Interpretative Guidelines and Possible Indications for Indocyanine Green Fluorescence Imaging in Robot-Assisted Sphincter-Saving Operations.

PubMed

Kim, Jin Cheon; Lee, Jong Lyul; Park, Seong Ho

2017-04-01

Since the introduction of indocyanine green angiography more than 25 years ago, few studies have presented interpretative guidelines for indocyanine green fluorescent imaging. We aimed to provide interpretative guidelines for indocyanine green fluorescent imaging through quantitative analysis and to suggest possible indications for indocyanine green fluorescent imaging during robot-assisted sphincter-saving operations. This is a retrospective observational study. This study was conducted at a single center. A cohort of 657 patients with rectal cancer who consecutively underwent curative robot-assisted sphincter-saving operations was enrolled between 2010 and 2016, including 310 patients with indocyanine green imaging (indocyanine green fluorescent imaging+ group) and 347 patients without indocyanine green imaging (indocyanine green fluorescent imaging- group). We tried to quantitatively define the indocyanine green fluorescent imaging findings based on perfusion (mesocolic and colic) time and perfusion intensity (5 grades) to provide probable indications. The anastomotic leakage rate was significantly lower in the indocyanine green fluorescent imaging+ group than in the indocyanine green fluorescent imaging- group (0.6% vs 5.2%) (OR, 0.123; 95% CI, 0.028-0.544; p = 0.006). Anastomotic stricture was closely correlated with anastomotic leakage (p = 0.002) and a short descending mesocolon (p = 0.003). Delayed perfusion (>60 s) and low perfusion intensity (1-2) were more frequently detected in patients with anastomotic stricture and marginal artery defects than in those without these factors (p ≤ 0.001). In addition, perfusion times greater than the mean were more frequently observed in patients aged >58 years, whereas low perfusion intensity was seen more in patients with short descending mesocolon and high ASA classes (≥3). The 300 patients in the indocyanine green fluorescent imaging- group underwent operations 3 years before indocyanine green fluorescent imaging. Quantitative analysis of indocyanine green fluorescent imaging may help prevent anastomotic complications during robot-assisted sphincter-saving operations, and may be of particular value in high-class ASA patients, older patients, and patients with a short descending mesocolon.

Evaluation of a real-time PCR assay based on the single-copy SAG1 gene for the detection of Toxoplasma gondii.

PubMed

Yu, Haijie; Huang, Bin; Zhuo, Xunhui; Chen, Xueqiu; Du, Aifang

2013-11-08

Real-time PCR-based detection of Toxoplasma gondii is very sensitive and convenient for diagnosing toxoplasmosis. However, the performance of the PCR assays could be influenced by the target gene chosen. Here we evaluate a real-time PCR assay using double-stranded DNA dyes (SYBR(®) Green I assay) with a new set of primers targeting the SAG1 gene for the fast and specific detection of T. gondii. The assay showed higher sensitivity than conventional PCR protocols using T. gondii DNA as template. The detection limit of the developed real-time PCR assay was in the order of 1 tachyzoite. The assay was also assessed by experimentally infected mice and showed positive results for blood (25%), spleen (50%) and lung (50%) as early as 1 dpi. The specificity of the assay was confirmed by using DNA from Neospora caninum, Escherichia coli, Babesia bovis, Trypanosoma brucei, Cryptosporidium parvum, and Toxocara canis. Assay applicability was successfully tested in blood samples collected from slaughtered pigs. These results indicate that, based on SYBR(®) green I, the quantitative SAG1 assay may also be useful in the study of the pathogenicity, immunoprophylaxis, and treatment of T. gondii. Copyright © 2013 Elsevier B.V. All rights reserved.

Analysis on the restriction factors of the green building scale promotion based on DEMATEL

NASA Astrophysics Data System (ADS)

Wenxia, Hong; Zhenyao, Jiang; Zhao, Yang

2017-03-01

In order to promote the large-scale development of the green building in our country, DEMATEL method was used to classify influence factors of green building development into three parts, including green building market, green technology and macro economy. Through the DEMATEL model, the interaction mechanism of each part was analyzed. The mutual influence degree of each barrier factor that affects the green building promotion was quantitatively analysed and key factors for the development of green building in China were also finally determined. In addition, some implementation strategies of promoting green building scale development in our country were put forward. This research will show important reference value and practical value for making policies of the green building promotion.

Application of Airborne Hydrographic Laser Scanning for Mapping Shallow Water Riverine Environments in the Pacific Northwest, United States

NASA Astrophysics Data System (ADS)

Cooper, C.; Nayegandhi, A.; Faux, R.

2013-12-01

Small-footprint, green wavelength airborne LiDAR systems can provide seamless topography across the land-water interface at very high spatial resolution. These data have the potential to improve floodplain modeling, fisheries habitat assessments, stream restoration efforts, and other applications by continuously mapping shallow water depths that are difficult or impossible to measure using traditional ground-based or water-borne survey techniques. WSI (Corvallis, Oregon) in collaboration with Dewberry, (Tampa, Florida) and Riegl (Orlando, Florida), deployed the Riegl VQ-820-G hydrographic airborne laser scanner to map riverine and lacustrine environments from Oregon to Minnesota. Discussion will focus on the ability to accurately map depth and underwater structure, as well as riparian vegetation and terrain under different conditions. Results indicate that depth penetration varies with both water (i.e. clarity and surface conditions) and bottom conditions (i.e. substrate, depth, and landform). Depth penetration was typically limited to 1 Secchi depth or less across selected project areas. As an example, the green LiDAR system effectively mapped 83% of a shallow water river system, the Sandy River, with typical depths ranging from 0-2.5 meters. WSI will show quantitative comparisons of Green LiDAR surveys against more traditional methods such as rod or sonar surveys. WSI will also discuss advantages and limitations of Green LiDAR surveys for bathymetric modeling including survey accuracy, density, and efficiency along with data processing challenges not inherent with traditional NIR LiDAR processing.

The nexus between climate change, ecosystem services and human health: Towards a conceptual framework.

PubMed

Chiabai, Aline; Quiroga, Sonia; Martinez-Juarez, Pablo; Higgins, Sahran; Taylor, Tim

2018-09-01

This paper addresses the impact that changes in natural ecosystems can have on health and wellbeing focusing on the potential co-benefits that green spaces could provide when introduced as climate change adaptation measures. Ignoring such benefits could lead to sub-optimal planning and decision-making. A conceptual framework, building on the ecosystem-enriched Driver, Pressure, State, Exposure, Effect, Action model (eDPSEEA), is presented to aid in clarifying the relational structure between green spaces and human health, taking climate change as the key driver. The study has the double intention of (i) summarising the literature with a special emphasis on the ecosystem and health perspectives, as well as the main theories behind these impacts, and (ii) modelling these findings into a framework that allows for multidisciplinary approaches to the underlying relations between human health and green spaces. The paper shows that while the literature based on the ecosystem perspective presents a well-documented association between climate, health and green spaces, the literature using a health-based perspective presents mixed evidence in some cases. The role of contextual factors and the exposure mechanism are rarely addressed. The proposed framework could serve as a multidisciplinary knowledge platform for multi-perspecitve analysis and discussion among experts and stakeholders, as well as to support the operationalization of quantitative assessment and modelling exercises. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Green Nanochemistry Approach to Titanium Dioxide Nanoparticle, Dye- Sensitized Solar Cells

DTIC Science & Technology

2012-06-01

of flavonoids , is commonly found in tissues of many different fruits and plants. In cell vacuoles, anthocyanins absorb light in the blue-green...their relative merits for application in green chemistry -based DSSCs. 10 5. References 1. O’Regan, B.; Grätzel, M. A Low-Cost, High-Efficiency...of Photochemistry and Photobiology A Chemistry 2011, 219, 188–194. 4. Fuleki, T.; Francis, F. J. Quantitative Methods for Anthocyanins

Modeling Uncertainty and Its Implications in Complex Interdependent Networks

DTIC Science & Technology

2016-04-30

observables chosen evolve dynamically (i.e., change over time); also, it is absolutely NECESSARY for these to be numerical, or to correspond to some sort ...ascertain the quantitative mechanism for color transitions of the red, yellow, or green bubbles that capture the changes in value of Cost, Schedule

Accurate thermometry based on the red and green fluorescence intensity ratio in NaYF₄: Yb, Er nanocrystals for bioapplication.

PubMed

Liu, Lixin; Qin, Feng; Lv, Tianquan; Zhang, Zhiguo; Cao, Wenwu

2016-10-15

A biological temperature measurement method based on the fluorescence intensity ratio (FIR) was developed to reduce uncertainty. The upconversion luminescence of NaYF₄:Yb, Er nanocrystals was studied as a function of temperature around the physiologically relevant range of 300-330 K. We found that the green-green FIR Fe and red-green FIR (I₆₆₀/I₅₄₀) varied linearly as temperature increased. The thermometric uncertainties using the two FIRs were discussed and were determined to be almost constant at 0.6 and 0.09 K for green-green and red-green, respectively. The lower thermometric uncertainty comes from the intense signal-to-noise ratio of the measured FIRs owing to their comparable fluorescence intensities.

Duration comparison: relative stimulus differences stimulus age, and stimulus predictiveness.

PubMed Central

Stubbs, D A; Dreyfus, L R; Fetterman, J G; Boynton, D M; Locklin, N; Smith, L D

1994-01-01

Under a psychophysical trials procedure, pigeons were presented with a red light of one duration followed by a green light of a second duration. Eight geometrically spaced base durations were paired with one of four shorter and four longer durations as the alternate member of a duration pair, with different pairs randomly intermixed. One choice was reinforced if red had lasted longer than green, and a second choice was reinforced if green had lasted longer. Performance was compared when all the base durations and their pair members were included (entire-range condition) or when only the four longest base durations and their comparison durations (restricted-range condition) were used. Discrimination sensitivity decreased for longer duration pairs under both conditions, supporting a memory-based account. Sensitivity was lower under the restricted-range condition. Under both conditions, a bias to report "green as longer" increased as the second green duration increased. Bias changed as a matching function of the green-duration predictiveness of the correct choice. The results are related to a quantitative model of timing and remembering proposed by Staddon. PMID:8064211

The Teaching Excellence Framework: Would You Tell Me, Please, Which Way I Ought to Go from Here

ERIC Educational Resources Information Center

Berger, Dan; Wild, Charles

2016-01-01

The UK government's Green Paper, "Fulfilling Our Potential: Teaching Excellence, Social Mobility and Student Choice", presents both significant challenges and opportunities for universities. Whilst the quantitative element of the proposed Teaching Excellence Framework (TEF), underpinned by Big Data, offers the tantalizing opportunity to…

Single Cell Transfection through Precise Microinjection with Quantitatively Controlled Injection Volumes

NASA Astrophysics Data System (ADS)

Chow, Yu Ting; Chen, Shuxun; Wang, Ran; Liu, Chichi; Kong, Chi-Wing; Li, Ronald A.; Cheng, Shuk Han; Sun, Dong

2016-04-01

Cell transfection is a technique wherein foreign genetic molecules are delivered into cells. To elucidate distinct responses during cell genetic modification, methods to achieve transfection at the single-cell level are of great value. Herein, we developed an automated micropipette-based quantitative microinjection technology that can deliver precise amounts of materials into cells. The developed microinjection system achieved precise single-cell microinjection by pre-patterning cells in an array and controlling the amount of substance delivered based on injection pressure and time. The precision of the proposed injection technique was examined by comparing the fluorescence intensities of fluorescent dye droplets with a standard concentration and water droplets with a known injection amount of the dye in oil. Injection of synthetic modified mRNA (modRNA) encoding green fluorescence proteins or a cocktail of plasmids encoding green and red fluorescence proteins into human foreskin fibroblast cells demonstrated that the resulting green fluorescence intensity or green/red fluorescence intensity ratio were well correlated with the amount of genetic material injected into the cells. Single-cell transfection via the developed microinjection technique will be of particular use in cases where cell transfection is challenging and genetically modified of selected cells are desired.

Single Cell Transfection through Precise Microinjection with Quantitatively Controlled Injection Volumes.

PubMed

Chow, Yu Ting; Chen, Shuxun; Wang, Ran; Liu, Chichi; Kong, Chi-Wing; Li, Ronald A; Cheng, Shuk Han; Sun, Dong

2016-04-12

Cell transfection is a technique wherein foreign genetic molecules are delivered into cells. To elucidate distinct responses during cell genetic modification, methods to achieve transfection at the single-cell level are of great value. Herein, we developed an automated micropipette-based quantitative microinjection technology that can deliver precise amounts of materials into cells. The developed microinjection system achieved precise single-cell microinjection by pre-patterning cells in an array and controlling the amount of substance delivered based on injection pressure and time. The precision of the proposed injection technique was examined by comparing the fluorescence intensities of fluorescent dye droplets with a standard concentration and water droplets with a known injection amount of the dye in oil. Injection of synthetic modified mRNA (modRNA) encoding green fluorescence proteins or a cocktail of plasmids encoding green and red fluorescence proteins into human foreskin fibroblast cells demonstrated that the resulting green fluorescence intensity or green/red fluorescence intensity ratio were well correlated with the amount of genetic material injected into the cells. Single-cell transfection via the developed microinjection technique will be of particular use in cases where cell transfection is challenging and genetically modified of selected cells are desired.

Priority survey between indicators and analytic hierarchy process analysis for green chemistry technology assessment.

PubMed

Kim, Sungjune; Hong, Seokpyo; Ahn, Kilsoo; Gong, Sungyong

2015-01-01

This study presents the indicators and proxy variables for the quantitative assessment of green chemistry technologies and evaluates the relative importance of each assessment element by consulting experts from the fields of ecology, chemistry, safety, and public health. The results collected were subjected to an analytic hierarchy process to obtain the weights of the indicators and the proxy variables. These weights may prove useful in avoiding having to resort to qualitative means in absence of weights between indicators when integrating the results of quantitative assessment by indicator. This study points to the limitations of current quantitative assessment techniques for green chemistry technologies and seeks to present the future direction for quantitative assessment of green chemistry technologies.

Quantitative analysis on the urban flood mitigation effect by the extensive green roof system.

PubMed

Lee, J Y; Moon, H J; Kim, T I; Kim, H W; Han, M Y

2013-10-01

Extensive green-roof systems are expected to have a synergetic effect in mitigating urban runoff, decreasing temperature and supplying water to a building. Mitigation of runoff through rainwater retention requires the effective design of a green-roof catchment. This study identified how to improve building runoff mitigation through quantitative analysis of an extensive green-roof system. Quantitative analysis of green-roof runoff characteristics indicated that the extensive green roof has a high water-retaining capacity response to rainfall of less than 20 mm/h. As the rainfall intensity increased, the water-retaining capacity decreased. The catchment efficiency of an extensive green roof ranged from 0.44 to 0.52, indicating reduced runoff comparing with efficiency of 0.9 for a concrete roof. Therefore, extensive green roofs are an effective storm water best-management practice and the proposed parameters can be applied to an algorithm for rainwater-harvesting tank design. © 2013 Elsevier Ltd. All rights reserved.

Detection of Alicyclobacillus spp. in Fruit Juice by Combination of Immunomagnetic Separation and a SYBR Green I Real-Time PCR Assay

PubMed Central

Yuan, Yahong; Liu, Bin; Wang, Ling; Yue, Tianli

2015-01-01

An approach based on immunomagnetic separation (IMS) and SYBR Green I real-time PCR (real-time PCR) with species-specific primers and melting curve analysis was proposed as a rapid and effective method for detecting Alicyclobacillus spp. in fruit juices. Specific primers targeting the 16S rDNA sequences of Alicyclobacillus spp. were designed and then confirmed by the amplification of DNA extracted from standard strains and isolates. Spiked samples containing known amounts of target bacteria were used to obtain standard curves; the correlation coefficient was greater than 0.986 and the real-time PCR amplification efficiencies were 98.9%- 101.8%. The detection limit of the testing system was 2.8×101 CFU/mL. The coefficient of variation for intra-assay and inter-assay variability were all within the acceptable limit of 5%. Besides, the performance of the IMS-real-time PCR assay was further investigated by detecting naturally contaminated kiwi fruit juice; the sensitivity, specificity and accuracy were 91.7%, 95.9% and 95.3%, respectively. The established IMS-real-time PCR procedure provides a new method for identification and quantitative detection of Alicyclobacillus spp. in fruit juice. PMID:26488469

Evaluation of green building rating tools based on existing green building achievement in Indonesia using Life Cycle Assessment Method

NASA Astrophysics Data System (ADS)

Basten, Van; Latief, Yusuf; Berawi, Mohammed Ali; Budiman, Rachmat; Riswanto

2017-03-01

Total completed building construction value in Indonesia increased 116% during 2009 to 2011. That's followed by increasing 11% energy consumption in Indonesia in the last three years with 70% energy met to the electricity needs of commercial building. In addition, a few application of green building concept in Indonesia made the greenhouse gas emissions or CO2 amount increased by 25%. Construction, operation, and maintain of building cost consider relatively high. The evaluation in this research is used to improve the building performance with some of green concept alternatives. The research methodology is conducted by combination of qualitative and quantitative approaches through interview and case study. Assessing the successful of optimization functions in the existing green building is based on the operational and maintenance phase with the Life Cycle Assessment (LCA) Method. The result of optimization that is the largest efficiency and effective of building life cycle.

Young Children's Learning Performance and Efficiency When Using Virtual Manipulative Mathematics iPad Apps

ERIC Educational Resources Information Center

Moyer-Packenham, Patricia S.; Shumway, Jessica F.; Bullock, Emma; Tucker, Stephen I.; Anderson-Pence, Katie L.; Westenskow, Arla; Boyer-Thurgood, Jennifer; Maahs-Fladung, Cathy; Symanzik, Juergen; Mahamane, Salif; MacDonald, Beth; Jordan, Kerry

2015-01-01

Part of a larger initiation mixed methods study (Greene, Caracelli, & Graham, 1989), this paper discusses the changes in young children's learning performance and efficiency (one element of the quantitative portion of the larger study) during clinical interviews in which each child interacted with a variety of virtual manipulative…

Development of a rapid, robust, and universal picogreen-based method to titer adeno-associated vectors.

PubMed

Piedra, Jose; Ontiveros, Maria; Miravet, Susana; Penalva, Cristina; Monfar, Mercè; Chillon, Miguel

2015-02-01

Recombinant adeno-associated viruses (rAAVs) are promising vectors in preclinical and clinical assays for the treatment of diseases with gene therapy strategies. Recent technological advances in amplification and purification have allowed the production of highly purified rAAV vector preparations. Although quantitative polymerase chain reaction (qPCR) is the current method of choice for titrating rAAV genomes, it shows high variability. In this work, we report a rapid and robust rAAV titration method based on the quantitation of encapsidated DNA with the fluorescent dye PicoGreen®. This method allows detection from 3×10(10) viral genome/ml up to 2.4×10(13) viral genome/ml in a linear range. Contrasted with dot blot or qPCR, the PicoGreen-based assay has less intra- and interassay variability. Moreover, quantitation is rapid, does not require specific primers or probes, and is independent of the rAAV pseudotype analyzed. In summary, development of this universal rAAV-titering method may have substantive implications in rAAV technology.

Comparisons of Utilizations and Nutrient Contents of a Rations and Short Order Meals at the Air Force Dining Facility, Lowry Air Force Base, Denver, Colorado

DTIC Science & Technology

1983-03-01

amounts and or unacceptability by the patrons. Certain food items (Spanish franks, green beans, and lyonnaise potatoes ) had large amounts of kitchen...Greens 12.89 Gravy, Cream 22.42 Beans, Green 12.44 Soup, Vegetable 18.15 Potatoes , Lyonnaise 10.62 Potatoes , Oven-Browned 10.16 Grits, (hominy) 6.51...for canned pears and 7.92% for coffee cake. Quantitatively, the largest amounts of wastes were milk, orange juice, and hash brown potatoes . Although the

Priority survey between indicators and analytic hierarchy process analysis for green chemistry technology assessment

PubMed Central

Kim, Sungjune; Hong, Seokpyo; Ahn, Kilsoo; Gong, Sungyong

2015-01-01

Objectives This study presents the indicators and proxy variables for the quantitative assessment of green chemistry technologies and evaluates the relative importance of each assessment element by consulting experts from the fields of ecology, chemistry, safety, and public health. Methods The results collected were subjected to an analytic hierarchy process to obtain the weights of the indicators and the proxy variables. Results These weights may prove useful in avoiding having to resort to qualitative means in absence of weights between indicators when integrating the results of quantitative assessment by indicator. Conclusions This study points to the limitations of current quantitative assessment techniques for green chemistry technologies and seeks to present the future direction for quantitative assessment of green chemistry technologies. PMID:26206364

DOTAP cationic liposomes prefer relaxed over supercoiled plasmids.

PubMed

Even-Chen, S; Barenholz, Y

2000-12-20

Cationic liposomes and DNA interact electrostatically to form complexes called lipoplexes. The amounts of unbound (free) DNA in a mixture of cationic liposomes and DNA at different cationic lipid:DNA molar ratios can be used to describe DNA binding isotherms; these provide a measure of the binding efficiency of DNA to different cationic lipid formulations at various medium conditions. In order to quantify the ratio between the various forms of naked DNA and supercoiled, relaxed and single-stranded DNA, and the ratio between cationic lipid bound and unbound DNA of various forms we developed a simple, sensitive quantitative assay using agarose gel electrophoresis, followed by staining with the fluorescent cyanine DNA dyes SYBR Green I or SYBR Gold. This assay was compared with that based on the use of ethidium bromide (the most commonly used nucleic acid stain). Unlike ethidium bromide, SYBR Green I DNA sensitivity and concentration-dependent fluorescence intensity were identical for supercoiled and nicked-relaxed forms. DNA detection by SYBR Green I in solution is approximately 40-fold more sensitive than by ethidium bromide for double-stranded DNA and approximately 10-fold for single-stranded DNA, and in agarose gel it is 16-fold more sensitive for double-stranded DNA compared with ethidium bromide. SYBR Gold performs similarly to SYBR Green I. This study shows that: (a) there is no significant difference in DNA binding isotherms to the monocationic DOTAP (DOTAP/DOPE) liposomes and to the polycationic DOSPA (DOSPA/DOPE) liposomes, even when four DOSPA positive charges are involved in the electrostatic interaction with DNA; (b) the helper lipids affect DNA binding, as DOTAP/DOPE liposomes bind more DNA than DOTAP/cholesterol; (c) in the process of lipoplex formation, when the DNA is a mixture of two forms, supercoiled and nicked-relaxed (open circular), there is a preference for the binding to the cationic liposomes of plasmid DNA in the nicked-relaxed over the supercoiled form. This preference is much more pronounced when the cationic liposome formulation is based on the monocationic lipid DOTAP than on the polycationic lipid DOSPA. The preference of DOTAP formulations to bind to the relaxed DNA plasmid suggests that the binding of supercoiled DNA is weaker and easier to dissociate from the complex.

Automated high resolution full-field spatial coherence tomography for quantitative phase imaging of human red blood cells

NASA Astrophysics Data System (ADS)

Singla, Neeru; Dubey, Kavita; Srivastava, Vishal; Ahmad, Azeem; Mehta, D. S.

2018-02-01

We developed an automated high-resolution full-field spatial coherence tomography (FF-SCT) microscope for quantitative phase imaging that is based on the spatial, rather than the temporal, coherence gating. The Red and Green color laser light was used for finding the quantitative phase images of unstained human red blood cells (RBCs). This study uses morphological parameters of unstained RBCs phase images to distinguish between normal and infected cells. We recorded the single interferogram by a FF-SCT microscope for red and green color wavelength and average the two phase images to further reduced the noise artifacts. In order to characterize anemia infected from normal cells different morphological features were extracted and these features were used to train machine learning ensemble model to classify RBCs with high accuracy.

Productivity, absorbed photosynthetically active radiation, and light use efficiency in crops: implications for remote sensing of crop primary production.

PubMed

Gitelson, Anatoly A; Peng, Yi; Arkebauer, Timothy J; Suyker, Andrew E

2015-04-01

Vegetation productivity metrics such as gross primary production (GPP) at the canopy scale are greatly affected by the efficiency of using absorbed radiation for photosynthesis, or light use efficiency (LUE). Thus, close investigation of the relationships between canopy GPP and photosynthetically active radiation absorbed by vegetation is the basis for quantification of LUE. We used multiyear observations over irrigated and rainfed contrasting C3 (soybean) and C4 (maize) crops having different physiology, leaf structure, and canopy architecture to establish the relationships between canopy GPP and radiation absorbed by vegetation and quantify LUE. Although multiple LUE definitions are reported in the literature, we used a definition of efficiency of light use by photosynthetically active "green" vegetation (LUE(green)) based on radiation absorbed by "green" photosynthetically active vegetation on a daily basis. We quantified, irreversible slowly changing seasonal (constitutive) and rapidly day-to-day changing (facultative) LUE(green), as well as sensitivity of LUE(green) to the magnitude of incident radiation and drought events. Large (2-3-fold) variation of daily LUE(green) over the course of a growing season that is governed by crop physiological and phenological status was observed. The day-to-day variations of LUE(green) oscillated with magnitude 10-15% around the seasonal LUE(green) trend and appeared to be closely related to day-to-day variations of magnitude and composition of incident radiation. Our results show the high variability of LUE(green) between C3 and C4 crop species (1.43 g C/MJ vs. 2.24 g C/MJ, respectively), as well as within single crop species (i.e., maize or soybean). This implies that assuming LUE(green) as a constant value in GPP models is not warranted for the crops studied, and brings unpredictable uncertainties of remote GPP estimation, which should be accounted for in LUE models. The uncertainty of GPP estimation due to facultative and constitutive changes in LUE(green) can be considered as a critical component of the total error budget in the context of remotely sensed based estimations of GPP. The quantitative framework of LUE(green) estimation presented here offers a way of characterizing LUE(green) in plants that can be used to assess their phenological and physiological status and vulnerability to drought under current and future climatic conditions and is essential for calibration and validation of globally applied LUE algorithms. Copyright © 2015 Elsevier GmbH. All rights reserved.

Effect of multi-wavelength irradiation on color characterization with light-emitting diodes (LEDs)

NASA Astrophysics Data System (ADS)

Park, Hyeong Ju; Song, Woosub; Lee, Byeong-Il; Kim, Hyejin; Kang, Hyun Wook

2017-06-01

In the current study, a multi-wavelength light-emitting diode (LED)-integrated CMOS imaging device was developed to investigate the effect of various wavelengths on multiple color characterization. Various color pigments (black, red, green, and blue) were applied on both white paper and skin phantom surfaces for quantitative analysis. The artificial skin phantoms were made of polydimethylsiloxane (PDMS) mixed with coffee and TiO2 powder to emulate the optical properties of the human dermis. The customized LED-integrated imaging device acquired images of the applied pigments by sequentially irradiating with the LED lights in the order of white, red, green, and blue. Each color pigment induced a lower contrast during illumination by the light with the equivalent color. However, the illumination by light with the complementary (opposite) color increased the signal-to-noise ratio by up to 11-fold due to the formation of a strong contrast ( i.e., red LED = 1.6 ± 0.3 vs. green LED = 19.0 ± 0.6 for red pigment). Detection of color pigments in conjunction with multi-wavelength LEDs can be a simple and reliable technique to estimate variations in the color pigments quantitatively.

Quantitative surface temperature measurement using two-color thermographic phosphors and video equipment

NASA Technical Reports Server (NTRS)

Buck, Gregory M. (Inventor)

1989-01-01

A thermal imaging system provides quantitative temperature information and is particularly useful in hypersonic wind tunnel applications. An object to be measured is prepared by coating with a two-color, ultraviolet-activated, thermographic phosphor. The colors emitted by the phosphor are detected by a conventional color video camera. A phosphor emitting blue and green light with a ratio that varies depending on temperature is used so that the intensity of light in the blue and green wavelengths detected by the blue and green tubes in the video camera can be compared. Signals representing the intensity of blue and green light at points on the surface of a model in a hypersonic wind tunnel are used to calculate a ratio of blue to green light intensity which provides quantitative temperature information for the surface of the model.

Fluorometric determination of nucleic acids based on the use of polydopamine nanotubes and target-induced strand displacement amplification.

PubMed

Ge, Jia; Bai, Dong-Mei; -Geng, Xin; Hu, Ya-Lei; Cai, Qi-Yong; Xing, Ke; Zhang, Lin; Li, Zhao-Hui

2018-01-10

The authors describe a fluorometric method for the quantitation of nucleic acids by combining (a) cycled strand displacement amplification, (b) the unique features of the DNA probe SYBR Green, and (c) polydopamine nanotubes. SYBR Green undergoes strong fluorescence enhancement upon intercalation into double-stranded DNA (dsDNA). The polydopamine nanotubes selectively adsorb single-stranded DNA (ssDNA) and molecular beacons. In the absence of target DNA, the molecular beacon, primer and SYBR Green are adsorbed on the surface of polydopamine nanotubes. This results in quenching of the fluorescence of SYBR Green, typically measured at excitation/emission wavelengths of 488/518 nm. Upon addition of analyte (target DNA) and polymerase, the stem of the molecular beacon is opened so that it can bind to the primer. This triggers target strand displacement polymerization, during which dsDNA is synthesized. The hybridized target is then displaced due to the strand displacement activity of the polymerase. The displaced target hybridizes with another molecular beacon. This triggers the next round of polymerization. Consequently, a large amount of dsDNA is formed which is detected by addition of SYBR Green. Thus, sensitive and selective fluorometric detection is realized. The fluorescent sensing strategy shows very good analytical performances towards DNA detection, such as a wide linear range from 0.05 to 25 nM with a low limit of detection of 20 pM. Graphical abstract Schematic of a fluorometric strategy for highly sensitive and selective determination of nucleic acids by combining strand displacement amplification and the unique features of SYBR Green I (SG) and polydopamine nanotubes.

Identification of cis-elements conferring high levels of gene expression in non-green plastids.

PubMed

Zhang, Jiang; Ruf, Stephanie; Hasse, Claudia; Childs, Liam; Scharff, Lars B; Bock, Ralph

2012-10-01

Although our knowledge about the mechanisms of gene expression in chloroplasts has increased substantially over the past decades, next to nothing is known about the signals and factors that govern expression of the plastid genome in non-green tissues. Here we report the development of a quantitative method suitable for determining the activity of cis-acting elements for gene expression in non-green plastids. The in vivo assay is based on stable transformation of the plastid genome and the discovery that root length upon seedling growth in the presence of the plastid translational inhibitor kanamycin is directly proportional to the expression strength of the resistance gene nptII in transgenic tobacco plastids. By testing various combinations of promoters and translation initiation signals, we have used this experimental system to identify cis-elements that are highly active in non-green plastids. Surprisingly, heterologous expression elements from maize plastids were significantly more efficient in conferring high expression levels in root plastids than homologous expression elements from tobacco. Our work has established a quantitative method for characterization of gene expression in non-green plastid types, and has led to identification of cis-elements for efficient plastid transgene expression in non-green tissues, which are valuable tools for future transplastomic studies in basic and applied research. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

Near-infrared fluorescence imaging with a mobile phone (Conference Presentation)

NASA Astrophysics Data System (ADS)

Ghassemi, Pejhman; Wang, Bohan; Wang, Jianting; Wang, Quanzeng; Chen, Yu; Pfefer, T. Joshua

2017-03-01

Mobile phone cameras employ sensors with near-infrared (NIR) sensitivity, yet this capability has not been exploited for biomedical purposes. Removing the IR-blocking filter from a phone-based camera opens the door to a wide range of techniques and applications for inexpensive, point-of-care biophotonic imaging and sensing. This study provides proof of principle for one of these modalities - phone-based NIR fluorescence imaging. An imaging system was assembled using a 780 nm light source along with excitation and emission filters with 800 nm and 825 nm cut-off wavelengths, respectively. Indocyanine green (ICG) was used as an NIR fluorescence contrast agent in an ex vivo rodent model, a resolution test target and a 3D-printed, tissue-simulating vascular phantom. Raw and processed images for red, green and blue pixel channels were analyzed for quantitative evaluation of fundamental performance characteristics including spectral sensitivity, detection linearity and spatial resolution. Mobile phone results were compared with a scientific CCD. The spatial resolution of CCD system was consistently superior to the phone, and green phone camera pixels showed better resolution than blue or green channels. The CCD exhibited similar sensitivity as processed red and blue pixels channels, yet a greater degree of detection linearity. Raw phone pixel data showed lower sensitivity but greater linearity than processed data. Overall, both qualitative and quantitative results provided strong evidence of the potential of phone-based NIR imaging, which may lead to a wide range of applications from cancer detection to glucose sensing.

Camera-based ratiometric fluorescence transduction of nucleic acid hybridization with reagentless signal amplification on a paper-based platform using immobilized quantum dots as donors.

PubMed

Noor, M Omair; Krull, Ulrich J

2014-10-21

Paper-based diagnostic assays are gaining increasing popularity for their potential application in resource-limited settings and for point-of-care screening. Achievement of high sensitivity with precision and accuracy can be challenging when using paper substrates. Herein, we implement the red-green-blue color palette of a digital camera for quantitative ratiometric transduction of nucleic acid hybridization on a paper-based platform using immobilized quantum dots (QDs) as donors in fluorescence resonance energy transfer (FRET). A nonenzymatic and reagentless means of signal enhancement for QD-FRET assays on paper substrates is based on the use of dry paper substrates for data acquisition. This approach offered at least a 10-fold higher assay sensitivity and at least a 10-fold lower limit of detection (LOD) as compared to hydrated paper substrates. The surface of paper was modified with imidazole groups to assemble a transduction interface that consisted of immobilized QD-probe oligonucleotide conjugates. Green-emitting QDs (gQDs) served as donors with Cy3 as an acceptor. A hybridization event that brought the Cy3 acceptor dye in close proximity to the surface of immobilized gQDs was responsible for a FRET-sensitized emission from the acceptor dye, which served as an analytical signal. A hand-held UV lamp was used as an excitation source and ratiometric analysis using an iPad camera was possible by a relative intensity analysis of the red (Cy3 photoluminescence (PL)) and green (gQD PL) color channels of the digital camera. For digital imaging using an iPad camera, the LOD of the assay in a sandwich format was 450 fmol with a dynamic range spanning 2 orders of magnitude, while an epifluorescence microscope detection platform offered a LOD of 30 fmol and a dynamic range spanning 3 orders of magnitude. The selectivity of the hybridization assay was demonstrated by detection of a single nucleotide polymorphism at a contrast ratio of 60:1. This work provides an important framework for the integration of QD-FRET methods with digital imaging for a ratiometric transduction of nucleic acid hybridization on a paper-based platform.

Identification of cypermethrin induced protein changes in green algae by iTRAQ quantitative proteomics.

PubMed

Gao, Yan; Lim, Teck Kwang; Lin, Qingsong; Li, Sam Fong Yau

2016-04-29

Cypermethrin (CYP) is one of the most widely used pesticides in large scale for agricultural and domestic purpose and the residue often seriously affects aquatic system. Environmental pollutant-induced protein changes in organisms could be detected by proteomics, leading to discovery of potential biomarkers and understanding of mode of action. While proteomics investigations of CYP stress in some animal models have been well studied, few reports about the effects of exposure to CYP on algae proteome were published. To determine CYP effect in algae, the impact of various dosages (0.001μg/L, 0.01μg/L and 1μg/L) of CYP on green algae Chlorella vulgaris for 24h and 96h was investigated by using iTRAQ quantitative proteomics technique. A total of 162 and 198 proteins were significantly altered after CYP exposure for 24h and 96h, respectively. Overview of iTRAQ results indicated that the influence of CYP on algae protein might be dosage-dependent. Functional analysis of differentially expressed proteins showed that CYP could induce protein alterations related to photosynthesis, stress responses and carbohydrate metabolism. This study provides a comprehensive view of complex mode of action of algae under CYP stress and highlights several potential biomarkers for further investigation of pesticide-exposed plant and algae. Copyright © 2016 Elsevier B.V. All rights reserved.

Quantitative PCR-based parasite burden estimation of Babesia gibsoni in the vector tick, Haemaphysalis longicornis (Acari: Ixodidae), fed on an experimentally infected dog.

PubMed

Hatta, Takeshi; Matsubayashi, Makoto; Miyoshi, Takeharu; Islam, Khyrul; Alim, M Abdul; Anisuzzaman; Yamaji, Kayoko; Fujisaki, Kozo; Tsuji, Naotoshi

2013-01-31

Most causative agents of babesiosis, Babesia parasites, are transmitted transovarially in ixodid ticks. In this study, B. gibsoni, the causative agent of canine babesiosis which has transovarial transmission, was detected in tissues of the vector tick, Haemaphysalis longicornis using a modified quantitative PCR assay. Conventional PCR results showed that the newly designed primer set, which amplifies a 143-bp fragment of rhoptry-associated protein-1 (BgRAP-1) gene in B. gibsoni, was 100 times more sensitive than primers targeting P18 gene encoding 18 kDa protein of B. gibsoni, which was recently renamed as thrombospondin related adhesive protein (BgTRAP) gene, in an artificially generated sample solution containing metagenomic DNA (B. gibsoni DNA extracted from infected dog blood mixed with tick DNA). The TaqMan probe-based quantitative PCR (qPCR) for BgRAP-1 could also detect infected RBCs (iRBCs) at levels of 3.5 × 10(5) to 3.5 × 10(1)/μl, a range that is broader than that of a past SYBR Green-based qPCR method for P18/BgTRAP, which had a detection limit of 3.5 × 10(3) iRBCs/μl. Using this qPCR assay, we attempted to quantify the B. gibsoni burden in tick ovaries and embryonated eggs. Levels of infection were normalized to the copy number of tick's genomic DNA fragment of ribosomal DNA internal transcribed spacer region 2 (ITS2) for the standardization. According to this, low levels of parasite burden were quantified in ovaries and eggs. This detection system is sensitive and is recommended as a tool for elucidating the biological interactions between the vector tick H. longicornis and the parasite, B. gibsoni.

Estimating root-zone soil moisture in the West Africa Sahel using remotely sensed rainfall and vegetation

NASA Astrophysics Data System (ADS)

McNally, Amy L.

Agricultural drought is characterized by shortages in precipitation, large differences between actual and potential evapotranspiration, and soil water deficits that impact crop growth and pasture productivity. Rainfall and other agrometeorological gauge networks in Sub-Saharan Africa are inadequate for drought early warning systems and hence, satellite-based estimates of rainfall and vegetation greenness provide the main sources of information. While a number of studies have described the empirical relationship between rainfall and vegetation greenness, these studies lack a process based approach that includes soil moisture storage. In Chapters I and II, I modeled soil moisture using satellite rainfall inputs and developed a new method for estimating soil moisture with NDVI calibrated to in situ and microwave soil moisture observations. By transforming both NDVI and rainfall into estimates of soil moisture I was able to easily compare these two datasets in a physically meaningful way. In Chapter II, I also show how the new NDVI derived soil moisture can be assimilated into a water balance model that calculates an index of crop water stress. Compared to the analogous rainfall derived estimates of soil moisture and crop stress the NDVI derived estimates were better correlated with millet yields. In Chapter III, I developed a metric for defining growing season drought events that negatively impact millet yields. This metric is based on the data and models used in the Chapters I and II. I then use this metric to evaluate the ability of a sophisticated land surface model to detect drought events. The analysis showed that this particular land surface model's soil moisture estimates do have the potential to benefit the food security and drought early warning communities. With a focus on soil moisture, this dissertation introduced new methods that utilized a variety of data and models for agricultural drought monitoring applications. These new methods facilitate a more quantitative, transparent `convergence of evidence' approach to identifying agricultural drought events that lead to food insecurity. Ideally, these new methods will contribute to better famine early warning and the timely delivery of food aid to reduce the human suffering caused by drought.

Quantitative Determination of Photosynthetic Pigments in Green Beans Using Thin-Layer Chromatography and a Flatbed Scanner as Densitometer

ERIC Educational Resources Information Center

Valverde, Juan; This, Herve; Vignolle, Marc

2007-01-01

A simple method for the quantitative determination of photosynthetic pigments extracted from green beans using thin-layer chromatography is proposed. Various extraction methods are compared, and it is shown how a simple flatbed scanner and free software for image processing can give a quantitative determination of pigments. (Contains 5 figures.)

Single Fluorescence Channel-based Multiplex Detection of Avian Influenza Virus by Quantitative PCR with Intercalating Dye

PubMed Central

Ahberg, Christian D.; Manz, Andreas; Neuzil, Pavel

2015-01-01

Since its invention in 1985 the polymerase chain reaction (PCR) has become a well-established method for amplification and detection of segments of double-stranded DNA. Incorporation of fluorogenic probe or DNA intercalating dyes (such as SYBR Green) into the PCR mixture allowed real-time reaction monitoring and extraction of quantitative information (qPCR). Probes with different excitation spectra enable multiplex qPCR of several DNA segments using multi-channel optical detection systems. Here we show multiplex qPCR using an economical EvaGreen-based system with single optical channel detection. Previously reported non quantitative multiplex real-time PCR techniques based on intercalating dyes were conducted once the PCR is completed by performing melting curve analysis (MCA). The technique presented in this paper is both qualitative and quantitative as it provides information about the presence of multiple DNA strands as well as the number of starting copies in the tested sample. Besides important internal control, multiplex qPCR also allows detecting concentrations of more than one DNA strand within the same sample. Detection of the avian influenza virus H7N9 by PCR is a well established method. Multiplex qPCR greatly enhances its specificity as it is capable of distinguishing both haemagglutinin (HA) and neuraminidase (NA) genes as well as their ratio. PMID:26088868

The rapid quantitation of the filamentous blue-green alga plectonema boryanum by the luciferase assay for ATP

NASA Technical Reports Server (NTRS)

Bush, V. N.

1974-01-01

Plectonema boryanum is a filamentous blue green alga. Blue green algae have a procaryotic cellular organization similar to bacteria, but are usually obligate photoautotrophs, obtaining their carbon and energy from photosynthetic mechanism similar to higher plants. This research deals with a comparison of three methods of quantitating filamentous populations: microscopic cell counts, the luciferase assay for ATP and optical density measurements.

Web-based automation of green building rating index and life cycle cost analysis

NASA Astrophysics Data System (ADS)

Shahzaib Khan, Jam; Zakaria, Rozana; Aminuddin, Eeydzah; IzieAdiana Abidin, Nur; Sahamir, Shaza Rina; Ahmad, Rosli; Nafis Abas, Darul

2018-04-01

Sudden decline in financial markets and economic meltdown has slow down adaptation and lowered interest of investors towards green certified buildings due to their higher initial costs. Similarly, it is essential to fetch investor’s attention towards more development of green buildings through automated tools for the construction projects. Though, historical dearth is found on the automation of green building rating tools that brings up an essential gap to develop an automated analog computerized programming tool. This paper present a proposed research aim to develop an integrated web-based automated analog computerized programming that applies green building rating assessment tool, green technology and life cycle cost analysis. It also emphasizes to identify variables of MyCrest and LCC to be integrated and developed in a framework then transformed into automated analog computerized programming. A mix methodology of qualitative and quantitative survey and its development portray the planned to carry MyCrest-LCC integration to an automated level. In this study, the preliminary literature review enriches better understanding of Green Building Rating Tools (GBRT) integration to LCC. The outcome of this research is a pave way for future researchers to integrate other efficient tool and parameters that contributes towards green buildings and future agendas.

Quantification of silkworm coactivator of MBF1 mRNA by SYBR Green I real-time RT-PCR reveals tissue- and stage-specific transcription levels.

PubMed

Li, Guang-li; Roy, Bhaskar; Li, Xing-hua; Yue, Wan-fu; Wu, Xiao-feng; Liu, Jian-mei; Zhang, Chuan-xi; Miao, Yun-gen

2009-05-01

Transcriptional coactivators play a crucial role in gene transcription and expression. Multiprotein bridging factor 1 (MBF1) is a transcriptional coactivator necessary for transcriptional activation caused by DNA-binding activators, such as FTZ-F1 and GCN4. Until now, very few studies have been reported in the silkworm. We selected the Bombyx mori because it is a model insect and acts as an economic animal for silk industry. In this study, we conducted the quantitative analysis of MBF1 mRNA in silkworm B. mori L. with actin (A3) as internal standard by means of SYBR Green I real-time RT-PCR method. The total RNA was extracted from the silk gland, epidermis, fat body, and midguts of the fifth instar B. mori larvae. The mRNA was reverse transcripted, and the cDNA fragments of MBF1 mRNA and actin gene were amplified by RT-PCR using specific primers. MBF1 mRNA expression in different tissues of silkworm B. mori L. was quantified using standardized SYBR Green I RT-PCR. The results suggested MBF1 gene was expressed in all investigated organs but highly expressed in the silk gland, showing its relation to biosynthesis of silk proteins.

Quantitative detection of the potato cyst nematode, Globodera pallida, and the beet cyst nematode, Heterodera schachtii, using Real-Time PCR with SYBR green I dye.

PubMed

Madani, Mehrdad; Subbotin, Sergei A; Moens, Maurice

2005-04-01

The potato cyst nematode Globodera pallida and the beet cyst nematode Heterodera schachtii are major nematode pests in world agriculture. Precise identification and knowledge about the number of nematodes in field soil are necessary to develop effective integrated pest control. Here we report the results of the Real-Time PCR assay for the rapid detection and quantification of G. pallida and H. schachtii. Using species specific primers and SYBR green I dye, we were able to detect a single second stage juvenile of cyst forming nematodes in samples. The specificity of the reaction was confirmed by the lack of amplification of DNAs from other Heterodera or Globodera species. Validation tests showed a rather high correlation between real numbers of second stage juveniles in a sample and expected numbers detected by Real-Time PCR. Reasons for observed differences in sensitivity and reliability of quantification detection for two species as well as other problems of Real-Time PCR are discussed. The Real-Time PCR assay with SYBR green I dye targeting fragments of the ITS-rDNA provided a sensitive means for the rapid and simultaneous detection and quantification of juveniles of these pests.

An iPhone-based digital image colorimeter for detecting tetracycline in milk.

PubMed

Masawat, Prinya; Harfield, Antony; Namwong, Anan

2015-10-01

An iPhone-based digital image colorimeter (DIC) was fabricated as a portable tool for monitoring tetracycline (TC) in bovine milk. An application named ColorConc was developed for the iPhone that utilizes an image matching algorithm to determine the TC concentration in a solution. The color values; red (R), green (G), blue (B), hue (H), saturation (S), brightness (V), and gray (Gr) were measured from each pictures of the TC standard solutions. TC solution extracted from milk samples using solid phase extraction (SPE) was captured and the concentration was predicted by comparing color values with those collected in a database. The amount of TC could be determined in the concentration range of 0.5-10 μg mL(-1). The proposed DIC-iPhone is able to provide a limit of detection (LOD) of 0.5 μg mL(-1) and limit of quantitation (LOQ) of 1.5 μg mL(-1). The enrichment factor was 70 and color of the extracted milk sample was a strong yellow solution after SPE. Therefore, the SPE-DIC-iPhone could be used for the assay of TC residues in milk at the concentration lower than LOD and LOQ of the proposed technique. Copyright © 2015 Elsevier Ltd. All rights reserved.

Water quality of the Fox River and four tributaries in Green Lake County, Wisconsin, 2001-2002

USGS Publications Warehouse

Graczyk, David J.; Garn, Herbert S.

2003-01-01

The purpose of this report is to summarize the water-quality data collected on the Fox River and its tributaries in Green Lake County, Wisconsin, from November 2001 through August 2002. The goals of the project were to (1) determine the current water quality of the Fox River and selected main tributaries in Green Lake County, (2) assess the spacial variation of the water-quality conditions of the main Fox River reach, and (3) build on the quantitative data base so that future monitoring can help detect and evaluate improving or declining water-quality conditions objectively.

The Green Bank Ammonia Survey of the Gould Belt

NASA Astrophysics Data System (ADS)

Friesen, Rachel; Pineda, Jaime; GAS Team

2018-01-01

The past several years have seen a tremendous advancement in our ability to characterize the structure of nearby molecular clouds traced by large-scale continuum surveys. Critical, comparable data on the dense gas kinematics and temperatures are needed to understand the history and future fate of star-forming material. Filling this gap is the Green Bank Ammonia Survey (GAS), an ambitious legacy survey for the Green Bank Telescope to observe key molecular tracers of dense gas within all Gould Belt clouds visible from the northern hemisphere. I will present the latest science from GAS, whose goals are to 1) evaluate the stability of dense gas structures as a function of scale, 2) track the dissipation of turbulence and evolution of angular momentum in filaments and cores, and 3) quantitatively test predictions of models of core and filament formation via mass flows and accretion.

Using multiple PCR and CE with chemiluminescence detection for simultaneous qualitative and quantitative analysis of genetically modified organism.

PubMed

Guo, Longhua; Qiu, Bin; Chi, Yuwu; Chen, Guonan

2008-09-01

In this paper, an ultrasensitive CE-CL detection system coupled with a novel double-on-column coaxial flow detection interface was developed for the detection of PCR products. A reliable procedure based on this system had been demonstrated for qualitative and quantitative analysis of genetically modified organism-the detection of Roundup Ready Soy (RRS) samples was presented as an example. The promoter, terminator, function and two reference genes of RRS were amplified with multiplex PCR simultaneously. After that, the multiplex PCR products were labeled with acridinium ester at the 5'-terminal through an amino modification and then analyzed by the proposed CE-CL system. Reproducibility of analysis times and peak heights for the CE-CL analysis were determined to be better than 0.91 and 3.07% (RSD, n=15), respectively, for three consecutive days. It was shown that this method could accurately and qualitatively detect RRS standards and the simulative samples. The evaluation in terms of quantitative analysis of RRS provided by this new method was confirmed by comparing our assay results with those of the standard real-time quantitative PCR (RT-QPCR) using SYBR Green I dyes. The results showed a good coherence between the two methods. This approach demonstrated the possibility for accurate qualitative and quantitative detection of GM plants in a single run.

Life-Cycle Inventory Analysis of Cellulosic Fiberboard Production in North America

Treesearch

Richard D. Bergman

2014-01-01

Documenting the environmental performance of building products is becoming widespread because of many green-marketing claims made without scientific merit (i.e., green-washing). Developing environmental product declarations (EPDs) for building products is one way to accomplish this objective for scientific documentation and to counter green-washing. EPDs are based on...

The Human Respiratory Syncytial Virus Nonstructural Protein 1 Regulates Type I and Type II Interferon Pathways*

PubMed Central

Hastie, Marcus L.; Headlam, Madeleine J.; Patel, Nirav B.; Bukreyev, Alexander A.; Buchholz, Ursula J.; Dave, Keyur A.; Norris, Emma L.; Wright, Cassandra L.; Spann, Kirsten M.; Collins, Peter L.; Gorman, Jeffrey J.

2012-01-01

Respiratory syncytial viruses encode a nonstructural protein (NS1) that interferes with type I and III interferon and other antiviral responses. Proteomic studies were conducted on human A549 type II alveolar epithelial cells and type I interferon-deficient Vero cells (African green monkey kidney cells) infected with wild-type and NS1-deficient clones of human respiratory syncytial virus to identify other potential pathway and molecular targets of NS1 interference. These analyses included two-dimensional differential gel electrophoresis and quantitative Western blotting. Surprisingly, NS1 was found to suppress the induction of manganese superoxide dismutase (SOD2) expression in A549 cells and to a much lesser degree Vero cells in response to infection. Because SOD2 is not directly inducible by type I interferons, it served as a marker to probe the impact of NS1 on signaling of other cytokines known to induce SOD2 expression and/or indirect effects of type I interferon signaling. Deductive analysis of results obtained from cell infection and cytokine stimulation studies indicated that interferon-γ signaling was a potential target of NS1, possibly as a result of modulation of STAT1 levels. However, this was not sufficient to explain the magnitude of the impact of NS1 on SOD2 induction in A549 cells. Vero cell infection experiments indicated that NS1 targeted a component of the type I interferon response that does not directly induce SOD2 expression but is required to induce another initiator of SOD2 expression. STAT2 was ruled out as a target of NS1 interference using quantitative Western blot analysis of infected A549 cells, but data were obtained to indicate that STAT1 was one of a number of potential targets of NS1. A label-free mass spectrometry-based quantitative approach is proposed as a means of more definitive identification of NS1 targets. PMID:22322095

Real-time PCR (qPCR) primer design using free online software.

PubMed

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

New GREEN Products for the Military Aviation Maintenance Community

DTIC Science & Technology

2012-05-01

Petroleum Base, for Preservation and Operation • MIL -H-19457 - Hydraulic Fluid, Fire-resistant, Non-neurotoxic • MIL -H- 81019 ...ENHANCEMENT STEWARDSHIP EXCELLENCE WORKFORCE DEVELOPMENT 14 New GREEN products (NAVAIR) MIL -PRF-85570...aircraft spot cleaners Mil -C-43616 • 6850-01-578-4978 type I • 6850-01-581-9413 type II • 6850-01-587-3779 type I

Development and validation of a SYBR Green real-time PCR assay for rapid and quantitative detection of goose interferons and proinflammatory cytokines.

PubMed

Zhou, Hao; Chen, Shun; Qi, Yulin; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Liu, Fei; Chen, Xiaoyue; Cheng, Anchun

2015-10-01

Real time quantitative polymerase chain reaction (RT-qPCR) based on SYBR-Green I binding is a quick, reliable, and easy method for analyzing small amounts of mRNA. Viral pathogens are recognized at the time of infection by pattern recognition receptors; thus, the inflammatory cytokines (IL1β, IL6, and IL18) and antiviral cytokines (IFNα, IFNγ) are secreted by innate immune cells and induced to respond to the pathogens. The objective of this study was to develop an effective and sensitive RT-qPCR assay for the rapid and accurate quantification of goose cytokines: IFNα, IFNγ, IL1β, IL6, and IL18. Subsequently, the established methods were employed to detect the immune response in agonist-stimulated goose spleen cells in vitro. These data indicated that the established RT-qPCR is a reliable method for determining relative gene expression. The results revealed that Imiquimod led to the significant upregulation of goose IFNα (P < 0.01), IFNγ (P < 0.01), IL1β (P < 0.01), IL6 (P < 0.01), and IL18 (P < 0.05). The established methods are important for scientific research and clinical applications, which require rapid and accurate results in a short period of time. The technique can potentially be used in the further research of goose molecular immunology, which will help us understand the interactions between hosts and pathogens. © 2015 Poultry Science Association Inc.

Premium cost optimization of operational and maintenance of green building in Indonesia using life cycle assessment method

NASA Astrophysics Data System (ADS)

Latief, Yusuf; Berawi, Mohammed Ali; Basten, Van; Budiman, Rachmat; Riswanto

2017-06-01

Building has a big impact on the environmental developments. There are three general motives in building, namely the economy, society, and environment. Total completed building construction in Indonesia increased by 116% during 2009 to 2011. It made the energy consumption increased by 11% within the last three years. In fact, 70% of energy consumption is used for electricity needs on commercial buildings which leads to an increase of greenhouse gas emissions by 25%. Green Building cycle costs is known as highly building upfront cost in Indonesia. The purpose of optimization in this research improves building performance with some of green concept alternatives. Research methodology is mixed method of qualitative and quantitative approaches through questionnaire surveys and case study. Assessing the successful of optimization functions in the existing green building is based on the operational and maintenance phase with the Life Cycle Assessment Method. Choosing optimization results were based on the largest efficiency of building life cycle and the most effective cost to refund.

GaN-based photon-recycling green light-emitting diodes with vertical-conduction structure.

PubMed

Sheu, Jinn-Kong; Chen, Fu-Bang; Yen, Wei-Yu; Wang, Yen-Chin; Liu, Chun-Nan; Yeh, Yu-Hsiang; Lee, Ming-Lun

2015-04-06

A p-i-n structure with near-UV(n-UV) emitting InGaN/GaN multiple quantum well(MQW) structure stacked on a green unipolar InGaN/GaN MQW was epitaxially grown at the same sapphire substrate. Photon recycling green light-emitting diodes(LEDs) with vertical-conduction feature on silicon substrates were then fabricated by wafer bonding and laser lift-off techniques. The green InGaN/GaN QWs were pumped with n-UV light to reemit low-energy photons when the LEDs were electrically driven with a forward current. Efficiency droop is potentially insignificant compared with the direct green LEDs due to the increase of effective volume of active layer in the optically pumped green LEDs, i.e., light emitting no longer limited in the QWs nearest to the p-type region to cause severe Auger recombination and carrier overflow losses.

Portable microwave assisted extraction: An original concept for green analytical chemistry.

PubMed

Perino, Sandrine; Petitcolas, Emmanuel; de la Guardia, Miguel; Chemat, Farid

2013-11-08

This paper describes a portable microwave assisted extraction apparatus (PMAE) for extraction of bioactive compounds especially essential oils and aromas directly in a crop or in a forest. The developed procedure, based on the concept of green analytical chemistry, is appropriate to obtain direct in-field information about the level of essential oils in natural samples and to illustrate green chemical lesson and research. The efficiency of this experiment was validated for the extraction of essential oil of rosemary directly in a crop and allows obtaining a quantitative information on the content of essential oil, which was similar to that obtained by conventional methods in the laboratory. Copyright © 2013 Elsevier B.V. All rights reserved.

Functional Use Change in Green Spaces: A Case Study of Kirklareli Province

NASA Astrophysics Data System (ADS)

Sat Gungor, Beyza; Culha Ozanguc, Kadiriye

2017-10-01

Green spaces which are one of the most important public spaces in urban design have an important role on qualified daily urban life. People escape from intense work pressure and traffic jam of metropoles to those urban green areas to take a breath even they cover a small size. In time, people’s expectations from green spaces as functional and quantitative needs are changing. This change occurs due to increasing population and as the character of the urban life. This study examines the functional use and quantitative change of urban green spaces of Kırklareli Province from past to present. Kırklareli is a border city to Bulgaria which is located in north-west part of Turkey and this gives a transitional and a multicultural character to the city. The population is about 67360. In the course of time; green space needs have increased by the increasing population. In addition to this, green spaces’ functional use change has been identified. According to the results of the study; from the aspect of the green space standards, Kırklareli found above standards with 17.5 m2 per capita, but on the other hand, sport and playground areas found insufficient. The Oldest and the newest city plans of Kırklareli (1940s and 2012s cadastral plans) have been compared and site surveys implemented as the methodology. In site survey, current green spaces’ functional uses as sport or playground are observed and determined and also current quantitative measure of the green spaces are verified. Urban green spaces in Kırklareli Province evaluated through considering world’s most populated urban green space standards and Turkey’s standards. This study utilizes to compose a substructure of the urban green space. Determined deficiencies and inadequacies of green spaces and functional needs in this study, can guide to further studies and implementations of Kırklareli Municipality.

Comparison of nine different real-time PCR chemistries for qualitative and quantitative applications in GMO detection.

PubMed

Buh Gasparic, Meti; Tengs, Torstein; La Paz, Jose Luis; Holst-Jensen, Arne; Pla, Maria; Esteve, Teresa; Zel, Jana; Gruden, Kristina

2010-03-01

Several techniques have been developed for detection and quantification of genetically modified organisms, but quantitative real-time PCR is by far the most popular approach. Among the most commonly used real-time PCR chemistries are TaqMan probes and SYBR green, but many other detection chemistries have also been developed. Because their performance has never been compared systematically, here we present an extensive evaluation of some promising chemistries: sequence-unspecific DNA labeling dyes (SYBR green), primer-based technologies (AmpliFluor, Plexor, Lux primers), and techniques involving double-labeled probes, comprising hybridization (molecular beacon) and hydrolysis (TaqMan, CPT, LNA, and MGB) probes, based on recently published experimental data. For each of the detection chemistries assays were included targeting selected loci. Real-time PCR chemistries were subsequently compared for their efficiency in PCR amplification and limits of detection and quantification. The overall applicability of the chemistries was evaluated, adding practicability and cost issues to the performance characteristics. None of the chemistries seemed to be significantly better than any other, but certain features favor LNA and MGB technology as good alternatives to TaqMan in quantification assays. SYBR green and molecular beacon assays can perform equally well but may need more optimization prior to use.

Rapid prediction of single green coffee bean moisture and lipid content by hyperspectral imaging.

PubMed

Caporaso, Nicola; Whitworth, Martin B; Grebby, Stephen; Fisk, Ian D

2018-06-01

Hyperspectral imaging (1000-2500 nm) was used for rapid prediction of moisture and total lipid content in intact green coffee beans on a single bean basis. Arabica and Robusta samples from several growing locations were scanned using a "push-broom" system. Hypercubes were segmented to select single beans, and average spectra were measured for each bean. Partial Least Squares regression was used to build quantitative prediction models on single beans (n = 320-350). The models exhibited good performance and acceptable prediction errors of ∼0.28% for moisture and ∼0.89% for lipids. This study represents the first time that HSI-based quantitative prediction models have been developed for coffee, and specifically green coffee beans. In addition, this is the first attempt to build such models using single intact coffee beans. The composition variability between beans was studied, and fat and moisture distribution were visualized within individual coffee beans. This rapid, non-destructive approach could have important applications for research laboratories, breeding programmes, and for rapid screening for industry.

Imaging of pharmacokinetic rates of indocyanine green in mouse liver with a hybrid fluorescence molecular tomography/x-ray computed tomography system.

PubMed

Zhang, Guanglei; Liu, Fei; Zhang, Bin; He, Yun; Luo, Jianwen; Bai, Jing

2013-04-01

Pharmacokinetic rates have the potential to provide quantitative physiological and pathological information for biological studies and drug development. Fluorescence molecular tomography (FMT) is an attractive imaging tool for three-dimensionally resolving fluorophore distribution in small animals. In this letter, pharmacokinetic rates of indocyanine green (ICG) in mouse liver are imaged with a hybrid FMT and x-ray computed tomography (XCT) system. A recently developed FMT method using structural priors from an XCT system is adopted to improve the quality of FMT reconstruction. In the in vivo experiments, images of uptake and excretion rates of ICG in mouse liver are obtained, which can be used to quantitatively evaluate liver function. The accuracy of the results is validated by a fiber-based fluorescence measurement system.

Green initiative impact on stock prices: A quantitative study of the clean energy industry

NASA Astrophysics Data System (ADS)

Jurisich, John M.

The purpose of this quantitative ex post facto research study was to explore the relationship between green initiative expense disclosures and stock prices of 46 NASDAQ listed Clean Edge Green Energy global companies from 2007 to 2010. The independent variables were sales and marketing, environmental, customer and supplier, community, and corporate governance practices that were correlated with the dependent variable in the study of stock prices. Expense disclosures were examined in an effort to measure the impact of green initiative programs and to expose the interrelationships between green initiative expense disclosures and fluctuations of stock prices. The data for the research was secondary data from existing annual reports. A statistically significant relationship was revealed between environmental practices and changes in stock prices. The study results also provided substantial evidence for leadership and managerial decision making to reduce or increase green initiative practices to maximize shareholder wealth of their respective organizations.

Comparative recreational assessment of Karaganda city public green spaces

NASA Astrophysics Data System (ADS)

Akylbekova, I. S.; Zengina, T. Yu

2018-01-01

This article represents evaluation of recreation environment on the territory of the large industrial city of Karaganda, located in the dry steppe zone of Central Kazakhstan. A comparison of quantitative and qualitative indicators, level of recreational attractiveness and providing the citizens with public green spaces, allowed to make a more complete characterization the urban recreation places and to identify the city districts, which require prioritized fundraising for development of existing parks and public gardens, and for creation of new territories of recreational purpose. Based on the results of conducted expert assessment and sociological survey of visitors, the main problems of urban green areas were identified and also the most high-demand trends and practical recommendations for their improvement and further use were proposed.

Rapid and Specific Method for Evaluating Streptomyces Competitive Dynamics in Complex Soil Communities

USDA-ARS?s Scientific Manuscript database

Quantifying target microbial populations in complex communities remains a barrier to studying species interactions in soil environments. Quantitative real-time PCR (qPCR) offers a rapid and specific means to assess populations of target microorganisms. SYBR Green and TaqMan-based qPCR assays were de...

Quantitative analysis and comparative study of four cities green pattern in API system on the background of big data

NASA Astrophysics Data System (ADS)

Xin, YANG; Si-qi, WU; Qi, ZHANG

2018-05-01

Beijing, London, Paris, New York are typical cities in the world, so comparative study of four cities green pattern is very important to find out gap and advantage and to learn from each other. The paper will provide basis and new ideas for development of metropolises in China. On the background of big data, API (Application Programming Interface) system can provide extensive and accurate basic data to study urban green pattern in different geographical environment in domestic and foreign. On the basis of this, Average nearest neighbor tool, Kernel density tool and Standard Ellipse tool in ArcGIS platform can process and summarize data and realize quantitative analysis of green pattern. The paper summarized uniqueness of four cities green pattern and reasons of formation on basis of numerical comparison.

Environmental Management Competitive Pressure Effect on SME Environmental Innovation Activities: A Green Supply Chain Perspective

NASA Astrophysics Data System (ADS)

Rashid, A. A.; Sidek, A. A.; Suffian, S. A.; Daud, M. R. C.

2018-01-01

The idea of assimilating green supply chain is to integrate and establish environmental management into the supply chain practices. The study aims to explore how environmental management competitive pressure influences a SME company in Malaysia to incorporate green supply chain integration, which is an efficient platform to develop environmental innovation. This study further advances green supply chain management research in Malaysia by using the method of quantitative analysis to analyze the model developed which data will be collected based on a sample of SMEs in Malaysia in manufacturing sector. The model developed in this study illustrates how environmental management competitive pressure from main competitors affects three fundamental dimensions of green supply chain integration. The research findings suggest that environmental management competitive pressure is a vital driving force for a SME company to incorporate internal and external collaboration in developing green product innovation. From the analysis conducted, the study strongly demonstrated that the best way for a company to counteract competitor’s environmental management success is to first implement strong internal green product development process then move to incorporate external environmental management innovation between their suppliers and customers. The findings also show that internal integration of green product innovation fully mediates the relationship of environmental management competitive pressure and the external integration of green product innovation.

Urban green valuation integrating biophysical and qualitative aspects.

PubMed

Lang, Stefan

2018-01-01

Urban green mapping has become an operational task in city planning, urban land management, and quality of life assessments. As a multi-dimensional, integrative concept, urban green comprising several ecological, socio-economic, and policy-related aspects. In this paper, the author advances the representation of urban green by deriving scale-adapted, policy-relevant units. These so-called geons represent areas of uniform green valuation under certain size and homogeneity constraints in a spatially explicit representation. The study accompanies a regular monitoring scheme carried out by the urban municipality of the city of Salzburg, Austria, using optical satellite data. It was conducted in two stages, namely SBG_QB (10.2 km², QuickBird data from 2005) and SBG_WV (140 km², WorldView-2 data from 2010), within the functional urban area of Salzburg. The geon delineation was validated by several quantitative measures and spatial analysis techniques, as well as ground documentation, including panorama photographs and visual interpretation. The spatial association pattern was assessed by calculating Global Moran's I with incremental search distances. The final geonscape, consisting of 1083 units with an average size of 13.5 ha, was analyzed by spatial metrics. Finally, categories were derived for different types of functional geons. Future research paths and improvements to the described strategy are outlined.

Characterization of Essential Oil Composition in Different Basil Species and Pot Cultures by a GC-MS Method.

PubMed

Muráriková, Andrea; Ťažký, Anton; Neugebauerová, Jarmila; Planková, Alexandra; Jampílek, Josef; Mučaji, Pavel; Mikuš, Peter

2017-07-20

Basil ( Ocimum L.) species are used as medicinal plants due to their essential oils exhibiting specific biological activity. The present work demonstrated that both the variety and season/conditions of cultivation had a significant effect on (i) the produced amount (extraction yield), (ii) qualitative, as well as (iii) quantitative profile of basil essential oil. Among studied basil varieties, a new variety, 'Mánes', was characterized for the first time. Based on our quantitative evaluation of GC-MS profiles, the following chemotypes and average concentrations of a main component were detected in the studied basil varieties: 'Ohře', 'Lettuce Leaf', 'Purple Opaal', 'Dark Green' (linalool, 5.99, 2.49, 2.34, 2.01 mg/mL, respectively), and 'Mammolo Genovese', 'Mánes', 'Red Rubin' (eucalyptol, 1.34, 0.96, 0.76 mg/mL, respectively). At the same time, when considering other compounds identified in GC-MS profiles, all the studied varieties, except from 'Lettuce Leaf', were methyl eugenol-rich with a strong dependence of the eugenol:methyl eugenol ratio on the seasonal changes (mainly solar irradiation, but also temperature and relative humidity). More complex and/or variable (depending on the season and cultivation) chemotypes were observed with 'Lettuce Leaf' (plus estragole, 2.27 mg/mL), 'Dark Green' (plus eucalyptol, 1.36 mg/mL), 'Mammolo Genovese' (plus eugenol, 1.19 mg/mL), 'Red Rubin' (plus linalool and eugenol, 0.46 and 0.56 mg/mL, respectively), and 'Mánes' (plus linalool and eugenol, 0.58 and 0.40 mg/mL, respectively). When considering superior extraction yield (ca. 17 mL·kg -1 , i.e., two to five times higher than other examined varieties) and consistent amounts (yields) of essential oil when comparing inter-seasonal or inter-year data (RSD and inter-year difference in mean yield values ˂2.5%), this new basil variety is very promising for use in the pharmaceutical, food, and cosmetic industries.

Development of SYBR Green I Based Real-Time RT-PCR Assay for Specific Detection of Watermelon silver mottle Virus.

PubMed

Rao, Xueqin; Sun, Jie

2015-09-01

Watermelon silver mottle virus (WSMoV), which belongs to the genus Tospovirus , causes significant loss in Cucurbitaceae plants. Development of a highly sensitive and reliable detection method for WSMoV. Recombinant plasmids for targeting the sequence of nucleocapsid protein gene of WSMoV were constructed. SYBR Green I real-time PCR was established and evaluated with standard recombinant plasmids and 27 watermelon samples showing WSMoV infection symptoms. The recombinant plasmid was used as template for SYBR Green I real-time PCR to generate standard and melting curves. Melting curve analysis indicated no primer-dimers and non-specific products in the assay. No cross-reaction was observed with Capsicum chlorosis virus (genus Tospovirus ) and Cucumber mosaic virus (genus Cucumovirus). Repeatability tests indicated that inter-assay variability of the Ct values was 1.6%. A highly sensitive, reliable and rapid detection method of SYBR Green I real-time PCR for timely detection of WSMoV plants and vector thrips was established, which will facilitate disease forecast and control.

A modern robust approach to remotely estimate chlorophyll in coastal and inland zones

NASA Astrophysics Data System (ADS)

Shanmugam, Palanisamy; He, Xianqiang; Singh, Rakesh Kumar; Varunan, Theenathayalan

2018-05-01

The chlorophyll concentration of a water body is an important proxy for representing the phytoplankton biomass. Its estimation from multi or hyper-spectral remote sensing data in natural waters is generally achieved by using (i) the waveband ratioing in two or more bands in the blue-green or (ii) by using a combination of the radiance peak position and magnitude in the red-near-infrared (NIR) spectrum. The blue-green ratio algorithms have been extensively used with satellite ocean color data to investigate chlorophyll distributions in open ocean and clear waters and the application of red-NIR algorithms is often restricted to turbid productive water bodies. These issues present the greatest obstacles to our ability to formulate a modern robust method suitable for quantitative assessments of the chlorophyll concentration in a diverse range of water types. The present study is focused to investigate the normalized water-leaving radiance spectra in the visible and NIR region and propose a robust algorithm (Generalized ABI, GABI algorithm) for chlorophyll concentration retrieval based on Algal Bloom index (ABI) which separates phytoplankton signals from other constituents in the water column. The GABI algorithm is validated using independent in-situ data from various regional to global waters and its performance is further evaluated by comparison with the blue-green waveband ratios and red-NIR algorithms. The results revealed that GABI yields significantly more accurate chlorophyll concentrations (with uncertainties less than 13.5%) and remains more stable in different waters types when compared with the blue-green waveband ratios and red-NIR algorithms. The performance of GABI is further demonstrated using HICO images from nearshore turbid productive waters and MERIS and MODIS-Aqua images from coastal and offshore waters of the Arabian Sea, Bay of Bengal and East China Sea.

A Novel Strategy for Human Papillomavirus Detection and Genotyping with SybrGreen and Molecular Beacon Polymerase Chain Reaction

PubMed Central

Szuhai, Károly; Sandhaus, Emily; Kolkman-Uljee, Sandra M.; Lemaître, Marc; Truffert, Jean-Christophe; Dirks, Roeland W.; Tanke, Hans J.; Fleuren, Gert Jan; Schuuring, Ed; Raap, Anton K.

