Science.gov

Sample records for groupings usingbranched dna

  1. Directed assembly of discrete gold nanoparticle groupings usingbranched DNA scaffolds

    SciTech Connect

    Claridge, Shelley A.; Goh, Sarah L.; Frechet, Jean M.J.; Williams, Shara C.; Micheel, Christine M.; Alivisatos, A. Paul

    2004-09-14

    The concept of self-assembled dendrimers is explored for the creation of discrete nanoparticle assemblies. Hybridization of branched DNA trimers and nanoparticle-DNA conjugates results in the synthesis of nanoparticle trimer and tetramer complexes. Multiple tetramer architectures are investigated, utilizing Au-DNA conjugates with varying secondary structural motifs. Hybridization products are analyzed by gel electrophoresis, and discrete bands are observed corresponding to structures with increasing numbers of hybridization events. Samples extracted from each band are analyzed by transmission electron microscopy, and statistics compiled from micrographs are used to compare assembly characteristics for each architecture. Asymmetric structures are also produced in which both 5 and 10 nm Au particles are assembled on branched scaffolds.

  2. Asymmetric lateral distribution of unshielded phosphate groups in nucleosomal DNA and its role in DNA bending.

    PubMed Central

    Mirzabekov, A D; Rich, A

    1979-01-01

    We suggest that an asymmetric charge neutralization of DNA phosphate groups produces part of the driving force for nucleosome folding. In nucleosome core particle DNA, many of the phosphate groups are neutralized by histones, and a lateral alignment of these histones along the core DNA has been demonstrated [Mirzabekov A. D., Shick, V. V., Belyavsky, A. V. & Bavykin, S. G. (1978) Proc. Natl. Acad. Sci. USA 75, 4184--4189]. Histones appear to shield DNA phosphatases asymmetrically at one side of the surface of the DNA double helix along all its length inside the core. The external side of the DNA helix remains unneutralized. The electrostatic repulsion between negatively charged unneutralized phosphates may fold the nucleosomal DNA towards the side occupied by histones. PMID:286297

  3. Hydration of the phosphate group in double-helical DNA.

    PubMed Central

    Schneider, B; Patel, K; Berman, H M

    1998-01-01

    Water distributions around phosphate groups in 59 B-, A-, and Z-DNA crystal structures were analyzed. It is shown that the waters are concentrated in six hydration sites per phosphate and that the positions and occupancies of these sites are dependent on the conformation and type of nucleotide. The patterns of hydration that are characteristic of the backbone of the three DNA helical types can be attributed in part to the interactions of these hydration sites. PMID:9788937

  4. Affine reflection groups for tiling applications: Knot theory and DNA

    NASA Astrophysics Data System (ADS)

    Bodner, M.; Patera, J.; Peterson, M.

    2012-01-01

    We present in this paper some non-conventional applications of affine Weyl groups Waff of rank 2, the symmetry group of the tiling/lattice. We first develop and present the tools for applications requiring tilings of a real Euclidean plane {R}^2. We then elucidate the equivalence of these tilings with 2D projections of knots. The resulting mathematical structure provides a framework within which is encompassed recent work utilizing knot theory for modeling the structure and function of genetic molecules, specifically the action of particular enzymes in altering the topology of DNA in site-specific recombination.

  5. DNA SEQUENCING RESEARCH GROUP (DSRG) 2003—A GENERAL SURVEY OF CORE DNA SEQUENCING FACILITIES

    PubMed Central

    Wiebe, Glenis J.; Pershad, Rashmi; Escobar, Helaman; Hawes, John W.; Hunter, Timothy; Jackson-Machelski, Emily; Knudtson, Kevin L.; Robertson, Margaret; Thannhauser, Theodore W.

    2003-01-01

    DNA sequencing core facilities serve as centralized resources within both academic and commercial institutions, providing expertise in the area of DNA analysis. The composition and configuration of these facilities continue to evolve in response to new developments in instrumentation and methodology. The goal of the 2003 DNA Sequencing Research Group (DSRG) survey was to identify recent changes in staffing, funding, instrumentation, services, and customer relations. Responses to 58 survey questions from 30 participants are presented to offer a look at the current typical DNA core sequencing facility. The results from this study will serve as a resource for institutions to benchmark their shared core laboratories, and to give facility directors an opportunity to compare and contrast their respective services and experiences.

