challenges the microbiologist, engineer, and technologist to find the best ways to prevent the entry of microorganisms, destroy those that do get in along with their enzymes, and prevent the growth and activities of those that escape processing treatments. Troublesome spoilage microorganisms include aerobic psychrotrophic Gram-negative bacteria, yeasts, molds, heterofermentative lactobacilli, and spore-forming bacteria. Psychrotrophic bacteria can produce large amounts of extracellular hydrolytic enzymes, and the extent of recontamination of pasteurized fluid milk products with these bacteria is a major determinant of their shelf life. Fungal spoilage of dairy foods is manifested by the presence of a wide variety of metabolic by-products, causing off-odors and flavors, in addition to visible changes in color or texture.

Structural engineering of a phage lysin that targets Gram-negative pathogens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lukacik, Petra; Barnard, Travis J.; Keller, Paul W.

Bacterial pathogens are becoming increasingly resistant to antibiotics. As an alternative therapeutic strategy, phage therapy reagents containing purified viral lysins have been developed against Gram-positive organisms but not against Gram-negative organisms due to the inability of these types of drugs to cross the bacterial outer membrane. We solved the crystal structures of a Yersinia pestis outer membrane transporter called FyuA and a bacterial toxin called pesticin that targets this transporter. FyuA is a {beta}-barrel membrane protein belonging to the family of TonB dependent transporters, whereas pesticin is a soluble protein with two domains, one that binds to FyuA and anothermore » that is structurally similar to phage T4 lysozyme. The structure of pesticin allowed us to design a phage therapy reagent comprised of the FyuA binding domain of pesticin fused to the N-terminus of T4 lysozyme. This hybrid toxin kills specific Yersinia and pathogenic E. coli strains and, importantly, can evade the pesticin immunity protein (Pim) giving it a distinct advantage over pesticin. Furthermore, because FyuA is required for virulence and is more common in pathogenic bacteria, the hybrid toxin also has the advantage of targeting primarily disease-causing bacteria rather than indiscriminately eliminating natural gut flora.« less

In vitro activity of tigecycline and comparators against gram-negative bacteria isolated from a tertiary hospital in Alexandria, Egypt.

PubMed

Mohamed, Nelly M; Youssef, Alaa A F

2011-12-01

The emergence of infections caused by multidrug-resistant Gram-negative bacteria, in particular Pseudomonas aeruginosa, Acinetobacter baumannii, and Klebsiella pneumoniae, has necessitated the search for alternative therapy by either introducing new agents or renewing interest in old agents. This study compares the in vitro activity of tigecycline (TIG), recently introduced to Egyptian market, to other potentially active antimicrobials as Colistin (COL), imipenem (IPM), levofloxacin (LEV), and piperacillin/tazobactam (PIP/TAZ) against 67 Gram-negative clinical isolates obtained from El- Meery Hospital in Alexandria, Egypt. El-Meery Hospital is a 1,500-bed tertiary teaching hospital where TIG has not been previously used. Based on MIC(90)s, TIG was found to be a comparator to IPM and COL (MIC(90)= 8 μg/ml). LEV and PIP/TAZ were less active than TIG exhibiting high MIC(90)s. TIG inhibited 100% of Escherichia coli and K. pneumoniae and 60% of Ps. aeruginosa and A. baumannii isolates. In time-kill studies against IPM-resistant isolates, TIG showed bactericidal activity after 6 hours of contact against the Enterobacteriaceae isolates and after 3 hours for the tested Ps. aeruginosa isolates at 4× and 8× MIC. Against A. baumannii, TIG exerted a bacteriostatic effect. TIG demonstrated variable ability to suppress biofilm formation affecting mainly E. coli and A. baumannii isolates. These results point TIG to be a promising agent in treatment of infections caused by strains for which adequate therapy has been limited. As far as we know, this is the first report evaluating the in vitro activity of TIG against Egyptian clinical isolates.

Microbial population dynamics in the sediments of a eutrophic lake (Aydat, France) and characterization of some heterotrophic bacterial isolates.

PubMed

Mallet, C; Basset, M; Fonty, G; Desvilettes, C; Bourdier, G; Debroas, D

2004-07-01

The bacterial populations of anoxic sediments in a eutrophic lake (Aydat, Puy-de-Dôme-France) were studied by phospholipid fatty acid analysis (PLFA) and also by culturing heterotrophic bacteria under strictly anaerobic conditions. The mean PLFA concentrations of prokaryotes and microeukaryotes were 5.7 +/- 2.9 mgC g(-1) DS and 9.6 +/- 6.7 mgC g(-1) DS, respectively. The analysis of bacterial PLFA markers was used to determine the dynamics of the Gram-positive and Gram-negative species of anaerobic bacteria, Clostridiae, and sulfate-reducing bacteria. Throughout the sampling period the concentrations of i15:0 (from 20 nmol g(-1) DS to 130 nmol g(-1) DS), markers of Gram-positive bacteria, were higher than those for Gram-negative bacteria. The dynamics of Clostridiae (Cy15:0) paralleled those of sulfate-reducing bacteria that were marked by i17:1omega7. Partial 16S rDNA sequencing and the physiological study of the various fermenting strains, whose abundance in the superficial sediment layer was 1.1 +/- 0.4 x 10(6) cells mL(-1), showed that all the isolates belonged to the Clostridiae and related taxa ( Lactosphaera pasteurii, Clostridium vincentii, C. butyricum, C. algidixylanolyticum, C. puniceum, C. lituseburense, and C. gasigenes). All the isolates were capable of metabolizing a wide range of organic substrates.

In Vitro Assessment of Early Bacterial Activity on Micro/Nanostructured Ti6Al4V Surfaces.