2001-01-01

Human papillomaviruses (HPVs) play an important role in the pathogenesis of cervical cancer. For identification of the large number of different HPV types found in (pre)malignant lesions, a robust methodology is needed that combines general HPV detection with HPV genotyping. We have developed for formaldehyde-fixed samples a strategy that, in a homogenous, real-time fluorescence polymerase chain reaction (PCR)-based assay, accomplishes general HPV detection by SybrGreen reporting of HPV-DNA amplicons, and genotyping of seven prevalent HPV types (HPV-6, -11, -16, -18, -31, -33, -45) by real-time molecular beacon PCR. The false-positive rate of the HPV SybrGreen-PCR was 4%, making it well suited as a prescreening, general HPV detection technology. The type specificity of the seven selected HPV molecular beacons was 100% and double infections were readily identified. The multiplexing capacity of the HPV molecular beacon PCR was analyzed and up to three differently labeled molecular beacons could be used in one PCR reaction without observing cross talk. The inherent quantitation capacities of real-time fluorescence PCR allowed the determination of average HPV copy number per cell. We conclude that the HPV SybrGreen-PCR in combination with the HPV molecular beacon PCR provides a robust, sensitive, and quantitative general HPV detection and genotyping methodology. PMID:11696426

Pressurized hot water extraction followed by miniaturized membrane assisted solvent extraction for the green analysis of alkylphenols in sediments.

PubMed

Salgueiro-González, N; Turnes-Carou, I; Muniategui-Lorenzo, S; López-Mahía, P; Prada-Rodríguez, D

2015-02-27

A novel and Green analytical methodology for the determination of alkylphenols (4-tert-octylphenol, 4-n-octylphenol, 4-n-nonylphenol, nonylphenol) in sediments was developed and validated. The method was based on pressurized hot water extraction (PHWE) followed by miniaturized membrane assisted solvent extraction (MASE) and liquid chromatography-electrospray ionization tandem mass spectrometry detection (LC-ESI-MS/MS). The extraction conditions were optimized by a Plackett-Burman design in order to minimize the number of assays according to Green principles. Matrix effect was studied and compensated using deuterated labeled standards as surrogate standards for the quantitation of the target compounds. The analytical features of the method were satisfactory: relative recoveries varied between 92 and 103% and repeatability and intermediate precision were <9% for all compounds. Quantitation limits of the method (MQL) ranged from 0.061 (4-n-nonylphenol) to 1.7ngg(-1) dry weight (nonylphenol). Sensitivity, selectivity, automaticity and fastness are the main advantages of the exposed methodology. Reagent consumption, analysis time and waste generation were minimized. The "greenness" of the proposed method was evaluated using an analytical Eco-Scale approach and satisfactory results were obtained. The applicability of the proposed method was demonstrated analysing sediment samples of Galicia coast (NW of Spain) and the ubiquity of alkylphenols in the environment was demonstrated. Copyright © 2015 Elsevier B.V. All rights reserved.

Development and evaluation of a quantitative PCR assay for detection of Hepatozoon sp.

PubMed

Criado-Fornelio, A; Buling, A; Cunha-Filho, N A; Ruas, J L; Farias, N A R; Rey-Valeiron, C; Pingret, J L; Etievant, M; Barba-Carretero, J C

2007-12-25

With the aim to improve current molecular diagnostic techniques of Hepatozoon sp. in carnivore mammals, we developed a quantitative PCR (qPCR) assay with SYBR Green I((R)). The method, consisting of amplification of a 235bp fragment of the 18S rRNA gene, is able to detect at least 0.1fg of parasite DNA. Reproducible quantitative results were obtained over a range of 0.1ng-0.1fg of Hepatozoon sp. DNA. To assess the performance of the qPCR assay, DNA samples from dogs (140) and cats (50) were tested with either standard PCR or qPCR. Positive samples were always confirmed by partial sequencing of the 18S rRNA gene. Quantitative PCR was 15.8% more sensitive than standard PCR to detect H. canis in dogs. In cats, no infections were detected by standard PCR, compared to two positives by qPCR (which were infected by H. canis as shown by sequencing).

Pathological and immunological responses associated with differential survival of Chinook salmon following Renibacterium salmoninarum challenge

USGS Publications Warehouse

Metzger, David C.; Elliott, Diane G.; Wargo, Andrew; Park, Linda K.; Purcell, Maureen K.

2010-01-01

Chinook salmon Oncorhynchus tshawytscha are highly susceptible to Renibacterium salmoninarum, the causative agent of bacterial kidney disease (BKD). Previously we demonstrated that introduced Chinook salmon from Lake Michigan, Wisconsin (WI), USA, have higher survival following R. salmoninarum challenge relative to the progenitor stock from Green River, Washington, USA. In the present study, we investigated the pathological and immunological responses that are associated with differential survival in the 2 Chinook salmon stocks following intra-peritoneal R. salmoninarum challenge of 2 different cohort years (2003 and 2005). Histological evaluation revealed delayed appearance of severe granulomatous lesions in the kidney and lower overall prevalence of membranous glomerulopathy in the higher surviving WI stock. The higher survival WI stock had a lower bacterial load at 28 d post-infection, as measured by reverse-transcriptase quantitative polymerase chain reaction (RT-qPCR). However, at all other time points, bacterial load levels were similar despite higher mortality in the more susceptible Green River stock, suggesting the possibility that the stocks may differ in their tolerance to infection by the bacterium. Interferon-γ, inducible nitric oxide synthase (iNOS), Mx-1, and transferrin gene expression were up-regulated in both stocks following challenge. A trend of higher iNOS gene expression at later time points (≥28 d post-infection) was observed in the lower surviving Green River stock, suggesting the possibility that higher iNOS expression may contribute to greater pathology in that stock.

Development of a duplex ddPCR assay for detection of “Candidatus Liberibacter asiaticus”

USDA-ARS?s Scientific Manuscript database

Huanglongbing (HLB) (aka citrus greening) is a devastating citrus disease associated with “Candidatus Liberibacter asiaticus” (CLas). Currently, diagnosis of CLas in regulatory samples is based on a real-time quantitative polymerase chain reaction (qPCR) assay using 16S rRNA gene specific primers/pr...

A GIS-BASED METHOD FOR MULTI-OBJECTIVE EVALUATION OF PARK VEGETATION. (R824766)

EPA Science Inventory

Abstract

In this paper we describe a method for evaluating the concordance between a set of mapped landscape attributes and a set of quantitatively expressed management priorities. The method has proved to be useful in planning urban green areas, allowing objectively d...

Single-Cell Based Quantitative Assay of Chromosome Transmission Fidelity

PubMed Central

Zhu, Jin; Heinecke, Dominic; Mulla, Wahid A.; Bradford, William D.; Rubinstein, Boris; Box, Andrew; Haug, Jeffrey S.; Li, Rong

2015-01-01

Errors in mitosis are a primary cause of chromosome instability (CIN), generating aneuploid progeny cells. Whereas a variety of factors can influence CIN, under most conditions mitotic errors are rare events that have been difficult to measure accurately. Here we report a green fluorescent protein−based quantitative chromosome transmission fidelity (qCTF) assay in budding yeast that allows sensitive and quantitative detection of CIN and can be easily adapted to high-throughput analysis. Using the qCTF assay, we performed genome-wide quantitative profiling of genes that affect CIN in a dosage-dependent manner and identified genes that elevate CIN when either increased (icCIN) or decreased in copy number (dcCIN). Unexpectedly, qCTF screening also revealed genes whose change in copy number quantitatively suppress CIN, suggesting that the basal error rate of the wild-type genome is not minimized, but rather, may have evolved toward an optimal level that balances both stability and low-level karyotype variation for evolutionary adaptation. PMID:25823586

Single-Cell Based Quantitative Assay of Chromosome Transmission Fidelity.

PubMed

Zhu, Jin; Heinecke, Dominic; Mulla, Wahid A; Bradford, William D; Rubinstein, Boris; Box, Andrew; Haug, Jeffrey S; Li, Rong

2015-03-30

Errors in mitosis are a primary cause of chromosome instability (CIN), generating aneuploid progeny cells. Whereas a variety of factors can influence CIN, under most conditions mitotic errors are rare events that have been difficult to measure accurately. Here we report a green fluorescent protein-based quantitative chromosome transmission fidelity (qCTF) assay in budding yeast that allows sensitive and quantitative detection of CIN and can be easily adapted to high-throughput analysis. Using the qCTF assay, we performed genome-wide quantitative profiling of genes that affect CIN in a dosage-dependent manner and identified genes that elevate CIN when either increased (icCIN) or decreased in copy number (dcCIN). Unexpectedly, qCTF screening also revealed genes whose change in copy number quantitatively suppress CIN, suggesting that the basal error rate of the wild-type genome is not minimized, but rather, may have evolved toward an optimal level that balances both stability and low-level karyotype variation for evolutionary adaptation. Copyright © 2015 Zhu et al.

Effects of Green Tea Gargling on the Prevention of Influenza Infection: An Analysis Using Bayesian Approaches.

PubMed

Ide, Kazuki; Kawasaki, Yohei; Akutagawa, Maiko; Yamada, Hiroshi

2017-02-01

The aim of this study is to analyze the data obtained from a randomized trial on the prevention of influenza by gargling with green tea, which gave nonsignificant results based on frequentist approaches, by using Bayesian approaches. The posterior proportion, with 95% credible interval (CrI), of influenza in each group was calculated. The Bayesian index θ is the probability that a hypothesis is true. In this case, θ is the probability that the hypothesis that green tea gargling reduced influenza compared with water gargling is true. Univariate and multivariate logistic regression analyses were also performed by using the Markov chain Monte Carlo method. The full analysis set included 747 participants. During the study period, influenza occurred in 44 participants (5.9%). The difference between the two independent binominal proportions was -0.019 (95% CrI, -0.054 to 0.015; θ = 0.87). The partial regression coefficients in the univariate analysis were -0.35 (95% CrI, -1.00 to 0.24) with use of a uniform prior and -0.34 (95% CrI, -0.96 to 0.27) with use of a Jeffreys prior. In the multivariate analysis, the values were -0.37 (95% CrI, -0.96 to 0.30) and -0.36 (95% CrI, -1.03 to 0.21), respectively. The difference between the two independent binominal proportions was less than 0, and θ was greater than 0.85. Therefore, green tea gargling may slightly reduce influenza compared with water gargling. This analysis suggests that green tea gargling can be an additional preventive measure for use with other pharmaceutical and nonpharmaceutical measures and indicates the need for additional studies to confirm the effect of green tea gargling.

A Dual-Color Reporter Assay of Cohesin-Mediated Gene Regulation in Budding Yeast Meiosis.

PubMed

Fan, Jinbo; Jin, Hui; Yu, Hong-Guo

2017-01-01

In this chapter, we describe a quantitative fluorescence-based assay of gene expression using the ratio of the reporter green fluorescence protein (GFP) to the internal red fluorescence protein (RFP) control. With this dual-color heterologous reporter assay, we have revealed cohesin-regulated genes and discovered a cis-acting DNA element, the Ty1-LTR, which interacts with cohesin and regulates gene expression during yeast meiosis. The method described here provides an effective cytological approach for quantitative analysis of global gene expression in budding yeast meiosis.

The green hemoproteins of bovine erythrocytes. II. Spectral, ligand-binding, and electrochemical properties.

PubMed

DeFilippi, L J; Hultquist, D E

1978-05-10

The two green hemoproteins isolated from bovine erythrocytes (form I and form II) have been characterized as to spectral, electrochemical, and chemical properties. The absorption spectra of the isolated hemoproteins are typical of high spin ferric states. Reduction of the hemoproteins yields high spin ferrohemoproteins. Complexation of the ferrohemoproteins with CO and the ferrihemoproteins with cyanide yields low spin complexes, demonstrating the presence of an exchangeable weak field ligand in both the ferrous and ferric states of the hemoproteins. The differences in position and intensity of the absorption peaks of the visible spectra allow the two forms to be distinguished from one another. The midpoint potential of forms I and II were found to be +0.075 and +0.019 V, respectively, at pH 6.4 and +0.038 and -0.005 V, respectively, at pH 7.0. This is consistent with the gaining of 1 proton/electron during the reduction. The Nernst plot reveals an unusual 0.5-electron transfer, whereas a quantitative titration demonstrates a 1-electron transfer. Form I binds cyanide more tightly than form II (KD of 84 and 252 micrometer, respectively). The observed spectral, electrochemical, and ligand-binding differences between forms I and II can be explained in terms of a greater electron-withdrawing ability of the side chains of the heme of form I relative to the heme of form II.

O'odham I:waki. Wild Greens of the Desert People. Sourcebook.

ERIC Educational Resources Information Center

Meals for Millions/Freedom from Hunger Foundation, Tucson, AZ.

I:waki are what the O'odham (Papago and Pima People) call young green leafy plants that they eat as cooked "greens" and serve as an important part of the traditional Papago diet. Sketches of five different kinds of i:waki are presented in the booklet to help identify the "greens." Names of each of the "greens" are…

NMR Confirmation and HPLC Quantification of Javamide-I and Javamide-II in Green Coffee Extract Products Available in the Market.

PubMed

Park, Jae B

2017-01-01

Javamide-I/javamide-II are phenolic amides found in coffee. Recent reports suggested that they may contain several biological activities related to human health. Therefore, there is emergent interest about their quantities in coffee-related products. Green coffee extract is a powder extract made of unroasted green coffee beans, available as a dietary supplement. However, there is little information about the amounts of javamide-I/javamide-II in green coffee extract products in the market. Therefore, in this paper, javamide-I/javamide-II were extracted from green coffee extract products and their identifications were confirmed by NMR. After that, the amounts of javamide-I/javamide-II were individually quantified from seven different green coffee extract samples using the HPLC method coupled to an electrochemical detector. The HPLC method provided accurate and reliable measurement of javamide-I/javamide-II with excellent peak resolution and low detection limit. In all seven green coffee extract samples, javamide-II was found to be between 0.28 and 2.96 mg/g, but javamide-I was detected in only five samples in the concentration levels of 0.15-0.52 mg/g, suggesting that green coffee extract products contain different amounts of javamide-I/javamide-II. In summary, javamide-I/javamide-II can be found in green coffee extract products sold in the market, but their amounts are likely to be comparatively different in between green coffee extract brands.

Basic versus applied research: Julius Sachs (1832-1897) and the experimental physiology of plants.

PubMed

Kutschera, Ulrich

2015-01-01

The German biologist Julius Sachs was the first to introduce controlled, accurate, quantitative experimentation into the botanical sciences, and is regarded as the founder of modern plant physiology. His seminal monograph Experimental-Physiologie der Pflanzen (Experimental Physiology of Plants) was published 150 y ago (1865), when Sachs was employed as a lecturer at the Agricultural Academy in Poppelsdorf/Bonn (now part of the University). This book marks the beginning of a new era of basic and applied plant science. In this contribution, I summarize the achievements of Sachs and outline his lasting legacy. In addition, I show that Sachs was one of the first biologists who integrated bacteria, which he considered to be descendants of fungi, into the botanical sciences and discussed their interaction with land plants (degradation of wood etc.). This "plant-microbe-view" of green organisms was extended and elaborated by the laboratory botanist Wilhelm Pfeffer (1845-1920), so that the term "Sachs-Pfeffer-Principle of Experimental Plant Research" appears to be appropriate to characterize this novel way of performing scientific studies on green, photoautotrophic organisms (embryophytes, algae, cyanobacteria).

Are green caterers more likely to serve healthy meals than non-green caterers? Results from a quantitative study in Danish worksite catering.

PubMed

Mikkelsen, Be; Bruselius-Jensen, M; Andersen, Js; Lassen, A

2006-10-01

The present study aimed to investigate whether organic conversion in catering has positive effects on the nutritional quality of menus offered. The methodology was based on a self-administered questionnaire. The self-declared priority given to the use of organic foods was measured as the basis for assigning catering managers to one of two groups: 'green' or 'non-green' caterers. These groups were then compared with regard to the relative nutritional quality of the menu options offered to customers. The study was carried out among randomly selected Danish worksite catering outlets. The subjects participating in the study comprised 526 Danish worksite catering managers. The results showed a strong correlation between caterers' 'green-ness' and the nutritional quality of the menu options offered. Green caters had more healthy options in their menus than non-green caters, which is likely to result in improved nutritional quality of the diets of end consumers. The reason for this may partly be the increased service training efforts that green caterers practise in order to be able to implement organic foods successfully. It may also be associated with the fact that the price premiums and availability of the organic products forces caterers to serve menus with higher amounts of root and non-green leafy vegetables, pulses and seasonal vegetables. The present findings suggest that organic conversion of public canteens may be a good opportunity to promote healthier eating in public catering.

Identification of aster yellows phytoplasma in garlic and green onion by PCR-based methods.

PubMed

Khadhair, A H; Evans, I R; Choban, B

2002-01-01

In the summer of 1999, typical yellows-type symptoms were observed on garlic and green onion plants in a number of gardens and plots around Edmonton, Alberta, Canada. DNA was extracted from leaf tissues of evidently healthy and infected plants. DNA amplifications were conducted on these samples, using two primer pairs, R16F2n/R2 and R16(1)F1/R1, derived from phytoplasma rDNA sequences. DNA samples of aster yellows (AY), lime witches'-broom (LWB) and potato witches'-broom (PWB) phytoplasmas served as controls and were used to determine group relatedness. In a direct polymerase chain reaction (PCR) assay, DNA amplification with universal primer pair R16F2n/R2 gave the expected amplified products of 1.2 kb. Dilution (1/40) of each of the latter products were used as template and nested with specific primer pair R16(1)F1/R1. An expected PCR product of 1.1 kb was obtained from each phytoplasma-infected garlic and green onion samples, LWB and AY phytoplasmas but not from PWB phytoplasma. An aliquot from each amplification product (1.2 kb) with universal primers was subjected to PCR-based restriction fragment length polymorphism (RFLP) to identify phytoplasma isolates, using four restriction endonucleases (AluI, KpnI, MseI and RsaI). DNA amplification with specific primer pair R16(1)F1/R1 and RFLP analysis indicated the presence of AY phytoplasma in the infected garlic and green onion samples. These results suggest that AY phytoplasma in garlic and green onion samples belong to the subgroup 16Sr1-A.

Integrative Review of the Intersection of Green Space and Neighborhood Violence.

PubMed

Mancus, Gibran C; Campbell, Jacquelyn

2018-03-01

To systematically analyze evidence about the impact of green space on the perception and actual safety of residents of urban neighborhoods. Systematic review of green space and violence based on Broome review criteria. One landmark study prompted the initial hand search and identification of search terms. Twenty-three quantitative, five qualitative, and two mixed-methods studies were found in the urban planning, public health, medical, and psychological literature that met the following criteria: analyzed green space and violence as factors in the perception of safety as an outcome measure, including action taken by being outside for recreation, exercise, or self-report in the survey. Findings were inconsistent regarding the direct relationship between perception of safety and green space when using recreation and exercise as a proxy for perception of safety. Findings regarding perception of safety in surveys were limited but indicated a positive correlation with green space. There is sufficient evidence to conclude that the perception of safety is supported by quality, accessibility, and aesthetic dimensions of neighborhood green space, and the perception of safety is often unrelated to actual crime rates. The science for understanding mechanisms between green space and violence as part of environmental health has been insufficiently developed and requires further study. Environmental health, including green space, is central to health promotion, and understanding is key to preventing the epidemic of violence. This article provides a summary of research related to green space, violence in communities, perception of safety, and violent crime in those communities. It identifies gaps in our knowledge where future research is needed. Nurses have the opportunity to lead the development, implementation, and evaluation of evidence-based interventions and policies addressing the inequality of quality and quantity of green space in the built and natural environment and related co-benefits. © 2018 Sigma Theta Tau International.

Effect of feed to inoculum ratios on biogas yields of food and green wastes.

PubMed

Liu, Guangqing; Zhang, Ruihong; El-Mashad, Hamed M; Dong, Renjie

2009-11-01

Biogas and methane yields of food and green wastes and their mixture were determined using batch anaerobic digesters at mesophilic (35+/-2 degrees C) and thermophilic (50+/-2 degrees C) temperatures. The mixture was composed of 50% food waste and 50% green waste, based on the volatile solids (VS) initially added to the reactors. The thermophilic digestion tests were performed with four different feed to inoculum (F/I) ratios (i.e., 1.6, 3.1, 4.0 and 5.0) and the mesophilic digestion was conducted at one F/I (3.1). The results showed that the F/I significantly affected the biogas production rate. At four F/Is tested, after 25 days of thermophilic digestion, the biogas yield was determined to be 778, 742, 784 and 396 mL/g VS for food waste, respectively; 631, 529, 524 and 407 mL/g VS for green waste, respectively; and 716, 613, 671 and 555 mL/g VS for the mixture, respectively. About 80% of the biogas production was obtained during the first 10 days of digestion. At the F/I of 3.1, the biogas and methane yields from mesophilic digestion of food waste, green waste and their mixture were lower than the yields obtained at thermophilic temperature. The biogas yields were 430, 372 and 358 mL/g VS, respectively, and the methane yields were 245, 206, and 185 mL/g VS, respectively.

A Dual Reporter Iodinated Labeling Reagent for Cancer Positron Emission Tomography Imaging and Fluorescence-Guided Surgery

PubMed Central

2018-01-01

The combination of early diagnosis and complete surgical resection offers the greatest prospect of curative cancer treatment. An iodine-124/fluorescein-based dual-modality labeling reagent, 124I-Green, constitutes a generic tool for one-step installation of a positron emission tomography (PET) and a fluorescent reporter to any cancer-specific antibody. The resulting antibody conjugate would allow both cancer PET imaging and intraoperative fluorescence-guided surgery. 124I-Green was synthesized in excellent radiochemical yields of 92 ± 5% (n = 4) determined by HPLC with an improved one-pot three-component radioiodination reaction. The A5B7 carcinoembryonic antigen (CEA)-specific antibody was conjugated to 124I-Green. High tumor uptake of the dual-labeled A5B7 of 20.21 ± 2.70, 13.31 ± 0.73, and 10.64 ± 1.86%ID/g was observed in CEA-expressing SW1222 xenograft mouse model (n = 3) at 24, 48, and 72 h post intravenous injection, respectively. The xenografts were clearly visualized by both PET/CT and ex vivo fluorescence imaging. These encouraging results warrant the further translational development of 124I-Green for cancer PET imaging and fluorescence-guided surgery. PMID:29388770

Dynamic analysis of the urban-based low-carbon policy using system dynamics: Focused on housing and green space

NASA Astrophysics Data System (ADS)

Hong, Taehoon; Kim, Jimin; Koo, Choongwan; Jeong, Kwangbok

2015-02-01

To systematically manage the energy consumption of existing buildings, the government has to enforce greenhouse gas reduction policies. However, most of the policies are not properly executed because they do not consider various factors from the urban level perspective. Therefore, this study aimed to conduct a dynamic analysis of an urban-based low-carbon policy using system dynamics, with a specific focus on housing and green space. This study was conducted in the following steps: (i) establishing the variables of urban-based greenhouse gases (GHGs) emissions; (ii) creating a stock/flow diagram of urban-based GHGs emissions; (iii) conducting an information analysis using the system dynamics; and (iv) proposing the urban-based low-carbon policy. If a combined energy policy that uses the housing sector (30%) and the green space sector (30%) at the same time is implemented, 2020 CO2 emissions will be 7.23 million tons (i.e., 30.48% below 2020 business-as-usual), achieving the national carbon emissions reduction target (26.9%). The results of this study could contribute to managing and improving the fundamentals of the urban-based low-carbon policies to reduce greenhouse gas emissions.

[Ph-Sensor Properties of a Fluorescent Protein from Dendronephthya sp].

PubMed

Pakhomov, A A; Chertkova, R V; Martynov, V I

2015-01-01

Genetically encoded biosensors based on fluorescent proteins are now widely applicable for monitoring pH changes in live cells. Here, we have shown that a fluorescent protein from Dendronephthya sp. (DendFP) exhibits a pronounced pH-sensitivity. Unlike most of known genetically encoded pH-sensors, fluorescence of the protein is not quenched upon medium acidification, but is shifting from the red to green spectral range. Therefore, quantitative measurements of intracellular pH are feasible by ratiometric comparison of emission intensities in the red and green spectral ranges, which makes DendFP advantageous compared with other genetically encoded pH-sensors.

Robust red-emission spectra and yields in firefly bioluminescence against temperature changes

NASA Astrophysics Data System (ADS)

Mochizuki, Toshimitsu; Wang, Yu; Hiyama, Miyabi; Akiyama, Hidefumi

2014-05-01

We measured the quantitative spectra of firefly (Photinus pyralis) bioluminescence at various temperatures to investigate the temperature dependence of the luciferin-luciferase reaction at 15-34 °C. The quantitative spectra were decomposed very well into red (1.9 eV), orange (2.0 eV), and green (2.2 eV) Gaussian components. The intensity of the green component was the only temperature sensitive quantity that linearly decreased as the temperature increased at pH 7 and 8. We found the quantitative bioluminescence spectra to be robust below 2.0 eV against temperature and other experimental conditions. The revealed robustness of the red emissions should be useful for quantitative applications such as adenosine-5'-triphosphate detection.

Validation of quantitative method for azoxystrobin residues in green beans and peas.

PubMed

Abdelraheem, Ehab M H; Hassan, Sayed M; Arief, Mohamed M H; Mohammad, Somaia G

2015-09-01

This study presents a method validation for extraction and quantitative analysis of azoxystrobin residues in green beans and peas using HPLC-UV and the results confirmed by GC-MS. The employed method involved initial extraction with acetonitrile after the addition of salts (magnesium sulfate and sodium chloride), followed by a cleanup step by activated neutral carbon. Validation parameters; linearity, matrix effect, LOQ, specificity, trueness and repeatability precision were attained. The spiking levels for the trueness and the precision experiments were (0.1, 0.5, 3 mg/kg). For HPLC-UV analysis, mean recoveries ranged between 83.69% to 91.58% and 81.99% to 107.85% for green beans and peas, respectively. For GC-MS analysis, mean recoveries ranged from 76.29% to 94.56% and 80.77% to 100.91% for green beans and peas, respectively. According to these results, the method has been proven to be efficient for extraction and determination of azoxystrobin residues in green beans and peas. Copyright © 2015 Elsevier Ltd. All rights reserved.

Quantitative structure-activity relationships for green algae growth inhibition by polymer particles.

PubMed

Nolte, Tom M; Peijnenburg, Willie J G M; Hendriks, A Jan; van de Meent, Dik

2017-07-01

After use and disposal of chemical products, many types of polymer particles end up in the aquatic environment with potential toxic effects to primary producers like green algae. In this study, we have developed Quantitative Structure-Activity Relationships (QSARs) for a set of highly structural diverse polymers which are capable to estimate green algae growth inhibition (EC50). The model (N = 43, R 2  = 0.73, RMSE = 0.28) is a regression-based decision tree using one structural descriptor for each of three polymer classes separated based on charge. The QSAR is applicable to linear homo polymers as well as copolymers and does not require information on the size of the polymer particle or underlying core material. Highly branched polymers, non-nitrogen cationic polymers and polymeric surfactants are not included in the model and thus cannot be evaluated. The model works best for cationic and non-ionic polymers for which cellular adsorption, disruption of the cell wall and photosynthesis inhibition were the mechanisms of action. For anionic polymers, specific properties of the polymer and test characteristics need to be known for detailed assessment. The data and QSAR results for anionic polymers, when combined with molecular dynamics simulations indicated that nutrient depletion is likely the dominant mode of toxicity. Nutrient depletion in turn, is determined by the non-linear interplay between polymer charge density and backbone flexibility. Copyright © 2017 Elsevier Ltd. All rights reserved.

Evaluation of a method based on liquid chromatography-diode array detector-tandem mass spectrometry for a rapid and comprehensive characterization of the fat-soluble vitamin and carotenoid profile of selected plant foods.

PubMed

Gentili, Alessandra; Caretti, Fulvia

2011-02-04

The feasibility of using reversed-phase liquid chromatography/diode array/tandem mass spectrometry (LC-DAD-MS/MS) for a rapid and comprehensive profiling of fat soluble vitamins and pigments in some foods of plant origin (maize flour, green and golden kiwi) was evaluated. The instrumental approach was planned for obtaining two main outcomes within the same chromatographic run: (i) the quantitative analysis of ten target analytes, whose standards are commercially available; (ii) the screening of pigments occurring in the selected matrices. The quantitative analysis was performed simultaneously for four carotenoids (lutein, zeaxanthin, β-cryptoxanthin, and β-carotene) and six compounds with fat-soluble activity (α-tocopherol, δ-tocopherol, γ-tocopherol, ergocalciferol, phylloquinone and menaquinone-4), separated on a C30 reversed-phase column and detected by atmospheric pressure chemical ionization (APCI) tandem mass spectrometry, operating in Selected Reaction Monitoring (SRM) mode. Extraction procedure was based on matrix solid-phase dispersion with recoveries of all compounds under study exceeding 78 and 60% from maize flour and kiwi, respectively. The method intra-day precision ranged between 3 and 7%, while the inter-day one was below 12%. The mild isolation conditions precluded artefacts creation, such as cis-isomerization phenomena for carotenoids. During the quantitative LC-SRM determination of the ten target analytes, the identification power of the diode array detector joined to that of the triple quadrupole (QqQ) allowed the tentatively identification of several pigments (chlorophylls and carotenoids), without the aid of standards, on the basis of: (i) the UV-vis spectra recorded in the range of 200-700nm; (ii) the expected retention time; (iii) the two SRM transitions, chosen for the target carotenoids but also common to many of isomeric carotenoids occurring in the selected foods. Copyright © 2010 Elsevier B.V. All rights reserved.

Development and validation of a SYBR Green I-based real-time polymerase chain reaction method for detection of haptoglobin gene deletion in clinical materials.

PubMed

Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro

2010-06-01

Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).

Aircraft Alerting Systems Criteria Study. Volume 1. Collation and Analysis of Aircraft Alerting Systems Data

DTIC Science & Technology

1977-05-01

light, or flag. The term .gI4er includes the situation wheroin a pointer or tape on an analog Indicator displays a parameter value in the green, yellow...or flap. Only the parameter limit information (bands) on the instruments was considered to have a significant impact on the visual effectiveness of the...the time it takes the obse.-ver to react to the signal ( reactive time) when that was the only task that he had to do. The quantitative applicobility

Quantitative analysis of SMN1 gene and estimation of SMN1 deletion carrier frequency in Korean population based on real-time PCR.

PubMed

Lee, Tae-Mi; Kim, Sang-Wun; Lee, Kwang-Soo; Jin, Hyun-Seok; Koo, Soo Kyung; Jo, Inho; Kang, Seongman; Jung, Sung-Chul

2004-12-01

Spinal muscular atrophy (SMA) is an autosomal recessive disorder, caused by homozygous absence of the survival motor neuron gene (SMN1) in approximately 94% of patients. Since most carriers have only one SMN1 gene copy, several SMN1 quantitative analyses have been used for the SMA carrier detection. We developed a reliable quantitative real-time PCR with SYBR Green I dye and studied 13 patients with SMA and their 24 parents, as well as 326 healthy normal individuals. The copy number of the SMN1 gene was determined by the comparative threshold cycle (Ct) method and albumin was used as a reference gene. The homozygous SMN1 deletion ratio of patients was 0.00 and the hemizygous SMN1 deletion ratio of parents ranged from 0.39 to 0.59. The deltadelta Ct ratios of 7 persons among 326 normal individuals were within the carrier range, 0.41-0.57. According to these data, we estimated the carrier and disease prevalence of SMA at 1/47 and 1/8,496 in Korean population, respectively. These data indicated that there would be no much difference in disease prevalence of SMA compared with western countries. Since the prevalence of SMA is higher than other autosomal recessive disorders, the carrier detection method using real-time PCR could be a useful tool for genetic counseling.

Using the iPhone as a device for a rapid quantitative analysis of trinitrotoluene in soil.

PubMed

Choodum, Aree; Kanatharana, Proespichaya; Wongniramaikul, Worawit; Daeid, Niamh Nic

2013-10-15

Mobile 'smart' phones have become almost ubiquitous in society and are typically equipped with a high-resolution digital camera which can be used to produce an image very conveniently. In this study, the built-in digital camera of a smart phone (iPhone) was used to capture the results from a rapid quantitative colorimetric test for trinitrotoluene (TNT) in soil. The results were compared to those from a digital single-lens reflex (DSLR) camera. The colored product from the selective test for TNT was quantified using an innovative application of photography where the relationships between the Red Green Blue (RGB) values and the concentrations of colorimetric product were exploited. The iPhone showed itself to be capable of being used more conveniently than the DSLR while providing similar analytical results with increased sensitivity. The wide linear range and low detection limits achieved were comparable with those from spectrophotometric quantification methods. Low relative errors in the range of 0.4 to 6.3% were achieved in the analysis of control samples and 0.4-6.2% for spiked soil extracts with good precision (2.09-7.43% RSD) for the analysis over 4 days. The results demonstrate that the iPhone provides the potential to be used as an ideal novel platform for the development of a rapid on site semi quantitative field test for the analysis of explosives. © 2013 Elsevier B.V. All rights reserved.

Qualitative and quantitative analysis of ochratoxin A contamination in green coffee beans using Fourier transform near infrared spectroscopy.

PubMed

Taradolsirithitikul, Panchita; Sirisomboon, Panmanas; Dachoupakan Sirisomboon, Cheewanun

2017-03-01

Ochratoxin A (OTA) contamination is highly prevalent in a variety of agricultural products including the commercially important coffee bean. As such, rapid and accurate detection methods are considered necessary for the identification of OTA in green coffee beans. The goal of this research was to apply Fourier transform near infrared spectroscopy to detect and classify OTA contamination in green coffee beans in both a quantitative and qualitative manner. PLSR models were generated using pretreated spectroscopic data to predict the OTA concentration. The best model displayed a correlation coefficient (r) of 0.814, a standard error of prediction (SEP and bias of 1.965 µg kg -1 and 0.358 µg kg -1 , respectively. Additionally, a PLS-DA model was also generated, displaying a classification accuracy of 96.83% for a non-OTA contaminated model and 80.95% for an OTA contaminated model, with an overall classification accuracy of 88.89%. The results demonstrate that the developed model could be used for detecting OTA contamination in green coffee beans in either a quantitative or qualitative manner. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Simple saponification method for the quantitative determination of carotenoids in green vegetables.

PubMed

Larsen, Erik; Christensen, Lars P

2005-08-24

A simple, reliable, and gentle saponification method for the quantitative determination of carotenoids in green vegetables was developed. The method involves an extraction procedure with acetone and the selective removal of the chlorophylls and esterified fatty acids from the organic phase using a strongly basic resin (Ambersep 900 OH). Extracts from common green vegetables (beans, broccoli, green bell pepper, chive, lettuce, parsley, peas, and spinach) were analyzed by high-performance liquid chromatography (HPLC) for their content of major carotenoids before and after action of Ambersep 900 OH. The mean recovery percentages for most carotenoids [(all-E)-violaxanthin, (all-E)-lutein epoxide, (all-E)-lutein, neolutein A, and (all-E)-beta-carotene] after saponification of the vegetable extracts with Ambersep 900 OH were close to 100% (99-104%), while the mean recovery percentages of (9'Z)-neoxanthin increased to 119% and that of (all-E)-neoxanthin and neolutein B decreased to 90% and 72%, respectively.

A field- and laboratory-based quantitative analysis of alluvium: Relating analytical results to TIMS data

NASA Technical Reports Server (NTRS)

Wenrich, Melissa L.; Hamilton, Victoria E.; Christensen, Philip R.

1995-01-01

Thermal Infrared Multispectral Scanner (TIMS) data were acquired over the McDowell Mountains northeast of Scottsdale, Arizona during August 1994. The raw data were processed to emphasize lithologic differences using a decorrelation stretch and assigning bands 5, 3, and 1 to red, green, and blue, respectively. Processed data of alluvium flanking the mountains exhibit moderate color variation. The objective of this study was to determine, using a quantitative approach, what environmental variable(s), in the absence of bedrock, is/are responsible for influencing the spectral properties of the desert alluvial surface.

Designing green derivatives of β-blocker Metoprolol: a tiered approach for green and sustainable pharmacy and chemistry.

PubMed

Rastogi, Tushar; Leder, Christoph; Kümmerer, Klaus

2014-09-01

The presences of micro-pollutants (active pharmaceutical ingredients, APIs) are increasingly seen as a challenge of the sustainable management of water resources worldwide due to ineffective effluent treatment and other measures for their input prevention. Therefore, novel approaches are needed like designing greener pharmaceuticals, i.e. better biodegradability in the environment. This study addresses a tiered approach of implementing green and sustainable chemistry principles for theoretically designing better biodegradable and pharmacologically improved pharmaceuticals. Photodegradation process coupled with LC-MS(n) analysis and in silico tools such as quantitative structure-activity relationships (QSAR) analysis and molecular docking proved to be a very significant approach for the preliminary stages of designing chemical structures that would fit into the "benign by design" concept in the direction of green and sustainable pharmacy. Metoprolol (MTL) was used as an example, which itself is not readily biodegradable under conditions found in sewage treatment and the aquatic environment. The study provides the theoretical design of new derivatives of MTL which might have the same or improved pharmacological activity and are more degradable in the environment than MTL. However, the in silico toxicity prediction by QSAR of those photo-TPs indicated few of them might be possibly mutagenic and require further testing. This novel approach of theoretically designing 'green' pharmaceuticals can be considered as a step forward towards the green and sustainable pharmacy field. However, more knowledge and further experience have to be collected on the full scope, opportunities and limitations of this approach. Copyright © 2014 Elsevier Ltd. All rights reserved.

One-step multiplex RT-qPCR detects three citrus viroids from different genera in a wide range of hosts.

PubMed

Osman, Fatima; Dang, Tyler; Bodaghi, Sohrab; Vidalakis, Georgios

2017-07-01

A one-step multiplex reverse transcription real-time quantitative polymerase chain reaction (RT-qPCR) based on species-specific minor groove binding (MGB) probes, was developed for the simultaneous detection, identification, and quantification of three citrus viroids belonging to different genera. Citrus exocortis viroid (Pospiviroid), Hop stunt viroid (Hostuviroid), and Citrus bark cracking viroid (Cocadviroid) cause a variety of maladies in agriculturally significant crops. Therefore, reliable assays for their detection are essential tools for various government and industry organizations implementing disease management programs. Singleplex qPCR primers and MGB probes were designed individually for the detection of the three targeted viroids, and subsequently combined in a one-step multiplex RT-qPCR reaction. A wide host range of woody plants, including citrus, grapevines, apricots, plums and herbaceous plants such as tomato, cucumber, eggplant and chrysanthemum different world regions were used to validate the assay. Single, double and triple viroid infections were identified in the tested samples. The developed multiplex RT-qPCR assay was compared with a previously reported SYBR Green I RT-qPCR for the universal detection of citrus viroids. Both assays accurately identified all citrus viroid infected samples. The multiplex assay complemented the SYBR Green I universal detection assay by differentiating among citrus viroid species in the positive samples. The developed multiplex RT-qPCR assay has the potential to simultaneously detect each targeted viroid and could be used in high throughput screenings for citrus viroids in field surveys, germplasm banks, nurseries and other viroid disease management programs. Copyright © 2017. Published by Elsevier B.V.

Comparison of Metabolomics Approaches for Evaluating the Variability of Complex Botanical Preparations: Green Tea (Camellia sinensis) as a Case Study.

PubMed

Kellogg, Joshua J; Graf, Tyler N; Paine, Mary F; McCune, Jeannine S; Kvalheim, Olav M; Oberlies, Nicholas H; Cech, Nadja B

2017-05-26

A challenge that must be addressed when conducting studies with complex natural products is how to evaluate their complexity and variability. Traditional methods of quantifying a single or a small range of metabolites may not capture the full chemical complexity of multiple samples. Different metabolomics approaches were evaluated to discern how they facilitated comparison of the chemical composition of commercial green tea [Camellia sinensis (L.) Kuntze] products, with the goal of capturing the variability of commercially used products and selecting representative products for in vitro or clinical evaluation. Three metabolomic-related methods-untargeted ultraperformance liquid chromatography-mass spectrometry (UPLC-MS), targeted UPLC-MS, and untargeted, quantitative 1 HNMR-were employed to characterize 34 commercially available green tea samples. Of these methods, untargeted UPLC-MS was most effective at discriminating between green tea, green tea supplement, and non-green-tea products. A method using reproduced correlation coefficients calculated from principal component analysis models was developed to quantitatively compare differences among samples. The obtained results demonstrated the utility of metabolomics employing UPLC-MS data for evaluating similarities and differences between complex botanical products.

Comparison of Metabolomics Approaches for Evaluating the Variability of Complex Botanical Preparations: Green Tea (Camellia sinensis) as a Case Study

PubMed Central

2017-01-01

A challenge that must be addressed when conducting studies with complex natural products is how to evaluate their complexity and variability. Traditional methods of quantifying a single or a small range of metabolites may not capture the full chemical complexity of multiple samples. Different metabolomics approaches were evaluated to discern how they facilitated comparison of the chemical composition of commercial green tea [Camellia sinensis (L.) Kuntze] products, with the goal of capturing the variability of commercially used products and selecting representative products for in vitro or clinical evaluation. Three metabolomic-related methods—untargeted ultraperformance liquid chromatography–mass spectrometry (UPLC-MS), targeted UPLC-MS, and untargeted, quantitative 1HNMR—were employed to characterize 34 commercially available green tea samples. Of these methods, untargeted UPLC-MS was most effective at discriminating between green tea, green tea supplement, and non-green-tea products. A method using reproduced correlation coefficients calculated from principal component analysis models was developed to quantitatively compare differences among samples. The obtained results demonstrated the utility of metabolomics employing UPLC-MS data for evaluating similarities and differences between complex botanical products. PMID:28453261

Method validation for the determination of ochratoxin A in green and soluble coffee by immunoaffinity column cleanup and liquid chromatography.

PubMed

Diaz, G J; Ariza, D; Perilla, N S

2004-06-01

A method was validated for the determination of ochratoxin A (OTA) in soluble and green coffee. Performance parameters evaluated included selectivity, accuracy, intermediate precision, linearity, limit of detection, limit of quantitation, and ruggedness. The method was found to be selective for OTA in both matrices tested. Recovery rates from soluble coffee samples ranged from 73.5 to 91.2%, and from green coffee samples from 68.7 to 84.5%. The intermediate precision (RSDr) was between 9.1 and 9.4% for soluble coffee and between 14.3 and 15.5% for green coffee analysis. The linearity of the standard calibration curve (r(2)) was <0.999 for OTA levels of 1.0-20.0 μg/kg in coffee samples. The limit of detection was determined to be 0.01 ng of OTA on column, while the limit of quantitation was found to be 0.03 ng on column. The limit of quantitation is equivalent to 0.6 μg/kg in soluble coffee samples and 0.3 μg/kg in green coffee samples. The results of the ruggedness trial showed two factors are critical for soluble coffee analysis: the extraction method, and the flow rate of the mobile phase. For green coffee analysis two critical factors detected were the extraction method and the storage temperature of the immunoaffinity column.Five samples of soluble coffee and 42 of green coffee were analysed using the validated method. All soluble coffee samples contained OTA at levels that ranged from 8.4 to 13.9 μg/kg. Six of the 42 green coffee samples analysed (14.3%) contained OTA at levels ranging from 0.9 to 19.4 μg/kg. The validated method can be used to monitor OTA levels in Colombian coffee for export or for local consumption.

[Identification of green tea brand based on hyperspectra imaging technology].

PubMed

Zhang, Hai-Liang; Liu, Xiao-Li; Zhu, Feng-Le; He, Yong

2014-05-01

Hyperspectral imaging technology was developed to identify different brand famous green tea based on PCA information and image information fusion. First 512 spectral images of six brands of famous green tea in the 380 approximately 1 023 nm wavelength range were collected and principal component analysis (PCA) was performed with the goal of selecting two characteristic bands (545 and 611 nm) that could potentially be used for classification system. Then, 12 gray level co-occurrence matrix (GLCM) features (i. e., mean, covariance, homogeneity, energy, contrast, correlation, entropy, inverse gap, contrast, difference from the second-order and autocorrelation) based on the statistical moment were extracted from each characteristic band image. Finally, integration of the 12 texture features and three PCA spectral characteristics for each green tea sample were extracted as the input of LS-SVM. Experimental results showed that discriminating rate was 100% in the prediction set. The receiver operating characteristic curve (ROC) assessment methods were used to evaluate the LS-SVM classification algorithm. Overall results sufficiently demonstrate that hyperspectral imaging technology can be used to perform classification of green tea.

Environmental Education in Botanic Gardens: Exploring Brooklyn Botanic Garden's Project Green Reach

ERIC Educational Resources Information Center

Morgan, Susan Conlon; Hamilton, Susan L.; Bentley, Michael L.; Myrie, Sharon

2009-01-01

Brooklyn Botanic Garden's Project Green Reach (PGR) is a children's program that has offered garden-based youth education since 1990. PGR focuses on Grade K-8 students and teachers from local Title I schools who work in teams on garden and science projects. In this exploratory study, the authors used field observations, document analysis, and past…

Development and comparative evaluation of SYBR Green I-based one-step real-time RT-PCR assay for detection and quantification of West Nile virus in human patients.

PubMed

Kumar, Jyoti S; Saxena, Divyasha; Parida, Manmohan

2014-01-01

The recent outbreaks of West Nile Virus (WNV) in the Northeastern American continents and other regions of the world have made it essential to develop an efficient protocol for surveillance of WN virus. Nucleic acid based techniques like, RT-PCR have the advantage of sensitivity, specificity and rapidity. A one step single tube Env gene specific real-time RT-PCR was developed for early and reliable clinical diagnosis of WNV infection in clinical samples. The applicability of this assay for clinical diagnosis was validated with 105 suspected acute-phase serum and plasma samples from the recent epidemic of mysterious fever in Tamil Nadu, India in 2009-10. The comparative evaluation revealed the higher sensitivity of real-time RT-PCR assay by picking up 4 additional samples with low copy number of template in comparison to conventional RT-PCR. All the real-time positive samples further confirmed by CDC reported TaqMan real-time RT-PCR and quantitative real-time RT-PCR assays for the simultaneous detection of WNV lineage 1 and 2 strains. The quantitation of the viral load samples was done using a standard curve. These findings demonstrated that the assay has the potential usefulness for clinical diagnosis due to detection and quantification of WNV in acute-phase patient serum samples. Copyright © 2014 Elsevier Ltd. All rights reserved.

Green buildings for Egypt: a call for an integrated policy

NASA Astrophysics Data System (ADS)

Bampou, P.

2017-11-01

As global warming is on the threshold of each country worldwide, Middle East and North African (MENA) region has already adopted energy efficiency (EE) policies on several consuming sectors. The present paper valuates the impact of temperature increase in the residential building sector of Egypt that is the most integrated example of the 7 out of the 20 MENA countries that have started their green efforts upon building environment. Furthermore, as it is based on a literature research upon socio-economic characteristics, existing building stock, existing legal and institutional framework, it elaborates a quantitative evaluation of Egypt's energy-saving potential, outlining basic constraints upon energy conservation, in order for Egypt to be able to handle the high energy needs due to its warm climate. Last but not least, the paper proposes a policy pathway for the implementation of green building codes and concludes with the best available technologies to promote EE in the Egyptian building sector.

Dynamic inundation mapping of Hurricane Harvey flooding in the Houston metro area using hyper-resolution modeling and quantitative image reanalysis

NASA Astrophysics Data System (ADS)

Noh, S. J.; Lee, J. H.; Lee, S.; Zhang, Y.; Seo, D. J.

2017-12-01

Hurricane Harvey was one of the most extreme weather events in Texas history and left significant damages in the Houston and adjoining coastal areas. To understand better the relative impact to urban flooding of extreme amount and spatial extent of rainfall, unique geography, land use and storm surge, high-resolution water modeling is necessary such that natural and man-made components are fully resolved. In this presentation, we reconstruct spatiotemporal evolution of inundation during Hurricane Harvey using hyper-resolution modeling and quantitative image reanalysis. The two-dimensional urban flood model used is based on dynamic wave approximation and 10 m-resolution terrain data, and is forced by the radar-based multisensor quantitative precipitation estimates. The model domain includes Buffalo, Brays, Greens and White Oak Bayous in Houston. The model is simulated using hybrid parallel computing. To evaluate dynamic inundation mapping, we combine various qualitative crowdsourced images and video footages with LiDAR-based terrain data.

Assessing visual green effects of individual urban trees using airborne Lidar data.

PubMed

Chen, Ziyue; Xu, Bing; Gao, Bingbo

2015-12-01

Urban trees benefit people's daily life in terms of air quality, local climate, recreation and aesthetics. Among these functions, a growing number of studies have been conducted to understand the relationship between residents' preference towards local environments and visual green effects of urban greenery. However, except for on-site photography, there are few quantitative methods to calculate green visibility, especially tree green visibility, from viewers' perspectives. To fill this research gap, a case study was conducted in the city of Cambridge, which has a diversity of tree species, sizes and shapes. Firstly, a photograph-based survey was conducted to approximate the actual value of visual green effects of individual urban trees. In addition, small footprint airborne Lidar (Light detection and ranging) data was employed to measure the size and shape of individual trees. Next, correlations between visual tree green effects and tree structural parameters were examined. Through experiments and gradual refinement, a regression model with satisfactory R2 and limited large errors is proposed. Considering the diversity of sample trees and the result of cross-validation, this model has the potential to be applied to other study sites. This research provides urban planners and decision makers with an innovative method to analyse and evaluate landscape patterns in terms of tree greenness. Copyright © 2015 Elsevier B.V. All rights reserved.

Microcolumn-based speciation analysis of thallium in soil and green cabbage.

PubMed

Jia, Yanlong; Xiao, Tangfu; Sun, Jialong; Yang, Fei; Baveye, Philippe C

2018-07-15

Thallium (Tl) is a toxic trace metal, whose geochemical behavior and biological effects are closely controlled by its chemical speciation in the environment. However, little tends to be known about this speciation of Tl in soil and plant systems that directly affect the safety of food supplies. In this context, the objective of the present study was to elaborate an efficient method to separate and detect Tl(I) and Tl(III) species for soil and plant samples. This method involves the selective adsorption of Tl(I) on microcolumns filled with immobilized oxine, in the presence of DTPA (diethylenetriaminepentaacetic acid), followed by DTPA-enhanced ultrasonic and heating-induced extraction, coupled with ICP-MS detection. The method was characterized by a LOD of 0.037 μg/L for Tl(I) and 0.18 μg/L for Tl(III) in 10  mL samples. With this method, a second objective of the research was to assess the speciation of Tl in pot and field soils and in green cabbage crops. Experimental results suggest that DTPA extracted Tl was mainly present as Tl(I) in soils (>95%). Tl in hyperaccumulator plant green cabbage was also mainly present as Tl(I) (>90%). With respect to Tl uptake in plants, this study provides direct evidence that green cabbage mainly takes up Tl(I) from soil, and transports it into the aboveground organs. In soils, Tl(III) is reduced to Tl(I) even at the surface where the chemical environment promotes oxidation. This observation is conducive to understanding the mechanisms of Tl isotope fractionation in the soil-plant system. Based on geochemical fraction studies, the reducible fraction was the main source of Tl getting accumulated by plants. These results indicate that the improved analytical method presented in this study offers an economical, simple, fast, and sensitive approach for the separation of Tl species present in soils at trace levels. Copyright © 2018 Elsevier B.V. All rights reserved.

[Effect of green tea or green tea extract consumption on body weight and body composition; systematic review and meta-analysis].

PubMed

Baladia, Eduard; Basulto, Julio; Manera, María; Martínez, Rodrigo; Calbet, David

2014-03-01

Caffeine and catechins contained in green tea may have a thermogenic effect favoring weight and body fat loss. The aim of this study is to evaluate the magnitude of the effect of green tea or its extracts (caffeine and catechins) on body weight and body composition. A systematic review and meta-analysis was conducted to determine the magnitude of the effect of green tea or its extracts on body weight (kg), body mass index (BMI) (kg/m2), fat mass (%), and waist and hip circumference (cm). We included studies published between 2000 and 2013, retrieved from PubMed/Medline with the following characteristics: randomized controlled trials (RCTs) of parallel groups (intervention and placebo), randomized, double-blind, and a minimum 12-week follow-up, in healthy individuals of either gender, 18 years or older, with a BMI of 25-40 kg/m2. Quality and risk of bias was assessed for every included study, and the statistical analysis was performed with the Crochrane Collaboration RevMan 5.1.6 software, according to the random effects model with a confidence interval of 95% (95%). It was established that the effect was statistically significant at p < 0.05, and the homogeneity of the studies was assessed using the I2 index. The search strategy retrieved 154 studies, of which only five could be included in the quantitative analysis. The analysis revealed a not statistically significant mean difference (MD) in weight loss in the analyzed sample and subgroups: Asian individuals -0.81 kg (95% CI: -2.76 to 1.13; P = 0.41; I2 = 0%, n = 210), Caucasians -0.73 kg (95% CI: -3.22 to 1.75; P = 0.45; I2 = 0%; n = 91), as well as in the sample as a whole: -0.78 kg (95% CI: -2.31 to 0.75; P = 0.32; I2 = 0%; n = 301). No statistically significant decrease was revealed in BMI in the analyzed sample and subgroups: Asian individuals -0.65 (95% CI: -1.85 to 0.54; P = 0.29; I2 = 0%; n = 71), -0.21 Caucasians (95% CI: -0.96 to 0.53; P = 0.58; I2 = 22%; n = 91), as well as in the sample as a whole: -0.31 kg (95% CI: -0.88 to 0.27; P = 0.30; I2 = 0%; n = 162), nor for the waist circumference 0.08 cm (95% CI: -0.39 to 0.55; P = 0.73; I2 = 3%; n = 301) or hip (95% CI: -1.14 to 0.93; P = 0.85; I2 = 0%; n = 210). In the evaluation of the effect on the percentage of fat mass (FM%), MD was found not statistically significant for population subgroups: Asian individuals -0.76 (95% CI: -1.59 to 0.08; P = 0.08; I2 = 0%; n = 169), Caucasians -0.76 (95% CI: -2.22 to 0.70; P = 0.31; I2 = 36%; n = 93), but a small, although statistically significant, decrease in the overall effect was found -0.76 (95% CI: -1.44 to -0.09; P = 0.03; I2 = 0%; n = 260). The statistically significant effect of green tea on the FM% of the entire sample was not clinically relevant, a fact also highlighted in the results of other meta-analysis. CONCLUSION OF THE AUTHORS: Green tea or gree tea extracts intake or its extracts exerts no statistically significant effect on the weight of overweight or obese adults. There is a small effect on the decrease in the percentage of fat mass, but it is not clinically relevant. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

The Concept of Directly Connected Impervious Areas and Its Implication on Sustainable Development in Urban Catchments

NASA Astrophysics Data System (ADS)

Seo, Yongwon; Hwang, Junsik; Choi, Hyun Il

2017-04-01

The concept of directly connected impervious area (DCIA) or efficient impervious areas (EIA) refers to a subset of impervious cover, which is directly connected to a drainage system or a water body via continuous impervious surfaces. The concept of DCIA is important in that it is regarded as a better predictor of stream ecosystem health than the total impervious area (TIA). DCIA is a key concept for a better assessment of green infrastructures introduced in urban catchments. Green infrastructure can help restore water cycle; it improves water quality, manages stormwater, provides recreational environment even at lower cost compared to conventional alternatives. In this study, we evaluated several methods to obtain the DCIA based on a GIS database and showed the importance of the accurate measurement of DCIA in terms of resulting hydrographs. We also evaluated several potential green infrastructure scenarios and showed how the spatial planning of green infrastruesture affects the shape of hydrographs and reduction of peak flows. These results imply that well-planned green infrastructure can be introduced to urban catchments for flood risk managements and quantitative assessment of spatial distribution of DCIA is crucial for sustainable development in urban environment.

Green ergonomics: definition and scope.

PubMed

Thatcher, Andrew

2013-01-01

This paper demonstrates that the goals of ergonomics (i.e. effectiveness, efficiency, health, safety and usability) are closely aligned with the goals of design for environmental sustainability. In this paper, the term 'green ergonomics' is conceptualised to specifically describe ergonomics interventions with a pro-nature emphasis. Green ergonomics is focused on the bi-directional connections between human systems and nature. This involves looking at (1) how ergonomics design and evaluation might be used to conserve, preserve, and restore nature and (2) how ecosystem services might be harnessed to facilitate the improved wellbeing and effectiveness of human systems. The paper proposes the scope of green ergonomics based on these bi-directional relationships in the areas of the design of low resource systems and products, the design of green jobs, and the design for behaviour change. Suggestions for further work in the green ergonomics domain are also made. Given the enormous environmental challenges facing modern industrial society, this paper encourages ergonomics science to embrace a pro-nature understanding of work design and research. This paper sets out the role for green ergonomics based on an appreciation of the human-nature connections that have been integrated with our understanding of ergonomics science and practice.

Development of a fluorescence in situ hybridization (FISH) method for rapid detection of Ulva prolifera

NASA Astrophysics Data System (ADS)

Zhang, Qing-Chun; Liu, Qing; Kang, Zhen-Jun; Yu, Ren-Cheng; Yan, Tian; Zhou, Ming-Jiang

2015-09-01

Large-scale green tides have occurred consecutively since 2007 in the Yellow Sea (YS), China. The dominant causative species of the green tides has been identified as Ulva prolifera. The origin of green tides in the YS has been traced back to the Subei Shoal based on the results of remote-sensing, numerical simulations and field investigations. However, it is difficult to study the early development of green tides in the Subei Shoal because of the mixture of multiple green algae and the morphological diversity of U. prolifera when under variable environmental conditions. In this study, a rapid and accurate fluorescence in situ hybridization (FISH) method was developed to detect U. prolifera from the community of green algae targeting the 5S rDNA spacer region of U. prolifera. Two specific probes, 5S-1 and 5S-2, were designed based on the sequences of the 5S rDNA spacer regions of U. prolifera, Ulva linza and Ulva flexuosa. Specificity of the FISH method was tested using the six species of green algae commonly occurring in the Subei Shoal, including U. prolifera, U. linza, U. flexuosa, Ulva compressa, Ulva pertusa and Blidingia sp. The results showed that only U. prolifera could be labeled with both probes. Probe 5S-1, which showed a much higher labeling efficiency on U. prolifera, was ultimately selected as the probe for the FISH detection. The sample preparation method was optimized, particularly for the mature green algae, by the addition of cellulase and proteinase K in the pre-hybridization solution. Labeling efficiency with the probe 5S-1 reached 96% on average under the optimized conditions. The successful development of the FISH method has been applied to qualitative and quantitative analysis of field samples collected from the YS, and the results indicate a potential use in future green algae studies.

Desertification, resilience, and re-greening in the African Sahel - a matter of the observation period?

NASA Astrophysics Data System (ADS)

Kusserow, Hannelore

2017-12-01

Since the turn of the millennium various scientific publications have been discussing a re-greening of the Sahel after the 1980s drought mainly based on coarse-resolution satellite data. However, the author's own field studies suggest that the situation is far more complex and that both paradigms, the encroaching Sahara and the re-greening Sahel, need to be questioned.

This paper discusses the concepts of desertification, resilience, and re-greening by addressing four main aspects: (i) the relevance of edaphic factors for a vegetation re-greening, (ii-iii) the importance of the selected observation period in the debate on Sahel greening or browning, and (iv) modifications in the vegetation pattern as possible indicators of ecosystem changes (shift from originally diffuse to contracted vegetation patterns).

The data referred to in this paper cover a time period of more than 150 years and include the author's own research results from the early 1980s until today. A special emphasis, apart from fieldwork data and remote sensing data, is laid on the historical documents.

The key findings summarised at the end show the following: (i) vegetation recovery predominantly depends on soil types; (ii) when discussing Sahel greening vs. Sahel browning, the majority of research papers only focus on post-drought conditions. Taking pre-drought conditions (before the 1980s) into account, however, is essential to fully understand the situation. Botanical investigations and remote-sensing-based time series clearly show a substantial decline in woody species diversity and cover density compared to pre-drought conditions; (iii) the self-organised patchiness of vegetation is considered to be an important indicator of ecosystem changes.

Gene expression in developing watermelon fruit

PubMed Central

Wechter, W Patrick; Levi, Amnon; Harris, Karen R; Davis, Angela R; Fei, Zhangjun; Katzir, Nurit; Giovannoni, James J; Salman-Minkov, Ayelet; Hernandez, Alvaro; Thimmapuram, Jyothi; Tadmor, Yaakov; Portnoy, Vitaly; Trebitsh, Tova

2008-01-01

Background Cultivated watermelon form large fruits that are highly variable in size, shape, color, and content, yet have extremely narrow genetic diversity. Whereas a plethora of genes involved in cell wall metabolism, ethylene biosynthesis, fruit softening, and secondary metabolism during fruit development and ripening have been identified in other plant species, little is known of the genes involved in these processes in watermelon. A microarray and quantitative Real-Time PCR-based study was conducted in watermelon [Citrullus lanatus (Thunb.) Matsum. & Nakai var. lanatus] in order to elucidate the flow of events associated with fruit development and ripening in this species. RNA from three different maturation stages of watermelon fruits, as well as leaf, were collected from field grown plants during three consecutive years, and analyzed for gene expression using high-density photolithography microarrays and quantitative PCR. Results High-density photolithography arrays, composed of probes of 832 EST-unigenes from a subtracted, fruit development, cDNA library of watermelon were utilized to examine gene expression at three distinct time-points in watermelon fruit development. Analysis was performed with field-grown fruits over three consecutive growing seasons. Microarray analysis identified three hundred and thirty-five unique ESTs that are differentially regulated by at least two-fold in watermelon fruits during the early, ripening, or mature stage when compared to leaf. Of the 335 ESTs identified, 211 share significant homology with known gene products and 96 had no significant matches with any database accession. Of the modulated watermelon ESTs related to annotated genes, a significant number were found to be associated with or involved in the vascular system, carotenoid biosynthesis, transcriptional regulation, pathogen and stress response, and ethylene biosynthesis. Ethylene bioassays, performed with a closely related watermelon genotype with a similar phenotype, i.e. seeded, bright red flesh, dark green rind, etc., determined that ethylene levels were highest during the green fruit stage followed by a decrease during the white and pink fruit stages. Additionally, quantitative Real-Time PCR was used to validate modulation of 127 ESTs that were differentially expressed in developing and ripening fruits based on array analysis. Conclusion This study identified numerous ESTs with putative involvement in the watermelon fruit developmental and ripening process, in particular the involvement of the vascular system and ethylene. The production of ethylene during fruit development in watermelon gives further support to the role of ethylene in fruit development in non-climacteric fruits. PMID:18534026

Ratiometric Matryoshka biosensors from a nested cassette of green- and orange-emitting fluorescent proteins.

PubMed

Ast, Cindy; Foret, Jessica; Oltrogge, Luke M; De Michele, Roberto; Kleist, Thomas J; Ho, Cheng-Hsun; Frommer, Wolf B

2017-09-05

Sensitivity, dynamic and detection range as well as exclusion of expression and instrumental artifacts are critical for the quantitation of data obtained with fluorescent protein (FP)-based biosensors in vivo. Current biosensors designs are, in general, unable to simultaneously meet all these criteria. Here, we describe a generalizable platform to create dual-FP biosensors with large dynamic ranges by employing a single FP-cassette, named GO-(Green-Orange) Matryoshka. The cassette nests a stable reference FP (large Stokes shift LSSmOrange) within a reporter FP (circularly permuted green FP). GO- Matryoshka yields green and orange fluorescence upon blue excitation. As proof of concept, we converted existing, single-emission biosensors into a series of ratiometric calcium sensors (MatryoshCaMP6s) and ammonium transport activity sensors (AmTryoshka1;3). We additionally identified the internal acid-base equilibrium as a key determinant of the GCaMP dynamic range. Matryoshka technology promises flexibility in the design of a wide spectrum of ratiometric biosensors and expanded in vivo applications.Single fluorescent protein biosensors are susceptible to expression and instrumental artifacts. Here Ast et al. describe a dual fluorescent protein design whereby a reference fluorescent protein is nested within a reporter fluorescent protein to control for such artifacts while preserving sensitivity and dynamic range.

Superalgebraically convergent smoothly windowed lattice sums for doubly periodic Green functions in three-dimensional space

PubMed Central

Bruno, Oscar P.; Turc, Catalin; Venakides, Stephanos

2016-01-01

This work, part I in a two-part series, presents: (i) a simple and highly efficient algorithm for evaluation of quasi-periodic Green functions, as well as (ii) an associated boundary-integral equation method for the numerical solution of problems of scattering of waves by doubly periodic arrays of scatterers in three-dimensional space. Except for certain ‘Wood frequencies’ at which the quasi-periodic Green function ceases to exist, the proposed approach, which is based on smooth windowing functions, gives rise to tapered lattice sums which converge superalgebraically fast to the Green function—that is, faster than any power of the number of terms used. This is in sharp contrast to the extremely slow convergence exhibited by the lattice sums in the absence of smooth windowing. (The Wood-frequency problem is treated in part II.) This paper establishes rigorously the superalgebraic convergence of the windowed lattice sums. A variety of numerical results demonstrate the practical efficiency of the proposed approach. PMID:27493573

Use of a capillary electrophoresis instrument with laser-induced fluorescence detection for DNA quantitation. Comparison of YO-PRO-1 and PicoGreen assays.

PubMed

Guillo, Christelle; Ferrance, Jerome P; Landers, James P

2006-04-28

Highly selective and sensitive assays are required for detection and quantitation of the small masses of DNA typically encountered in clinical and forensic settings. High detection sensitivity is achieved using fluorescent labeling dyes and detection techniques such as spectrofluorometers, microplate readers and cytometers. This work describes the use of a laser-induced fluorescence (LIF) detector in conjunction with a commercial capillary electrophoresis instrument for DNA quantitation. PicoGreen and YO-PRO-1, two fluorescent DNA labeling dyes, were used to assess the potential of the system for routine DNA analysis. Linearity, reproducibility, sensitivity, limits of detection and quantitation, and sample stability were examined for the two assays. The LIF detector response was found to be linear (R2 > 0.999) and reproducible (RSD < 9%) in both cases. The PicoGreen assay displayed lower limits of detection and quantitation (20 pg and 60 pg, respectively) than the YO-PRO-1 assay (60 pg and 260 pg, respectively). Although a small variation in fluorescence was observed for the DNA/dye complexes over time, quantitation was not significantly affected and the solutions were found to be relatively stable for 80 min. The advantages of the technique include a 4- to 40-fold reduction in the volume of sample required compared to traditional assays, a 2- to 20-fold reduction in the volume of reagents consumed, fast and automated analysis, and low cost (no specific instrumentation required).

Change in the Green-Up Dates for Quercus mongolica in Northeast China and Its Climate-Driven Mechanism from 1962 to 2012.

PubMed

Fan, Deqin; Zhu, Wenquan; Zheng, Zhoutao; Zhang, Donghai; Pan, Yaozhong; Jiang, Nan; Zhou, Xiafei

2015-01-01

The currently available studies on the green-up date were mainly based on ground observations and/or satellite data, and few model simulations integrated with wide coverage satellite data have been reported at large scale over a long time period (i.e., > 30 years). In this study, we combined phenology mechanism model, long-term climate data and synoptic scale remote sensing data to investigate the change in the green-up dates for Quercus mongolica over 33 weather stations in Northeast China and its climate-driven mechanism during 1962-2012. The results indicated that the unified phenology model can be well parameterized with the satellite derived green-up dates. The optimal daily mean temperature for chilling effect was between -27°C and 1°C for Q. mongolica in Northeast China, while the optimal daily mean temperature for forcing effect was above -3°C. The green-up dates for Q. mongolica across Northeast China showed a delayed latitudinal gradient of 2.699 days degree-1, with the earliest date on the Julian day 93 (i.e., 3th April) in the south and the latest date on the Julian day 129 (i.e., 9th May) in the north. The green-up date for Q. mongolica in Northeast China has advanced 6.6 days (1.3 days decade-1) from 1962 to 2012. With the prevailing warming in autumn, winter and spring in Northeast China during the past 51 years, the chilling effect for Q. mongolica has been weakened, while the forcing effect has been enhanced. The advancing trend in the green-up dates for Q. mongolica implied that the enhanced forcing effect to accelerate green-up was stronger than the weakened chilling effect to hold back green-up while the changes of both effects were caused by the warming climate.

Basic versus applied research: Julius Sachs (1832–1897) and the experimental physiology of plants

PubMed Central

Kutschera, Ulrich

2015-01-01

The German biologist Julius Sachs was the first to introduce controlled, accurate, quantitative experimentation into the botanical sciences, and is regarded as the founder of modern plant physiology. His seminal monograph Experimental-Physiologie der Pflanzen (Experimental Physiology of Plants) was published 150 y ago (1865), when Sachs was employed as a lecturer at the Agricultural Academy in Poppelsdorf/Bonn (now part of the University). This book marks the beginning of a new era of basic and applied plant science. In this contribution, I summarize the achievements of Sachs and outline his lasting legacy. In addition, I show that Sachs was one of the first biologists who integrated bacteria, which he considered to be descendants of fungi, into the botanical sciences and discussed their interaction with land plants (degradation of wood etc.). This “plant-microbe-view” of green organisms was extended and elaborated by the laboratory botanist Wilhelm Pfeffer (1845–1920), so that the term “Sachs-Pfeffer-Principle of Experimental Plant Research” appears to be appropriate to characterize this novel way of performing scientific studies on green, photoautotrophic organisms (embryophytes, algae, cyanobacteria). PMID:26146794

Quantitative Detection of Trace Malachite Green in Aquiculture Water Samples by Extractive Electrospray Ionization Mass Spectrometry

PubMed Central

Fang, Xiaowei; Yang, Shuiping; Chingin, Konstantin; Zhu, Liang; Zhang, Xinglei; Zhou, Zhiquan; Zhao, Zhanfeng

2016-01-01

Exposure to malachite green (MG) may pose great health risks to humans; thus, it is of prime importance to develop fast and robust methods to quantitatively screen the presence of malachite green in water. Herein the application of extractive electrospray ionization mass spectrometry (EESI-MS) has been extended to the trace detection of MG within lake water and aquiculture water, due to the intensive use of MG as a biocide in fisheries. This method has the advantage of obviating offline liquid-liquid extraction or tedious matrix separation prior to the measurement of malachite green in native aqueous medium. The experimental results indicate that the extrapolated detection limit for MG was ~3.8 μg·L−1 (S/N = 3) in lake water samples and ~0.5 μg·L−1 in ultrapure water under optimized experimental conditions. The signal intensity of MG showed good linearity over the concentration range of 10–1000 μg·L−1. Measurement of practical water samples fortified with MG at 0.01, 0.1 and 1.0 mg·L−1 gave a good validation of the established calibration curve. The average recoveries and relative standard deviation (RSD) of malachite green in lake water and Carassius carassius fish farm effluent water were 115% (6.64% RSD), 85.4% (9.17% RSD) and 96.0% (7.44% RSD), respectively. Overall, the established EESI-MS/MS method has been demonstrated suitable for sensitive and rapid (<2 min per sample) quantitative detection of malachite green in various aqueous media, indicating its potential for online real-time monitoring of real life samples. PMID:27529262

Quantitative Detection of Trace Malachite Green in Aquiculture Water Samples by Extractive Electrospray Ionization Mass Spectrometry.

PubMed

Fang, Xiaowei; Yang, Shuiping; Chingin, Konstantin; Zhu, Liang; Zhang, Xinglei; Zhou, Zhiquan; Zhao, Zhanfeng

2016-08-11

Exposure to malachite green (MG) may pose great health risks to humans; thus, it is of prime importance to develop fast and robust methods to quantitatively screen the presence of malachite green in water. Herein the application of extractive electrospray ionization mass spectrometry (EESI-MS) has been extended to the trace detection of MG within lake water and aquiculture water, due to the intensive use of MG as a biocide in fisheries. This method has the advantage of obviating offline liquid-liquid extraction or tedious matrix separation prior to the measurement of malachite green in native aqueous medium. The experimental results indicate that the extrapolated detection limit for MG was ~3.8 μg·L(-1) (S/N = 3) in lake water samples and ~0.5 μg·L(-1) in ultrapure water under optimized experimental conditions. The signal intensity of MG showed good linearity over the concentration range of 10-1000 μg·L(-1). Measurement of practical water samples fortified with MG at 0.01, 0.1 and 1.0 mg·L(-1) gave a good validation of the established calibration curve. The average recoveries and relative standard deviation (RSD) of malachite green in lake water and Carassius carassius fish farm effluent water were 115% (6.64% RSD), 85.4% (9.17% RSD) and 96.0% (7.44% RSD), respectively. Overall, the established EESI-MS/MS method has been demonstrated suitable for sensitive and rapid (<2 min per sample) quantitative detection of malachite green in various aqueous media, indicating its potential for online real-time monitoring of real life samples.

Colorimetric determination of DNase I activity with a DNA-methyl green substrate.

