Characterizing the Catalytic Potential of Deinococcus, Arthrobacter and other Robust Bacteria in Contaminated Subsurface Environments of the Hanford Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fredrickson, Jim K.; Daly, Michael J.

2006-06-01

Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR), desiccation, and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus & Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella & Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny, where very high and verymore » low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR (http://cfyn.ifas.ufl.edu/radiation.pdf).« less

Evaluation of antibacterial properties of Barium Zirconate Titanate (BZT) nanoparticle

PubMed Central

Mohseni, Simin; Aghayan, Mahdi; Ghorani-Azam, Adel; Behdani, Mohammad; Asoodeh, Ahmad

2014-01-01

So far, the antibacterial activity of some organic and inorganic compounds has been studied. Barium zirconate titanate [Ba(ZrxTi1-x)O3] (x = 0.05) nanoparticle is an example of inorganic materials. In vitro studies have provided evidence for the antibacterial activity of this nanoparticle. In the current study, the nano-powder was synthesized by sol-gel method. X-ray diffraction showed that the powder was single-phase and had a perovskite structure at the calcination temperature of 1000 °C. Antibacterial activity of the desired nanoparticle was assessed on two gram-positive (Staphylococcus aureus PTCC1431 and Micrococcus luteus PTCC1625) and two gram-negative (Escherichia coli HP101BA 7601c and clinically isolated Klebsiella pneumoniae) bacteria according to Radial Diffusion Assay (RDA). The results showed that the antibacterial activity of BZT nano-powder on both gram-positive and gram-negative bacteria was acceptable. The minimum inhibitory concentration of this nano-powder was determined. The results showed that MIC values for E. coli, K. pneumoniae, M. luteus and S. aureus were about 2.3 μg/mL, 7.3 μg/mL, 3 μg/mL and 12 μg/mL, respectively. Minimum bactericidal concentration (MBC) was also evaluated and showed that the growth of E. coli, K. pneumoniae, M. luteus and S. aureus could be decreased at 2.3, 14, 3 and 18 μg/mL of BZT. Average log reduction in viable bacteria count in time-kill assay ranged between 6 Log10 cfu/mL to zero after 24 h of incubation with BZT nanoparticle. PMID:25763046

Structural changes and cellular localization of resuscitation-promoting factor in environmental isolates of Micrococcus luteus.

PubMed

Koltunov, Viktoria; Greenblatt, Charles L; Goncharenko, Anna V; Demina, Galya R; Klein, Benjamin Y; Young, Michael; Kaprelyants, Arseny S

2010-02-01

Dormancy among nonsporulating actinobacteria is now a widely accepted phenomenon. In Micrococcus luteus, the resuscitation of dormant cells is caused by a small secreted protein (resuscitation-promoting factor, or Rpf) that is found in "spent culture medium." Rpf is encoded by a single essential gene in M. luteus. Homologs of Rpf are widespread among the high G + C Gram-positive bacteria, including mycobacteria and streptomycetes, and most organisms make several functionally redundant proteins. M. luteus Rpf comprises a lysozyme-like domain that is necessary and sufficient for activity connected through a short linker region to a LysM motif, which is present in a number of cell-wall-associated enzymes. Muralytic activity is responsible for resuscitation. In this report, we characterized a number of environmental isolates of M. luteus, including several recovered from amber. There was substantial variation in the predicted rpf gene product. While the lysozyme-like and LysM domains showed little variation, the linker region was elongated from ten amino acid residues in the laboratory strains to as many as 120 residues in one isolate. The genes encoding these Rpf proteins have been characterized, and a possible role for the Rpf linker in environmental adaptation is proposed. The environmental isolates show enhanced resistance to lysozyme as compared with the laboratory strains and this correlates with increased peptidoglycan acetylation. In strains that make a protein with an elongated linker, Rpf was bound to the cell wall, rather than being released to the growth medium, as occurs in reference strains. This rpf gene was introduced into a lysozyme-sensitive reference strain. Both rpf genes were expressed in transformants which showed a slight but statistically significant increase in lysozyme resistance.

Survival of Microorganisms in Nature.

DTIC Science & Technology

1982-04-07

number) Survival of bacteria; Death of bacteria; Cysts; Dormancy; Pseudomonas aeruginosa; Azotobacter; Chemotaxis; Micrococcus luteus; Predation...attracted to and rapidly destroys (lyses) added Micrococcus luteus cells. There is also attack of predator on predator in this system. DO 1 DIT1 473 Oor I OV...and on laboratory media. 4 1 SUMMARY OF IMPORTANT RESULTS Micrococcus luteus was shown to survive only poorly in soil (Casida, 1980a). This was

Alkylation Induced DNA Repair and Mutagenesis in Escherichia coli.

DTIC Science & Technology

1987-11-23

III (Gates and inn, 1977), Micrococcus luteus UV endo- nuclease (Grossman et al, 1978) and bacteriophage T UV endonuclease (Warner et al, 1980) have DNA...34, Garland Publishing, Inc. New York & London USA. Ather, A., Z. Ahmed and S. Riazxxddin, 1984. Adaptive response of Micrococcus luteus to alkylating...Laval, J., 3. Pierre and F. Laval. 1981. Release of 7-nmthylguanine residues frain alkylated ENA by extracts of Micrococcus luteus and Escherichia

Emended descriptions of the genus Micrococcus, Micrococcus luteus (Cohn 1872) and Micrococcus lylae (Kloos et al. 1974).

PubMed

Wieser, Monika; Denner, Ewald B M; Kämpfer, Peter; Schumann, Peter; Tindall, Brian; Steiner, Ulrike; Vybiral, Dietmar; Lubitz, Werner; Maszenan, A M; Patel, B K C; Seviour, Robert J; Radax, Christian; Busse, Hans-Jürgen

2002-03-01

Nine yellow-pigmented, spherical bacterial strains isolated from a medieval wall painting (strain D7), from indoor air (strains 3, 6, 7, 13C2, 38, 83 and 118) and from an activated-sludge plant (strain Ballarat) were classified by a polyphasic approach. Analyses of the 16S rRNA gene sequences of three representatives (strains D7, 118 and Ballarat) indicated that they all belong to the genus Micrococcus. The three isolates shared the highest sequence similarities with Micrococcus luteus DSM 20030T (97.9-98%), Micrococcus antarcticus AS 1.2372T (97.9-98.3%) and Micrococcus lylae DSM 20315T (97.5-97.9%). DNA-DNA reassociation studies clearly demonstrated that all nine isolates belong to the species M. luteus. However, neither their chemotaxonomic features nor their physiological and biochemical properties were consistent with those of M. luteus DSM 20030T. In contrast to M. luteus DSM 20030T, all isolates investigated possessed MK-8(H2) as the major respiratory quinone, and strain Ballarat had an A4alpha peptidoglycan type. On the basis of analyses of their Fourier transform-infrared spectroscopy spectra, isolates D7, 3, 6, 7, 13C2, 38, 83 and 118 could be grouped into a single cluster separate from M. luteus DSM 20030T, strain Ballarat and M. lylae DSM 20315T. In addition, all these isolates could be distinguished from M. luteus DSM 20030T by their ability to assimilate D-maltose, D-trehalose, DL-3-hydroxybutyrate, DL-lactate, pyruvate and L-histidine and to hydrolyse casein. Strains D7, 3, 6, 7, 13C2, 38, 83 and 118 differed from both M. luteus DSM 20030T and strain Ballarat by their ability to assimilate acetate, L-phenylalanine, L-serine and phenylacetate. Furthermore, REP-PCR fingerprinting yielded one common band for these strains, whereas this band was not observed for M. luteus DSM 20030T, strain Ballarat or M. lylae DSM 20315T. On the basis of these data, the species M. luteus can be divided into three biovars that are distinguished by several chemotaxonomic and biochemical traits: biovar I, represented by M. luteus DSM 20030T; biovar II, represented by strains D7 (= DSM 14234 = CCM 4959), 3, 6, 7, 13C2, 38, 83 and 118; and biovar III, represented by strain Ballarat (= DSM 14235 = CCM 4960). On the basis of the results generated in this study, emended descriptions of the genus Micrococcus and the species M. luteus and M. lylae are given.

Antioxidant and antibacterial properties of green, black, and herbal teas of Camellia sinensis.

PubMed

Chan, Eric W C; Soh, Eu Ying; Tie, Pei Pei; Law, Yon Peng

2011-10-01

The role of non-polymeric phenolic (NP) and polymeric tannin (PT) constituents in the antioxidant and antibacterial properties of six brands of green, black, and herbal teas of Camellia sinensis were investigated. Total phenolic content (TPC) and ascorbic acid equivalent antioxidant capacity (AEAC) were assessed using the Folin-Ciocalteu and 2,2-diphenyl-1-picrylhydrazyl (DPPH) assays, respectively. Minimum inhibitory dose (MID) against Gram-positive Micrococcus luteus, Staphylococcus aureus, and Bacillus cereus, and Gram-negative. Escherichia coli, Salmonella typhi, and Pseudomonas aeruginosa was assessed using the disc-diffusion method. Teas were extracted with hot water successively three times for one hour each time. The extracts were fractionated using Sephadex LH-20 column chromatography to obtain the NP and PT constituents. Extraction yields ranged from 12 to 23%. Yields of NP fractions (70-81%) were much higher than those of PT fractions (1-11%), suggesting that the former are the major tea components. Ranking of antioxidant properties of extracts was green tea>black tea>herbal tea. For all six teas, antioxidant properties of PT fractions were significantly higher than extracts and NP fractions. Extracts and fractions of all six teas showed no activity against the three Gram-negative bacteria. Green teas inhibited all three Gram-positive bacteria with S. aureus being the least susceptible. Black and herbal teas inhibited the growth of M. luteus and B. cereus, but not S. aureus. The most potent were the PT fractions of Boh Cameron Highlands and Ho Yan Hor with MID of 0.01 and 0.03 mg/disc against M. luteus. Results suggested that NP constituents are major contributors to the antioxidant and antibacterial properties of teas of C. sinensis. Although PT constituents have stronger antioxidant and antibacterial properties, they constitute only a minor component of the teas.

Standardized Procedures for Use of Nucleic Acid-Based Tools

DTIC Science & Technology

2008-08-01

Dhc size or cell wall characteristics including Brevundimonas diminuta (small), Micrococcus sp. (small coccoid) and Halobacterium sp. (Dhc-like cell...Halobacterium species as a Dhc surrogate. Another potential surrogate based on size and shape is Micrococcus species including Micrococcus luteus... Micrococcus luteus (ATCC-4442) are relatively small (1,000 nm) spherical bacteria (Madigan et al., 2006). Due to the fact that introduction and

Synthesis of novel antimicrobial aryl himachalene derivatives from naturally occurring himachalenes

PubMed Central

Chaudhary, Abha; Sood, Swati; Das, Pralay; Kaur, Pushpinder; Mahajan, Isha; Gulati, Arvind; Singh, Bikram

2014-01-01

Five new 2,9,9-trimethyl-6,7,8,9-tetrahydro-benzocyclohepten-5-ylidene-amine derivatives (16a-16e) were synthesized from α-dehydro-ar-himachalene (11) that was originally prepared from an isomeric mixture of α, β and γ himachalenes (10), the abundant sesquiterpenes of Cedrus deodara essential oil. In addition, different aryl himachalenes derivatives (9, 12, 14 and 15) were also formed from 11. The structures of the synthesized compounds were confirmed on the basis of their NMR, IR and mass spectral data. The prepared compounds were tested against a group of sixteen organisms including gram positive and gram negative bacterial and fungal strains. The introduction of a series of substituted imine groups into aryl himachalenes at 5th position (16a-16e) enhanced antimicrobial activity as compared to the aromatized derivatives (9, 12, 14 and 15) against gram-positive bacteria Bacillus subtilis, Micrococcus luteus and Staphylococcus aureus, and mycotoxigenic fungi Aspergillus parasiticus, A. ochraceous and A. sydowii. graphical Abstract, Figure 1(Fig. 1) PMID:26417335

21 CFR 610.12 - Sterility.

Code of Federal Regulations, 2010 CFR

2010-04-01

.... Non-spore-formers 3. Candida albicans (ATCC No. 10231) Do. 4. Micrococcus luteus (ATCC No. 9341) Do. 5.... 6633) 20 to 25 °C. Non-spore-formers 2. Candida albicans (ATCC No. 10231) Do. 3. Micrococcus luteus...

Monohexosylceramides from Rhizopus Species Isolated from Brazilian Caatinga: Chemical Characterization and Evaluation of Their Anti-Biofilm and Antibacterial Activities.

PubMed

Vieira, Edson Rodrigues; Xisto, Mariana Ingrid Dutra da Silva; Pele, Milagre Américo; Alviano, Daniela Sales; Alviano, Celuta Sales; Barreto-Bergter, Eliana; de Campos-Takaki, Galba Maria

2018-06-01

Monohexosylceramides (CMHs) are highly conserved fungal glycosphingolipids playing a role in several cellular processes such as growth, differentiation and morphological transition. In this study, we report the isolation, purification and chemical characterization of CMHs from Rhizopus stolonifer and R. microspores . Using positive ion mode ESI-MS, two major ion species were observed at m / z 750 and m / z 766, respectively. Both ion species consisted of a glucose/galactose residue attached to a ceramide moiety containing 9-methyl-4,8-sphingadienine with an amidic linkage to a hydroxylated C16:0 fatty acid. The antimicrobial activity of CMH was evaluated against Gram positive and Gram negative bacteria using the agar diffusion assay. CMH from both Rhizopus species inhibited the growth of Bacillus terrae , Micrococcus luteus ( M. luteus ) and Pseudomonas stutzeri ( P. stutzeri ) with a MIC 50 of 6.25, 6.25 and 3.13 mg/mL, respectively. The bactericidal effect was detected only for M. luteus and P. stutzeri , with MBC values of 25 and 6.25 mg/mL, respectively. Furthermore, the action of CMH on the biofilm produced by methicillin-resistant Staphylococcus aureus (MRSA) was analyzed using 12.5 and 25 mg/mL of CMH from R. microsporus . Total biofilm biomass, biofilm matrix and viability of the cells that form the biofilm structure were evaluated. CMH from R. microsporus was able to inhibit the MRSA biofilm formation in all parameters tested.

Antibacterial activity of oregano (Origanum vulgare Linn.) against gram positive bacteria.

PubMed

Saeed, Sabahat; Tariq, Perween

2009-10-01

The present investigation is focused on antibacterial potential of infusion, decoction and essential oil of oregano (Origanum vulgare) against 111 Gram-positive bacterial isolates belonging to 23 different species related to 3 genera. Infusion and essential oil exhibited antibacterial activity against Staphylococcus saprophyticus, S. aureus, Micrococcus roseus, M. kristinae, M. nishinomiyaensis, M. lylae, M. luteus, M. sedentarius, M. varians, Bacillus megaterium, B. thuringiensis, B. alvei, B. circulans, B. brevis, B. coagulans, B. pumilus, B. laterosporus, B. polymyxa, B. macerans, B. subtilis, B. firmus, B. cereus and B. lichiniformis. The infusion exhibited maximum activity against B. laterosporus (17.5 mm mean zone of inhibition+/-1.5 Standard deviation) followed by B. polymyxa (17.0 mm+/-2.0 SD) and essential oil of oregano exhibited maximum activity against S. saprophyticus (16.8 mm+/-1.8 SD) followed by B. circulans (14.5 mm+/-0.5 SD). While all these tested isolates were found resistant to decoction of oregano.

In Vitro Repair of UV-Irradiated Micrococcus luteus Bacteriophage N1 Transfecting DNA 1

PubMed Central

Mahler, Inga; George, Jeanne; Grossman, Lawrence

1974-01-01

Calcium-treated UV-sensitive, host cell reactivation− strains of Micrococcus luteus are infected with UV-irradiated N1 DNA. In strains lacking UV endonuclease, in vitro treatment of the irradiated DNA results in transfection enhancement. PMID:4823319

University Research Initiative Program for Combat Readiness

DTIC Science & Technology

1999-05-01

found in sponge-associated bacteria Micrococcus luteus (Bultel-Ponce et al., 1998). Such compounds have antimicrobial activity. Water contact angles...Guyot, M. 1998. Metabolites from the sponge-associated bacterium Micrococcus luteus. J. Mar. Biotechnol. 6:233-236. 3. Incze, B.I., Sea Technol. 1996, 37

Bioaerosol Exposure to Filtering Facepiece Respirators in a Clinical Environment (Author’s Final Manuscript)

DTIC Science & Technology

2013-03-11

Gram-positive staphylococci and Micrococcus spp . 73% of the Gram-positive and 67% of the Gram-negative isolates were resistant to oxacillin...staphylococci and Micrococcus spp . 73% of the Gram-positive and 67% of the Gram-negative isolates were resistant to oxacillin. Vancomycin...identified 26 species, primarily coagulase- negative staphylococci (CNS) and Micrococcus spp. Acinetobacter baumanii/calcoaceticus and S. aureus were

Relative Roles of the Cellular and Humoral Responses in the Drosophila Host Defense against Three Gram-Positive Bacterial Infections

PubMed Central

Cho, Ju Hyun; Lee, Janice; Lafarge, Marie-Céline; Kocks, Christine; Ferrandon, Dominique

2011-01-01

Background Two NF-kappaB signaling pathways, Toll and immune deficiency (imd), are required for survival to bacterial infections in Drosophila. In response to septic injury, these pathways mediate rapid transcriptional activation of distinct sets of effector molecules, including antimicrobial peptides, which are important components of a humoral defense response. However, it is less clear to what extent macrophage-like hemocytes contribute to host defense. Methodology/Principal Findings In order to dissect the relative importance of humoral and cellular defenses after septic injury with three different Gram-positive bacteria (Micrococcus luteus, Enterococcus faecalis, Staphylococcus aureus), we used latex bead pre-injection to ablate macrophage function in flies wildtype or mutant for various Toll and imd pathway components. We found that in all three infection models a compromised phagocytic system impaired fly survival – independently of concomitant Toll or imd pathway activation. Our data failed to confirm a role of the PGRP-SA and GNBP1 Pattern Recognition Receptors for phagocytosis of S. aureus. The Drosophila scavenger receptor Eater mediates the phagocytosis by hemocytes or S2 cells of E. faecalis and S. aureus, but not of M. luteus. In the case of M. luteus and E. faecalis, but not S. aureus, decreased survival due to defective phagocytosis could be compensated for by genetically enhancing the humoral immune response. Conclusions/Significance Our results underscore the fundamental importance of both cellular and humoral mechanisms in Drosophila immunity and shed light on the balance between these two arms of host defense depending on the invading pathogen. PMID:21390224

Natural History of Multi-Drug Resistant Organisms in a New Military Medical Facility

DTIC Science & Technology

2012-10-01

Enterobacter cloacae  Maternity Ward  05.312  Sink top  Micrococcus  luteus  Maternity Ward  05.312  Telephone  Pantoea agglomerans  Maternity Ward...Acinetobacter baumannii  Surgical Ward  06.316  Call box  Acinetobacter  baumannii/calcoaceticus complex  Surgical Ward  06.316  Sink top  Micrococcus  luteus...Medical Ward  07.216  Sink top  Micrococcus  luteus  Medical Ward  07.216  Room Sink  Staphylococcus sciuri  ICU  02.123  Toilet seat  Staphylococcus

Sterilization effects of atmospheric cold plasma brush

NASA Astrophysics Data System (ADS)

Yu, Q. S.; Huang, C.; Hsieh, F.-H.; Huff, H.; Duan, Yixiang

2006-01-01

This study investigated the sterilization effects of a brush-shaped plasma created at one atmospheric pressure. A population of 1.0×104-1.0×105 Escherichia coli or Micrococcus luteus bacteria was seeded in filter paper media and then subjected to Ar and/or Ar +O2 plasmas. A complete kill of the Micrococcus luteus required about 3 min argon plasma exposures. With oxygen addition into the argon plasma gas streams, a complete kill of the bacteria needed only less than 1 min plasma exposure for Micrococcus luteus and about 2 min exposure for Escherichia coli. The plasma treatment effects on the different bacteria cell structures were examined using scanning electron microscopy.

Sterilization effects of atmospheric cold plasma brush

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Q.S.; Huang, C.; Hsieh, F.-H.

2006-01-02

This study investigated the sterilization effects of a brush-shaped plasma created at one atmospheric pressure. A population of 1.0x10{sup 4}-1.0x10{sup 5} Escherichia coli or Micrococcus luteus bacteria was seeded in filter paper media and then subjected to Ar and/or Ar+O{sub 2} plasmas. A complete kill of the Micrococcus luteus required about 3 min argon plasma exposures. With oxygen addition into the argon plasma gas streams, a complete kill of the bacteria needed only less than 1 min plasma exposure for Micrococcus luteus and about 2 min exposure for Escherichia coli. The plasma treatment effects on the different bacteria cell structuresmore » were examined using scanning electron microscopy.« less

Antimicrobial and antifungal activities of the extracts and essential oils of Bidens tripartita.

PubMed

Tomczykowa, Monika; Tomczyk, Michał; Jakoniuk, Piotr; Tryniszewska, Elzbieta

2008-01-01

The aim of this study was to determine the antibacterial and antifungal properties of the extracts, subextracts and essential oils of Bidens tripartita flowers and herbs. In the study, twelve extracts and two essential oils were investigated for activity against different Gram-positive Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, Gram-negative bacteria Escherichia coli, E. coli (beta-laktamase+), Klebsiella pneumoniae (ESBL+), Pseudomonas aeruginosa and some fungal organisms Candida albicans, C. parapsilosis, Aspergillus fumigatus, A. terreus using a broth microdilution and disc diffusion methods. The results obtained indicate antimicrobial activity of the tested extracts (except butanolic extracts), which however did not inhibit the growth of fungi used in this study. Bacteriostatic effect of both essential oils is insignificant, but they have strong antifungal activity. These results support the use of B. tripartita to treat a microbial infections and it is indicated as an antimicrobial and antifungal agent, which may act as pharmaceuticals and preservatives.

Taxonomic dissection of the genus Micrococcus: Kocuria gen. nov., Nesterenkonia gen. nov., Kytococcus gen. nov., Dermacoccus gen. nov., and Micrococcus Cohn 1872 gen. emend.

PubMed

Stackebrandt, E; Koch, C; Gvozdiak, O; Schumann, P

1995-10-01

The results of a phylogenetic and chemotaxonomic analysis of the genus Micrococcus indicated that it is significantly heterogeneous. Except for Micrococcus lylae, no species groups phylogenetically with the type species of the genus, Micrococcus luteus. The other members of the genus form three separate phylogenetic lines which on the basis of chemotaxonomic properties can be assigned to four genera. These genera are the genus Kocuria gen. nov. for Micrococcus roseus, Micrococcus varians, and Micrococcus kristinae, described as Kocuria rosea comb. nov., Kocuria varians comb. nov., and Kocuria kristinae comb. nov., respectively; the genus Nesterenkonia gen. nov. for Micrococcus halobius, described as Nesterenkonia halobia comb. nov.; the genus Nesterenkonia gen. nov. for Micrococcus halobius, described as Nesterenkonia halobia comb. nov.; the genus Dermacoccus gen. nov. for Micrococcus nishinomiyaensis, described as Dermacoccus nishinomiyaensis comb. nov.; and the genus Kytocossus gen. nov. for Micrococcus sedentarius, described as Kytococcus sedentarius comb. nov. M. luteus and M. lylae, which are closely related phylogenetically but differ in some chemotaxonomic properties, are the only species that remain in the genus Micrococcus Cohn 1872. An emended description of the genus Micrococcus is given [corrected].

Detailed Investigations on the Solid Cell Culture and Antimicrobial Activities of the Iranian Arnebia euchroma

PubMed Central

Haghbeen, K.; Pourmolaei, S.; Mareftjo, M. J.; Mousavi, A.; Akbari Noghabi, K.; Hosseini Shirazi, F.; Meshkat, A.

2011-01-01

In pursuit of strong shikalkin-producing cell lines, seeds of the Iranian Arnebia euchroma were collected from Dena altitudes in the central Zagross. Chemical analysis showed that the dried root of the plant contained about 8.5% (w/w) shikalkin pigment. The root explants of the young plantlets, obtained from the germinated seeds, were used for establishing callus. Then, parameters effective on proliferation and pigment production of the resulting calli were studied in detail. Accordingly, two modified media called mLS and mM9 were optimized for propagation and pigment production, respectively. Using these media, the biomass of the A.euchroma calli was increased to 600%, and the pigment production reached to a maximum of 16.3 mg per gram of the wet biomass in a period of a subculture (21 days). Parallel to these experiments, the antimicrobial activity of shikalkin pigment was examined on some fungi and Gram-positive and Gram-negative bacteria. Results indicated that the pigment was almost ineffective on fungi and Gram-negative bacteria, but it was meaningfully effective against Micrococcus luteus. PMID:21772789

Surface interactions and fouling properties of Micrococcus luteus with microfiltration membranes.

PubMed

Feng, Lei; Li, Xiufen; Song, Ping; Du, Guocheng; Chen, Jian

2011-11-01

This study was conducted to investigate microbial adhesion of Micrococcus luteus to polypropylene (PP) and polyvinylidene fluoride (PVDF) membranes in relation to the variation of the interfacial energies in the membrane-bacteria systems, for revealing effects of short-range surface interactions on filtration behavior. Both the membranes and M. luteus showed typical strong electron donors and hydrophilic properties. The AB component was dominant in the interfacial energies of the two membrane-bacteria systems. M. luteus presented larger negative U(mlb)(XDLVO) to the PP membrane than to the PVDF membrane. The adhesion experiments also proved that M. luteus had higher adhesion percentage to the PP membrane. This study demonstrated that the adhesion potentials of M. luteus to the PP and PVDF membranes might be explained in terms of bacterium, membrane, and intervening medium surface properties, which are mainly determined by the interfacial energies in the systems according to the XDLVO theory.

Micrococcus flavus sp. nov., isolated from activated sludge in a bioreactor.

PubMed

Liu, Xing-Yu; Wang, Bao-Jun; Jiang, Cheng-Ying; Liu, Shuang-Jiang

2007-01-01

Bacterial strain LW4(T) was isolated from activated sludge of a wastewater-treatment bioreactor. Cells of strain LW4(T) were Gram-positive cocci, with a diameter of 0.7-1.0 microm. Colonies produced on LB agar plates were yellow, smooth, circular and 0.5-1.5 mm in diameter. Strain LW4(T) was aerobic and grew over the temperature range 26-34 degrees C and pH range 5-9, with optimal growth at 30.5-31.5 degrees C and pH 6.0-6.2. The cell-wall peptidoglycan of strain LW4(T) contained amino acid residues of lysine, glutamic acid, alanine, glycine and aspartic acid. The most abundant cellular fatty acids of strain LW4(T) were anteiso-C(15 : 0) (32.15 %) and iso-C(15 : 0) (31.65 %). Major respiratory quinones were MK-8(H(2)) (57.3 %) and MK-7(H(2)) (32.9 %). The DNA G+C content was 71.4 mol% (T(m)). 16S rRNA gene sequence analysis indicated that strain LW4(T) was phylogenetically related to members of the genus Micrococcus, with similarities ranging from 96.5 to 97.3 %. Levels of DNA-DNA relatedness of strain LW4(T) to Micrococcus luteus DSM 20030(T), Micrococcus lylae DSM 20315(T) and Micrococcus antarcticus AS 1.2372(T) were 55, 48 and 36 %, respectively. Based on these results, it is concluded that strain LW4(T) represents a novel species of the genus Micrococcus, for which the name Micrococcus flavus sp. nov. is proposed. The type strain is strain LW4(T) (=CGMCC 1.5361(T)=JCM 14000(T)).

[In vitro studies on antioxidant and antimicrobial activities of polysaccharide from Lycoris aurea].

PubMed

Ru, Qiao-Mei; Pei, Zhen-Ming; Zheng, Hai-Lei

2008-10-01

To study the preliminary antioxidant and antimicrobial activities of polysaccharide extracted from Lycoris aurea. The scavenging activities of the polysaccharide in vitro on superoxide radical (O2-*), hydroxyl radical (*OH), alkyl radical (R*) and hydrogen peroxide (H2O2) were investigated by modified chemical systems. Meanwhile, the antimicrobial activities were tested using paper-discagar diffusion method. In general, the antioxidant activities of the polysaccharide were lower compared with Vc. However, the scavenging effects to *OH and H2O2 were parallel to Vc. Meanwhile, polysaccharide from Lycoris aurea had strong antimicrobial activities against Micrococcus luteus, Bacillus pumilus and Staphylococcus aureus. The polysaccharide extracted from L. aurea can scavenge *OH and H2O2 effectively and inhibit Gram-positive bacterias.

Effect of calcium and magnesium on the antimicrobial action of enterocin LR/6 produced by Enterococcus faecium LR/6.

PubMed

Kumar, Manoj; Srivastava, Sheela

2011-06-01

Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Effect of impact stress on microbial recovery on an agar surface.

PubMed Central

Stewart, S L; Grinshpun, S A; Willeke, K; Terzieva, S; Ulevicius, V; Donnelly, J

1995-01-01

Microbial stress due to the impaction of microorganisms onto an agar collection surface was studied experimentally. The relative recovery rates of aerosolized Pseudomonas fluorescens and Micrococcus luteus were determined as a function of the impaction velocity by using a moving agar slide impactor operating over a flow rate range from 3.8 to 40 liters/min yielding impaction velocities from 24 to 250 m/s. As a reference, the sixth stage of the Andersen Six-Stage Viable Particle Sizing Sampler was used at its operating flow rate of 28.3 liters/min (24 m/s). At a collection efficiency of close to 100% for the agar slide impactor, an increase in sampling flow rate and, therefore, in impaction velocity produced a significant decline in the percentage of microorganisms recovered. Conversely, when the collection efficiency was less than 100%, greater recovery and lower injury rates occurred. The highest relative rate of recovery (approximately 51% for P. fluorescens and approximately 62% for M. luteus) was obtained on the complete (Trypticase soy agar) medium at 40 and 24 m/s (6.4 and 3.8 liters/min), respectively. M. luteus demonstrated less damage than P. fluorescens, suggesting the hardy nature of the gram-positive strain versus that of the gram-negative microorganism. Comparison of results from the agar slide and Andersen impactors at the same sampling velocity showed that recovery and injury due to collection depends not only on the magnitude of the impaction velocity but also on the degree to which the microorganisms may be embedded in the collection medium.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7747946

A novel phagocytic receptor (CgNimC) from Pacific oyster Crassostrea gigas with lipopolysaccharide and gram-negative bacteria binding activity.

PubMed

Wang, Weilin; Liu, Rui; Zhang, Tao; Zhang, Ran; Song, Xuan; Wang, Lingling; Song, Linsheng

2015-03-01

Phagocytosis is an evolutionarily conserved process to ingest the invading microbes and apoptotic or necrotic corpses, playing vital roles in defensing invaders and maintenance of normal physiological conditions. In the present study, a new Nimrod family phagocytic receptor with three EGF-like domains was identified in Pacific oyster Crassostrea gigas (designated CgNimC). CgNimC shared homology with other identified multiple EGF-like domain containing proteins. The mRNA transcripts of CgNimC were mainly distributed in mantle and hemocytes. Its relative expression level in hemocytes was significantly (P < 0.01) up-regulated after the injection of bacteria Vibrio anguillarum. Different to the NimC in Drosophila and Anopheles gambiae, the recombinant protein of CgNimC (rCgNimC) could bind directly to two gram-negative bacteria V. anguillarum and Vibrio splendidus, but not to gram-positive bacteria Staphylococci aureus, Micrococcus luteus or fungi Yarrowia lipolytica and Pichia pastoris. The affinity of rCgNimC toward M. luteus and Y. lipolytica was enhanced when the microorganisms were pre-incubated with the cell free hemolymph. rCgNimC exhibited higher affinity to lipopolysaccharide (LPS) and relatively lower affinity to peptidoglycan (PGN), while no affinity to glucan (GLU). After the CgNimC receptor was blocked by anti-rCgNimC antibody in vitro, the phagocytic rate of hemocytes toward two gram-negative bacteria V. anguillarum and V. splendidus was reduced significantly (P < 0.05), but no significant change of phagocytic rate was observed toward M. luteus and Y. lipolytica. All these results implied that CgNimC, with significant binding capability to LPS and gram-negative bacteria, was a novel phagocytic receptor involved in immune response of Pacific oyster. Further, it was speculated that receptors of Nimrod family might function as a phagocytic receptor to recognize PAMPs on the invaders and its recognition could be promoted by opsonization of molecules in hemolymph. Copyright © 2014 Elsevier Ltd. All rights reserved.

Antioxidant, electrochemical, thermal, antimicrobial and alkane oxidation properties of tridentate Schiff base ligands and their metal complexes

NASA Astrophysics Data System (ADS)

Ceyhan, Gökhan; Çelik, Cumali; Uruş, Serhan; Demirtaş, İbrahim; Elmastaş, Mahfuz; Tümer, Mehmet

2011-10-01

In this study, two Schiff base ligands (HL 1 and HL 2) and their Cu(II), Co(II), Ni(II), Pd(II) and Ru(III) metal complexes were synthesized and characterized by the analytical and spectroscopic methods. Alkane oxidation activities of the metal complexes were studied on cyclohexane as substrate. The ligands and their metal complexes were evaluated for their antimicrobial activity against Corynebacterium xerosis, Bacillus brevis, Bacillus megaterium, Bacillus cereus, Mycobacterium smegmatis, Staphylococcus aureus, Micrococcus luteus and Enterococcus faecalis (as Gram-positive bacteria) and Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Yersinia enterocolitica, Klebsiella fragilis, Saccharomyces cerevisiae, and Candida albicans (as Gram-negative bacteria). The antioxidant properties of the Schiff base ligands were evaluated in a series of in vitro tests: 1,1-diphenyl-2-picrylhydrazyl (DPPH rad ) free radical scavenging and reducing power activity of superoxide anion radical generated non-enzymatic systems. Electrochemical and thermal properties of the compounds were investigated.

Pure and zinc doped nano-hydroxyapatite: Synthesis, characterization, antimicrobial and hemolytic studies

NASA Astrophysics Data System (ADS)

Tank, Kashmira P.; Chudasama, Kiran S.; Thaker, Vrinda S.; Joshi, Mihir J.

2014-09-01

The structural, antimicrobial, and hemolytic properties and bioactivity have been studied of pure hydroxyapatite (HAP) and zinc doped hydroxyapatite (Zn-HAP) nano-particles for their medical applications. Pure HAP and Zn-HAP nano-particles were synthesized by the surfactant mediated approach. The doping of zinc was estimated by EDAX. The average particle size was determined by applying Scherrer's formula to powdered XRD patterns. The nano-particle morphology was studied by TEM and the presence of various functional groups was identified by FTIR spectroscopy. Good antimicrobial activity of nano-HAP and nano-Zn-HAP was found against five organisms, viz., Pseudomonas aeruginosa and Shigella flexneri as Gram negative as well as Micrococcus luteus, Staphylococcous aureus and Bacillus cereus as Gram positive. The ability of new apatite formation on the surface of pure and doped HAP samples was studied by using Simulated Body Fluid (SBF) in vitro. Hemolytic study indicated that all samples were non-hemolytic and suggesting potential application as bone implant material.

Irradiation of Microbes from Spent Nuclear Fuel Storage Pool Environments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Breckenridge, C.R.; Watkins, C.S.; Bruhn, D.F.

Microbes have been isolated and identified from spent nuclear fuel storage pools at the Idaho National Engineering and Environmental Laboratory (INEEL). Included among these are Corynebacterium aquaticum, Pseudomonas putida, Comamonas acidovorans, Gluconobacter cerinus, Micrococcus diversus, Rhodococcus rhodochrous, and two strains of sulfate-reducing bacteria (SRB). We examined the sensitivity of these microbes to a variety of total exposures of radiation generated by a 6-MeV linear accelerator (LINAC). The advantage of using a LINAC is that it provides a relatively quick screen of radiation tolerance. In the first set of experiments, we exposed each of the aforementioned microbes along with four additionalmore » microbes, pseudomonas aeruginosa, Micrococcus luteus, Escherchia coli, and Deinococcus radiodurans to exposures of 5 x 10{sup 3} and 6 x 10{sup 4} rad. All microbial specimens withstood the lower exposure with little or no reduction in cell population. Upon exposing the microbes to the larger dose of 6 x 10{sup 4} rad, we observed two distinct groupings: microbes that demonstrate resistance to radiation, and microbes that display intolerance through a dramatic reduction from their initial population. Microbes in the radiation tolerant grouping were exposed to 1.1 x 10{sup 5} rad to examine the extent of their resistance. We observe a correlation between radiation resistance and gram stain. The gram-positive species we examined seem to demonstrate a greater radiation resistance.« less

Endocarditis associated with cardiac catheterization due to a Gram-positive coccus designated Micrococcus mucilaginosus incertae sedis.

PubMed Central

Rubin, S J; Lyons, R W; Murcia, A J

1978-01-01

A gram-positive coccus, presently named Micrococcus mucilaginosus incertae sedis, was isolated from 14 blood cultures from a patient with endocarditis. The first positive blood culture was drawn 5 days after the patient underwent cardiac catheterization. PMID:670378

Comparative analysis of Micrococcus luteus isolates from blood cultures of patients with pulmonary hypertension receiving epoprostenol continuous infusion.

PubMed

Hirata, Yoshinori; Sata, Makoto; Makiuchi, Yuko; Morikane, Keita; Wada, Akihito; Okabe, Nobuhiko; Tomoike, Hitonobu

2009-12-01

During the period 2002-2008, at the National Cardiovascular Center, Osaka, 28 Micrococcus luteus isolates and one Kocuria spp. isolate were obtained from blood cultures of pulmonary hypertension (PH) patients who were receiving continuous infusion therapy with epoprostenol. Pulsed-field gel electrophoresis patterns of the isolates were unrelated, suggesting that the infections had multiple origins. The preparation of epoprostenol solution by patients themselves was thought to be a risk factor.

Whole genome sequences and annotation of Micrococcus luteus SUBG006, a novel phytopathogen of mango.

PubMed

Rakhashiya, Purvi M; Patel, Pooja P; Thaker, Vrinda S

2015-12-01

Actinobaceria, Micrococcus luteus SUBG006 was isolated from infected leaves of Mangifera indica L. vr. Nylon in Rajkot, (22.30°N, 70.78°E), Gujarat, India. The genome size is 3.86 Mb with G + C content of 69.80% and contains 112 rRNA sequences (5S, 16S and 23S). The whole genome sequencing has been deposited in DDBJ/EMBL/GenBank under the accession number JOKP00000000.

Evaluation of enhanced thermostability and operational stability of carbonic anhydrase from Micrococcus species.

PubMed

Bhattacharya, Abhishek; Shrivastava, Ankita; Sharma, Anjana

2013-06-01

Carbonic anhydrase (CA) was purified from Micrococcus lylae and Micrococcus luteus with 49.90 and 53.8 % yield, respectively, isolated from calcium carbonate kilns. CA from M. lylae retained 80 % stability in the pH and temperature range of 6.0-8.0 and 35-45 °C, respectively. However, CA from M. luteus was stable in the pH and temperature range of 7.5-10.0 and 35-55 °C, respectively. Cross-linked enzyme aggregates (CLEAs) raised the transition temperature of M. lylae and M. luteus CA up to 67.5 and 74.0 °C, while the operational stability (T(1/20) of CA at 55 °C was calculated to be 7.7 and 12.0 h, respectively. CA from both the strains was found to be monomeric in nature with subunit molecular weight and molecular mass of 29 kDa. Ethoxozolamide was identified as the most potent inhibitor based on both IC(50) values and inhibitory constant measurement (K(i)). The K(m) and V(max) for M. lylae CA (2.31 mM; 769.23 μmol/mg/min) and M. luteus CA (2.0 mM; 1,000 μmol/mg/min) were calculated from Lineweaver-Burk plots in terms of esterase activity. Enhanced thermostability of CLEAs alleviates its role in operational stability for application at an on-site scrubber. The characteristic profile of purified CA from Micrococcus spp. advocates its effective application in biomimetic CO(2) sequestration.

An antibacterial ortho-quinone diterpenoid and its derivatives from Caryopteris mongolica.

PubMed

Saruul, Erdenebileg; Murata, Toshihiro; Selenge, Erdenechimeg; Sasaki, Kenroh; Yoshizaki, Fumihiko; Batkhuu, Javzan

2015-06-15

To identify antibacterial components in traditional Mongolian medicinal plant Caryopteris mongolica, an ortho-quinone abietane caryopteron A (1) and three its derivatives caryopteron B-D (2-4) were isolated from the roots of the plant together with three known abietanes demethylcryptojaponol (5), 6α-hydroxydemethyl cryptojaponol (6), and 14-deoxycoleon U (7). The chemical structures of these abietane derivatives were elucidated on the basis of spectroscopic data. Compounds 1-4 had C-13 methylcyclopropane substructures, and 2-4 had a hexanedioic anhydride ring C instead of ortho-quinone in 1. The stereochemistry of these compound was assumed from NOE spectra and ECD Cotton effects. Compounds 1 and 5-7 showed antibacterial activities against the Gram-positive bacteria Staphylococcus aureus, Staphylococcus epidermidis, Enterococcus faecalis, and Micrococcus luteus, being 1 the more potent. Copyright © 2015 Elsevier Ltd. All rights reserved.

Antibacterial Activity of the Alkaloid-Enriched Extract from Prosopis juliflora Pods and Its Influence on in Vitro Ruminal Digestion

PubMed Central

dos Santos, Edilene T.; Pereira, Mara Lúcia A.; da Silva, Camilla Flávia P.G.; Souza-Neta, Lourdes C.; Geris, Regina; Martins, Dirceu; Santana, Antônio Euzébio G.; Barbosa, Luiz Cláudio A.; Silva, Herymá Giovane O.; Freitas, Giovana C.; Figueiredo, Mauro P.; de Oliveira, Fernando F.; Batista, Ronan

2013-01-01

The purpose of this study was to assess the in vitro antimicrobial activity of alkaloid-enriched extracts from Prosopis juliflora (Fabaceae) pods in order to evaluate them as feed additives for ruminants. As only the basic chloroformic extract (BCE), whose main constituents were juliprosopine (juliflorine), prosoflorine and juliprosine, showed Gram-positive antibacterial activity against Micrococcus luteus (MIC = 25 μg/mL), Staphylococcus aureus (MIC = 50 μg/mL) and Streptococcus mutans (MIC = 50 μg/mL), its influence on ruminal digestion was evaluated using a semi-automated in vitro gas production technique, with monensin as the positive control. Results showed that BCE has decreased gas production as efficiently as monensin after 36 h of fermentation, revealing its positive influence on gas production during ruminal digestion. Since P. juliflora is a very affordable plant, this study points out this alkaloid enriched extract from the pods of Prosopis juliflora as a potential feed additive to decrease gas production during ruminal digestion. PMID:23595000

Tribolium castaneum defensins are primarily active against Gram-positive bacteria.

PubMed

Tonk, Miray; Knorr, Eileen; Cabezas-Cruz, Alejandro; Valdés, James J; Kollewe, Christian; Vilcinskas, Andreas

2015-11-01

The red flour beetle Tribolium castaneum is a destructive insect pest of stored food and feed products, and a model organism for development, evolutionary biology and immunity. The insect innate immune system includes antimicrobial peptides (AMPs) with a wide spectrum of targets including viruses, bacteria, fungi and parasites. Defensins are an evolutionarily-conserved class of AMPs and a potential new source of antimicrobial agents. In this context, we report the antimicrobial activity, phylogenetic and structural properties of three T. castaneum defensins (Def1, Def2 and Def3) and their relevance in the immunity of T. castaneum against bacterial pathogens. All three recombinant defensins showed bactericidal activity against Micrococcus luteus and Bacillus thuringiensis serovar tolworthi, but only Def1 and Def2 showed a bacteriostatic effect against Staphylococcus epidermidis. None of the defensins showed activity against the Gram-negative bacteria Escherichia coli and Pseudomonas entomophila or against the yeast Saccharomyces cerevisiae. All three defensins were transcriptionally upregulated following a bacterial challenge, suggesting a key role in the immunity of T. castaneum against bacterial pathogens. Phylogenetic analysis showed that defensins from T. castaneum, mealworms, Udo longhorn beetle and houseflies cluster within a well-defined clade of insect defensins. We conclude that T. castaneum defensins are primarily active against Gram-positive bacteria and that other AMPs may play a more prominent role against Gram-negative species. Copyright © 2015 Elsevier Inc. All rights reserved.

Effect of Encapsulation on Antimicrobial Activity of
Herbal Extracts with Lysozyme

PubMed Central

Matouskova, Petra; Bokrova, Jitka; Benesova, Pavla

2016-01-01

Summary Resistance of microorganisms to antibiotics has increased. The use of natural components with antimicrobial properties can be of great significance to reduce this problem. The presented work is focused on the study of the effect of encapsulation of selected plant and animal antimicrobial substances (herbs, spices, lysozyme and nisin) on their activity and stability. Antimicrobial components were packaged into liposomes and polysaccharide particles (alginate, chitosan and starch). Antimicrobial activity was tested against two Gram-positive (Bacillus subtilis and Micrococcus luteus) and two Gram-negative (Escherichia coli and Serratia marcescens) bacteria. Encapsulation was successful in all types of polysaccharide particles and liposomes. The prepared particles exhibited very good long-term stability, especially in aqueous conditions. Antimicrobial activity was retained in all types of particles. Liposomes with encapsulated herb and spice extracts exhibited very good inhibitory effect against all tested bacterial strains. Most of herbal extracts had very good antimicrobial effect against the tested Gram-negative bacterial strains, while Gram-positive bacteria were more sensitive to lysozyme particles. Thus, particles with co-encapsulated herbs and lysozyme are more active against different types of bacteria, and more stable and more effective during long-term storage. Particles with encapsulated mixture of selected plant extracts and lysozyme could be used as complex antimicrobial preparation with controlled release in the production of food and food supplements, pharmaceutical and cosmetic industries. PMID:27956862

N-O chemistry for antibiotics: discovery of N-alkyl-N-(pyridin-2-yl)hydroxylamine scaffolds as selective antibacterial agents using nitroso Diels-Alder and ene chemistry.

PubMed

Wencewicz, Timothy A; Yang, Baiyuan; Rudloff, James R; Oliver, Allen G; Miller, Marvin J

2011-10-13

The discovery, syntheses, and structure-activity relationships (SAR) of a new family of heterocyclic antibacterial compounds based on N-alkyl-N-(pyridin-2-yl)hydroxylamine scaffolds are described. A structurally diverse library of ∼100 heterocyclic molecules generated from Lewis acid-mediated nucleophilic ring-opening reactions with nitroso Diels-Alder cycloadducts and nitroso ene reactions with substituted alkenes was evaluated in whole cell antibacterial assays. Compounds containing the N-alkyl-N-(pyridin-2-yl)hydroxylamine structure demonstrated selective and potent antibacterial activity against the Gram-positive bacterium Micrococcus luteus ATCC 10240 (MIC(90) = 2.0 μM or 0.41 μg/mL) and moderate activity against other Gram-positive strains including antibiotic resistant strains of Staphylococcus aureus (MRSA) and Enterococcus faecalis (VRE). A new synthetic route to the active core was developed using palladium-catalyzed Buchwald-Hartwig amination reactions of N-alkyl-O-(4-methoxybenzyl)hydroxylamines with 2-halo-pyridines that facilitated SAR studies and revealed the simplest active structural fragment. This work shows the value of using a combination of diversity-oriented synthesis (DOS) and parallel synthesis for identifying new antibacterial scaffolds.

N-O Chemistry for Antibiotics: Discovery of N-Alkyl-N-(pyridin-2-yl)hydroxylamine Scaffolds as Selective Antibacterial Agents Using Nitroso Diels-Alder and Ene Chemistry

PubMed Central

Wencewicz, Timothy A.; Yang, Baiyuan; Rudloff, James R.; Oliver, Allen G.; Miller, Marvin J.

2011-01-01

The discovery, syntheses, and structure-activity relationships (SAR) of a new family of heterocyclic antibacterial compounds based on N-alkyl-N-(pyridin-2-yl)hydroxylamine scaffolds are described. A structurally diverse library of ~100 heterocyclic molecules generated from Lewis acid-mediated nucleophilic ring opening reactions with nitroso Diels-Alder cycloadducts and nitroso ene reactions with substituted alkenes was evaluated in whole cell antibacterial assays. Compounds containing the N-alkyl-N-(pyridin-2-yl)hydroxylamine structure demonstrated selective and potent antibacterial activity against the Gram-positive bacterium Micrococcus luteus ATCC 10240 (MIC90 = 2.0 μM or 0.41 μg/mL) and moderate activity against other Gram-positive strains including antibiotic resistant strains of Staphylococcus aureus (MRSA) and Enterococcus faecalis (VRE). A new synthetic route to the active core was developed using palladium-catalyzed Buchwald-Hartwig amination reactions of N-alkyl-O-(4-methoxybenzyl)hydroxylamines with 2-halo-pyridines that facilitated SAR studies and revealed the simplest active structural fragment. This work shows the value of using a combination of diversity-oriented synthesis (DOS) and parallel synthesis for identifying new antibacterial scaffolds. PMID:21859126

Cobalt-doped nanohydroxyapatite: synthesis, characterization, antimicrobial and hemolytic studies

NASA Astrophysics Data System (ADS)

Tank, Kashmira P.; Chudasama, Kiran S.; Thaker, Vrinda S.; Joshi, Mihir J.

2013-05-01

Hydroxyapatite (Ca10(PO4)6(OH)2; HAP) is a major mineral component of the calcified tissues, and it has various applications in medicine and dentistry. In the present investigation, cobalt-doped hydroxyapatite (Co-HAP) nanoparticles were synthesized by surfactant-mediated approach and characterized by different techniques. The EDAX was carried out to estimate the amount of doping in Co-HAP. The transmission electron microscopy result suggested the transformation of morphology from needle shaped to spherical type on increasing the doping concentration. The powder XRD study indicated the formation of a new phase of brushite for higher concentration of cobalt. The average particle size and strain were calculated using Williamson-Hall analysis. The average particle size was found to be 30-60 nm. The FTIR study confirmed the presence of various functional groups in the samples. The antimicrobial activity was evaluated against four organisms Pseudomonas aeruginosa and Shigella flexneri as Gram negative as well as Micrococcus luteus and Staphylococcus aureus as Gram positive. The hemolytic test result suggested that all samples were non-hemolytic. The photoluminescence study was carried out to identify its possible applicability as a fluorescent probe.

Enhancement of antidandruff activity of shampoo by biosynthesized silver nanoparticles from Solanum trilobatum plant leaf

NASA Astrophysics Data System (ADS)

Pant, Gaurav; Nayak, Nitesh; Gyana Prasuna, R.

2013-10-01

The present investigation describes simple and effective method for synthesis of silver nanoparticles via green route. Solanum trilobatum Linn extract were prepared by both conventional and homogenization method. We optimized the production of silver nanoparticles under sunlight, microwave and room temperature. The best results were obtained with sunlight irradiation, exhibiting 15-20 nm silver nanoparticles having cubic and hexagonal shape. Biosynthesized nanoparticles were highly toxic to various bacterial strains tested. In this study we report antibacterial activity against various Gram negative ( Klebsiella pneumoniae, Vibrio cholerae and Salmonella typhi) and Gram positive ( Staphylococcus aureus, Bacillus cereus and Micrococcus luteus) bacterial strains. Screening was also performed for any antifungal properties of the nanoparticles against human pathogenic fungal strains ( Candida albicans and Candida parapsilosis). We also demonstrated that these nanoparticles when mixed with shampoo enhance the anti-dandruff effect against dandruff causing fungal pathogens ( Pityrosporum ovale and Pityrosporum folliculitis). The present study showed a simple, rapid and economical route to synthesize silver nanoparticles and their applications hence has a great potential in biomedical field.

Heterogeneous precipitation of silver nanoparticles on kaolinite plates

NASA Astrophysics Data System (ADS)

Cabal, B.; Torrecillas, R.; Malpartida, F.; Moya, J. S.

2010-11-01

Two different methods to obtain silver nanoparticles supported on kaolin crystals have been performed: the first one followed a thermal reduction and the second one a chemical reduction. In both cases, the silver nanoparticles with two different average particles size (ca.12 and 30 nm) were perfectly isolated and attached to the surface of the kaolin plates. The silver nanoparticles were localized mainly at the edge of the single crystal plates, the hydroxyl groups being the main centres of adsorption. The samples were fully characterized by XRD, UV-vis spectroscopy and TEM. The antimicrobial benefits of the composites were evaluated as antibacterial against common Gram-positive and Gram-negative bacteria, and antifungal activity against yeast. The results indicated a high antimicrobial activity for Escherichia coli JM 110 and Micrococcus luteus, while being inactive against yeast under our experimental conditions. The chemical analysis of Ag in the fermentation broths show that only a small portion of metal (<9 ppm) is released from the kaolin/metakaolin particles. Therefore, the risk of toxicity due to a high concentration of metal in the medium is minimized.

Biosorption of lead and copper by heavy-metal tolerant Micrococcus luteus DE2008.

PubMed

Puyen, Zully M; Villagrasa, Eduard; Maldonado, Juan; Diestra, Elia; Esteve, Isabel; Solé, Antoni

2012-12-01

Micrococcus luteus DE2008 has the ability to absorb lead and copper. The effect of these metals on biomass and viability of this microorganism were investigated and removal of the metals from culture media was determined. Lead had no effect on the biomass expressed as mg Carbon/cm(3) of M. Iuteus DE2008, but in the case of copper, the minimum metal concentration that affected the biomass was 0.1 mM Cu(II). According to these results this microorganism shows a greater tolerance for lead. The minimum metal concentration that affected viability (expressed as the percentage of live cells) was 0.5 mM for both metals. M. luteus DE2008 exhibited a specific removal capacity of 408 mg/g for copper and 1965 mg/g for lead. This microorganism has a greater ability to absorb Pb(II) than Cu(II). M. luteus DE2008 could be seen as a microorganism capable of restoring environments polluted by lead and copper. Copyright © 2012 Elsevier Ltd. All rights reserved.

Influence of environmental factors on composition of volatile constituents and biological activity of Helichrysum italicum (Roth) Don (Asteraceae).

PubMed

Tundis, R; Statti, G A; Conforti, F; Bianchi, A; Agrimonti, C; Sacchetti, G; Muzzoli, M; Ballero, M; Menichini, F; Poli, F

2005-06-01

The biovariability of Helichrysum italicum (Roth) Don grown wild in Calabria and Sardinia (Italy) was reported. This species has been characterized through the detection, isolation and quantitative evaluation of chemical markers (alpha-terpinolene, trans-cariophyllene and neryl acetate) by GC and GC-MS. Antioxidant activity of the methanolic H. italicum extracts using DPPH and beta-carotene bleaching test showed that the Calabrian samples were more active than those from Sardinia. The antibacterial activity of all extracts evidenced the best performance on the Gram positive bacteria particularly on Micrococcus luteus. Moreover, antifungal activity of all extracts was also tested evidencing important results particularly on the phytopathogene fungus Pythium ultimum. In general, as regards the antifungal activity, the extracts from Sardinia were more active than those from Calabria. The phytochemical analysis and the biological activity data suggested a possible use of these plant matrices in alimentary, cosmetic and pharmaceutical fields.

Antimicrobial effects of Finnish plant extracts containing flavonoids and other phenolic compounds.

PubMed

Rauha, J P; Remes, S; Heinonen, M; Hopia, A; Kähkönen, M; Kujala, T; Pihlaja, K; Vuorela, H; Vuorela, P

2000-05-25

Plant phenolics, especially dietary flavonoids, are currently of growing interest owing to their supposed functional properties in promoting human health. Antimicrobial screening of 13 phenolic substances and 29 extracts prepared from Finnish plant materials against selected microbes was conducted in this study. The tests were carried out using diffusion methods with four to nine microbial species (Aspergillus niger, Bacillus subtilis, Candida albicans, Escherichia coli, Micrococcus luteus, Pseudomonas aeruginosa, Saccharomyces cerevisiae, Staphylococcus aureus and Staphylococcus epidermidis). Flavone, quercetin and naringenin were effective in inhibiting the growth of the organisms. The most active plant extracts were purple loosestrife (Lythrum salicaria L.) against Candida albicans, meadowsweet (Filipendula ulmaria (L.) Maxim.), willow herb (Epilobium angustifolium L.), cloudberry (Rubus chamaemorus L.) and raspberry (Rubus idaeus L.) against bacteria, and white birch (Betula pubescens Ehrh.), pine (Pinus sylvestris L.) and potato (Solanum tuberosum. L.) against gram-positive Staphylococcus aureus.

Differential transcriptomic responses of Biomphalaria glabrata (Gastropoda, Mollusca) to bacteria and metazoan parasites, Schistosoma mansoni and Echinostoma paraensei (Digenea, Platyhelminthes)

PubMed Central

Adema, Coen M; Hanington, Patrick C.; Lun, Cheng-Man; Rosenberg, George H.; Aragon, Anthony D; Stout, Barbara A; Richard, Mara L. Lennard; Gross, Paul S.; Loker, Eric S

2009-01-01

A 70-mer oligonucleotide-based microarray (1152 features) that emphasizes stress and immune responses factors was constructed to study transcriptomic responses of the snail Biomphalaria glabrata to different immune challenges. In addition to sequences with relevant putative ID and Gene Ontology (GO) annotation, the array features non-immune factors and unknown B. glabrata ESTs for functional gene discovery. The transcription profiles of B. glabrata (3 biological replicates, each a pool of 5 snails) were recorded at 12 hours post wounding, exposure to Gram negative or Gram positive bacteria (Escherichia coli and Micrococcus luteus, respectively), or infection with compatible trematode parasites (S. mansoni or E. paraensei, 20 miracidia/snail), relative to controls, using universal reference RNA. The data were subjected to Significance Analysis for Microarrays (SAM), with a false positive rate (FPR) ≤10%. Wounding yielded a modest differential expression profile (27 up/21 down) with affected features mostly dissimilar from other treatments. Partially overlapping, yet distinct expression profiles were recorded from snails challenged with E. coli (83 up/20 down) or M. luteus (120 up/42 down), mostly showing up-regulation of defense and stress-related features. Significantly altered expression of selected immune features indicates that B. glabrata detects and responds differently to compatible trematodes. Echinostoma paraensei infection was associated mostly with down regulation of many (immune-) transcripts (42 up/68 down), whereas S. mansoni exposure yielded a preponderance of up-regulated features (140 up/23 down), with only few known immune genes affected. These observations may reflect the divergent strategies developed by trematodes during their evolution as specialized pathogens of snails to negate host defense responses. Clearly, the immune defenses of B. glabrata distinguish and respond differently to various immune challenges. PMID:19962194

Genomic and functional characterization of three new venom peptides from the scorpion Heterometrus spinifer.

PubMed

Wu, Shifen; Nie, Yao; Zeng, Xian-Chun; Cao, Hanjun; Zhang, Lei; Zhou, Lingli; Yang, Ye; Luo, Xuesong; Liu, Yichen

2014-03-01

Three new cysteine-free venom peptides, which are referred to as Heterin-1, Heterin-2 and Spiniferin, respectively, were identified from the scorpion Heterometrus spinifer. Heterin-1, Heterin-2 and Spiniferin contain 43, 24 and 13 amino acid residues, respectively. Genomic analysis showed that the genomic organizations of the three peptides are consistent with those of the known Na(+), K(+) or Cl(-)-channel specific toxins from scorpions; this suggests that the genes of the cysteine-free and cysteine-rich peptides from scorpions were derived from a common ancestor. Antimicrobial assay demonstrated that Heterin-1 possesses potent activities against both Gram-positive and Gram-negative bacteria. Among the tested bacterial species, Heterin-1 is the most active against Bacillus megaterium and Micrococcus luteus with MICs of 4.0 μM and 4.0 μM, respectively. Heterin-2 is able to potently inhibit the growth of Gram-positive bacteria with MICs from 5.6 μM to 30.0 μM; however, it has weaker activities against the tested Gram-negative bacteria. It is interesting to see that deletion of the C-terminal random coiled tail (KKD) in Heterin-2 markedly changed the antimicrobial specificity and activity of the peptide. Spiniferin has very weak antimicrobial activities against both Gram-positive and Gram-negative bacteria. We found that introducing three net charges into the polar face of Spiniferin significantly increased its antimicrobial activity against the majority of the tested bacteria; however, in some instances, net charge on the polar face is not important for the antimicrobial activity of the peptide. These studies have expanded our understanding of the diversity, evolution and structure/function relationships of the cysteine-free peptides from scorpions. Copyright © 2013 Elsevier Inc. All rights reserved.

Phytoremediation of fuel oil and lead co-contaminated soil by Chromolaena odorata in association with Micrococcus luteus.

PubMed

Jampasri, Kongkeat; Pokethitiyook, Prayad; Kruatrachue, Maleeya; Ounjai, Puey; Kumsopa, Acharaporn

2016-10-02

Phytoremediation is widely promoted as a cost-effective technology for treating heavy metal and total petroleum hydrocarbon (TPH) co-contaminated soil. This study investigated the concurrent removal of TPHs and Pb in co-contaminated soil (27,000 mg kg(-1) TPHs, 780 mg kg(-1) Pb) by growing Siam weed (Chromolaena odorata) in a pot experiment for 90 days. There were four treatments: co-contaminated soil; co-contaminated soil with C. odorata only; co-contaminated soil with C. odorata and Micrococcus luteus inoculum; and co-contaminated soil with M. luteus only. C. odorata survived and grew well in the co-contaminated soil. C. odorata with M. luteus showed the highest Pb accumulation (513.7 mg kg(-1)) and uptake (7.7 mg plant(-1)), and the highest reduction percentage of TPHs (52.2%). The higher TPH degradation in vegetated soils indicated the interaction between the rhizosphere microorganisms and plants. The results suggested that C. odorata together with M. luteus and other rhizosphere microorganisms is a promising candidate for the removal of Pb and TPHs in co-contaminated soils.

Pitting failure of copper pipings for emergency fire sprinkler in ground water

NASA Astrophysics Data System (ADS)

Baek, Seung-won; Lee, Jong-kwon; Kim, Jong-jip; Kim, Kyung-ja

2015-05-01

The possibility of microbiologically influenced corrosion was investigated in the early pitted copper pipes. The pipes were installed for less than 6 months as an immergency fire sprinkler. The bacteria were cultured by sampling of corrosion by-product near pits on failed copper pipes for the aerobic as well as anaerobic bacteria. However, only aerobic bacteria was found, which were Micrococcus Luteus and Bacillus sp.. The corrosion rate of copper pipes were studied by weight loss in the groundwater and polarization method. In immersion test as well as the electrochemical polarization test in ground water, only Micrococcus Luteus could activate corrosion of copper by 20% and 15%, respectively. On the other hand, Bacillus sp. showed little effect on corrosion in the above two tests. The shape and characteristics of failed copper pipes as well as simulated copper were investigated using stereoscope, optical microscopy, scanning electron microscope and EDS. The cause of pits were discussed, related with the dissolved copper concentrations, pH, and optical density. It could be concluded that the early failure of copper pipings could be ascribed to the acceration of copper in the presence of bacteria, i.e., Micrococcus Luteus.

Micrococcus luteus mediated dual mode synthesis of gold nanoparticles: involvement of extracellular α-amylase and cell wall teichuronic acid.

PubMed

Arunkumar, Pichaimani; Thanalakshmi, Muthukrishnan; Kumar, Priyadarsini; Premkumar, Kumpati

2013-03-01

In the present study we have utilized the bioreductive potential of Micrococcus luteus for the synthesis of gold nanoparticles. Biochemical and physiological analysis indicate that the biosynthesized GNPs were achieved by dual mode, involving extracellular α-amylase and cell wall teichuronic acid (TUA) of M. luteus. The biosynthetic potential of both α-amylase and TUA, after isolation from bacterium, was examined. Under optimum conditions, these biomolecules reduces Au(3+) into Au(0) and the resulting GNPs were found to be stable for 1 month. The synthesized GNPs were characterized by UV-VIS spectrometry, transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FTIR) and dynamic light scattering (DLS). Results demonstrated that the synthesized GNPs were found to be monodispersive and spherical in shape with an average size of ∼6 nm and ∼50 nm for α-amylase and teichuronic acid, respectively. These findings suggest that M. luteus can be exploited as a potential biosource for the eco-friendly synthesis of gold nanoparticles. Copyright © 2012 Elsevier B.V. All rights reserved.

The Role of Inducible DNA Repair in W-Reactivation and Related Phenomena.

DTIC Science & Technology

1981-10-14

unexcised dimers in X DNA. This was consistent with the finding of Tomilin and Mosevitskaya (1975) which showed that the UV-endonuclease from Micrococcus ...of DNA in vitro with UV-endonuclease from Micrococcus luteus. Mutat. Res. 27, 147-156 (1975) Tomizawa, J., Ogawa, T.: Effect of ultraviolet irradiation

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

[Features of interaction bacterial strains Micrococcus luteus LBK1 from plants varieties/hybrids cucumber and sweet pepper and with fungus Fusarium oxysporum Scelecht].

PubMed

Parfeniuk, A; Sterlikova, O; Beznosko, I; Krut', V

2014-01-01

The article presents the results of studying the impact of bacterial strain M. luteus LBK1, stimulating the growth and development of plant varieties/hybrids of cucumber and sweet pepper on the intensity of sporulation of the fungus F. oxysporum Scelecht--fusariose rot pathogen.

Endocarditis due to Micrococcus sedentarius incertae sedis.

PubMed Central

Old, D C; McNeill, G P

1979-01-01

The clinical and bacteriological features of a case of endocarditis are described in which a Gram-positive coccus, presently designated Micrococcus sedentarius incertae sedis, was repeatedly isolated. PMID:512056

DNA-binding studies and biological activities of new nitrosubstituted acyl thioureas

NASA Astrophysics Data System (ADS)

Tahir, Shaista; Badshah, Amin; Hussain, Raja Azadar; Tahir, Muhammad Nawaz; Tabassum, Saira; Patujo, Jahangir Ali; Rauf, Muhammad Khawar

2015-11-01

Four new nitrosubstituted acylthioureas i.e. 1-acetyl-3-(4-nitrophenyl)thiourea (TU1), 1-acetyl-3-(2-methyl-4-nitrophenyl)thiourea (TU2), 1-acetyl-3-(2-methoxy-4-nitrophenyl)thiourea (TU3) and 1-acetyl-3-(4-chloro-3-nitrophenyl)thiourea (TU4) have been synthesized and characterized (by C13 and H1 nuclear magnetic resonance, Fourier transform infrared spectroscopy and single crystal X-ray diffraction). As a preliminary investigation of the anti-cancer potencies of the said compounds, DNA interaction studies have been carried out using cyclic voltammetry and UV-vis spectroscopy along with verification from computational studies. The drug-DNA binding constants are found to be in the order, KTU3 9.04 × 106 M-1 > KTU4 8.57 × 106 M-1 > KTU2 6.05 × 106 M-1 > KTU1 1.16 × 106 M-1. Furthermore, the antioxidant, cytotoxic, antibacterial and antifungal activities have been carried out against DPPH (1,1-diphenyl-2-dipicrylhydrazyl), Brine shrimp eggs, gram positive (Micrococcus luteus, Staphylococcus aureus) and gram negative (Bordetella bronchiseptica, Salmonella typhimurium, Enterobacter aerogens) and fungal cultures (Aspergillus fumigatus, Mucor species, Aspergillus niger, Aspergillus flavus) respectively.

Detection of Micrococcus luteus biofilm formation in microfluidic environments by pH measurement using an ion-sensitive field-effect transistor.

PubMed

Matsuura, Koji; Asano, Yuka; Yamada, Akira; Naruse, Keiji

2013-02-18

Biofilm formation in microfluidic channels is difficult to detect because sampling volumes are too small for conventional turbidity measurements. To detect biofilm formation, we used an ion-sensitive field-effect transistor (ISFET) measurement system to measure pH changes in small volumes of bacterial suspension. Cells of Micrococcus luteus (M. luteus) were cultured in polystyrene (PS) microtubes and polymethylmethacrylate (PMMA)-based microfluidic channels laminated with polyvinylidene chloride. In microtubes, concentrations of bacteria and pH in the suspension were analyzed by measuring turbidity and using an ISFET sensor, respectively. In microfluidic channels containing 20 μL of bacterial suspension, we measured pH changes using the ISFET sensor and monitored biofilm formation using a microscope. We detected acidification and alkalinization phases of M. luteus from the ISFET sensor signals in both microtubes and microfluidic channels. In the alkalinization phase, after 2 day culture, dense biofilm formation was observed at the bottom of the microfluidic channels. In this study, we used an ISFET sensor to detect biofilm formation in clinical and industrial microfluidic environments by detecting alkalinization of the culture medium. 

Effect of simulated microgravity on growth and production of exopolymeric substances of Micrococcus luteus space and earth isolates.

PubMed

Mauclaire, Laurie; Egli, Marcel

2010-08-01

Microorganisms tend to form biofilms on surfaces, thereby causing deterioration of the underlaying material. In addition, biofilm is a potential health risk to humans. Therefore, microorganism growth is not only an issue on Earth but also in manned space habitats like the International Space Station (ISS). The aim of the study was to identify physiological processes relevant for Micrococcus luteus attachment under microgravity conditions. The results demonstrate that simulated microgravity influences physiological processes which trigger bacterial attachment and biofilm formation. The ISS strains produced larger amounts of exopolymeric substances (EPS) compared with a reference strain from Earth. In contrast, M. luteus strains were growing faster, and Earth as well as ISS isolates produced a higher yield of biomass under microgravity conditions than under normal gravity. Furthermore, microgravity caused a reduction of the colloidal EPS production of ISS isolates in comparison with normal gravity, which probably influences biofilm thickness and stability as well.

Antimicrobial and Cytotoxic Activity of Extracts of Ferula heuffelii Griseb. ex Heuff. and Its Metabolites.

PubMed

Pavlović, Ivan; Petrović, Silvana; Milenković, Marina; Stanojković, Tatjana; Nikolić, Dejan; Krunić, Aleksej; Niketić, Marjan

2015-10-01

The antimicrobial and cytotoxic activities of isolates (CHCl3 and MeOH extracts and selected metabolites) obtained from the underground parts of the Balkan endemic plant Ferula heuffelii Griseb. ex Heuff. were assessed. The CHCl3 and MeOH extracts exhibited moderate antimicrobial activity, being more pronounced against Gram-positive than Gram-negative bacteria, especially against Staphylococcus aureus (MIC=12.5 μg/ml for both extracts) and Micrococcus luteus (MIC=50 and 12.5 μg/ml, resp.). Among the tested metabolites, (6E)-1-(2,4-dihydroxyphenyl)-3,7,11-trimethyl-3-vinyldodeca-6,10-dien-1-one (2) and (2S*,3R*)-2-[(3E)-4,8-dimethylnona-3,7-dien-1-yl]-2,3-dihydro-7-hydroxy-2,3-dimethylfuro[3,2-c]coumarin (4) demonstrated the best antimicrobial activity. Compounds 2 and 4 both strongly inhibited the growth of M. luteus (MIC=11.2 and 5.2 μM, resp.) and Staphylococcus epidermidis (MIC=22.5 and 10.5 μM, resp.) and compound 2 additionally also the growth of Bacillus subtilis (MIC=11.2 μM). The cytotoxic activity of the isolates was tested against three human cancer cell lines, viz., cervical adenocarcinoma (HeLa), chronic myelogenous leukemia (K562), and breast cancer (MCF-7) cells. The CHCl3 extract exhibited strong cytotoxic activity against all cell lines (IC50 <11.0 μg/ml). All compounds strongly inhibited the growth of the K562 and HeLa cell lines. Compound 4 exhibited also a strong activity against the MCF-7 cell line, comparable to that of cisplatin (IC50 =22.32±1.32 vs. 18.67±0.75μM). Copyright © 2015 Verlag Helvetica Chimica Acta AG, Zürich.

Genome-wide identification and characterization of five MyD88 duplication genes in Yesso scallop (Patinopecten yessoensis) and expression changes in response to bacterial challenge.

PubMed

Ning, Xianhui; Wang, Ruijia; Li, Xue; Wang, Shuyue; Zhang, Mengran; Xing, Qiang; Sun, Yan; Wang, Shi; Zhang, Lingling; Hu, Xiaoli; Bao, Zhenmin

2015-10-01

Myeloid differentiation factor 88 (MyD88) is a pivotal adaptor in the TLR/IL-1R signaling pathway, which plays an important role in activating the innate immune system. Although MyD88 genes have been identified in a variety of species, they have not been systematically characterized in scallops. In this study, five MyD88 genes were identified in Yesso scallop (Patinopecten yessoensis), PyMyD88-1, PyMyD88-2a, PyMyD88-2b, PyMyD88-3 and PyMyD88-4, which consisted of two pairs of tandem duplications located on the same chromosome. To our knowledge, this is the largest number of MyD88 genes found in an invertebrate. Phylogenetic and protein structural analyses were carried out to determine the identities and evolutionary relationships of these genes. PyMyD88s have highly conserved structures compared to MyD88 genes from other invertebrate species, except for PyMyD88-4, which contains only a DD domain, suggesting the evolutionarily conserved form of this particular gene member. We investigated the expression profiles of PyMyD88 genes at different developmental stages and in healthy adult tissues and hemocytes after Micrococcus luteus and Vibrio anguillarum infection using quantitative real-time PCR (qRT-PCR). The expression of most PyMyD88s was significantly induced in the acute phase (3-6 h) after infection with both gram-positive (M. luteus) and gram-negative (V. anguillarum) bacteria, with much more dramatic changes in PyMyD88 expression being observed after V. anguillarum challenge. Collectively, the abundance of MyD88s and their specific expression patterns provide insight into their versatile roles in the response of the bivalve innate immune system to gram-negative bacterial pathogens. Copyright © 2015 Elsevier Ltd. All rights reserved.

[Occurrence of bacteria in the mouth from genera of Micrococcus, Kocuria, Nesterenkonia, Kytococcus and Dermacoccus].

PubMed

Szczerba, Izabela; Krzemiński, Zbigniew

2002-01-01

The aim of the study was to assess the prevalence of different bacteria in the oral cavity. The bacteria were present in the oral cavities of 73 (48.7%) of 150 individuals. Nesterenkonia halobia, the most frequently isolated species, was found in 20 (27%) individuals, Micrococcus luteus in 16 (22%), Kocuria kristinae in 12 (16%), Kocuria varians in 10 (14%), Dermacoccus sedentarius in 9 (12%), Micrococcus lylae in 8 (11%), and Kytococcus nishinomiyaensis in 3 (4%). Mean counts of these microorganisms were relatively low and amounted in log10 CFU/ml saliva for M. luteus 1.87 +/- 0.52, for M. lylae 2.03 +/- 0.39, for N. halobia 2.14 +/- 0.56, for K. kristinae 2.20 +/- 0.69, for K. varians 2.19 +/- 0.67, for K. nishinomiyaensis 1.72 +/- 0.39, and for D. sedentarius 2.27 +/- 0.55. The factor limiting the population sizes of these microorganisms was most probably the antagonistic activity of the bacteria living in oral cavity.

Peroxiredoxin 1 protects the pea aphid Acyrthosiphon pisum from oxidative stress induced by Micrococcus luteus infection.

PubMed

Zhang, Yongdong; Lu, Zhiqiang

2015-05-01

Reactive oxygen species (ROSs) are generated in organisms in response to infections caused by invading microbes. However, excessive ROSs will inflict oxidative damage on the host. Peroxiredoxins (Prxs) are antioxidative enzymes that may eliminate ROSs efficiently. In this study, ApPrx1 from the pea aphid Acyrthosiphon pisum was cloned, and its function was investigated in vitro and in vivo. In the presence of DTT, recombinant ApPrx1 protein from Escherichia coli showed antioxidative activity by eliminating H2O2 effectively. The H2O2 levels were significantly higher in Micrococcus luteus-infected aphids than in uninfected aphids, and ApPrx1 expression was remarkably up-regulated when the aphids were infected with M. luteus or injected with H2O2. When ApPrx1 expression was reduced by dsRNA injection, the survival of the aphids decreased significantly after M. luteus infection. Knockdown of ApPrx1 decreased M. luteus loads inside the aphids 48h post-infection. While under infection conditions, the H2O2 levels were much higher in ApPrx1 knockdown aphids than in dsGFP-injected aphids, indicating that the decreased survival of the aphids was caused by increased oxidative stress. Taken together, our results reveal that ApPrx1 plays a protective role in oxidative stress caused by bacterial infection. Copyright © 2015 Elsevier Inc. All rights reserved.

Micrococcus species-related peritonitis in patients receiving peritoneal dialysis.

PubMed

Kao, Chih-Chin; Chiang, Chih-Kang; Huang, Jenq-Wen

2014-01-01

Peritonitis is a major complication of peritoneal dialysis (PD) and remains the most common cause of PD failure. Micrococci are catalase-positive, coagulase-negative, and gram-positive cocci that are spherical, often found in tetrad, and belong to the family Micrococcaceae. Micrococcus species are commonly found in the environment, and it is now recognized that Micrococcus species can be opportunistic pathogens in immunocompromised patients. The only consistent predisposing factor for Micrococcus infection is an immunocompromised state. We report three cases of Micrococcus PD peritonitis. Improper practice of PD may have been the causative factor. Although Micrococcus species are low-virulence pathogens, infection could result in refractory peritonitis and subsequent PD failure. Intraperitoneal administration of vancomycin for at least 2 weeks is recommended for Micrococcus peritonitis.

Development of a rapid optic bacteria detecting system based on ATP bioluminescence

NASA Astrophysics Data System (ADS)

Liu, Jun Tao; Luo, JinPing; Liu, XiaoHong; Cai, XinXia

2014-12-01

A rapid optic bacteria detecting system based on the principle of Adenosine triphosphate(ATP) bioluminescence was presented in this paper. This system consisted of bioluminescence-based biosensor and the high-sensitivity optic meter. A photon counting photomultiplier tube (PMT) module was used to improve the detection sensitivity, and a NIOS II/f processor based on a Field Programmable Gate Array(FPGA) was used to control the system. In this work, Micrococcus luteus were chosen as the test sample. Several Micrococcus luteus suspension with different concentration was tested by both T2011 and plate counting method. By comparing the two group results, an calibration curve was obtained from the bioluminescence intensity for Micrococcus luteus in the range of 2.3×102 ~ 2.3×106 CFU/mL with a good correlation coefficient of 0.960. An impacting Air microorganism sampler was used to capture Airborne Bacteria, and 8 samples were collected in different place. The TBC results of 8 samples by T2011 were between 10 ~ 2×103 cfu/mL, consistent with that of plate counting method, which indicated that 8 samples were between 10 ~ 3×103 cfu/mL. For total airborne bacteria count was small, correlation coefficient was poor. Also no significant difference was found between T2011 and plate counting method by statistical analyses.

Fast Mechanically Driven Daughter Cell Separation Is Widespread in Actinobacteria.

PubMed

Zhou, Xiaoxue; Halladin, David K; Theriot, Julie A

2016-08-30

Dividing cells of the coccoid Gram-positive bacterium Staphylococcus aureus undergo extremely rapid (millisecond) daughter cell separation (DCS) driven by mechanical crack propagation, a strategy that is very distinct from the gradual, enzymatically driven cell wall remodeling process that has been well described in several rod-shaped model bacteria. To determine if other bacteria, especially those in the same phylum (Firmicutes) or with similar coccoid shapes as S. aureus, might use a similar mechanically driven strategy for DCS, we used high-resolution video microscopy to examine cytokinesis in a phylogenetically wide range of species with various cell shapes and sizes. We found that fast mechanically driven DCS is rather rare in the Firmicutes (low G+C Gram positives), observed only in Staphylococcus and its closest coccoid relatives in the Macrococcus genus, and we did not observe this division strategy among the Gram-negative Proteobacteria In contrast, several members of the high-G+C Gram-positive phylum Actinobacteria (Micrococcus luteus, Brachybacterium faecium, Corynebacterium glutamicum, and Mycobacterium smegmatis) with diverse shapes ranging from coccoid to rod all undergo fast mechanical DCS during cell division. Most intriguingly, similar fast mechanical DCS was also observed during the sporulation of the actinobacterium Streptomyces venezuelae Much of our knowledge on bacterial cytokinesis comes from studying rod-shaped model organisms such as Escherichia coli and Bacillus subtilis Less is known about variations in this process among different bacterial species. While cell division in many bacteria has been characterized to some extent genetically or biochemically, few species have been examined using video microscopy to uncover the kinetics of cytokinesis and daughter cell separation (DCS). In this work, we found that fast (millisecond) DCS is exhibited by species in two independent clades of Gram-positive bacteria and is particularly prevalent among the Actinobacteria, a diverse group that includes significant pathogens as well as bacteria that generate medically important antibiotics. Copyright © 2016 Zhou et al.

Amino acids in cell wall of Gram-positive bacterium Micrococcus sp. hsn08 with flocculation activity on Chlorella vulgaris biomass.

PubMed

Li, Yi; Xu, Yanting; Zheng, Tianling; Wang, Hailei

2018-02-01

The aim of this work was to investigate the flocculation mechanism by Gram-positive bacterium, Micrococcus sp. hsn08 as a means for harvesting Chlorella vulgaris biomass. Bacterial cells of Micrococcus sp. hsn08 were added into algal culture to harvest algal cells through direct contacting with algae to form flocs. Viability dependence test confirmed that flocculation activity does not depend on live bacteria, but on part of the peptidoglycan. The further investigation has determined that amino acids in cell wall play an important role to flocculate algal cells. Positively charged calcium can combine bacterial and algal cells together, and form a bridge between them, thereby forming the flocs, suggesting that ions bridging is the main flocculation mechanism. These results suggest that bacterial cells of Micrococcus sp. hsn08 can be applied to harvest microalgae biomass with the help of amino acids in cell wall. Copyright © 2017 Elsevier Ltd. All rights reserved.

Physicochemical parameters influencing coaggregation between the freshwater bacteria Sphingomonas natatoria 2.1 and Micrococcus luteus 2.13.

PubMed

Min, K R; Zimmer, M N; Rickard, A H

2010-11-01

The aim of this study was to explore the physicochemical parameters that influence coaggregation between the freshwater bacteria Sphingomonas natatoria 2.1 and Micrococcus luteus 2.13. Using visual coaggregation assays, the effect of different buffers, solutions of differing ionic strength, pH, temperature, and viscosity on the degree of coaggregation was assessed. Coaggregation occurred maximally in distilled water but was inhibited when coaggregates were suspended in a commonly-used oral bacterial coaggregation buffer, saline solutions, and Tris-Cl buffers. Coaggregation was weakly expressed in standard laboratory buffers. The ionic strength of inorganic salt solutions required to inhibit coaggregation depended upon the inorganic salt being tested. Coaggregation occurred at a pH of 3-10, between 5 and 80°C and was inhibited in solutions with a viscosity of 22.5 centipoises at 20°C. Inhibition of coaggregation with NaCl impaired biofilm development. When developing buffers to test for coaggregation, the natural liquid environment should be considered. Coaggregation between S. natatoria 2.1 and M. luteus 2.13 is only affected by physicochemical conditions beyond those typically found in natural freshwater ecosystems. Such a robust ability to coaggregate may enhance the ability of S. natatoria 2.1 and M. luteus 2.13 to develop a niche in freshwater biofilms.

Genome sequence of the Fleming strain of Micrococcus luteus, a simple free- living actinobacterium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Young, Michael; Artsatbanov, Vladislav; Beller, Harry R.