  6. Indirect readout of DNA sequence by p22 repressor: roles of DNA and protein functional groups in modulating DNA conformation.

    PubMed

    Harris, Lydia-Ann; Watkins, Derrick; Williams, Loren Dean; Koudelka, Gerald B

    2013-01-09

    The repressor of bacteriophage P22 (P22R) discriminates between its various DNA binding sites by sensing the identity of non-contacted base pairs at the center of its binding site. The "indirect readout" of these non-contacted bases is apparently based on DNA's sequence-dependent conformational preferences. The structures of P22R-DNA complexes indicate that the non-contacted base pairs at the center of the binding site are in the B' state. This finding suggests that indirect readout and therefore binding site discrimination depend on P22R's ability to either sense and/or impose the B' state on the non-contacted bases of its binding sites. We show here that the affinity of binding sites for P22R depends on the tendency of the central bases to assume the B'-DNA state. Furthermore, we identify functional groups in the minor groove of the non-contacted bases as the essential modulators of indirect readout by P22R. In P22R-DNA complexes, the negatively charged E44 and E48 residues are provocatively positioned near the negatively charged DNA phosphates of the non-contacted nucleotides. The close proximity of the negatively charged groups on protein and DNA suggests that electrostatics may play a key role in the indirect readout process. Changing either of two negatively charged residues to uncharged residues eliminates the ability of P22R to impose structural changes on DNA and to recognize non-contacted base sequence. These findings suggest that these negatively charged amino acids function to force the P22R-bound DNA into the B' state and therefore play a key role in indirect readout by P22R.

  7. Mitochondrial DNA evolution in the Anaxyrus boreas species group

    USGS Publications Warehouse

    Goebel, A.M.; Ranker, T.A.; Corn, P.S.; Olmstead, R.G.

    2009-01-01

    The Anaxyrus boreas species group currently comprises four species in western North America including the broadly distributed A. boreas, and three localized species, Anaxyrus nelsoni, Anaxyrus exsul and Anaxyrus canorus. Phylogenetic analyses of the mtDNA 12S rDNA, cytochrome oxidase I, control region, and restriction sites data, identified three major haplotype clades. The Northwest clade (NW) includes both subspecies of A. boreas and divergent minor clades in the middle Rocky Mountains, coastal, and central regions of the west and Pacific Northwest. The Southwest (SW) clade includes A. exsul, A. nelsoni, and minor clades in southern California. Anaxyrus canorus, previously identified as paraphyletic, has populations in both the NW and SW major clades. The Eastern major clade (E) includes three divergent lineages from southern Utah, the southern Rocky Mountains, and north of the Great Basin at the border of Utah and Nevada. These results identify new genetic variation in the eastern portion of the toad's range and are consistent with previous regional studies from the west coast. Low levels of control region sequence divergence between major clades (2.2-4.7% uncorrected pair-wise distances) are consistent with Pleistocene divergence and suggest that the phylogeographic history of the group was heavily influenced by dynamic Pleistocene glacial and climatic changes, and especially pluvial changes, in western North America. Results reported here may impact conservation plans in that the current taxonomy does not reflect the diversity in the group. ?? 2008 Elsevier Inc.

  8. Genetic Kinship Investigation from Blood Groups to DNA Markers

    PubMed Central

    Geserick, Gunther; Wirth, Ingo

    2012-01-01

    The forensic application of hereditary characteristics became possible after the discovery of human blood groups by Karl Landsteiner in 1901. The foundation for their use in kinship investigation was laid by Emil von Dungern and Ludwig Hirschfeld in 1910 by clarification of the inheritance of the ABO groups. Up to the middle of the 20th century further red cell membrane systems were discovered. From the 1920s Fritz Schiff and Georg Strassmann fought for the introduction of blood groups into forensic kinship investigation. A new era of hemogenetics was opened from 1955 as genetic polymorphisms were described in serum proteins. Starting in 1958 there followed the complex HLA system of white blood cells, which from 1963 was joined by polymophisms in erythrocyte enzymes. Therefore, from the 1980s, it was possible to clarify the majority of kinship cases with a combination of conventional markers. From 1990 to 2000 the conventional markers were gradually replaced by the more effective DNA markers. Simultaneously typing shifted from the phenotype level to the genotype level. The genomic structure of conventional genetic markers could also now be explained. As a reflection of scientific progress the legal situation also changed, particularly in the form of the official guidelines for kinship investigation. PMID:22851931