PubMed

Sinicropi, D; Baker, D L; Prince, W S; Shiffer, K; Shak, S

1994-11-01

A simple, high throughput, and precise assay was developed for quantification of deoxyribonuclease I (DNase; IUB 3.1.21.1) activity. The method was adapted from the procedure devised by Kurnick which employs a substrate comprised of highly polymerized native DNA complexed with methyl green. Hydrolysis of the DNA produced unbound methyl green and a decrease in the absorbance of the solution at 620 nm. By adjusting the time and temperature of the reaction, the assay permits quantification of DNase activity over a wide concentration range (0.4 to 8900 ng/ml). Samples and standards were added to the substrate in microtiter plates and were incubated for 1-24 h at 25-37 degrees C to achieve the desired assay range. The DNase activity of the samples was interpolated from a standard curve generated with Pulmozyme recombinant human deoxyribonuclease I (rhDNase). Interassay precision was less than 12% CV and recovery was within 100 +/- 11%. Activity determination by the DNA-methyl green method correlated well with that determined by the widely used "hyperchromicity" method originated by Kunitz, which is based on the increase in absorbance at 260 nm upon hydrolysis of DNA. The DNA-methyl green assay was simpler and more versatile than the hyperchromicity method and was used to characterize the activity of rhDNase and DNase isolated from human urine.

Redefining RECs: Additionality in the voluntary Renewable Energy Certificate market

NASA Astrophysics Data System (ADS)

Gillenwater, Michael Wayne

In the United States, electricity consumers are told that they can "buy" electricity from renewable energy projects, versus fossil fuel-fired facilities, through participation in a voluntary green power program. The marketing messages communicate to consumers that their participation and premium payments for a green label will cause additional renewable energy generation and thereby allow them to claim they consume electricity that is absent pollution as well as reduce pollutant emissions. Renewable Energy Certificates (RECs) and wind energy are the basis for the majority of the voluntary green power market in the United States. This dissertation addresses the question: Do project developers respond to the voluntary REC market in the United States by altering their decisions to invest in wind turbines? This question is investigated by modeling and probabilistically quantifying the effect of the voluntary REC market on a representative wind power investor in the United States using data from formal expert elicitations of active participants in the industry. It is further explored by comparing the distribution of a sample of wind power projects supplying the voluntary green power market in the United States against an economic viability model that incorporates geographic factors. This dissertation contributes the first quantitative analysis of the effect of the voluntary REC market on project investment. It is found that 1) RECs should be not treated as equivalent to emission offset credits, 2) there is no clearly credible role for voluntary market RECs in emissions trading markets without dramatic restructuring of one or both markets and the environmental commodities they trade, and 3) the use of RECs in entity-level GHG emissions accounting (i.e., "carbon footprinting") leads to double counting of emissions and therefore is not justified. The impotence of the voluntary REC market was, at least in part, due to the small magnitude of the REC price signal and lack of long-term contracts that would reduce the risk of relying on revenue the voluntary green power market. Although no simple solutions are identified, a proposal for integrating RECs into a load based cap-and-trade system is presented. Keywords: Renewable Energy Certificate (REC); Renewable Portfolio Standard (RPS); emission offset; additionality; attributes

DNA microsatellite region for a reliable quantification of soft wheat adulteration in durum wheat-based foodstuffs by real-time PCR.

PubMed

Sonnante, Gabriella; Montemurro, Cinzia; Morgese, Anita; Sabetta, Wilma; Blanco, Antonio; Pasqualone, Antonella

2009-11-11

Italian industrial pasta and durum wheat typical breads must be prepared using exclusively durum wheat semolina. Previously, a microsatellite sequence specific of the wheat D-genome had been chosen for traceability of soft wheat in semolina and bread samples, using qualitative and quantitative Sybr green-based real-time experiments. In this work, we describe an improved method based on the same soft wheat genomic region by means of a quantitative real-time PCR using a dual-labeled probe. Standard curves based on dilutions of 100% soft wheat flour, pasta, or bread were constructed. Durum wheat semolina, pasta, and bread samples were prepared with increasing amounts of soft wheat to verify the accuracy of the method. Results show that reliable quantifications were obtained especially for the samples containing a lower amount of soft wheat DNA, fulfilling the need to verify labeling of pasta and typical durum wheat breads.

Energy Security and Climate Change Policy in the OECD: The Political Economy of Carbon-Energy Taxation

NASA Astrophysics Data System (ADS)

Lachapelle, Erick

Why do countries tax the same fuels at widely different rates, even among similarly situated countries in the global political economy? Given the potentially destabilizing effects of climate change, and the political and economic risks associated with a reliance on geographically concentrated, finite fossil fuels, International Organizations and economists of all political stripes have consistently called for increasing tax rates on fossil-based energy. Despite much enthusiasm among policy experts, however, politicians concerned with distributional consequences, economic performance and competitiveness impacts continue to be wary of raising taxes on carbon-based fuels. In this context, this thesis investigates the political economy of tax rates affecting the price of fossil fuels in advanced capitalist democracies. Through an examination of the political limits of government capacity to implement stricter carbon-energy policy, as well as the identification of the correlates of higher carbon-based energy taxes, it throws new light on the conditions under which carbon-energy tax reform becomes politically possible. Based on recent data collected from the OECD, EEA and IEA, I develop an estimate of the relative size of implicit carbon taxes across OECD member countries on six carbon-based fuels and across the household and industrial sectors. I exploit large cross-national differences in these carbon-energy tax rates in order to identify the correlates of, and constraints on, carbon-energy tax reform. Applying multiple regression analysis to both cross-section and time-series cross-sectional (TSCS) data, this thesis leverages considerable empirical evidence to demonstrate how and why electoral systems matter for energy and environmental tax policy outcomes. In particular, I find considerable empirical evidence to support the claim that systems of proportional representation (PR), in addition to the partisan preferences of the electorate, work together to explain differential rates of carbon-energy taxation. By opening up the ideological space to a broader spectrum of "green" parties, I argue that PR systems create a favourable institutional context within which higher rates of carbon-energy taxation become politically possible. After specifying a key causal mechanism within different types of electoral systems -- the seat-vote elasticity -- I argue further that, voters in disproportional systems actually have more leverage over politicians, and that an increase in environmental voting can have an impact on rates of carbon energy taxation, even in the absence of PR. While the accession to power of green political parties in PR systems is more likely to lead to higher rates of carbon energy taxation, voting for green parties in highly disproportional systems creates incentives for other parties to adopt "green" policies, leading to a similar outcome. In this way, the effect of green votes and green seats will have the opposite effect on policy according to the type of electoral system in use.

Differentiation of hepatocytes from induced pluripotent stem cells derived from human hair follicle mesenchymal stem cells.

PubMed

Shi, Xu; Lv, Shuang; He, Xia; Liu, Xiaomei; Sun, Meiyu; Li, Meiying; Chi, Guangfan; Li, Yulin

2016-10-01

Due to the limitations of organ donors and immune rejection in severe liver diseases, stem cell-based therapy presents a promising application for tissue repair and regeneration. As a novel cell source, mesenchymal stem cells separated from human hair follicles (HF-MSCs) are convenient to obtain and have no age limit. To date, the differentiation of HF-MSCs into hepatocytes has not been reported. In this study, we explored whether HF-MSCs and HF-MSC-derived-induced pluripotent stem cells (HF-iPS) could differentiate into hepatocytes in vitro. Flow cytometry, Oil Red O stain and Alizarin Red stain were used to identify the characteristics of HF-MSCs. The expression of liver-specific gene was detected by immunofluorescence and Quantitative Polymerase Chain Reaction. Periodic Acid-Schiff stain, Indocyanine Green stain and Low-Density Lipoprotein stain were performed to evaluate the functions of induced hepatocyte-like cells (HLCs). HF-MSCs were unable to differentiate into HLCs using previously reported procedures for MSCs from other tissues. However, HF-iPS efficiently induced the generation of HLCs that expressed hepatocyte markers and drug metabolism-related genes. HF-iPS can be used as novel and alternative cellular tools for inducing hepatocytes in vitro, simultaneously benefiting from utilizing HF-MSCs as a noninvasive and convenient cell source for reprogramming.

An imaging system for quantitive surface temperature mapping using two-color thermographic phosphors

NASA Technical Reports Server (NTRS)

Buck, Gregory M.

1988-01-01

A technique for obtaining detailed quantitative temperature distributions on test models in hypersonic wind tunnels is presented. This technique is based on the ratio of blue to green (450, 520 nm) emission from an UV (365 nm) excited phosphor coating. Separately filtered images are recorded from a three-tube color camera, utilizing off-the-shelf front-end video optics to discriminate wavelengths. Two demonstration studies in a 31-inch Mach 10 tunnel are discussed. One study presents the windward surface temperature-time history for a transatmospheric vehicle, and the other illustrates nosetip heating on a spherically blunted slender cone.

HPLC Analysis of Chlorophyll a, Chlorophyll b, and Beta-Carotene in Collard Greens: A Project for a Problem-Oriented Laboratory Course.

ERIC Educational Resources Information Center

Silveira, Augustine, Jr.; And Others

1984-01-01

High performance liquid chromatography (HPLC) is used to separate and quantitate beta-carotene, chlorophyll a, and chlorophyll b originating from collard greens. Experimental procedures used and typical results obtained are discussed. (JN)

Hamiltonian lattice field theory: Computer calculations using variational methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zako, Robert L.

1991-12-03

I develop a variational method for systematic numerical computation of physical quantities -- bound state energies and scattering amplitudes -- in quantum field theory. An infinite-volume, continuum theory is approximated by a theory on a finite spatial lattice, which is amenable to numerical computation. I present an algorithm for computing approximate energy eigenvalues and eigenstates in the lattice theory and for bounding the resulting errors. I also show how to select basis states and choose variational parameters in order to minimize errors. The algorithm is based on the Rayleigh-Ritz principle and Kato`s generalizations of Temple`s formula. The algorithm could bemore » adapted to systems such as atoms and molecules. I show how to compute Green`s functions from energy eigenvalues and eigenstates in the lattice theory, and relate these to physical (renormalized) coupling constants, bound state energies and Green`s functions. Thus one can compute approximate physical quantities in a lattice theory that approximates a quantum field theory with specified physical coupling constants. I discuss the errors in both approximations. In principle, the errors can be made arbitrarily small by increasing the size of the lattice, decreasing the lattice spacing and computing sufficiently long. Unfortunately, I do not understand the infinite-volume and continuum limits well enough to quantify errors due to the lattice approximation. Thus the method is currently incomplete. I apply the method to real scalar field theories using a Fock basis of free particle states. All needed quantities can be calculated efficiently with this basis. The generalization to more complicated theories is straightforward. I describe a computer implementation of the method and present numerical results for simple quantum mechanical systems.« less

Effects of Green Space and Land Use/Land Cover on Urban Heat Island in a Subtropical Mega-city in China

NASA Astrophysics Data System (ADS)

Qiu, G. Y.; Li, X.; Li, H.; Guo, Q.

2014-12-01

With the quick expansion of urban in size and population, its urban heat island intensity (UHII, expressed as the temperature difference between urban and rural areas) increased rapidly. However, very few studies could quantitatively reveal the effects of green space and land use/land cover (LULC) on urban thermal environment because of lacking of the detailed measurement. This study focuses on quantifying the effects of green space and LULC on urban Heat Island (UHI) in Shenzhen, a mega subtropical city in China. Extensive measurements (air temperature and humidity) were made by mobile traverse method in a transect of 8 km in length, where a variety of LULC types were included. Measurements were carried out at 2 hours interval for 2 years (totally repeated for 7011 times). According to LULC types, we selected 5 different LULC types for studying, including water body, village in the city, shopping center (commercial area), urban green space (well-vegetated area) and suburb (forest). The main conclusions are obtained as follows: (1) The temperature difference between the 5 different urban landscapes is obvious, i.e. shopping center > village in the city > urban water body > urban green space > suburb; (2) Air temperature and UHII decreases linearly with the increase of green space in urban; (3) Green space and water body in urban have obvious effects to reduce the air temperature by evapotranspiration. Compared to the commercial areas, urban water body can relieve the IUHI by 0.9℃, while the urban green space can relieve the IUHI by 1.57℃. The cooling effect of the urban green space is better than that of the urban water body; (4) Periodic activity of human being has obvious effects on urban air temperature. The UHII on Saturday and Sunday are higher than that from Monday to Friday, respectively higher for 0.65, 0.57, 0.26 and 0.21℃. Thursday and Friday have the minimum air temperature and UHII. These results indicate that increase in urban evapotranspiration by increasing green space could be a useful way to improve urban thermal environment and mitigation of UHI.

Regulating urban surface runoff through nature-based solutions - An assessment at the micro-scale.

PubMed

Zölch, Teresa; Henze, Lisa; Keilholz, Patrick; Pauleit, Stephan

2017-08-01

Urban development leads to changes of surface cover that disrupt the hydrological cycle in cities. In particular, impermeable surfaces and the removal of vegetation reduce the ability to intercept, store and infiltrate rainwater. Consequently, the volume of stormwater runoff and the risk of local flooding rises. This is further amplified by the anticipated effects of climate change leading to an increased frequency and intensity of heavy rain events. Hence, urban adaptation strategies are required to mitigate those impacts. A nature-based solution, more and more promoted in politics and academia, is urban green infrastructure as it contributes to the resilience of urban ecosystems by providing services to maintain or restore hydrological functions. However, this poses a challenge to urban planners in deciding upon effective adaptation measures as they often lack information on the performance of green infrastructure to moderate surface runoff. It remains unclear what type of green infrastructure (e.g. trees, green roofs), offers the highest potential to reduce discharge volumes and to what extent. Against this background, this study provides an approach to gather quantitative evidence on green infrastructure's regulation potential. We use a micro-scale scenario modelling approach of different variations of green cover under current and future climatic conditions. The scenarios are modelled with MIKE SHE, an integrated hydrological simulation tool, and applied to a high density residential area of perimeter blocks in Munich, Germany. The results reveal that both trees and green roofs increase water storage capacities and hence reduce surface runoff, although the main contribution of trees lies in increasing interception and evapotranspiration, whereas green roofs allow for more retention through water storage in their substrate. With increasing precipitation intensities as projected under climate change their regulating potential decreases due to limited water storage capacities. The performance of both types stays limited to a maximum reduction of 2.4% compared to the baseline scenario, unless the coverage of vegetation and permeable surfaces is significantly increased as a 14.8% reduction is achieved by greening all roof surfaces. We conclude that the study provides empirical support for the effectiveness of urban green infrastructure as nature-based solution to stormwater regulation and assists planners and operators of sewage systems in selecting the most effective measures for implementation and estimation of their effects. Copyright © 2017 Elsevier Inc. All rights reserved.

The mass-action law based algorithms for quantitative econo-green bio-research.

PubMed

Chou, Ting-Chao

2011-05-01

The relationship between dose and effect is not random, but rather governed by the unified theory based on the median-effect equation (MEE) of the mass-action law. Rearrangement of MEE yields the mathematical form of the Michaelis-Menten, Hill, Henderson-Hasselbalch and Scatchard equations of biochemistry and biophysics, and the median-effect plot allows linearization of all dose-effect curves regardless of potency and shape. The "median" is the universal common-link and reference-point for the 1st-order to higher-order dynamics, and from single-entities to multiple-entities and thus, it allows the all for one and one for all unity theory to "integrate" simple and complex systems. Its applications include the construction of a dose-effect curve with a theoretical minimum of only two data points if they are accurately determined; quantification of synergism or antagonism at all dose and effect levels; the low-dose risk assessment for carcinogens, toxic substances or radiation; and the determination of competitiveness and exclusivity for receptor binding. Since the MEE algorithm allows the reduced requirement of the number of data points for small size experimentation, and yields quantitative bioinformatics, it points to the deterministic, efficient, low-cost biomedical research and drug discovery, and ethical planning for clinical trials. It is concluded that the contemporary biomedical sciences would greatly benefit from the mass-action law based "Green Revolution".

Exo-Dye-based assay for rapid, inexpensive, and sensitive detection of DNA-binding proteins.

PubMed

Chen, Zaozao; Ji, Meiju; Hou, Peng; Lu, Zuhong

2006-07-07

We reported herein a rapid, inexpensive, and sensitive technique for detecting sequence-specific DNA-binding proteins. In this technique, the common exonuclease III (ExoIII) footprinting assay is coupled with simple SYBR Green I staining for monitoring the activities of DNA-binding proteins. We named this technique as ExoIII-Dye-based assay. In this assay, a duplex probe was designed to detect DNA-binding protein. One side of the probe contains one protein-binding site, and another side of it contains five protruding bases at 3' end for protection from ExoIII digestion. If a target protein is present, it will bind to binding sites of probe and produce a physical hindrance to ExoIII, which protects the duplex probe from digestion of ExoIII. SYBR Green I will bind to probe, which results in high fluorescence intensity. On the contrary, in the absence of the target protein, the naked duplex probe will be degraded by ExoIII. SYBR Green I will be released, which results in a low fluorescence intensity. In this study, we employed this technique to successfully detect transcription factor NF-kappaB in crude cell extracts. Moreover, it could also be used to evaluate the binding affinity of NF-kappaB. This technique has therefore wide potential application in research, medical diagnosis, and drug discovery.

Shining a light on LAMP assays--a comparison of LAMP visualization methods including the novel use of berberine.

PubMed

Fischbach, Jens; Xander, Nina Carolin; Frohme, Marcus; Glökler, Jörn Felix

2015-04-01

The need for simple and effective assays for detecting nucleic acids by isothermal amplification reactions has led to a great variety of end point and real-time monitoring methods. Here we tested direct and indirect methods to visualize the amplification of potato spindle tuber viroid (PSTVd) by loop-mediated isothermal amplification (LAMP) and compared features important for one-pot in-field applications. We compared the performance of magnesium pyrophosphate, hydroxynaphthol blue (HNB), calcein, SYBR Green I, EvaGreen, and berberine. All assays could be used to distinguish between positive and negative samples in visible or UV light. Precipitation of magnesium-pyrophosphate resulted in a turbid reaction solution. The use of HNB resulted in a color change from violet to blue, whereas calcein induced a change from orange to yellow-green. We also investigated berberine as a nucleic acid-specific dye that emits a fluorescence signal under UV light after a positive LAMP reaction. It has a comparable sensitivity to SYBR Green I and EvaGreen. Based on our results, an optimal detection method can be chosen easily for isothermal real-time or end point screening applications.

Genome-Scale Metabolic Model for the Green Alga Chlorella vulgaris UTEX 395 Accurately Predicts Phenotypes under Autotrophic, Heterotrophic, and Mixotrophic Growth Conditions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zuniga, Cristal; Li, Chien -Ting; Huelsman, Tyler

The green microalgae Chlorella vulgaris has been widely recognized as a promising candidate for biofuel production due to its ability to store high lipid content and its natural metabolic versatility. Compartmentalized genome-scale metabolic models constructed from genome sequences enable quantitative insight into the transport and metabolism of compounds within a target organism. These metabolic models have long been utilized to generate optimized design strategies for an improved production process. Here, we describe the reconstruction, validation, and application of a genome-scale metabolic model for C. vulgaris UTEX 395, iCZ843. The reconstruction represents the most comprehensive model for any eukaryotic photosynthetic organismmore » to date, based on the genome size and number of genes in the reconstruction. The highly curated model accurately predicts phenotypes under photoautotrophic, heterotrophic, and mixotrophic conditions. The model was validated against experimental data and lays the foundation for model-driven strain design and medium alteration to improve yield. Calculated flux distributions under different trophic conditions show that a number of key pathways are affected by nitrogen starvation conditions, including central carbon metabolism and amino acid, nucleotide, and pigment biosynthetic pathways. Moreover, model prediction of growth rates under various medium compositions and subsequent experimental validation showed an increased growth rate with the addition of tryptophan and methionine.« less

Genome-Scale Metabolic Model for the Green Alga Chlorella vulgaris UTEX 395 Accurately Predicts Phenotypes under Autotrophic, Heterotrophic, and Mixotrophic Growth Conditions

DOE PAGES

Zuniga, Cristal; Li, Chien -Ting; Huelsman, Tyler; ...

2016-07-02

The green microalgae Chlorella vulgaris has been widely recognized as a promising candidate for biofuel production due to its ability to store high lipid content and its natural metabolic versatility. Compartmentalized genome-scale metabolic models constructed from genome sequences enable quantitative insight into the transport and metabolism of compounds within a target organism. These metabolic models have long been utilized to generate optimized design strategies for an improved production process. Here, we describe the reconstruction, validation, and application of a genome-scale metabolic model for C. vulgaris UTEX 395, iCZ843. The reconstruction represents the most comprehensive model for any eukaryotic photosynthetic organismmore » to date, based on the genome size and number of genes in the reconstruction. The highly curated model accurately predicts phenotypes under photoautotrophic, heterotrophic, and mixotrophic conditions. The model was validated against experimental data and lays the foundation for model-driven strain design and medium alteration to improve yield. Calculated flux distributions under different trophic conditions show that a number of key pathways are affected by nitrogen starvation conditions, including central carbon metabolism and amino acid, nucleotide, and pigment biosynthetic pathways. Moreover, model prediction of growth rates under various medium compositions and subsequent experimental validation showed an increased growth rate with the addition of tryptophan and methionine.« less

Upconversion-pumped luminescence efficiency of rare-earth-doped hosts sensitized with trivalent ytterbium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Page, R.H.; Schaffers, K.I.; Waide, P.A.

We discuss the upconversion luminescence efficiencies of phosphors that generate red, green, and blue light. The phosphors studied are single crystals and powders co-doped with Er{sup 3+} and Yb{sup 3+}, and with Tm{sup 3+} and Yb{sup 3+}. The Yb ions are pumped near 980 nm; transfers of two or three quanta to the co-doped rare earth ion generate visible luminescence. The main contribution embodied in this work is the quantitative measurement of this upconversion efficiency, based on the use of a calibrated integrating sphere, determination of the fraction of pump light absorbed, and careful control of the pump laser beammore » profile. The green phosphors are the most efficient, yielding efficiency values as high as 4 %, with the red and blue materials giving 1 - 2 %. Saturation was observed in all cases, suggesting that populations of upconversion steps of the ions are maximized at higher power. Quasi-CW modeling of the intensity- dependent upconversion efficiency was attempted; input data included level lifetimes, transition cross sections, and cross-relaxation rate coefficients. The saturation of the Yb,Er:fluoride media is explained as the pumping of Er{sup 3+} ions into a bottleneck (long-lived state)- the {sup 4}I{sub 13/2} metastable level, making them unavailable for further excitation transfer. 32 refs., 5 figs., 3 tabs.« less

Genome-Scale Metabolic Model for the Green Alga Chlorella vulgaris UTEX 395 Accurately Predicts Phenotypes under Autotrophic, Heterotrophic, and Mixotrophic Growth Conditions.

PubMed

Zuñiga, Cristal; Li, Chien-Ting; Huelsman, Tyler; Levering, Jennifer; Zielinski, Daniel C; McConnell, Brian O; Long, Christopher P; Knoshaug, Eric P; Guarnieri, Michael T; Antoniewicz, Maciek R; Betenbaugh, Michael J; Zengler, Karsten

2016-09-01

The green microalga Chlorella vulgaris has been widely recognized as a promising candidate for biofuel production due to its ability to store high lipid content and its natural metabolic versatility. Compartmentalized genome-scale metabolic models constructed from genome sequences enable quantitative insight into the transport and metabolism of compounds within a target organism. These metabolic models have long been utilized to generate optimized design strategies for an improved production process. Here, we describe the reconstruction, validation, and application of a genome-scale metabolic model for C. vulgaris UTEX 395, iCZ843. The reconstruction represents the most comprehensive model for any eukaryotic photosynthetic organism to date, based on the genome size and number of genes in the reconstruction. The highly curated model accurately predicts phenotypes under photoautotrophic, heterotrophic, and mixotrophic conditions. The model was validated against experimental data and lays the foundation for model-driven strain design and medium alteration to improve yield. Calculated flux distributions under different trophic conditions show that a number of key pathways are affected by nitrogen starvation conditions, including central carbon metabolism and amino acid, nucleotide, and pigment biosynthetic pathways. Furthermore, model prediction of growth rates under various medium compositions and subsequent experimental validation showed an increased growth rate with the addition of tryptophan and methionine. © 2016 American Society of Plant Biologists. All rights reserved.

Genome-Scale Metabolic Model for the Green Alga Chlorella vulgaris UTEX 395 Accurately Predicts Phenotypes under Autotrophic, Heterotrophic, and Mixotrophic Growth Conditions1

PubMed Central

Zuñiga, Cristal; Li, Chien-Ting; Zielinski, Daniel C.; Guarnieri, Michael T.; Antoniewicz, Maciek R.; Zengler, Karsten

2016-01-01

The green microalga Chlorella vulgaris has been widely recognized as a promising candidate for biofuel production due to its ability to store high lipid content and its natural metabolic versatility. Compartmentalized genome-scale metabolic models constructed from genome sequences enable quantitative insight into the transport and metabolism of compounds within a target organism. These metabolic models have long been utilized to generate optimized design strategies for an improved production process. Here, we describe the reconstruction, validation, and application of a genome-scale metabolic model for C. vulgaris UTEX 395, iCZ843. The reconstruction represents the most comprehensive model for any eukaryotic photosynthetic organism to date, based on the genome size and number of genes in the reconstruction. The highly curated model accurately predicts phenotypes under photoautotrophic, heterotrophic, and mixotrophic conditions. The model was validated against experimental data and lays the foundation for model-driven strain design and medium alteration to improve yield. Calculated flux distributions under different trophic conditions show that a number of key pathways are affected by nitrogen starvation conditions, including central carbon metabolism and amino acid, nucleotide, and pigment biosynthetic pathways. Furthermore, model prediction of growth rates under various medium compositions and subsequent experimental validation showed an increased growth rate with the addition of tryptophan and methionine. PMID:27372244

A Simplified Undergraduate Laboratory Experiment to Evaluate the Effect of the Ionic Strength on the Equilibrium Concentration Quotient of the Bromcresol Green Dye

ERIC Educational Resources Information Center

Rodriguez, Hernan B.; Mirenda, Martin

2012-01-01

A modified laboratory experiment for undergraduate students is presented to evaluate the effects of the ionic strength, "I", on the equilibrium concentration quotient, K[subscript c], of the acid-base indicator bromcresol green (BCG). The two-step deprotonation of the acidic form of the dye (sultone form), as it is dissolved in water, yields…

Determination of catechins in matcha green tea by micellar electrokinetic chromatography.

PubMed

Weiss, David J; Anderton, Christopher R

2003-09-05

Catechins in green tea are known to have many beneficial health properties. Recently, it has been suggested that matcha has greater potential health benefits than other green teas. Matcha is a special powdered green tea used in the Japanese tea ceremony. However, there has been no investigation to quantitate the catechin intake from matcha compared to common green teas. We have developed a rapid method of analysis of five catechins and caffeine in matcha using micellar electrokinetic chromatography. Results are presented for water and methanol extractions of matcha compared with water extraction of a popular green tea. Using a mg catechin/g of dry leaf comparison, results indicate that the concentration of epigallocatechin gallate (EGCG) available from drinking matcha is 137 times greater than the amount of EGCG available from China Green Tips green tea, and at least three times higher than the largest literature value for other green teas.

Spectrally resolved laser interference microscopy

NASA Astrophysics Data System (ADS)

Butola, Ankit; Ahmad, Azeem; Dubey, Vishesh; Senthilkumaran, P.; Singh Mehta, Dalip

2018-07-01

We developed a new quantitative phase microscopy technique, namely, spectrally resolved laser interference microscopy (SR-LIM), with which it is possible to quantify multi-spectral phase information related to biological specimens without color crosstalk using a color CCD camera. It is a single shot technique where sequential switched on/off of red, green, and blue (RGB) wavelength light sources are not required. The method is implemented using a three-wavelength interference microscope and a customized compact grating based imaging spectrometer fitted at the output port. The results of the USAF resolution chart while employing three different light sources, namely, a halogen lamp, light emitting diodes, and lasers, are discussed and compared. The broadband light sources like the halogen lamp and light emitting diodes lead to stretching in the spectrally decomposed images, whereas it is not observed in the case of narrow-band light sources, i.e. lasers. The proposed technique is further successfully employed for single-shot quantitative phase imaging of human red blood cells at three wavelengths simultaneously without color crosstalk. Using the present technique, one can also use a monochrome camera, even though the experiments are performed using multi-color light sources. Finally, SR-LIM is not only limited to RGB wavelengths, it can be further extended to red, near infra-red, and infra-red wavelengths, which are suitable for various biological applications.

Laser characteristics at 1535 nm and thermal effects of an Er:Yb phosphate glass microchip pumped by Ti:sapphire laser

NASA Astrophysics Data System (ADS)

Cai, Zhiping; Chardon, Alain; Xu, Huiying; Féron, Patrice; Michel Stéphan, Guy

2002-03-01

An Er:Yb codoped phosphate glass microchip laser has been studied under pumping with a Ti:sapphire laser ranging from 945 to 990 nm. The characteristics (threshold, slope efficiency) are first described for an optimized laser. The gain spectrum is calculated for the transition 4I13/2→ 4I15/2 around 1535 nm from fundamental spectroscopic data and from experimental results. Red-shift effect on the frequency of a single mode is experimentally observed when the pump power is increased, originating from thermal effects. Temperature inside the microchip cavity and thermal expansion coefficient were determined by employing the intensity ratio of two green upconversion emission line centered at 530 and 554 nm, respectively, which quantitatively explain this red shift.

A new numerical algorithm for the analytic continuation of Green`s functions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Natoli, V.D.; Cohen, M.H.; Fornberg, B.

1996-06-01

The need to calculate the spectral properties of a Hermitian operation H frequently arises in the technical sciences. A common approach to its solution involves the construction of the Green`s function operator G(z) = [z - H]{sup -1} in the complex z plane. For example, the energy spectrum and other physical properties of condensed matter systems can often be elegantly and naturally expressed in terms of the Kohn-Sham Green`s functions. However, the nonanalyticity of resolvents on the real axis makes them difficult to compute and manipulate. The Herglotz property of a Green`s function allows one to calculate it along anmore » arc with a small but finite imaginary part, i.e., G(x + iy), and then to continue it to the real axis to determine quantities of physical interest. In the past, finite-difference techniques have been used for this continuation. We present here a fundamentally new algorithm based on the fast Fourier transform which is both simpler and more effective. 14 refs., 9 figs.« less

An effective method for the quantitative detection of porcine endogenous retrovirus in pig tissues.

PubMed

Zhang, Peng; Yu, Ping; Wang, Wei; Zhang, Li; Li, Shengfu; Bu, Hong

2010-05-01

Xenotransplantation shows great promise for providing a virtually limitless supply of cells, tissues, and organs for a variety of therapeutical procedures. However, the potential of porcine endogenous retrovirus (PERV) as a human-tropic pathogen, particularly as a public health risk, is a major concern for xenotransplantation. This study focus on the detection of copy number in various tissues and organs in Banna Minipig Inbreed (BMI) from 2006 to 2007 in West China Hospital, Sichuan University. Real-time quantitative polymerase chain reaction (SYBR Green I) was performed in this study. The results showed that the pol gene had the most copy number in tissues compared with gag, envA, and envB. Our experiment will offer a rapid and accurate method for the detection of the copy number in various tissues and was especially suitable for the selection of tissues or organs in future clinical xenotransplantation.

UHPLC determination of catechins for the quality control of green tea.

PubMed

Naldi, Marina; Fiori, Jessica; Gotti, Roberto; Périat, Aurélie; Veuthey, Jean-Luc; Guillarme, Davy; Andrisano, Vincenza

2014-01-01

An ultra-high performance liquid chromatography (UHPLC) with UV detection method was developed for the fast quantitation of the most represented and biologically important green tea catechins and caffeine. UHPLC system was equipped with C18 analytical column (50mm×2.1mm, 1.8μm), utilizing a mobile phase composed of pH 2.5 triethanolamine phosphate buffer (0.1M) and acetonitrile in a gradient elution mode; under these conditions six major catechins and caffeine were separated in a 3min run. The method was fully validated in terms of precision, detection and quantification limits, linearity, accuracy, and it was applied to the identification and quantification of catechins and caffeine present in green tea infusions. In particular, commercially available green tea leaves samples of different geographical origin (Sencha, Ceylon Green and Lung Ching) were used for infusion preparations (water at 85°C for 15min). The selectivity of the developed UHPLC method was confirmed by comparison with UHPLC-MS/MS analysis. The recovery of the main six catechins and caffeine on the three analyzed commercial tea samples ranged from 94 to 108% (n=3). Limits of detection (LOD) were comprised in the range 0.1-0.4μgmL(-1). An orthogonal micellar electrokinetic (MEKC) method was applied for comparative purposes on selectivity and quantitative data. The combined use of the results obtained by the two techniques allowed for a fast confirmation on quantitative characterization of commercial samples. Copyright © 2013 Elsevier B.V. All rights reserved.

The Promotion Strategy of Green Construction Materials: A Path Analysis Approach.

PubMed

Huang, Chung-Fah; Chen, Jung-Lu

2015-10-14

As one of the major materials used in construction, cement can be very resource-consuming and polluting to produce and use. Compared with traditional cement processing methods, dry-mix mortar is more environmentally friendly by reducing waste production or carbon emissions. Despite the continuous development and promotion of green construction materials, only a few of them are accepted or widely used in the market. In addition, the majority of existing research on green construction materials focuses more on their physical or chemical characteristics than on their promotion. Without effective promotion, their benefits cannot be fully appreciated and realized. Therefore, this study is conducted to explore the promotion of dry-mix mortars, one of the green materials. This study uses both qualitative and quantitative methods. First, through a case study, the potential of reducing carbon emission is verified. Then a path analysis is conducted to verify the validity and predictability of the samples based on the technology acceptance model (TAM) in this study. According to the findings of this research, to ensure better promotion results and wider application of dry-mix mortar, it is suggested that more systematic efforts be invested in promoting the usefulness and benefits of dry-mix mortar. The model developed in this study can provide helpful references for future research and promotion of other green materials.

Evaluation of Green Infrastructure on Peak Flow Mitigation Focusing on the Connectivity of Impervious Areas

NASA Astrophysics Data System (ADS)

Seo, Y.; Hwang, J.; Kwon, Y.

2017-12-01

The existence of impervious areas is one of the most distinguishing characteristics of urban catchments. It decreases infiltration and increases direct runoff in urban catchments. The recent introduction of green infrastructure in urban catchments for the purpose of sustainable development contributes to the decrease of the directly connected impervious areas (DCIA) by isolating existing impervious areas and consequently, to the flood risk mitigation. This study coupled the width function-based instantaneous hydrograph (WFIUH), which is able to handle the spatial distribution of the impervious areas, with the concept of the DCIA to assess the impact of decreasing DCIA on the shape of direct runoff hydrographs. Using several scenarios for typical green infrastructure and corresponding changes of DCIA in a test catchment, this study evaluated the effect of green infrastructure on the shape of the resulting direct runoff hydrographs and peak flows. The results showed that the changes in the DCIA immediately affects the shape of the direct runoff hydrograph and decreases peak flows depending on spatial implementation scenarios. The quantitative assessment of the spatial distribution of impervious areas and also the changes to the DCIA suggests effective and well-planned green infrastructure can be introduced in urban environments for flood risk management.

Inequality, green spaces, and pregnant women: roles of ethnicity and individual and neighbourhood socioeconomic status.

PubMed

Dadvand, Payam; Wright, John; Martinez, David; Basagaña, Xavier; McEachan, Rosemary R C; Cirach, Marta; Gidlow, Christopher J; de Hoogh, Kees; Gražulevičienė, Regina; Nieuwenhuijsen, Mark J

2014-10-01

Evidence of the impact of green spaces on pregnancy outcomes is limited with no report on how this impact might vary by ethnicity. We investigated the association between residential surrounding greenness and proximity to green spaces and birth weight and explored the modification of this association by ethnicity and indicators of individual (maternal education) and neighbourhood (Index of Multiple Deprivation) socioeconomic status. Our study was based on 10,780 singleton live-births from the Born in Bradford cohort, UK (2007-2010). We defined residential surrounding greenness as average of satellite-based Normalized Difference Vegetation Index (NDVI) in buffers of 50 m, 100 m, 250 m, 500 m and 1000 m around each maternal home address. Residential proximity to green spaces was defined as living within 300 m of a green space with an area of ≥ 5000 m(2). We utilized mixed effects models to estimate adjusted change in birth weight associated with residential surrounding greenness as well as proximity to green spaces. We found a positive association between birth weight and residential surrounding greenness. Furthermore, we observed an interaction between ethnicity and residential surrounding greenness in that for White British participants there was a positive association between birth weight and residential surrounding greenness whereas for participants of Pakistani origin there was no such an association. For surrounding greenness in larger buffers (500 m and 1000 m) there were some indications of stronger associations for participants with lower education and those living in more deprived neighbourhoods which were not replicated for surrounding greenness in smaller buffer sizes (i.e. 50 m, 100 m, and 250 m). The findings for residential proximity to a green space were not conclusive. Our study showed that residential surrounding greenness is associated with better foetal growth and this association could vary between different ethnic and socioeconomic groups. Copyright © 2014 Elsevier Ltd. All rights reserved.

Extraction and Antibacterial Properties of Thyme Leaf Extracts: Authentic Practice of Green Chemistry

ERIC Educational Resources Information Center

Purcell, Sean C.; Pande, Prithvi; Lin, Yingxin; Rivera, Ernesto J.; Paw U, Latisha; Smallwood, Luisa M.; Kerstiens, Geri A.; Armstrong, Laura B.; Robak, MaryAnn T.; Baranger, Anne M.; Douskey, Michelle C.

2016-01-01

In this undergraduate analytical chemistry experiment, students quantitatively assess the antibacterial activity of essential oils found in thyme leaves ("Thymus vulgaris") in an authentic, research-like environment. This multi-week experiment aims to instill green chemistry principles as intrinsic to chemical problem solving. Students…

Health promoting outdoor environments--associations between green space, and health, health-related quality of life and stress based on a Danish national representative survey.

PubMed

Stigsdotter, Ulrika K; Ekholm, Ola; Schipperijn, Jasper; Toftager, Mette; Kamper-Jørgensen, Finn; Randrup, Thomas B

2010-06-01

To investigate the associations between green space and health, health-related quality of life and stress, respectively. Data were derived from the 2005 Danish Health Interview Survey and are based on a region-stratified random sample of 21,832 adults. Data were collected via face-to-face interviews followed by a self-administered questionnaire, including the SF-36, which measures eight dimensions of health and the Perceived Stress Scale, which measures self-reported stress. A total of 11,238 respondents completed the interview and returned the questionnaire. Multiple logistic regression analyses were performed to investigate the association between distance to green space and self-perceived stress. Danes living more than 1 km away from the nearest green space report poorer health and health-related quality of life, i.e. lower mean scores on all eight SF-36 dimensions of health than respondents living closer. Respondents living more than 1 km away from a green space have 1.42 higher odds of experiencing stress than do respondents living less than 300 m from a green space. Respondents not reporting stress are more likely to visit a green space than are respondents reporting stress. Reasons for visiting green spaces differ significantly depending on whether or not respondents experience stress. Respondents reporting stress are likely to use green spaces to reduce stress. An association between distance to a green space and health and health-related quality of life was found. Further, the results indicate awareness among Danes that green spaces may be of importance in managing stress and that green spaces may play an important role as health-promoting environments.

Improving green enrichment of virgin olive oil by oregano. Effects on antioxidants.

PubMed

Peñalvo, Gregorio Castañeda; Robledo, Virginia Rodríguez; Callado, Carolina Sánchez-Carnerero; Santander-Ortega, M J; Castro-Vázquez, L; Lozano, M Victoria; Arroyo-Jiménez, M M

2016-04-15

This work is about improvement of a maceration method in order to achieve a green process for the enrichment of virgin olive oil (VOO) with natural antioxidants, specifically from oregano leaves. This goal was accomplished after evaluating different mechanical methods, i.e. magnetic stirring, sonication, vertical stirring and sonication in combination with vertical stirring, for promoting the extraction of the antioxidants from oregano. The results obtained indicated that the best extraction procedure was vertical stirring at 1000 r.p.m. for 3 h. Therefore, these conditions were selected to enrich VOO with phenolic acids (mainly rosmarinic acid) and endogenous antioxidants (o-coumaric and vanillic acids), and further determine their stability at room temperature or under temperature stress (50°C) during 45 days. Quantitative analysis of rosmarinic, o-coumaric and vanillic acids was carried out by an off-line, solid phase extraction, capillary zone, electrophoresis method combined with diode-array detector (SPE-CE-DAD). Copyright © 2015 Elsevier Ltd. All rights reserved.

An Image Analysis Algorithm for Malaria Parasite Stage Classification and Viability Quantification

PubMed Central

Moon, Seunghyun; Lee, Sukjun; Kim, Heechang; Freitas-Junior, Lucio H.; Kang, Myungjoo; Ayong, Lawrence; Hansen, Michael A. E.

2013-01-01

With more than 40% of the world’s population at risk, 200–300 million infections each year, and an estimated 1.2 million deaths annually, malaria remains one of the most important public health problems of mankind today. With the propensity of malaria parasites to rapidly develop resistance to newly developed therapies, and the recent failures of artemisinin-based drugs in Southeast Asia, there is an urgent need for new antimalarial compounds with novel mechanisms of action to be developed against multidrug resistant malaria. We present here a novel image analysis algorithm for the quantitative detection and classification of Plasmodium lifecycle stages in culture as well as discriminating between viable and dead parasites in drug-treated samples. This new algorithm reliably estimates the number of red blood cells (isolated or clustered) per fluorescence image field, and accurately identifies parasitized erythrocytes on the basis of high intensity DAPI-stained parasite nuclei spots and Mitotracker-stained mitochondrial in viable parasites. We validated the performance of the algorithm by manual counting of the infected and non-infected red blood cells in multiple image fields, and the quantitative analyses of the different parasite stages (early rings, rings, trophozoites, schizonts) at various time-point post-merozoite invasion, in tightly synchronized cultures. Additionally, the developed algorithm provided parasitological effective concentration 50 (EC50) values for both chloroquine and artemisinin, that were similar to known growth inhibitory EC50 values for these compounds as determined using conventional SYBR Green I and lactate dehydrogenase-based assays. PMID:23626733

Integrated Modelling and Performance Analysis of Green Roof Technologies in Urban Environments

NASA Astrophysics Data System (ADS)

Liu, Xi; Mijic, Ana; Maksimovic, Cedo

2014-05-01

As a result of the changing global climate and increase in urbanisation, the behaviour of the urban environment has been significantly altered, causing an increase in both the frequency of extreme weather events, such as flooding and drought, and also the associated costs. Moreover, uncontrolled or inadequately planned urbanisation can exacerbate the damage. The Blue-Green Dream (BGD) project therefore develops a series of components for urban areas that link urban vegetated areas (green infrastructure) with existing urban water (blue) systems, which will enhance the synergy of urban blue and green systems and provide effective, multifunctional BGD solutions to support urban adaptation to future climatic changes. Coupled with new urban water management technologies and engineering, multifunctional benefits can be gained. Some of the technologies associated with BGD solutions include green roofs, swales that might deal with runoff more effectively and urban river restoration that can produce benefits similar to those produced from sustainable urban drainage systems (SUDS). For effective implementation of these technologies, however, appropriate tools and methodologies for designing and modelling BGD solutions are required to be embedded within urban drainage models. Although several software packages are available for modelling urban drainage, the way in which green roofs and other BGD solutions are integrated into these models is not yet fully developed and documented. This study develops a physically based mass and energy balance model to monitor, test and quantitatively evaluate green roof technology for integrated BGD solutions. The assessment of environmental benefits will be limited to three aspects: (1) reduction of the total runoff volume, (2) delay in the initiation of runoff, and (3) reduction of building energy consumption, rather than water quality, visual, social or economic impacts. This physically based model represents water and heat dynamics in a layered soil profile covered with vegetation which can be used to simulate the physical behaviour of different green roof systems in response to rainfall under various climatic conditions. Because it is a physically based model, this model could be generalised to other atmosphere-plant-soil systems. The validity of this mass and energy balance approach will be demonstrated by comparing its outcomes with observations from a green roof experimental site in London, UK.

Detection and Identification of Psilocybe cubensis DNA Using a Real-Time Polymerase Chain Reaction High Resolution Melt Assay.

PubMed

Cowan, Ashley F; Elkins, Kelly M

2017-12-01

Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.

The antioxidant property of chitosan green tea polyphenols complex induces transglutaminase activation in wound healing.

PubMed

Qin, Yao; Guo, Xing Wei; Li, Lei; Wang, Hong Wei; Kim, Wook

2013-06-01

The present study examined, for the first time, the in vitro wound healing potential of chitosan green tea polyphenols (CGP) complex based on the activation of transglutaminase (TGM) genes in epidermal morphogenesis. Response surface methodology was applied to determine the optimal processing condition that gave maximum extraction of green tea polyphenols. The antioxidant activity, scavenging ability, and chelating ability were studied and expressed as average EC50 values of CGP and other treatments. In silico analysis and gene coexpression network was subjected to the TGM sequences analysis. The temporal expressions of TGMs were profiled by semi-quantitative reverse transcription (RT)-PCR technology within 10 days after wounding and 2 days postwounding. CGP showed the effectiveness of antioxidant properties, and the observations of histopathological photography showed advanced tissue granulation and epithelialization formation by CGP treatment. In silico and coexpression analysis confirmed the regulation via TGM gene family in dermatological tissues. RT-PCR demonstrated increased levels of TGM1-3 expression induced by CGP treatment. The efficacy of CGP in wound healing based on these results may be ascribed to its antioxidant properties and activation of the expression of TGMs, and is, thus, essential for the facilitated repair of skin injury.

Accurate Quantitative Sensing of Intracellular pH based on Self-ratiometric Upconversion Luminescent Nanoprobe.

PubMed

Li, Cuixia; Zuo, Jing; Zhang, Li; Chang, Yulei; Zhang, Youlin; Tu, Langping; Liu, Xiaomin; Xue, Bin; Li, Qiqing; Zhao, Huiying; Zhang, Hong; Kong, Xianggui

2016-12-09

Accurate quantitation of intracellular pH (pH i ) is of great importance in revealing the cellular activities and early warning of diseases. A series of fluorescence-based nano-bioprobes composed of different nanoparticles or/and dye pairs have already been developed for pH i sensing. Till now, biological auto-fluorescence background upon UV-Vis excitation and severe photo-bleaching of dyes are the two main factors impeding the accurate quantitative detection of pH i . Herein, we have developed a self-ratiometric luminescence nanoprobe based on förster resonant energy transfer (FRET) for probing pH i , in which pH-sensitive fluorescein isothiocyanate (FITC) and upconversion nanoparticles (UCNPs) were served as energy acceptor and donor, respectively. Under 980 nm excitation, upconversion emission bands at 475 nm and 645 nm of NaYF 4 :Yb 3+ , Tm 3+ UCNPs were used as pH i response and self-ratiometric reference signal, respectively. This direct quantitative sensing approach has circumvented the traditional software-based subsequent processing of images which may lead to relatively large uncertainty of the results. Due to efficient FRET and fluorescence background free, a highly-sensitive and accurate sensing has been achieved, featured by 3.56 per unit change in pH i value 3.0-7.0 with deviation less than 0.43. This approach shall facilitate the researches in pH i related areas and development of the intracellular drug delivery systems.

Automatic registration of ICG images using mutual information and perfusion analysis

NASA Astrophysics Data System (ADS)

Kim, Namkug; Seo, Jong-Mo; Lee, June-goo; Kim, Jong Hyo; Park, Kwangsuk; Yu, Hyeong-Gon; Yu, Young Suk; Chung, Hum

2005-04-01

Introduction: Indocyanin green fundus angiographic images (ICGA) of the eyes is useful method in detecting and characterizing the choroidal neovascularization (CNV), which is the major cause of the blindness over 65 years of age. To investigate the quantitative analysis of the blood flow on ICGA, systematic approach for automatic registration of using mutual information and a quantitative analysis was developed. Methods: Intermittent sequential images of indocyanin green angiography were acquired by Heidelberg retinal angiography that uses the laser scanning system for the image acquisition. Misalignment of the each image generated by the minute eye movement of the patients was corrected by the mutual information method because the distribution of the contrast media on image is changing throughout the time sequences. Several region of interest (ROI) were selected by a physician and the intensities of the selected region were plotted according to the time sequences. Results: The registration of ICGA time sequential images is required not only translate transform but also rotational transform. Signal intensities showed variation based on gamma-variate function depending on ROIs and capillary vessels show more variance of signal intensity than major vessels. CNV showed intermediate variance of signal intensity and prolonged transit time. Conclusion: The resulting registered images can be used not only for quantitative analysis, but also for perfusion analysis. Various investigative approached on CNV using this method will be helpful in the characterization of the lesion and follow-up.

[A review of green roof performance towards management of roof runoff].

PubMed

Chen, Xiao-ping; Huang, Pei; Zhou, Zhi-xiang; Gao, Chi

2015-08-01

Green roof has a significant influence on reducing runoff volume, delaying runoff-yielding time, reducing the peak flow and improving runoff quality. This paper addressed the related research around the world and concluded from several aspects, i.e., the definition of green roof of different types, the mechanism how green roof manages runoff quantity and quality, the ability how green roof controls roof runoff, and the influence factors of green roof toward runoff quantity and quality. Afterwards, there was a need for more future work on research of green roof toward roof runoff, i.e., vegetation selection of green roof, efficient construction model selection of green roof, the regulating characteristics of green roof on roof runoff, the value assessment of green roof on roof runoff, analysis of source-sink function of green roof on the water pollutants of roof runoff and the research on the mitigation measures of roof runoff pollution. This paper provided a guideline to develop green roofs aiming to regulating roof runoff.

Frequency-doubled green picosecond laser based on K3B6O10Br nonlinear optical crystal

NASA Astrophysics Data System (ADS)

Meng, Luping; Zhang, Ling; Hou, Zhanyu; Wang, Lirong; Xu, Hui; Shi, Meng; Wang, Lingwu; Yang, Yingying; Qi, Yaoyao; He, Chaojian; Yu, Haijuan; Lin, Xuechun; Su, Fufang; Xia, Mingjun; Li, Rukang

2018-05-01

We report a frequency-doubled green picosecond (ps) laser based on K3B6O10Br (KBB) nonlinear optical crystal with cutting angle of θ = 34.7° and φ = 30°. Through intracavity frequency doubling using a type I phase-matched KBB crystal with dimensions of 4 mm × 4 mm × 13.2 mm, the average output power of 185.00 mW green ps laser was obtained with a repetition rate of 80 MHz and pulse width of 25.0 ps. In addition, we present external frequency doubling using KBB crystal. The average output power of 3.00 W green ps laser was generated with a repetition rate of 10 kHz and pulse width of 38.1 ps, which corresponds to a pulse energy of 0.30 mJ and a peak power 7.89 MW, respectively. The experimental results show that KBB crystal is a promising nonlinear optical material.

The Principalship: Essential Core Competencies for Instructional Leadership and Its Impact on School Climate

ERIC Educational Resources Information Center

Ross, Dorrell J.; Cozzens, Jeffry A.

2016-01-01

The purpose of this quantitative study was to investigate teachers' perceptions of principals' leadership behaviors influencing the schools' climate according to Green's (2010) ideologies of the 13 core competencies within the four dimensions of principal leadership. Data from the "Leadership Behavior Inventory" (Green, 2014) suggest 314…

Fatty Amide Determination in Neutral Molecular Fractions of Green Crude Hydrothermal Liquefaction Oils From Algal Biomass

DOE PAGES

Palardy, Oliver; Behnke, Craig; Laurens, Lieve M. L.

2017-07-05

Even though hydrothermal liquefaction (HTL) is a promising route to produce crude oils (referred to as 'green crude'), the molecular composition of the nitrogen fraction of such green crude oils is not fully understood. The goal of this work was to identify and quantify the fraction of fatty amides in green crude oils obtained from five different samples derived from Desmodesmus armatus, Tetraselmis sp., and Chlorella sp. biomass treated under different HTL conditions (260 or 340 degrees C as batch or continuous processes). The goal of this work was to elucidate the nature of the high nitrogen content of themore » green crude oils. We identified at least 19 distinct fatty amides present in green crude oils and quantified them based on relevant standards in purified fractions after functional group-based separation and enrichment. It was not known how much these compounds contributed to the oils or which molecular fraction they are associated with. We found that fatty amides exclusively partitioned with the neutral fraction of the oils and belonged mainly to one of five categories, based on their functional group substitution, i.e., fatty amides, monomethyl, dimethyl, monoethanolamide, and diethanolamide. The quantification of fatty amides in the neutral oil fraction was based on respective fatty amide standards, after verification of consistency in response factors between molecules with different substitutions of the amide group. Here, we found that the amount of fatty amides found in each of the five samples varied considerably and ranged between 1.4 and 3.0% of the green crude oils, with the highest levels detected in the sample with the highest oil content, after HTL of biomass derived from a nutrient deprived Chlorella sp. culture.« less

Self-potential method for characterizing streaming flows in the saturated and vadose zones: state of the art and limitations

NASA Astrophysics Data System (ADS)

Sailhac, P.

2005-12-01

Self-Potential (SP) method is sensitive not only to the water content, but, above all, to flow velocities within the underground porous medium. So it can be considered as a crucial help in hydrogeophysics. This is underlined by the so-called electrokinetic coupling and has been early used in geophysics (e.g. Bogoslovsky and Ogilvy, 1970) and hydrology (Abaza and Clyde 1969). During the last decade, both experimental and theoretical progresses have moved ahead SP to provide quantitative flow parameters. Now SP time and/or spatial variations can be used to monitor water fluxes during infiltration (e.g. Thony et al. 1997, Doussan et al. 2002, Darnet & Marquis 2004), seepage (Titov et al. 2000), or pumping (e.g. Fagerlund & Heinson 2003, Darnet et al. 2003, Revil et al. 2003). In order that SP is used by a larger community, it would be useful to recall the fundamentals, to review recent interpretation techniques in a simple framework and to precise their limitations. First considering flows in the saturated zone and a pumping experiment, I will show different interpretation techniques that are based upon Green function decompositions (e.g. wavelets, COP tomography of Patella, and iso-α line of Revil et al.). Classical application of theses techniques is underlined by the assumption of a constant electrical conductivity medium that involves uncertainty and bias in quantitative flow parameter estimates. For instance, the diffusive effect of a conductive shallow layer tends to increase the apparent depth of an underground flow source or sink. To correct this problem, one can use Green functions of a tabular medium in the COP tomography. In the complex case of unsaturated zone, the hydraulic and electric conductivities are depending on the water content. We will discuss on different soil models and different experiments that can be used for the monitoring of the infiltration and the characterisation of the soil hydraulic parameters.

Epitope mapping and targeted quantitation of the cardiac biomarker troponin by SID-MRM mass spectrometry.

PubMed

Zhao, Cheng; Trudeau, Beth; Xie, Helen; Prostko, John; Fishpaugh, Jeffrey; Ramsay, Carol

2014-06-01

The absolute quantitation of the targeted protein using MS provides a promising method to evaluate/verify biomarkers used in clinical diagnostics. In this study, a cardiac biomarker, troponin I (TnI), was used as a model protein for method development. The epitope peptide of TnI was characterized by epitope excision followed with LC/MS/MS method and acted as the surrogate peptide for the targeted protein quantitation. The MRM-based MS assay using a stable internal standard that improved the selectivity, specificity, and sensitivity of the protein quantitation. Also, plasma albumin depletion and affinity enrichment of TnI by anti-TnI mAb-coated microparticles reduced the sample complexity, enhanced the dynamic range, and further improved the detecting sensitivity of the targeted protein in the biological matrix. Therefore, quantitation of TnI, a low abundant protein in human plasma, has demonstrated the applicability of the targeted protein quantitation strategy through its epitope peptide determined by epitope mapping method. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

2D shear-wave ultrasound elastography (SWE) evaluation of ablation zone following radiofrequency ablation of liver lesions: is it more accurate?

PubMed Central

Bo, Xiao W; Li, Xiao L; Guo, Le H; Li, Dan D; Liu, Bo J; Wang, Dan; He, Ya P; Xu, Xiao H

2016-01-01

Objective: To evaluate the usefulness of two-dimensional quantitative ultrasound shear-wave elastography (2D-SWE) [i.e. virtual touch imaging quantification (VTIQ)] in assessing the ablation zone after radiofrequency ablation (RFA) for ex vivo swine livers. Methods: RFA was performed in 10 pieces of fresh ex vivo swine livers with a T20 electrode needle and 20-W output power. Conventional ultrasound, conventional strain elastography (SE) and VTIQ were performed to depict the ablation zone 0 min, 10 min, 30 min and 60 min after ablation. On VTIQ, the ablation zones were evaluated qualitatively by evaluating the shear-wave velocity (SWV) map and quantitatively by measuring the SWV. The ultrasound, SE and VTIQ results were compared against gross pathological and histopathological specimens. Results: VTIQ SWV maps gave more details about the ablation zone, the central necrotic zone appeared as red, lateral necrotic zone as green and transitional zone as light green, from inner to exterior, while the peripheral unablated liver appeared as blue. Conventional ultrasound and SE, however, only marginally depicted the whole ablation zone. The volumes of the whole ablation zone (central necrotic zone + lateral necrotic zone + transitional zone) and necrotic zone (central necrotic zone + lateral necrotic zone) measured by VTIQ showed excellent correlation (r = 0.915, p < 0.001, and 0.856, p = 0.002, respectively) with those by gross pathological specimen, whereas both conventional ultrasound and SE underestimated the volume of the whole ablation zone. The SWV values of the central necrotic zone, lateral necrotic zone, transitional zone and unablated liver parenchyma were 7.54–8.03 m s−1, 5.13–5.28 m s−1, 3.31–3.53 m s−1 and 2.11–2.21 m s−1, respectively (p < 0.001 for all the comparisons). The SWV value for each ablation zone did not change significantly at different observation times within an hour after RFA (all p > 0.05). Conclusion: The quantitative 2D-SWE of VTIQ is useful for the depiction of the ablation zone after RFA and it facilitates discrimination of different areas in the ablation zone qualitatively and quantitatively. This elastography technique might be useful for the therapeutic response evaluation instantly after RFA. Advances in knowledge: A new quantitative 2D-SWE (i.e. VTIQ) for evaluation treatment response after RFA is demonstrated. It facilitates discrimination of the different areas in the ablation zone qualitatively and quantitatively and may be useful for the therapeutic response evaluation instantly after RFA in the future. PMID:26933911

Wavelength dispersive X-ray fluorescence analysis using fundamental parameter approach of Catha edulis and other related plant samples

NASA Astrophysics Data System (ADS)

Shaltout, Abdallah A.; Moharram, Mohammed A.; Mostafa, Nasser Y.

2012-01-01

This work is the first attempt to quantify trace elements in the Catha edulis plant (Khat) with a fundamental parameter approach. C. edulis is a famous drug plant in east Africa and Arabian Peninsula. We have previously confirmed that hydroxyapatite represents one of the main inorganic compounds in the leaves and stalks of C. edulis. Comparable plant leaves from basil, mint and green tea were included in the present investigation as well as trifolium leaves were included as a non-related plant. The elemental analyses of the plants were done by Wavelength Dispersive X-Ray Fluorescence (WDXRF) spectroscopy. Standard-less quantitative WDXRF analysis was carried out based on the fundamental parameter approaches. According to the standard-less analysis algorithms, there is an essential need for an accurate determination of the amount of organic material in the sample. A new approach, based on the differential thermal analysis, was successfully used for the organic material determination. The obtained results based on this approach were in a good agreement with the commonly used methods. Depending on the developed method, quantitative analysis results of eighteen elements including; Al, Br, Ca, Cl, Cu, Fe, K, Na, Ni, Mg, Mn, P, Rb, S, Si, Sr, Ti and Zn were obtained for each plant. The results of the certified reference materials of green tea (NCSZC73014, China National Analysis Center for Iron and Steel, Beijing, China) confirmed the validity of the proposed method.

Optimisation of a green gas supply chain--a review.

PubMed

Bekkering, J; Broekhuis, A A; van Gemert, W J T

2010-01-01

In this review the knowledge status of and future research options on a green gas supply based on biogas production by co-digestion is explored. Applications and developments of the (bio)gas supply in The Netherlands have been considered, whereafter literature research has been done into the several stages from production of dairy cattle manure and biomass to green gas injection into the gas grid. An overview of a green gas supply chain has not been made before. In this study it is concluded that on installation level (micro-level) much practical knowledge is available and on macro-level knowledge about availability of biomass. But on meso-level (operations level of a green gas supply) very little research has been done until now. Future research should include the modeling of a green gas supply chain on an operations level, i.e. questions must be answered as where to build digesters based on availability of biomass. Such a model should also advise on technology of upgrading depending on scale factors. Future research might also give insight in the usability of mixing (partly upgraded) biogas with natural gas. The preconditions for mixing would depend on composition of the gas, the ratio of gases to be mixed and the requirements on the mixture.

Neighborhood-based PA and its environmental correlates: a GIS- and GPS based cross-sectional study in the Netherlands.

PubMed

Jansen, Marijke; Kamphuis, Carlijn B M; Pierik, Frank H; Ettema, Dick F; Dijst, Martin J

2018-02-09

To improve our understanding of the neighborhood environment - physical activity (PA) relationship, it is of importance to assess associations between neighborhood environmental characteristics and neighborhood-based PA. Participants' (N = 308; 45-65 years) light PA (LPA) and moderate-vigorous PA (MVPA) within a 400, 800, and 1600 m buffer around adults' homes was measured using accelerometers and GPS-devices. Land use data in ArcGIS provided neighborhood characteristics for the same buffers. Multilevel linear regression models, adjusted for socio-demographic variables and attitude towards PA, were used to assess associations of objective neighborhood characteristics with neighborhood-based LPA and MVPA. LPA was positively associated with the proportions of roads (within a 400 m buffer), and negatively associated with the proportions of recreational areas (within an 800 m buffer), and the proportion of green space (within the 800 m and 1600 m buffers). Multiple characteristics of 400 m buffers were positively associated with MVPA, i.e. proportions of green space, blue space, residences, shops and foodservice industry, sports terrain, and public social-cultural facilities. Also, characteristics of larger buffers were positively associated with MVPA, i.e. the proportions of shops and foodservice industry, sports terrain, and blue space (within an 800 m buffer), and the proportion of public social-cultural facilities (within the 800 m and 1600 m buffers). Objective neighborhood characteristics of smaller as well as larger sized buffers were associated with neighborhood-based LPA and MVPA. Green and blue spaces seem to be of particular importance for PA in the smallest buffer, i.e. in the direct surrounding of adults' homes.

Discipline in Organizations: A Field Study.

DTIC Science & Technology

1982-09-01

with the job and supervisor? In this study we will also investigate discipline from an attributional perspective. Mitchell, Green , & Wood (I%1) hove...representing two major d mr nm stability and locus of control. Mitchell, Green , & Wood (1980 and Green & Mitchell (I0) preent a discussion of the kinds...Attributions to external causes prompt the leader to focus on changing the situation. In addition, Mitchell, Green , & Wood (1981) indicate that if the

Microfluidic paper-based device for colorimetric determination of glucose based on a metal-organic framework acting as peroxidase mimetic.

PubMed

Ortiz-Gómez, Inmaculada; Salinas-Castillo, Alfonso; García, Amalia García; Álvarez-Bermejo, José Antonio; de Orbe-Payá, Ignacio; Rodríguez-Diéguez, Antonio; Capitán-Vallvey, Luis Fermín

2017-12-13

This work presents a microfluidic paper-based analytical device (μPAD) for glucose determination using a supported metal-organic framework (MOF) acting as a peroxidase mimic. The catalytic action of glucose oxidase (GOx) on glucose causes the formation of H 2 O 2 , and the MOF causes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to form a blue-green product with an absorption peak at 650 nm in the detection zone. A digital camera and the iOS feature of a smartphone are used for the quantitation of glucose with the S coordinate of the HSV color space as the analytical parameter. Different factors such as the concentration of TMB, GOx and MOF, pH and buffer, sample volume, reaction time and reagent position in the μPAD were optimized. Under optimal conditions, the value for the S coordinate increases linearly up to 150 μmol·L -1 glucose concentrations, with a 2.5 μmol·L -1 detection limit. The μPAD remains stable for 21 days under conventional storage conditions. Such an enzyme mimetic-based assay to glucose determination using Fe-MIL-101 MOF implemented in a microfluidic paper-based device possesses advantages over enzyme-based assays in terms of costs, durability and stability compared to other existing glucose determination methods. The procedure was applied to the determination of glucose in (spiked) serum and urine. Graphical abstract Schematic representation of microfluidic paper-based analytical device using metal-organic framework as a peroxidase mimic for colorimetric glucose detection with digital camera or smartphone and iOS app readout.

Belgian and Spanish consumption data and consumer handling practices for fresh fruits and vegetables useful for further microbiological and chemical exposure assessment.

PubMed

Jacxsens, L; Ibañez, I Castro; Gómez-López, V M; Fernandes, J Araujo; Allende, A; Uyttendaele, M; Huybrechts, I

2015-04-01

A consumer survey was organized in Spain and Belgium to obtain consumption data and to gain insight into consumer handling practices for fresh vegetables consumed raw or minimally processed (i.e., heads of leafy greens, bell peppers, tomatoes, fresh herbs, and precut and packed leafy greens) and fruits to be consumed without peeling (i.e., apples, grapes, strawberries, raspberries, other berries, fresh juices, and precut mixed fruit). This information can be used for microbiological and/or chemical food safety research. After extensive cleanup of rough databases for missing and extreme values and age correction, information from 583 respondents from Spain and 1,605 respondents from Belgium (18 to 65 years of age) was retained. Daily intake (grams per day) was calculated taking into account frequency and seasonality of consumption, and distributions were obtained that can be used in quantitative risk assessment for chemical hazards with chronic effects on human health. Data also were recalculated to obtain discrete distributions of consumption per portion and the corresponding frequency of consumption, which can be used in acute microbiological risk assessment or outbreak investigations. The ranked median daily consumption of fruits and vegetables was similar in Spain and Belgium: apple > strawberry > grapes > strawberries and raspberries; and tomatoes > leafy greens > bell peppers > fresh herbs. However, vegetable consumption was higher (in terms of both portion and frequency of consumption) in Spain than in Belgium, whereas the opposite was found for fruit consumption. Regarding consumer handling practices related to storage time and method, Belgian consumers less frequently stored their fresh produce in a refrigerator and did so for shorter times compared with Spanish consumers. Washing practices for lettuce heads and packed leafy greens also were different. The survey revealed differences between these two countries in consumption and consumer handling practices, which can have an impact on outcomes of future microbiological or chemical risk assessment studies.

Single shot white light interference microscopy with colour fringe analysis for quantitative phase imaging of biological cells

NASA Astrophysics Data System (ADS)

Srivastava, Vishal; Mehta, D. S.

2013-02-01

To quantitatively obtain the phase map of Onion and human red blood cell (RBC) from white light interferogram we used Hilbert transform color fringe analysis technique. The three Red, Blue and Green color components are decomposed from single white light interferogram and Refractive index profile for Red, Blue and Green colour were computed in a completely non-invasive manner for Onion and human RBC. The present technique might be useful for non-invasive determination of the refractive index variation within cells and tissues and morphological features of sample with ease of operation and low cost.

A New Green Method for the Quantitative Analysis of Enrofloxacin by Fourier-Transform Infrared Spectroscopy.

PubMed

Rebouças, Camila Tavares; Kogawa, Ana Carolina; Salgado, Hérida Regina Nunes

2018-05-18

Background: A green analytical chemistry method was developed for quantification of enrofloxacin in tablets. The drug, a second-generation fluoroquinolone, was first introduced in veterinary medicine for the treatment of various bacterial species. Objective: This study proposed to develop, validate, and apply a reliable, low-cost, fast, and simple IR spectroscopy method for quantitative routine determination of enrofloxacin in tablets. Methods: The method was completely validated according to the International Conference on Harmonisation guidelines, showing accuracy, precision, selectivity, robustness, and linearity. Results: It was linear over the concentration range of 1.0-3.0 mg with correlation coefficients >0.9999 and LOD and LOQ of 0.12 and 0.36 mg, respectively. Conclusions: Now that this IR method has met performance qualifications, it can be adopted and applied for the analysis of enrofloxacin tablets for production process control. The validated method can also be utilized to quantify enrofloxacin in tablets and thus is an environmentally friendly alternative for the routine analysis of enrofloxacin in quality control. Highlights: A new green method for the quantitative analysis of enrofloxacin by Fourier-Transform Infrared spectroscopy was validated. It is a fast, clean and low-cost alternative for the evaluation of enrofloxacin tablets.

Detection of mixed infection level of Plasmodium falciparum and Plasmodium vivax by SYBR Green I-based real-time PCR in North Gondar, north-west Ethiopia.

PubMed

Tajebe, Addimas; Magoma, Gabriel; Aemero, Mulugeta; Kimani, Francis

2014-10-18

Malaria is caused by five Plasmodium species and transmitted by anopheline mosquitoes. It occurs in single and mixed infections. Mixed infection easily leads to misdiagnosis. Accurate detection of malaria species is vital. Therefore, the study was conducted to determine the level of mixed infection and misdiagnosis of malaria species in the study area using SYBR Green I-based real time PCR. The study was conducted in seven health centres from North Gondar, north-west Ethiopia. The data of all febrile patients, who attended the outpatient department for malaria diagnosis, from October to December 2013, was recorded. Dried blood spots were prepared from 168 positive samples for molecular re-evaluation. Parasite DNA was extracted using a commercial kit and Plasmodium species were re-evaluated with SYBR Green I-based real time PCR to detect mixed infections and misdiagnosed mono-infections. Among 7343 patients who were diagnosed for malaria in six study sites within the second quarter of the Ethiopian fiscal year (2013) 1802 (24.54%) were positive for malaria parasite. Out of this, 1,216 (67.48%) Plasmodium falciparum, 553 (30.68%) Plasmodium vivax and 33 (1.8%) mixed infections of both species were recorded. The result showed high prevalence of P. falciparum and P. vivax, but very low prevalence of mixed infections. Among 168 samples collected on dried blood spot 7 (4.17%) were P. vivax, 158 (94.05%) were P. falciparum and 3 (1.80%) were mixed infections of both species. After re-evaluation 10 (5.95%) P. vivax, 112 (66.67%) P. falciparum, 21 (12.50%) P. falciparum + P. vivax mixed infection, and 17 (10.12%) Plasmodium ovale positive rate was recorded. The re-evaluation showed high level of mixed infection, and misdiagnosis of P. ovale and P. vivax. The result shows that P. falciparum prevalence is higher than P. vivax in the study area. The results, obtained from SYBR Green I-based real time PCR, indicated that the diagnosis efficiency of microscopy is very low for species-specific and mixed infection detection. Therefore, real time PCR-based species diagnosis should be applied for clinical diagnosis and quality control purposes in order to prevent the advent of drug resistant strains due to misdiagnosis and mistreatment.

40 CFR 93.123 - Procedures for determining localized CO, PM10, and PM2.5 concentrations (hot-spot analysis).

Code of Federal Regulations, 2011 CFR

2011-07-01

... (“Localized CO, PM10, and PM2.5 violations”) must be based on quantitative analysis using the applicable air... § 93.116 may be based on either: (i) Quantitative methods that represent reasonable and common... hot-spot analyses. (1) The hot-spot demonstration required by § 93.116 must be based on quantitative...

40 CFR 93.123 - Procedures for determining localized CO, PM10, and PM2.5 concentrations (hot-spot analysis).

Code of Federal Regulations, 2013 CFR

2013-07-01

... (“Localized CO, PM10, and PM2.5 violations”) must be based on quantitative analysis using the applicable air... § 93.116 may be based on either: (i) Quantitative methods that represent reasonable and common... hot-spot analyses. (1) The hot-spot demonstration required by § 93.116 must be based on quantitative...

40 CFR 93.123 - Procedures for determining localized CO, PM10, and PM2.5 concentrations (hot-spot analysis).

Code of Federal Regulations, 2012 CFR

2012-07-01

... (“Localized CO, PM10, and PM2.5 violations”) must be based on quantitative analysis using the applicable air... § 93.116 may be based on either: (i) Quantitative methods that represent reasonable and common... hot-spot analyses. (1) The hot-spot demonstration required by § 93.116 must be based on quantitative...

40 CFR 93.123 - Procedures for determining localized CO, PM10, and PM2.5 concentrations (hot-spot analysis).

Code of Federal Regulations, 2010 CFR

2010-07-01

... (“Localized CO, PM10, and PM2.5 violations”) must be based on quantitative analysis using the applicable air... § 93.116 may be based on either: (i) Quantitative methods that represent reasonable and common... hot-spot analyses. (1) The hot-spot demonstration required by § 93.116 must be based on quantitative...