Micrococcus luteus (NCTC2665, Fleming strain) has one of the smallest genomes of free living actinobacteria sequenced to date, comprising a single circular chromosome of 2,501,097 bp (G+C content 73%) predicted to encode 2403 proteins. The genome shows extensive synteny with that of the closely related organism, Kocuria rhizophila, from which it was taxonomically separated relatively recently. Despite its small size, the genome harbors 73 IS elements, almost all of which are closely related to elements found in other actinobacteria. An IS element is inserted into the rrs gene of one of only two rrn operons found in M. luteus. Themore » genome encodes only four sigma factors and fourteen response regulators, indicative of adaptation to a rather strict ecological niche (mammalian skin). The high sensitivity of M. luteus to {Beta}-lactam antibiotics may result from the presence of a reduced set of penicillin binding proteins and the absence of a wblC gene, which plays an important role in antibiotic resistance in other actinobacteria. Consistent with the restricted range of compounds it can use as a sole source of carbon for energy and growth, M. luteus has a minimal complement of genes concerned with carbohydrate transport and metabolism and its inability to utilize glucose as a sole carbon source may be due to the apparent absence of a gene encoding glucokinase. Uniquely among characterized bacteria, M. luteus appears to be able to metabolize glycogen only via trehalose, and to make trehalose only via glycogen. It has very few genes associated with secondary metabolism. In contrast to other actinobacteria, M. luteus encodes only one resuscitation-promoting factor (Rpf) required for emergence from dormancy and its complement of other dormancy-related proteins is also much reduced. M. luteus is capable of long-chain alkene biosynthesis, which is of interest for advanced biofuel production; a three gene cluster essential for this metabolism has been identified in the genome.« less

Binding of Dissolved Strontium by Micrococcus luteus

PubMed Central

Faison, Brendlyn D.; Cancel, Carmen A.; Lewis, Susan N.; Adler, Howard I.

1990-01-01

Resting cells of Micrococcus luteus have been shown to remove strontium (Sr) from dilute aqueous solutions of SrCl2 at pH 7. Loadings of 25 mg of Sr per g of cell dry weight were achieved by cells exposed to a solution containing 50 ppm (mg/liter) of Sr. Sr binding occurred in the absence of nutrients and did not require metabolic activity. Initial binding was quite rapid (<0.5 h), although a slow, spontaneous release of Sr was observed over time. Sr binding was inhibited in the presence of polyvalent cations but not monovalent cations. Ca and Sr were bound preferentially over all other cations tested. Sr-binding activity was localized on the cell envelope and was sensitive to various chemical and physical pretreatments. Bound Sr was displaced by divalent ions or by H+. Other monovalent ions were less effective. Bound Sr was also removed by various chelating agents. It was concluded that Sr binding by M. luteus is a reversible equilibrium process. Both ion exchange mediated by acidic cell surface components and intracellular uptake may be involved in this activity. PMID:16348370

Isolation and characterization of a novel nitrobenzene-degrading bacterium with high salinity tolerance: Micrococcus luteus.

PubMed

Zheng, Chunli; Qu, Baocheng; Wang, Jing; Zhou, Jiti; Wang, Jing; Lu, Hong

2009-06-15

Strain Z3 was isolated from nitrobenzene-contaminated sludge. Strain Z3 was able to utilize nitrobenzene as a sole source of carbon, nitrogen and energy under aerobic condition. Based on the morphology, physiological biochemical characteristics, and 16S rDNA sequence, strain Z3 was identified as Micrococcus luteus. Strain Z3 completely degraded nitrobenzene with initial concentration of 100, 150, 200, and 250 mg L(-1) within 70, 96, 120 and 196 h, respectively. Kinetics of nitrobenzene degradation was described using the Andrews equation. The kinetic parameters were as follows: q(max)=1.19 h(-1), K(s)=29.11 mg L(-1), and K(i)=94.00 mg L(-1). Strain Z3 had a high salinity tolerance. It degraded 200 mg L(-1) nitrobenzene completely in 5% NaCl (w/w%). Strain Z3 therefore could be an excellent candidate for the bio-treatment of nitrobenzene industrial wastewaters with high salinity. This is the first report on the degradation of nitrobenzene by M. luteus and the degradation of nitrobenzene achieved in such a high salinity.

Composition and antimicrobial activity of the essential oils of Laserpitium latifolium L. and L. ochridanum Micevski (Apiaceae).

PubMed

Popović, Višnja B; Petrović, Silvana D; Milenković, Marina T; Drobac, Milica M; Couladis, Maria A; Niketić, Marjan S

2015-01-01

The chemical composition and antimicrobial activity of essential oils of Laserpitium latifolium and L. ochridanum were investigated. The essential oils were isolated by steam distillation and characterized by GC-FID and GC/MS analyses. All essential oils were distinguished by high contents of monoterpenes, and α-pinene was the most abundant compound in the essential oils of L. latifolium underground parts and fruits (contents of 44.4 and 44.0%, resp.). The fruit essential oil was also rich in sabinene (26.8%). Regarding the L. ochridanum essential oils, the main constituents were limonene in the fruit oil (57.7%) and sabinene in the herb oil (25.9%). The antimicrobial activity of these essential oils as well as that of L. ochridanum underground parts, whose composition was reported previously, was tested by the broth-microdilution method against four Gram-positive and three Gram-negative bacteria and two Candida albicans strains. Except the L. latifolium underground-parts essential oil, the other investigated oils showed a high antimicrobial potential against Staphylococcus aureus, S. epidermidis, Micrococcus luteus, or Candida albicans (minimal inhibitory concentrations of 13.0-73.0 μg/ml), comparable to or even higher than that of thymol, which was used as reference compound. Copyright © 2015 Verlag Helvetica Chimica Acta AG, Zürich.

Multilayer polyelectrolyte films functionalized by insertion of defensin: a new approach to protection of implants from bacterial colonization.

PubMed

Etienne, O; Picart, C; Taddei, C; Haikel, Y; Dimarcq, J L; Schaaf, P; Voegel, J C; Ogier, J A; Egles, C

2004-10-01

Infection of implanted materials by bacteria constitutes one of the most serious complications following prosthetic surgery. In the present study, we developed a new strategy based on the insertion of an antimicrobial peptide (defensin from Anopheles gambiae mosquitoes) into polyelectrolyte multilayer films built by the alternate deposition of polyanions and polycations. Quartz crystal microbalance and streaming potential measurements were used to follow step by step the construction of the multilayer films and embedding of the defensin within the films. Antimicrobial assays were performed with two strains: Micrococcus luteus (a gram-positive bacterium) and Escherichia coli D22 (a gram-negative bacterium). The inhibition of E. coli D22 growth at the surface of defensin-functionalized films was found to be 98% when 10 antimicrobial peptide layers were inserted in the film architecture. Noticeably, the biofunctionalization could be achieved only when positively charged poly(l-lysine) was the outermost layer of the film. On the basis of the results of bacterial adhesion experiments observed by confocal or electron microscopy, these observations could result from the close interaction of the bacteria with the positively charged ends of the films, which allows defensin to interact with the bacterial membrane structure. These results open new possibilities for the use of such easily built and functionalized architectures onto any type of implantable biomaterial. The modified surfaces are active against microbial infection and represent a novel means of local host protection.

Endonuclease from Micrococcus luteus Which Has Activity Toward Ultraviolet-Irradiated Deoxyribonucleic Acid: Its Action on Transforming Deoxyribonucleic Acid

PubMed Central

Setlow, R. B.; Setlow, Jane K.; Carrier, W. L.

1970-01-01

An endonuclease purified from Micrococcus luteus makes single-strand breaks in ultraviolet (UV)-irradiated, native deoxyribonucleic acid (DNA). The purified endonuclease is able to reactivate UV-inactivated transforming DNA of Haemophilus influenzae, especially when the DNA is assayed on a UV-sensitive mutant of H. influenzae. After extensive endonuclease action, there is a loss of transforming DNA when assayed on both UV-sensitive and -resistant cells. The endonuclease does not affect unirradiated DNA. The results indicate that the endonuclease function is involved in the repair of biological damage resulting from UV irradiation and that the UV-sensitive mutant is deficient in this step. We interpret the data as indicating that the various steps in the repair of DNA must be well coordinated if repair is to be effective. PMID:4314478

[Expression in E.coli and bioactivity assay of Micrococcus luteus resuscitation promoting factor domain and its mutants].

PubMed

Yue, Chen-Li; Shi, Jie-Ran; Shi, Chang-Hong; Zhang, Hai; Zhao, Lei; Zhang, Ting-Fen; Zhao, Yong; Xi, Li

2008-10-01

To express Micrococcus luteus resuscitation promoting factor (Rpf) domain and its mutants in prokaryotic cells, and to investigate their bioactivity. The gene of Rpf domain and its mutants (E54K, E54A) were amplified by polymerase chain reaction (PCR) from the genome of Micrococcus luteus and cloned into pMD18-T vector. After sequenced, the Rpf domain and its mutant gene were subcloned into expression vector PGEX-4T-1, and transfected into E. coli DH5alpha. The expressed product was purified by affinity chromatography using GST Fusion Protein Purification bead. The aim proteins were identified by SDS-PAGE analysis and by Western blot with monoclonal antibodies against Rpf domain (mAb). The bioactivity of the proteins was analyzed by stimulating the resuscitation of Mycobacterium smegmatis. The sequences of the PCR products were identical to those of the Rpf domain and its mutant gene in GenBank. The relative molecular mass identified by SDS-PAGE analysis was consistent with that had been reported, which was also confirmed by Western blot analysis that there were specific bindings at 32 000 with Rpf domain mAb. The purified GST-Rpf domain could stimulate resuscitation of Mycobacterium smegmatis. Replacements E54A and especially E54K resulted in inhibition of Rpf resuscitation activity. Rpf domain and two kinds of its mutant protein were obtained, and its effects on the resuscitation of dormant Mycobacterium smegmatis were clarified.

A Repeating Sulfated Galactan Motif Resuscitates Dormant Micrococcus luteus Bacteria.

PubMed

Böttcher, Thomas; Szamosvári, Dávid; Clardy, Jon

2018-07-01

Only a small fraction of bacteria can autonomously initiate growth on agar plates. Nongrowing bacteria typically enter a metabolically inactive dormant state and require specific chemical trigger factors or signals to exit this state and to resume growth. Micrococcus luteus has become a model organism for this important yet poorly understood phenomenon. Only a few resuscitation signals have been described to date, and all of them are produced endogenously by bacterial species. We report the discovery of a novel type of resuscitation signal that allows M. luteus to grow on agar but not agarose plates. Fractionation of the agar polysaccharide complex and sulfation of agarose allowed us to identify the signal as highly sulfated saccharides found in agar or carrageenans. Purification of hydrolyzed κ-carrageenan ultimately led to the identification of the signal as a small fragment of a large linear polysaccharide, i.e., an oligosaccharide of five or more sugars with a repeating disaccharide motif containing d-galactose-4-sulfate (G4S) 1,4-linked to 3,6-anhydro-α-d-galactose (DA), G4S-(DA-G4S) n ≥2 IMPORTANCE Most environmental bacteria cannot initiate growth on agar plates, but they can flourish on the same plates once growth is initiated. While there are a number of names for and manifestations of this phenomenon, the underlying cause appears to be the requirement for a molecular signal indicating safe growing conditions. Micrococcus luteus has become a model organism for studying this growth initiation process, often called resuscitation, because of its apparent connection with the persistent or dormant form of Mycobacterium tuberculosis , an important human pathogen. In this report, we identify a highly sulfated saccharide from agar or carrageenans that robustly resuscitates dormant M. luteus on agarose plates. We identified and characterized the signal as a small repeating disaccharide motif. Our results indicate that signals inherent in or absent from the polysaccharide composition of solid growth media can have major effects on bacterial growth. Copyright © 2018 American Society for Microbiology.

Lysozyme as a recognition element for monitoring of bacterial population.

PubMed

Zheng, Laibao; Wan, Yi; Yu, Liangmin; Zhang, Dun

2016-01-01

Bacterial infections remain a significant challenge in biomedicine and environment safety. Increasing worldwide demand for point-of-care techniques and increasing concern on their safe development and use, require a simple and sensitive bioanalysis for pathogen detection. However, this goal is not yet achieved. A design for fluorescein isothiocyanate-labeled lysozyme (FITC-LYZ), which provides quantitative binding information for gram-positive bacteria, Micrococcus luteus, and detects pathogen concentration, is presented. The functional lysozyme is used not only as the pathogenic detection platform, but also as a tracking reagent for microbial population in antibacterial tests. A nonlinear relationship between the system response and the logarithm of the bacterial concentration was observed in the range of 1.2×10(2)-1.2×10(5) cfu mL(-1). The system has a potential for further applications and provides a facile and simple method for detection of pathogenic bacteria. Meanwhile, the fluorescein isothiocyanate -labeled lysozyme is also employed as the tracking agent for antibacterial dynamic assay, which show a similar dynamic curve compared with UV-vis test. Copyright © 2015 Elsevier B.V. All rights reserved.

Prokaryotic complex of newly formed soils on nepheline-containing industrial waste

NASA Astrophysics Data System (ADS)

Evdokimova, G. A.; Kalmykova, V. V.

2010-06-01

The characteristics are given of the prokaryotic complex participating in the processes of the primary soil formation on nepheline-containing waste and depending on the time of the waste disposal and degree of reclamation. The total population density of the bacteria determined with the method of fluorescent microscopy in “pure” sand ranged within 0.34—0.60 billion CFU/g soil; in the reclaimed sand under different vegatation communities, from 2.6 to 7.2 billion CFU/g soil. Gram-positive bacteria dominate in the prokaryotic complex of the nepheline sands, whereas the Grarrmegative ones dominate in the zonal soils. The bacteria predominating in the nepheline sands were classified on the basis of the comparative analysis of the nucleotide sequences in the 16S rRNA genes within the Actinobacteria class (Arthrobacter boritolerans, A. ramosus, Rhodococcusfascians, Micrococcus luteus, and Streptomyces spp.). The evolution of the microbial community in the nepheline sands in the course of their reclamation and in the course of their overgrowing by plants proceeds in way toward the microbial communities of the zonal soils on moraine deposits.

Genome Sequence of the Fleming Strain of Micrococcus luteus, a Simple Free-Living Actinobacterium▿ †‡

PubMed Central

Young, Michael; Artsatbanov, Vladislav; Beller, Harry R.; Chandra, Govind; Chater, Keith F.; Dover, Lynn G.; Goh, Ee-Been; Kahan, Tamar; Kaprelyants, Arseny S.; Kyrpides, Nikos; Lapidus, Alla; Lowry, Stephen R.; Lykidis, Athanasios; Mahillon, Jacques; Markowitz, Victor; Mavromatis, Konstantinos; Mukamolova, Galina V.; Oren, Aharon; Rokem, J. Stefan; Smith, Margaret C. M.; Young, Danielle I.; Greenblatt, Charles L.

2010-01-01

Micrococcus luteus (NCTC2665, “Fleming strain”) has one of the smallest genomes of free-living actinobacteria sequenced to date, comprising a single circular chromosome of 2,501,097 bp (G+C content, 73%) predicted to encode 2,403 proteins. The genome shows extensive synteny with that of the closely related organism, Kocuria rhizophila, from which it was taxonomically separated relatively recently. Despite its small size, the genome harbors 73 insertion sequence (IS) elements, almost all of which are closely related to elements found in other actinobacteria. An IS element is inserted into the rrs gene of one of only two rrn operons found in M. luteus. The genome encodes only four sigma factors and 14 response regulators, a finding indicative of adaptation to a rather strict ecological niche (mammalian skin). The high sensitivity of M. luteus to β-lactam antibiotics may result from the presence of a reduced set of penicillin-binding proteins and the absence of a wblC gene, which plays an important role in the antibiotic resistance in other actinobacteria. Consistent with the restricted range of compounds it can use as a sole source of carbon for energy and growth, M. luteus has a minimal complement of genes concerned with carbohydrate transport and metabolism and its inability to utilize glucose as a sole carbon source may be due to the apparent absence of a gene encoding glucokinase. Uniquely among characterized bacteria, M. luteus appears to be able to metabolize glycogen only via trehalose and to make trehalose only via glycogen. It has very few genes associated with secondary metabolism. In contrast to most other actinobacteria, M. luteus encodes only one resuscitation-promoting factor (Rpf) required for emergence from dormancy, and its complement of other dormancy-related proteins is also much reduced. M. luteus is capable of long-chain alkene biosynthesis, which is of interest for advanced biofuel production; a three-gene cluster essential for this metabolism has been identified in the genome. PMID:19948807

Ultraviolet/ultrasound-activated persulfate for degradation of drug by zinc selenide quantum dots: Catalysis and microbiology study.

PubMed

Fakhri, Ali; Naji, Mahsa; Tahami, Shiva

2017-05-01

In this study, wet chemical method used for ZnSe quantum dots (QDs) and characterized by, UV-vis, photoluminescence spectroscopy, X-ray diffraction and transmission electron microscopy. The crystallites size of ZnSe QDs was 4.0nm. The average diameters of ZnSe QDs were 3.0-5.3nm. Ritalin was degraded using the UV/ZnSe QDs/persulfate process. The several parameters investigated for the influence of Rtialin degradation were the temperature, the persulfate concentration, and the initial Ritalin concentration. The values of optimum parameters ware room temperature, concentration persulfate 5mmol/L and initial Ritalin concentration 0.09mmol/L. Comparative analyses showed the maximum degradation of Ritalin was found for ZnSe/persulfate under ultra-visible and ultra-sonic irradiation process. Comparative analysis showed the maximum degradation of Ritalin was found for ZnSe/persulfate under ultra-visible and ultra-sonic irradiation process. The values of first-order rate constants from degradation of Ritalin at 25°C were 0.96×10 -2 , 1.09×10 -2 , 1.59×10 -2 and 2.19×10 -2 for US/PS, UV/PS, ZnSe/US/PS and ZnSe/UV/PS system, respectively. The antibacterial activity evaluation against two bacterials, including Gram-positive bacteria Staphylococcus aureus (ATCC 43300), Bacillus megaterium (ATCC 14581) and Gram-negative bacteria Pseudomonas aeruginosa (ATCC 27853), Micrococcus luteus (ATCC 4698) was considered. It was found that the MIC values for the antibacterial assay in the presence of ZnSe QDs were around 0.30mM with 64.0, 66.0, 79.2, and 83.5% inhibition for the S. aureus, B. megaterium, P. aeruginosa and M. luteus bacterial strains, respectively. Then, results show that the ZnSe QDs have antibacterial activity. Copyright © 2017 Elsevier B.V. All rights reserved.

Biochemical Properties and Mechanism of Action of Enterocin LD3 Purified from Enterococcus hirae LD3.

PubMed

Gupta, Aabha; Tiwari, Santosh Kumar; Netrebov, Victoria; Chikindas, Michael L

2016-09-01

Enterocin LD3 was purified using activity-guided multistep chromatography techniques such as cation-exchange and gel-filtration chromatography. The preparation's purity was tested using reverse-phase ultra-performance liquid chromatography. The specific activity was tested to be 187.5 AU µg(-1) with 13-fold purification. Purified enterocin LD3 was heat stable up to 121 °C (at 15 psi pressure) and pH 2-6. The activity was lost in the presence of papain, reduced by proteinase K, pepsin and trypsin, but was unaffected by amylase and lipase, suggesting proteinaceous nature of the compound and no role of carbohydrate and lipid moieties in the activity. MALDI-TOF/MS analysis of purified enterocin LD3 resolved m/z 4114.6, and N-terminal amino acid sequence was found to be H2NQGGQANQ-COOH suggesting a new bacteriocin. Dissipation of membrane potential, loss of internal ATP and bactericidal effect were recorded when indicator strain Micrococcus luteus was treated with enterocin LD3. It inhibited Gram-positive and Gram-negative bacteria including human pathogens such as Staphylococcus aureus, Pseudomonas fluorescens, Pseudomonas aeruginosa, Salmonella typhi, Shigella flexneri, Listeria monocytogenes, Escherichia coli O157:H7, E. coli (urogenic, a clinical isolate) and Vibrio sp. These properties of purified enterocin LD3 suggest its applications as a food biopreservative and as an alternative to clinical antibiotics.

Leptoglycin: a new Glycine/Leucine-rich antimicrobial peptide isolated from the skin secretion of the South American frog Leptodactylus pentadactylus (Leptodactylidae).

PubMed

Sousa, Juliana C; Berto, Raquel F; Gois, Elicélia A; Fontenele-Cardi, Nauíla C; Honório, José E R; Konno, Katsuhiro; Richardson, Michael; Rocha, Marcos F G; Camargo, Antônio A C M; Pimenta, Daniel C; Cardi, Bruno A; Carvalho, Krishnamurti M

2009-07-01

Antimicrobial peptides are components of innate immunity that is the first-line defense against invading pathogens for a wide range of organisms. Here, we describe the isolation, biological characterization and amino acid sequencing of a novel neutral Glycine/Leucine-rich antimicrobial peptide from skin secretion of Leptodactylus pentadactylus named leptoglycin. The amino acid sequence of the peptide purified by RP-HPLC (C(18) column) was deduced by mass spectrometric de novo sequencing and confirmed by Edman degradation: GLLGGLLGPLLGGGGGGGGGLL. Leptoglycin was able to inhibit the growth of Gram-negative bacteria Pseudomonas aeruginosa, Escherichia coli and Citrobacter freundii with minimal inhibitory concentrations (MICs) of 8 microM, 50 microM, and 75 microM respectively, but it did not show antimicrobial activity against Gram-positive bacteria (Staphylococcus aureus, Micrococcus luteus and Enterococcus faecalis), yeasts (Candida albicans and Candida tropicalis) and dermatophytes fungi (Microsporum canis and Trichophyton rubrum). No hemolytic activity was observed at the 2-200 microM range concentration. The amino acid sequence of leptoglycin with high level of glycine (59.1%) and leucine (36.4%) containing an unusual central proline suggests the existence of a new class of Gly/Leu-rich antimicrobial peptides. Taken together, these results suggest that this natural antimicrobial peptide could be a tool to develop new antibiotics.

Inducible factors with antimicrobial activity after immune challenge in the haemolymph of Red Palm Weevil (Insecta).

PubMed

Mastore, Maristella; Binda Rossetti, Simona; Giovannardi, Stefano; Scarì, Giorgio; Brivio, Maurizio F

2015-05-01

Insects are capable of innate immune responses elicited after microbial infection. In this process, the receptor-mediated recognition of foreign bodies and the subsequent activation of immunocompetent cells lead to the synthesis ex novo of a peptide pool with antimicrobial activity. We investigated the inducible immune response of a coleopteran, Rhynchophorus ferrugineus, challenged with both Gram-negative and Gram-positive bacteria. After immunization, we evaluated the presence of antimicrobial peptides using either biochemical analyses or microbiological techniques. The antimicrobial properties of the newly synthesized protein pool, detectable in haemolymph fractions of low molecular mass, showed strong antibacterial activity against various bacterial strains (Escherichia coli, Pseudomonas sp. OX1, Bacillus subtilis and Micrococcus luteus). In addition to the preliminary study of the mechanism of action of the pool of antimicrobial peptides, we also investigated its effects on bacterial cell walls by means of fluorescence microscopy and scanning electron microscopy. The data suggest that the main effects seem to be directed at destabilizing and damaging the bacterial wall. This study provides data that help us to understand some aspects of the inducible innate immunity in a system model that lacks anticipatory responses. However, the weevil has finely tuned its defensive strategies to counteract effectively microbial infection. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

Chicken-type lysozyme functions in the antibacterial immunity in red swamp crayfish, Procambarus clarkii.

PubMed

Liao, Tian-Jiang; Gao, Jie; Wang, Jin-Xing; Wang, Xian-Wei

2018-08-01

Lysozymes possess antibacterial activities, making them crucial defense proteins in innate immunity. In this study, a chicken-type (c-type) lysozyme (designated PcLyzc) was cloned and characterized from red swamp crayfish Procambarus clarkii. The full-length cDNA had an open reading frame of 435 base pairs encoding a polypeptide of 144 amino acid residues. Multiple alignments and phylogenetic analysis revealed that PcLyzc shared high similarity to the other known invertebrate c-type lysozymes. PcLyzc transcripts were steadily expressed in a wide range of tissues in healthy crayfish, and were prominently up-regulated in the hepatopancreas and gills after Vibrio anguillarum or Aeromonas hydrophila challenge. Recombinant PcLyzc showed inhibitory activity in vitro against both Gram-positive bacteria, including Staphylococcus aureus, Micrococcus luteus and Bacillus thuringiensis, and Gram-negative bacteria, including A. hydrophila, V. anguillarum and Escherichia coli. By overexpressing PcLyzc through introducing exogenous recombinant protein, or silencing PcLyzc expression through injecting double strand RNA, it was found that PcLyzc could help eliminate the invading bacteria in crayfish hemolymph and could protect crayfish from death, possibly by promoting the hemocytic phagocytosis. These results indicated that PcLyzc played a role in the antibacterial immunity of crustaceans, and laid a foundation of developing new therapeutic agents in aquaculture. Copyright © 2018 Elsevier Ltd. All rights reserved.

Exploring the potential environmental functions of viable but non-culturable bacteria.

PubMed

Su, Xiaomei; Chen, Xi; Hu, Jinxing; Shen, Chaofeng; Ding, Linxian

2013-12-01

A conventional plate count is the most commonly employed method to estimate the number of living bacteria in environmental samples. In fact, judging the level of viable culture by plate count is limited, because it is often several orders of magnitude less than the number of living bacteria actually present. Most of the bacteria are in "viable but non-culturable" (VBNC) state, whose cells are intact and alive and can resuscitate when surrounding conditions are more favorable. The most exciting recent development in resuscitating VBNC bacteria is a bacterial cytokine, namely, the resuscitation-promoting factor (Rpf), secreted by Micrococcus luteus, which promotes the resuscitation and growth of high G+C Gram-positive organisms, including some species of the genus Mycobacterium. However, most of studies deal with VBNC bacteria only from the point of view of medicine and epidemiology. It is therefore of great significance to research whether these VBNC state bacteria also possess some useful environmental capabilities, such as degradation, flocculation, etc. Further studies are needed to elucidate the possible environmental role of the VBNC bacteria, rather than only considering their role as potential pathogens from the point view of epidemiology and public health. We have studied the resuscitation of these VBNC bacteria in polluted environments by adding culture supernatant containing Rpf from M. luteus, and it was found that, as a huge microbial resource, VBNC bacteria could provide important answers to dealing with existing problems of environmental pollution. This mini-review will provide new insight for considering the potentially environmental functions of VBNC bacteria.

Hemocyte-mediated phagocytosis and melanization in the mosquito Armigeres subalbatus following immune challenge by bacteria.

PubMed

Hillyer, Julián F; Schmidt, Shelley L; Christensen, Bruce M

2003-07-01

Mosquitoes are important vectors of disease. These insects respond to invading organisms with strong cellular and humoral immune responses that share many similarities with vertebrate immune systems. The strength and specificity of these responses are directly correlated to a mosquito's ability to transmit disease. In the current study, we characterized the hemocytes (blood cells) of Armigeres subalbatus by morphology (ultrastructure), lectin binding, enzyme activity, immunocytochemistry, and function. We found four hemocyte types: granulocytes, oenocytoids, adipohemocytes, and thrombocytoids. Granulocytes contained acid phosphatase activity and bound the exogenous lectins Helix pomatia agglutinin, Galanthus nivalis lectin, and wheat germ agglutinin. Following bacteria inoculation, granulocytes mounted a strong phagocytic response as early as 5 min postexposure. Bacteria also elicited a hemocyte-mediated melanization response. Phenoloxidase, the rate-limiting enzyme in the melanization pathway, was present exclusively in oenocytoids and in many of the melanotic capsules enveloping bacteria. The immune responses mounted against different bacteria were not identical; gram(-) Escherichia coli were predominantly phagocytosed and gram(+) Micrococcus luteus were melanized. These studies implicate hemocytes as the primary line of defense against bacteria.

Culture-dependent and culture-independent characterization of potentially functional biphenyl-degrading bacterial community in response to extracellular organic matter from Micrococcus luteus.

PubMed

Su, Xiao-Mei; Liu, Yin-Dong; Hashmi, Muhammad Zaffar; Ding, Lin-Xian; Shen, Chao-Feng

2015-05-01

Biphenyl (BP)-degrading bacteria were identified to degrade various polychlorinated BP (PCB) congers in long-term PCB-contaminated sites. Exploring BP-degrading capability of potentially useful bacteria was performed for enhancing PCB bioremediation. In the present study, the bacterial composition of the PCB-contaminated sediment sample was first investigated. Then extracellular organic matter (EOM) from Micrococcus luteus was used to enhance BP biodegradation. The effect of the EOM on the composition of bacterial community was investigated by combining with culture-dependent and culture-independent methods. The obtained results indicate that Proteobacteria and Actinobacteria were predominant community in the PCB-contaminated sediment. EOM from M. luteus could stimulate the activity of some potentially difficult-to-culture BP degraders, which contribute to significant enhancement of BP biodegradation. The potentially difficult-to-culture bacteria in response to EOM addition were mainly Rhodococcus and Pseudomonas belonging to Gammaproteobacteria and Actinobacteria respectively. This study provides new insights into exploration of functional difficult-to-culture bacteria with EOM addition and points out broader BP/PCB degrading, which could be employed for enhancing PCB-bioremediation processes. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

EFFECT OF IMPACT STRESS ON MICROBIAL RECOVERY ON AN AGAR SURFACE

EPA Science Inventory

Microbial stress due to the impaction of microorganisms onto an agar collection surface was studied experimentally. he relative recovery rates of aerosolized Pseudomonas fluorescens and Micrococcus luteus were determined as a function of the impaction velocity by using a moving a...

Effect of Nisin's Controlled Release on Microbial Growth as Modeled for Micrococcus luteus.

PubMed

Balasubramanian, Aishwarya; Lee, Dong Sun; Chikindas, Michael L; Yam, Kit L

2011-06-01

The need for safe food products has motivated food scientists and industry to find novel technologies for antimicrobial delivery for improving food safety and quality. Controlled release packaging is a novel technology that uses the package to deliver antimicrobials in a controlled manner and sustain antimicrobial stress on the targeted microorganism over the required shelf life. This work studied the effect of controlled release of nisin to inhibit growth of Micrococcus luteus (a model microorganism) using a computerized syringe pump system to mimic the release of nisin from packaging films which was characterized by an initially fast rate and a slower rate as time progressed. The results show that controlled release of nisin was strikingly more effective than instantly added ("formulated") nisin. While instant addition experiments achieved microbial inhibition only at the beginning, controlled release experiments achieved complete microbial inhibition for a longer time, even when as little as 15% of the amount of nisin was used as compared to instant addition.

Regioselective synthesis of 3-benzyl substituted pyrimidino chromen-2-ones and evaluation of anti-microbial and anti-biofilm activities.

PubMed

Emmadi, Narender Reddy; Atmakur, Krishnaiah; Bingi, Chiranjeevi; Godumagadda, Narender Reddy; Chityal, Ganesh Kumar; Nanubolu, Jagadeesh Babu

2014-01-15

Regioselective synthesis of a number of highly functionalized 3-benzylpyrimidino chromen-2-ones (4) were accomplished in a one pot three component reaction in acetic acid and determined their anti-microbial and anti-biofilm activities. Compounds 4o and 4p showed an excellent anti-microbial activity against Micrococcus luteus MTCC 2470 at a par with standard control (Ciprofloxacin) and exhibited best activity against Staphylococcus aureus MTCC 96 and Bacillus subtilis MTCC 121. Further, compounds 4h, 4i, 4m, 4n and 4q showed promising activity against Micrococcus luteus MTCC 2470, Staphylococcus aureus MTCC 96 and Bacillus subtilis MTCC 121. Whereas, compounds 4m showed very promising biofilm inhibition activity against Staphylococcus aureus MLS 16 MTCC 2940 and 4o, 4p showed very potent activity against Staphylococcus aureus MTCC 96 at a par with Ciprofloxacin used as standard control. Copyright © 2013 Elsevier Ltd. All rights reserved.

Expression levels of chaperones influence biotransformation activity of recombinant Escherichia coli expressing Micrococcus luteus alcohol dehydrogenase and Pseudomonas putida Baeyer-Villiger monooxygenase.

PubMed

Baek, A-Hyong; Jeon, Eun-Yeong; Lee, Sun-Mee; Park, Jin-Byung

2015-05-01

We demonstrated for the first time that the archaeal chaperones (i.e., γ-prefoldin and thermosome) can stabilize enzyme activity in vivo. Ricinoleic acid biotransformation activity of recombinant Escherichia coli expressing Micrococcus luteus alcohol dehydrogenase and the Pseudomonas putida KT2440 Baeyer-Villiger monooxygenase improved significantly with co-expression of γ-prefoldin or recombinant themosome originating from the deep-sea hyperthermophile archaea Methanocaldococcus jannaschii. Furthermore, the degree of enhanced activity was dependent on the expression levels of the chaperones. For example, whole-cell biotransformation activity was highest at 12 µmol/g dry cells/min when γ-prefoldin expression level was approximately 46% of the theoretical maximum. This value was approximately two-fold greater than that in E. coli, where the γ-prefoldin expression level was zero or set to the theoretical maximum. Therefore, it was assumed that the expression levels of chaperones must be optimized to achieve maximum biotransformation activity in whole-cell biocatalysts. © 2014 Wiley Periodicals, Inc.

A novel approach to enhance biological nutrient removal using a culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (Rpf) in SBR process.

PubMed

Liu, Yindong; Su, Xiaomei; Lu, Lian; Ding, Linxian; Shen, Chaofeng

2016-03-01

A culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (SRpf) was used to enhance the biological nutrient removal of potentially functional bacteria. The obtained results suggest that SRpf accelerated the start-up process and significantly enhanced the biological nutrient removal in sequencing batch reactor (SBR). PO4 (3-)-P removal efficiency increased by over 12 % and total nitrogen removal efficiency increased by over 8 % in treatment reactor acclimated by SRpf compared with those without SRpf addition. The Illumina high-throughput sequencing analysis showed that SRpf played an essential role in shifts in the composition and diversity of bacterial community. The phyla of Proteobacteria and Actinobacteria, which were closely related to biological nutrient removal, were greatly abundant after SRpf addition. This study demonstrates that SRpf acclimation or addition might hold great potential as an efficient and cost-effective alternative for wastewater treatment plants (WWTPs) to meet more stringent operation conditions and legislations.

Biosynthetic elongation of isolated teichuronic acid polymers via glucosyl- and N-acetylmannosaminuronosyltransferases from solubilized cytoplasmic membrane fragments of Micrococcus luteus.

PubMed Central

Hildebrandt, K M; Anderson, J S

1990-01-01

Cytoplasmic membrane fragments of Micrococcus luteus catalyze in vitro biosynthesis of teichuronic acid from uridine diphosphate D-glucose (UDP-glucose), uridine diphosphate N-acetyl-D-mannosaminuronic acid (UDP-ManNAcA), and uridine diphosphate N-acetyl-D-glucosamine. Membrane fragments solubilized with Thesit (dodecyl alcohol polyoxyethylene ether) can utilize UDP-glucose and UDP-ManNAcA to effect elongation of teichuronic acid isolated from native cell walls. When UDP-glucose is the only substrate supplied, the detergent-solubilized glucosyltransferase incorporates a single glucosyl residue onto each teichuronic acid acceptor. When both UDP-glucose and UDP-ManNAcA are supplied, the glucosyltransferase and the N-acetylmannosaminuronosyltransferase act cooperatively to elongate the teichuronic acid acceptor by multiple additions of the disaccharide repeat unit. As shown by polyacrylamide gel electrophoresis, low-molecular-weight fractions of teichuronic acid are converted to higher-molecular-weight polymers by the addition of as many as 17 disaccharide repeat units. Images PMID:2118507

Physicochemical properties and membrane biofouling of extra-cellular polysaccharide produced by a Micrococcus luteus strain.

PubMed

Feng, Lei; Li, Xiufen; Song, Ping; Du, Guocheng; Chen, Jian

2014-07-01

The physicochemical properties of the extra-cellular polysaccharide (EPS) produced by a Micrococcus luteus strain, a dominating strain isolated from membrane biofouling layer, were determined in this study. The EPS isolated from this strain was measured to have an average molecular weight of 63,540 Da and some typical polysaccharide absorption peaks in Fourier transform infrared spectrum. Monosaccharide components of the EPS contained rhamnose, fucose, arabinose, xylose, mannose, galactose and glucose in a molar ratio of 0.2074:0.0454:0.0262:0.0446:1.7942:1.2086:0.4578. Pseudo plastic properties were also observed for the EPS through the rheological measurement. The EPS was further characterized for its behavior to cause membrane flux decline. The results showed that both flux declines for polyvinylidenefluoride (PVDF) and polypropylene membranes became more severe as EPS feed concentration increased. A higher irreversible fouling for the PVDF membrane suggested that the EPS had the larger fouling potential to this microfiltration membrane.

Pentocin MQ1: A Novel, Broad-Spectrum, Pore-Forming Bacteriocin From Lactobacillus pentosus CS2 With Quorum Sensing Regulatory Mechanism and Biopreservative Potential

PubMed Central

Wayah, Samson B.; Philip, Koshy

2018-01-01

Micrococcus luteus, Listeria monocytogenes, and Bacillus cereus are major food-borne pathogenic and spoilage bacteria. Emergence of antibiotic resistance and consumer demand for foods containing less of chemical preservatives led to a search for natural antimicrobials. A study aimed at characterizing, investigating the mechanism of action and regulation of biosynthesis and evaluating the biopreservative potential of pentocin from Lactobacillus pentosus CS2 was conducted. Pentocin MQ1 is a novel bacteriocin isolated from L. pentosus CS2 of coconut shake origin. The purification strategy involved adsorption-desorption of bacteriocin followed by RP-HPLC. It has a molecular weight of 2110.672 Da as determined by MALDI-TOF mass spectrometry and a molar extinction value of 298.82 M−1 cm−1. Pentocin MQ1 is not plasmid-borne and its biosynthesis is regulated by a quorum sensing mechanism. It has a broad spectrum of antibacterial activity, exhibited high chemical, thermal and pH stability but proved sensitive to proteolytic enzymes. It is potent against M. luteus, B. cereus, and L. monocytogenes at micromolar concentrations. It is quick-acting and exhibited a bactericidal mode of action against its targets. Target killing was mediated by pore formation. We report for the first time membrane permeabilization as a mechanism of action of the pentocin from the study against Gram-positive bacteria. Pentocin MQ1 is a cell wall-associated bacteriocin. Application of pentocin MQ1 improved the microbiological quality and extended the shelf life of fresh banana. This is the first report on the biopreservation of banana using bacteriocin. These findings place pentocin MQ1 as a potential biopreservative for further evaluation in food and medical applications. PMID:29636737

Antimicrobial peptides expressed in medicinal maggots of the blow fly Lucilia sericata show combinatorial activity against bacteria.

PubMed

Pöppel, Anne-Kathrin; Vogel, Heiko; Wiesner, Jochen; Vilcinskas, Andreas

2015-05-01

The larvae of the common green bottle fly (Lucilia sericata) produce antibacterial secretions that have a therapeutic effect on chronic and nonhealing wounds. Recent developments in insect biotechnology have made it possible to use these larvae as a source of novel anti-infectives. Here, we report the application of next-generation RNA sequencing (RNA-Seq) to characterize the transcriptomes of the larval glands, crop, and gut, which contribute to the synthesis of antimicrobial peptides (AMPs) and proteins secreted into wounds. Our data confirm that L. sericata larvae have adapted in order to colonize microbially contaminated habitats, such as carrion and necrotic wounds, and are protected against infection by a diverse spectrum of AMPs. L. sericata AMPs include not only lucifensin and lucimycin but also novel attacins, cecropins, diptericins, proline-rich peptides, and sarcotoxins. We identified 47 genes encoding putative AMPs and produced 23 as synthetic analogs, among which some displayed activities against a broad spectrum of microbial pathogens, including Pseudomonas aeruginosa, Proteus vulgaris, and Enterococcus faecalis. Against Escherichia coli (Gram negative) and Micrococcus luteus (Gram positive), we found mostly additive effects but also synergistic activity when selected AMPs were tested in combination. The AMPs that are easy to synthesize are currently being produced in bulk to allow their evaluation as novel anti-infectives that can be formulated in hydrogels to produce therapeutic wound dressings and adhesive bandages. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Anthocyanins, antioxidative, and antimicrobial properties of American cranberry (Vaccinium macrocarpon Ait.) and their press cakes.

PubMed

Viskelis, P; Rubinskiene, M; Jasutiene, I; Sarkinas, A; Daubaras, R; Cesoniene, L

2009-03-01

Amounts of total phenolics, anthocyanins, and ascorbic acid in 4 American cranberry varieties harvested at 4 stages of maturity were measured. The larger amount of phenolic compounds was found in berries of "Black Veil" cultivar (504 mg/100 g) at II stage of maturity. Significantly larger amounts of anthocyanins were determined in the overripe berries of the cultivars "Ben Lear" and "Black Veil." The amount of ascorbic acid in berries increased during ripening from I to III stage, and slightly decreased in the overripe berries. The biggest quantities of ascorbic acid were found in the ripe berries of "Ben Lear" cultivar (15.8 mg/100 g). The distribution of anthocyanins pigments was determined by HPLC-UV/MS in mature berries. The composition of individual anthocyanins in berries was quite similar in all the studied cranberry cultivars. While skins of cranberries are rich in anthocyanins and other phenolic compounds, the extracts of the by-products of cranberries juice-berry cakes, were analyzed and obtained results were compared with the properties of extracts made from whole berries. The anthocyanins and total phenolics content, radical scavenging activity, antimicrobial activity of the whole berries, and their press cakes extracts were measured. All investigated extracts from berries and their press cakes showed good radical scavenging activity and revealed antimicrobial properties. It was found that Bacillus cereus (ATCC 10876) and Micrococcus luteus (ATCC 9341) were the most sensitive among 10 tested Gram-negative and Gram-positive bacteria.

Biologically active Schiff bases containing thiophene/furan ring and their copper(II) complexes: Synthesis, spectral, nonlinear optical and density functional studies

NASA Astrophysics Data System (ADS)

Gündüzalp, Ayla Balaban; Özsen, İffet; Alyar, Hamit; Alyar, Saliha; Özbek, Neslihan

2016-09-01

Schiff bases; 1,8-bis(thiophene-2-carboxaldimine)-p-menthane (L1) and 1,8-bis(furan-2-carboxaldimine)-p-menthane (L2) have been synthesized and characterized by elemental analysis, 1Hsbnd 13C NMR, UV-vis, FT-IR and LC-MS methods. 1H and 13C shielding tensors for L1 and L2 were calculated with GIAO/DFT/B3LYP/6-311++G(d,p) methods in CDCl3. The vibrational band assignments, nonlinear optical (NLO) activities, frontier molecular orbitals (FMOs) and absorption spectrum have been investigated by the same basis set. Schiff base-copper(II) complexes have been synthesized and structurally characterized with spectroscopic methods, magnetic and conductivity measurements. The spectroscopic data suggest that Schiff base ligands coordinate through azomethine-N and thiophene-S/furan-O donors (as SNNS and ONNO chelating systems) to give a tetragonal geometry around the copper(II) ions. Schiff bases and Cu(II) complexes have been screened for their biological activities on different species of pathogenic bacteria, those are, Gram positive bacteria: Bacillus subtitilus, Yersinia enterotica, Bacillus cereus, Listeria monocytogenes, Micrococcus luteus and Gram negative bacteria: Escherichia coli, Pseudomonas aeroginosa, Shigella dysenteriae, Salmonella typhi, Klebsiella pseudomonas by using microdilution technique (MIC values in mM). Biological activity results show that Cu(II) complexes have higher activities than parent ligands and metal chelation may affect significantly the antibacterial behavior of the organic ligands.

Ligational behavior of Schiff bases towards transition metal ion and metalation effect on their antibacterial activity

NASA Astrophysics Data System (ADS)

Devi, Jai; Batra, Nisha; Malhotra, Rajesh

2012-11-01

New Schiff bases pyrazine-2-carboxylicacid (phenyl-pyridin-2-yl-methylene)-hydrazide (Hpch-bp) HL1 and pyrazine-2-carboxylicacid (pyridin-2-ylmethylene)-hydrazide (Hpch-pc) HL2 derived from condensation of pyrazine carboxylic hydrazide (Hpch) with 2-benzoyl pyridine (bp) or pyridine 2-carbaldehyde (pc) and their transition metal complexes of type ML(1-2)2 have been synthesized, where M = Mn(II), Co(II), Ni(II), Cu(II) and Zn(II). Characterization of ligands and their metal complexes was carried out by elemental analysis, conductimetric studies, magnetic susceptibility, spectroscopic techniques (IR, UV-VIS, NMR, ESR, Mass) and thermogravimetric analysis. The physico-chemical studies revealed octahedral geometry or distorted octahedral geometry around metal ion. These azomethine Schiff base ligands acted as tridentate ? coordinating through carbonyl, azomethine and pyridine nitrogen present in the ligand. The thermodynamic and thermal properties of the complexes have been investigated and it was observed on the basis of these studies that thermal stability of complexes follows the order Mn < Zn < Cu < Co < Ni. The ligands and their complexes were tested for in vitro antibacterial activity at different concentrations against bacteria viz. Gram positive Bacillus subtilis, Micrococcus luteus and Gram negative Pseudomonas aeruginosa, Pseudomonas mendocina. A marked enhancement in biocidal activity of the ligands under similar experimental conditions was observed as a consequence of coordination with metal ions. The trend of growth inhibition in the complexes was found to be in the order: Cu > Mn > Ni > Co > Zn.

Keratinolytic abilities of Micrococcus luteus from poultry waste.

PubMed

Laba, Wojciech; Choinska, Anna; Rodziewicz, Anna; Piegza, Michal

2015-01-01

Keratinolytic microorganisms have become the subject of scientific interest due to their ability to biosynthesize specific keratinases and their prospective application in keratinic waste management. Among several bacterial classes, actinobacteria remain one of the most important sources of keratin-degrading strains, however members of the Micrococcaceae family are rarely scrutinized in regard to their applicatory keratinolytic potential. The tested Micrococcus sp. B1pz isolate from poultry feather waste was identified as M. luteus. The strain, grown in the medium with 1-2% chicken feathers and a yeast extract supplement, produced keratinases of 32 KU and lower level of proteases, 6 PU. It was capable to effectively decompose feathers or "soft" keratin of stratum corneum, in contrast to other "hard" hair-type keratins. The produced keratinolytic enzymes were mainly a combination of alkaline serine or thiol proteases, active at the optimum pH 9.4, 55 °C. Four main protease fractions of 62, 185, 139 and 229 kDa were identified in the crude culture fluid. The research on the auxiliary role of reducing factors revealed that reducing sulfur compounds could be applied in keratinolysis enhancement during enzymatic digestion of keratin, rather than in culture conditions. The presented M. luteus isolate exhibits a significant keratinolytic potential, which determines its feasible applicatory capacity towards biodegradation of poultry by-products or formulation of keratin-based feed components.

Dynamic miRNA-mRNA regulations are essential for maintaining Drosophila immune homeostasis during Micrococcus luteus infection.

PubMed

Wei, Guanyun; Sun, Lianjie; Li, Ruimin; Li, Lei; Xu, Jiao; Ma, Fei

2018-04-01

Pathogen bacteria infections can lead to dynamic changes of microRNA (miRNA) and mRNA expression profiles, which may control synergistically the outcome of immune responses. To reveal the role of dynamic miRNA-mRNA regulation in Drosophila innate immune responses, we have detailedly analyzed the paired miRNA and mRNA expression profiles at three time points during Drosophila adult males with Micrococcus luteus (M. luteus) infection using RNA- and small RNA-seq data. Our results demonstrate that differentially expressed miRNAs and mRNAs represent extensively dynamic changes over three time points during Drosophila with M. luteus infection. The pathway enrichment analysis indicates that differentially expressed genes are involved in diverse signaling pathways, including Toll and Imd as well as orther signaling pathways at three time points during Drosophila with M. luteus infection. Remarkably, the dynamic change of miRNA expression is delayed by compared to mRNA expression change over three time points, implying that the "time" parameter should be considered when the function of miRNA/mRNA is further studied. In particular, the dynamic miRNA-mRNA regulatory networks have shown that miRNAs may synergistically regulate gene expressions of different signaling pathways to promote or inhibit innate immune responses and maintain homeostasis in Drosophila, and some new regulators involved in Drosophila innate immune response have been identified. Our findings strongly suggest that miRNA regulation is a key mechanism involved in fine-tuning cooperatively gene expressions of diverse signaling pathways to maintain innate immune response and homeostasis in Drosophila. Taken together, the present study reveals a novel role of dynamic miRNA-mRNA regulation in immune response to bacteria infection, and provides a new insight into the underlying molecular regulatory mechanism of Drosophila innate immune responses. Copyright © 2017 Elsevier Ltd. All rights reserved.

Genes involved in long-chain alkene biosynthesis in Micrococcus luteus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beller, Harry R.; Goh, Ee-Been; Keasling, Jay D.

2010-01-07

Aliphatic hydrocarbons are highly appealing targets for advanced cellulosic biofuels, as they are already predominant components of petroleum-based gasoline and diesel fuels. We have studied alkene biosynthesis in Micrococcus luteus ATCC 4698, a close relative of Sarcina lutea (now Kocuria rhizophila), which four decades ago was reported to biosynthesize iso- and anteiso branched, long-chain alkenes. The underlying biochemistry and genetics of alkene biosynthesis were not elucidated in those studies. We show here that heterologous expression of a three-gene cluster from M. luteus (Mlut_13230-13250) in a fatty-acid overproducing E. coli strain resulted in production of long-chain alkenes, predominantly 27:3 and 29:3more » (no. carbon atoms: no. C=C bonds). Heterologous expression of Mlut_13230 (oleA) alone produced no long-chain alkenes but unsaturated aliphatic monoketones, predominantly 27:2, and in vitro studies with the purified Mlut_13230 protein and tetradecanoyl-CoA produced the same C27 monoketone. Gas chromatography-time of flight mass spectrometry confirmed the elemental composition of all detected long-chain alkenes and monoketones (putative intermediates of alkene biosynthesis). Negative controls demonstrated that the M. luteus genes were responsible for production of these metabolites. Studies with wild-type M. luteus showed that the transcript copy number of Mlut_13230-13250 and the concentrations of 29:1 alkene isomers (the dominant alkenes produced by this strain) generally corresponded with bacterial population over time. We propose a metabolic pathway for alkene biosynthesis starting with acyl-CoA (or -ACP) thioesters and involving decarboxylative Claisen condensation as a key step, which we believe is catalyzed by OleA. Such activity is consistent with our data and with the homology (including the conserved Cys-His-Asn catalytic triad) of Mlut_13230 (OleA) to FabH (?-ketoacyl-ACP synthase III), which catalyzes decarboxylative Claisen condensation during fatty acid biosynthesis.« less

Genes involved in long-chain alkene biosynthesis in Micrococcus luteus.

PubMed

Beller, Harry R; Goh, Ee-Been; Keasling, Jay D

2010-02-01

Aliphatic hydrocarbons are highly appealing targets for advanced cellulosic biofuels, as they are already predominant components of petroleum-based gasoline and diesel fuels. We have studied alkene biosynthesis in Micrococcus luteus ATCC 4698, a close relative of Sarcina lutea (now Kocuria rhizophila), which 4 decades ago was reported to biosynthesize iso- and anteiso-branched, long-chain alkenes. The underlying biochemistry and genetics of alkene biosynthesis were not elucidated in those studies. We show here that heterologous expression of a three-gene cluster from M. luteus (Mlut_13230-13250) in a fatty acid-overproducing Escherichia coli strain resulted in production of long-chain alkenes, predominantly 27:3 and 29:3 (no. carbon atoms: no. C=C bonds). Heterologous expression of Mlut_13230 (oleA) alone produced no long-chain alkenes but unsaturated aliphatic monoketones, predominantly 27:2, and in vitro studies with the purified Mlut_13230 protein and tetradecanoyl-coenzyme A (CoA) produced the same C(27) monoketone. Gas chromatography-time of flight mass spectrometry confirmed the elemental composition of all detected long-chain alkenes and monoketones (putative intermediates of alkene biosynthesis). Negative controls demonstrated that the M. luteus genes were responsible for production of these metabolites. Studies with wild-type M. luteus showed that the transcript copy number of Mlut_13230-13250 and the concentrations of 29:1 alkene isomers (the dominant alkenes produced by this strain) generally corresponded with bacterial population over time. We propose a metabolic pathway for alkene biosynthesis starting with acyl-CoA (or-ACP [acyl carrier protein]) thioesters and involving decarboxylative Claisen condensation as a key step, which we believe is catalyzed by OleA. Such activity is consistent with our data and with the homology (including the conserved Cys-His-Asn catalytic triad) of Mlut_13230 (OleA) to FabH (beta-ketoacyl-ACP synthase III), which catalyzes decarboxylative Claisen condensation during fatty acid biosynthesis.

A scallop C-type lectin from Argopecten irradians (AiCTL5) with activities of lipopolysaccharide binding and Gram-negative bacteria agglutination.

PubMed

Mu, Changkao; Song, Xiaoyan; Zhao, Jianmin; Wang, Lingling; Qiu, Limei; Zhang, Huan; Zhou, Zhi; Wang, Mengqiang; Song, Linsheng; Wang, Chunlin

2012-05-01

C-type lectins are a family of calcium-dependent carbohydrate-binding proteins. In the present study, a C-type lectin (designated as AiCTL5) was identified and characterized from Argopecten irradians. The full-length cDNA of AiCTL5 was of 673 bp, containing a 5' untranslated region (UTR) of 24 bp, a 3' UTR of 130 bp with a poly (A) tail, and an open reading frame (ORF) of 519 bp encoding a polypeptide of 172 amino acids with a putative signal peptide of 17 amino acids. A C-type lectin-like domain (CRD) containing 6 conserved cysteines and a putative glycosylation sites were identified in the deduced amino acid sequence of AiCTL5. AiCTL5 shared 11%-27.5% identity with the previous reported C-type lectin from A. irradians. The cDNA fragment encoding the mature peptide of AiCTL5 was recombined into pET-21a (+) with a C-terminal hexa-histidine tag fused in-frame, and expressed in Escherichia coli Origami (DE3). The recombinant AiCTL5 (rAiCTL5) agglutinated Gram-negative E. coli TOP10F' and Listonella anguillarum, but did not agglutinate Gram-positive bacteria Bacillus thuringiensis and Micrococcus luteus, and the agglutination could be inhibited by EDTA, indicating that AiCTL5 was a Ca(2+)-dependent lectin. rAiCTL5 exhibited a significantly strong activity to bind LPS from E. coli, which conformed to the agglutinating activity toward Gram-negative bacteria. Moreover, rAiCTL5 also agglutinated rabbit erythrocytes. These results indicated that AiCTL5 could function as a pattern recognition receptor to protect bay scallop from Gram-negative bacterial infection, and also provide evidence to understand the structural and functional diverse of lectin. Copyright © 2012 Elsevier Ltd. All rights reserved.

Biosynthetic pathway for γ-cyclic sarcinaxanthin in Micrococcus luteus: heterologous expression and evidence for diverse and multiple catalytic functions of C(50) carotenoid cyclases.

PubMed

Netzer, Roman; Stafsnes, Marit H; Andreassen, Trygve; Goksøyr, Audun; Bruheim, Per; Brautaset, Trygve

2010-11-01

We report the cloning and characterization of the biosynthetic gene cluster (crtE, crtB, crtI, crtE2, crtYg, crtYh, and crtX) of the γ-cyclic C(50) carotenoid sarcinaxanthin in Micrococcus luteus NCTC2665. Expression of the complete and partial gene cluster in Escherichia coli hosts revealed that sarcinaxanthin biosynthesis from the precursor molecule farnesyl pyrophosphate (FPP) proceeds via C(40) lycopene, C(45) nonaflavuxanthin, C(50) flavuxanthin, and C(50) sarcinaxanthin. Glucosylation of sarcinaxanthin was accomplished by the crtX gene product. This is the first report describing the biosynthetic pathway of a γ-cyclic C(50) carotenoid. Expression of the corresponding genes from the marine M. luteus isolate Otnes7 in a lycopene-producing E. coli host resulted in the production of up to 2.5 mg/g cell dry weight sarcinaxanthin in shake flasks. In an attempt to experimentally understand the specific difference between the biosynthetic pathways of sarcinaxanthin and the structurally related ε-cyclic decaprenoxanthin, we constructed a hybrid gene cluster with the γ-cyclic C(50) carotenoid cyclase genes crtYg and crtYh from M. luteus replaced with the analogous ε-cyclic C(50) carotenoid cyclase genes crtYe and crtYf from the natural decaprenoxanthin producer Corynebacterium glutamicum. Surprisingly, expression of this hybrid gene cluster in an E. coli host resulted in accumulation of not only decaprenoxanthin, but also sarcinaxanthin and the asymmetric ε- and γ-cyclic C(50) carotenoid sarprenoxanthin, described for the first time in this work. Together, these data contributed to new insight into the diverse and multiple functions of bacterial C(50) carotenoid cyclases as key catalysts for the synthesis of structurally different carotenoids.

First report of linear megaplasmids in the genus Micrococcus.

PubMed

Dib, Julian R; Wagenknecht, Martin; Hill, Russell T; Farías, María E; Meinhardt, Friedhelm

2010-01-01

High-altitude wetlands (above 4200m) in the northwest of Argentina are considered pristine and extreme environments. Micrococcus sp. A1, H5, and V7, isolated from such environments, were shown to contain linear megaplasmids, designated pLMA1, pLMH5, and pLMV7, respectively. As known from linear plasmids of other actinomycetes, all three plasmids were resistant to lambda exonuclease treatment, which is consistent with having terminal proteins covalently attached to their 5' DNA ends. Electrophoretic mobility, Southern analysis, and restriction endonuclease patterns revealed pLMA1 and pLMH5 being indistinguishable plasmids, even though they were found in different strains isolated from two distant wetlands - Laguna Azul and Laguna Huaca Huasi. Analysis of 16S rDNA sequences of Micrococcus sp. A1, H5, and V7 suggested a close relationship to Micrococcus luteus. Typing of isolates was performed using fingerprint patterns generated by BOX-PCR. Plasmid-deficient strains, generated from Micrococcus sp. A1, showed a significantly decreased resistance level for erythromycin. Copyright 2009 Elsevier Inc. All rights reserved.

Antimicrobial activity of Bryum argenteum.

PubMed

Sabovljevic, Aneta; Sokovic, Marina; Sabovljevic, Marko; Grubisic, Dragoljub

2006-02-01

The antimicrobial activity of Bryum argenteum ethanol extracts was evaluated by microdilution method against four bacterial (Escherichia coli, Bacillus subtilis, Micrococcus luteus and Staphilococcus aureus) and four fungal species (Aspergillus niger, Penicillium ochrochloron, Candida albicans and Trichophyton mentagrophyes). All the investigated ethanol extracts have been proved to be active against all bacteria and fungi tested.

Distribution and Persistence of Staphylococcus and Micrococcus Species and Other Aerobic Bacteria on Human Skin1

PubMed Central

Kloos, Wesley E.; Musselwhite, Margaret S.

1975-01-01

The distribution of Staphylococcus and Micrococcus species and associated coryneform bacteria, Acinetobacter, Klebsiella, Enterobacter, Bacillus, and Streptomyces on skin was determined during October 1971 from samples collected on persons living in North Carolina and New Jersey. Persistence of these organisms on skin was estimated in temporal studies conducted during the period from June 1971 to June 1972 on persons living in North Carolina. Staphylococci and coryneforms were the most predominant and persistent bacteria isolated from the nares and axillae. Staphylococci, coryneforms, micrococci, and Bacillus were the most predominant and persistent bacteria isolated from the head, legs, and arms. Acinetobacters were most frequently isolated during the warmer months of the years. Staphylococcus aureus and S. epidermidis were the most predominant and persistent staphylococci isolated from the nares, whereas S. epidermidis and S. hominis were the most predominant and persistent staphylococci isolated from the axillae, head, legs, and arms. S. capitis was often isolated from the head and arms and S. haemolyticus was often isolated from the head, legs, and arms. S. simulans, S. xylosus, S. cohnii, S. saprophyticus, S. warneri, and an unclassified coagulase-positive species were only occasionally isolated from skin. Micrococcus luteus was the most predominant and persistent Micrococcus isolated from skin and preferred regions of the head, legs, and arms. M. varians was the second most frequent Micrococcus isolated. M. lylae, M. sedentarius, M. roseus, M. kristinae, and M. nishinomiyaensis were only occasionally isolated from skin. M. lylae was most frequently isolated during the colder months of the years. PMID:810086

Blechnum Orientale Linn - a fern with potential as antioxidant, anticancer and antibacterial agent

PubMed Central

2010-01-01

Background Blechnum orientale Linn. (Blechnaceae) is used ethnomedicinally for the treatment of various skin diseases, stomach pain, urinary bladder complaints and sterilization of women. The aim of the study was to evaluate antioxidant, anticancer and antibacterial activity of five solvent fractions obtained from the methanol extract of the leaves of Blechnum orientale Linn. Methods Five solvent fractions were obtained from the methanol extract of B. orientale through successive partitioning with petroleum ether, chloroform, ethyl acetate, butanol and water. Total phenolic content was assessed using Folin-Ciocalteu's method. The antioxidant activity was determined by measuring the scavenging activity of DPPH radicals. Cytotoxic activity was tested against four cancer cell lines and a non-malignant cell using MTT assay. Antibacterial activity was assessed using the disc diffusion and broth microdilution assays. Standard phytochemical screening tests for saponins, tannins, terpenoids, flavonoids and alkaloids were also conducted. Results The ethyl acetate, butanol and water fractions possessed strong radical scavenging activity (IC50 8.6-13.0 μg/ml) and cytotoxic activity towards human colon cancer cell HT-29 (IC50 27.5-42.8 μg/ml). The three extracts were also effective against all Gram-positive bacteria tested: Bacillus cereus, Micrococcus luteus, methicillin-susceptible Staphylococcus aureus (MSSA), methicillin-resistant Staphylococcus aureus (MRSA) and Stapylococcus epidermidis(minimum inhibitory concentration MIC 15.6-250 μg/ml; minimum bactericidal concentration MBC 15.6-250 μg/ml). Phytochemical analysis revealed the presence of flavonoids, terpenoids and tannins. Ethyl acetate and butanol fractions showed highest total phenolic content (675-804 mg gallic acid equivalent/g). Conclusions The results indicate that this fern is a potential candidate to be used as an antioxidant agent, for colon cancer therapy and for treatment of MRSA infections and other MSSA/Gram-positive bacterial infectious diseases. PMID:20429956

A novel firmicute protein family related to the actinobacterial resuscitation-promoting factors by non-orthologous domain displacement.

PubMed

Ravagnani, Adriana; Finan, Christopher L; Young, Michael

2005-03-17

In Micrococcus luteus growth and resuscitation from starvation-induced dormancy is controlled by the production of a secreted growth factor. This autocrine resuscitation-promoting factor (Rpf) is the founder member of a family of proteins found throughout and confined to the actinobacteria (high G + C Gram-positive bacteria). The aim of this work was to search for and characterise a cognate gene family in the firmicutes (low G + C Gram-positive bacteria) and obtain information about how they may control bacterial growth and resuscitation. In silico analysis of the accessory domains of the Rpf proteins permitted their classification into several subfamilies. The RpfB subfamily is related to a group of firmicute proteins of unknown function, represented by YabE of Bacillus subtilis. The actinobacterial RpfB and firmicute YabE proteins have very similar domain structures and genomic contexts, except that in YabE, the actinobacterial Rpf domain is replaced by another domain, which we have called Sps. Although totally unrelated in both sequence and secondary structure, the Rpf and Sps domains fulfil the same function. We propose that these proteins have undergone "non-orthologous domain displacement", a phenomenon akin to "non-orthologous gene displacement" that has been described previously. Proteins containing the Sps domain are widely distributed throughout the firmicutes and they too fall into a number of distinct subfamilies. Comparative analysis of the accessory domains in the Rpf and Sps proteins, together with their weak similarity to lytic transglycosylases, provide clear evidence that they are muralytic enzymes. The results indicate that the firmicute Sps proteins and the actinobacterial Rpf proteins are cognate and that they control bacterial culturability via enzymatic modification of the bacterial cell envelope.

Dihydroxo-bridged dimeric Cu(II) system containing sandwiched non-coordinating phenylacetate anion: Crystal structure, spectroscopic, anti-bacterial, anti-fungal and DNA-binding studies of [(phen)(H2O)Cu(OH)2Cu(H2O)(phen)]2L.6H2O: (HL = phenylacetic acid; phen = 1,10-phenanthroline)

NASA Astrophysics Data System (ADS)

Iqbal, Muhammad; Ali, Saqib; Tahir, Muhammad Nawaz; Shah, Naseer Ali

2017-09-01

This paper reports the synthesis, X-ray crystal structure, DNA-binding, antibacterial and antifungal studies of a rare dihydroxo-bridged dinuclear copper(II) complex including 1,10-phenanthroline (Phen) ligands and phenylacetate (L) anions, [Cu2(Phen)2(OH)2(H2O)2].2L.6H2O. Structural data revealed distorted square-pyramidal geometry for each copper(II) atom with the basal plane formed by the two nitrogen atoms of the phenantroline ligand and the oxygen atoms of two bridging hydroxyl groups. The apical positions are filled by the oxygen atom from a water molecule. This forms a centrosymmetric cationic dimer where the uncoordinated phenylacetate ligands serve to balance the electrical charge. The dimers interact by means of hydrogen bonds aided by the coordinated as well as uncoordinated water molecules and phenyl-acetate moieties in the crystal lattice. The binding ability of the complex with salmon sperm DNA was determined using cyclic voltammetry and absorption spectroscopy yielding binding constants 2.426 × 104 M-1 and 1.399 × 104 M-1, respectively. The complex was screened against two Gram-positive (Micrococcus luteus and Bacillus subtilis) and one Gram-negative (Escherichia coli) bacterial strains exhibiting significant activity against all the three strains. The complex exhibited significant, moderate and no activity against fungal strains Mucor piriformis, Helminthosporium solani and Aspergillus Niger, respectively. These preliminary tests indicate the competence of the complex towards the development of a potent biological drug.

Characterization of Micrococcus strains isolated from indoor air.

PubMed

Kooken, Jennifer M; Fox, Karen F; Fox, Alvin

2012-02-01

The characterization of microbes, such as opportunists and pathogens (e.g., methicillin resistant Staphylococcus aureus [MRSA]), in indoor air is important for understanding disease transmission from person-to-person. Common genera found in the human skin microbiome include Micrococcus and Staphylococcus, but there only a limited number of tests to differentiate these genera and/or species. Both genera are believed to be released into indoor air from the shedding of human skin and are morphologically difficult to distinguish. In the current work, after the extraction of proteins from micrococci and the separation of these proteins on one dimensional electrophoretic gels, tryptic peptides were analyzed by MALDI TOF MS and the mass profiles compared with those of a reference strain (ATCC 4698). The results confirmed that all strains were consistent in identity with Micrococcus luteus. Copyright © 2011 Elsevier Ltd. All rights reserved.

Characterization of Micrococcus strains isolated from indoor air

PubMed Central

Kooken, Jennifer M.; Fox, Karen F.; Fox, Alvin

2014-01-01

The characterization of microbes, such as of opportunists and pathogens (e.g. methicillin resistant Staphylococcus aureus [MRSA]), in indoor air is important for understanding disease transmission from person-to-person. Common genera found in the human skin microbiome include Micrococcus and Staphylococcus, but there only a limited number of tests to differentiate these genera and/or species. Both genera are believed to be released into indoor air from the shedding of human skin and are morphologically difficult to distinguish. In the current work, after the extraction of proteins from micrococci and the separation of these proteins on one dimensional electrophoretic gels, tryptic peptides were analyzed by MALDI TOF MS and the mass profiles compared with those of a reference strain (ATCC 4698). The results confirmed that all strains were consistent in identity with Micrococcus luteus. PMID:21963944

Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris.

PubMed

Yoshimune, Kazuaki; Shirakihara, Yasuo; Wakayama, Mamoru; Yumoto, Isao

2010-02-01

Glutaminase from Micrococcus luteus K-3 [Micrococcus glutaminase (Mglu); 456 amino acid residues (aa); 48 kDa] is a salt-tolerant enzyme. Our previous study determined the structure of its major 42-kDa fragment. Here, using new crystallization conditions, we determined the structures of the intact enzyme in the presence and absence of its product L-glutamate and its activator Tris, which activates the enzyme by sixfold. With the exception of a 'lid' part (26-29 aa) and a few other short stretches, the structures were all very similar over the entire polypeptide chain. However, the presence of the ligands significantly reduced the length of the disordered regions: 41 aa in the unliganded structure (N), 21 aa for L-glutamate (G), 8 aa for Tris (T) and 6 aa for both L-glutamate and Tris (TG). L-glutamate was identified in both the G and TG structures, whereas Tris was only identified in the TG structure. Comparison of the glutamate-binding site between Mglu and salt-labile glutaminase (YbgJ) from Bacillus subtilis showed significantly smaller structural changes of the protein part in Mglu. A comparison of the substrate-binding pocket of Mglu, which is highly specific for L-glutamine, with that of Erwinia carotovora asparaginase, which has substrates other than L-glutamine, shows that Mglu has a larger substrate-binding pocket that prevents the binding of L-asparagine with proper interactions.

Improved antimicrobial activities of synthetic-hybrid bacteriocins designed from enterocin E50-52 and pediocin PA-1.

PubMed

Tiwari, Santosh Kumar; Sutyak Noll, Katia; Cavera, Veronica L; Chikindas, Michael L

2015-03-01

Two hybrid bacteriocins, enterocin E50-52/pediocin PA-1 (EP) and pediocin PA-1/enterocin E50-52 (PE), were designed by combining the N terminus of enterocin E50-52 and the C terminus of pediocin PA-1 and by combining the C terminus of pediocin PA-1 and the N terminus of enterocin E50-52, respectively. Both hybrid bacteriocins showed reduced MICs compared to those of their natural counterparts. The MICs of hybrid PE and EP were 64- and 32-fold lower, respectively, than the MIC of pediocin PA-1 and 8- and 4-fold lower, respectively, than the MIC of enterocin E50-52. In this study, the effect of hybrid as well as wild-type (WT) bacteriocins on the transmembrane electrical potential (ΔΨ) and their ability to induce the efflux of intracellular ATP were investigated. Enterocin E50-52, pediocin PA-1, and hybrid bacteriocin PE were able to dissipate ΔΨ, but EP was unable to deplete this component. Both hybrid bacteriocins caused a loss of the intracellular concentration of ATP. EP, however, caused a faster efflux than PE and enterocin E50-52. Enterocin E50-52 and hybrids PE and EP were active against the Gram-positive and Gram-negative bacteria tested, such as Micrococcus luteus, Salmonella enterica serovar Enteritidis 20E1090, and Escherichia coli O157:H7. The hybrid bacteriocins designed and described herein are antimicrobial peptides with MICs lower those of their natural counterparts. Both hybrid peptides induce the loss of intracellular ATP and are capable of inhibiting Gram-negative bacteria, and PE dissipates the electrical potential. In this study, the MIC of hybrid bacteriocin PE decreased 64-fold compared to the MIC of its natural peptide counterpart, pediocin PA-1. Inhibition of Gram-negative pathogens confers an additional advantage for the application of these peptides in therapeutics. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Improved Antimicrobial Activities of Synthetic-Hybrid Bacteriocins Designed from Enterocin E50-52 and Pediocin PA-1

PubMed Central

Tiwari, Santosh Kumar; Sutyak Noll, Katia; Cavera, Veronica L.

2014-01-01

Two hybrid bacteriocins, enterocin E50-52/pediocin PA-1 (EP) and pediocin PA-1/enterocin E50-52 (PE), were designed by combining the N terminus of enterocin E50-52 and the C terminus of pediocin PA-1 and by combining the C terminus of pediocin PA-1 and the N terminus of enterocin E50-52, respectively. Both hybrid bacteriocins showed reduced MICs compared to those of their natural counterparts. The MICs of hybrid PE and EP were 64- and 32-fold lower, respectively, than the MIC of pediocin PA-1 and 8- and 4-fold lower, respectively, than the MIC of enterocin E50-52. In this study, the effect of hybrid as well as wild-type (WT) bacteriocins on the transmembrane electrical potential (ΔΨ) and their ability to induce the efflux of intracellular ATP were investigated. Enterocin E50-52, pediocin PA-1, and hybrid bacteriocin PE were able to dissipate ΔΨ, but EP was unable to deplete this component. Both hybrid bacteriocins caused a loss of the intracellular concentration of ATP. EP, however, caused a faster efflux than PE and enterocin E50-52. Enterocin E50-52 and hybrids PE and EP were active against the Gram-positive and Gram-negative bacteria tested, such as Micrococcus luteus, Salmonella enterica serovar Enteritidis 20E1090, and Escherichia coli O157:H7. The hybrid bacteriocins designed and described herein are antimicrobial peptides with MICs lower those of their natural counterparts. Both hybrid peptides induce the loss of intracellular ATP and are capable of inhibiting Gram-negative bacteria, and PE dissipates the electrical potential. In this study, the MIC of hybrid bacteriocin PE decreased 64-fold compared to the MIC of its natural peptide counterpart, pediocin PA-1. Inhibition of Gram-negative pathogens confers an additional advantage for the application of these peptides in therapeutics. PMID:25527560

Immune challenge differentially affects transcript abundance of three antimicrobial peptides in hemocytes from the moth Pseudoplusia includens.

PubMed

Lavine, M D; Chen, G; Strand, M R

2005-12-01

Inducible expression of antimicrobial peptides and other humoral immune factors by the insect fat body is well documented. Hemocytes comprise the second essential arm of the insect immune system but it is unclear whether antimicrobial peptide genes are expressed by all or only some types of hemocytes. Here we report the cloning of cecropin A (Pi-cecA), lebocin (Pi-leb) and lysozyme (Pi-lys) homologs from the moth Pseudoplusia includens. Relative-quantitative real-time PCR (rq-rtPCR) indicated that transcript abundance for each antimicrobial gene increased in fat body and hemocytes following immune challenge with the Gram-negative bacterium Escherichia coli. Relative transcript abundance of Pi-cecA was much higher in fat body than hemocytes. In contrast, transcript levels of Pi-leb were three-fold lower in hemocytes than fat body while transcript levels of Pi-lys were three-fold higher. Estimates for the overall contribution of the fat body and hemocytes to antimicrobial peptide expression suggested that hemocytes contribute significantly to Pi-lys transcript levels in larvae but produce much smaller amounts of Pi-cecA and Pi-leb compared to the fat body. Each antimicrobial peptide was also inducibly expressed in hemocytes following challenge with the Gram-positive bacterium Micrococcus luteus or when hemocytes formed capsules around chromatography beads. Analysis of hemocyte types indicated that granulocytes and plasmatocytes expressed all three antimicrobial peptides, whereas spherule cells and oenocytoids expressed only lysozyme. Transcriptional profiles of these antimicrobial genes were similar in granulocytes and plasmatocytes in vivo but were very different in vitro.

Green synthesis, biological and spectroscopic study on the interaction of multi-component Mannich bases of imidazo[2,1-b]benzothiazoles with human serum albumin.

PubMed

Maddili, Swetha K; Yandrati, Leela Prasad; Siddam, Shakuntala; Kannekanti, Vijaya Kumar; Gandham, Himabindu

2017-11-01

A series of Mannich bases of imidazo[2, l-b]benzothiazoles were prepared through one-pot multi-component reaction in the presence of water as an eco-friendly solvent. All the synthesized compounds were confirmed from IR, 1 HNMR, 13 CNMR, and Mass spectroscopy. Evaluation of in vitro anti-inflammatory and anti-microbial activities of all the synthesized derivatives was further accomplished. These results clearly displayed that compound 6d exhibited outstanding anti-inflammatory activity with a percentage inhibition of 70.23% by membrane stabilization method whereas 67.54% at 100μgmL -1 by the albumin denaturation method, which is comparable to the standard Diclofenac. Further screening against five fungal species (C. albicans ATCC 76615, C. mycoderma, C. utilis, A. flavus, and B. yeast) along with four gram positive (Methicillin-resistant S. aureus N315 (MRSA), Staphylococcus aureus ATCC 6538, Bacillus subtilis ATCC 21216, and Micrococcus luteus ATCC 4698), and six Gram-negative bacterial strains (Escherichia coli DH52, Escherichia coli JM109, Salmonella dysenteriae, Pseudomonas aeruginosa ATCC 27853, Bacillus proteus ATCC13315 and Bacillus typhi) was carried out. These findings manifested that compound 7c displayed excellent antifungal efficacy while compound 7b revealed significant anti-microbial activity. In addition binding behaviour of compound 7b was investigated by binding study between calf thymus DNA and compound 7b by UV-Vis absorption spectroscopy and further research about HSA interactions was carried out. Copyright © 2017 Elsevier B.V. All rights reserved.

Enhanced anti-cancer and antimicrobial activities of curcumin nanoparticles.

PubMed

Adahoun, Mo'ath Ahmad; Al-Akhras, Mohammed-Ali Hassan; Jaafar, Mohamad Suhaimi; Bououdina, Mohamed

2017-02-01

Background Curcumin (diferuloylmethane) is a polyphenol derived from the plant Curcuma longa, commonly called turmeric. Extensive research over the last 50 years has demonstrated that these polyphenols play an important role in the maintenance of health and prevention of diseases, in addition to its therapeutic benefits such as anti-tumor, anti-inflammatory, and anti-oxidant activities. Materials and methods This study is devoted to the enhancement of the solubility and bioavailability of curcumin nanoparticles prepared by a process based on a wet-milling technique and then examine in vitro against prostate cancer cell line 3 (PC3), human embryonic kidney cell line (HEK), human erythrocytes (red blood cells (RBCs)), and against fourth different bacterial strains two gram-positive (Micrococcus luteus ATCC 9341, Staphylococcus aureus ATCC 29213), two gram-negative (Escherichia coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853). Results The cell viability curve, the half maximal inhibitory concentration (IC 50 ), and the minimum bactericidal concentration (MBC) were evaluated. Nanocurcumin displayed significant activity against cancer cell line (PC3) and low toxicity against normal cells (HEK) compared with parent curcumin in favor of PC3 (P < 0.05). In addition, it was found that the efficiency of toxicity for nanocurcumin against PC3 (E% = 59.66%) was much better than HEK (E% = 36.07%) compared with parent curcumin. The results also demonstrate that, although nanocurcumin has a little more ability to lays RBCs than parent curcumin after incubated 60 min, but the hemolysis % remained very low and there was no significant difference between hemolysis % of nanocurcumin and parent curcumin (P > 0.05). On the other hand, the results demonstrate that, the MBCs of nanocurcumin were lower than curcumin for all different bacterial strains. Moreover, the selected gram-positive bacteria had higher sensitivity than the selected gram-negative bacteria for both curcumin and nanocurcumin. In conclusion, all these findings not only indicate that nanocurcumin safe compound has a potent ability as anti-cancer and antimicrobial activities, but also well justify the avail of using nanocurcumin as prostate cells PC3 anti-cancer, and antimicrobial agent for nanocurcumin are markedly improved by decreasing particle size to the nano-scale regime.

A New Perspective on Radiation Resistance Based on Deinococcus radiodurans

DTIC Science & Technology

2009-03-01

Halobacterium sp. NRc-1 | Lactobacillus plantarum | Micrococcus luteus | Pyrococcus furiosus | Shewanella oneidensis | Synechocystis sp. Pcc... Lactobacillus plantarum16,47, which lacks the enzyme superoxide dismutase, and Synechocystis sp. PCC 68034 (Ref. 48) accumulated exceptionally high levels...high specificity for Mn2+, has been detected in L. plantarum , but has not been found in D. radiodurans. Manganese transport in D. radiodurans is

Improved agar diffusion method for detecting residual antimicrobial agents.

PubMed

Tsai, C E; Kondo, F

2001-03-01

The improved agar diffusion method for determination of residual antimicrobial agents was investigated, and the sensitivities of various combinations of test organisms and assay media were determined using 7 organisms, 5 media, and 31 antimicrobial agents. Bacillus stearothermophilus and synthetic assay medium (SAM) showed the greatest sensitivity for screening penicillins (penicillin G and ampicillin). The combination of Bacillus subtilis and minimum medium (MM) was the most sensitive for tetracyclines (oxytetracycline and chlortetracycline), B. stearothermophilus and SAM or Micrococcus luteus and Mueller-Hinton agar (MHA) for detecting tylosin and erythromycin, B. subtilis and MHA for aminoglycosides (streptomycin, kanamycin, gentamicin, and dihydrostreptomycin), B. stearothermophilus and SAM for polyethers (salinomycin and lasalocid), and B. subtilis and MM or Clostridium perfringens and GAM for polypeptides (thiopeptin, enramycin, virginiamycin, and bacitracin). However, gram-negative bacterium Escherichia coli ATCC 27166 and MM were better for screening for colistin and polymixin-B. For detecting the synthetic drugs tested, the best combination was B. subtilis and MM for sulfonamides, E. coli 27166 and MM for quinolones (oxolinic acid and nalidixic acid), B. subtilis and MM for furans (furazolidone), and the bioluminescent bacterium Photobacterium phosphoreum and luminescence assay medium for chloramphenicol and oxolinic acid. The results showed that the use of four assay plates, B. stearothermophilus and SAM, B. subtilis and MM, M. luteus and MHA, and E. coli 27166 and MM, was superior to the currently available techniques for screening for residual antimicrobial agents in edible animal tissues.

Agrococcus terreus sp. nov. and Micrococcus terreus sp. nov., isolated from forest soil.

PubMed

Zhang, Jia-Yue; Liu, Xing-Yu; Liu, Shuang-Jiang

2010-08-01

Two bacterial strains, DNG5T and V3M1T, isolated from forest soil of the Changbai mountains in China, were characterized using a polyphasic approach. Analysis of their 16S rRNA gene sequences indicated that strains DNG5T and V3M1T were phylogenetically related to members of the genus Agrococcus (96.0-98.4% similarity) and Micrococcus (96.7-98.0% similarity), respectively, within the order Actinomycetales. Strains DNG5T and V3M1T were Gram-stain-positive and strictly aerobic and formed yellow colonies on LB agar. Cells of strain DNG5T were short, non-motile rods, 0.4-0.5x0.8-1.0 microm. Strain DNG5T contained MK-10 and MK-11 as the major respiratory quinones and anteiso-C15:0 (49.2%) and iso-C16:0 (22.4%) as the major fatty acids. The diamino acid in the peptidoglycan of strain DNG5T was 2,4-diaminobutyric acid and the murein was of the acetyl type. Cells of strain V3M1T were cocci, 0.6-0.7 microm in diameter. The cell-wall peptidoglycan of strain V3M1T contained the amino acids lysine, glutamic acid, alanine and glycine. Strain V3M1T contained MK-7, MK-7(H2), MK-8 and MK-8(H2) as respiratory quinones and anteiso-C15:0 (78.2%) and iso-C15:0 (13.1%) as the major cellular fatty acids. The DNA G+C contents of strains DNG5T and V3M1T were 75.9 and 67.2 mol%, respectively. The DNA-DNA relatedness of strain DNG5T to Agrococcus jejuensis DSM 22002T, A. jenensis JCM 9950T, A. baldri JCM 12132T and A. citreus JCM 12398T was 58.3, 43.9, 36.1 and 54.1%, respectively. The DNA-DNA relatedness of strain V3M1T to Micrococcus luteus CGMCC 1.2299T, M. antarcticus CGMCC 1.2373T and M. lylae CGMCC 1.2300T was 57.5, 45.4 and 39.0%, respectively. Combining phenotypic and genotypic traits, strain DNG5T represents a novel species of the genus Agrococcus, for which the name Agrococcus terreus sp. nov. is proposed, with DNG5T (=CGMCC 1.6960T =NBRC 104260T) as the type strain. Strain V3M1T represents a novel species of the genus Micrococcus, for which the name Micrococcus terreus sp. nov. is proposed, with V3M1T (=CGMCC 1.7054T =NBRC 104258T) as the type strain.

In vitro antioxidant, anticholinesterase and antimicrobial activity studies on three Agaricus species with fatty acid compositions and iron contents: a comparative study on the three most edible mushrooms.