  9. Biochemical identification and characterization of DNA groups within the Proteus vulgaris complex.

    PubMed

    Janda, J M; Abbott, S L; Khashe, S; Probert, W

    2001-04-01

    We placed 43 isolates belonging to the Proteus vulgaris complex into proposed DNA groups (genomovars) using five previously recommended tests (tests for esculin hydrolysis, production of acid from salicin, L-rhamnose fermentation, and elaboration of DNase and lipase). On the basis of the results of these five tests, 49% of the isolates fell into DNA groups 5 and 6, 37% fell into DNA group 2, and the remaining 14% fell into DNA groups 3 and 4. Sequencing of the 16S rRNA genes of 11 members of DNA groups 5 and 6 indicated that 10 of these isolates (91%) could be unambiguously assigned to one of these two genomospecies. Overall expression of selected enzymatic and virulence-associated characteristics did not differ significantly among DNA groups.

  10. Hands on Group Work Paper Model for Teaching DNA Structure, Central Dogma and Recombinant DNA

    ERIC Educational Resources Information Center

    Altiparmak, Melek; Nakiboglu Tezer, Mahmure

    2009-01-01

    Understanding life on a molecular level is greatly enhanced when students are given the opportunity to visualize the molecules. Especially understanding DNA structure and function is essential for understanding key concepts of molecular biology such as DNA, central dogma and the manipulation of DNA. Researches have shown that undergraduate…

  11. Sequence of figwort mosaic virus DNA (caulimovirus group).

    PubMed

    Richins, R D; Scholthof, H B; Shepherd, R J

    1987-10-26

    The nucleotide sequence of an infectious clone of figwort mosaic virus (FMV) was determined using the dideoxynucleotide chain termination method. The double-stranded DNA genome (7743 base pairs) contained eight open reading frames (ORFs), seven of which corresponded approximately in size and location to the ORFs found in the genome of cauliflower mosaic virus (CaMV) and carnation etched ring virus (CERV). ORFs I and V of FMV demonstrated the highest degrees of nucleotide and amino acid sequence homology with the equivalent coding regions of CaMV and CERV. Regions II, III and IV showed somewhat less homology with the analogous regions of CaMV and CERV, and ORF VI showed homology with the corresponding gene of CaMV and CERV in only a short segment near the middle of the putative gene product. A 16 nucleotide sequence, complementary to the 3' terminus of methionine initiator tRNA (tRNAimet) and presumed to be the primer binding site for initiation of reverse transcription to produce minus strand DNA, was found in the FMV genome near the discontinuity in the minus strand. Sequences near the three interruptions in the plus strand of FMV DNA bear strong resemblance to similarly located sequences of 3 other caulimoviruses and are inferred to be initiation sites for second strand DNA synthesis. Additional conserved sequences in the small and large intergenic regions are pointed out including a highly conserved 35 bp sequence that occurs in the latter region.

  12. Two high-mobility group box domains act together to underwind and kink DNA

    SciTech Connect

    Sánchez-Giraldo, R.; Acosta-Reyes, F. J.; Malarkey, C. S.; Saperas, N.; Churchill, M. E. A.; Campos, J. L.

    2015-06-30

    The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A is thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA.

  13. Correction of the DNA repair defect in xeroderma pigmentosum group E by injection of a DNA damage-binding protein

    SciTech Connect

    Keeney, S.; Brody, T.; Linn, S.; Eker, A.P.M.; Vermeulen, W.; Bootsma, D.; Hoeijmakers, J.H.J.

    1994-04-26

    Cells from a subset of patients with the DNA-repair-defective disease xeroderma pigmentosum complementation group E (XP-E) are known to lack a DNA damage-binding (DDB) activity. Purified human DDB protein was injected into XP-E cells to test whether the DNA-repair defect in these cells is caused by a defect in DDB activity. Injected DDB protein stimulated DNA repair to normal levels in those strains that lack the DDB activity but did not stimulate repair in cells from other xeroderma pigmentosum groups or in XP-E cells that contain the activity. These results provide direct evidence that defective DDB activity causes the repair defect in a subset of XP-E patients, which in turn establishes a role for this activity in nucleotide-excision repair in vivo.