A GIS-based Quantitative Approach for the Search of Clandestine Graves, Italy.

PubMed

Somma, Roberta; Cascio, Maria; Silvestro, Massimiliano; Torre, Eliana

2018-05-01

Previous research on the RAG color-coded prioritization systems for the discovery of clandestine graves has not considered all the factors influencing the burial site choice within a GIS project. The goal of this technical note was to discuss a GIS-based quantitative approach for the search of clandestine graves. The method is based on cross-referenced RAG maps with cumulative suitability factors to host a burial, leading to the editing of different search scenarios for ground searches showing high-(Red), medium-(Amber), and low-(Green) priority areas. The application of this procedure allowed several outcomes to be determined: If the concealment occurs at night, then the "search scenario without the visibility" will be the most effective one; if the concealment occurs in daylight, then the "search scenario with the DSM-based visibility" will be most appropriate; the different search scenarios may be cross-referenced with offender's confessions and eyewitnesses' testimonies to verify the veracity of their statements. © 2017 American Academy of Forensic Sciences.

Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

NASA Astrophysics Data System (ADS)

Huang, Su-Hua; Yang, Tsuey-Ching; Tsai, Ming-Hong; Tsai, I.-Shou; Lu, Huang-Chih; Chuang, Pei-Hsin; Wan, Lei; Lin, Ying-Ju; Lai, Chih-Ho; Lin, Cheng-Wen

2008-10-01

Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples.

A novel label-free fluorescence assay for one-step sensitive detection of Hg2+ in environmental drinking water samples

NASA Astrophysics Data System (ADS)

Li, Ya; Liu, Nan; Liu, Hui; Wang, Yu; Hao, Yuwei; Ma, Xinhua; Li, Xiaoli; Huo, Yapeng; Lu, Jiahai; Tang, Shuge; Wang, Caiqin; Zhang, Yinhong; Gao, Zhixian

2017-04-01

A novel label-free fluorescence assay for detection of Hg2+ was developed based on the Hg2+-binding single-stranded DNA (ssDNA) and SYBR Green I (SG I). Differences from other assays, the designed rich-thymine (T) ssDNA probe without fluorescent labelling can be rapidly formed a T-Hg2+-T complex and folded into a stable hairpin structure in the presence of Hg2+ in environmental drinking water samples by facilitating fluorescence increase through intercalating with SG I in one-step. In the assay, the fluorescence signal can be directly obtained without additional incubation within 1 min. The dynamic quantitative working ranges was 5-1000 nM, the determination coefficients were satisfied by optimization of the reaction conditions. The lowest detection limit of Hg2+ was 3 nM which is well below the standard of U.S. Environmental Protection Agency. This method was highly specific for detecting of Hg2+ without being affected by other possible interfering ions from different background compositions of water samples. The recoveries of Hg2+ spiked in these samples were 95.05-103.51%. The proposed method is more viable, low-costing and simple for operation in field detection than the other methods with great potentials, such as emergency disposal, environmental monitoring, surveillance and supporting of ecological risk assessment and management.

Fitting It All In: Adapting a Green Chemistry Extraction Experiment for Inclusion in an Undergraduate Analytical Laboratory

ERIC Educational Resources Information Center

Buckley, Heather L.; Beck, Annelise R.; Mulvihill, Martin J.; Douskey, Michelle C.

2013-01-01

Several principles of green chemistry are introduced through this experiment designed for use in the undergraduate analytical chemistry laboratory. An established experiment of liquid CO2 extraction of D-limonene has been adapted to include a quantitative analysis by gas chromatography. This facilitates drop-in incorporation of an exciting…

19 CFR 351.522 - Green light and green box subsidies.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 19 Customs Duties 3 2010-04-01 2010-04-01 false Green light and green box subsidies. 351.522... COUNTERVAILING DUTIES Identification and Measurement of Countervailable Subsidies § 351.522 Green light and green... domestic support measures that are provided to certain agricultural products (i.e., products listed in...

Performance analysis and experimental study on rainfall water purification with an extensive green roof matrix layer in Shanghai, China.

PubMed

Guo, Jiankang; Zhang, Yanting; Che, Shengquan

2018-02-01

Current research has validated the purification of rainwater by a substrate layer of green roofs to some extent, though the effects of the substrate layer on rainwater purification have not been adequately quantified. The present study set up nine extensive green roof experiment combinations based on the current conditions of precipitation characteristics observed in Shanghai, China. Different rain with pollutants were simulated, and the orthogonal design L9 (33) test was conducted to measure purification performance. The purification influences of the extensive green roof substrate layer were quantitatively analyzed in Shanghai to optimize the thickness, proportion of substrate, and sodium polyacrylate content. The experimental outcomes resulted in ammonium nitrogen (NH 4 + -N), lead (Pb), and zinc (Zn) removal of up to 93.87%, 98.81%, and 94.55% in the artificial rainfall, respectively, and NH 4 + -N, Pb, and Zn event mean concentration (EMC) was depressed to 0.263 mg/L, 0.002 mg/L and 0.018 mg/L, respectively, which were all well below the pollutant concentrations of artificial rainfall. With reference to the rainfall chemical characteristics of Shanghai, a combination of a 200 mm thickness, proportions of 1:1:2 of Loam: Perlite: Cocopeat and 2 g/L sodium polyacrylate content was suggested for the design of an extensive green roof substrate to purify NH 4 + -N, Pb and Zn.

The Promotion Strategy of Green Construction Materials: A Path Analysis Approach

PubMed Central

Huang, Chung-Fah; Chen, Jung-Lu

2015-01-01

As one of the major materials used in construction, cement can be very resource-consuming and polluting to produce and use. Compared with traditional cement processing methods, dry-mix mortar is more environmentally friendly by reducing waste production or carbon emissions. Despite the continuous development and promotion of green construction materials, only a few of them are accepted or widely used in the market. In addition, the majority of existing research on green construction materials focuses more on their physical or chemical characteristics than on their promotion. Without effective promotion, their benefits cannot be fully appreciated and realized. Therefore, this study is conducted to explore the promotion of dry-mix mortars, one of the green materials. This study uses both qualitative and quantitative methods. First, through a case study, the potential of reducing carbon emission is verified. Then a path analysis is conducted to verify the validity and predictability of the samples based on the technology acceptance model (TAM) in this study. According to the findings of this research, to ensure better promotion results and wider application of dry-mix mortar, it is suggested that more systematic efforts be invested in promoting the usefulness and benefits of dry-mix mortar. The model developed in this study can provide helpful references for future research and promotion of other green materials. PMID:28793613

40 CFR 93.123 - Procedures for determining localized CO, PM10, and PM2.5 concentrations (hot-spot analysis).

Code of Federal Regulations, 2014 CFR

2014-07-01

... PM2.5 violations”) must be based on quantitative analysis using the applicable air quality models... either: (i) Quantitative methods that represent reasonable and common professional practice; or (ii) A...) The hot-spot demonstration required by § 93.116 must be based on quantitative analysis methods for the...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, Taehoon, E-mail: hong7@yonsei.ac.kr; Kim, Jimin, E-mail: cookie6249@yonsei.ac.kr; Jeong, Kwangbok, E-mail: kbjeong7@yonsei.ac.kr

To systematically manage the energy consumption of existing buildings, the government has to enforce greenhouse gas reduction policies. However, most of the policies are not properly executed because they do not consider various factors from the urban level perspective. Therefore, this study aimed to conduct a dynamic analysis of an urban-based low-carbon policy using system dynamics, with a specific focus on housing and green space. This study was conducted in the following steps: (i) establishing the variables of urban-based greenhouse gases (GHGs) emissions; (ii) creating a stock/flow diagram of urban-based GHGs emissions; (iii) conducting an information analysis using the systemmore » dynamics; and (iv) proposing the urban-based low-carbon policy. If a combined energy policy that uses the housing sector (30%) and the green space sector (30%) at the same time is implemented, 2020 CO{sub 2} emissions will be 7.23 million tons (i.e., 30.48% below 2020 business-as-usual), achieving the national carbon emissions reduction target (26.9%). The results of this study could contribute to managing and improving the fundamentals of the urban-based low-carbon policies to reduce greenhouse gas emissions.« less

Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

PubMed

Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

2005-01-01

Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific, sensitive, and economic alternative to the current quantitative methods.

Green tribology: principles, research areas and challenges.

PubMed

Nosonovsky, Michael; Bhushan, Bharat

2010-10-28

In this introductory paper for the Theme Issue on green tribology, we discuss the concept of green tribology and its relation to other areas of tribology as well as other 'green' disciplines, namely, green engineering and green chemistry. We formulate the 12 principles of green tribology: the minimization of (i) friction and (ii) wear, (iii) the reduction or complete elimination of lubrication, including self-lubrication, (iv) natural and (v) biodegradable lubrication, (vi) using sustainable chemistry and engineering principles, (vii) biomimetic approaches, (viii) surface texturing, (ix) environmental implications of coatings, (x) real-time monitoring, (xi) design for degradation, and (xii) sustainable energy applications. We further define three areas of green tribology: (i) biomimetics for tribological applications, (ii) environment-friendly lubrication, and (iii) the tribology of renewable-energy application. The integration of these areas remains a primary challenge for this novel area of research. We also discuss the challenges of green tribology and future directions of research.

Real-time PCR to determine transgene copy number and to quantitate the biolocalization of adoptively transferred cells from EGFP-transgenic mice.

PubMed

Joshi, Molishree; Keith Pittman, H; Haisch, Carl; Verbanac, Kathryn

2008-09-01

Quantitative real-time PCR (qPCR) is a sensitive technique for the detection and quantitation of specific DNA sequences. Here we describe a Taqman qPCR assay for quantification of tissue-localized, adoptively transferred enhanced green fluorescent protein (EGFP)-transgenic cells. A standard curve constructed from serial dilutions of a plasmid containing the EGFP transgene was (i) highly reproducible, (ii) detected as few as two copies, and (iii) was included in each qPCR assay. qPCR analysis of genomic DNA was used to determine transgene copy number in several mouse strains. Fluorescent microscopy of tissue sections showed that adoptively transferred vascular endothelial cells (VEC) from EGFP-transgenic mice specifically localized to tissue with metastatic tumors in syngeneic recipients. VEC microscopic enumeration of liver metastases strongly correlated with qPCR analysis of identical sections (Pearson correlation 0.81). EGFP was undetectable in tissue from control mice by qPCR. In another study using intra-tumor EGFP-VEC delivery to subcutaneous tumors, manual cell count and qPCR analysis of alternating sections also strongly correlated (Pearson correlation 0.82). Confocal microscopy of the subcutaneous tumor sections determined that visual fluorescent signals were frequently tissue artifacts. This qPCR methodology offers specific, objective, and rapid quantitation, uncomplicated by tissue autofluorescence, and should be readily transferable to other in vivo models to quantitate the biolocalization of transplanted cells.

Modeling Flow in Porous Media with Double Porosity/Permeability.

NASA Astrophysics Data System (ADS)

Seyed Joodat, S. H.; Nakshatrala, K. B.; Ballarini, R.

2016-12-01

Although several continuum models are available to study the flow of fluids in porous media with two pore-networks [1], they lack a firm theoretical basis. In this poster presentation, we will present a mathematical model with firm thermodynamic basis and a robust computational framework for studying flow in porous media that exhibit double porosity/permeability. The mathematical model will be derived by appealing to the maximization of rate of dissipation hypothesis, which ensures that the model is in accord with the second law of thermodynamics. We will also present important properties that the solutions under the model satisfy, along with an analytical solution procedure based on the Green's function method. On the computational front, a stabilized mixed finite element formulation will be derived based on the variational multi-scale formalism. The equal-order interpolation, which is computationally the most convenient, is stable under this formulation. The performance of this formulation will be demonstrated using patch tests, numerical convergence study, and representative problems. It will be shown that the pressure and velocity profiles under the double porosity/permeability model are qualitatively and quantitatively different from the corresponding ones under the classical Darcy equations. Finally, it will be illustrated that the surface pore-structure is not sufficient in characterizing the flow through a complex porous medium, which pitches a case for using advanced characterization tools like micro-CT. References [1] G. I. Barenblatt, I. P. Zheltov, and I. N. Kochina, "Basic concepts in the theory of seepage of homogeneous liquids in fissured rocks [strata]," Journal of Applied Mathematics and Mechanics, vol. 24, pp. 1286-1303, 1960.

On Measuring Quantitative Interpretations of Reasonable Doubt

ERIC Educational Resources Information Center

Dhami, Mandeep K.

2008-01-01

Beyond reasonable doubt represents a probability value that acts as the criterion for conviction in criminal trials. I introduce the membership function (MF) method as a new tool for measuring quantitative interpretations of reasonable doubt. Experiment 1 demonstrated that three different methods (i.e., direct rating, decision theory based, and…

Search for OH 18 cm Radio Emission from 1I/2017 U1 with the Green Bank Telescope

NASA Astrophysics Data System (ADS)

Park, Ryan S.; Pisano, D. J.; Lazio, T. Joseph W.; Chodas, Paul W.; Naidu, Shantanu P.

2018-05-01

This paper reports the first OH 18 cm line observation of the first detected interstellar object 1I/2017 U1 (‘Oumuamua) using the Green Bank Telescope. We have observed the OH lines at 1665.402, 1667.359, and 1720.53 MHz frequencies with a spectral resolution of 357 Hz (approximately 0.06 km s‑1). At the time of the observation, ‘Oumuamua was at topocentric distance and velocity of 1.07 au and 63.4 km s‑1, respectively, or at heliocentric distance and velocity of 1.8 au and 39 km s‑1, respectively. Based on a detailed data reduction and an analogy-based inversion, our final results confirm the asteroidal origin of ‘Oumuamua with an upper bound OH production of Q[OH] < 0.17 × 1028 s‑1.

Planning of Green Space Ecological Network in Urban Areas: An Example of Nanchang, China

PubMed Central

Li, Haifeng; Chen, Wenbo; He, Wei

2015-01-01

Green space plays an important role in sustainable urban development and ecology by virtue of multiple environmental, recreational, and economic benefits. Constructing an effective and harmonious urban ecological network and maintaining a sustainable living environment in response to rapid urbanization are the key issues required to be resolved by landscape planners. In this paper, Nanchang City, China was selected as a study area. Based on a series of landscape metrics, the landscape pattern analysis of the current (in 2005) and planned (in 2020) green space system were, respectively, conducted by using FRAGSTATS 3.3 software. Considering the actual situation of the Nanchang urban area, a “one river and two banks, north and south twin cities” ecological network was constructed by using network analysis. Moreover, the ecological network was assessed by using corridor structure analysis, and the improvement of an ecological network on the urban landscape was quantitatively assessed through a comparison between the ecological network and green space system planning. The results indicated that: (1) compared to the green space system in 2005, the planned green space system in 2020 of the Nanchang urban area will decline in both districts (Changnan and Changbei districts). Meanwhile, an increase in patch density and a decrease in mean patch size of green space patches at the landscape level implies the fragmentation of the urban green space landscape. In other words, the planned green space system does not necessarily improve the present green space system; (2) the ecological network of two districts has high corridor density, while Changnan’s ecological network has higher connectivity, but Changbei’s ecological network is more viable from an economic point of view, since it has relatively higher cost efficiency; (3) decrease in patch density, Euclidean nearest neighbor distance, and an increase in mean patch size and connectivity implied that the ecological network could improve landscape connectivity greatly, as compared with the planned green space system. That is to say, the planned ecological network would reduce landscape fragmentation, and increase the shape complexity of green space patches and landscape connectivity. As a result, the quality of the urban ecological environment would be improved. PMID:26501298

Planning of Green Space Ecological Network in Urban Areas: An Example of Nanchang, China.

PubMed

Li, Haifeng; Chen, Wenbo; He, Wei

2015-10-15

Green space plays an important role in sustainable urban development and ecology by virtue of multiple environmental, recreational, and economic benefits. Constructing an effective and harmonious urban ecological network and maintaining a sustainable living environment in response to rapid urbanization are the key issues required to be resolved by landscape planners. In this paper, Nanchang City, China was selected as a study area. Based on a series of landscape metrics, the landscape pattern analysis of the current (in 2005) and planned (in 2020) green space system were, respectively, conducted by using FRAGSTATS 3.3 software. Considering the actual situation of the Nanchang urban area, a "one river and two banks, north and south twin cities" ecological network was constructed by using network analysis. Moreover, the ecological network was assessed by using corridor structure analysis, and the improvement of an ecological network on the urban landscape was quantitatively assessed through a comparison between the ecological network and green space system planning. The results indicated that: (1) compared to the green space system in 2005, the planned green space system in 2020 of the Nanchang urban area will decline in both districts (Changnan and Changbei districts). Meanwhile, an increase in patch density and a decrease in mean patch size of green space patches at the landscape level implies the fragmentation of the urban green space landscape. In other words, the planned green space system does not necessarily improve the present green space system; (2) the ecological network of two districts has high corridor density, while Changnan's ecological network has higher connectivity, but Changbei's ecological network is more viable from an economic point of view, since it has relatively higher cost efficiency; (3) decrease in patch density, Euclidean nearest neighbor distance, and an increase in mean patch size and connectivity implied that the ecological network could improve landscape connectivity greatly, as compared with the planned green space system. That is to say, the planned ecological network would reduce landscape fragmentation, and increase the shape complexity of green space patches and landscape connectivity. As a result, the quality of the urban ecological environment would be improved.

Quantitative determination of wool in textile by near-infrared spectroscopy and multivariate models.

PubMed

Chen, Hui; Tan, Chao; Lin, Zan

2018-08-05

The wool content in textiles is a key quality index and the corresponding quantitative analysis takes an important position due to common adulterations in both raw and finished textiles. Conventional methods are maybe complicated, destructive, time-consuming, environment-unfriendly. Developing a quick, easy-to-use and green alternative method is interesting. The work focuses on exploring the feasibility of combining near-infrared (NIR) spectroscopy and several partial least squares (PLS)-based algorithms and elastic component regression (ECR) algorithms for measuring wool content in textile. A total of 108 cloth samples with wool content ranging from 0% to 100% (w/w) were collected and all the compositions are really existent in the market. The dataset was divided equally into the training and test sets for developing and validating calibration models. When using local PLS, the original spectrum axis was split into 20 sub-intervals. No obvious difference of performance can be seen for the local PLS models. The ECR model is comparable or superior to the other models due its flexibility, i.e., being transition state from PCR to PLS. It seems that ECR combined with NIR technique may be a potential method for determining wool content in textile products. In addition, it might have regulatory advantages to avoid time-consuming and environmental-unfriendly chemical analysis. Copyright © 2018 Elsevier B.V. All rights reserved.

Decay Of Bacterial Pathogens, Fecal Indicators, And Real-Time Quantitative PCR Genetic Markers In Manure-Amended Soils

EPA Science Inventory

This study examined persistence and decay of bacterial pathogens, fecal indicator bacteria (FIB), and emerging real-time quantitative PCR (qPCR) genetic markers for rapid detection of fecal pollution in manure-amended agricultural soils. Known concentrations of transformed green...

Decay Of Bacterial Pathogen, Fecal Indicators, And Real-Time Quantitative PCR Genetic Markers In Manure Amended Soils

EPA Science Inventory

This study examined persistence and decay of bacterial pathogens, fecal indicator bacteria, and emerging real-time quantitative PCR (qPCR) genetic markers for rapid detection of fecal pollution in manre-amended agricultural soils. Known concentrations of transformed green fluore...

Isobaric Tags for Relative and Absolute Quantification (iTRAQ)-Based Untargeted Quantitative Proteomic Approach To Identify Change of the Plasma Proteins by Salbutamol Abuse in Beef Cattle.

PubMed

Zhang, Kai; Tang, Chaohua; Liang, Xiaowei; Zhao, Qingyu; Zhang, Junmin

2018-01-10

Salbutamol, a selective β 2 -agonist, endangers the safety of animal products as a result of illegal use in food animals. In this study, an iTRAQ-based untargeted quantitative proteomic approach was applied to screen potential protein biomarkers in plasma of cattle before and after treatment with salbutamol for 21 days. A total of 62 plasma proteins were significantly affected by salbutamol treatment, which can be used as potential biomarkers to screen for the illegal use of salbutamol in beef cattle. Enzyme-linked immunosorbent assay measurements of five selected proteins demonstrated the reliability of iTRAQ-based proteomics in screening of candidate biomarkers among the plasma proteins. The plasma samples collected before and after salbutamol treatment were well-separated by principal component analysis (PCA) using the differentially expressed proteins. These results suggested that an iTRAQ-based untargeted quantitative proteomic strategy combined with PCA pattern recognition methods can discriminate differences in plasma protein profiles collected before and after salbutamol treatment.

A First Estimation of County-Based Green Water Availability and Its Implications for Agriculture and Bioenergy Production in the United States

DOE PAGES

Xu, Hui; Wu, May

2018-02-02

Green water is vital for the terrestrial ecosystem, but water resource assessment often focuses on blue water. In this study, we estimated green water availability for major crops (i.e., corn, soybean, and wheat) and all other users(e.g., forest, grassland, and ecosystem services) at the county level in the United States. We estimated green water resources from effective rain(ER) using three different methods: Smith, U.S. Department of Agriculture-Soil Conservation Service (USDA-SCS), and the NHD plus V2 dataset. The analysis illustrates that, if green water meets all crop water demands, the fraction of green water resources available to all other users variesmore » significantly across regions, from the Northern Plains (0.71) to the Southeast (0.98). At the county level, this fraction varies from 0.23 to 1.0. Green water resources estimated using the three different ER methods present diverse spatiotemporal distribution patterns across regions, which could affect green water availability estimates. The water availability index for green water (WAI_R) was measured taking into account crop water demand and green water resources aggregated at the county level. Beyond these parameters, WAI_R also depends on the precipitation pattern, crop type and spatially differentiated regions. In addition, seasonal analysis indicated that WAI_R is sensitive to the temporal boundary of the analysis.« less

A First Estimation of County-Based Green Water Availability and Its Implications for Agriculture and Bioenergy Production in the United States

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Hui; Wu, May

Green water is vital for the terrestrial ecosystem, but water resource assessment often focuses on blue water. In this study, we estimated green water availability for major crops (i.e., corn, soybean, and wheat) and all other users(e.g., forest, grassland, and ecosystem services) at the county level in the United States. We estimated green water resources from effective rain(ER) using three different methods: Smith, U.S. Department of Agriculture-Soil Conservation Service (USDA-SCS), and the NHD plus V2 dataset. The analysis illustrates that, if green water meets all crop water demands, the fraction of green water resources available to all other users variesmore » significantly across regions, from the Northern Plains (0.71) to the Southeast (0.98). At the county level, this fraction varies from 0.23 to 1.0. Green water resources estimated using the three different ER methods present diverse spatiotemporal distribution patterns across regions, which could affect green water availability estimates. The water availability index for green water (WAI_R) was measured taking into account crop water demand and green water resources aggregated at the county level. Beyond these parameters, WAI_R also depends on the precipitation pattern, crop type and spatially differentiated regions. In addition, seasonal analysis indicated that WAI_R is sensitive to the temporal boundary of the analysis.« less

Cloning of fox (Vulpes vulpes) Il2, Il6, Il10 and IFNgamma and analysis of their expression by quantitative RT-PCR in fox PBMC after in vitro stimulation by Concanavalin A.

PubMed

Rolland-Turner, Magali; Farré, Guillaume; Boué, Franck

2006-04-15

The immune response in the fox (Vulpes vulpes), despite the success of the oral rabies vaccine is not well characterised, and specific immunological tools are needed. A quantitative RT-PCR using SyBR Green to investigate fox cytokine expression after antigen PBMC in vitro re-stimulation is presented here. First, we cloned by homology with dog cytokine sequences the fox IL2, IL6, IL10, IFNgamma and a partial 18S sequence. Fox specific primers were then defined and used to set up a species-specific quantitative RT-PCR assay using SyBR Green and 18S housekeeping gene as internal standard. The technique was validated using total RNA from fox PBMC stimulated with a polyclonal activator, Concanavaline A.

Fluorescent staining for leukocyte chemotaxis. Eosinophil-specific fluorescence with aniline blue.

PubMed

McCrone, E L; Lucey, D R; Weller, P F

1988-11-10

To overcome problems associated with the quantitation of human eosinophil chemotaxis in micropore filters, we have developed a fluorescent method of specifically staining eosinophils in chemotactic filters. A neutral solution of aniline blue yielded bright green fluorescent staining of the cytoplasmic granules of eosinophils. Other leukocytes and contaminating neutrophils potentially present with eosinophils did not fluoresce with aniline blue. The fluorescent staining eosinophils within filters provided bright, non-fading images that facilitated visual microscopic counting and were of sufficiently high contrast, unlike those with conventional eosinophil stains, to allow image analyzer based enumeration of eosinophil chemotactic responses at levels through the filters. Although not cell type-specific, congo red and ethidium bromide also provided high contrast, fluorescent images of all leukocyte types within chemotactic filters. Fluorescent staining with aniline blue constitutes a rapid, stable and eosinophil-specific stain that facilitates the visual or image analyzer-based quantitation of eosinophil chemotaxis.

Decoupled diversity dynamics in green and brown webs during primary succession in a saltmarsh.

PubMed

Schrama, Maarten; van der Plas, Fons; Berg, Matty P; Olff, Han

2017-01-01

Terrestrial ecosystems are characterized by a strong functional connection between the green (plant-herbivore-based) and brown (detritus-detritivore-based) parts of the food web, which both develop over successional time. However, the interlinked changes in green and brown food web diversity patterns in relation to key ecosystem processes are rarely studied. Here, we demonstrate changes in species richness, diversity and evenness over a wide range of invertebrate green and brown trophic groups during 100 years of primary succession in a saltmarsh ecosystem, using a well-calibrated chronosequence. We contrast two hypotheses on the relationship between green and brown food web diversity across succession: (i) 'coupled diversity hypothesis', which predicts that all trophic groups covary similarly with the main drivers of successional ecosystem assembly vs. (ii) the 'decoupled diversity hypothesis', where green and brown trophic groups diversity respond to different drivers during succession. We found that, while species richness for plants and invertebrate herbivores (green web groups) both peaked at intermediate productivity and successional age, the diversity of macrodetritivores, microarthropod microbivores and secondary consumers (brown web groups) continuously increased towards the latest successional stages. These results suggest that green web trophic groups are mainly driven by vegetation parameters, such as the amount of bare soil, vegetation biomass production and vegetation height, while brown web trophic groups are mostly driven by the production and standing stock of dead organic material and soil development. Our results show that plant diversity cannot simply be used as a proxy for the diversity of all other species groups that drive ecosystem functioning, as brown and green diversity components in our ecosystem responded differently to successional gradients. © 2016 The Authors. Journal of Animal Ecology © 2016 British Ecological Society.

Relationship between Color and Emotion: A Study of College Students

ERIC Educational Resources Information Center

Kaya, Naz; Epps, Helen H.

2004-01-01

Ninety-eight college students were asked to indicate their emotional responses to five principle hues (i.e., red, yellow, green, blue, purple), five intermediate hues (i.e., yellow-red, green-yellow, blue-green, purple-blue, and red-purple), and three achromatic colors (white, gray, and black) and the reasons for their choices. The color stimuli…

Application of Green Net Metropolitan Product to Measure ...

EPA Pesticide Factsheets

The U.S. Environmental Protection Agency (USEPA) has been increasingly incorporating the concept of sustainability in its research programs. One facet of this research is the quantitative assessment of the sustainability of urban systems in light of several multidisciplinary sustainability metrics. In this work, we explore the estimation of economic measure of sustainability for Chicago Metropolitan Area (CMA) based on Green Net Metropolitan Product (GNMP), by adapting the economic models of sustainability at the macroeconomic level to regional sustainability. GNMP aims at amending the limitations of Net Domestic Product (NDP), a classical indicator of economic wellbeing, which fails to account for the degradation of environmental and natural resources caused by economic activities. We collect data for computing GNMP from publicly available secondary sources on variables such as gross metropolitan product, net income, emissions, solid waste, etc. In estimating GNMP for CMA, we have accounted for the damage costs associated with pollution emissions based on marginal damage values obtained from the literature using benefit transfers method. In addition, we attempt at accounting for the marginal value of depletion of natural resources in the CMA in terms of water depletion and changes in urban ecosystems such as green spaces. We account for the marginal damage cost associated with solid waste generation. It is expected the preliminary results of this exploration se

The return of "Gasoline station-park" status into green-open space in DKI Jakarta Province

NASA Astrophysics Data System (ADS)

Kautsar, L. H. R.; Waryono, T.; Sobirin

2017-07-01

The development of gasoline stations in 1970 increased drastically due to the Government support through DKT Jaya Official Note (DKT Jakarta), resulting in a great number of the parks (green open space or RTH - Ruang Terbuka Hijau) converted into a gasoline station. Currently, to meet the RTH target (13.94 % RTH based RTRW [(Rencana Tata Ruang Wilayah) DKT Jakarta 2010], the policy was changed by Decree No.728 year 2009 and Governor Tnstruction No.75 year 2009. Land function of 27 gasoline stations unit must be returned. This study is to determine the appropriateness of gasoline Station-Park conversion into RTH based site and situation approach. The scope of this study was limited only to gasoline stations not converted into RTH. The methodology was the combination of AHP (Analytical Hierarchy Process) and ranking method. Site variables were meant for prone to flooding, the width of land for gasoline station, land status. Situation variables were meant for other public space, availability of other gasoline stations, gasoline stations service, road segments, and the proportions of built space. Analysis study used quantitative descriptive analysis. The results were three of the five gasoline stations were congruence to be converted into a green open space (RTH).

Quantitative phase imaging of human red blood cells using phase-shifting white light interference microscopy with colour fringe analysis

NASA Astrophysics Data System (ADS)

Singh Mehta, Dalip; Srivastava, Vishal

2012-11-01

We report quantitative phase imaging of human red blood cells (RBCs) using phase-shifting interference microscopy. Five phase-shifted white light interferograms are recorded using colour charge coupled device camera. White light interferograms were decomposed into red, green, and blue colour components. The phase-shifted interferograms of each colour were then processed by phase-shifting analysis and phase maps for red, green, and blue colours were reconstructed. Wavelength dependent refractive index profiles of RBCs were computed from the single set of white light interferogram. The present technique has great potential for non-invasive determination of refractive index variation and morphological features of cells and tissues.

Spectral ’Fingerprinting’ of Phytoplankton Populations by Two-Dimensional Fluorescence and Fourier-Transform-Based Pattern Recognition.

DTIC Science & Technology

1985-07-08

comparison to a library of known spectra. A preliminary study (Warner et al., 1984) of the application of this method to the pattern recognition of...case, the spectra from two blue-green algae are shown. Figure 3A indicates phycocyanin as the major fluorophore and 3B indicates phycoerythrin. Except...445. Ho, C.H., G.D. Christian, and E.R. Davidson, 1978. Application of the method of rank annihilation to quantitative analyses of multicomponent

Influence factors and prediction of stormwater runoff of urban green space in Tianjin, China: laboratory experiment and quantitative theory model.

PubMed

Yang, Xu; You, Xue-Yi; Ji, Min; Nima, Ciren

2013-01-01

The effects of limiting factors such as rainfall intensity, rainfall duration, grass type and vegetation coverage on the stormwater runoff of urban green space was investigated in Tianjin. The prediction equation of stormwater runoff was established by the quantitative theory with the lab experimental data of soil columns. It was validated by three field experiments and the relative errors between predicted and measured stormwater runoff are 1.41, 1.52 and 7.35%, respectively. The results implied that the prediction equation could be used to forecast the stormwater runoff of urban green space. The results of range and variance analysis indicated the sequence order of limiting factors is rainfall intensity > grass type > rainfall duration > vegetation coverage. The least runoff of green land in the present study is the combination of rainfall intensity 60.0 mm/h, duration 60.0 min, grass Festuca arundinacea and vegetation coverage 90.0%. When the intensity and duration of rainfall are 60.0 mm/h and 90.0 min, the predicted volumetric runoff coefficient is 0.23 with Festuca arundinacea of 90.0% vegetation coverage. The present approach indicated that green space is an effective method to reduce stormwater runoff and the conclusions are mainly applicable to Tianjin and the semi-arid areas with main summer precipitation and long-time interval rainfalls.

Principles of Work Sample Testing. 2. Evaluation of Personnel Testing Programs

DTIC Science & Technology

1979-04-01

i ARI TECHNICAL REPORT VE TR-79-A9 Principles of Work Sample Testing: II. Evaluation of Personnel Testing Programs by Robert M. Guion BOWLING GREEN ...STATE UNIVERSITY .Bowling Green , Ohio 43403 April 1979 Contract DAHC 19-77-C-0007 UK 0-. Prepared for C-, LA. U.S. ARMY RESEARCH INSTITUTE w for the...NAME AND ADDRESS V.PROGRAM ELEMENT. PROJECT. TASK Bowl iiq Green ’tate UniversityV Bowlilnq Green , Ohio 4 340i3 11. CONTROLLING OFFICE NAME AND ADDRESS

Using hybrid method to evaluate the green performance in uncertainty.

PubMed

Tseng, Ming-Lang; Lan, Lawrence W; Wang, Ray; Chiu, Anthony; Cheng, Hui-Ping

2011-04-01

Green performance measure is vital for enterprises in making continuous improvements to maintain sustainable competitive advantages. Evaluation of green performance, however, is a challenging task due to the dependence complexity of the aspects, criteria, and the linguistic vagueness of some qualitative information and quantitative data together. To deal with this issue, this study proposes a novel approach to evaluate the dependence aspects and criteria of firm's green performance. The rationale of the proposed approach, namely green network balanced scorecard, is using balanced scorecard to combine fuzzy set theory with analytical network process (ANP) and importance-performance analysis (IPA) methods, wherein fuzzy set theory accounts for the linguistic vagueness of qualitative criteria and ANP converts the relations among the dependence aspects and criteria into an intelligible structural modeling used IPA. For the empirical case study, four dependence aspects and 34 green performance criteria for PCB firms in Taiwan were evaluated. The managerial implications are discussed.

Effect of supercritical carbon dioxide decaffeination on volatile components of green teas.

PubMed

Lee, S; Park, M K; Kim, K H; Kim, Y-S

2007-09-01

Volatile components in regular and decaffeinated green teas were isolated by simultaneous steam distillation and solvent extraction (SDE), and then analyzed by GC-MS. A total of 41 compounds, including 8 alcohols, 15 terpene-type compounds, 10 carbonyls, 4 N-containing compounds, and 4 miscellaneous compounds, were found in regular and decaffeinated green teas. Among them, linalool and phenylacetaldehyde were quantitatively dominant in both regular and decaffeinated green teas. By a decaffeination process using supercritical carbon dioxide, most volatile components decreased. The more caffeine was removed, the more volatile components were reduced in green teas. In particular, relatively nonpolar components such as terpene-type compounds gradually decreased according to the decaffeination process. Aroma-active compounds in regular and decaffeinated green teas were also determined and compared by aroma extract dilution analysis (AEDA). Most greenish and floral flavor compounds such as hexanal, (E)-2-hexenal, and some unknown compounds disappeared or decreased after the decaffeination process.

Comparison of Gull Feces-specific Assays Targeting the 16S rRNA Gene of Catellicoccus Marimammalium and Streptococcus spp.

EPA Science Inventory

Two novel gull-specific qPCR assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR-green-based assay targeting Streptococcus spp. (i.e., gull3) and a TaqMan qPCR assay targeting Catellicoccus marimammalium (i.e., gull4). The main objectives ...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palardy, Oliver; Behnke, Craig; Laurens, Lieve M. L.

Even though hydrothermal liquefaction (HTL) is a promising route to produce crude oils (referred to as 'green crude'), the molecular composition of the nitrogen fraction of such green crude oils is not fully understood. The goal of this work was to identify and quantify the fraction of fatty amides in green crude oils obtained from five different samples derived from Desmodesmus armatus, Tetraselmis sp., and Chlorella sp. biomass treated under different HTL conditions (260 or 340 degrees C as batch or continuous processes). The goal of this work was to elucidate the nature of the high nitrogen content of themore » green crude oils. We identified at least 19 distinct fatty amides present in green crude oils and quantified them based on relevant standards in purified fractions after functional group-based separation and enrichment. It was not known how much these compounds contributed to the oils or which molecular fraction they are associated with. We found that fatty amides exclusively partitioned with the neutral fraction of the oils and belonged mainly to one of five categories, based on their functional group substitution, i.e., fatty amides, monomethyl, dimethyl, monoethanolamide, and diethanolamide. The quantification of fatty amides in the neutral oil fraction was based on respective fatty amide standards, after verification of consistency in response factors between molecules with different substitutions of the amide group. Here, we found that the amount of fatty amides found in each of the five samples varied considerably and ranged between 1.4 and 3.0% of the green crude oils, with the highest levels detected in the sample with the highest oil content, after HTL of biomass derived from a nutrient deprived Chlorella sp. culture.« less

An extended diffraction tomography method for quantifying structural damage using numerical Green's functions.

PubMed

Chan, Eugene; Rose, L R Francis; Wang, Chun H

2015-05-01

Existing damage imaging algorithms for detecting and quantifying structural defects, particularly those based on diffraction tomography, assume far-field conditions for the scattered field data. This paper presents a major extension of diffraction tomography that can overcome this limitation and utilises a near-field multi-static data matrix as the input data. This new algorithm, which employs numerical solutions of the dynamic Green's functions, makes it possible to quantitatively image laminar damage even in complex structures for which the dynamic Green's functions are not available analytically. To validate this new method, the numerical Green's functions and the multi-static data matrix for laminar damage in flat and stiffened isotropic plates are first determined using finite element models. Next, these results are time-gated to remove boundary reflections, followed by discrete Fourier transform to obtain the amplitude and phase information for both the baseline (damage-free) and the scattered wave fields. Using these computationally generated results and experimental verification, it is shown that the new imaging algorithm is capable of accurately determining the damage geometry, size and severity for a variety of damage sizes and shapes, including multi-site damage. Some aspects of minimal sensors requirement pertinent to image quality and practical implementation are also briefly discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

In vitro assessment of the chemotherapeutic action of a specific hydrogen peroxide, peracetic, acetic, and peroctanoic acid-based formulation against the free-living stages of Ichthyophthirius multifiliis (Ciliophora).

PubMed

Picón-Camacho, Sara M; Marcos-Lopez, Mar; Beljean, Alexandre; Debeaume, Sylvain; Shinn, Andrew P

2012-02-01

Traditionally, malachite green administrated as in-bath treatment was the most effective and common strategy used in freshwater aquaculture systems to control infections of the ciliate protozoan parasite Ichthyophthirius multifiliis Fouquet, 1876. After the ban of malachite green in the USA and Europe to be used in fish for human consumption, there has been extensive research destined to find efficacious replacements. Recently, peracetic acid-based compounds have demonstrated a strong cytotoxic effect in vitro and in vivo against I. multifiliis. In the present study, we tested the efficacy of a hydrogen peroxide, peracetic, acetic and peroctanoic acid-based formulation (HPPAPA) to eliminate the free-living stages of I. multifiliis (tomonts, cysts and theronts). The results obtained showed that the administration of low doses (8, 12 or 15 mg/l) of a specific HPPAPA-based product during a short window of exposure (60 min) kills nearly all free-living stages of I. multifiliis (theronts, tomonts and cysts) within the window of treatment (∼100% mortality for all the stages; one-way ANOVA, P ≤ 0.001). Of note, even the lowest concentration of HPPAPA tested (8 mg/l) was able to disrupt normal cyst development and therefore theront release. The demonstrated in vitro efficacy of the peracetic acid-based product tested on the present study suggests its great potential to control I. multifiliis infections in commercial aquacultural systems.

Sensory quality evaluation for appearance of needle-shaped green tea based on computer vision and nonlinear tools*

PubMed Central

Dong, Chun-wang; Zhu, Hong-kai; Zhao, Jie-wen; Jiang, Yong-wen; Yuan, Hai-bo; Chen, Quan-sheng

2017-01-01

Tea is one of the three greatest beverages in the world. In China, green tea has the largest consumption, and needle-shaped green tea, such as Maofeng tea and Sparrow Tongue tea, accounts for more than 40% of green tea (Zhu et al., 2017). The appearance of green tea is one of the important indexes during the evaluation of green tea quality. Especially in market transactions, the price of tea is usually determined by its appearance (Zhou et al., 2012). Human sensory evaluation is usually conducted by experts, and is also easily affected by various factors such as light, experience, psychological and visual factors. In the meantime, people may distinguish the slight differences between similar colors or textures, but the specific levels of the tea are hard to determine (Chen et al., 2008). As human description of color and texture is qualitative, it is hard to evaluate the sensory quality accurately, in a standard manner, and objectively. Color is an important visual property of a computer image (Xie et al., 2014; Khulal et al., 2016); texture is a visual performance of image grayscale and color changing with spatial positions, which can be used to describe the roughness and directivity of the surface of an object (Sanaeifar et al., 2016). There are already researchers who have used computer visual image technologies to identify the varieties, levels, and origins of tea (Chen et al., 2008; Xie et al., 2014; Zhu et al., 2017). Most of their research targets are crush, tear, and curl (CTC) red (green) broken tea, curly green tea (Bilochun tea), and flat-typed green tea (West Lake Dragon-well green tea) as the information sources. However, the target of the above research is to establish a qualitative evaluation method on tea quality (Fu et al., 2013). There is little literature on the sensory evaluation of the appearance quality of needle-shaped green tea, especially research on a quantitative evaluation model (Zhou et al., 2012; Zhu et al., 2017). PMID:28585431

Sensory quality evaluation for appearance of needle-shaped green tea based on computer vision and nonlinear tools.

PubMed

Dong, Chun-Wang; Zhu, Hong-Kai; Zhao, Jie-Wen; Jiang, Yong-Wen; Yuan, Hai-Bo; Chen, Quan-Sheng

2017-06-01

Tea is one of the three greatest beverages in the world. In China, green tea has the largest consumption, and needle-shaped green tea, such as Maofeng tea and Sparrow Tongue tea, accounts for more than 40% of green tea (Zhu et al., 2017). The appearance of green tea is one of the important indexes during the evaluation of green tea quality. Especially in market transactions, the price of tea is usually determined by its appearance (Zhou et al., 2012). Human sensory evaluation is usually conducted by experts, and is also easily affected by various factors such as light, experience, psychological and visual factors. In the meantime, people may distinguish the slight differences between similar colors or textures, but the specific levels of the tea are hard to determine (Chen et al., 2008). As human description of color and texture is qualitative, it is hard to evaluate the sensory quality accurately, in a standard manner, and objectively. Color is an important visual property of a computer image (Xie et al., 2014; Khulal et al., 2016); texture is a visual performance of image grayscale and color changing with spatial positions, which can be used to describe the roughness and directivity of the surface of an object (Sanaeifar et al., 2016). There are already researchers who have used computer visual image technologies to identify the varieties, levels, and origins of tea (Chen et al., 2008; Xie et al., 2014; Zhu et al., 2017). Most of their research targets are crush, tear, and curl (CTC) red (green) broken tea, curly green tea (Bilochun tea), and flat-typed green tea (West Lake Dragon-well green tea) as the information sources. However, the target of the above research is to establish a qualitative evaluation method on tea quality (Fu et al., 2013). There is little literature on the sensory evaluation of the appearance quality of needle-shaped green tea, especially research on a quantitative evaluation model (Zhou et al., 2012; Zhu et al., 2017).

FACTORS AFFECTING THE UPTAKE OF LISSAMINE GREEN BY SERUM PROTEINS

PubMed Central

Brackenridge, C. J.

1960-01-01

Eight physicochemical factors which affect the uptake of lissamine green on filter paper impregnated with serum proteins have been examined, and their relevance to the staining of electrophoretically separated protein fractions is discussed. It is shown that grade of paper, weight of protein applied, separate and combined denaturation and staining time, temperature and concentration of staining solution, concentration of denaturant, and type of protein all influence the weight of dye absorbed per unit weight of applied protein, and must be rigidly standardized if valid quantitative results are to be obtained. Five sets of conditions are obtained for optimal staining and it is found that separation of denaturant from dye yields the best procedure. It is concluded that lissamine green is an excellent dye for the staining and quantitative estimation of separated protein fractions in paper electrophoresis, and that conditions can usually be arranged to produce a linear relation between dye uptake and protein concentration in an experimentally efficient manner. PMID:13803681

Impact of Site-Directed Mutant Luciferase on Quantitative Green and Orange/Red Emission Intensities in Firefly Bioluminescence

NASA Astrophysics Data System (ADS)

Wang, Yu; Akiyama, Hidefumi; Terakado, Kanako; Nakatsu, Toru

2013-08-01

Firefly bioluminescence has attracted great interest because of its high quantum yield and intriguing modifiable colours. Modifications to the structure of the enzyme luciferase can change the emission colour of firefly bioluminescence, and the mechanism of the colour change has been intensively studied by biochemists, structural biologists, optical physicists, and quantum-chemistry theorists. Here, we report on the quantitative spectra of firefly bioluminescence catalysed by wild-type and four site-directed mutant luciferases. While the mutation caused different emission spectra, the spectra differed only in the intensity of the green component (λmax ~ 560 nm). In contrast, the orange (λmax ~ 610 nm) and red (λmax ~ 650 nm) components present in all the spectra were almost unaffected by the modifications to the luciferases and changes in pH. Our results reveal that the intensity of the green component is the unique factor that is influenced by the luciferase structure and other reaction conditions.

Smartphone-Based Dual-Modality Imaging System for Quantitative Detection of Color or Fluorescent Lateral Flow Immunochromatographic Strips

NASA Astrophysics Data System (ADS)

Hou, Yafei; Wang, Kan; Xiao, Kun; Qin, Weijian; Lu, Wenting; Tao, Wei; Cui, Daxiang

2017-04-01

Nowadays, lateral flow immunochromatographic assays are increasingly popular as a diagnostic tool for point-of-care (POC) test based on their simplicity, specificity, and sensitivity. Hence, quantitative detection and pluralistic popular application are urgently needed in medical examination. In this study, a smartphone-based dual-modality imaging system was developed for quantitative detection of color or fluorescent lateral flow test strips, which can be operated anywhere at any time. In this system, the white and ultra-violet (UV) light of optical device was designed, which was tunable with different strips, and the Sobel operator algorithm was used in the software, which could enhance the identification ability to recognize the test area from the background boundary information. Moreover, this technology based on extraction of the components from RGB format (red, green, and blue) of color strips or only red format of the fluorescent strips can obviously improve the high-signal intensity and sensitivity. Fifty samples were used to evaluate the accuracy of this system, and the ideal detection limit was calculated separately from detection of human chorionic gonadotropin (HCG) and carcinoembryonic antigen (CEA). The results indicated that smartphone-controlled dual-modality imaging system could provide various POC diagnoses, which becomes a potential technology for developing the next-generation of portable system in the near future.

A Blue/Green Water-based Accounting Framework for Assessment of Water Security

NASA Astrophysics Data System (ADS)

Rodrigues, D. B.; Gupta, H. V.; Mendiondo, E. M.

2013-12-01

A comprehensive assessment of water security can incorporate several water-related concepts, including provisioning and support for freshwater ecosystem services, water footprint, water scarcity, and water vulnerability, while accounting for Blue and Green Water (BW and GW) flows defined in accordance with the hydrological processes involved. Here, we demonstrate how a quantitative analysis of provisioning and demand (in terms of water footprint) for BW and GW ecosystem services can be conducted, so as to provide indicators of water scarcity and vulnerability at the basin level. To illustrate the approach, we use the Soil and Water Assessment Tool (SWAT) to model the hydrology of an agricultural basin (291 sq.km) within the Cantareira water supply system in Brazil. To provide a more comprehensive basis for decision-making, we compute the BW provision using three different hydrological-based methods for specifying monthly Environmental Flow Requirements (EFRs) for 23 year-period. The current BW-Footprint was defined using surface water rights for reference year 2012. Then we analyzed the BW- and GW-Footprints against long-term series of monthly values of freshwater availability. Our results reveal clear spatial and temporal patterns of water scarcity and vulnerability levels within the basin, and help to distinguish between human and natural reasons (drought) for conditions of insecurity. The Blue/Green water-based accounting framework developed here can be benchmarked at a range of spatial scales, thereby improving our understanding of how and where water-related threats to human and aquatic ecosystem security can arise. Future investigation will be necessary to better understand the intra-annual variability of blue water demand and to evaluate the impacts of uncertainties associated with a) the water rights database, b) the effects of climate change projections on blue and green freshwater provision.

Quantitative phase and amplitude imaging using Differential-Interference Contrast (DIC) microscopy

NASA Astrophysics Data System (ADS)

Preza, Chrysanthe; O'Sullivan, Joseph A.

2009-02-01

We present an extension of the development of an alternating minimization (AM) method for the computation of a specimen's complex transmittance function (magnitude and phase) from DIC images. The ability to extract both quantitative phase and amplitude information from two rotationally-diverse DIC images (i.e., acquired by rotating the sample) extends previous efforts in computational DIC microscopy that have focused on quantitative phase imaging only. Simulation results show that the inverse problem at hand is sensitive to noise as well as to the choice of the AM algorithm parameters. The AM framework allows constraints and penalties on the magnitude and phase estimates to be incorporated in a principled manner. Towards this end, Green and De Pierro's "log-cosh" regularization penalty is applied to the magnitude of differences of neighboring values of the complex-valued function of the specimen during the AM iterations. The penalty is shown to be convex in the complex space. A procedure to approximate the penalty within the iterations is presented. In addition, a methodology to pre-compute AM parameters that are optimal with respect to the convergence rate of the AM algorithm is also presented. Both extensions of the AM method are investigated with simulations.

Graphene oxide membrane as an efficient extraction and ionization substrate for spray-mass spectrometric analysis of malachite green and its metabolite in fish samples.

PubMed

Wei, Shih-Chun; Fan, Shen; Lien, Chia-Wen; Unnikrishnan, Binesh; Wang, Yi-Sheng; Chu, Han-Wei; Huang, Chih-Ching; Hsu, Pang-Hung; Chang, Huan-Tsung

2018-03-20

A graphene oxide (GO) nanosheet-modified N + -nylon membrane (GOM) has been prepared and used as an extraction and spray-ionization substrate for robust mass spectrometric detection of malachite green (MG), a highly toxic disinfectant in liquid samples and fish meat. The GOM is prepared by self-deposition of GO thin film onto an N + -nylon membrane, which has been used for efficient extraction of MG in aquaculture water samples or homogenized fish meat samples. Having a dissociation constant of 2.17 × 10 -9  M -1 , the GOM allows extraction of approximately 98% of 100 nM MG. Coupling of the GOM-spray with an ion-trap mass spectrometer allows quantitation of MG in aquaculture freshwater and seawater samples down to nanomolar levels. Furthermore, the system possesses high selectivity and sensitivity for the quantitation of MG and its metabolite (leucomalachite green) in fish meat samples. With easy extraction and efficient spray ionization properties of GOM, this membrane spray-mass spectrometry technique is relatively simple and fast in comparison to the traditional LC-MS/MS methods for the quantitation of MG and its metabolite in aquaculture products. Copyright © 2017 Elsevier B.V. All rights reserved.

Quantitative simulation tools to analyze up- and downstream interactions of soil and water conservation measures: supporting policy making in the Green Water Credits program of Kenya.

PubMed

Hunink, J E; Droogers, P; Kauffman, S; Mwaniki, B M; Bouma, J

2012-11-30

Upstream soil and water conservation measures in catchments can have positive impact both upstream in terms of less erosion and higher crop yields, but also downstream by less sediment flow into reservoirs and increased groundwater recharge. Green Water Credits (GWC) schemes are being developed to encourage upstream farmers to invest in soil and water conservation practices which will positively effect upstream and downstream water availability. Quantitative information on water and sediment fluxes is crucial as a basis for such financial schemes. A pilot design project in the large and strategically important Upper-Tana Basin in Kenya has the objective to develop a methodological framework for this purpose. The essence of the methodology is the integration and use of a collection of public domain tools and datasets: the so-called Green water and Blue water Assessment Toolkit (GBAT). This toolkit was applied in order to study different options to implement GWC in agricultural rainfed land for the pilot study. Impact of vegetative contour strips, mulching, and tied ridges were determined for: (i) three upstream key indicators: soil loss, crop transpiration and soil evaporation, and (ii) two downstream indicators: sediment inflow in reservoirs and groundwater recharge. All effects were compared with a baseline scenario of average conditions. Thus, not only actual land management was considered but also potential benefits of changed land use practices. Results of the simulations indicate that especially applying contour strips or tied ridges significantly reduces soil losses and increases groundwater recharge in the catchment. The model was used to build spatial expressions of the proposed management practices in order to assess their effectiveness. The developed procedure allows exploring the effects of soil conservation measures in a catchment to support the implementation of GWC. Copyright © 2012 Elsevier Ltd. All rights reserved.

Reduction of aqueous chromate by Fe(II)/Fe(III) carbonate green rust: kinetic and mechanistic studies.

PubMed

Legrand, Ludovic; El Figuigui, Alaaeddine; Mercier, Florence; Chausse, Annie

2004-09-01

This work describes the heterogeneous reaction between FeII in carbonate green rust and aqueous chromate, in NaHCO3 solutions at 25 degrees C, and at pH values of 9.3-9.6. Evidence for reduction of CrVI to CrIII and concomitant solid-state oxidation of lattice FeII to FeIII was found from FeII titration and from structural analysis of the solids using FTIR, XRD, SEM, and XPS methods. Results indicate the formation of ferric oxyhydroxycarbonate and the concomitant precipitation of CrIII monolayers at the surface of the iron compound that induce passivation effects and progressive rate limitations. The number of CrIII monolayers formed at the completion of the reaction depends on [FeII]t=0, the molar concentration of FeII(solid) at t=0; on [n(o)]t=0, the molar concentration of reaction sites present at the surface of the solid phase at t=0; and on [CrVI]t=0, the molar concentration of CrVI at t=0. Kinetic data were modeled using a model based on the formation of successive CrIII monolayers, -(d[CrVI]/dt) = sigma(1)j k(i)[S] [CrVI]([n(i - 1)] - [n(i)]) with k(i)[S] (in s(-1) L mol(-1)), the rate coefficient of formation of CrIII monolayer i, and [n(i)] and [n(i - 1)], the molar concentration of CrIII precipitated in monolayer i and monolayer i - 1, respectively. Good matching curves were obtained with kinetic coefficients: k(1)[S] = 5-8 x 10(-4), k(2)[S] = 0.5-3 x 10(-5), and k(3)[S] about 1.7 x 10(-6) s(-1) m(-2) L. The CrVI removal efficiency progressively decreases along with the accumulation of CrIII monolayers at the surface of carbonate green rust particles. In the case of thick green rust particles resulting from the corrosion of iron in permeable reactive barriers, the quantity of FeII readily accessible for efficient CrVI removal should be rather low.

Smart phone: a popular device supports amylase activity assay in fisheries research.

PubMed

Thongprajukaew, Karun; Choodum, Aree; Sa-E, Barunee; Hayee, Ummah

2014-11-15

Colourimetric determinations of amylase activity were developed based on a standard dinitrosalicylic acid (DNS) staining method, using maltose as the analyte. Intensities and absorbances of red, green and blue (RGB) were obtained with iPhone imaging and Adobe Photoshop image analysis. Correlation of green and analyte concentrations was highly significant, and the accuracy of the developed method was excellent in analytical performance. The common iPhone has sufficient imaging ability for accurate quantification of maltose concentrations. Detection limits, sensitivity and linearity were comparable to a spectrophotometric method, but provided better inter-day precision. In quantifying amylase specific activity from a commercial source (P>0.02) and fish samples (P>0.05), differences compared with spectrophotometric measurements were not significant. We have demonstrated that iPhone imaging with image analysis in Adobe Photoshop has potential for field and laboratory studies of amylase. Copyright © 2014 Elsevier Ltd. All rights reserved.

Mössbauer analysis of the firing process of the sky-green glaze of the imitative ancient Chinese Ru porcelain

NASA Astrophysics Data System (ADS)

Songhua, Chen; Zhengyao, Gao; Guoju, Hu; Xiande, Chen

1994-12-01

The variation of the Mössbauer parameters of the imitative ancient Ru porcelain skygreen glaze with the firing conditions is studied in detail in the present paper. The Mössbauer spectra show that the sky-green glaze contains three kinds of iron minerals, i.e. the structural iron (Fe2+ and Fe3+); Fe2O3 and Fe3O4. The relative intensity of the paramagnetic peak Fe2+ increases and the magnetic ratio of the magnetic peak decreases with increasing temperature. Based on the variation of the quadrupole splitting ( QS) of the paramagnetic peak Fe2+, the phase transformation characteristics of the sky-green glaze in the firing process is discussed. The coloring mechanism of the sky-green glaze and the variation of its magnetism in the firing process are also investigated in the present paper.

Rapid and Quantitative Detection of Hepatitis A Virus from Green Onion and Strawberry Rinses by Use of Real-Time Reverse Transcription-PCR

PubMed Central

Shan, X. C.; Wolffs, P.; Griffiths, M. W.

2005-01-01

In this study, an immunomagnetic capture method and a real-time reverse transcription-PCR assay were used to quantify hepatitis A virus (HAV) in green onion and strawberry rinses. This combined protocol detected as low as 0.5 PFU HAV in produce rinses and concentrated HAV levels up to 20-fold. PMID:16151164

Green Building Implementation at Schools in North Sulawesi, Indonesia

NASA Astrophysics Data System (ADS)

Harimu, D. A. J.; Tumanduk, M. S. S. S.

2018-02-01

This research aims at investigating the green building implementation at schools in North Sulawesi, Indonesia; and to analysis the relationship between implementation of green building concept at school with students’ green behaviour. This research is Survey Research with quantitative descriptive method. The analysis unit is taken purposively, that is school that had been implemented the green building concept, Manado’s 3rd Public Vocational High School, Lokon High School at Tomohon, Manado Independent School at North Minahasa, and Tondano’s 3rd Public Vocational High School. Data collecting is acquired by observation and questionnaire. The Assessment Criteria of green building on Analysis Unit, is taken from Greenship Existing Building ver 1. There are 4 main points that being assessed, which are Energy Conservation and Efficiency; Water Conservation; Indoor Health and Comfort; Waste Managerial. The Analysis technique used in this research is the simple regression analysis. The result of the research shows that there is a significant relation between green building implementation at school and students’ green behavior. The result is accordance with the Gesalts Psychologist theories, that architecture can change the user’s behaviour.

A comparison of methods for counting viruses in aquatic systems.

PubMed

Bettarel, Y; Sime-Ngando, T; Amblard, C; Laveran, H

2000-06-01

In this study, we compared different methods-including transmission electron microscopy-and various nucleic acid labeling methods in which we used the fluorochromes 4',6'-diamidino-2-phenylindole (DAPI), 4-[3-methyl-2,3-dihydro-(benzo-1, 3-oxazole)-2-methylmethyledene]-1-(3'-trimethyl ammoniumpropyl)-quinilinium diioide (YOPRO-1), and SYBR Green I, which can be detected by epifluorescence microscopy (EM), for counting viruses in samples obtained from freshwater ecosystems whose trophic status varied and from a culture of T7 phages. From a quantitative and qualitative viewpoint, our results showed that the greatest efficiency for all ecosystems was obtained when we used the EM counting protocol in which YOPRO-1 was the label, as this fluorochrome exhibited strong and very stable fluorescence. A modification of the original protocol in which YOPRO-1 was used is recommended, because this modification makes the protocol faster and allows it to be used for routine analysis of fixed samples. Because SYBR Green I fades very quickly, the use of this fluorochrome is not recommended for systems in which the viral content is very high (>10(8) particles/ml), such as treated domestic sewage effluents. Experiments in which we used DNase and RNase revealed that the number of viruses determined by EM was slightly overestimated (by approximately 15%) because of interference caused by the presence of free nucleic acids.

A Comparison of Methods for Counting Viruses in Aquatic Systems

PubMed Central

Bettarel, Yvan; Sime-Ngando, Telesphore; Amblard, Christian; Laveran, Henri

2000-01-01

In this study, we compared different methods—including transmission electron microscopy—and various nucleic acid labeling methods in which we used the fluorochromes 4′,6′-diamidino-2-phenylindole (DAPI), 4-[3-methyl-2,3-dihydro-(benzo-1,3-oxazole)-2-methylmethyledene]-1-(3′-trimethyl ammoniumpropyl)-quinilinium diioide (YOPRO-1), and SYBR Green I, which can be detected by epifluorescence microscopy (EM), for counting viruses in samples obtained from freshwater ecosystems whose trophic status varied and from a culture of T7 phages. From a quantitative and qualitative viewpoint, our results showed that the greatest efficiency for all ecosystems was obtained when we used the EM counting protocol in which YOPRO-1 was the label, as this fluorochrome exhibited strong and very stable fluorescence. A modification of the original protocol in which YOPRO-1 was used is recommended, because this modification makes the protocol faster and allows it to be used for routine analysis of fixed samples. Because SYBR Green I fades very quickly, the use of this fluorochrome is not recommended for systems in which the viral content is very high (>108 particles/ml), such as treated domestic sewage effluents. Experiments in which we used DNase and RNase revealed that the number of viruses determined by EM was slightly overestimated (by approximately 15%) because of interference caused by the presence of free nucleic acids. PMID:10831400

Cathodoluminescence Studies of the Inhomogeneities in Sn-doped Ga2O3 Nanowires

DTIC Science & Technology

2009-01-01

Cathodoluminescence Studies of the Inhomogeneities in Sn-doped Ga2O3 Nanowires S. I. Maximenko, L. Mazeina, Y. N. Picard, J. A. Freitas, Jr., V. M...color imaging and spectroscopy were employed to study the properties of Ga2O3 nanowires grown with different Sn/Ga ratios. The structures grown under...green to red emission correlates with a phase transition of β- Ga2O3 to polycrystalline SnO2. The origin of the green emission band is discussed based

[Research of expression of L-DOPA decarboxylase in laryngeal cancer].

PubMed

Lai, Shisheng; Wan, Zhili

2014-12-01

This study aimed to investigate the expression levels of L-DOPA decarboxylase (DDC) mRNA and protein in laryngeal cancer, and to determine the clinical significance of DDC in diagnosis and prognosis of laryngeal cancer. Total RNA was isolated from 106 tissue samples surgically removed from 53 laryngeal cancer patients. A quantitative real-time polymerase chain reaction (RT-PCR) methodology based on SYBR Green I fluorescent dye was developed for the quantification of mRNA levels. In addition, Western Blot analysis was performed to detect the expression level of DDC protein. DDC mRNA expression in both primary (P= 0. 000) and recurrent (P=0. 033) laryngeal cancer samples downregulated significantly compared with their nonmalignant counterparts. Moreover, expression of DDC mRNA was not associated with age and histologic grade, but the significantly decreased mRNA were correlated with early TMN stage (P=0. 021). Additionally, DDC protein was detected in both cancerous and noncancerous tissues. Expression levels of DDC may play a vital role in the progression of laryngeal cancer, which can be served as a promising biomarker for the future clinical management of laryngeal cancer patients.

Should policy ethics come in two colours: green or white?

PubMed

Oswald, Malcolm

2013-05-01

When writing about policy, do you think in green or white? If not, I recommend that you do. I suggest that writers and journal editors should explicitly label every policy ethics paper either 'green' or 'white'. A green paper is an unconstrained exploration of a policy question. The controversial 'After-birth abortion' paper is an example. Had it been labelled as 'green', readers could have understood what Giubilini and Minerva explained later: that it was a discussion of philosophical ideas, and not a policy proposal advocating infanticide. A serious policy proposal should be labelled by writer(s) and editor(s) as 'white'. Its purpose should be to influence policy. In order to influence policy, I suggest three essential, and two desirable, characteristics of any white paper. Most importantly, a white paper should be set in the context in which the policy is to be made and applied.

Implementing Response to Intervention in Title I Elementary Schools: A Quantitative Study of Teacher Response Relationships

ERIC Educational Resources Information Center

Webster, Katina F.

2012-01-01

General educators and special educators in Title I elementary schools perceive the relationships between principles of RTI and their state RTI framework, the implementation of RTI, and professional development received in RTI differently. A quantitative survey-based research methodology was employed including the use of Cronbach's alpha to…

mcrA-Targeted Real-Time Quantitative PCR Method To Examine Methanogen Communities▿

PubMed Central

Steinberg, Lisa M.; Regan, John M.

2009-01-01

Methanogens are of great importance in carbon cycling and alternative energy production, but quantitation with culture-based methods is time-consuming and biased against methanogen groups that are difficult to cultivate in a laboratory. For these reasons, methanogens are typically studied through culture-independent molecular techniques. We developed a SYBR green I quantitative PCR (qPCR) assay to quantify total numbers of methyl coenzyme M reductase α-subunit (mcrA) genes. TaqMan probes were also designed to target nine different phylogenetic groups of methanogens in qPCR assays. Total mcrA and mcrA levels of different methanogen phylogenetic groups were determined from six samples: four samples from anaerobic digesters used to treat either primarily cow or pig manure and two aliquots from an acidic peat sample stored at 4°C or 20°C. Only members of the Methanosaetaceae, Methanosarcina, Methanobacteriaceae, and Methanocorpusculaceae and Fen cluster were detected in the environmental samples. The three samples obtained from cow manure digesters were dominated by members of the genus Methanosarcina, whereas the sample from the pig manure digester contained detectable levels of only members of the Methanobacteriaceae. The acidic peat samples were dominated by both Methanosarcina spp. and members of the Fen cluster. In two of the manure digester samples only one methanogen group was detected, but in both of the acidic peat samples and two of the manure digester samples, multiple methanogen groups were detected. The TaqMan qPCR assays were successfully able to determine the environmental abundance of different phylogenetic groups of methanogens, including several groups with few or no cultivated members. PMID:19447957

Terpenes as green solvents for extraction of oil from microalgae.

PubMed

Dejoye Tanzi, Celine; Abert Vian, Maryline; Ginies, Christian; Elmaataoui, Mohamed; Chemat, Farid

2012-07-09

Herein is described a green and original alternative procedure for the extraction of oil from microalgae. Extractions were carried out using terpenes obtained from renewable feedstocks as alternative solvents instead of hazardous petroleum solvents such as n-hexane. The described method is achieved in two steps using Soxhlet extraction followed by the elimination of the solvent from the medium using Clevenger distillation in the second step. Oils extracted from microalgae were compared in terms of qualitative and quantitative determination. No significant difference was obtained between each extract, allowing us to conclude that the proposed method is green, clean and efficient.

Protective effect of red-stemmed type of Ipomoea aquatica Forsk against CCl4-induced oxidative damage in mice.

PubMed

Hirai, Shizuka; Ishibuchi, Toyohito; Watabe, Shinpei; Makita, Miki; Kishida, Chiaki; Takagaki, Michiko; Kurauchi, Nobuyuki; Egashira, Yukari

2011-01-01

Water spinach (Ipomoea aquatica Forsk; I. aquatica) of the green-stemmed type (green type) is widely consumed, but there also exists a red-stemmed variety (red type). In the present study, the antioxidant capacity of the red type was compared to that of the green type in carbon tetrachloride (CCl(4))-treated mice. CCl(4)-induced thiobarbituric acid reactive substrate (TBARS) formation in the liver was significantly suppressed in mice fed 5% red-type I. aquatica, while the green type showed no effect. Hydrophobic oxygen radical absorbance capacity (H-ORAC(FL)) in the red type showed a lower level than that in the green type; however, lipophilic ORAC (L-ORAC(FL)) and total-ORAC(FL) levels were significantly higher in the red type than in the green type. α-Tocopherol, anthocyanidin/proanthocyanidin, and β-carotene contents were all significantly higher in the red type than in the green type. These results suggest that the wild red-type I. aquatica contains certain lipophilic components that exert antioxidant capacities not only in vitro but also in vivo. Such effective components in the red type would be beneficial phytochemicals for suppressing several diseases related to oxidative stress.

A multi-residue method for pesticides analysis in green coffee beans using gas chromatography-negative chemical ionization mass spectrometry in selective ion monitoring mode.

PubMed

Pizzutti, Ionara R; de Kok, Andre; Dickow Cardoso, Carmem; Reichert, Bárbara; de Kroon, Marijke; Wind, Wouter; Weber Righi, Laís; Caiel da Silva, Rosselei

2012-08-17

In this study, a new gas chromatography-mass spectrometry (GC-MS) method, using the very selective negative chemical ionization (NCI) mode, was developed and applied in combination with a modified acetonitrile-based extraction method (QuEChERS) for the analysis of a large number of pesticide residues (51 pesticides, including isomers and degradation products) in green coffee beans. A previously developed integrated sample homogenization and extraction method for both pesticides and mycotoxins analysis was used. An homogeneous slurry of green milled coffee beans and water (ratio 1:4, w/w) was prepared and extracted with acetonitrile/acetic acid (1%), followed by magnesium sulfate addition for phase separation. Aliquots from this extract could be used directly for LC-MS/MS analysis of mycotoxins and LC-amenable pesticides. For GC-MS analysis, a further clean-up was necessary. C18- and PSA-bonded silica were tested as dispersive solid-phase extraction (d-SPE) sorbents, separate and as a mixture, and the best results were obtained using C18-bonded silica. For the optimal sensitivity and selectivity, GC-MS detection in the NCI-selected ion monitoring (SIM) mode had to be used to allow the fast analysis of the difficult coffee bean matrix. The validation was performed by analyzing recovery samples at three different spike concentrations, 10, 20 and 50 μg kg(-1), with 6 replicates (n=6) at each concentration. Linearity (r(2)) of calibration curves, estimated instrument and method limits of detection and limits of quantification (LOD(i), LOD(m), LOQ(i) and LOQ(m), respectively), accuracy (as recovery %), precision (as RSD%) and matrix effects (%) were determined for each individual pesticide. From the 51 analytes (42 parent pesticides, 4 isomers and 5 degradation products) determined by GC-MS (NCI-SIM), approximately 76% showed average recoveries between 70-120% and 75% and RSD ≤ 20% at the lowest spike concentration of 10 μg kg(-1), the target method LOQ. For the spike concentrations of 20 and 50 μg kg(-1), the recoveries and RSDs were even better. The validated LOQ(m) was 10, 20 and 50 μg kg(-1) for respectively 33, 3 and 6 of the analytes studied. For five compounds, the European Union method performance requirements for the validation of a quantitative method (average recoveries between 70-120% and repeatability RSD ≤ 20%) were not achieved and 4 problematic pesticides (captan, captafol, folpet and dicofol) could not be detected as their parent compound, but only via their degradation products. Although the matrix effect (matrix-enhanced detector response) was high for all pesticides studied, the matrix interference was minimal, due to the high selectivity obtained with the GC-NCI-MS detection. Matrix-matched calibration for applying the method in routine analysis is recommended for reliable quantitative results. Copyright © 2012 Elsevier B.V. All rights reserved.

In vivo photoacoustic flow cytometry for early malaria diagnosis.

PubMed

Cai, Chengzhong; Carey, Kai A; Nedosekin, Dmitry A; Menyaev, Yulian A; Sarimollaoglu, Mustafa; Galanzha, Ekaterina I; Stumhofer, Jason S; Zharov, Vladimir P

2016-06-01

In vivo photoacoustic (PA) flow cytometry (PAFC) has already demonstrated a great potential for the diagnosis of deadly diseases through ultrasensitive detection of rare disease-associated circulating markers in whole blood volume. Here, we demonstrate the first application of this powerful technique for early diagnosis of malaria through label-free detection of malaria parasite-produced hemozoin in infected red blood cells (iRBCs) as high-contrast PA agent. The existing malaria tests using blood smears can detect the disease at 0.001-0.1% of parasitemia. On the contrary, linear PAFC showed a potential for noninvasive malaria diagnosis at an extremely low level of parasitemia of 0.0000001%, which is ∼10(3) times better than the existing tests. Multicolor time-of-flight PAFC with high-pulse repetition rate lasers at wavelengths of 532, 671, and 820 nm demonstrated rapid spectral and spatial identification and quantitative enumeration of individual iRBCs. Integration of PAFC with fluorescence flow cytometry (FFC) provided real-time simultaneous detection of single iRBCs and parasites expressing green fluorescence proteins, respectively. A combination of linear and nonlinear nanobubble-based multicolor PAFC showed capability to real-time control therapy efficiency by counting of iRBCs before, during, and after treatment. Our results suggest that high-sensitivity, high-resolution ultrafast PAFC-FFC platform represents a powerful research tool to provide the insight on malaria progression through dynamic study of parasite-cell interactions directly in bloodstream, whereas portable hand-worn PAFC device could be broadly used in humans for early malaria diagnosis. © 2016 International Society for Advancement of Cytometry. © 2016 International Society for Advancement of Cytometry.

Fluorescent Protein-Based Quantification of Alternative Splicing of a Target Cassette Exon in Mammalian Cells.