PubMed

Öztürk, Mehmet; Duru, Mehmet Emin; Kivrak, Seyda; Mercan-Doğan, Nazime; Türkoglu, Aziz; Özler, Mehmet Ali

2011-06-01

The fatty acids of Agaricus essettei, Agaricus bitorquis and Agaricus bisporus were investigated by using GC and GC-MS. The dominant fatty acids were found to be linoleic (61.82-67.29%) and palmitic (12.67-14.71%) acids among the 13 fatty acids detected in the oils. Total unsaturation for the oils was calculated as 77.50%, 77.44%, and 79.72%, respectively. In vitro antioxidant, anticholinesterase and antimicrobial activities were also studied. The ethyl acetate extract of Agaricus bitorquis showed the highest activity in β-carotene-linoleic acid, DPPH(·) and ABTS(·)(+) assays, while the hexane extract of Agaricus bisporus exhibited the best metal chelating activity. The ethyl acetate and hexane extract of Agaricus bitorquis and the hexane extract of Agaricus essettei showed meaningful butyrylcholinesterase activity being close to that of galantamine. The extracts were found to be effective on Gram (+) bacteria, especially against Micrococcus luteus, Micrococcus flavus, Bacillus subtilis and Bacillus cereus. In conclusion, Agaricus bitorquis and Agaricus essettei demonstrated higher iron content, and better antioxidant, anticholinesterase and antimicrobial activities than those of Agaricus bisporus commonly consumed mushroom. Hence, Agaricus species, particularly Agaricus bitorquis might be useful as antioxidant agents and moderate anticholinesterase agents, and their extracts will probably be used for development of dietary foods, food products and additives. Copyright © 2011 Elsevier Ltd. All rights reserved.

The effects of garlic-supplemented diets on skin mucosal immune responses, stress resistance and growth performance of the Caspian roach (Rutilus rutilus) fry.

PubMed

Ghehdarijani, Mahbubeh Salmanian; Hajimoradloo, Abdolmajid; Ghorbani, Rasol; Roohi, Zahra

2016-02-01

This study was conducted to evaluate the effects of garlic supplementation on some skin mucus immune parameters, mucus antimicrobial activity and growth performance of the Caspian roach (Rutilus rutilus caspicus) fry. Fish (1 ± 0.07 g) were divided into four groups fed diets containing 0 (control), 5, 10 and 15 g kg(-1) garlic for 8 weeks. The results showed that there was a significant increase in weight gain and specific growth rate in those fish fed garlic diets compared with the control (P < 0.05). Condition factor was not significantly affected by garlic dosage. At the end of trial, the epidermal mucus protein level, alkaline phosphatase and antimicrobial activity against 2 g-negative bacteria (Escherichia coli and Serratia marcescens) and gram-positive bacteria (Streptococcus faecium and Micrococcus luteus) were measured. Skin mucus alkaline phosphatase, protein levels and antimicrobial activity were increased following garlic administration, and the bacterial growth inhibition zones were significantly elevated in garlic-fed fish (P < 0.05). In salinity stress experiment, no differences were observed for survival rate among the experimental diets. No mortality was recorded during the feeding trial. These results indicated that dietary garlic beneficially affects the skin mucus immune parameters and growth performance of the Caspian roach fry. Copyright © 2015 Elsevier Ltd. All rights reserved.

Synthesis, antimicrobial evaluation and theoretical prediction of NMR chemical shifts of thiazole and selenazole derivatives with high antifungal activity against Candida spp.

NASA Astrophysics Data System (ADS)

Łączkowski, Krzysztof Z.; Motylewska, Katarzyna; Baranowska-Łączkowska, Angelika; Biernasiuk, Anna; Misiura, Konrad; Malm, Anna; Fernández, Berta

2016-03-01

Synthesis and investigation of antimicrobial activities of novel thiazoles and selenazoles is presented. Their structures were determined using NMR, FAB(+)-MS, HRMS and elemental analyses. To support the experiment, theoretical calculations of the 1H NMR shifts were carried out for representative systems within the DFT B3LYP/6-311++G** approximation which additionally confirmed the structure of investigated compounds. Among the derivatives, compounds 4b, 4h, 4j and 4l had very strong activity against reference strains of Candida albicans ATCC and Candida parapsilosis ATCC 22019 with MIC = 0.49-7.81 μg/ml. In the case of compounds 4b, 4c, 4h - 4j and 4l, the activity was very strong against of Candida spp. isolated from clinical materials, i.e. C. albicans, Candida krusei, Candida inconspicua, Candida famata, Candida lusitaniae, Candida sake, C. parapsilosis and Candida dubliniensis with MIC = 0.24-15.62 μg/ml. The activity of several of these was similar to the activity of commonly used antifungal agent fluconazole. Additionally, compounds 4m - 4s were found to be active against Gram-positive bacteria, both pathogenic staphylococci Staphylococcus aureus ATCC with MIC = 31.25-125 μg/ml and opportunistic bacteria, such as Staphylococcus epidermidis ATCC 12228 and Micrococcus luteus ATCC 10240 with MIC = 7.81-31.25 μg/ml.

Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Hepatopancreas of Microbial Challenged Mitten Crab Eriocheir sinensis

PubMed Central

Li, Xihong; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen; Shi, Guohui

2013-01-01

Background The Chinese mitten crab Eriocheir sinensis is an important economic crustacean and has been seriously attacked by various diseases, which requires more and more information for immune relevant genes on genome background. Recently, high-throughput RNA sequencing (RNA-seq) technology provides a powerful and efficient method for transcript analysis and immune gene discovery. Methods/Principal Findings A cDNA library from hepatopancreas of E. sinensis challenged by a mixture of three pathogen strains (Gram-positive bacteria Micrococcus luteus, Gram-negative bacteria Vibrio alginolyticus and fungi Pichia pastoris; 108 cfu·mL−1) was constructed and randomly sequenced using Illumina technique. Totally 39.76 million clean reads were assembled to 70,300 unigenes. After ruling out short-length and low-quality sequences, 52,074 non-redundant unigenes were compared to public databases for homology searching and 17,617 of them showed high similarity to sequences in NCBI non-redundant protein (Nr) database. For function classification and pathway assignment, 18,734 (36.00%) unigenes were categorized to three Gene Ontology (GO) categories, 12,243 (23.51%) were classified to 25 Clusters of Orthologous Groups (COG), and 8,983 (17.25%) were assigned to six Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. Potentially, 24, 14, 47 and 132 unigenes were characterized to be involved in Toll, IMD, JAK-STAT and MAPK pathways, respectively. Conclusions/Significance This is the first systematical transcriptome analysis of components relating to innate immune pathways in E. sinensis. Functional genes and putative pathways identified here will contribute to better understand immune system and prevent various diseases in crab. PMID:23874555

A Chlorhexidine Solution Reduces Aerobic Organism Growth in Operative Splash Basins in a Randomized Controlled Trial.

PubMed

Lindgren, Kevin E; Pelt, Christopher E; Anderson, Mike B; Peters, Christopher L; Spivak, Emily S; Gililland, Jeremy M

2018-01-01

Despite recommendations against the use of splash basins, due to the potential of bacterial contamination, our observation has been that they continue to be used in operating theaters. In hopes of decontaminating the splash basin, we sought to determine if the addition of chlorhexidine gluconate (CHG) would eliminate aerobic bacterial growth within the splash basin. After Institutional Review Board approval, we began enrollment in a randomized controlled trial comparing 2 splash basin solutions. Splash basins (n = 111) were randomized to either the standard of care (control) solution of sterile water or the experimental solution containing 0.05% CHG. One 20 mL aliquot was taken from the basin at the end of the surgical case and delivered to an independent laboratory. Samples were plated on tryptic soy agar (medium) and incubated at 30°C-35°C to encourage growth. After 48-72 hours, the agar plates were examined for growth and a standard plate count of aerobic cultures was performed. The sterile water group was found to have bacterial growth in 9% of samples compared to no growth in the CHG group (P = .045). The organisms included Micrococcus luteus, Staphylococcus hominis, Gram-variable coccobacilli, and unidentifiable Gram-positive rods. Given the safety and efficacy of a concentration of 0.05% CHG in reducing the bacterial contamination in the operative splash basin, it would seem that if the practice of using a splash basin in the operating theater is to be continued, the addition of an antiseptic solution such as that studied here should be considered. Copyright © 2017 Elsevier Inc. All rights reserved.

Antimicrobial function of the GAPDH-related antimicrobial peptide in the skin of skipjack tuna, Katsuwonus pelamis.

PubMed

Seo, Jung-Kil; Lee, Min Jeong; Go, Hye-Jin; Kim, Yeon Jun; Park, Nam Gyu

2014-02-01

A 3.4 kDa of antimicrobial peptide was purified from an acidified skin extract of skipjack tuna, Katsuwonus pelamis, by preparative acid-urea-polyacrylamide gel electrophoresis and C18 reversed-phase HPLC. A comparison of the N-terminal amino acid sequence of the purified peptide with that of other known polypeptides revealed high sequence homology with the YFGAP (Yellowfin tuna Glyceraldehyde-3-phosphate dehydrogenase-related Antimicrobial Peptide); thus, this peptide was identified as the skipjack tuna GAPDH-related antimicrobial peptide (SJGAP). SJGAP showed potent antimicrobial activity against Gram-positive bacteria, such as Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, and Streptococcus iniae (minimal effective concentrations [MECs], 1.2-17.0 μg/mL), Gram-negative bacteria, such as Aeromonas hydrophila, Escherichia coli D31, and Vibrio parahaemolyticus (MECs, 3.1-12.0 μg/mL), and against Candida albicans (MEC, 16.0 μg/mL) without significant hemolytic activity. Antimicrobial activity of this peptide is heat-stable but salt-sensitive. According to the secondary structural prediction and the homology modeling, this peptide consists of three secondary structural motifs, including one α-helix and two parallel β-strands, and forms an amphipathic structure. This peptide showed neither membrane permeabilization ability nor killing ability, but did display a small degree of leakage ability. These results suggest that SJGAP acts through a bacteriostatic process rather than bactericidal one. SJGAP is another GAPDH-related antimicrobial peptide isolated from skipjack tuna and likely plays an important role for GAPDH in the innate immune defense of tuna fish. Copyright © 2014 Elsevier Ltd. All rights reserved.

Genome-wide identification, characterization and expression analyses of two TNFRs in Yesso scallop (Patinopecten yessoensis) provide insight into the disparity of responses to bacterial infections and heat stress in bivalves.

PubMed

Xing, Qiang; Yu, Qian; Dou, Huaiqian; Wang, Jing; Li, Ruojiao; Ning, Xianhui; Wang, Ruijia; Wang, Shi; Zhang, Lingling; Hu, Xiaoli; Bao, Zhenmin

2016-05-01

Tumor necrosis factors receptors (TNFRs) comprise a superfamily of proteins characterized by a unique cysteine-rich domain (CRD) and play important roles in diverse physiological and pathological processes in the innate immune system, including inflammation, apoptosis, autoimmunity and organogenesis. Although significant effects of TNFRs on immunity have been reported in most vertebrates as well as some invertebrates, the complete TNFR superfamily has not been systematically characterized in scallops. In this study, two different types of TNFR-like genes, including PyTNFR1 and PyTNFR2 genes were identified from Yesso scallop (Patinopecten yessoensis, Jay, 1857) through whole-genome scanning. Phylogenetic and protein structural analyses were carried out to determine the identities and evolutionary relationships of the two genes. The expression profiling of PyTNFRs was performed at different development stages, in healthy adult tissues and in hemocytes after bacterial infection and heat stress. Expression analysis revealed that both PyTNFRs were significantly induced during the acute phase (3 h) after infection with Gram-positive (Micrococcus luteus) and Gram-negative (Vibrio anguillarum) bacteria, though much more dramatic chronic-phase (24 h) changes were observed after V. anguillarum challenge. For heat stress, only PyTNFR2 displayed significant elevation at 12 h and 24 h, which suggests a functional difference in the two PyTNFRs. Collectively, this study provides novel insight into the PyTNFRs and the specific role and response of TNFR-involved pathways in host immune responses against different bacterial pathogens and heat stress in bivalves. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identification and biological activity of the volatile compounds of Glycyrrhiza triphylla Fisch. & C.A.Mey.

PubMed

Shakeri, Abolfazl; Akhtari, Javad; Soheili, Vahid; Taghizadeh, Seyedeh Faezeh; Sahebkar, Amirhossein; Shaddel, Rezvan; Asili, Javad

2017-08-01

Chemical composition and biological (antimicrobial, antioxidant and cytotoxic) activities of essential oils (EO) obtained from the aerial parts of Glycyrrhiza triphylla Fisch. & C.A.Mey (G. triphylla) were evaluated in the present study. The EO was isolated and analyzed using gas chromatography-mass spectrometry (GC-MS). Fifty-five compounds representing 99.3% of the total oil composition were identified. Major components of the oil were β-caryophyllene (25.4%), limonene (16.7%), β-myrcene (16.0%) and α-humulene (4.4%). The oil composition was dominated by the presence of sesquiterpene hydrocarbons comprising 43.6% of the total oil. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the oil were determined against eight bacterial strains and one fungus. The EO showed a good antibacterial activity against both Gram-positive and Gram-negative bacteria. The most susceptible strain was Micrococcus luteus (MIC = 2.7 μg/mL, MBC = 43.6 μg/mL). The antioxidant potential of the EO was examined using DPPH and β-carotene/linoleic acid (BCB) assays. The oil was considerably active in the DPPH assay (IC 50  = 100.40 ± 0.03 μg/mL). Moreover, in vitro cytotoxic activity was assessed against six cancer cell lines using MTT assay. The EO showed no significant cytotoxic activity. In light of the present findings, G. triphylla oil may deserves to be further investigated for its potential therapeutic effects and also as a natural preservative in food industry. Copyright © 2017 Elsevier Ltd. All rights reserved.

Synthesis, structural characterization and photoluminescence properties of a novel La(III) complex

NASA Astrophysics Data System (ADS)

Köse, Muhammet; Ceyhan, Gökhan; Atcı, Emine; McKee, Vickie; Tümer, Mehmet

2015-05-01

In this study, a novel La(III) complex [La(H2L)2(NO3)3(MeOH)] of a Schiff base ligand was synthesized and characterized by spectroscopic and analytical methods. Single crystals of the complex suitable for X-ray diffraction study were obtained by slow diffusion of diethyl ether into a MeOH solution of the complex which was found to crystallise as [La(H2L)2(NO3)3(MeOH)]ṡ2MeOHṡH2O. The structure was solved in monoclinic crystal system, P21/n space group with unit cell parameters a = 10.5641(11), b = 12.6661(16), c = 16.0022(17) Å, α = 67.364(2), β = 83.794(2)°, γ = 70.541(2)°, V = 1862.9(4) Å3 and Z = 2 with R final value of 0.526. In the complex, the La(III) ion is ten-coordinated by O atoms, five of which come from three nitrate ions, four from the two Schiff base ligands and one from MeOH oxygen atom. The Schiff base ligands in the structure are in a zwitter ion form with the phenolic H transferred to the imine N atom. Thermal properties of the La(III) complex were examined by thermogravimetric analysis and the complex was found to be thermally stable up to 310 °C. The Schiff base ligand and its La(II) complex were screened for their in vitro antimicrobial activity against Bacillus megaterium, Staphylococcus aureus, Bacillus subtilis, Micrococcus luteus (Gram positive bacteria), Klebsiella pneumonia, Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa (Gram negative bacteria), Candida albicans,Yarrowia lipolytica (fungus) and Saccharomyces cerevisiae (yeast). The complex shows more antimicrobial activity than the free ligand.

Molecular identification and nanoremediation of microbial contaminants in algal systems using untreated wastewater.

PubMed

Limayem, Alya; Gonzalez, Francisco; Micciche, Andrew; Haller, Edward; Nayak, Bina; Mohapatra, Shyam

2016-12-01

Wastewater-algal biomass is a promising option to biofuel production. However, microbial contaminants constitute a substantial barrier to algal biofuel yield. A series of algal strains, Nannochloris oculata and Chlorella vulgaris samples (n = 30), were purchased from the University of Texas, and were used for both stock flask cultures and flat-panel vertical bioreactors. A number of media were used for isolation and differentiation of potential contaminants according to laboratory standards (CLSI). Conventional PCR amplification was performed followed by 16S rDNA sequencing to identify isolates at the species level. Nanotherapeutics involving a nanomicellar combination of natural chitosan and zinc oxide (CZNPs) were tested against the microbial lytic groups through Minimum Inhibitory Concentration (MIC) tests and Transmission Electronic Microscopy (TEM). Results indicated the presence of Pseudomonas spp., Bacillus pumilus/ safensis, Cellulosimicrobium cellulans, Micrococcus luteus and Staphylococcus epidermidis strains at a substantial level in the wastewater-fed algal reactors. TEM confirmed the effectiveness of CZNPs on the lytic group while the average MICs (mg/mL) detected for the strains, Pseudomonas spp, Micrococcus luteus, and Bacillus pumilus were 0.417, 3.33, and 1.458, respectively. Conclusively, CZNP antimicrobials proved to be effective as inhibitory agents against currently identified lytic microbial group, did not impact algae cells, and shows promise for in situ interventions.

Viability and biomass of Micrococcus luteus DE2008 at different salinity concentrations determined by specific fluorochromes and CLSM-image analysis.

PubMed

Puyen, Zully M; Villagrasa, Eduard; Maldonado, Juan; Esteve, Isabel; Solé, Antonio

2012-01-01

In previous studies, our group developed a method based on Confocal Laser Scanning Microscopy and Image Analysis (CLSM-IA) to analyze the diversity and biomass of cyanobacteria in microbial mats. However, this method cannot be applied to heterotrophic microorganisms, as these do not have autofluorescence. In this article, we present a method that combines CLSM-IA and Hoechst 33342 and SYTOX Green fluorochromes (FLU-CLSM-IA) to determine the viability and biomass of Micrococcus luteus DE2008, isolated from a saline microbial mat (Ebro Delta, Tarragona, Spain). The method has been applied to assess the effect of salinity on this microorganism. A reduction in viability and biomass (live cells) was observed as the salt concentration increases. The largest effect was at 100‰ NaCl with a cell death of 27.25% and a decrease in total and individual biomass of 39.75 and 0.009 mgC/cm(3), respectively, both with respect to optimal growth (10 ‰ NaCl). On the other hand, another important contribution of this article was that combining the FLU-CLSM-IA results with those achieved by plate counts enabled us to determine, for first time, the viability and the total biomass of the "dormant cells" (66.75% of viability and 40.59 mgC/cm(3) of total biomass at 100‰ NaCl). FLU-CLSM-IA is an efficient, fast, and reliable method for making a total count of cells at pixel level, including the dormant cells, to evaluate the viability and the biomass of a hetetrophic microorganism, M. luteus DE2008.

Radiation-Resistant Micrococcus luteus SC1204 and Its Proteomics Change Upon Gamma Irradiation.

PubMed

Deng, Wuyuan; Yang, Yang; Gao, Peng; Chen, Hao; Wen, Wenting; Sun, Qun

2016-06-01

To explore the radiation-resistance mechanisms in bacteria, a radiation-resistant strain SC1204 was isolated from the surrounding area of a (60)Co-γ radiation facility. SC1204 could survive up to 8 kGy dose of gamma irradiation and was identified as Micrococcus luteus by phylogenetic analysis of 16S rRNA gene sequences. Its proteomic changes under 2-kGy irradiation were examined by two-dimensional electrophoresis followed by MALDI-TOF-TOF/MS analysis. The results showed that at least 24 proteins displayed significant changes (p < 0.05) at expression level under the radiation stress, among which 22 were successfully identified and classified into the major functional categories of metabolism, energy production and conservation, translation, ribosomal structure, and biogenesis. Among these proteins, leucyl aminopeptidase involved in synthesis of glutathione was the most abundant induced protein during postirradiation recovery, indicating that anti-oxidation protection was the most important line of defense in SC1204 against radiation. The next abundant protein was phosphoribosyl aminoimidazole carboxamide formyltransferase/IMP cyclohydrolase (AICAR Tfase/IMPCH), the key enzyme in the biosynthetic pathway of purine that is anti-radiation compound. Other proteins changing significantly (p < 0.05) after radiation exposure included urocanate hydratase, dihydrolipoyl dehydrogenase, succinyl-CoA synthetase subunit alpha, phosphoglycerate kinase, cell division protein FtsZ, elongation factor Ts and Tu, translation elongation factor Tu and G, 30S ribosomal protein S1, histidyl-tRNA synthetase, and arginyl-tRNA synthetase, which were considered to be the key proteins in urocanate metabolism, tricarboxylic acid cycle, glycolysis, cell division process, and synthesis process of proteins. Therefore, these proteins may also play important roles in radiation resistance in M. luteus.

Micrococcus lactis sp. nov., isolated from dairy industry waste.

PubMed

Chittpurna; Singh, Pradip K; Verma, Dipti; Pinnaka, Anil Kumar; Mayilraj, Shanmugam; Korpole, Suresh

2011-12-01

A Gram-positive, yellow-pigmented, actinobacterial strain, DW152(T), was isolated from a dairy industry effluent treatment plant. 16S rRNA gene sequence analysis indicated that strain DW152(T) exhibited low similarity with many species with validly published names belonging to the genera Micrococcus and Arthrobacter. However, phenotypic properties including chemotaxonomic markers affiliated strain DW152(T) to the genus Micrococcus. Strain DW152(T) had ai-C(15:0) and i-C(15:0) as major cellular fatty acids, and MK-8(H(2)) as the major menaquinone. The cell-wall peptidoglycan of strain DW152(T) had l-lysine as the diagnostic amino acid and the type was A4α. The DNA G+C content of strain DW152(T) was 68.0 mol%. In 16S rRNA gene sequence analysis, strain DW152(T) exhibited significant similarity with Micrococcus terreus NBRC 104258(T), but the mean value of DNA-DNA relatedness between these strains was only 42.3%. Moreover, strain DW152(T) differed in biochemical and chemotaxonomic characteristics from M. terreus and other species of the genus Micrococcus. Based on the above differences, we conclude that strain DW152(T) should be treated as a novel species of the genus Micrococcus, for which the name Micrococcus lactis sp. nov. is proposed. The type strain of Micrococcus lactis sp. nov. is DW152(T) (=MTCC10523(T) =DSM 23694(T)).

Phylogenetic and Biochemical Studies on Stomatococcus mucilaginosus.

PubMed

Stackebrandt, E; Scheuerlein, C; Schleifer, K H

1983-01-01

The degree of relatedness of nine strains of Stomatococcus mucilaginosus (formerly classified as 'Micrococcus mucilaginosus') was investigated by deoxyribonucleic acid hybridization. We confirm that all strains are highly related. Differences in the peptidoglycan type and the cytochrome pattern between S. mucilaginosus and members of Micrococcus, together with the results of 23 S ribosomal ribonucleic acid cistron similarity studies and the analysis of the 16S ribosomal ribonucleic acid support the exclusion of this species from the genus Micrococcus and justifies its reclassification as a member of a new genus, Stomatococcus (Bergan and Kocur, 1982). Phylogenetically, S. mucilaginosus represents an independent line of descent within a broad group of Gram-positive bacteria that contains arthrobacteria, micrococci, cellulomonads, brevibacteria and microbacteria. Copyright © 1983 Gustav Fischer Verlag, Stuttgart/New York. Published by Elsevier GmbH.. All rights reserved.

Evaluation of antibacterial properties of some medicinal plants used in Iran.

PubMed

Bonjar, Shahidi

2004-10-01

Forty-five species of 29 plant families used in the traditional medicine by Iranian people, showed antibacterial activities against one or more of the bacterial species: Bacillus cereus, Bacillus pumilus, Bordetella bronchiseptica, Escherichia coli, Klebsiella pneumoniae, Micrococcus luteus, Pseudomonas aeruginosa, Pseudomonas fluorescens, Serratia marcescens, Staphylococcus aureus and Staphylococcus epidermidis. No plant showed activity against Serratia marcescens; Bordetella bronchiseptica being the most susceptible species. All extracts showed the same activity 18 months later.

Devices for monitoring content of microparticles and bacterium in injection solutions in pharmaceutical production

NASA Astrophysics Data System (ADS)

Bilyi, Olexander I.; Getman, Vasyl B.; Konyev, Fedir A.; Sapunkov, Olexander; Sapunkov, Pavlo G.

2001-06-01

The devices for monitoring of parameters of efficiency of water solutions filtration, which are based on the analysis of scattered light by microparticles are considered in this article. The efficiency of using of devices in pharmaceutics in technological processes of manufacturing medical injection solutions is shown. The examples of monitoring of contents of bacterial cultures Pseudomonas aeruginosa, Escherichia coli, and Micrococcus luteus in water solutions of glucose are indicated.

White shrimp (Litopenaeus vannamei) recombinant lysozyme has antibacterial activity against Gram negative bacteria: Vibrio alginolyticus, Vibrio parahemolyticus and Vibrio cholerae.

PubMed

de-la-Re-Vega, Enrique; García-Galaz, Alfonso; Díaz-Cinco, Martha E; Sotelo-Mundo, Rogerio R

2006-03-01

C-type lysozyme has been described as an antibacterial component of the shrimp innate defence system. We determined quantitatively the antibacterial activity of white shrimp (Litopenaeus vannamei) recombinant lysozyme against three Gram negative bacteria: Vibrio alginolyticus, Vibrio parahemolyticus and Vibrio cholerae, using a turbidimetric assay with live bacteria and differential bacterial viable count after interaction with the protein. In conclusion, the antibacterial activity of recombinant shrimp lysozyme against Vibrio sp. is at least equal to the values against the Gram positive M. luteus and more active against the shrimp pathogens V. alginolyticus and V. parahemolyticus.

Impact of Branched-Chain Amino Acid Catabolism on Fatty Acid and Alkene Biosynthesis in Micrococcus luteus.

PubMed

Surger, Maximilian J; Angelov, Angel; Stier, Philipp; Übelacker, Maria; Liebl, Wolfgang

2018-01-01

Micrococcus luteus naturally produces alkenes, unsaturated aliphatic hydrocarbons, and represents a promising host to produce hydrocarbons as constituents of biofuels and lubricants. In this work, we identify the genes for key enzymes of the branched-chain amino acid catabolism in M. luteus , whose first metabolic steps lead also to the formation of primer molecules for branched-chain fatty acid and olefin biosynthesis, and demonstrate how these genes can be used to manipulate the production of specific olefins in this organism. We constructed mutants of several gene candidates involved in the branched-chain amino acid metabolism or its regulation and investigated the resulting changes in the cellular fatty acid and olefin profiles by GC/MS. The gene cluster encoding the components of the branched-chain α-keto acid dehydrogenase (BCKD) complex was identified by deletion and promoter exchange mutagenesis. Overexpression of the BCKD gene cluster resulted in about threefold increased olefin production whereas deletion of the cluster led to a drastic reduction in branched-chain fatty acid content and a complete loss of olefin production. The specificities of the acyl-CoA dehydrogenases of the branched amino acid degradation pathways were deduced from the fatty acid and olefin profiles of the respective deletion mutant strains. In addition, growth experiments with branched amino acids as the only nitrogen source were carried out with the mutants in order to confirm our annotations. Both the deletion mutant of the BCKD complex, responsible for the further degradation of all three branched-chain amino acids, as well as the deletion mutant of the proposed isovaleryl-CoA dehydrogenase (specific for leucine degradation) were not able to grow on leucine in contrast to the parental strain. In conclusion, our experiments allow the unambigous assignment of specific functions to the genes for key enzymes of the branched-chain amino acid metabolism of M. luteus . We also show how this knowledge can be used to engineer the isomeric composition and the chain lengths of the olefins produced by this organism.

Nurses’ uniforms: How many bacteria do they carry after one shift?

PubMed Central

Sanon, Marie-Anne; Watkins, Sally

2013-01-01

This pilot study investigated the pathogens that nurses are potentially bringing into the public and their home when they wear work uniforms outside of the work environment. To achieve this, sterilized uniforms were distributed to 10 nurses at a local hospital in Washington State at the beginning of their shift. Worn uniforms were collected at the end of the shifts and sent to a laboratory for analysis. Four tests were conducted: 1) a heterotrophic growth plate count, 2) methicillin-resistant Staphylococcus aureus (MRSA) growth, 3) vancomycin-resistant Enterococci (VRE), and 4) identification of the heterotrophic plate counts. Each participant completed a questionnaire and a survey. The results showed that the average bacteria colony growth per square inch was 1,246 and 5,795 for day and night shift, respectively. After 48 h, MRSA positives were present on 4 of the day shift and 3 of the night shift uniforms. Additional bacteria identified include: Bacillus sp., Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, and Micrococcus roseus. The significant presence of bacteria on the uniforms 48 h after the shift ended necessitates further study, discussions and policy consideration regarding wearing health care uniforms outside of the work environment. PMID:25285235

Nurses' uniforms: How many bacteria do they carry after one shift?

PubMed

Sanon, Marie-Anne; Watkins, Sally

2012-12-01

This pilot study investigated the pathogens that nurses are potentially bringing into the public and their home when they wear work uniforms outside of the work environment. To achieve this, sterilized uniforms were distributed to 10 nurses at a local hospital in Washington State at the beginning of their shift. Worn uniforms were collected at the end of the shifts and sent to a laboratory for analysis. Four tests were conducted: 1) a heterotrophic growth plate count, 2) methicillin-resistant Staphylococcus aureus (MRSA) growth, 3) vancomycin-resistant Enterococci (VRE), and 4) identification of the heterotrophic plate counts. Each participant completed a questionnaire and a survey. The results showed that the average bacteria colony growth per square inch was 1,246 and 5,795 for day and night shift, respectively. After 48 h, MRSA positives were present on 4 of the day shift and 3 of the night shift uniforms. Additional bacteria identified include: Bacillus sp., Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, and Micrococcus roseus. The significant presence of bacteria on the uniforms 48 h after the shift ended necessitates further study, discussions and policy consideration regarding wearing health care uniforms outside of the work environment.

Failure Analysis of Pitted Copper Pipes Used in Underground Water and Preventive Measures

NASA Astrophysics Data System (ADS)

Nam, Gi-ho; Lee, Jong-kwon; Kim, Kyung-ja

2018-05-01

This study performed an experiment on the causes of pitting corrosion in a copper tubing used for a sprinkler system. Corrosion products of a copper tubing that sustained pitting corrosion were collected and cultured in Culture medium [Luria-Bertani, Brain heart infusion, Tryptic soy broth (TSB), R2A]. Four types of bacteria were found through identification: Micrococcus luteus sp (species)., Staphylococcus sp., Sphingomonas sp., and Bacillus sp. The copper toxicity test was performed for each microorganism. Among the four microorganisms, Micrococcus luteus sp. showed good growth in the environment containing copper ions. On the immersion test, changes in pH and Optical density were measured; On the inductively coupled plasma optical emission spectrometry test, the copper concentration of each culture medium was measured. The surface of each copper sample was observed using a scanning electron microscope. The corrosion potential of a copper sample, after 48 h exposure of the TSB medium containing Micrococcus luteus sp., was measured using a potentiodynamic polarization experiment. The next experiment was conducted to prevent microbial corrosion by suppressing the growth of microorganisms. Six 30 ml TSB culture media with controlled pH value of 4, 5, 6, 7, 8, and 9 through HCl and NaOH were manufactured. Then the microorganisms were cultured in 37 °C 133 rpm, of which the growth status was checked every 24 h for 3 days. It was found that microorganisms did not grow on culture media with the pH value of 6 and lower. The same experiment conducted on culture media controlled with acetic acid, nitric acid, and sulfuric acid, also showed no growth of microorganisms on media with pH value of 6 and lower. Six 5 ml TSB culture media each containing 0.5, 0.25, 0.125, 0.0625, 0.0312%, and 0.0156% NaOCl and NaOBr as germicides were manufactured. 0.01 μl of microorganisms were inoculated on the media and cultured in 37 °C for 48 h. It was found that microorganisms did not grow in media with NaOCl and NaOBr concentration of 0.0625% and higher. Therefore, it can be suggested that in environments with pH value of 6 or lower, or NaOCl and NaOBr concentration of higher than 0.0625% suppresses microbial growth, thereby preventing microbial corrosion.

Failure Analysis of Pitted Copper Pipes Used in Underground Water and Preventive Measures

NASA Astrophysics Data System (ADS)

Nam, Gi-ho; Lee, Jong-kwon; Kim, Kyung-ja

2018-03-01

This study performed an experiment on the causes of pitting corrosion in a copper tubing used for a sprinkler system. Corrosion products of a copper tubing that sustained pitting corrosion were collected and cultured in Culture medium [Luria-Bertani, Brain heart infusion, Tryptic soy broth (TSB), R2A]. Four types of bacteria were found through identification: Micrococcus luteus sp (species)., Staphylococcus sp., Sphingomonas sp., and Bacillus sp. The copper toxicity test was performed for each microorganism. Among the four microorganisms, Micrococcus luteus sp. showed good growth in the environment containing copper ions. On the immersion test, changes in pH and Optical density were measured; On the inductively coupled plasma optical emission spectrometry test, the copper concentration of each culture medium was measured. The surface of each copper sample was observed using a scanning electron microscope. The corrosion potential of a copper sample, after 48 h exposure of the TSB medium containing Micrococcus luteus sp., was measured using a potentiodynamic polarization experiment. The next experiment was conducted to prevent microbial corrosion by suppressing the growth of microorganisms. Six 30 ml TSB culture media with controlled pH value of 4, 5, 6, 7, 8, and 9 through HCl and NaOH were manufactured. Then the microorganisms were cultured in 37 °C 133 rpm, of which the growth status was checked every 24 h for 3 days. It was found that microorganisms did not grow on culture media with the pH value of 6 and lower. The same experiment conducted on culture media controlled with acetic acid, nitric acid, and sulfuric acid, also showed no growth of microorganisms on media with pH value of 6 and lower. Six 5 ml TSB culture media each containing 0.5, 0.25, 0.125, 0.0625, 0.0312%, and 0.0156% NaOCl and NaOBr as germicides were manufactured. 0.01 μl of microorganisms were inoculated on the media and cultured in 37 °C for 48 h. It was found that microorganisms did not grow in media with NaOCl and NaOBr concentration of 0.0625% and higher. Therefore, it can be suggested that in environments with pH value of 6 or lower, or NaOCl and NaOBr concentration of higher than 0.0625% suppresses microbial growth, thereby preventing microbial corrosion.

A Proteomic Signature of Dormancy in the Actinobacterium Micrococcus luteus.

PubMed

Mali, Sujina; Mitchell, Morgan; Havis, Spencer; Bodunrin, Abiodun; Rangel, Jonathan; Olson, Gabriella; Widger, William R; Bark, Steven J

2017-07-15

Dormancy is a protective state in which diverse bacteria, including Mycobacterium tuberculosis , Staphylococcus aureus , Treponema pallidum (syphilis), and Borrelia burgdorferi (Lyme disease), curtail metabolic activity to survive external stresses, including antibiotics. Evidence suggests dormancy consists of a continuum of interrelated states, including viable but nonculturable (VBNC) and persistence states. VBNC and persistence contribute to antibiotic tolerance, reemergence from latent infections, and even quorum sensing and biofilm formation. Previous studies indicate that the protein mechanisms regulating persistence and VBNC states are not well understood. We have queried the VBNC state of Micrococcus luteus NCTC 2665 (MI-2665) by quantitative proteomics combining gel electrophoresis, high-performance liquid chromatography, and tandem mass spectrometry to elucidate some of these mechanisms. MI-2665 is a nonpathogenic actinobacterium containing a small (2.5-Mb), high-GC-content genome which exhibits a well-defined VBNC state induced by nutrient deprivation. The MI-2665 VBNC state demonstrated a loss of protein diversity accompanied by increased levels of 18 proteins that are conserved across actinobacteria, 14 of which have not been previously identified in VNBC. These proteins implicate an anaplerotic strategy in the transition to VBNC, including changes in the glyoxylate shunt, redox and amino acid metabolism, and ribosomal regulatory processes. Our data suggest that MI-2665 is a viable model for dissecting the protein mechanisms underlying the VBNC stress response and provide the first protein-level signature of this state. We expect that this protein signature will enable future studies deciphering the protein mechanisms of dormancy and identify novel therapeutic strategies effective against antibiotic-tolerant bacterial infections. IMPORTANCE Dormancy is a protective state enabling bacteria to survive antibiotics, starvation, and the immune system. Dormancy is comprised of different states, including persistent and viable but nonculturable (VBNC) states that contribute to the spread of bacterial infections. Therefore, it is imperative to identify how bacteria utilize these different dormancy states to survive antibiotic treatment. The objective of our research is to eliminate dormancy as a route to antibiotic tolerance by understanding the proteins that control dormancy in Micrococcus luteus NCTC 2665. This bacterium has unique advantages for studying dormancy, including a small genome and a well-defined and reproducible VBNC state. Our experiments implicate four previously identified and 14 novel proteins upregulated in VBNC that may regulate this critical survival mechanism. Copyright © 2017 American Society for Microbiology.

Interconversion of large packets and small groups of cells of Micrococcus rubens: dependence upon magnesium and phosphate.

PubMed Central

Yamada, M; Koyama, T; Matsuhashi, M

1977-01-01

Micrococcus rubens, a gram-positive occus, usually forms large, cubic packets of more than 500 cells that are regularly arranged in three-dimensional cell groups. In medium with extremely low concentration of Mg2+ and phosphate, in which the cells can only grow on a agar surface, it formed small groups of 2 to 20 cells. Irregularly arraged cell groups of intermediated size were obtained in culture media containing intermediated concentrations of Mg2+ and phosphate. Mutants that formed irregular cell groups of intermediate size under normal culture conditions were also obtained. Images PMID:845123

Identification and Expression Profile Analysis of Antimicrobial Peptide/Protein in Asian Corn Borer, Ostrinia furnacalis (Guenée)

PubMed Central

Zhang, Mingming; Zhou, Fan; Chu, Yuan; Zhao, Zhangwu; An, Chunju

2013-01-01

Antimicrobial peptides/proteins (AMPs) are a group of immune proteins that exhibit strong antibiotic properties against numerous infectious bacterial strains. They are evolutionarily conserved and present in every kingdom and phylum, ranging from prokaryotes to humans. We analyzed the transciptome from the larvae of Asian corn borer, Ostrinia furnacalis (Guenée), and identified several putative AMP transcripts, OfgLys5, OfgLys6, OfgLys10, OfgAtt, and OfgIID. OfgLys5, OfgLys6, and OfgLys10 are all highly homologous with c-type lysozymes, and OfgAtt shows significant identities with Lepidoptera attacin. The amino acid sequence of OfgLys5 and OfgLys6 possessed all conserved features critical for fundamental structure and function of c-type lysozyme, including the two catalytic sites, Glu32 and Asp50. OfgAtt is a typical glycine-rich protein. The antimicrobial activity of O. furnacalis hemolymph increased significantly after injection with Escherichia coli, Micrococcus luteus, or Beauveria bassiana. OfgAtt, IDD, and Lys6 are expressed at low level prior to the challenge, but strongly induced against Gram-positive and negative bacteria, and fungi. Under the same inducement conditions, the transcripts of these three genes elevated most when fifth instar larvae were injected. Therefore, O. furnacalis larvae are induced to produce antimicrobial materials in the hemolymph after the infection, and increase of lysozyme and attacin may contribute to the antimicrobial activity. PMID:24155672

Antimicrobial activity of a nisin-activated plastic film for food packaging.

PubMed

Mauriello, G; De Luca, E; La Storia, A; Villani, F; Ercolini, D

2005-01-01

To determine the effectiveness of a packaging film coated with nisin to inhibit Micrococcus luteus ATCC 10240 in tryptone soya broth (TSB) and the microbiota of raw milk during storage. A further aim was to examine the release of nisin from the activated film. An active package, obtained from nisin-treated film, was filled with 1 l of M. luteus ATCC 10240 (ML) suspension in TSB and stored at 4 and 25 degrees C for 2 days. After 24 h at 25 degrees C there was a remarkable reduction of M. luteus ATCC 10240 compared with the control, while at 4 degrees C a slight reduction was observed. Moreover, microbial growth was controlled when 1 l of three different kinds of milk was poured into the active package and stored at 4 degrees C for 7 days. The most significant results were observed in raw milk and pasteurized milk with a reduction of 0.9 log and 1.3 log, respectively. The release experiments showed that nisin release from the film was unpredictable, but it was favoured by low pH and high temperature. It appears that nisin-coated films were effective in inhibiting M. luteus ATCC 10240 in TSB and the bacterial flora in milk, and the release of nisin was pH and temperature dependent. Nisin-activated film may control bacterial growth, maintaining food quality, safety and extending the shelf-life of food products.

[Production and characteristics of bacteria-labeled talc dust for experimental air hygiene studies].

PubMed

Ohgke, H; Oldenburg, B; Gropengiesser, R; Herbst, M

1983-04-01

Freeze-drying of suspensions of Micrococcus luteus together with talc yields bacteria-labelled dust. This material can be used in experimental air hygiene. Loss of viability due to drying in air during experiments can be expected to be negligible. A wide range of particle diameters (1 to greater than 23 micron) is available. Scanning electron microscopy shows the bacteria sticking on talc particles after freeze-drying (Fig. 3a + b). Viable counts of the material decreased very slowly on storage.

One-pot and two-step synthesis of novel carbonylthioureas and dicarbonyldithioureas derivatives

NASA Astrophysics Data System (ADS)

Banaei, Alireza; Shiran, Jafar Abbasi; Saadat, Afshin; Ardabili, Farnaz Fazlalizadeh; McArdle, Patrick

2015-11-01

One-pot, two-step synthesis of several 1-cyclopropanecarbonyl-3-(substituted phenyl)-thioureas and 1-(phenylene-1,4-dione)-3,3‧-(substituted phenyl)-dithioureas have been successfully prepared. The structures of the synthesized compounds were confirmed by elemental analysis, FT-IR spectroscopy and NMR. Also the crystal structure one of these compounds was determined by X-ray crystallography. All synthesized compounds were evaluated for antibacterial activity using Salmonella enterica (SE), Micrococcus luteus (ML), Bacillus subtilis (BS) and Pseudomonas aeruginosa (PS).

Pitfalls in efficacy testing--how important is the validation of neutralization of chlorhexidine digluconate?

PubMed

Reichel, Mirja; Heisig, Peter; Kampf, Günter

2008-12-02

Effective neutralization of active agents is essential to obtain valid efficacy results, especially when non-volatile active agents like chlorhexidine digluconate (CHG) are tested. The aim of this study was to determine an effective and non-toxic neutralizing mixture for a propan-1-ol solution containing 2% CHG. Experiments were carried out according to ASTM E 1054-02. The neutralization capacity was tested separately with five challenge microorganisms in suspension, and with a rayon swab carrier. Either 0.5 mL of the antiseptic solution (suspension test) or a saturated swab with the antiseptic solution (carrier test) was added to tryptic soy broth containing neutralizing agents. After the samples were mixed, aliquots were spread immediately and after 3 h of storage at 2 - 8 degrees C onto tryptic soy agar containing a neutralizing mixture. The neutralizer was, however, not consistently effective in the suspension test. Immediate spread yielded a valid neutralization with Staphylococcus aureus, Staphylococcus epidermidis and Corynebacterium jeikeium but not with Micrococcus luteus (p < 0.001) and Candida albicans (p < 0.001). A 3-h storage period of the neutralized active agents in suspension resulted in significant carry-over activity of CHG in addition against Staphylococcus epidermidis (p < 0.001) and Corynebacterium jeikeium (p = 0.044). In the carrier test, the neutralizing mixture was found to be effective and non toxic to all challenge microorganisms when spread immediately. However, after 3 h storage of the neutralized active agents significant carry-over activity of CHG against Micrococcus luteus (p = 0.004; Tukey HSD) was observed. Without effective neutralization in the sampling fluid, non-volatile active ingredients will continue to reduce the number of surviving microorganisms after antiseptic treatment even if the sampling fluid is kept cold straight after testing. This can result in false-positive antiseptic efficacy data. Attention should be paid during the neutralization validation process to the amount of antiseptic solution, the storage time and to the choice of appropriate and sensitive microorganisms.

Micrococcus endophyticus sp. nov., isolated from surface-sterilized Aquilaria sinensis roots.

PubMed

Chen, Hua-Hong; Zhao, Guo-Zhen; Park, Dong-Jin; Zhang, Yu-Qin; Xu, Li-Hua; Lee, Jae-Chan; Kim, Chang-Jin; Li, Wen-Jun

2009-05-01

A Gram-positive bacterial strain, designated YIM 56238(T), was isolated from plant roots (Aquilaria sinensis), and characterized by using a polyphasic approach. Strain YIM 56238(T) grew optimally at pH 7.0-8.0 and at 28 degrees C. Analysis of the 16S rRNA gene sequence of strain YIM 56238(T) indicated that it belongs to the genus Micrococcus. Chemotaxonomic data strongly supported the classification of this strain within the genus Micrococcus: the cell-wall peptidoglycan contained lysine, glutamic acid, alanine and glycine; the predominant menaquinones were MK-8(H(2)) (63.6 %) and MK-7(H(2)) (21.1 %); the phospholipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and an unknown ninhydrin-negative phospholipid; and the major cellular fatty acids were iso-C(15 : 0) (30.95 %) and anteiso-C(15 : 0) (53.75 %). The G+C content of the genomic DNA was 72.9 mol%. A number of physiological features were found that clearly distinguished strain YIM 56238(T) from recognized species of the genus Micrococcus. DNA-DNA hybridization studies suggested that the novel strain represents a separate genomic species. On the basis of the data, therefore, strain YIM 56238(T) represents a novel species of the genus Micrococcus, for which the name Micrococcus endophyticus sp. nov. is proposed. The type strain is YIM 56238(T) (=DSM 17945(T)=KCTC 19156(T)).

Responses of Mytilus galloprovincialis to bacterial challenges by metabolomics and proteomics.

PubMed

Ji, Chenglong; Wu, Huifeng; Wei, Lei; Zhao, Jianmin; Wang, Qing; Lu, Hongjian

2013-08-01

Pathogens can cause diseases and lead to massive mortalities of aquaculture animals and substantial economic loss. In this work, we studied the responses induced by Micrococcus luteus and Vibrio anguillarum in gill of mussel Mytilus galloprovincialis at protein and metabolite levels. Metabolic biomarkers (e.g., amino acids, betaine, ATP) suggested that both M. luteus and V. anguillarum induced disturbances in energy metabolism and osmotic regulation. The unique and some more remarkably altered metabolic biomarkers (threonine, alanine, aspartate, taurine, succinate) demonstrated that V. anguillarum could cause more severe disturbances in osmotic regulation and energy metabolism. Proteomic biomarkers (e.g., goose-type lysozyme 2, matrilin, ependymin-related protein, peptidyl-prolyl cis-trans isomerases) indicated that M. luteus caused immune stress, and disturbances in signaling pathways and protein synthesis. However, V. anguillarum mainly induced oxidative stress and disturbance in energy metabolism in mussel gills indicated by altered procollagen-proline dioxygenase, protein disulfide isomerase, nucleoside diphosphate kinases, electron transfer flavoprotein and glutathione S-transferase. This work confirmed that an integration of proteomics and metabolomics could provide an insightful view into the effects of pathogens to the marine mussel M. galloprovincialis. Copyright © 2013 Elsevier Ltd. All rights reserved.

[Occurrence and number of bacteria from the Micrococcus, Kocuria, Nesterenkonia, Kytococcus and Dermacoccus genera on skin and mucous membranes in humans].

PubMed

Szczerba, Izabela

2003-01-01

The aim of work was to evaluate the frequency of occurrence of bacteria from genera of Micrococcus, Kocuria, Nesterenkonia, kytococcus and Dermatococcus on human skin and mucous membranes in healthy population. Among 150 investigated persons these bacteria were found in 122 (81.3%). The frequency of isolation was similar in both sex (82.4% in female and 79.7% in male). Most often the strains were isolated from oral cavity (48.7%), and from skin of palm and forearm (40.7% and 37.3%). Least frequency of occurrence was observed in vestibule of nose (26%). The predominant isolated strains were: M. luteus (26.2%), and N. halobia (21%) followed by K. varians (16.4%), M. lylae (12.2%), D. sedentarius (9.1%), K. kristinae (7.3%), K. nishinomiyaensis (7.3%), K. rosea (0.3%).

[Quantitative and qualitative analysis of oral microbiota by orthopedic rehabilitation with full and partial removable dentures].

PubMed

Stafeev, A A; Chesnokova, M G; Chesnokov, V A

2015-01-01

Microbiological analysis of biomaterial surface in dental prosthesis showed the most common colonizing gram-positive species to be S. aureus, Micrococcus spp., S. haemolyticus, E. faecalis, mainly massive colonization with S. aureus was seen. The highest concentration of C. albicans colonization was found in removable dentures and may have a destructive effect on prosthetic material.

Synthesis and antibacterial activity of Schiff bases and amines derived from alkyl 2-(2-formyl-4-nitrophenoxy)alkanoates.

PubMed

Goszczyńska, Agata; Kwiecień, Halina; Fijałkowski, Karol

A series of novel Schiff bases and secondary amines were obtained in good yields, as a result of the reductive amination of alkyl 2-(2-formyl-4-nitrophenoxy)alkanoates with both aniline and 4-methoxyaniline under established mild reaction conditions. Sodium triacetoxyborohydride as well as hydrogen in the presence of palladium on carbon were used as efficient reducing agents of the Schiff bases, in both direct and stepwise reductive amination processes. The Schiff bases, amines, and amine hydrochlorides were designed as potential antibacterial agents, and structure-activity relationship could be established following in vitro assays against Gram-positive and Gram-negative bacteria. The minimal inhibitory concentration and zone of inhibition were also determined. In these tests, some of Schiff bases and secondary amine hydrochlorides showed moderate-to-good activity against Gram-positive bacteria, including S. aureus , M. luteus , and S. mutans .

Characterisation and functional comparison of single-CRD and multidomain containing galectins CgGal-2 and CgGal-3 from oyster Crassostrea gigas.

PubMed

Huang, Mengmeng; Zhou, Tao; Wu, Yuehong; Fei, Hui; Wang, Gaoyang; Li, Zhi; Lei, Yutong; Liu, Qian; Sun, Cong; Lv, Zhengbing; Xu, Xue-Wei

2018-04-18

Galectins are β-galactoside binding lectins that play crucial roles in innate immunity in vertebrates and invertebrates through their conserved carbohydrate-recognition domains (CRDs). In the present study, single- and four-CRD-containing galectins were identified in oyster Crassostrea gigas (designated CgGal-2 and CgGal-3). The open reading frames (ORFs) of CgGal-2 and CgGal-3 encode polypeptides of 200 and 555 amino acids, respectively. All CRDs of CgGal-3 include two consensus motifs essential for ligand-binding, and a novel motif is present in CgGal-2. Pathogen-associated molecular pattern (PAMP) profiles were determined for recombinant rCgGal-2 and rCgGal-3, and rCgGal-2 displayed low binding affinity for PAMPs, while rCgGal-3 bound various PAMPs including glucan, lipopolysaccharide (LPS), and peptidoglycan (PGN) with relatively high affinity. Furthermore, rCgGal-2 and rCgGal-3 exhibited different microbe binding profiles; rCgGal-2 bound to Gram-negative bacteria (Escherichia coli and Vibrio vulnificus) and fungi (Saccharomyces cerevisiae and Pichia pastoris), while rCgGal-3 bound to these microbes but also to Gram-positive bacteria (Micrococcus luteus). In addition, rCgGal-3 possessed microbial agglutinating activity and coagulation activity against fungi and erythrocytes, respectively, but rCgGal-2 lacked any agglutinating activity. Carbohydrate binding specificity analysis showed that rCgGal-3 specifically bound D-galactose. Furthermore, rCgGal-2 and rCgGal-3 functioned as opsonin participating in the clearance against invaders in C. gigas. Thus, CgGal-2 with one CRD and CgGal-3 with four CRDs are new members of the galectin family involved in immune responses against bacterial infection. Differences in the organisation and amino acid sequences of CRDs may affect their specificity and affinity for nonself substances. Copyright © 2018 Elsevier Ltd. All rights reserved.

Diversity of pigmented Gram-positive bacteria associated with marine macroalgae from Antarctica.

PubMed

Leiva, Sergio; Alvarado, Pamela; Huang, Ying; Wang, Jian; Garrido, Ignacio

2015-12-01

Little is known about the diversity and roles of Gram-positive and pigmented bacteria in Antarctic environments, especially those associated with marine macroorganisms. This work is the first study about the diversity and antimicrobial activity of culturable pigmented Gram-positive bacteria associated with marine Antarctic macroalgae. A total of 31 pigmented Gram-positive strains were isolated from the surface of six species of macroalgae collected in the King George Island, South Shetland Islands. On the basis of 16S rRNA gene sequence similarities ≥99%, 18 phylotypes were defined, which were clustered into 11 genera of Actinobacteria (Agrococcus, Arthrobacter, Brachybacterium, Citricoccus, Kocuria, Labedella, Microbacterium, Micrococcus, Rhodococcus, Salinibacterium and Sanguibacter) and one genus of the Firmicutes (Staphylococcus). It was found that five isolates displayed antimicrobial activity against a set of macroalgae-associated bacteria. The active isolates were phylogenetically related to Agrococcus baldri, Brachybacterium rhamnosum, Citricoccus zhacaiensis and Kocuria palustris. The results indicate that a diverse community of pigmented Gram-positive bacteria is associated with Antartic macroalgae and suggest its potential as a promising source of antimicrobial and pigmented natural compounds. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Micrococcus cohnii sp. nov., isolated from the air in a medical practice.

PubMed

Rieser, Gernot; Scherer, Siegfried; Wenning, Mareike

2013-01-01

Three Gram-reaction-positive bacteria, isolated from the air in a medical practice (strains WS4601(T), WS4602) or a pharmaceutical clean room (strain WS4599), were characterized using a polyphasic approach. Phylogenetic analyses based on 16S rRNA and recA gene sequences of the three novel strains showed that they formed a distinct lineage within the genus Micrococcus, sharing 16S rRNA gene sequence similarities of 96.1-98.0 % with other species of this genus. Chemotaxonomic features also supported the classification of the three novel strains within the genus Micrococcus. The major cellular fatty acids of strain WS4601(T) were anteiso-C(15 : 0) and iso-C(15 : 0), the cell-wall peptidoglycan was of type A3α (L-Lys-L-Ala), and the predominant respiratory quinones were MK-7(H(2)) and MK-8(H(2)). The polar lipid profile contained diphosphatidylglycerol and phosphatidylglycerol, but no phosphatidylinositol. The G+C content of the genomic DNA was 70.4 mol%. Numerous physiological properties were found that clearly distinguished strains WS4599, WS4601(T) and WS4602 from established members of the genus Micrococcus. Based on the phenotypic and phylogenetic data, strains WS4599, WS4601(T) and WS4602 are considered to represent three different strains of a novel species of the genus Micrococcus, for which the name Micrococcus cohnii sp. nov. is proposed. The type strain is WS4601(T) (=DSM 23974(T)=LMG 26183(T)).

Antibacterial potential of Calotropis procera (flower) extract against various pathogens.

PubMed

Ali, Abid; Ansari, Asma; Qader, Shah Ali Ul; Mumtaz, Majid; Saied, Sumayya; Mahboob, Tabassum

2014-09-01

Increased bacterial resistance towards commonly used antibiotics has become a debated issue all over the world in a last few decades. Due to this, consumer demand towards natural anti-microbial agents is increasing day by day. Natural anti-microbial agents have gained enormous attention as an alternative therapeutic agent in pharmaceutical industry. Current study is an effort to explore and identify a bactericidal potential of various solvent extracts of Calotropis procera flower. Flowers of C. procera were extracted with hexane, butanol, ethyl acetate and aqua to evaluate the antibacterial activity by agar well diffusion method against the various human pathogens. The microorganisms used in this study includes Salmonella typhi, Escherichia coli (O157:H7), Micrococcus luteus KIBGE-IB20 (Gen Bank accession: JQ250612) and methicillin resistant Staphylococcus aureus (MRSA) KIBGE-IB23 (Gen Bank accession: KC465400). Zones of inhibition were observed against all four pathogenic strains. Fraction soluble in hexane showed broad spectrum of inhibition against all the studied pathogens. However, fractions soluble in ethyl acetate inhibited the growth of E. coli, MRSA, and M. luteus. In case of butanol and aqueous extracts only growth of M. luteus was inhibited. Results revealed that the flower extracts of C. procera have a potential to be used as an antibacterial agent against these pathogenic organisms.

Facile fabrication and characterization of chitosan-based zinc oxide nanoparticles and evaluation of their antimicrobial and antibiofilm activity

NASA Astrophysics Data System (ADS)

Dhillon, Gurpreet Singh; Kaur, Surinder; Brar, Satinder Kaur

2014-06-01

The present investigation deals with the facile synthesis and characterization of chitosan (CTS)-based zinc oxide (ZnO) nanoparticles (NPs) and their antimicrobial activities against pathogenic microorganisms. ZnO-CTS NPs were synthesized through two different methods: nano spray drying and precipitation, using various organic compounds (citric acid, glycerol, starch and whey powder) as stabilizers. Both the synthesis methods were simple and were devoid of any chemical usage. The detailed characterization of the NPs was carried out using UV-Vis spectroscopy, dynamic light scattering particle size analysis, zeta potential measurements and scanning electron microscopy, which confirmed the fabrication of NPs with different shapes and sizes. Antimicrobial assay of synthesized ZnO-CTS NPs was carried out against different pathogenic microbial strains ( Candida albicans, Micrococcus luteus and Staphylococcus aureus). The significant ( p < 0.05) inhibition of growth was observed for both M. luteus and S. aureus with ZnO-CTS NPs (with a concentration ranging from 0.625 to 0.156 mg/ml) as compared to control treatment. ZnO-CTS NPs also showed significant biofilm inhibition activity ( p < 0.05) against M. luteus and S. aureus. The study demonstrated the potential of ZnO-CTS NPs as antimicrobial and antibiofilm agents.

Activity and immunodetection of lysozyme in earthworm Dendrobaena veneta (Annelida).

PubMed

Fiołka, Marta J; Zagaja, Mirosław P; Hułas-Stasiak, Monika; Wielbo, Jerzy

2012-01-01

In the present study, lysozyme-like activity against Micrococcus luteus was detected in the coelomic fluid, the extract from coelomocytes, intestine and in the homogenates from cocoons of Dendrobaena veneta. Four hours after immunization with Escherichia coli, the lysozyme activity in the coelomic fluid increased about three times and in the extract of coelomocytes - four times, in comparison to the control. In three cases: of the coelomic fluid, the homogenates from cocoons and the extract from coelomocytes, the antibody against HEWL (hen egg white lysozyme) recognized only one protein with a molecular mass of about 14.4 kDa. In the coelomic fluid, apart from the protein with molecular mass of 14.4 kDa the antibody directed against human lysozyme recognized an additional protein of 22 kDa. Using the bioautography technique after electrophoretic resolution of native proteins in acidic polyacrylamide gels, two lytic zones of M. luteus were observed in the case of the coelomic fluid and three after the analysis of the extract of coelomocytes and the egg homogenates. The results indicated the existence of several forms of lysozyme with a different electric charge in the analyzed D. veneta samples. The highest lysozyme activity in the intestine of D. veneta was observed in the midgut. The antibody directed against human lysozyme indicated a strong positive signal in epidermal and midgut cells of earthworm. Copyright © 2011 Elsevier Inc. All rights reserved.

Limazepines A-F, pyrrolo[1,4]benzodiazepine Antibiotics from an Indonesian Micrococcus sp.

PubMed

Fotso, Serge; Zabriskie, T Mark; Proteau, Philip J; Flatt, Patricia M; Santosa, Dwi Andreas; Mahmud, Taifo

2009-04-01

In our screening of Indonesian microorganisms for novel bioactive natural products we have isolated seven new compounds, designated as limazepines A, B1 and B2 (isolated as an isomeric mixture), C, D, E, and F, from the culture broth of Micrococcus sp. strain ICBB 8177. In addition, the known natural products prothracarcin and 7-O-succinylmacrolactin A, as well as two previously reported synthetic compounds, 2-amino-3-hydroxy-4-methoxybenzoic acid methyl ester and 4-ethylpyrrole-2-carboxaldehyde, were obtained from the extract. Chemical structures were determined by spectroscopic methods and by comparison with the NMR data of structurally related compounds. The limazepines belong to the growing group of the pyrrolo[1,4]benzodiazepine antitumor antibiotics isolated from various soil bacteria. Limazepines B1/B2 mixture, C, and E were active against the Gram-positive bacterium Staphylococcus aureus and the Gram-negative bacterium Escherichia coli. Limazepine D was also active against S. aureus, but was not active against E. coli. Interestingly, only the limazepines B1/B2 mixture and D were active against Pseudomonas aeruginosa.

Screening of the constituents, antimicrobial and antioxidant activity of endemic Origanum hypericifolium O. Schwartz & P.H. Davis.

PubMed

Celik, Ali; Nur Herken, E; Arslan, Idris; Zafer Ozel, M; Mercan, Nazime

2010-10-01

The chemical compositions, total phenol content, antioxidant and antimicrobial activities with oxidant status of the essential oil from an endemic Turkish species, Origanum hypericifolium, were investigated. Steam distillation (SD) was used to isolate the essential oils, and the chemical analyses were performed by gas chromatography-mass spectrometry (GC-MS). The antimicrobial activity was tested by agar disc diffusion method against Morganella morganii (clinic isolate), Micrococcus flavus (clinic isolate), Micrococcus luteus NRLL B-4375, Proteus vulgaris RSKK 96026, Escherichia coli ATCC 11230, Escherichia coli ATCC 25922, Yersinia enterecolitica RSKK 1501, Staphylococcus aureus ATCC 25923, S. aureus ATCC 25933, S. aureus ATCC 12598, S. aureus (clinic isolate), MRSA 1 (clinic isolate), MRSA 2 (clinic isolate), MRSA 3 (clinic isolate) and MRSA 4 (clinic isolate). The major compounds found in volatiles of O. hypericifolium were p-cymene, carvacrol and γ-terpinene. Results showed that O. hypericifolium has the potential for being used in food and medicine because of its antioxidant and antibacterial activity.

Presence of a new cytochrome b - like pigment with a peak at 567 nm in various aerobic bacteria.

PubMed

Jacobs, N J; O'Hara, J; Gray, C T

1983-09-01

Several physiological groups of bacteria were examined for the presence of a cytochrome b - like pigment which is demonstrable in dithionite-reduced minus substrate-reduced difference spectra. This pigment is characterized by an unusually high alpha band at 567 nm, a low concentration relative to conventional cytochromes, and an inability to be fully reduced by endogenous substrates or NADH. Previous studies with one denitrifying and nondenitrifying species of the genus Pseudomonas, in Paracoccus denitrificans, in Alcaligenes faecalis, in Azotobacter vinelandii, in Branhamella catarrhalis, and in Neisseria lactamicus. In all these organisms, the peak of the 567-nm pigment is accompanied by a peak of about equal height at approximately 559 nm, which exhibits similar properties to the 567-nm pigment. The 567-nm pigment was not demonstrable by this technique in Gluconobacter oxydans subspecies suboxydans, Bacillus subtilis, Bacillus licheniformis, Aeromonas hydrophilia, Escherichia coli, a Klebsiella species, Moraxella osloensis, Aquaspirillum itersonii, Micrococcus lysodeikticus, Micrococcus luteus, Agrobacterium tumefaciens, or Rhizobium meliloti.

Isolation and characterization of aerobic culturable arsenic-resistant bacteria from surfacewater and groundwater of Rautahat District, Nepal.

PubMed

Shakya, S; Pradhan, B; Smith, L; Shrestha, J; Tuladhar, S

2012-03-01

Arsenic (As) contamination of groundwater is a serious Environmental Health Management issue of drinking water sources especially in Terai region of Nepal. Many studies have reported that due to natural abundance of arsenic in the environment, various bacteria have developed different resistance mechanisms for arsenic compound. In this study, the culturable arsenic-resistant bacteria indigenous to surfacewater as well as groundwater from Rautahat District of Nepal were randomly isolated by standard plate count method on the basis of viable growth on plate count agar amended with arsenate ranging from 0, 0.5, 10, 40, 80 to 160 milligram per liter (mg/l). With respect to the morphological and biochemical tests, nine morphologically distinct potent arsenate tolerant bacteria showed relatedness with Micrococcus varians, Micrococcus roseus, Micrococcus luteus, Pseudomonas maltophilia, Pseudomonas sp., Vibrio parahaemolyticus, Bacillus cereus, Bacillus smithii 1 and Bacillus smithii 2. The isolates were capable of tolerating more than 1000 mg/l of arsenate and 749 mg/l of arsenite. Likewise, bioaccumulation capability was highest with M. roseus (85.61%) and the least with B. smithii (47.88%) indicating the potential of the organisms in arsenic resistance and most probably in bioremediation. Copyright © 2011 Elsevier Ltd. All rights reserved.

Structural studies of 4-aminoantipyrine derivatives

NASA Astrophysics Data System (ADS)

Cunha, Silvio; Oliveira, Shana M.; Rodrigues, Manoel T.; Bastos, Rodrigo M.; Ferrari, Jailton; de Oliveira, Cecília M. A.; Kato, Lucília; Napolitano, Hamilton B.; Vencato, Ivo; Lariucci, Carlito

2005-10-01

Reaction of 4-aminoantipyrine with acetylacetone, ethyl acetoacetate, benzoyl isothiocyanate, phenyl isothiocyanate, maleic anhydride and methoxymethylene Meldrum's acid afforded a series of new antipyrine derivatives. The antibacterial activity of the synthesized compounds against Micrococcus luteus ATCC 9341, Staphilococcus aureus ATCC 29737, and Escherichia coli ATCC 8739 was evaluated and the minimal inhibitory concentration determined. Modest activity was found only to the maleamic acid obtained from the reaction of 4-aminoantipyrine and maleic anhydride. 1H NMR investigation of this maleamic acid showed that it is slowly converted to the corresponding toxic maleimide. The structures of three derivatives were determined by X-ray diffraction analysis.

Regioselective synthesis of novel 3-allyl-2-(substituted imino)-4-phenyl-3H-thiazole and 2,2‧-(1,3-phenylene)bis(3-substituted-2-imino-4-phenyl-3H-thiazole) derivatives as antibacterial agents

NASA Astrophysics Data System (ADS)

Abbasi Shiran, Jafar; Yahyazadeh, Asieh; Mamaghani, Manouchehr; Rassa, Mehdi

2013-05-01

Several novel 3-allyl-2-(substituted imino)-4-phenyl-3H-thiazole derivatives were synthesized by the reaction of allyl-thioureas and 2-bromoacetophenone. We also report the synthesis of bis-allyl-3H thiazoles using the reaction of various isothiocyanates and 1,3-phenylenediamine. The structures of all compounds were characterized by spectral and elemental analysis. Most of the synthesized compounds exhibited efficient antibacterial activities against Salmonella enterica, Micrococcus luteus, Bacillus subtilis and Pseudomonas aeruginosa.

Pitfalls in efficacy testing – how important is the validation of neutralization of chlorhexidine digluconate?

PubMed Central

Reichel, Mirja; Heisig, Peter; Kampf, Günter

2008-01-01

Background Effective neutralization of active agents is essential to obtain valid efficacy results, especially when non-volatile active agents like chlorhexidine digluconate (CHG) are tested. The aim of this study was to determine an effective and non-toxic neutralizing mixture for a propan-1-ol solution containing 2% CHG. Methods Experiments were carried out according to ASTM E 1054-02. The neutralization capacity was tested separately with five challenge microorganisms in suspension, and with a rayon swab carrier. Either 0.5 mL of the antiseptic solution (suspension test) or a saturated swab with the antiseptic solution (carrier test) was added to tryptic soy broth containing neutralizing agents. After the samples were mixed, aliquots were spread immediately and after 3 h of storage at 2 – 8°C onto tryptic soy agar containing a neutralizing mixture. Results The neutralizer was, however, not consistently effective in the suspension test. Immediate spread yielded a valid neutralization with Staphylococcus aureus, Staphylococcus epidermidis and Corynebacterium jeikeium but not with Micrococcus luteus (p < 0.001) and Candida albicans (p < 0.001). A 3-h storage period of the neutralized active agents in suspension resulted in significant carry-over activity of CHG in addition against Staphylococcus epidermidis (p < 0.001) and Corynebacterium jeikeium (p = 0.044). In the carrier test, the neutralizing mixture was found to be effective and non toxic to all challenge microorganisms when spread immediately. However, after 3 h storage of the neutralized active agents significant carry-over activity of CHG against Micrococcus luteus (p = 0.004; Tukey HSD) was observed. Conclusion Without effective neutralization in the sampling fluid, non-volatile active ingredients will continue to reduce the number of surviving microorganisms after antiseptic treatment even if the sampling fluid is kept cold straight after testing. This can result in false-positive antiseptic efficacy data. Attention should be paid during the neutralization validation process to the amount of antiseptic solution, the storage time and to the choice of appropriate and sensitive microorganisms. PMID:19046465

Phenolic glycosides and ionone glycoside from the stem of Sargentodoxa cuneata.

PubMed

Chang, Jun; Case, Ryan

2005-12-01

Four phenolic glycosides, cuneatasides A-D (1-4), and one ionone glycoside cuneataside E (5), together with seven known phenolic compounds (6-12) were isolated from the water-soluble constituents of the stem of Sargentodoxa cuneata (Sargentodoxaceae). Their structures were elucidated by spectroscopic analysis. In vitro tests for antimicrobial activity showed compounds 1 and 2 to possess significant activity against two Gram-positive organisms, Staphylococcus aureus and Micrococcus epidermidis.

HSP70 gene expression in Mytilus galloprovincialis hemocytes is triggered by moderate heat shock and Vibrio anguillarum, but not by V. splendidus or Micrococcus lysodeikticus.

PubMed

Cellura, Cinzia; Toubiana, Mylène; Parrinello, Nicolo; Roch, Philippe

2006-01-01

Complete sequence of HSP70 cDNA from the mussel, Mytilus galloprovincialis was established before quantifying its expression following moderate heat shock or injection of heat-killed bacteria. HSP70 cDNA is comprised of 2378 bp including one ORF of 654 aa, with a predicted 70 bp 5'-UTR and a 343 bp 3'-UTR (GenBank, 18 Jan 05, AY861684). Alignment identity ranged from 89% for Crassostrea ariakensis to 72% for C. virginica. Curiously, HSP70 gene and cDNA sequences from M. galloprovincialis, deposited later (03 and 27 May), show only 73% identity with the present sequence. Meanwhile, characteristic motifs of the HSP70 family were located in conserved positions. Expression of HSP70 gene was quantified on circulating hemocyte mRNA using Q-PCR after RT using random hexaprimers. Housekeeping gene was 28S rRNA. Four stresses were applied: heat shock that consisted of immersing mussels for 90 min at 30 degrees C and returning them to 20 degrees C sea water, one injection of heat-killed Gram-negative bacteria, Vibrio splendidus LGP32, one injection of heat-killed Gram-negative bacteria Vibrio anguillarum, one injection of heat-killed Gram-positive bacteria Micrococcus lysodeikticus. We found no significant modification of 28S rRNA gene expression. Significant increase of 5.2 +/- 0.4 fold the ratio HSP70/28S rRNA was observed 6 h after heat shock and was maximum at 15 h (6.1 +/- 1.1), and still significant after 24 h (1.7 +/- 0.03). Similarly, injecting V. anguillarum resulted in a significant increase of 2.7 +/- 0.1 after 12 h. Expression was maximum after 48 h (5.2 +/- 0.05) and returned to baseline after 72 h. In contrast, injecting V. splendidus or M. lysodeikticus failed to significantly modulate HSP70 gene expression at least during the first 3 days post-injection. Consequently, mussel hemocytes appeared to discriminate between pathogenic and non-pathogenic Vibrios, as well as between Gram-negative and Gram-positive bacteria.

Evaluation of autochthonous micrococcus strains as starter cultures for the production of Kedong sufu.

PubMed

Feng, Z; Huang, S; Ai, Z W; Zhang, M; Zhai, S; Chen, X

2016-03-01

The technological properties of 22 micrococcus strains from traditional fermented Kedong sufu were evaluated in order to develop autochthonous starter cultures. The proteolytic, autolytic and lipolytic activity, salt tolerance, production and degradation of the biogenic amines of six Micrococcus luteus, nine Kocuria kristinae and seven Kocuria rosea were evaluated. The results indicated that these micrococcus strains exhibited a certain technological diversity, and the results also indicated the best properties to be used in mixed starter cultures. Based on the above findings, two sets of autochthonous starters were formulated. Considering the physicochemical properties and sensory characteristics of sufu, the maturation period of sufu was shortened by 30 days. The profiles of free amino acids and peptides partly revealed the mechanism of sensory quality and shorter ripening time of sufu manufactured using autochthonous mixed starters. Compared to back-slopping fermentation, sufu manufactured with selected autochthonous starter cultures exhibited lower levels of total biogenic amines. The selected strains could be used as starter to avoid the accumulation of high concentrations of biogenic amines while also maintaining typical sensory characteristics and preserving the autochthonous strains of the traditional Kedong sufu. The maturation times of Kedong sufu were shortened by 30 days with application of the autochthonous starter. Autochthonous mixed starters can reduce the generation of biogenic amines, speed up the sufu maturation process and preserve typical sensory quality. Furthermore, the rotation of two sets of mixed starter cultures can effectively resist phage attack during the production of sufu. © 2015 The Society for Applied Microbiology.

Agreement Between Deoxyribonucleic Acid Base Composition and Taxometric Classification of Gram-Positive Cocci1

PubMed Central

Silvestri, L. G.; Hill, L. R.

1965-01-01

Silvestri, L. G. (Università Statale, Milan, Italy), and L. R. Hill. Agreement between deoxyribonucleic acid base composition and taxometric classification of gram-positive cocci. J. Bacteriol. 90:136–140. 1965.—It had been previously proposed, from taxometric analyses, that gram-positive, catalase-positive cocci be divided into two subgroups. Thirteen strains, representative of both subgroups, were examined for deoxyribonucleic acid (DNA) base composition, determined from melting temperatures. Per cent GC (guanine + cytosine/total bases) values fell into two groups: 30.8 to 36.5% GC and 69 to 75% GC. Strains with low per cent GC values belonged to the Staphylococcus aureus–S. saprophyticus–S. lactis taxometric subgroups, and those with high per cent GC values belonged to the S. roseus–S. afermentans subgroup. The hypothetical nature of any classification is emphasized, and, in the present work, the hypothesis derived from taxometric analyses of division into two subgroups is confirmed by the study of DNA base ratios. The two subgroups correspond, respectively, to the genera Staphylococcus and Micrococcus. PMID:16562008

Chemical composition and pharmacological properties of the essential oils obtained seasonally from Lippia thymoides.

PubMed

Silva, Fabrício Souza; Menezes, Pedro Modesto Nascimento; de Sá, Pedro Guilherme Souza; Oliveira, André Luís de Santana; Souza, Eric Alencar Araújo; Almeida, Jackson Roberto Guedes da Silva; de Lima, Julianeli Tolentino; Uetanabaro, Ana Paula Trovatti; Silva, Tânia Regina dos Santos; Peralta, Edna Dória; Lucchese, Angélica Maria

2016-01-01

Lippia thymoides Mart. & Schauer (Verbenaceae) is used in folk medicine to treat wounds, fever, bronchitis, rheumatism, headaches, and weakness. This study determinates the chemical composition of essential oils from L. thymoides, obtained at during each of the four seasons and correlates with pharmacological properties. Essential oils were obtained by hydrodistillation and analyzed by gas chromatography coupled to mass spectroscopy (GC-MS). Antioxidant activity was determined by DPPH free radical scavenging and β-carotene bleaching methods. The antimicrobial assays were performed by minimum inhibitory concentration (MIC) and minimum microbicidal concentration (MMC) methods. Isolated rat aorta and uterus, and guinea-pig trachea were utilized to evaluate relaxant potential in pre-contracted smooth muscle. Essential oils from leaves of L. thymoides had the sesquiterpene β-caryophyllene (17.22-26.27%) as the major constituent followed by borneol (4.45-7.36%), camphor (3.22-8.61%), camphene (2.64-5.66%), and germacrene D (4.72-6.18%). In vitro assays showed that these essential oils do not have antioxidant activity, have antimicrobial selectivity to Gram-positive bacteria Staphylococcus aureus (MIC = 0.004 mg/mL and MMC = 0.26-10.19 mg/mL) and Micrococcus luteus (MIC = 0.03 mg/mL and MMC = 8.43 mg/mL), relax isolated rat aorta (EC50 = 305-544 μg/mL, with endothelium; and EC50 = 150-283 μg/mL, without endothelium), and uterus (EC50 = 74-257 μg/mL), and minor potency, isolated guinea-pig trachea. Lippia thymoides is a source of natural products of pharmaceutical interest, being necessary additional studies to determine the substances involved in the biological activities.

Phylogeny and bioactivity of epiphytic Gram-positive bacteria isolated from three co-occurring antarctic macroalgae.

PubMed

Alvarado, Pamela; Huang, Ying; Wang, Jian; Garrido, Ignacio; Leiva, Sergio

2018-02-19

Marine macroalgae are emerging as an untapped source of novel microbial diversity and, therefore, of new bioactive secondary metabolites. This study was aimed at assessing the diversity and antimicrobial activity of the culturable Gram-positive bacteria associated with the surface of three co-occurring Antarctic macroalgae. Specimens of Adenocystis utricularis (brown alga), Iridaea cordata (red alga) and Monostroma hariotii (green alga) were collected from the intertidal zone of King George Island, Antarctica. Gram-positive bacteria were investigated by cultivation-based methods and 16S rRNA gene sequencing, and screened for antimicrobial activity against a panel of pathogenic microorganisms. Isolates were found to belong to 12 families, with a dominance of Microbacteriaceae and Micrococcaceae. Seventeen genera of Actinobacteria and 2 of Firmicutes were cultured from the three macroalgae, containing 29 phylotypes. Three phylotypes within Actinobacteria were regarded as potentially novel species. Sixteen isolates belonging to the genera Agrococcus, Arthrobacter, Micrococcus, Pseudarthrobacter, Pseudonocardia, Sanguibacter, Staphylococcus, Streptomyces and Tessaracoccus exhibited antibiotic activity against at least one of the indicator strains. The bacterial phylotype composition was distinct among the three macroalgae species, suggesting that these macroalgae host species-specific Gram-positive associates. The results highlight the importance of Antarctic macroalgae as a rich source of Gram-positive bacterial diversity and potentially novel species, and a reservoir of bacteria producing biologically active compounds with pharmacological potential.

The affect of low-coherent light on microbial colony forming ability and morphology of some gram-positive and gram-negative bacteria

NASA Astrophysics Data System (ADS)

Popov, Denis E.; Tuchina, Elena S.; Chernova, Julia A.; Podshibyakin, Dmitry; Rudik, Dmitry V.; Samsonova, Maria; Gromov, Igor; Tuchin, Valery V.

2005-06-01

Gram-negative E. coli, gram-positive facultative anaerobe cocci Staphylococcus lugdensis, Micrococcus halobius, and Stomatococcus mucilaginosus as subjects of study were chosen. LEDs with spectrum maxima at 405 nm (without any exogenous sensitizer) and 660 nm (in conjunction with methylene blue) and power densities of 23 mW/cm2 and 5.7 mW/cm2 accordingly as continuous light sources were chosen. Photosensitized light's affect by methylene blue was studied on E. coli only. The original scheme of experiment set up was developed. It permits one to increase expositions quantity in each experiment for more certain trend's construction over dose curves and decrease parasite flora sowing. As a result of accomplished studies it was established that blue low-coherent light have unalike weak light's dose depending suppressing effect on cocci whereas red low-coherent light have a moderate dose-depended suppressing effect at low irradiation doses and a moderate dose-depended stimulating effect at high irradiation doses on sensitized by MeBlue E. coli. For all ofthis, but Staphylococcus morphology changes were observed.

Antimicrobial and anticancer efficacy of antineoplastic agent capped gold nanoparticles.

PubMed

Selvaraj, V; Grace, A Nirmala; Alagar, M; Hamerton, I

2010-04-01

Synthesis of thioguanine (TG)-capped Au nanoparticles (Au@TG) and their enhanced in vitro antimicrobial and anticancer efficacy against Micrococcus luteus, Staphylococcus aureus, Pseudomonas aeruginosa, E. coli, Aspergillus fumigatus, Aspergillus niger and Hep2 cancer cell (Human epidermiod cell) have been reported. The nature of binding between 6-TG and the gold nanoparticles via complexation is investigated using ultraviolet-visible spectrum, cyclic voltammetry, transmission electron microscopy, fluorescence and Fourier transform infrared (FT-IR) spectroscopy. The present experimental studies suggests that Au@TG are more potential than TG towards antimicrobial and anticancer activities. Hence, gold nanoparticles have the potential to be used as effective carriers for anticancer drug.

Comparative Study of Hydroalcoholic Extracts of Momordica charantia L. against Foodborne Pathogens

PubMed Central

Rakholiya, Kalpna; Vaghela, P.; Rathod, T.; Chanda, Sumitra

2014-01-01

The antimicrobial effect of 24 different hydroalcoholic extracts (100, 75, 50 and 25% methanol and water) obtained from four parts (leaf+stem (aerial), peel, pulp and seed) of Momordica charantia L. were investigated against five Gram-positive, six Gram-negative and four fungal strains. The extraction was done by individual cold percolation method using hexane, different hydroalcoholic solvent (100, 75, 50 and 25% methanol) and water. The antimicrobial activity was done by agar well diffusion assay. The extracts, which showed >15 mm zone of inhibition, were further screened to determine minimum inhibitory concentration and minimum bactericidal concentration using a broth dilution method performed in 96-well microtitre plate. The extractive yield was highest in aqueous extracts of all the four parts closely followed by 25% methanol. Micrococcus flavus was the most susceptible Gram-positive bacteria and Pseudomonas testosteroni was the most susceptible Gram-negative bacteria. The highest antibacterial activity was shown by 100% methanol. The Gram-negative Pseudomonas spp. was more susceptible towards all the extracts than the Gram-positive bacteria or fungal strains investigated. One hundred percent and 50% methanol extracts of seed showed lowest minimum inhibitory concentration and minimum bactericidal concentration values, that is <39 and 625 μg/ml, respectively, against Pseudomonas pictorum. Therefore, these extracts would be of interest in the control of Pseudomonas spp. in food industry as well as used for therapeutic purposes. PMID:24843188

Glycosidases in Brachionus plicatilis (Rotifera).

PubMed

Kühle, K; Kleinow, W

1990-01-01

1. Tests for glycosidases were performed in homogenates of Brachionus plicatilis. 2. Hydrolytic activity was detected with the following substrates: (a) with synthetic substrates (NP = 4-nitrophenyl): NP-alpha- and NP-beta-D-glucopyranoside, NP-alpha- and NP-beta-D-galactopyranoside, NP-N-acetyl-beta-D-glucosaminide, NP-N-acetyl-beta-D-galactosaminide, NP-alpha- and NP-beta-D-mannopyranoside and NP-alpha-L-fucopyranoside; (b) with disaccharides: sucrose, maltose, trehalose, isomaltose, cellobiose, gentiobiose and lactose; (c) with polysaccharides: laminarine, carboxymethyl-cellulose, avicel, Micrococcus luteus (for lysozyme) and 4-nitrophenyl-alpha-D-maltoheptaoside (for amylase). 3. The pH dependence of the glycosidase activities was determined. 4. The distribution of enzyme activities within fractions from the homogenate was studied in order to localize them within the cell. 5. Proteins from Brachionus homogenate were separated by SDS-gel electrophoresis and the positions of the following glycosidase activities were detected by assays performed on the gels (estimated molecular weights in parentheses): alpha-glucosidase (250,000); beta-glucosidase (200,000); beta-galactosidase (70,000); N-acetyl-beta-glucosaminidase (60,000).

Micrococcus-associated central venous catheter infection in patients with pulmonary arterial hypertension.