PubMed

Valdez-Salas, Benjamin; Beltrán-Partida, Ernesto; Castillo-Uribe, Sandra; Curiel-Álvarez, Mario; Zlatev, Roumen; Stoytcheva, Margarita; Montero-Alpírez, Gisela; Vargas-Osuna, Lidia

2017-05-18

It is imperative to understand and systematically compare the initial interactions between bacteria genre and surface properties. Thus, we fabricated a flat, anodized with 80 nm TiO₂ nanotubes (NTs), and a rough Ti6Al4V surface. The materials were characterized using field-emission scanning electron microscopy (FE-SEM), energy dispersive X-ray spectroscopy (EDX) and atomic force microscopy (AFM). We cultured in vitro Staphylococcus epidermidis ( S. epidermidis ) and Pseudomonas aeruginosa ( P. aeruginosa ) to evaluate the bacterial-surface behavior by FE-SEM and viability calculation. In addition, the initial effects of human osteoblasts were tested on the materials. Gram-negative bacteria showed promoted adherence and viability over the flat and rough surface, while NTs displayed opposite activity with altered morphology. Gram-positive bacteria illustrated similar cellular architecture over the surfaces but with promoted surface adhesion bonds on the flat alloy. Rough surfaces supported S. epidermidis viability, whilst NTs exhibited lower vitality. NTs advocated promoted better osteoblast organization with enhanced vitality. Gram-positive bacteria suggested preferred adhesion capability over flat and carbon-rich surfaces. Gram-negative bacteria were strongly disturbed by NTs but largely stimulated by flat and rough materials. Our work proposed that the chemical profile of the material surface and the bacterial cell wall characteristics might play an important role in the bacteria-surface interactions.

Highly dynamic biodegradable micelles capable of lysing Gram-positive and Gram-negative bacterial membrane.

PubMed

Qiao, Yuan; Yang, Chuan; Coady, Daniel J; Ong, Zhan Yuin; Hedrick, James L; Yang, Yi-Yan

2012-02-01

The development of biodegradable antimicrobial polymers adds to the toolbox of attractive antimicrobial agents against antibiotic-resistant microbes. To this end, the potential of polycarbonate polymers as such materials were explored. A series of random polycarbonate polymers consisting of monomers MTC-OEt and MTC-CH(2)CH(3)Cl were designed and synthesized using metal-free organocatalytic ring-opening polymerization. Random polycarbonate polymers self-assembled in solution but appeared highly dynamic; such behaviors are desirable as ready disassembly of polymers at the microbial membrane facilitates membrane disruption. Their activities against clinically relevant Gram-positive (Staphylococcus aureus) and Gram-negative bacteria (E.coli and Pseudomonas aeruginosa) revealed that the hydrophobic-hydrophilic composition balance in polymers are important to render antimicrobial potency. Scanning electron microscopy (SEM) studies indicated microbial cell surface damage after treatment with polymers, and confocal microscopy studies also showed entry of FITC-dextran dye in Escherichia coli as a result of membrane disruption. On the other hand, the polymers exhibited minimal toxicity against red blood cells in hemolysis tests. Therefore, these random polycarbonate polymers are promising antimicrobial agents against both Gram-positive and Gram-negative bacteria for various biomedical applications. Copyright © 2011 Elsevier Ltd. All rights reserved.

Detection of pathogenic gram negative bacteria using infrared thermography

NASA Astrophysics Data System (ADS)

Lahiri, B. B.; Divya, M. P.; Bagavathiappan, S.; Thomas, Sabu; Philip, John

2012-11-01

Detection of viable bacteria is of prime importance in all fields of microbiology and biotechnology. Conventional methods of enumerating bacteria are often time consuming and labor-intensive. All living organisms generate heat due to metabolic activities and hence, measurement of heat energy is a viable tool for detection and quantification of bacteria. In this article, we employ a non-contact and real time method - infrared thermography (IRT) for measurement of temperature variations in four clinically significant gram negative pathogenic bacteria, viz. Vibrio cholerae, Vibrio mimicus, Proteus mirabilis and Pseudomonas aeruginosa. We observe that, the energy content, defined as the ratio of heat generated by bacterial metabolic activities to the heat lost from the liquid medium to the surrounding, vary linearly with the bacterial concentration in all the four pathogenic bacteria. The amount of energy content observed in different species is attributed to their metabolisms and morphologies that affect the convection velocity and hence heat transport in the medium.

[Utility of MALDI-TOF MS for the identification of anaerobic bacteria].

PubMed

Zárate, Mariela S; Romano, Vanesa; Nievas, Jimena; Smayevsky, Jorgelina

2014-01-01

The analysis by MALDI-TOF MS (Matrix-assited laser desorption/ionization time-of-flight mass spectrometry) has become a reference method for the identification of microorganisms in Clinical Microbiology. However, data on some groups of microorganisms are still controversial. The aim of this study is to determine the utility of MALDI-TOF MS for the identification of clinical isolates of anaerobic bacteria. One-hundred and six anaerobic bacteria isolates were analyzed by MALDI-TOF MS and by conventional biochemical tests. In those cases where identification by conventional methodology was not applicable or in the face of discordance between sequencing methodologies, 16 S rRNA gene sequence analysis was performed. The conventional method and MALDI-TOF MS agreed at genus and species level by 95.3 %. Concordance in gram-negative bacilli was 91.4% and 100% among gram-positive bacilli; there was also concordance both in the 8 isolates studied in gram-positive cocci and in the single gram-negative cocci included. The data obtained in this study demonstrate that MALDI-TOF MS offers the possibility of adequate identification of anaerobic bacteria. Copyright © 2014 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

Small subunits of RNA polymerase: localization, levels and implications for core enzyme composition.

PubMed

Doherty, Geoff P; Fogg, Mark J; Wilkinson, Anthony J; Lewis, Peter J

2010-12-01

Bacterial RNA polymerases (RNAPs) contain several small auxiliary subunits known to co-purify with the core α, β and β' subunits. The ω subunit is conserved between Gram-positive and Gram-negative bacteria, while the δ subunit is conserved within, but restricted to, Gram-positive bacteria. Although various functions have been assigned to these subunits via in vitro assays, very little is known about their in vivo roles. In this work we constructed a pair of vectors to investigate the subcellular localization of the δ and ω subunits in Bacillus subtilis with respect to the core RNAP. We found these subunits to be closely associated with RNAP involved in transcribing both mRNA and rRNA operons. Quantification of these subunits revealed δ to be present at equimolar levels with RNAP and ω to be present at around half the level of core RNAP. For comparison, the localization and quantification of RNAP β' and ω subunits in Escherichia coli was also investigated. Similar to B. subtilis, β' and ω closely associated with the nucleoid and formed subnucleoid regions of high green fluorescent protein intensity, but, unlike ω in B. subtilis, ω levels in E. coli were close to parity with those of β'. These results indicate that δ is likely to be an integral RNAP subunit in Gram-positives, whereas ω levels differ substantially between Gram-positives and -negatives. The ω subunit may be required for RNAP assembly and subsequently be turned over at different rates or it may play roles in Gram-negative bacteria that are performed by other factors in Gram-positives.