PubMed

Gurskaya, N G; Staroverov, D B; Lukyanov, K A

2016-01-01

Alternative splicing is an important mechanism of regulation of gene expression and expansion of proteome complexity. Recently we developed a new fluorescence reporter for quantitative analysis of alternative splicing of a target cassette exon in live cells (Gurskaya et al., 2012). It consists of a specially designed minigene encoding red and green fluorescent proteins (Katushka and TagGFP2) and a fragment of the target gene between them. Skipping or inclusion of the alternative exon induces a frameshift; ie, alternative exon length must not be a multiple of 3. Finally, red and green fluorescence intensities of cells expressing this reporter are used to estimate the percentage of alternative (exon-skipped) and normal (exon-retained) transcripts. Here, we provide a detailed description of design and application of the fluorescence reporter of a target alternative exon splicing in mammalian cell lines. © 2016 Elsevier Inc. All rights reserved.

Quantitation of chlorophylls and 22 of their colored degradation products in culinary aromatic herbs by HPLC-DAD-MS and correlation with color changes during the dehydration process.

PubMed

Lafeuille, Jean-Louis; Lefèvre, Stéphane; Lebuhotel, Julie

2014-02-26

Chlorophylls and their green and olive-brown derivatives were successfully separated from culinary herb extracts by HPLC with photodiode-array and mass spectrometry detection. The method involved a ternary gradient elution and reverse-phase separation conditions capable of resolving 24 different pigments (2 chlorophylls and 22 of their derivatives) of different polarities within 28 min. The method was applied to monitor color changes in 50 samples of culinary aromatic herbs subjected to five different drying treatments. Of the 24 pigments, 14 were key to understanding the differences between the primary degradation pathways of chlorophyll a and chlorophyll b in culinary herbs during drying processes. A color degradation ladder based on the total molar percentage of all the remaining green pigments was also proposed as a tool to measure the impact of drying treatments on aromatic herb visual aspects.

A surprising method for green extraction of essential oil from dry spices: Microwave dry-diffusion and gravity.

PubMed

Farhat, Asma; Fabiano-Tixier, Anne-Sylvie; Visinoni, Franco; Romdhane, Mehrez; Chemat, Farid

2010-11-19

Without adding any solvent or water, we proposed a novel and green approach for the extraction of secondary metabolites from dried plant materials. This "solvent, water and vapor free" approach based on a simple principle involves the application of microwave irradiation and earth gravity to extract the essential oil from dried caraway seeds. Microwave dry-diffusion and gravity (MDG) has been compared with a conventional technique, hydrodistillation (HD), for the extraction of essential oil from dried caraway seeds. Essential oils isolated by MDG were quantitatively (yield) and qualitatively (aromatic profile) similar to those obtained by HD, but MDG was better than HD in terms of rapidity (45min versus 300min), energy saving, and cleanliness. The present apparatus permits fast and efficient extraction, reduces waste, avoids water and solvent consumption, and allows substantial energy savings. Copyright © 2010 Elsevier B.V. All rights reserved.

50 CFR 223.210 - North American green sturgeon.

Code of Federal Regulations, 2013 CFR

2013-10-01

... the applicant. (i) An FMEP must prohibit retention of green sturgeon (i.e., zero bag limit); set... absolute defense to liability under section 9(a)(1)(G) of the ESA with respect to the alleged violation...

Equilibrium water and solute uptake in silicone hydrogels.

PubMed

Liu, D E; Dursch, T J; Oh, Y; Bregante, D T; Chan, S Y; Radke, C J

2015-05-01

Equilibrium water content of and solute partitioning in silicone hydrogels (SiHys) are investigated using gravimetric analysis, fluorescence confocal laser-scanning microscopy (FCLSM), and back extraction with UV/Vis-absorption spectrophotometry. Synthesized silicone hydrogels consist of silicone monomer, hydrophilic monomer, cross-linking agent, and triblock-copolymer macromer used as an amphiphilic compatibilizer to prevent macrophase separation. In all cases, immiscibility of the silicone and hydrophilic polymers results in microphase-separated morphologies. To investigate solute uptake in each of the SiHy microphases, equilibrium partition coefficients are obtained for two hydrophilic solutes (i.e., theophylline and caffeine dissolved in aqueous phosphate-buffered saline) and two oleophilic solutes (i.e., Nile Red and Bodipy Green dissolved in silicone oil), respectively. Measured water contents and aqueous-solute partition coefficients increase linearly with increasing solvent-free hydrophilic-polymer volume fraction. Conversely, oleophilic-solute partition coefficients decrease linearly with rising solvent-free hydrophilic-polymer volume fraction (i.e., decreasing hydrophobic silicone-polymer fraction). We quantitatively predict equilibrium SiHy water and solute uptake assuming that water and aqueous solutes reside only in hydrophilic microdomains, whereas oleophilic solutes partition predominately into silicone microdomains. Predicted water contents and solute partition coefficients are in excellent agreement with experiment. Our new procedure permits a priori estimation of SiHy water contents and solute partition coefficients based solely on properties of silicone and hydrophilic homopolymer hydrogels, eliminating the need for further mixed-polymer-hydrogel experiments. Copyright © 2015 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

The Effects of Green Schooling Knowledge Level and Intensity of Parental Guidance on the Environmental Awareness of the Early Age Student

ERIC Educational Resources Information Center

Wihardjo, Sihadi Darmo; Hartati, Sofia; Nurani, Yuliani; Sujarwanta, Agus

2017-01-01

This study was conducted to determine the effect of green schooling knowledge and parents guidance on the environmental awareness of the students. This study used a quantitative approach with the expost facto method. This study was conducted in Muhammadiyah 41 elementary school in East Jakarta at July to December on the 2nd semester of the…

78 FR 54449 - Subzone 8I, Authorization of Production Activity, Whirlpool Corporation (Washing Machines); Clyde...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-09-04

... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board [B-43-2013] Subzone 8I, Authorization of Production Activity, Whirlpool Corporation (Washing Machines); Clyde and Green Springs, Ohio On May 1, 2013...-Trade Zones (FTZ) Board for its facility within Subzone 8I, in Clyde and Green Springs, Ohio. The...

Spectroscopy by joint spectral and time domain optical coherence tomography

NASA Astrophysics Data System (ADS)

Szkulmowski, Maciej; Tamborski, Szymon; Wojtkowski, Maciej

2015-03-01

We present the methodology for spectroscopic examination of absorbing media being the combination of Spectral Optical Coherence Tomography and Fourier Transform Spectroscopy. The method bases on the joint Spectral and Time OCT computational scheme and simplifies data analysis procedure as compared to the mostly used windowing-based Spectroscopic OCT methods. The proposed experimental setup is self-calibrating in terms of wavelength-pixel assignment. The performance of the method in measuring absorption spectrum was checked with the use of the reflecting phantom filled with the absorbing agent (indocyanine green). The results show quantitative accordance with the controlled exact results provided by the reference method.

Story telling and social action: engaging young people to act on climate change

NASA Astrophysics Data System (ADS)

Cordero, E.

2014-12-01

The realization that well designed graphs and clearly worded summaries were not enough to spur the public and policy makers towards an appropriate understanding of our planet encouraged me to search for other ways to share climate stories with the general public. After co-authoring a popular book on food and climate change and giving many talks to the general public, it struck me that young people were largely missing from the dialogue, and little meaningful progress was being made to design effective solutions. I then started working with faculty and students from the Film and Animation Departments at San Jose State University to develop stories about climate change that would be engaging to younger audiences. The result was the Green Ninja Project, based around the Green Ninja, a superhero who focuses on solutions to climate change using humor and silliness to soften what can be a somewhat challenging topic. The Project includes a) The Green Ninja Show - a series of YouTube videos (over 1,000,000 views) highlighting actions young people can take to reduce climate change, b) The Green Ninja Film Festival where students tell their own climate solutions stories, and c) a collection of educational resources that help teachers bring climate science topics into their classroom using hands-on activities. A key component to this work is promoting social action experiences, so that young people can understand how their actions can make a difference. Based on these experiences, I will provide my own reflections on the challenges and opportunities of communicating climate change with young people.

Green Infrastructure and Stormwater Utility Credit Design for Sustainability

EPA Science Inventory

A current trend in funding urban stormwater programs relies on the issuance of stormwater utilities (i.e., fees) based on some measure of impervious surface (e.g., actual, estimated, average), and local programs vary greatly, dependent upon state law, municipal ordinances, and co...

Er3+-Tm3+-Yb3+:CaMoO4 phosphor as an outstanding upconversion-based optical temperature sensor and optical heater.

PubMed

Dey, Riya; Kumar Rai, Vineet

2017-03-22

Optical temperature sensing in Er 3+ -Tm 3+ -Yb 3+ codoped CaMoO 4 phosphor prepared by chemical co-precipitation route based on the near infrared (NIR) to green upconversion emission from Er 3+ ion is reported. The variation with respect to external temperature in emission intensity ratio of the green emissions around 530 nm and 552 nm, corresponding to the 2 H 11/2  →  4 I 15/2 and 4 S 3/2  →  4 I 15/2 transitions respectively, under 980 nm excitation has been studied in detail, to report the sensing property of the prepared material; the maximum sensor sensitivity ∼0.0182 K -1 was attained at 413 K. The laser induced optical heating within the prepared phosphor has been explored and the heat generation caused by the laser effect has been verified by comparison of experimental and calculated data.

A Rapid Growth-Independent Antibiotic Resistance Detection Test by SYBR Green/Propidium Iodide Viability Assay.

PubMed

Feng, Jie; Yee, Rebecca; Zhang, Shuo; Tian, Lili; Shi, Wanliang; Zhang, Wen-Hong; Zhang, Ying

2018-01-01

Antibiotic-resistant bacteria have caused huge concerns and demand innovative approaches for their prompt detection. Current antimicrobial susceptibility tests (AST) rely on the growth of the organisms which takes 1-2 days for fast-growing organisms and several weeks for slow growing organisms. Here, we show for the first time the utility of the SYBR Green I/propidium iodide (PI) viability assay for rapidly identifying antibiotic resistance in less than 30 min for major, antibiotic-resistant, fast-growing bacteria, such as Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae , and Acinetobacter baumannii for bactericidal and bacteriostatic agents and in 16 h for extremely rapid detection of drug resistance for isoniazid and pyrazinamide in slow-growing Mycobacterium tuberculosis . The SYBR Green I/PI assay generated rapid and robust results in concordance with traditional AST methods. This novel growth-independent methodology changes the concept of the current growth-based AST and may revolutionize current drug susceptibility testing for all cells of prokaryotic and eukaryotic origin and, subject to further clinical validation, may play a major role in saving lives and improving patient outcomes.

Monitoring crop gross primary productivity using Landsat data (Invited)

NASA Astrophysics Data System (ADS)

Gitelson, A. A.; Peng, Y.; Keydan, G. P.; Masek, J.; Rundquist, D. C.; Verma, S. B.; Suyker, A. E.

2009-12-01

There is a growing interest in monitoring the gross primary productivity (GPP) of crops due mostly to their carbon sequestration potential. We presented a new technique for GPP estimation in irrigated and rainfed maize and soybeans based on the close and consistent relationship between GPP and crop chlorophyll content, and entirely on remotely sensed data. A recently proposed Green Chlorophyll Index (Green CI), which employs the green and the NIR spectral bands, was used to retrieve daytime GPP from Landsat ETM+ data. Due to its high spatial resolution (i.e., 30x30m/pixel), this satellite system is particularly appropriate for detecting not only between but also within field GPP variability during the growing season. The Green CI obtained using atmospherically corrected Landsat ETM+ data was found to be linearly related with crop GPP explaining about 90% of GPP variation. Green CI constitutes an accurate surrogate measure for GPP estimation. For comparison purposes, other vegetation indices were also tested. These results open new possibilities for analyzing the spatio-temporal variation of the GPP of crops using the extensive archive of Landsat imagery acquired since the early 1980s.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kabisch, Nadja, E-mail: nadja.kabisch@geo.hu-berlin.de; Department of Urban and Environmental Sociology, Helmholtz Centre for Environmental Research — UFZ, 04318 Leipzig; Qureshi, Salman

Scientific papers on landscape planning underline the importance of maintaining and developing green spaces because of their multiple environmental and social benefits for city residents. However, a general understanding of contemporary human–environment interaction issues in urban green space is still incomplete and lacks orientation for urban planners. This review examines 219 publications to (1) provide an overview of the current state of research on the relationship between humans and urban green space, (2) group the different research approaches by identifying the main research areas, methods, and target groups, and (3) highlight important future prospects in urban green space research. -more » Highlights: • Reviewed literature on urban green pins down a dearth of comparative studies. • Case studies in Africa and Russia are marginalized – the Europe and US dominate. • Questionnaires are used as major tool followed by GIS and quantitative approaches. • Developing countries should contribute in building an urban green space agenda. • Interdisciplinary, adaptable and pluralistic approaches can satiate a knowledge gap.« less

Quantitative comparison of cancer and normal cell adhesion using organosilane monolayer templates: an experimental study on the anti-adhesion effect of green-tea catechins.

PubMed

Sakamoto, Rumi; Kakinuma, Eisuke; Masuda, Kentaro; Takeuchi, Yuko; Ito, Kosaku; Iketaki, Kentaro; Matsuzaki, Takahisa; Nakabayashi, Seiichiro; Yoshikawa, Hiroshi Y; Yamamoto, Hideaki; Sato, Yuko; Tanii, Takashi

2016-09-01

The main constituent of green tea, (-)-Epigallocatechin-3-O-gallate (EGCG), is known to have cancer-specific chemopreventive effects. In the present work, we investigated how EGCG suppresses cell adhesion by comparing the adhesion of human pancreatic cancer cells (AsPC-1 and BxPC-3) and their counterpart, normal human embryonic pancreas-derived cells (1C3D3), in catechin-containing media using organosilane monolayer templates (OMTs). The purpose of this work is (1) to evaluate the quantitativeness in the measurement of cell adhesion with the OMT and (2) to show how green-tea catechins suppress cell adhesion in a cancer-specific manner. For the first purpose, the adhesion of cancer and normal cells was compared using the OMT. The cell adhesion in different type of catechins such as EGCG, (-)-Epicatechin-3-O-gallate (ECG) and (-)-Epicatechin (EC) was also evaluated. The measurements revealed that the anti-adhesion effect of green-tea catechins is cancer-specific, and the order is EGCG≫ECG>EC. The results agree well with the data reported to date, showing the quantitativeness of the new method. For the second purpose, the contact area of cells on the OMT was measured by reflection interference contrast microscopy. The cell-OMT contact area of cancer cells decreases with increasing EGCG concentration, whereas that of normal cells remains constant. The results reveal a twofold action of EGCG on cancer cell adhesion-suppressing cell attachment to a candidate adhesion site and decreasing the contact area of the cells-and validates the use of OMT as a tool for screening cancer cell adhesion.

A multi-element screening method to identify metal targets for blood biomonitoring in green sea turtles (Chelonia mydas).

PubMed

Villa, C A; Finlayson, S; Limpus, C; Gaus, C

2015-04-15

Biomonitoring of blood is commonly used to identify and quantify occupational or environmental exposure to chemical contaminants. Increasingly, this technique has been applied to wildlife contaminant monitoring, including for green turtles, allowing for the non-lethal evaluation of chemical exposure in their nearshore environment. The sources, composition, bioavailability and toxicity of metals in the marine environment are, however, often unknown and influenced by numerous biotic and abiotic factors. These factors can vary considerably across time and space making the selection of the most informative elements for biomonitoring challenging. This study aimed to validate an ICP-MS multi-element screening method for green turtle blood in order to identify and facilitate prioritisation of target metals for subsequent fully quantitative analysis. Multi-element screening provided semiquantitative results for 70 elements, 28 of which were also determined through fully quantitative analysis. Of the 28 comparable elements, 23 of the semiquantitative results had an accuracy between 67% and 112% relative to the fully quantified values. In lieu of any available turtle certified reference materials (CRMs), we evaluated the use of human blood CRMs as a matrix surrogate for quality control, and compared two commonly used sample preparation methods for matrix related effects. The results demonstrate that human blood provides an appropriate matrix for use as a quality control material in the fully quantitative analysis of metals in turtle blood. An example for the application of this screening method is provided by comparing screening results from blood of green turtles foraging in an urban and rural region in Queensland, Australia. Potential targets for future metal biomonitoring in these regions were identified by this approach. Copyright © 2014 Elsevier B.V. All rights reserved.

Quantitative assessment of the microbial risk of leafy greens from farm to consumption: preliminary framework, data, and risk estimates.

PubMed

Danyluk, Michelle D; Schaffner, Donald W

2011-05-01

This project was undertaken to relate what is known about the behavior of Escherichia coli O157:H7 under laboratory conditions and integrate this information to what is known regarding the 2006 E. coli O157:H7 spinach outbreak in the context of a quantitative microbial risk assessment. The risk model explicitly assumes that all contamination arises from exposure in the field. Extracted data, models, and user inputs were entered into an Excel spreadsheet, and the modeling software @RISK was used to perform Monte Carlo simulations. The model predicts that cut leafy greens that are temperature abused will support the growth of E. coli O157:H7, and populations of the organism may increase by as much a 1 log CFU/day under optimal temperature conditions. When the risk model used a starting level of -1 log CFU/g, with 0.1% of incoming servings contaminated, the predicted numbers of cells per serving were within the range of best available estimates of pathogen levels during the outbreak. The model predicts that levels in the field of -1 log CFU/g and 0.1% prevalence could have resulted in an outbreak approximately the size of the 2006 E. coli O157:H7 outbreak. This quantitative microbial risk assessment model represents a preliminary framework that identifies available data and provides initial risk estimates for pathogenic E. coli in leafy greens. Data gaps include retail storage times, correlations between storage time and temperature, determining the importance of E. coli O157:H7 in leafy greens lag time models, and validation of the importance of cross-contamination during the washing process.

Comparing quantitative values of two generations of laser-assisted indocyanine green dye angiography systems: can we predict necrosis?

PubMed

Phillips, Brett T; Fourman, Mitchell S; Rivara, Andrew; Dagum, Alexander B; Huston, Tara L; Ganz, Jason C; Bui, Duc T; Khan, Sami U

2014-01-01

Several devices exist today to assist the intraoperative determination of skin flap perfusion. Laser-Assisted Indocyanine Green Dye Angiography (LAICGA) has been shown to accurately predict mastectomy skin flap necrosis using quantitative perfusion values. The laser properties of the latest LAICGA device (SPY Elite) differ significantly from its predecessor system (SPY 2001), preventing direct translation of previous published data. The purpose of this study was to establish a mathematical relationship of perfusion values between these 2 devices. Breast reconstruction patients were prospectively enrolled into a clinical trial where skin flap evaluation and excision was based on quantitative SPY Q values previously established in the literature. Initial study patients underwent mastectomy skin flap evaluation using both SPY systems simultaneously. Absolute perfusion unit (APU) values at identical locations on the breast were then compared graphically. 210 data points were identified on the same patients (n = 4) using both SPY systems. A linear relationship (y = 2.9883x + 12.726) was identified with a high level or correlation (R(2) = 0.744). Previously published values using SPY 2001 (APU 3.7) provided a value of 23.8 APU on the SPY Elite. In addition, postoperative necrosis in these patients correlated to regions of skin identified with the SPY Elite with APU less than 23.8. Intraoperative comparison of LAICGA systems has provided direct correlation of perfusion values predictive of necrosis that were previously established in the literature. An APU value of 3.7 from the SPY 2001 correlates to a SPY Elite APU value of 23.8.

Comparing Quantitative Values of Two Generations of Laser-Assisted Indocyanine Green Dye Angiography Systems: Can We Predict Necrosis?

PubMed Central

Fourman, Mitchell S.; Rivara, Andrew; Dagum, Alexander B.; Huston, Tara L.; Ganz, Jason C.; Bui, Duc T.; Khan, Sami U.

2014-01-01

Objective: Several devices exist today to assist the intraoperative determination of skin flap perfusion. Laser-Assisted Indocyanine Green Dye Angiography (LAICGA) has been shown to accurately predict mastectomy skin flap necrosis using quantitative perfusion values. The laser properties of the latest LAICGA device (SPY Elite) differ significantly from its predecessor system (SPY 2001), preventing direct translation of previous published data. The purpose of this study was to establish a mathematical relationship of perfusion values between these 2 devices. Methods: Breast reconstruction patients were prospectively enrolled into a clinical trial where skin flap evaluation and excision was based on quantitative SPY Q values previously established in the literature. Initial study patients underwent mastectomy skin flap evaluation using both SPY systems simultaneously. Absolute perfusion unit (APU) values at identical locations on the breast were then compared graphically. Results: 210 data points were identified on the same patients (n = 4) using both SPY systems. A linear relationship (y = 2.9883x + 12.726) was identified with a high level or correlation (R2 = 0.744). Previously published values using SPY 2001 (APU 3.7) provided a value of 23.8 APU on the SPY Elite. In addition, postoperative necrosis in these patients correlated to regions of skin identified with the SPY Elite with APU less than 23.8. Conclusion: Intraoperative comparison of LAICGA systems has provided direct correlation of perfusion values predictive of necrosis that were previously established in the literature. An APU value of 3.7 from the SPY 2001 correlates to a SPY Elite APU value of 23.8. PMID:25525483

Mendel's green cotyledon gene encodes a positive regulator of the chlorophyll-degrading pathway.

PubMed

Sato, Yutaka; Morita, Ryouhei; Nishimura, Minoru; Yamaguchi, Hiroyasu; Kusaba, Makoto

2007-08-28

Mutants that retain greenness of leaves during senescence are known as "stay-green" mutants. The most famous stay-green mutant is Mendel's green cotyledon pea, one of the mutants used in determining the law of genetics. Pea plants homozygous for this recessive mutation (known as i at present) retain greenness of the cotyledon during seed maturation and of leaves during senescence. We found tight linkage between the I locus and stay-green gene originally found in rice, SGR. Molecular analysis of three i alleles including one with no SGR expression confirmed that the I gene encodes SGR in pea. Functional analysis of sgr mutants in pea and rice further revealed that leaf functionality is lowered despite a high chlorophyll a (Chl a) and chlorophyll b (Chl b) content in the late stage of senescence, suggesting that SGR is primarily involved in Chl degradation. Consistent with this observation, a wide range of Chl-protein complexes, but not the ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit, were shown to be more stable in sgr than wild-type plants. The expression of OsCHL and NYC1, which encode the first enzymes in the degrading pathways of Chl a and Chl b, respectively, was not affected by sgr in rice. The results suggest that SGR might be involved in activation of the Chl-degrading pathway during leaf senescence through translational or posttranslational regulation of Chl-degrading enzymes.

GreenCube and RocketCube: Low-Resource Sensorcraft for Atmospheric and Ionospheric Science

NASA Astrophysics Data System (ADS)

Bracikowski, P. J.; Lynch, K. A.; Slagle, A. K.; Fagin, M. H.; Currey, S. R.; Siddiqui, M. U.

2009-12-01

In situ atmospheric and ionospheric studies benefit greatly from the ability to separate variations in space from variations in time. Arrays of many probes are a method of doing this, but because of the technical character and expense of developing large arrays, so far probe arrays have been the domain of well-funded science missions. CubeSats and low-resource craft (``Picosats") are an avenue for bringing array-based studies of the atmosphere and ionosphere into the mainstream. The Lynch Rocket Lab at Dartmouth College is attempting to develop the instruments, experience, and heritage to implement arrays of many low-resource sensorcraft while doing worthwhile science in the development process. We are working on two CubeSat projects to reach this goal: GreenCube for atmospheric studies and RocketCube for ionospheric studies. GreenCube is an undergraduate student-directed high-altitude balloon-borne 3U CubeSat. GreenCube I was a bus, telemetry, and mechanical system development project. GreenCube I flew in the fall of 2008. The flight was successfully recovered and tracked over the 97km range and through the 29km altitude rise. GreenCube I carried six thermal housekeeping sensors, a GPS, a magnetometer, and a HAM radio telemetry system with a reporting rate of once every 30 seconds. The velocity profile obtained from the GPS data implies the presence of atmospheric gravity waves during the flight. GreenCube II flew in August 2009 with the science goal of detecting atmospheric gravity waves over the White Mountains of New Hampshire. Two balloons with identical payloads were released 90 seconds apart to make 2-point observations. Each payload carried a magnetometer, 5 thermistors for ambient temperature readings, a GPS, and an amateur radio telemetry system with a 7 second reporting cadence. A vertically oriented video camera on one payload and a horizontally oriented video camera on the other recorded the characteristics of gravity waves in the nearby clouds. We expect to be able to detect atmospheric gravity waves from the GPS-derived position and velocity of the two balloons and the ambient temperature profiles. Preliminary analysis of the temperature data shows indications of atmospheric gravity waves. RocketCube is a graduate student-designed low-resource sensorcraft development project being designed for future ionospheric multi-point missions. The FPGA-based bus system, based on GreenCube’s systems, will be able to control and digitize analog data from any low voltage instrument and telemeter that data. RocketCube contains a GPS and high-resolution magnetometer for position and orientation information. The Lynch Rocket Lab's initial interest in developing RocketCube is to investigate the k-spectrum of density irregularities in the auroral ionosphere. To this end, RocketCube will test a new Petite retarding potential analyzer Ion Probe (PIP) for examining subsonic and supersonic thermal ion populations in the ionosphere. The tentatively planned launch will be from a Wallops Flight Facility sounding rocket test flight in 2011. RocketCube serves as a step toward a scientific auroral sounding rocket mission that will feature an array of subpayloads to study the auroral ionosphere.

Green synthesis of manganese oxide nanoparticles for the electrochemical sensing of p-nitrophenol

NASA Astrophysics Data System (ADS)

Kumar, Vineet; Singh, Kulvinder; Panwar, Shaily; Mehta, Surinder Kumar

2017-03-01

Manganese oxide (MnO) NPs are widely used in contaminant sensing, drug delivery, data storage, catalysis and biomedical imaging. Green synthesis of NPs is important due to increased concern of environmental pollution. Green chemistry based synthesis of NPs is preferred due to its ecofriendly nature. In this study, MnO NPs of different sizes were synthesized in aqueous medium using clove, i.e., Syzygium aromaticum extract (CE) as reducing and stabilizing agents. These NPs were used for the electrochemical sensing of p-nitrophenol (PNP). The synthesis of MnO NPs was over in 30 min. MnO NPs of different sizes were obtained by varying metal ion concentration, metal ion volume ratio, CE concentration, CE volume ratio, and incubation temperature. Selectively, 4 nm MnO NPs were used for electrochemical sensing of paranitrophenol. The MnO NPs modified gold electrodes detected PNP with good sensitivity, 0.16 µA µM-1 cm2. The limit of PNP detection was 15.65 µM. The MnO NPs prepared using CE based green chemistry approach is useful for PNP sensing. These NPs can also be useful for various in vivo applications in which the NPs come in human contact.

THE ROLE OF CONSUMER VALUES AND SOCIO-DEMOGRAPHICS IN GREEN PRODUCT SATISFACTION: THE CASE OF HYBRID CARS.

PubMed

Hur, Won-Moo; Woo, Jeong; Kim, Yeonshin

2015-10-01

This study investigated the relationship between consumer value and customer satisfaction, seeking a better understanding of the motivations underlying "green product" purchases. Based on the influence of demographic factors, it further explores the moderation effects of buyers' socio-demographics on the link between value and satisfaction. Data were collected through a mail survey of American hybrid car buyers. Consumer value, satisfaction, and socio-demographic information were measured, and the proposed relationships among them were tested using hierarchical multiple regression analysis. This study's findings reveal that values (i.e., functional and social) significantly impact hybrid satisfaction and that the effects vary by sex and age. This research provides insight into the motivations of green product purchases by incorporating important consumer characteristics.

Generation of 46 W green-light by frequency doubling of 96 W picosecond unpolarized Yb-doped fiber amplifier

NASA Astrophysics Data System (ADS)

Qi, Yaoyao; Yu, Haijuan; Zhang, Jingyuan; Zhang, Ling; He, Chaojian; Lin, Xuechun

2018-05-01

We demonstrated a high efficiency and high average power picosecond green light source based on SHG (second harmonic generation) of an unpolarized ytterbium-doped fiber amplifier chain. Using single-pass frequency doubling in two temperature-tuned type-I phase-matching LBO crystals, we were able to generate 46 W, >70 ps pulses at 532 nm from a fundamental beam at 1064 nm, whose output is 96 W, 4.8 μJ, with a repetition frequency of 20 MHz and nearly diffraction limited. The optical conversion efficiency was ∼48% in a highly compact design. To the best of our knowledge, this is the first reported on ps green source through SHG of an unpolarized fiber laser with such a high output and high efficiency.

Chemo-sensory approach for the identification of chemical compounds driving green character in red wines.

PubMed

Sáenz-Navajas, María-Pilar; Arias, Ignacio; Ferrero-Del-Teso, Sara; Fernández-Zurbano, Purificación; Escudero, Ana; Ferreira, Vicente

2018-07-01

The present work seeks to define the "green character" of red wines and characterise the groups of molecules potentially involved in that perception. Fifty-four wines were screened by wine experts for different levels of green character. Six different phenolic fractions were obtained by liquid chromatography (LC) and further submitted to sensory and chemical characterisation. The volatile fraction was screened by semipreparative LC, Gas Chromatography-Olfactometry (GC-O) and quantitative analysis. The green character was linked to vegetal aroma, astringency, green and dry tannins according to experts of the Somontano region. Non-volatile fractions containing tannins with mean degree of polymerisation of ten and smaller anthocyanin-derivative pigments (

A Green-Light-Responsive System for the Control of Transgene Expression in Mammalian and Plant Cells.

PubMed

Chatelle, Claire; Ochoa-Fernandez, Rocio; Engesser, Raphael; Schneider, Nils; Beyer, Hannes M; Jones, Alex R; Timmer, Jens; Zurbriggen, Matias D; Weber, Wilfried

2018-05-18

The ever-increasing complexity of synthetic gene networks and applications of synthetic biology requires precise and orthogonal gene expression systems. Of particular interest are systems responsive to light as they enable the control of gene expression dynamics with unprecedented resolution in space and time. While broadly used in mammalian backgrounds, however, optogenetic approaches in plant cells are still limited due to interference of the activating light with endogenous photoreceptors. Here, we describe the development of the first synthetic light-responsive system for the targeted control of gene expression in mammalian and plant cells that responds to the green range of the light spectrum in which plant photoreceptors have minimal activity. We first engineered a system based on the light-sensitive bacterial transcription factor CarH and its cognate DNA operator sequence CarO from Thermus thermophilus to control gene expression in mammalian cells. The system was functional in various mammalian cell lines, showing high induction (up to 350-fold) along with low leakiness, as well as high reversibility. We quantitatively described the systems characteristics by the development and experimental validation of a mathematical model. Finally, we transferred the system into A. thaliana protoplasts and demonstrated gene repression in response to green light. We expect that this system will provide new opportunities in applications based on synthetic gene networks and will open up perspectives for optogenetic studies in mammalian and plant cells.

New insights into the red and green pigments in the illuminated foral charter of Setubal (1515) by combined use of μ-Raman and X-ray fluorescence spectrometry

NASA Astrophysics Data System (ADS)

Guerra, M.; Carvalho, M. L.; Le Gac, A.; Manso, M.; Mortari, C.; Longelin, S.; Pessanha, S.

2016-03-01

The richly decorated foral charter attributed by D. Manuel I of Portugal, in 1515, to the village of Setubal, was studied using Energy Dispersive X-ray Fluorescence spectrometry and Raman micro-spectroscopy. An in situ characterization of the pigments used in the production of this masterpiece showed a very different pigment palette choice when compared to other similar Manueline charters. The red and green pigments are particularly puzzling, as the widely used mercury- and copper-based pigments, vermillion and malachite, respectively, were not found in the illuminated frontispiece. Instead, the cheaper lead-based pigment minium was used in the King's flag, while a mixture of copper sulfates was found for the green color, identified by means of micro-Raman spectroscopy. This result led to a new look at the conception that only one Royal workshop existed for the elaboration of Manueline foral charters.

Quantitative microbial risk assessment for Escherichia coli O157:H7, salmonella, and Listeria monocytogenes in leafy green vegetables consumed at salad bars.

PubMed

Franz, E; Tromp, S O; Rijgersberg, H; van der Fels-Klerx, H J

2010-02-01

Fresh vegetables are increasingly recognized as a source of foodborne outbreaks in many parts of the world. The purpose of this study was to conduct a quantitative microbial risk assessment for Escherichia coli O157:H7, Salmonella, and Listeria monocytogenes infection from consumption of leafy green vegetables in salad from salad bars in The Netherlands. Pathogen growth was modeled in Aladin (Agro Logistics Analysis and Design Instrument) using time-temperature profiles in the chilled supply chain and one particular restaurant with a salad bar. A second-order Monte Carlo risk assessment model was constructed (using @Risk) to estimate the public health effects. The temperature in the studied cold chain was well controlled below 5 degrees C. Growth of E. coli O157:H7 and Salmonella was minimal (17 and 15%, respectively). Growth of L. monocytogenes was considerably greater (194%). Based on first-order Monte Carlo simulations, the average number of cases per year in The Netherlands associated the consumption leafy greens in salads from salad bars was 166, 187, and 0.3 for E. coli O157:H7, Salmonella, and L. monocytogenes, respectively. The ranges of the average number of annual cases as estimated by second-order Monte Carlo simulation (with prevalence and number of visitors as uncertain variables) were 42 to 551 for E. coli O157:H7, 81 to 281 for Salmonella, and 0.1 to 0.9 for L. monocytogenes. This study included an integration of modeling pathogen growth in the supply chain of fresh leafy vegetables destined for restaurant salad bars using software designed to model and design logistics and modeling the public health effects using probabilistic risk assessment software.

Data-nonintrusive photonics-based credit card verifier with a low false rejection rate.

PubMed

Sumriddetchkajorn, Sarun; Intaravanne, Yuttana

2010-02-10

We propose and experimentally demonstrate a noninvasive credit card verifier with a low false rejection rate (FRR). Our key idea is based on the use of three broadband light sources in our data-nonintrusive photonics-based credit card verifier structure, where spectral components of the embossed hologram images are registered as red, green, and blue. In this case, nine distinguishable variables are generated for a feed-forward neural network (FFNN). In addition, we investigate the center of mass of the image histogram projected onto the x axis (I(color)), making our system more tolerant of the intensity fluctuation of the light source. We also reduce the unwanted signals on each hologram image by simply dividing the hologram image into three zones and then calculating their corresponding I(color) values for red, green, and blue bands. With our proposed concepts, we implement our field test prototype in which three broadband white light light-emitting diodes (LEDs), a two-dimensional digital color camera, and a four-layer FFNN are used. Based on 249 genuine credit cards and 258 counterfeit credit cards, we find that the average of differences in I(color) values between genuine and counterfeit credit cards is improved by 1.5 times and up to 13.7 times. In this case, we can effectively verify credit cards with a very low FRR of 0.79%.

Quantitative multi-pinhole small-animal SPECT: uniform versus non-uniform Chang attenuation correction.

PubMed

Wu, C; de Jong, J R; Gratama van Andel, H A; van der Have, F; Vastenhouw, B; Laverman, P; Boerman, O C; Dierckx, R A J O; Beekman, F J

2011-09-21

Attenuation of photon flux on trajectories between the source and pinhole apertures affects the quantitative accuracy of reconstructed single-photon emission computed tomography (SPECT) images. We propose a Chang-based non-uniform attenuation correction (NUA-CT) for small-animal SPECT/CT with focusing pinhole collimation, and compare the quantitative accuracy with uniform Chang correction based on (i) body outlines extracted from x-ray CT (UA-CT) and (ii) on hand drawn body contours on the images obtained with three integrated optical cameras (UA-BC). Measurements in phantoms and rats containing known activities of isotopes were conducted for evaluation. In (125)I, (201)Tl, (99m)Tc and (111)In phantom experiments, average relative errors comparing to the gold standards measured in a dose calibrator were reduced to 5.5%, 6.8%, 4.9% and 2.8%, respectively, with NUA-CT. In animal studies, these errors were 2.1%, 3.3%, 2.0% and 2.0%, respectively. Differences in accuracy on average between results of NUA-CT, UA-CT and UA-BC were less than 2.3% in phantom studies and 3.1% in animal studies except for (125)I (3.6% and 5.1%, respectively). All methods tested provide reasonable attenuation correction and result in high quantitative accuracy. NUA-CT shows superior accuracy except for (125)I, where other factors may have more impact on the quantitative accuracy than the selected attenuation correction.

Green design application on campus to enhance student’s quality of life

NASA Astrophysics Data System (ADS)

Tamiami, H.; Khaira, F.; Fachrudin, A.

2018-02-01

Green design becomes an important thing to applied in the building. Green building will provide comfortability and enhance Quality of Life (QoL) for the users. The purpose of this research is to analyze how green design application on campus to enhance student’s QoL. This research conducted in three campuses which located in North Sumatera Province, namely Universitas Sumatera Utara (USU), Universitas Negeri Medan (Unimed) and Universitas Medan Area (UMA) which have a lot of vegetation, open space, and multi-mass buildings. This research compared the green design application to QoL from three universities. Green design in this research that become independent variables focus on the energy efficiency and conservation (EEC), indoor health and comfort (IHC) and building environment management (BEM) with dependent variable is QoL. This research uses quantitative methods with questionnaire survey techniques. The population is students from the three universities with the sample of each University is 50 samples. The analysis uses multiple regression analysis. The results show that green design application may enhance QoL of students. The campus should have a good green design application to enhance QoL of students and give them comfortability.

Spatially controlled immobilisation of biomolecules: A complete approach in green chemistry

NASA Astrophysics Data System (ADS)

Grinenval, Eva; Nonglaton, Guillaume; Vinet, Françoise

2014-01-01

The development of 'green' sensors is a challenging task in the field of biomolecule sensing, for example in the detection of cardiac troponin-I (cTnI). In the present work a complete approach in green chemistry was developed to create chemically active patterns for the immobilisation of biological probes. This key technology is discussed on the basis of the twelve green chemistry principles, and is a combination of surface patterning by spotting and surface chemistries modified by molecular vapour deposition. The (1H,1H,2H,2H)-perfluorodecyltrichlorosilane (FDTS) was used as a novel anti-adsorption layer while the 3,4-epoxybutyltrimethoxysilane (EBTMOS) was used to immobilise probes. Oligonucleotides and the anti-cTnI antibody were studied. The spatially controlled immobilisation of probes was characterised by fluorescence. The demonstrated surface modification has broad applications in areas such as diagnostics and bio-chemical sensing. Moreover, the environmental impacts of surface patterning and surface chemistry were discussed from a 'greenness' point of view.

A fluorescent nucleic acid nanodevice quantitatively images elevated cyclic adenosine monophosphate in membrane-bound compartments.

PubMed

Sharma, Suruchi; Zaveri, Anisha; Visweswariah, Sandhya S; Krishnan, Yamuna

2014-11-12

cAMPhor: In the presence of cAMP, cAMPhor folds into a structure that binds DFHBI (green), increasing its fluorescence, while Alexa 647 (red) functions as a normalizing dye. It can thus be used to spatially image cAMP quantitatively in membrane-bound compartments. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

9 CFR 424.22 - Certain other permitted uses.

Code of Federal Regulations, 2014 CFR

2014-01-01

... based on the actual or estimated skin-free green weight of the bacon belly. (c) Irradiation of meat food... documentation on premises, available to FSIS: (i) Documentation that the irradiation facility is licensed or... radiation source irradiation facility is registered with the appropriate State government, if applicable...

9 CFR 424.22 - Certain other permitted uses.

Code of Federal Regulations, 2012 CFR

2012-01-01

... based on the actual or estimated skin-free green weight of the bacon belly. (c) Irradiation of meat food... documentation on premises, available to FSIS: (i) Documentation that the irradiation facility is licensed or... radiation source irradiation facility is registered with the appropriate State government, if applicable...

9 CFR 424.22 - Certain other permitted uses.

Code of Federal Regulations, 2013 CFR

2013-01-01

... based on the actual or estimated skin-free green weight of the bacon belly. (c) Irradiation of meat food... documentation on premises, available to FSIS: (i) Documentation that the irradiation facility is licensed or... radiation source irradiation facility is registered with the appropriate State government, if applicable...

9 CFR 424.22 - Certain other permitted uses.

Code of Federal Regulations, 2011 CFR

2011-01-01

... based on the actual or estimated skin-free green weight of the bacon belly. (c) Irradiation of meat food... documentation on premises, available to FSIS: (i) Documentation that the irradiation facility is licensed or... radiation source irradiation facility is registered with the appropriate State government, if applicable...

9 CFR 424.22 - Certain other permitted uses.

Code of Federal Regulations, 2010 CFR

2010-01-01

... based on the actual or estimated skin-free green weight of the bacon belly. (c) Irradiation of meat food... documentation on premises, available to FSIS: (i) Documentation that the irradiation facility is licensed or... radiation source irradiation facility is registered with the appropriate State government, if applicable...

Scaling the consequences of interactions between invaders from the individual to the population level.

PubMed

Griffen, Blaine D

2016-03-01

The impact of human-induced stressors, such as invasive species, is often measured at the organismal level, but is much less commonly scaled up to the population level. Interactions with invasive species represent an increasingly common source of stressor in many habitats. However, due to the increasing abundance of invasive species around the globe, invasive species now commonly cause stresses not only for native species in invaded areas, but also for other invasive species. I examine the European green crab Carcinus maenas, an invasive species along the northeast coast of North America, which is known to be negatively impacted in this invaded region by interactions with the invasive Asian shore crab Hemigrapsus sanguineus. Asian shore crabs are known to negatively impact green crabs via two mechanisms: by directly preying on green crab juveniles and by indirectly reducing green crab fecundity via interference (and potentially exploitative) competition that alters green crab diets. I used life-table analyses to scale these two mechanistic stressors up to the population level in order to examine their relative impacts on green crab populations. I demonstrate that lost fecundity has larger impacts on per capita population growth rates, but that both predation and lost fecundity are capable of reducing population growth sufficiently to produce the declines in green crab populations that have been observed in areas where these two species overlap. By scaling up the impacts of one invader on a second invader, I have demonstrated that multiple documented interactions between these species are capable of having population-level impacts and that both may be contributing to the decline of European green crabs in their invaded range on the east coast of North America.

A one-step colorimetric acid-base titration sensor using a complementary color changing coordination system.

PubMed

Cho, Hui Hun; Kim, Si Hyun; Heo, Jun Hyuk; Moon, Young Eel; Choi, Young Hun; Lim, Dong Cheol; Han, Kwon-Hoon; Lee, Jung Heon

2016-06-21

We report the development of a colorimetric sensor that allows for the quantitative measurement of the acid content via acid-base titration in a single-step. In order to create the sensor, we used a cobalt coordination system (Co-complex sensor) that changes from greenish blue colored Co(H2O)4(OH)2 to pink colored Co(H2O)6(2+) after neutralization. Greenish blue and pink are two complementary colors with a strong contrast. As a certain amount of acid is introduced to the Co-complex sensor, a portion of greenish blue colored Co(H2O)4(OH)2 changes to pink colored Co(H2O)6(2+), producing a different color. As the ratio of greenish blue and pink in the Co-complex sensor is determined by the amount of neutralization reaction occurring between Co(H2O)4(OH)2 and an acid, the sensor produced a spectrum of green, yellow green, brown, orange, and pink colors depending on the acid content. In contrast, the color change appeared only beyond the end point for normal acid-base titration. When we mixed this Co-complex sensor with different concentrations of citric acid, tartaric acid, and malic acid, three representative organic acids in fruits, we observed distinct color changes for each sample. This color change could also be observed in real fruit juice. When we treated the Co-complex sensor with real tangerine juice, it generated diverse colors depending on the concentration of citric acid in each sample. These results provide a new angle on simple but quantitative measurements of analytes for on-site usage in various applications, such as in food, farms, and the drug industry.

Band-limited Green's Functions for Quantitative Evaluation of Acoustic Emission Using the Finite Element Method

NASA Technical Reports Server (NTRS)

Leser, William P.; Yuan, Fuh-Gwo; Leser, William P.

2013-01-01

A method of numerically estimating dynamic Green's functions using the finite element method is proposed. These Green's functions are accurate in a limited frequency range dependent on the mesh size used to generate them. This range can often match or exceed the frequency sensitivity of the traditional acoustic emission sensors. An algorithm is also developed to characterize an acoustic emission source by obtaining information about its strength and temporal dependence. This information can then be used to reproduce the source in a finite element model for further analysis. Numerical examples are presented that demonstrate the ability of the band-limited Green's functions approach to determine the moment tensor coefficients of several reference signals to within seven percent, as well as accurately reproduce the source-time function.

Modulation of coffee aroma via the fermentation of green coffee beans with Rhizopus oligosporus: I. Green coffee.

PubMed

Lee, Liang Wei; Cheong, Mun Wai; Curran, Philip; Yu, Bin; Liu, Shao Quan

2016-11-15

Modulation of coffee aroma via the biotransformation/fermentation of different coffee matrices during post-harvest remains sparingly explored despite some studies showing their positive impacts on coffee aroma. Therefore, this is an unprecedented study aimed at modulating coffee aroma via the fermentation of green coffee beans with a food-grade fungus Rhizopus oligosporus. The objective of part I of this two-part study was to characterize the volatile and non-volatile profiles of green coffee beans after fermentation. Proteolysis during fermentation resulted in 1.5-fold increase in the concentrations of proline and aspartic acid which exhibited high Maillard reactivity. Extensive degradation of ferulic and caffeic acids led to 2-fold increase in the total concentrations of volatile phenolic derivatives. 36% of the total volatiles detected in fermented green coffee beans were generated during fermentation. Hence, the work presented demonstrated that R. oligosporus fermentation of green coffee beans could induce modification of the aroma precursors of green coffees. Copyright © 2016 Elsevier Ltd. All rights reserved.

Lead concentrations in bullfrog Rana catesbeiana and green frog R. clamitans tadpoles inhabiting highway drainages

USGS Publications Warehouse

Birdsall, C.W.; Grue, C.E.; Anderson, A.

1986-01-01

Lead concentrations were determined in sediment and tadpoles of bullfrogs Rana catesbeiana and green frogs R. clamitans from drainages along highways with different daily average traffic volumes (range, 4272 to I08,800 vehicles day-I) and from ponds >0.4 km from the nearest highway. Lead concentrations (mg kg--I dry weight) in sediment (7-8 to 940) were usually greater (4-5 times) than those in the tadpoles (bullfrog, 0,07 to 270; green frog, 0,90 to 240 mg kg-I). Lead concentrations in sediment (r =0.63) and in both species of tadpoles (bullfrog, r = 0.69; green frog, r = 0.57) were positively correlated with average daily traffic volume. Lead concentrations in both species of tadpoles (bullfrog, r = (). 76: green frog, r = 0.75) were also positively correlated with lead concentrations in sediment. At sites where both bullfrog and green frog tadpoles were collected. lead concentrations in the two species were closely related (r = 0.84). Lead concentrations in tadpoles living near highways may contribute to the elevated lead levels reported in wildlife that are potential tadpole predators. Dietary lead concentrations similar to those in our tadpoles have been associated with physiological and reproductive effects in some species of birds and mammals. However, additional data are needed to determine the hazards to predators of lead concentrations in tadpoles.

Reduction of Ag{sup I}, Au{sup III}, Cu{sup II}, and Hg{sup II} by Fe{sup II}/Fe{sup III} hydroxysulfate green rust.

DOE Office of Scientific and Technical Information (OSTI.GOV)

O'Loughlin, E. J.; Kelly, S. D.; Kemner, K. M.

Green rusts are mixed Fe{sup II}/Fe{sup III} hydroxides that are found in many suboxic environments where they are believed to play a central role in the biogeochemical cycling of iron. X-ray absorption fine structure analysis of hydroxysulfate green rust suspensions spiked with aqueous solutions of AgCH{sub 3}COO, AuCl{sub n}(OH){sub 4-n}, CuCl{sub 2}, or HgCl{sub 2} showed that Ag{sup I}, Au{sup III}, Cu{sup II}, and Hg{sup II} were readily reduced to Ag{sup 0}, Au{sup 0}, Cu{sup 0}, and Hg{sup 0}. Imaging of the resulting solids from the Ag{sup I}-, Au{sup III}-, and Cu{sup II}-amended green rust suspensions by transmission electron microscopymore » indicated the formation of submicron-sized particles of Ag{sup 0}, Au{sup 0}, and Cu{sup 0}. The facile reduction of Ag{sup I}, Au{sup III}, Cu{sup II}, and Hg{sup II} to Ag{sup 0}, Au{sup 0}, Cu{sup 0}, and Hg{sup 0}, respectively, by green rust suggests that the presence of green rusts in suboxic soils and sediments can have a significant impact on the biogeochemistry of silver, gold, copper, and mercury, particularly with respect to their mobility.« less

[The intensity of phytodetrite decomposition in Larch Forest of the permafrost zone in central Siberia].

PubMed

Prokushkin, S G; Prokushkin, A S; Sorokin, N D

2014-01-01

Based on the results of long-term investigations, quantitative assessment ofphytodetrite mineralization rates is provided. Their role in the biological cycle of larch stands growing in the permafrost zone of Central Evenkia is discussed. It is demonstrated that their destruction in the subshrub-sphagnum and cowberry-green moss larch stands is extremely slow, the plant litter contains the most cecalcitrant organic matter demonstrating the lowest decomposition coefficient of 0.03-0.04 year(-1), whereas fresh components of the plant litter have 3- to 4-fold higher values. An insignificant input of N and C from the analyzed mortmass to the soil has been registered. It has been revealed that the changes in N and C in the decomposition components are closely related to the quantitative dynamics (biomass) of microorganisms, such as hydrolytics and, especially, micromicetes.

Interaction of photosystem I from Phaeodactylum tricornutum with plastocyanins as compared with its native cytochrome c6: Reunion with a lost donor.

PubMed

Bernal-Bayard, Pilar; Pallara, Chiara; Carmen Castell, M; Molina-Heredia, Fernando P; Fernández-Recio, Juan; Hervás, Manuel; Navarro, José A

2015-12-01

In the Phaeodactylum tricornutum alga, as in most diatoms, cytochrome c6 is the only electron donor to photosystem I, and thus they lack plastocyanin as an alternative electron carrier. We have investigated, by using laser-flash absorption spectroscopy, the electron transfer to Phaeodactylum photosystem I from plastocyanins from cyanobacteria, green algae and plants, as compared with its own cytochrome c6. Diatom photosystem I is able to effectively react with eukaryotic acidic plastocyanins, although with less efficiency than with Phaeodactylum cytochrome c6. This efficiency, however, increases in some green alga plastocyanin mutants mimicking the electrostatics of the interaction site on the diatom cytochrome. In addition, the structure of the transient electron transfer complex between cytochrome c6 and photosystem I from Phaeodactylum has been analyzed by computational docking and compared to that of green lineage and mixed systems. Taking together, the results explain why the Phaeodactylum system shows a lower efficiency than the green systems, both in the formation of the properly arranged [cytochrome c6-photosystem I] complex and in the electron transfer itself. Copyright © 2015 Elsevier B.V. All rights reserved.

Green noise wall construction and evaluation.

DOT National Transportation Integrated Search

2011-09-01

This report details the research performed under Phase I of a research study titled Green Noise Wall Construction and Evaluation that looks into the feasibility of using green noise barriers as a noise mitigation option in Ohio. This phase incl...

Seeds of Green: My Own Arctic Copper/Mine

ERIC Educational Resources Information Center

Blenkinsop, Sean

2006-01-01

In this narrative essay, I explore some fundamental assumptions in my understanding of environmental education. Questions are raised concerning the nature of perception, experience, and the interplay between the world and ourselves. The narrative is based on a recent trip down the Coppermine River in the Barrenlands of Canada's Arctic. The…

Ratiometric analysis of Acridine Orange staining in the study of acidic organelles and autophagy.

PubMed

Thomé, Marcos P; Filippi-Chiela, Eduardo C; Villodre, Emilly S; Migliavaca, Celina B; Onzi, Giovana R; Felipe, Karina B; Lenz, Guido

2016-12-15

Acridine Orange is a cell-permeable green fluorophore that can be protonated and trapped in acidic vesicular organelles (AVOs). Its metachromatic shift to red fluorescence is concentration-dependent and, therefore, Acridine Orange fluoresces red in AVOs, such as autolysosomes. This makes Acridine Orange staining a quick, accessible and reliable method to assess the volume of AVOs, which increases upon autophagy induction. Here, we describe a ratiometric analysis of autophagy using Acridine Orange, considering the red-to-green fluorescence intensity ratio (R/GFIR) to quantify flow cytometry and fluorescence microscopy data of Acridine-Orange-stained cells. This method measured with accuracy the increase in autophagy induced by starvation or rapamycin, and the reduction in autophagy produced by bafilomycin A1 or the knockdown of Beclin1 or ATG7. Results obtained with Acridine Orange, considering R/GFIR, correlated with the conversion of the unlipidated form of LC3 (LC3-I) into the lipidated form (LC3-II), SQSTM1 degradation and GFP-LC3 puncta formation, thus validating this assay to be used as an initial and quantitative method for evaluating the late step of autophagy in individual cells, complementing other methods. © 2016. Published by The Company of Biologists Ltd.

Dynamical correlation effects in a weakly correlated material: Inelastic x-ray scattering and photoemission spectra of beryllium

NASA Astrophysics Data System (ADS)

Seidu, Azimatu; Marini, Andrea; Gatti, Matteo

2018-03-01

Beryllium is a weakly correlated simple metal. Still we find that dynamical correlation effects, beyond the independent-particle picture, are necessary to successfully interpret the electronic spectra measured by inelastic x-ray scattering (IXS) and photoemission spectroscopies (PES). By combining ab initio time-dependent density-functional theory (TDDFT) and many-body Green's function theory in the G W approximation (G W A ), we calculate the dynamic structure factor, the quasiparticle (QP) properties and PES spectra of bulk Be. We show that band-structure effects (i.e., due to interaction with the crystal potential) and QP lifetimes (LT) are both needed in order to explain the origin of the measured double-peak features in the IXS spectra. A quantitative agreement with experiment is obtained only when LT are supplemented to the adiabatic local-density approximation (ALDA) of TDDFT. Besides the valence band, PES spectra display a satellite, a signature of dynamical correlation due to the coupling of QPs and plasmons, which we are able to reproduce thanks to the combination of the G W A for the self-energy with the cumulant expansion of the Green's function.

Use of Hyperspectral Imagery to Assess Cryptic Color Matching in Sargassum Associated Crabs.

PubMed

Russell, Brandon J; Dierssen, Heidi M

2015-01-01

Mats of the pelagic macroalgae Sargassum represent a complex environment for the study of marine camouflage at the air-sea interface. Endemic organisms have convergently evolved similar colors and patterns, but quantitative assessments of camouflage strategies are lacking. Here, spectral camouflage of two crab species (Portunus sayi and Planes minutus) was assessed using hyperspectral imagery (HSI). Crabs matched Sargassum reflectance across blue and green wavelengths (400-550 nm) and diverged at longer wavelengths. Maximum discrepancy was observed in the far-red (i.e., 675 nm) where Chlorophyll a absorption occurred in Sargassum and not the crabs. In a quantum catch color model, both crabs showed effective color matching against blue/green sensitive dichromat fish, but were still discernible to tetrachromat bird predators that have visual sensitivity to far red wavelengths. The two species showed opposing trends in background matching with relation to body size. Variation in model parameters revealed that discrimination of crab and background was impacted by distance from the predator, and the ratio of cone cell types for bird predators. This is one of the first studies to detail background color matching in this unique, challenging ecosystem at the air-sea interface.

Use of Hyperspectral Imagery to Assess Cryptic Color Matching in Sargassum Associated Crabs

PubMed Central

2015-01-01

Mats of the pelagic macroalgae Sargassum represent a complex environment for the study of marine camouflage at the air-sea interface. Endemic organisms have convergently evolved similar colors and patterns, but quantitative assessments of camouflage strategies are lacking. Here, spectral camouflage of two crab species (Portunus sayi and Planes minutus) was assessed using hyperspectral imagery (HSI). Crabs matched Sargassum reflectance across blue and green wavelengths (400–550 nm) and diverged at longer wavelengths. Maximum discrepancy was observed in the far-red (i.e., 675 nm) where Chlorophyll a absorption occurred in Sargassum and not the crabs. In a quantum catch color model, both crabs showed effective color matching against blue/green sensitive dichromat fish, but were still discernible to tetrachromat bird predators that have visual sensitivity to far red wavelengths. The two species showed opposing trends in background matching with relation to body size. Variation in model parameters revealed that discrimination of crab and background was impacted by distance from the predator, and the ratio of cone cell types for bird predators. This is one of the first studies to detail background color matching in this unique, challenging ecosystem at the air-sea interface. PMID:26352667

Measurement of Epstein-Barr virus DNA load using a novel quantification standard containing two EBV DNA targets and SYBR Green I dye.

PubMed

Lay, Meav-Lang J; Lucas, Robyn M; Ratnamohan, Mala; Taylor, Janette; Ponsonby, Anne-Louise; Dwyer, Dominic E

2010-09-22

Reactivation of Epstein-Barr virus (EBV) infection may cause serious, life-threatening complications in immunocompromised individuals. EBV DNA is often detected in EBV-associated disease states, with viral load believed to be a reflection of virus activity. Two separate real-time quantitative polymerase chain reaction (QPCR) assays using SYBR Green I dye and a single quantification standard containing two EBV genes, Epstein-Barr nuclear antigen-1 (EBNA-1) and BamHI fragment H rightward open reading frame-1 (BHRF-1), were developed to detect and measure absolute EBV DNA load in patients with various EBV-associated diseases. EBV DNA loads and viral capsid antigen (VCA) IgG antibody titres were also quantified on a population sample. EBV DNA was measurable in ethylenediaminetetraacetic acid (EDTA) whole blood, peripheral blood mononuclear cells (PBMCs), plasma and cerebrospinal fluid (CSF) samples. EBV DNA loads were detectable from 8.0 × 10(2) to 1.3 × 10(8) copies/ml in post-transplant lymphoproliferative disease (n = 5), 1.5 × 10(3) to 2.0 × 10(5) copies/ml in infectious mononucleosis (n = 7), 7.5 × 10(4) to 1.1 × 10(5) copies/ml in EBV-associated haemophagocytic syndrome (n = 1), 2.0 × 10(2) to 5.6 × 10(3) copies/ml in HIV-infected patients (n = 12), and 2.0 × 10(2) to 9.1 × 10(4) copies/ml in the population sample (n = 218). EBNA-1 and BHRF-1 DNA were detected in 11.0% and 21.6% of the population sample respectively. There was a modest correlation between VCA IgG antibody titre and BHRF-1 DNA load (rho = 0.13, p = 0.05) but not EBNA-1 DNA load (rho = 0.11, p = 0.11). Two sensitive and specific real-time PCR assays using SYBR Green I dye and a single quantification standard containing two EBV DNA targets, were developed for the detection and measurement of EBV DNA load in a variety of clinical samples. These assays have application in the investigation of EBV-related illnesses in immunocompromised individuals.

Validation of the GreenLight™ Simulator and development of a training curriculum for photoselective vaporisation of the prostate.

PubMed

Aydin, Abdullatif; Muir, Gordon H; Graziano, Manuela E; Khan, Muhammad Shamim; Dasgupta, Prokar; Ahmed, Kamran

2015-06-01

To assess face, content and construct validity, and feasibility and acceptability of the GreenLight™ Simulator as a training tool for photoselective vaporisation of the prostate (PVP), and to establish learning curves and develop an evidence-based training curriculum. This prospective, observational and comparative study, recruited novice (25 participants), intermediate (14) and expert-level urologists (seven) from the UK and Europe at the 28th European Association of Urological Surgeons Annual Meeting 2013. A group of novices (12 participants) performed 10 sessions of subtask training modules followed by a long operative case, whereas a second group (13) performed five sessions of a given case module. Intermediate and expert groups performed all training modules once, followed by one operative case. The outcome measures for learning curves and construct validity were time to task, coagulation time, vaporisation time, average sweep speed, average laser distance, blood loss, operative errors, and instrument cost. Face and content validity, feasibility and acceptability were addressed through a quantitative survey. Construct validity was demonstrated in two of five training modules (P = 0.038; P = 0.018) and in a considerable number of case metrics (P = 0.034). Learning curves were seen in all five training modules (P < 0.001) and significant reduction in case operative time (P < 0.001) and error (P = 0.017) were seen. An evidence-based training curriculum, to help trainees acquire transferable skills, was produced using the results. This study has shown the GreenLight Simulator to be a valid and useful training tool for PVP. It is hoped that by using the training curriculum for the GreenLight Simulator, novice trainees can acquire skills and knowledge to a predetermined level of proficiency. © 2014 The Authors. BJU International © 2014 BJU International.

The study of in-situ formed alumina and aluminide intermetallic reinforced aluminum-based metal matrix composites

NASA Astrophysics Data System (ADS)

Yu, Peng

Aluminum-based metal matrix composites (MMCs) have been widely used as structural materials in the automobile and aerospace industry due to their specific properties. In this thesis, we report the fabrication of in-situ formed alumina and aluminide intermetallic reinforced aluminum-based metal matrix composites by the displacement reactions between Al and selected metal oxides (NiO, CuO and ZnO). These MMCs were produced when the Al-20wt% NiO, Al-20wt% CuO and Al-10wt% ZnO green compacts were reaction sintered in the tube furnaces. In this work, differential thermal analysis (DTA) was performed on the green samples. The green samples were then sintered separately in different tube furnaces for 30 minutes. In order to study the reaction mechanisms, the x-ray diffractometry (XRD) was used to obtain diffraction patterns of these sintered samples, the scanning electron microscope (SEM) and transmission electron microscope (TEM) were used to study the microstructures of these samples. The elemental quantitative compositions of samples were determined by the energy dispersive x-ray spectrometry (EDX). In order to study the effect of cooling rate on the samples, the green samples were further sintered to 1000°C and cooled down to room temperature in different conditions: by furnace-cooling, air-quenching, oil-quenching or NaCl-solution-quenching. The SEM, TEM and atomic force microscopy (AFM) were conducted to investigate their microstructures. A microhardness tester was used to measure the hardness values of these samples. It was found that during sintering of the Al-20wt% NiO green sample, displacement reaction between Al and NiO initially occurred in solid-solid form and was soon halted by its products that separated the NiO particles from the Al matrix. The reaction then resumed in solid-liquid form as the temperature increased to the eutectic temperature of Al3Ni-Al when liquid (Al, Ni) phase appeared in the sample. After cooling, Al2O 3 particles, Al3Ni proeutectic phase and fiber-like Al 3Ni-Al eutectic were found in the sintered Al-MMC sample. (Abstract shortened by UMI.)

The green areas of San Juan, Puerto Rico

Treesearch

O.M. Ramos-Gonzalez

2014-01-01

Green areas, also known as green infrastructure or urban vegetation, are vital to urbanites for their critical roles in mitigating urban heat island effects and climate change and for their provision of multiple ecosystem services and aesthetics. Here, I provide a high spatial resolution snapshot of the green cover distribution of the city of San Juan, Puerto Rico, by...

Detection of periodontal pathogen Porphyromonas gingivalis by loop-mediated isothermal amplification method.

PubMed

Maeda, Hiroshi; Kokeguchi, Susumu; Fujimoto, Chiyo; Tanimoto, Ichiro; Yoshizumi, Wakako; Nishimura, Fusanori; Takashiba, Shogo

2005-02-01

A method for nucleic acid amplification, loop-mediated isothermal amplification (LAMP) was employed to develop a rapid and simple detection system for periodontal pathogen, Porphyromonas gingivalis. A set of six primers was designed by targeting the 16S ribosomal RNA gene. By the detection system, target DNA was amplified and visualized on agarose gel within 30 min under isothermal condition at 64 degrees C with a detection limit of 20 cells of P. gingivalis. Without gel electrophoresis, the LAMP amplicon was directly visualized in the reaction tube by addition of SYBR Green I for a naked-eye inspection. The LAMP reaction was also assessed by white turbidity of magnesium pyrophosphate (a by-product of LAMP) in the tube. Detection limits of these naked-eye inspections were 20 cells and 200 cells, respectively. Although false-positive DNA amplification was observed from more than 10(7) cells of Porphyromonas endodontalis, no amplification was observed in other five related oral pathogens. Further, quantitative detection of P. gingivalis was accomplished by a real-time monitoring of the LAMP reaction using SYBR Green I with linearity over a range of 10(2)-10(6) cells. The real-time LAMP was then applied to clinical samples of dental plaque and demonstrated almost identical results to the conventional real-time PCR with an advantage of rapidity. These findings indicate the potential usefulness of LAMP for detecting and quantifying P. gingivalis, especially in its rapidity and simplicity.

A novel quantitative reverse-transcription PCR (qRT-PCR) for the enumeration of total bacteria, using meat micro-flora as a model.

PubMed

Dolan, Anthony; Burgess, Catherine M; Barry, Thomas B; Fanning, Seamus; Duffy, Geraldine

2009-04-01

A sensitive quantitative reverse-transcription PCR (qRT-PCR) method was developed for enumeration of total bacteria. Using two sets of primers separately to target the ribonuclease-P (RNase P) RNA transcripts of gram positive and gram negative bacteria. Standard curves were generated using SYBR Green I kits for the LightCycler 2.0 instrument (Roche Diagnostics) to allow quantification of mixed microflora in liquid media. RNA standards were used and extracted from known cell equivalents and subsequently converted to cDNA for the construction of standard curves. The number of mixed bacteria in culture was determined by qRT-PCR, and the results correlated (r(2)=0.88, rsd=0.466) with the total viable count over the range from approx. Log(10) 3 to approx. Log(10) 7 CFU ml(-1). The rapid nature of this assay (8 h) and its potential as an alternative method to the standard plate count method to predict total viable counts and shelf life are discussed.

[Colonization of Porphyromonas endodontalis in primary and secondary endodontic infections].

PubMed

Hong, Li; Hai, Ji; Yan-Yan, He; Shenghui, Yang; Benxiang, Hou

2015-02-01

This study aims to assess and compare the prevalence of Porphyromonas endodontalis (P. endodontalis) in root canals associated with primary and secondary endodontic infections by using 16s rDNA PCR and real-time fluorescence quantitative polymerase chain reaction (RTFQ-PCR). A total of 120 adult patients with one radiographically documented periapical lesion were included. Sixty teeth presented with primary endodontic infections and 60 with secondary endodontic infections requiring retreatment. P. endodontalis was identified by using 16s rDNA PCR techniques. The positive DNA expression of P. endodontalis in two types of infected root canals were quantitatively compared by using SYBR GREEN I RTFQ-PCR. The prevalence of P. endodontalis in the root canals with primary endodontic infections was significantly higher than that in root canals with secondary endodontic infections (P = 0.001). However, RTFQ-PCR results showed no significant difference in DNA expression quantities between the primary and secondary endodontic infections root canals (P = 0.303). P. endodontalis is more highly associated with root canals having primary endodontic infections, although P. endodontalis colonize in both root canals with primary and secondary chronic apical periodontitis.

A blue/green water-based accounting framework for assessment of water security

NASA Astrophysics Data System (ADS)

Rodrigues, Dulce B. B.; Gupta, Hoshin V.; Mendiondo, Eduardo M.

2014-09-01

A comprehensive assessment of water security can incorporate several water-related concepts, while accounting for Blue and Green Water (BW and GW) types defined in accordance with the hydrological processes involved. Here we demonstrate how a quantitative analysis of provision probability and use of BW and GW can be conducted, so as to provide indicators of water scarcity and vulnerability at the basin level. To illustrate the approach, we use the Soil and Water Assessment Tool (SWAT) to model the hydrology of an agricultural basin (291 km2) within the Cantareira Water Supply System in Brazil. To provide a more comprehensive basis for decision making, we analyze the BW and GW-Footprint components against probabilistic levels (50th and 30th percentile) of freshwater availability for human activities, during a 23 year period. Several contrasting situations of BW provision are distinguished, using different hydrological-based methodologies for specifying monthly Environmental Flow Requirements (EFRs), and the risk of natural EFR violation is evaluated by use of a freshwater provision index. Our results reveal clear spatial and temporal patterns of water scarcity and vulnerability levels within the basin. Taking into account conservation targets for the basin, it appears that the more restrictive EFR methods are more appropriate than the method currently employed at the study basin. The blue/green water-based accounting framework developed here provides a useful integration of hydrologic, ecosystem and human needs information on a monthly basis, thereby improving our understanding of how and where water-related threats to human and aquatic ecosystem security can arise.

[Assessment of the potential for urban facade greening in Xinjiekou District, Nanjing, China.

PubMed

Shi, Bao Gang; Yin, Hai Wei; Kong, Fan Hua

2018-05-01

Green facade is an important strategy to improve the urban eco-environment and reduce the negative effects of human activities in central districts of cities which are land-scarce and lack green spaces. We first summarized the limiting factors for the construction of green facades locally and internationally. Then, we used the Xinjiekou District of Nanjing City in China as a case study area, and selected the wind environment, solar environment, and physical build environment that might impact the potential development of green facades as key factors to quantitatively analyze singlely by geographic information systems (GIS) and computational fluid dynamics (CFD). Finally, the potential area to develop green facades was assessed through a multi-factor overlay analysis. The results showed that 17726 m 2 of wall spaces in the Xinjiekou District had a high potential for facade greening, accounting for 30.8% of all exterior wall space under a height of 12 m and 17.3% of the entire study area. Sunlight was a key limiting factor in determining whether a green facade should be developed. Irrigation was identified as another important factor that might strongly affect the growth of vertical vegetation in urban environment. The spatial distribution of walls suitable for facade greening was uneven, with an "inner-high and south-high" spatial pattern. Our results would help to guide the design and development of green facades in Xinjiekou, and also provide a reference for planning and utilizing green wall space projects in other built and dense urban areas.

Efficient and Scalable Synthesis of 4-Carboxy-Pennsylvania Green Methyl Ester: A Hydrophobic Building Block for Fluorescent Molecular Probes.

PubMed

Woydziak, Zachary R; Fu, Liqiang; Peterson, Blake R

2014-01-01

Fluorinated fluorophores are valuable tools for studies of biological systems. However, amine-reactive single-isomer derivatives of these compounds are often very expensive. To provide an inexpensive alternative, we report a practical synthesis of 4-carboxy-Pennsylvania Green methyl ester. Derivatives of this hydrophobic fluorinated fluorophore, a hybrid of the dyes Oregon Green and Tokyo Green, are often cell permeable, enabling labeling of intracellular targets and components. Moreover, the low pKa of Pennsylvania Green (4.8) confers bright fluorescence in acidic cellular compartments such as endosomes, enhancing its utility for chemical biology investigations. To improve access to the key intermediate 2,7-difluoro-3,6-dihydroxyxanthen-9-one, we subjected bis-(2,4,5-trifluorophenyl)methanone to iterative nucleophilic aromatic substitution by hydroxide on scales of > 40 g. This intermediate was used to prepare over 15 grams of pure 4-carboxy-Pennsylvania Green methyl ester in 28% overall yield without requiring chromatography. This compound can be converted into the amine reactive N -hydroxysuccinimidyl ester in essentially quantitative yield for the synthesis of a wide variety of fluorescent molecular probes.

Water Quantity and Quality Processes in Urban Wetlands and Green Stormwater Management Practices

EPA Science Inventory

I have been invited to give a presentation as part of the Environmental Studies Program’s weekly seminar series at the Richard Stockton College in Pomona, NJ. I will present my dissertation research on urban wetlands and the green infrastructure research here, including the park...

Effects of elevated seawater pCO2 on gene expression patterns in the gills of the green crab, Carcinus maenas

PubMed Central

2011-01-01

Background The green crab Carcinus maenas is known for its high acclimation potential to varying environmental abiotic conditions. A high ability for ion and acid-base regulation is mainly based on an efficient regulation apparatus located in gill epithelia. However, at present it is neither known which ion transport proteins play a key role in the acid-base compensation response nor how gill epithelia respond to elevated seawater pCO2 as predicted for the future. In order to promote our understanding of the responses of green crab acid-base regulatory epithelia to high pCO2, Baltic Sea green crabs were exposed to a pCO2 of 400 Pa. Gills were screened for differentially expressed gene transcripts using a 4,462-feature microarray and quantitative real-time PCR. Results Crabs responded mainly through fine scale adjustment of gene expression to elevated pCO2. However, 2% of all investigated transcripts were significantly regulated 1.3 to 2.2-fold upon one-week exposure to CO2 stress. Most of the genes known to code for proteins involved in osmo- and acid-base regulation, as well as cellular stress response, were were not impacted by elevated pCO2. However, after one week of exposure, significant changes were detected in a calcium-activated chloride channel, a hyperpolarization activated nucleotide-gated potassium channel, a tetraspanin, and an integrin. Furthermore, a putative syntaxin-binding protein, a protein of the transmembrane 9 superfamily, and a Cl-/HCO3- exchanger of the SLC 4 family were differentially regulated. These genes were also affected in a previously published hypoosmotic acclimation response study. Conclusions The moderate, but specific response of C. maenas gill gene expression indicates that (1) seawater acidification does not act as a strong stressor on the cellular level in gill epithelia; (2) the response to hypercapnia is to some degree comparable to a hypoosmotic acclimation response; (3) the specialization of each of the posterior gill arches might go beyond what has been demonstrated up to date; and (4) a re-configuration of gill epithelia might occur in response to hypercapnia. PMID:21978240

A Review of the Aquatic Biological Resources of the Atlantic Coastal Area Off Virginia Beach, Virginia.