PubMed

Oudiz, Ronald J; Widlitz, Allison; Beckmann, X Joy; Camanga, Daisy; Alfie, Jose; Brundage, Bruce H; Barst, Robyn J

2004-07-01

To determine the incidence of catheter-related infection in patients with pulmonary arterial hypertension (PAH) receiving epoprostenol (EPO), and to note an etiologic role for Micrococcus spp, which is rarely reported as a pathogen in the medical literature. Observational study. Two PAH specialty treatment centers, Harbor-UCLA Medical Center (Torrance, CA), and the College of Physicians and Surgeons, Columbia University (New York, NY). A total of 192 patients with PAH receiving continuous therapy with IV EPO. From 1987 to 2000, 192 patients with PAH received infusions of EPO via central venous catheter. Catheter care included regular dressing changes with dry gauze using a sterile procedure, without the use of flushes. Patients were asked to report on known infections and treatments, and symptoms. All infections were verified by a telephone call to the patient, care provider, and microbiology laboratory whenever possible. There were 335,285 catheter days (mean +/- SD, 1,325 +/- 974 catheter days). There were 88 clinical catheter infections with 51 blood culture-positive infections, necessitating catheter removal in 38 instances. The following pathogens were isolated: Staphylococcus aureus (25); Micrococcus spp (14); mixed flora (3); coagulase-negative Staphylococcus spp (2); Corynebacterium spp (2); Serratia marcessens (1); Enterobacter spp (1); Pseudomonas aeruginosa (1); enterococci (1); and unidentified Gram-positive cocci (1). The catheter infection rate was 0.26 per 1,000 catheter days. The use of long-term therapy with continuous EPO appears to be associated with a low incidence of catheter-related infections. Micrococcus spp were the second most common etiologic agent. Caregivers managing patients with PAH must be aware of the risk of catheter infection, as it may contribute to the morbidity and mortality associated with the use of EPO. When isolated, Micrococcus spp should not be viewed as a contaminant, but rather as a true pathogen that may require therapeutic intervention.

Efficient biotransformation of herbicide diuron by bacterial strain Micrococcus sp. PS-1.

PubMed

Sharma, Priyanka; Chopra, Adity; Cameotra, Swaranjit Singh; Suri, C Raman

2010-11-01

A Gram-positive, Micrococcus sp. strain PS-1 capable of utilizing phenylurea herbicide diuron as a sole carbon source at a high concentration (up to 250 ppm) was isolated from diuron storage site by selective enrichment study. The taxonomic characterization with 16S rRNA gene sequencing (1,477 bp) identified PS-1 as a member of Micrococcus sp. It was studied for the degradation of diuron and a range of its analogues (monuron, linuron, monolinuron, chlortoluron and fenuron). The shake flasks experiments demonstrated fast degradation of diuron (up to 96% at 250 ppm within 30 h incubation) with the addition of small quantity (0.01%) of non-ionic detergent. The relative degradation profile by the isolate was in the order of fenuron > monuron > diuron > linuron > monolinuron > chlortoluron. Further, the biochemical characterization of catabolic pathway by spectroscopic and chromatographic techniques demonstrated that the degradation proceeded via formation of dealkylated metabolites to form 3,4-dichloroaniline (3,4-DCA). It was the major metabolite formed, associated with profound increase in degradation kinetics in presence of appropriate additive.

[The effect of dexamethoxin on the integrity of cytoplasmic membrane in gram-positive and gram-negative microorganisms].

PubMed

Shchetina, V N; Belanov, E F; Starobinets, Z G; Volianskiĭ, Iu L

1990-01-01

Decamethoxin is shown to be able to increase membrane permeability of Pseudomonas aeruginosa, Escherichia coli and Micrococcus lysodeikticus, that is confirmed by a loss of compounds with the absorption maximum at 260 nm by cells. Parallel with this the number of viable individuals has fallen and activity of dehydrogenases has been inhibited. The aspartate and alanine aminotransferase activity was not inhibited by decamethoxin and even increased. Decamethoxin lysed the protoplasts of the tested microorganisms. At high decamethoxin concentrations (over 500 micrograms/ml for P. aeruginosa and over 200 mu/ml--for E. coli) the outflow of components from the cells of gram-negative bacteria ceased, that may be associated with the coagulation changes in the cytoplasm. A loss of the low-molecular components by M. lysodeikticus cells and lysis of protoplasts proceeded less intensely than the same processes in the gram-negative microorganisms, that is explained by a less resistance of M. lysodeikticus to decamethoxin and earlier coagulation of the cytoplasm preventing lysis.

Spätzle-Processing Enzyme-independent Activation of the Toll Pathway in Drosophila Innate Immunity.

PubMed

Yamamoto-Hino, Miki; Goto, Satoshi

2016-05-07

The Toll pathway regulates innate immunity in insects and vertebrates. The Drosophila Toll receptor is activated by a processed form of a ligand, Spätzle. Spätzle-processing enzyme (SPE) is the only enzyme identified to date that functions in converting Spätzle to an active form during the immune response. In the present study, Toll activation induced by immune challenge was almost suppressed in spätzle mutant larvae and adults, whereas it was present in SPE mutant larvae challenged with Micrococcus luteus and adults challenged with Bacillus subtilis. Our data suggest that an unidentified protease besides SPE processes Spätzle under conditions of microbial challenge.

One-pot synthesis of biologically active 1,2,3-trisubstituted pyrrolo[2,3-b]quinoxalines through a palladium-catalyzed reaction with internal alkyne moieties.

PubMed

Keivanloo, Ali; Besharati-Seidani, Tayebeh; Kaboudin, Babak; Yoshida, Akihiro; Yokomatsu, Tsutomu

2018-06-16

Synthesis of 2,3-disubstituted 1-alkylpyrrolo[2,3-b]quinoxalines was accomplished through the reaction of 3-chloroquinoxalin-2-amines with internal alkynes in the presence of Pd(OAc)[Formula: see text], NaOAc, and KOtBu in DMSO. This method afforded desired pyrrolo[2,3-b]quinoxalines in 65-92% reaction yields. The minimum inhibition concentration and minimum bactericidal concentration determinations against Micrococcus luteus and Pseudomonas aeruginosa revealed that some of the synthesized compounds showed the same values compared to tetracycline. These compounds could be used in the future research for the development of new antibiotics.

Isolation of DNA methyltransferase from plants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ehrlich, K.; Malbroue, C.

1987-05-01

DNA methyltransferases (DMT) were isolated from nuclei of cauliflower, soybean, and pea by extraction with 0.35 M NaCl. Assays were performed on hemimethylated Micrococcus luteus DNA or on M. luteus DNA to test for maintenance or de novo methylase activity, respectively. Fully methylated DNA was used as a substrate to determine background levels of methylation. Based on these tests, yields of maintenance DMT activity in the crude extract from pea hypocotyl, soybean hypocotyl, and cauliflower inflorescence were 2.8, 0.9, and 1.6 units per g wet tissue (one unit equals 1 pmol of methyl from (/sup 3/H)AdoMet incorporated into acid precipitablemore » material per h at 30/sup 0/). Two peaks of DMT activity were detected in the soybean nuclear extract following phosphocellulose chromatography. One eluted at 0.4 M and the other at 0.8 M KCl. With both fractions maintenance activity was approximately 2 times that of the de novo activity. Using gel filtration the DMT eluted at 220,000 Daltons. The optimal pH for activity was between 6.5 and 7.0, and the optimal temperature was 30/sup 0/.« less

[Microfloral study of bull seminal fluid stored at low temperatures].

PubMed

Korudzhiĭski, N

1979-01-01

Hundred twenty three samples of bull semen fluid frozen at 196 degrees C including 83 plastic ampules, 20 granules and 20 plastic straws obtained from the containers of the insemination stations of 10 farms from the Sofia district were investigated. Two hundred twelve strains were isolated and identified as: Escherichia coli--25 strains, Hafnia--16 strains, Citrobacter, Enterobacter and Proteus mirabilis--9 strains of each. The remaining Gram-negative genera and species were more rarely encountered. Gram positive bacteria: Micrococcus--19 strains, Staphylococcus aureus--17 strains, Staph. epidermidis--15 strains, Bacillus cereus--15 strains, B. subtilis--12 strains. Other representatives of Gram-positive bacteria were also found but in lower percentages. Least bacteria were observed in semen fluid frozen in plastic straws and most--in plastic ampules which were mainly used until recently for cow insemination. It was established that the same bacteria isolated by other authors from fresh sperm were encountered in semen fluid stored at minus temperatures. The conclusion is made that semen fluid stored at low temperature is contaminated with bacteria. It is only natural that these bacteria are introduced in cow genitals by insemination.

Radiation resistence of microorganisms from radiation sterilization processing environments

NASA Astrophysics Data System (ADS)

Sabovljev, Svetlana A.; Žunić, Zora S.

The radiation resistance of microorganisms was examined on the samples of dust collected from the radiation sterilization processing environments including assembly, storage, and sterilization plant areas. The isolation of radiation resistant strains was performed by irradiation with screening doses ranging from 10 to 35 kGy and test pieces containing 10 6 to 10 8 CFU in dried serum-broth, representing 100 to 5000 colonies of primary cultures of microorganisms from 7 different sites. In an examination of 16900 colonies of aerobic microorganisms from 3 hygienically controlled production sites and 4 uncontrolled ones, 30 strains of bacteria were isolated. Of those 15 were classified as genus Bacillus, 9 as Micrococcus and 6 as Sarcina. All of the 15 strains of Gram positive sporeforming aerobic rods exhibited an exponential decrease in the surviving fraction as a function of dose, indicating that the inactivation of spores of aerobic rods is a consequence of a single energy deposition into the target. All strains were found to be moderately resistant to radiation with D-6 values (dose required to reduce survival to 6 log cycles) between 18 and 26 kGy. All of the isolated Gram positive cocci showed inactivation curves having a shoulder, indicating that different processes are involved in the inactivation of these cells, e.g. accumulation of sublethal lesions, or final repair capacity of potential lethal lesions. Moderate radiation resistance was observed in 13 strains with D-6 values between 16 to 30 kGy. Two slow-growing, red pigmented strains tentatively classified as genus Micrococcus isolated from uncontrolled sites (human dwellings) were exceptionally resistant with D-6 more than 45 kGy. For hygienically controlled sites, Gram positive spereforming rods composed two thirds of the resistant microflora, while Gram positive cocci comprised one third. For hygienically uncontrolled sites this ratio was reversed. An assumption is made that one isolated strain has grown up from one CFU in the original microflora. In the light of the observed proportion of radiation resistant bacteria in microflora from hygienically controlled radiation sterilization processing environments, and assuming an initial contamination of 50 CFU per product unit, there is no more than one chance of a contaminated item remaining within a population of 10 7 items subjected to sterilization by exposure to a radiation dose of 25 kGy.

Crystal structure of heterodimeric hexaprenyl diphosphate synthase from Micrococcus luteus B-P 26 reveals that the small subunit is directly involved in the product chain length regulation.

PubMed

Sasaki, Daisuke; Fujihashi, Masahiro; Okuyama, Naomi; Kobayashi, Yukiko; Noike, Motoyoshi; Koyama, Tanetoshi; Miki, Kunio

2011-02-04

Hexaprenyl diphosphate synthase from Micrococcus luteus B-P 26 (Ml-HexPPs) is a heterooligomeric type trans-prenyltransferase catalyzing consecutive head-to-tail condensations of three molecules of isopentenyl diphosphates (C(5)) on a farnesyl diphosphate (FPP; C(15)) to form an (all-E) hexaprenyl diphosphate (HexPP; C(30)). Ml-HexPPs is known to function as a heterodimer of two different subunits, small and large subunits called HexA and HexB, respectively. Compared with homooligomeric trans-prenyltransferases, the molecular mechanism of heterooligomeric trans-prenyltransferases is not yet clearly understood, particularly with respect to the role of the small subunits lacking the catalytic motifs conserved in most known trans-prenyltransferases. We have determined the crystal structure of Ml-HexPPs both in the substrate-free form and in complex with 7,11-dimethyl-2,6,10-dodecatrien-1-yl diphosphate ammonium salt (3-DesMe-FPP), an analog of FPP. The structure of HexB is composed of mostly antiparallel α-helices joined by connecting loops. Two aspartate-rich motifs (designated the first and second aspartate-rich motifs) and the other characteristic motifs in HexB are located around the diphosphate part of 3-DesMe-FPP. Despite the very low amino acid sequence identity and the distinct polypeptide chain lengths between HexA and HexB, the structure of HexA is quite similar to that of HexB. The aliphatic tail of 3-DesMe-FPP is accommodated in a large hydrophobic cleft starting from HexB and penetrating to the inside of HexA. These structural features suggest that HexB catalyzes the condensation reactions and that HexA is directly involved in the product chain length control in cooperation with HexB.

Antimicrobial Activity and Phytochemical Screening of Buchenavia tetraphylla (Aubl.) R. A. Howard (Combretaceae: Combretoideae)

PubMed Central

de Oliveira, Ygor Lucena Cabral; Nascimento da Silva, Luís Cláudio; da Silva, Alexandre Gomes; Macedo, Alexandre José; de Araújo, Janete Magali; Correia, Maria Tereza dos Santos; da Silva, Márcia Vanusa

2012-01-01

This study evaluated the antimicrobial and hemolytic activities and phytochemical constituents of hydroalcoholic extract and its fractions from Buchenavia tetraphylla leaves. Cyclohexane (BTCF), ethyl acetate (BTEF), and n-butanol-soluble (BTSBF) and non-soluble (BTNBF) fractions were obtained from a liquid-liquid partition of hydroalcoholic extract (BTHE) from B. tetraphylla leaves. The hemolytic activity of active fractions was checked. The BTHE inhibited the growth of Micrococcus luteus (MIC: 0.10 mg/mL), Pseudomonas aeruginosa (MIC: 0.20 mg/mL), Mycobacterium smegmatis (MIC: 0.39 mg/mL), Proteus vulgaris, and Staphylococcus aureus (MIC: 0.78 mg/mL for both). The more active fractions were BTCF and BTBSF. BTCF showed better potential to inhibit M. luteus (0.10 mg/mL), P. aeruginosa (0.20 mg/mL), S. enteritidis (0.39 mg/mL), and S. aureus (1.56 mg/mL). BTBSF showed the best results for M. luteus (0.10 mg/mL), M. smegmatis, B. subtilis (0.39 mg/mL for both), and P. vulgaris (0.10 mg/mL). The HC50 were greater than observed MIC: 20.30, 4.70 and 2.53 mg/mL, respectively, to BTBF, BTHE and BTCF, which. The phytochemical analysis detected the presence of flavanoids, triterpene, carbohydrate, and tannin. Our work showed for the first time the broad-spread antimicrobial activity of B. tetraphylla, which has nonhemolytic action, creating a new perspective on the interesting association of traditional and scientific knowledge. PMID:23365533

Composition of Asarum heterotropoides var. mandshuricum radix oil from different extraction methods and activities against human body odor-producing bacteria.

PubMed

Haque, A S M Tanbirul; Moon, Jin Nam; Saravana, P S; Tilahun, Adane; Chun, Byung-Soo

2016-10-01

In this study, oils from Asarum heterotropoides were extracted by traditional solvent extraction and supercritical CO 2 (SC-CO 2 ) extraction methods and their antioxidant activities along with antimicrobial and inhibitory activities against five human body odor-producing bacteria (Staphylococcus epidermidis, Propionibacterium freudenreichii, Micrococcus luteus, Corynebacterium jeikeium, and Corynebacterium xerosis) were evaluated. The oil was found to contain 15 components, among which the most abundant component was methyl eugenol (37.6%), which was identified at every condition studied in different extraction methods. The oil extracted with n-hexane and ethanol mixture exhibited a strong antioxidant activity (92% ± 2%) and the highest ABTS and 2,2-diphenyl-1-picrylhydrazyl scavenging activities (89% ± 0.2%). The highest amounts of total phenolic content and total flavonoid content were 23.1±0.4 mg/g and 4.9±0.1 mg/g, respectively, in the traditional method. In the SC-CO 2 method performed at 200 bar/50°C using ethanol as an entrainer, the highest inhibition zone was recorded against all the aforementioned bacteria. In particular, strong antibacterial activity (38±2 mm) was found against M. luteus. The minimum inhibitory concentration (MIC) for the oil against bacteria ranged from 10.1±0.1 μg/mL to 46±2 μg/mL. The lowest MIC was found against M. luteus. Methyl eugenol was found to be one of the major compounds working against human body odor-producing bacteria. Copyright © 2016. Published by Elsevier B.V.

Bacterial Coaggregation and Cohesion Among Isolates From Contact Lens Cases.

PubMed

Datta, Ananya; Stapleton, Fiona; Willcox, Mark D P

2018-06-01

The aim of this study was to examine cohesion, coaggregation, and coculture between bacteria commonly isolated from contact lens cases. Staphylococcus epidermidis, Staphylococcus haemolyticus, Micrococcus luteus, and Acinetobacter radioresistens (two strains each) isolated from contact lens cases of two asymptomatic wearers were used in this study. In the cohesion assay, bacteria were grown, washed, and examined by incubating lens cases with two different types of bacteria sequentially and assessing the number of adhered cells of each isolate. The ability of isolates to interfere with the growth of other isolates was tested by growing strains in cocultures for 24 hours and determining the numbers of cells of individual strains. For coaggregation, equal proportions of two bacterial suspensions were mixed and allowed to coaggregate for 24 hours. Inhibition of coaggregation was tested by the addition of lactose (0.06 M) or sucrose (0.06 M) or pronase. The initial adhesion of M. luteus or A. radioresistens significantly (P < 0.05) enhanced the subsequent adhesion of the staphylococci. The addition of A. radioresistens in liquid media significantly (P < 0.05) enhanced the growth of staphylococci. S. epidermidis or S. haemolyticus coaggregated with M. luteus or A. radioresistens. The degree of coaggregation varied between 30% and 54%. The highest coaggregation (54% ± 5%) was seen between A. radioresistens 22-1 and S. epidermidis 22-1, isolated from the same lens case. Only lactose or sucrose treatment of staphylococci could partly inhibit coaggregation of some pairs. Coaggregation, cohesion, and growth promotion may facilitate the process of bacterial colonization of contact lens cases.

Culturable bacteria present in the fluid of the hooded-pitcher plant Sarracenia minor based on 16S rDNA gene sequence data.

PubMed

Siragusa, Alex J; Swenson, Janice E; Casamatta, Dale A

2007-08-01

The culturable microbial community within the pitcher fluid of 93 Sarracenia minor carnivorous plants was examined over a 2-year study. Many aspects of the plant/bacterial/insect interaction within the pitcher fluid are minimally understood because the bacterial taxa present in these pitchers have not been identified. Thirteen isolates were characterized by 16S rDNA sequencing and subsequent phylogenetic analysis. The Proteobacteria were the most abundant taxa and included representatives from Serratia, Achromobacter, and Pantoea. The Actinobacteria Micrococcus was also abundant while Bacillus, Lactococcus, Chryseobacterium, and Rhodococcus were infrequently encountered. Several isolates conformed to species identifiers (>98% rDNA gene sequence similarity) including Serratia marcescens (isolates found in 27.5% of pitchers), Achromobacter xylosoxidans (37.6%), Micrococcus luteus (40.9%), Bacillus cereus (isolates found in 10.2%), Bacillus thuringiensis (5.4%), Lactococcus lactis (17.2%), and Rhodococcus equi (2.2%). Species-area curves suggest that sampling efforts were sufficient to recover a representative culturable bacterial community. The bacteria present represent a diverse community probably as a result of introduction by insect vectors, but the ecological significance remains under explored.

[Bacterial flora of the conjunctival sac of the horse].

PubMed

Cattabiani, F; Cabassi, E; Allodi, C; Gianelli, F

1976-01-01

The AA. report the results of taxonomic research conducted on the conjunctival sac of 59 horses for identification of the present bacterial flora. In the controlled animals, it was observed, at the level of the considered niche, a community constituted of normal bacterial populations, but not autochtonous in the significance they attributed from DUBOS et al., relative to the characterization of the indigenous microbiota of the intestine. The isolated normal bacterial flora seems to be constituted of: Micrococcus (subgroup 6 of Baird-Parker, M. luteus, Micrococcus spp.) isolated in 49,15% of the samples; Staphylococcus aureus and St. epidermidis (18,64%); Moraxella osloensis, M. phenylpiruvica, M. equi and Moraxella spp. (11,86%); Bacillus cereus (11,86%); Neisseria catarrhalis (8,47%); Streptococcus equi and Str. zooepidemicus (6,77%); Corynebacterium spp. (6,77%) and Acinetobacter lwoffi (5,08%). The AA. have found, besides, a particular group of bacteria of uncertain classification, attributed to the coryneforms and found in 30,50% of the examined horses. So-called transient bacteria taxa have been considered are Streptomyces spp., isolated in the 10,16% of the controlled subjects, Aerococcus viridans and Bacillus spp. found in only one equine.

Gram-positive, catalase-positive cocci from dry cured Iberian ham and their enterotoxigenic potential.

PubMed Central

Rodríguez, M; Núñez, F; Córdoba, J J; Bermúdez, E; Asensio, M A

1996-01-01

Iberian ham is an uncooked, cured meat product ripened under natural uncontrolled conditions for 18 to 24 months. Gram-positive, catalase-positive cocci are the main microbial population in Iberian ham for most of the ripening time. Since some of these organisms are able to produce enterotoxins, adequate characterization and toxicological study are needed. For this, 1,327 gram-positive, catalase-positive cocci, isolated from Iberian hams at different stages and locations, were characterized by physiological and biochemical tests. Selected isolates were further characterized by guanine-cytosine (G+C) content and restriction enzyme analysis of genes coding for 16S rRNA. The toxigenic potential of these organisms was tested with specific DNA gene probes for staphylococcal enterotoxins A, B, C, and D and confirmed by semiquantitative sandwich enzyme immunoassay. The majority of the isolates were identified as Staphylococcus spp. and Micrococcus spp. Non-identified gram-positive, catalase-positive cocci which were moderately halophilic and showed a 42 to 52% G+C content were detected. A great variety of staphylococcal strains were found within the different species at any sampling time. Two strains of Staphylococcus xylosus, one Staphylococcus cohnii strain, and four of the non-identified organisms with 42 to 52% G+C contents hybridized with some of the DNA probes for C and D staphylococcal enterotoxin genes. S. xylosus hybridizing with C-enterotoxin probe reacted with both C and D enterotoxins in the immunological test. In addition, enterotoxin D was confirmed in the nonidentified strains. Some toxigenic organisms were isolated from the final product, posing a health hazard for the consumer. PMID:8787389

Comprehensive update of dalbavancin activity when tested against uncommonly isolated streptococci, Corynebacterium spp., Listeria monocytogenes, and Micrococcus spp. (1357 strains).

PubMed

Jones, Ronald N; Stilwell, Matthew G

2013-06-01

Dalbavancin is an investigational lipoglycopeptide having an extended serum elimination half-life allowing once-weekly dosing. Data from testing 1357 strains of uncommonly isolated species expand the dalbavancin spectrum details as follows (MIC50/90): β-haemolytic streptococcal serogroups C, F, and G (≤0.03/≤0.03 μg/mL), 7 viridans group of streptococci (≤0.03/≤0.03-0.06 μg/mL), 5 Corynebacterium spp. (0.06/0.12 μg/mL), Listeria monocytogenes (0.06/0.12 μg/mL), and Micrococcus spp. (≤0.03/≤0.03 μg/mL). Among all reported isolates, 99.8% of tested strains were inhibited at dalbavancin MIC values at ≤0.12 μg/mL. Dalbavancin remains very potent against rarer Gram-positive pathogens, using in vitro test experience with organisms cultured through 2011. Copyright © 2013 Elsevier Inc. All rights reserved.

A novel antibacterial and antifungal phenolic compound from the endophytic fungus Pestalotiopsis mangiferae.

PubMed

Subban, Kamalraj; Subramani, Ramesh; Johnpaul, Muthumary

2013-01-01

A novel phenolic compound, 4-(2,4,7-trioxa-bicyclo[4.1.0]heptan-3-yl) phenol (1), was isolated from Pestalotiopsis mangiferae, an endophytic fungus associated with Mangifera indica Linn. The structure of the compound was elucidated on the basis of comprehensive spectral analysis (UV, IR, ¹H-, ¹³C- and 2D-NMR, as well as HRESI-MS). Compound (1) shows potent antibacterial and antifungal activity against Bacillus subtilis, Klebsiella pneumoniae, Escherichia coli, Micrococcus luteus, Pseudomonas aeruginosa and Candida albicans. The transmission electron microscope study for the mode of inhibition of compound (1) on bacterial pathogens revealed the destruction of bacterial cells by cytoplasm agglutination with the formation of pores in cell wall membranes.

Analytical detection and biological assay of antileukemic drug 5-fluorouracil using gold nanoparticles as probe.

PubMed

Selvaraj, Vaithilingam; Alagar, Muthukaruppan

2007-06-07

Gold nanoparticles are reported and evaluated as probes for the detection of anticancer drug 5-fluorouracil (5FU). The nature of binding between 5FU and gold nanoparticles via complexation is investigated using ultraviolet visible spectrophotometry, cyclic voltammetry, transmission electron microscopy, fluorescence and Fourier transform infrared (FTIR) spectroscopy. The bound antileukemic drug is fluorescent and the quenching property of gold nanoparticles could be exploited for biological investigations. The 5FU-colloidal gold complex (Au@5FU) is observed to have appreciable antibacterial and antifungal activity against Micrococcus luteus, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Aspergillus fumigatus, and Aspergillus niger. The experimental studies suggest that gold nanoparticles have the potential to be used as effective carriers for anticancer drugs.

Recovery and screening for antibiotic susceptibility of potential bacterial pathogens from the oral cavity of shark species involved in attacks on humans in Recife, Brazil.

PubMed

Interaminense, J A; Nascimento, D C O; Ventura, R F; Batista, J E C; Souza, M M C; Hazin, F H V; Pontes-Filho, N T; Lima-Filho, J V

2010-08-01

The number of incidents involving sharks and humans at beaches in Recife, on the north-eastern Brazilian coast, is among the highest worldwide. In addition, wound infections in survivors are common; but the nature and risk of the aetiological agents is unknown. In the present study, 81 potential bacterial pathogens were identified in the oral cavity of sharks involved in attacks in Recife, and were subjected to antibiotic susceptibility tests using the standardized disc-diffusion method. The majority were enterobacteria such as Enterobacter spp., Citrobacter spp., Proteus spp., Providencia alcalifaciens, Escherichia coli, Moellerella wisconcensis and Leclercia adecarboxylata. Other Gram-negative bacteria included Vibrio spp., Burkholderia cepacia, Acinetobacter spp. and Pseudomonas spp. In addition, coagulase-positive and coagulase-negative Staphylococcus spp., Enterococcus spp. and Micrococcus spp. were identified, besides Streptococcus spp. from the viridans group. Resistance was especially found in the Proteus mirabilis and Citrobacter freundii, and ranged from 4 to 6 antibiotics out of the 13 tested. Gentamicin and vancomycin were the most effective against Gram-positive cocci strains, whereas levofloxacin was fully inhibitory against Gram-positive and Gram-negative bacteria. These data are discussed in light of a retrospective evaluation of the medical records of three shark victims treated at Restauração Hospital in Recife.

Multiplex Identification of Gram-Positive Bacteria and Resistance Determinants Directly from Positive Blood Culture Broths: Evaluation of an Automated Microarray-Based Nucleic Acid Test

PubMed Central

Buchan, Blake W.; Ginocchio, Christine C.; Manii, Ryhana; Cavagnolo, Robert; Pancholi, Preeti; Swyers, Lettie; Thomson, Richard B.; Anderson, Christopher; Kaul, Karen; Ledeboer, Nathan A.

2013-01-01

Background A multicenter study was conducted to evaluate the diagnostic accuracy (sensitivity and specificity) of the Verigene Gram-Positive Blood Culture Test (BC-GP) test to identify 12 Gram-positive bacterial gene targets and three genetic resistance determinants directly from positive blood culture broths containing Gram-positive bacteria. Methods and Findings 1,252 blood cultures containing Gram-positive bacteria were prospectively collected and tested at five clinical centers between April, 2011 and January, 2012. An additional 387 contrived blood cultures containing uncommon targets (e.g., Listeria spp., S. lugdunensis, vanB-positive Enterococci) were included to fully evaluate the performance of the BC-GP test. Sensitivity and specificity for the 12 specific genus or species targets identified by the BC-GP test ranged from 92.6%–100% and 95.4%–100%, respectively. Identification of the mecA gene in 599 cultures containing S. aureus or S. epidermidis was 98.6% sensitive and 94.3% specific compared to cefoxitin disk method. Identification of the vanA gene in 81 cultures containing Enterococcus faecium or E. faecalis was 100% sensitive and specific. Approximately 7.5% (87/1,157) of single-organism cultures contained Gram-positive bacteria not present on the BC-GP test panel. In 95 cultures containing multiple organisms the BC-GP test was in 71.6% (68/95) agreement with culture results. Retrospective analysis of 107 separate blood cultures demonstrated that identification of methicillin resistant S. aureus and vancomycin resistant Enterococcus spp. was completed an average of 41.8 to 42.4 h earlier using the BC-GP test compared to routine culture methods. The BC-GP test was unable to assign mecA to a specific organism in cultures containing more than one Staphylococcus isolate and does not identify common blood culture contaminants such as Micrococcus, Corynebacterium, and Bacillus. Conclusions The BC-GP test is a multiplex test capable of detecting most leading causes of Gram-positive bacterial blood stream infections as well as genetic markers of methicillin and vancomycin resistance directly from positive blood cultures. Please see later in the article for the Editors' Summary PMID:23843749

Functional gene-based discovery of phenazines from the actinobacteria associated with marine sponges in the South China Sea.

PubMed

Karuppiah, Valliappan; Li, Yingxin; Sun, Wei; Feng, Guofang; Li, Zhiyong

2015-07-01

Phenazines represent a large group of nitrogen-containing heterocyclic compounds produced by the diverse group of bacteria including actinobacteria. In this study, a total of 197 actinobacterial strains were isolated from seven different marine sponge species in the South China Sea using five different culture media. Eighty-seven morphologically different actinobacterial strains were selected and grouped into 13 genera, including Actinoalloteichus, Kocuria, Micrococcus, Micromonospora, Mycobacterium, Nocardiopsis, Prauserella, Rhodococcus, Saccharopolyspora, Salinispora, Serinicoccus, and Streptomyces by the phylogenetic analysis of 16S rRNA gene. Based on the screening of phzE genes, ten strains, including five Streptomyces, two Nocardiopsis, one Salinispora, one Micrococcus, and one Serinicoccus were found to be potential for phenazine production. The level of phzE gene expression was highly expressed in Nocardiopsis sp. 13-33-15, 13-12-13, and Serinicoccus sp. 13-12-4 on the fifth day of fermentation. Finally, 1,6-dihydroxy phenazine (1) from Nocardiopsis sp. 13-33-15 and 13-12-13, and 1,6-dimethoxy phenazine (2) from Nocardiopsis sp. 13-33-15 were isolated and identified successfully based on ESI-MS and NMR analysis. The compounds 1 and 2 showed antibacterial activity against Bacillus mycoides SJ14, Staphylococcus aureus SJ51, Escherichia coli SJ42, and Micrococcus luteus SJ47. This study suggests that the integrated approach of gene screening and chemical analysis is an effective strategy to find the target compounds and lays the basis for the production of phenazine from the sponge-associated actinobacteria.

Antioxidant and antimicrobial potentials of Serbian red wines produced from international Vitis vinifera grape varieties.

PubMed

Radovanović, Aleksandra N; Jovančićević, Branimir S; Radovanović, Blaga C; Mihajilov-Krstev, Tatjana; Zvezdanović, Jelena B

2012-08-15

Antioxidant and antimicrobial potentials of Serbian red wines produced from different international Vitis vinifera grape varieties and their correlation with contents of phenolic compounds were studied by spectrophotometric and chromatographic methods. The antioxidant activity of red wines was estimated through their ability to scavenge 2,2'-diphenyl-1-picrylhydrazyl free radical (DPPH(•) ). The red wines, gallic acid, (+)-catechin and quercetin were screened in vitro for antimicrobial activity against Gram-positive and Gram-negative strains using microdilution and disc diffusion techniques. Excellent correlations between the contents of quercetin-3-glucoside (R(2) = 0.9463) and quercetin (R(2) = 0.9337) and DPPH(•) -scavenging ability of the red wines were found. Serbian red wines exhibited significant activity against Staphylococcus aureus, Listeria inocua, Micrococcus flavus, Sarcina lutea, Bacillus subtilis, Escherichia coli, Pseudomonas aeruginosa, Salmonella enteritidis and Shigella sonnei strains, which was in correlation with their phenolic composition and antioxidant activity. The compounds gallic acid, quercetin and (+)-catechin showed high activity against B. subtilis, S. aureus, S. lutea and M. flavus Gram-positive and S. enteritidis and P. aeruginosa Gram-negative strains. The results show that quercetin-3-glucoside and quercetin concentrations can be used as markers for the determination of antioxidant and antimicrobial potentials of red wines. Copyright © 2012 Society of Chemical Industry.

The influence of bacteria-dominated diets on Daphnia magna somatic growth, reproduction, and lipid composition.

PubMed

Taipale, Sami J; Brett, Michael T; Pulkkinen, Katja; Kainz, Martin J

2012-10-01

We explored how dietary bacteria affect the life history traits and biochemical composition of Daphnia magna, using three bacteria taxa with very different lipid composition. Our objectives were to (1) examine whether and how bacteria-dominated diets affect Daphnia survival, growth, and fecundity, (2) see whether bacteria-specific fatty acid (FA) biomarkers accrued in Daphnia lipids, and (3) explore the quantitative relationship between bacteria availability in Daphnia diets and the amounts of bacterial FA in their lipids. Daphnia were fed monospecific and mixed diets of heterotrophic (Micrococcus luteus) or methanotrophic bacteria (Methylomonas methanica and Methylosinus trichosporium) and two phytoplankton species (Cryptomonas ozolinii and Scenedesmus obliquus). Daphnia neonates fed pure bacteria diets died after 6-12 days and produced no viable offspring, whereas those fed pure phytoplankton diets had high survival, growth, and reproduction success. Daphnia fed a mixed diet with 80% M. luteus and 20% of either phytoplankton had high somatic growth, but low reproduction. Conversely, Daphnia fed mixed diets including 80% of either methane-oxidizing bacteria and 20% Cryptomonas had high reproduction rates, but low somatic growth. All Daphnia fed mixed bacteria and phytoplankton diets had strong evidence of both bacteria- and phytoplankton-specific FA biomarkers in their lipids. FA mixing model calculations indicated that Daphnia that received 80% of their carbon from bacteria assimilated 46 ± 25% of their FA from this source. A bacteria-phytoplankton gradient experiment showed a strong positive correlation between the proportions of the bacterial FA in the Daphnia and their diet, indicating that bacterial utilization can be traced in this keystone consumer using FA biomarkers. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Antibacterial activity and genotypic-phenotypic characteristics of bacteriocin-producing Bacillus subtilis KKU213: potential as a probiotic strain.

PubMed

Khochamit, Nalisa; Siripornadulsil, Surasak; Sukon, Peerapol; Siripornadulsil, Wilailak

2015-01-01

The antimicrobial activity and probiotic properties of Bacillus subtilis strain KKU213, isolated from local soil, were investigated. The cell-free supernatant (CFS) of a KKU213 culture containing crude bacteriocins exhibited inhibitory effects on Gram-positive bacteria, including Bacillus cereus, Listeria monocytogenes, Micrococcus luteus, and Staphylococcus aureus. The antibacterial activity of the CFS precipitated with 40% ammonium sulfate (AS) remained even after treatment at 60 and 100 °C, at pH 4 and 10 and with proteolytic enzymes, detergents and heavy metals. When analyzed by SDS-PAGE and overlaid with the indicator strains B. cereus and S. aureus, the 40% AS precipitate exhibited inhibitory activity on proteins smaller than 10 kDa. However, proteins larger than 25 kDa and smaller than 10 kDa were still observed on a native protein gel. Purified subtilosin A was prepared by Amberlite XAD-16 bead extraction and HPLC and analyzed by Nano-LC-QTOF-MS. Its molecular mass was found to be 3.4 kDa, and it retained its antibacterial activity. These results are consistent with the detection of the anti-listerial subtilosin A gene of the sbo/alb cluster in the KKU213 strain, which is 100% identical to that of B. subtilis subsp. subtilis 168. In addition to stable and cyclic subtilosin A, a mixture of many extracellular antibacterial peptides was also detected in the KKU213 culture. The KKU213 strain produced extracellular amylase, cellulase, lipase and protease, is highly acid-resistant (pH 2) when cultured in inulin and promotes health and reduces infection of intestinally colonized broiler chickens. Therefore, we propose that bacteriocin-producing B. subtilis KKU213 could be used as a potential probiotic strain or protective culture. Copyright © 2014 Elsevier GmbH. All rights reserved.

Electromechanical and Elastic Probing of Bacteria in Cell Culture Medium

PubMed Central

Thompson, G.L.; Reukov, V.V.; Nikiforov, M.P.; Jesse, S.; Kalinin, S.V.; Vertegel, A.A.

2012-01-01

Rapid phenotype characterization and identification of cultured cells, which is needed for progress in tissue engineering and drug testing, requires an experimental technique that measures physical properties of cells with sub-micron resolution. Recently, band excitation piezoresponse force microscopy (BEPFM) has been proven useful for recognition and imaging of different types of bacteria in pure water. Here, the BEPFM method is performed for the first time in physiologically-relevant electrolyte media, such as Dulbecco’s phosphate-buffered saline (DPBS) and Dulbecco’s modified Eagle’s medium (DMEM). Distinct electromechanical responses for Micrococcus lysodeikticus (Gram-positive) and Pseudomonas fluorescens (Gram-negative) bacteria are demonstrated in DPBS. The results suggest that mechanical properties of the outer surface coating each bacterium, as well as the electrical double layer around them, are responsible for the BEPFM image formation mechanism in electrolyte media. PMID:22641388

Electromechanical and elastic probing of bacteria in a cell culture medium

NASA Astrophysics Data System (ADS)

Thompson, G. L.; Reukov, V. V.; Nikiforov, M. P.; Jesse, S.; Kalinin, S. V.; Vertegel, A. A.

2012-06-01

Rapid phenotype characterization and identification of cultured cells, which is needed for progress in tissue engineering and drug testing, requires an experimental technique that measures physical properties of cells with sub-micron resolution. Recently, band excitation piezoresponse force microscopy (BEPFM) has been proven useful for recognition and imaging of bacteria of different types in pure water. Here, the BEPFM method is performed for the first time on physiologically relevant electrolyte media, such as Dulbecco’s phosphate-buffered saline (DPBS) and Dulbecco’s modified Eagle’s medium (DMEM). Distinct electromechanical responses for Micrococcus lysodeikticus (Gram-positive) and Pseudomonas fluorescens (Gram-negative) bacteria in DPBS are demonstrated. The results suggest that mechanical properties of the outer surface coating each bacterium, as well as the electrical double layer around them, are responsible for the BEPFM image formation mechanism in electrolyte media.

Fungal Root Microbiome from Healthy and Brittle Leaf Diseased Date Palm Trees (Phoenix dactylifera L.) Reveals a Hidden Untapped Arsenal of Antibacterial and Broad Spectrum Antifungal Secondary Metabolites

PubMed Central

Mefteh, Fedia B.; Daoud, Amal; Chenari Bouket, Ali; Alenezi, Faizah N.; Luptakova, Lenka; Rateb, Mostafa E.; Kadri, Adel; Gharsallah, Neji; Belbahri, Lassaad

2017-01-01

In this study, we aimed to explore and compare the composition, metabolic diversity and antimicrobial potential of endophytic fungi colonizing internal tissues of healthy and brittle leaf diseased (BLD) date palm trees (Phoenix dactylifera L.) widely cultivated in arid zones of Tunisia. A total of 52 endophytic fungi were isolated from healthy and BLD roots of date palm trees, identified based on internal transcribed spacer-rDNA sequence analysis and shown to represent 13 species belonging to five genera. About 36.8% of isolates were shared between healthy and diseased root fungal microbiomes, whereas 18.4 and 44.7% of isolates were specific to healthy and BLD root fungal microbiomes, respectively. All isolates were able to produce at least two of the screened enzymes including amylase, cellulase, chitinase, pectinase, protease, laccase and lipase. A preliminary screening of the isolates using disk diffusion method for antibacterial activity against four Gram-positive and three Gram-negative bacteria and antifungal activities against three phytopathogenic fungi indicated that healthy and BLD root fungal microbiomes displayed interesting bioactivities against examined bacteria and broad spectrum bioactivity against fungal pathogens. Some of these endophytic fungi (17 isolates) were fermented and their extracts were evaluated for antimicrobial potential against bacterial and fungal isolates. Results revealed that fungal extracts exhibited antibacterial activities and were responsible for approximately half of antifungal activities against living fungi. These results suggest a strong link between fungal bioactivities and their secondary metabolite arsenal. EtOAc extracts of Geotrichum candidum and Thielaviopsis punctulata originating from BLD microbiome gave best results against Micrococcus luteus and Bacillus subtilis with minimum inhibitory concentration (MIC, 0.78 mg/mL) and minimum bactericidal concentration (6.25 mg/mL). G. candidum gave the best result against Rhizoctonia solani with MIC 0.78 mg/mL and minimum fungicidal concentration (MFC, 6.25 mg/mL). In conclusion, using plant microbiomes subjected to biotic stresses offers new endophytes with different bioactivities than those of healthy plants. Therefore, date palm endophytic fungi represent a hidden untapped arsenal of antibacterial and broad spectrum antifungal secondary metabolites and could be considered promising source of bioactive compounds with industrial and pharmaceutical applications. PMID:28293229

Chemical constituents of Helichrysum italicum (Roth) G. Don essential oil and their antimicrobial activity against Gram-positive and Gram-negative bacteria, filamentous fungi and Candida albicans.

PubMed

Djihane, Bouzid; Wafa, Nouioua; Elkhamssa, Soltani; Pedro, De Haro Juan; Maria, Angeles Esteban; Mohamed Mihoub, Zerroug

2017-07-01

The aerial parts of Helichrysum italicum (Roth) G. Don were subjected to hydrodistillation to obtain essential oils which had been analyzed by gas chromatography and gas chromatography coupled with mass spectrometry and tested for antimicrobial activity against 12 bacteria, two yeasts and four fungi by agar diffusion method. The essential oil yielded 0.44% (v/w) and 67 compounds accounting for 99.24% of the oil were identified with a high content of oxygenated sesquiterpenes (61.42%). The most oxygenated sesquiterpene compounds were α-Cedrene (13.61%), α-Curcumene (11.41%), Geranyl acetate (10.05%), Limonene (6.07%), Nerol (5.04%), Neryl acetate (4.91%) and α-Pinene (3.78%). The antimicrobial activity of the essential oil was assayed by using the disk diffusion method on Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 6538, Micrococcus luteus ATCC 4698, Klebsiella pneumonia ATCC 4352, Enterococcus cereus ATCC 2035, Bacillus cereus ATCC 10876, Staphylococcus epidermidis ATCC 12228, Bacillus subtilis ATCC 9372, Pseudomonas aeruginosa ATCC 27853, Enterococcus faecalis ATCC 49452, Proteus mirabilis ATCC 35659, Listeria monocytogenes ATCC 15313 and yeasts Candida albicans ATCC 10231, Saccharomyces cerevisiae ATCC 9763 and fungi, Fusarium solani var. coeruleum , Aspergillus niger , Alternaria alternata , Ascochyta rabiei . H. italicum inhibited the growth of all the tested microorganisms except three bacteria, E. coli ATCC 25922, K. pneumonia ATCC 4352 and L. monocytogenes ATCC 15313. The most sensitive bacterium was E. cereus ATCC 2035 with minimum inhibitory and bactericidal concentrations of 0.79 μg ml -1 . A minimum fungistatic and fungicide concentration of 6.325 μg ml -1 and 12.65 μg ml -1 respectively was obtained with C. albicans ATCC 10231 and S. cerevisiae ATCC 9763. However the four fungi were more resistant with fungistatic minimum concentration ranging from 6.325 μg ml -1 to 50.6 μg ml -1 and a fungicide minimum concentration of 50.6 μg ml -1 . This antimicrobial activity could be attributed to the essential oil chemical composition. Thus this study represents a first step in the study of the chemical composition of H. italicum (Roth) G. Don collected from north Algeria and its antimicrobial properties.

Fungal Root Microbiome from Healthy and Brittle Leaf Diseased Date Palm Trees (Phoenix dactylifera L.) Reveals a Hidden Untapped Arsenal of Antibacterial and Broad Spectrum Antifungal Secondary Metabolites.

PubMed

Mefteh, Fedia B; Daoud, Amal; Chenari Bouket, Ali; Alenezi, Faizah N; Luptakova, Lenka; Rateb, Mostafa E; Kadri, Adel; Gharsallah, Neji; Belbahri, Lassaad

2017-01-01

In this study, we aimed to explore and compare the composition, metabolic diversity and antimicrobial potential of endophytic fungi colonizing internal tissues of healthy and brittle leaf diseased (BLD) date palm trees ( Phoenix dactylifera L.) widely cultivated in arid zones of Tunisia. A total of 52 endophytic fungi were isolated from healthy and BLD roots of date palm trees, identified based on internal transcribed spacer-rDNA sequence analysis and shown to represent 13 species belonging to five genera. About 36.8% of isolates were shared between healthy and diseased root fungal microbiomes, whereas 18.4 and 44.7% of isolates were specific to healthy and BLD root fungal microbiomes, respectively. All isolates were able to produce at least two of the screened enzymes including amylase, cellulase, chitinase, pectinase, protease, laccase and lipase. A preliminary screening of the isolates using disk diffusion method for antibacterial activity against four Gram-positive and three Gram-negative bacteria and antifungal activities against three phytopathogenic fungi indicated that healthy and BLD root fungal microbiomes displayed interesting bioactivities against examined bacteria and broad spectrum bioactivity against fungal pathogens. Some of these endophytic fungi (17 isolates) were fermented and their extracts were evaluated for antimicrobial potential against bacterial and fungal isolates. Results revealed that fungal extracts exhibited antibacterial activities and were responsible for approximately half of antifungal activities against living fungi. These results suggest a strong link between fungal bioactivities and their secondary metabolite arsenal. EtOAc extracts of Geotrichum candidum and Thielaviopsis punctulata originating from BLD microbiome gave best results against Micrococcus luteus and Bacillus subtilis with minimum inhibitory concentration (MIC, 0.78 mg/mL) and minimum bactericidal concentration (6.25 mg/mL). G. candidum gave the best result against Rhizoctonia solani with MIC 0.78 mg/mL and minimum fungicidal concentration (MFC, 6.25 mg/mL). In conclusion, using plant microbiomes subjected to biotic stresses offers new endophytes with different bioactivities than those of healthy plants. Therefore, date palm endophytic fungi represent a hidden untapped arsenal of antibacterial and broad spectrum antifungal secondary metabolites and could be considered promising source of bioactive compounds with industrial and pharmaceutical applications.

Kocuria varians infection associated with brain abscess: a case report.

PubMed

Tsai, Cheng-Yu; Su, Shou-hsin; Cheng, Yu-Hsin; Chou, Yu-lin; Tsai, Tai-Hsin; Lieu, Ann-Shung

2010-04-27

Kocuria, established by Stackebrandt et al., previously was classified into Micrococcus. Only two species, K. rosea and K. kristinae are reported to be associated as pathogenic and found with catheter-related bacteremia and acute cholecystitis. We herein report the first case of brain abscess caused by Kocuria varians, a gram-positive microorganism, in a 52-year-old man. Hematogenous spread is the probable pathogenesis. This report presents a case of Kocuria varians brain abscess successfully treated with surgical excision combined with antimicrobial therapy. In addition, Vitek 2 system has been used to identify and differentiate between coagulase-negative staphylococcus.

Characterization of Catalase from Psychrotolerant Psychrobacter piscatorii T-3 Exhibiting High Catalase Activity

PubMed Central

Kimoto, Hideyuki; Yoshimune, Kazuaki; Matsuyma, Hidetoshi; Yumoto, Isao

2012-01-01

A psychrotolerant bacterium, strain T-3 (identified as Psychrobacter piscatorii), that exhibited an extraordinarily high catalase activity was isolated from the drain pool of a plant that uses H2O2 as a bleaching agent. Its cell extract exhibited a catalase activity (19,700 U·mg protein−1) that was higher than that of Micrococcus luteus used for industrial catalase production. Catalase was approximately 10% of the total proteins in the cell extract of the strain. The catalase (PktA) was purified homogeneously by only two purification steps, anion exchange and hydrophobic chromatographies. The purified catalase exhibited higher catalytic efficiency and higher sensitivity of activity at high temperatures than M. luteus catalase. The deduced amino acid sequence showed the highest homology with catalase of Psycrobacter cryohalolentis, a psychrotolelant bacterium obtained from Siberian permafrost. These findings suggest that the characteristics of the PktA molecule reflected the taxonomic relationship of the isolate as well as the environmental conditions (low temperatures and high concentrations of H2O2) under which the bacterium survives. Strain T-3 efficiently produces a catalase (PktA) at a higher rate than Exiguobacterium oxidotolerans, which produces a very strong activity of catalase (EktA) at a moderate rate, in order to adapt to high concentration of H2O2. PMID:22408420

Antimicrobial activity in the common seawhip, Leptogorgia virgulata (Cnidaria: Gorgonaceae).

PubMed

Shapo, Jacqueline L; Moeller, Peter D; Galloway, Sylvia B

2007-09-01

Antimicrobial activity was examined in the gorgonian Leptogorgia virgulata (common seawhip) from South Carolina waters. Extraction and assay protocols were developed to identify antimicrobial activity in crude extracts of L. virgulata. Detection was determined by liquid growth inhibition assays using Escherichia coli BL21, Vibrio harveyii, Micrococcus luteus, and a Bacillus sp. isolate. This represents the first report of antimicrobial activity in L. virgulata, a temperate/sub-tropical coral of the western Atlantic Ocean. Results from growth inhibition assays guided a fractionation scheme to identify active compounds. Reverse-phase HPLC, HPLC-mass spectrometry, and 1H and 13C NMR spectroscopy were used to isolate, purify, and characterize metabolites in antimicrobial fractions of L. virgulata. Corroborative HPLC-MS/NMR evidence validated the presence of homarine and a homarine analog, well-known emetic metabolites previously isolated from L. virgulata, in coral extracts. In subsequent assays, partially-purified L. virgulata fractions collected from HPLC-MS fractionation were shown to contain antimicrobial activity using M. luteus and V. harveyii. This study provides evidence that homarine is an active constituent of the innate immune system in L. virgulata. We speculate it may act synergistically with cofactors and/or congeners in this octocoral to mount a response to microbial invasion and disease.

Antimicrobial Air Filters Using Natural Euscaphis japonica Nanoparticles

PubMed Central

Yun, Ji Ho; Lee, Jung Eun; Lee, Hee Ju; Nho, Chu Won; Bae, Gwi- Nam; Jung, Jae Hee

2015-01-01

Controlling bioaerosols has become more important with increasing participation in indoor activities. Treatments using natural-product nanomaterials are a promising technique because of their relatively low toxicity compared to inorganic nanomaterials such as silver nanoparticles or carbon nanotubes. In this study, antimicrobial filters were fabricated from natural Euscaphis japonica nanoparticles, which were produced by nebulizing E. japonica extract. The coated filters were assessed in terms of pressure drop, antimicrobial activity, filtration efficiency, major chemical components, and cytotoxicity. Pressure drop and antimicrobial activity increased as a function of nanoparticle deposition time (590, 855, and 1150 µg/cm2filter at 3-, 6-, and 9-min depositions, respectively). In filter tests, the antimicrobial efficacy was greater against Staphylococcus epidermidis than Micrococcus luteus; ~61, ~73, and ~82% of M. luteus cells were inactivated on filters that had been coated for 3, 6, and 9 min, respectively, while the corresponding values were ~78, ~88, and ~94% with S. epidermidis. Although statistically significant differences in filtration performance were not observed between samples as a function of deposition time, the average filtration efficacy was slightly higher for S. epidermidis aerosols (~97%) than for M. luteus aerosols (~95%). High-performance liquid chromatography (HPLC) and electrospray ionization-tandem mass spectrometry (ESI/MS) analyses confirmed that the major chemical compounds in the E. japonica extract were 1(ß)-O-galloyl pedunculagin, quercetin-3-O-glucuronide, and kaempferol-3-O-glucoside. In vitro cytotoxicity and disk diffusion tests showed that E. japonica nanoparticles were less toxic and exhibited stronger antimicrobial activity toward some bacterial strains than a reference soluble nickel compound, which is classified as a human carcinogen. This study provides valuable information for the development of a bioaerosol control system that is environmental friendly and suitable for use in indoor environments. PMID:25974109

Degradable Polymer with Protein Resistance in a Marine Environment.

PubMed

Ma, Jielin; Ma, Chunfeng; Zhang, Guangzhao

2015-06-16

Protein resistance is the central issue in marine antibiofouling. We have prepared poly(ε-caprolactone) (PCL)-based polyurethane with 2-(dimethylamino) ethyl methacrylate (DEM) as pendant groups by a combination of the thiol-ene click reaction and the condensation reaction. By the use of quartz crystal microbalance with dissipation (QCM-D) and surface plasmon resonance (SPR), we have investigated the adsorption of fibrinogen, bovine serum albumin (BSA), and lysozyme on the polymer surface. The polymer exhibits protein resistance in seawater but not in fresh water because DEM pendant groups carry net neutral charges in the former. The evaluation of antibacterial adhesion of the polymer by using Micrococcus luteus demonstrates that the polymer can effectively inhibit the settlement of marine bacteria. Our studies also show that the polymer is degradable in marine environments.

Indoleacetic acid production and plant growth promoting potential of bacterial endophytes isolated from rice (Oryza sativa L.) seeds.

PubMed

Shahzad, Raheem; Waqas, Muhammad; Khan, Abdul Latif; Al-Hosni, Khadija; Kang, Sang-Mo; Seo, Chang-Woo; Lee, In-Jung

2017-06-01

Bacterial endophytes from the phyllosphere and rhizosphere have been used to produce bioactive metabolites and to promote plant growth. However, little is known about the endophytes residing in seeds. This study aimed to isolate and identify seed-borne bacterial endophytes from rice and elucidate their potential for phytohormone production and growth enhancement. The isolated endophytes included Micrococcus yunnanensis RWL-2, Micrococcus luteus RWL-3, Enterobacter soli RWL-4, Leclercia adecarboxylata RWL-5, Pantoea dispersa RWL-6, and Staphylococcus epidermidis RWL-7, which were identified using 16S rRNA sequencing and phylogenetic analysis. These strains were analyzed for indoleacetic acid (IAA) production by using GC-MS and IAA was found in the range of 11.50 ± 0.77 μg ml -1 to 38.80 ± 1.35 μg ml -1 . We also assessed the strains for plant growth promoting potential because these isolates were able to produce IAA in pure culture. Most of the growth attributes of rice plants (shoot and root length, fresh and dry biomass, and chlorophyll content) were significantly increased by bacterial endophytes compared to the controls. These results show that IAA producing bacterial endophytes can improve hostplant growth traits and can be used as bio-fertilizers.

A CASE OF ACUTE ENDOCARDITIS CAUSED BY MICROCOCCUS ZYMOGENES (NOV. SPEC.), WITH A DESCRIPTION OF THE MICROORGANISM

PubMed Central

MacCallum, William G.; Hastings, Thomas W.

1899-01-01

From a case of acute endocarditis of the aortic and mitral valves with infarctions m the spleen and kidneys a micrococcus was twice isolated in pure culture from the blood during life and was demonstrated after death both microscopically and in pure culture in large numbers in the valvular vegetations, the infarctions and other parts. No other species of microorganism was found. This micrococcus is very small, occurs mainly in pairs, sometimes in short chains, stains by Gram's method, grows in small, pale, grayish-white colonies on gelatine and agar, at first clouds bouillon, which then becomes clear with a whitish sediment, does not produce gas in glucose media, liquefies gelatine slowly and to some extent also blood serum, and is especially characterized by its behavior in milk, which it acidifies, coagulates and subsequently liquefies. It produces a milk-curdling ferment and also a proteolytic ferment, each of which is separable from the bacterial cells. It remains viable for months in old cultures and is tolerably resistant to the action of heat and antiseptics. The micrococcus is pathogenic for mice and rabbits, causing either abscesses or general infections. Typical acute vegetative endocarditis was experimentally produced by intravenous inoculation of the organism in a rabbit and a dog, and the cocci were demonstrated in pure culture in the vegetations and other parts of these animals after death. Although the micrococcus here described has some points of resemblance to the pneumococcus and Streptococcus pyogenes on the one hand and to the pyogenic staphylococci on the other, it is readily distinguished from each of these species by cultural features which have been described and which are so obvious that the differentiation of these species from our micrococcus need not be discussed in detail. We have searched through the records concerning microorganisms described in association with endocarditis and other diseases, as well as those isolated from water, soil and other sources, and have been unable to find a description of a micrococcus identical in all particulars with that here described. Such points as staining by Gram, liquefaction of gelatine, coagulation and peptonization of milk, served singly or in combination to distinguish our micrococcus from other forms which in some respects might resemble it. We feel justified, therefore, in recognizing this organism as a new species and from its fermentative properties propose for it the name "Micrococcus zymogenes." Micrococcus zymogenes must be added to the already considerable list of bacteria which have been found as the specific infective agents in endocarditis. That it was the cause of this affection in our case was conclusively demonstrated by its repeated isolation in pure culture from the blood during life, by its presence in pure culture and large numbers after death in the cardiac vegetations, the infarctions, and other parts of the body, and by the experimental proof of its pathogenic properties, and notably its capacity to produce vegetative endocarditis by intravenous inoculation in animals. PMID:19866921

A CASE OF ACUTE ENDOCARDITIS CAUSED BY MICROCOCCUS ZYMOGENES (NOV. SPEC.), WITH A DESCRIPTION OF THE MICROORGANISM.

PubMed

Maccallum, W G; Hastings, T W

1899-09-01

From a case of acute endocarditis of the aortic and mitral valves with infarctions m the spleen and kidneys a micrococcus was twice isolated in pure culture from the blood during life and was demonstrated after death both microscopically and in pure culture in large numbers in the valvular vegetations, the infarctions and other parts. No other species of microorganism was found. This micrococcus is very small, occurs mainly in pairs, sometimes in short chains, stains by Gram's method, grows in small, pale, grayish-white colonies on gelatine and agar, at first clouds bouillon, which then becomes clear with a whitish sediment, does not produce gas in glucose media, liquefies gelatine slowly and to some extent also blood serum, and is especially characterized by its behavior in milk, which it acidifies, coagulates and subsequently liquefies. It produces a milk-curdling ferment and also a proteolytic ferment, each of which is separable from the bacterial cells. It remains viable for months in old cultures and is tolerably resistant to the action of heat and antiseptics. The micrococcus is pathogenic for mice and rabbits, causing either abscesses or general infections. Typical acute vegetative endocarditis was experimentally produced by intravenous inoculation of the organism in a rabbit and a dog, and the cocci were demonstrated in pure culture in the vegetations and other parts of these animals after death. Although the micrococcus here described has some points of resemblance to the pneumococcus and Streptococcus pyogenes on the one hand and to the pyogenic staphylococci on the other, it is readily distinguished from each of these species by cultural features which have been described and which are so obvious that the differentiation of these species from our micrococcus need not be discussed in detail. We have searched through the records concerning microorganisms described in association with endocarditis and other diseases, as well as those isolated from water, soil and other sources, and have been unable to find a description of a micrococcus identical in all particulars with that here described. Such points as staining by Gram, liquefaction of gelatine, coagulation and peptonization of milk, served singly or in combination to distinguish our micrococcus from other forms which in some respects might resemble it. We feel justified, therefore, in recognizing this organism as a new species and from its fermentative properties propose for it the name "Micrococcus zymogenes." Micrococcus zymogenes must be added to the already considerable list of bacteria which have been found as the specific infective agents in endocarditis. That it was the cause of this affection in our case was conclusively demonstrated by its repeated isolation in pure culture from the blood during life, by its presence in pure culture and large numbers after death in the cardiac vegetations, the infarctions, and other parts of the body, and by the experimental proof of its pathogenic properties, and notably its capacity to produce vegetative endocarditis by intravenous inoculation in animals.

Coral-Associated Actinobacteria: Diversity, Abundance, and Biotechnological Potentials

PubMed Central

Mahmoud, Huda M.; Kalendar, Aisha A.

2016-01-01

Marine Actinobacteria, particularly coral-associated Actinobacteria, have attracted attention recently. In this study, the abundance and diversity of Actinobacteria associated with three types of coral thriving in a thermally stressed coral reef system north of the Arabian Gulf were investigated. Coscinaraea columna, Platygyra daedalea and Porites harrisoni have been found to harbor equivalent numbers of culturable Actinobacteria in their tissues but not in their mucus. However, different culturable actinobacterial communities have been found to be associated with different coral hosts. Differences in the abundance and diversity of Actinobacteria were detected between the mucus and tissue of the same coral host. In addition, temporal and spatial variations in the abundance and diversity of the cultivable actinobacterial communities were detected. In total, 19 different actinobacterial genera, namely Micrococcus, Brachybacterium, Brevibacterium, Streptomyces, Micromonospora, Renibacterium, Nocardia, Microbacterium, Dietzia, Cellulomonas, Ornithinimicrobium, Rhodococcus, Agrococcus, Kineococcus, Dermacoccus, Devriesea, Kocuria, Marmoricola, and Arthrobacter, were isolated from the coral tissue and mucus samples. Furthermore, 82 isolates related to Micromonospora, Brachybacterium, Nocardia, Micrococcus, Arthrobacter, Rhodococcus, and Streptomyces showed antimicrobial activities against representative Gram-positive and/or Gram-negative bacteria. Even though Brevibacterium and Kocuria were the most dominant actinobacterial isolates, they failed to show any antimicrobial activity, whereas less dominant genera, such as Streptomyces, did show antimicrobial activity. Focusing on the diversity of coral-associated Actinobacteria may help to understand how corals thrive under harsh environmental conditions and may lead to the discovery of novel antimicrobial metabolites with potential biotechnological applications. PMID:26973601

Characterization of Staphylococcus spp. and Micrococcus spp. isolated from Iberian ham throughout the ripening process.

PubMed

Rodríguez, M; Núñez, F; Córdoba, J J; Sanabria, C; Bermúdez, E; Asensio, M A

1994-12-01

The Iberian dry cured ham is an uncooked meat product highly appreciated because of its characteristic flavour. This product is obtained from highly marbled Iberian pig hindlegs after 18-24 months of maturation under natural environmental conditions. The role of Micrococcaceae in the development of the aroma characteristics of this products remains unclear. Identification of Gram-positive, catalase-positive cocci isolated from Mannitol Salt Agar plates showed that Staphylococcus xylosus followed by Staphylococcus equorum are the predominant organisms, even after 16 months of maturing. A remarkable variety of types of both staphylococci and micrococci are detected at any sampling time. The metabolic activities of these organisms could contribute to the characteristics of the final product.

Diversity of Culturable Thermophilic Actinobacteria in Hot Springs in Tengchong, China and Studies of their Biosynthetic Gene Profiles.

PubMed

Liu, Lan; Salam, Nimaichand; Jiao, Jian-Yu; Jiang, Hong-Chen; Zhou, En-Min; Yin, Yi-Rui; Ming, Hong; Li, Wen-Jun

2016-07-01

The class Actinobacteria has been a goldmine for the discovery of antibiotics and has attracted interest from both academics and industries. However, an absence of novel approaches during the last few decades has limited the discovery of new microbial natural products useful for industries. Scientists are now focusing on the ecological aspects of diverse environments including unexplored or underexplored habitats and extreme environments in the search for new metabolites. This paper reports on the diversity of culturable actinobacteria associated with hot springs located in Tengchong County, Yunnan Province, southwestern China. A total of 58 thermophilic actinobacterial strains were isolated from the samples collected from ten hot springs distributed over three geothermal fields (e.g., Hehua, Rehai, and Ruidian). Phylogenetic positions and their biosynthetic profiles were analyzed by sequencing 16S rRNA gene and three biosynthetic gene clusters (KS domain of PKS-I, KSα domain of PKS-II and A domain of NRPS). On the basis of 16S rRNA gene phylogenetic analysis, the 58 strains were affiliated with 12 actinobacterial genera: Actinomadura Micromonospora, Microbispora, Micrococcus, Nocardiopsis, Nonomuraea, Promicromonospora, Pseudonocardia, Streptomyces, Thermoactinospora, Thermocatellispora, and Verrucosispora, of which the two novel genera Thermoactinospora and Thermocatellisopora were recently described from among these strains. Considering the biosynthetic potential of these actinobacterial strains, 22 were positive for PCR amplification of at least one of the three biosynthetic gene clusters (PKS-I, PKS-II, and NRPS). These actinobacteria were further subjected to antimicrobial assay against five opportunistic human pathogens (Acinetobacter baumannii, Escherichia coli, Micrococcus luteus, Staphylococcus aureus and Streptococcus faecalis). All of the 22 strains that were positive for PCR amplification of at least one of the biosynthetic gene domains exhibited antimicrobial activities against at least one of the five test organisms. Among the remaining 36 actinobacteria that are negative for PCR amplification of the domains for the biosynthetic genes, 33 strains showed antimicrobial activities against at least one of the five test pathogens. In summary, the findings presented in this study emphasized the importance of underexplored habitats such as Tengchong hot springs as potential sources for search of bioactive molecules.

Kocuria varians infection associated with brain abscess: A case report

PubMed Central

2010-01-01

Background Kocuria, established by Stackebrandt et al., previously was classified into Micrococcus. Only two species, K. rosea and K. kristinae are reported to be associated as pathogenic and found with catheter-related bacteremia and acute cholecystitis. Case presentation We herein report the first case of brain abscess caused by Kocuria varians, a gram-positive microorganism, in a 52-year-old man. Hematogenous spread is the probable pathogenesis. Conclusions This report presents a case of Kocuria varians brain abscess successfully treated with surgical excision combined with antimicrobial therapy. In addition, Vitek 2 system has been used to identify and differentiate between coagulase-negative staphylococcus. PMID:20423506

Antibacterial studies of novel Cu2WS4 ternary chalcogenide synthesized by hydrothermal process

NASA Astrophysics Data System (ADS)

Kannan, Selvaraj; Vinitha, Perumal; Mohanraj, Kannusamy; Sivakumar, Ganesan

2018-02-01

This is the first report for the synthesis of L-cysteine mediated Cu2WS4 nanoparticles for different temperatures by an inexpensive and less pollutive hydrothermal method. The as-synthesized particles were characterized by XRD, FTIR, FESEM, UV-vis diffuse reflectance and PL spectra technique respectively. The phase purity and structural confirmation were studied by X-ray powder diffraction technique. It is observed that the synthesis temperature affecting the crystalline size. The optical analysis of the Cu2WS4 nanoparticles showed direct band gap in the range of 2.1-2.3 eV. The intensity of the PL emission spectra decreases with increase of reaction temperature. The antibacterial performance of Cu2WS4 nanoparticles were investigated by agar well diffusion method and the results confirm that the antibacterial activity of Cu2WS4 against Gram-positive (B. subtilis, M. luteus) and Gram-negative (E. coli, P. aeruginosa and K. pneumoniae) bacteria.

Evaluation of the Nanosphere Verigene Gram-Positive Blood Culture Assay with the VersaTREK Blood Culture System and Assessment of Possible Impact on Selected Patients

PubMed Central

Beal, Stacy G.; Ciurca, Jane; Smith, Geremy; John, Jeffrey; Lee, Francesca; Doern, Christopher D.

2013-01-01

The Verigene Gram-positive blood culture (BC-GP) assay (Nanosphere, Northbrook, IL) is a molecular method for the rapid identification of Gram-positive organisms and resistance markers directly from blood culture bottles. A total of 148 VersaTREK REDOX 1 40-ml aerobic bottles demonstrating Gram-positive bacteria were tested. Results were compared with those from conventional biochemical and matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) identifications. We obtained isolates of methicillin-resistant Staphylococcus aureus (MRSA) (24), methicillin-susceptible Staphylococcus aureus (MSSA) (14), methicillin-resistant Staphylococcus epidermidis (MRSE) (17), methicillin-susceptible Staphylococcus epidermidis (MSSE) (9), other coagulase-negative staphylococci (19), Streptococcus salivarius (5), Streptococcus parasanguinis (2), Streptococcus sanguinis (1), Streptococcus cristatus (1), the Streptococcus bovis group (5), Streptococcus agalactiae (9), the Streptococcus anginosus group (1), Streptococcus pneumoniae (6), vancomycin-resistant Enterococcus faecium (VRE FCM) (16), vancomycin-susceptible Enterococcus faecalis (3), Aerococcus viridans (2), Bacillus (6), Corynebacterium (8), Lactobacillus (2), Micrococcus (2), Neisseria mucosa (1), Escherichia coli (3), Candida tropicalis (1), Propionibacterium (1), and Rothia (1). Overall agreement with the culture results was 95%. A total of 137 of 138 (99%) monomicrobial cultures were concordant. We tested 9 polymicrobial samples and found 33% agreement. A chart review of 31 patients with MRSA, MSSA, or VRE demonstrated that the Nanosphere BC-GP assay might have led to more appropriate antibiotic selection for these patients an average of 42 h earlier. Additionally, contact isolation could have been initiated an average of 37 h earlier for patients with MRSA or VRE. The BC-GP assay may have a positive impact on patient care, health care costs, and antibiotic stewardship. PMID:24048531

Microencapsulation, Chemical Characterization, and Antimicrobial Activity of Mexican (Lippia graveolens H.B.K.) and European (Origanum vulgare L.) Oregano Essential Oils

PubMed Central

Regalado-González, Carlos; Vázquez-Landaverde, Pedro; Guerrero-Legarreta, Isabel; García-Almendárez, Blanca E.

2014-01-01

The effect of solvent polarity (methanol and pentane) on the chemical composition of hydrodistilled essential oils (EO's) of Lippia graveolens H.B.K. (MXO) and Origanum vulgare L. (EUO) was studied by GC-MS. Composition of modified starch microencapsulated EO's was conducted by headspace-solid-phase microextraction (HS-SPME). The antimicrobial activity of free and microencapsulated EO's was evaluated. They were tested against Salmonella sp., Brochothrix thermosphacta, Pseudomonas fragi, Lactobacillus plantarum, and Micrococcus luteus. Thymol and carvacrol were among the main components of EO's and their free and microencapsulated inhibitory activity was tested against M. luteus, showing an additive combined effect. Chemical composition of EO's varied according to the solvent used for GC analysis and to volatile fraction as evaluated by HS-SPME. Thymol (both solvents) was the main component in essential oil of MXO, while carvacrol was the main component of the volatile fraction. EUO showed α-pinene (methanol) and γ-terpinene (pentane) as major constituents, the latter being the main component of the volatile fraction. EO's showed good stability after 3 months storage at 4°C, where antimicrobial activity of microencapsulated EO's remained the same, while free EO's decreased 41% (MXO) and 67% (EUO) from initial activity. Microencapsulation retains most antimicrobial activity and improves stability of EO's from oregano. PMID:25177730

Microencapsulation, chemical characterization, and antimicrobial activity of Mexican (Lippia graveolens H.B.K.) and European (Origanum vulgare L.) oregano essential oils.

PubMed

Hernández-Hernández, Elvia; Regalado-González, Carlos; Vázquez-Landaverde, Pedro; Guerrero-Legarreta, Isabel; García-Almendárez, Blanca E

2014-01-01

The effect of solvent polarity (methanol and pentane) on the chemical composition of hydrodistilled essential oils (EO's) of Lippia graveolens H.B.K. (MXO) and Origanum vulgare L. (EUO) was studied by GC-MS. Composition of modified starch microencapsulated EO's was conducted by headspace-solid-phase microextraction (HS-SPME). The antimicrobial activity of free and microencapsulated EO's was evaluated. They were tested against Salmonella sp., Brochothrix thermosphacta, Pseudomonas fragi, Lactobacillus plantarum, and Micrococcus luteus. Thymol and carvacrol were among the main components of EO's and their free and microencapsulated inhibitory activity was tested against M. luteus, showing an additive combined effect. Chemical composition of EO's varied according to the solvent used for GC analysis and to volatile fraction as evaluated by HS-SPME. Thymol (both solvents) was the main component in essential oil of MXO, while carvacrol was the main component of the volatile fraction. EUO showed α-pinene (methanol) and γ-terpinene (pentane) as major constituents, the latter being the main component of the volatile fraction. EO's showed good stability after 3 months storage at 4°C, where antimicrobial activity of microencapsulated EO's remained the same, while free EO's decreased 41% (MXO) and 67% (EUO) from initial activity. Microencapsulation retains most antimicrobial activity and improves stability of EO's from oregano.

Mode of action and safety of lactosporin, a novel antimicrobial protein produced by Bacillus coagulans ATCC 7050

PubMed Central

Riazi, Shadi; Dover, Sara E.; Chikindas, Michael L.

2012-01-01

Aims To determine the mechanism of action of antimicrobial protein, lactosporin, against Gardnerella vaginalis and to evaluate its safety in-vitro. Methods and Results Bacillus coagulans ATCC 7050 was grown at 37 °C for 18 hours. The cell free supernatant was concentrated 10-fold and screened for antimicrobial activity against indicator strain Micrococcus luteus. The mode of action of lactosporin was determined by measuring the potassium release and monitoring the changes in transmembrane potential (Δψ) and transmembrane pH (ΔpH) of the sensitive cells. Lactosporin caused efflux of potassium ions from M. luteus cells and dissipation of ΔpH in G. vaginalis while it had no effect on the Δψ. The safety of lactosporin was evaluated by using EpiVaginal™ ectocervical (VEC-100) tissue model. Over 80% of the cells in the vaginal tissue remained viable after exposure to lactosporin for 24 hours. Conclusions Lactosporin potentially exerts its antimicrobial activity by selective dissipation of ΔpH and/or by causing leakage of ions from the sensitive cells. Safety studies suggest that lactosporin is a non-cytotoxix antimicrobial for vaginal application. Significance and Impact of the Study This study revealed that lactosporin is an effective and safe antimicrobial preparation with potential application for control of bacterial vaginosis. PMID:22737982

Development of a simple and low cost microbioreactor for high-throughput bioprocessing.

PubMed

Rahman, Pattanathu K S M; Pasirayi, Godfrey; Auger, Vincent; Ali, Zulfiqur

2009-02-01

A simple microbioreactor for high-throughput bioprocessing made from low cost polymer polytetrafluoroethylene (PTFE) tubes with a working volume of 1.5 ml is described. We have developed a microfluidic system that handles a small population of cells of a model microorganism, Pseudomonas aeruginosa DS10-129. Under the conditions of the microbioreactor, the organism produced extracellular secondary metabolites by using nutrient broth modified with glycerol. Pyocyanins were isolated from the fermented medium as a metabolite of interest. Antibiotic properties of pyocyanin were effective against a number of microorganisms such as Staphylococcus aureus, S. epidermis, Bacillus subtilis, Micrococcus luteus and Saccharomyces cerevisiae. Batch fermentation of the model organism in the microbioreactor was compared to shake-flask and conventional bench fermenter methods. Results obtained from the microbioreactor compared favourably with the conventional processes.

Violacein-producing Collimonas sp. from the sea surface microlayer of costal waters in Trøndelag, Norway.

PubMed

Hakvåg, Sigrid; Fjaervik, Espen; Klinkenberg, Geir; Borgos, Sven Even F; Josefsen, Kjell D; Ellingsen, Trond E; Zotchev, Sergey B

2009-11-12

A new strain belonging to the genus Collimonas was isolated from the sea surface microlayer off the coast of Trøndelag, Norway. The bacterium, designated Collimonas CT, produced an antibacterial compound active against Micrococcus luteus. Subsequent studies using LC-MS identified this antibacterial compound as violacein, known to be produced by several marine-derived bacteria. Fragments of the violacein biosynthesis genes vioA and vioB were amplified by PCR from the Collimonas CT genome and sequenced. Phylogenetic analysis of these sequences demonstrated close relatedness of the Collimonas CT violacein biosynthetic gene cluster to those in Janthinobacterium lividum and Duganella sp., suggesting relatively recent horizontal gene transfer. Considering diverse biological activities of violacein, Collimonas CT shall be further studied as a potential producer of this compound.

Violacein-Producing Collimonas sp. from the Sea Surface Microlayer of Costal Waters in Trøndelag, Norway

PubMed Central

Hakvåg, Sigrid; Fjærvik, Espen; Klinkenberg, Geir; Borgos, Sven Even F.; Josefsen, Kjell D.; Ellingsen, Trond E.; Zotchev, Sergey B.

2009-01-01

A new strain belonging to the genus Collimonas was isolated from the sea surface microlayer off the coast of Trøndelag, Norway. The bacterium, designated Collimonas CT, produced an antibacterial compound active against Micrococcus luteus. Subsequent studies using LC-MS identified this antibacterial compound as violacein, known to be produced by several marine-derived bacteria. Fragments of the violacein biosynthesis genes vioA and vioB were amplified by PCR from the Collimonas CT genome and sequenced. Phylogenetic analysis of these sequences demonstrated close relatedness of the Collimonas CT violacein biosynthetic gene cluster to those in Janthinobacterium lividum and Duganella sp., suggesting relatively recent horizontal gene transfer. Considering diverse biological activities of violacein, Collimonas CT shall be further studied as a potential producer of this compound. PMID:20098599

Antibacterial properties of grapefruit seed extract against Paenibacillus larvae subsp. larvae.

PubMed

Semprini, P; Langella, V; Pasini, B; Falda, M T; Calvarese, S

2004-01-01

Twenty-one samples of grapefruit seed extract (GSE) either from marketed products or provided by an apiculturist were analysed to verify their inhibition activity, in particular against Paenibacillus larvae subsp. larvae, responsible for American foulbrood. The bactericide capacity of GSE has been measured in Bacillus subtilis BGA, Bacillus cereus 11778, Bacillus cereus K250 and Micrococcus luteus 9341a; these bacteria are normally used in the laboratory to study inhibitors. The results showed that not all GSE have the same inhibitory activity and two of those analysed do not inhibit the five bacteria used. Considering that 19 samples inhibited American foulbrood bacillus, the authors conclude that the use of a natural product (such as GSE) to control this important disease of bees, can be used as a substitute for chemotherapeutic products, after appropriate expedients.

Enzymatic synthesis of polymers containing nicotinamide mononucleotide

NASA Technical Reports Server (NTRS)

Liu, Rihe

1995-01-01

Nicotinamide mononucleoside 5'-diphosphate in its reduced form is an excellent substrate for polynucleotide phosphorylase from Micrococcus luteus both in de novo polymerization reactions and in primer extension reactions. The oxidized form of the diphosphate is a much less efficient substrate; it can be used to extend primers but does not oligomerize in the absence of a primer. The cyanide adduct of the oxidized substrate, like the reduced substrate, polymerizes efficiently. Loss of cyanide yields high molecular weight polymers of the oxidized form. Terminal transferase from calf thymus accepts nicotinamide mononucleoside 5'-triphosphate as a substrate and efficiently adds one residue to the 3'-end of an oligodeoxynucleotide. T4 polynucleotide kinase accepts oligomers of nicotinamide mononucleotide as substrates. However, RNA polymerases do not incorporate nicotinamide mononucleoside 5'-triphosphate into products on any of the templates that we used.

Enzymatic Synthesis of Polymers Containing Nicotinamide Mononucleotide

NASA Technical Reports Server (NTRS)

Liu, Rihe; Orgel, Leslie E.

1995-01-01

Nicotinamide mononucleoside 5'-diphosphate in its reduced form is an excellent substrate for polynucleotide phosphorylase from Micrococcus luteus both in de novo polymerization reactions and in primer extension reactions. The oxidized form of the diphosphate is a much less efficient substrate; it can be used to extend primers but does not oligomerize in the absence of a primer. The cyanide adduct of the oxidized substrate, like the reduced substrate, polymerizes efficiently. Loss of cyanide yields high molecular weight polymers of the oxidized form. Terminal transferase from calf thymus accepts nicotinamide mononucleoside 5'-triphosphate as a substrate and efficiently adds one residue to the 3'-end of an oligodeoxynucleotide. T4 polynucleotide kinase accepts oligomers of nicotinamide mononucleotide as substrates. However, RNA polymerases do not incorporate nicotinamide mononucleoside 5'-triphosphate into products on any of the templates that we used.

A novel green one-step synthesis of silver nanoparticles using chitosan: catalytic activity and antimicrobial studies

NASA Astrophysics Data System (ADS)

Venkatesham, Maragoni; Ayodhya, Dasari; Madhusudhan, Alle; Veera Babu, Nagati; Veerabhadram, Guttena

2014-01-01

Stable silver nanoparticles were synthesized using chitosan acting as both reducing and stabilizing agent without using any toxic chemicals. This reaction was carried out in an autoclave at a pressure of 15 psi and 120 °C temperature by varying the time. The influence of different parameters such as time, change of concentration of silver nitrate and concentration of chitosan on the formation of silver nanoparticles were studied. The synthesized silver nanoparticles were characterized by UV-visible spectroscopy, Fourier transform infrared, X-ray diffraction and transmission electron microscopy. The results of catalytic reduction of 4-nitrophenol by sodium borohydride in the presence of green synthesized silver nanoparticles were presented. The antimicrobial activity of silver nanoparticles was tested against Escherichia coli and Micrococcus luteus and was found to be possessing inhibiting property.

Immunochemical analysis of Micrococcus lysodeikticus (luteus) F1-ATPase and its subunits.

PubMed

Urban, C; Salton, M R

1983-08-31

The F1-ATPase from Micrococcus lysodeikticus has been purified to 95% protein homogeneity in this laboratory and as all other bacterial F1S, possesses five distinct subunits with molecular weights ranging from 60 000 to 10 000 (Huberman, M. and Salton, M.R.J. (1979) Biochim. Biophys. Acta 547, 230-240). In this communication, we demonstrate the immunochemical reactivities of antibodies to native and SDS-dissociated subunits with the native and dissociated F1-ATPase and show that: (1) the antibodies generated to the native or SDS-dissociated subunits react with the native molecule; (2) all of the subunits comprising the F1 are antigenically unique as determined by crossed immunoelectrophoresis and the Ouchterlony double-diffusion techniques; (3) antibodies to the SDS-denatured individual delta- and epsilon-subunits can be used to destabilize the interaction of these specific subunits with the rest of the native F1; and (4) all subunit antibodies as well as anti-native F1 were found to inhibit ATPase activity to varying degrees, the strongest inhibition being seen with antibodies to the total F1 and anti-alpha- and anti-beta-subunit antibodies. The interaction of specific subunit antibodies may provide a new and novel way to study further and characterize the catalytic portions of F1-ATPases and in general may offer an additional method for the examination of multimeric proteins.

Some biological activities of pigments extracted from Micrococcus roseus (PTCC 1411) and Rhodotorula glutinis (PTCC 5257).

PubMed

Rostami, Hossein; Hamedi, Hassan; Yolmeh, Mahmoud

2016-12-01

The importance of replacing synthetic pigments with natural types is increasing day by day in the food industry due to the harmful effects of some synthetic pigments. Microorganisms are a major source of natural pigments, which nowadays have attracted the attention of researchers. In this study, carotenoid pigments were produced by Micrococcus roseus and Rhodotorula glutinis, and some of their biological properties such as antimicrobial, antioxidant, anticancer, and anti-inflammatory activities were evaluated. Given the results, bacteria, especially gram-positive bacteria, had higher sensitivity to the pigments extracted from M. roseus (PEM) and R. glutinis (PER) compared to molds so that Bacillus cereus and Alternaria citri had the highest and the lowest sensitivity, respectively. PER showed a higher antioxidant activity compared with PEM in the various methods of measuring antioxidant activity. In vitro and in vivo anti-tumor-promoting activities of PER were measured significantly more than PEM (P <0.05). Both pigment extracts remarkably inhibited the 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced inflammation, so that ID 50 (50% inhibitory dose) of PEM and PER were 0.22 and 0.09 mg/ear, respectively. © The Author(s) 2016.