Rapid spot test for the determination of esculin hydrolysis.

PubMed Central

Edberg, S C; Gam, K; Bottenbley, C J; Singer, J M

1976-01-01

Esculin hydrolysis is a useful test in the differentiation of both gram-positive and gram-negative bacteria covering a wide spectrum of aerobes, facultative anaerobes, and anaerobes. Commonly utilized methods require a minimum of 18 h of incubation in broth or agar medium and utilize the production of a brown-black compound, due to the combination of ferric ions with the hydrolysis product esculetin, as indicator. A procedure is presented that requires 15 to 30 min for completion and utilizes fluorescence loss as the indicator of hydrolysis. Esculin fluoresces at 366 nm, whereas the hydrolysis product esculetin does not. Over 1,400 strains of gram-positive and gram-negative bacteria were tested. There was 98.4% of correlation between the spot test and esculin broth and 97% correlation with the bile-esculin agar. Images PMID:787006

Antibiotic susceptibility patterns of different bacteria isolated from patients with ventilator associated pneumonia (vap).

PubMed

Alqurashi, Abdulrahman M

2005-09-01

Ventilator associated pneumonia (VAP) is a frequent complication of mechanical ventilation (MV) and it is a leading cause of death in MV patients. The development of VAP has been demonstrated as being due to aspiration of oropharyngeal secretion, ventilator tubing condensate, or gastric contents that are colonized with pathogenic microorganisms. The aim of the present study is to isolate and identify bacteria that cause VAP and to study antibiotic susceptibility. This study was carried out on 95 patients who fulfilled the diagnostic criteria for VAP. Quantitative cultures of endotracheal aspirates (EA) using a cut-off point of 10(6) cfu/ml was done. The microbiological results revealed that gram negative bacilli were the most common bacterial agents responsible for VAP and accounted for 78.8% of all the causative agents. The most common isolated organisms were Klebsiella pnemouniae (30.9 %) followed by Pseudomonas aeruginosa (22.5%), Staphylococcus aureus (21.2%), Eschericia coli (12.8 %), Proteus spp. (9.8%), and Citrobacter spp. (2.8%). Blood cultures were positive in 25.9% of patients with Klebsiella pnemouniae in about 33.3%. From this study, it can be concluded that VAP is an important nosocomial infection. EA is a simple procedure to obtain respiratory samples and perform sensitivity testing in patients with VAP. Also, the commonest cause of VAP is gram negative bacilli.

In vitro activity of ceftaroline against 623 diverse strains of anaerobic bacteria.

PubMed

Citron, D M; Tyrrell, K L; Merriam, C V; Goldstein, E J C

2010-04-01

The in vitro activities of ceftaroline, a novel, parenteral, broad-spectrum cephalosporin, and four comparator antimicrobials were determined against anaerobic bacteria. Against Gram-positive strains, the activity of ceftaroline was similar to that of amoxicillin-clavulanate and four to eight times greater than that of ceftriaxone. Against Gram-negative organisms, ceftaroline showed good activity against beta-lactamase-negative strains but not against the members of the Bacteroides fragilis group. Ceftaroline showed potent activity against a broad spectrum of anaerobes encountered in respiratory, skin, and soft tissue infections.

Current and future challenges in the development of antimicrobial agents.

PubMed

Rennie, Robert P

2012-01-01

Micro-organisms exist to survive. Even in the absence of antimicrobial agents, many have determinants of resistance that may be expressed phenotypically, should the need arise. With the advent of the antibiotic age, as more and more drugs were developed to treat serious infections, micro-organisms (particularly bacteria) rapidly developed resistance determinants to prevent their own demise.The most important determinants of resistance have been in the Gram-positive and Gram-negative bacteria. Among Gram-positive bacteria, methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-resistant enterococci (VRE) and penicillin-resistant Streptococcus pneumoniae (PRSP) have taxed researchers and pharmaceutical companies to develop new agents that are effective against these resistant strains. Among the Gram-negative bacteria, extended-spectrum beta-lactamase (ESBL) enzymes, carbapenemases (CREs) and the so-called amp-C enzymes that may be readily transferred between species of enterobacteriaceae and other facultative species have created multi-drug resistant organisms that are difficult to treat. Other resistance determinants have been seen in other clinically important bacterial species such as Neisseria gonorrhoeae, Clostridium difficile, Haemophilus influenzae and Mycobacterium tuberculosis. These issues have now spread to fungal agents of infection.A variety of modalities have been used to stem the tide of resistance. These include the development of niche compounds that target specific resistance determinants. Other approaches have been to find new targets for antimicrobial activity, use of combination agents that are effective against more than one target in the cell, or new delivery mechanism to maximize the concentration of antimicrobial agents at the site of infection without causing toxicity to the host. It is important that such new modalities have been proved effective for clinical therapy. Animal models and non-mammalian systems have been developed to determine if new agents will reach sufficient concentrations at infection sites to predict clinical efficacy without toxicity. It will also be key to consider antimicrobial stewardship as an important component of the continuing battle to prevent the development of antimicrobial resistance.

Trans-generational Immune Priming Protects the Eggs Only against Gram-Positive Bacteria in the Mealworm Beetle

PubMed Central

Dubuffet, Aurore; Zanchi, Caroline; Boutet, Gwendoline; Moreau, Jérôme; Teixeira, Maria; Moret, Yannick

2015-01-01

In many vertebrates and invertebrates, offspring whose mothers have been exposed to pathogens can exhibit increased levels of immune activity and/or increased survival to infection. Such phenomena, called “Trans-generational immune priming” (TGIP) are expected to provide immune protection to the offspring. As the offspring and their mother may share the same environment, and consequently similar microbial threats, we expect the immune molecules present in the progeny to be specific to the microbes that immune challenged the mother. We provide evidence in the mealworm beetle Tenebrio molitor that the antimicrobial activity found in the eggs is only active against Gram-positive bacteria, even when females were exposed to Gram-negative bacteria or fungi. Fungi were weak inducers of TGIP while we obtained similar levels of anti-Gram-positive activity using different bacteria for the maternal challenge. Furthermore, we have identified an antibacterial peptide from the defensin family, the tenecin 1, which spectrum of activity is exclusively directed toward Gram-positive bacteria as potential contributor to this antimicrobial activity. We conclude that maternal transfer of antimicrobial activity in the eggs of T. molitor might have evolved from persistent Gram-positive bacterial pathogens between insect generations. PMID:26430786