DTIC Science & Technology

1984-02-01

Leptocylindrus minimus Thalassiosira nordenskioldii Nitzschia pungens Thalassiorsira rotula Paralia sulcata * Emiliania huxleyi Rhizosolenia delicatula Green...minimum *Green cells ɛ microns *Green cells 3-5 microns June Chaetoceros spp. Rhizosolenia alata Cylindrotheca closterium. * Emiliania huxl2i...fragilissima Lauderia borealis Skeletonema costatum Leptocylindrus danicus * Emiliania huxleyi Nitzschia pungens *Green cells (3 microns Rhizosolenia

Identifying challenges in project consultants engagement practices

NASA Astrophysics Data System (ADS)

Shariffuddin, Nadia Alina Amir; Abidin, Nazirah Zainul

2017-10-01

Construction projects, green or conventional, involve multi-faceted disciplines engaged with the goal of delivering products i.e. building, infrastructure etc. at the best quality within stipulated budgets. For green projects, additional attention is added for environmental quality. Due to the various responsibilities and liabilities involved as well as the complexity of the construction process itself, formal engagement of multi-disciplinary professionals i.e. project consultants is required in any construction project. Poor selection of project consultants will lead to a multitude of complications resulting in delay, cost escalation, conflicts and poor quality. This paper explores the challenges that occur during the engagement of project consultants in a green project. As the engagement decision involves developers and architects, these two groups of respondents with green project backgrounds were approached qualitatively using interview technique. The challenges identified are limited experience and knowledge, consultants' fee vs. quality, green complexity, conflicts of interest, clients' extended expectation and less demand in green projects. The construction shifts to green project demands engagement of project consultants with added skills. It is expected that through the identification of challenges, better management and administration can be created which would give impact to the overall process of engagement in green projects.

Pictorial relief for equiluminant images

NASA Astrophysics Data System (ADS)

van Doorn, Andrea J.; de Ridder, Huib; Koenderink, Jan J.

2005-03-01

Pictorial relief depends strongly on "cues" in the image. For isoluminant renderings some cues are missing, namely all information that is related to luminance contrast (e.g., shading, atmospheric perspective). It has been suggested that spatial discrimination and especially pictorial space suffer badly in isoluminant conditions. We have investigated the issue through quantitative measurement of pictorial depth-structure under normal and isoluminant conditions. As stimuli we used monochrome halftone photographs, either as such, or "transposed" to Red/Green or Green/Red hue modulations. We used two distinct methods, one to probe pictorial pose (by way of correspondences settings between pictures of an object in different poses), the other to probe pictorial depth (by way of attitude settings of a gauge figure to a perceptual "fit"). In both experiments the depth reconstructions for Red/Green, Green/Red and monochrome conditions were very similar. Moreover, observers performed equally well in Red/Green, Green/Red and monochrome conditions. Thus, the general conclusion is that observers did not do markedly worse with the isoluminant Red/Green and Green/Red transposed images. Whereas the transposed images certainly looked weird, they were easily interpreted. Much of the structure of pictorial space was apparently preserved. Thus the notion that spatial representations are not sustained under isoluminant conditions should be applied with caution.

Genotype identification of Math1/LacZ knockout mice based on real-time PCR with SYBR Green I dye.

PubMed

Krizhanovsky, Valery; Golenser, Esther; Ben-Arie, Nissim

2004-07-30

Knockout mice are widely used in all fields of biomedical research. Determining the genotype of every newborn mouse is a tedious task, usually performed by Southern blot hybridization or Polymerase Chain Reaction (PCR). We describe here a quick and simple genotype identification assay based on real-time PCR and SYBR Green I dye, without using fluorescent primers. The discrimination between the wild type and targeted alleles is based on a PCR design that leads to a different melting temperature for each product. The identification of the genotype is obvious immediately after amplification, and no post-PCR manipulations are needed, reducing cost and time. Therefore, while the real-time PCR amplification increases the sensitivity, the fact that the reactions tubes are never opened after amplification, reduces the risk of contamination and eliminates errors, which are common during the repeated handling of dozens of samples from the same mouse line. The protocol we provide was tested on Math1 knockout mice, but is general, and may be utilized for any knockout line and real-time thermocycler, without any further modification, accessories or special reagents. Copyright 2004 Elsevier B.V.

Development of a SYBR Green I-based real-time PCR for detection of elephant endotheliotropic herpesvirus 1 infection in Asian elephants (Elephas maximus).

PubMed

Sariya, Ladawan; Chatsirivech, Jarin; Suksai, Parut; Wiriyarat, Witthawat; Songjaeng, Adisak; Tangsudjai, Siriporn; Kanthasaewee, Oraphan; Maikaew, Umaporn; Chaichoun, Kridsada

2012-10-01

Elephant endotheliotropic herpesvirus 1 (EEHV1) can cause fatal hemorrhagic disease in Asian elephants (Elephas maximus). Several studies have described this virus as a major threat to young Asian elephants. A SYBR Green I-based real-time polymerase chain reaction (PCR) was developed to identify EEHV1 on trunk swabs and necropsied tissues. Two of 29 (6.9%) trunk swab samples from healthy Asian elephants were positive for EEHV1. The viruses were analyzed and classified as EEHV1A based on 231 nucleotides of the terminase gene. Necropsied spleen and heart tissue showed the highest level and second highest levels of DNA virus copy accumulation, respectively. The detection limit of the test was 276 copies/μl of DNA. There was no cross-reaction with other mammalian herpesviruses, such as herpes simplex virus 1 and equine herpesvirus 2. Inter- and intra-assay showed low coefficients of variation values indicating the reproducibility of the test. The results indicated that the test can be practically used for epidemiological study, clinical diagnosis, and management and control of EEHV1. Copyright © 2012 Elsevier B.V. All rights reserved.

Mendel's green cotyledon gene encodes a positive regulator of the chlorophyll-degrading pathway

PubMed Central

Sato, Yutaka; Morita, Ryouhei; Nishimura, Minoru; Yamaguchi, Hiroyasu; Kusaba, Makoto

2007-01-01

Mutants that retain greenness of leaves during senescence are known as “stay-green” mutants. The most famous stay-green mutant is Mendel's green cotyledon pea, one of the mutants used in determining the law of genetics. Pea plants homozygous for this recessive mutation (known as i at present) retain greenness of the cotyledon during seed maturation and of leaves during senescence. We found tight linkage between the I locus and stay-green gene originally found in rice, SGR. Molecular analysis of three i alleles including one with no SGR expression confirmed that the I gene encodes SGR in pea. Functional analysis of sgr mutants in pea and rice further revealed that leaf functionality is lowered despite a high chlorophyll a (Chl a) and chlorophyll b (Chl b) content in the late stage of senescence, suggesting that SGR is primarily involved in Chl degradation. Consistent with this observation, a wide range of Chl–protein complexes, but not the ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit, were shown to be more stable in sgr than wild-type plants. The expression of OsCHL and NYC1, which encode the first enzymes in the degrading pathways of Chl a and Chl b, respectively, was not affected by sgr in rice. The results suggest that SGR might be involved in activation of the Chl-degrading pathway during leaf senescence through translational or posttranslational regulation of Chl-degrading enzymes. PMID:17709752

Monitoring the Vernal Advancement and Retrogradation (Green Wave Effect) of Natural Vegetation. [Great Plains Corridor

NASA Technical Reports Server (NTRS)

Rouse, J. W., Jr. (Principal Investigator); Haas, R. H.; Deering, D. W.; Schell, J. A.; Harlan, J. C.

1974-01-01

The author has identified the following significant results. The Great Plains Corridor rangeland project successfully utilized natural vegetation systems as phenological indicators of seasonal development and climatic effects upon regional growth conditions. An effective method was developed for quantitative measurement of vegetation conditions, including green biomass estimates, recorded in bands 5 and 6, corrected for sun angle, were used to compute a ratio parameter (TV16) which is shown to be highly correlated with green biomass and vegatation moisture content. Analyses results of ERTS-1 digital data and correlated ground data are summarized. Attention was given to analyzing weather influences and test site variables on vegetation condition measurements with ERTS-1 data.

Quantitative microbial risk assessment for Escherichia coli O157:H7, Salmonella enterica, and Listeria monocytogenes in leafy green vegetables consumed at salad bars, based on modeling supply chain logistics.

PubMed

Tromp, S O; Rijgersberg, H; Franz, E

2010-10-01

Quantitative microbial risk assessments do not usually account for the planning and ordering mechanisms (logistics) of a food supply chain. These mechanisms and consumer demand determine the storage and delay times of products. The aim of this study was to quantitatively assess the difference between simulating supply chain logistics (MOD) and assuming fixed storage times (FIX) in microbial risk estimation for the supply chain of fresh-cut leafy green vegetables destined for working-canteen salad bars. The results of the FIX model were previously published (E. Franz, S. O. Tromp, H. Rijgersberg, and H. J. van der Fels-Klerx, J. Food Prot. 73:274-285, 2010). Pathogen growth was modeled using stochastic discrete-event simulation of the applied logistics concept. The public health effects were assessed by conducting an exposure assessment and risk characterization. The relative growths of Escherichia coli O157 (17%) and Salmonella enterica (15%) were identical in the MOD and FIX models. In contrast, the relative growth of Listeria monocytogenes was considerably higher in the MOD model (1,156%) than in the FIX model (194%). The probability of L. monocytogenes infection in The Netherlands was higher in the MOD model (5.18×10(-8)) than in the FIX model (1.23×10(-8)). The risk of listeriosis-induced fetal mortality in the perinatal population increased from 1.24×10(-4) (FIX) to 1.66×10(-4) (MOD). Modeling the probabilistic nature of supply chain logistics is of additional value for microbial risk assessments regarding psychrotrophic pathogens in food products for which time and temperature are the postharvest preventive measures in guaranteeing food safety.

Multifunctional Eu3+- and Er3+/Yb3+-doped GdVO4 nanoparticles synthesized by reverse micelle method

PubMed Central

Gavrilović, Tamara V.; Jovanović, Dragana J.; Lojpur, Vesna; Dramićanin, Miroslav D.

2014-01-01

Synthesis of Eu3+- and Er3+/Yb3+-doped GdVO4 nanoparticles in reverse micelles and their multifunctional luminescence properties are presented. Using cyclohexane, Triton X-100, and n-pentanol as the oil, surfactant, and co-surfactant, respectively, crystalline nanoparticles with ~4 nm diameter are prepared at low temperatures. The particle size assessed using transmission electron microscopy is similar to the crystallite size obtained from X-ray diffraction measurements, suggesting that each particle comprises a single crystallite. Eu3+-doped GdVO4 nanoparticles emit red light through downconversion upon UV excitation. Er3+/Yb3+-doped GdVO4 nanoparticles exhibit several functions; apart from the downconversion of UV radiation into visible green light, they act as upconvertors, transforming near-infrared excitation (980 nm) into visible green light. The ratio of green emissions from 2H11/2 → 2I15/2 and 4S3/2 → 4I15/2 transitions is temperature dependent and can be used for nanoscale temperature sensing with near-infrared excitation. The relative sensor sensitivity is 1.11%K−1, which is among the highest sensitivities recorded for upconversion-luminescence-based thermometers. PMID:24572638

Multifunctional Eu3+- and Er3+/Yb3+-doped GdVO4 nanoparticles synthesized by reverse micelle method

NASA Astrophysics Data System (ADS)

Gavrilović, Tamara V.; Jovanović, Dragana J.; Lojpur, Vesna; Dramićanin, Miroslav D.

2014-02-01

Synthesis of Eu3+- and Er3+/Yb3+-doped GdVO4 nanoparticles in reverse micelles and their multifunctional luminescence properties are presented. Using cyclohexane, Triton X-100, and n-pentanol as the oil, surfactant, and co-surfactant, respectively, crystalline nanoparticles with ~4 nm diameter are prepared at low temperatures. The particle size assessed using transmission electron microscopy is similar to the crystallite size obtained from X-ray diffraction measurements, suggesting that each particle comprises a single crystallite. Eu3+-doped GdVO4 nanoparticles emit red light through downconversion upon UV excitation. Er3+/Yb3+-doped GdVO4 nanoparticles exhibit several functions; apart from the downconversion of UV radiation into visible green light, they act as upconvertors, transforming near-infrared excitation (980 nm) into visible green light. The ratio of green emissions from 2H11/2 --> 2I15/2 and 4S3/2 --> 4I15/2 transitions is temperature dependent and can be used for nanoscale temperature sensing with near-infrared excitation. The relative sensor sensitivity is 1.11%K-1, which is among the highest sensitivities recorded for upconversion-luminescence-based thermometers.

A model for evaluating the environmental benefits of elementary school facilities.

PubMed

Ji, Changyoon; Hong, Taehoon; Jeong, Kwangbok; Leigh, Seung-Bok

2014-01-01

In this study, a model that is capable of evaluating the environmental benefits of a new elementary school facility was developed. The model is composed of three steps: (i) retrieval of elementary school facilities having similar characteristics as the new elementary school facility using case-based reasoning; (ii) creation of energy consumption and material data for the benchmark elementary school facility using the retrieved similar elementary school facilities; and (iii) evaluation of the environmental benefits of the new elementary school facility by assessing and comparing the environmental impact of the new and created benchmark elementary school facility using life cycle assessment. The developed model can present the environmental benefits of a new elementary school facility in terms of monetary values using Environmental Priority Strategy 2000, a damage-oriented life cycle impact assessment method. The developed model can be used for the following: (i) as criteria for a green-building rating system; (ii) as criteria for setting the support plan and size, such as the government's incentives for promoting green-building projects; and (iii) as criteria for determining the feasibility of green building projects in key business sectors. Copyright © 2013 Elsevier Ltd. All rights reserved.

Multifunctional Eu3+- and Er3+/Yb3+-doped GdVO4 nanoparticles synthesized by reverse micelle method.

PubMed

Gavrilović, Tamara V; Jovanović, Dragana J; Lojpur, Vesna; Dramićanin, Miroslav D

2014-02-27

Synthesis of Eu(3+)- and Er(3+)/Yb(3+)-doped GdVO4 nanoparticles in reverse micelles and their multifunctional luminescence properties are presented. Using cyclohexane, Triton X-100, and n-pentanol as the oil, surfactant, and co-surfactant, respectively, crystalline nanoparticles with ~4 nm diameter are prepared at low temperatures. The particle size assessed using transmission electron microscopy is similar to the crystallite size obtained from X-ray diffraction measurements, suggesting that each particle comprises a single crystallite. Eu(3+)-doped GdVO4 nanoparticles emit red light through downconversion upon UV excitation. Er(3+)/Yb(3+)-doped GdVO4 nanoparticles exhibit several functions; apart from the downconversion of UV radiation into visible green light, they act as upconvertors, transforming near-infrared excitation (980 nm) into visible green light. The ratio of green emissions from (2)H11/2 → (2)I15/2 and (4)S3/2 → (4)I15/2 transitions is temperature dependent and can be used for nanoscale temperature sensing with near-infrared excitation. The relative sensor sensitivity is 1.11%K(-1), which is among the highest sensitivities recorded for upconversion-luminescence-based thermometers.

Internal and External Crisis Early Warning and Monitoring.

DTIC Science & Technology

1980-12-01

refining EWAMS. Initial EWAMS research revolved around the testing of quantitative political indicators, the development of general scans, and the...Initial Research ...................27 3.1.1 Quantitative indicators .......... 28 03.1.2 General scans.................34 3.1.3 Computer base...generalizations reinforce the desirability of the research from the vantage point of the I&W thrust. One is the proliferation of quantitative and

Succession and diversity of microorganisms and their association with physicochemical properties during green waste thermophilic composting.

PubMed

Liu, Ling; Wang, Shuqi; Guo, Xiaoping; Zhao, Tingning; Zhang, Bolin

2018-03-01

A comprehensive characterization of the bacterial diversity associated to thermophilic stages of green waste composting was achieved. In this study, eight different treatments (T1-T8) and three replicated lab-scale green waste composting were carried out to compare the effect of the cellulase (i.e. 0, 2%), microbial inoculum (i.e. 0, 2 and 4%) and particle size (i.e. 2 and 5 mm) on bacterial community structure. Physicochemical properties and bacterial communities of T1-T8 composts were observed, and the bacterial structure and diversity were examined by high-throughput sequencing via a MiSeq platform. The results showed that the most abundant phyla among the treatments were the Firmicutes, Chloroflexi and Proteobacteria. The shannon index and non-metric multidimensional scaling (NMDS) showed higher bacterial abundance and diversity at the metaphase of composting. Comparing with 5-mm treatments, particle size of 2-mm had a richer diversity of bacterial communities. The addition of cellulase and a microbial inoculum could promote the fermentation temperature, reduce the compost pH and C/N ratio and result in higher GI index. The humic substance (HS) and humic acid (HA) contents for 2-mm particle size treatments were higher than those of 5-mm treatments. Canonical correspondence analysis suggested that differences in bacterial abundance and diversity significantly correlated with HA, E 4 /E 6 and temperature, and the relationship between bacterial diversity and environmental parameters was affected by composting stages. Based on these results, the application of cellulase to promote green waste composting was feasible, and particle size was identified as a potential control of composting physicochemical properties and bacterial diversity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Porter Takes Reins of the FNL Green Team | Poster

Cancer.gov

Courtesy of the FNL Green Team Melissa Porter, who recently joined the staff of Craig Reynolds, Ph.D., director, Office of Scientific Operations, as administrative manager, has stepped forward to lead the Frederick National Laboratory for Cancer Research (FNL) Green Team in its efforts to promote a “green” work environment. “I am excited to lead the FNL Green Team and have been impressed by the enthusiasm and commitment of the FNL Green Team,” Porter said.

The Effect of Brain Based Instruction on Student Achievement in Algebra I

ERIC Educational Resources Information Center

Vass, Melissa G.

2010-01-01

This quantitative quasi-experimental study examined the effect of brain-based instruction compared to teacher-centered instruction on student achievement in algebra I. A pre-test and post-test were given to a control group of 30 and experimental group of 42 before and after a unit if study in algebra I, which was taught using the two instructional…

ITS2 data corroborate a monophyletic chlorophycean DO-group (Sphaeropleales)

PubMed Central

2008-01-01

Background Within Chlorophyceae the ITS2 secondary structure shows an unbranched helix I, except for the 'Hydrodictyon' and the 'Scenedesmus' clade having a ramified first helix. The latter two are classified within the Sphaeropleales, characterised by directly opposed basal bodies in their flagellar apparatuses (DO-group). Previous studies could not resolve the taxonomic position of the 'Sphaeroplea' clade within the Chlorophyceae without ambiguity and two pivotal questions remain open: (1) Is the DO-group monophyletic and (2) is a branched helix I an apomorphic feature of the DO-group? In the present study we analysed the secondary structure of three newly obtained ITS2 sequences classified within the 'Sphaeroplea' clade and resolved sphaeroplealean relationships by applying different phylogenetic approaches based on a combined sequence-structure alignment. Results The newly obtained ITS2 sequences of Ankyra judayi, Atractomorpha porcata and Sphaeroplea annulina of the 'Sphaeroplea' clade do not show any branching in the secondary structure of their helix I. All applied phylogenetic methods highly support the 'Sphaeroplea' clade as a sister group to the 'core Sphaeropleales'. Thus, the DO-group is monophyletic. Furthermore, based on characteristics in the sequence-structure alignment one is able to distinguish distinct lineages within the green algae. Conclusion In green algae, a branched helix I in the secondary structure of the ITS2 evolves past the 'Sphaeroplea' clade. A branched helix I is an apomorph characteristic within the monophyletic DO-group. Our results corroborate the fundamental relevance of including the secondary structure in sequence analysis and phylogenetics. PMID:18655698

Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

PubMed

Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

2003-12-15

Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

Determination of malachite green residues in the eggs, fry, and adult muscle-tissue of rainbow-trout (Oncorhynchus-mykiss)

USGS Publications Warehouse

Allen, John L.; Gofus, J.E.; Meinertz, Jeffery R.

1994-01-01

Malachite green, an effective antifungal therapeutant used in fish culture, is a known teratogen. We developed a method to simultaneously detect both the chromatic and leuco forms of malachite green residues in the eggs, fry, and adult muscle tissue of rainbow trout (oncorhynchus mykiss). Homogenates of these tissues were fortified with [c-14] malachite green chloride and extracted with 1% (v/v) acetic acid in acetonitrile or in methanol. The extracts were partitioned with chloroform, dried, redissolved in mobile phase, and analyzed by liquid chromatography (lc) with postcolumn oxidation of leuco malachite green to the chromatic form. Lc fractions were collected every 30 s for quantitation by scintillation counting. Recoveries of total [c-14] malachite green chloride residue were 85 and 98% in eggs fortified with labeled malachite green at concentrations of 0.5 And 1.00 Mug/g, respectively; 68% in fry similarly fortified at a concentration of 0.65 Mug/g; and 66% in muscle homogenate similarly fortified at a level of 1.00 Mug/g. The method was tested under operational conditions by exposing adult rainbow trout to 1.00 Mg/l [c-14] malachite green chloride bath for 1 h. Muscle samples analyzed by sample oxidation and scintillation counting contained 1.3 And 0.5 Mug/g total malachite green chloride residues immediately after exposure and after a 5-day withdrawal period, respectively.

1H NMR quantitative determination of photosynthetic pigments from green beans (Phaseolus vulgaris L.).

PubMed

Valverde, Juan; This, Hervé

2008-01-23

Using 1H nuclear magnetic resonance spectroscopy (1D and 2D), the two types of photosynthetic pigments (chlorophylls, their derivatives, and carotenoids) of "green beans" (immature pods of Phaseolus vulgaris L.) were analyzed. Compared to other analytical methods (light spectroscopy or chromatography), 1H NMR spectroscopy is a fast analytical way that provides more information on chlorophyll derivatives (allomers and epimers) than ultraviolet-visible spectroscopy. Moreover, it gives a large amount of data without prior chromatographic separation.

My Green Car: Painting Motor City Green (Ep. 2) – DOE Lab-Corps Video Series

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saxena, Samveg; Shah, Nihar; Hansen, Dana

The Lab’s MyGreenCar team kicks off its customer discovery process in Detroit with a business boot camp designed for scientists developing energy-related technologies. Customer interviews lead to late night discussions and insights on less-than-receptive consumers. Back in Berkeley, the team decides to fine tune targeted customer segments. What makes a new technology compelling enough to transition out of the lab and become a consumer product? That’s the question Berkeley Lab researchers Samveg Saxena, Nihar Shah, and Dana Hansen plus industry mentor Russell Carrington set out to answer for MyGreenCar, an app providing personalized fuel economy or electric vehicle range estimatesmore » for consumers researching new cars. DOE’s Lab-Corps program offered the technology team some answers. The EERE-funded program, based on the National Science Foundation’s I-Corps™ model for entrepreneurial training, provides tools and training to move energy-related inventions to the marketplace. During Lab-Corp’s intensive six-week session, technology teams interview 100 customer and value chain members to discover which potential products based on their technologies will have significant market pull. A six video series follows the MyGreenCar team’s Lab-Corps experience, from pre-training preparation with the Lab’s Innovation and Partnerships Office through the ups and downs of the customer discovery process. Will the app make it to the marketplace? You’ll just have to watch.« less

One-pot microwave assisted synthesis under green chemistry conditions, antioxidant screening, and cytotoxicity assessments of benzimidazole Schiff bases and pyrimido[1,2-a]benzimidazol-3(4H)-ones.

PubMed

Neochoritis, Constantinos G; Zarganes-Tzitzikas, Tryfon; Tsoleridis, Constantinos A; Stephanidou-Stephanatou, Julia; Kontogiorgis, Christos A; Hadjipavlou-Litina, Dimitra J; Choli-Papadopoulou, Theodora

2011-01-01

The synthesis of a number of benzimidazole Schiff bases 3 and 3-oxo-pyrimido[1,2-a]benzimidazoles 4 in excellent yields by a one-step sequence from the reaction of 2-aminobenzimidazole under green chemistry conditions is described. Structural assignments of the new compounds as well as complete assignment of (1)H and (13)C NMR signals have been unambiguously achieved based on the analysis of their (1)H and (13)C NMR (1D and 2D), IR, MS and elemental analysis data. To the synthesized Schiff bases the E-configuration was assigned on the basis of comparison of experimental and calculated (DFT) (13)C NMR chemical shifts. Compounds 3 and 4 were evaluated as inhibitors of lipoxygenase (LOX) and of lipid peroxidation (LPO). All the tested derivatives showed inhibition of lipid peroxidation, whereas most of them were found to have higher activation than the reference compound trolox; The Schiff bases 3e, 3h, and 3i, and the pyrimidobenzimidazoles 4a, 4e and 4f were found to be the most potent. The most potent LOX inhibitor within the subset of Schiff bases was found compound 3i, followed by 3f, whereas compounds 4a and 4g were found the most potent of the 3-oxo-pyrimido[1,2-a]benzimidazole group. Moreover, some cytotoxicity assessments were undertaken, whereupon it was found that Schiff base 3i and pyrimidobenzimidazoles 4e and 4f did not exhibit cytotoxicity at similar concentrations resembling thus the inhibitory activity of lipid peroxidation. The most cytotoxic Schiff base and pyrimidobenzimidazole were found to be 3d and 4c, respectively. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

Collisional Relaxation of Vibrational Energy Transients in the Methylcyclopropane System. A Variable Encounter Method Study.

DTIC Science & Technology

1980-08-01

Edwards AFB, CA 93523 Attn: Mr. 0. Siegel Attn: Dr. F. Roberto Office of Naval Research I AFSC Western Office Andrews AFB, Code DLFP 1030 East Green...Research Eastern Central Regional Directorate of Chemical & p Office Atmospheric Sciences 495 Summer Street Bolling Air Force Base Boston, MA 02210

Peered and Tiered Learning: Action Research as Creative Cultural Pedagogy

ERIC Educational Resources Information Center

Harris, Anne

2013-01-01

This article presents and problematizes a peered and tiered model of creative and educational knowledge transfer piloted in Culture Shack, a community-based arts education program in Melbourne, Australia. Drawing on Eisner and Sefton-Green and Soep, I argue the value of this approach as a potential new pedagogical strategy in both secondary…

Anomalous heat conduction in a one-dimensional ideal gas.

PubMed

Casati, Giulio; Prosen, Tomaz

2003-01-01

We provide firm convincing evidence that the energy transport in a one-dimensional gas of elastically colliding free particles of unequal masses is anomalous, i.e., the Fourier law does not hold. Our conclusions are confirmed by a theoretical and numerical analysis based on a Green-Kubo-type approach specialized to momentum-conserving lattices.

Design of three-well indirect pumping terahertz quantum cascade lasers for high optical gain based on nonequilibrium Green's function analysis

NASA Astrophysics Data System (ADS)

Liu, Tao; Kubis, Tillmann; Jie Wang, Qi; Klimeck, Gerhard

2012-03-01

The nonequilibrium Green's function approach is applied to the design of three-well indirect pumping terahertz (THz) quantum cascade lasers (QCLs) based on a resonant phonon depopulation scheme. The effects of the anticrossing of the injector states and the dipole matrix element of the laser levels on the optical gain of THz QCLs are studied. The results show that a design that results in a more pronounced anticrossing of the injector states will achieve a higher optical gain in the indirect pumping scheme compared to the traditional resonant-tunneling injection scheme. This offers in general a more efficient coherent resonant-tunneling transport of electrons in the indirect pumping scheme. It is also shown that, for operating temperatures below 200 K and low lasing frequencies, larger dipole matrix elements, i.e., vertical optical transitions, offer a higher optical gain. In contrast, in the case of high lasing frequencies, smaller dipole matrix elements, i.e., diagonal optical transitions are better for achieving a higher optical gain.

School-Based Speech-Language Pathologists' Use of iPads

ERIC Educational Resources Information Center

Romane, Garvin Philippe

2017-01-01

This study explored school-based speech-language pathologists' (SLPs') use of iPads and apps for speech and language instruction, specifically for articulation, language, and vocabulary goals. A mostly quantitative-based survey was administered to approximately 2,800 SLPs in a K-12 setting; the final sample consisted of 189 licensed SLPs. Overall,…

Toward Quantitative Small Animal Pinhole SPECT: Assessment of Quantitation Accuracy Prior to Image Compensations

PubMed Central

Chen, Chia-Lin; Wang, Yuchuan; Lee, Jason J. S.; Tsui, Benjamin M. W.

2011-01-01

Purpose We assessed the quantitation accuracy of small animal pinhole single photon emission computed tomography (SPECT) under the current preclinical settings, where image compensations are not routinely applied. Procedures The effects of several common image-degrading factors and imaging parameters on quantitation accuracy were evaluated using Monte-Carlo simulation methods. Typical preclinical imaging configurations were modeled, and quantitative analyses were performed based on image reconstructions without compensating for attenuation, scatter, and limited system resolution. Results Using mouse-sized phantom studies as examples, attenuation effects alone degraded quantitation accuracy by up to −18% (Tc-99m or In-111) or −41% (I-125). The inclusion of scatter effects changed the above numbers to −12% (Tc-99m or In-111) and −21% (I-125), respectively, indicating the significance of scatter in quantitative I-125 imaging. Region-of-interest (ROI) definitions have greater impacts on regional quantitation accuracy for small sphere sources as compared to attenuation and scatter effects. For the same ROI, SPECT acquisitions using pinhole apertures of different sizes could significantly affect the outcome, whereas the use of different radii-of-rotation yielded negligible differences in quantitation accuracy for the imaging configurations simulated. Conclusions We have systematically quantified the influence of several factors affecting the quantitation accuracy of small animal pinhole SPECT. In order to consistently achieve accurate quantitation within 5% of the truth, comprehensive image compensation methods are needed. PMID:19048346

Atomic Resolution Modeling of the Ferredoxin:[FeFe] Hydrogenase Complex from Chlamydomonas reinhardtii

PubMed Central

Chang, Christopher H.; King, Paul W.; Ghirardi, Maria L.; Kim, Kwiseon

2007-01-01

The [FeFe] hydrogenases HydA1 and HydA2 in the green alga Chlamydomonas reinhardtii catalyze the final reaction in a remarkable metabolic pathway allowing this photosynthetic organism to produce H2 from water in the chloroplast. A [2Fe-2S] ferredoxin is a critical branch point in electron flow from Photosystem I toward a variety of metabolic fates, including proton reduction by hydrogenases. To better understand the binding determinants involved in ferredoxin:hydrogenase interactions, we have modeled Chlamydomonas PetF1 and HydA2 based on amino-acid sequence homology, and produced two promising electron-transfer model complexes by computational docking. To characterize these models, quantitative free energy calculations at atomic resolution were carried out, and detailed analysis of the interprotein interactions undertaken. The protein complex model we propose for ferredoxin:HydA2 interaction is energetically favored over the alternative candidate by 20 kcal/mol. This proposed model of the electron-transfer complex between PetF1 and HydA2 permits a more detailed view of the molecular events leading up to H2 evolution, and suggests potential mutagenic strategies to modulate electron flow to HydA2. PMID:17660315

Atomic resolution modeling of the ferredoxin:[FeFe] hydrogenase complex from Chlamydomonas reinhardtii.

PubMed

Chang, Christopher H; King, Paul W; Ghirardi, Maria L; Kim, Kwiseon

2007-11-01

The [FeFe] hydrogenases HydA1 and HydA2 in the green alga Chlamydomonas reinhardtii catalyze the final reaction in a remarkable metabolic pathway allowing this photosynthetic organism to produce H(2) from water in the chloroplast. A [2Fe-2S] ferredoxin is a critical branch point in electron flow from Photosystem I toward a variety of metabolic fates, including proton reduction by hydrogenases. To better understand the binding determinants involved in ferredoxin:hydrogenase interactions, we have modeled Chlamydomonas PetF1 and HydA2 based on amino-acid sequence homology, and produced two promising electron-transfer model complexes by computational docking. To characterize these models, quantitative free energy calculations at atomic resolution were carried out, and detailed analysis of the interprotein interactions undertaken. The protein complex model we propose for ferredoxin:HydA2 interaction is energetically favored over the alternative candidate by 20 kcal/mol. This proposed model of the electron-transfer complex between PetF1 and HydA2 permits a more detailed view of the molecular events leading up to H(2) evolution, and suggests potential mutagenic strategies to modulate electron flow to HydA2.

Effects of chromatic image statistics on illumination induced color differences.

PubMed

Lucassen, Marcel P; Gevers, Theo; Gijsenij, Arjan; Dekker, Niels

2013-09-01

We measure the color fidelity of visual scenes that are rendered under different (simulated) illuminants and shown on a calibrated LCD display. Observers make triad illuminant comparisons involving the renderings from two chromatic test illuminants and one achromatic reference illuminant shown simultaneously. Four chromatic test illuminants are used: two along the daylight locus (yellow and blue), and two perpendicular to it (red and green). The observers select the rendering having the best color fidelity, thereby indirectly judging which of the two test illuminants induces the smallest color differences compared to the reference. Both multicolor test scenes and natural scenes are studied. The multicolor scenes are synthesized and represent ellipsoidal distributions in CIELAB chromaticity space having the same mean chromaticity but different chromatic orientations. We show that, for those distributions, color fidelity is best when the vector of the illuminant change (pointing from neutral to chromatic) is parallel to the major axis of the scene's chromatic distribution. For our selection of natural scenes, which generally have much broader chromatic distributions, we measure a higher color fidelity for the yellow and blue illuminants than for red and green. Scrambled versions of the natural images are also studied to exclude possible semantic effects. We quantitatively predict the average observer response (i.e., the illuminant probability) with four types of models, differing in the extent to which they incorporate information processing by the visual system. Results show different levels of performance for the models, and different levels for the multicolor scenes and the natural scenes. Overall, models based on the scene averaged color difference have the best performance. We discuss how color constancy algorithms may be improved by exploiting knowledge of the chromatic distribution of the visual scene.

Review of fluorescence guided surgery systems: identification of key performance capabilities beyond indocyanine green imaging

PubMed Central

DSouza, Alisha V.; Lin, Huiyun; Henderson, Eric R.; Samkoe, Kimberley S.; Pogue, Brian W.

2016-01-01

Abstract. There is growing interest in using fluorescence imaging instruments to guide surgery, and the leading options for open-field imaging are reviewed here. While the clinical fluorescence-guided surgery (FGS) field has been focused predominantly on indocyanine green (ICG) imaging, there is accelerated development of more specific molecular tracers. These agents should help advance new indications for which FGS presents a paradigm shift in how molecular information is provided for resection decisions. There has been a steady growth in commercially marketed FGS systems, each with their own differentiated performance characteristics and specifications. A set of desirable criteria is presented to guide the evaluation of instruments, including: (i) real-time overlay of white-light and fluorescence images, (ii) operation within ambient room lighting, (iii) nanomolar-level sensitivity, (iv) quantitative capabilities, (v) simultaneous multiple fluorophore imaging, and (vi) ergonomic utility for open surgery. In this review, United States Food and Drug Administration 510(k) cleared commercial systems and some leading premarket FGS research systems were evaluated to illustrate the continual increase in this performance feature base. Generally, the systems designed for ICG-only imaging have sufficient sensitivity to ICG, but a fraction of the other desired features listed above, with both lower sensitivity and dynamic range. In comparison, the emerging research systems targeted for use with molecular agents have unique capabilities that will be essential for successful clinical imaging studies with low-concentration agents or where superior rejection of ambient light is needed. There is no perfect imaging system, but the feature differences among them are important differentiators in their utility, as outlined in the data and tables here. PMID:27533438

Review of fluorescence guided surgery systems: identification of key performance capabilities beyond indocyanine green imaging

NASA Astrophysics Data System (ADS)

DSouza, Alisha V.; Lin, Huiyun; Henderson, Eric R.; Samkoe, Kimberley S.; Pogue, Brian W.

2016-08-01

There is growing interest in using fluorescence imaging instruments to guide surgery, and the leading options for open-field imaging are reviewed here. While the clinical fluorescence-guided surgery (FGS) field has been focused predominantly on indocyanine green (ICG) imaging, there is accelerated development of more specific molecular tracers. These agents should help advance new indications for which FGS presents a paradigm shift in how molecular information is provided for resection decisions. There has been a steady growth in commercially marketed FGS systems, each with their own differentiated performance characteristics and specifications. A set of desirable criteria is presented to guide the evaluation of instruments, including: (i) real-time overlay of white-light and fluorescence images, (ii) operation within ambient room lighting, (iii) nanomolar-level sensitivity, (iv) quantitative capabilities, (v) simultaneous multiple fluorophore imaging, and (vi) ergonomic utility for open surgery. In this review, United States Food and Drug Administration 510(k) cleared commercial systems and some leading premarket FGS research systems were evaluated to illustrate the continual increase in this performance feature base. Generally, the systems designed for ICG-only imaging have sufficient sensitivity to ICG, but a fraction of the other desired features listed above, with both lower sensitivity and dynamic range. In comparison, the emerging research systems targeted for use with molecular agents have unique capabilities that will be essential for successful clinical imaging studies with low-concentration agents or where superior rejection of ambient light is needed. There is no perfect imaging system, but the feature differences among them are important differentiators in their utility, as outlined in the data and tables here.

Submesoscale characteristics and transcription of a fatty acid elongase gene from a freshwater green microalgae, Myrmecia incisa Reisigl

NASA Astrophysics Data System (ADS)

Yu, Shuiyan; Liu, Shicheng; Li, Chunyang; Zhou, Zhigang

2011-01-01

Myrmecia incisa is a green coccoid freshwater microalgae, which is rich in arachidonic acid (ArA, C20: 4ω-6, δ5, 8, 11, 14), a long chain polyunsaturated fatty acid (PUFA), especially under nitrogen starvation stress. A cDNA library of M. incisa was constructed with λ phage vectors and a 545 nt expressed sequence tag (EST) was screened from this library as a putative elongase gene due to its 56% and 49% identity to Marchantia polymorpha L. and Ostreococcus tauri Courties et Chrétiennot-Dinet, respectively. Based upon this EST sequence, an elongase gene designated MiFAE was isolated from M. incisa via 5'/3' rapid amplification of cDNA ends (RACE). The cDNA sequence was 1 331 bp long and included a 33 bp 5'-untranslated region (UTR) and a 431 bp 3'-UTR with a typical poly-A tail. The 867 bp ORF encoded a predicted protein of 288 amino acids. This protein was characterized by a conserved histidine-rich box and a MYxYY motif that was present in other members of the elongase family. The genomic DNA sequence of MiFAE was found to be interrupted by three introns with splicing sites of Introns I (81 bp), II (81 bp), and III (67 bp) that conformed to the GT-AG rule. Quantitative real-time PCR showed that the transcription level of MiFAE in this microalga under nitrogen starvation was higher than that under normal condition. Prior to the ArA content accumulation, the transcription of MiFAE was enhanced, suggesting that it was possibly responsible for the ArA accumulation in this microalga cultured under nitrogen starvation conditions.

Development and validation of a harmonized TaqMan-based triplex real-time RT-PCR protocol for the quantitative detection of normalized gene expression profiles of seven porcine cytokines.

PubMed

Petrov, Anja; Beer, Martin; Blome, Sandra

2014-01-01

Dysregulation of cytokine responses plays a major role in the pathogenesis of severe and life-threatening infectious diseases like septicemia or viral hemorrhagic fevers. In pigs, diseases like African and classical swine fever are known to show exaggerated cytokine releases. To study these responses and their impact on disease severity and outcome in detail, reliable, highly specific and sensitive methods are needed. For cytokine research on the molecular level, real-time RT-PCRs have been proven to be suitable. Yet, the currently available and most commonly used SYBR Green I assays or heterogeneous gel-based RT-PCRs for swine show a significant lack of specificity and sensitivity. The latter is however absolutely essential for an accurate quantification of rare cytokine transcripts as well as for detection of small changes in gene expressions. For this reason, a harmonized TaqMan-based triplex real-time RT-PCR protocol for the quantitative detection of normalized gene expression profiles of seven porcine cytokines was designed and validated within the presented study. Cytokines were chosen to represent different immunological pathways and targets known to be involved in the pathogenesis of the above mentioned porcine diseases, namely interleukin (IL)-1β, IL-2, IL-4, IL-6, IL-8, tumor necrosis factor (TNF)-α and interferon (IFN)-α. Beta-Actin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as reference genes for normalization. For absolute quantification a synthetic standard plasmid was constructed comprising all target cytokines and reference genes within a single molecule allowing the generation of positive control RNA. The standard as well as positive RNAs from samples, and additionally more than 400 clinical samples, which were collected from animal trials, were included in the validation process to assess analytical sensitivity and applicability under routine conditions. The resulting assay allows the reliable assessment of gene expression profiles and provides a broad applicability to any kind of immunological research in swine.

UPLC-ESI-MS/MS method for the quantitative measurement of aliphatic diamines, trimethylamine N-oxide, and β-methylamino-l-alanine in human urine.

PubMed

Bhandari, Deepak; Bowman, Brett A; Patel, Anish B; Chambers, David M; De Jesús, Víctor R; Blount, Benjamin C

2018-04-15

This work describes a quantitative high-throughput analytical method for the simultaneous measurement of small aliphatic nitrogenous biomarkers, i.e., 1,6-hexamethylenediamine (HDA), isophoronediamine (IPDA), β-methylamino-l-alanine (BMAA), and trimethylamine N-oxide (TMAO), in human urine. Urinary aliphatic diamines, HDA and IPDA, are potential biomarkers of environmental exposure to their corresponding diisocyanates. Urinary BMAA forms as a result of human exposure to blue-green algae contaminated food. And, TMAO is excreted in urine due to the consumption of carnitine- and choline-rich diets. These urinary biomarkers represent classes of small aliphatic nitrogen-containing compounds (N-compounds) that have a high aqueous solubility, low logP, and/or high basic pK a . Because of the highly polar characteristics, analysis of these compounds in complex sample matrices is often challenging. We report on the development of ion-pairing chemistry based ultra-performance liquid chromatography-electrospray ionization-tandem mass spectrometry (UPLC-ESI-MS/MS) method for the simultaneous measurement of these biomarkers in human urine. Chromatographic separation was optimized using heptafluorobutyric acid-(HFBA-) based mobile phase and a reversed-phase C18 column. All four analytes were baseline separated within 2.6 min with an overall run time of 5 min per sample injection. Sample preparation involved 4 h of acid hydrolysis followed by automated solid phase extraction (SPE) performed using strong cation exchange sorbent bed with 7 N ammonia solution in methanol as eluent. Limits of detection ranged from 0.05 ng/mL to 1.60 ng/mL. The inter-day and intra-day accuracy were within 10%, and reproducibility within 15%. The method is accurate, fast, and well-suited for biomonitoring studies within targeted groups, as well as larger population-based studies such as the U. S. National Health and Nutrition Examination Survey (NHANES). Published by Elsevier B.V.

Fast screening and quantitation of microcystins in microalgae dietary supplement products and water by liquid chromatography coupled to time of flight mass spectrometry.

PubMed

Ortelli, Didier; Edder, Patrick; Cognard, Emmanuelle; Jan, Philippe

2008-06-09

Cyanobacteria, commonly called "blue-green algae", may accumulate in surface water supplies as "blooms" and may concentrate on the surface as blue-green "scums". Some species of cyanobacteria produce toxins and are of relevance to water supplies and to microalgae dietary supplements. To ensure the safety of drinking water and blue-green algae products, analyses are the only way to determine the presence or absence of toxins. This paper shows the use of ultra performance liquid chromatography (UPLC) coupled to orthogonal acceleration time of flight (TOF) mass spectrometry for the detection and quantitation of microcystins. The method presented is very sensitive, simple, fast, robust and did not require fastidious clean-up step. Limits of detection of 0.1 microg L(-1) in water and 0.1-0.2 microg g(-1) in microalgae samples were achieved. Method performances were satisfactory and appropriate for monitoring of water and dietary supplements. The method was applied in routine to samples taken from Swiss market or buy on internet website. Among 19 samples, six showed the presence of microcystins LR and LA at harmful levels.

Optimization of Diamond Nucleic Acid Dye for quantitative PCR.

PubMed

Haines, Alicia M; Tobe, Shanan S; Linacre, Adrian

2016-10-01

Here, we evaluate Diamond Nucleic Acid Dye (DD) for use in quantitative PCR (qPCR) applications. Although DD is a commercially available stain for detection of DNA separated by gel electrophoresis, its use as a detection dye in qPCR has yet to be described. To determine if DD can be used in qPCR, we investigated its inhibitory effects on qPCR at concentrations ranging 0.1-2.5×. Serial dilution of DNA was used to determine the efficiency, sensitivity, and linearity of DD-generated qPCR data in comparison to other commonly used fluorescent dyes such as SYBR Green (SG), EvaGreen (EG), and BRYT Green (BG). DD was found to be comparable with other dyes for qPCR applications, with an R2 value >0.9 and an efficiency of 0.83. Mitochondrial DNA (mtDNA) target signals were successfully produced by DD over a DNA dilution range of ~28 ng- 0.28 pg, demonstrating comparable sensitivity to the other dyes investigated. Cq values obtained using DD were lower than those using EG by almost 7 cycles. We conclude that Diamond Nucleic Acid Dye is a cheaper, less toxic alternative for qPCR applications.

Porter Takes Reins of the FNL Green Team | Poster

Cancer.gov

Courtesy of the FNL Green Team Melissa Porter, who recently joined the staff of Craig Reynolds, Ph.D., director, Office of Scientific Operations, as administrative manager, has stepped forward to lead the Frederick National Laboratory for Cancer Research (FNL) Green Team in its efforts to promote a “green” work environment. “I am excited to lead the FNL Green Team and have

Correspondence: comment on “Green Space, health inequality, and pregnancy.”

Treesearch

Geoffrey H. Donovan; Yvonne L. Michael; David T. Butry; Amy D. Sullivan; John M. Chase

2012-01-01

We read with great interest a recent Environment International article—Green Space, health inequality, and pregnancy—which explores the relationship between greenness around a mother's home, proximity to green space, and pregnancy outcomes in Barcelona (Dadvand et aI., in press). The authors were clearly unaware of a similar study that we recently published on...

Self-consistent Green's function embedding for advanced electronic structure methods based on a dynamical mean-field concept

NASA Astrophysics Data System (ADS)

Chibani, Wael; Ren, Xinguo; Scheffler, Matthias; Rinke, Patrick

2016-04-01

We present an embedding scheme for periodic systems that facilitates the treatment of the physically important part (here a unit cell or a supercell) with advanced electronic structure methods, that are computationally too expensive for periodic systems. The rest of the periodic system is treated with computationally less demanding approaches, e.g., Kohn-Sham density-functional theory, in a self-consistent manner. Our scheme is based on the concept of dynamical mean-field theory formulated in terms of Green's functions. Our real-space dynamical mean-field embedding scheme features two nested Dyson equations, one for the embedded cluster and another for the periodic surrounding. The total energy is computed from the resulting Green's functions. The performance of our scheme is demonstrated by treating the embedded region with hybrid functionals and many-body perturbation theory in the GW approach for simple bulk systems. The total energy and the density of states converge rapidly with respect to the computational parameters and approach their bulk limit with increasing cluster (i.e., computational supercell) size.

SERS Detection of Biomolecules by Highly Sensitive and Reproducible Raman-Enhancing Nanoparticle Array

NASA Astrophysics Data System (ADS)

Chan, Tzu-Yi; Liu, Ting-Yu; Wang, Kuan-Syun; Tsai, Kun-Tong; Chen, Zhi-Xin; Chang, Yu-Chi; Tseng, Yi-Qun; Wang, Chih-Hao; Wang, Juen-Kai; Wang, Yuh-Lin

2017-05-01

This paper describes the preparation of nanoarrays composed of silver nanoparticles (AgNPs: 20-50 nm) for use as surface-enhanced Raman scattering (SERS) substrates. The AgNPs were grown on porous anodic aluminum oxide (AAO) templates by electrochemical plating, and the inter-channel gap of AAO channels is between 10 and 20 nm. The size and interparticle gap of silver particles were adjusted in order to achieve optimal SERS signals and characterized by scanning electron microscopy, atomic force microscopy, and Raman spectroscopy. The fluctuation of SERS intensity is about 10-20% when measuring adenine solutions, showing a great reproducible SERS sensing. The nanoparticle arrays offer a large potential for practical applications as shown by the SERS-based quantitative detection and differentiation of adenine (A), thymine (T), cytosine (C), guanine (G), β-carotene, and malachite green. The respective detection limits are <1 ppb for adenine and <0.63 ppm for β-carotene and malachite green, respectively.

Fast and sensitive trace analysis of malachite green using a surface-enhanced Raman microfluidic sensor.

PubMed

Lee, Sangyeop; Choi, Junghyun; Chen, Lingxin; Park, Byungchoon; Kyong, Jin Burm; Seong, Gi Hun; Choo, Jaebum; Lee, Yeonjung; Shin, Kyung-Hoon; Lee, Eun Kyu; Joo, Sang-Woo; Lee, Kyeong-Hee

2007-05-08

A rapid and highly sensitive trace analysis technique for determining malachite green (MG) in a polydimethylsiloxane (PDMS) microfluidic sensor was investigated using surface-enhanced Raman spectroscopy (SERS). A zigzag-shaped PDMS microfluidic channel was fabricated for efficient mixing between MG analytes and aggregated silver colloids. Under the optimal condition of flow velocity, MG molecules were effectively adsorbed onto silver nanoparticles while flowing along the upper and lower zigzag-shaped PDMS channel. A quantitative analysis of MG was performed based on the measured peak height at 1615 cm(-1) in its SERS spectrum. The limit of detection, using the SERS microfluidic sensor, was found to be below the 1-2 ppb level and this low detection limit is comparable to the result of the LC-Mass detection method. In the present study, we introduce a new conceptual detection technology, using a SERS microfluidic sensor, for the highly sensitive trace analysis of MG in water.

Sensory characteristics and consumer acceptability of decaffeinated green teas.

PubMed

Lee, S M; Lee, H-S; Kim, K-H; Kim, K-O

2009-04-01

Green tea has been widely consumed for its mild flavors and its health benefits, yet caffeine in green tea has been a limitation for those who want to avoid it. The limitation brought increase in need for decaffeinated products in the green tea market. Most of the conventional decaffeination techniques applied in food use organic solvents. However, supercritical carbon dioxide fluid extraction (SC-CO2) method is gaining its intension as one of the future decaffeination methods that overcomes the problems of conventional methods. The purpose of this study was to identify sensory characteristics of decaffeinated green teas applied with SC-CO2 method and to observe the relationship with consumer acceptability to elucidate the potentiality of applying SC-CO2 technique in decaffeinated green tea market. Descriptive analysis was performed on 8 samples: green teas containing 4 caffeine levels (10%, 35%, 60%, and 100%) infused at 2 infusing periods (1 or 2 min). It was found that the SC-CO2 process not only reduced caffeine but also decreased some important features of original tea flavors. Two groups were recruited for consumer acceptability test: one (GP I, N = 52), consuming all types of green teas including hot/cold canned teas; and the other (GP II, N = 40), only consuming the loose type. While GP II liked original green tea the most, GP I liked highly decaffeinated green teas. Although the SC-CO2 method had limitations of losing complex flavors of green teas, it appeared to have future potential in the decaffeinated green tea market within or without the addition of desirable flavors.

Modelling green macroalgal blooms on the coasts of Brittany, France to enhance water quality management

NASA Astrophysics Data System (ADS)

Perrot, Thierry; Rossi, Nadège; Ménesguen, Alain; Dumas, Franck

2014-04-01

First recorded in the 1970s, massive green macroalgal blooms have since become an annual recurrence in Brittany, France. Eutrophication (in particular to anthropogenic nitrogen input) has been identified as the main factor controlling Ulva ‘green tide' events. In this study, we modelled Ulva proliferation using a two-dimensional model by coupling hydrodynamic and biological models (coined ‘MARS-Ulves') for five sites along the Brittany coastline (La Fresnaye Bay, Saint-Brieuc Bay, Lannion Bay, Guissény Bay and Douarnenez Bay). Calibration of the biological model was mainly based on the seasonal variation of the maximum nitrogen uptake rate (VmaxN) and the half-saturation constant for nitrogen (KN) to reproduce the internal nutrient quotas measured in situ for each site. In each bay, model predictions were in agreement with observed algal coverage converted into biomass. A numerical tracking method was implemented to identify the contribution of the rivers that empty into the study bays, and scenarios of decreases in nitrate concentration in rivers were simulated. Results from numerical nitrogen tracking highlighted the main nitrogen sources of green tides and also showed that each river contributes locally to green tides. In addition, dynamic modelling showed that the nitrate concentrations in rivers must be limited to between 5 and 15 mg l- 1, depending on the bay, to reduce Ulva biomass by half on the coasts. The three-step methodology developed in this study (analysing total dissolved inorganic nitrogen flux from rivers, tracking nitrogen sources in Ulva and developing scenarios for reducing nitrogen) provides qualitative and quantitative guidelines for stakeholders to define specific nitrogen reduction targets for better environmental management of water quality.

Artificial neural network modeling and optimization of ultrahigh pressure extraction of green tea polyphenols.

PubMed

Xi, Jun; Xue, Yujing; Xu, Yinxiang; Shen, Yuhong

2013-11-01

In this study, the ultrahigh pressure extraction of green tea polyphenols was modeled and optimized by a three-layer artificial neural network. A feed-forward neural network trained with an error back-propagation algorithm was used to evaluate the effects of pressure, liquid/solid ratio and ethanol concentration on the total phenolic content of green tea extracts. The neural network coupled with genetic algorithms was also used to optimize the conditions needed to obtain the highest yield of tea polyphenols. The obtained optimal architecture of artificial neural network model involved a feed-forward neural network with three input neurons, one hidden layer with eight neurons and one output layer including single neuron. The trained network gave the minimum value in the MSE of 0.03 and the maximum value in the R(2) of 0.9571, which implied a good agreement between the predicted value and the actual value, and confirmed a good generalization of the network. Based on the combination of neural network and genetic algorithms, the optimum extraction conditions for the highest yield of green tea polyphenols were determined as follows: 498.8 MPa for pressure, 20.8 mL/g for liquid/solid ratio and 53.6% for ethanol concentration. The total phenolic content of the actual measurement under the optimum predicated extraction conditions was 582.4 ± 0.63 mg/g DW, which was well matched with the predicted value (597.2mg/g DW). This suggests that the artificial neural network model described in this work is an efficient quantitative tool to predict the extraction efficiency of green tea polyphenols. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Spectrochemical analysis of powdered biological samples using transversely excited atmospheric carbon dioxide laser plasma excitation

NASA Astrophysics Data System (ADS)

Zivkovic, Sanja; Momcilovic, Milos; Staicu, Angela; Mutic, Jelena; Trtica, Milan; Savovic, Jelena

2017-02-01

The aim of this study was to develop a simple laser induced breakdown spectroscopy (LIBS) method for quantitative elemental analysis of powdered biological materials based on laboratory prepared calibration samples. The analysis was done using ungated single pulse LIBS in ambient air at atmospheric pressure. Transversely-Excited Atmospheric pressure (TEA) CO2 laser was used as an energy source for plasma generation on samples. The material used for the analysis was a blue-green alga Spirulina, widely used in food and pharmaceutical industries and also in a few biotechnological applications. To demonstrate the analytical potential of this particular LIBS system the obtained spectra were compared to the spectra obtained using a commercial LIBS system based on pulsed Nd:YAG laser. A single sample of known concentration was used to estimate detection limits for Ba, Ca, Fe, Mg, Mn, Si and Sr and compare detection power of these two LIBS systems. TEA CO2 laser based LIBS was also applied for quantitative analysis of the elements in powder Spirulina samples. Analytical curves for Ba, Fe, Mg, Mn and Sr were constructed using laboratory produced matrix-matched calibration samples. Inductively coupled plasma optical emission spectroscopy (ICP-OES) was used as the reference technique for elemental quantification, and reasonably well agreement between ICP and LIBS data was obtained. Results confirm that, in respect to its sensitivity and precision, TEA CO2 laser based LIBS can be successfully applied for quantitative analysis of macro and micro-elements in algal samples. The fact that nearly all classes of materials can be prepared as powders implies that the proposed method could be easily extended to a quantitative analysis of different kinds of materials, organic, biological or inorganic.

Effect of Green Tea on Plasma Adiponectin Levels: A Systematic Review and Meta-analysis of Randomized Controlled Clinical Trials.

PubMed

Haghighatdoost, Fahimeh; Nobakht M Gh, B Fatemeh; Hariri, Mitra

2017-01-01

Our objective was to perform a systematic review and meta-analysis on randomized controlled trials (RCTs) assessing the effect of green tea on serum adiponectin concentration. We searched PubMed, ISI Web of Science, Scopus, and the Google Scholar databases up to November 2016. RCTs conducted among human adults studied the effects of green tea and green tea extract on serum adiponectin concentrations as an outcome variable was included. The weighted mean differences and standard deviations (SD) of change in serum adiponectin levels were calculated. The random effects model was used for deriving a summary of mean estimates with their corresponding SDs. The protocol was registered with PROSPERO (No. CRD42017057716). Fourteen RCTs were eligible to be included in the systematic review and the meta-analysis. Our analysis showed that green tea did not significantly affect adiponectin concentrations in comparison with placebo (weighted mean difference = -0.02 µg/ml, 95% confidence interval [CI], -0.41, 0.38; p = 0.936). There was a substantial heterogeneity between studies (I 2 = 91.7%; p < 0.0001). Subgroup analyses based on sex, type of intervention, continent, and body mass index (BMI) could not explain the sources of heterogeneity. Metaregression analyses revealed that the dose and duration of green tea ingestion did not have any effect on adiponectin concentrations. Green tea could not change the circulatory adiponectin levels. The dose and duration of green tea could not change the result. RCTs with longer follow-up periods and higher doses are needed to replicate our results.

The Development of Mathematical Knowledge for Teaching for Quantitative Reasoning Using Video-Based Instruction

NASA Astrophysics Data System (ADS)

Walters, Charles David

Quantitative reasoning (P. W. Thompson, 1990, 1994) is a powerful mathematical tool that enables students to engage in rich problem solving across the curriculum. One way to support students' quantitative reasoning is to develop prospective secondary teachers' (PSTs) mathematical knowledge for teaching (MKT; Ball, Thames, & Phelps, 2008) related to quantitative reasoning. However, this may prove challenging, as prior to entering the classroom, PSTs often have few opportunities to develop MKT by examining and reflecting on students' thinking. Videos offer one avenue through which such opportunities are possible. In this study, I report on the design of a mini-course for PSTs that featured a series of videos created as part of a proof-of-concept NSF-funded project. These MathTalk videos highlight the ways in which the quantitative reasoning of two high school students developed over time. Using a mixed approach to grounded theory, I analyzed pre- and postinterviews using an extant coding scheme based on the Silverman and Thompson (2008) framework for the development of MKT. This analysis revealed a shift in participants' affect as well as three distinct shifts in their MKT around quantitative reasoning with distances, including shifts in: (a) quantitative reasoning; (b) point of view (decentering); and (c) orientation toward problem solving. Using the four-part focusing framework (Lobato, Hohensee, & Rhodehamel, 2013), I analyzed classroom data to account for how participants' noticing was linked with the shifts in MKT. Notably, their increased noticing of aspects of MKT around quantitative reasoning with distances, which features prominently in the MathTalk videos, seemed to contribute to the emergence of the shifts in MKT. Results from this study link elements of the learning environment to the development of specific facets of MKT around quantitative reasoning with distances. These connections suggest that vicarious experiences with two students' quantitative reasoning over time was critical for participants' development of MKT.

Effects of contaminants on Double-crested Cormorant reproduction in Green Bay, Wisconsin, USA

USGS Publications Warehouse

Custer, T.W.; Custer, Christine M.; Stromborg, K.L.; Melancon, M.J.; Adams, N.J.; Slotow, R.H.

1998-01-01

In 1994 and 1995, Double-crested Cormorants Phalacrocorax auritus were monitored from egg-laying through 12 days of age at Cat Island, Green Bay, Wisconsin, USA. Sample eggs at hatching were analysed for organochlorines (including total PCBs, PCB congeners, and DDE), hepatic microsomal ethoxyresorufin-O-dealkylase (EROD) activity in livers of embryos, and eggshell thickness. The number of eggs per nest that hatched and survived to i 2 days of age was estimated to be 2.2 in 1994 and 2.0 in 1995. Hatching success of eggs was not correlated with PCBs, the toxicity of PCBs based on congeners, or EROD activity. Hatching success was correlated with eggshell thickness and negatively correlated with DDE concentrations. Even though the insecticide DDT was banned in the early 1970s, we suggest that DDE concentrations in cormorant eggs in Green Bay are still having an affect on reproduction in this species.

Effects of contaminants on Double-crested Cormorant reproduction in Green Bay, Wisconsin, USA

USGS Publications Warehouse

Custer, T.W.; Custer, Christine M.; Stromborg, K.L.; Melancon, M.J.; Adams, N.J.; Slotow, R.H.

1999-01-01

In 1994 and 1995, Double-crested Cormorants Phalacrocorax auritus were monitored from egg-laying through 12 days of age at Cat Island, Green Bay, Wisconsin, USA. Sample eggs at hatching were analysed for organochlorines (including total PCBs, PCB congeners, and DDE), hepatic microsomal ethoxyresorufin-O-dealkylase (EROD) activity in livers of embryos, and eggshell thickness. The number of eggs per nest that hatched and survived to i 2 days of age was estimated to be 2.2 in 1994 and 2.0 in 1995. Hatching success of eggs was not correlated with PCBs, the toxicity of PCBs based on congeners, or EROD activity. Hatching success was correlated with eggshell thickness and negatively correlated with DDE concentrations. Even though the insecticide DDT was banned in the early 1970s, we suggest that DDE concentrations in cormorant eggs in Green Bay are still having an affect on reproduction in this species.

Failure to Integrate Quantitative Measurement Methods of Ocular Inflammation Hampers Clinical Practice and Trials on New Therapies for Posterior Uveitis.

PubMed

Herbort, Carl P; Tugal-Tutkun, Ilknur; Neri, Piergiorgio; Pavésio, Carlos; Onal, Sumru; LeHoang, Phuc

2017-05-01

Uveitis is one of the fields in ophthalmology where a tremendous evolution took place in the past 25 years. Not only did we gain access to more efficient, more targeted, and better tolerated therapies, but also in parallel precise and quantitative measurement methods developed allowing the clinician to evaluate these therapies and adjust therapeutic intervention with a high degree of precision. Objective and quantitative measurement of the global level of intraocular inflammation became possible for most inflammatory diseases with direct or spill-over anterior chamber inflammation, thanks to laser flare photometry. The amount of retinal inflammation could be quantified by using fluorescein angiography to score retinal angiographic signs. Indocyanine green angiography gave imaging insight into the hitherto inaccessible choroidal compartment, rendering possible the quantification of choroiditis by scoring indocyanine green angiographic signs. Optical coherence tomography has enabled measurement and objective monitoring of retinal and choroidal thickness. This multimodal quantitative appraisal of intraocular inflammation represents an exquisite security in monitoring uveitis. What is enigmatic, however, is the slow pace with which these improvements are integrated in some areas. What is even more difficult to understand is the fact that clinical trials to assess new therapeutic agents still mostly rely on subjective parameters such as clinical evaluation of vitreous haze as a main endpoint; whereas a whole array of precise, quantitative, and objective modalities are available for the design of clinical studies. The scope of this work was to review the quantitative investigations that improved the management of uveitis in the past 2-3 decades.

A double-label time-resolved fluorescent strip for rapidly quantitative detection of carbofuran residues in agro-products.

PubMed

Zhang, Qi; Qu, Qiaoyu; Chen, Shanshan; Liu, Xiaowei; Li, Peiwu

2017-09-15

A rapid and quantitative time-resolved fluorescent immunochromatographic assay (TRFICA) for detecting carbofuran residues in agro-products was reported in this paper. This assay was developed based on double-label immunoprobes, one of which was a carbofuran-specific antibody coupled with europium microbeads for the test (T) line signal while the other was mouse IgG coupled with europium microbeads for the control (C) line signal. Quantitative relationships between carbofuran concentrations and T/C ratios were established to determine the analyte concentration. To increase assay accuracy, four standard curves were established for the agro-products (green bean, cabbage, apple, and pear). The limits of detection (LODs) ranged from 0.04 to 0.76mgL -1 . The spiked recoveries of carbofuran in the agro-products were in the range of 81-103%, which was in good agreement with a standard HPLC method. Therefore, we provided a new and reliable method for determination of N-methylcarbamate pesticide carbofuran residues in agro-products including vegetables and fruits. Copyright © 2017. Published by Elsevier Ltd.

Recognition of spectral identifier from green coffee beans of arabica and robusta varieties using laser-induced breakdown spectroscopy

NASA Astrophysics Data System (ADS)

Anggraeni, Karina; Nasution, Aulia; Suyanto, Hery

2016-11-01

Coffee is one of the world's commodity that is cultivated in more than 50 countries. Production of coffee in Indonesia is positioned of fourth rank in the world, after Brazil, Vietnam, and Colombia. There are two varieties of coffee grown in Indonesia, i.e. the arabica and robusta. The chemical compositions between arabica and robusta are different each other. A trained coffee tester can distinguish these differences from its taste, but it is very subjective. Laser-Induced Breakdown Spectroscopy (LIBS) is a spectroscopic technique based on the analysis of micro-plasma induced on the surface sample after being shot with a laser pulse. In this study, elemental spectra acquired using Laser-Induced Breakdown Spectroscopy (LIBS) technique were analysed to differentate between green coffee beans of arabica and robusta, which are collected from plantations in Malang, Bondowoso, Prigen, and Pasuruan. Results show that optimum conditions for acquiring spectra from green coffee beans using LIBS are at 120 mJ of laser energy and 1,0 μs of delay time. Green coffee beans of arabica and robusta contain some elements such as Ca, W, Sr, Mg, Be, Na, H, N, K, Rb, and O. Discriminant analysis method was then applied to distinguish the green beans of arabica and robusta coffee. Element identifiers of green coffee beans are Ca, W, Mg, Be, Na, and Sr. The abundant element in green coffee beans is Calcium (Ca), and depth-profile testing shows that Ca is homogeneous inside the beans.

Connecting plug-in vehicles with green electricity through consumer demand

NASA Astrophysics Data System (ADS)

Axsen, Jonn; Kurani, Kenneth S.

2013-03-01

The environmental benefits of plug-in electric vehicles (PEVs) increase if the vehicles are powered by electricity from ‘green’ sources such as solar, wind or small-scale hydroelectricity. Here, we explore the potential to build a market that pairs consumer purchases of PEVs with purchases of green electricity. We implement a web-based survey with three US samples defined by vehicle purchases: conventional new vehicle buyers (n = 1064), hybrid vehicle buyers (n = 364) and PEV buyers (n = 74). Respondents state their interest in a PEV as their next vehicle, in purchasing green electricity in one of three ways, i.e., monthly subscription, two-year lease or solar panel purchase, and in combining the two products. Although we find that a link between PEVs and green electricity is not presently strong in the consciousness of most consumers, the combination is attractive to some consumers when presented. Across all three respondent segments, pairing a PEV with a green electricity program increased interest in PEVs—with a 23% demand increase among buyers of conventional vehicles. Overall, about one-third of respondents presently value the combination of a PEV with green electricity; the proportion is much higher among previous HEV and PEV buyers. Respondents’ reported motives for interest in both products and their combination include financial savings (particularly among conventional buyers), concerns about air pollution and the environment, and interest in new technology (particularly among PEV buyers). The results provide guidance regarding policy and marketing strategies to advance PEVs and green electricity demand.

Evaluation of methods to derive green-up dates based on daily NDVI satellite observations

NASA Astrophysics Data System (ADS)

Doktor, Daniel

2010-05-01

Bridging the gap between satellite derived green-up dates and in situ phenological observations has been the purpose of many studies over the last decades. Despite substantial advancements in satellite technology and data quality checks there is as yet no universally accepted method for extracting phenological metrics based on satellite derived vegetation indices. Dependent on the respective method derived green-up dates can vary up to serveral weeks using identical data sets. Consequently, it is difficult to compare various studies and to accurately determine an increased vegetation length due to changing temperature patterns as observed by ground phenological networks. Here, I compared how the characteristic NDVI increase over temperate deciduous forests in Germany in spring relates to respective budburst events observed on the ground. MODIS Terra daily surface reflectances with a 250 m resolution (2000-2008) were gathered to compute daily NDVI values. As ground truth, observations of the extensive phenological network of the German Weather Service were used. About 1500 observations per year and species (Beech, Oak and Birch) were available evenly distributed all over Germany. Two filtering methods were tested to reduce the noisy raw data. The first method only keeps NDVI values which are classified as ‚ideal global quality' and applies on those a temporal moving window where values are removed which differ more than 20% of the mean. The second method uses an adaptation of the BISE (Best Index Slope Extraction) algorithm. Subsequently, three functions were fitted to the selected observations: a simple linear interpolation, a sigmoidal function and a double logistic sigmoidal function allowing to approximate two temporally separated green-up signals. The green-up date was then determined at halfway between minimum and maximum (linear interpolation) or at the inflexion point of the sigmoidal curve. A number of global threshold values (NDVI 0.4,0.5,0.6) and varying definitions of the NDVI baseline during dormancy were also tested. In contrast to most past studies, I did not attempt to identify matched pairs of geographically coincident ground and satellite observations. Rather than comparing on an individual grid-cell basis I analysed and compared the statistical properties of distributions generated from ground and satellite observations. It has been noticed that remote sensing provides a statistical distribution of a random variable, not an exact representation of the state of the land surface or atmosphere at a particular pixel. The same holds true for ground observations as they sample from biological variability and landscapes with heterogeneous microclimates. First results reveal substantial differences between the applied methods. Based on the assumption that the satellite captures predominantly the greening-up of the canopy - which occurs about 2 weeks later than observed budburst dates - the double sigmoidal function combined with the BISE filtering procedure performed best.

Plasma appearance and correlation between coffee and green tea metabolites in human subjects.

PubMed

Renouf, Mathieu; Guy, Philippe; Marmet, Cynthia; Longet, Karin; Fraering, Anne-Lise; Moulin, Julie; Barron, Denis; Dionisi, Fabiola; Cavin, Christophe; Steiling, Heike; Williamson, Gary

2010-12-01

Coffee and green tea are two of the most widely consumed hot beverages in the world. Their respective bioavailability has been studied separately, but absorption of their respective bioactive phenolics has not been compared. In a randomised cross-over design, nine healthy subjects drank instant coffee and green tea. Blood samples were collected over 12 h and at 24 h to assess return to baseline. After green tea consumption, (-)-epigallocatechin (EGC) was the major catechin, appearing rapidly in the plasma; (-)-EGC gallate (EGCg) and (-)-epicatechin (EC) were also present, but (-)-EC gallate and C were not detected. Dihydroferulic acid and dihydrocaffeic acid were the major metabolites that appeared after coffee consumption with a long time needed to reach maximum plasma concentration, suggesting metabolism and absorption in the colon. Other phenolic acid equivalents (caffeic acid (CA), ferulic acid (FA) and isoferulic acid (iFA)) were detected earlier, and they peaked at lower concentrations. Summations of the plasma area under the curves (AUC) for the measured metabolites showed 1.7-fold more coffee-derived phenolic acids than green tea-derived catechins (P = 0.0014). Furthermore, we found a significant correlation between coffee metabolites based on AUC. Inter-individual differences were observed, but individuals with a high level of CA also showed a correspondingly high level of FA. However, no such correlation was observed between the tea catechins and coffee phenolic acids. Correlation between AUC and maximum plasma concentration was also significant for CA, FA and iFA and for EGCg. This implies that the mechanisms of absorption for these two classes of compounds are different, and that a high absorber of phenolic acids is not necessarily a high absorber of catechins.

The effect of antioxidants on quantitative changes of lysine and methionine in linoleic acid emulsions at different pH conditions.