Some biological activities of pigments extracted from Micrococcus roseus (PTCC 1411) and Rhodotorula glutinis (PTCC 5257)

PubMed Central

Rostami, Hossein; Hamedi, Hassan; Yolmeh, Mahmoud

2016-01-01

The importance of replacing synthetic pigments with natural types is increasing day by day in the food industry due to the harmful effects of some synthetic pigments. Microorganisms are a major source of natural pigments, which nowadays have attracted the attention of researchers. In this study, carotenoid pigments were produced by Micrococcus roseus and Rhodotorula glutinis, and some of their biological properties such as antimicrobial, antioxidant, anticancer, and anti-inflammatory activities were evaluated. Given the results, bacteria, especially gram-positive bacteria, had higher sensitivity to the pigments extracted from M. roseus (PEM) and R. glutinis (PER) compared to molds so that Bacillus cereus and Alternaria citri had the highest and the lowest sensitivity, respectively. PER showed a higher antioxidant activity compared with PEM in the various methods of measuring antioxidant activity. In vitro and in vivo anti-tumor-promoting activities of PER were measured significantly more than PEM (P <0.05). Both pigment extracts remarkably inhibited the 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced inflammation, so that ID50 (50% inhibitory dose) of PEM and PER were 0.22 and 0.09 mg/ear, respectively. PMID:27895288

Microbiological Safety of Kitchen Sponges Used in Food Establishments

PubMed Central

Bacha, Ketema

2016-01-01

Kitchen sponges are among the possible sources of contaminants in food establishments. The main purpose of the current study was, therefore, to assess the microbiological safety of sponges as it has been used in selected food establishments of Jimma town. Accordingly, the microbiological safety of a total of 201 kitchen sponges randomly collected from food establishments was evaluated against the total counts of aerobic mesophilic bacteria (AMB), Enterobacteriaceae, coliforms, and yeast and molds. The mean counts of aerobic mesophilic bacteria ranged from 7.43 to 12.44 log CFU/mm3. The isolated genera were dominated by Pseudomonas (16.9%), Bacillus (11.1%), Micrococcus (10.6%), Streptococcus (7.8%), and Lactobacillus (6%) excluding the unidentified Gram positive rods (4.9%) and Gram negative rods (9.9%). The high microbial counts (aerobic mesophilic bacteria, coliforms, Enterobacteriaceae, and yeast and molds) reveal the existence of poor kitchen sponge sanitization practice. Awareness creation training on basic hygienic practices to food handlers and periodic change of kitchen sponges are recommended. PMID:27840819

Bioprospecting highly diverse endophytic Pestalotiopsis spp. with antibacterial properties from Maytenus ilicifolia, a medicinal plant from Brazil.

PubMed

Gomes-Figueiredo, Josiane; Pimentel, Ida C; Vicente, Vânia A; Pie, Marcio R; Kava-Cordeiro, Vanessa; Galli-Terasawa, Lygia; Pereira, José O; de Souza, Antonia Q L; Glienke, Chirlei

2007-10-01

Thirteen endophytic fungal strains of the genus Pestalotiopsis were isolated from the medicinal plant Maytenus ilicifolia Mart. ex. Reiss (commonly known as "espinheira santa") and their antimicrobial properties were investigated. Two isolates were successful in inhibiting the growth of the tested microorganisms (Escherichia coli, Klebsiella pneumoniae, Micrococcus luteus, Staphylococcus aureus, and methicillin-resistant Staphylococcus aureus (MRSA)) using the technique of bioautographic thin-layer chromatography (TLC) agar overlay assay. An analysis based on a polyphasic approach integrating taxonomic information, morphological traits, RAPD markers, and the sequencing of the ITS1-5.8S-ITS2 of the rDNA led to the assignment of the isolates as belonging to the species Pestalotiopsis microspora, Pestalotiopsis vismiae, and Pestalotiopsis leucothoes. Therefore, the present study presents a new approach to the study of endophytic fungi of the genus Pestalotiopsis.

Whole Microorganisms Studied by Pyrolysis-Gas Chromatography-Mass Spectrometry: Significance for Extraterrestrial Life Detection Experiments 1

PubMed Central

Simmonds, Peter G.

1970-01-01

Pyrolysis-gas chromatography-mass spectrometric studies of two microorganisms, Micrococcus luteus and Bacillus subtilis var. niger, indicate that the majority of thermal fragments originate from the principal classes of bio-organic matter found in living systems such as protein and carbohydrate. Furthermore, there is a close qualitative similarity between the type of pyrolysis products found in microorganisms and the pyrolysates of other biological materials. Conversely, there is very little correlation between microbial pyrolysates and comparable pyrolysis studies of meteoritic and fossil organic matter. These observations will aid in the interpretation of a soil organic analysis experiment to be performed on the surface of Mars in 1975. The science payload of this landed mission will include a combined pyrolysis-gas chromatography-mass spectrometry instrument as well as several “direct biology experiments” which are designed to search for extraterrestrial life. PMID:16349890

Antimicrobial activity of honokiol and magnolol isolated from Magnolia officinalis.

PubMed

Ho, K Y; Tsai, C C; Chen, C P; Huang, J S; Lin, C C

2001-03-01

The antimicrobial activity of honokiol and magnolol, the main constituents of Magnolia officinalis was investigated. The antimicrobial activity was assayed by the agar dilution method using brain heart infusion medium and the minimum inhibitory concentration (MIC) were determined for each compound using a twofold serial dilution assay. The results showed that honokiol and magnolol have a marked antimicrobial effect (MIC = 25 microg/mL) against Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, Micrococcus luteus and Bacillus subtilis, but did not show antimicrobial activity (MIC > or = 100 microg/mL) for Shigella flexneii, Staphylococcus epidermidis, Enterobacter aerogenes, Proteus vulgaris, Escherichia coli and Pseudomonas aeruginosa. Our results indicate that honokiol and magnolol, although less potent than tetracycline, show a significant antimicrobial activity for periodontal pathogens. Hence we suggest that honokiol and magnolol might have the potential to be an adjunct in the treatment of periodontitis. Copyright 2001 John Wiley & Sons, Ltd.

Chemical constituents and antimicrobial activity of the essential oil of Lantana xenica.

PubMed

Juliani, Hector R; Biurrun, Fernando; Koroch, Adolfina R; Oliva, M M; Demo, Mirta S; Trippi, Victorio S; Zygadlo, Julio A

2002-08-01

The aim of this work was to evaluate the chemical composition of Lantana xenica essential oil and its antimicrobial activity. The oil from the aerial parts of Lantana xenica Mold. (Verbenacea) was obtained by steam distillation and analyzed by gas chromatography/mass spectrometry. The major constituent of the oil was (E)-caryophyllene (35.2 %), with minor amounts of gamma-cadinene (13.3 %), alpha-pinene (9.3 %), ocimene (9.2 %) and germacrene D (6.6 %). The antimicrobial assays showed that the essential oil of L. xenica inhibited the growth of Bacillus cereus and Proteus mirabilis and both bacteria were inhibited by (E)-caryophyllene, the major component of the oil. Enterococcus faecalis, Staphylococcus epidermidis and S. aureus showed a lower inhibition. The bacteria Micrococcus luteus, Klebsiella sp., Escherichia coli and the yeast Candida albicans were insensitive to both the oil and (E)-caryophyllene.

New Benzophenones and Xanthones from Cratoxylum sumatranum ssp. neriifolium and Their Antibacterial and Antioxidant Activities.

PubMed

Tantapakul, Cholpisut; Maneerat, Wisanu; Sripisut, Tawanun; Ritthiwigrom, Thunwadee; Andersen, Raymond J; Cheng, Ping; Cheenpracha, Sarot; Raksat, Achara; Laphookhieo, Surat

2016-11-23

Two new benzophenones (1 and 2) and four new xanthones (4-6 and 17) together with 24 known compounds (3, 7-16, and 18-30) were isolated from the roots and twigs of Cratoxylum sumatranum ssp. neriifolium. Their structures were elucidated by spectroscopic methods. Compounds 5 and 26 showed antibacterial activity against Micrococcus luteus, Bacillus cereus, and Staphylococcus epidermis with minimum inhibitory concentrations ranging from 4 to 8 μg/mL, whereas compounds 7, 20, and 26 displayed selective antibacterial activities against Staphylococcus aureus (8 μg/mL), Salmonella typhimurium (4 μg/mL), and Pseudomonas aeruginosa (4 μg/mL), respectively. The radical scavenging effects of some isolated compounds were investigated. Compounds 11 and 21 exhibited potent activity against 2,2-diphenyl-1-picrylhydrazyl (DPPH) with IC 50 values of 7.0 ± 1.0 and 6.0 ± 0.2 μM, respectively.

Functional properties of honey supplemented with bee bread and propolis.

PubMed

Kowalski, S; Makarewicz, M

2017-11-01

The aim of this work was characterisation of functional properties of honey enriched with propolis and beebread. In first step of experiment, soft propolis extract (SPEx) was obtained by extraction of propolis with ethanol. SPEx (0.25 to 1.0% w/w) as well as beebread (5 to 15% w/w) were implemented into natural honey. Fortified honeys were investigated in terms of total phenolic content, radical scavenging activity and ferric reducing antioxidant power, also their effects on the micro-organisms growth was examined. It was found that beebread had the most significant influence on antioxidant properties. On the other hand, all tested honeys showed antibacterial activity against Escherichia coli but not against Micrococcus luteus. Honeys with 1% of propolis addition were the most effective in this case. Research has indicated that for antioxidant and antimicrobial properties of honey, it is beneficial to enrich it in both beebread and propolis.

Synthesis of some metallophthalocyanines with dimethyl 5-(phenoxy)-isophthalate substituents and evaluation of their antioxidant-antibacterial activities

NASA Astrophysics Data System (ADS)

Salih Ağırtaş, M.; Karataş, Ceyhun; Özdemir, Sadin

2015-01-01

The synthesis, characterization, spectral, antioxidant and antibacterial properties of dimethyl 5-(phenoxy)-isophthalate substituted Zinc, Cobalt, Copper, and Nickel phthalocyanines are reported. The novel compounds have been characterized by using electronic absorption, nuclear magnetic resonance spectroscopy, infrared, elemental analysis and mass spectrometry. The antioxidant and antibacterial activities of newly synthesized phthalocyanines and its starting material are tested. The DPPH free radical scavenging ability of phthalocyanine Co(II) and Zn(II) complexes on DPPH are 44.8% and 40.1% at 100 mg/L concentration, respectively. The phthalocyanine Co(II) and Cu(II) complexes show very strong ferrous ion chelating activity of 91.2% and 89.3% at concentration of 100 mg/L, respectively. Compound 3 displays strong reducing power like α-tocopherol. Antibacterial activities of phthalocyanine Co(II) and Amikacin (30 μg/disk) against Micrococcus luteus (ATCC 9341) are 16 mm in diameter.

Cell Based Drug Delivery: Micrococcus luteus Loaded Neutrophils as Chlorhexidine Delivery Vehicles in a Mouse Model of Liver Abscesses in Cattle.

PubMed

Wendel, Sebastian O; Menon, Sailesh; Alshetaiwi, Hamad; Shrestha, Tej B; Chlebanowski, Lauren; Hsu, Wei-Wen; Bossmann, Stefan H; Narayanan, Sanjeev; Troyer, Deryl L

2015-01-01

The recent WHO report on antibiotic resistances shows a dramatic increase of microbial resistance against antibiotics. With only a few new antibiotics in the pipeline, a different drug delivery approach is urgently needed. We have obtained evidence demonstrating the effectiveness of a cell based drug delivery system that utilizes the innate immune system as targeting carrier for antibacterial drugs. In this study we show the efficient loading of neutrophil granulocytes with chlorhexidine and the complete killing of E. coli as well as Fusobacterium necrophorum in in-vitro studies. Fusobacterium necrophorum causes hepatic abscesses in cattle fed high grain diets. We also show in a mouse model that this delivery system targets infections of F. necrophorum in the liver and reduces the bacterial burden by an order of magnitude from approximately 2•106 to 1•105.

Resistance of bacterial biofilms formed on stainless steel surface to disinfecting agent.

PubMed

Królasik, Joanna; Zakowska, Zofia; Krepska, Milena; Klimek, Leszek

2010-01-01

The natural ability of microorganisms for adhesion and biofilm formation on various surfaces is one of the factors causing the inefficiency of a disinfection agent, despite its proven activity in vitro. The aim of the study was to determine the effectiveness of disinfecting substances on bacterial biofilms formed on stainless steel surface. A universally applied disinfecting agent was used in the tests. Bacterial strains: Listeria innocua, Pseudomonas putida, Micrococcus luteus, Staphylococcus hominis strains, were isolated from food contact surfaces, after a cleaning and disinfection process. The disinfecting agent was a commercially available acid specimen based on hydrogen peroxide and peroxyacetic acid, the substance that was designed for food industry usage. Model tests were carried out on biofilm formed on stainless steel (type 304, no 4 finish). Biofilms were recorded by electron scanning microscope. The disinfecting agent in usable concentration, 0.5% and during 10 minutes was ineffective for biofilms. The reduction of cells in biofilms was only 1-2 logarithmic cycles. The use of the agent in higher concentration--1% for 30 minutes caused reduction of cell number by around 5 logarithmic cycles only in the case of one microorganism, M. luteus. For other types: L. innocua, P. putida, S. hominis, the requirements placed on disinfecting agents were not fulfilled. The results of experiments proved that bacterial biofilms are resistant to the disinfectant applied in its operational parameters. Disinfecting effectiveness was achieved after twofold increase of the agent's concentration.

Isolation and identification of symbiotic bacteria from the skin, mouth, and rectum of wild and captive tree shrews.

PubMed

Li, Gui; Lai, Ren; Duan, Gang; Lyu, Long-Bao; Zhang, Zhi-Ye; Liu, Huang; Xiang, Xun

2014-11-18

Endosymbionts influence many aspects of their hosts' health conditions, including physiology, development, immunity, metabolism, etc. Tree shrews (Tupaia belangeri chinensis) have attracted increasing attention in modeling human diseases and therapeutic responses due to their close relationship with primates. To clarify the situation of symbiotic bacteria from their body surface, oral cavity, and anus, 12 wild and 12 the third generation of captive tree shrews were examined. Based on morphological and cultural characteristics, physiological and biochemical tests, as well as the 16S rDNA full sequence analysis, 12 bacteria strains were isolated and identified from the wild tree shrews: body surface: Bacillus subtilis (detection rate 42%), Pseudomonas aeruginosa (25%), Staphlococcus aureus (33%), S. Epidermidis (75%), Micrococcus luteus (25%), Kurthia gibsonii (17%); oral cavity: Neisseria mucosa (58%), Streptococcus pneumonia (17%); anus: Enterococcus faecalis (17%), Lactococus lactis (33%), Escherichia coli (92%), Salmonella typhosa (17%); whereas, four were indentified from the third generation captive tree shrews: body surface: S. epidermidis (75%); oral cavity: N.mucosa (67%); anus: L. lactis (33%), E. coli (100%). These results indicate that S. epidermidis, N. mucosa, L. lactis and E. coli were major bacteria in tree shrews, whereas, S. aureus, M. luteus, K. gibsonii, E. faecalis and S. typhosa were species-specific flora. This study facilitates the future use of tree shrews as a standard experimental animal and improves our understanding of the relationship between endosymbionts and their hosts.

Antibacterial serine protease from Wrightia tinctoria: Purification and characterization.

PubMed

Muthu, Sakthivel; Gopal, Venkatesh Babu; Soundararajan, Selvakumar; Nattarayan, Karthikeyan; S Narayan, Karthik; Lakshmikanthan, Mythileeswari; Malairaj, Sathuvan; Perumal, Palani

2017-03-01

A serine protease was purified from the leaves of Wrightia tinctoria by sequential flow through method comprising screening, optimization, ammonium sulfate precipitation, gel filtration and ion exchange column chromatography. The yield and purification fold obtained were 11.58% and 9.56 respectively. A single band of serine protease was visualized on SDS-PAGE and 2-D gel electrophoretic analyses were revealed with the molecular mass of 38.5 kDa. Serine protease had an optimum pH of 8.0 and was stable at 45°C with high relative protease activity. The addition of metal ions such as Mg2+ and Mn2+ exhibits a high relative activity. Serine protease had a potent antibacterial activity against both Gram-positive and Gram-negative bacteria. A 10 μg/ml of serine protease was tested against S. aureus, M. luteus, P. aeruginosa and K. pneumoniae which had 21, 20, 18 and 17 mm of zone of inhibition respectively. Serine protease from W. tinctoria degrades the peptidoglycan layer of bacteria which was visualized by transmission electron microscopic analysis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Lupin nad9 and nad6 genes and their expression: 5' termini of the nad9 gene transcripts differentiate lupin species.

PubMed

Rurek, Michał; Nuc, Katarzyna; Raczyńska, Katarzyna Dorota; Augustyniak, Halina

2003-10-02

The mitochondrial nad9 and nad6 genes were analyzed in four lupin species: Lupinus luteus, Lupinus angustifolius, Lupinus albus and Lupinus mutabilis. The nucleotide sequence of these genes confirmed their high conservation, however, higher number of nucleotide substitution was observed in the L. albus genes. Southern hybridizations confirmed the presence of single copy number of these genes in L. luteus, L. albus and L. angustifolius. The expression of nad9 and nad6 genes was analyzed by Northern in different tissue types of analyzed lupin species. Transcription analyses of the two nad genes displayed single predominant mRNA species of about 0.6 kb in L. luteus and L. angustifolius. The L. albus transcripts were larger in size. The nad9 and nad6 transcripts were modified by RNA editing at 8 and 11 positions, in L. luteus and L. angustifolius, respectively. The gene order, rps3-rpl16-nad9, found in Arabidopsis thaliana is also conserved in L. luteus and L. angustifolius mitochondria. L. luteus and L. angustifolius showed some variability in the sequence of the nad9 promoter region. The last feature along with the differences observed in nad9 mRNA 5' termini of two lupins differentiate L. luteus and L. angustifolius species.

Antibacterial, Antiradical Potential and Phenolic Compounds of Thirty-One Polish Mushrooms

PubMed Central

Los, Renata; Malm, Anna

2015-01-01

Background Among many sources of natural bioactive substances, mushrooms constitute a huge and almost unexplored group. Fungal compounds have been repeatedly reported to exert biological effects which have prompted their use in pharmaceutical and cosmetic industry. Therefore, the aim of this study was analysis of chemical composition and biological activity of 31 wild growing mushroom species (including saprophytic and parasitic) from Poland. Methods Qualitative and quantitative LC-ESI-MS/MS analysis of fourteen phenolic acids in the mushrooms analysed was performed. Moreover, total phenolic content was determined by the modified Folin-Ciocalteau method. Antioxidative activity of ethanolic extracts towards DPPH• free radical was examined. Antibacterial activity against Gram-positive (S. epidermidis, S. aureus, B. subtilis, M. luteus) and Gram-negative (E. coli, K. pneumoniae, P. aeruginosa, P. mirabilis) microbial strains was analyzed. Results As a result, the first such broad report on polyphenolic composition, antiradical and antimicrobial potential of wild growing Polish mushrooms was developed. Mushroom extracts were found to contain both benzoic (protocatechuic, 4-OH-benzoic, vanillic, syringic) and cinnamic acid derivatives (caffeic, p-coumaric, ferulic). Total phenolic content in mushrooms ranged between 2.79 and 53.13 mg gallic acid equivalent /g of dried extract in Trichaptum fuscoviolaceum and Fomes fomentarius, respectively. Fungi showed much differentiated antiradical activity, from highly active F. fomentarius to poorly effective Russula fragilis (IC50 1.39 to 120.54 mg per mg DPPH•, respectively). A quite considerable relationship between phenolic content and antiradical activity has been demonstrated. Mushrooms varied widely in antimicrobial potential (MIC from 0.156 to 5 mg/ml). Generally, a slightly higher activity against Gram-positive than Gram-negative strains was observed. This is the first study concerning the chemical composition and biological activity of the majority of investigated species. PMID:26468946

[Micrococcus sp.--the pathogen of leaf necrosis of horse-chestnuts (Aesculus L.) in Kiev].

PubMed

Iakovleva, L M; Makhinia, L V; Shcherbina, T N; Ogorodnik, L E

2013-01-01

A group of phytopathogenic bacteria was isolated from patterns of drying horse-chestnuts (Aesculus L.), which grow in Kyiv. The properties of slowly growing, highly aggressive microorganisms have been described in the paper. They grow up on the 8-10th day after sowing. The investigated microorganisms form very small (0.5-1 mm in diameter) colonies on the potato agar. Bacteria are protuberant, shining, smooth with flat edges, they are pale yellow, yellow, or pink. The bacteria are Gram-positive, spherical, are disposed in smears singly, in pairs, as accumulations, or netting. They are aerobes, do not form spores, are not mobile. They are inert in respect of different sources of carbon. They reduce nitrates, do not dilute gelatin, do not hydrolyze starch, do not release hydrogen sulphide and indole. The bacteria are catalase-positive, oxidase-negative. They do not cause potato and carrot rot. They lose quickly their viability under the laboratory conditions. The saturated acids C 14:0; C 15:0; C16:0; C18:0 have been revealed in the composition of cellular fatty acids. Microorganisms are identified as Micrococcus sp. Under artificial inoculation this highly aggressive pathogen causes drying of the horse-chestnut buds and necrosis, which occupies 1/3-1/2 of the leaf plate. A wide zone of chlorosis, surrounding necrosis, may occupy the whole leaf surface. The infected leaves use to twist up from the top (apex) or along a midrib and to dry.

Molecular microbial diversity of a spacecraft assembly facility

NASA Technical Reports Server (NTRS)

Venkateswaran, K.; Satomi, M.; Chung, S.; Kern, R.; Koukol, R.; Basic, C.; White, D.

2001-01-01

In ongoing investigations to map and archive the microbial footprints in various components of the spacecraft and its accessories, we have examined the microbial populations of the Jet Propulsion Laboratory's Spacecraft Assembly Facility (JPL-SAF). Witness plates made up of spacecraft materials, some painted with spacecraft qualified paints, were exposed for approximately 7 to 9 months at JPL-SAF and examined the particulate materials collected for the incidence of total cultivable aerobic heterotrophs and heat-tolerant (80 degrees C for 15-min.) spore-formers. The results showed that the witness plates coated with spacecraft qualified paints attracted more dust particles than the non-coated stainless steel witness plates. Among the four paints tested, witness plates coated with NS43G accumulated the highest number of particles, and hence attracted more cultivable microbes. The conventional microbiological examination revealed that the JPL-SAF harbors mainly Gram-positive microbes and mostly spore-forming Bacillus species. Most of the isolated microbes were heat resistant to 80 degrees C and proliferate at 60 degrees C. The phylogenetic relationships among 23 cultivable heat-tolerant microbes were examined using a battery of morphological, physiological, molecular and chemotaxonomic characterizations. By 16S rDNA sequence analysis, the isolates fell into seven clades: Bacillus licheniformis, B. pumilus, B. cereus, B. circulans, Staphylococcus capitis, Planococcus sp. and Micrococcus lylae. In contrast to the cultivable approach, direct DNA isolation, cloning and 16S rDNA sequencing analysis revealed equal representation of both Gram-positive and Gram-negative microorganisms.

Application of Lactic Acid Bacteria (LAB) in freshness keeping of tilapia fillets as sashimi

NASA Astrophysics Data System (ADS)

Cao, Rong; Liu, Qi; Chen, Shengjun; Yang, Xianqing; Li, Laihao

2015-08-01

Aquatic products are extremely perishable food commodities. Developing methods to keep the freshness of fish represents a major task of the fishery processing industry. Application of Lactic Acid Bacteria (LAB) as food preservative is a novel approach. In the present study, the possibility of using lactic acid bacteria in freshness keeping of tilapia fillets as sashimi was examined. Fish fillets were dipped in Lactobacillus plantarum 1.19 (obtained from China General Microbiological Culture Collection Center) suspension as LAB-treated group. Changes in K-value, APC, sensory properties and microbial flora were analyzed. Results showed that LAB treatment slowed the increase of K-value and APC in the earlier storage, and caused a smooth decrease in sensory score. Gram-negative bacteria dominated during refrigerated storage, with Pseudomonas and Aeromonas being relatively abundant. Lactobacillus plantarum 1.19 had no obvious inhibitory effect against these Gram-negatives. However, Lactobacillus plantarum 1.19 changed the composition of Gram-positive bacteria. No Micrococcus were detected and the proportion of Staphylococcus decreased in the spoiled LAB-treated samples. The period that tilapia fillets could be used as sashimi material extended from 24 h to 48 h after LAB treatment. The potential of using LAB in sashimi processing was confirmed.

Impact of Middle Eastern dust storms on indoor and outdoor composition of bioaerosol

NASA Astrophysics Data System (ADS)

Goudarzi, Gholamreza; Soleimani, Zahra; Sorooshian, Armin; Marzouni, Mohammad Bagherian; Maleki, Heidar

2016-08-01

The presence of microbes in airborne aerosol particles, especially dust, is a major public health concern in desert regions. This study is the first of its kind to examine the effect of dust storms on indoor and outdoor microbial air quality at a hospital on the western side of Iran (city of Ahvaz), which is notorious for being highly vulnerable to dust emissions. Air samples were collected inside and outside of the hospital environment for six months, with the unique advantage of this study being that the region and duration of measurements allow for a clear comparison between dusty and normal days. On normal days, the average concentrations (outdoor/indoor) of bacteria and fungi were 423/329 cfu m-3 and 596/386 cfu m-3, respectively, which increased to 1257/406 cfu m-3 and 1116/550 cfu m-3 on dust event days. Indoor/Outdoor ratios for bacteria and fungi are lower on dust event days (0.26-0.60) versus normal days (0.44-0.95). Bacillus spp., Micrococcus spp., Streptomyces spp., and Staphylococcus spp. were the dominant bacteria both indoors and outdoors on normal and dust event days. Gram positive bacteria exhibited higher concentrations than Gram negative bacteria in both outdoor and indoor air samples as well as during both normal and dust event days. The data suggest that Gram positive bacteria are more resistant to undesirable outdoor conditions (e.g., high incident solar radiation) as compared to Gram negative ones. These results have implications for other populated arid regions where more stringent control of indoor air quality can greatly benefit public health.

Simple one step synthesis of nonionic dithiol surfactants and their self-assembling with silver nanoparticles: Characterization, surface properties, biological activity

NASA Astrophysics Data System (ADS)

Abd-Elaal, Ali A.; Tawfik, Salah M.; Shaban, Samy M.

2015-07-01

Simple esterification of 2-mercaptoacetic acid and polyethylene glycol with different molecular weights was done to form the desired nonionic dithiol surfactants. The chemical structures of synthesized thiol surfactants were confirmed using FT-IR and 1H NMR spectra. The surface activity of the synthesized surfactants was determined by measurement of the surface tension at different temperatures. The surface activity measurements showed their high tendency towards adsorption and micellization. The thermodynamic parameters of micellization (ΔGmic, ΔHmic and ΔSmic) and adsorption (ΔGads, ΔGads and ΔSads) showed their tendency toward adsorption at the interfaces and also micellization in the bulk of their solutions. The nanostructure of the synthesized nonionic dithiol surfactants with silver nanoparticles was prepared and investigated using UV and TEM techniques. Screening tests of the synthesized dithiol surfactants and their nanostructure with silver nanoparticles, against gram positive bacteria (Bacillus subtilis and Microccus luteus), gram negative bacteria (Escherichia coli and Bordatella pertussis) and fungi (Aspergillus niger and Candida albicans) showed that they are highly active biocides. The presence of silver nanoparticles enhancement the biological activities of the individual synthesized nonionic dithiol surfactants.

Chitosan/Mimosa tenuiflora films as potential cellular patch for skin regeneration.

PubMed

Valencia-Gómez, Laura Elizabeth; Martel-Estrada, Santos Adriana; Vargas-Requena, Claudia; Rivera-Armenta, José Luis; Alba-Baena, Noe; Rodríguez-González, Claudia; Olivas-Armendáriz, Imelda

2016-12-01

Bio-composites films were prepared by casting and drying of aqueous solutions containing different weight ratios of chitosan and bark of Mimosa tenuiflora. The physico-chemical and functional properties of the films were characterized by scanning electron microscopy, dynamical mechanical analysis, wettability, cytotoxicity and in vitro antibacterial activities. The morphology studies confirmed that the presence of Mimosa tenuiflora change the surface of films. Moreover, the incorporation of Mimosa tenuiflora improved the thermal stability of the films, as it was indicated by the changes in the glass temperatures obtained. Water-uptake ability changed in relation to polymeric composition of film. This property increased by the addition of Mimosa tenuiflora to the film. Improved antibacterial properties were measured against Escherichia Coli and Micrococcus lysodeikticus or luteus. Finally, cytotoxicity was studied by MTT assay and the films were non-toxic. These preliminary results provide a cheap way to prepare chitosan/Mimosa tenuiflora films for wound healing and skin regeneration. Copyright © 2016 Elsevier B.V. All rights reserved.

Chemical composition, antimicrobial, insecticidal, phytotoxic and antioxidant activities of Mediterranean Pinus brutia and Pinus pinea resin essential oils.

PubMed

Ulukanli, Zeynep; Karabörklü, Salih; Bozok, Fuat; Ates, Burhan; Erdogan, Selim; Cenet, Menderes; Karaaslan, Merve Göksin

2014-12-01

Essential oils of the resins of Pinus brutia and Pinus pinea were evaluated for their biological potential. Essential oils were characterized using GC-MS and GC/FID. in vitro antimicrobial, phytotoxic, antioxidant, and insecticidal activities were carried out using the direct contact and the fumigant assays, respectively. The chemical profile of the essential oils of the resins of P. pinea and P. brutia included mainly α-pinene (21.39% and 25.40%), β-pinene (9.68% and 9.69%), and caryophyllene (9.12% and 4.81%). The essential oils of P. pinea and P. brutia exerted notable antimicrobial activities on Micrococcus luteus and Bacillus subtilis, insecticidal activities on Ephestia kuehniella eggs, phytotoxic activities on Lactuca sativa, Lepidium sativum, and Portulaca oleracea, as well as antioxidant potential. Indications of the biological activities of the essential oils suggest their use in the formulation of ecofriendly and biocompatible pharmaceuticals. Copyright © 2014 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

Antimicrobial activity of antihypertensive food-derived peptides and selected alanine analogues.

PubMed

McClean, Stephen; Beggs, Louise B; Welch, Robert W

2014-03-01

This study evaluated four food-derived peptides with known antihypertensive activities for antimicrobial activity against pathogenic microorganisms, and assessed structure-function relationships using alanine analogues. The peptides (EVSLNSGYY, barley; PGTAVFK, soybean; TTMPLW, α-casein; VHLPP, α-zein) and the six alanine substitution peptides of PGTAVFK were synthesised, characterised and evaluated for antimicrobial activity using the bacteria, Escherichia coli, Staphylococcus aureus, and Micrococcus luteus and the yeast, Candida albicans. The peptides TTMPLW and PGTAVFK inhibited growth of all four microorganisms tested, with activities of a similar order of magnitude to ampicillin and ethanol controls. EVSLNSGYY inhibited the growth of the bacteria, but VHLPP showed no antimicrobial activity. The alanine analogue, PGAAVFK showed the highest overall antimicrobial activity and PGTAVFA showed no activity; overall, the activities of the analogues were consistent with their structures. Some peptides with antihypertensive activity also show antimicrobial activity, suggesting that food-derived peptides may exert beneficial effects via a number of mechanisms. Copyright © 2013 Elsevier Ltd. All rights reserved.

Production of human lactoferrin in animal milk.

PubMed

Goldman, I L; Georgieva, S G; Gurskiy, Ya G; Krasnov, A N; Deykin, A V; Popov, A N; Ermolkevich, T G; Budzevich, A I; Chernousov, A D; Sadchikova, E R

2012-06-01

Genetic constructs containing the human lactoferrin (hLf) gene were created within a joint program of Russian and Belorussian scientists. Using these constructs, transgenic mice were bred (the maximum hLf concentration in their milk was 160 g/L), and transgenic goats were also generated (up to 10 g/L hLf in their milk). Experimental goatherds that produced hLf in their milk were also bred, and the recombinant hLf was found to be identical to the natural protein in its physical and chemical properties. These properties included electrophoretic mobility, isoelectric point, recognition by polyclonal and monoclonal antibodies, circular dichroic spectra, interaction with natural ligands (DNA, lipopolysaccharides, and heparin), the binding of iron ions, the sequence of the 7 terminal amino acids, and its biological activity. The latter was assessed by the agglutination of Micrococcus luteus protoplasts, bactericidal activity against Escherichia coli and Listeria monocytogenes , and fungicidal activity against Candida albicans . We also demonstrated a significant increase in the activity of antibiotics when used in combination with Lf.

Assessment of the bacterial contamination of hand air dryer in washrooms.

PubMed

Alharbi, Sulaiman Ali; Salmen, Saleh Hussein; Chinnathambi, Arunachalam; Alharbi, Naiyf S; Zayed, M E; Al-Johny, Bassam O; Wainwright, Milton

2016-03-01

The present study was carried out, using standard techniques, to identify and count the bacterial contamination of hand air dryers, used in washrooms. Bacteria were isolated from the air flow, outlet nozzle of warm air dryers in fifteen air dryers used in these washrooms. Bacteria were found to be relatively numerous in the air flows. Bacterially contaminated air was found to be emitted whenever a warm air dryer was running, even when not being used for hand drying. Our investigation shows that Staphylococcus haemolyticus, Micrococcus luteus, Pseudomonas alcaligenes, Bacillus cereus and Brevundimonad diminuta/vesicularis were emitted from all of the dryers sampled, with 95% showing evidence of the presence of the potential pathogen S. haemolyticus. It is concluded that hot air dryers can deposit pathogenic bacteria onto the hands and body of users. Bacteria are distributed into the general environment whenever dryers are running and could be inhaled by users and none-users alike. The results provide an evidence base for the development and enhancement of hygienic hand drying practices.

Assessment of the bacterial contamination of hand air dryer in washrooms

PubMed Central

Alharbi, Sulaiman Ali; Salmen, Saleh Hussein; Chinnathambi, Arunachalam; Alharbi, Naiyf S.; Zayed, M.E.; Al-Johny, Bassam O.; Wainwright, Milton

2015-01-01

The present study was carried out, using standard techniques, to identify and count the bacterial contamination of hand air dryers, used in washrooms. Bacteria were isolated from the air flow, outlet nozzle of warm air dryers in fifteen air dryers used in these washrooms. Bacteria were found to be relatively numerous in the air flows. Bacterially contaminated air was found to be emitted whenever a warm air dryer was running, even when not being used for hand drying. Our investigation shows that Staphylococcus haemolyticus, Micrococcus luteus, Pseudomonas alcaligenes, Bacillus cereus and Brevundimonad diminuta/vesicularis were emitted from all of the dryers sampled, with 95% showing evidence of the presence of the potential pathogen S. haemolyticus. It is concluded that hot air dryers can deposit pathogenic bacteria onto the hands and body of users. Bacteria are distributed into the general environment whenever dryers are running and could be inhaled by users and none-users alike. The results provide an evidence base for the development and enhancement of hygienic hand drying practices. PMID:26981009

Chemical and biological evaluation of Ranunculus muricatus.

PubMed

Khan, Farhat Ali; Zahoor, Muhammad; Khan, Ezzat

2016-03-01

Ranunculus muricatus is commonly known as spiny fruit buttercup and is used in the treatment of intermittent fevers, gout and asthma. Qualitative analysis of phytochemicals of Ranunculus muricatus indicated the presence of saponins, tannins, phenols, flavonoids and alkaloids. Saponins were present in high amount as compared with other chemicals. Inorganic and heavy metals constituents were determined. Heavy metals estimation in the sample showed that iron was present in high amount followed by zinc even then the concentration of these metals is below acceptable limit. The physical parameters, antioxidant and antimicrobial activities of the extracts were determined. Acetone extract fraction showed optimal antioxidant activity as compared to ethanol and chloroform fractions of the candidate plant. The antimicrobial and antifungal activities of the crude extract and extract fractions were determined by well agar diffusion method. Highest zone of inhibitions were observed for crude extract followed by acetone extract fraction against Micrococcus luteus. Antifungal activities were high for crude extracts against Candida Albican. Findings of this study show that Ranunculus muricatus has a good medicinal impact.

[Isolation and antimicrobial activities of actinomycetes from vermicompost].

PubMed

Wang, Xue-jun; Yan, Shuang-lin; Min, Chang-li; Yang, Yan

2015-02-01

In this paper, actinomycetes were isolated from vermicompost by tablet coating method. Antimicrobial activities of actinomycetes were measured by the agar block method. Strains with high activity were identified based on morphology and biochemical characteristics, as well as 16S rDNA gene sequence analysis. The results showed that 26 strains of actinomycetes were isolated, 16 of them had antimicrobial activities to the test strains which accounts for 61.54% of all strains. Among the 16 strains, the strain QYF12 and QYF22 had higher antimicrobial activity to Micrococcus luteus, with a formed inhibition zone of 27 mm and 31 mm, respectively. While the strain QYF26 had higher antimicrobial activity to Bacillus subtilis, and the inhibition zone diameter was 21 mm. Based on the identification of strains with high activity, the strain QYF12 was identified as Streptomyces chartreusis, the strain QYF22 was S. ossamyceticus and the strain QYF26 was S. gancidicus. This study provided a theoretical basis for further separate antibacterial product used for biological control.

An easy, rapid and inexpensive method to monitor tributyltin (TBT) toxicity in the laboratory.

PubMed

Cruz, Andreia; Moreira, Rafael; Mendo, Sónia

2014-05-01

Tributyltin (TBT) contamination remains a major problem worldwide. Many laboratories are committed to the development of remediation methodologies that could help reduce the negative impact of this compound in the environment. Furthermore, it is important to have at hand simple methodologies for evaluating TBT toxicity in the laboratory, besides the use of complex and costly analytical instrumentation. With that purpose, a method was adapted that is based on the inhibition of growth of an indicator strain, Micrococcus luteus ATCC 9341, under TBT. Different types of matrices, of TBT concentrations and sample treatments were tested. The results herein reported show that the bioassay method can be applied for both aqueous and soil samples and also for a high range of TBT concentrations (at least up to 500 μmol/L). Besides being cheap and easy to perform, it can be performed in any laboratory. Additionally, one possible application of the method to monitor TBT degradation is presented as an example.

Search for antibacterial and antifungal agents from selected Indian medicinal plants.

PubMed

Kumar, V Prashanth; Chauhan, Neelam S; Padh, Harish; Rajani, M

2006-09-19

A series of 61 Indian medicinal plants belonging to 33 different families used in various infectious disorders, were screened for their antimicrobial properties. Screening was carried out at 1000 and 500 microg/ml concentrations by agar dilution method against Bacillus cereus var mycoides, Bacillus pumilus, Bacillus subtilis, Bordetella bronchiseptica, Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Streptococcus faecalis, Candida albicans, Aspergillus niger and Saccharomyces cerevisiae. Twenty-eight plant extracts showed activity against at least one of the test organisms used in the screening. On the basis of the results obtained, we conclude that the crude extracts of Dorema ammoniacum, Sphaeranthus indicus, Dracaena cinnabari, Mallotus philippinensis, Jatropha gossypifolia, Aristolochia indica, Lantana camara, Nardostachys jatamansi, Randia dumetorum and Cassia fistula exhibited significant antimicrobial activity and properties that support folkloric use in the treatment of some diseases as broad-spectrum antimicrobial agents. This probably explains the use of these plants by the indigenous people against a number of infections.

Antimicrobial activity of Chinese bayberry extract for the preservation of surimi.

PubMed

Li, Jianrong; Han, Qiang; Chen, Wei; Ye, Libin

2012-08-30

Chemical preservatives such as sodium nitrite and potassium sorbate have been widely used to keep surimi products fresh. However, the potential harmfulness to human health cannot be ignored. This study was conducted to develop natural preservatives for the storage of Collichthys surimi. Among the eight Chinese traditional herbs and fruits, Chinese bayberry extract showed the greatest inhibitory effect against surimi spoilage bacteria Serratia marcescens and Pseudomonas aeruginosa. Moreover, N-butanol phase extract of bayberry (NB) showed the greatest activity among the different phases of bayberry extract. When Chinese bayberry extract was combined with tea polyphenol, an additive inhibitory effect was observed on growth of Hansenula anomala, Micrococcus luteus, Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. Our results further indicated that the shelf life of surimi products stored at room temperature can be extended when supplemented with Chinese bayberry extract. Our results suggest that Chinese bayberry extract can be used as a natural preservative for the storage of Collichthys surimi. Copyright © 2012 Society of Chemical Industry.

Characterization of Light Non-Methane Hydrocarbons, Surface Water DOC, and Aerosols over the Nordic Seas

NASA Astrophysics Data System (ADS)

Hudson, E. D.; Ariya, P. A.

2006-12-01

Whole air, size-fractionated marine aerosols, and surface ocean water DOC were sampled together during June-July 2004 on the Nordic seas, in order to explore factors leading to the formation of volatile organic compounds (VOCs) at the sea surface and their transfer to the atmosphere. High site-to-site variability in 19 non-methane hydrocarbon concentrations suggests highly variable, local sources for these compounds. Acetone, C5 and C6 hydrocarbons, and dimethylsulfide were identified in the seawater samples using solid-phase microextraction/GC-MS. The aerosols were analysed by SEM-EDX and contained primarily inorganic material (sea salt, marine sulfates, and carbonates) and little organic matter. However, a culturable bacterium was isolated from the large (9.9 - 18 μ m) fraction at one site, and identified as Micrococcus luteus. We will discuss the implication of these results on potential exchange processes at the ocean-atmosphere interface and the impact of bioaerosols in transferring marine organic carbon to atmospheric organic carbon.

In Vitro Structural and Functional Evaluation of Gold Nanoparticles Conjugated Antibiotics

NASA Astrophysics Data System (ADS)

Saha, Biswarup; Bhattacharya, Jaydeep; Mukherjee, Ananda; Ghosh, Anup Kumar; Santra, Chitta Ranjan; Dasgupta, Anjan K.; Karmakar, Parimal

2007-12-01

Bactericidal efficacy of gold nanoparticles conjugated with ampicillin, streptomycin and kanamycin were evaluated. Gold nanoparticles (Gnps) were conjugated with the antibiotics during the synthesis of nanoparticles utilizing the combined reducing property of antibiotics and sodium borohydride. The conjugation of nanoparticles was confirmed by dynamic light scattering (DLS) and electron microscopic (EM) studies. Such Gnps conjugated antibiotics showed greater bactericidal activity in standard agar well diffusion assay. The minimal inhibitory concentration (MIC) values of all the three antibiotics along with their Gnps conjugated forms were determined in three bacterial strains, Escherichia coli DH5α, Micrococcus luteus and Staphylococcus aureus. Among them, streptomycin and kanamycin showed significant reduction in MIC values in their Gnps conjugated form whereas; Gnps conjugated ampicillin showed slight decrement in the MIC value compared to its free form. On the other hand, all of them showed more heat stability in their Gnps conjugated forms. Thus, our findings indicated that Gnps conjugated antibiotics are more efficient and might have significant therapeutic implications.

Application of autochthonous mixed starter for controlled Kedong sufu fermentation in pilot plant tests.

PubMed

Feng, Zhen; Xu, Miao; Zhai, Shuang; Chen, Hong; Li, Ai-li; Lv, Xin-tong; Deng, Hong-ling

2015-01-01

Traditional sufu is fermented by back-slopping and back-slopping has many defects. The objective of this study was to apply autochthonous mixed starter to control Kedong sufu fermentation. Sufu was manufactured using back-slopping (batch A) and autochthonous mixed starter (batch B) with Kocuria kristinae F7, Micrococcus luteus KDF1, and Staphylococcus carnosus KDFR1676. Considering physicochemical properties of sufu, 150-day sufu samples from batch A and 90-day sufu samples from batch B met the standard requirements, respectively. Considering sensory characteristics of sufu, 150-day sufu samples from batch A and 90-day sufu samples from batch B showed no significant differences (P > 0.05). The maturation period of sufu was shortened by 60 d. Profiles of free amino acids and peptides partly revealed the mechanism of typical sensory quality and shorter ripening time of sufu manufactured by autochthonous mixed starter. In final products, content of total biogenic amines was reduced by 48%. Autochthonous mixed starter performed better than back-slopping. Fermentation had a positive influence on the quality, safety, and sensory properties of sufu. The application of autochthonous mixed starter does not change the sensory characteristics of traditional fermented sufu. In addition, it reduces maturation period and improves their homogeneity and safety. It is possible to substitute autochthonous mixed starter for back-slopping in the manufacture of sufu. © 2014 Institute of Food Technologists®

First Total Syntheses and Antimicrobial Evaluation of Penicimonoterpene, a Marine-Derived Monoterpenoid, and Its Various Derivatives

PubMed Central

Zhao, Jian-Chun; Li, Xiao-Ming; Gloer, James B.; Wang, Bin-Gui

2014-01-01

The first total synthesis of marine-derived penicimonoterpene (±)-1 has been achieved in four steps from 6-methylhept-5-en-2-one using a Reformatsky reaction as the key step to construct the basic carbon skeleton. A total of 24 new derivatives of 1 have also been designed and synthesized. Their structures were characterized by analysis of their 1H NMR, 13C NMR and HRESIMS data. Some of them showed significant antibacterial activity against Aeromonas hydrophila, Escherichia coli, Micrococcus luteus, Staphylococcus aureus, Vibrio anguillarum, V. harveyi and/or V. parahaemolyticus, and some showed activity against plant-pathogenic fungi (Alternaria brassicae, Colletotrichum gloeosporioides and/or Fusarium graminearum). Some of the derivatives exhibited antimicrobial MIC values ranging from 0.25 to 4 μg/mL, which were stronger than those of the positive control. Notably, Compounds 3b and 10 showed extremely high selectively against plant-pathogenic fungus F. graminearum (MIC 0.25 μg/mL) and pathogenic bacteria E. coli (MIC 1 μg/mL), implying their potential as antimicrobial agents. SAR analysis of 1 and its derivatives indicated that modification of the carbon-carbon double bond at C-6/7, of groups on the allylic methylene unit and of the carbonyl group at C-1, effectively enhanced the antimicrobial activity. PMID:24897384

INFLUENCE OF INTRAMUSCULAR FAT LEVEL ON ORGANOLEPTIC, PHYSICAL, AND CHEMICAL CHARACTERISTICS OF IRRADIATED PORK. II. LOW-TEMPERATURE LONG-TIME PRE-IRRADIATION HEAT TREATMENT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bray, R.W.; Weckel, K.G.; Evans, G.W.

1964-02-01

Pork muscle (longissimus dorsi) was graded in three marbling levels by both visual appraisal and ether-extraction analysis of total fat. A low- temperature (121 deg F, gradually increasing to 191 deg F), long-time (19-hr) heat treatment was used for enzyme inactivation. Samples were packed under vacuum in rigid containers and irradiated to 4.5 Mrad with gamma radiation. Irradiated and frozen control samples were evaluated at intervals over a 180-day period. The heat treatment caused excessive connective-tissue breakdown as evidenced by a soft, dry texture. Marbling level had no significant effect on consumer-panel judgments of irradiated or frozen control samples (servedmore » plain, without bread). Lower degrees of marbling were preferred in irradiated sandwich items. Irradiated samples were less preferred than frozen control samples in both plain and sandwich form. Hunter L (color) values a/sub L/ (redness), hue, and saturation attributes were increased by irradiation treatment. Hunter L and b/sub L/ (yellowness) values of highly marbled irradiated sample-s were elevated. Highly marbled samples displayed greater tenderness qualities, as evidenced by mechanical tenderness measurements. Expressible moisture values were decreased by marbling degree and radiation treatment and increased by advancing storage time. As a measure of oxidation rancidity, thiobarbituric acid values were increased by increasing levels of marbling and advancing storage time, but were not influenced by preservation method. No significant differences in pH values due to marbling level or preservation method were detected. Bacteriologic counts of randomly selected irradiated samples indicated that they were commercially sterile (average of 57 colonies/g of sample). Methylene blue stains of colonles revealed Micrococcus. Frozen (control) samples contained moderate numbers of colonies (av. 2300 colonies per g of sample). Micrococcus colonies were again predominant, but a few colonles of film yeasts were also seen. Irradiated samples were negative for thermophilic anaerobic spores producing gas. Control samples were positive, containing gram-negative rods, Escherichia coli, and gram- positive cocci. (BBB)« less

Comparison on conjunctival sac bacterial flora of the seniors with dry eye in Ganzi autonomous prefecture

PubMed Central

Zhang, Yue; Liu, Zhi-Rong; Chen, Hui; Fan, Ying-Chuan; Duo, Ji; Zheng, Hong; Wang, Guang-Jin; Li, Yu-Chan; Jiachu, Dan-Ba; Zewang, Ge-Ma

2013-01-01

AIM To compare the bacterial flora in palpebral conjunctiva of xerophthalmia seniors of Tibetan, Yi and Han, and analyze the differences and similarities of the bacteria. METHODS The test subjects were selected from 2 Tibetan, 2 Yi and 3 Han populated places, respectively. Total 222 seniors (444 eyes) with dry eye were examined. Secretion was collected from the palpebral conjunctiva of the subjects and then inoculated onto a blood agar plate. After 48h of incubation, the bacteria were examined for the differences and similarities between different ethnics. RESULTS There was no significant difference (P>0.05) of Gram stain characterization, dominant bacteria and number of the bacterial species present in oxrophthalmia patients among Tibetan, Yi and Han nationalities. The bacteria presented in all groups include staphylococcus epidermidis, corynebacterium, micrococcus luteu, intracellular bacteria sphingomonas, pseudomonas aeruginosa. The bacteria detected from the two of three ethnic groups were staphylococcus aureus, staphylococcus haemolyticus, escherichia coli, kytococcus sedentarius, streptococcus angina, micrococcus lylae, and staphylococcus heads. The incidence rate of bacteria-associated dry eye in Tibetan population was significantly lower than that of Han and Yi population. CONCLUSION There is no significant difference in the bacteria flora of palpebral conjunctiva observed among dry eye elder populations of Tibetan, Yi and Han people. All of staphylococcus epidermidis, corynebacterium, micrococcus luteu, intracellular bacteria sphingomonas, pseudomonas aeruginosa, staphylococcus aureus, staphylococcus haemolyticus, escherichia coli, kytococcus sedentarius, streptococcus angina, micrococcus lylae and staphylococcus heads are common bacteria flora of the three nationalities inhibiting in this area. PMID:23991377

Recognition of microbial molecular patterns and stimulation of prophenoloxidase activation by a β-1,3-glucanase-related protein in Manduca sexta larval plasma

PubMed Central

Wang, Yang; Sumathipala, Niranji; Rayaprolu, Subrahmanyam; Jiang, Haobo

2011-01-01

Detection of pathogenic invaders is the essential first step of a successful defense response in multicellular organisms. In this study, we have identified a new member of the β-1,3-glucanase-related protein superfamily from the tobacco hornworm Manduca sexta. This protein, designated microbe binding protein (MBP), is 61% identical in sequence to Bombyx mori Gram-negative bacteria binding protein, but only 34-36% identical to M. sexta β-1,3-glucan recognition protein-1 and 2. Its mRNA levels were strongly up-regulated in hemocytes and fat body of immune challenged larvae, along with an increase in concentration of the plasma protein. We expressed M. sexta MBP in a baculovirus-insect cell system. The purified protein associated with intact bacteria and fungi. It specifically bound to lipoteichoic acid, lipopolysaccharide, diaminopimelic acid-type peptidoglycans (DAP-PGs) from Escherichia coli and Bacillus subtilis, but less so to laminarin or Lys-type PG from Staphylococcus aureus. The complex binding pattern was influenced by other plasma factors and additional microbial surface molecules. After different amounts of MBP had been incubated with larval plasma on ice, a concentration-dependent increase in phenoloxidase (PO) activity occurred in the absence of any microbial elicitor. The activity increase was also observed in the mixture of plasma and a bacterial or fungal cell wall component. The prophenoloxidase (proPO) activation became more prominent when DAP-PGs, Micrococcus luteus Lys-PG, or lipoteichoic acid was included in the mixture of MBP and plasma. Statistic analysis suggested that a synergistic enhancement of proPO activation was caused by an interaction between MBP and these elicitors, but not S. aureus Lys-PG, lipopolysaccharide, curdlan, or laminarin. These data indicate that M. sexta MBP is a component of the surveillance mechanism and, by working together with other pattern recognition molecules and serine proteinases, triggers the proPO activation system. PMID:21296155

A novel junctional adhesion molecule A (CgJAM-A-L) from oyster (Crassostrea gigas) functions as pattern recognition receptor and opsonin.

PubMed

Liu, Conghui; Wang, Mengqiang; Jiang, Shuai; Wang, Lingling; Chen, Hao; Liu, Zhaoqun; Qiu, Limei; Song, Linsheng

2016-02-01

Junctional adhesion molecule (JAM), a subfamily of immunoglobulin superfamily (IgSF) with a couple of immunoglobulin domains, can act as regulator in homeostasis and inflammation of vertebrates. In the present study, a structural homolog of JAM-A (designated CgJAM-A-L) was screened out from oyster, Crassostrea gigas, through a search of JAM-A D1 domain (N-terminal Ig domain in JAM-A). The cDNA of CgJAM-A-L was of 1188 bp encoding a predicted polypeptide of 395 amino acids. The immunoreactive area of CgJAM-A-L mainly distributed over the plasma membrane of hemocytes. After Vibro splendidus or tumor necrosis factor (CgTNF-1) stimulation, the mRNA transcripts of CgJAM-A-L in hemocytes increased significantly by 4.46-fold and 9.00-fold (p < 0.01) of those in control group, respectively. The recombinant CgJAM-A-L protein (rCgJAM-A-L) could bind multiple PAMPs including lipopolysaccharides (LPS), peptidoglycan (PGN), lipoteichoic acid (LTA), mannose (MAN), β-glucan (GLU) and poly(I:C), and various microorganisms including Micrococcus luteus, Staphylococcus aureus, Escherichia coli, Vibro anguillarum, V. splendidus, Pastoris pastoris and Yarrowia lipolytica. The phagocytic rates of oyster hemocytes towards Gram-negative bacteria V. anguillarum and yeast P. pastoris were significantly enhanced after the incubation of rCgJAM-A-L, and even increased more significantly after the pre-incubation of rCgJAM-A-L with microbes (p < 0.01). The results collectively indicated that CgJAM-A-L functioned as an important pattern recognition receptor (PRR) and opsonin in the immune defense against invading pathogen in oyster. Moreover, as the most primitive specie with homolog of JAMs, the information of CgJAM-A-L in oyster would provide useful clues for the evolutionary study of JAMs and immunoglobulins. Copyright © 2015 Elsevier Ltd. All rights reserved.

A novel carbohydrate-binding surface layer protein from the hyperthermophilic archaeon Pyrococcus horikoshii.

PubMed

Goda, Shuichiro; Koga, Tomoyuki; Yamashita, Kenichiro; Kuriura, Ryo; Ueda, Toshifumi

2018-04-08

In Archaea and Bacteria, surface layer (S-layer) proteins form the cell envelope and are involved in cell protection. In the present study, a putative S-layer protein was purified from the crude extract of Pyrococcus horikoshii using affinity chromatography. The S-layer gene was cloned and expressed in Escherichia coli. Isothermal titration calorimetry analyses showed that the S-layer protein bound N-acetylglucosamine and induced agglutination of the gram-positive bacterium Micrococcus lysodeikticus. The protein comprised a 21-mer structure, with a molecular mass of 1,340 kDa, as determined using small-angle X-ray scattering. This protein showed high thermal stability, with a midpoint of thermal denaturation of 79 °C in dynamic light scattering experiments. This is the first description of the carbohydrate-binding archaeal S-layer protein and its characteristics.

Immune function of a Rab-related protein by modulating the JAK-STAT signaling pathway in the silkworm, Bombyx mori.

PubMed

Chen, Chen; Eldein, Salah; Zhou, Xiaosan; Sun, Yu; Gao, Jin; Sun, Yuxuan; Liu, Chaoliang; Wang, Lei

2018-01-01

The Rab-family GTPases mainly regulate intracellular vesicle transport, and play important roles in the innate immune response in invertebrates. However, the function and signal transduction of Rab proteins in immune reactions remain unclear in silkworms. In this study, we analyzed a Rab-related protein of silkworm Bombyx mori (BmRABRP) by raising antibodies against its bacterially expressed recombinant form. Tissue distribution analysis showed that BmRABRP mRNA and protein were high expressed in the Malpighian tubule and fat body, respectively. However, among the different stages, only the fourth instar larvae and pupae showed significant BmRABRP levels. After challenge with four pathogenic microorganisms (Escherichia coli, BmNPV, Beauveria bassiana, Micrococcus luteus), the expression of BmRABRP mRNA in the fat body was significantly upregulated. In contrast, the BmRABRP protein was significantly upregulated after infection with BmNPV, while it was downregulated by E. coli, B. bassiana, and M. luteus. A specific dsRNA was used to explore the immune function and relationship between BmRABRP and the JAK-STAT signaling pathway. After BmRABRP gene interference, significant reduction in the number of nodules and increased mortality suggested that BmRABRP plays an important role in silkworm's response to bacterial challenge. In addition, four key genes (BmHOP, BmSTAT, BmSOCS2, and BmSOCS6) of the JAK-STAT signaling pathway showed significantly altered expressions after BmRABRP silencing. BmHOP and BmSOCS6 expressions were significantly decreased, while BmSTAT and BmSOCS2 were significantly upregulated. Our results suggested that BmRABRP is involved in the innate immune response against pathogenic microorganisms through the JAK-STAT signaling pathway in silkworm. © 2017 Wiley Periodicals, Inc.

Diversity in the antibacterial potential of probiotic cultures Bacillus licheniformis MCC2514 and Bacillus licheniformis MCC2512.

PubMed

Shobharani, Papanna; Padmaja, Radhakrishnan J; Halami, Prakash M

2015-01-01

The aim of the present study was to investigate the characteristic diversity and stability of antimicrobial compounds produced by two probiotic strains of Bacillus licheniformis (MCC2514 and MCC2512). Antimicrobial compounds from the two strains notably varied, related to stability and potency. The inhibitory spectrum of B. licheniformis MCC2512 was higher than MCC2514, but, related to the effect on Micrococcus luteus ATCC9341, MCC2514 (LD50 = 450 AU ml(-1)) was more potent than MCC2512 (LD50 = 750 AU ml(-1)). The compounds were thermo-resistant and stable at a wide range of pH and exhibited considerable resistance to digestive enzymes and bile salts (anionic biological detergents), contributing to their appropriate application in various food systems. The isolate B. licheniformis MCC2512 gave a positive response to Bacillus subtilis-based biosensors BSF2470 and BS168.BS2, confirming the mode of action on the cell wall and subtilin-type, respectively. For B. licheniformis MCC2514, the mode of action was characterized by constructing B. subtilis reporters that interfered in five major biosynthetic pathways, i.e., biosynthesis of DNA, RNA, protein, the cell wall and fatty acids. B. licheniformis MCC2514 responded to the yvgS reporter, indicating it as an RNA synthesis inhibitor. Overall, the investigation reveals variability of the antimicrobial compounds from B. licheniformis of different origins and for their possible application as biopreservative agents. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

[The estimation of systemic chemotherapy treatment administered in breast cancer on lysozyme activity in tears--preliminary report].

PubMed

Wojciechowska, Katarzyna; Jurowski, Piotr; Wieckowska-Szakiel, Marzena; Rózalska, Barbara

2012-01-01

Estimation of cytostatics influence used in breast cancer treatment on lysozyme activity in human tears depend on time of treatment. 8 women were treated at the base of chemotherapy schema: docetaxel with doxorubicin and 4 women treated with schema CMF: cyclophosphamide, methotrexate, 5-fluorouracil. Lysozyme activity in tears was assessed by measurement of diameter zone of Micrococcus lysodeicticus growth inhibition. It was revealed that both chemotherapy schema caused statistically significant reduction of diameter zone of M. lysodeicticus growth inhibition, after first and second course of chemotherapy treatment. After second chemotherapy course CMF schema induced loss of lysozyme activity in patient's tears (zero mm of M. lysodeicticus diameter zone growth inhibition). Systemic chemotherapy administered in breast cancer induce reduction of lysozyme activity in tears, that may cause higher morbidity of ocular surface infections caused by Gram-positive bacteria.

Diversity and antibacterial activities of fungi derived from the Gorgonian Echinogorgia rebekka from the South China Sea.

PubMed

Wang, Ya-Nan; Shao, Chang-Lun; Zheng, Cai-Juan; Chen, Yi-Yan; Wang, Chang-Yun

2011-01-01

The diversity of symbiotic fungi associated with the gorgonian coral Echinogorgia rebekka from the Weizhou coral reef in the South China Sea was investigated. Combined with morphologic traits, ITS-rDNA sequences revealed 18 fungal strains from this gorgonian. All of the 18 fungi belonged to the phylum Ascomycota and were distributed among seven genera in five orders: Eurotiales (Aspergillus and Penicillium), Pleosporales (Alternaria), Capnodiales (Cladosporium), Trichosphaeriales (Nigrospora) and Hypocreales (Hypocrea and Nectria). Antibacterial activities of these fungal strains were investigated with five pathogenic bacteria. All of the 18 fungal strains displayed different levels of antibacterial activities, most of which exhibited moderate to high antibacterial activities to the Gram-positive pathogens Staphylococcus aureus and Micrococcus tetragenus, and showed relatively low bioactivities to other three pathogenic bacteria. Several fungal strains in the genera Penicillium and Cladosporium with strong antibacterial activities provide potential for further research on isolation of bioactive secondary metabolites.

Microbiological assay for the determination of meropenem in pharmaceutical dosage form.

PubMed

Mendez, Andreas S L; Weisheimer, Vanessa; Oppe, Tércio P; Steppe, Martin; Schapoval, Elfrides E S

2005-04-01

Meropenem is a highly active carbapenem antibiotic used in the treatment of a wide range of serious infections. The present work reports a microbiological assay, applying the cylinder-plate method, for the determination of meropenem in powder for injection. The validation method yielded good results and included linearity, precision, accuracy and specificity. The assay is based on the inhibitory effect of meropenem upon the strain of Micrococcus luteus ATCC 9341 used as the test microorganism. The results of assay were treated statistically by analysis of variance (ANOVA) and were found to be linear (r=0.9999) in the range of 1.5-6.0 microg ml(-1), precise (intra-assay: R.S.D.=0.29; inter-assay: R.S.D.=0.94) and accurate. A preliminary stability study of meropenem was performed to show that the microbiological assay is specific for the determination of meropenem in the presence of its degradation products. The degraded samples were also analysed by the HPLC method. The proposed method allows the quantitation of meropenem in pharmaceutical dosage form and can be used for the drug analysis in routine quality control.

Characterization of Cladosporols from the Marine Algal-Derived Endophytic Fungus Cladosporium cladosporioides EN-399 and Configurational Revision of the Previously Reported Cladosporol Derivatives.

PubMed

Li, Hong-Lei; Li, Xiao-Ming; Mándi, Attila; Antus, Sándor; Li, Xin; Zhang, Peng; Liu, Yang; Kurtán, Tibor; Wang, Bin-Gui

2017-10-06

Four new cladosporol derivatives, cladosporols F-I (1-4), the known cladosporol C (5), and its new epimer, cladosporol J (6), were isolated and identified from the marine algal-derived endophytic fungus Cladosporium cladosporioides EN-399. Their structures were determined by detailed interpretation of NMR and MS data, and the absolute configurations were established on the basis of TDDFT-ECD and OR calculations. The configurational assignment of cladosporols F (1) and G (2) showed that the previously reported absolute configuration of cladosporol A and all the related cladosporols need to be revised from (4'R) to (4'S). Compounds 1-6 showed antibacterial activity against Escherichia coli, Micrococcus luteus, and Vibrio harveyi with MIC values ranging from 4 to 128 μg/mL. Compound 3 showed significant cytotoxicity against A549, Huh7, and LM3 cell lines with IC 50 values of 5.0, 1.0, and 4.1 μM, respectively, and compound 5 showed activity against H446 cell line with IC 50 value of 4.0 μM.

Identification of Streptomyces sp. KH29, which produces an antibiotic substance processing an inhibitory activity against multidrug-resistant Acinetobacter baumannii.

PubMed

Lee, Keyong Ho; Kim, Kye-Woong; Rhee, Ki-Hyeong

2010-12-01

The Actinomycete strain KH29 is antagonistic to the multidrug-resistant Acinetobacter baumannii. Based on the diaminopimelic acid (DAP) type, and the morphological and physiological characteristics observed through the use of scanning electron microscopy (SEM), KH29 was confirmed as belonging to the genus Streptomyces. By way of its noted 16S rDNA nucleotide sequences, KH29 was found to have a relationship with Streptomyces cinnamonensis. The production of an antibiotic from this strain was found to be most favorable when cultured with glucose, polypeptone, and yeast extract (PY) medium for 6 days at 27 degrees C. The antibiotic produced was identified, through comparisons with reported spectral data including MS and NMR as a cyclo(L-tryptophanyl-L-tryptophanyl). Cyclo(L-Trp-L-Trp), from the PY cultures of KH29, was seen to be highly effective against 41 of 49 multidrugresistant Acinetobacter baumannii. Furthermore, cyclo(LTrp- L-Trp) had antimicrobial activity against Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, Saccharomyces cerevisiae, Aspergillus niger, and Candida albicans, However, it was ineffective against Streptomyces murinus.

[Preparation and characterization of polyhydroxyalkanoate bioplastics with antibacterial activity].

PubMed

Lou, Qiuli; Ma, Yiming; Che, Xuemei; Zhong, Jin; Sun, Xiaoxia; Zhang, Haoqian

2016-08-25

Polyhydroxyalkanoates (PHAs), as a novel class of biopolymer, are attracting more attention due to their diverse material properties and environment-independent biodegradability. Here we report the preparation of PHA exhibiting efficient antibacterial activity by embedding Nisin, a food additive generally recognized as safe, into poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) (PHBHHx), a type of PHA with high biocompatibility. We first prepared Nisin-containing PHBHHx films using solvent casting method. Confocal laser scanning microscopy analysis showed that a well-mixed integrated structure of the films with an even distribution of the Nisin particles in the PHBHHx matrices. Then the antimicrobial activity of PHBHHx/Nisin films against Micrococcus luteus was quantified on agar plate by measuring the size of inhibition zone. Cultivation in liquid media further confirmed the releasing of Nisin from the films and the long-time antibacterial activity. Results showed that the threshold of Nisin concentration for long-time and effective inhibition against bacteria growth is 25 μg/g. These results altogether establish a technological foundation for the application of PHA in biomedicine and food industry.

Comparative Pharmacokinetics of Cefquinome (Cobactan 2.5%) following Repeated Intramuscular Administrations in Sheep and Goats

PubMed Central

El-Hewaity, Mohamed; Abd El Latif, Amera

2014-01-01

The comparative pharmacokinetic profile of cefquinome was studied in sheep and goats following repeated intramuscular (IM) administrations of 2 mg/kg body weight. Cefquinome concentrations in serum were determined by microbiological assay technique using Micrococcus luteus (ATCC 9341) as test organism. Following intramuscular injection of cefquinome in sheep and goats, the disposition curves were best described by two-compartment open model in both sheep and goats. The pharmacokinetics of cefquinome did not differ significantly between sheep and goats; similar intramuscular dose rate of cefquinome should therefore be applicable to both species. On comparing the data of serum levels of repeated intramuscular injections with first intramuscular injection, it was revealed that repeated intramuscular injections of cefquinome have cumulative effect in both species sheep and goats. The in vitro serum protein-binding tendency was 15.65% in sheep and 14.42% in goats. The serum concentrations of cefquinome along 24 h after injection in this study were exceeding the MICs of different susceptible microorganisms responsible for serious disease problems. These findings indicate successful use of cefquinome in sheep and goats. PMID:26464946

Elution kinetics, antimicrobial activity, and mechanical properties of 11 different antibiotic loaded acrylic bone cement.

PubMed

Gálvez-López, Ruben; Peña-Monje, Alejandro; Antelo-Lorenzo, Ramón; Guardia-Olmedo, Juan; Moliz, Juan; Hernández-Quero, José; Parra-Ruiz, Jorge

2014-01-01

Antibiotic-loaded acrylic bone cements (ALABC) spacers are routinely used in the treatment of prosthetic joint infections. The objectives of our study were to evaluate different ALABC for elution kinetics, thermal stability, and mechanical properties. A 10 or 20% mixture (w/w) beads of medium viscosity bone cement (DePuy, Inc) and vancomycin (VAN), gentamycin (GM), daptomycin (DAP), moxifloxacin (MOX), rifampicin (RIF), cefotaxime (CTX), cefepime (FEP), amoxicillin clavulanate (AmC), ampicillin (AMP), meropenem (MER), and ertapenem (ERT) were formed and placed into wells filled with phosphate-buffered saline. Antibiotic concentrations were determined using high-performance liquid chromatography. Antimicrobial activity was tested against Micrococcus luteus ATCC 9341 or Escherichia coli ATCC 25922. AmC, AMP, and FEP concentration rapidly decreased after day 2, being almost undetectable at day 4. Sustained and high elution rates were observed with VAN, GM, MOX, and RIF for the 30-day duration of the experiment. DAP, MER, ERT, and CTX elution rates constantly decreased from day 4. All antibiotics tested retained antimicrobial activity proving thermal stability. Mechanical properties of ALABC were maintained except when RIF was used. © 2013.

Lipopeptide biosurfactants from Paenibacillus polymyxa inhibit single and mixed species biofilms.

PubMed

Quinn, Gerry A; Maloy, Aaron P; McClean, Stephen; Carney, Brian; Slater, John W

2012-01-01

Although biofilms are recognised as important in microbial colonisation, solutions to their inhibition are predominantly based on planktonic assays. These solutions have limited efficacy against biofilms. Here, a series of biofilm-orientated tests were used to identify anti-biofilm compounds from marine micro-flora. This led to the isolation of a complex of anti-biofilm compounds from an extract of Paenibacillus polymyxa (PPE). A combination of rpHPLC and mass spectrometry identified the principle components of PPE as fusaricidin B (LI-FO4b) and polymyxin D1, with minor contributions from surfactins. This complex (PPE) reduced the biofilm biomass of Bacillus subtilis, Micrococcus luteus, Pseudomonas aeruginosa, Staphylococcus aureus and Streptococcus bovis. In contrast, ampicillin was only effective against S. aureus. PPE also inhibited a self-assembling marine biofilm (SAMB) in co-incubation assays by 99.3% ± 1.9 and disrupted established SAMB by 72.4% ± 4.4, while ampicillin showed no significant reduction. The effectiveness of this complex of lipopeptides against single and multispecies biofilms suggests a future role in biofilm prevention strategies.

High-Throughput Identification of Antimicrobial Peptides from Amphibious Mudskippers

PubMed Central

You, Xinxin; Bian, Chao; Chen, Shixi; Lv, Zhao; Qiu, Limei; Shi, Qiong

2017-01-01

Widespread existence of antimicrobial peptides (AMPs) has been reported in various animals with comprehensive biological activities, which is consistent with the important roles of AMPs as the first line of host defense system. However, no big-data-based analysis on AMPs from any fish species is available. In this study, we identified 507 AMP transcripts on the basis of our previously reported genomes and transcriptomes of two representative amphibious mudskippers, Boleophthalmus pectinirostris (BP) and Periophthalmus magnuspinnatus (PM). The former is predominantly aquatic with less time out of water, while the latter is primarily terrestrial with extended periods of time on land. Within these identified AMPs, 449 sequences are novel; 15 were reported in BP previously; 48 are identically overlapped between BP and PM; 94 were validated by mass spectrometry. Moreover, most AMPs presented differential tissue transcription patterns in the two mudskippers. Interestingly, we discovered two AMPs, hemoglobin β1 and amylin, with high inhibitions on Micrococcus luteus. In conclusion, our high-throughput screening strategy based on genomic and transcriptomic data opens an efficient pathway to discover new antimicrobial peptides for ongoing development of marine drugs. PMID:29165344

High-Throughput Identification of Antimicrobial Peptides from Amphibious Mudskippers.

PubMed

Yi, Yunhai; You, Xinxin; Bian, Chao; Chen, Shixi; Lv, Zhao; Qiu, Limei; Shi, Qiong

2017-11-22

Widespread existence of antimicrobial peptides (AMPs) has been reported in various animals with comprehensive biological activities, which is consistent with the important roles of AMPs as the first line of host defense system. However, no big-data-based analysis on AMPs from any fish species is available. In this study, we identified 507 AMP transcripts on the basis of our previously reported genomes and transcriptomes of two representative amphibious mudskippers, Boleophthalmus pectinirostris (BP) and Periophthalmus magnuspinnatus (PM). The former is predominantly aquatic with less time out of water, while the latter is primarily terrestrial with extended periods of time on land. Within these identified AMPs, 449 sequences are novel; 15 were reported in BP previously; 48 are identically overlapped between BP and PM; 94 were validated by mass spectrometry. Moreover, most AMPs presented differential tissue transcription patterns in the two mudskippers. Interestingly, we discovered two AMPs, hemoglobin β1 and amylin, with high inhibitions on Micrococcus luteus . In conclusion, our high-throughput screening strategy based on genomic and transcriptomic data opens an efficient pathway to discover new antimicrobial peptides for ongoing development of marine drugs.

Antifouling potentials of eight deep-sea-derived fungi from the South China Sea.

PubMed

Zhang, Xiao-Yong; Xu, Xin-Ya; Peng, Jiang; Ma, Chun-Feng; Nong, Xu-Hua; Bao, Jie; Zhang, Guang-Zhao; Qi, Shu-Hua

2014-04-01

Marine-derived microbial secondary metabolites are promising potential sources of nontoxic antifouling agents. The search for environmentally friendly and low-toxic antifouling components guided us to investigate the antifouling potentials of eight novel fungal isolates from deep-sea sediments of the South China Sea. Sixteen crude ethyl acetate extracts of the eight fungal isolates showed distinct antibacterial activity against three marine bacteria (Loktanella hongkongensis UST950701-009, Micrococcus luteus UST950701-006 and Pseudoalteromonas piscida UST010620-005), or significant antilarval activity against larval settlement of bryozoan Bugula neritina. Furthermore, the extract of Aspergillus westerdijkiae DFFSCS013 displayed strong antifouling activity in a field trial lasting 4 months. By further bioassay-guided isolation, five antifouling alkaloids including brevianamide F, circumdatin F and L, notoamide C, and 5-chlorosclerotiamide were isolated from the extract of A. westerdijkiae DFFSCS013. This is the first report about the antifouling potentials of metabolites of the deep-sea-derived fungi from the South China Sea, and the first stage towards the development of non- or low-toxic antifouling agents from deep-sea-derived fungi.

Synthesis, pharmacological activities and molecular docking studies of pyrazolyltriazoles as anti-bacterial and anti-inflammatory agents.

PubMed

Dayakar, Cherupally; Kumar, Buddana Sudheer; Sneha, Galande; Sagarika, Gudem; Meghana, Koneru; Ramakrishna, Sistla; Prakasham, Reddy Shetty; China Raju, Bhimapaka

2017-10-15

A series of novel pyrazolyl alcohols (5a-h), pyrazolyl azides (6a-h), and pyrazolyltriazoles (8a-h, 10a-p and 12a-l) were prepared and evaluated for their bioactivity (anti-bacterial and anti-inflammatory) profile. The compound 5c displayed the potent anti-bacterial activity against Micrococcus luteus (MIC 3.9 and MBC 7.81µg/mL). In vitro anti-inflammatory activity data denoted that compound 8b is effective among the tested compounds against IL-6 (IC 50 6.23μM). Docking analysis of compounds 5f, 8a-b, 8e-f and 8h displayed high binding energies for the compounds 8a-b and 8h towards TNF-α dimer (2AZ5 protein) and IL-6 (1ALU protein). In vivo anti-inflammatory activity of compounds 8b and 8h with respect to LPS induced mice model indicated that compound 8h showed significant reduction in TNF-α. Copyright © 2017 Elsevier Ltd. All rights reserved.

Ecological effects of a deodorant and a plain soap upon human skin bacteria.

PubMed Central

Bibel, D. J.

1977-01-01

The effects of a commercial trichlorocarbanilide-containing deodorant soap and a commercial plain soap upon the cutaneous flora of individuals were compared. Using a cross-over design, 21 volunteers (10 women and 11 men) washed their forearms at least once a day with one soap for 3 weeks and then switched soaps for another 4 weeks use. By analysis of variance no significant difference in total colony counts was noted among individuals in their use of the two soaps. With the exception of individual variation, neither sequence of use, sex, nor any combination was influential. However, in 20 of 21 subjects an alteration in the composition of skin flora was observed. The deodorant soap, which in six cases increased total flora, tended to reduce or eliminate diphtheroids in 12 to 17 carriers (71%). Fewer kinds of bacteria were also noted. More Staphylococcus epidermidis was seen with the plain soap, but washing with the deodorant soap seemed to favour Acinetobacter calcoaceticus and Micrococcus luteus. The impact of this alteration and the use of total counts to measure effectiveness of deodorant soaps were brought into question. PMID:264493

Bombyx mori Serpin6 regulates prophenoloxidase activity and the expression of antimicrobial proteins.

PubMed

Li, Bing; Yu, Hai-Zhong; Ye, Chong-Jun; Ma, Yan; Li, Xing; Fan, Tao; Chen, Fu-Sheng; Xu, Jia-Ping

2017-04-30

Serpins are a family of serine protease inhibitors that are found widely in insects. They play an important role in insect physiological responses, such as innate immunity and development. In this study, we obtained the Bombyx mori serpin6 (BmSerpin6) sequence from National Center for Biotechnology Information (NCBI) and the silkworm genome database (SilkDB). Reverse transcription PCR (RT-PCR) results showed that BmSerpin6 was expressed highly in hemocytes, the midgut, and the fat body. After challenging with Micrococcus luteus (Mi) and Serratia marcescens (Sm), the BmSerpin6 expression level was induced significantly. Transcript levels of gloverin2 and prophenoloxidase (PPO) activity were reduced significantly in the fat body and hemocytes after injecting the recombinant BmSerpin6 protein into silkworm larvae. A BmSerpin6 recombinant plasmid (BmSerpin6-pAC 5.1) was constructed successfully and transfected into Drosophila S2 cells, which resulted in significantly reduced expression of the drosomycin protein. These results indicated that BmSerpin6 might regulate silkworm immune responses. Copyright © 2017 Elsevier B.V. All rights reserved.

The constituents of essential oil: antimicrobial and antioxidant activity of Micromeria congesta Boiss. & Hausskn. ex Boiss. from East Anatolia.

PubMed

Herken, Emine Nur; Celik, Ali; Aslan, Mustafa; Aydınlık, Nilüfer

2012-09-01

The chemical composition, antimicrobial activity, total phenol content, total antioxidant activity, and total oxidant status of the essential oil from Micromeria congesta Boiss. & Hausskn. ex Boiss. were investigated. Steam distillation was used to obtain the essential oil, and the chemical analyses were performed by gas chromatography-mass spectrometry. The antimicrobial activity was tested by an agar disc diffusion method against the tested microorganisms: Bacillus subtilis NRRL B-744, Bacillus cereus NRRL B-3711, Staphylococcus aureus ATCC 12598, S. aureus ATCC 25923, S. aureus ATCC 25933, Escherichia coli 0157H7, E. coli ATCC25922, Micrococcus luteus NRLL B-4375, Enterococcus faecalis ATCC 19433, Proteus vulgaris RSKK 96026, and Yersinia enterecolitica RSKK 1501. The major compounds found in volatiles of M. congesta were piperitone oxide, linalool oxide, veratrole, pulegone, dihydro carvone, naphthalene, iso-menthone, para-menthone, and cyclohexanone. Compared to that of reference antibiotics, the antibacterial activity of the essential oil is considered as significant. Results showed that M. congesta has the potential for being used in food and medicine depending on its antioxidant and antibacterial activity.

Evaluation of dermal wound healing activity and in vitro antibacterial and antioxidant activities of a new exopolysaccharide produced by Lactobacillus sp.Ca6.

PubMed

Trabelsi, Imen; Ktari, Naourez; Ben Slima, Sirine; Triki, Mehdi; Bardaa, Sana; Mnif, Hela; Ben Salah, Riadh

2017-10-01

The present study aimed to evaluate the in vitro antibacterial and antioxidant activities and the in vivo wound healing performance of a noval exopolysaccharides (EPS-Ca 6 ) produced by Lactobacillus sp.Ca 6 strain. The results showed that EPS-Ca 6 had a potential antioxidant activity determined through four different assays: DPPH scavenging activity, reducing power, β-carotene bleaching by linoleic acid assay, and Metal chelating activities. It also exhibited significant antibacterial activity against pathogenic bacteria Salmonella enterica and Micrococcus luteus. The wound healing activity of the EPS-Ca 6 , using excision wound model in rats, showed that this novel EPS accelerated significantly wound healing activity as compared to the control group, and a total closure was achieved after 14days of wound induction. Furthermore, histological examination of biopsies showed fully re-epithelialized wound with a complete epidermal regeneration. Overall the finding indicates that the EPS-Ca 6 might be useful as a wound healing agent in modern medicine. Copyright © 2017 Elsevier B.V. All rights reserved.

Standoff detection and classification of bacteria by multispectral laser-induced fluorescence

NASA Astrophysics Data System (ADS)

Duschek, Frank; Fellner, Lea; Gebert, Florian; Grünewald, Karin; Köhntopp, Anja; Kraus, Marian; Mahnke, Peter; Pargmann, Carsten; Tomaso, Herbert; Walter, Arne

2017-04-01

Biological hazardous substances such as certain fungi and bacteria represent a high risk for the broad public if fallen into wrong hands. Incidents based on bio-agents are commonly considered to have unpredictable and complex consequences for first responders and people. The impact of such an event can be minimized by an early and fast detection of hazards. The presented approach is based on optical standoff detection applying laser-induced fluorescence (LIF) on bacteria. The LIF bio-detector has been designed for outdoor operation at standoff distances from 20 m up to more than 100 m. The detector acquires LIF spectral data for two different excitation wavelengths (280 and 355 nm) which can be used to classify suspicious samples. A correlation analysis and spectral classification by a decision tree is used to discriminate between the measured samples. In order to demonstrate the capabilities of the system, suspensions of the low-risk and non-pathogenic bacteria Bacillus thuringiensis, Bacillus atrophaeus, Bacillus subtilis, Brevibacillus brevis, Micrococcus luteus, Oligella urethralis, Paenibacillus polymyxa and Escherichia coli (K12) have been investigated with the system, resulting in a discrimination accuracy of about 90%.

Study of Bacterial Samples Using Laser Induced Breakdown Spectroscopy

NASA Astrophysics Data System (ADS)

W, A. Farooq; M, Atif; W, Tawfik; M, S. Alsalhi; Z, A. Alahmed; M, Sarfraz; J, P. Singh

2014-12-01

Laser-induced breakdown spectroscopy (LIBS) technique has been applied to investigate two different types of bacteria, Escherichia coli (B1) and Micrococcus luteus (B2) deposited on glass slides using Spectrolaser 7000. LIBS spectra were analyzed using spectrolaser software. LIBS spectrum of glass substrate was compared with bacteria spectra. Ca, Mg, Na, K, P, S, Cl, Fe, Al, Mn, Cu, C, H and CN-band appeared in bacterial samples in air. Two carbon lines at 193.02 nm, 247.88 nm and one hydrogen line at 656.28 nm with intensity ratios of 1.9, 1.83 and 1.53 appeared in bacterial samples B1 and B2 respectively. Carbon and hydrogen are the important components of the bio-samples like bacteria and other cancer cells. Investigation on LIBS spectra of the samples in He and Ar atmospheres is also presented. Ni lines appeared only in B2 sample in Ar atmosphere. From the present experimental results we are able to show that LIBS technique has a potential in the identification and discrimination of different types of bacteria.

Synthesis, structural characterisation and antibacterial activity of Ag+-doped fluorapatite nanomaterials prepared by neutralization method

NASA Astrophysics Data System (ADS)

Stanić, Vojislav; Radosavljević-Mihajlović, Ana S.; Živković-Radovanović, Vukosava; Nastasijević, Branislav; Marinović-Cincović, Milena; Marković, Jelena P.; Budimir, Milica D.