The effects of interfacial potential on antimicrobial propensity of ZnO nanoparticle

PubMed Central

Arakha, Manoranjan; Saleem, Mohammed; Mallick, Bairagi C.; Jha, Suman

2015-01-01

The work investigates the role of interfacial potential in defining antimicrobial propensity of ZnO nanoparticle (ZnONP) against different Gram positive and Gram negative bacteria. ZnONPs with positive and negative surface potential are tested against different bacteria with varying surface potentials, ranging −14.7 to −23.6 mV. Chemically synthesized ZnONPs with positive surface potential show very high antimicrobial propensity with minimum inhibitory concentration of 50 and 100 μg/mL for Gram negative and positive bacterium, respectively. On other hand, ZnONPs of the same size but with negative surface potential show insignificant antimicrobial propensity against the studied bacteria. Unlike the positively charged nanoparticles, neither Zn2+ ion nor negatively charged ZnONP shows any significant inhibition in growth or morphology of the bacterium. Potential neutralization and colony forming unit studies together proved adverse effect of the resultant nano-bacterial interfacial potential on bacterial viability. Thus, ZnONP with positive surface potential upon interaction with negative surface potential of bacterial membrane enhances production of the reactive oxygen species and exerts mechanical stress on the membrane, resulting in the membrane depolarization. Our results show that the antimicrobial propensity of metal oxide nanoparticle mainly depends upon the interfacial potential, the potential resulting upon interaction of nanoparticle surface with bacterial membrane. PMID:25873247

PVC biodeterioration and DEHP leaching by DEHP-degrading bacteria

PubMed Central

Latorre, Isomar; Hwang, Sangchul; Sevillano, Maria; Montalvo-Rodriguez, Rafael

2012-01-01

Newly isolated, not previously reported, di-(2-ethylhexyl) phthalate (DEHP)-degraders were augmented to assess their role in polyvinyl chloride (PVC) shower curtain deterioration and DEHP leaching. The biofilms that developed on the surfaces of the bioaugmented shower curtains with Gram-positive strains LHM1 and LHM2 were thicker than those of the biostimulated and Gram-negative strain LHM3-augmented shower curtains. The first derivative thermogravimetric (DTG) peaks of the bioaugmented shower curtains with the Gram-positive bacteria were observed at ~287°C, whereas the control and Gram-negative strain LHM3-augmented shower curtains were detected at ~283°C. This slight delay in the first DTG peak temperature is indicative of lower plasticizer concentrations in the shower curtains that were bioaugmented with Gram positive bacteria. Despite bioaugmentation with DEHP-degraders, aqueous solutions of the bioaugmentation reactors were not DEHP-free due probably to the presence of co-solutes that must have supported microbial growth. Generally, the bioaugmented reactors with the Gram-positive strains LHM1 and LHM2 had greater aqueous DEHP concentrations in the first-half (<3 wk) of the biodeterioration experiment than the biostimulated and strain LHM3-augmented reactors. Therefore, strains LHM1 and LHM2 may play an important role in DEHP leaching to the environment and PVC biodeterioration. PMID:22736894

[Left-sided endocarditis due to gram-negative bacilli: epidemiology and clinical characteristics].

PubMed

Noureddine, Mariam; de la Torre, Javier; Ivanova, Radka; Martínez, Francisco José; Lomas, Jose María; Plata, Antonio; Gálvez, Juan; Reguera, Jose María; Ruiz, Josefa; Hidalgo, Carmen; Luque, Rafael; García-López, María Victoria; de Alarcón, Arístides

2011-04-01

The aim of this study is to describe the epidemiological, clinical characteristics, and outcome of patients with left-side endocarditis caused by gram-negative bacteria. Prospective multicenter study of left-sided infective endocarditis reported in the Andalusian Cohort for the Study of Cardiovascular Infections between 1984 and 2008. Among the 961 endocarditis, 24 (2.5%) were caused by gram-negative bacilli. The most common pathogens were Escherichia coli, Pseudomonas aeruginosa and Salmonella enterica. Native valves (85.7%) were mainly affected, most of them with previous valve damage (57%). Comorbidity was greater (90% vs 39%; P=.05) than in endocarditis due to other microorganism, the most frequent being, diabetes, hepatic cirrhosis and neoplasm. A previous manipulation was found in 47.6% of the cases, and 37% were considered hospital-acquired. Renal failure (41%), central nervous system involvement (33%) and ventricular dysfunction (45%) were the most frequent complications. Five cases (21%) required cardiac surgery, mostly due to ventricular dysfunction. More than 50% of cases were treated with aminoglycosides, but this did not lead to a better outcome or prognosis. Mortality (10 patients) was higher than that reported with other microorganisms (41% vs 35%; P=.05). Left-sided endocarditis due to gram-negative bacilli is a rare disease, which affects patients with major morbidities and often with a previous history of hospital manipulations. Cardiac, neurological and renal complications are frequent and associated with a high mortality. The association of aminoglycosides in the antimicrobial treatment did not involve a better outcome or prognosis. Copyright © 2010 Elsevier España, S.L. All rights reserved.

An Interaction of LPS and RSV Infection in Augmenting the AHR and Airway Inflammation in Mice.

PubMed

Zhou, Na; Li, Wei; Ren, Luo; Xie, Xiaohong; Liu, Enmei

2017-10-01

Respiratory syncytial virus (RSV) is the leading cause of acute lower respiratory tract infection (LRTI) in children under 5 years of age, especially infants with severe bronchiolitis. Our preliminary clinical experiments showed that bacterial colonization was commonly observed in children with virus-induced wheezing, particularly in those with recurrent wheezing, suggesting that bacterial colonization with an accompanying viral infection may contribute to disease severity. In most cases, RSV-infected infants were colonized with pathogenic bacteria (mainly Gram-negative bacteria). LPS is the main component of Gram-negative bacteria and acts as a ligand for Toll-like receptor 4 (TLR4). Relevant studies have reported that the TLR family is crucial in mediating the link between viral components and immunologic responses to infection. Of note, TLR4 activation has been associated with disease severity during RSV infection. In the present study, we identified that LPS aggravated RSV-induced AHR and airway inflammation in BALB/c mice using an RSV coinfection model. We found that the airway inflammatory cells and cytokines present in BALF and TRIF in lung tissue play a role in inducing AHR and airway inflammation upon RSV and bacteria coinfection, which might occur through the TRIF-MMP-9-neutrophil-MMP-9 signalling pathway. These results may aid in the development of novel treatments and improve vaccine design.