PubMed

Hęś, Marzanna; Gliszczyńska-Świgło, Anna; Gramza-Michałowska, Anna

2017-01-01

Plants are an important source of phenolic compounds. The antioxidant capacities of green tea, thyme and rosemary extracts that contain these compounds have been reported earlier. However, there is a lack of accessible information about their activity against lipid oxidation in emulsions and inhibit the interaction of lipid oxidation products with amino acids. Therefore, the influence of green tea, thyme and rosemary extracts and BHT (butylated hydroxytoluene) on quantitative changes in lysine and methionine in linoleic acid emulsions at a pH of isoelectric point and a pH lower than the isoelectric point of amino acids was investigated. Total phenolic contents in plant extracts were determined spectrophotometrically by using Folin-Ciocalteu's reagent, and individual phenols by using HPLC. The level of oxidation of emulsion was determined using the measurement of peroxides and TBARS (thiobarbituric acid reactive substances). Methionine and lysine in the system were reacted with sodium nitroprusside and trinitrobenzenesulphonic acid respectively, and the absorbance of the complexes was measured. Extract of green tea had the highest total polyphenol content. The system containing antioxidants and amino acid protected linoleic acid more efficiently than by the addition of antioxidants only. Lysine and methionine losses in samples without the addition of antioxidants were lower in their isoelectric points than below these points. Antioxidants decrease the loss of amino acids. The protective properties of antioxidants towards methionine were higher in a pH of isoelectric point whereas towards lysine in pH below this point. Green tea, thyme and rosemary extracts exhibit antioxidant activity in linoleic acid emulsions. Moreover, they can be utilized to inhibit quantitative changes in amino acids in lipid emulsions. However, the antioxidant efficiency of these extracts seems to depend on pH conditions. Further investigations should be carried out to clarify this issue.

Growing Power?: Social Benefits From Urban Greening Projects

Treesearch

Lynne Westphal

1999-01-01

In this study I investigated practitioners claims for social benefits of urban greening projects (e.g., tree planting, community gardens). Practitioners' claims of increased neighborliness, reduced drug dealing and other social benefits have led to interest in using greening projects specifically to achieve these ends.Four sites that...

A holistic water balance of Austria - how does the quantitative proportion of urban water requirements relate to other users?

PubMed

Vanham, D

2012-01-01

Traditional water use statistics only include the blue water withdrawal/consumption of municipalities, industry and irrigated agriculture. When, however, green water use of the agricultural sector is included as well as the virtual water use/water footprint (WF), water use quantity statistics become very different. In common water use statistics, Austria withdraws in total about 2.5 km(3) per year, only 3% of available resources (total discharge 81.4 km(3) = surface and ground water). The total water consumption (0.5 km(3)) is less than 1% of available resources. Urban (municipal) water requirements account for 27% of total withdrawal or 33% of consumption. When agricultural green water use (cropland) is included in statistics, the fraction of municipal water requirements diminishes to 7.6% of total withdrawal and 2.5% of total consumption. If the evapotranspiration of grassland and alpine meadows is also included in agricultural green water use, this fraction decreases to 3.2% and 0.9% respectively. When the WF is assessed as base value for water use in Austria, the municipal water use represents 5.8% of this value. In this globalized world, these traditional water use statistics are no longer recommendable. Only a holistic water balance approach really represents water use statistics.

Differentiating self-projection from simulation during mentalizing: evidence from fMRI.

PubMed

Schurz, Matthias; Kogler, Christoph; Scherndl, Thomas; Kronbichler, Martin; Kühberger, Anton

2015-01-01

We asked participants to predict which of two colors a similar other (student) and a dissimilar other (retiree) likes better. We manipulated if color-pairs were two hues from the same color-category (e.g. green) or two conceptually different colors (e.g. green versus blue). In the former case, the mental state that has to be represented (i.e., the percept of two different hues of green) is predominantly non-conceptual or phenomenal in nature, which should promote mental simulation as a strategy for mentalizing. In the latter case, the mental state (i.e. the percept of green versus blue) can be captured in thought by concepts, which facilitates the use of theories for mentalizing. In line with the self-projection hypothesis, we found that cortical midline areas including vmPFC / orbitofrontal cortex and precuneus were preferentially activated for mentalizing about a similar other. However, activation was not affected by the nature of the color-difference, suggesting that self-projection subsumes simulation-like processes but is not limited to them. This indicates that self-projection is a universal strategy applied in different contexts--irrespective of the availability of theories for mentalizing. Along with midline activations linked to self-projection, we also observed activation in right lateral frontal and dorsal parietal areas showing a theory-like pattern. Taken together, this shows that mentalizing does not operate based on simulation or theory, but that both strategies are used concurrently to predict the choices of others.

II-VI Semiconductor Superlattices

DTIC Science & Technology

1992-12-01

N. Otsuka, H. icon, J. Ding, and A.V. Nurmikko, " Blue /Green Injection Lasers and Light Emitting Diodes" J. Vac. Sci. Technology B, 10(2) March/April...34Indium tin oxide as transparent electrode material for ZnSe-based blue quantum well light emitters" AppI. Phys. Lett. 60(23) 8 June 1992, p. 2825...characteristics of this contact scheme have been demon- strated tI)gether with their use Jn both blue ,/groen light lip emitting diodes and diode laser:- The

Green Adsorbents for Wastewaters: A Critical Review

PubMed Central

Kyzas, George Z.; Kostoglou, Margaritis

2014-01-01

One of the most serious environmental problems is the existence of hazardous and toxic pollutants in industrial wastewaters. The major hindrance is the simultaneous existence of many/different types of pollutants as (i) dyes; (ii) heavy metals; (iii) phenols; (iv) pesticides and (v) pharmaceuticals. Adsorption is considered to be one of the most promising techniques for wastewater treatment over the last decades. The economic crisis of the 2000s led researchers to turn their interest in adsorbent materials with lower cost. In this review article, a new term will be introduced, which is called “green adsorption”. Under this term, it is meant the low-cost materials originated from: (i) agricultural sources and by-products (fruits, vegetables, foods); (ii) agricultural residues and wastes; (iii) low-cost sources from which most complex adsorbents will be produced (i.e., activated carbons after pyrolysis of agricultural sources). These “green adsorbents” are expected to be inferior (regarding their adsorption capacity) to the super-adsorbents of previous literature (complex materials as modified chitosans, activated carbons, structurally-complex inorganic composite materials etc.), but their cost-potential makes them competitive. This review is a critical approach to green adsorption, discussing many different (maybe in some occasions doubtful) topics such as: (i) adsorption capacity; (ii) kinetic modeling (given the ultimate target to scale up the batch experimental data to fixed-bed column calculations for designing/optimizing commercial processes) and (iii) critical techno-economical data of green adsorption processes in order to scale-up experiments (from lab to industry) with economic analysis and perspectives of the use of green adsorbents. PMID:28788460

Arid Green Infrastructure for Water Control and Conservation ...

EPA Pesticide Factsheets

Green infrastructure is an approach to managing wet weather flows using systems and practices that mimic natural processes. It is designed to manage stormwater as close to its source as possible and protect the quality of receiving waters. Although most green infrastructure practices were first developed in temperate climates, green infrastructure also can be a cost-effective approach to stormwater management and water conservation in arid and semi-arid regions, such as those found in the western and southwestern United States. Green infrastructure practices can be applied at the site, neighborhood and watershed scales. In addition to water management and conservation, implementing green infrastructure confers many social and economic benefits and can address issues of environmental justice. The U.S. Environmental Protection Agency (EPA) commissioned a literature review to identify the state-of-the science practices dealing with water control and conservation in arid and semi-arid regions, with emphasis on these regions in the United States. The search focused on stormwater control measures or practices that slow, capture, treat, infiltrate and/or store runoff at its source (i.e., green infrastructure). The material in Chapters 1 through 3 provides background to EPA’s current activities related to the application of green infrastructure practices in arid and semi-arid regions. An introduction to the topic of green infrastructure in arid and semi-arid regions i

A cost-effective assay for antioxidant using simple cotton thread combining paper based device with mobile phone detection.

PubMed

Sateanchok, Suphasinee; Wangkarn, Sunanta; Saenjum, Chalermpong; Grudpan, Kate

2018-01-15

A cost-effective assay for antioxidant using simple cotton thread combining paper based device with mobile phone detection has been investigated. Standard and sample solutions flow along a bunch of cotton thread treated with sodium hydroxide via microfluidic behaviors without external pumping. The analyte solution reacts with the reagents that have been immobilized on the paper strip fixed at the end of the cotton bunch. The developed platforms were used for the assays of total phenolic content and antioxidant capacity by employing Folin-Ciocalteu and 2, 2-diphenyl-1-picryhydrazyl (DPPH) respectively. Simple detection can be made by employing a mobile phone camera (iPhone 4S) with Image J or Photoshop for image processing and evaluation. Gallic acid was used as a reference standard in this work, as its polyphenol structures can be found in many plants. The total phenolic content is expressed as gallic acid equivalents (GAE) (mg/g material). Inhibition capacity is calculated by the equation: % I = [(I o - I s )/ I o ] × 100, where I s is the relative magenta intensity (CMYK mode) of sample, and I o the relative magenta intensity of DPPH•. IC 50 inhibition can be estimated from the graph and can be used for the antioxidant capacity consideration. Applications to the assay green tea samples were demonstrated. The total phenolic contents in the green tea samples were found to be 48-105mg/g, with %RSD of less than 10 for that of higher 50 GAE mg/g and IC 50 values of the samples studied were 25-50mg/L. The results obtained by the developed methods agree with that of the standard methods. Copyright © 2017 Elsevier B.V. All rights reserved.

Modelling Lean and Green Supply Chain

NASA Astrophysics Data System (ADS)

Duarte, Susana Carla Vieira Lino Medina

The success of an organization depends on the effective control of its supply chain. It is important to recognize new opportunities for organization and its supply chain. In the last few years the approach to lean, agile, resilient and green supply chain paradigms has been addressed in the scientific literature. Research in this field shows that the integration of these concepts revealed some contradictions among so many paradigms. This thesis is mainly focused on the lean and green approaches. Thirteen different management frameworks, embodied in awards, standards and tools were studied to understand if they could contribute for the modelling process of a lean and green approach. The study reveals a number of categories that are common in most management frameworks, providing adequate conditions for a lean and green supply chain transformation. A conceptual framework for the evaluation of a lean and green organization`s supply chain was proposed. The framework considers six key criteria, namely, leadership, people, strategic planning, stakeholders, processes and results. It was proposed an assessment method considering a criteria score for each criterion. The purpose is to understand how lean and green supply chain can be compatible, using principles, practices, techniques or tools (i.e. elements) that support both, a lean and a green approach, in all key criteria. A case study in the automotive upstream supply chain was performed to understand more deeply if the elements proposed for the conceptual framework could be implemented in a real-scenario. Based on the conceptual framework and the case study, a roadmap to achieve a lean-green transformation is presented. The proposed roadmap revealed its contribution to the understanding on how and when an organization`s supply chain should apply the lean and green elements. This study is relevant to practice, as it may assist managers in the adoption of a lean and green supply chain approach, giving insights for the implementation of a hybrid supply chain.

Modal Analysis and Testing of Missile Systems

DTIC Science & Technology

1988-12-01

TECHNICAL REPORT -Rb-ST-eS MODAL ANALY AND TESMG OF MISSU E SYSTEMS Lfl 0 N Larry C. Mixon John A4 Schaeffel , Jr. Peter L. Green ,I iLT Roque L...Include Stcurty Claz ficaDin) MODAL ANALYSIS AND TESTING OF MISSILE SYSTEMS 12. PERSONAL AUTHOR(S) Larry C. Mixon, John A. Schaeffel , Jr., Peter L. Green

Hole transport in c-plane InGaN-based green laser diodes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, Yang; Liu, Jianping, E-mail: jpliu2010@sinano.ac.cn; Tian, Aiqin

2016-08-29

Hole transport in c-plane InGaN-based green laser diodes (LDs) has been investigated by both simulations and experiments. It is found that holes can overflow from the green double quantum wells (DQWs) at high current density, which reduces carrier injection efficiency of c-plane InGaN-based green LDs. A heavily silicon-doped layer right below the green DQWs can effectively suppress hole overflow from the green DQWs.

Enhanced frequency upconversion study in Er3+/Yb3+ doped/codoped TWTi glasses

NASA Astrophysics Data System (ADS)

Azam, Mohd; Rai, Vineet Kumar

2018-04-01

Er3+/Yb3+ doped/codoped TeO2-WO3-TiO2 (TWTi) glasses have been prepared by using the melt-quenching technique. The upconversion (UC) emission spectra of the developed glasses have been recorded upon 980 nm laser excitation. Three intense UC emission bands have been observed within the green and red region centered at ˜532 nm, ˜553 nm and ˜669 nm corresponding to the 2H11/2→4I15/2, 4S3/2→4I15/2 and 4F9/2→4I15/2 transitions respectively in the singly Er3+ doped glass. On introducing Yb3+ ions in the singly Er3+ doped glass, an enhancement of about ˜ 12 times and ˜50 times in the green and red bands respectively have been observed even at low pump power ˜ 364 mW followed by two photon absorption process. Colour tunability from yellowish green to pure green colour region has been observed on varying the pump power. The prepared glass can be used to produce NIR to green upconverter and colour tunable display devices.

Life-cycle Economic and Environmental Effects of Green, Gray and Hybrid Stormwater Infrastructure

NASA Astrophysics Data System (ADS)

Stokes-Draut, J. R.; Taptich, M. N.; Horvath, A.

2016-12-01

Cities throughout the U.S. are seeking efficient ways to manage stormwater for many reasons, including flood control, pollution management, water supply augmentation and to prepare for a changing climate. Traditionally, cities have relied primarily on gray infrastructure, namely sewers, storage and treatment facilities. In these systems, urban runoff, its volume increasing as impervious surfaces expand, is channeled to a wastewater plant where it is mixed with raw sewage prior to treatment or it is discharged, generally untreated, to local water bodies. These facilities are inflexible and expensive to build and maintain. Many systems are deteriorating and/or approaching, if not exceeding, their design capacity. Increasingly, more innovative approaches that integrate stormwater management into the natural environment and that make sense at both local and regional scales are sought. Identifying the best stormwater solution will require evaluating the life-cycle economic costs associated with these alternatives, including costs associated with construction, operation, and maintenance including regulatory and permitting costs, financing, as well as other indirect costs (e.g., avoided wastewater processing or system capacity expansion, increased property value) and non-economic co-benefits (i.e, aesthetics, habitat provision). Beyond conventional life-cycle costing, applying life-cycle assessment (LCA) will contribute to more holistic and sustainable decision-making. LCA can be used to quantitatively track energy use, greenhouse gas emissions, and other environmental effects associated with constructing, operating, and maintaining green and gray infrastructure, including supply chain contributions. We will present the current state of knowledge for implementing life-cycle costing and LCA into stormwater management decisions for green, gray and hybrid infrastructure.

Development and evaluation of a simple and effective RT-qPCR inhibitory assay for detection of the efficacy of compounds towards HIV reverse transcriptase.

PubMed

Marino-Merlo, Francesca; Frezza, Caterina; Papaianni, Emanuela; Valletta, Elena; Mastino, Antonio; Macchi, Beatrice

2017-11-01

Assessing the actual efficacy of compounds to directly inhibit HIV reverse transcriptase (RT) activity is a main goal in preclinical antiretroviral studies. Our previous studies demonstrated that the effects of inhibitor compounds towards HIV-RT could be efficiently assessed through a simple cell-free assay based on conventional reverse transcription PCR. In the present study, we describe a modified variant of our assay, termed RT real-time quantitative PCR inhibitory assay (RT-qPCR-IA), in which the ability of compounds to restrict the complementary DNA (cDNA) generation by HIV-RT using a specific RNA template is performed by the real-time technique, in order to improve both accuracy and sensitivity of the method. As specific RNA template, RNA extracted from stable transfectants ectopically expressing the herpes simplex virus 1 glycoprotein D gene was utilized. HIV-RT, of both commercial or house-made viral lysate origin, was employed for the assay. To assess the reliability of RT-qPCR-IA, we performed a comparative, quantitative analysis of the dose-dependent effect exerted by known nucleotide and non-nucleotide reverse-transcriptase inhibitors, using the SYBR Green dye chemistry as detection system. The results obtained with RT-qPCR-IA were compared to that obtained using a one-step PicoGreen technology-based commercial kit. The outcome of our study indicates that the development of the novel RT-qPCR-IA will provide rapid and accurate evaluation of the inhibitory efficacy of compounds towards HIV-RT activity. This evaluation could be very useful for large-scale screening of potential new anti-HIV drugs.

Red Fluorescent Carbon Nanoparticle-Based Cell Imaging Probe.

PubMed

Ali, Haydar; Bhunia, Susanta Kumar; Dalal, Chumki; Jana, Nikhil R

2016-04-13

Fluorescent carbon nanoparticle-based probes with tunable visible emission are biocompatible, environment friendly and most suitable for various biomedical applications. However, synthesis of red fluorescent carbon nanoparticles and their transformation into functional nanoparticles are very challenging. Here we report red fluorescent carbon nanoparticle-based nanobioconjugates of <25 nm hydrodynamic size and their application as fluorescent cell labels. Hydrophobic carbon nanoparticles are synthesized via high temperature colloid-chemical approach and transformed into water-soluble functional nanoparticles via coating with amphiphilic polymer followed by covalent linking with desired biomolecules. Following this approach, carbon nanoparticles are functionalized with polyethylene glycol, primary amine, glucose, arginine, histidine, biotin and folic acid. These functional nanoparticles can be excited with blue/green light (i.e., 400-550 nm) to capture their emission spanning from 550 to 750 nm. Arginine and folic acid functionalized nanoparticles have been demonstrated as fluorescent cell labels where blue and green excitation has been used for imaging of labeled cells. The presented method can be extended for the development of carbon nanoparticle-based other bioimaging probes.

Seeing Life through Positive-Tinted Glasses: Color–Meaning Associations

PubMed Central

Gil, Sandrine; Le Bigot, Ludovic

2014-01-01

There is a growing body of literature to show that color can convey information, owing to its emotionally meaningful associations. Most research so far has focused on negative hue–meaning associations (e.g., red) with the exception of the positive aspects associated with green. We therefore set out to investigate the positive associations of two colors (i.e., green and pink), using an emotional facial expression recognition task in which colors provided the emotional contextual information for the face processing. In two experiments, green and pink backgrounds enhanced happy face recognition and impaired sad face recognition, compared with a control color (gray). Our findings therefore suggest that because green and pink both convey positive information, they facilitate the processing of emotionally congruent facial expressions (i.e., faces expressing happiness) and interfere with that of incongruent facial expressions (i.e., faces expressing sadness). Data also revealed a positive association for white. Results are discussed within the theoretical framework of emotional cue processing and color meaning. PMID:25098167

Seeing life through positive-tinted glasses: color-meaning associations.

PubMed

Gil, Sandrine; Le Bigot, Ludovic

2014-01-01

There is a growing body of literature to show that color can convey information, owing to its emotionally meaningful associations. Most research so far has focused on negative hue-meaning associations (e.g., red) with the exception of the positive aspects associated with green. We therefore set out to investigate the positive associations of two colors (i.e., green and pink), using an emotional facial expression recognition task in which colors provided the emotional contextual information for the face processing. In two experiments, green and pink backgrounds enhanced happy face recognition and impaired sad face recognition, compared with a control color (gray). Our findings therefore suggest that because green and pink both convey positive information, they facilitate the processing of emotionally congruent facial expressions (i.e., faces expressing happiness) and interfere with that of incongruent facial expressions (i.e., faces expressing sadness). Data also revealed a positive association for white. Results are discussed within the theoretical framework of emotional cue processing and color meaning.

Is crypsis a common defensive strategy in plants?

PubMed Central

2010-01-01

Color is a common feature of animal defense. Herbivorous insects are often colored in shades of green similar to their preferred food plants, making them difficult for predators to locate. Other insects advertise their presence with bright colors after they sequester enough toxins from their food plants to make them unpalatable. Some insects even switch between cryptic and aposomatic coloration during development.1 Although common in animals, quantitative evidence for color-based defense in plants is rare. After all, the primary function of plant leaves is to absorb light for photosynthesis, rather than reflect light in ways that alter their appearance to herbivores. However, recent research is beginning to challenge the notion that color-based defence is restricted to animals. PMID:20592801

Improvement of High-throughput Genotype Analysis After Implementation of a Dual-curve Sybr Green I-based Quantification and Normalization Procedure

USDA-ARS?s Scientific Manuscript database

The ability to rapidly screen a large number of individuals is the key to any successful plant breeding program. One of the primary bottlenecks in high throughput screening is the preparation of DNA samples, particularly the quantification and normalization of samples for downstream processing. A ...

High-sensitivity assay for Hg (II) and Ag (I) ion detection: A new class of droplet digital PCR logic gates for an intelligent DNA calculator.

PubMed

Cheng, Nan; Zhu, Pengyu; Xu, Yuancong; Huang, Kunlun; Luo, Yunbo; Yang, Zhansen; Xu, Wentao

2016-10-15

The first example of droplet digital PCR logic gates ("YES", "OR" and "AND") for Hg (II) and Ag (I) ion detection has been constructed based on two amplification events triggered by a metal-ion-mediated base mispairing (T-Hg(II)-T and C-Ag(I)-C). In this work, Hg(II) and Ag(I) were used as the input, and the "true" hierarchical colors or "false" green were the output. Through accurate molecular recognition and high sensitivity amplification, positive droplets were generated by droplet digital PCR and viewed as the basis of hierarchical digital signals. Based on this principle, YES gate for Hg(II) (or Ag(I)) detection, OR gate for Hg(II) or Ag(I) detection and AND gate for Hg(II) and Ag(I) detection were developed, and their sensitively and selectivity were reported. The results indicate that the ddPCR logic system developed based on the different indicators for Hg(II) and Ag(I) ions provides a useful strategy for developing advanced detection methods, which are promising for multiplex metal ion analysis and intelligent DNA calculator design applications. Copyright © 2016 Elsevier B.V. All rights reserved.

Near-infrared fluorescence image quality test methods for standardized performance evaluation

NASA Astrophysics Data System (ADS)

Kanniyappan, Udayakumar; Wang, Bohan; Yang, Charles; Ghassemi, Pejhman; Wang, Quanzeng; Chen, Yu; Pfefer, Joshua

2017-03-01

Near-infrared fluorescence (NIRF) imaging has gained much attention as a clinical method for enhancing visualization of cancers, perfusion and biological structures in surgical applications where a fluorescent dye is monitored by an imaging system. In order to address the emerging need for standardization of this innovative technology, it is necessary to develop and validate test methods suitable for objective, quantitative assessment of device performance. Towards this goal, we develop target-based test methods and investigate best practices for key NIRF imaging system performance characteristics including spatial resolution, depth of field and sensitivity. Characterization of fluorescence properties was performed by generating excitation-emission matrix properties of indocyanine green and quantum dots in biological solutions and matrix materials. A turbid, fluorophore-doped target was used, along with a resolution target for assessing image sharpness. Multi-well plates filled with either liquid or solid targets were generated to explore best practices for evaluating detection sensitivity. Overall, our results demonstrate the utility of objective, quantitative, target-based testing approaches as well as the need to consider a wide range of factors in establishing standardized approaches for NIRF imaging system performance.

Developing laser-based therapy monitoring of early caries in pediatric dental settings

NASA Astrophysics Data System (ADS)

Zhou, Yaxuan; Jiang, Yang; Kim, Amy S.; Xu, Zheng; Berg, Joel H.; Seibel, Eric J.

2017-02-01

Optical imaging modalities and therapy monitoring protocols are required for the emergence of non-surgical interventions for treating infections in teeth to remineralize the enamel. Current standard of visual inspection, tactile probing and radiograph for caries detection is not highly sensitive, quantitative, and safe. Furthermore, the latter two are not viable options for interproximal caries. We present preliminary results of multimodal laser-based imaging and uorescence spectroscopy in a blinded clinical study comparing two topical therapies of early interproximal caries in children. With a spacer placed interproximally both at baseline and followup examinations, the 405-nm excited red porphyrin uorescence imaging with green auto uorescence is measured and compared to a 12-month follow-up. 405-nm laser-induced uorescence spectroscopy is also measured from the center of selected multimodal video imaging frames. These results of three subjects are analyzed both qualitatively by comparing spectra and quantitatively based on uorescence region segmentation, and then are compared to the standard of care(visual examination and radiograph interpretation). Furthermore, this study points out challenges associated with optically monitoring non-surgical dental interventions over long periods of time in clinical practice and also indicates future direction for improvement on the protocol.

[Scale effect of Nanjing urban green infrastructure network pattern and connectivity analysis.

PubMed

Yu, Ya Ping; Yin, Hai Wei; Kong, Fan Hua; Wang, Jing Jing; Xu, Wen Bin

2016-07-01

Based on ArcGIS, Erdas, GuidosToolbox, Conefor and other software platforms, using morphological spatial pattern analysis (MSPA) and landscape connectivity analysis methods, this paper quantitatively analysed the scale effect, edge effect and distance effect of the Nanjing urban green infrastructure network pattern in 2013 by setting different pixel sizes (P) and edge widths in MSPA analysis, and setting different dispersal distance thresholds in landscape connectivity analysis. The results showed that the type of landscape acquired based on the MSPA had a clear scale effect and edge effect, and scale effects only slightly affected landscape types, whereas edge effects were more obvious. Different dispersal distances had a great impact on the landscape connectivity, 2 km or 2.5 km dispersal distance was a critical threshold for Nanjing. When selecting the pixel size 30 m of the input data and the edge wide 30 m used in the morphological model, we could get more detailed landscape information of Nanjing UGI network. Based on MSPA and landscape connectivity, analysis of the scale effect, edge effect, and distance effect on the landscape types of the urban green infrastructure (UGI) network was helpful for selecting the appropriate size, edge width, and dispersal distance when developing these networks, and for better understanding the spatial pattern of UGI networks and the effects of scale and distance on the ecology of a UGI network. This would facilitate a more scientifically valid set of design parameters for UGI network spatiotemporal pattern analysis. The results of this study provided an important reference for Nanjing UGI networks and a basis for the analysis of the spatial and temporal patterns of medium-scale UGI landscape networks in other regions.

Enhancing the response of CALUX and CAFLUX cell bioassays for quantitative detection of dioxin-like compounds

PubMed Central

ZHAO, Bin; BASTON, David S.; KHAN, Elaine; SORRENTINO, Claudio; DENISON, Michael S.

2011-01-01

Reporter genes produce a protein product in transfected cells that can be easily measured in intact or lysed cells and they have been extensively used in numerous basic and applied research applications. Over the past 10 years, reporter gene assays have been widely accepted and used for analysis of 2,3,7,8-tetrachlorodibenzo-p-dioxin and related dioxin-like compounds in various types of matrices, such as biological, environmental, food and feed samples, given that high-resolution instrumental analysis techniques are impractical for large-scale screening analysis. The most sensitive cell-based reporter gene bioassay systems developed are the mechanism-based CALUX (Chemically Activated Luciferase Expression) and CAFLUX (Chemically Activated Fluorescent Expression) bioassays, which utilize recombinant cell lines containing stably transfected dioxin (AhR)-responsive firefly luciferase or enhanced green fluorescent protein (EGFP) reporter genes, respectively. While the current CALUX and CAFLUX bioassays are very sensitive, increasing their lower limit of sensitivity, magnitude of response and dynamic range for chemical detection would significantly increase their utility, particularly for those samples that contain low levels of dioxin-like HAHs (i.e., serum). In this study, we report that the addition of modulators of cell signaling pathways or modification of cell culture conditions results in significant improvement in the magnitude and overall responsiveness of the existing CALUX and CAFLUX cell bioassays. PMID:21394221

Establishing a safe, rapid, convenient and low-cost antiviral assay of interferon bioactivity based on recombinant VSV expressing GFP.

PubMed

Chen, Weiye; Wen, Zhiyuan; Zhang, Jialin; Li, Cuicui; Huang, Kehe; Bu, Zhigao

2018-02-01

The methods of the quantitative assay of the antiviral activity of interferons (IFNs) (type I, II or III) are very important during carrying out of the research of them, since they were found. Here a recombinant vesicular stomatitis virus expressing green fluorescent protein (GFP) (VSV/GFP) and MDBK cells were used to develop an antiviral assay (AVA) for IFNs. This method was carried out on a 96-well cell culture plate, and the half reduction of virus replication was quantified by assaying GFP. To quantify GFP, cell lysis buffer was directly added to the wells infected with VSV/GFP to lyse cells, the VSV/GFP was then inactivated, and relative fluorescence unit (RFU) of GFP was measured and used to calculate the antiviral activity. This method needed only one step instead of three steps in the staining method with naphthol blue black, medium with phenol red can be used, and it had good reproducibility. The GFP-containing samples could be stored at 4°C in a wet box for at least 1 week without affecting the assay results. In addition, the results obtained with this method were similar to those obtained with the staining method. In conclusion, a safe, rapid, convenient and low-cost AVA of IFN based on recombinant VSV/GFP was established. Copyright © 2017. Published by Elsevier B.V.

Confocal epifluorescence sensor with an arc-shaped aperture for slide-based PCR quantification.

PubMed

Weng, Jui-Hong; Chen, Lin-Chi

2018-02-15

The increasing needs of point-of-care diagnostics, quarantine of epidemic pathogens, and prevention of terrorism's bio-attacks have promised the future of portable real-time quantitative polymerase chain reaction (qPCR) sensors. This work aims at developing a highly sensitive and low-cost light emitting diode (LED)-based epifluorescence sensor module for qPCR sensor development and relevant bioassay applications. Inspired by the light stop design and dark-field detection of microscopes, this paper first reports a compact confocal LED epifluorescence sensor using a light stop with an arc-shaped aperture for enhancing the flexibility of quick DNA and PCR detection. The sensor features the advantages of the dichroic mirror-free and confocal (shared-focus) characteristics, which benefits size reduction and minimal optics used. It also allows extension to integrate with in situ real-time PCR thermal cycling since the sample slide is placed apart from the epi-sensing module. The epifluorescence sensor can detect as low as sub-ng/μL standard DNA and 10 1 copies of Salmonella typhimurium InvA gene sequences (cloned in E. coli and after 30-cycle PCR) with SYBR ® Green I from non-purified culture samples, having highly sensitive and specific signal responses comparable with that of a commercial qPCR instrument. Copyright © 2017 Elsevier B.V. All rights reserved.

Digital quantitative analysis of microRNA in single cell based on ligation-depended polymerase colony (Polony).

PubMed

Wang, Hui; Wang, Honghong; Duan, Xinrui; Liu, Chenghui; Li, Zhengping

2017-09-15

The ability to dissect cell-to-cell variations of microRNA (miRNA) expression with single-cell resolution has become a powerful tool to investigate the regulatory function of miRNAs in biological processes and the pathogenesis of miRNA-related diseases. Herein, we have developed a novel scheme for digital detection of miRNA in single cell by using the ligation-depended DNA polymerase colony (polony). Firstly, two simply designed target-specific DNA probes were ligated by using individual miRNA as the template. Then the ligated DNA probe acted as polony template that was amplified by PCR process in the thin polyacrylamide hydrogel. Due to the covalent attachment of a PCR primer on polyacrylamide matrix and the retarding effect of the polyacrylamide hydrogel matrix itself, as the polony reaction proceeds, the PCR products diffused radially near individual template molecule to form a bacteria colony-like spots of DNA molecules. The spots can be counted after staining the polyacrylamide gel with SYBR Green I and imaging with a microarray scanner. Our polony-based method is sensitive enough to detect 60 copies of miRNA molecules. Meanwhile, the new strategy has the capability of distinguishing singe-base difference. Due to its high sensitivity and specificity, the proposed method has been successfully applied to analysis of the expression profiling of miRNA in single cell. Copyright © 2017 Elsevier B.V. All rights reserved.

Antioxidant changes of leek (Allium ampeloprasum var. porrum) during spontaneous fermentation of the white shaft and green leaves.

PubMed

Bernaert, Nathalie; Wouters, Dorrit; De Vuyst, Luc; De Paepe, Domien; De Clercq, Hervé; Van Bockstaele, Erik; De Loose, Marc; Van Droogenbroeck, Bart

2013-07-01

Leek is grown for its thickened cylindrical white shaft made up of long leaf bases. Despite the potentially valuable nutritional profile of the green leaves, a large portion remains unused owing its restricted culinary applications. This large quantity of this plant biomass could be valorized given an adequate stabilization method. In this study, we examined leek fermentation with regard to antioxidant changes. The oxygen radical absorbance capacity (ORAC) increased by 62% when the green leaves were fermented for 21 days, while 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity did not increase significantly. Fermentation resulted in an increase of endogenous polyphenolic compounds such as ferulic acid, astragalin, luteolin and naringenin. Moreover, fermentation stimulated the production of a series of polyphenolic compounds that were not present in the fresh leek. The flavour precursors in leek, i.e. methiin and isoalliin, were reduced by 91-93% and 100%, respectively, when spontaneous fermentation was allowed to occur on the white shaft and green leaves. Our results demonstrated that application of fermentation resulted in a higher ORAC value and polyphenol content of the leek plant, especially in the green leaves. These results indicate the nutritional relevance of fermentation, which hold promise as a stabilization technique. © 2013 Society of Chemical Industry.

Car and Parrinello meet Green and Kubo: simulating atomic heat transport from equilibrium ab initio molecular dynamics

NASA Astrophysics Data System (ADS)

Baroni, Stefano

Modern simulation methods based on electronic-structure theory have long been deemed unfit to compute heat transport coefficients within the Green-Kubo formalism. This is so because the quantum-mechanical energy density from which the heat flux is derived is inherently ill defined, thus allegedly hampering the use of the Green-Kubo formula. While this objection would actually apply to classical systems as well, I will demonstrate that the thermal conductivity is indeed independent of the specific microscopic expression for the energy density and current from which it is derived. This fact results from a kind of gauge invariance stemming from energy conservation and extensivity, which I will illustrate numerically for a classical Lennard-Jones fluid. I will then introduce an expression for the adiabatic energy flux, derived within density-functional theory, that allows simulating atomic heat transport using equilibrium ab initio molecular dynamics. The resulting methodology is demonstrated by comparing results from ab-initio and classical molecular-dynamics simulations of a model liquid-Argon system, for which accurate inter-atomic potentials are derived by the force-matching method, and applied to compute the thermal conductivity of heavy water at ambient conditions. The problem of evaluating transport coefficients along with their accuracy from relatively short trajectories is finally addressed and discussed with a few representative examples. Partially funded by the European Union through the MaX Centre of Excellence (Grant No. 676598).

[Application of rapid PCR to authenticate medicinal snakes].

PubMed

Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man

2014-10-01

To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.

Development and evaluation of a model-based downscatter compensation method for quantitative I-131 SPECT

PubMed Central

Song, Na; Du, Yong; He, Bin; Frey, Eric C.

2011-01-01

Purpose: The radionuclide 131I has found widespread use in targeted radionuclide therapy (TRT), partly due to the fact that it emits photons that can be imaged to perform treatment planning or posttherapy dose verification as well as beta rays that are suitable for therapy. In both the treatment planning and dose verification applications, it is necessary to estimate the activity distribution in organs or tumors at several time points. In vivo estimates of the 131I activity distribution at each time point can be obtained from quantitative single-photon emission computed tomography (QSPECT) images and organ activity estimates can be obtained either from QSPECT images or quantification of planar projection data. However, in addition to the photon used for imaging, 131I decay results in emission of a number of other higher-energy photons with significant abundances. These higher-energy photons can scatter in the body, collimator, or detector and be counted in the 364 keV photopeak energy window, resulting in reduced image contrast and degraded quantitative accuracy; these photons are referred to as downscatter. The goal of this study was to develop and evaluate a model-based downscatter compensation method specifically designed for the compensation of high-energy photons emitted by 131I and detected in the imaging energy window. Methods: In the evaluation study, we used a Monte Carlo simulation (MCS) code that had previously been validated for other radionuclides. Thus, in preparation for the evaluation study, we first validated the code for 131I imaging simulation by comparison with experimental data. Next, we assessed the accuracy of the downscatter model by comparing downscatter estimates with MCS results. Finally, we combined the downscatter model with iterative reconstruction-based compensation for attenuation (A) and scatter (S) and the full (D) collimator-detector response of the 364 keV photons to form a comprehensive compensation method. We evaluated this combined method in terms of quantitative accuracy using the realistic 3D NCAT phantom and an activity distribution obtained from patient studies. We compared the accuracy of organ activity estimates in images reconstructed with and without addition of downscatter compensation from projections with and without downscatter contamination. Results: We observed that the proposed method provided substantial improvements in accuracy compared to no downscatter compensation and had accuracies comparable to reconstructions from projections without downscatter contamination. Conclusions: The results demonstrate that the proposed model-based downscatter compensation method is effective and may have a role in quantitative 131I imaging. PMID:21815394

My Green Car: Painting Motor City Green (Ep. 2) – DOE Lab-Corps Video Series

ScienceCinema

Saxena, Samveg; Shah, Nihar; Hansen, Dana

2018-06-12

The Lab’s MyGreenCar team kicks off its customer discovery process in Detroit with a business boot camp designed for scientists developing energy-related technologies. Customer interviews lead to late night discussions and insights on less-than-receptive consumers. Back in Berkeley, the team decides to fine tune targeted customer segments. What makes a new technology compelling enough to transition out of the lab and become a consumer product? That’s the question Berkeley Lab researchers Samveg Saxena, Nihar Shah, and Dana Hansen plus industry mentor Russell Carrington set out to answer for MyGreenCar, an app providing personalized fuel economy or electric vehicle range estimates for consumers researching new cars. DOE’s Lab-Corps program offered the technology team some answers. The EERE-funded program, based on the National Science Foundation’s I-Corps™ model for entrepreneurial training, provides tools and training to move energy-related inventions to the marketplace. During Lab-Corp’s intensive six-week session, technology teams interview 100 customer and value chain members to discover which potential products based on their technologies will have significant market pull. A six video series follows the MyGreenCar team’s Lab-Corps experience, from pre-training preparation with the Lab’s Innovation and Partnerships Office through the ups and downs of the customer discovery process. Will the app make it to the marketplace? You’ll just have to watch.

Numerical analysis of the change in skin color due to ecchymosis and petechiae generated by cupping: a pilot study.

PubMed

Kim, Soo-Byeong; Lee, Yong-Heum

2014-12-01

Cupping is one of the various treatment methods used in traditional oriental medicine. Cupping is also used as a diagnostic method and it may cause skin hyperpigmentation. Quantitative measurements and analysis of changes in skin color due to cupping are critical. The purpose of this study is to suggest an optical technique to visualize and identify changes in skin color due to cupping. We suggest the following analysis methods: digital color spaces [red, green, and blue (RGB) and L∗a∗b], the Erythema Index (E.I.), and the Melanin Index (M.I.). For experiments, we selected and stimulated 10 acupoints at 80 kilopascals (kPa) per minute. The RGB and L∗a∗b color spaces were observed to be decreased (p < 0.05) after cupping. The E.I. and M.I. were observed to be increased significantly (p < 0.05) after cupping. To assess various changes in skin color, we observed the changes for 72 hours. We also obtained the color changes by using the recovery pattern during the recovery period (p < 0.01). We propose that this method can be useful for visual identification and as a way to improve the identification of skin color changes. Copyright © 2014. Published by Elsevier B.V.

School Administrators' Use of iPads: Impact of Training and Attitudes toward School Use

ERIC Educational Resources Information Center

Dogan, Bulent; Almus, Kadir

2014-01-01

As Apple iPads are increasingly being adopted in schools for educational purposes, school administrators are seen as the key facilitators in the implementation of this new technology. This survey-based quantitative study investigated the impact of receiving iPad training on school administrators' attitudes towards iPad use in their professional…

Transferable green fluorescence-tagged pEI2 in Edwardsiella ictaluri

USDA-ARS?s Scientific Manuscript database

The pEI2 plasmid of Edwardsiella ictaluri isolate, I49, was tagged using a Tn10-GFP-kan cassette to create the green fluorescence-expressing derivative I49-gfp. The Tn10-GFP-kan insertion site was mapped by plasmid sequencing to 663 bp upstream of orf2 and appeared to be at a neutral site in the pla...

Silaffin peptides as a novel signal enhancer for gravimetric biosensors.

PubMed

Nam, Dong Hyun; Lee, Jeong-O; Sang, Byoung-In; Won, Keehoon; Kim, Yong Hwan

2013-05-01

Application of biomimetic silica formation to gravimetric biosensors has been conducted for the first time. As a model system, silaffin peptides fused with green fluorescent protein (GFP) were immobilized on a gold quartz crystal resonator for quartz crystal microbalances using a self-assembled monolayer. When a solution of silicic acid was supplied, silica particles were successfully deposited on the Au surface, resulting in a significant change in resonance frequency (i.e., signal enhancement) with the silaffin-GFP. However, frequency was not altered when bare GFP was used as a control. The novel peptide enhancer is advantageous because it can be readily and quantitatively conjugated with sensing proteins using recombinant DNA technology. As a proof of concept, this study shows that the silaffin domains can be employed as a novel and efficient biomolecular signal enhancer for gravimetric biosensors.

Stable isotopic labeling-based quantitative targeted glycomics (i-QTaG).

PubMed

Kim, Kyoung-Jin; Kim, Yoon-Woo; Kim, Yun-Gon; Park, Hae-Min; Jin, Jang Mi; Hwan Kim, Young; Yang, Yung-Hun; Kyu Lee, Jun; Chung, Junho; Lee, Sun-Gu; Saghatelian, Alan

2015-01-01

Mass spectrometry (MS) analysis combined with stable isotopic labeling is a promising method for the relative quantification of aberrant glycosylation in diseases and disorders. We developed a stable isotopic labeling-based quantitative targeted glycomics (i-QTaG) technique for the comparative and quantitative analysis of total N-glycans using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). We established the analytical procedure with the chemical derivatizations (i.e., sialic acid neutralization and stable isotopic labeling) of N-glycans using a model glycoprotein (bovine fetuin). Moreover, the i-QTaG using MALDI-TOF MS was evaluated with various molar ratios (1:1, 1:2, 1:5) of (13) C6 /(12) C6 -2-aminobenzoic acid-labeled glycans from normal human serum. Finally, this method was applied to direct comparison of the total N-glycan profiles between normal human sera (n = 8) and prostate cancer patient sera (n = 17). The intensities of the N-glycan peaks from i-QTaG method showed a good linearity (R(2) > 0.99) with the amount of the bovine fetuin glycoproteins. The ratios of relative intensity between the isotopically 2-AA labeled N-glycans were close to the theoretical molar ratios (1:1, 1:2, 1:5). We also demonstrated that the up-regulation of the Lewis antigen (~82%) in sera from prostate cancer patients. In this proof-of-concept study, we demonstrated that the i-QTaG method, which enables to achieve a reliable comparative quantitation of total N-glycans via MALDI-TOF MS analysis, has the potential to diagnose and monitor alterations in glycosylation associated with disease states or biotherapeutics. © 2015 American Institute of Chemical Engineers.

Quantitative analysis of major constituents in green tea with different plucking periods and their antioxidant activity.

PubMed

Lee, Lan-Sook; Kim, Sang-Hee; Kim, Young-Boong; Kim, Young-Chan

2014-07-01

The objective of this study was to determine the relationship between the plucking periods and the major constituents and the antioxidant activity in green tea. Green tea was prepared from leaves plucked from the end of April 2013 to the end of May 2013 at intervals of one week or longer. The contents of theanine, theobromine, caffeine, catechin (C), and gallocatechin gallate (GCg) were significantly decreased, whereas those of epicatechin (EC), epigallocatechin gallate (EGCg) and epigallocatechin (EGC) were significantly increased along with the period of tea leaf plucking. In addition, antioxidant activity of green tea and standard catechins was investigated using ABTS, FRAP and DPPH assays. The highest antioxidant activity was observed in relatively the oldest leaf, regardless of the assay methods used. Additionally, the order of antioxidant activity of standard catechins was as follows: EGCg≥GCg≥ECg>EGC≥GC≥EC≥C. Moreover, the cis-catechins contents were the key factor affecting the antioxidant activity of green tea in all assays employed (ABTS, r=0.731, p<0.01; FRAP, r=0.886, p<0.01; DPPH, r=0.778, p<0.01).

Tribal Green Building Administrative Code Example

EPA Pesticide Factsheets

This Tribal Green Building Administrative Code Example can be used as a template for technical code selection (i.e., building, electrical, plumbing, etc.) to be adopted as a comprehensive building code.

SU-E-I-51: Quantitative Assessment of X-Ray Imaging Detector Performance in a Clinical Setting - a Simple Approach Using a Commercial Instrument

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sjoeberg, J; Bujila, R; Omar, A

2015-06-15

Purpose: To measure and compare the performance of X-ray imaging detectors in a clinical setting using a dedicated instrument for the quantitative determination of detector performance. Methods: The DQEPro (DQE Instruments Inc., London, Ontario Canada) was used to determine the MTF, NPS and DQE using an IEC compliant methodology for three different imaging modalities: conventional radiography (CsI-based detector), general-purpose radioscopy (CsI-based detector), and mammography (a-Se based detector). The radiation qualities (IEC) RQA-5 and RQA-M-2 were used for the CsI-based and a-Se-based detectors, respectively. The DQEPro alleviates some of the difficulties associated with DQE measurements by automatically positioning test devices overmore » the detector, guiding the user through the image acquisition process and providing software for calculations. Results: A comparison of the NPS showed that the image noise of the a-Se detector was less correlated than the CsI detectors. A consistently higher performance was observed for the a-Se detector at all spatial frequencies (MTF: 0.97@0.25 cy/mm, DQE: 0.72@0.25 cy/mm) and the DQE drops off slower than for the CsI detectors. The CsI detector used for conventional radiography displayed a higher performance at low spatial frequencies compared to the CsI detector used for radioscopy (DQE: 0.65 vs 0.60@0.25 cy/mm). However, at spatial frequencies above 1.3 cy/mm, the radioscopy detector displayed better performance than the conventional radiography detector (DQE: 0.35 vs 0.24@2.00 cy/mm). Conclusion: The difference in the MTF, NPS and DQE that was observed for the two different CsI detectors and the a-Se detector reflect the imaging tasks that the different detector types are intended for. The DQEPro has made the determination and calculation of quantitative metrics of X-ray imaging detector performance substantially more convenient and accessible to undertake in a clinical setting.« less

On a decrease of high-latitude corona temperature of the Sun in the last 50 years

NASA Astrophysics Data System (ADS)

Makarov, V. I.; Tlatov, A. G.

2002-03-01

The ground-based observations of the green Fe XIV 5303 Å and red Fe X 6374 Å corona forbidden lines obtained at the Kislovodsk Solar Station since 1952 are used to determine the temperature variations of the solar corona. The observations of the solar corona at the Arosa, Pic du Midi, Kislovodsk, Norikura, Kanzelhöhe, Wendelstein and Lomnický Stit have been used to receive the Kislovodsk series of the green K I5303 and red K I6374 corona intensities for 1947-2000. Comparison of the K I5303 with the Wolf numbers W(t) shows high correlation factor 0.91. The mean monthly corona intensity has been calculated in the sunspot (0° - 45°) and at the high-latitude (45° - 90°) zones. We found a decrease of the K I5303 in 1.5 times at the high-latitudes in this period. It was shown that the ratio K I6374/K I5303 increased more than two times. We have found a decrease of temperature in polar zones of the Sun of order 0.1×106 during the last 50 years. It is supposed that a decrease of polar corona temperature connected with an increase of magnetic flux from high-latitude regions of the Sun during the last 120 years.

Quantitative imaging with Fucci and mathematics to uncover temporal dynamics of cell cycle progression.

PubMed

Saitou, Takashi; Imamura, Takeshi

2016-01-01

Cell cycle progression is strictly coordinated to ensure proper tissue growth, development, and regeneration of multicellular organisms. Spatiotemporal visualization of cell cycle phases directly helps us to obtain a deeper understanding of controlled, multicellular, cell cycle progression. The fluorescent ubiquitination-based cell cycle indicator (Fucci) system allows us to monitor, in living cells, the G1 and the S/G2/M phases of the cell cycle in red and green fluorescent colors, respectively. Since the discovery of Fucci technology, it has found numerous applications in the characterization of the timing of cell cycle phase transitions under diverse conditions and various biological processes. However, due to the complexity of cell cycle dynamics, understanding of specific patterns of cell cycle progression is still far from complete. In order to tackle this issue, quantitative approaches combined with mathematical modeling seem to be essential. Here, we review several studies that attempted to integrate Fucci technology and mathematical models to obtain quantitative information regarding cell cycle regulatory patterns. Focusing on the technological development of utilizing mathematics to retrieve meaningful information from the Fucci producing data, we discuss how the combined methods advance a quantitative understanding of cell cycle regulation. © 2015 Japanese Society of Developmental Biologists.

Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

PubMed

Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

2014-12-10

A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

An experimental approach to identify dynamical models of transcriptional regulation in living cells

NASA Astrophysics Data System (ADS)

Fiore, G.; Menolascina, F.; di Bernardo, M.; di Bernardo, D.

2013-06-01

We describe an innovative experimental approach, and a proof of principle investigation, for the application of System Identification techniques to derive quantitative dynamical models of transcriptional regulation in living cells. Specifically, we constructed an experimental platform for System Identification based on a microfluidic device, a time-lapse microscope, and a set of automated syringes all controlled by a computer. The platform allows delivering a time-varying concentration of any molecule of interest to the cells trapped in the microfluidics device (input) and real-time monitoring of a fluorescent reporter protein (output) at a high sampling rate. We tested this platform on the GAL1 promoter in the yeast Saccharomyces cerevisiae driving expression of a green fluorescent protein (Gfp) fused to the GAL1 gene. We demonstrated that the System Identification platform enables accurate measurements of the input (sugars concentrations in the medium) and output (Gfp fluorescence intensity) signals, thus making it possible to apply System Identification techniques to obtain a quantitative dynamical model of the promoter. We explored and compared linear and nonlinear model structures in order to select the most appropriate to derive a quantitative model of the promoter dynamics. Our platform can be used to quickly obtain quantitative models of eukaryotic promoters, currently a complex and time-consuming process.

Quantitative iTRAQ secretome analysis of Aspergillus niger reveals novel hydrolytic enzymes.

PubMed

Adav, Sunil S; Li, An A; Manavalan, Arulmani; Punt, Peter; Sze, Siu Kwan

2010-08-06

The natural lifestyle of Aspergillus niger made them more effective secretors of hydrolytic proteins and becomes critical when this species were exploited as hosts for the commercial secretion of heterologous proteins. The protein secretion profile of A. niger and its mutant at different pH was explored using iTRAQ-based quantitative proteomics approach coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS). This study characterized 102 highly confident unique proteins in the secretome with zero false discovery rate based on decoy strategy. The iTRAQ technique identified and relatively quantified many hydrolyzing enzymes such as cellulases, hemicellulases, glycoside hydrolases, proteases, peroxidases, and protein translocating transporter proteins during fermentation. The enzymes have potential application in lignocellulosic biomass hydrolysis for biofuel production, for example, the cellulolytic and hemicellulolytic enzymes glucan 1,4-alpha-glucosidase, alpha-glucosidase C, endoglucanase, alpha l-arabinofuranosidase, beta-mannosidase, glycosyl hydrolase; proteases such as tripeptidyl-peptidase, aspergillopepsin, and other enzymes including cytochrome c oxidase, cytochrome c oxidase, glucose oxidase were highly expressed in A. niger and its mutant secretion. In addition, specific enzyme production can be stimulated by controlling pH of the culture medium. Our results showed comprehensive unique secretory protein profile of A. niger, its regulation at different pH, and the potential application of iTRAQ-based quantitative proteomics for the microbial secretome analysis.

Effects of building roof greening on air quality in street canyons

NASA Astrophysics Data System (ADS)

Baik, Jong-Jin; Kwak, Kyung-Hwan; Park, Seung-Bu; Ryu, Young-Hee

2012-12-01

Building roof greening is a successful strategy for improving urban thermal environment. It is of theoretical interest and practical importance to study the effects of building roof greening on urban air quality in a systematic and quantitative way. In this study, we examine the effects of building roof greening on air quality in street canyons using a computational fluid dynamics (CFD) model that includes the thermodynamic energy equation and the transport equation of passive, non-reactive pollutants. For simplicity, building roof greening is represented by specified cooling. Results for a simple building configuration with a street canyon aspect ratio of one show that the cool air produced due to building roof greening flows into the street canyon, giving rise to strengthened street canyon flow. The strengthened street canyon flow enhances pollutant dispersion near the road, which decreases pollutant concentration there. Thus, building roof greening improves air quality near the road. The degree of air quality improvement near the road increases as the cooling intensity increases. In the middle region of the street canyon, the air quality can worsen when the cooling intensity is not too strong. Results for a real urban morphology also show that building roof greening improves air quality near roads. The degree of air quality improvement near roads due to building roof greening depends on the ambient wind direction. These findings provide a theoretical foundation for constructing green roofs for the purpose of improving air quality near roads or at a pedestrian level as well as urban thermal environment. Further studies using a CFD model coupled with a photochemistry model and a surface energy balance model are required to evaluate the effects of building roof greening on air quality in street canyons in a more realistic framework.

Contrasting effects of visiting urban green-space and the countryside on biodiversity knowledge and conservation support.

PubMed

Coldwell, Deborah F; Evans, Karl L

2017-01-01

Conservation policy frequently assumes that increasing people's exposure to green-space enhances their knowledge of the natural world and desire to protect it. Urban development is, however, considered to be driving declining connectedness to nature. Despite this the evidence base supporting the assumption that visiting green-spaces promotes biodiversity knowledge and conservation support, and the impacts of urbanization on these relationships, is surprisingly limited. Using data from door-to-door surveys of nearly 300 residents in three pairs of small and large urban areas in England we demonstrate that people who visit green-space more regularly have higher biodiversity knowledge and support for conservation (measured using scales of pro-environmental behavior). Crucially these relationships only arise when considering visits to the countryside and not the frequency of visits to urban green-space. These patterns are robust to a suite of confounding variables including nature orientated motivations for visiting green-space, socio-economic and demographic factors, garden-use and engagement with natural history programs. Despite this the correlations that we uncover cannot unambiguously demonstrate that visiting the countryside improves biodiversity knowledge and conservation support. We consider it likely, however, that two mechanisms operate through a positive feedback loop i.e. increased visits to green-space promote an interest in and knowledge of biodiversity and support for conservation, which in turn further increase the desire to visit green-space and experience nature. The intensity of urbanization around peoples' homes, but not city size, is negatively associated with their frequency of countryside visits and biodiversity knowledge. Designing less intensely urbanized cities with good access to the countryside, combined with conservation policies that promote access to the countryside thus seems likely to maximize urban residents' biodiversity knowledge and support for conservation.

Contrasting effects of visiting urban green-space and the countryside on biodiversity knowledge and conservation support

PubMed Central

Coldwell, Deborah F.; Evans, Karl L.

2017-01-01

Conservation policy frequently assumes that increasing people’s exposure to green-space enhances their knowledge of the natural world and desire to protect it. Urban development is, however, considered to be driving declining connectedness to nature. Despite this the evidence base supporting the assumption that visiting green-spaces promotes biodiversity knowledge and conservation support, and the impacts of urbanization on these relationships, is surprisingly limited. Using data from door-to-door surveys of nearly 300 residents in three pairs of small and large urban areas in England we demonstrate that people who visit green-space more regularly have higher biodiversity knowledge and support for conservation (measured using scales of pro-environmental behavior). Crucially these relationships only arise when considering visits to the countryside and not the frequency of visits to urban green-space. These patterns are robust to a suite of confounding variables including nature orientated motivations for visiting green-space, socio-economic and demographic factors, garden-use and engagement with natural history programs. Despite this the correlations that we uncover cannot unambiguously demonstrate that visiting the countryside improves biodiversity knowledge and conservation support. We consider it likely, however, that two mechanisms operate through a positive feedback loop i.e. increased visits to green-space promote an interest in and knowledge of biodiversity and support for conservation, which in turn further increase the desire to visit green-space and experience nature. The intensity of urbanization around peoples’ homes, but not city size, is negatively associated with their frequency of countryside visits and biodiversity knowledge. Designing less intensely urbanized cities with good access to the countryside, combined with conservation policies that promote access to the countryside thus seems likely to maximize urban residents’ biodiversity knowledge and support for conservation. PMID:28334034

Multiparametric evaluation of hindlimb ischemia using time-series indocyanine green fluorescence imaging.

PubMed

Guang, Huizhi; Cai, Chuangjian; Zuo, Simin; Cai, Wenjuan; Zhang, Jiulou; Luo, Jianwen

2017-03-01

Peripheral arterial disease (PAD) can further cause lower limb ischemia. Quantitative evaluation of the vascular perfusion in the ischemic limb contributes to diagnosis of PAD and preclinical development of new drug. In vivo time-series indocyanine green (ICG) fluorescence imaging can noninvasively monitor blood flow and has a deep tissue penetration. The perfusion rate estimated from the time-series ICG images is not enough for the evaluation of hindlimb ischemia. The information relevant to the vascular density is also important, because angiogenesis is an essential mechanism for post-ischemic recovery. In this paper, a multiparametric evaluation method is proposed for simultaneous estimation of multiple vascular perfusion parameters, including not only the perfusion rate but also the vascular perfusion density and the time-varying ICG concentration in veins. The target method is based on a mathematical model of ICG pharmacokinetics in the mouse hindlimb. The regression analysis performed on the time-series ICG images obtained from a dynamic reflectance fluorescence imaging system. The results demonstrate that the estimated multiple parameters are effective to quantitatively evaluate the vascular perfusion and distinguish hypo-perfused tissues from well-perfused tissues in the mouse hindlimb. The proposed multiparametric evaluation method could be useful for PAD diagnosis. The estimated perfusion rate and vascular perfusion density maps (left) and the time-varying ICG concentration in veins of the ankle region (right) of the normal and ischemic hindlimbs. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Fast and selective pressurized liquid extraction with simultaneous in cell clean up for the analysis of alkylphenols and bisphenol A in bivalve molluscs.

PubMed

Salgueiro-González, N; Turnes-Carou, I; Muniategui-Lorenzoa, S; López-Mahía, P; Prada-Rodríguez, D

2012-12-28

A novel and green analytical methodology for the determination of alkylphenols (4-tert-octylphenol, 4-n-octylphenol, 4-n-nonylphenol, nonylphenol technical mixture) and bisphenol A in bivalve mollusc samples was developed and validated. The method was based on selective pressurized liquid extraction (SPLE) with a simultaneous in cell clean up combined with liquid chromatography–electrospray ionization tandem mass spectrometry in negative mode (LC–ESI-MS/MS). Quantitation was performed by standard addition curves in order to correct matrix effects. The analytical features of the method were satisfactory: relative recoveries varied between 80 and 107% and repeatability and intermediate precision were <20% for all compounds. Uncertainty assessment of measurement was estimated on the basis of an in-house validation according to EURACHEM/CITAC guide. Quantitation limits of the method (MQL) ranged between 0.34 (4-n-octylphenol) and 3.6 ng g(−1) dry weight (nonylphenol). The main advantages of the method are sensitivity, selectivity, automaticity, low volumes of solvents required and low sample analysis time (according with the principles of Green Chemistry). The method was applied to the analysis of mussel samples of Galicia coast (NW of Spain). Nonylphenol and 4-tert-octylphenol were measured in all samples at concentrations between 9.3 and 372 ng g(−1) dw. As an approach, the human daily intake of these compounds was estimated and no risk for human health was found.

Aptamer-fluorescent silica nanoparticles bioconjugates based dual-color flow cytometry for specific detection of Staphylococcus aureus.

PubMed

He, Xiaoxiao; Li, Yuhong; He, Dinggen; Wang, Kemin; Shangguan, Jingfang; Shi, Hui

2014-07-01

This paper describes a sensitive and specific determination strategy for Staphylococcus aureus (S. aureus) detection using aptamer recognition and fluorescent silica nanoparticles (FSiNPs) label based dual-color flow cytometry assay (Aptamer/FSiNPs-DCFCM). In the protocol, an aptamer, having high affinity to S. aureus, was first covalently immobilized onto chloropropyl functionalized FSiNPs through a click chemistry approach to generate aptamer-nanoparticles bioconjugates (Aptamer/FSiNPs). Next, S. aureus was incubated with Aptamer/FSiNPs, and then stained with SYBR Green I (a special staining material for the duplex DNA). Upon target binding and nucleic acid staining with SYBR Green I, the S. aureus was determined using two-color flow cytometry. The method took advantage of the specificity of aptamer, signal amplification of FSiNPs label and decreased false positives of two-color flow cytometry assay. It was demonstrated that these Aptamer/FSiNPs could efficiently recognize and fluorescently label target S. aureus. Through multiparameter determination with flow cytometry, this assay allowed for detection of as low as 1.5 x 10(2) and 7.6 x 10(2) cells mL(-1) S. aureus in buffer and spiked milk, respectively, with higher sensitivity than the Aptamer/FITC based flow cytometry.

Real-time PCR based on SYBR-Green I fluorescence: an alternative to the TaqMan assay for a relative quantification of gene rearrangements, gene amplifications and micro gene deletions.

PubMed

Ponchel, Frederique; Toomes, Carmel; Bransfield, Kieran; Leong, Fong T; Douglas, Susan H; Field, Sarah L; Bell, Sandra M; Combaret, Valerie; Puisieux, Alain; Mighell, Alan J; Robinson, Philip A; Inglehearn, Chris F; Isaacs, John D; Markham, Alex F

2003-10-13

Real-time PCR is increasingly being adopted for RNA quantification and genetic analysis. At present the most popular real-time PCR assay is based on the hybridisation of a dual-labelled probe to the PCR product, and the development of a signal by loss of fluorescence quenching as PCR degrades the probe. Though this so-called 'TaqMan' approach has proved easy to optimise in practice, the dual-labelled probes are relatively expensive. We have designed a new assay based on SYBR-Green I binding that is quick, reliable, easily optimised and compares well with the published assay. Here we demonstrate its general applicability by measuring copy number in three different genetic contexts; the quantification of a gene rearrangement (T-cell receptor excision circles (TREC) in peripheral blood mononuclear cells); the detection and quantification of GLI, MYC-C and MYC-N gene amplification in cell lines and cancer biopsies; and detection of deletions in the OPA1 gene in dominant optic atrophy. Our assay has important clinical applications, providing accurate diagnostic results in less time, from less biopsy material and at less cost than assays currently employed such as FISH or Southern blotting.

The Isolation and Characterization of Human Prostate Cancer Stem Cells

DTIC Science & Technology

2015-05-01

GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was performed with iQ SYBR Green Supermix in an iCycler iQ System (Bio-Rad) using the SYBR Green Detection...initiate prostate tumorigenesis. Proc Natl Acad Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer...receptor protein. Cancer Res. 1995; 55:3068–3072. [PubMed: 7541709] Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer resistance

Development of SYBR Green and TaqMan quantitative real-time PCR assays for hepatopancreatic parvovirus (HPV) infecting Penaeus monodon in India.

PubMed

Yadav, Reena; Paria, Anutosh; Mankame, Smruti; Makesh, M; Chaudhari, Aparna; Rajendran, K V

2015-12-01

Hepatopancreatic parvovirus (HPV) infects Penaeus monodon and causes mortality in the larval stages. Further, it has been implicated in the growth retardation in cultured P. monodon. Though different geographical isolates of HPV show large sequence variations, a sensitive PCR assay specific to Indian isolate has not yet been reported. Here, we developed a sensitive SYBR Green-based and TaqMan real-time PCR for the detection and quantification of the virus. A 441-bp PCR amplicon was cloned in pTZ57 R/T vector and the plasmid copy number was estimated. A 10-fold serial dilution of the plasmid DNA from 1 × 10(9) copies to 1 copy was prepared and used as the standard. The primers were tested initially using the standard on a conventional PCR format to determine the linearity of detection. The standards were further tested on real-time PCR format using SYBR Green and TaqMan chemistry and standard curves were generated based on the Ct values from three well replicates for each dilution. The assays were found to be sensitive, specific and reproducible with a wide dynamic range (1 × 10(9) to 10 copies) with coefficient of regression (R(2)) > 0.99, calculated average slope -3.196 for SYBR Green assay whereas, for TaqMan assay it was >0.99 and -3.367, respectively. The intra- and inter-assay variance of the Ct values ranged from 0.26% to 0.94% and 0.12% to 0.81%, respectively, for SYBR Green assay, and the inter-assay variance of the Ct values for TaqMan assay ranged from 0.07% to 1.93%. The specificity of the assays was proved by testing other DNA viruses of shrimp such as WSSV, IHHNV and MBV. Standardized assays were further tested to detect and quantify HPV in the post-larvae of P. monodon. The result was further compared with conventional PCR to test the reproducibility of the test. The assay was also used to screen Litopeneaus vannamei, Macrobrachium rosenbergii and Scylla serrata for HPV. Copyright © 2015 Elsevier Ltd. All rights reserved.

[Effect of tea extracts, catechin and caffeine against type-I allergic reaction].

PubMed

Shiozaki, T; Sugiyama, K; Nakazato, K; Takeo, T

1997-07-01

The antiallergic effects of green tea, oolong tea, and black tea extracts by hot water were examined. These extracts inhibited the passive cutaneous anaphylaxis (PCA) reaction of rat after oral administration. Three tea catechins, (--)-epigallocatechin (EGC), (--)-epicatechin gallate (ECg), and (--)-epigallocatechin gallate (EGCg) isolated from green tea showed stronger inhibitory effects than that of a green tea extract on the PCA reaction. The inhibitory effects of EGC and EGCg on the PCA reaction were greater than that of ECg. Caffeine also showed a inhibitory effect on the PCA reaction. These results indicate that tea could provide a significant protection against the type-I allergic reaction. These findings also suggest that tea catechins and caffeine play an important role in having an inhibitory effect on the type-I allergic reaction.

Study of cell-differentiation and assembly of photosynthetic proteins during greening of etiolated Zea mays leaves using confocal fluorescence microspectroscopy at liquid-nitrogen temperature.

PubMed

Shibata, Yutaka; Katoh, Wataru; Tahara, Yukari

2013-04-01

Fluorescence microspectroscopy observations were used to study the processes of cell differentiation and assemblies of photosynthesis proteins in Zea mays leaves under the greening process. The observations were done at 78K by setting the sample in a cryostat to avoid any undesired progress of the greening process during the measurements. The lateral and axial spatial resolutions of the system were 0.64μm and 4.4μm, respectively. The study revealed the spatial distributions of protochlorophyllide (PChld) in both the 632-nm-emitting and 655-nm-emitting forms within etiolated Zea mays leaves. The sizes of the fluorescence spots attributed to the former were larger than those of the latter, validating the assignment of the former and latter to the prothylakoid and prolamellar bodies, respectively. In vivo microspectroscopy observations of mature Zea mays leaves confirmed the different photosystem II (PS I)/photosystem I (PS II) ratio between the bundle sheath (BS) and mesophyll (MS) cells, which is specific for C4-plants. The BS cells in Zea mays leaves 1h after the initiation of the greening process tended to show fluorescence spectra at shorter wavelength side (at around 679nm) than the MS cells (at around 682nm). The 679-nm-emitting chlorophyll-a form observed mainly in the BS cells was attributed to putative precursor complexes to PS I. The BS cells under 3-h greening showed higher relative intensities of the PS I fluorescence band at around 735nm, suggesting the reduced PS II amount in the BS cells in this greening stage. Copyright © 2013 Elsevier B.V. All rights reserved.

iRENEX: a clinically informed decision support system for the interpretation of ⁹⁹mTc-MAG3 scans to detect renal obstruction.

PubMed

Garcia, Ernest V; Taylor, Andrew; Folks, Russell; Manatunga, Daya; Halkar, Raghuveer; Savir-Baruch, Bital; Dubovsky, Eva

2012-09-01

Decision support systems for imaging analysis and interpretation are rapidly being developed and will have an increasing impact on the practice of medicine. RENEX is a renal expert system to assist physicians evaluate suspected obstruction in patients undergoing mercaptoacetyltriglycine (MAG3) renography. RENEX uses quantitative parameters extracted from the dynamic renal scan data using QuantEM™II and heuristic rules in the form of a knowledge base gleaned from experts to determine if a kidney is obstructed; however, RENEX does not have access to and could not consider the clinical information available to diagnosticians interpreting these studies. We designed and implemented a methodology to incorporate clinical information into RENEX, implemented motion detection and evaluated this new comprehensive system (iRENEX) in a pilot group of 51 renal patients. To reach a conclusion as to whether a kidney is obstructed, 56 new clinical rules were added to the previously reported 60 rules used to interpret quantitative MAG3 parameters. All the clinical rules were implemented after iRENEX reached a conclusion on obstruction based on the quantitative MAG3 parameters, and the evidence of obstruction was then modified by the new clinical rules. iRENEX consisted of a library to translate parameter values to certainty factors, a knowledge base with 116 heuristic interpretation rules, a forward chaining inference engine to determine obstruction and a justification engine. A clinical database was developed containing patient histories and imaging report data obtained from the hospital information system associated with the pertinent MAG3 studies. The system was fine-tuned and tested using a pilot group of 51 patients (21 men, mean age 58.2 ± 17.1 years, 100 kidneys) deemed by an expert panel to have 61 unobstructed and 39 obstructed kidneys. iRENEX, using only quantitative MAG3 data agreed with the expert panel in 87 % (34/39) of obstructed and 90 % (55/61) of unobstructed kidneys. iRENEX, using both quantitative and clinical data agreed with the expert panel in 95 % (37/39) of obstructed and 92 % (56/61) of unobstructed kidneys. The clinical information significantly (p < 0.001) increased iRENEX certainty in detecting obstruction over using the quantitative data alone. Our renal expert system for detecting renal obstruction has been substantially expanded to incorporate the clinical information available to physicians as well as advanced quality control features and was shown to interpret renal studies in a pilot group at a standardized expert level. These encouraging results warrant a prospective study in a large population of patients with and without renal obstruction to establish the diagnostic performance of iRENEX.

Eifel maars: Quantitative shape characterization of juvenile ash particles (Eifel Volcanic Field, Germany)

NASA Astrophysics Data System (ADS)

Rausch, Juanita; Grobéty, Bernard; Vonlanthen, Pierre

2015-01-01

The Eifel region in western central Germany is the type locality for maar volcanism, which is classically interpreted to be the result of explosive eruptions due to shallow interaction between magma and external water (i.e. phreatomagmatic eruptions). Sedimentary structures, deposit features and particle morphology found in many maar deposits of the West Eifel Volcanic Field (WEVF), in contrast to deposits in the East Eifel Volcanic Field (EEVF), lack the diagnostic criteria of typical phreatomagmatic deposits. The aim of this study was to determine quantitatively the shape of WEVF and EEVF maar ash particles in order to infer the governing eruption style in Eifel maar volcanoes. The quantitative shape characterization was done by analyzing fractal dimensions of particle contours (125-250 μm sieve fraction) obtained from Scanning electron microscopy (SEM) and SEM micro-computed tomography (SEM micro-CT) images. The fractal analysis (dilation method) and the fractal spectrum technique confirmed that the WEVF and EEVF maar particles have contrasting multifractal shapes. Whereas the low small-scale dimensions of EEVF particles (Eppelsberg Green Unit) coincide with previously published values for phreatomagmatic particles, the WEVF particles (Meerfelder Maar, Pulvermaar and Ulmener Maar) have larger values indicating more complex small-scale features, which are characteristic for magmatic particles. These quantitative results are strengthening the qualitative microscopic observations, that the studied WEVF maar eruptions are rather dominated by magmatic processes. The different eruption styles in the two volcanic fields can be explained by the different geological and hydrological settings found in both regions and the different chemical compositions of the magmas.

Reactions of green lizards (Lacerta viridis) to major repellent compounds secreted by Graphosoma lineatum (Heteroptera: Pentatomidae).

PubMed

Gregorovičová, Martina; Černíková, Alena

2015-06-01

The chemical defence of Heteroptera is primarily based on repellent secretions which signal the potential toxicity of the bug to its predators. We tested the aversive reactions of green lizards (Lacerta viridis) towards the major compounds of the defensive secretion of Graphosoma lineatum, specifically: (i) a mixture of three aldehydes: (E)-hex-2-enal, (E)-oct-2-enal, (E)-dec-2-enal; (ii) a mixture of these three aldehydes and tridecane; (iii) oxoaldehyde: (E)-4-oxohex-2-enal; (iv) secretion extracted from metathoracic scent glands of G. lineatum adults and (v) hexane as a non-polar solvent. All chemicals were presented on a palatable food (Tenebrio molitor larvae). The aversive reactions of the green lizards towards the mealworms were evaluated by observing the approach latencies, attack latencies and approach-attack intervals. The green lizards exhibited a strong aversive reaction to the mixture of three aldehydes. Tridecane reduced the aversive reaction to the aldehyde mixture. Oxoaldehyde caused the weakest, but still significant, aversive reaction. The secretion from whole metathoracic scent glands also clearly had an aversive effect on the green lizards. Moreover, when a living specimen of G. lineatum or Pyrrhocoris apterus (another aposematic red-and-black prey) was presented to the green lizards before the trials with the aldehyde mixture, the aversive effect of the mixture was enhanced. In conclusion, the mixture of three aldehydes had the strong aversive effect and could signal the potential toxicity of G. lineatum to the green lizards. Copyright © 2015 Elsevier GmbH. All rights reserved.