2015-05-01

Silver doped fluorapatite nanopowders were synthesised by neutralization method, which consists of dissolving Ag2O in solution of HF and H3PO4 and addition to suspension of Ca(OH)2. The powder XRD, SEM and FTIR studies indicated the formation of a fluorapatite nanomaterials with average length of the particles is about 80 nm and a width of about 15 nm. The FTIR studies show that carbonate content in samples is very small and carbonte ions substitute both phosphate and hydroxyl groups in the crystal structure of samples, forming AB-type fluorapatite. Antibacterial studies have demonstrated that all Ag+-doped fluorapatite samples exhibit bactericidal effect against pathogens: Staphylococcus aureus, Micrococcus luteus and Kllebsiela pneumoniae. Antibacterial activity increased with the increase of Ag+ in the samples. The atomic force microscopy studies revealed extensive damage to the bacterial cell envelops in the presence of Ag+-doped fluorapatite particles which may lead to their death. The synthesized Ag+-doped fluorapatite nanomaterials are promising as antibacterial biomaterials in orthopedics and dentistry.

Effect of flash-heat treatment on antimicrobial activity of breastmilk.

PubMed

Chantry, Caroline J; Wiedeman, Jean; Buehring, Gertrude; Peerson, Janet M; Hayfron, Kweku; K'Aluoch, Okumu; Lonnerdal, Bo; Israel-Ballard, Kiersten; Coutsoudis, Anna; Abrams, Barbara

2011-06-01

The World Health Organization recommends human immunodeficiency virus (HIV)-positive mothers in resource-poor regions heat-treat expressed breastmilk during periods of increased maternal-to-child transmission risk. Flash-heat, a "low tech" pasteurization method, inactivates HIV, but effects on milk protein bioactivity are unknown. The objectives were to measure flash-heat's effect on antimicrobial properties of lactoferrin, lysozyme, and whole milk and on the digestive resistance of lactoferrin and lysozyme. Flash-heated and unheated breastmilk aliquots from HIV-positive mothers in South Africa were "spiked" with Staphylococcus aureus and Escherichia coli and then cultured for 0, 3, and 6 hours. Lysozyme and lactoferrin activities were determined by lysis of Micrococcus luteus cells and inhibition of enteropathogenic E. coli, respectively, measured spectrophotometrically. Percentages of proteins surviving in vitro digestion, lactoferrin and lysozyme activity, and bacteriostatic activity of whole milk in heated versus unheated samples were compared. There was no difference in rate of growth of E. coli or S. aureus in flash-heated versus unheated whole milk (p = 0.61 and p = 0.96, respectively). Mean (95% confidence interval) antibacterial activity of lactoferrin was diminished 11.1% (7.8%, 14.3%) and that of lysozyme by up to 56.6% (47.1%, 64.5%) by flash-heat. Digestion of lysozyme was unaffected (p = 0.12), but 25.4% less lactoferrin survived digestion (p < 0.0001). In summary, flash-heat resulted in minimally decreased lactoferrin and moderately decreased lysozyme bioactivity, but bacteriostatic activity of whole milk against representative bacteria was unaffected. This suggests flash-heated breastmilk likely has a similar profile of resistance to bacterial contamination as that of unheated milk. Clinical significance of the decreased bioactivity should be tested in clinical trials.

Effect of Flash-Heat Treatment on Antimicrobial Activity of Breastmilk

PubMed Central

Wiedeman, Jean; Buehring, Gertrude; Peerson, Janet M.; Hayfron, Kweku; K'Aluoch, Okumu; Lonnerdal, Bo; Israel-Ballard, Kiersten; Coutsoudis, Anna; Abrams, Barbara

2011-01-01

Abstract Background and Objectives The World Health Organization recommends human immunodeficiency virus (HIV)-positive mothers in resource-poor regions heat-treat expressed breastmilk during periods of increased maternal-to-child transmission risk. Flash-heat, a “low tech” pasteurization method, inactivates HIV, but effects on milk protein bioactivity are unknown. The objectives were to measure flash-heat's effect on antimicrobial properties of lactoferrin, lysozyme, and whole milk and on the digestive resistance of lactoferrin and lysozyme. Methods Flash-heated and unheated breastmilk aliquots from HIV-positive mothers in South Africa were “spiked” with Staphylococcus aureus and Escherichia coli and then cultured for 0, 3, and 6 hours. Lysozyme and lactoferrin activities were determined by lysis of Micrococcus luteus cells and inhibition of enteropathogenic E. coli, respectively, measured spectrophotometrically. Percentages of proteins surviving in vitro digestion, lactoferrin and lysozyme activity, and bacteriostatic activity of whole milk in heated versus unheated samples were compared. Results There was no difference in rate of growth of E. coli or S. aureus in flash-heated versus unheated whole milk (p = 0.61 and p = 0.96, respectively). Mean (95% confidence interval) antibacterial activity of lactoferrin was diminished 11.1% (7.8%, 14.3%) and that of lysozyme by up to 56.6% (47.1%, 64.5%) by flash-heat. Digestion of lysozyme was unaffected (p = 0.12), but 25.4% less lactoferrin survived digestion (p < 0.0001). Conclusions In summary, flash-heat resulted in minimally decreased lactoferrin and moderately decreased lysozyme bioactivity, but bacteriostatic activity of whole milk against representative bacteria was unaffected. This suggests flash-heated breastmilk likely has a similar profile of resistance to bacterial contamination as that of unheated milk. Clinical significance of the decreased bioactivity should be tested in clinical trials. PMID:21091243

Compositional pressure and translational selection determine codon usage in the extremely GC-poor unicellular eukaryote Entamoeba histolytica.

PubMed

Romero, H; Zavala, A; Musto, H

2000-01-25

It is widely accepted that the compositional pressure is the only factor shaping codon usage in unicellular species displaying extremely biased genomic compositions. This seems to be the case in the prokaryotes Mycoplasma capricolum, Rickettsia prowasekii and Borrelia burgdorferi (GC-poor), and in Micrococcus luteus (GC-rich). However, in the GC-poor unicellular eukaryotes Dictyostelium discoideum and Plasmodium falciparum, there is evidence that selection, acting at the level of translation, influences codon choices. This is a twofold intriguing finding, since (1) the genomic GC levels of the above mentioned eukaryotes are lower than the GC% of any studied bacteria, and (2) bacteria usually have larger effective population sizes than eukaryotes, and hence natural selection is expected to overcome more efficiently the randomizing effects of genetic drift among prokaryotes than among eukaryotes. In order to gain a new insight about this problem, we analysed the patterns of codon preferences of the nuclear genes of Entamoeba histolytica, a unicellular eukaryote characterised by an extremely AT-rich genome (GC = 25%). The overall codon usage is strongly biased towards A and T in the third codon positions, and among the presumed highly expressed sequences, there is an increased relative usage of a subset of codons, many of which are C-ending. Since an increase in C in third codon positions is 'against' the compositional bias, we conclude that codon usage in E. histolytica, as happens in D. discoideum and P. falciparum, is the result of an equilibrium between compositional pressure and selection. These findings raise the question of why strongly compositionally biased eukaryotic cells may be more sensitive to the (presumed) slight differences among synonymous codons than compositionally biased bacteria.

Rhizostabilization of metals in soils using Lupinus luteus inoculated with the metal resistant rhizobacterium Serratia sp. MSMC541.

PubMed

El Aafi, N; Brhada, F; Dary, M; Maltouf, A Filali; Pajuelo, E

2012-03-01

The aim of this work was to test Lupinus luteus plants, inoculated with metal resistant rhizobacteria, in order to phytostabilise metals in contaminated soils. The resistance to heavy metals of strains isolated from nodules of Lupinus plants was evaluated. The strain MSMC541 showed multi-resistance to several metals (up to 13.3 mM As, 2.2 mM Cd, 2.3 mM Cu, 9 mM Pb and 30 mM Zn), and it was selected for further characterization. Furthermore, this strain was able to biosorb great amounts of metals in cell biomass. 16S rDNA sequencing positioned this strain within the genus Serratia. The presence of arsenic resistance genes was confirmed by southern blot and PCR amplification. A rhizoremediation pot experiment was conducted using Lupinus luteus grown on sand supplemented with heavy metals and inoculated with MSMC541. Plant growth parameters and metal accumulation were determined in inoculated vs. non-inoculated Lupinus luteus plants. The results showed that inoculation with MSMC541 improved the plant tolerance to metals. At the same time, metal translocation to the shoot was significantly reduced upon inoculation. These results suggest that Lupinus luteus plants, inoculated with the metal resistant strain Serratia sp. MSMC541, have a great potential for phytostabilization of metal contaminated soils.

Community structure and PAH ring-hydroxylating dioxygenase genes of a marine pyrene-degrading microbial consortium.

PubMed

Gallego, Sara; Vila, Joaquim; Tauler, Margalida; Nieto, José María; Breugelmans, Philip; Springael, Dirk; Grifoll, Magdalena

2014-07-01

Marine microbial consortium UBF, enriched from a beach polluted by the Prestige oil spill and highly efficient in degrading this heavy fuel, was subcultured in pyrene minimal medium. The pyrene-degrading subpopulation (UBF-Py) mineralized 31 % of pyrene without accumulation of partially oxidized intermediates indicating the cooperation of different microbial components in substrate mineralization. The microbial community composition was characterized by culture dependent and PCR based methods (PCR-DGGE and clone libraries). Molecular analyses showed a highly stable community composed by Alphaproteobacteria (84 %, Breoghania, Thalassospira, Paracoccus, and Martelella) and Actinobacteria (16 %, Gordonia). The members of Thalasosspira and Gordonia were not recovered as pure cultures, but five additional strains, not detected in the molecular analysis, that classified within the genera Novosphingobium, Sphingopyxis, Aurantimonas (Alphaproteobacteria), Alcanivorax (Gammaproteobacteria) and Micrococcus (Actinobacteria), were isolated. None of the isolates degraded pyrene or other PAHs in pure culture. PCR amplification of Gram-positive and Gram-negative dioxygenase genes did not produce results with any of the cultured strains. However, sequences related to the NidA3 pyrene dioxygenase present in mycobacterial strains were detected in UBF-Py consortium, suggesting the representative of Gordonia as the key pyrene degrader, which is consistent with a preeminent role of actinobacteria in pyrene removal in coastal environments affected by marine oil spills.

Yellow lupin (Lupinus luteus L.) transcriptome sequencing: molecular marker development and comparative studies

PubMed Central

2012-01-01

Background Yellow lupin (Lupinus luteus L.) is a minor legume crop characterized by its high seed protein content. Although grown in several temperate countries, its orphan condition has limited the generation of genomic tools to aid breeding efforts to improve yield and nutritional quality. In this study, we report the construction of 454-expresed sequence tag (EST) libraries, carried out comparative studies between L. luteus and model legume species, developed a comprehensive set of EST-simple sequence repeat (SSR) markers, and validated their utility on diversity studies and transferability to related species. Results Two runs of 454 pyrosequencing yielded 205 Mb and 530 Mb of sequence data for L1 (young leaves, buds and flowers) and L2 (immature seeds) EST- libraries. A combined assembly (L1L2) yielded 71,655 contigs with an average contig length of 632 nucleotides. L1L2 contigs were clustered into 55,309 isotigs. 38,200 isotigs translated into proteins and 8,741 of them were full length. Around 57% of L. luteus sequences had significant similarity with at least one sequence of Medicago, Lotus, Arabidopsis, or Glycine, and 40.17% showed positive matches with all of these species. L. luteus isotigs were also screened for the presence of SSR sequences. A total of 2,572 isotigs contained at least one EST-SSR, with a frequency of one SSR per 17.75 kbp. Empirical evaluation of the EST-SSR candidate markers resulted in 222 polymorphic EST-SSRs. Two hundred and fifty four (65.7%) and 113 (30%) SSR primer pairs were able to amplify fragments from L. hispanicus and L. mutabilis DNA, respectively. Fifty polymorphic EST-SSRs were used to genotype a sample of 64 L. luteus accessions. Neighbor-joining distance analysis detected the existence of several clusters among L. luteus accessions, strongly suggesting the existence of population subdivisions. However, no clear clustering patterns followed the accession’s origin. Conclusion L. luteus deep transcriptome sequencing will facilitate the further development of genomic tools and lupin germplasm. Massive sequencing of cDNA libraries will continue to produce raw materials for gene discovery, identification of polymorphisms (SNPs, EST-SSRs, INDELs, etc.) for marker development, anchoring sequences for genome comparisons and putative gene candidates for QTL detection. PMID:22920992

Yellow lupin (Lupinus luteus L.) transcriptome sequencing: molecular marker development and comparative studies.

PubMed

Parra-González, Lorena B; Aravena-Abarzúa, Gabriela A; Navarro-Navarro, Cristell S; Udall, Joshua; Maughan, Jeff; Peterson, Louis M; Salvo-Garrido, Haroldo E; Maureira-Butler, Iván J

2012-08-24

Yellow lupin (Lupinus luteus L.) is a minor legume crop characterized by its high seed protein content. Although grown in several temperate countries, its orphan condition has limited the generation of genomic tools to aid breeding efforts to improve yield and nutritional quality. In this study, we report the construction of 454-expresed sequence tag (EST) libraries, carried out comparative studies between L. luteus and model legume species, developed a comprehensive set of EST-simple sequence repeat (SSR) markers, and validated their utility on diversity studies and transferability to related species. Two runs of 454 pyrosequencing yielded 205 Mb and 530 Mb of sequence data for L1 (young leaves, buds and flowers) and L2 (immature seeds) EST- libraries. A combined assembly (L1L2) yielded 71,655 contigs with an average contig length of 632 nucleotides. L1L2 contigs were clustered into 55,309 isotigs. 38,200 isotigs translated into proteins and 8,741 of them were full length. Around 57% of L. luteus sequences had significant similarity with at least one sequence of Medicago, Lotus, Arabidopsis, or Glycine, and 40.17% showed positive matches with all of these species. L. luteus isotigs were also screened for the presence of SSR sequences. A total of 2,572 isotigs contained at least one EST-SSR, with a frequency of one SSR per 17.75 kbp. Empirical evaluation of the EST-SSR candidate markers resulted in 222 polymorphic EST-SSRs. Two hundred and fifty four (65.7%) and 113 (30%) SSR primer pairs were able to amplify fragments from L. hispanicus and L. mutabilis DNA, respectively. Fifty polymorphic EST-SSRs were used to genotype a sample of 64 L. luteus accessions. Neighbor-joining distance analysis detected the existence of several clusters among L. luteus accessions, strongly suggesting the existence of population subdivisions. However, no clear clustering patterns followed the accession's origin. L. luteus deep transcriptome sequencing will facilitate the further development of genomic tools and lupin germplasm. Massive sequencing of cDNA libraries will continue to produce raw materials for gene discovery, identification of polymorphisms (SNPs, EST-SSRs, INDELs, etc.) for marker development, anchoring sequences for genome comparisons and putative gene candidates for QTL detection.

Isolation, biochemical characterization, and cloning of a bacteriocin from the poultry-associated Staphylococcus aureus strain CH-91.

PubMed

Wladyka, Benedykt; Wielebska, Katarzyna; Wloka, Marcin; Bochenska, Oliwia; Dubin, Grzegorz; Dubin, Adam; Mak, Pawel

2013-08-01

Staphylococcus aureus strain CH-91, isolated from a broiler chicken with atopic dermatitis, has a highly proteolytic phenotype that is correlated with the disease. We describe the isolation and biochemical and molecular characterization of the AI-type lantibiotic BacCH91 from S. aureus CH-91 culture medium. The bacteriocin was purified using a three-stage procedure comprising precipitation with ammonium sulfate, extraction with organic solvents, and reversed-phase HPLC. The BacCH91 peptide is thermostable and highly resistant to cleavage by both prokaryotic and eukaryotic peptidases. The MIC for the Gram-positive bacteria ranged from 2.5 nM for Microococcus luteus through 1.3-6.0 μM for staphylococcal strains up to more than 100 μM for Lactococcus lactis. BacCH91 was ineffective against the Gram-negative strains tested at the maximal concentration (100 μM). The amino acid sequence of BacCH91 is similar to that of epidermin and gallidermin. The encoding gene (bacCH91) occurred in two allelic variants distinguishable in the restriction fragment length polymorphism assay. Variant I, identified in S. aureus CH-91, dominated in S. aureus strains of poultry origin, although strains with variant II were also identified in this group. S. aureus strains of human origin were characterized exclusively by variant II.

Multiphoton near-infrared femtosecond laser pulse-induced DNA damage with and without the photosensitizer proflavine.

PubMed

Shafirovich, V; Dourandin, A; Luneva, N P; Singh, C; Kirigin, F; Geacintov, N E

1999-03-01

The excitation of pBr322 supercoiled plasmid DNA with intense near-IR 810 nm fs laser pulses by a simultaneous multiphoton absorption mechanism results in single-strand breaks after treatment of the irradiated samples with Micrococcus luteus UV endonuclease. This enzyme cleaves DNA strands at sites of cyclobutane dimers that are formed by the simultaneous absorption of three (or more) 810 nm IR photons (pulse width approximately 140 fs, 76 MHz pulse repetition, average power output focused through 10x microscope objective is approximately 1.2 MW/cm2). Direct single-strand breaks (without treatment with M. luteus) were not observed under these conditions. However, in the presence of 6 microM of the intercalator proflavine (PF), both direct single- and double-strand breaks are observed under conditions where substantial fractions of undamaged supercoiled DNA molecules are still present. The fraction of direct double-strand breaks is 30 +/- 5% of all measurable strand cleavage events, is independent of dosage (up to 6.4 GJ/cm2) and is proportional to In, where I is the average power/area of the 810 nm fs laser pulses, and n = 3 +/- 1. The nicking of two DNA strands in the immediate vicinity of the excited PF molecules gives rise to this double-strand cleavage. In contrast, excitation of the same samples under low-power, single-photon absorption conditions (approximately 400-500 nm) gives rise predominantly to single-strand breaks, but some double-strand breaks are observed at the higher dosages. Thus, single-photon excitation with 400-500 nm light and multiphoton activation of PF by near-IR fs laser pulses produces different distributions of single- and double-strand breaks. These results suggest that DNA strand cleavage originates from unrelaxed, higher excited states when PF is excited by simultaneous IR multiphoton absorption processes.

ORIGIN OF PALMITIC ACID CARBON IN PALMITATES FORMED FROM HEXADECANE-1-C14 AND TETRADECANE-1-C14 BY MICROCOCCUS CERIFICANS

PubMed Central

Finnerty, W. R.; Kallio, R. E.

1964-01-01

Finnerty, W. R. (University of Iowa, Iowa City), and R. E. Kallio. Origin of palmitic acid carbon in palmitates formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans. J. Bacteriol. 87:1261–1265. 1964.—Degradation of the palmitic acid moiety of cetyl palmitate and myristyl palmitate formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans was carried out. The patterns of C14 labeling in palmitic acid from cetyl palmitate showed that hexadecane is oxidized at the C1 position, and cetyl alcohol and palmitic acid thus formed are directly esterified. Palmitic acid arising from tetradecane and esterified to tetradecanol appeared to have been synthesized by the addition of two carbon atoms to an existing 14-carbon atom skeleton. Considerable mixing of C14 occurred in the C1 and C2 positions of palmitic acid thus synthesized. PMID:14188700

Antimicrobial activity, cytotoxicity, and phytochemical screening of Voacanga globosa (Blanco) Merr. leaf extract (Apocynaceae).

PubMed

Vital, Pierangeli G; Rivera, Windell L

2011-10-01

To determine the antibacterial, antifungal, antiprotozoal, cytotoxic, and phytochemical properties of ethanol extracts of leaves of Voacanga globosa (Blanco) Merr. (V. globosa). The extracts were tested against bacteria and fungus through disc diffusion assay; against protozoa through growth curve determination, antiprotozoal and cytotoxicity assays. The extract revealed antibacterial activities, inhibiting the growth of Staphylococcus aureus, Bacillus cereus, Pseudomonas aeruginosa, Micrococcus luteus, and Salmonella typhimurium. Antifungal assay showed that it inhibited Candida albicans. The antiprotozoal assay against Trichomonas vaginalis and Entamoeba histolytica showed that V. globosa can inhibit the parasites, wherein the action can be comparable to metronidazole. With the in situ cell death detection kit, Trichomonas vaginalis and Entamoeba histolytica exposed to V. globosa leaf extract was observed to fluoresce simultaneously in red and yellow signals signifying apoptotic-like changes. Preliminary phytochemical screening revealed the chemical composition of plant extract containing alkaloids, saponins, 2-deoxysugars, and hydrolysable tannins. Thus, this study provides scientific evidence on the traditional use of V. globosa leaf extract in treating microbial diseases. Further, the leaf extract can possibly be used to produce alternative forms of antimicrobials. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

Bacteria associated with Amblyomma cajennense tick eggs

PubMed Central

Machado-Ferreira, Erik; Vizzoni, Vinicius Figueiredo; Piesman, Joseph; Gazeta, Gilberto Salles; Soares, Carlos Augusto Gomes

2015-01-01

Abstract Ticks represent a large group of pathogen vectors that blood feed on a diversity of hosts. In the Americas, the Ixodidae ticks Amblyomma cajennense are responsible for severe impact on livestock and public health. In the present work, we present the isolation and molecular identification of a group of culturable bacteria associated with A. cajennense eggs from females sampled in distinct geographical sites in southeastern Brazil. Additional comparative analysis of the culturable bacteria from Anocentor nitens, Rhipicephalus sanguineus and Ixodes scapularis tick eggs were also performed. 16S rRNA gene sequence analyses identified 17 different bacterial types identified as Serratia marcescens, Stenotrophomonas maltophilia, Pseudomonas fluorescens, Enterobacter spp., Micrococcus luteus, Ochrobactrum anthropi, Bacillus cereus and Staphylococcus spp., distributed in 12 phylogroups. Staphylococcus spp., especially S. sciuri, was the most prevalent bacteria associated with A. cajennense eggs, occurring in 65% of the samples and also frequently observed infecting A. nitens eggs. S. maltophilia, S. marcescens and B. cereus occurred infecting eggs derived from specific sampling sites, but in all cases rising almost as pure cultures from infected A. cajennense eggs. The potential role of these bacterial associations is discussed and they possibly represent new targets for biological control strategies of ticks and tick borne diseases. PMID:26537602

Hexapeptide Derivatives of Glycopeptide Antibiotics: Tools for Mechanism of Action Studies

PubMed Central

Allen, Norris E.; LeTourneau, Deborah L.; Hobbs, Joe N.; Thompson, Richard C.

2002-01-01

Hexapeptide (des-N-methylleucyl) derivatives of LY264826 were prepared in order to examine further the role of N-substituted hydrophobic side chains in defining the mechanisms of action of semisynthetic glycopeptide antibiotics. The hexapeptide of LY264826 binds to the cell wall intermediate analog l-Lys-d-Ala-d-Ala with a 100-fold lower affinity than LY264826 and inhibits Micrococcus luteus almost 200-fold more poorly than LY264826 does. Alkylation of the 4-epi-vancosamine moiety of the disaccharide significantly enhanced the antibacterial activity of the hexapeptide. Alkylation did not affect the binding affinity for d-alanyl-d-alanine residues; however, it did enhance dimerization 7,000-fold and enhanced binding to bacterial membrane vesicles noticeably compared with the levels of dimerization and binding for the unsubstituted hexapeptide. The findings from this study complement those presented in an earlier report (N. E. Allen, D. L. LeTourneau, and J. N. Hobbs, Jr., J. Antibiot. 50:677-684, 1997) and are consistent with the conclusion that the enhanced antibacterial activities of semisynthetic glycopeptide antibiotics derive from the ability of the hydrophobic side chain to markedly affect both dimerization and binding to bacterial membranes. PMID:12121903

A new laboratory cultivation of Paramecium bursaria using non-pathogenic bacteria strains.

PubMed

Bator, Tomasz

2010-01-01

In most studies dealing with the laboratory cultivation of paramecia (Paramecium bursaria), Klebsiella pneumoniae bacteria are used to inoculate the medium. However, Klebsiella pneumoniae is a typical pathogen, and its use is always associated with a risk of infection. The aim of the present research was to examine non-pathogenic bacteria strains as components of the medium for Paramecium bursaria. The paramecia were incubated on lettuce infusions bacterized with different bacteria strains: Bacillus subtilis DSM 10, Bacillus megaterium DSM 32, Escherichia coli DSM 498, Micrococcus luteus DSM 348. A strain derived from the natural habitat of Paramecium bursaria was used as the control one. Experiments were conducted under constant light and in the dark. Paramecia cells were counted under a stereomicroscope on consecutive days of incubation. The obtained results show that the most intensive growth of Paramecium bursaria occurs in the presence of Escherichia coli DSM 498. The use of this strain as a component of the medium allows one to obtain a high number of ciliates regardless of the light conditions. It can be concluded that the Paramecium bursaria cultivation procedure can be modified by using the non-pathogenic bacteria strain Escherichia coli DSM 498 instead of Klebsiella pneumoniae.

Antimicrobial and free radical scavenging activities of five Palestinian medicinal plants.

PubMed

Qabaha, Khaled Ibraheem

2013-01-01

Extracts from five indigenous Palestinian medicinal plants including Rosmarinus officinalis, Pisidium guajava, Punica granatum peel, grape seeds and Teucrium polium were investigated for antimicrobial and free radical scavenging activities against eight microorganisms, using well diffusion method. The microorganisms included six bacterial isolates (i.e. Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginos, Klebsiella pneumonia, Bacillus subtilis and Micrococcus luteus) and two fungal isolates (i.e. Candida albicans and Aspergillus niger). A standard antioxidant assay was performed on the plant extracts to assess their capability in scavenging 2,2-diphenyl-1-picrylhydrazyl (DPPH). Of the five tested plant extract, only Rosmarinus offcinalis extract contained significant antimicrobial activity against all eight microbial isolates including Pseudomonas aeruginosa. Extracts from other four plants exhibited a variable antimicrobial activity against all microorganisms, except Pseudomonas aeruginosa. Significant antioxidant activity was detected in all plant extracts. However, extracts from Pisidium guajava leaves contained significantly higher antioxidant activity compared to the other extracts tested. The antimicrobial and scavenging activities detected in this in vitro study in extracts from the five Palestinian medicinal plants suggest that further study is needed to identify active compounds to target diseases caused by a wide-spectrum pathogens.

Cloning and heterologous expression of plnE, -F, -J and -K genes derived from soil metagenome and purification of active plantaricin peptides.

PubMed

Pal, Gargi; Srivastava, Sheela

2014-02-01

Plantaricin gene-specific primers were used to obtain plnE, -F, -J and -K structural gene amplicons from soil metagenome. These amplicons were cloned and expressed in pET32a (+) vector in Escherichia coli BL21 (DE3). PlnE, -F, -J and -K peptides were expressed as His-tagged-fusion proteins and were separated by Ni(2+) -chelating affinity chromatography. The peptides were released from the fusion by enterokinase cleavage and separated from the carrier thioredoxin. The cleaved peptides were further analysed for antimicrobial activity and found to be active against Listeria innocua NRRL B33314, Micrococcus luteus MTCC 106 and lactic acid bacteria, such as Enterococcus casseliflavus NRRL B3502, Lactococcus lactis lactis NRRL 1821, Lactobacillus curvatus NRRL B4562 and Lactobacillus plantarum NRRL B4496. E. coli has been successfully exploited as a host for heterologous expression with a significant yield of fused and cleaved peptides in the range of 8-12 and 1-1.5 mg/l of the culture, respectively. Heterologous expression, therefore, can be used to overcome the constraints of low yield often reported from a native strain.

Two-stage phyto-microremediation of tannery effluent by Spirodela polyrrhiza (L.) Schleid. and chromium resistant bacteria.

PubMed

Singh, Asha; Vyas, Dhiraj; Malaviya, Piyush

2016-09-01

Two-stage sequential treatment of tannery effluent was conducted employing a wetland plant, Spirodela polyrrhiza (L.) Schleid., and chromium (Cr) resistant bacterial strains. The bacterial strains were isolated from Cr-enriched environmental matrices and rhizosphere of Spirodela polyrrhiza. The phyto-rhizoremediation of tannery effluent by Spirodela and its rhizospheric bacteria (Cellulomonas biazotea APBR1-6, Bacillus safensis APBR2-12, Staphylococcus warneri APBR3-5, Microbacterium oleivorans APBR2-6), followed by microremediation by Cr resistant bacteria (Micrococcus luteus APBS5-1, Bacillus pumilus APBS5-2, Bacillus flexus APBE3-1, Virgibacillus sediminis APBS6-1) resulted in reduction of pollution parameters [COD (81.2%), total Cr (97.3%), Cr(VI) (99.3%), Pb(II) (97.0%), Ni (95.7%)]. The LC-MS analysis showed that many pollutants detected in untreated tannery effluent were diminished after bioremediation or long chains of alcohol polyethoxylates viz. C18EO6 in untreated effluent were broken down into smaller unit of alcohol polyethoxylate ((+)HHO[CH2CH2O]H), indicating that bacteria and Spirodela polyrrhiza, alongwith its rhizospheric associates utilized them as carbon and energy source. Copyright © 2016 Elsevier Ltd. All rights reserved.

Antioxidant and Antimicrobial Properties of the Essential Oil and Extracts of Zanthoxylum alatum Grown in North-Western Himalaya

PubMed Central

Tiku, A. K.; Koul, Apurva; Gupta, Sahil; Singh, Gurjinder; Razdan, V. K.

2013-01-01

The essential oil obtained from the fresh leaves of Zanthoxylum alatum was analysed by gas chromatography/mass spectrometry (GC/MS). Fourteen components were identified, and linalool (30.58%), 2-decanone (20.85%), β-fenchol (9.43%), 2-tridecanone (8.86%), β-phellandrene (5.99%), Sabinene (4.82%), and α-pinene (4.11%) were the main components. The EO and methanolic extract of Z. alatum exhibited potent antifungal activity against Alternaria alternata, Alternaria brassicae, and Curvularia lunata. The EO also showed significant antibacterial activity against Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, and Escherichia coli. Further, antimicrobial constituents of the EO were isolated by bioautography and preparative thin layer chromatography (PTLC) and identified as β-fenchol and linalool using GC/MS analysis. In addition to this, the free radical scavenging activity and antioxidant potential of EO and methanolic extract/fractions of Z. alatum were also investigated using in vitro assays including scavenging ability against DPPH•, reducing power and chelating ability on Fe2+ ions. Our results demonstrate that Z. alatum could be used as a resource of antioxidant and antimicrobial compounds which may find applications in food and pesticide industries. PMID:23781160

Utilization of Industrial Waste for the Production of Bio-Preservative from Bacillus licheniformis Me1 and Its Application in Milk and Milk-Based Food Products.

PubMed

Nithya, Vadakedath; Prakash, Maya; Halami, Prakash M

2018-06-01

The bio-preservative efficacy of a partially purified antibacterial peptide (ppABP) produced by Bacillus licheniformis Me1 in an economical medium developed using agro-industry waste was evaluated by direct application in milk and milk-based food products. The addition of ppABP in milk samples stored at 4 ± 2 °C and 28 ± 2 °C resulted in the growth inhibition of pathogens Listeria monocytogenes Scott A, Micrococcus luteus ATCC 9341, and Staphylococcus aureus FRI 722. The shelf life of milk samples with added ppABP increased to 4 days at 28 ± 2 °C, whereas curdling and off-odor were noticed in samples without ppABP. Furthermore, the milk samples with ppABP were sensorily acceptable. Antilisterial effect was also observed in cheese and paneer samples treated with ppABP. These results clearly indicate that the ppABP of B. licheniformis Me1 can be utilized as a bio-preservative to control the growth of spoilage and pathogenic bacteria, thereby reducing the risk of food-borne diseases.

Speleothems from Mawsmai and Krem Phyllut caves, Meghalaya, India: some evidences on biogenic activities

NASA Astrophysics Data System (ADS)

Baskar, Sushmitha; Baskar, R.; Lee, Natuschka; Theophilus, P. K.

2009-05-01

The Mawsmai cave and Krem Phyllut caves, East Khasi hills, Meghalaya, India has so far not yet attracted the attention of geomicrobiologists. Observations and hypotheses on the possible influence of identified microorganisms for speleothem formations in Meghalaya are reported for the first time. XRD studies identified calcite in speleothems and gypsum in cave wall deposits as the dominant minerals. SEM-EDAX showed interesting microfabric features showing strong resemblance with fossilised bacteria, calcified filaments, needle calcite and numerous nano scale calcite crystals, highly weathered and disintegrated crystals of calcite, that point towards a significant microbial influence in its genesis. Thin section petrography showed laminated stromatolitic features. The microorganisms identified by conventional isolation and further evaluation of isolates by molecular techniques include Bacillus cereus, Bacillus mycoides, Bacillus licheniformis, Micrococcus luteus, and Actinomycetes. Microscopic observations also showed unidentifiable cocci and four unidentifiable strains of CaSO4 (gypsum) precipitating bacteria. Experimental studies confirmed that these bacteria are able to precipitate calcium minerals (calcite, gypsum, minor amounts of dolomite) in the laboratory. These results allow us to postulate that species like these may contribute to active biogenic influence in the cave formations at Meghalaya.

Emerging Bacterial Infection: Identification and Clinical Significance of Kocuria Species

PubMed Central

Palange, Padmavali; Vaish, Ritu; Bhatti, Adnan Bashir; Kale, Vinod; Kandi, Maheshwar Reddy; Bhoomagiri, Mohan Rao

2016-01-01

Recently there have been reports of gram-positive cocci which are morphologically similar to both Staphylococci and the Micrococci. These bacteria have been identified as Kocuria species with the help of automated identification system and other molecular methods including 16S rRNA (ribosomal ribonucleic acid) evaluation. Kocuria belongs to the family Micrococcaceae which also includes Staphylococcus species and Micrococcus species. Isolation and clinical significance of these bacteria from human specimens warrant great caution as it does not necessarily confirm infection due to their ubiquitous presence, and as a normal flora of skin and mucous membranes in human and animals. Most clinical microbiology laboratories ignore such bacteria as laboratory and specimen contaminants. With increasing reports of infections associated with these bacteria, it is now important for clinical microbiologists to identify and enumerate the virulence and antibiotic susceptibility patterns of such bacteria and assist clinicians in improving the patient care and management. We review the occurrence and clinical significance of Kocuria species. PMID:27630804

Characterization of the gut bacterial community in Manduca sexta and effect of antibiotics on bacterial diversity and nematode reproduction.

PubMed

van der Hoeven, Ransome; Betrabet, Geeta; Forst, Steven

2008-09-01

The tobacco hornworm, Manduca sexta, is a model lepidopteran insect used to study the pathogenic and mutualistic phases of entomopathogenic nematodes (EPNs) and their bacterial symbionts. While intestinal microbial communities could potentially compete with the EPN and its bacterial partner for nutrient resources of the insect, the microbial gut community had not been characterized previously. Here, we show that the midgut of M. sexta raised on an artificial diet contained mostly Gram-positive cocci and coryneforms including Staphylococcus, Pediococcus, Micrococcus and Corynebacterium. Major perturbation in the gut community was observed on addition of antibiotics to the diet. Paenibacillus and several Proteobacteria such as Methylobacterium, Sphingomonas and Acinetobacter were primary genera identified under these conditions. Furthermore, the reproduction of the nematode Steinernema carpocapsae was less efficient, and the level of nematode colonization by its symbiont Xenorhabdus nematophila reduced, in insects reared on a diet containing antibiotics. The effect of antibiotics and perturbation of gut microbiota on nematode reproduction is discussed.

Microbiological characteristics of "androlla", a Spanish traditional pork sausage.

PubMed

García Fontán, María C; Lorenzo, José M; Parada, Ana; Franco, Inmaculada; Carballo, Javier

2007-02-01

Counts of total aerobic mesophilic microflora, lactic acid bacteria, salt-tolerant microflora, Enterobacteriaceae, enterococci, moulds and yeasts, and staphylococci, and some physico-chemical parameters (total solids, NaCl and nitrate contents and pH and aw values) were determined in 20 units of "androlla", a traditional dry-fermented sausage made in the NW of Spain. In general, high counts of all the investigated microbial groups were observed, with average values of 8.99 +/- 0.46 log cfu/g for the total aerobic mesophilic microflora, 9.11 +/- 0.16 log cfu/g for the lactic acid bacteria, 6.87 +/- 0.68 log cfu/g for the salt-tolerant microflora, 2.80+/-1.85 log cfu/g for the Enterobacteriaceae, 3.25 +/- 1.86 log cfu/g for the enterococci, 4.30 +/- 1.73 log cfu/g for the moulds and yeasts, and 3.62 +/- 0.60 log cfu/g for the staphylococci. From MRS agar, SPC agar + 7.5% NaCl, VRBG agar, and KAA agar, 10 colonies were randomly taken from each androlla unit and from each culture medium. A total of 200 strains per culture medium were then identified using the classical methods. Among the isolates from MRS agar, Lactobacillus sakei predominated, followed by Lactobacillus curvatus, Lactobacillus alimentarius and Lactobacillus plantarum. Of the 200 isolates obtained from SPC agar + 7.5% NaCl, only 56 strains belonged to the Staphylococcaceae or Micrococcaceae families. Among the Staphylococcaceae, Staphylococcus xylosus was the main species, followed by Staph. epidermidis; Staph. equorum, Staph. capitis and Staph. saprophyticus were isolated in very low proportions. Among the Micrococcaceae, Micrococcus luteus predominated, followed by Micrococcus lylae, Kocuria varians and Kocuria kristinae. Of the 150 isolates obtained from VRBG agar, Hafnia alvei was the main species, followed by Serratia liquefaciens and Enterobacter amnigenus; six isolates were identified as Salmonella. Among the 190 isolates obtained from KAA agar, 122 were considered enterococci; 20 isolates were identified as Enterococcus faecium, one as Enterococcus faecalis and 101 as Enterococcus inter faecalis-faecium.

Bioprospection of actinobacteria derived from freshwater sediments for their potential to produce antimicrobial compounds.

PubMed

Zothanpuia; Passari, Ajit Kumar; Leo, Vincent Vineeth; Chandra, Preeti; Kumar, Brijesh; Nayak, Chandra; Hashem, Abeer; Abd Allah, Elsayed Fathi; Alqarawi, Abdulaziz A; Singh, Bhim Pratap

2018-05-05

Actinobacteria from freshwater habitats have been explored less than from other habitats in the search for compounds of pharmaceutical value. This study highlighted the abundance of actinobacteria from freshwater sediments of two rivers and one lake, and the isolates were studied for their ability to produce antimicrobial bioactive compounds. 16S rRNA gene sequencing led to the identification of 84 actinobacterial isolates separated into a common genus (Streptomyces) and eight rare genera (Nocardiopsis, Saccharopolyspora, Rhodococcus, Prauserella, Amycolatopsis, Promicromonospora, Kocuria and Micrococcus). All strains that showed significant inhibition potentials were found against Gram-positive, Gram-negative and yeast pathogens. Further, three biosynthetic genes, polyketide synthases type II (PKS II), nonribosomal peptide synthetases (NRPS) and aminodeoxyisochorismate synthase (phzE), were detected in 38, 71 and 29% of the strains, respectively. Six isolates based on their antimicrobial potentials were selected for the detection and quantification of standard antibiotics using ultra performance liquid chromatography (UPLC-ESI-MS/MS) and volatile organic compounds (VOCs) using gas chromatography mass spectrometry (GC/MS). Four antibiotics (fluconazole, trimethoprim, ketoconazole and rifampicin) and 35 VOCs were quantified and determined from the methanolic crude extract of six selected Streptomyces strains. Infectious diseases still remain one of the leading causes of death globally and bacterial infections caused millions of deaths annually. Culturable actinobacteria associated with freshwater lake and river sediments has the prospects for the production of bioactive secondary metabolites.

LYZL6, an acidic, bacteriolytic, human sperm-related protein, plays a role in fertilization

PubMed Central

Huang, Peng; Li, Wenshu; Yang, Zhifang; Zhang, Ning; Xu, Yixin; Bao, Jianying; Jiang, Deke; Dong, Xianping

2017-01-01

Lysozyme-like proteins (LYZLs) belong to the c-type lysozyme/α-lactalbumin family and are selectively expressed in the mammalian male reproductive tract. Two members, human sperm lysozyme-like protein (SLLP) -1 and mouse LYZL4, have been reported to contribute to fertilization but show no bacteriolytic activity. Here, we focused on the possible contribution of LYZL6 to immunity and fertilization. In humans, LYZL6 was selectively expressed by the testis and epididymis and became concentrated on spermatozoa. Native LYZL6 isolated from sperm extracts exhibited bacteriolytic activity against Micrococcus lysodeikticus. Recombinant LYZL6 (rLYZL6) reached its peak activity at pH 5.6 and 15 mM of Na+, and could inhibit the growth of Gram-positive, but not Gram-negative bacteria. Nevertheless, the bacteriolytic activity of rLYZL6 proved to be much lower than that of human lysozyme under physiological conditions. Immunodetection with a specific antiserum localized the LYZL6 protein on the postacrosomal membrane of mature spermatozoa. Immunoneutralization of LYZL6 significantly decreased the numbers of human spermatozoa fused with zona-free hamster eggs in a dose-dependent manner in vitro. Thus, we report here for the first time that LYZL6, an acidic, bacteriolytic and human sperm-related protein, is likely important for fertilization but not for the innate immunity of the male reproductive tract. PMID:28182716

Expression profiles of antimicrobial peptides (AMPs) and their regulation by Relish

NASA Astrophysics Data System (ADS)

Wang, Dongdong; Li, Fuhua; Li, Shihao; Wen, Rong; Xiang, Jianhai

2012-07-01

Antimicrobial peptides (AMPs), as key immune effectors, play important roles in the innate immune system of invertebrates. Different types of AMPs, including Penaeidin, Crustin, ALF (antilipopolysaccharide factor) have been identified in different penaeid shrimp; however, systematic analyses on the function of different AMPs in shrimp responsive to different types of bacteria are very limited. In this study, we analyzed the expression profiles of AMPs in the Chinese shrimps, Fenneropenaeus chinensis, simultaneously by real-time RT-PCR (reverse transcription-polymerase chain reaction) when shrimp were challenged with Micrococcus lysodeikticus (Gram-positive, G+) or Vibrio anguillarium (Gram-negative, G-). Different AMPs showed different expression profiles when shrimp were injected with one type of bacterium, and one AMP also showed different expression profiles when shrimp were challenged with different bacteria. Furthermore, the expression of these AMPs showed temporal expression profiles, suggesting that different AMPs function coordinately in bacteria-infected shrimp. An RNA interference approach was used to study the function of the Relish transcription factor in regulating the transcription of different AMPs. The current study showed that Relish could regulate the transcription of different AMPs in shrimp. Differential expression profiles of AMPs in shrimp injected with different types of bacteria indicated that a complicated antimicrobial response network existed in shrimp. These data contribute to our understanding of immunity in shrimp and may provide a strategy for the control of disease in shrimp.

21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Catalase derived from Micrococcus lysodeikticus... Micrococcus lysodeikticus. Bacterial catalase derived from Micrococcus lysodeikticus by a pure culture... cheese, in accordance with the following conditions. (a) The organism Micrococcus lysodeikticus from...

CexTi1-xO 2 nanomaterials applied as photocatalyst and disinfectants

NASA Astrophysics Data System (ADS)

Ancha, Bhumika

The thesis extensively studied the synthesis, characterization and photocatalyticity of Ce-dopedTiO2 (CTO-NPs). An environmental-friendly and cost-effective Sol-Gel approach was used to prepare different formulations of CTO-NPs.The starting materials of Ce(NO3)3 and Ti(nOBu) 4 were used and water iso-proponol mixture was used as a solvent to ensure the solubility of the above starting materials. The fabrication variables of CTO-NPs were optimized according to the photocatalytical reactivity and antibacterial activities. The powders of CTO-NPs were prepared after calculation at 200-400 °C with an increment of 50 °C for 2 hours. These so-prepared CTO-NPs were characterized using X-ray powder diffraction, scanning & transmission electron microscopy, ultra-violet and Raman spectroscopy, to evaluate their crystalline structure, morphology, and vibrational modes. It was found that the TiO2 tetragonal anatase structure (PDF 01-086-1157, 3.7852 x 9.5139 A and 90x90 °) was obtained. The cerium cation substituted the lattice Ti, leading to one phase formation. These CTO-NPs were found to be effective at decomposing methylene blue under visible light. Both Gram-negative (S. marcescens, ATCC 49732) and Gram-positive (M. luteus, ATCC 13880) bacteria were also tested using CTO-NPs as disinfectants. The maximum bactericidal concentrations (MBCs) were found to be 0.6 ppm to inactivate both bacteria within 1 hr.

Species diversity and molecular analysis of Staphylococcus in confectioneries of a developing country, Iran.

PubMed

Hoveida, Laleh; Ataei, Behrooz; Amirmozafari, Nour; Noormohammadi, Zahra

2018-06-01

Confectionery is one of the potential sources of contamination and transmission of gastrointestinal infections to humans. Staphylococcus species, and particularly the coagulase-positive ones, have the remarkable capability to produce high amounts of enterotoxin in food. In the present study, the frequency and diversity of Staphylococcus in confectioneries in Iran were assessed by using a combination of conventional and molecular methods. A total of 55 confection samples were collected from 30 confectioneries of Isfahan. They were analyzed for the presence of Staphylococcus using standard protocols for isolation and characterization of the isolates. The conventional tests were used for primary identification and the sequence analysis of 16S rRNA was used for the species identification. A total of 47 out of 55 samples were gram-positive cocci (85.45%). They belonged to 39 Staphylococcus spp., 7 Macrococcus spp., and one Micrococcus spp. The most prevalent 11 various Staphylococcus species were S. aureus 30.8 %, S. warneri 20.5% and S. succinus 17.9. Identification and characterization of Staphylococcus species can be important for epidemiological investigations and assessment of virulence factors such as enterotoxin production and development of specific management practices to prevent staphylococcal food poisoning.

Characterization of 15 selected coccal bacteria isolated from Antarctic rock and soil samples from the McMurdo-Dry Valleys (South-Victoria Land)

NASA Technical Reports Server (NTRS)

Siebert, J.; Hirsch, P.; Friedmann, E. I. (Principal Investigator)

1988-01-01

Approximately 1500 cultures of microorganisms were isolated from rocks and soils of the Ross Desert (McMurdo-Dry Valleys). From these, 15 coccoid strains were chosen for more detailed investigation. They were characterized by morphological, physiological and chemotaxonomical properties. All isolates were Gram-positive, catalase-positive and nonmotile. Six strains showed red pigmentation and could be identified as members of the genera Micrococcus (M. roseus, M. agilis) or Deinococcus. In spite of their coccoid morphology, the remaining nine strains had to be associated with coryneform bacteria (Arthrobacter, Brevibacterium), because of their cell wall composition and G+C ratios. Most of the strains were psychrotrophic, but one strain was even obligately psychrophilic, with a temperature maximum below 20 degrees C. Red cocci had in vitro pH optima above 9.0 although they generally originated from acid samples. Most isolates showed a preference for sugar alcohols and organic acids, compounds which are commonly known to be released by lichens, molds and algae, the other components of the cryptoendolithic ecosystem. These properties indicate that our strains are autochthonous members of the natural Antarctic microbial population.

Early lysis of Lactobacillus helveticus CNRZ 303 in Swiss cheese is not prophage-related.

PubMed

Deutsch, Stéphanie Marie; Neveu, Anthony; Guezenec, Stéphane; Ritzenthaler, Paul; Lortal, Sylvie

2003-03-15

Lactobacillus helveticus is mainly used as starter in Swiss-type cheeses. Often, lysogenic strains are eliminated because of the risk of early lysis and acidification failure due to phage expression. On the other hand, L. helveticus lysis was shown to positively influence cheese proteolysis during ripening. In order to better assess the relationship between lysis and lysogeny, a prophage-cured derivative of L. helveticus CNRZ 303 was isolated (LH 303-G11) and relysogenised (LH 303-G11R), as demonstrated by hybridisation using the whole phage DNA as probe. The growth, lysis in buffered solutions and lytic activities in zymogram using either Micrococcus luteus or L. helveticus as substrate were identical between the mother strain and its cured derivatives. Only morphological differences were observed by scanning electron microscopy: the cells of the cured derivative were shorter in length. The mother strain and its cured and relysogenised derivatives were assayed in triplicate in experimental Swiss cheeses (scale 1:100). No differences were noted during the cheese making: the three strains exhibited identical kinetics of acidification, leading to similar cheeses at day 1 in terms of gross composition and pH. Phages were detected only in the cheeses made with the mother strain and the relysogenised derivative. The lysis of L. helveticus, estimated by viability decrease and release of the intracellular marker D-lactate deshydrogenase, started early before brining and continued during the cold room ripening. No obvious differences of lysis extent were observed. These results demonstrated for the first time that, in the case of LH 303, the extensive lysis observed in cheese is mainly due to autolysin activity and not to prophage induction.

Standoff laser-induced fluorescence of suspensions from different bacterial strains

NASA Astrophysics Data System (ADS)

Duschek, Frank; Walter, Arne; Fellner, Lea; Grünewald, Karin; Pargmann, Carsten; Handke, Jürgen; Tomaso, Herbert

2016-10-01

Biological hazardous substances like certain fungi and bacteria represent a high risk for the broad public if fallen into wrong hands. Incidents based on bio agents are commonly considered to have incalculable and complex consequences for first responders and people. The impact of such an event can be minimized by a combination of different sensor technologies that have been developed to detect bio-threats and to gather information after an incident. Sensors for bio-agents can be grouped into two categories. Sampling devices collect material from locations supposed to be contaminated, and they are able to identify biological material with high sensitivity and selectivity. However, these point sensors need to be positioned correctly in advance of an attack, and moving sources of biological material cannot be tracked. A different approach is based on optical standoff detection. For biological samples laser induced florescence (LIF) has been proven to get real time data on location and type of hazards without being in contact with the suspicious substance. This work is based on a bio-detector developed at the DLR Lampoldshausen. The LIF detection has been designed for outdoor operation at standoff distances from 20 m up to more than 100 m. The detector acquires LIF spectral data for two different excitation wavelengths (280 and 355 nm) as well as time resolved information for the fluorescence decay which can be used to classify suspicious samples. While the classification device had been trained on uncritical samples (like amino acids, NADH, yeast, chemicals, oils), this work presents the progress to more relevant, living bacteria of different strains. The low risk and non-pathogenic bacteria Bacillus thuringensis, Bacillus atrophaeus, Bacillus subtilis, Brevibacillus brevis, Micrococcus luteus, Oligella urethralis, Paenibacillus polymyxa and Escherichia coli (K12) have been investigated with the above set-up at both excitation wavelengths

Synthesis of ectomycorrhizae on northern red oak seedlings in a Michigan nursery

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dixon, R.K.; Johnson, P.S.

1993-01-01

Vegetative inoculum of the ectomycorrhizal fungus Suillus luteus was thoroughly mixed into fumigated nursery soil, and northern red oak seedlings of four families were evaluated one and two years after sowing for ectomycorrhizal development, growth, and nutrition. At the end of year one, treated seedlings were successfully inoculated with S. luteus, but the percentage varied significantly with family. Suillus luteus persisted on lateral roots two years following sowing. Two of four seedling families inoculated with S. luteus were significantly larger in size than control plants. These results suggest that the fungal symbiont S. luteus can be successfully introduced into nurseriesmore » and that early ectomycorrhizal development improves the growth of northern red oak seedlings.« less

Purification and Characterization of Bacteriocin Produced by Weissella confusa A3 of Dairy Origin

PubMed Central

Goh, Hweh Fen; Philip, Koshy

2015-01-01

A dramatic increase in bacterial resistance towards currently available antibiotics has raised worldwide concerns for public health. Therefore, antimicrobial peptides (AMPs) have emerged as a promisingly new group of therapeutic agents for managing infectious diseases. The present investigation focusses on the isolation and purification of a novel bacteriocin from an indigenous sample of cow milk and it’s mode of action. The bacteriocin was isolated from Weissella confusa A3 that was isolated from the sample and was shown to have inhibitory activity towards pathogenic bacteria namely Bacillus cereus, Escherichia coli, Pseudomonas aeruginosa and Micrococcus luteus. The bacteriocin was shown to be heat stable and functioned well at low pH (2 to 6). Reduction of activity was shown after treatment with proteinase K, trypsin and peptidase that confirmed the proteinaceous nature of the compound. MALDI-TOF analysis of the sample gave a mass approximating 2.7 kDa. The membrane of the bacteria was disrupted by the bacteriocin causing SYTOX® green dye to enter the cell and bind to the bacterial DNA giving fluorescence signal. Bacterial cell treated with the bacteriocin also showed significant morphological changes under transmission electron microscope. No virulence and disease related genes can be detected from the genome of the strain. PMID:26474074

Commercial probiotic bacteria and prebiotic carbohydrates: a fundamental study on prebiotics uptake, antimicrobials production and inhibition of pathogens.

PubMed

Cruz-Guerrero, Alma; Hernández-Sánchez, Humberto; Rodríguez-Serrano, Gabriela; Gómez-Ruiz, Lorena; García-Garibay, Mariano; Figueroa-González, Ivonne

2014-08-01

Probiotics and prebiotics are among the most important functional food ingredients worldwide. The proven benefits of such ingredients to human health have encouraged the development of functional foods containing both probiotics and prebiotics. In this work, the production of antimicrobial compounds coupled to the uptake of commercial prebiotics by probiotic bacteria was investigated. The probiotic bacteria studied were able to take up commercial prebiotic carbohydrates to the same or higher extent than that observed for lactose (control carbohydrate). The growth of probiotic bacteria was coupled to the production of antimicrobials such as short-chain fatty acids (SCFA), H2 O2 and bacteriocins. A higher production of antimicrobial compounds was recorded with Oligomate 55® compared with Regulact® and Frutafit® (3-5 and 10-115 times higher SCFA and H2 O2 production, respectively). The probiotic bacteria grown with Oligomate 55® also produced bacteriocins and other non-identified antimicrobial compounds. The antimicrobials produced by the probiotic bacteria inhibited up to 50% the growth of model pathogens such as Escherichia coli, Listeria innocua and Micrococcus luteus compared with control cultures. The results here obtained are useful for the adequate selection of probiotic/prebiotics pairs and therefore in the development of efficient functional foods. © 2013 Society of Chemical Industry.

Antimicrobial, wound healing and antioxidant activity of Plagiochasma appendiculatum Lehm. et Lind.

PubMed

Singh, Meenakshi; Govindarajan, Raghavan; Nath, Virendra; Rawat, Ajay Kumar Singh; Mehrotra, Shanta

2006-08-11

Plagiochasma appendiculatum (Aytoniaceae) of the order Marchantiales is widely used in the form of paste ethnomedicinally by Gaddi tribe in Kangra valley for treating skin diseases. In this context, antimicrobical potential of Plagiochasma appendiculatum against a wide range of microorganisms was studied. To validate the ethnotherapeutic claims of the plant in skin diseases, wound healing activity was studied, besides antioxidant activity to understand the mechanism of wound healing activity. The plant (alchoholic and aqueous extract) showed significant antibacterial and antifungal activity against almost all the organisms: Micrococcus luteus, Bacillus subtilis, Bacillus cereus, Staphylococcus aureus, Streptococcus pneumoniae, Enterobacter aerogenes, Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa, Salmonella typhimurium, and eight fungi Candida albicans and Cryptococcus albidus-dimorphic fungi, Trichophyton rubrum-dermatophyte fungi, Aspergillus niger, Aspergillus flavus, Aspergillus spinulosus, Aspergillus terreus and Aspergillus nidulans-systemic fungi, with especially good activity against the dermatophyte (Trichophyton rubrum) and some infectious bacteria (Escherichia coli, Proteus mirabilis and Salmonella typhimurium) with an MIC of 2.5 microg/disc. The results show that Plagiochasma appendiculatum extract has potent wound healing capacity as evident from the wound contraction and increased tensile strength. The results also indicated that Plagiochasma appendiculatum extract possesses potent antioxidant activity by inhibiting lipid peroxidation and increase in the superoxide dismutase (SOD) and Catalase activity.

Rapid High-Throughput Assessment of Aerobic Bacteria in Complex Samples by Fluorescence-Based Oxygen Respirometry

PubMed Central

O'Mahony, Fiach C.; Papkovsky, Dmitri B.

2006-01-01

A simple method has been developed for the analysis of aerobic bacteria in complex samples such as broth and food homogenates. It employs commercial phosphorescent oxygen-sensitive probes to monitor oxygen consumption of samples containing bacteria using standard microtiter plates and fluorescence plate readers. As bacteria grow in aqueous medium, at certain points they begin to deplete dissolved oxygen, which is seen as an increase in probe fluorescence above baseline signal. The time required to reach threshold signal is used to either enumerate bacteria based on a predetermined calibration or to assess the effects of various effectors on the growth of test bacteria by comparison with an untreated control. This method allows for the sensitive (down to a single cell), rapid (0.5 to 12 h) enumeration of aerobic bacteria without the need to conduct lengthy (48 to 72 h) and tedious colony counts on agar plates. It also allows for screening a wide range of chemical and environmental samples for their toxicity. These assays have been validated with different bacteria, including Escherichia coli, Micrococcus luteus, and Pseudomonas fluorescens, with the enumeration of total viable counts in broth and industrial food samples (packaged ham, chicken, and mince meat), and comparison with established agar plating and optical-density-at-600-nm assays has been given. PMID:16461677

Chemical constituents of essential oil of endemic Rhanterium suaveolens Desf. growing in Algerian Sahara with antibiofilm, antioxidant and anticholinesterase activities.

PubMed

Chemsa, Ahmed Elkhalifa; Erol, Ebru; Öztürk, Mehmet; Zellagui, Amar; Özgür, Ceylan; Gherraf, Noureddine; Duru, Mehmet Emin

2016-09-01

Twenty compounds were detected in the essential oil of Rhanterium suaveolens representing 98.01% of the total oil content. Perillaldehyde (45.79%), caryophyllene oxide (24.82%) and β-cadinol (5.61%) were identified as the main constituents. In β-carotene-linoleic acid assay, both the oil and the methanol extract exhibited good lipid peroxidation inhibition activity, with IC50 values of 17.97 ± 5.40 and 11.55 ± 3.39 μg/mL, respectively. In DPPH and CUPRAC assays, however, the methanol extract exhibited a good antioxidant activity. The highest antibiofilm activity has been found 50.30% against Staphylococcus epidermidis (MU 30) at 20 μg/mL for essential oil and 58.34% against Micrococcus luteus (NRRL B-4375) at 25 mg/mL concentration for methanol extract. The in vitro anticholinesterase activity of methanol extract showed a moderate acetylcholinesterase inhibitory (IC50 = 168.76 ± 0.62 μg/mL) and good butyrylcholinesterase inhibitory (IC50 = 54.79 ± 1.89 μg/mL) activities. The essential oil was inactive against both enzymes.

Microbiological assay for the analysis of certain macrolides in pharmaceutical dosage forms.

PubMed

Mahmoudi, A; Fourar, R E-A; Boukhechem, M S; Zarkout, S

2015-08-01

Clarithromycin (CLA) and roxithromycin (ROX) are macrolide antibiotics with an expanded spectrum of activity that are commercially available as tablets. A microbiological assay, applying the cylinder-plate method and using a strain of Micrococcus luteus ATCC 9341 as test organism, has been used and validated for the quantification of two macrolide drugs; CLA and ROX in pure and pharmaceutical formulations. The validation of the proposed method was carried out for linearity, precision, accuracy and specificity. The linear dynamic ranges were from 0.1 to 0.5μg/mL for both compounds. Logarithmic calibration curve was obtained for each macrolide (r>0.989) with statistically equal slopes varying from 3.275 to 4.038, and a percentage relative standard deviation in the range of 0.24-0.92%. Moreover, the method was applied successfully for the assay of the studied drugs in pharmaceutical tablet dosage forms. Recovery from standard addition experiments in commercial products was 94.71-96.91% regarding clarithromycin and 93.94-98.12% regarding roxithromycin, with a precision (%RSD) 1.32-2.11%. Accordingly, this microbiological assay can be used for routine quality control analysis of titled drugs in tablet formulations. Copyright © 2015 Elsevier B.V. All rights reserved.

Purification and Characterization of Bacteriocin Produced by Weissella confusa A3 of Dairy Origin.

PubMed

Goh, Hweh Fen; Philip, Koshy

2015-01-01

A dramatic increase in bacterial resistance towards currently available antibiotics has raised worldwide concerns for public health. Therefore, antimicrobial peptides (AMPs) have emerged as a promisingly new group of therapeutic agents for managing infectious diseases. The present investigation focusses on the isolation and purification of a novel bacteriocin from an indigenous sample of cow milk and it's mode of action. The bacteriocin was isolated from Weissella confusa A3 that was isolated from the sample and was shown to have inhibitory activity towards pathogenic bacteria namely Bacillus cereus, Escherichia coli, Pseudomonas aeruginosa and Micrococcus luteus. The bacteriocin was shown to be heat stable and functioned well at low pH (2 to 6). Reduction of activity was shown after treatment with proteinase K, trypsin and peptidase that confirmed the proteinaceous nature of the compound. MALDI-TOF analysis of the sample gave a mass approximating 2.7 kDa. The membrane of the bacteria was disrupted by the bacteriocin causing SYTOX® green dye to enter the cell and bind to the bacterial DNA giving fluorescence signal. Bacterial cell treated with the bacteriocin also showed significant morphological changes under transmission electron microscope. No virulence and disease related genes can be detected from the genome of the strain.

Comparative study of antibiotic-containing polymethylmetacrylate capsules and beads.

PubMed

Borzsei, László; Mintál, Tibor; Horváth, Aranka; Koós, Zoltán; Kocsis, Béla; Nyárády, József

2006-01-01

This study aimed at making local antibiotic therapy wider in cases of chronic suppurations by administering antibiotics which previously could not be given in this way through the conventional polymethylmetacrylate (PMMA) carrier techniques. Capsules from this material were produced with a pressing machine designed and laid out by us. The characteristics of antibiotic penetration from this novel carrier were compared to those of PMMA beads. The time-dependent outflow of amikacin, clindamycin, pefloxacin, piperacillin + tazobactam, amoxicillin + clavulanic acid and cefotaxime was examined from the capsules and the beads with standard microbiological techniques using the Micrococcus luteus ATCC9341 test strain. The diameter of the inhibitory zones was measured after 24 h incubation at 37 degrees C and converted to mug/ml antibiotic concentrations. Our results revealed that all antibiotics showed longer-lasting and higher concentration outflow from the PMMA capsules than from the beads. Therefore, these capsules can provide a more promising new opportunity for specific local antimicrobial treatment in cases of chronic suppurative bone and soft tissue injuries. In these cases the polymerization has already been completed and the heat does not influence the structure of the antibiotics; therefore, it can be inserted into the capsules in powder or solution form. Copyright 2006 S. Karger AG, Basel.

Intersubunit structure within heterodimers of medium-chain prenyl diphosphate synthases. Formation of a hybrid-type heptaprenyl diphosphate synthase.

PubMed

Koike-Takeshita, A; Koyama, T; Ogura, K

1998-10-01

Among prenyltransferases that catalyze the sequential condensation of isopentenyl diphosphate with allylic diphosphate to produce prenyl diphosphates with various chain lengths and stereochemistries, medium-chain prenyl diphosphate synthases are exceptional in that they comprise two dissociable heteromeric protein components. These components exist without binding with each other under physiological conditions, and neither of them has any prenyltransferase activity by itself. In order to elucidate the precise molecular mechanism underlying expression of the catalytic function by such a unique two-component system, we examined the possibility of forming a hybrid between two of the components of three different medium-chain prenyl diphosphate synthases, components I and II of heptaprenyl diphosphate synthase from Bacillus subtilis, components I' and II' of heptaprenyl diphosphate synthase from Bacillus stearothermophilus, and components A and B of hexaprenyl diphosphate synthase from Micrococcus luteus B-P 26. As a result, only the hybrid-type combination of component I and component II' gave distinct prenyltransferase activity. The hybrid-type enzyme catalyzed the synthesis of heptaprenyl diphosphate and showed moderate heat stability, which lay between those of the natural enzymes from B. subtilis and B. stearothermophilus. There is no possibility of forming a hybrid between the heptaprenyl and hexaprenyl diphosphate synthases.

Activity of Fusion Prophenoloxidase-GFP and Its Potential Applications for Innate Immunity Study

PubMed Central

Yang, Bing; Lu, Anrui; Peng, Qin; Ling, Qing-Zhi; Ling, Erjun

2013-01-01

Insect prophenoloxidase (PPO) is essential for physiological functions such as melanization of invading pathogens, wound healing and cuticle sclerotization. The insect PPO activation pathway is well understood. However, it is not very clear how PPO is released from hemocytes and how PPO takes part in cellular immunity. To begin to assess this, three Drosophila melanogaster PPO genes were separately fused with GFP at the C-terminus (rPPO-GFP) and were over-expressed in S2 cells. The results of staining and morphological observation show that rPPO-GFP expressed in S2 cells has green fluorescence and enzyme activity if Cu2+ was added during transfection. Each rPPO-GFP has similar properties as the corresponding rPPO. However, cells with rPPO-GFP over-expressed are easier to trace without PO activation and staining. Further experiments show that rPPO1-GFP is cleaved and activated by Drosophila serine protease, and rPPO1-GFP binds to Micrococcus luteus and Beauveria bassiana spores as silkworm plasma PPO. The above research indicates that the GFP-tag has no influence on the fusion enzyme activation and PPO-involved innate immunity action in vitro. Thus, rPPO-GFP may be a convenient tool for innate immunity study in the future if it can be expressed in vivo. PMID:23717543

Characterization of microbial contamination in United States Air Force aviation fuel tanks.

PubMed

Rauch, Michelle E; Graef, Harold W; Rozenzhak, Sophie M; Jones, Sharon E; Bleckmann, Charles A; Kruger, Randell L; Naik, Rajesh R; Stone, Morley O

2006-01-01

Bacteria and fungi, isolated from United States Air Force (USAF) aviation fuel samples, were identified by gas chromatograph fatty acid methyl ester (GC-FAME) profiling and 16S or 18S rRNA gene sequencing. Thirty-six samples from 11 geographically separated USAF bases were collected. At each base, an above-ground storage tank, a refueling truck, and an aircraft wing tank were sampled at the lowest sample point, or sump, to investigate microbial diversity and dispersion within the fuel distribution chain. Twelve genera, including four Bacillus species and two Staphylococcus species, were isolated and identified. Bacillus licheniformis, the most prevalent organism isolated, was found at seven of the 11 bases. Of the organisms identified, Bacillus sp., Micrococcus luteus, Sphinogmonas sp., Staphylococcus sp., and the fungus Aureobasidium pullulans have previously been isolated from aviation fuel samples. The bacteria Pantoea ananatis, Arthrobacter sp., Alcaligenes sp., Kocuria rhizophilia, Leucobacter komagatae, Dietza sp., and the fungus Discophaerina fagi have not been previously reported in USAF aviation fuel. Only at two bases were the same organisms isolated from all three sample points in the fuel supply distribution chain. Isolation of previously undocumented organisms suggests either, changes in aviation fuel microbial community in response to changes in aviation fuel composition, additives and biocide use, or simply, improvements in isolation and identification techniques.

Isolation of Viable but Non-culturable Bacteria from Printing and Dyeing Wastewater Bioreactor Based on Resuscitation Promoting Factor.

PubMed

Jin, Yi; Gan, Guojuan; Yu, Xiaoyun; Wu, Dongdong; Zhang, Li; Yang, Na; Hu, Jiadan; Liu, Zhiheng; Zhang, Lixin; Hong, Huachang; Yan, Xiaoqing; Liang, Yan; Ding, Linxian; Pan, Yonglong

2017-07-01

Printing and dyeing wastewater with high content of organic matters, high colority, and poor biochemical performance is hard to be degraded. In this study, we isolated viable but non-culturable (VBNC) bacteria from printing and dyeing wastewater with the culture media contained resuscitation promoting factor (Rpf) protein secreted by Micrococcus luteus, counted the culturable cells number with the most probable number, sequenced 16S rRNA genes, and performed polymerase chain reaction-denaturing gradient gel electrophoresis. It is obviously that the addition of Rpf in the enrichment culture could promote growth and resuscitation of bacteria in VBNC state to obtain more fastidious bacteria significantly. The identified bacteria were assigned to nine genera in the treatment group, while the two strains of Ochrobactrum anthropi and Microbacterium sp. could not be isolated from the control group. The function of isolated strains was explored and these strains could degrade the dye of Congo red. This study provides a new sight into the further study including the present state, composition, formation mechanism, and recovery mechanism about VBNC bacteria in printing and dyeing wastewater, which would promote to understand bacterial community in printing and dyeing wastewater, and to obtain VBNC bacteria from ecological environment.

Antibiotics production by an actinomycete isolated from the termite gut.

PubMed

Matsui, Toru; Tanaka, Junichi; Namihira, Tomoyuki; Shinzato, Naoya

2012-12-01

As well as the search for new antibiotics, a new resource or strains for the known antibiotics is also important. Microbial symbionts in the gut of termites could be regarded as one of the feasible resource for such purpose. In this study, antibiotic-producing actinomycetes were screened from symbionts of the termite gut. 16SrRNA sequence analysis for the 10 isolates revealed that they belong to actinomycetes such as Streptomyces sp., Kitasatospora sp., and Mycobacterium sp. A culture broth from one of the isolate, namely strain CA1, belonging to the genera Streptomyces exhibited antagonistic activity against actinomycetes (Micrococcus spp.), gram-positive bacteria (Bacillus spp.), and yeast (Candida spp.). The structures of 2 compounds isolated from the culture broth of the strain CA1 were identified as those of actinomycin X2 and its analog, D. This study is the first to report that some symbionts of the termite gut are antibiotic-producing actinomycetes, and suggest that the termite gut is a feasible resource for bioprospecting. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Catalase derived from Micrococcus lysodeikticus... FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.135 Catalase derived from Micrococcus lysodeikticus. Bacterial catalase derived from Micrococcus lysodeikticus by a pure culture...

Nocardioides albertanoniae sp. nov., isolated from Roman catacombs.

PubMed

Alias-Villegas, Cynthia; Jurado, Valme; Laiz, Leonila; Miller, Ana Z; Saiz-Jimenez, Cesareo

2013-04-01

A Gram-reaction-positive, aerobic, non-spore-forming, rod- or coccoid-shaped, strain, CD40127(T), was isolated from a green biofilm covering the wall of the Domitilla Catacombs in Rome, Italy. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain CD40127(T) belongs to the genus Nocardioides, closely related to Nocardioides luteus DSM 43366(T) and Nocardioides albus DSM 43109(T) with 98.86 % and 98.01 % similarity values, respectively. Strain CD40127(T) exhibited 16S rRNA gene sequence similarity values below 96.29 % with the rest of the species of the genus Nocardioides. The G+C content of the genomic DNA was 69.7 mol%. The predominant fatty acid was iso-C16 : 0 and the major menaquinone was MK-8(H4) in accordance with the phenotypes of other species of the genus Nocardioides. A polyphasic approach using physiological tests, fatty acid profiles, DNA base ratios and DNA-DNA hybridization showed that isolate CD40127(T) represents a novel species within the genus Nocardioides, for which the name Nocardioides albertanoniae is proposed. The type strain is CD40127(T) ( = DSM 25218(T) = CECT 8014(T)).

Biotechnological methods for chalcone reduction using whole cells of Lactobacillus, Rhodococcus and Rhodotorula strains as a way to produce new derivatives.

PubMed

Stompor, Monika; Kałużny, Mateusz; Żarowska, Barbara

2016-10-01

Microbial strains of the genera Dietzia, Micrococcus, Pseudomonas, Rhodococcus, Gordonia, Streptomyces, Pseudomonas, Bacillus, Penicillium, Rhodotorula and Lactobacillus were screened for the ability to convert chalcones. Synthesis of chalcones was performed by the Claisen-Schmidt reaction. There were three groups of chalcones obtained as the products, which included the derivatives containing 4-substituted chalcone, 2'-hydroxychalcone and 4'-methoxychalcone. The B ring of the chalcones was substituted in the para position with different groups, such as halide, hydroxyl, nitro, methyl, ethyl and ethoxy one. The structure-activity relationship of the tested chalcones in biotransformation processes was studied. It has been proven that Gram-positive bacterial strains Rhodococcus and Lactobacillus catalyzed reduction of C=C bond in the chalcones to give respective dihydrochalcones. The strain Rhodotorula rubra AM 82 transformed chalcones into dihydrochalcones and respective secondary alcohols. These results suggest that the probiotic strain of Lactobacillus can be used for biotransformations of chalcones, which has not been described before. The structure of new metabolites 14a and 15b were established as 4-ethoxy-4'-methoxydihydrochalcone and 3-(4-bromophenyl)-1-(4'-O-methylphenyl)-2-propan-1-ol, respectively, which was confirmed by (1)H NMR and (13)C NMR analysis.

Fluorescence of Bacteria, Pollens, and Naturally Occurring Airborne Particles: Excitation/Emission Spectra

DTIC Science & Technology

2009-02-01

EEM spectra of Micrococcus lysodeikticus vegetative cells, dry............................... 24 Figure 18. EEM spectra of Micrococcus lysodeikticus...tryptophan, B. subtilis (vegetative cells) ATCC 6633, Pseudomonas fluorescens, Micrococcus lysodeikticus, Staphylococcus aureus, and Clostridium...present the EEM spectra of Pseudomonas fluorescens (dry), Yersinia pestis (dry and in water), Micrococcus lysodeikticus (dry and in water

Members of Microvirga and Bradyrhizobium genera are native endosymbiotic bacteria nodulating Lupinus luteus in Northern Tunisian soils.

PubMed

Msaddak, Abdelhakim; Rejili, Mokhtar; Durán, David; Rey, Luis; Imperial, Juan; Palacios, Jose Manuel; Ruiz-Argüeso, Tomas; Mars, Mohamed

2017-06-01

The genetic diversity of bacterial populations nodulating Lupinus luteus (yellow lupine) in Northern Tunisia was examined. Phylogenetic analyses of 43 isolates based on recA and gyrB partial sequences grouped them in three clusters, two of which belong to genus Bradyrhizobium (41 isolates) and one, remarkably, to Microvirga (2 isolates), a genus never previously described as microsymbiont of this lupine species. Representatives of the three clusters were analysed in-depth by multilocus sequence analysis of five housekeeping genes (rrs, recA, glnII, gyrB and dnaK). Surprisingly, the Bradyrhizobium cluster with the two isolates LluI4 and LluTb2 may constitute a new species defined by a separate position between Bradyrhizobium manausense and B. denitrificans. A nodC-based phylogeny identified only two groups: one formed by Bradyrhizobium strains included in the symbiovar genistearum and the other by the Microvirga strains. Symbiotic behaviour of representative isolates was tested, and among the seven legumes inoculated only a difference was observed i.e. the Bradyrhizobium strains nodulated Ornithopus compressus unlike the two strains of Microvirga. On the basis of these data, we conclude that L. luteus root nodule symbionts in Northern Tunisia are mostly strains within the B. canariense/B. lupini lineages, and the remaining strains belong to two groups not previously identified as L. luteus endosymbionts: one corresponding to a new clade of Bradyrhizobium and the other to the genus Microvirga. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Bacterial diversity in a nonsaline alkaline environment: heterotrophic aerobic populations.

PubMed

Tiago, Igor; Chung, Ana Paula; Veríssimo, António

2004-12-01

Heterotrophic populations were isolated and characterized from an alkaline groundwater environment generated by active serpentinization, which results in a Ca(OH)2-enriched, extremely diluted groundwater with pH 11.4. One hundred eighty-five strains were isolated in different media at different pH values during two sampling periods. To assess the degree of diversity present in the environment and to select representative strains for further characterization of the populations, we screened the isolates by using random amplified polymorphic DNA-PCR profiles and grouped them based on similarities determined by fatty acid methyl ester analysis. Phenotypic characterization, determinations of G+C content, phylogenetic analyses by direct sequencing of 16S rRNA genes, and determinations of pH tolerance were performed with the selected isolates. Although 38 different populations were identified and characterized, the vast majority of the isolates were gram positive with high G+C contents and were affiliated with three distinct groups, namely, strains closely related to the species Dietzia natrolimnae (32% of the isolates), to Frigoribacterium/Clavibacter lineages (29% of the isolates), and to the type strain of Microbacterium kitamiense (20% of the isolates). Other isolates were phylogenetically related to strains of the genera Agrococcus, Leifsonia, Kytococcus, Janibacter, Kocuria, Rothia, Nesterenkonia, Citrococcus, Micrococcus, Actinomyces, Rhodococcus, Bacillus, and Staphylococcus. Only five isolates were gram negative: one was related to the Sphingobacteria lineage and the other four were related to the alpha-Proteobacteria lineage. Despite the pH of the environment, the vast majority of the populations were alkali tolerant, and only two strains were able to grow at pH 11.

Antagonistic intestinal microflora produces antimicrobial substance inhibitory to Pseudomonas species and other spoilage organisms.

PubMed

Hatew, Bayissa; Delessa, Tenagne; Zakin, Vered; Gollop, Natan

2011-10-01

Chicken intestine harbors a vast number of bacterial strains. In the present study, antimicrobial substance produced by lactic acid bacteria (LAB) isolated from the gastrointestinal tract of healthy chicken was detected, characterized, and purified. Based on 16S rRNA sequencing, the bacteria were identified as Lactobacillus plantarum vN. The antimicrobial substance produced by this bacterium was designated vN-1 and exhibited a broad-spectrum of activity against many important pathogenic and spoilage microorganisms, including Pseudomonas aeruginosa, Staphylococcus aureus, Micrococcus luteus, Salmonella Typhimurium, and Erwinia amylovova. vN-1 was determined to be thermostable, insensitive to pH values ranging from 2.0 to 8.0, resistant to various organic solvents and to enzymatic inactivation. The inhibition kinetics displayed a bactericidal mode of action. This study revealed an antimicrobial substance with low molecular mass of less than 1 kDa as determined by ultrafiltration and having features not previously reported for LAB isolated from chicken intestines. The detection of this antimicrobial substance addresses an important aspect of biotechnological control agents of spoilage caused by Pseudomonas spp. and promises the possibility for preservation of refrigerated poultry meat. Practical Application:  The newly characterized antimicrobial substance and designated as vN-1 may have the potential to be used in food preservation. © 2011 Institute of Food Technologists®

Heat treatment effects on the antimicrobial activity of macrolide and lincosamide antibiotics in milk.

PubMed

Zorraquino, M A; Althaus, R L; Roca, M; Molina, M P

2011-02-01

Antibiotic residues in milk can cause serious problems for consumers and the dairy industry. Heat treatment of milk may diminish the antimicrobial activity of these antibiotic residues. This study analyzed the effect of milk processing (60 °C for 30 min, 120 °C for 20 min, and 140 °C for 10 s) on the antimicrobial activity of milk samples fortified with three concentrations of three macrolides (erythromycin: 20, 40 and 80 μg/liter; spiramycin: 100, 200, and 400 μg/liter; and tylosin: 500, 1,000, and 2,000 μg/liter) and one lincosamide (lincomycin: 1,000, 2,000, and 4,000 μg/liter). To measure the loss of antimicrobial activity, a bioassay based on the growth inhibition of Micrococcus luteus was done. The data were analyzed using a multiple linear regression model. The results indicate that treatment at 120 °C for 20 min produces inactivation percentages of 93% (erythromycin), 64% (spiramycin), 51% (tylosin), and 5% (lincomycin), while treatment at 140 °C for 10 s results in generally lower percentages (30% erythromycin, 35% spiramycin, 12% tylosin, and 5% lincomycin). The lowest loss or lowest reduction of antimicrobial activity (21% erythromycin and 13% spiramycin) was obtained by treatment at 60 °C for 30 min. Copyright ©, International Association for Food Protection

Exploring multi potential uses of marine bacteria; an integrated approach for PHB production, PAHs and polyethylene biodegradation.

PubMed

Mohanrasu, K; Premnath, N; Siva Prakash, G; Sudhakar, Muniyasamy; Boobalan, T; Arun, A

2018-05-19

There are copious of bacteria exist in marine environment and it is very important to screen the potential microbes that has the ability to produce biopolymer polyhydroxybutyrate (PHB) as well as polycyclic aromatic hydrocarbons (PAHs) degradation and conventional plastic high density polyethylene (HDPE) biodegradation. Numerous studies have been investigated individually on either one of characteristic feature like PHB production, PAHs and high density polyethylene (HDPE) degradation, but not all together. Hence, in this study, we tried to screen potential marine microbes that have the ability to perform all three features. We have isolated 203 phenotyphicaly different colonies from 19 different sites (marine soil sediments, marine water and oil spilled marine water) which cover the north east to down south seashore regions of Tamilnadu, India. Of the 203 microbial isolates, the best PHB producing (Micrococcus luteus), PAHs degradation (Klebsiella pneumonia) and HDPE degradation (Brevibacillus borstelensis) microorganisms were identified through 16S rRNA sequencing. Analytical studies confirmed PHB production by fourier transform infrared spectroscopy (FT-IR) and nuclear magnetic resonance ( 1 H & 13 C NMR); PAHs degradation by high performance liquid chromatography (HPLC), confocal laser scanning microscopy (CLSM), scanning electron microscopy (SEM); HDPE degradation by CLSM, FT-IR and SEM which cover the spectroscopy studies on biological systems. Copyright © 2018. Published by Elsevier B.V.

Studies on interaction of colloidal silver nanoparticles (SNPs) with five different bacterial species.

PubMed

Khan, S Sudheer; Mukherjee, Amitava; Chandrasekaran, N

2011-10-01

Silver nanoparticles (SNPs) are being increasingly used in many consumer products like textile fabrics, cosmetics, washing machines, food and drug products owing to its excellent antimicrobial properties. Here we have studied the adsorption and toxicity of SNPs on bacterial species such as Pseudomonas aeruginosa, Micrococcus luteus, Bacillus subtilis, Bacillus barbaricus and Klebsiella pneumoniae. The influence of zeta potential on the adsorption of SNPs on bacterial cell surface was investigated at acidic, neutral and alkaline pH and with varying salt (NaCl) concentrations (0.05, 0.1, 0.5, 1 and 1.5 M). The survival rate of bacterial species decreased with increase in adsorption of SNPs. Maximum adsorption and toxicity was observed at pH 5, and NaCl concentration of <0.5 M. A very less adsorption was observed at pH 9 and NaCl concentration >0.5 M, there by resulting in less toxicity. The zeta potential study suggests that, the adsorption of SNPs on the cell surface was related to electrostatic force of attraction. The equilibrium and kinetics of the adsorption process were also studied. The adsorption equilibrium isotherms fitted well to the Langmuir model. The kinetics of adsorption fitted best to pseudo-first-order. These findings form a basis for interpreting the interaction of nanoparticles with environmental bacterial species. Copyright © 2011 Elsevier B.V. All rights reserved.

Effect of Nanoemulsified and Microencapsulated Mexican Oregano (Lippia graveolens Kunth) Essential Oil Coatings on Quality of Fresh Pork Meat.

PubMed

Hernández-Hernández, Elvia; Lira-Moreno, César Y; Guerrero-Legarreta, Isabel; Wild-Padua, Graciela; Di Pierro, Prospero; García-Almendárez, Blanca E; Regalado-González, Carlos

2017-06-01

Fresh meat is a highly perishable food. This work aimed to evaluate the influence of Mexican oregano (Lippia graveolens Kunth) incorporated into active coatings (ACs) spread on fresh pork meat as free (FEO), nanoemulsified (NEO), and microencapsulated (MEO) essential oil (EO), on its microbiological, physicochemical and sensory properties during 15 d at 4 ± 1 °C. Thymol and γ-terpinene were identified in the EO. In vitro effect of 2.85 mg EO/cm 2 was tested against Brochothrix thermosphacta, Micrococcus luteus, Lactobacillus plantarum, Pseudomonas fragi, and Salmonella Infantis. FEO antioxidant capacity (DPPH assay) was significantly higher than that of thymol, NEO and MEO (93.53%, 89.92%, 77.79%, and 78.50% inhibition, respectively), and similar to BHA (96.03%) and gallic acid (95.57%). FEO, NEO, and MEO ACs on meat caused growth inhibition of lactic acid bacteria (5 log population reduction) and Pseudomonas spp. (4 log reduction), whereas ≤1.5 log population reduction was observed for B. thermosphacta and Salmonella Infantis. Meat microbiota was more efficiently controlled by MEO than by FEO or NEO. ACs delayed lipid and oxymyoglobin oxidation of fresh pork meat. After 15 d of cold storage meat added with EO coatings was desirable for panelists, whereas untreated (UT) samples were undesirable. Active coatings are a significant alternative method for fresh meat preservation. © 2017 Institute of Food Technologists®.