  14. Hydrogel with chains functionalized with carboxyl groups as universal 3D platform in DNA biosensors.

    PubMed

    Kowalczyk, Agata; Fau, Michal; Karbarz, Marcin; Donten, Mikolaj; Stojek, Zbigniew; Nowicka, Anna M

    2014-04-15

    Application of hydrogel based on N-isopropylacrylamide with carboxyl groups grafted to the chains enabled the immobilization of DNA at an extent exceeding that for flat surfaces by at least one order of magnitude. The probe DNA strands in the 3D platform were fully available for the hybridization process. The examination of the gels containing different amounts of grafted carboxyl groups (1-10%) was done using quartz crystal microbalance, electrochemical impedance spectroscopy, chronoamperometry and ionic coupled plasma with laser ablation. The optimal carboxyl group content was determined to be 5%. A very good agreement of the data obtained with independent techniques on content of DNA in the gel was obtained. In comparison to the other methods of immobilization of DNA the new platform enabled complete removal of DNA after the measurements and analysis and, therefore, could be used many times. After a 10-fold exchange of the DNA-sensing layer the efficiency of hybridization and analytical signal did not change by more than 5%. The sensor response increased linearly with logarithm of concentration of target DNA in the range 1×10(-13)-1×10(-6) M. The obtained detection limit was circa 8×10(-13) M of target DNA in the sample which is a substantial improvement over the planar sensing layers.

  15. High Electronic Conductance through Double-Helix DNA Molecules with Fullerene Anchoring Groups

    PubMed Central

    2017-01-01

    Determining the mechanism of charge transport through native DNA remains a challenge as different factors such as measuring conditions, molecule conformations, and choice of technique can significantly affect the final results. In this contribution, we have used a new approach to measure current flowing through isolated double-stranded DNA molecules, using fullerene groups to anchor the DNA to a gold substrate. Measurements were performed at room temperature in an inert environment using a conductive AFM technique. It is shown that the π-stacked B-DNA structure is conserved on depositing the DNA. As a result, currents in the nanoampere range were obtained for voltages ranging between ±1 V. These experimental results are supported by a theoretical model that suggests that a multistep hopping mechanism between delocalized domains is responsible for the long-range current flow through this specific type of DNA. PMID:28094940

  16. Mitochondrial DNA sequence diversity in two groups of Italian Veneto speakers from Veneto.

    PubMed

    Mogentale-Profizi, N; Chollet, L; Stévanovitch, A; Dubut, V; Poggi, C; Pradié, M P; Spadoni, J L; Gilles, A; Béraud-Colomb, E

    2001-03-01

    Although frequencies of mitochondrial DNA (mtDNA) haplogroups in the different European populations are rather homogenous, there are a few European populations or linguistic isolates that show different mtDNA haplogroup distributions; examples are the Saami and Ladin speakers from the eastern Italian Alps. MtDNA sequence diversity was analysed from subjects from two villages in Veneto. The first, Posina, is situated in the Venetian Alps near Vicenza. The second, Barco di Pravisdomini is a village on the plains near Venice. In spite of their common Veneto dialect, the two group populations have not preserved a genetic homogeneity; particularly, they show differences in T and J haplogroups frequencies. MtDNA diversity in these two groups seems to depend more on their geographic situation.

  17. Hematopoietic gene promoters subjected to a group-combinatorial study of DNA samples: identification of a megakaryocytic selective DNA signature

    PubMed Central

    Hazony, Yehonathan; Lu, Jun; St. Hilaire, Cynthia; Ravid, Katya

    2006-01-01

    Identification of common sub-sequences for a group of functionally related DNA sequences can shed light on the role of such elements in cell-specific gene expression. In the megakaryocytic lineage, no one single unique transcription factor was described as linage specific, raising the possibility that a cluster of gene promoter sequences presents a unique signature. Here, the megakaryocytic gene promoter group, which consists of both human and mouse 5′ non-coding regions, served as a case study. A methodology for group-combinatorial search has been implemented as a customized software platform. It extracts the longest common sequences for a group of related DNA sequences and allows for single gaps of varying length, as well as double- and multiple-gap sequences. The results point to common DNA sequences in a group of genes that is selectively expressed in megakaryocytes, and which does not appear in a large group of control, random and specific sequences. This suggests a role for a combination of these sequences in cell-specific gene expression in the megakaryocytic lineage. The data also point to an intrinsic cross-species difference in the organization of 5′ non-coding sequences within the mammalian genomes. This methodology may be used for the identification of regulatory sequences in other lineages. PMID:16936310