Adhesion of gram-negative rod-shaped bacteria on 1D nano-ripple glass pattern in weak magnetic fields.

PubMed

Saleem, Iram; Masood, Samina; Smith, Derek; Chu, Wei-Kan

2018-05-24

This research project has major applications in the healthcare and biomedical industries. Bacteria reside in human bodies and play an integral role in the mechanism of life. However, their excessive growth or the invasion of similar agents can be dangerous and may cause fatal or incurable diseases. On the other hand, increased exposure to electromagnetic radiation and its impact on health and safety is a common concern to medical science. Some nanostructure materials have interesting properties regarding facilitating or impeding cell growth. An understanding of these phenomena can be utilized to establish the optimum benefit of these structures in healthcare and medical research. We focus on the commonly found rod-shaped, gram-negative bacteria and their orientation and community development on the cellular level in the presence of weak magnetic fields on one dimensional nano-ripple glass patterns to investigate the impact of nanostructures on the growth pattern of bacteria. The change in bacterial behavior on nanostructures and the impact of magnetic fields will open up new venues in the utilization of nanostructures. It is noticed that bacterial entrapment in nano-grooves leads to the growth of larger colonies on the nanostructures, whereas magnetic fields reduce the size of colonies and suppress their growth. © 2018 Texas Center for Superconductivity, University of Houston. MicrobiologyOpen published by John Wiley & Sons Ltd.

Outcome of Transplantation Using Organs From Donors Infected or Colonized With Carbapenem-Resistant Gram-Negative Bacteria.

PubMed

Mularoni, A; Bertani, A; Vizzini, G; Gona, F; Campanella, M; Spada, M; Gruttadauria, S; Vitulo, P; Conaldi, P; Luca, A; Gridelli, B; Grossi, P

2015-10-01

Donor-derived infections due to multidrug-resistant bacteria are a growing problem in solid organ transplantation, and optimal management options are not clear. In a 2-year period, 30/214 (14%) recipients received an organ from 18/170 (10.5%) deceased donors with infection or colonization caused by a carbapenem-resistant gram-negative bacteria that was unknown at the time of transplantation. Among them, 14/30 recipients (47%) received a transplant from a donor with bacteremia or with infection/colonization of the transplanted organ and were considered at high risk of donor-derived infection transmission. The remaining 16/30 (53%) recipients received an organ from a nonbacteremic donor with colonization of a nontransplanted organ and were considered at low risk of infection transmission. Proven transmission occurred in 4 of the 14 high-risk recipients because donor infection was either not recognized, underestimated, or not communicated. These recipients received late, short or inappropriate posttransplant antibiotic therapy. Transmission did not occur in high-risk recipients who received appropriate and prompt antibiotic therapy for at least 7 days. The safe use of organs from donors with multidrug-resistant bacteria requires intra- and inter-institutional communication to allow appropriate management and prompt treatment of recipients in order to avoid transmission of infection. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

Large Scale Screening of Ethnomedicinal Plants for Identification of Potential Antibacterial Compounds.

PubMed

Panda, Sujogya Kumar; Mohanta, Yugal Kishore; Padhi, Laxmipriya; Park, Young-Hwan; Mohanta, Tapan Kumar; Bae, Hanhong

2016-03-14

The global burden of bacterial infections is very high and has been exacerbated by increasing resistance to multiple antibiotics. Antibiotic resistance leads to failed treatment of infections, which can ultimately lead to death. To overcome antibiotic resistance, it is necessary to identify new antibacterial agents. In this study, a total of 662 plant extracts (diverse parts) from 222 plant species (82 families, 177 genera) were screened for antibacterial activity using the agar cup plate method. The aqueous and methanolic extracts were prepared from diverse plant parts and screened against eight bacterial (two Gram-positive and six Gram-negative) species, most of which are involved in common infections with multiple antibiotic resistance. The methanolic extracts of several plants were shown to have zones of inhibition ≥ 12 mm against both Gram-positive and Gram-negative bacteria. The minimum inhibitory concentration was calculated only with methanolic extracts of selected plants, those showed zone of inhibition ≥ 12 mm against both Gram-positive and Gram-negative bacteria. Several extracts had minimum inhibitory concentration ≤ 1 mg/mL. Specifically Adhatoda vasica, Ageratum conyzoides, Alangium salvifolium, Alpinia galanga, Andrographis paniculata, Anogeissus latifolia, Annona squamosa, A. reticulate, Azadirachta indica, Buchanania lanzan, Cassia fistula, Celastrus paniculatus, Centella asiatica, Clausena excavate, Cleome viscosa, Cleistanthus collinus, Clerodendrum indicum, Croton roxburghii, Diospyros melanoxylon, Eleutherine bulbosa, Erycibe paniculata, Eryngium foetidum, Garcinia cowa, Helicteres isora, Hemidesmus indicus, Holarrhena antidysenterica, Lannea coromandelica, Millettia extensa, Mimusops elengi, Nyctanthes arbor-tristis, Oroxylum indicum, Paederia foetida, Pterospermum acerifolium, Punica granatum, Semecarpus anacardium, Spondias pinnata, Terminalia alata and Vitex negundo were shown to have significant antimicrobial activity. The species listed here were shown to have anti-infective activity against both Gram-positive and Gram-negative bacteria. These results may serve as a guide for selecting plant species that could yield the highest probability of finding promising compounds responsible for the antibacterial activities against a broad spectrum of bacterial species. Further investigation of the phytochemicals from these plants will help to identify the lead compounds for drug discovery.

A novel C-type lectin with triple carbohydrate recognition domains has critical roles for the hard tick Haemaphysalis longicornis against Gram-negative bacteria.