Sterility maintenance study: Dynamic evaluation of sterilized rigid containers and wrapped instrument trays to prevent bacterial ingress.

PubMed

Shaffer, Harry L; Harnish, Delbert A; McDonald, Michael; Vernon, Reid A; Heimbuch, Brian K

2015-12-01

Sterilized packaging systems are designed to maintain the sterility of surgical instruments and devices from the time of sterilization until use. This study evaluated the effectiveness of rigid containers versus wrapped instrument trays, sterilized using North American sterilization protocols, to maintain a sterile internal environment poststerilization when challenged with aerosolized bacteria under dynamic environmental conditions. Using a custom aerosol chamber, 111 rigid containers of various durations of use (unused, used <5 years, used 5-9 years) and 161 wrapped trays using 3 grades of sterilization wrap were challenged with ~10(2) colony-forming units per liter of air containing aerosolized Micrococcus luteus with a count median particle size of 1 μm, while simultaneously experiencing air volume exchanges due to vacuum cycles-two 1-psi cycles, three 0.7-psi cycles, and three 0.4-psi cycles-to simulate air exchange events occurring during the sterilization, transportation, and storage of sterilized instrument trays in health care facilities. Of 111 rigid containers tested, 97 (87%) demonstrated bacterial ingress into the container. Of 161 wrapped trays, 0 (0%) demonstrated bacterial ingress into the tray. Contamination rates of rigid containers increased significantly with increasing duration of use. In this study using a dynamic bacterial aerosol challenge, sterilized wrapped trays demonstrated significantly greater protection than sterilized rigid containers against the ingress of airborne bacteria. Copyright © 2015. Published by Elsevier Inc.

Membrane-acting bacteriocin purified from a soil isolate Pediococcus pentosaceus LB44 shows broad host-range.

PubMed

Kaur, Ramanjeet; Tiwari, Santosh Kumar

2018-04-15

Bacteriocin LB44 was purified from cell-free supernatant (CFS) of Pediococcus pentosaceus LB44 using activity-guided chromatography techniques. It was stable up to 121 °C, pH 2.0-6.0, sensitive to proteinase K, papain and trypsin, and retained complete activity in the presence of organic solvents tested. The molecular weight of bacteriocin was ∼6 kDa and initial ten amino acid residues (GECGMCXECG) suggested a new compound. The loss in viable cell count and K + ion efflux of target cells of Micrococcus luteus suggested bactericidal activity. The cell membrane of bacteriocin-treated cells was found to be ruptured which was further confirmed by Fourier Transform Infrared (FTIR) analysis suggesting interaction of bacteriocin with phospholipids in cell membrane. It showed broad host-range and inhibited the growth of Lactobacillus delbrueckii NRRL B-4525, L. plantarum NRRL B-4496, L. acidophilus NRRL B-4495, Enterococcus hirae LD3, Weissella confusa LM85, Staphylococcus aureus, Salmonella typhi ATCC 13311, Serratia marcescens ATCC 27137, Pseudomonas aeruginosa ATCC 27853, Proteus vulgaris ATCC 29905, Haloferax larsenii HA1, HA3, HA8, HA9 and HA10. These properties suggested a new bacteriocin from soil isolate P. pentosaceus LB44 which may offers possible applications in food-safety and therapeutics. Copyright © 2018 Elsevier Inc. All rights reserved.

The modulation of extracellular superoxide dismutase in the specifically enhanced cellular immune response against secondary challenge of Vibrio splendidus in Pacific oyster (Crassostrea gigas).

PubMed

Liu, Conghui; Zhang, Tao; Wang, Lingling; Wang, Mengqiang; Wang, Weilin; Jia, Zhihao; Jiang, Shuai; Song, Linsheng

2016-10-01

Extracellular superoxide dismutase (EcSOD) is a copper-containing glycoprotein playing an important role in antioxidant defense of living cells exposed to oxidative stress, and also participating in microorganism internalization and cell adhesion in invertebrates. EcSOD from oyster (designated CgEcSOD) had been previously reported to bind lipopolysaccharides (LPS) and act as a bridge molecule in Vibrio splendidus internalization. Its mRNA expression pattern, PAMP binding spectrum and microorganism binding capability were examined in the present study. The mRNA expression of CgEcSOD in hemocytes was significantly up-regulated at the initial phase and decreased sharply at 48 h post V. splendidus stimulation. The recombinant CgEcSOD protein (rCgEcSOD) could bind LPS, PGN and poly (I:C), as well as various microorganisms including Micrococcus luteus, Staphylococcus aureus, Escherichia coli, Vibrio anguillarum, V. splendidus, Pastoris pastoris and Yarrowia lipolytica at the presence of divalent metal ions Cu(2+). After the secondary V. splendidus stimulation, the mRNA and protein of CgEcSOD were both down-regulated significantly. The results collectively indicated that CgEcSOD could not only function in the immune recognition, but also might contribute to the immune priming of oyster by inhibiting the foreign microbe invasion through a specific down-regulation. Copyright © 2016 Elsevier Ltd. All rights reserved.

Isolation and characterization of bacteriocinogenic lactic bacteria from M-Tuba and Tepache, two traditional fermented beverages in México

PubMed Central

de la Fuente-Salcido, Norma M; Castañeda-Ramírez, José Cristobal; García-Almendárez, Blanca E; Bideshi, Dennis K; Salcedo-Hernández, Rubén; Barboza-Corona, José E

2015-01-01

Mexican Tuba (M-Tuba) and Tepache are Mexican fermented beverages prepared mainly with pineapple pulp and coconut palm, respectively. At present, reports on the microbiota and nutritional effects of both beverages are lacking. The purpose of this study was to determine whether M-Tuba and Tepache contain cultivable lactic acid bacteria (LAB) capable of producing bacteriocins. Tepache and M-Tuba contain mesophilic aerobic bacteria, LAB, and yeast. Bacillus subtilis, Listeria monocytogenes, Listeria innocua, Streptococcus agalactiae, Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, Salmonella typhimurium, and Salmonella spp, were the microorganisms most susceptible to metabolites produced by bacterial isolates. M-Tuba and Tepache contain bacteria that harbor genes coding for nisin and enterocin, but not pediocin. The presence of Lactococcus lactis and E. faecium in M-Tuba and Tepache, was identified by 16S rDNA. These bacteria produced bacteriocins of ∼3.5 kDa and 4.0–4.5 kDa, respectively. Partial purified bacteriocins showed inhibitory effect against Micrococcus luteus, L. monocytogenes, L. innocua, Str. agalactiae, S. aureus, Bacillus cereus, B. subtilis, E. faecalis, and K. pneumoniae. We characterized, for the first time, cultivable microbiota of M-Tuba and Tepache, and specifically, identified candidate lactic bacteria (LAB) present in these beverages that were capable of synthesizing antimicrobial peptides, which collectively could provide food preservative functions. PMID:26405529

Phytoremediation of mercury in pristine and crude oil contaminated soils: Contributions of rhizobacteria and their host plants to mercury removal.

PubMed

Sorkhoh, N A; Ali, N; Al-Awadhi, H; Dashti, N; Al-Mailem, D M; Eliyas, M; Radwan, S S

2010-11-01

The rhizospheric soils of three tested legume crops: broad beans (Vicia faba), beans (Phaseolus vulgaris) and pea (Pisum sativum), and two nonlegume crops: cucumber (Cucumis sativus) and tomato, (Lycopersicon esculentum) contained considerable numbers (the magnitude of 10(5)g(-1) soil) of bacteria with the combined potential for hydrocarbon-utilization and mercury-resistance. Sequencing of the 16S rRNA coding genes of rhizobacteria associated with broad beans revealed that they were affiliated to Citrobacter freundii, Enterobacter aerogenes, Exiquobacterium aurantiacum, Pseudomonas veronii, Micrococcus luteus, Brevibacillus brevis, Arthrobacter sp. and Flavobacterium psychrophilum. These rhizobacteria were also diazotrophic, i.e. capable of N(2) fixation, which makes them self-sufficient regarding their nitrogen nutrition and thus suitable remediation agents in nitrogen-poor soils, such as the oily desert soil. The crude oil attenuation potential of the individual rhizobacteria was inhibited by HgCl(2), but about 50% or more of this potential was still maintained in the presence of up to 40 mgl(-1) HgCl(2). Rhizobacteria-free plants removed amounts of mercury from the surrounding media almost equivalent to those removed by the rhizospheric bacterial consortia in the absence of the plants. It was concluded that both the collector plants and their rhizospheric bacterial consortia contributed equivalently to mercury removal from soil. Copyright © 2010 Elsevier Inc. All rights reserved.

Diverse deep-sea fungi from the South China Sea and their antimicrobial activity.

PubMed

Zhang, Xiao-Yong; Zhang, Yun; Xu, Xin-Ya; Qi, Shu-Hua

2013-11-01

We investigated the diversity of fungal communities in nine different deep-sea sediment samples of the South China Sea by culture-dependent methods followed by analysis of fungal internal transcribed spacer (ITS) sequences. Although 14 out of 27 identified species were reported in a previous study, 13 species were isolated from sediments of deep-sea environments for the first report. Moreover, these ITS sequences of six isolates shared 84-92 % similarity with their closest matches in GenBank, which suggested that they might be novel phylotypes of genera Ajellomyces, Podosordaria, Torula, and Xylaria. The antimicrobial activities of these fungal isolates were explored using a double-layer technique. A relatively high proportion (56 %) of fungal isolates exhibited antimicrobial activity against at least one pathogenic bacterium or fungus among four marine pathogenic microbes (Micrococcus luteus, Pseudoaltermonas piscida, Aspergerillus versicolor, and A. sydowii). Out of these antimicrobial fungi, the genera Arthrinium, Aspergillus, and Penicillium exhibited antibacterial and antifungal activities, while genus Aureobasidium displayed only antibacterial activity, and genera Acremonium, Cladosporium, Geomyces, and Phaeosphaeriopsis displayed only antifungal activity. To our knowledge, this is the first report to investigate the diversity and antimicrobial activity of culturable deep-sea-derived fungi in the South China Sea. These results suggest that diverse deep-sea fungi from the South China Sea are a potential source for antibiotics' discovery and further increase the pool of fungi available for natural bioactive product screening.

Cytotoxicity, Bactericidal, and Antioxidant Activity of Sodium Alginate Hydrosols Treated with Direct Electric Current

PubMed Central

Król, Żaneta; Marycz, Krzysztof; Kulig, Dominika; Marędziak, Monika; Jarmoluk, Andrzej

2017-01-01

The aim of the study was to investigate the effect of using direct electric current (DC) of 0, 200, and 400 mA for five minutes on the physiochemical properties, cytotoxicity, antibacterial, and antioxidant activity of sodium alginate hydrosols with different sodium chloride concentrations. The pH, oxidation-reduction potential (ORP), electrical conductivity (EC), and available chlorine concentration (ACC) were measured. The effect of sodium alginate hydrosols treated with DC on Staphylococcus aureus, Listeria monocytogenes, Bacillus cereus, Micrococcus luteus, Escherichia coli, Salmonella enteritidis, Yersinia enterocolitica, Pseudomonas fluorescence, and RAW 264.7 and L929 cells was investigated. Subsequently, the antioxidant properties of hydrosols were evaluated by determining the scavenging ability of 1,1-diphenyl-2-picrylhydrazyl free radical (DPPH) and ferric reducing antioxidant power (FRAP). The results have shown that after applying 400 mA in hydrosol samples with 0.1% and 0.2% NaCl all tested bacteria were inactivated. The ACC concentration of C400 samples with NaCl was equal to 13.95 and 19.71 mg/L, respectively. The cytotoxicity analysis revealed that optimized electric field conditions and the addition of sodium chloride allow for the avoidance of toxicity effects on normal cells without disturbing the antibacterial effects. Due to the presence of oxidizing substances, the DPPH of variants treated with DC was lower than the DPPH of control samples. PMID:28327520

Cytotoxicity, Bactericidal, and Antioxidant Activity of Sodium Alginate Hydrosols Treated with Direct Electric Current.

PubMed

Król, Żaneta; Marycz, Krzysztof; Kulig, Dominika; Marędziak, Monika; Jarmoluk, Andrzej

2017-03-22

The aim of the study was to investigate the effect of using direct electric current (DC) of 0, 200, and 400 mA for five minutes on the physiochemical properties, cytotoxicity, antibacterial, and antioxidant activity of sodium alginate hydrosols with different sodium chloride concentrations. The pH, oxidation-reduction potential (ORP), electrical conductivity (EC), and available chlorine concentration (ACC) were measured. The effect of sodium alginate hydrosols treated with DC on Staphylococcus aureus , Listeria monocytogenes , Bacillus cereus , Micrococcus luteus , Escherichia coli , Salmonella enteritidis , Yersinia enterocolitica , Pseudomonas fluorescence , and RAW 264.7 and L929 cells was investigated. Subsequently, the antioxidant properties of hydrosols were evaluated by determining the scavenging ability of 1,1-diphenyl-2-picrylhydrazyl free radical (DPPH) and ferric reducing antioxidant power (FRAP). The results have shown that after applying 400 mA in hydrosol samples with 0.1% and 0.2% NaCl all tested bacteria were inactivated. The ACC concentration of C400 samples with NaCl was equal to 13.95 and 19.71 mg/L, respectively. The cytotoxicity analysis revealed that optimized electric field conditions and the addition of sodium chloride allow for the avoidance of toxicity effects on normal cells without disturbing the antibacterial effects. Due to the presence of oxidizing substances, the DPPH of variants treated with DC was lower than the DPPH of control samples.

Spectroscopic studies, antimicrobial activities and crystal structures of N-(2-hydroxy-3-methoxybenzalidene)1-aminonaphthalene

NASA Astrophysics Data System (ADS)

Ünver, Hüseyin; Yıldız, Mustafa; Dülger, Başaran; Özgen, Özen; Kendi, Engin; Durlu, Tahsin Nuri

2005-03-01

Schiff base N-(2-hydroxy-3-methoxybenzalidene)1-aminonaphthalene has been synthesized from the reaction of 2-hydroxy-3-methoxybenzaldehyde with 1-aminonaphthalene. The compound were characterized by elemental analysis, FT-IR, 1H NMR, 13C NMR and UV-visible techniques. The UV-visible spectra of the Schiff base were studied in polar and nonpolar solvents in acidic and basic media. The structure of the compound has been examined cyrstallographically. There are two independent molecules in the asymmetric unit. It crystallizes in the monoclinic space group P21/c, with unit cell parameters: a=14, 602(2), b=5,800(1), c=16, 899(1) Å, V=1394.4(2) Å 3, Dx=1.321 g cm -3 and Z=4. The crystal structure was solved by direct methods and refined by full-matrix least squares to a find R=0.041 of for 1179 observed reflections. The title compound's antimicrobial activities also have been studied. The antimicrobial activities of the ligand has been screened in vitro against the organisms Escherichia coli ATCC 11230, Staphylococcus aureus ATCC 6538, Klebsiella pneumoniae UC57, Micrococcus luteus La 2971, Proteus vulgaris ATCC 8427, Pseudomonas aeruginosa ATCC 27853, Mycobacterium smegmatis CCM 2067, Bacillus cereus ATCC 7064 and Listeria monocytogenes ATCC 15313, the yeast cultures Candida albicans ATCC 10231, Kluyveromyces fragilis NRRL 2415, Rhodotorula rubra DSM 70403, Debaryomyces hansenii DSM 70238 and Hanseniaspora guilliermondii DSM 3432.

Synthesis and spectral studies on metal complexes of s-triazine based ligand and non linear optical properties

NASA Astrophysics Data System (ADS)

Shanmugakala, R.; Tharmaraj, P.; Sheela, C. D.

2014-11-01

A series of transition metal complexes of type [ML] and [ML2]Cl2 (where M = Cu(II), Ni(II), Co(II) have synthesized from 2-phenylamino-4,6-dichloro-s-triazine and 3,5-dimethyl pyrazole; their characteristics have been investigated by means of elemental analyses, magnetic susceptibility, molar conductance, IR, UV-Vis, Mass, NMR and ESR spectra. The electrochemical behavior of copper(II) complexes we have studied, by using cyclic voltammetry. The ESR spectra of copper(II) complexes are recorded at 300 K and 77 K and their salient features are appropriately reported. Spectral datas, we found, show that the ligand acts as a neutral tridentate, and coordinates through the triazine ring nitrogen and pyrazolyl ring nitrogen atoms to the metal ion. Evident from our findings, the metal(II) complexes of [ML] type exhibit square pyramidal geometry, and that of [ML2]Cl2 exhibit octahedral geometry. The in vitro antimicrobial activities of the ligand and its complexes are evaluated against Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus mutans, Escherichia coli, Enterobacter aerogenes, Klebsiella pneumoniae, Proteus vulgaris, Cryptococcus neoformans, Pseudomonas aeruginosa, Salmonella typhi, Serratia marcescens, Shigella flexneri, Vibrio cholera, Vibris parahaemolyticus, Aspergillus niger, Candida albicans and Penicillium oxalicum by well-diffusion method. The second harmonic generation efficiency of the ligand and its complexes are determined and compared with urea and KDP.

Radiation and Heat Resistance of Moraxella-Acinetobacter in Meats

DTIC Science & Technology

1978-01-23

Parrish, and D. Duggan. 1956. Studies on a radiation-resistant Micrococcus . I. Isolation, morphology, cul- tural characteristics, and resistance to...Anderson, and P. R. Elliker. 1965. Ecology of Micrococcus radiodurans. Appl. Microbiol. 13: 1030. Lewis, N. F. 1973. Radio-resistant Micrococcus

Optimization of Nutrients and Culture Conditions for Alkaline Protease Production Using Two Endophytic Micrococci: Micrococcus aloeverae and Micrococcus yunnanensis.

PubMed

Prakash, Om; Nimonkar, Yogesh; Chavadar, Mahesh S; Bharti, Nidhi; Pawar, Shrikant; Sharma, Ashutosh; Shouche, Yogesh S

2017-06-01

An endophytic species of Micrococcus was isolated from Aloe vera leaf (syn. Aloe barbadensis ) and screened for protease production with five other species of Micrococcus . Data indicated that endophytic Micrococcus aloeverae AE-6 MCC 2184 T and Micrococcus yunnanensis DSM 21948 T showed efficient protease production potential and secreted active protease at high salt (10%), temperature (40 °C) and in wide range of pH 8-10. Unlike M . yunnanensis DSM 21948 T , protease production by M . aloeverae AE-6 MCC 2184 T was stringently controlled by pH. Protease induction study using different group of peptides, peptide carbohydrates and peptide macronutrient combinations showed variable response with both the organisms. Result indicated that the amount of protease was not directly related to cell biomass but it depends on nature of inducible peptides. In this study we also developed a modified agar-well assay for semi-quantitative data from large number of replicates.

Spectroscopic study, antimicrobial activity and crystal structures of N-(2-hydroxy-5-nitrobenzalidene)4-aminomorpholine and N-(2-hydroxy-1-naphthylidene)4-aminomorpholine

NASA Astrophysics Data System (ADS)

Yıldız, Mustafa; Ünver, Hüseyin; Dülger, Başaran; Erdener, Diğdem; Ocak, Nazan; Erdönmez, Ahmet; Durlu, Tahsin Nuri

2005-03-01

Schiff bases N-(2-hydroxy-3-nitrobenzalidene)4-aminomorpholine ( 1) and N-(2-hydroxy-1-naphthylidene)4-aminomorpholine ( 2) were synthesized from the reaction of 4-aminomorpholine with 2-hydroxy-5-nitrobenzaldehyde and 2-hydroxy-1-naphthaldehyde. Compounds 1 and 2 were characterized by elemental analysis, IR, 1H NMR, 13C NMR and UV-Visible techniques. The UV-Visible spectra of the Schiff bases with OH group in ortho position to the imino group were studied in polar and nonpolar solvents in acidic and basic media. The structures of compounds 1 and 2 have been examined cyrstallographically, for two compounds exist as dominant form of enol-imines in both the solutions and solid state. The title compounds 1 and 2 crystallize in the monoclinic space group P2 1/ c and P2 1/ n with unit cell parameters: a=8.410(1) and 11.911(3), b=6.350(9) and 4.860(9), c=21.728(3) and 22.381(6) Å, β=90.190(1) and 95.6(2)°, V=1160.6(3) and 1289.5(5) Å 3, Dx=1.438 and 1.320 g cm -3, respectively. The crystal structures were solved by direct methods and refined by full-matrix least squares. The antimicrobial activities of compounds 1 and 2 have also been studied. The antimicrobial activities of the ligands have been screened in vitro against the organisms Escherichia coli ATCC 11230, Staphylococcus aureus ATCC 6538, Klebsiella pneumoniae UC57, Micrococcus luteus La 2971, Proteus vulgaris ATCC 8427, Pseudomonas aeruginosa ATCC 27853, Mycobacterium smegmatis CCM 2067, Bacillus cereus ATCC 7064, Listeria monocytogenes ATCC 15313, Candida albicans ATCC 10231, Kluyveromyces fragilis NRRL 2415, Rhodotorula rubra DSM 70403, Debaryomyces hansenii DSM 70238 and Hanseniaspora guilliermondii DSM 3432.

Novel Compounds from Shark and Stingray Epidermal Mucus With Antimicrobial Activity Against Wound Infection Pathogens

DTIC Science & Technology

2013-03-01

530-E6 MSSA, MRSA, E. coli, VRE, E. faecalis, B. subtilis 530-E7 MSSA, MRSA, E. coli, VRE, E. faecalis, B. subtilis B. anthracis, Micrococcus sp...530-E10 MSSA, MRSA, E. coli, VRE, E. faecalis, B. subtilis Micrococcus sp. 530-A5 VRE 530-B12 VRE 530-C12 VRE B. anthracis 530-D12 VRE 530-E12...VRE Micrococcus sp. 530-F11 VRE Micrococcus sp. 530-F12 VRE Enterococcus. faecium Figure 9. Pathogen overlay assay plates showing

Molecular cloning of the BLADE-ON-PETIOLE gene and expression analyses during nodule development in Lupinus luteus.

PubMed

Frankowski, Kamil; Wilmowicz, Emilia; Kućko, Agata; Zienkiewicz, Agnieszka; Zienkiewicz, Krzysztof; Kopcewicz, Jan

2015-05-01

The BLADE-ON-PETIOLE (BOP) genes have been recently shown to play an essential role in many physiological processes, including embryogenesis, meristem determinacy, leaf patterning and nodule development. In our research we used Lupinus luteus, a plant with great agronomic potential due to its high protein content and nitrogen fixation ability. In this work, LlBOP in L. luteus was identified for the first time and its expression during nodule development was analyzed. The high expression levels of LlBOP and LlLbI (LEGHEMOGLOBIN), essential to nitrogen-fixing symbiosis, were noted in the developing root nodules and were correlated with the occurrence of leghemoglobin. All of these data indicate that LlBOP is an important regulator of root nodule formation and functioning in L. luteus. Copyright © 2015 Elsevier GmbH. All rights reserved.

Development of microsatellite markers in Lupinus luteus (Fabaceae) and cross-species amplification in other lupine species.

PubMed

Gonzalez, Lorena B Parra; Straub, Shannon C K; Doyle, Jeff J; Ortega, Paula E Mora; Garrido, Haroldo E Salvo; Butler, Iván J Maureira

2010-08-01

Microsatellite primers were developed in Lupinus luteus L., an emerging temperate protein crop, to investigate genetic diversity, population structure, and to facilitate the generation of better yellow lupine varieties. • Thirteen polymorphic primer sets were evaluated in a European and Eastern European accession collection of L. luteus. The primers amplified di-, tri-, and tetranucleotide repeats with 2-4 alleles per locus. These revealed a moderate to low level of genetic variation, as indicated by an average observed heterozygosity of 0.0126. Select loci also amplified successfully in the closely related species L. hispanicus Boiss. & Reut. and in the New World species L. mutabilis Sweet. • These results indicate the utility of primers for the study of genetic diversity across L. luteus populations and related lupine species. The use of these microsatellite markers will facilitate the implementation of several molecular breeding strategies in yellow lupine.

[Estimation of activity of pharmakopeal disinfectants and antiseptics against Gram-negative and Gram-positive bacteria isolated from clinical specimens, drugs and environment].

PubMed

Grzybowska, Wanda; Młynarczyk, Grazyna; Młynarczyk, Andrzej; Bocian, Ewa; Luczak, Mirosław; Tyski, Stefan

2007-01-01

The MIC of nine different disinfectants and antiseptics were determined for the Gram-negative and Gram-positive bacteria. Strains originated from clinical specimens, drugs and environment. A sensitivity was determined against chlorhexidinum digluconate (Gram-negative: 0,625-80 mg/L, Gram-positive: 0,3-10 mg/L), benzalconium chloride (Gram-negative: 2,5-1280 mg/L, Gram-positive: 1,25-20 mg/L), salicilic acid (Gram-negative and Gram-positive: 400-1600 mg/L), benzoic acid (Gram-negative: 800-1600 mg/L, Gram-positive: 400-1 600 mg/L), boric acid (Gram-negative: 800-12 800 mg/L, Gram-positive: 1 600-6400 mg/L), chloramine B (Gram-negative: 1600-6400 mg/L, Gram-positive:800- 6400 mg/L), jodine (Gram-negative: 200-1600 mg/L, Gram-positive: 200-1600 mg/L), etacridine lactate (Gram-negative: 40 do > 20480 mg/L, Gram-positive: 40-1280 mg/L) and resorcine (Gram-negative: 1600-6400 mg/L, Gram-positive: 800-6400 mg/L). Diversified values of MIC for different strains were obtained, especially in the case of benzalconium chloride, etacridine lactate, chlorhexidinum digluconate, boric acid and iodine. Strains isolated from environment were usually more susceptible to examined compounds than clinical strains. The biggest diversification of sensitivity was observed among strains originated from drugs where besides sensitive appeared strains characterizing by very high MIC values of some substances, eg. boric acid.

Whole-Genome Sequence of the Soil Bacterium Micrococcus sp. KBS0714.

PubMed

Kuo, V; Shoemaker, W R; Muscarella, M E; Lennon, J T

2017-08-10

We present here a draft genome assembly of Micrococcus sp. KBS0714, which was isolated from agricultural soil. The genome provides insight into the strategies that Micrococcus spp. use to contend with environmental stressors such as desiccation and starvation in environmental and host-associated ecosystems. Copyright © 2017 Kuo et al.

Wound healing properties and kill kinetics of Clerodendron splendens G. Don, a Ghanaian wound healing plant

PubMed Central

Gbedema, Stephen Y.; Emelia, Kisseih; Francis, Adu; Kofi, Annan; Eric, Woode

2010-01-01

As part of our general objective of investigating indigenous plants used in wound healing in Ghana, we hereby report our findings from some in vitro and in vivo studies related to wound healing activities of Clerodendron splendens G. Don (Verbanaceae). Methanolic extract of the aerial parts of the plant was tested for antimicrobial activity against Gram positive bacteria (Bacillus subtilis, Staphylococcus aureus, Streptococcus faecalis, Micrococcus flavus, as well as resistant strains of Staph. aureus SA1199B, RN4220 and XU212), Gram negative bacteria (Escherichia coli, Pseudomonas aeruginosa, Proteous mirabilis, Klebsiella pneumoniae) and Candida albicans using the micro-well dilution method. Survivor–time studies of the microorganisms, radical scavenging activity using 2,2’-diphenylpicrylhydrazyl (DPPH) and various in vivo wound healing activity studies were also conducted on the extract. The extract exhibited biostatic action against all the test microorganisms with a Minimum Inhibition Concentration (MIC) ranging between 64 and 512 μg/ml and a free radical scavenging property with an IC50 value of 103.2 μg/ml. The results of the in vivo wound healing tests showed that upon application of C. splendens ointment, there was a reduction in the epithelization period from 26.7 days (control) to 13.6 days along with a marked decrease in the scar area from 54.2 mm2 (control) to 25.2 mm2. Significant increase in the tensile strength and hydroxyproline content were also observed as compared to the control and was comparable to nitrofurazone. The above results appear to justify the traditional use of C. splendens in wound healing and treatment of skin infections in Ghana. PMID:21808542

The effectiveness of photocatalytic ionisation disinfection of filter materials.

PubMed

Pietrzak, Katarzyna; Gutarowska, Beata

2013-01-01

The purpose of this study was to determine the effectiveness of photocatalytic ionisation as a disinfection method for filter materials contaminated by microorganisms, and to assess how air relative humidity (RH), time and microbe type influence the effectiveness of this disinfection. In the quantitative analysis of a used car air filter, bacterial contamination equalled 1.2 x 10(5) cfu/cm2, fungal contamination was 3.8 x 10(6) cfu/cm2, and the isolated microorganisms were Aspergillus niger, Bacillus megaterium, Cladosporium herbarum, Cryptococcus laurenti, Micrococcus sp., Rhodotorula glutinis and Staphylococcus cohnii. In the model experiment, three isolates (C. herbarum, R. glutinis, S. cohnii) and 3 ATCC species (A. niger, E. coli, S. aureus) were used for photocatalytic ionisation disinfection. The conditions of effective photocatalytic ionisation disinfection (R > or = 99.9%) were established as 2-3 h at RH = 77% (bacteria) and 6-24 h at RH = 53% (fungi). RH has an influence on the effectiveness of the photocatalytic disinfection process; the highest effectiveness was obtained for bacteria at RH = 77%, with results 5% higher than for RH = 49%. The studies show that the sensitivity of microorganisms to photocatalytic ionisation disinfection is ordered as follows: Gram-positive bacteria (S. cohnii, S. aureus), Gram-negative bacteria (E. coli), yeasts (R. glutinis), and moulds (C. herbarum, A. niger). Of all the mathematical models used for the description of death dynamics after photocatalytic ionisation disinfection, the Chick-Watson model is the most useful, but for more resistant microorganisms, the delayed Chick-Watson model is highly recommended. It therefore seems, that the presented disinfection method of photocatalytic ionisation can be successfully used to clean filtration materials.

The transcriptome of Spodoptera exigua larvae exposed to different types of microbes.

PubMed

Pascual, Laura; Jakubowska, Agata K; Blanca, Jose M; Cañizares, Joaquin; Ferré, Juan; Gloeckner, Gernot; Vogel, Heiko; Herrero, Salvador

2012-08-01

We have obtained and characterized the transcriptome of Spodoptera exigua larvae with special emphasis on pathogen-induced genes. In order to obtain a highly representative transcriptome, we have pooled RNA from diverse insect colonies, conditions and tissues. Sequenced cDNA included samples from 3 geographically different colonies. Enrichment of RNA from pathogen-related genes was accomplished by exposing larvae to different pathogenic and non-pathogenic microbial agents such as the bacteria Bacillus thuringiensis, Micrococcus luteus, and Escherichia coli, the yeast Saccharomyces cerevisiae, and the S. exigua nucleopolyhedrovirus (SeMNPV). In addition, to avoid the loss of tissue-specific genes we included cDNA from the midgut, fat body, hemocytes and integument derived from pathogen exposed insects. RNA obtained from the different types of samples was pooled, normalized and sequenced. Analysis of the sequences obtained using the Roche 454 FLX and Sanger methods has allowed the generation of the largest public set of ESTs from S. exigua, including a large group of immune genes, and the identification of an important number of SSR (simple sequence repeats) and SNVs (single nucleotide variants: SNPs and INDELs) with potential use as genetic markers. Moreover, data mining has allowed the discovery of novel RNA viruses with potential influence in the insect population dynamics and the larval interactions with the microbial pesticides that are currently in use for the biological control of this pest. Copyright © 2012 Elsevier Ltd. All rights reserved.

Engineering of Baeyer-Villiger monooxygenase-based Escherichia coli biocatalyst for large scale biotransformation of ricinoleic acid into (Z)-11-(heptanoyloxy)undec-9-enoic acid

PubMed Central

Seo, Joo-Hyun; Kim, Hwan-Hee; Jeon, Eun-Yeong; Song, Young-Ha; Shin, Chul-Soo; Park, Jin-Byung

2016-01-01

Baeyer-Villiger monooxygenases (BVMOs) are able to catalyze regiospecific Baeyer-Villiger oxygenation of a variety of cyclic and linear ketones to generate the corresponding lactones and esters, respectively. However, the enzymes are usually difficult to express in a functional form in microbial cells and are rather unstable under process conditions hindering their large-scale applications. Thereby, we investigated engineering of the BVMO from Pseudomonas putida KT2440 and the gene expression system to improve its activity and stability for large-scale biotransformation of ricinoleic acid (1) into the ester (i.e., (Z)-11-(heptanoyloxy)undec-9-enoic acid) (3), which can be hydrolyzed into 11-hydroxyundec-9-enoic acid (5) (i.e., a precursor of polyamide-11) and n-heptanoic acid (4). The polyionic tag-based fusion engineering of the BVMO and the use of a synthetic promoter for constitutive enzyme expression allowed the recombinant Escherichia coli expressing the BVMO and the secondary alcohol dehydrogenase of Micrococcus luteus to produce the ester (3) to 85 mM (26.6 g/L) within 5 h. The 5 L scale biotransformation process was then successfully scaled up to a 70 L bioreactor; 3 was produced to over 70 mM (21.9 g/L) in the culture medium 6 h after biotransformation. This study demonstrated that the BVMO-based whole-cell reactions can be applied for large-scale biotransformations. PMID:27311560

Cathepsin O is involved in the innate immune response and metamorphosis of Antheraea pernyi.

PubMed

Sun, Yu-Xuan; Zhu, Bao-Jian; Tang, Lin; Sun, Yu; Chen, Chen; Nadeem Abbas, Muhammad; Wang, Lei; Qian, Cen; Wei, Guo-Qing; Liu, Chao-Liang

2017-11-01

Cathepsins are key members of mammalian papain-like cysteine proteases that play an important role in the immune response. In this study, a fragment of cDNA encoding cathepsin O proteinase (ApCathepsin O) was cloned from Antheraea pernyi. It contains an open reading frame of 1170bp and encodes a protein with 390 amino acid residues, including a conserved I29 inhibitor domain and a peptidase C1A (clan CA of cysteine proteases, papain family C1 subfamily) domain. Comparison with other previously reported cathepsin O proteins showed identity ranging from 45% to 79%. Quantitative real-time PCR (qRT-PCR) and Western blot analysis revealed that ApCathepsin O was highly expressed in the fat body; furthermore, the high expression during the pupal stage indicated that it might be involved during metamorphosis. After exposure to four different heat-killed pathogens (Escherichia coli, Beauveria bassiana, Micrococcus luteus, and A. pernyi nucleopolyhedrovirus), the expression levels of ApCathepsin O mRNA significantly increased and showed variable expression patterns. This indicates that ApCathepsin O is potentially involved in the innate immune system of A. pernyi. Interestingly, ApCathepsin O expression was upregulated after 20-hydroxyecdysone (20E) injection, which suggested that it might be regulated by 20E. In conclusion, ApCathepsin O is a protease that may play an important role in the innate immune response and metamorphosis of A. pernyi. Copyright © 2017. Published by Elsevier Inc.

Residual antibacterial activity of chlorhexidine digluconate and camphorated p-monochlorophenol in calcium hydroxide-based root canal dressings.

PubMed

Soares, Janir Alves; Leonardo, Mario Roberto; Tanomaru Filho, Mário; Silva, Léa Assed Bezerra da; Ito, Izabel Yoko

2007-01-01

The purpose of this study was to evaluate the residual antibacterial activity of several calcium hydroxide [Ca(OH)2]-based pastes, placed in root canals of dogs' teeth with induced chronic periapical lesions. Root canals were instrumented with the ProFile rotary system and filled with 4 pastes: G1 (n=16): Ca(OH)2 paste + anesthetic solution; G2 (n=20): Calen paste + camphorated p-monochlorophenol (CMCP); G3 (n=18): Calen; and G4 (n=18): Ca(OH)2 paste + 2% chlorhexidine digluconate. After 21 days, the pastes were removed with size 60 K-files and placed on Petri plates with agar inoculated with Micrococcus luteus ATCC 9341. Pastes that were not placed into root canals served as control. After pre-diffusion, incubation and optimization, the inhibition zones of bacterial growth were measured and analyzed by Mann-Whitney U test at 5% significance level. All pastes showed residual antibacterial activity. The control samples had larger halos (p<0.05). The mean residual antibacterial activity halos in G1, G2, G3 and G4 were 7.6; 10.4; 17.7 and 21.4 mm, respectively. The zones of bacterial growth of G4 were significantly larger than those of G1 and G2 (p<0.05). In conclusion, regardless of the vehicle and antiseptic, all Ca(OH)2-based pastes showed different degrees of measurable residual antibacterial activity. Furthermore, unlike CMCP, chlorhexidine increased significantly the antibacterial activity of Ca(OH)2.

Phylogenetic analysis and antifouling potentials of culturable fungi in mangrove sediments from Techeng Isle, China.

PubMed

Zhang, Xiao-Yong; Fu, Wen; Chen, Xiao; Yan, Mu-Ting; Huang, Xian-De; Bao, Jie

2018-06-09

To search for more microbial resources for screening environment-friendly antifoulants, we investigated the phylogenetic diversity and antifouling potentials of culturable fungi in mangrove sediments from Techeng Isle, China. A total of 176 isolates belonging to 57 fungal taxa were recovered and identified. The high levels of diversity and abundance of mangrove fungi from Techeng Isle were in accordance with previous studies on fungi from other mangrove ecosystems. Fifteen of the 176 isolates demonstrated high divergence (87-93%) from the known fungal taxa in GenBank. Moreover, 26 isolates recorded in mangrove ecosystems for the first time. These results suggested that mangrove sediments from Techeng Isle harbored some new fungal communities compared with other mangrove ecosystems. The antifouling activity of 57 representative isolates (belonging to 57 different fungal taxa) was tested against three marine bacteria (Loktanella hongkongensis, Micrococcus luteus and Pseudoalteromonas piscida) and two marine macrofoulers (bryozoan Bugula neritina and barnacle Balanus amphitrite). Approximately 40% of the tested isolates displayed distinct antifouling activity. Furthermore, 17 fungal isolates were found to display strong or a wide spectrum of antifouling activity in this study, suggesting that these isolates deserve further study as potential sources of novel antifouling metabolites. To our knowledge, this is the first report on the investigation of the phylogenetic diversity and antifouling potential of culturable fungi in mangrove sediments from Techeng Isle, China. These results contribute to our knowledge of mangrove fungi and further increases the pool of fungi available for natural bioactive product screening.

Enrichment and isolation of crude oil degrading bacteria from some mussels collected from the Persian Gulf.

PubMed

Bayat, Zeynab; Hassanshahian, Mehdi; Hesni, Majid Askari

2015-12-15

To date, little is known about existing relationships between mussels and bacteria in hydrocarbon-contaminated marine environments. The aim of this study is to find crude oil degrading bacteria in some mussels at the Persian Gulf. Twenty eight crude oil degrading bacteria were isolated from three mussels species collected from oil contaminated area at Persian Gulf. According to high growth and degradation of crude oil four strains were selected between 28 isolated strains for more study. Determination the nucleotide sequence of the gene encoding for 16S rRNA show that these isolated strains belong to: Shewanella algae isolate BHA1, Micrococcus luteus isolate BHA7, Pseudoalteromonas sp. isolate BHA8 and Shewanella haliotis isolate BHA35. The residual crude oil in culture medium was analysis by Gas Chromatography (GC). The results confirmed that these strains can degrade: 47.24%, 66.08%, 27.13% and 69.17% of crude oil respectively. These strains had high emulsification activity and biosurfactant production. Also, the effects of some factors on crude oil degradation by isolated strains were studied. The results show that the optimum concentration of crude oil was 2.5% and the best degradation take place at 12% of salinity. This research is the first reports on characterization of crude oil degrading bacteria from mussels at Persian Gulf and by using of these bacteria in the field the effect of oil pollution can be reduce on this marine environment. Copyright © 2015 Elsevier Ltd. All rights reserved.

Evaluation of wound healing, anti-microbial and antioxidant potential of Pongamia pinnata in wistar rats.

PubMed

Dwivedi, Deepak; Dwivedi, Mona; Malviya, Sourabh; Singh, Vinod

2017-01-01

To investigate wound healing, antimicrobial and antioxidant activity of leaf extract of Pongamia Pinnata . Methanolic extracts of P. pinnata leaf were studied for wound healing efficiency, and was assessed by the rate of wound contraction, tensile strength, breaking strength, hydroxyproline and hexosamine content, along with its effect on pro-inflammatory and anti-inflammatory cytokines was assessed using excision and incision model of wound repair in Wistar rats. Antimicrobial activity against ten microorganisms was also assessed. In vivo antioxidant activity was performed to understand the mechanism of wound healing potency. The results indicated that P. pinnata extract has potent wound healing capacity as evident from the wound contraction and increased tensile strength. Hydroxyproline and hexosamine expression were also well correlated with the healing pattern observed. extract exhibited significant antimicrobial activity, Staphylococcus aureus, Staphylococcus pyogenes, Staphylococcus epidermidis, Escherichia coli, Micrococcus luteus, Enterobacter aerogenes, Salmonella typhi, Pseudomonas aeruginosa, Candida albicans, Aspergillus niger also indicate that P. pinnata posses potent antioxidant activity by inhibition lipid peroxidation, reduce glutathione, superoxide dismutase level and increases catalase activity. During early wound healing phase TNF-α and IL-6 level were found to be up-regulated by P. pinnata treatment. Increased wound contraction and tensile strength, augmented hydroxyproline and hexosamine content, antioxidative activity and moderate antimicrobial activity support the early wound healing exhibited by P. pinnata . Induction in cytokine production may be one of the mechanisms in accelerating the wound healing. Results suggest that P. pinnata may be useful in tropical management of wound healing.

Surface Microflora of Four Smear-Ripened Cheeses

PubMed Central

Mounier, Jérôme; Gelsomino, Roberto; Goerges, Stefanie; Vancanneyt, Marc; Vandemeulebroecke, Katrien; Hoste, Bart; Scherer, Siegfried; Swings, Jean; Fitzgerald, Gerald F.; Cogan, Timothy M.

2005-01-01

The microbial composition of smear-ripened cheeses is not very clear. A total of 194 bacterial isolates and 187 yeast isolates from the surfaces of four Irish farmhouse smear-ripened cheeses were identified at the midpoint of ripening using pulsed-field gel electrophoresis (PFGE), repetitive sequence-based PCR, and 16S rRNA gene sequencing for identifying and typing the bacteria and Fourier transform infrared spectroscopy and mitochondrial DNA restriction fragment length polymorphism (mtDNA RFLP) analysis for identifying and typing the yeast. The yeast microflora was very uniform, and Debaryomyces hansenii was the dominant species in the four cheeses. Yarrowia lipolytica was also isolated in low numbers from one cheese. The bacteria were highly diverse, and 14 different species, Corynebacterium casei, Corynebacterium variabile, Arthrobacter arilaitensis, Arthrobacter sp., Microbacterium gubbeenense, Agrococcus sp. nov., Brevibacterium linens, Staphylococcus epidermidis, Staphylococcus equorum, Staphylococcus saprophyticus, Micrococcus luteus, Halomonas venusta, Vibrio sp., and Bacillus sp., were identified on the four cheeses. Each cheese had a more or less unique microflora with four to nine species on its surface. However, two bacteria, C. casei and A. arilaitensis, were found on each cheese. Diversity at the strain level was also observed, based on the different PFGE patterns and mtDNA RFLP profiles of the dominant bacterial and yeast species. None of the ripening cultures deliberately inoculated onto the surface were reisolated from the cheeses. This study confirms the importance of the adventitious, resident microflora in the ripening of smear cheeses. PMID:16269673

Gram-negative, but not Gram-positive, bacteria elicit strong PGE2 production in human monocytes.

PubMed

Hessle, Christina C; Andersson, Bengt; Wold, Agnes E

2003-12-01

Gram-positive and Gram-negative bacteria induce different cytokine patterns in human mononuclear cells. We have seen that Gram-positives preferentially induce IL-12 and TNF-alpha, whereas Gram-negatives induce more IL-10, IL-6, and IL-8. In this study, we compared the capacity of these two groups of bacteria to induce PGE2. Monocytes stimulated with Gram-negative bacterial species induced much more PGE2 than did Gram-positive bacteria (5600 +/- 330 vs. 1700 +/- 670 pg/mL, p < 0.001). Blocking of COX-2 by NS398 abolished PGE2 production, but did not alter the cytokine patterns induced by Gram-positive and Gram-negative bacteria. We suggest that Gram-positive and Gram-negative bacteria may stimulate different innate effector functions; Gram-positive bacteria promoting cell-mediated effector functions whereas Gram-negative bacteria inducing mediators inhibiting the same.

Urinary infection caused by Micrococcus subgroup 3

PubMed Central

Kerr, Helen

1973-01-01

The laboratory findings and clinical presentations in urinary infections in 23 nurses, 10 caused by Micrococcus subgroup 3 and 13 by Escherichia coli, were studied, and the symptoms and possible predisposing factors compared. There were no important differences between the two groups. The infections caused by Micrococcus subgroup 3 were symptomatically severe, as were those caused by Escherichia coli. PMID:4593863

Production of gluconic acid using Micrococcus sp.: optimisation of carbon and nitrogen sources.

PubMed

Joshi, V D; Sreekantiah, K R; Manjrekar, S P

1996-01-01

A process for production of gluconic acid from glucose by a Micrococcus sp. is described. More than 400 bacterial cultures isolated from local soil were tested for gluconic acid production. Three isolates, were selected on basis of their ability to produce gluconic acid and high titrable acidity. These were identified as Micrococcus sp. and were named M 27, M 54 and M 81. Nutritional and other parameters for maximum production of gluconic acid by the selected isolates were optimised. It was found that Micrococcus sp. isolate M 27 gave highest yield of 8.19 g gluconic acid from 9 g glucose utilised giving 91% conversion effeciency.

Micrococcus yunnanensis sp. nov., a novel actinobacterium isolated from surface-sterilized Polyspora axillaris roots.

PubMed

Zhao, Guo-Zhen; Li, Jie; Qin, Sheng; Zhang, Yu-Qin; Zhu, Wen-Yong; Jiang, Cheng-Lin; Xu, Li-Hua; Li, Wen-Jun

2009-10-01

In this study, strain YIM 65004(T), isolated from roots of Polyspora axillaris, was shown to represent a novel species of the genus Micrococcus by means of a polyphasic approach. Chemotaxonomic data gathered for peptidoglycan type, menaquinones, phospholipids and fatty acids strongly supported the classification of this strain within the genus Micrococcus: the cell-wall peptidoglycan contained lysine, glutamic acid, alanine, glycine and aspartic acid, the predominant menaquinones were MK-8(H(2)) (66.97 %) and MK-7(H(2)) (23.26 %), the phospholipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and an unknown ninhydrin-negative phospholipid, and the major cellular fatty acids were anteiso-C(15 : 0) (61.98 %), iso-C(16 : 0) (14.25 %) and iso-C(15 : 0) (13.04 %). The G+C content of the genomic DNA was 71.7 mol%. A number of physiological features were found that clearly distinguished strain YIM 65004(T) from recognized Micrococcus species. DNA-DNA hybridization studies suggested that the novel strain represents a separate genomic species. Based on the above data, a novel species of the genus Micrococcus, Micrococcus yunnanensis sp. nov., is proposed, with the type strain YIM 65004(T) (=CCTCC AA 208060(T)=DSM 21948(T)).

Improvement of cadmium phytoremediation after soil inoculation with a cadmium-resistant Micrococcus sp.

PubMed

Sangthong, Chirawee; Setkit, Kunchaya; Prapagdee, Benjaphorn

2016-01-01

Cadmium-resistant Micrococcus sp. TISTR2221, a plant growth-promoting bacterium, has stimulatory effects on the root lengths of Zea mays L. seedlings under toxic cadmium conditions compared to uninoculated seedlings. The performance of Micrococcus sp. TISTR2221 on promoting growth and cadmium accumulation in Z. mays L. was investigated in a pot experiment. The results indicated that Micrococcus sp. TISTR2221significantly promoted the root length, shoot length, and dry biomass of Z. mays L. transplanted in both uncontaminated and cadmium-contaminated soils. Micrococcus sp. TISTR2221 significantly increased cadmium accumulation in the roots and shoots of Z. mays L. compared to uninoculated plants. At the beginning of the planting period, cadmium accumulated mainly in the shoots. With a prolonged duration of cultivation, cadmium content increased in the roots. As expected, little cadmium was found in maize grains. Soil cadmium was significantly reduced with time, and the highest percentage of cadmium removal was found in the bacterial-inoculated Z. mays L. after transplantation for 6 weeks. We conclude that Micrococcus sp. TISTR2221 is a potent bioaugmenting agent, facilitating cadmium phytoextraction in Z. mays L.

COLLABORATIVE RESEARCH AND DEVELOPMENT CONTRACT. Delivery Order 0038: Microbial Biotechnology and Biocatalysis

DTIC Science & Technology

2010-04-01

encapsulated lysozyme. Bacteriolytic activity was inves- tigated with Micrococcus lysodeikticus cells and by hydroly- sis of a synthetic membrane mimic...immobilized lysozyme in silica or tita- nia nanoparticles. Lysozyme activity determined by lytic assay with Micrococcus lysodeikticus cells (&) or with...voltage of 200 V and according to the manufacturer’s instruc- tions. Lysozyme activity assays were performed with Micrococcus lysodeikticus cells

Novel Compounds From Shark And Stingray Epidermal Mucus With Antimicrobial Activity Against Wound Infection Pathogens

DTIC Science & Technology

2012-03-01

Staphylococcus epidermidis, Micrococcus sp., Enterococcus faecalis, Listeria monocytogenes, Shigella boydii, Shigella sonnei, Shigella flexneri...MSSA, VRE B. cereus, MSSA, MRSA, Micrococcus , E. faecalis, L. monocytogenes, Shigella, E. coli, S. enterica, Acinetobacter 505 G1 B. subtilis 505...subtilis B. cereus 506 B3 VRE B. cereus, MSSA, MRSA, Micrococcus , E. faecalis, L. monocytogenes, Shigella, E. coli, S. enterica, Acinetobacter

An evidential example of airborne bacteria in a crowded, underground public concourse in Tokyo

NASA Astrophysics Data System (ADS)

Seino, Kaoruko; Takano, Takehito; Nakamura, Keiko; Watanabe, Masafumi

2005-01-01

We examined airborne bacteria in an underground concourse in Tokyo and investigated conditions that influenced bacterial counts. Airborne bacteria were collected by using an impactor sampler. Colonies on plate count agar (PCA) and Columbia colistin-nalidixic acid agar with 5% sheep blood (CNA agar) were enumerated. The range, geometric mean, and 95% CI of the bacterial counts (CFU m-3) on PCA and CNA agar were 150-1380, 456, 382-550 and 50-990, 237, 182-309, respectively. Bacterial counts on PCA significantly correlated with number of the pedestrians (r=0.89), relative humidity (r=0.70) and airborne dust (PM5.0) (r=0.73). Results of a multiple regression indicated independent positive association between the number of pedestrians and bacterial counts on PCA (p<0.01) after excluding the influence of relative humidity and airborne dust. Similar results were obtained with the statistical analysis for the counts of bacteria on CNA agar. Gram-positive cocci were dominant on PCA and CNA agar. Staphylococcus epidermidis and Micrococcus spp. were dominant among the 11 genera and 19 species identified in the present study. Considering the pattern of identified species and the significant independent association between number of pedestrians and bacterial counts, airborne bacteria in a crowded underground concourse were mostly originated from the pedestrians who were walking in the underground concourse. This study gave an evidential example of bacterial conditions in the air of an underground crowded public space in Tokyo.

Gram staining for the treatment of peritonsillar abscess.

PubMed

Takenaka, Yukinori; Takeda, Kazuya; Yoshii, Tadashi; Hashimoto, Michiko; Inohara, Hidenori

2012-01-01

Objective. To examine whether Gram staining can influence the choice of antibiotic for the treatment of peritonsillar abscess. Methods. Between 2005 and 2009, a total of 57 cases of peritonsillar abscess were analyzed with regard to cultured bacteria and Gram staining. Results. Only aerobes were cultured in 16% of cases, and only anaerobes were cultured in 51% of cases. Mixed growth of aerobes and anaerobes was observed in 21% of cases. The cultured bacteria were mainly aerobic Streptococcus, anaerobic Gram-positive cocci, and anaerobic Gram-negative rods. Phagocytosis of bacteria on Gram staining was observed in 9 cases. The bacteria cultured from these cases were aerobic Streptococcus, anaerobic Gram-positive cocci, and anaerobic Gram-negative rods. The sensitivity of Gram staining for the Gram-positive cocci and Gram-negative rods was 90% and 64%, respectively. The specificity of Gram staining for the Gram-positive cocci and Gram-negative rods was 62% and 76%, respectively. Most of the Gram-positive cocci were sensitive to penicillin, but some of anaerobic Gram-negative rods were resistant to penicillin. Conclusion. When Gram staining shows only Gram-positive cocci, penicillin is the treatment of choice. In other cases, antibiotics effective for the penicillin-resistant organisms should be used.

Identification of key genes in Gram-positive and Gram-negative sepsis using stochastic perturbation

PubMed Central

Li, Zhenliang; Zhang, Ying; Liu, Yaling; Liu, Yanchun; Li, Youyi

2017-01-01

Sepsis is an inflammatory response to pathogens (such as Gram-positive and Gram-negative bacteria), which has high morbidity and mortality in critically ill patients. The present study aimed to identify the key genes in Gram-positive and Gram-negative sepsis. GSE6535 was downloaded from Gene Expression Omnibus, containing 17 control samples, 18 Gram-positive samples and 25 Gram-negative samples. Subsequently, the limma package in R was used to screen the differentially expressed genes (DEGs). Hierarchical clustering was conducted for the specific DEGs in Gram-negative and Gram-negative samples using cluster software and the TreeView software. To analyze the correlation of samples at the gene level, a similarity network was constructed using Cytoscape software. Functional and pathway enrichment analyses were conducted for the DEGs using DAVID. Finally, stochastic perturbation was used to determine the significantly differential functions between Gram-positive and Gram-negative samples. A total of 340 and 485 DEGs were obtained in Gram-positive and Gram-negative samples, respectively. Hierarchical clustering revealed that there were significant differences between control and sepsis samples. In Gram-positive and Gram-negative samples, myeloid cell leukemia sequence 1 was associated with apoptosis and programmed cell death. Additionally, NADH:ubiquinone oxidoreductase subunit S4 was associated with mitochondrial respiratory chain complex I assembly. Stochastic perturbation analysis revealed that NADH:ubiquinone oxidoreductase subunit B2 (NDUFB2), NDUFB8 and ubiquinol-cytochrome c reductase hinge protein (UQCRH) were associated with cellular respiration in Gram-negative samples, whereas large tumor suppressor kinase 2 (LATS2) was associated with G1/S transition of the mitotic cell cycle in Gram-positive samples. NDUFB2, NDUFB8 and UQCRH may be biomarkers for Gram-negative sepsis, whereas LATS2 may be a biomarker for Gram-positive sepsis. These findings may promote the therapies of sepsis caused by Gram-positive and Gram-negative bacteria. PMID:28714002

Systematics of a widely distributed western North American springsnail, Pyrgulopsis micrococcus (Caenogastropoda, Hydrobiidae), with descriptions of three new congeners.

PubMed

Hershler, Robert; Liu, Hsiu-Ping; Bradford, Corbin

2013-01-01

We describe three new species of springsnails (genus Pyrgulopsis) from the Amargosa River basin, California and Nevada (P. licina sp. n., P. perforata sp. n., P. sanchezi sp. n.), each of which was previously considered to be part of P. micrococcus. We also restrict P. micrococcus to its type locality area (Oasis Valley) and redefine a regional congener, P. turbatrix, to include populations from the central Death Valley region and San Bernardino Mountains that had been previously identified as P. micrococcus. The five species treated herein form genetically distinct lineages that differ from each other by 4.2-12.6% for mtCOI and 5.2-13.6% for mtNDI (based on previously published and newly obtained data), and are diagnosable by shell and/or penial characters. The new molecular data presented herein confirm sympatry of P. licina and P. sanchezi in Ash Meadows (consistent with morphological evidence) and delineate an additional lineage of P. micrococcus (in the broad sense) that we do not treat taxonomically owing to the paucity of morphological material. Conservation measures are needed to ensure the long term persistence of populations of P. micrococcus and a genetically differentiated lineage of P. sanchezi which live in disturbed habitats on private lands.

Sustained Protection against Superficial Bacterial and Fungal Infection by Topical Treatment.

DTIC Science & Technology

1974-12-31

from 1:100 to 1:1,000,000. The test organisms were a cutaneous micrococcus (Baird-Parker type 3), a diphtheroid, C. minutis- simum, Pseudomonas...all aluminum salts. Aluminum chlorhydroxide killed the micrococcus and diphtheroid out to the 1:1000 dilution. Aluminum chloride was lethal to the... micrococcus and diphtheroid only at the 1:100 concentration. Aluminum acetate was lethal only to the micrococcU . at the 1:100 concentration. COMMENT All

Novel Compounds From Shark and Stingray Epidermal Mucus With Antimicrobial Activity Against Wound Infection Pathogens

DTIC Science & Technology

2014-03-01

Micrococcus sp., Enterococcus faecalis, Enterococcus faecium, Vancomycin resistant Enterococcus, and Escherichia coli). During the second Quarter of...mm) 803 D10 Rhinoptera bonasus MRSA (9.5) MSSA (4.5) Bacillus cereus (6) Listeria monocytogenes (6) MRSA (2) Micrococcus sp (7) VRE (2) 803...E6 Rhinoptera bonasus MRSA (7.5) MSSA (8.5) VRE (4.5) Bacillus subtilis (10) MRSA (10) MRSA (10) Micrococcus (16) Listeria monocytogenes (13

Molecular assessment of the membrane menaquinones of irradiated micrococcus on disposable medical devices with high performance liquid chromatography (HPLC)

NASA Astrophysics Data System (ADS)

Ghojaie, M.

1993-10-01

The genus of micrococcus and its main species like; M. Roseus, M. Nishinomiyansis consist of upto 10% of microbial contamination of disposable medical devices. Chemical alteration of Menuquinones Mainly [MK-7-(H2), MK-8(H2),…] from some Irradiated species of the micrococcus at different doses (500 Gy to 25 kGy; the sterilization dose) are quantitatively evaluated by HPLC.

Antimicrobial susceptibilities of Stomatococcus mucilaginosus and of Micrococcus spp.

PubMed Central

von Eiff, C; Herrmann, M; Peters, G

1995-01-01

The in vitro susceptibilities of 63 isolates of Stomatococcus mucilaginosus and of 188 isolates of Micrococcus spp. to 18 antimicrobial agents were determined by the agar dilution method. Many beta-lactams, imipenem, rifampin, and the glycopeptides were shown to be active in vitro against Stomatococcus and Micrococcus isolates, whereas the activities of antibiotics such as some aminoglycosides, erythromycin, and fosfomycin against an important number of these microorganisms are limited. PMID:7695321

Gram-positive rods prevailing in teeth with apical periodontitis undergoing root canal treatment.

PubMed

Chávez de Paz, L E; Molander, A; Dahlén, G

2004-09-01

To identify Gram-positive rods from root canals of teeth with apical periodontitis and to examine their associations with other species. Consecutive root canal samples (RCSs) from 139 teeth undergoing root canal treatment were analyzed prospectively for cultivable microbes. Gram-positive rods in the first RCS submitted after chemo-mechanical preparation were categorised to genus level by selective media and gas-liquid chromatography (GLC), and identified to species level by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Associations between organisms were measured by odds ratios (OR). In the first samples submitted a total of 158 Gram-positive rods, 115 Gram-positive cocci, 26 Gram-negative rods and 9 Gram-negative cocci, were identified. At genus levels Gram-positive rods were classified into: Lactobacillus spp. (38%), Olsenella spp. (18%), Propionibacterium spp. (13%), Actinomyces spp. (12%), Bifidobacterium spp. (13%) and Eubacterium spp. (6%). The most frequent species were Olsenella uli, Lactobacillus paracasei and Propionibacterium propionicum. In subsequent samples taken during treatment, Gram-positive rods were also identified, although the number of strains was considerably reduced. Positive associations were observed between members of the genus lactobacilli and Gram-positive cocci (OR>2). Olsenella uli and Lactobacillus spp. predominated over other Gram-positive rods. A possible association exists between Lactobacillus spp. and Gram-positive cocci in root canals of teeth with apical periodontitis receiving treatment.

A Myeloid Hypoxia-inducible Factor 1α-Krüppel-like Factor 2 Pathway Regulates Gram-positive Endotoxin-mediated Sepsis*

PubMed Central

Mahabeleshwar, Ganapati H.; Qureshi, Muhammad Awais; Takami, Yoichi; Sharma, Nikunj; Lingrel, Jerry B.; Jain, Mukesh K.

2012-01-01

Although Gram-positive infections account for the majority of cases of sepsis, the molecular mechanisms underlying their effects remains poorly understood. We investigated how cell wall components of Gram-positive bacteria contribute to the development of sepsis. Experimental observations derived from cultured primary macrophages and the cell line indicate that Gram-positive bacterial endotoxins induce hypoxia-inducible factor 1α (HIF-1α) mRNA and protein expression. Inoculation of live or heat-inactivated Gram-positive bacteria with macrophages induced HIF-1 transcriptional activity in macrophages. Concordant with these results, myeloid deficiency of HIF-1α attenuated Gram-positive bacterial endotoxin-induced cellular motility and proinflammatory gene expression in macrophages. Conversely, Gram-positive bacteria and their endotoxins reduced expression of the myeloid anti-inflammatory transcription factor Krüppel-like transcription factor 2 (KLF2). Sustained expression of KLF2 reduced and deficiency of KLF2 enhanced Gram-positive endotoxins induced HIF-1α mRNA and protein expression in macrophages. More importantly, KLF2 attenuated Gram-positive endotoxins induced cellular motility and proinflammatory gene expression in myeloid cells. Consistent with these results, mice deficient in myeloid HIF-1α were protected from Gram-positive endotoxin-induced sepsis mortality and clinical symptomatology. By contrast, myeloid KLF2-deficient mice were susceptible to Gram-positive sepsis induced mortality and clinical symptoms. Collectively, these observations identify HIF-1α and KLF2 as critical regulators of Gram-positive endotoxin-mediated sepsis. PMID:22110137

Comparative activity of ceftobiprole against Gram-positive and Gram-negative isolates from Europe and the Middle East: the CLASS study.

PubMed

Rossolini, Gian M; Dryden, Matthew S; Kozlov, Roman S; Quintana, Alvaro; Flamm, Robert K; Läuffer, Jörg M; Lee, Emma; Morrissey, Ian; CLASS Study Group

2011-01-01

to assess the in vitro activity of ceftobiprole and comparators against a recent collection of Gram-positive and Gram-negative pathogens, in order to detect potential changes in susceptibility patterns, and to evaluate the Etest assay for ceftobiprole susceptibility testing. contemporary Gram-positive and Gram-negative isolates (excluding extended-spectrum β-lactamase-producing isolates) from across Europe and the Middle East were collected, and their susceptibility to ceftobiprole, vancomycin, teicoplanin, linezolid, ceftazidime and cefepime was assessed using the Etest method. Quality testing [using Etest and broth microdilution (BMD)] was conducted at a central reference laboratory. some 5041 Gram-positive and 4026 Gram-negative isolates were included. Against Gram-positive isolates overall, ceftobiprole had the lowest MIC50 (0.5 mg/L), compared with 1 mg/L for its comparators (vancomycin, teicoplanin and linezolid). Against methicillin-resistant Staphylococcus aureus, all four agents had a similar MIC90 (2 mg/L), but ceftobiprole had a 4-fold better MIC90 (0.5 mg/L) against methicillin-susceptible strains. Only 38 Gram-positive isolates were confirmed as ceftobiprole resistant. Among Gram-negative strains, 86.9%, 91.7% and 95.2% were susceptible to ceftobiprole, ceftazidime and cefepime, respectively. Pseudomonas aeruginosa was less susceptible to all three antimicrobials than any other Gram-negative pathogen. There was generally good agreement between local Etest results and those obtained at the reference laboratory (for ceftobiprole: 86.8% with Gram-negatives; and 94.7% with Gram-positives), as well as between results obtained by BMD and Etest methods (for ceftobiprole: 98.2% with Gram-negatives; and 98.4% with Gram-positives). ceftobiprole exhibits in vitro activity against a wide range of Gram-positive and Gram-negative pathogens, including multidrug-resistant strains. No changes in its known susceptibility profile were identified.

Studies on organic and in-organic biostimulants in bioremediation of diesel-contaminated arable soil.

PubMed

Nwankwegu, Amechi S; Orji, Michael U; Onwosi, Chukwudi O

2016-11-01

In this study, use of inorganic fertilizer (N.P.K) was compared with organic manure (compost) in the bioremediation of diesel-polluted agricultural soil over a two-month period. Renewal by enhanced natural attenuation was used as control. The results revealed that total petroleum hydrocarbon removal from polluted soil was 71.40 ± 5.60% and 93.31 ± 3.60% for N.P.K and compost amended options, respectively. The control (natural attenuation) had 57.90 ± 3.98% of total petroleum hydrocarbon removed. Experimental data fitted second order kinetic model adequately for compost amended option. The fertilizer amended option was found to be 1.04 times slower (k2 = 4.00 ± 1.40 × 10(-7)gmg(-1)d(-1), half-life = 28.15 d) than compost amended option (k2 = 1.39 ± 0.54 × 10(-5) gmg(-1)d(-1), half-life = 8.10 d) but 1.21 times (20.6%) faster than the control (k2 = 2.57 ± 0.16 × 10(-7) gmg(-1)d(-1), half-life = 43.81 d). The hydrocarbon utilizers isolated from the diesel contaminated soil were: Bacillus nealsoni, Micrococcus luteus, Aspergillus awamori, and Fusarium proliferatum. The phytotoxicity test showed that germination indices for natural attenuation (control), fertilizer (NPK) and compost amended options were 34%, 56%, and 89%, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.

Activation of the Glutamic Acid-Dependent Acid Resistance System in Escherichia coli BL21(DE3) Leads to Increase of the Fatty Acid Biotransformation Activity.

PubMed

Woo, Ji-Min; Kim, Ji-Won; Song, Ji-Won; Blank, Lars M; Park, Jin-Byung

The biosynthesis of carboxylic acids including fatty acids from biomass is central in envisaged biorefinery concepts. The productivities are often, however, low due to product toxicity that hamper whole-cell biocatalyst performance. Here, we have investigated factors that influence the tolerance of Escherichia coli to medium chain carboxylic acid (i.e., n-heptanoic acid)-induced stress. The metabolic and genomic responses of E. coli BL21(DE3) and MG1655 grown in the presence of n-heptanoic acid indicated that the GadA/B-based glutamic acid-dependent acid resistance (GDAR) system might be critical for cellular tolerance. The GDAR system, which is responsible for scavenging intracellular protons by catalyzing decarboxylation of glutamic acid, was inactive in E. coli BL21(DE3). Activation of the GDAR system in this strain by overexpressing the rcsB and dsrA genes, of which the gene products are involved in the activation of GadE and RpoS, respectively, resulted in acid tolerance not only to HCl but also to n-heptanoic acid. Furthermore, activation of the GDAR system allowed the recombinant E. coli BL21(DE3) expressing the alcohol dehydrogenase of Micrococcus luteus and the Baeyer-Villiger monooxygenase of Pseudomonas putida to reach 60% greater product concentration in the biotransformation of ricinoleic acid (i.e., 12-hydroxyoctadec-9-enoic acid (1)) into n-heptanoic acid (5) and 11-hydroxyundec-9-enoic acid (4). This study may contribute to engineering E. coli-based biocatalysts for the production of carboxylic acids from renewable biomass.

Microbiological Contamination of Drugs during Their Administration for Anesthesia in the Operating Room.

PubMed

Gargiulo, Derryn A; Mitchell, Simon J; Sheridan, Janie; Short, Timothy G; Swift, Simon; Torrie, Jane; Webster, Craig S; Merry, Alan F

2016-04-01

The aseptic techniques of anesthesiologists in the preparation and administration of injected medications have not been extensively investigated, but emerging data demonstrate that inadvertent lapses in aseptic technique may be an important contributor to surgical site and other postoperative infections. A prospective, open, microbiological audit of 303 cases in which anesthesiologists were asked to inject all bolus drugs, except propofol and antibiotics, through a 0.2-µm filter was performed. The authors cultured microorganisms, if present, from the 0.2-µm filter unit and from the residual contents of the syringes used for drawing up or administering drugs. Participating anesthesiologists rated ease of use of the filters after each case. Twenty-three anesthesiologists each anesthetized up to 25 adult patients. The authors isolated microorganisms from filter units in 19 (6.3%) of 300 cases (3 cases were excluded), including Staphylococcus capitis, Staphylococcus warneri, Staphylococcus epidermidis, Staphylococcus haemolyticus, Micrococcus luteus/lylae, Corynebacterium, and Bacillus species. The authors collected used syringes at the end of each case and grew microorganisms from residual drug in 55 of these 2,318 (2.4%) syringes including all the aforementioned microorganisms and also Kocuria kristinae, Staphylococcus aureus, and Staphylococcus hominus. Participants' average rating of ease of use of the filter units was 3.5 out of 10 (0 being very easy and 10 being very difficult). Microorganisms with the potential to cause infection are being injected (presumably inadvertently) into some patients during the administration of intravenous drugs by bolus during anesthesia. The relevance of this finding to postoperative infections warrants further investigation.

α-Glucosidase Inhibition and Antibacterial Activity of Secondary Metabolites from the Ecuadorian Species Clinopodium taxifolium (Kunth) Govaerts.

PubMed

Morocho, Vladimir; Valle, Andrea; García, Jessica; Gilardoni, Gianluca; Cartuche, Luis; Suárez, Alírica I

2018-01-11

The phytochemical investigation of both volatile and fixed metabolites of Clinopodium taxifolium (Kunth) Govaerts (Lamiaceae) was performed for the first time. It allowed the isolation and characterization of the essential oil and six known compounds: carvacrol ( 1 ), squalane ( 2 ), uvaol ( 3 ), erythrodiol ( 4 ), ursolic acid ( 5 ), and salvigenin ( 6 ). Their structures were identified and characterized by Nuclear Magnetic Resonance (NMR) and Gas Chromatography coupled to Mass Spectroscopy (GC-MS), and corroborated by literature. The essential oil of the leaves was obtained by hydrodistillation in two different periods and analyzed by GC-MS and GC coupled to Flame Ionization Detector (GC-FID). A total of 54 compounds were detected, of which 42 were identified (including trace constituents). The major constituents were carvacrol methyl ether (18.9-23.2%), carvacrol (13.8-16.3%) and, carvacryl acetate (11.4-4.8%). The antibacterial activities were determined as Minimum Inhibition Concentration (MIC) against Staphylococcus aureus , Enterococcus faecalis , Escherichia coli , Klebsiella pneumoniae , Proteus vulgaris , Pseudomonas aeruginosa and Micrococcus luteus . The hexane and methanol extracts exhibited activity only against Klebsiella pneumoniae (250 and 500 μg/mL respectively), while the ethyl acetate extract was inactive. The hypoglycemic activity was evaluated by the in vitro inhibition of α-glucosidase. The ethyl acetate (EtOAc) extract showed strong inhibitory activity with IC 50 = 24.88 µg/mL, however methanolic and hexanic extracts showed weak activity. As a pure compound, only ursolic acid showed a strong inhibitory activity, with IC 50 = 72.71 μM.

Identification of subsurface microorganisms at Yucca Mountain; Second quarterly report, October 1, 1993--December 31, 1993

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stetzenbach, L.D.

1993-12-31

The primary effort of this past quarter was to develop a procedure where accumulated data files could be evaluated to determine the naming consistency and inter-relationships of the various species which have been identified by the Microbial Identification System (MIDI) system. This involved a series of steps, including the clustering of similarly named organisms in a dendrogram format to determine how closely similarly named isolates are related. The experience of other researchers using the MIDI system has shown that clusters which are joined at a Euclidian distance of 10 or less belong to the same species. Strains which are verymore » similar cluster at less than 6 Euclidian units and clusters below two units have nearly identical fatty acid patterns. When the dendrograms derived from the springs were scrutinized, some organisms were found which did not match the pattern of their named group. Then a decision was made whether to rename the isolates and exclude them from the group or redefine the group. This decision was assisted by plotting the principal components derived from an analysis of the fatty acid composition of members of the genus. Each species can be examined by the same procedure to determine group homogeneity. In these 2-dimensional plots members of the same species are roughly bounded by a box of 100 squared units while closely related strains are grouped more tightly together. The 2-dimensional plot of isolates of Micrococcus luteus demonstrates the presence of three identifiable sub-species.« less

Patterns of cell division, DNA base compositions, and fine structures of some radiation-resistant vegetative bacteria found in food

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sanders, S.W.; Maxcy, R.B.

1979-01-01

Representative highly radiation-resistant Moraxella-Acinetobacter (M-A), Pseudomonas radiora, Micrococcus radiodurans, and Micrococcus radiophilus exhibited a wide variety of division systems and cell wall characteristics. However, the more resistant M-A possessed unusually thick cell walls, indicating a possible role of the cell wall in radiation resistance in the M-A. Thick septation was present in most of the bacteria studied, but was absent in P. radiora, thus excluding this as a necessity for high resistance. Reliable determination of the number of division planes of the M-A for use as a taxonomic criterion was achieved by the direct observation of dividing cells. The highlymore » resistant M-A were found to divide in multiple planes and had base compositions of 54.0 to 57.5%, unlike typical Moraxella and/or Acinetobacter species. The taxonomic position of most highly resistant bacteria remains unclear.« less

Factors Affecting Transformation of Micrococcus lysodeikticus

PubMed Central

Kloos, Wesley E.

1969-01-01

Relatively high transfo mation frequencies were obtained with Micrococcus lysodeikticus cells, previou[ill]sly grown in defined broth, with a tris(hydroxymethyl)-aminomethane-glutamate b uffer containing Mg++, Ca++, Ba++, or Sr++. PMID:5788710

Rapid lysostaphin test to differentiate Staphylococcus and Micrococcus species.

PubMed Central

Geary, C; Stevens, M

1986-01-01

A rapid, simple lysostaphin lysis susceptibility test to differentiate the genera Staphylococcus and Micrococcus was evaluated. Of 181 strains from culture collections, 95 of 95 Staphylococcus strains were lysed, and 79 of 79 Micrococcus strains were not lysed. The seven Planococcus strains were resistant. Clinical isolates (890) were tested with lysostaphin and for the ability to produce acid from glycerol in the presence of erythromycin. Overall agreement between the methods was 99.2%. All clinical Micrococcus strains (43) were resistant to lysostaphin, and all clinical Staphylococcus strains (847) were susceptible. Seven of the Staphylococcus strains did not produce acid from glycerol in the presence of erythromycin. This lysostaphin test provides results in 2 h. It is easier to perform than previously described lysostaphin lysis methods. It is also more rapid and accurate than the glycerol-erythromycin test. PMID:3519667

Stimulation of Lactic Acid Bacteria by a Micrococcus Isolate: Evidence for Multiple Effects

PubMed Central

Nath, K. R.; Wagner, B. J.

1973-01-01

Growth of, and rate of acid production by, six cultures of lactic acid bacteria were increased in the presence of Micrococcus isolate F4 or a preparation of its capsular material. Concentrations of hydrogen peroxide found in pure cultures of the lactic acid bacteria were not detectable, or were greatly reduced, in mixed culture with Micrococcus isolate F4. The capsular material was not as effective as whole cells in preventing accumulation of H2O2. Catalase stimulated growth of, and the rate of acid production by, the lactic acid bacteria, but not to the same extent as Micrococcus isolate F4 in some cultures. The existence of two mechanisms for micrococcal stimulation of the lactic acid bacteria is postulated. One mechanism involves removal of H2O2; the other has not been characterized. PMID:4199337

Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1

PubMed Central

Tallur, Preeti N.; Mulla, Sikandar I.; Megadi, Veena B.; Talwar, Manjunatha P.; Ninnekar, Harichandra Z.

2015-01-01

Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF), polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM) than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water. PMID:26413046

Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1.

PubMed

Tallur, Preeti N; Mulla, Sikandar I; Megadi, Veena B; Talwar, Manjunatha P; Ninnekar, Harichandra Z

2015-01-01

Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF), polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM) than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water.

Rapid Discrimination of Gram-Positive and Gram-Negative Bacteria in Liquid Samples by Using NaOH-Sodium Dodecyl Sulfate Solution and Flow Cytometry

PubMed Central

Wada, Atsushi; Kono, Mari; Kawauchi, Sawako; Takagi, Yuri; Morikawa, Takashi; Funakoshi, Kunihiro

2012-01-01

Background For precise diagnosis of urinary tract infections (UTI), and selection of the appropriate prescriptions for their treatment, we explored a simple and rapid method of discriminating gram-positive and gram-negative bacteria in liquid samples. Methodology/Principal Findings We employed the NaOH-sodium dodecyl sulfate (SDS) solution conventionally used for plasmid extraction from Escherichia coli and the automated urine particle analyzer UF-1000i (Sysmex Corporation) for our novel method. The NaOH-SDS solution was used to determine differences in the cell wall structures between gram-positive and gram-negative bacteria, since the tolerance to such chemicals reflects the thickness and structural differences of bacterial cell walls. The UF-1000i instrument was used as a quantitative bacterial counter. We found that gram-negative bacteria, including E. coli, in liquid culture could easily be lysed by direct addition of equal volumes of NaOH-SDS solution. In contrast, Enterococcus faecalis, which is a gram-positive bacterium, could not be completely lysed by the solution. We then optimized the reaction time of the NaOH-SDS treatment at room temperature by using 3 gram-positive and 4 gram-negative bacterial strains and determined that the optimum reaction time was 5 min. Finally, in order to evaluate the generalizability of this method, we treated 8 gram-positive strains and 8 gram-negative strains, or 4 gram-positive and 4 gram-negative strains incubated in voluntary urine from healthy volunteers in the same way and demonstrated that all the gram-positive bacteria were discriminated quantitatively from gram negative bacteria using this method. Conclusions/Significance Using our new method, we could easily discriminate gram-positive and gram-negative bacteria in liquid culture media within 10 min. This simple and rapid method may be useful for determining the treatment course of patients with UTIs, especially for those without a prior history of UTIs. The method may be easily applied in order to obtain additional information for clinical prescriptions from bacteriuria. PMID:23077549

Halophilic Amylase from a Moderately Halophilic Micrococcus

PubMed Central

Onishi, Hiroshi

1972-01-01

A moderately halophilic Micrococcus sp., isolated from unrefined solar salt, produced a considerable amount of extracellular dextrinogenic amylase when cultivated aerobically in media containing 1 to 3 m NaCl. The Micrococcus amylase had maximal activity at pH 6 to 7 in 1.4 to 2 m NaCl or KCl at 50 C. Calcium ion and a high concentration of NaCl or KCl were essential for activity and stability of the amylase. The salt response of the amylase depended greatly on the pH and temperature of the enzyme assay. PMID:5058445

Restriction of the anti-bovine serum albumin response in rabbits immunized with Micrococcus lysodeikticus.

PubMed Central

De Baetselier, P; Hamers-Casterman, C; Van der Loo, W; Hamers, R

1977-01-01

Rabbits capable of producing antibodies of restricted heterogeneity in response to Micrococcus lysodeikticus are equally capable of producing antibodies of restricted heterogeneity to bovine serum albumin. These antibodies are produced when animals are simultaneously injected with micrococcus and BSA and their specificity is restricted to a small number of epitopes. These results suggest that micrococcal vaccines can induce the restriction of heterogeneity in antibodies raised against totally unrelated antigens. Images Figure 4 Figure 5 Figure 2 Figure 6 Figure 7 Figure 8 PMID:71263

A marine bacterium, Micrococcus MCCB 104, antagonistic to vibrios in prawn larval rearing systems.

PubMed

Jayaprakash, N S; Pai, S Somnath; Anas, A; Preetha, R; Philip, Rosamma; Singh, I S Bright

2005-12-30

A marine bacterium, Micrococcus MCCB 104, isolated from hatchery water, demonstrated extracellular antagonistic properties against Vibrio alginolyticus, V. parahaemolyticus, V. vulnificus, V. fluviallis, V. nereis, V. proteolyticus, V. mediterranei, V cholerae and Aeromonas sp., bacteria associated with Macrobrachium rosenbergii larval rearing systems. The isolate inhibited the growth of V. alginolyticus during co-culture. The antagonistic component of the extracellular product was heat-stable and insensitive to proteases, lipase, catalase and alpha-amylase. Micrococcus MCCB 104 was demonstrated to be non-pathogenic to M. rosenbergii larvae.

Antibacterial activities of β-glucan (laminaran) against gram-negative and gram-positive bacteria

NASA Astrophysics Data System (ADS)

Chamidah, A.; Hardoko, Prihanto, A. A.

2017-05-01

This study aimed to determine the antibacterial activity of β-Glucan (laminaran) of LAE and LME extracts from brown algae Sargassum crassifolium using HPMS and Ultrasonication against Gram-positive bacteria (Bacillus subtilis and Staphylococcus aureus) and Gram-negative bacteria (Salmonella typhimurium and Escherichia coli). The highest antibacterial activities of LME extract obtained using the HPMS method against Gram-positive bacteria (B. subtilis and S. aureus) were at 18:10 and 18.80 mm. The ultrasonication method showed a lower inhibition trend than the HPMS method, with MIC and MBC values of 250 mg/ml and 2-8 CFU/ml, respectively, in all Gram-negative and Gram-positive bacteria. The results showed that LME extract at a concentration of 250 mg/mL is bacteriostatic against Gram-positive and -negative bacteria.

Microbiological and biochemical origins of human axillary odour.

PubMed

James, A Gordon; Austin, Corrine J; Cox, Diana S; Taylor, David; Calvert, Ralph

2013-03-01

The generation of malodour on various sites of the human body is caused by the microbial biotransformation of odourless natural secretions into volatile odorous molecules. On the skin surface, distinctive odours emanate, in particular, from the underarm (axilla), where a large and permanent population of microorganisms thrives on secretions from the eccrine, apocrine and sebaceous glands. Traditional culture-based microbiological studies inform us that this resident microbiota consists mainly of Gram-positive bacteria of the genera Staphylococcus, Micrococcus, Corynebacterium and Propionibacterium. Among the molecular classes that have been implicated in axillary malodour are short- and medium-chain volatile fatty acids, 16-androstene steroids and, most recently, thioalcohols. Most of the available evidence suggests that members of the Corynebacterium genus are the primary causal agents of axillary odour, with the key malodour substrates believed to originate from the apocrine gland. In this article, we examine, in detail, the microbiology and biochemistry of malodour formation on axillary skin, focussing on precursor-product relationships, odour-forming enzymes and metabolic pathways and causal organisms. As well as reviewing the literature, some relevant new data are presented and considered alongside that already available in the public domain to reach an informed view on the current state-of-the-art, as well as future perspectives. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Higher platelet reactivity and platelet-monocyte complex formation in Gram-positive sepsis compared to Gram-negative sepsis.

PubMed

Tunjungputri, Rahajeng N; van de Heijden, Wouter; Urbanus, Rolf T; de Groot, Philip G; van der Ven, Andre; de Mast, Quirijn

2017-09-01

Platelets may play a role in the high risk for vascular complications in Gram-positive sepsis. We compared the platelet reactivity of 15 patients with Gram-positive sepsis, 17 with Gram-negative sepsis and 20 healthy controls using a whole blood flow cytometry-based assay. Patients with Gram-positive sepsis had the highest median fluorescence intensity (MFI) of the platelet membrane expression of P-selectin upon stimulation with high dose adenosine diphosphate (ADP; P = 0.002 vs. Gram-negative and P = 0.005 vs. control groups) and cross-linked collagen-related peptide (CRP-XL; P = 0.02 vs. Gram-negative and P = 0.0001 vs. control groups). The Gram-positive group also demonstrated significantly higher ADP-induced fibrinogen binding (P = 0.001), as wll as platelet-monocyte complex formation (P = 0.02), compared to the Gram-negative group and had the highest plasma levels of platelet factor 4, β-thromboglobulin and soluble P-selectin. In contrast, thrombin-antithrombin complex and C-reactive protein levels were comparable in both patient groups. In conclusion, common Gram-positive pathogens induce platelet hyperreactivity, which may contribute to a higher risk for vascular complications.