  18. Molecular basis of xeroderma pigmentosum group C DNA recognition by engineered meganucleases.

    PubMed

    Redondo, Pilar; Prieto, Jesús; Muñoz, Inés G; Alibés, Andreu; Stricher, Francois; Serrano, Luis; Cabaniols, Jean-Pierre; Daboussi, Fayza; Arnould, Sylvain; Perez, Christophe; Duchateau, Philippe; Pâques, Frédéric; Blanco, Francisco J; Montoya, Guillermo

    2008-11-06

    Xeroderma pigmentosum is a monogenic disease characterized by hypersensitivity to ultraviolet light. The cells of xeroderma pigmentosum patients are defective in nucleotide excision repair, limiting their capacity to eliminate ultraviolet-induced DNA damage, and resulting in a strong predisposition to develop skin cancers. The use of rare cutting DNA endonucleases-such as homing endonucleases, also known as meganucleases-constitutes one possible strategy for repairing DNA lesions. Homing endonucleases have emerged as highly specific molecular scalpels that recognize and cleave DNA sites, promoting efficient homologous gene targeting through double-strand-break-induced homologous recombination. Here we describe two engineered heterodimeric derivatives of the homing endonuclease I-CreI, produced by a semi-rational approach. These two molecules-Amel3-Amel4 and Ini3-Ini4-cleave DNA from the human XPC gene (xeroderma pigmentosum group C), in vitro and in vivo. Crystal structures of the I-CreI variants complexed with intact and cleaved XPC target DNA suggest that the mechanism of DNA recognition and cleavage by the engineered homing endonucleases is similar to that of the wild-type I-CreI. Furthermore, these derivatives induced high levels of specific gene targeting in mammalian cells while displaying no obvious genotoxicity. Thus, homing endonucleases can be designed to recognize and cleave the DNA sequences of specific genes, opening up new possibilities for genome engineering and gene therapy in xeroderma pigmentosum patients whose illness can be treated ex vivo.

  19. Genetic polymorphisms of 54 mitochondrial DNA SNP loci in Chinese Xibe ethnic minority group

    PubMed Central

    Shen, Chun-Mei; Hu, Li; Yang, Chun-Hua; Yin, Cai-Yong; Li, Zhi-Dan; Meng, Hao-Tian; Guo, Yu-Xin; Mei, Ting; Chen, Feng; Zhu, Bo-Feng

    2017-01-01

    We analyzed the genetic polymorphisms of 54 mitochondrial DNA (mtDNA) variants in Chinese Xibe ethnic minority group. A total of 137 unrelated healthy volunteers from Chinese Xibe group were the objects of our study. Among the selected loci, there were 51 variable positions including transitions and transversions, and single nucleotide transitions were common (83.93%) versus transversions. These variations defined 64 different mtDNA haplotypes exclusive of (CA)n and 9 bp deletion variation. The haplotype diversity and discrimination power in Xibe population were 0.9800 ± 0.004 and 0.9699, respectively. Besides, we compared Xibe group with 18 other populations and reconstructed a phylogenetic tree using Neighbor-Joining method. The result revealed that Xibe group was a close to Xinjiang Han and Yanbian Korean groups. Our data also indicated that Xibe group has a close relationship with Daur and Ewenki groups, which is reflected by the history that Xibe was influenced by Daur and Ewenki groups during the development of these groups. In conclusion, the variants we studied are polymorphic and could be used as informative genetic markers for forensic and population genetic application. PMID:28327596

  20. A mitochondrial DNA based phylogeny of weakfish species of the Cynoscion group (Pisces: Sciaenidae).

    PubMed

    Vergara-Chen, Carlos; Aguirre, Windsor E; González-Wangüemert, Mercedes; Bermingham, Eldredge

    2009-11-01

    We infer the phylogeny of fishes in the New World Cynoscion group (Cynoscion, Isopisthus, Macrodon, Atractoscion, Plagioscion) using 1603bp of DNA sequence data from three mitochondrial genes. With the exception of Plagioscion, whose position was ambiguous, the Cynoscion group is monophyletic. However, several genera examined are not monophyletic. Atlantic and Pacific species of Cynoscion are interspersed in the tree and geminate species pairs are identified. Intergeneric relationships in the group are clarified. Our analysis is the first comprehensive phylogeny for the Cynoscion group based on molecular data and provides a baseline for future comparative studies of this important group.