PubMed

Maeda, Hiroki; Miyata, Takeshi; Kusakisako, Kodai; Galay, Remil Linggatong; Talactac, Melbourne Rio; Umemiya-Shirafuji, Rika; Mochizuki, Masami; Fujisaki, Kozo; Tanaka, Tetsuya

2016-04-01

C-type lectins (CLecs) play an important role in innate immunity against invaders. In this study, a novel CLec was identified from Haemaphysalis longicornis ticks (HlCLec). HlCLec contains a signal peptide and a transmembrane region. Interestingly, HlCLec possesses three dissimilar carbohydrate recognition domains (CRDs). Each CRD contains the mutated motif of Ca(2+)-binding site 2. HlCLec mRNA was up-regulated during blood feeding, and had highest expression in the midgut and ovary. HlCLec localization was also confirmed by immunofluorescent antibody test (IFAT). HlCLec was found on the cell membrane and basal lamina of midgut and ovary. In addition, the recombinant HlCLec and individual CRDs demonstrated direct binding activity to Escherichia coli and Staphylococcus aureus; however, no growth inhibition activity was observed. Furthermore, E. coli injection after silencing of HlCLec caused drastic reduction in survival rate of ticks. These results strongly suggest the key role of HlCLec in tick innate immunity against Gram-negative bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

Significance of Viable but Nonculturable Escherichia coli: Induction, Detection, and Control.

PubMed

Ding, Tian; Suo, Yuanjie; Xiang, Qisen; Zhao, Xihong; Chen, Shiguo; Ye, Xingqian; Liu, Donghong

2017-03-28

Diseases caused by foodborne or waterborne pathogens are emerging. Many pathogens can enter into the viable but nonculturable (VBNC) state, which is a survival strategy when exposed to harsh environmental stresses. Pathogens in the VBNC state have the ability to evade conventional microbiological detection methods, posing a significant and potential health risk. Therefore, controlling VBNC bacteria in food processing and the environment is of great importance. As the typical one of the gram-negatives, Escherichia coli ( E. coli ) is a widespread foodborne and waterborne pathogenic bacterium and is able to enter into a VBNC state in extreme conditions (similar to the other gram-negative bacteria), including inducing factors and resuscitation stimulus. VBNC E. coli has the ability to recover both culturability and pathogenicity, which may bring potential health risk. This review describes the concrete factors (nonthermal treatment, chemical agents, and environmental factors) that induce E. coli into the VBNC state, the condition or stimulus required for resuscitation of VBNC E. coli , and the methods for detecting VBNC E. coli . Furthermore, the mechanism of genes and proteins involved in the VBNC E. coli is also discussed in this review.

Identification of Prevotella in pedal osteomyelitis of a diabetic patient.

PubMed

Dominiak, Barbara J; Oxberry, William; Chen, Patrick C

2003-01-01

Osteomyelitis in a diabetic patient with a nonhealing foot ulcer, multiple medical conditions, and recurrent hospitalization for antibiotic therapy was found to be associated with gram-negative bacteria Prevotella melanginoganica and Prevotella melaninoganica hemagglutinating variant. Those organisms were identified due to the morphologically distinct features in electron microscopy and sequencing of the genes after Polymerase chain reaction amplification from the pathological material. The bacteria invaded the bone and resided in osteocyte, osteoblast, and endothelial cells. The bacteria are usually associated with periodontal plaques, causing inflammation and destruction of gingival tissue and resorption of the alveolar bone. This is the first ultrastructural and molecular study of a diabetic bone lesion with anaerobic bacterial infection.

High-touch surfaces: microbial neighbours at hand.

PubMed

Cobrado, L; Silva-Dias, A; Azevedo, M M; Rodrigues, A G

2017-11-01

Despite considerable efforts, healthcare-associated infections (HAIs) continue to be globally responsible for serious morbidity, increased costs and prolonged length of stay. Among potentially preventable sources of microbial pathogens causing HAIs, patient care items and environmental surfaces frequently touched play an important role in the chain of transmission. Microorganisms contaminating such high-touch surfaces include Gram-positive and Gram-negative bacteria, viruses, yeasts and parasites, with improved cleaning and disinfection effectively decreasing the rate of HAIs. Manual and automated surface cleaning strategies used in the control of infectious outbreaks are discussed and current trends concerning the prevention of contamination by the use of antimicrobial surfaces are taken into consideration in this manuscript.

[Clinical and pharmacological aspects of rifaximin, local antibiotic therapy in intestinal disorders].

PubMed

Gasztonyi, Beáta; Hunyady, Béla

2004-10-24

The authors report pharmacokinetics and indications of rifaximin and the results of clinical studies. Rifaximin has a large antibacterial spectrum with a good therapeutic effect on both gram positive and gram negative aerob and anaerob bacteria. Practically there is no absorption (< 1%) following oral administration with a high concentration in gastrointestinal mucosa (8000 microg/g). No increase in absorption can be detected in intestinal damage caused by inflammatory bowel disease. The remarkable safety profile of rifaximin is due to its negligible quality of absorption. According to the clinical studies rifaximin could be an adequate therapeutic approach in all gastrointestinal diseases and interventions when antibacterial therapy is needed.

Expression levels of matrix metalloproteinase-9 and gram-negative bacteria in symptomatic and asymptomatic periapical lesions.

PubMed

Ahmed, Geraldine M; El-Baz, Alaa A; Hashem, Ahmed Abdel Rahman; Shalaan, Abeer K

2013-04-01

The aim of this study was to test the hypothesis that the expression of matrix metalloproteinase (MMP)-9 is significantly elevated in patients with symptomatic apical periodontitis and to correlate this with the detected amount of gram-negative bacteria. Twenty-six patients with periapical lesions involving at least 2 teeth were included in this study. The patients were divided into 2 groups: the symptomatic (SYM) group included 13 patients expressing pain with periapical lesions, and the asymptomatic (ASYM) group included 13 patients expressing no pain. Root canal treatment was performed followed by endodontic surgery and periapical lesion collection. Periapical lesions were serially cut into 4-μ sections. Some sections were processed for histologic examination using hematoxylin-eosin stain. Other sections were processed for immunohistochemical examination. For MMP-9, the area fraction of the positive cells was measured, and the percentage of the MMP-9-immunopositive area to the total area of the microscopic field was calculated. For gram-negative stain cells, the number of cells showing the pink-red color was counted per microscopic field. The Student's t test was used to compare the SYM and ASYM groups. The Pearson correlation coefficient was used to determine a significant correlation between the number of cells and the MMP-9 level. The significance level was set at P ≤ .05. The SYM group showed a statistically significantly higher mean number of gram-negative cells (P = .001) and MMP-9 area percent (P < .001) than the ASYM group. There was a statistically significant positive (r = .927) correlation between the number of gram-negative cells and the MMP-9 area percent (P< .001). There is good evidence to suspect a significant role of gram-negative bacteria and MMP-9 in symptomatic periapical lesions. Copyright © 2013 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Prevalence of antibiotic-resistant Gram-negative bacteria associated with the red-eared slider (Trachemys scripta elegans).