Effect of Hydroxyurea on Staphylococcus epidermidis and Micrococcus lysodeikticus: Thickening of the Cell Wall

PubMed Central

Feiner, Rose R.; Coward, Joe E.; Rosenkranz, Herbert S.

1973-01-01

Hydroxyurea-sensitive strains of Staphylococcus epidermidis and Micrococcus lysodeikticus showed marked thickening of cell walls and reduction in deoxyribonucleic acid synthesis when grown in the presence of hydroxyurea. Images PMID:4790602

Cobalt Complexes as Antiviral and Antibacterial Agents

DTIC Science & Technology

2010-01-01

observed. Complex 26 has antibacterial activity against E. coli, S. aureus and Micrococcus lysodeikiticus, showing better growth inhibitory activity in...complexes exhibited activity towards E. coli, B. subtilis, S. aureus and Micrococcus lysodeikiticus. Figure 15. Selenium containing and

Use of plant growth promoting bacterial strains to improve Cytisus striatus and Lupinus luteus development for potential application in phytoremediation.

PubMed

Balseiro-Romero, María; Gkorezis, Panagiotis; Kidd, Petra S; Van Hamme, Jonathan; Weyens, Nele; Monterroso, Carmen; Vangronsveld, Jaco

2017-03-01

Plant growth promoting (PGP) bacterial strains possess different mechanisms to improve plant development under common environmental stresses, and are therefore often used as inoculants in soil phytoremediation processes. The aims of the present work were to study the effects of a collection of plant growth promoting bacterial strains on plant development, antioxidant enzyme activities and nutritional status of Cytisus striatus and/or Lupinus luteus plants a) growing in perlite under non-stress conditions and b) growing in diesel-contaminated soil. For this, two greenhouse experiments were designed. Firstly, C. striatus and L. luteus plants were grown from seeds in perlite, and periodically inoculated with 6 PGP strains, either individually or in pairs. Secondly, L. luteus seedlings were grown in soil samples of the A and B horizons of a Cambisol contaminated with 1.25% (w/w) of diesel and inoculated with best PGP inoculant selected from the first experiment. The results indicated that the PGP strains tested in perlite significantly improved plant growth. Combination treatments provoked better growth of L. luteus than the respective individual strains, while individual inoculation treatments were more effective for C. striatus. L. luteus growth in diesel-contaminated soil was significantly improved in the presence of PGP strains, presenting a 2-fold or higher increase in plant biomass. Inoculants did not provoke significant changes in plant nutritional status, with the exception of a subset of siderophore-producing and P-solubilising bacterial strains that resulted in significantly modification of Fe or P concentrations in leaf tissues. Inoculants did not cause significant changes in enzyme activities in perlite experiments, however they significantly reduced oxidative stress in contaminated soils suggesting an improvement in plant tolerance to diesel. Some strains were applied to non-host plants, indicating a non-specific performance of their plant growth promotion. The use of PGP strains in phytoremediation may help plants to overcome contaminant and other soil stresses, increasing phytoremediation efficiency. Copyright © 2016 Elsevier B.V. All rights reserved.

The first complete chloroplast genome of the Genistoid legume Lupinus luteus: evidence for a novel major lineage-specific rearrangement and new insights regarding plastome evolution in the legume family

PubMed Central

Martin, Guillaume E.; Rousseau-Gueutin, Mathieu; Cordonnier, Solenn; Lima, Oscar; Michon-Coudouel, Sophie; Naquin, Delphine; de Carvalho, Julie Ferreira; Aïnouche, Malika; Salmon, Armel; Aïnouche, Abdelkader

2014-01-01

Background and Aims To date chloroplast genomes are available only for members of the non-protein amino acid-accumulating clade (NPAAA) Papilionoid lineages in the legume family (i.e. Millettioids, Robinoids and the ‘inverted repeat-lacking clade’, IRLC). It is thus very important to sequence plastomes from other lineages in order to better understand the unusual evolution observed in this model flowering plant family. To this end, the plastome of a lupine species, Lupinus luteus, was sequenced to represent the Genistoid lineage, a noteworthy but poorly studied legume group. Methods The plastome of L. luteus was reconstructed using Roche-454 and Illumina next-generation sequencing. Its structure, repetitive sequences, gene content and sequence divergence were compared with those of other Fabaceae plastomes. PCR screening and sequencing were performed in other allied legumes in order to determine the origin of a large inversion identified in L. luteus. Key Results The first sequenced Genistoid plastome (L. luteus: 155 894 bp) resulted in the discovery of a 36-kb inversion, embedded within the already known 50-kb inversion in the large single-copy (LSC) region of the Papilionoideae. This inversion occurs at the base or soon after the Genistoid emergence, and most probably resulted from a flip–flop recombination between identical 29-bp inverted repeats within two trnS genes. Comparative analyses of the chloroplast gene content of L. luteus vs. Fabaceae and extra-Fabales plastomes revealed the loss of the plastid rpl22 gene, and its functional relocation to the nucleus was verified using lupine transcriptomic data. An investigation into the evolutionary rate of coding and non-coding sequences among legume plastomes resulted in the identification of remarkably variable regions. Conclusions This study resulted in the discovery of a novel, major 36-kb inversion, specific to the Genistoids. Chloroplast mutational hotspots were also identified, which contain novel and potentially informative regions for molecular evolutionary studies at various taxonomic levels in the legumes. Taken together, the results provide new insights into the evolutionary landscape of the legume plastome. PMID:24769537

Proposal for creation of a new genus Neomicrococcus gen. nov. to accommodate Zhihengliuella aestuarii Baik et al. 2011 and Micrococcus lactis Chittpurna et al. 2011 as Neomicrococcus aestuarii comb. nov. and Neomicrococcus lactis comb. nov.

PubMed

Prakash, Om; Sharma, Avinash; Nimonkar, Yogesh; Shouche, Yogesh S

2015-11-01

Micrococcus lactis and Zhihengliuella aestuarii were described independently in 2011. Their type strains showed high levels of 16S rRNA gene sequence similarity (99.3%). Phylogenetic analysis revealed that M. lactis MCC 2278T and Z. aestuarii JCM 16166T formed a monophyletic group and showed distant relationships to other members of closely related genera such as Micrococcus, Zhihengliuella, Arthrobacter and Citricoccus. The presence of large proportions of iso-C14:0 and iso-C16:0 with small amounts of iso-C15:0 distinguished M. lactis MCC 2278T and Z. aestuarii JCM 16166T from other members of the genera Micrococcus and Zhihengliuella. Unlike other members of the genera Zhihengliuella and Micrococcus, M. lactis MCC 2278T and Z. aestuarii JCM 16166T showed growth at low concentrations of NaCl. Thus, based on distinctive phylogenetic, chemotaxonomic and physiological features of these two organisms in comparison with other members of the genera Micrococcus and Zhihengliuella, it is clear that they do not fit within the existing classification and deserve separate status. DNA-DNA hybridization between the two type strains was 63%, indicating that they represent separate species. In this study, we propose the creation of a novel genus, Neomicrococcus gen. nov., to accommodate the two species with Neomicrococcus aestuarii gen. nov., comb. nov. (type strain JCM 16166T = KCTC 19557T) as the type species. Neomicrococcus lactis comb. nov. (type strain MCC 2278T = DSM 23694T) is also proposed.

Misinterpretation of Gram Stain from the Stationary Growth Phase of Positive Blood Cultures for Brucella and Acinetobacter Species.

PubMed

Bazzi, Ali M; Al-Tawfiq, Jaffar A; Rabaan, Ali A

2017-01-01

Acinetobacter baumannii and Brucella species are Gram-negative organisms that are vulnerable to misinterpretation as Gram-positive or Gram-variable in blood cultures. We assess the random errors in gram stain interpretation to reduce the likelihood of such errors and therefore patient harm. Aerobic and anaerobic blood cultures from two patients in an acute care facility in Saudi Arabia were subjected to preliminary Gram-staining. In case 1, VITEK-2 Anaerobe Identification, repeat Gram staining from a blood agar plate, Remel BactiDrop™ Oxidase test, Urea Agar urease test and real-time PCR were used to confirm presence of Brucella and absence of Coryneform species. In case 2, repeat Gram- staining from the plate and the vials, VITEK-2 Gram-Negative Identification, real-time PCR and subculture on to Columbia agar, blood agar, and MacConkey agar were carried out to identify A. baumannii . In case 1, initially pleomorphic Gram-positive bacteria were identified. Coryneform species were suspected. Tiny growth was observed after 24 h on blood agar plates, and good growth by 48 h. Presence of Brucella species was ultimately confirmed. In case 2, preliminary Gram-stain results suggested giant Gram-positive oval cocci. Further testing over 18-24 h identified A. baumannii . Oxidase test from the plate and urease test from the culture vial is recommended after apparent identification of pleomorphic Gram-positive bacilli from blood culture, once tiny growth is observed, to distinguish Brucella from Corynebacterium species. If giant Gram-positive oval cocci are indicated by preliminary Gram-staining, it is recommended that the Gram stain be repeated from the plate after 4-6 h, or culture should be tested in Triple Sugar Iron (TSI) medium and the Gram stain repeated after 2-4 h incubation.

The Causes of Post-Operative Meningitis: The Comparison Of Gram-Negative and Gram-Positive Pathogens.

PubMed

Kurtaran, Behice; Kuscu, Ferit; Ulu, Aslihan; Inal, Ayse Seza; Komur, Suheyla; Kibar, Filiz; Cetinalp, Nuri Eralp; Ozsoy, Kerem Mazhar; Arslan, Yusuf Kemal; Aksu, Hasan Salih; Tasova, Yesim

2017-06-20

In this study, we aim to determine the microbiological etiology in critically ill neurosurgical patients with nosocomial meningitis (NM) and show the impact of Gram-negative rods and differences of patient's characteristics, clinical and prognostic measures between Gram-negative and Gram-positive meningitis. In this prospective, one center study we reviewed all adult patients hospitalized during a 12-year period and identified pathogens isolated from post-neurosurgical cases of NM. Demographic, clinical, and treatment characteristics were noted from the medical records. Of the 134 bacterial NM patients, 78 were male and 56 were female, with a mean age of 46±15.9 and median age of 50 (18-80) years. 141 strains isolated; 82 (58.2%) were Gram negative, 59 (41.8%) were Gram positive. Most common isolated microorganism was Acinetobacter baumannii (%34.8). In comparison of mortality data shows that the patients who have meningitis with Gram-negative pathogens have higher mortality than with Gram positives (p=0.034). The duration between surgery and meningitis was shorter in Gram negative meningitis cases compared to others (p=0.045) but the duration between the diagnosis and death was shorter in Gram-positive meningitis cases compared to Gram negatives (p= 0.017). CSF protein and lactate level were higher and glucose level was lower in cases of NM with Gram negatives (p value were respectively, 0.022, 0.039 and 0.049). As conclusions; in NM, Gram-negative pathogens were seen more frequently; A.baumanni was the predominant pathogen; and NM caused by Gram negatives had worse clinical and laboratory characteristic and prognostic outcome than Gram positives.

Problem Definition Studies on Potential Environmental Pollutants. II. Physical, Chemical, Toxicological, and Biological Properties of 16 Substances

DTIC Science & Technology

1975-12-01

Micrococcus sp., capable of reducing 10- 3M sodium arsenate o Tarsenite--Th-s property was possessed by growing cells, resting cells, and the soluble...Corynebacterium, and Micrococcus sp. K-29 KA4 TABLE K-12. Microorgani ms Producing Water-Soluble Metabolites from Dieldrin - 14C, Isolated after 8 Weeks... Micrococcus 0 0 0 1 1 11.5 Bacillus 1 1 3.4 0 0 0 Yeasts 1 1 8.0 2 2 5.5 Total 73 35 104 56 *Per cent increase in water soluble activity brought about

Differential expression of the lethal gene Luteus-Pa in cacao of the Parinari series.

PubMed

Rehem, B C; Almeida, A-A F; Figueiredo, G S F; Gesteira, A S; Santos, S C; Corrêa, R X; Yamada, M M; Valle, R R

2016-02-22

The recessive lethal character Luteus-Pa is found in cacao (Theobroma cacao) genotypes of the Parinari series (Pa) and is characterized by expression of leaf chlorosis and seedling death. Several genotypes of the Pa series are bearers of the gene responsible for the expression of the Luteus-Pa character, which can be used as a tool for determining relationships between genotypes of this group. To evaluate this phenomenon, we analyzed the differential expression of genes between mutant seedlings and wild-type hybrid Pa 30 x 169 seedlings, with the aim of elucidating the possible lethal mechanisms of the homozygous recessive character Luteus-Pa. Plant material was harvested from leaves of wild and mutant seedlings at different periods to construct a subtractive library and perform quantitative analysis using real-time PCR. The 649 sequences obtained from the subtractive library had an average length of 500 bp, forming 409 contigs. The probable proteins encoded were grouped into 10 functional categories. Data from ESTs identified genes associated with Rubisco, peroxidases, and other proteins and enzymes related to carbon assimilation, respiration, and photosystem 2. Mutant seedlings were characterized by synthesizing defective PsbO and PsbA proteins, which were overexpressed from 15 to 20 days after seedling emergence.

Bioaugmentation with cadmium-resistant plant growth-promoting rhizobacteria to assist cadmium phytoextraction by Helianthus annuus.

PubMed

Prapagdee, Benjaphorn; Chanprasert, Maesinee; Mongkolsuk, Skorn

2013-07-01

Micrococcus sp. MU1 and Klebsiella sp. BAM1, the cadmium-resistant plant growth-promoting rhizobacteria (PGPR), produce high levels of indole-3-acetic acid (IAA) during the late stationary phase of their growth. The ability of PGPR to promote root elongation, plant growth and cadmium uptake in sunflowers (Helianthus annuus) was evaluated. Both species of bacteria were able to remove cadmium ions from an aqueous solution and enhanced cadmium mobilization in contaminated soil. Micrococcus sp. and Klebsiella sp. use aminocyclopropane carboxylic acid as a nitrogen source to support their growth, and the minimum inhibitory concentrations of cadmium for Micrococcus sp. and Klebsiella sp. were 1000 and 800mM, respectively. These bacteria promoted root elongation in H. annuus seedlings in both the absence and presence of cadmium compared to uninoculated seedlings. Inoculation with these bacteria was found to increase the root lengths of H. annuus that had been planted in cadmium-contaminated soil. An increase in dry weight was observed for H. annuus inoculated with Micrococcus sp. Moreover, Micrococcus sp. enhanced the accumulation of cadmium in the root and leaf of H. annuus compared to untreated plants. The highest cadmium accumulation in the whole plant was observed when the plants were treated with EDTA following the treatment with Micrococcus sp. In addition, the highest translocation of cadmium from root to the above-ground tissues of H. annuus was found after treatment with Klebsiella sp. in the fourth week after planting. Our results show that plant growth and cadmium accumulation in H. annuus was significantly enhanced by cadmium-resistant PGPRs, and these bacterial inoculants are excellent promoters of phytoextraction for the rehabilitation of heavy metal-polluted environments. Copyright © 2013 Elsevier Ltd. All rights reserved.

Monomicrobial necrotizing fasciitis in a single center: the emergence of Gram-negative bacteria as a common pathogen.

PubMed

Yahav, D; Duskin-Bitan, H; Eliakim-Raz, N; Ben-Zvi, H; Shaked, H; Goldberg, E; Bishara, J

2014-11-01

Necrotizing fasciitis (NF) is a life-threatening soft tissue infection. It is usually caused by Streptococcus pyogenes and other Gram-positive bacteria. Several reports, however, emphasize the importance of Gram-negative rods in this infection. We retrospectively studied all cases of monomicrobial necrotizing fasciitis hospitalized in our center during the years 2002-2012. We compared clinical characteristics and outcomes of patients with Gram-negative versus Gram-positive infection. Forty-five cases were reviewed, 19 caused by Gram-negative organisms, 10 of them Escherichia coli, and 26 caused by Gram-positive organisms, 10 of them S. pyogenes. Compared to Gram-positive infections, patients with Gram-negative infections were more likely to have a baseline malignancy (9/19, 47.4%) or to have undergone recent surgery (4/19, 42.3%). The 30-day mortality was higher among Gram-negative infected patients (8/19, 42.1% vs. 8/26, 30.8%). Creatine phosphokinase (CPK) was elevated in a minority of patients with Gram-negative necrotizing fasciitis, and its absolute value was lower than in Gram-positive necrotizing fasciitis. In our center, 42% of monomicrobial necrotizing fasciitis cases were found to be caused by Gram-negative organisms, mostly E. coli. These infections usually appeared in immunocompromised or postoperative patients, often presented with normal CPK levels, and were associated with high mortality rates.

Diagnosing periprosthetic infection: false-positive intraoperative Gram stains.

PubMed

Oethinger, Margret; Warner, Debra K; Schindler, Susan A; Kobayashi, Hideo; Bauer, Thomas W

2011-04-01

Intraoperative Gram stains have a reported low sensitivity but high specificity when used to help diagnose periprosthetic infections. In early 2008, we recognized an unexpectedly high frequency of apparent false-positive Gram stains from revision arthroplasties. The purpose of this report is to describe the cause of these false-positive test results. We calculated the sensitivity and specificity of all intraoperative Gram stains submitted from revision arthroplasty cases during a 3-month interval using microbiologic cultures of the same samples as the gold standard. Methods of specimen harvesting, handling, transport, distribution, specimen processing including tissue grinding/macerating, Gram staining, and interpretation were studied. After a test modification, results of specimens were prospectively collected for a second 3-month interval, and the sensitivity and specificity of intraoperative Gram stains were calculated. The retrospective review of 269 Gram stains submitted from revision arthroplasties indicated historic sensitivity and specificity values of 23% and 92%, respectively. Systematic analysis of all steps of the procedure identified Gram-stained but nonviable bacteria in commercial broth reagents used as diluents for maceration of periprosthetic membranes before Gram staining and culture. Polymerase chain reaction and sequencing showed mixed bacterial DNA. Evaluation of 390 specimens after initiating standardized Millipore filtering of diluent fluid revealed a reduced number of positive Gram stains, yielding 9% sensitivity and 99% specificity. Clusters of false-positive Gram stains have been reported in other clinical conditions. They are apparently rare related to diagnosing periprosthetic infections but have severe consequences if used to guide treatment. Even occasional false-positive Gram stains should prompt review of laboratory methods. Our observations implicate dead bacteria in microbiologic reagents as potential sources of false-positive Gram stains.

Environmental conditions affecting exopolysaccharide production by Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp.

PubMed

Kiliç, Nur Koçberber; Dönmez, Gönül

2008-06-15

Three different chromium-resistant microorganisms (Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp.) were tested with regard to their EPS production at different pH levels, temperatures, Cr(VI) concentrations, and incubation periods. The optimum pH level was 7 for P. aeruginosa and Micrococcus sp., while it was 8 for Ochrobactrum sp. according to the highest EPS amount at 100 mg/L Cr(VI) concentration. The highest production of EPSs by the three bacteria was obtained under different environmental conditions. P. aeruginosa produced the highest EPS (863.3 mg/L) after incubation for 96 h on media with 50 mg/L Cr(VI) at 20 degrees C, Micrococcus sp. gave the highest yield (444.6 mg/L) after incubation for 72 h on media with 100 mg/L Cr(VI) at the same temperature, and Ochrobactrum sp. had the highest production (430.5 mg/L) on media with 150 mg/L Cr(VI) at 30 degrees C at the end of 48 h of incubation.

Transformation of gram positive bacteria by sonoporation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Yunfeng; Li, Yongchao

The present invention provides a sonoporation-based method that can be universally applied for delivery of compounds into Gram positive bacteria. Gram positive bacteria which can be transformed by sonoporation include, for example, Bacillus, Streptococcus, Acetobacterium, and Clostridium. Compounds which can be delivered into Gram positive bacteria via sonoporation include nucleic acids (DNA or RNA), proteins, lipids, carbohydrates, viruses, small organic and inorganic molecules, and nano-particles.

The impact of metabolic state on Cd adsorption onto bacterial cells

USGS Publications Warehouse

Johnson, K.J.; Ams, D.A.; Wedel, A.N.; Szymanowski, J.E.S.; Weber, D.L.; Schneegurt, M.A.; Fein, J.B.

2007-01-01

This study examines the effect of bacterial metabolism on the adsorption of Cd onto Gram-positive and Gram-negative bacterial cells. Metabolically active Gram-positive cells adsorbed significantly less Cd than non-metabolizing cells. Gram-negative cells, however, showed no systematic difference in Cd adsorption between metabolizing and non-metabolizing cells. The effect of metabolism on Cd adsorption to Gram-positive cells was likely due to an influx of protons in and around the cell wall from the metabolic proton motive force, promoting competition between Cd and protons for adsorption sites on the cell wall. The relative lack of a metabolic effect on Cd adsorption onto Gram-negative compared to Gram-positive cells suggests that Cd binding in Gram-negative cells is focused in a region of the cell wall that is not reached, or is unaffected by this proton flux. Thermodynamic modeling was used to estimate that proton pumping causes the pH in the cell wall of metabolizing Gram-positive bacteria to decrease from the bulk solution value of 7.0 to approximately 5.7. ?? 2007 The Authors.

Antimicrobial Activity and Phytochemical Analysis of Organic Extracts from Cleome spinosa Jaqc.

PubMed Central

da Silva, Ana P. Sant'Anna; Nascimento da Silva, Luís C.; Martins da Fonseca, Caíque S.; de Araújo, Janete M.; Correia, Maria T. dos Santos; Cavalcanti, Marilene da Silva; Lima, Vera L. de Menezes

2016-01-01

Due to the use of Cleome spinosa Jacq. (Cleomaceae) in traditional medicine against inflammatory and infectious processes, this study evaluated the in vitro antimicrobial potential and phytochemical composition of extracts from its roots and leaves. From leaves (L) and roots (R) of C. spinosa different extracts were obtained (cyclohexane: ChL and ChR; chloroform: CL and CR; ethyl acetate: EAL and EAR, methanol: ML and MR). The antimicrobial activity was evaluated by the broth microdilution method to obtain the minimum inhibitory (MIC) and microbicidal (MMC) concentrations against 17 species, including bacteria and yeasts. Additionally, antimicrobial and combinatory effects with oxacillin were assessed against eight clinical isolates of Staphylococcus aureus. All C. spinosa extracts showed a broad spectrum of antimicrobial activity, as they have inhibited all tested bacteria and yeasts. This activity seems to be related to the phytochemicals (flavonoid, terpenoids and saponins) detected into the extracts of C. spinosa. ChL and CL extracts were the most actives, with MIC less than 1 mg/mL against S. aureus, Bacillus subtilis, and Micrococcus luteus. It is important to note that these concentrations are much lower than their 50% hemolysis concentration (HC50) values. Strong correlations were found between the average MIC against S. aureus and their phenolic (r = −0.89) and flavonoid content (r = −0.87), reinforcing the possible role of these metabolite classes on the antimicrobial activity of C. spinosa derived extracts. Moreover, CL and CR showed the best inhibitory activity against S. aureus clinical isolates, they also showed synergistic action with oxacillin against all these strains (at least at one combined proportion). These results encourage the identification of active substances which could be used as lead(s) molecules in the development of new antimicrobial drugs. PMID:27446005

An Integrin from Shrimp Litopenaeus vannamei Mediated Microbial Agglutination and Cell Proliferation

PubMed Central

Zhang, Ying; Wang, Leilei; Wang, Lingling; Wu, Ning; Zhou, Zhi; Song, Linsheng

2012-01-01

Background Integrins are a family of adhesion receptors which regulate cell proliferation, differentiation, leukocyte migration, and complement receptor-dependent phagocytosis. In invertebrates, as a cell adhesion receptor, β integrins play an important role for the balanced activation of immune defense responses especially during the encounter of infections. The present study attempts to characterize the immune functions of shrimp integrin (LvIntegrin) to have better understanding on the immune system and its regulation mechanisms in shrimps. Methodology A shrimp integrin was identified from the Pacific white shrimp Litopenaeus vannamei (designated as LvIntegrin). Its full-length cDNA was of 2621 bp with an open reading frame (ORF) of 2439 bp encoding a polypeptide of 812 amino acids. The mRNA expression of LvIntegrin was significantly up-regulated at 3, 6 and 12 h after Listonella anguillarum challenge. The cDNA fragment encoding β integrin domains (βA and hybrid domain) of LvIntegrin was recombined and expressed in Escherichia coli BL21(DE3)-pLysS. The recombinant protein (rLvIntegrin) could significantly agglutinate the tested microbe including E. coli JM109, L. anguillarum, Micrococcus luteus and Candida dattiladattila in the presence of divalent cations. Moreover, when NIH3T3 cells were cultured with rLvIntegrin, the proliferation rate increased significantly in a dose-dependent manner. Conclusions LvIntegrin, a shrimp β integrin was identified from L. vannamei, shared several highly conserved features. LvIntegrin exhibited broad-spectrum agglutination activity towards both bacteria and fungi and could improve the proliferation of NIH3T3 cells, indicating that LvIntegrin is involved in the immune response against microbe challenge and regulation of cell proliferation as a cell adhesion receptor in shrimp. PMID:22792387

An integrin from shrimp Litopenaeus vannamei mediated microbial agglutination and cell proliferation.

PubMed

Zhang, Ying; Wang, Leilei; Wang, Lingling; Wu, Ning; Zhou, Zhi; Song, Linsheng

2012-01-01

Integrins are a family of adhesion receptors which regulate cell proliferation, differentiation, leukocyte migration, and complement receptor-dependent phagocytosis. In invertebrates, as a cell adhesion receptor, β integrins play an important role for the balanced activation of immune defense responses especially during the encounter of infections. The present study attempts to characterize the immune functions of shrimp integrin (LvIntegrin) to have better understanding on the immune system and its regulation mechanisms in shrimps. A shrimp integrin was identified from the Pacific white shrimp Litopenaeus vannamei (designated as LvIntegrin). Its full-length cDNA was of 2621 bp with an open reading frame (ORF) of 2439 bp encoding a polypeptide of 812 amino acids. The mRNA expression of LvIntegrin was significantly up-regulated at 3, 6 and 12 h after Listonella anguillarum challenge. The cDNA fragment encoding β integrin domains (βA and hybrid domain) of LvIntegrin was recombined and expressed in Escherichia coli BL21(DE3)-pLysS. The recombinant protein (rLvIntegrin) could significantly agglutinate the tested microbe including E. coli JM109, L. anguillarum, Micrococcus luteus and Candida dattiladattila in the presence of divalent cations. Moreover, when NIH3T3 cells were cultured with rLvIntegrin, the proliferation rate increased significantly in a dose-dependent manner. LvIntegrin, a shrimp β integrin was identified from L. vannamei, shared several highly conserved features. LvIntegrin exhibited broad-spectrum agglutination activity towards both bacteria and fungi and could improve the proliferation of NIH3T3 cells, indicating that LvIntegrin is involved in the immune response against microbe challenge and regulation of cell proliferation as a cell adhesion receptor in shrimp.

A galectin from Eriocheir sinensis functions as pattern recognition receptor enhancing microbe agglutination and haemocytes encapsulation.

PubMed

Wang, Mengqiang; Wang, Lingling; Huang, Mengmeng; Yi, Qilin; Guo, Ying; Gai, Yunchao; Wang, Hao; Zhang, Huan; Song, Linsheng

2016-08-01

Galectins are a family of β-galactoside binding lectins that function as pattern recognition receptors (PRRs) in innate immune system of both vertebrates and invertebrates. The cDNA of Chinese mitten crab Eriocheir sinensis galectin (designated as EsGal) was cloned via rapid amplification of cDNA ends (RACE) technique based on expressed sequence tags (ESTs) analysis. The full-length cDNA of EsGal was 999 bp. Its open reading frame encoded a polypeptide of 218 amino acids containing a GLECT/Gal-bind_lectin domain and a proline/glycine rich low complexity region. The deduced amino acid sequence and domain organization of EsGal were highly similar to those of crustacean galectins. The mRNA transcripts of EsGal were found to be constitutively expressed in a wide range of tissues and mainly in hepatopancreas, gill and haemocytes. The mRNA expression level of EsGal increased rapidly and significantly after crabs were stimulated by different microbes. The recombinant EsGal (rEsGal) could bind various pathogen-associated molecular patterns (PAMPs), including lipopolysaccharide (LPS), peptidoglycan (PGN) and glucan (GLU), and exhibited strong activity to agglutinate Escherichia coli, Vibrio anguillarum, Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus and Pichia pastoris, and such agglutinating activity could be inhibited by both d-galactose and α-lactose. The in vitro encapsulation assay revealed that rEsGal could enhance the encapsulation of haemocytes towards agarose beads. These results collectively suggested that EsGal played crucial roles in the immune recognition and elimination of pathogens and contributed to the innate immune response against various microbes in crabs. Copyright © 2016 Elsevier Ltd. All rights reserved.

Involvement of a Serpin serine protease inhibitor (OoSerpin) from mollusc Octopus ocellatus in antibacterial response.

PubMed

Wei, Xiumei; Xu, Jie; Yang, Jianmin; Liu, Xiangquan; Zhang, Ranran; Wang, Weijun; Yang, Jialong

2015-01-01

Serpin is an important member of serine protease inhibitors (SPIs), which is capable of regulating proteolytic events and involving in a variety of physiological processes. In present study, a Serpin homolog was identified from Octopus ocellatus (designated as OoSerpin). Full-length cDNA of OoSerpin was of 1735 bp, containing a 5' untranslated region of 214 bp, a 3' UTR of 282 bp, and an open reading frame of 1239 bp. The open reading frame encoded a polypeptide of 412 amino acids which has a predicted molecular weight of 46.5 kDa and an isoelectric point of 8.52. The OoSerpin protein shares 37% sequence identity with other Serpins from Mus musculus (NP_941373) and Ixodes scapularis (XP_002407493). The existence of a conserved SERPIN domain strongly suggested that OoSerpin was a member of the Serpin subfamily. Expression patterns of OoSerpin, both in tissues and towards bacterial stimulation, were then characterized. The mRNA of OoSerpin was constitutively expressed at different levels in all tested tissues of untreated O. ocellatus, including mantle (lowest), muscle, renal sac, gill, hemocyte, gonad, systemic heart, and hepatopancreas (highest). The transcriptional level of OoSerpin was significantly up-regulated (P<0.01) in O. ocellatus upon bacterial challenges with Vibrio anguillarum and Micrococcus luteus, indicating its involvement in the antibacterial immune response. Furthermore, rOoSerpin, the recombinant protein of OoSerpin, exhibited strong abilities to inhibit proteinase activities of trypsin and chymotrypsin as well as the growth of Escherichia coli. Our results demonstrate that OoSerpin is a potential antibacterial factor involved in the immune response of O. ocellatus against bacterial infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

Activation of the Glutamic Acid-Dependent Acid Resistance System in Escherichia coli BL21(DE3) Leads to Increase of the Fatty Acid Biotransformation Activity

PubMed Central

Woo, Ji-Min; Kim, Ji-Won; Song, Ji-Won; Blank, Lars M.; Park, Jin-Byung

2016-01-01

The biosynthesis of carboxylic acids including fatty acids from biomass is central in envisaged biorefinery concepts. The productivities are often, however, low due to product toxicity that hamper whole-cell biocatalyst performance. Here, we have investigated factors that influence the tolerance of Escherichia coli to medium chain carboxylic acid (i.e., n-heptanoic acid)-induced stress. The metabolic and genomic responses of E. coli BL21(DE3) and MG1655 grown in the presence of n-heptanoic acid indicated that the GadA/B-based glutamic acid-dependent acid resistance (GDAR) system might be critical for cellular tolerance. The GDAR system, which is responsible for scavenging intracellular protons by catalyzing decarboxylation of glutamic acid, was inactive in E. coli BL21(DE3). Activation of the GDAR system in this strain by overexpressing the rcsB and dsrA genes, of which the gene products are involved in the activation of GadE and RpoS, respectively, resulted in acid tolerance not only to HCl but also to n-heptanoic acid. Furthermore, activation of the GDAR system allowed the recombinant E. coli BL21(DE3) expressing the alcohol dehydrogenase of Micrococcus luteus and the Baeyer-Villiger monooxygenase of Pseudomonas putida to reach 60% greater product concentration in the biotransformation of ricinoleic acid (i.e., 12-hydroxyoctadec-9-enoic acid (1)) into n-heptanoic acid (5) and 11-hydroxyundec-9-enoic acid (4). This study may contribute to engineering E. coli-based biocatalysts for the production of carboxylic acids from renewable biomass. PMID:27681369

Compound-specific nitrogen isotope analysis of D-alanine, L-alanine, and valine: application of diastereomer separation to delta15N and microbial peptidoglycan studies.

PubMed

Takano, Yoshinori; Chikaraishi, Yoshito; Ogawa, Nanako O; Kitazato, Hiroshi; Ohkouchi, Naohiko

2009-01-01

We have developed an analytical method to determine the compound-specific nitrogen isotope compositions of individual amino acid enantiomers using gas chromatography/combustion/isotope ratio mass spectrometry. A novel derivatization of amino acid diastereomers by optically active (R)-(-)-2-butanol or (S)-(+)-2-butanol offers two advantages for nitrogen isotope analysis. First, chromatographic chiral separation can be achieved without the use of chiral stationary-phase columns. Second, the elution order of these compounds on the chromatogram can be switched by a designated esterification reaction. We applied the method to the compound-specific nitrogen isotope analysis of D- and L-alanine in a peptidoglycan derived from the cell walls of cultured bacteria (Firmicutes and Actinobacteria; Enterococcus faecalis, Staphylococcus aureus, Staphylococcus staphylolyticus, Lactobacillus acidophilus, Bacillus subtilis, Micrococcus luteus, and Streptomyces sp.), natural whole bacterial cells (Bacillus subtilis var. natto), (pseudo)-peptidoglycan from archaea (Methanobacterium sp.), and cell wall from eukaryota (Saccharomyces cerevisiae). We observed statistically significant differences in nitrogen isotopic compositions; e.g., delta15N ( per thousand vs air) in Staphylococcus staphylolyticus for d-alanine (19.2 +/- 0.5 per thousand, n = 4) and L-alanine (21.3 +/- 0.8 per thousand, n = 4) and in Bacillus subtilis for D-alanine (6.2 +/- 0.2 per thousand, n = 3) and L-alanine (8.2 +/- 0.4 per thousand, n = 3). These results suggest that enzymatic reaction pathways, including the alanine racemase reaction, produce a nitrogen isotopic difference in amino acid enantiomers, resulting in 15N-depleted D-alanine. This method is expected to facilitate compound-specific nitrogen isotope studies of amino acid stereoisomers.

Microbial development in distillers wet grains produced during fuel ethanol production from corn (Zea mays).

PubMed

Lehman, R Michael; Rosentrater, Kurt A

2007-09-01

Distillers grains are coproduced with ethanol and carbon dioxide during the production of fuel ethanol from the dry milling and fermentation of corn grain, yet there is little basic microbiological information on these materials. We undertook a replicated field study of the microbiology of distillers wet grains (DWG) over a 9 day period following their production at an industrial fuel ethanol plant. Freshly produced DWG had a pH of about 4.4, a moisture content of about 53.5% (wet mass basis), and 4 x 10(5) total yeast cells/g dry mass, of which about 0.1% were viable. Total bacterial cells were initially below detection limits (ca. 10(6) cells/g dry mass) and then were estimated to be approximately 5 x 10(7) cells/g dry mass during the first 4 days following production. Culturable aerobic heterotrophic organisms (fungi plus bacteria) ranged between 10(4) and 10(5) CFU/g dry mass during the initial 4 day period, and lactic acid bacteria increased from 36 to 10(3) CFU/g dry mass over this same period. At 9 days, total viable bacteria and yeasts and (or) molds topped 10(8) CFU/g dry mass and lactic acid bacteria approached 10(6) CFU/g dry mass. Community phospholipid fatty acid analysis indicated a stable microbial community over the first 4 days of storage. Thirteen morphologically distinct isolates were recovered, of which 10 were yeasts and molds from 6 different genera, 2 were strains of the lactic-acid-producing Pediococcus pentosaceus and only one was an aerobic heterotrophic bacteria, Micrococcus luteus. The microbiology of DWG is fundamental to the assessment of spoilage, deleterious effects (e.g., toxins), or beneficial effects (e.g., probiotics) in its use as feed or in alternative applications.

Production and Properties of Bacteriocin-Like Inhibitory Substances from the Swine Pathogen Streptococcus suis Serotype 2

PubMed Central

Mélançon, D.; Grenier, D.

2003-01-01

Streptococcus suis serotype 2 is a major pathogen found in the upper respiratory tract of swine. In this study, isolates of this bacterial species were tested for the production of bacteriocin-like inhibitory substances (BLIS). Of the 38 strains tested, four inhibited the growth of other S. suis isolates according to a deferred-antagonism plate assay. Interestingly, three of the strains were originally isolated from healthy carrier pigs and were considered nonvirulent. Three isolates (94-623, 90-1330, and AAH4) that produced BLIS in liquid broth were selected for further characterization. None of the inhibitory activities was related to the production of either organic acids or hydrogen peroxide. The BLIS produced by these strains were heat stable and proteinase K, pronase, and elastase sensitive but were trypsin and chymotrypsin resistant. They were stable at pH 2 and 12 and had molecular masses in the range of 14 to 30 kDa. Maximum production was observed during the mid-log phase. Following a curing procedure with novobiocin, only 90-1330 lost the ability to produce BLIS, suggesting that the BLIS might be plasmid encoded. Analysis of the inhibitory spectra revealed that the BLIS-producing strains also inhibited the growth of Actinobacillus minor, Actinobacillus porcinus, Enterococcus durans, Micrococcus luteus, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. dysgalactiae, Streptococcus equi subsp. zooepidemicus, and S. dysgalactiae subsp. equisimilis. This study reports for the first time the ability of the swine pathogen S. suis serotype 2 to produce BLIS with the characteristics of classic bacteriocins. Further studies are required to investigate the possibility of using bacteriocin-producing strains to prevent swine infections caused by virulent strains of S. suis serotype 2. PMID:12902232

Filthy lucre: A metagenomic pilot study of microbes found on circulating currency in New York City

PubMed Central

Maritz, Julia M.; Sullivan, Steven A.; Prill, Robert J.; Aksoy, Emre; Scheid, Paul; Carlton, Jane M.

2017-01-01

Background Paper currency by its very nature is frequently transferred from one person to another and represents an important medium for human contact with—and potential exchange of—microbes. In this pilot study, we swabbed circulating $1 bills obtained from a New York City bank in February (Winter) and June (Summer) 2013 and used shotgun metagenomic sequencing to profile the communities found on their surface. Using basic culture conditions, we also tested whether viable microbes could be recovered from bills. Results Shotgun metagenomics identified eukaryotes as the most abundant sequences on money, followed by bacteria, viruses and archaea. Eukaryotic assemblages were dominated by human, other metazoan and fungal taxa. The currency investigated harbored a diverse microbial population that was dominated by human skin and oral commensals, including Propionibacterium acnes, Staphylococcus epidermidis and Micrococcus luteus. Other taxa detected not associated with humans included Lactococcus lactis and Streptococcus thermophilus, microbes typically associated with dairy production and fermentation. Culturing results indicated that viable microbes can be isolated from paper currency. Conclusions We conducted the first metagenomic characterization of the surface of paper money in the United States, establishing a baseline for microbes found on $1 bills circulating in New York City. Our results suggest that money amalgamates DNA from sources inhabiting the human microbiome, food, and other environmental inputs, some of which can be recovered as viable organisms. These monetary communities may be maintained through contact with human skin, and DNA obtained from money may provide a record of human behavior and health. Understanding these microbial profiles is especially relevant to public health as money could potentially mediate interpersonal transfer of microbes. PMID:28384336

In vivo antioxidative property, antimicrobial and wound healing activity of flower extracts of Pyrostegia venusta (Ker Gawl) Miers.

PubMed

Roy, Purabi; Amdekar, Sarika; Kumar, Avnish; Singh, Rambir; Sharma, Poonam; Singh, Vinod

2012-03-06

Pyrostegia venusta (Ker Gawl) Miers. (Bignoniaceae), has been traditionally used as a remedy for treating white patches and infections on the skin (leukoderma, vitiligo). To investigate wound healing and antimicrobial activity of flower extract of Pyrostegia venusta, including in vivo antioxidant activity. Methanolic extracts of Pyrostegia venusta flowers were studied for wound healing efficiency along with its effect on pro-inflammatory and anti-inflammatory cytokines was assessed using excision and incision model of wound repair in Wistar rats. Healing was assessed by the rate of wound contraction, tensile strength, breaking strength, hydroxyproline and hexosamine content. Antimicrobial activity of the flower extract against twelve microorganisms was also assessed. In vivo antioxidant activity was performed to understand the mechanism of wound healing potency. The results indicated that Pyrostegia venusta extract has potent wound healing capacity as evident from the wound contraction and increased tensile strength. Hydroxyproline and hexosamine expression were also correlative with the healing pattern observed. Pyrostegia venusta extract exhibited moderate antimicrobial activity against the organisms: Bacillus subtilis, Staphylococcus epidermidis, Staphylococcus pyogenes, Staphylococcus aureus, Escherichia coli, Micrococcus luteus, Enterobacter aerogenes, Salmonella typhi, Pseudomonas aeruginosa, Candida albicans, Aspergillus niger and Candida tropicana. During early wound healing phase TNF-α and IL-6 level were found to be up regulated by Pyrostegia venusta treatment. Increased wound contraction and tensile strength, augmented hydroxyproline and hexosamine content along with antioxidative activity and moderate antimicrobial activity support the early wound healing exhibited by Pyrostegia venusta flower extract. Induction in cytokine production may be one of the mechanisms involved in accelerating the wound healing by Pyrostegia venusta extract. Results suggest that Pyrostegia venusta may be useful in the tropical management of wound healing. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Synthesis, XRD crystal structure, spectroscopic characterization (FT-IR, 1H and 13C NMR), DFT studies, chemical reactivity and bond dissociation energy studies using molecular dynamics simulations and evaluation of antimicrobial and antioxidant activities of a novel chalcone derivative, (E)-1-(4-bromophenyl)-3-(4-iodophenyl)prop-2-en-1-one

NASA Astrophysics Data System (ADS)

Zainuri, D. Alwani; Arshad, Suhana; Khalib, N. Che; Razak, I. Abdul; Pillai, Renjith Raveendran; Sulaiman, S. Fariza; Hashim, N. Shafiqah; Ooi, K. Leong; Armaković, Stevan; Armaković, Sanja J.; Panicker, C. Yohannan; Van Alsenoy, C.

2017-01-01

In the present study, the title compound named as (E)-1-(4-bromophenyl)-3-(4-iodophenyl)prop-2-en-1-one was synthesized and structurally characterized by single-crystal X-ray diffraction. The compound crystallizes in the monoclinic system with P21/c space group with the unit cell parameters of a = 16.147 (2) Å, b = 14.270 (2) Å, c = 5.9058 (9) Å, β = 92.577 (3)° and Z = 4. The molecular geometry obtained from X-Ray structure determination was optimized by Density Functional Theory (DFT) using B3LYP/6-31G+(d, p)/Lanl2dz(f) method in the ground state. The IR spectrum was recorded and interpreted in details with the aid of Density Functional Theory (DFT) calculations and Potential Energy Distribution (PED) analysis. In order to investigate local reactivity properties of the title molecule, we have conducted DFT calculations of average local ionization energy surface and Fukui functions which were mapped to the electron density surface. In order to predict the open air stability and possible degradation properties, within DFT approach, we have also calculated bond dissociation energies. 1H and 13C NMR spectra were recorded and chemical shifts were calculated theoretically and compared with the experimental values. In addition, in vitro antimicrobial results show that the title compound has great potential of antibacterial activity against Staphylococcus aureus, Staphylococcus epidermidis and Micrococcus luteus bacteria and antifungal activity against Candida albicans in comparison to some reported chalcone derivatives. Antioxidant studies revealed the highest metal chelating activity of this compound.

What are the critical steps in processing blood cultures? A prospective audit evaluating current practice of reporting blood cultures in a centralised laboratory serving secondary care hospitals.

PubMed

Meda, Manjula; Clayton, James; Varghese, Reela; Rangaiah, Jayakeerthi; Grundy, Clive; Dashti, Farnaz; Garner, David; Groves, Katherine; Fitzmaurice, Karen; Hutley, E

2017-04-01

To assess current procedures of processing positive blood cultures against national standards with an aim to evaluate its clinical impact and to determine the utility of currently available rapid identification and susceptibility tests in processing of blood cultures. Blood cultures from three secondary care hospitals, processed at a centralised laboratory, were prospectively audited. Data regarding processing times, communication with prescribers, changes to patient management and mortality within 30 days of a significant blood culture were collected in a preplanned pro forma for a 4-week period. Of 2206 blood cultures, 211 positive blood cultures flagged positive. Sixty-nine (3.1%) of all cultures were considered to be contaminated. Fifty per cent of blood cultures that flagged positive had a Gram stain reported within 2 hours. Two (0.99%) patients with a significant bacteraemia had escalation of antimicrobial treatment at the point of reporting the Gram stain that was subsequently deemed necessary once sensitivity results were known. Most common intervention was de-escalation of therapy for Gram-positive organisms at the point of availability of pathogen identification (25.6% in Gram positive vs 10% in Gram negative; p=0.012). For Gram-negative organisms, the most common intervention was de-escalation of therapy at the point of availability of sensitivity results (43% in Gram negatives vs 17.9% in Gram positive; p=0.0097). Overall mortality within 30 days of a positive blood culture was 10.9% (23/211). Antibiotic resistance may have contributed to mortality in four of these patients (three Gram negative and one Gram positive). Gram stain result had the least impact on antibiotic treatment interventions (escalation or de-escalation). Tests that improve identification time for Gram-positive pathogens and sensitivity time for Gram-negative pathogens had the greatest impact in making significant changes to antimicrobial treatment. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Simultaneous Fluorescent Gram Staining and Activity Assessment of Activated Sludge Bacteria

PubMed Central

Forster, Scott; Snape, Jason R.; Lappin-Scott, Hilary M.; Porter, Jonathan

2002-01-01

Wastewater treatment is one of the most important commercial biotechnological processes, and yet the component bacterial populations and their associated metabolic activities are poorly understood. The novel fluorescent dye hexidium iodide allows assessment of Gram status by differential absorption through bacterial cell walls. Differentiation between gram-positive and gram-negative wastewater bacteria was achieved after flow cytometric analysis. This study shows that the relative proportions of gram-positive and gram-negative bacterial cells identified by traditional microscopy and hexidium iodide staining were not significantly different. Dual staining of cells for Gram status and activity proved effective in analyzing mixtures of cultured bacteria and wastewater populations. Levels of highly active organisms at two wastewater treatment plants, both gram positive and gram negative, ranged from 1.5% in activated sludge flocs to 16% in the activated sludge fluid. Gram-positive organisms comprised <5% of the total bacterial numbers but accounted for 19 and 55% of the highly active organisms within flocs at the two plants. Assessment of Gram status and activity within activated sludge samples over a 4-day period showed significant differences over time. This method provides a rapid, quantitative measure of Gram status linked with in situ activity within wastewater systems. PMID:12324319

Simultaneous fluorescent gram staining and activity assessment of activated sludge bacteria.

PubMed

Forster, Scott; Snape, Jason R; Lappin-Scott, Hilary M; Porter, Jonathan

2002-10-01

Wastewater treatment is one of the most important commercial biotechnological processes, and yet the component bacterial populations and their associated metabolic activities are poorly understood. The novel fluorescent dye hexidium iodide allows assessment of Gram status by differential absorption through bacterial cell walls. Differentiation between gram-positive and gram-negative wastewater bacteria was achieved after flow cytometric analysis. This study shows that the relative proportions of gram-positive and gram-negative bacterial cells identified by traditional microscopy and hexidium iodide staining were not significantly different. Dual staining of cells for Gram status and activity proved effective in analyzing mixtures of cultured bacteria and wastewater populations. Levels of highly active organisms at two wastewater treatment plants, both gram positive and gram negative, ranged from 1.5% in activated sludge flocs to 16% in the activated sludge fluid. Gram-positive organisms comprised <5% of the total bacterial numbers but accounted for 19 and 55% of the highly active organisms within flocs at the two plants. Assessment of Gram status and activity within activated sludge samples over a 4-day period showed significant differences over time. This method provides a rapid, quantitative measure of Gram status linked with in situ activity within wastewater systems.

Identification of Staphylococcus and Micrococcus species with the STAPHYtest system.

PubMed

Sedlácek, I; Kocur, M

1991-01-01

A collection of 216 well-characterized strains of Staphylococcus, Micrococcus and Stomatococcus was examined by a commercially available STAPHYtest system (Lachema, Brno, Czechoslovakia). The results of STAPHYtest agreed with those of conventional tests. The STAPHYtest permitted a clear-cut separation of Staphylococcus from Micrococcus and Stomatococcus strains and correctly identified 104 of 145 (72%) Staphylococcus strains after 24 h of incubation. However, it allowed the identification only of 19 of 29 validly published Staphylococcus species. The STAPHYtest proved to be a simple and rapid system for the separation of staphylococci from micrococci and for the identification of most frequent clinically significant staphylococci.

Micrococcus sedentarius bacteraemia presenting with haemophagocytic syndrome in previously healthy boy.

PubMed

Kuskonmaz, Baris; Kara, Ates; Ozen, Maide; Cengiz, A Bülent; Ozen, Metehan; Seçmeer, Gülten; Gürgey, Aytemiz

2006-01-01

Haemophagocytic syndromes are the clinical manifestation of an increased macrophagic activity with haemophagocytosis. Infection-associated HS was originally described by Risdall in 1979, in viral disease. Since the initial description HS has also been documented in patients with bacterial, parasitic or fungal infections. We describe a case of Micrococcus sedentarius bacteraemia in a previously healthy 10-y-old boy with haemophagocytic syndrome. Species of micrococci are generally considered as non-pathogenic commensals that colonize the skin, mucosae and oropharynx. We report the first case of Microccoccus sedentarius bacteraemia in an immunocompetent host and first case of HS associated with Micrococcus species.

Protein Localization in Silica Nanospheres Derived via Biomimetic Mineralization (POSTPRINT)

DTIC Science & Technology

2010-01-01

lyse the cell wall of the bac- terial strain Micrococcus lysodeikticus demonstrating that its native hydrolase activity is retained. The K m (M) for...manufacturer’s instructions (Pierce, Rockford, IL). Lysozyme activity assays were performed with Micrococcus lysodeikticus cells according to the supplier’s

Is the gram stain useful in the microbiologic diagnosis of VAP? A meta-analysis.

PubMed

O'Horo, John C; Thompson, Deb; Safdar, Nasia

2012-08-01

In a meta-analysis examining respiratory specimen Gram stain for diagnosis of ventilator-associated pneumonia, absence of bacteria on Gram stain had a high negative predictive value, but a positive Gram stain correlated poorly with organisms recovered in culture. Rapid and accurate diagnosis of ventilator-associated pneumonia (VAP) is a major challenge and no generally accepted gold standard exists for VAP diagnosis. We conducted a meta-analysis to examine the role of respiratory specimen Gram stain to diagnose VAP, and the correlation with final culture results. In 21 studies, pooled sensitivity of Gram stain for VAP was 0.79 (95% confidence interval [CI], .77-0.81; P < .0001) and specificity was 0.75 (95% CI, .73-.78; P < .0001). Negative predictive value of Gram stain for a VAP prevalence of 20%-30% was 91%, suggesting that VAP is unlikely with a negative Gram stain but the positive predictive value of Gram stain was only 40%. Pooled kappa was 0.42 for gram-positive organisms and 0.34 for gram-negative organisms, suggesting fair concordance between organisms on Gram stain and recovery by culture. Therefore, a positive Gram stain should not be used to narrow anti-infective therapy until culture results become available.

The first complete chloroplast genome of the Genistoid legume Lupinus luteus: evidence for a novel major lineage-specific rearrangement and new insights regarding plastome evolution in the legume family.

PubMed

Martin, Guillaume E; Rousseau-Gueutin, Mathieu; Cordonnier, Solenn; Lima, Oscar; Michon-Coudouel, Sophie; Naquin, Delphine; de Carvalho, Julie Ferreira; Aïnouche, Malika; Salmon, Armel; Aïnouche, Abdelkader

2014-06-01

To date chloroplast genomes are available only for members of the non-protein amino acid-accumulating clade (NPAAA) Papilionoid lineages in the legume family (i.e. Millettioids, Robinoids and the 'inverted repeat-lacking clade', IRLC). It is thus very important to sequence plastomes from other lineages in order to better understand the unusual evolution observed in this model flowering plant family. To this end, the plastome of a lupine species, Lupinus luteus, was sequenced to represent the Genistoid lineage, a noteworthy but poorly studied legume group. The plastome of L. luteus was reconstructed using Roche-454 and Illumina next-generation sequencing. Its structure, repetitive sequences, gene content and sequence divergence were compared with those of other Fabaceae plastomes. PCR screening and sequencing were performed in other allied legumes in order to determine the origin of a large inversion identified in L. luteus. The first sequenced Genistoid plastome (L. luteus: 155 894 bp) resulted in the discovery of a 36-kb inversion, embedded within the already known 50-kb inversion in the large single-copy (LSC) region of the Papilionoideae. This inversion occurs at the base or soon after the Genistoid emergence, and most probably resulted from a flip-flop recombination between identical 29-bp inverted repeats within two trnS genes. Comparative analyses of the chloroplast gene content of L. luteus vs. Fabaceae and extra-Fabales plastomes revealed the loss of the plastid rpl22 gene, and its functional relocation to the nucleus was verified using lupine transcriptomic data. An investigation into the evolutionary rate of coding and non-coding sequences among legume plastomes resulted in the identification of remarkably variable regions. This study resulted in the discovery of a novel, major 36-kb inversion, specific to the Genistoids. Chloroplast mutational hotspots were also identified, which contain novel and potentially informative regions for molecular evolutionary studies at various taxonomic levels in the legumes. Taken together, the results provide new insights into the evolutionary landscape of the legume plastome. © The Author 2014. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

How bacterial cell division might cheat turgor pressure - a unified mechanism of septal division in Gram-positive and Gram-negative bacteria.

PubMed

Erickson, Harold P

2017-08-01

An important question for bacterial cell division is how the invaginating septum can overcome the turgor force generated by the high osmolarity of the cytoplasm. I suggest that it may not need to. Several studies in Gram-negative bacteria have shown that the periplasm is isoosmolar with the cytoplasm. Indirect evidence suggests that this is also true for Gram-positive bacteria. In this case the invagination of the septum takes place within the uniformly high osmotic pressure environment, and does not have to fight turgor pressure. A related question is how the V-shaped constriction of Gram-negative bacteria relates to the plate-like septum of Gram-positive bacteria. I collected evidence that Gram-negative bacteria have a latent capability of forming plate-like septa, and present a model in which septal division is the basic mechanism in both Gram-positive and Gram-negative bacteria. © 2017 WILEY Periodicals, Inc.

Gram-positive and gram-negative bacteria induce different patterns of cytokine production in human mononuclear cells irrespective of taxonomic relatedness.

PubMed

Skovbjerg, Susann; Martner, Anna; Hynsjö, Lars; Hessle, Christina; Olsen, Ingar; Dewhirst, Floyd E; Tham, Wilhelm; Wold, Agnes E

2010-01-01

Upon bacterial stimulation, tissue macrophages produce a variety of cytokines that orchestrate the immune response that clears the infection. We have shown that Gram-positives induce higher levels of interleukin-12 (IL-12), interferon-gamma (IFN-gamma), and tumor necrosis factor (TNF) from human peripheral blood mononuclear cells (PBMCs) than do Gram-negatives, which instead induce more of IL-6, IL-8, and IL-10. Here, we study whether these patterns follows or crosses taxonomic borders. PBMCs from blood donors were incubated with UV-inactivated bacteria representing 37 species from five phyla. IL-12, TNF, IL-1beta, IL-6, IL-8, and IL-10 were measured in the supernatants after 24 h and IFN-gamma after 5 days. Irrespective of phylogenetic position, Gram-positive bacteria induced much more IL-12 (nine times more on average) and IFN-gamma (seven times), more TNF (three times), and slightly more IL-1beta (1.5 times) than did Gram-negatives, which instead induced more IL-6 (1.5 times), IL-8 (1.9 times), and IL-10 (3.3 times) than did Gram-positives. A notable exception was the Gram-positive Listeria monocytogenes, which induced very little IL-12, IFN-gamma, and TNF. The results confirm the fundamental difference in innate immune responses to Gram-positive and Gram-negative bacteria, which crosses taxonomic borders and probably reflects differences in cell wall structure.

Techniques for controlling variability in gram staining of obligate anaerobes.

PubMed Central

Johnson, M J; Thatcher, E; Cox, M E

1995-01-01

Identification of anaerobes recovered from clinical samples is complicated by the fact that certain gram-positive anaerobes routinely stain gram negative; Peptostreptococcus asaccharolyticus, Eubacterium plautii, Clostridium ramosum, Clostridium symbiosum, and Clostridium clostridiiforme are among the nonconformists with regard to conventional Gram-staining procedures. Accurate Gram staining of American Type Culture Collection strains of these anaerobic bacteria is possible by implementing fixing and staining techniques within a gloveless anaerobic chamber. Under anaerobic conditions, gram-positive staining occurred in all test organisms with "quick" fixing techniques with both absolute methanol and formalin. The results support the hypothesis that, when anaerobic bacteria are exposed to oxygen, a breakdown of the physical integrity of the cell wall occurs, introducing Gram stain variability in gram-positive anaerobes. PMID:7538512

Distinction of Gram-positive and -negative bacteria using a colorimetric microbial viability assay based on the reduction of water-soluble tetrazolium salts with a selection medium.

PubMed

Tsukatani, Tadayuki; Suenaga, Hikaru; Higuchi, Tomoko; Shiga, Masanobu; Noguchi, Katsuya; Matsumoto, Kiyoshi

2011-01-01

Bacteria are fundamentally divided into two groups: Gram-positive and Gram-negative. Although the Gram stain and other techniques can be used to differentiate these groups, some issues exist with traditional approaches. In this study, we developed a method for differentiating Gram-positive and -negative bacteria using a colorimetric microbial viability assay based on the reduction of the tetrazolium salt {2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt} (WST-8) via 2-methyl-1,4-napthoquinone with a selection medium. We optimized the composition of the selection medium to allow the growth of Gram-negative bacteria while inhibiting the growth of Gram-positive bacteria. When the colorimetric viability assay was carried out in a selection medium containing 0.5µg/ml crystal violet, 5.0 µg/ml daptomycin, and 5.0µg/ml vancomycin, the reduction in WST-8 by Gram-positive bacteria was inhibited. On the other hand, Gram-negative bacteria produced WST-8-formazan in the selection medium. The proposed method was also applied to determine the Gram staining characteristics of bacteria isolated from various foodstuffs. There was good agreement between the results obtained using the present method and those obtained using a conventional staining method. These results suggest that the WST-8 colorimetric assay with selection medium is a useful technique for accurately differentiating Gram-positive and -negative bacteria.

21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN...

21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN...

21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Enzyme...

Analysis of the utility of stone gram stain in urolithiasis treated with percutaneous nephrolithotomy.

PubMed

Cockerill, Patrick A; Rivera, Marcelino E; Krambeck, Amy E

2014-06-01

To define the sensitivity and specificity of stone gram stain for infected urolithiasis treated with percutaneous nephrolithotomy (PCNL). PCNL procedures performed at our institution were analyzed between January 2009 and May 2013. Stone fragments were sent in a sterile fashion for aerobic and fungal cultures. A gram stain and fungal smear were performed on the stones and reported within 24 hours of collection. A total of 228 patients underwent 248 PCNLs. Of the 248 stones, 81 (33%) had a positive stone culture. Stone gram stain was positive in 31 cases and negative in 50. There were 167 negative stone cultures, and in these cases, gram stain was positive in 5 and negative in 162. The calculated sensitivity and specificity of stone gram stain were 38% and 97%. The positive and negative predictive values were 86% and 76%, respectively. In the subset of 16 patients with positive stone fungal cultures, fungal smear was performed in 12 and was positive in 4, giving fungal smear a sensitivity of 33%. The results of this study suggest that stone gram stain cannot be relied on to detect a positive stone culture and may fail to detect up to 62% of infected stones. However, when positive, gram stain accurately predicts a positive stone culture in 86% of cases. Copyright © 2014 Elsevier Inc. All rights reserved.

Isolation and characterisation of phosphate solubilising microorganisms from the cold desert habitat of Salix alba Linn. in trans Himalayan region of Himachal Pradesh.

PubMed

Chatli, Anshu S; Beri, Viraj; Sidhu, B S

2008-06-01

Phosphate solubilising microorganisms (PSM) (bacteria and fungi) associated with Salix alba Linn. from Lahaul and Spiti valleys of Himachal Pradesh were isolated on Pikovskaya (PVK), modified Pikovskaya (MPVK) and National Botanical Research Institute agar (NBRIP) media by spread plating. The viable colony count of P-solubilising bacteria (PSB) and fungi (PSF) was higher in rhizosphere than that of non-rhizosphere. The frequency of PSM was highest on MPVK followed by NBRIP and PVK agar. The maximum proportion of PSM out of total bacterial and fungal count was found in upper Keylong while the least in Rong Tong. The PSB frequently were Gram-positive, endosporeforming, motile rods and belonged to Bacillus sp. The PSF mainly belonged to Penicillium sp., Aspergillus fumigatus, A. niger, A. spp. and non-sporulating sterile. Amongst the isolates with high efficiency for tricalcium phosphate (TCP) solubilisation, seven bacterial and seven fungal isolates dissolved higher amount of P from North Carolina rock phosphate (NCRP) than Mussoorie rock phosphate (MRP) and Udaipur rock phosphate (URP). However, the organisms solubilised higher-P in NBRIP broth than PVK broth. SBC5 (Bacillus sp.) and SBC7 (Bacillus sp.) bacterial isolates exhibited maximun P solubilisation (40 and 33 μg ml(-1) respectively) whereas FC28 (Penicillium sp.) isolate (52.3 μg ml(-1)) amongst fungi while solubilising URP. The amount of P solubilised was positively correlated with the decrease in pH of medium. SBC5 (Bacillus sp.), SBC7 (Bacillus sp.) and SBC4 (Micrococcus) decreased the pH of medium from 6.8 to 6.08 while FC28 (Penicillium sp.) and FC39 (Penicillium sp.) isolates of fungi recorded maximum decrease in pH of medium from 6.8 to 5.96 in NBRIP broth.

Forthcoming therapeutic perspectives for infections due to multidrug-resistant Gram-positive pathogens.

PubMed

Cornaglia, G; Rossolini, G M

2009-03-01

Multidrug resistance in Gram-positive pathogens emerged as a major therapeutic challenge over two decades ago. The worldwide spread of methicillin-resistant Staphylococcus aureus (MRSA), glycopeptide-resistant enterococci and other resistant Gram-positive pathogens had a major impact on antibiotic policies, and prompted the discovery and development of new antibiotics to combat difficult-to-treat infections caused by such pathogens. Several new antibiotics active against multidrug-resistant Gram-positive pathogens have recently been introduced into clinical practice, and the antibiotic pipeline contains additional anti-Gram-positive drugs at an advanced stage of development, including new glycopeptides (dalbavancin, oritavancin, and telavancin), new anti-MRSA beta-lactams (ceftobiprole), and new diaminopyrimidines (iclaprim). This article provides a brief overview of these upcoming agents, partially based on the material presented at the ESCMID Conference entitled 'Fighting infections due to multidrug-resistant Gram-positives' (Venice, Italy, 29-31 May 2008) and on the most recent literature.

Differential staining of bacteria: gram stain.

PubMed

Moyes, Rita B; Reynolds, Jackie; Breakwell, Donald P

2009-11-01

In 1884, Hans Christian Gram, a Danish doctor, developed a differential staining technique that is still the cornerstone of bacterial identification and taxonomic division. This multistep, sequential staining protocol separates bacteria into four groups based on cell morphology and cell wall structure: Gram-positive cocci, Gram-negative cocci, Gram-positive rods, and Gram-negative rods. The Gram stain is useful for assessing bacterial contamination of tissue culture samples or for examining the Gram stain status and morphological features of bacteria isolated from mixed or isolated bacterial cultures. (c) 2009 by John Wiley & Sons, Inc.

Efficacy of direct Gram stain in differentiating staphylococci from streptococci in blood cultures positive for gram-positive cocci.

PubMed Central

Agger, W A; Maki, D G

1978-01-01

A preponderance of clusters seen on direct Gram stain of blood cultures positive for gram-positive cocci was 98% sensitive and 100% specific for identification of staphylococcal species or of Peptococcus. A preponderance of chains, pairs, or both was 100% sensitive and 98% specific for identifying streptococci. Further presumptive identification of either staphylococci or streptococci based on microscopic morphology was unreliable. The direct Gram stain is highly reliable for differentiating staphylococci from streptococci and should be of considerable value to clinicians selecting initial antimicrobial therapy. PMID:75888

Antimicrobial sensitivity pattern of bacterial pathogens in urinary tract infections in South Delhi, India.

PubMed

Akhtar, Mohammad Shabib; Mohsin, Nehal; Zahak, Ahmad; Ain, Mohammad Ruhal; Pillai, P K; Kapur, Prem; Ahmad, Mohammad Zaki

2014-01-01

Seventy-four bacterial proven cases of urinary tract infections were studied, and identified by Mac Conkey agar and blood agar medium separately; all the isolates were subjected to antimicrobial sensitivity testing by Stokes technique. Ninty-six percent of total isolated organisms were found to be gram negative while remaining 4% were gram positive. Among gram negatives, E. coli and gram positive S. aureus were the most prevalent organisms. The percentage of gram negative isolates were as follows, E. coli (79.7%) followed by Klebsiella (9.5%), Pseudomonas, Acinetobacter were (2.7% each), Proteus constituted (1.4%). and among gram positive S. aureus (4%). The antibiotic resistance of identified organisms was carried out by disc-diffusion method with commercially available disc of thirteen antibiotics having different mode of actions such as inhibition of cell wall synthesis, membrane permeability alternatives, inhibition of protein synthesis and DNA synthesis inhibitors. Gram negatives showed more resistance to these antibiotics as compared to gram positive organisms. The most effective antibiotic for gram negative UTI isolates is amikacin showing 63% efficacy followed by Cefotaxime 55% efficacy, Amoxicillin and Ciprofloxacin with (49% each) efficacy. Among gram positives, Chloramphenicol, Co-trimoxazole, Gentamicin, Amikacin, Ciprofloxacin and Cefotaxime are most effective with (66.6% each) efficacy, then Ampicillin, Amoxicillin, Tetracycline and norfloxacin with (33.3% each) efficacy.

Evaluation of White Blood Cell Count, Neutrophil Percentage, and Elevated Temperature as Predictors of Bloodstream Infection in Burn Patients

DTIC Science & Technology

2007-07-01

Table 2). Three cultures were mixed with gram-positive and gram- negative bacteria, and 3 cultures produced yeasts (Can- dida albicans [n=2] and Candida ...that were gram positive, 3 that were mixed gram positive/gram nega- tive, and 3 yeasts . Although white blood cell count and neutrophil percentage at the...negative [but not mixed], or yeast ) because of small numbers. Statistical significance was set at P .01. RESULTS During the study period, 223 patients were

Airborne Bacteria in an Urban Environment

PubMed Central

Mancinelli, Rocco L.; Shulls, Wells A.

1978-01-01

Samples were taken at random intervals over a 2-year period from urban air and tested for viable bacteria. The number of bacteria in each sample was determined, and each organism isolated was identified by its morphological and biochemical characteristics. The number of bacteria found ranged from 0.013 to 1.88 organisms per liter of air sampled. Representatives of 19 different genera were found in 21 samples. The most frequently isolated organisms and their percent of occurence were Micrococcus (41%), Staphylococcus (11%), and Aerococcus (8%). The bacteria isolated were correlated with various weather and air pollution parameters using the Pearson product-moment correlation coefficient method. Statistically significant correlations were found between the number of viable bacteria isolated and the concentrations of nitric oxide (−0.45), nitrogen dioxide (+0.43), and suspended particulate pollutants (+0.56). Calculated individually, the total number of Micrococcus, Aerococcus, and Staphylococcus, number of rods, and number of cocci isolated showed negative correlations with nitric oxide and positive correlations with nitrogen dioxide and particulates. Statistically significant positive correlations were found between the total number of rods isolated and the concentration of nitrogen dioxide (+0.54) and the percent relative humidity (+0.43). The other parameters tested, sulfur dioxide, hydrocarbons, and temperature, showed no significant correlations. Images PMID:677875

ROLE OF POTASSIUM IN THE OXIDATIVE METABOLISM OF MICROCOCCUS SODONENSIS1

PubMed Central

Perry, Jerome J.; Evans, James B.

1961-01-01

Perry, Jerome J. (The University of Chicago, Chicago, Ill.), and James B. Evans. Role of potassium in the oxidative metabolism of Micrococcus sodonensis. J. Bacteriol. 82:551–555. 1961.—An absolute potassium requirement has been established for the growth of Micrococcus sodonensis with lactate or pyruvate as substrate. Potassium at 0.67 × 10−2m concentration was necessary for maximal growth. Resting cell and cell-free preparations from cells grown on minimal levels of potassium were stimulated by potassium but, due to residual or bound cation, did not show an absolute requirement. Rubidium and cesium replaced potassium in these cells although cesium is much less effective. PMID:14485577

Cystic neutrophilic granulomatous mastitis: an underappreciated pattern strongly associated with gram-positive bacilli.

PubMed

Renshaw, Andrew A; Derhagopian, Robert P; Gould, Edwin W

2011-09-01

Although granulomatous lobular mastitis is associated with gram-positive bacilli such as Corynebacterium, this association is not well known. We report 3 cases of mastitis caused by gram-positive bacilli. All 3 abscesses were suppurative with distinct enlarged cystic spaces in which rare gram-positive bacilli were identified. Two cases were also granulomatous. Cultures in all 3 cases were negative. All 3 patients recovered after biopsy and tetracycline-based therapy. Infection in the breast by gram-positive bacilli is associated with a distinct histologic pattern, including cystic spaces in the setting of neutrophilic/granulomatous inflammation that can be recognized and should prompt careful search for the organism within enlarged vacuoles.

Gram-negative diabetic foot osteomyelitis: risk factors and clinical presentation.

PubMed

Aragón-Sánchez, Javier; Lipsky, Benjamin A; Lázaro-Martínez, Jose L

2013-03-01

Osteomyelitis frequently complicates infections in the feet of patients with diabetes. Gram-positive cocci, especially Staphylococcus aureus, are the most commonly isolated pathogens, but gram-negative bacteria also cause some cases of diabetic foot osteomyelitis (DFO). These gram-negatives require different antibiotic regimens than those commonly directed at gram-positives. There are, however, few data on factors related to their presence and how they influence the clinical picture. We conducted a retrospective study to determine the variables associated with the isolation of gram-negative bacteria from bone samples in cases of DFO and the clinical presentation of these infections. Among 341 cases of DFO, 150 had a gram-negative isolate (alone or combined with a gram-positive isolate) comprising 44.0% of all patients and 50.8% of those with a positive bone culture. Compared with gram-positive infections, wounds with gram-negative organisms more often had a fetid odor, necrotic tissue, signs of soft tissue infection accompanying osteomyelitis, and clinically severe infection. By multivariate analysis, the predictive variables related to an increased likelihood of isolating gram-negatives from bone samples were glycated hemoglobin <7% (odds ratio [OR] = 2.0, 95% confidence interval [CI] = 1.1-3.5) and a wound caused by traumatic injury (OR = 2.0, 95% CI = 1.0-3.9). Overall, patients whose bone samples contained gram-negatives had a statistically significantly higher prevalence of leukocytosis and higher white blood cell counts than those without gram-negatives. In conclusion, gram-negative organisms were isolated in nearly half of our cases of DFO and were associated with more severe infections, higher white blood cell counts, lower glycated hemoglobin levels, and wounds of traumatic etiology.

A molecular gram stain using broad range PCR and pyrosequencing technology: a potentially useful tool for diagnosing orthopaedic infections.

PubMed

Kobayashi, Naomi; Bauer, Thomas W; Togawa, Daisuke; Lieberman, Isador H; Sakai, Hiroshige; Fujishiro, Takaaki; Tuohy, Marion J; Procop, Gary W

2005-06-01

The bacteria associated with orthopaedic infections are usually common gram-positive and gram-negative bacteria. This fundamental grouping of bacteria is a necessary first step in the selection of appropriate antibiotics. Since polymerase chain reaction (PCR) is more rapid and may be more sensitive than culture, we developed a postamplification pyrosequencing method to subcategorize bacteria based on a few nucleotide polymorphisms in the 16S rRNA gene. We validated this method using well-characterized strains of bacteria and applied it to specimens from spinal surgery cases with suspected infections. Lysates of 114 bacteria including 75 species were created following standard cultivation to obtain DNA. The DNA was amplified by a broad-range real-time PCR. The amplicons were evaluated by pyrosequencing and were classified as gram-positive, gram-negative, or acid-fast bacilli based on the first three to five nucleotides sequenced. In addition, clinical cases of suspected infection were obtained from spinal surgery. The results of the "molecular Gram stain" were compared with the results of traditional Gram stain and culture. The lysates of 107 (93.9%) of the bacteria extracts tested were appropriately categorized as gram-positive and gram-negative or as acid-fast bacilli on the basis of this assay. The sensitivity and specificity of this assay were 100% and 97.4% for gram-positive and 88.3% and 100% for gram-negative isolates. All of the five clinical samples were appropriately categorized as containing gram-positive or gram-negative bacteria with this assay. This study demonstrates that high sensitivity and specificity of a molecular gram stain may be achieved using broad-range real-time PCR and pyrosequencing.

Low-molecular-weight thiols in streptomycetes and their potential role as antioxidants.

PubMed Central

Newton, G L; Fahey, R C; Cohen, G; Aharonowitz, Y

1993-01-01

The intracellular low-molecular-weight thiols present in five gram-positive Streptomyces species and one Flavobacterium species were analyzed by high-performance liquid chromatography after fluorescence labeling with monobromobimane. Bacteria were chosen to include penicillin and cephalosporin beta-lactam producers and nonproducers. No significant amount of glutathione was found in any of the streptomycetes. Major intracellular thiols in all strains examined were cysteine, coenzyme A, sulfide, thiosulfate, and an unknown thiol designated U17. Those streptomycetes that make beta-lactam antibiotics also produce significant amounts of delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine (ACV), a key intermediate in their biosynthesis. In Streptomyces clavuligerus, a potent producer of beta-lactams, the level of ACV was low during the early phase of growth and increased rapidly toward the end of exponential growth, paralleling that of antibiotic production. These and other observations indicate that ACV does not function as a protective thiol in streptomycetes. U17 may have this role since it was the major thiol in all streptomycetes and appeared to occur at levels about 10-fold higher than those of the other thiols measured, including ACV. Purification and amino acid analysis of U17 indicated that it contains cysteine and an unusual amine that is not one of the common amino acids. This thiol is identical to an unknown thiol found previously in Micrococcus roseus and Streptomyces griseus. A high level of ergothioneine was found in Streptomyces lactamdurans, and several unidentified thiols were detected in this and other streptomycetes. PMID:8478335

Surface Microbiology of Smartphone Screen Protectors Among Healthcare Professionals.

PubMed

Raza, Ibrahim; Raza, Awais; Razaa, Syed Ahmad; Sadar, Ahmad Bani; Qureshi, Ahmad Uzair; Talib, Usama; Chi, Gerald

2017-12-26

The use of smartphones with touch screens has become a norm for healthcare professionals (HCP). The risk of smart screen contamination has been proven, and guidelines are available to deal with possible contamination. A large number of smartphone users apply plastic or glass screen protectors onto their mobile phone screens to prevent scratches. However, these materials are not scratch proof, and their antipathogenic properties have not been studied. We have conducted a study to determine the frequency of smartphone screen protector contamination and compared the data with contamination on the bare area on the same mobile screens. The sample size included only HCPs working in acute care settings and having at least eight hours of exposure time every day. A total of 64 samples were collected, which reported 62.5% (n = 40/64) positive culture swabs from the protected areas of the screen and 45.3% (n = 29/64) from the unprotected area of the screen. Micrococcus and Gram-negative rods grew only on samples taken from the protected area whereas the bare area showed no such growth. There was no statistically significant difference in the frequency based on smart screen size, duration of use during duty hours, or the setting where it was used. Smartphone screen protectors from healthcare providers may harbor pathogenic bacteria, especially in acute care settings. Coagulase-negative Staphylococci followed by Bacillus species were the most commonly yielded bacteria among house officers and postgraduate trainees in the present study.

Purification and Properties of Clostridium perfringens Spore Lytic Enzymes.

DTIC Science & Technology

1983-01-01

Morita et aL, 1978; Ochi et aL, 1978). However, it is not a true lysozyme (N-acetylmuramidase) since it is ineffective against Micrococcus lysodeikticus...previously reported, in the N-Fthylinaleimide (5) 9S 99 inability of initiation protein to lyse Micrococcus ’ Concentration in mM given in parenthesis

Programmed Pathogen Sense and Destroy Circuits

DTIC Science & Technology

2009-02-18

detection and the peptide-mediated Com QS system of Bacillus subtilis for gram-positive detection. Together these two prototype sentinel circuits cover a...and E. coli. We are currently in the process of constructing receivers for a gram-positive pathogen, Bacillus subtilis . Gram-negative...QS signals. Figure 11: Gram positive QS systems. Agr QS of Staphylococcus aureus (left) and Com QS of Bacillus subtilis . Following the successful

Selective Imaging of Gram-Negative and Gram-Positive Microbiotas in the Mouse Gut.

PubMed

Wang, Wei; Zhu, Yuntao; Chen, Xing

2017-08-01

The diverse gut microbial communities are crucial for host health. How the interactions between microbial communities and between host and microbes influence the host, however, is not well understood. To facilitate gut microbiota research, selective imaging of specific groups of microbiotas in the gut is of great utility but remains technically challenging. Here we present a chemical approach that enables selective imaging of Gram-negative and Gram-positive microbiotas in the mouse gut by exploiting their distinctive cell wall components. Cell-selective labeling is achieved by the combined use of metabolic labeling of Gram-negative bacterial lipopolysaccharides with a clickable azidosugar and direct labeling of Gram-positive bacteria with a vancomycin-derivatized fluorescent probe. We demonstrated this strategy by two-color fluorescence imaging of Gram-negative and Gram-positive gut microbiotas in the mouse intestines. This chemical method should be broadly applicable to different gut microbiota research fields and other bacterial communities studied in microbiology.

An optimized staining technique for the detection of Gram positive and Gram negative bacteria within tissue.

PubMed

Becerra, Sandra C; Roy, Daniel C; Sanchez, Carlos J; Christy, Robert J; Burmeister, David M

2016-04-12

Bacterial infections are a common clinical problem in both acute and chronic wounds. With growing concerns over antibiotic resistance, treatment of bacterial infections should only occur after positive diagnosis. Currently, diagnosis is delayed due to lengthy culturing methods which may also fail to identify the presence of bacteria. While newer costly bacterial identification methods are being explored, a simple and inexpensive diagnostic tool would aid in immediate and accurate treatments for bacterial infections. Histologically, hematoxylin and eosin (H&E) and Gram stains have been employed, but are far from optimal when analyzing tissue samples due to non-specific staining. The goal of the current study was to develop a modification of the Gram stain that enhances the contrast between bacteria and host tissue. A modified Gram stain was developed and tested as an alternative to Gram stain that improves the contrast between Gram positive bacteria, Gram negative bacteria and host tissue. Initially, clinically relevant strains of Pseudomonas aeruginosa and Staphylococcus aureus were visualized in vitro and in biopsies of infected, porcine burns using routine Gram stain, and immunohistochemistry techniques involving bacterial strain-specific fluorescent antibodies as validation tools. H&E and Gram stain of serial biopsy sections were then compared to a modification of the Gram stain incorporating a counterstain that highlights collagen found in tissue. The modified Gram stain clearly identified both Gram positive and Gram negative bacteria, and when compared to H&E or Gram stain alone provided excellent contrast between bacteria and non-viable burn eschar. Moreover, when applied to surgical biopsies from patients that underwent burn debridement this technique was able to clearly detect bacterial morphology within host tissue. We describe a modification of the Gram stain that provides improved contrast of Gram positive and Gram negative microorganisms within host tissue. The samples used in this study demonstrate that this staining technique has laboratory and clinical applicability. This modification only adds minutes to traditional Gram stain with reusable reagents, and results in a cost- and time-efficient technique for identifying bacteria in any clinical biopsy containing connective tissue.

Gram staining.

PubMed

Coico, Richard

2005-10-01

Named after Hans Christian Gram who developed the method in 1884, the Gram stain allows one to distinguish between Gram-positive and Gram-negative bacteria on the basis of differential staining with a crystal violet-iodine complex and a safranin counterstain. The cell walls of Gram-positive organisms retain this complex after treatment with alcohol and appear purple, whereas gram-negative organisms decolorize following such treatment and appear pink. The method described here is useful for assessing bacterial contamination of tissue culture samples or for examining the Gram stain status and morphological features of bacteria isolated from mixed or isolated bacterial cultures.

Gram staining.

PubMed

Coico, R

2001-05-01

Named after Hans Christian Gram who developed the method in 1884, the Gram stain allows one to distinguish between Gram-positive and Gram-negative bacteria on the basis of differential staining with a crystal violet-iodine complex and a safranin counterstain. The cell walls of Gram-positive organisms retain this complex after treatment with alcohol and appear purple, whereas gram-negative organisms decolorize following such treatment and appear pink. The method described here is useful for assessing bacterial contamination of tissue culture samples or for examining the Gram stain status and morphological features of bacteria isolated from mixed or isolated bacterial cultures.

Gram-Positive Uropathogens, Polymicrobial Urinary Tract Infection, and the Emerging Microbiota of the Urinary Tract

PubMed Central

Kline, Kimberly A.; Lewis, Amanda L.

2015-01-01

Gram-positive bacteria are a common cause of urinary tract infection (UTI), particularly among individuals who are elderly, pregnant, or who have other risk factors for UTI. Here we review the epidemiology, virulence mechanisms, and host response to the most frequently isolated Gram-positive uropathogens: Staphylococcus saprophyticus, Enterococcus faecalis, and Streptococcus agalactiae. We also review several emerging, rare, misclassified, and otherwise underreported Gram-positive pathogens of the urinary tract including Aerococcus, Corynebacterium, Actinobaculum, and Gardnerella. The literature strongly suggests that urologic diseases involving Gram-positive bacteria may be easily overlooked due to limited culture-based assays typically utilized for urine in hospital microbiology laboratories. Some UTIs are polymicrobial in nature, often involving one or more Gram-positive bacteria. We herein review the risk factors and recent evidence for mechanisms of bacterial synergy in experimental models of polymicrobial UTI. Recent experimental data has demonstrated that, despite being cleared quickly from the bladder, some Gram-positive bacteria can impact pathogenic outcomes of co-infecting organisms. When taken together, the available evidence argues that Gram-positive bacteria are important uropathogens in their own right, but that some can be easily overlooked because they are missed by routine diagnostic methods. Finally, a growing body of evidence demonstrates that a surprising variety of fastidious Gram-positive bacteria may either reside in or be regularly exposed to the urinary tract and further suggests that their presence is widespread among women, as well as men. Experimental studies in this area are needed; however, there is a growing appreciation that the composition of bacteria found in the bladder could be a potentially important determinant in urologic disease, including susceptibility to UTI. PMID:27227294