  1. Spy: a new group of eukaryotic DNA transposons without target site duplications.

    PubMed

    Han, Min-Jin; Xu, Hong-En; Zhang, Hua-Hao; Feschotte, Cédric; Zhang, Ze

    2014-06-24

    Class 2 or DNA transposons populate the genomes of most eukaryotes and like other mobile genetic elements have a profound impact on genome evolution. Most DNA transposons belong to the cut-and-paste types, which are relatively simple elements characterized by terminal-inverted repeats (TIRs) flanking a single gene encoding a transposase. All eukaryotic cut-and-paste transposons so far described are also characterized by target site duplications (TSDs) of host DNA generated upon chromosomal insertion. Here, we report a new group of evolutionarily related DNA transposons called Spy, which also include TIRs and DDE motif-containing transposase but surprisingly do not create TSDs upon insertion. Instead, Spy transposons appear to transpose precisely between 5'-AAA and TTT-3' host nucleotides, without duplication or modification of the AAATTT target sites. Spy transposons were identified in the genomes of diverse invertebrate species based on transposase homology searches and structure-based approaches. Phylogenetic analyses indicate that Spy transposases are distantly related to IS5, ISL2EU, and PIF/Harbinger transposases. However, Spy transposons are distinct from these and other DNA transposon superfamilies by their lack of TSD and their target site preference. Our findings expand the known diversity of DNA transposons and reveal a new group of eukaryotic DDE transposases with unusual catalytic properties.

  2. Single-molecule studies of high-mobility group B architectural DNA bending proteins.

    PubMed

    Murugesapillai, Divakaran; McCauley, Micah J; Maher, L James; Williams, Mark C

    2017-02-01

    Protein-DNA interactions can be characterized and quantified using single molecule methods such as optical tweezers, magnetic tweezers, atomic force microscopy, and fluorescence imaging. In this review, we discuss studies that characterize the binding of high-mobility group B (HMGB) architectural proteins to single DNA molecules. We show how these studies are able to extract quantitative information regarding equilibrium binding as well as non-equilibrium binding kinetics. HMGB proteins play critical but poorly understood roles in cellular function. These roles vary from the maintenance of chromatin structure and facilitation of ribosomal RNA transcription (yeast high-mobility group 1 protein) to regulatory and packaging roles (human mitochondrial transcription factor A). We describe how these HMGB proteins bind, bend, bridge, loop and compact DNA to perform these functions. We also describe how single molecule experiments observe multiple rates for dissociation of HMGB proteins from DNA, while only one rate is observed in bulk experiments. The measured single-molecule kinetics reveals a local, microscopic mechanism by which HMGB proteins alter DNA flexibility, along with a second, much slower macroscopic rate that describes the complete dissociation of the protein from DNA.

  3. Water-soluble polymers bearing phosphorylcholine group and other zwitterionic groups for carrying DNA derivatives.

    PubMed

    Lin, Xiaojie; Ishihara, Kazuhiko

    2014-01-01

    Water-soluble polymers with equal positive and negative charges in the same monomer unit, such as the phosphorylcholine group and other zwitterionic groups, exhibit promising potential in gene delivery with appreciable transfection efficiency, compared with the traditional poly(ethylene glycol)-based polycation-gene complexes. These zwitterionic polymers with various architectural structures and properties have been synthesized by various polymerization methods, such as conventional radical polymerization, atom-transfer radical-polymerization, reversible addition-fragmentation chain-transfer polymerization, and nitroxide-mediated radical polymerization. These techniques have been used to efficiently facilitate gene therapy by fabrication of non-viral vectors with high cytocompatibility, large gene-carrying capacity, effective cell-membrane permeability, and in vivo gene-loading/releasing functionality. Zwitterionic polymer-based gene delivery vectors systems can be categorized into soluble-polymer/gene mixing, molecular self-assembly, and polymer-gene conjugation systems. This review describes the preparation and characterization of various zwitterionic polymer-based gene delivery vectors, specifically water-soluble phospholipid polymers for carrying gene derivatives.