PubMed

Liu, Dandan; Wilson, Cailin; Hearlson, Jodie; Singleton, Jennifer; Thomas, R Brent; Crupper, Scott S

2013-09-01

Free-ranging Red-eared Sliders (Trachemys scripta elegans) were captured from farm ponds located in the Flint Hills of Kansas and a zoo pond in Emporia, Kansas, USA, to evaluate their enteric bacterial flora and associated antibiotic resistance. Bacteria obtained from cloacal swabs were composed of six different Gram-negative genera. Although antibiotic resistance was present in turtles captured from both locations, 40 and 49% of bacteria demonstrated multiple antibiotic resistance to four of the antibiotics tested from the zoo captured and Flint Hills ponds turtles, respectively. These data illustrate environmental antibiotic resistance is widespread in the bacterial flora obtained from Red-eared Sliders in east central Kansas.

Peptidoglycan turnover and recycling in Gram-positive bacteria.

PubMed

Reith, Jan; Mayer, Christoph

2011-10-01

Bacterial cells are protected by an exoskeleton, the stabilizing and shape-maintaining cell wall, consisting of the complex macromolecule peptidoglycan. In view of its function, it could be assumed that the cell wall is a static structure. In truth, however, it is steadily broken down by peptidoglycan-cleaving enzymes during cell growth. In this process, named cell wall turnover, in one generation up to half of the preexisting peptidoglycan of a bacterial cell is released from the wall. This would result in a massive loss of cell material, if turnover products were not be taken up and recovered. Indeed, in the Gram-negative model organism Escherichia coli, peptidoglycan recovery has been recognized as a complex pathway, named cell wall recycling. It involves about a dozen dedicated recycling enzymes that convey cell wall turnover products to peptidoglycan synthesis or energy pathways. Whether Gram-positive bacteria also recover their cell wall is currently questioned. Given the much larger portion of peptidoglycan in the cell wall of Gram-positive bacteria, however, recovery of the wall material would provide an even greater benefit in these organisms compared to Gram-negatives. Consistently, in many Gram-positives, orthologs of recycling enzymes were identified, indicating that the cell wall may also be recycled in these organisms. This mini-review provides a compilation of information about cell wall turnover and recycling in Gram-positive bacteria during cell growth and division, including recent findings relating to muropeptide recovery in Bacillus subtilis and Clostridium acetobutylicum from our group. Furthermore, the impact of cell wall turnover and recycling on biotechnological processes is discussed.

Native and heterologous production of bacteriocins from gram-positive microorganisms.

PubMed

Muñoz, Mabel; Jaramillo, Diana; Melendez, Adelina Del Pilar; J Alméciga-Diaz, Carlos; Sánchez, Oscar F

2011-12-01

In nature, microorganisms can present several mechanisms for setting intercommunication and defense. One of these mechanisms is related to the production of bacteriocins, which are peptides with antimicrobial activity. Bacteriocins can be found in Gram-positive and Gram-negative bacteria. Nevertheless, bacteriocins produced by Gram-positive bacteria are of particular interest due to the industrial use of several strains that belong to this group, especially lactic acid bacteria (LAB), which have the status of generally recognized as safe (GRAS) microorganisms. In this work, we will review recent tendencies in the field of invention and state of art related to bacteriocin production by Gram-positive microorganism. Hundred-eight patents related to Gram-positive bacteriocin producers have been disclosed since 1965, from which 57% are related bacteriocins derived from Lactococcus, Lactobacillus, Streptococcus, and Pediococcus strains. Surprisingly, patents regarding heterologous bacteriocins production were mainly presented just in the last decade. Although the major application of bacteriocins is concerned to food industry to control spoilage and foodborne bacteria, during the last years bacteriocin applications have been displacing to the diagnosis and treatment of cancer, and plant disease resistance and growth promotion.

Antibacterial properties of tualang honey and its effect in burn wound management: a comparative study

PubMed Central

2010-01-01

Background The use of honey as a natural product of Apis spp. for burn treatment has been widely applied for centuries. Tualang honey has been reported to have antibacterial properties against various microorganisms, including those from burn-related diagnoses, and is cheaper and easier to be absorbed by Aquacel dressing. The aim of this study is to evaluate the potential antibacterial properties of tualang honey dressing and to determine its effectiveness as a partial thickness burn wound dressing. Methods In order to quantitate the bioburden of the swabs, pour plates were performed to obtain the colony count (CFU/ml). Swabs obtained from burn wounds were streaked on blood agar and MacConkey agar for bacterial isolation and identification. Later, antibacterial activity of Aquacel-tualang honey, Aquacel-Manuka honey, Aquacel-Ag and Aquacel- plain dressings against bacteria isolated from patients were tested (in-vitro) to see the effectiveness of those dressings by zone of inhibition assays. Results Seven organisms were isolated. Four types of Gram-negative bacteria, namely Enterobacter cloacae, Klebsiella pneumoniae, Pseudomonas spp. and Acinetobacter spp., and three Gram-positive bacteria, namely Staphylococcus aureus, coagulase-negative Staphylococcus aureus (CONS) and Streptococcus spp., were isolated. Total bacterial count decreased on day 6 and onwards. In the in-vitro antibacterial study, Aquacel-Ag and Aquacel-Manuka honey dressings gave better zone of inhibition for Gram positive bacteria compared to Aquacel-Tualang honey dressing. However, comparable results were obtained against Gram negative bacteria tested with Aquacel-Manuka honey and Aquacel-Tualang honey dressing. Conclusions Tualang honey has a bactericidal as well as bacteriostatic effect. It is useful as a dressing, as it is easier to apply and is less sticky compared to Manuka honey. However, for Gram positive bacteria, tualang honey is not as effective as usual care products such as silver-based dressing or medical grade honey dressing. PMID:20576085

Antibacterial properties of tualang honey and its effect in burn wound management: a comparative study.