VizieR Online Data Catalog: Lyα profile in 43 Green Pea galaxies (Yang+, 2017)

NASA Astrophysics Data System (ADS)

Yang, H.; Malhotra, S.; Gronke, M.; Rhoads, J. E.; Leitherer, C.; Wofford, A.; Jiang, T.; Dijkstra, M.; Tilvi, V.; Wang, J.

2018-03-01

In SDSS DR7, a sample of 251 Green Peas was observed as serendipitous spectroscopic targets (Cardamone+ 2009MNRAS.399.1191C). A subset of 66 Green Peas have sufficient signal-to-noise ratio (S/N) in both continuum and emission lines (Hα, Hβ, and [OIII]λ5007) to study galactic properties. In Paper I (Yang+ 2016ApJ...820..130Y), we matched these 66 Green Peas with the COS archive and studied Lyα escape in a sample of 12 Green Peas with COS UV spectra. To address the bias and expand the sample size, we took the Lyα spectra of 20 additional Green Peas (PI S. Malhotra, GO 14201). We also supplement this sample with 11 additional Green Peas from published literature. In total, we have 43 Green Peas from six HST programs -- 20 galaxies from GO 14201 (PI S. Malhotra), 9 galaxies from GO 12928 (PI A. Henry; Henry+ 2015ApJ...809...19H), 7 galaxies from GO 11727 and GO 13017 (PI T. Heckman; Heckman+ 2011ApJ...730....5H ; Alexandroff+ 2015ApJ...810..104A), 2 galaxies from GO 13293 (PI A. Jaskot; Jaskot & Oey 2014ApJ...791L..19J), and 5 galaxies from GO 13744 (PI T. Thuan; Izotov+ 2016MNRAS.461.3683I). (4 data files).

Cradle-to-Gate Life-Cycle Inventory of Cellulosic Fiberboard Produced in North America

Treesearch

Richard D. Bergman

2015-01-01

Documenting the environmental performance of building products is becoming widespread because of many green marketing claims made without scientific merit (i.e., green-washing). Developing environmental product declarations (EPDs) for building products is one way to accomplish this objective for scientific documentation and to counter green-washing (ISO 2006a; Bergman...

77 FR 22599 - Department of Housing and Urban Development Summary of Public Comments, Response to Public...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-04-16

... build or rehabilitate to a recognized green building rating standard (see section I.B.2. of HUD's Fiscal... progress and requests funding to support energy efficiency and green building initiatives which will allow.... Response: HUD values energy efficiency and is committed to efficient, green, and healthy homes. Subgoal 4B...

Marginal iodide deficiency and thyroid function: dose-response analysis for quantitative pharmacokinetic modeling.

PubMed

Gilbert, M E; McLanahan, E D; Hedge, J; Crofton, K M; Fisher, J W; Valentín-Blasini, L; Blount, B C

2011-04-28

Severe iodine deficiency (ID) results in adverse health outcomes and remains a benchmark for understanding the effects of developmental hypothyroidism. The implications of marginal ID, however, remain less well known. The current study examined the relationship between graded levels of ID in rats and serum thyroid hormones, thyroid iodine content, and urinary iodide excretion. The goals of this study were to provide parametric and dose-response information for development of a quantitative model of the thyroid axis. Female Long Evans rats were fed casein-based diets containing varying iodine (I) concentrations for 8 weeks. Diets were created by adding 975, 200, 125, 25, or 0 μg/kg I to the base diet (~25 μg I/kg chow) to produce 5 nominal I levels, ranging from excess (basal+added I, Treatment 1: 1000 μg I/kg chow) to deficient (Treatment 5: 25 μg I/kg chow). Food intake and body weight were monitored throughout and on 2 consecutive days each week over the 8-week exposure period, animals were placed in metabolism cages to capture urine. Food, water intake, and body weight gain did not differ among treatment groups. Serum T4 was dose-dependently reduced relative to Treatment 1 with significant declines (19 and 48%) at the two lowest I groups, and no significant changes in serum T3 or TSH were detected. Increases in thyroid weight and decreases in thyroidal and urinary iodide content were observed as a function of decreasing I in the diet. Data were compared with predictions from a recently published biologically based dose-response (BBDR) model for ID. Relative to model predictions, female Long Evans rats under the conditions of this study appeared more resilient to low I intake. These results challenge existing models and provide essential information for development of quantitative BBDR models for ID during pregnancy and lactation. Published by Elsevier Ireland Ltd.

Studies toward understanding the SAR around the sulfoximine moiety of the sap-feeding insecticide sulfoxaflor.

PubMed

Buysse, Ann M; Nugent, Benjamin M; Wang, Nick X; Benko, Zoltan; Breaux, Nneka; Rogers, Richard; Zhu, Yuanming

2017-04-01

The discovery of sulfoxaflor (Isoclast™ active) stemmed from a novel scaffold-based approach toward identifying bioactive molecules. It exhibits broad-spectrum control of many sap-feeding insect pests, including aphids, whiteflies, hoppers and Lygus. Systematic modifications of the substituents flanking each side of the sulfoximine moiety were carried out to determine whether these changes would improve potency. Structure-activity relationship (SAR) studies showed that, with respect to the methylene linker, both mono- and disubstitution with alkyl groups of varying sizes as well as cyclic analogs exhibited excellent control of cotton aphids. However, against green peach aphids a decrease in activity was observed with substituents larger than ethyl as well as larger cycloalkyl groups. At the terminal tail there appeared to be a narrow steric tolerance as well, with linear groups or small rings more active against green peach aphids than bulkier groups. A novel series of compounds exploring the substituents flanking the sulfoximine moiety of sulfoxaflor were prepared and tested for bioactivity against cotton aphids and green peach aphids. SAR studies indicated that a decrease in green peach aphid potency was observed at the methylene linker as well as at the terminal tail with bulkier substituents. A quantitative structure-activity relationship analysis of the compounds revealed significant correlation of activity with two molecular descriptors, vol (volume of a molecule) and GCUT_SMR_3 (molar refractivity). This predictive model helps to explain the observed activity with the various substituents. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Sonoelastography of Plantar Fascia: Reproducibility and Pattern Description in Healthy Subjects and Symptomatic Subjects.

PubMed

Ríos-Díaz, José; Martínez-Payá, Jacinto J; del Baño-Aledo, María Elena; de Groot-Ferrando, Ana; Botía-Castillo, Paloma; Fernández-Rodríguez, David

2015-10-01

The purpose of the work reported here was to describe the sonoelastographic appearance of the plantar fascia of healthy volunteers and patients with fasciitis. Twenty-three healthy subjects and 21 patients with plantar fasciitis were examined using B-mode and real-time sonoelastography (RTSR) scanning. B-Mode examination included fascia thickness and echotexture. Echogenicity and echovariation of the color histogram were analyzed. Fasciae were classified into type 1, blue (more elastic); type 2, blue/green (intermediate); or type 3, green (less elastic). RTSE revealed 72.7% of fasciae as type 2, with no significant association with fasciitis (χ(2) = 3.6, df = 2, p = 0.17). Quantitative analysis of the color histogram revealed a significantly greater intensity of green (mean = 77.8, 95% confidence interval [CI] = 71.9-83.6) and blue (mean = 74.2, 95% CI = 69.7-78.8) in healthy subjects. Echovariation of the color red was 33.4% higher in the fasciitis group than in the healthy group (95% CI = 16.7-50.1). Sonoelastography with quantitative analysis of echovariation can be a useful tool for evaluation of plantar fascia pathology. Copyright © 2015 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

Renilla luciferase-based quantitation of Potato virus A infection initiated with Agrobacterium infiltration of N. benthamiana leaves.

PubMed

Eskelin, K; Suntio, T; Hyvärinen, S; Hafren, A; Mäkinen, K

2010-03-01

A quantitation method based on the sensitive detection of Renilla luciferase (Rluc) activity was developed and optimized for Potato virus A (PVA; genus Potyviridae) gene expression. This system is based on infections initiated by Agrobacterium infiltration and subsequent detection of the translation of PVA::Rluc RNA, which is enhanced by viral replication, first within the cells infected initially and later by translation and replication within new cells after spread of the virus. Firefly luciferase (Fluc) was used as an internal control to normalize the Rluc activity. An approximately 10-fold difference in the Rluc/Fluc activity ratio between a movement-deficient and a replication-deficient mutant was observed starting from 48h post Agrobacterium infiltration (h.p.i.). The Rluc activity derived from wild type (wt) PVA increased significantly between 48 and 72h.p.i. and the Rluc/Fluc activity deviated clearly from that of the mutant viruses. Quantitation of the Rluc and Fluc mRNAs by semi-quantitative RT-PCR indicated that increases and decreases in the Renillareniformis luciferase (rluc) mRNA levels coincided with changes in Rluc activity. However, a subtle increase in the mRNA level led to pronounced changes in Rluc activity. PVA CP accumulation was quantitated by enzyme-linked immunosorbent assay. The increase in Rluc activity correlated closely with virus accumulation. Copyright (c) 2009 Elsevier B.V. All rights reserved.

A taxonomy of green supply chain management capability among electronics-related manufacturing firms in Taiwan.

PubMed

Shang, Kuo-Chung; Lu, Chin-Shan; Li, Shaorui

2010-05-01

This study investigated crucial green supply chain management (GSCM) capability dimensions and firm performance based on electronics-related manufacturing firms in Taiwan. On the basis of a factor analysis, six green supply chain management dimensions were identified: green manufacturing and packaging, environmental participation, green marketing, green suppliers, green stock, and green eco-design. According to their factor scores in the GSCM dimensions, a cluster analysis subsequently assigned responding firms into four groups, namely, the weak GSCM oriented group, the green marketing oriented group, the green supplier oriented group, and the green stock oriented group. Differences in firm performance and GSCM dimensions among groups were examined. Results indicated that the green marketing oriented group performed best. Based on the resource-based view (RBV), the capability of the green marketing oriented group was considered to be the deployment of a collection of resources that enables it to successfully compete against rivals. The importance of green marketing as a GSCM capability and strategic asset/critical resources for electronics-related manufacturing firms to obtain a competitive edge is therefore highlighted in this study. Copyright 2010 Elsevier Ltd. All rights reserved.

PLACE-BASED GREEN BUILDING: INTEGRATING LOCAL ENVIRONMENTAL AND PLANNING ANALYSIS INTO GREEN BUILDING GUIDELINES

EPA Science Inventory

This project will develop a model for place-based green building guidelines based on an analysis of local environmental, social, and land use conditions. The ultimate goal of this project is to develop a methodology and model for placing green buildings within their local cont...

The role of an ancestral hyperpolarization-activated cyclic nucleotide-gated K+ channel in branchial acid-base regulation in the green crab, Carcinus maenas.

PubMed

Fehsenfeld, Sandra; Weihrauch, Dirk

2016-03-01

Numerous electrophysiological studies on branchial K(+) transport in brachyuran crabs have established an important role for potassium channels in osmoregulatory ion uptake and ammonia excretion in the gill epithelium of decapod crustaceans. However, hardly anything is known of the actual nature of these channels in crustaceans. In the present study, the identification of a hyperpolarization-activated cyclic nucleotide-gated potassium channel (HCN) in the transcriptome of the green crab Carcinus maenas and subsequent performance of quantitative real-time PCR revealed the ubiquitous expression of this channel in this species. Even though mRNA expression levels in the cerebral ganglion were found to be approximately 10 times higher compared with all other tissues, posterior gills still expressed significant levels of HCN, indicating an important role for this transporter in branchial ion regulation. The relatively unspecific K(+)-channel inhibitor Ba(2+), as well as the HCN-specific blocker ZD7288, as applied in gill perfusion experiments and electrophysiological studies employing the split gill lamellae revealed the presence of at least two different K(+)/NH4(+)-transporting structures in the branchial epithelium of C. maenas. Furthermore, HCN mRNA levels in posterior gill 7 decreased significantly in response to the respiratory or metabolic acidosis that was induced by acclimation of green crabs to high environmental PCO2 and ammonia, respectively. Consequently, the present study provides first evidence that HCN-promoted NH4(+) epithelial transport is involved in both branchial acid-base and ammonia regulation in an invertebrate. © 2016. Published by The Company of Biologists Ltd.

Puffed cereals with added chamomile - quantitative analysis of polyphenols and optimization of their extraction method.

PubMed

Blicharski, Tomasz; Oniszczuk, Anna; Olech, Marta; Oniszczuk, Tomasz; Wójtowicz, Agnieszka; Krawczyk, Wojciech; Nowak, Renata

2017-05-11

[b]Abstract Introduction[/b]. Functional food plays an important role in the prevention, management and treatment of chronic diseases. One of the most interesting techniques of functional food production is extrusion-cooking. Functional foods may include such items as puffed cereals, breads and beverages that are fortified with vitamins, some nutraceuticals and herbs. Due to its pharmacological activity, chamomile flowers are the most popular components added to functional food. Quantitative analysis of polyphenolic antioxidants, as well as comparison of various methods for the extraction of phenolic compounds from corn puffed cereals, puffed cereals with an addition of chamomile (3, 5, 10 and 20%) and from [i]Chamomillae anthodium. [/i] [b]Materials and Methods[/b]. Two modern extraction methods - ultrasound assisted extraction (UAE) at 40 °C and 60 °C, as well as accelerated solvent extraction (ASE) at 100 °C and 120 °C were used for the isolation of polyphenols from functional food. Analysis of flavonoids and phenolic acids was carried out using reversed-phase high-performance liquid chromatography and electrospray ionization mass spectrometry (LC-ESI-MS/MS). [b]Results and Conclusions[/b]. For most of the analyzed compounds, the highest yields were obtained by ultrasound assisted extraction. The highest temperature during the ultrasonification process (60 °C) increased the efficiency of extraction, without degradation of polyphenols. UAE easily arrives at extraction equilibrium and therefore permits shorter periods of time, reducing the energy input. Furthermore, UAE meets the requirements of 'Green Chemistry'.

Comparative evaluation of border molding, using two different techniques in maxillary edentulous arches - An in vivo study

PubMed Central

Yarapatineni, Rameshbabu; Vilekar, Abhishek; Kumar, J Phani; Kumar, G Ajay; Aravind, Prasad; Kumar, P Anil

2013-01-01

Background: This study was undertaken to compare the retention between sectional border molding using low fusing greenstick compound and single step border molding using condensation silicone (putty) impression material in three stages- A. Immediately following border molding, B. After final impression and C. With the finished permanent denture base. Materials & Methods: In this study evaluation of retentive values of sectional border molding (Group I) (custom impression trays border molded with green stick compound ) and single step border molding (Group II) ( border molding with condensation silicone (putty) impression material ). In both techniques definitive wash impression were made with light body condensation silicone and permanent denture base with heat cure polymerization resin. Results: Group II was significantly higher (mean=8011.43) than Group I (mean=5777.43) in test-A. The t-value (1.5883) infers that there was significant difference between Group I and Group II (p =0.15). Group I was significantly higher (mean=6718.57) than Group II (mean=5224.29) in test -B. The t-value (1.6909) infers that there was significant difference between Group I and Group II (p=0.17). Group II was higher (mean=4025.14) than Group I (mean=3835.07) in test -C. The t-value was 0.1239. But it was found to be statistically insignificant (p=0.005). Conclusion: Within the limitation of this clinical study border molding custom tray with low fusing green stick compound provided similar retention as compared to custom impression tray with condensation silicone in permanent denture base. How to cite this article: Yarapatineni R, Vilekar A, Kumar JP, Kumar GA, Aravind P, Kumar PA. Comparative evaluation of border molding, using two different techniques in maxillary edentulous arches - An in vivo study. J Int Oral Health 2013; 5(6):82-7 . PMID:24453450

Assessing the Associations Between Types of Green Space, Physical Activity, and Health Indicators Using GIS and Participatory Survey

NASA Astrophysics Data System (ADS)

Akpinar, A.

2017-11-01

This study explores whether specific types of green spaces (i.e. urban green spaces, forests, agricultural lands, rangelands, and wetlands) are associated with physical activity, quality of life, and cardiovascular disease prevalence. A sample of 8,976 respondents from the Behavioral Risk Factor Surveillance System, conducted in 2006 in Washington State across 291 zip-codes, was analyzed. Measures included physical activity status, quality of life, and cardiovascular disease prevalence (i.e. heart attack, angina, and stroke). Percentage of green spaces was derived from the National Land Cover Dataset and measured with Geographical Information System. Multilevel regression analyses were conducted to analyze the data while controlling for age, sex, race, weight, marital status, occupation, income, education level, and zip-code population and socio-economic situation. Regression results reveal that no green space types were associated with physical activity, quality of life, and cardiovascular disease prevalence. On the other hand, the analysis shows that physical activity was associated with general health, quality of life, and cardiovascular disease prevalence. The findings suggest that other factors such as size, structure and distribution (sprawled or concentrated, large or small), quality, and characteristics of green space might be important in general health, quality of life, and cardiovascular disease prevalence rather than green space types. Therefore, further investigations are needed.

Green-Solvent-Processable, Dopant-Free Hole-Transporting Materials for Robust and Efficient Perovskite Solar Cells.

PubMed

Lee, Junwoo; Malekshahi Byranvand, Mahdi; Kang, Gyeongho; Son, Sung Y; Song, Seulki; Kim, Guan-Woo; Park, Taiho

2017-09-06

In addition to having proper energy levels and high hole mobility (μ h ) without the use of dopants, hole-transporting materials (HTMs) used in n-i-p-type perovskite solar cells (PSCs) should be processed using green solvents to enable environmentally friendly device fabrication. Although many HTMs have been assessed, due to the limited solubility of HTMs in green solvents, no green-solvent-processable HTM has been reported to date. Here, we report on a green-solvent-processable HTM, an asymmetric D-A polymer (asy-PBTBDT) that exhibits superior solubility even in the green solvent, 2-methylanisole, which is a known food additive. The new HTM is well matched with perovskites in terms of energy levels and attains a high μ h (1.13 × 10 -3 cm 2 /(V s)) even without the use of dopants. Using the HTM, we produced robust PSCs with 18.3% efficiency (91% retention after 30 days without encapsulation under 50%-75% relative humidity) without dopants; with dopants (bis(trifluoromethanesulfonyl) imide and tert-butylpyridine, a 20.0% efficiency was achieved. Therefore, it is a first report for a green-solvent-processable hole-transporting polymer, exhibiting the highest efficiencies reported so far for n-i-p devices with and without the dopants.

Alt-Energy Grand Prix Inspires an "I Can" Attitude

ERIC Educational Resources Information Center

Tessmer, Al; Trzeciak, Mark

2010-01-01

This article describes how a team comprised largely of high school students builds and races an E85-fueled car and takes first place at the Bowling Green (Ohio) State University (BGSU) Grand Prix. Free and open to the public, the event features student drivers and crews, racing go-karts powered by renewable, ethanol-based E85 fuel. The track is a…

Aerobic Alcohol Oxidation Using a Copper(I)/TEMPO Catalyst System: A Green, Catalytic Oxidation Reaction for the Undergraduate Organic Chemistry Laboratory

ERIC Educational Resources Information Center

Hill, Nicholas J.; Hoover, Jessica M.; Stahl, Shannon S.

2013-01-01

Modern undergraduate organic chemistry textbooks provide detailed discussion of stoichiometric Cr- and Mn-based reagents for the oxidation of alcohols, yet the use of such oxidants in instructional and research laboratories, as well as industrial chemistry, is increasingly avoided. This work describes a laboratory exercise that uses ambient air as…

Establishment of an indicator cell line to quantify bovine foamy virus infection.

PubMed

Ma, Zhe; Hao, Peng; Yao, Xue; Liu, Chang; Tan, Juan; Liu, Li; Yang, Rongge; Geng, Yunqi; Chen, Qimin; Qiao, Wentao

2008-08-01

A cell line derived from baby hamster kidney (BHK-21) cells was transfected with the enhanced green fluorescent protein gene driven by the bovine foamy virus (BFV) long terminal repeat (LTR) to establish a BFV indicator cell line (BICL). Among 48 clones, one clone was chosen for its little constitutive enhanced green fluorescent protein (EGFP) expression and high level of EGFP expression after activation by BFV infection. By detecting the EGFP expression of the BFV indicator cell line, the titers of BFV were quantified by the end point method. As a result, the titer determined by the EGFP based assay 5-6 days post infection (d.p.i.) was 100 fold higher than traditional assays measuring cytopathic effects 8-9 d.p.i.. Moreover, the EGFP based assay was also used to determine the titer of those cells infected by BFV without inducing cytopathic effects. Using this simple and rapid assay, we examined the in vitro host range of BFV. It was found that BFV can productively infect various cell lines derived from bovine, human, rat and monkey. (c) 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Green exercise as a workplace intervention to reduce job stress. Results from a pilot study.

PubMed

Calogiuri, Giovanna; Evensen, Katinka; Weydahl, Andi; Andersson, Kim; Patil, Grete; Ihlebæk, Camilla; Raanaas, Ruth K

2015-01-01

Stress and mental fatigue are major health threats to employees in office-based occupations. Physical activity is widely used as a stress-management intervention for employees. Moreover, experiences in contact with nature have been shown to provide stress-reduction and restoration from mental fatigue. In a pilot study designed as a randomized controlled trial we investigated the impact of a green-exercise intervention on psychological and physiological indicators of stress in municipality employees. Fourteen employees (7 females and 7 males, 49±8 yrs) volunteered in an exercise-based intervention in workplace either outdoors in a green/nature area or in an indoor exercise-setting. The intervention consisted of an information meeting and two exercise sessions, each including a biking bout and a circuit-strength sequence using elastic rubber bands (45-minutes, at about 55% of HR reserve, overall). Main outcomes were perceived environmental potential for restoration, affective state, blood pressure (BP) and cortisol awakening response (CAR AUC(G) and CAR AUC(I)) and cortisol levels in serum. Measurements were taken at baseline and in concomitance with the exercise sessions. Furthermore, affective state and self-reported physical activity levels were measured over a 10-weeks follow-up period. Compared with the indoor group, the nature group reported higher environmental potential for restoration (p <  0.001) and Positive Affect (p <  0.01), along with improved CAR AUC(I) (p = 0.04) and, marginally, diastolic BP (p = 0.05). The nature group also reported higher ratings of Positive Affect at follow-up (p = 0.02). Differences at post-exercise were not found for any of the other components of affective state, systolic BP, CAR AUC(G) and cortisol levels measured in serum. Green-exercise at the workplace could be a profitable way to manage stress and induce restoration among employees. Further studies on larger samples are needed in order to improve the generalizability of the results.

Laser-Induced Fluorescence in Gaseous [I[subscript]2] Excited with a Green Laser Pointer

ERIC Educational Resources Information Center

Tellinghuisen, Joel

2007-01-01

A green laser pointer could be used in a flashy demonstration of laser-induced fluorescence in the gas phase by directing the beam of the laser through a cell containing [I[subscript]2] at its room temperature vapor pressure. The experiment could be used to provide valuable insight into the requirements for laser-induced fluorescence (LIF) and the…

Stool Color: When to Worry

MedlinePlus

Stool color: When to worry Yesterday, my stool color was bright green. Should I be concerned? Answers from Michael ... M.D. Stool comes in a range of colors. All shades of brown and even green are ...

pc8.1, a major QTL for pigment content in pepper fruit, is associated with variation in plastid compartment size.

PubMed

Brand, Arnon; Borovsky, Yelena; Meir, Sagit; Rogachev, Ilana; Aharoni, Asaph; Paran, Ilan

2012-03-01

Studies on the genetic control of pigment content in pepper fruit have focused mainly on monogenic mutations leading to changes in fruit color. In addition to the qualitative variation in fruit color, quantitative variation in pigment content and color intensity exists in pepper giving rise to a range of color intensities. However, the genetic basis for this variation is poorly understood, hindering the development of peppers that are rich in these beneficial compounds. In this paper, quantitative variation in pigment content was studied in a cross between a dark-green Capsicum annuum pepper and a light-green C. chinense pepper. Two major pigment content QTLs that control chlorophyll content were identified, pc8.1 and pc10.1. The major QTL pc8.1, also affected carotenoid content in the ripe fruit. However, additional analyses in subsequent generations did not reveal a consistent effect of this QTL on carotenoid content in ripe fruit. Confocal microscopy analyses of green immature fruits of the parents and of near-isogenic lines for pc8.1 indicated that the QTL exerts its effect via increasing chloroplast compartment size in the dark-green genotypes, predominantly in a fruit-specific manner. Metabolic analyses indicated that in addition to chlorophyll, chloroplast-associated tocopherols and carotenoids are also elevated. Future identification of the genes controlling pigment content QTLs in pepper will provide a better understanding of this important trait and new opportunities for breeding peppers and other Solanaceae species with enhanced nutritional value.

Green light emitting curcumin dye in organic solvents

NASA Astrophysics Data System (ADS)

Mubeen, Mohammad; Deshmukh, Abhay D.; Dhoble, S. J.

2018-05-01

In this modern world, the demand for the white light emission has increased because of its wide applications in various display and lighting devices, sensors etc. This white light can be produced by mixing red, green and blue lights. Thus this green light can be produced from the plant extract i.e., Turmeric. Curcumin is the essential element present in turmeric to generate the green light. The Photoluminescence (PL) emission is observed at 540 nm at 380nm excitation. This method of generating green light is very simple, cost effective and efficient when compared to other methods.

Prevalence of sulfonamide and tetracycline resistance genes in drinking water treatment plants in the Yangtze River Delta, China.

PubMed

Guo, Xueping; Li, Jing; Yang, Fan; Yang, Jie; Yin, Daqiang

2014-09-15

The occurrence and distribution of antibiotic resistance genes (ARGs) in drinking water treatment plants (DWTPs) and finished water are not well understood, and even less is known about the contribution of each treatment process to resistance gene reduction. The prevalence of ten commonly detected sulfonamide and tetracycline resistance genes, namely, sul I, sul II, tet(C), tet(G), tet(X), tet(A), tet(B), tet(O), tet(M) and tet(W) as well as 16S-rRNA genes, were surveyed in seven DWTPs in the Yangtze River Delta, China, with SYBR Green I-based real-time quantitative polymerase chain reaction. All of the investigated ARGs were detected in the source waters of the seven DWTPs, and sul I, sul II, tet(C) and tet(G) were the four most abundant ARGs. Total concentrations of ARGs belonging to either the sulfonamide or tetracycline resistance gene class were above 10(5) copies/mL. The effects of a treatment process on ARG removal varied depending on the overall treatment scheme of the DWTP. With combinations of the treatment procedures, however, the copy numbers of resistance genes were reduced effectively, but the proportions of ARGs to bacteria numbers increased in several cases. Among the treatment processes, the biological treatment tanks might serve as reservoirs of ARGs. ARGs were found in finished water of two plants, imposing a potential risk to human health. The results presented in this study not only provide information for the management of antibiotics and ARGs but also facilitate improvement of drinking water quality. Copyright © 2014 Elsevier B.V. All rights reserved.

Temporal Dynamics and Decay of Putatively Allochthonous and Autochthonous Viral Genotypes in Contrasting Freshwater Lakes

PubMed Central

Barbosa, Jorge G.; Brown, Julia M.; Donelan, Ryan P.; Eaglesham, James B.; Eggleston, Erin M.; LaBarre, Brenna A.

2012-01-01

Aquatic viruses play important roles in the biogeochemistry and ecology of lacustrine ecosystems; however, their composition, dynamics, and interactions with viruses of terrestrial origin are less extensively studied. We used a viral shotgun metagenomic approach to elucidate candidate autochthonous (i.e., produced within the lake) and allochthonous (i.e., washed in from other habitats) viral genotypes for a comparative study of their dynamics in lake waters. Based on shotgun metagenomes prepared from catchment soil and freshwater samples from two contrasting lakes (Cayuga Lake and Fayetteville Green Lake), we selected two putatively autochthonous viral genotypes (phycodnaviruses likely infecting algae and cyanomyoviruses likely infecting picocyanobacteria) and two putatively allochthonous viral genotypes (geminiviruses likely infecting terrestrial plants and circoviruses infecting unknown hosts but common in soil libraries) for analysis by genotype-specific quantitative PCR (TaqMan) applied to DNAs from viruses in the viral size fraction of lake plankton, i.e., 0.2 μm > virus > 0.02 μm. The abundance of autochthonous genotypes largely reflected expected host abundance, while the abundance of allochthonous genotypes corresponded with rainfall and storm events in the respective catchments, suggesting that viruses with these genotypes may have been transported to the lake in runoff. The decay rates of allochthonous and autochthonous genotypes, assessed in incubations where all potential hosts were killed, were generally lower (0.13 to 1.50% h−1) than those reported for marine virioplankton but similar to those for freshwater virioplankton. Both allochthonous and autochthonous viral genotypes were detected at higher concentrations in subsurface sediments than at the water-sediment interface. Our data indicate that putatively allochthonous viruses are present in lake plankton and sediments, where their temporal dynamics reflect active transport to the lake during hydrological events and then decay once there. PMID:22773646

Green technology as a strategy in managing the black spots in Siak Highway, Indonesia

NASA Astrophysics Data System (ADS)

Sandhyavitri, A.; Wira, J.; Martin, A.

2018-04-01

It was identified that the total traffic accidents in the highway section of Siak, Indonesia within the period of 2011 to 2015 were 1,208 events (2 accidents per 3 days). This accidents figure were considered relatively high and it need to mitigate. The aim of this research are to; (i) analyze the location of Black Spot in the Siak highway, and (ii) drawn a strategy reducing the traffic accidents based on green technology. This study identified that the black spot area was located in the STA 44 + 050 (with a value of the weighted index was 86 and an accident severity rate was 6.21), these values were relatively high. The road horizontal alignment condition at this location was highlighted as a sub-standard high way, consists of low visibility, numerous turning pads, minimum road signs, and minimum road shoulders width. The technical strategy was then drawn as follow; conducting regular road rehabilitation and maintenance, equipping road markings and the street lights as well as road safety facilities based on the green technology such as solar cell traffic lights, solar cell street lights and deploying police statues in reducing traffic accidents within the black spot areas.

An RGB colour image steganography scheme using overlapping block-based pixel-value differencing

PubMed Central

Pal, Arup Kumar

2017-01-01

This paper presents a steganographic scheme based on the RGB colour cover image. The secret message bits are embedded into each colour pixel sequentially by the pixel-value differencing (PVD) technique. PVD basically works on two consecutive non-overlapping components; as a result, the straightforward conventional PVD technique is not applicable to embed the secret message bits into a colour pixel, since a colour pixel consists of three colour components, i.e. red, green and blue. Hence, in the proposed scheme, initially the three colour components are represented into two overlapping blocks like the combination of red and green colour components, while another one is the combination of green and blue colour components, respectively. Later, the PVD technique is employed on each block independently to embed the secret data. The two overlapping blocks are readjusted to attain the modified three colour components. The notion of overlapping blocks has improved the embedding capacity of the cover image. The scheme has been tested on a set of colour images and satisfactory results have been achieved in terms of embedding capacity and upholding the acceptable visual quality of the stego-image. PMID:28484623

Green roof valuation: a probabilistic economic analysis of environmental benefits.

PubMed

Clark, Corrie; Adriaens, Peter; Talbot, F Brian

2008-03-15

Green (vegetated) roofs have gained global acceptance as a technologythat has the potential to help mitigate the multifaceted, complex environmental problems of urban centers. While policies that encourage green roofs exist atthe local and regional level, installation costs remain at a premium and deter investment in this technology. The objective of this paper is to quantitatively integrate the range of stormwater, energy, and air pollution benefits of green roofs into an economic model that captures the building-specific scale. Currently, green roofs are primarily valued on increased roof longevity, reduced stormwater runoff, and decreased building energy consumption. Proper valuation of these benefits can reduce the present value of a green roof if investors look beyond the upfront capital costs. Net present value (NPV) analysis comparing a conventional roof system to an extensive green roof system demonstrates that at the end of the green roof lifetime the NPV for the green roof is between 20.3 and 25.2% less than the NPV for the conventional roof over 40 years. The additional upfront investment is recovered at the time when a conventional roof would be replaced. Increasing evidence suggests that green roofs may play a significant role in urban air quality improvement For example, uptake of N0x is estimated to range from $1683 to $6383 per metric ton of NOx reduction. These benefits were included in this study, and results translate to an annual benefit of $895-3392 for a 2000 square meter vegetated roof. Improved air quality leads to a mean NPV for the green roof that is 24.5-40.2% less than the mean conventional roof NPV. Through innovative policies, the inclusion of air pollution mitigation and the reduction of municipal stormwater infrastructure costs in economic valuation of environmental benefits of green roofs can reduce the cost gap that currently hinders U.S. investment in green roof technology.

The Impact of New State Accountability Standards on Algebra I Students

ERIC Educational Resources Information Center

Heath, Kyle G.

2013-01-01

The purpose of this quasi-experimental quantitative study was to determine if a new Algebra I curriculum resulted in improved student performance on the state Algebra I exam. The treatment group consisted of 383 9th grade Algebra I students who received the college-ready standards-based (CRSB) curricula. The control group consisted of 338 9th…

Potassium titanyl phosphate laser tissue ablation: development and experimental validation of a new numerical model.

PubMed

Elkhalil, Hossam; Akkin, Taner; Pearce, John; Bischof, John

2012-10-01

The photoselective vaporization of prostate (PVP) green light (532 nm) laser is increasingly being used as an alternative to the transurethral resection of prostate (TURP) for treatment of benign prostatic hyperplasia (BPH) in older patients and those who are poor surgical candidates. In order to achieve the goals of increased tissue removal volume (i.e., "ablation" in the engineering sense) and reduced collateral thermal damage during the PVP green light treatment, a two dimensional computational model for laser tissue ablation based on available parameters in the literature has been developed and compared to experiments. The model is based on the control volume finite difference and the enthalpy method with a mechanistically defined energy necessary to ablate (i.e., physically remove) a volume of tissue (i.e., energy of ablation E(ab)). The model was able to capture the general trends experimentally observed in terms of ablation and coagulation areas, their ratio (therapeutic index (TI)), and the ablation rate (AR) (mm(3)/s). The model and experiment were in good agreement at a smaller working distance (WD) (distance from the tissue in mm) and a larger scanning speed (SS) (laser scan speed in mm/s). However, the model and experiment deviated somewhat with a larger WD and a smaller SS; this is most likely due to optical shielding and heat diffusion in the laser scanning direction, which are neglected in the model. This model is a useful first step in the mechanistic prediction of PVP based BPH laser tissue ablation. Future modeling efforts should focus on optical shielding, heat diffusion in the laser scanning direction (i.e., including 3D effects), convective heat losses at the tissue boundary, and the dynamic optical, thermal, and coagulation properties of BPH tissue.

Optimization of the isolation and quantitation of kahweol and cafestol in green coffee oil.

PubMed

Chartier, Agnes; Beaumesnil, Mathieu; de Oliveira, Alessandra Lopes; Elfakir, Claire; Bostyn, Stephane

2013-12-15

Kahweol and cafestol are two diterpenes that exist mainly as esters of fatty acids in green coffee oil. To recover them under their free form they have to be either saponified or trans-esterified. These two compounds are well known to be sensitive to heat, and reagents, therefore experimental conditions used in the transesterification reaction are critical. In this paper, a Doehlert experimental design plan is used to optimize the transesterification conditions using some key variables such as the temperature of the reaction, the reagent base concentration and the duration of the reaction. Therefore, the optimal parameters determined from the Doehlert design are equal to 70 °C, temperature of the reaction; 1.25 mol L(-1) concentration of the reagent base; and 60 min reaction time. The contour plots show that the extracted quantity of kahweol and cafestol can depend greatly from the experimental conditions. After transesterification, the free form of the diterpernes is extracted from the lipid fraction using liquid-liquid extraction and analyzed using GC-FID without prior derivatization. The amount of kahweol and cafestol obtained from green coffee oil obtained by cold mechanical press of Catuai coffee bean is equal to 33.2±2.2 and 24.3±2.4 g kg(-1)oil, respectively. In an attempt to streamline the process, the transesterification reaction is performed in an in-flow chemistry reactor using the optimal conditions obtained with the Doehlert experimental design. The amount of kahweol and cafestol obtained from the same green coffee oil is equal to 43.5 and 30.072 g kg(-1)oil, respectively. Results are slightly higher compared to the ones obtained with the batch procedure. This can be explained by a better mixing of the coffee oil with the reagents and a faster transesterification reaction. © 2013 Elsevier B.V. All rights reserved.

Review of Strategies for Thermal Efficiency in Landscape Planning of Cities for Conservation of Energy and Enhanced Climatic Resilience to Urban Warming

NASA Astrophysics Data System (ADS)

Imam, Aabshar U. K.; Banerjee, Uttam Kumar

2017-09-01

Thermal discomfort, increased energy consumption, and heat related stress are some of the most prominent consequences of urban warming. Instances of heat related deaths have been reported; the elderly and the poor remain especially vulnerable. Urban greening has often been cited as an economically efficient method for inducing ambient cooling. Consequently, increased impetus is given to provision of public green spaces. However, a general increase in urban green cover especially in the form of parks and green spaces may be inadequate to achieve desired results. This article serves to highlight the thermal heterogeneity of landcape elements and stresses on the need for strategic shade provision. The originality of this study lies in the fact that it provides a comparative review of energy conservation potential of public and private green spaces. It is found that large parks may not have substantial cooling effect on the indoor built environment. Moreover, people tend to spend more time indoors than outdoors. Thus the need for greening of private areas has become an undeniable climatic necessity. The potential of shade trees, green walls, and roof gardens for cooling of built environment are discussed with quantitative evidences of their thermal and economic benefits. Parameters incurring cost expenditure and weaknesses of the greening strategies are enumerated for enabling prudent selection/implementation of strategies. Proposals are generated to improve climatic resilience to urban warming and for diligent planning of cities.

Characterization of skin tissue soldering using diode laser and indocyanine green: in vitro studies.

PubMed

Khosroshahi, M E; Nourbakhsh, M S; Saremi, S; Tabatabaee, F

2010-03-01

Laser tissue soldering based on protein as biological glues and other compounds can provide greater bond strength and less collateral damage. Endogenous and exogenous materials such as indocyanine green (ICG) are often added to solders to enhance light absorption. The purpose of this in vitro study was to examine the impact of different parameters of laser soldering on the thermo-physical properties of the skin. A mixture of albumin solder and ICG was prepared, and then the coated samples were irradiated by an 810 nm diode laser under different conditions. The temperature rise, number of scans (N(s)), and scan velocity (V(s)) were investigated in this study. The results showed that, at each laser irradiance (I), the tensile strength (sigma) of incisions repaired in static mode was higher than in dynamic mode and that the sigma increased with both increasing N(s) and increasing I. It is therefore important to consider the trade off between scan velocity and surface temperature for achieving an optimum operating condition.

Peatlands and green frogs: A relationship regulated by acidity?

USGS Publications Warehouse

Mazerolle, M.J.

2005-01-01

The effects of site acidification on amphibian populations have been thoroughly addressed in the last decades. However, amphibians in naturally acidic environments, such as peatlands facing pressure from the peat mining industry, have received little attention. Through two field studies and an experiment, I assessed the use of bog habitats by the green frog (Rana clamitans melanota), a species sensitive to various forestry and peat mining disturbances. First, I compared the occurrence and breeding patterns of frogs in bog and upland ponds. I then evaluated frog movements between forest and bog habitats to determine whether they corresponded to breeding or postbreeding movements. Finally, I investigated, through a field experiment, the value of bogs as rehydrating areas for amphibians by offering living Sphagnum moss and two media associated with uplands (i.e., water with pH ca 6.5 and water-saturated soil) to acutely dehydrated frogs. Green frog reproduction at bog ponds was a rare event, and no net movements occurred between forest and bog habitats. However, acutely dehydrated frogs did not avoid Sphagnum. Results show that although green frogs rarely breed in bogs and do not move en masse between forest and bog habitats, they do not avoid bog substrates for rehydrating, despite their acidity. Thus, bogs offer viable summering habitat to amphibians, which highlights the value of these threatened environments in terrestrial amphibian ecology.

The Dynamics of Oceanic Transform Faults: Constraints from Geophysical, Geochemical and Geodynamical Modeling

DTIC Science & Technology

2008-06-01

increases in pormisill 1L, red litv; or the presence serpenliinucd Southwst l ndianRidga,t:MA\\, Mid AliantineRd 4]ldlIl luan de lucu Rdge; mantle i green ...and the green wiggled indicate regions of accreing ITSCs; (41 pooling of(extruded lAv-as within the transfornm fault. increased porosity and...at an EPR-tvpc system ( green line with solid green squares). 100% and 25% serpcntinization is shown. and the shaded region marks the serpentine

Green thunderstorms

NASA Astrophysics Data System (ADS)

Gallagher, Frank Woolsey, III

Many people around the world have observed green light apparently emanating from severe thunderstorms, but until recently there has been no scientific study of the phenomenon. Green thunderstorms have been observed from time to time in association with deep convection or severe weather events. Some skeptics who have not personally observed a green thunderstorm suggest that they are some kind of illusion. The existence of green thunderstorms has been objectively demonstrated by recording spectra of light from thunderstorms using a handheld spectrophotometer. During the spring and summer of 1995 and the spring of 1996 numerous storms were observed and spectra of the light emanating from these storms were recorded. Observations were made both at the ground and aboard research aircraft. Furthermore, time series of spectra were recorded as the observed color of some storms changed from dark blue to a bluish-green. Several hypotheses have been advanced to explain the occurrence of green light in connection with severe storms. Fankhauser gave some observational support to the belief that green light from thunderstorms is possible and believed that the source of the light is from the blue sky penetrating thin regions in the clouds. Fraser believes that light from the setting sun, in combination with the process of scattering by atmospheric molecules, creates the green light associated with severe weather and the thunderstorm acts only as a black backdrop. Unfortunately, no cloud illuminated by the sun is black and the green airlight produced by the Fraser theory is in reality overwhelmed by light reflected by the cloud. Often the unusual coloration has been attributed to hail or to reflection of light from foliage on the ground. The quantitative measurements made during the observation period fail to support these assumptions. We have observed thunderstorms to be green over ground that was not green and we have observed blue thunderstorms over ground that was green. Finally, Bohren believes that reddened sunlight in combination with filtering done by naturally blue-colored water creates green light. Given our observations, this is the most likely explanation for the green light. Our observations and calculations indicate that, depending on the microphysical parameters of the cloud, sunlight transmitted by the cloud may appear green.

Can algae-based technologies be an affordable green process for biofuel production and wastewater remediation?

PubMed

Vo Hoang Nhat, P; Ngo, H H; Guo, W S; Chang, S W; Nguyen, D D; Nguyen, P D; Bui, X T; Zhang, X B; Guo, J B

2018-05-01

Algae is a well-known organism that its characteristic is prominent for biofuel production and wastewater remediation. This critical review aims to present the applicability of algae with in-depth discussion regarding three key aspects: (i) characterization of algae for its applications; (ii) the technical approaches and their strengths and drawbacks; and (iii) future perspectives of algae-based technologies. The process optimization and combinations with other chemical and biological processes have generated efficiency, in which bio-oil yield is up to 41.1%. Through life cycle assessment, algae bio-energy achieves high energy return than fossil fuel. Thus, the algae-based technologies can reasonably be considered as green approaches. Although selling price of algae bio-oil is still high (about $2 L -1 ) compared to fossil fuel's price of $1 L -1 , it is expected that the algae bio-oil's price will become acceptable in the next coming decades and potentially dominate 75% of the market. Copyright © 2018 Elsevier Ltd. All rights reserved.

Dynamically monitoring the gene expression of dual fluorophore in the cell cycle with quantitative spectrum analysis

NASA Astrophysics Data System (ADS)

Lee, Ja-Yun; Wu, Tzong-Yuan; Hsu, I.-Jen

2008-04-01

The cloning and transcription techniques on gene cloned fluorescent proteins have been widely used in many applications. They have been used as reporters of some conditions in a series of reactions. However, it is usually difficult to monitor the specific target with the exactly number of proteins during the process in turbid media, especially at micrometer scales. We successfully revealed an alternative way to monitor the cell cycle behavior and quantitatively analyzed the target cells with green and red fluorescent proteins (GFP and RFP) during different phases of the cell cycle by quantitatively analyzing its behavior and also monitoring its spatial distribution.

In vitro energy transfer in Renilla bioluminescence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ward, W.W.; Cormier, M.J.

1976-09-23

A quantitative study of in vitro energy transfer in a natural biological system is reported. The in vitro bioluminescent oxidation of Renilla (sea pansy) luciferin by luciferase produces a broad, structureless emission, peaking in the blue at 490 nm. In contrast, the live animal produces a structured emission peaking in the green at 509 nm. This difference in emission characteristics is due to the presence, in Renilla, of a green fluorescent protein (GFP). Addition of GFP in vitro sensitizes the oxyluciferin product excited state, resulting in the narrow, structured green emission characteristic of GFP fluorescence (lambda/sub max/ 509 nm). Undermore » conditions of efficient in vitro energy transfer (2.7 x 10/sup -6/ M GFP) the radiative quantum yield (with respect to luciferin) increases 5.7-fold from 5.3% (blue pathway) to 30% (green pathway). The fluorescence quantum yield of the Renilla GFP has been measured as 30%; thus, within the precision of our measurements (15% coefficient of variation) the in vitro energy transfer efficiency is a surprising 100%.« less

Mini-column assay for rapid detection of malachite green in fish.

PubMed

Shalaby, Ali R; Emam, Wafaa H; Anwar, Mervat M

2017-07-01

A simple, rapid and economical mini-column method for detecting malachite green (MG) residue in fish was developed. The method used a column with 2mm ID that was tightly packed with silica gel followed by alumina. Detection of MG was performed by viewing the developed mini-column at visible light by naked eye; where MG was seen as compact green band at the confluence of the silica gel layer with alumina layer. The limit of detection of the assay was 2ng which conform the minimum required performance limit (MRPL). Evaluation utility of the method indicated that all blank and spiked samples at levels below MRPL were assessed as accepted. The intensity of the green band increased whenever MG level in the extract increased; indicated that suggested mini-column technique could be used for semi-quantitative determination of MG in fish samples. The method can be used to select the questionable samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

Reduced-order surrogate models for Green's functions in black hole spacetimes

NASA Astrophysics Data System (ADS)

Galley, Chad; Wardell, Barry

2016-03-01

The fundamental nature of linear wave propagation in curved spacetime is encoded in the retarded Green's function (or propagator). Green's functions are useful tools because almost any field quantity of interest can be computed via convolution integrals with a source. In addition, perturbation theories involving nonlinear wave propagation can be expressed in terms of multiple convolutions of the Green's function. Recently, numerical solutions for propagators in black hole spacetimes have been found that are globally valid and accurate for computing physical quantities. However, the data generated is too large for practical use because the propagator depends on two spacetime points that must be sampled finely to yield accurate convolutions. I describe how to build a reduced-order model that can be evaluated as a substitute, or surrogate, for solutions of the curved spacetime Green's function equation. The resulting surrogate accurately and quickly models the original and out-of-sample data. I discuss applications of the surrogate, including self-consistent evolutions and waveforms of extreme mass ratio binaries. Green's function surrogate models provide a new and practical way to handle many old problems involving wave propagation and motion in curved spacetimes.

Changes in the planning target volume and liver volume dose based on the selected respiratory phase in respiratory-gated radiation therapy for a hepatocellular carcinoma

NASA Astrophysics Data System (ADS)

Lee, Jae-Seung; Im, In-Chul; Kang, Su-Man; Goo, Eun-Hoe; Baek, Seong-Min

2013-11-01

The aim of this study was to quantitatively analyze the changes in the planning target volume (PTV) and liver volume dose based on the respiratory phase to identify the optimal respiratory phase for respiratory-gated radiation therapy for a hepatocellular carcinoma (HCC). Based on the standardized procedure for respiratory-gated radiation therapy, we performed a 4-dimensional computed tomography simulation for 0 ˜ 90%, 30 ˜ 70%, and 40 ˜ 60% respiratory phases to assess the respiratory stability (S R ) and the defined PTV i for each respiratory phase i. A treatment plan was established, and the changes in the PTV i and dose volume of the liver were quantitatively analyzed. Most patients (91.5%) passed the respiratory stability test (S R = 0.111 ± 0.015). With standardized respiration training exercises, we were able to minimize the overall systematic error caused by irregular respiration. Furthermore, a quantitative analysis to identify the optimal respiratory phase revealed that when a short respiratory phase (40 ˜ 60%) was used, the changes in the PTV were concentrated inside the center line; thus, we were able to obtain both a PTV margin accounting for respiration and a uniform radiation dose within the PTV.

Low cost quantitative digital imaging as an alternative to qualitative in vivo bioassays for analysis of active aflatoxin B1.

PubMed

Rasooly, Reuven; Do, Paula M; Hernlem, Bradley J

2016-06-15

Aflatoxin B1 (AFB1) producing fungi contaminate food and feed and are a major health concern. To minimize the sources and incidence of AFB1 illness there is a need to develop affordable, sensitive mobile devices for detection of active AFB1. In the present study we used a low cost fluorescence detector and describe two quantitative assays for detection of detoxified and active AFB1 demonstrating that AFB1 concentration can be measured as intensity of fluorescence. When the assay plate containing increasing concentrations of AFB1 is illuminated with a 366 nm ultraviolet lamp, AFB1 molecules absorb photons and emit blue light with peak wavelength of 432 nm. The fluorescence intensity increased in dose dependent manner. However, this method cannot distinguish between active AFB1 which poses a threat to health, and the detoxified AFB1 which exhibits no toxicity. To measure the toxin activity, we used a cell based assay that makes quantification more robust and is capable of detecting multiple samples simultaneously. It is an alternative to the qualitative duckling bioassay which is the "gold-standard" assay currently being used for quantitative analysis of active AFB1. AFB1 was incubated with transduced Vero cells expressing the green fluorescence protein (GFP) gene. After excitation with blue light at 475 nm, cells emitted green light with emission peak at 509 nm. The result shows that AFB1 inhibits protein expression in a concentration dependent manner resulting in proportionately less GFP fluorescence in cells exposed to AFB1. The result also indicates strong positive linear relationship with R(2)=0.90 between the low cost CCD camera and a fluorometer, which costs 100 times more than a CCD camera. This new analytical method for measuring active AFB1 is low in cost and combined with in vitro assay, is quantitative. It also does not require the use of animals and may be useful especially for laboratories in regions with limited resources. Published by Elsevier B.V.

Green procedure using limonene in the Dean-Stark apparatus for moisture determination in food products.

PubMed

Veillet, Sébastien; Tomao, Valérie; Ruiz, Karine; Chemat, Farid

2010-07-26

In the past 10 years, trends in analytical chemistry have turned toward the green chemistry which endeavours to develop new techniques that reduce the influence of chemicals on the environment. The challenge of the green analytical chemistry is to develop techniques that meet the request for information output while reducing the environmental impact of the analyses. For this purpose petroleum-based solvents have to be avoided. Therefore, increasing interest was given to new green solvents such as limonene and their potential as alternative solvents in analytical chemistry. In this work limonene was used instead of toluene in the Dean-Stark procedure. Moisture determination on wide range of food matrices was performed either using toluene or limonene. Both solvents gave similar water percentages in food materials, i.e. 89.3+/-0.5 and 89.5+/-0.7 for carrot, 68.0+/-0.7 and 68.6+/-1.9 for garlic, 64.1+/-0.5 and 64.0+/-0.3 for minced meat with toluene and limonene, respectively. Consequently limonene could be used as a good alternative solvent in the Dean-Stark procedure. Copyright 2010 Elsevier B.V. All rights reserved.

Presidential Green Chemistry Challenge: 2016 Greener Synthetic Pathways Award

EPA Pesticide Factsheets

Presidential Green Chemistry Challenge 2016 award winners, Albemarle and CB&I, developed a safer technology to produce alkylate, a clean gasoline component by replacing liquid acid catalysts with a lower environmental impact catalyst

Complex I-complex II ratio strongly differs in various organs of Arabidopsis thaliana.

PubMed

Peters, Katrin; Niessen, Markus; Peterhänsel, Christoph; Späth, Bettina; Hölzle, Angela; Binder, Stefan; Marchfelder, Anita; Braun, Hans-Peter

2012-06-01

In most studies, amounts of protein complexes of the oxidative phosphorylation (OXPHOS) system in different organs or tissues are quantified on the basis of isolated mitochondrial fractions. However, yield of mitochondrial isolations might differ with respect to tissue type due to varying efficiencies of cell disruption during organelle isolation procedures or due to tissue-specific properties of organelles. Here we report an immunological investigation on the ratio of the OXPHOS complexes in different tissues of Arabidopsis thaliana which is based on total protein fractions isolated from five Arabidopsis organs (leaves, stems, flowers, roots and seeds) and from callus. Antibodies were generated against one surface exposed subunit of each of the five OXPHOS complexes and used for systematic immunoblotting experiments. Amounts of all complexes are highest in flowers (likewise with respect to organ fresh weight or total protein content of the flower fraction). Relative amounts of protein complexes in all other fractions were determined with respect to their amounts in flowers. Our investigation reveals high relative amounts of complex I in green organs (leaves and stems) but much lower amounts in non-green organs (roots, callus tissue). In contrast, complex II only is represented by low relative amounts in green organs but by significantly higher amounts in non-green organs, especially in seeds. In fact, the complex I-complex II ratio differs by factor 37 between callus and leaf, indicating drastic differences in electron entry into the respiratory chain in these two fractions. Variation in amounts concerning complexes III, IV and V was less pronounced in different Arabidopsis tissues (quantification of complex V in leaves was not meaningful due to a cross-reaction of the antibody with the chloroplast form of this enzyme). Analyses were complemented by in gel activity measurements for the protein complexes of the OXPHOS system and comparative 2D blue native/SDS PAGE analyses using isolated mitochondria. We suggest that complex I has an especially important role in the context of photosynthesis which might be due to its indirect involvement in photorespiration and its numerous enzymatic side activities in plants.

Calibration with MCNP of NaI detector for the determination of natural radioactivity levels in the field.

PubMed

Cinelli, Giorgia; Tositti, Laura; Mostacci, Domiziano; Baré, Jonathan

2016-05-01

In view of assessing natural radioactivity with on-site quantitative gamma spectrometry, efficiency calibration of NaI(Tl) detectors is investigated. A calibration based on Monte Carlo simulation of detector response is proposed, to render reliable quantitative analysis practicable in field campaigns. The method is developed with reference to contact geometry, in which measurements are taken placing the NaI(Tl) probe directly against the solid source to be analyzed. The Monte Carlo code used for the simulations was MCNP. Experimental verification of the calibration goodness is obtained by comparison with appropriate standards, as reported. On-site measurements yield a quick quantitative assessment of natural radioactivity levels present ((40)K, (238)U and (232)Th). On-site gamma spectrometry can prove particularly useful insofar as it provides information on materials from which samples cannot be taken. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Cicada wing decorated by silver nanoparticles as low-cost and active/sensitive substrates for surface-enhanced Raman scattering

NASA Astrophysics Data System (ADS)

Guo, Lei; Zhang, Chang Xing; Deng, Li; Zhang, Guo Xin; Xu, Hai Jun; Sun, Xiao Ming

2014-06-01

A green, low-cost and highly efficient surface-enhanced Raman scattering (SERS) substrate was achieved by a chemical deposition of silver nanoparticles on a cicada wing, which has the large-scale nanosized protrusions on its surface. Employing the already-formed Ag/cicada wing as substrate for SERS detection, the detection limit for rhodamine 6G could reach 10-7M, the Raman enhancement factor of the substrate was as large as 106 and the relative standard deviation remains lower than 7%. The three-dimensional finite-difference time-domain simulation results showed that two types of inter-Ag-nanoparticle nanogaps in the formed geometry created a huge number of SERS "hot spots" where the electromagnetic field is substantially amplified and contributes to the higher SERS sensitivity. Meanwhile, the water contact angle of the SERS substrate is roughly 150°, which indicates the super-hydrophobic surface of the substrate. This feature may be conducive to the gathering of target molecules during the SERS detection, which in turn further improves the detection limit of target molecules. In order to improve the application of the substrate, thiram was used as the probe molecule, and the detection limit also reached 10-7 M. Meanwhile, the calibration of the Raman peak intensities of Rhodamine 6G and thiram allowed their quantitative detection. Therefore, the green and low-cost SERS substrates could be used for fast and quantitative detection of trace organic molecules. Our findings may contribute to the development of the green and low-cost SERS substrates and will allow the fast and quantitative detection of trace organic molecules.

Copper-doped waveguides in glass substrates

NASA Astrophysics Data System (ADS)

Spirkova-Hradilova, Jarmila; Tresnakova-Nebolova, Pavlina; Jirka, Ivan; Mach, Karel; Perina, Vratislav; Mackova, Anna; Kuncova, Gabriela

2001-05-01

We have studied fabrication and properties of copper ion- exchanged waveguides fabricated in various types of special soda-lime silicate glass as well as commercial optical glass substrates. The ion exchange was performed in melts containing either CuI or CuII at temperatures from 350 degrees C to 500 degrees C for times ranging from 5 minutes to 21 hrs. Optical properties of the fabricated waveguides were studied using mode spectroscopy and photoluminescence spectroscopy and composition of the waveguides was determined by SEM, RBS, EPR and ESCA. After the ion exchange the refractive index increased, according to fabrication conditions, up to (Delta) n equals +0.0693 and the guides supported up to 16 TE and TM modes. The CuI $ARLR CuII redox reaction during the fabrication depended strongly on the composition as well as the temperature of the reaction melts. In the Cu2Cl2ZnCl2 melts the oxidation of CuI to CuII was strongly hampered, so that CuI prevailed in the waveguiding region. These samples exhibited the most intensive blue-green luminescence, in spite of those fabricated using the CuII-based reaction melts, where practically no blue-green luminescence was observed. ESCA measurement revealed an easy charge transfer between the both oxidation states of copper in the very surface regions of the samples.

A spectral measurement method for determining white OLED average junction temperatures

NASA Astrophysics Data System (ADS)

Zhu, Yiting; Narendran, Nadarajah

2016-09-01

The objective of this study was to investigate an indirect method of measuring the average junction temperature of a white organic light-emitting diode (OLED) based on temperature sensitivity differences in the radiant power emitted by individual emitter materials (i.e., "blue," "green," and "red"). The measured spectral power distributions (SPDs) of the white OLED as a function of temperature showed amplitude decrease as a function of temperature in the different spectral bands, red, green, and blue. Analyzed data showed a good linear correlation between the integrated radiance for each spectral band and the OLED panel temperature, measured at a reference point on the back surface of the panel. The integrated radiance ratio of the spectral band green compared to red, (G/R), correlates linearly with panel temperature. Assuming that the panel reference point temperature is proportional to the average junction temperature of the OLED panel, the G/R ratio can be used for estimating the average junction temperature of an OLED panel.

Color vision deficiency in Zahedan, Iran: lower than expected.

PubMed

Momeni-Moghaddam, Hamed; Ng, Jason S; Robabi, Hassan; Yaghubi, Farshid

2014-11-01

To estimate the prevalence of congenital red-green color vision defects in the elementary school students of Zahedan in 2012. In this cross-sectional study, 1000 students with a mean (±SD) age of 9.0 (±1.4) years were selected randomly from a large primary school population. Color vision was evaluated using the Ishihara pseudoisochromatic color plates (38-plate edition). A daylight fluorescent tube was used as an illuminant C equivalent (i.e., 860 lux, color rendering index greater than 92, and color temperature = 6500 K). Having more than three misreadings on the test was considered a failing criterion. Data were analyzed in SPSS version 17 software using χ2 tests. Nine students (0.9%) made more than three errors on the Ishihara test. Based on this criterion, the prevalence of red-green color vision deficiency in girls and boys was 0.2 and 1.6% (p = 0.02), respectively. The prevalence of red-green color vision deficiency was found to be significantly lower in Zahedan than comparable reports in the literature.

Portable real-time fluorescence cytometry of microscale cell culture analog devices

NASA Astrophysics Data System (ADS)

Kim, Donghyun; Tatosian, Daniel A.; Shuler, Michael L.

2006-02-01

A portable fluorescence cytometric system that provides a modular platform for quantitative real-time image measurements has been used to explore the applicability to investigating cellular events on multiple time scales. For a short time scale, we investigated the real-time dynamics of uptake of daunorubicin, a chemotherapeutic agent, in cultured mouse L-cells in a micro cell culture analog compartment using the fluorescent cytometric system. The green fluorescent protein (GFP) expression to monitor induction of pre-specified genes, which occurs on a much longer time scale, has also been measured. Here GFP fluorescence from a doxycycline inducible promoter in a mouse L-cell line was determined. Additionally, a system based on inexpensive LEDs showed performance comparable to a broadband light source based system and reduced photobleaching compared to microscopic examination.

Is crypsis a common defensive strategy in plants? Speculation on signal deception in the New Zealand flora.

PubMed

Burns, Kevin C

2010-01-01

Color is a common feature of animal defense. Herbivorous insects are often colored in shades of green similar to their preferred food plants, making them difficult for predators to locate. Other insects advertise their presence with bright colors after they sequester enough toxins from their food plants to make them unpalatable. Some insects even switch between cryptic and aposomatic coloration during development. Although common in animals, quantitative evidence for color-based defense in plants is rare. After all, the primary function of plant leaves is to absorb light for photosynthesis, rather than reflect light in ways that alter their appearance to herbivores. However, recent research is beginning to challenge the notion that color-based defence is restricted to animals.

Comparison of lymphoscintigraphy and indocyanine green lymphography for the diagnosis of extremity lymphoedema.

PubMed

Akita, Shinsuke; Mitsukawa, Nobuyuki; Kazama, Toshiki; Kuriyama, Motone; Kubota, Yoshitaka; Omori, Naoko; Koizumi, Tomoe; Kosaka, Kentaro; Uno, Takashi; Satoh, Kaneshige

2013-06-01

Lymphoscintigraphy is the gold-standard examination for extremity lymphoedema. Indocyanine green lymphography may be useful for diagnosis as well. We compared the utility of these two examination methods for patients with suspected extremity lymphoedema and for those in whom surgical treatment of lymphoedema was under consideration. A total of 169 extremities with lymphoedema secondary to lymph node dissection and 65 extremities with idiopathic oedema (suspected primary lymphoedema) were evaluated; the utility of indocyanine green lymphography for diagnosis was compared with lymphoscintigraphy. Regression analysis between lymphoscintigraphy type and indocyanine green lymphography stage was conducted in the secondary lymphoedema group. In secondary oedema, the sensitivity of indocyanine green lymphography, compared with lymphoscintigraphy, was 0.972, the specificity was 0.548 and the accuracy was 0.816. When patients with lymphoscintigraphy type I and indocyanine green lymphography stage I were regarded as negative, the sensitivity of the indocyanine green lymphography was 0.978, the specificity was 0.925 and the accuracy was 0.953. There was a significant positive correlation between the lymphoscintigraphy type and the indocyanine green lymphography stage. In idiopathic oedema, the sensitivity of indocyanine green lymphography was 0.974, the specificity was 0.778 and the accuracy was 0.892. In secondary lymphoedema, earlier and less severe dysfunction could be detected by indocyanine green lymphography. Indocyanine green lymphography is recommended to determine patients' suitability for lymphaticovenular anastomosis, because the diagnostic ability of the test and its evaluation capability for disease severity is similar to lymphoscintigraphy but with less invasiveness and a lower cost. To detect primary lymphoedema, indocyanine green lymphography should be used first as a screening examination; when the results are positive, lymphoscintigraphy is useful to obtain further information. Copyright © 2013 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

Development of a sensitive and quantitative diagnostic assay for fish nervous necrosis virus based on two-target real-time PCR.

PubMed

Dalla Valle, L; Toffolo, V; Lamprecht, M; Maltese, C; Bovo, G; Belvedere, P; Colombo, L

2005-10-31

The aim of the present work was to develop two new independent SYBR Green I-based real-time PCR assays for both detection and quantification of betanodavirus, an RNA virus that infects several species of marine teleost fish causing massive mortalities in larvae and juveniles. The assays utilized two pairs of primers targeting highly conserved regions of both the RNA molecules forming the betanodavirus genome: RNA1 encoding the RNA-dependent RNA polymerase (RdRP) and RNA2 encoding the coat protein (CP). The specificity of amplifications was monitored by the melting analysis and agarose gel electrophoresis of the amplified products. The applicability of these assays was confirmed with 21 betanodavirus strains, covering all the four main clades. In addition, a BLAST (NCBI) search with the primer sequences showed no genomic cross-reactivity with other viruses. The new assays were able to quantify concentrations of betanodavirus genes ranging from 10(1) to 10(8) copies per reaction. The intra-assay coefficients of variation (CV) of threshold cycle (Ct) values of the assays were 1.5% and 1.4% for CP and RdRP RNAs, respectively. The inter-assay CVs of Ct values were 2.3% and 2.4% for CP and RdRP RNAs, respectively. Moreover, regression analysis showed a significant correlation (R2>0.97) between genome number, as determined by real-time PCR assays and the corresponding virus titer expressed as TCID50/ml of two different betanodavirus strains propagated in cell culture. The two assays were compared with a previously established one-step RT-PCR assay and with the classical virus isolation test and found to be more sensitive. In conclusion, the developed real-time RT-PCR assays are a reliable, specific and sensitive tool for the quantitative diagnosis of betanodavirus.

Widespread IgE-mediated hypersensitivity in the Sudan to the 'green nimitti' midge, Cladotanytarsus lewisi (Diptera: Chironomidae) II. Identification of a major allergen.

PubMed Central

Gad El Rab, M O; Thatcher, D R; Kay, A B

1980-01-01

A major allergen has been identified in an aqueous extract of the 'green nimitti' midge, Cladotanytarsus lewisi (Diptera: Chironomidae). Following chromatography on Sephadex G-100 allergenic activity, as assessed by skin ('prick') testing, eluted as two closely related peaks (pools I and II) at about 50% bed volume. When these pools were applied separately to columns of CM-cellulose, activity in each eluted with 0 . 05 M NaCl. Isoelectric focusing of the unfractionated allergen gave a single peak of activity at pI 4 . 3. By SDS--PAGE, biological activity in the whole 'green nimitti' extract and the material eluting from both pools I and II of the Sephadex G-100 column migrated to the same positions and were associated with a molecular size of 15,000--20,000 daltons. Skin test reactivity of the unfractionated material and the Sephadex G-100 pool I and II eluates were all destroyed following incubation with trypsin, chymotrypsin, thermolysin and neuraminidase. These experiments indicate that a major allergen derived from the 'green nimitti' midge, a cause of widespread and severe immediate-type allergy in the Sudan, is an acidic glycoprotein of 15,000--20,000 molecular weight. Images Fig. 3 PMID:7438559

Quantitative phenotyping of X-disease resistance in chokecherry using real-time PCR.

PubMed

Huang, Danqiong; Walla, James A; Dai, Wenhao

2014-03-01

A quantitative real-time SYBR Green PCR (qPCR) assay has been developed to detect and quantify X-disease phytoplasmas in chokecherry. An X-disease phytoplasma-specific and high sensitivity primer pair was designed based on the 16S rRNA gene sequence of X-disease phytoplasmas. This primer pair was specific to the 16SrIII group (X-disease) phytoplasmas. The qPCR method can quantify phytoplasmas from a DNA mix (a mix of both chokecherry and X-disease phytoplasma DNA) at as low as 0.001 ng, 10-fold lower than conventional PCR using the same primer pair. A significant correlation between the copy number of phytoplasmas and visual phenotypic rating scores of X-disease resistance in chokecherry plants was observed. Disease resistant chokecherries had a significantly lower titer of X-disease phytoplasmas than susceptible plants. This suggests that the qPCR assay provides a more objective tool to phenotype phytoplasma disease severity, particularly for early evaluation of host resistance; therefore, this method will facilitate quantitative phenotyping of disease resistance and has great potential in enhancing plant breeding. Copyright © 2013 Elsevier B.V. All rights reserved.

Arctic tundra greening and browning (2007-2013) based on satellite-observed solar-induced fluorescence data

NASA Astrophysics Data System (ADS)

Fu, D.; Su, F.; Wang, J.

2017-12-01

More accurate evaluation of the state of Arctic tundra vegetation is important for our understanding of Arctic and global systems. Arctic tundra greening has been reported, increasing vegetation cover and productivity in many regions, but browning has been also reported, based on satellite-observed Normalized Difference Vegetation Index (NDVI) from 2011 until recently. Here we demonstrate a satellite-based method of estimating tundra greenness trend. A more direct indicator of greenness (spatially downscaling solar-induced fluorescence, SIF) was used to analyze the spatial and temporal patterns of Arctic tundra greenness trends based on ordinary least square regression (2007-2013). Meanwhile, two other greenness indices were used for the comparison, which were two NDVI products: GIMMS NDVI3g, and MOD13Q1 Collection 6. Generally, the Arctic tundra was not consistently greening, browning also existed. For the spatial trends, the results showed that most parts of the Arctic tundra below 75ºN was browning (-0.0098 mW/m2/sr/nm/year) using SIF, whereas spatially heterogeneous trends (greening or browning) were obtained based on the two NDVI products. For the temporal trends, the greenness value of Eurasia Arctic tundra is higher than Northern America and the whole Arctic tundra for the three greenness indices. From 2010, the Arctic tundra was greening based on MOD13Q1, whereas is browning using GIMMS NDVI3g. However, the Arctic tundra was obviously browning using SIF data. This study demonstrates a way of investigating the variation of Arctic tundra vegetation via new satellite-observed data.

Green roof and storm water management policies: monitoring experiments on the ENPC Blue Green Wave

NASA Astrophysics Data System (ADS)

Versini, Pierre-Antoine; Gires, Auguste; Fitton, George; Tchiguirinskaia, Ioulia; Schertzer, Daniel

2015-04-01

Currently widespread in new urban projects, green roofs have shown a positive impact on urban runoff at the building/parcel scale. Nevertheless, there is no specific policy promoting their implementation neither in Europe nor in France. Moreover they are not taken into account (and usually considered as an impervious area) in the sizing of a retention basin for instance. An interesting example is located in the heart of the Paris-East Cluster for Science and Technology (Champs-sur-Marne, France). Since 2013 a large (1 ha) wavy-form vegetated roof (called bleu green wave) is implemented. Green roof area and impervious areas are connected to a large retention basin, which has been oversized. The blue green wave represents a pioneering site where an initially amenity (decorative) design project has been transformed into a research oriented one. Several measurement campaigns have been conducted to investigate and better understand the hydrological behaviour of such a structure. Rainfall, humidity, wind velocity, water content and temperature have been particularly studied. The data collected are used for several purposes: (i) characterize the spatio-temporal variability of the green roof response, (ii) calibrate and validate a specific model simulating its hydrological behavior. Based on monitoring and modeling results, green roof performances will be quantified. It will be possible to estimate how they can reduce stormwater runoff and how these performances can vary in space and in time depending on green roof configuration, rainfall event characteristics and antecedent conditions. These quantified impacts will be related to regulation rules established by stormwater managers in order to connect the parcel to the sewer network. In the particular case of the building of a retention basin, the integration of green roof in the sizing of the basin will be studied. This work is funded by the European Blue Green Dream project (http://bgd.org.uk/, funded by Climate-KIC) which aims to promote a change of paradigm for efficient planning and management of new urban developments and retrofitting of existing ones to maximize ecosystem services and increase resilience to climate change.

Identification and quantitation of semi-crystalline microplastics using image analysis and differential scanning calorimetry.

PubMed

Rodríguez Chialanza, Mauricio; Sierra, Ignacio; Pérez Parada, Andrés; Fornaro, Laura

2018-06-01

There are several techniques used to analyze microplastics. These are often based on a combination of visual and spectroscopic techniques. Here we introduce an alternative workflow for identification and mass quantitation through a combination of optical microscopy with image analysis (IA) and differential scanning calorimetry (DSC). We studied four synthetic polymers with environmental concern: low and high density polyethylene (LDPE and HDPE, respectively), polypropylene (PP), and polyethylene terephthalate (PET). Selected experiments were conducted to investigate (i) particle characterization and counting procedures based on image analysis with open-source software, (ii) chemical identification of microplastics based on DSC signal processing, (iii) dependence of particle size on DSC signal, and (iv) quantitation of microplastics mass based on DSC signal. We describe the potential and limitations of these techniques to increase reliability for microplastic analysis. Particle size demonstrated to have particular incidence in the qualitative and quantitative performance of DSC signals. Both, identification (based on characteristic onset temperature) and mass quantitation (based on heat flow) showed to be affected by particle size. As a result, a proper sample treatment which includes sieving of suspended particles is particularly required for this analytical approach.