  4. The effect of paternal methyl-group donor intake on offspring DNA methylation and birth weight.

    PubMed

    Pauwels, S; Truijen, I; Ghosh, M; Duca, R C; Langie, S A S; Bekaert, B; Freson, K; Huybrechts, I; Koppen, G; Devlieger, R; Godderis, L

    2017-03-06

    Most nutritional studies on the development of children focus on mother-infant interactions. Maternal nutrition is critically involved in the growth and development of the fetus, but what about the father? The aim is to investigate the effects of paternal methyl-group donor intake (methionine, folate, betaine, choline) on paternal and offspring global DNA (hydroxy)methylation, offspring IGF2 DMR DNA methylation, and birth weight. Questionnaires, 7-day estimated dietary records, whole blood samples, and anthropometric measurements from 74 fathers were obtained. A total of 51 cord blood samples were collected and birth weight was obtained. DNA methylation status was measured using liquid chromatography-tandem mass spectrometry (global DNA (hydroxy)methylation) and pyrosequencing (IGF2 DMR methylation). Paternal betaine intake was positively associated with paternal global DNA hydroxymethylation (0.028% per 100 mg betaine increase, 95% CI: 0.003, 0.053, P=0.03) and cord blood global DNA methylation (0.679% per 100 mg betaine increase, 95% CI: 0.057, 1.302, P=0.03). Paternal methionine intake was positively associated with CpG1 (0.336% per 100 mg methionine increase, 95% CI: 0.103, 0.569, P=0.006), and mean CpG (0.201% per 100 mg methionine increase, 95% CI: 0.001, 0.402, P=0.049) methylation of the IGF2 DMR in cord blood. Further, a negative association between birth weight/birth weight-for-gestational age z-score and paternal betaine/methionine intake was found. In addition, a positive association between choline and birth weight/birth weight-for-gestational age z-score was also observed. Our data indicate a potential impact of paternal methyl-group donor intake on paternal global DNA hydroxymethylation, offspring global and IGF2 DMR DNA methylation, and prenatal growth.

  5. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome.

    PubMed

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo.

  6. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome

    PubMed Central

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo. PMID:26559182

  7. Coumestan inhibits radical-induced oxidation of DNA: is hydroxyl a necessary functional group?

    PubMed

    Xi, Gao-Lei; Liu, Zai-Qun

    2014-06-18

    Coumestan is a natural tetracycle with a C═C bond shared by a coumarin moiety and a benzofuran moiety. In addition to the function of the hydroxyl group on the antioxidant activity of coumestan, it is worth exploring the influence of the oxygen-abundant scaffold on the antioxidant activity as well. In this work, seven coumestans containing electron-withdrawing and electron-donating groups were synthesized to evaluate the abilities to trap 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonate) cationic radical (ABTS(•+)), 2,2'-diphenyl-1-picrylhydrazyl radical (DPPH), and galvinoxyl radical, respectively, and to inhibit the oxidations of DNA mediated by (•)OH, Cu(2+)/glutathione (GSH), and 2,2'-azobis(2-amidinopropane hydrochloride) (AAPH), respectively. It was found that all of the coumestans used herein can quench the aforementioned radicals and can inhibit (•)OH-, Cu(2+)/GSH-, and AAPH-induced oxidations of DNA. In particular, substituent-free coumestan exhibits higher ability to quench DPPH and to inhibit AAPH-induced oxidation of DNA than Trolox. In addition, nonsubstituted coumestan shows a similar ability to inhibit (•)OH- and Cu(2+)/GSH-induced oxidations of DNA relative to that of Trolox. The antioxidant effectiveness of the coumestan can be attributed to the lactone in the coumarin moiety and, therefore, a hydroxyl group may not be a necessary functional group for coumestan to be an antioxidant.