PubMed

Nasir, Nur-Azida Mohd; Halim, Ahmad Sukari; Singh, Kirnpal-Kaur Banga; Dorai, Ananda Aravazhi; Haneef, Mehru-Nisha Muhammad

2010-06-24

The use of honey as a natural product of Apis spp. for burn treatment has been widely applied for centuries. Tualang honey has been reported to have antibacterial properties against various microorganisms, including those from burn-related diagnoses, and is cheaper and easier to be absorbed by Aquacel dressing. The aim of this study is to evaluate the potential antibacterial properties of tualang honey dressing and to determine its effectiveness as a partial thickness burn wound dressing. In order to quantitate the bioburden of the swabs, pour plates were performed to obtain the colony count (CFU/ml). Swabs obtained from burn wounds were streaked on blood agar and MacConkey agar for bacterial isolation and identification. Later, antibacterial activity of Aquacel-tualang honey, Aquacel-Manuka honey, Aquacel-Ag and Aquacel- plain dressings against bacteria isolated from patients were tested (in-vitro) to see the effectiveness of those dressings by zone of inhibition assays. Seven organisms were isolated. Four types of Gram-negative bacteria, namely Enterobacter cloacae, Klebsiella pneumoniae, Pseudomonas spp. and Acinetobacter spp., and three Gram-positive bacteria, namely Staphylococcus aureus, coagulase-negative Staphylococcus aureus (CONS) and Streptococcus spp., were isolated. Total bacterial count decreased on day 6 and onwards. In the in-vitro antibacterial study, Aquacel-Ag and Aquacel-Manuka honey dressings gave better zone of inhibition for Gram positive bacteria compared to Aquacel-Tualang honey dressing. However, comparable results were obtained against Gram negative bacteria tested with Aquacel-Manuka honey and Aquacel-Tualang honey dressing. Tualang honey has a bactericidal as well as bacteriostatic effect. It is useful as a dressing, as it is easier to apply and is less sticky compared to Manuka honey. However, for Gram positive bacteria, tualang honey is not as effective as usual care products such as silver-based dressing or medical grade honey dressing.

A novel phagocytic receptor (CgNimC) from Pacific oyster Crassostrea gigas with lipopolysaccharide and gram-negative bacteria binding activity.

PubMed

Wang, Weilin; Liu, Rui; Zhang, Tao; Zhang, Ran; Song, Xuan; Wang, Lingling; Song, Linsheng

2015-03-01

Phagocytosis is an evolutionarily conserved process to ingest the invading microbes and apoptotic or necrotic corpses, playing vital roles in defensing invaders and maintenance of normal physiological conditions. In the present study, a new Nimrod family phagocytic receptor with three EGF-like domains was identified in Pacific oyster Crassostrea gigas (designated CgNimC). CgNimC shared homology with other identified multiple EGF-like domain containing proteins. The mRNA transcripts of CgNimC were mainly distributed in mantle and hemocytes. Its relative expression level in hemocytes was significantly (P < 0.01) up-regulated after the injection of bacteria Vibrio anguillarum. Different to the NimC in Drosophila and Anopheles gambiae, the recombinant protein of CgNimC (rCgNimC) could bind directly to two gram-negative bacteria V. anguillarum and Vibrio splendidus, but not to gram-positive bacteria Staphylococci aureus, Micrococcus luteus or fungi Yarrowia lipolytica and Pichia pastoris. The affinity of rCgNimC toward M. luteus and Y. lipolytica was enhanced when the microorganisms were pre-incubated with the cell free hemolymph. rCgNimC exhibited higher affinity to lipopolysaccharide (LPS) and relatively lower affinity to peptidoglycan (PGN), while no affinity to glucan (GLU). After the CgNimC receptor was blocked by anti-rCgNimC antibody in vitro, the phagocytic rate of hemocytes toward two gram-negative bacteria V. anguillarum and V. splendidus was reduced significantly (P < 0.05), but no significant change of phagocytic rate was observed toward M. luteus and Y. lipolytica. All these results implied that CgNimC, with significant binding capability to LPS and gram-negative bacteria, was a novel phagocytic receptor involved in immune response of Pacific oyster. Further, it was speculated that receptors of Nimrod family might function as a phagocytic receptor to recognize PAMPs on the invaders and its recognition could be promoted by opsonization of molecules in hemolymph. Copyright © 2014 Elsevier Ltd. All rights reserved.

Besifloxacin, a novel fluoroquinolone, has broad-spectrum in vitro activity against aerobic and anaerobic bacteria.

PubMed

Haas, Wolfgang; Pillar, Chris M; Zurenko, Gary E; Lee, Jacqueline C; Brunner, Lynne S; Morris, Timothy W

2009-08-01

The antibacterial spectrum of besifloxacin, a novel fluoroquinolone recently approved for treatment of ocular infections, was studied using 2,690 clinical isolates representing 40 species. Overall, besifloxacin was the most potent agent tested against gram-positive pathogens and anaerobes and was generally equivalent to comparator fluoroquinolones in activity against most gram-negative pathogens. Besifloxacin demonstrated potent, broad-spectrum activity, which was particularly notable against gram-positive and gram-negative isolates that were resistant to other fluoroquinolones and classes of antibacterial agents.

Multiparametric Profiling for Identification of Chemosensitizers against Gram-Negative Bacteria

PubMed Central

Lôme, Vincent; Brunel, Jean-Michel; Pagès, Jean-Marie; Bolla, Jean-Michel

2018-01-01

Antibiotic resistance is now a worldwide therapeutic problem. Since the beginning of anti-infectious treatment bacteria have rapidly shown an incredible ability to develop and transfer resistance mechanisms. In the last decades, the design variation of pioneer bioactive molecules has strongly improved their activity and the pharmaceutical companies partly won the race against the clock. Since the 1980s, the new classes of antibiotics that emerged were mainly directed to Gram-positive bacteria. Thus, we are now facing to multidrug-resistant Gram-negative bacteria, with no therapeutic options to deal with them. These bacteria are mainly resistant because of their double membrane that conjointly impairs antibiotic accumulation and extrudes these molecules when entered. The main challenge is to allow antibiotics to cross the impermeable envelope and reach their targets. One promising solution would be to associate, in a combination therapy, a usual antibiotic with a non-antibiotic chemosensitizer. Nevertheless, for effective drug discovery, there is a prominent lack of tools required to understand the rules of permeation and accumulation into Gram-negative bacteria. By the use of a multidrug-resistant enterobacteria, we introduce a high-content screening procedure for chemosensitizers discovery by quantitative assessment of drug accumulation, alteration of barriers, and deduction of their activity profile. We assembled and analyzed a control chemicals library to perform the proof of concept. The analysis was based on real-time monitoring of the efflux alteration and measure of the influx increase in the presence of studied compounds in an automatized bio-assay. Then, synergistic activity of compounds with an antibiotic was studied and kinetic data reduction was performed which led to the calculation of a score for each barrier to be altered. PMID:29556218