  8. A bridging model for persistence of a polycomb group protein complex through DNA replication in vitro.

    PubMed

    Lo, Stanley M; Follmer, Nicole E; Lengsfeld, Bettina M; Madamba, Egbert V; Seong, Samuel; Grau, Daniel J; Francis, Nicole J

    2012-06-29

    Epigenetic regulation may involve heritable chromatin states, but how chromatin features can be inherited through DNA replication is incompletely understood. We address this question using cell-free replication of chromatin. Previously, we showed that a Polycomb group complex, PRC1, remains continuously associated with chromatin through DNA replication. Here we investigate the mechanism of persistence. We find that a single PRC1 subunit, Posterior sex combs (PSC), can reconstitute persistence through DNA replication. PSC binds nucleosomes and self-interacts, bridging nucleosomes into a stable, oligomeric structure. Within these structures, individual PSC-chromatin contacts are dynamic. Stable association of PSC with chromatin, including through DNA replication, depends on PSC-PSC interactions. Our data suggest that labile individual PSC-chromatin contacts allow passage of the DNA replication machinery while PSC-PSC interactions prevent PSC from dissociating, allowing it to rebind to replicated chromatin. This mechanism may allow inheritance of chromatin proteins including PRC1 through DNA replication to maintain chromatin states.

  9. Maternal Methyl-Group Donor Intake and Global DNA (Hydroxy)Methylation before and during Pregnancy

    PubMed Central

    Pauwels, Sara; Duca, Radu Corneliu; Devlieger, Roland; Freson, Kathleen; Straetmans, Dany; Van Herck, Erik; Huybrechts, Inge; Koppen, Gurdun; Godderis, Lode

    2016-01-01

    It is still unclear to which extent methyl-group intake during pregnancy can affect maternal global DNA (hydroxyl)methylation. Pregnancy methylation profiling and its link with methyl-group intake in a healthy population could enhance our understanding of the development of pregnancy related disorders. One hundred forty-eight women were enrolled in the MANOE (MAternal Nutrition and Offspring’s Epigenome) study. Thiry-four women were enrolled before pregnancy and 116 during the first trimester of pregnancy. Global DNA (hydroxy)methylation in blood using LC-MS/MS and dietary methyl-group intake (methionine, folate, betaine, and choline) using a food-frequency questionnaire were estimated pre-pregnancy, during each trimester, and at delivery. Global DNA (hydroxy)methylation levels were highest pre-pregnancy and at weeks 18–22 of pregnancy. We observed a positive relation between folic acid and global DNA methylation (p = 0.04) and hydroxymethylation (p = 0.04). A high intake of methionine pre-pregnancy and in the first trimester showed lower (hydroxy)methylation percentage in weeks 11–13 and weeks 18–22, respectively. Choline and betaine intake in the first weeks was negatively associated with hydroxymethylation. Women with a high intake of these three methyl groups in the second and third trimester showed higher hyrdoxymethylation/methylation levels in the third trimester. To conclude, a time trend in DNA (hydroxy)methylation was found and women with higher methyl-group intake showed higher methylation in the third trimester, and not in earlier phases of pregnancy. PMID:27509522

  10. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    PubMed

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-08-05

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  11. Clinical characteristics, DNA repair, and complementation groups in xeroderma pigmentosum patients from Egypt.

    PubMed

    Hashem, N; Bootsma, D; Keijzer, W; Greene, A; Coriell, L; Thomas, G; Cleaver, J E

    1980-01-01

    Xeroderma pigmentosum (XP) has been reported to be unusually frequent among Middle Eastern populations. This report describes the first survey of DNA repair characteristics among Egyptians. Sixteen XP patients were contacted, and biopsies from eight were analyzed for unscheduled DNA synthesis, strand breakage during pyrimidine dimer excision, and complementation groups. The patients were equally distributed between Complementation Groups A and C. Unscheduled synthesis and strand breaks were significantly higher in Group C than in Group A cells. Central nervous system disorders were found in all of the Group A patients and in none of the Group C patients. No clinical symptoms were observed in the heterozygotes. A 2-month-old sib of an XP patient was free of symptoms, but unscheduled synthesis and strand breakage in cultures from this sib were the same as in the related XP homozygote. From the relative frequencies of each complementation group found in various parts of the world, we offer a hypothesis concerning the relative sizes and roles for gene products specified by the alleles or genes corresponding to each complementation group.

  12. UV damage-specific DNA-binding protein in xeroderma pigmentosum complementation group E

    SciTech Connect

    Kataoka, H.; Fujiwara, Y. )

    1991-03-29

    The gel mobility shift assay method revealed a specifically ultraviolet (UV) damage recognizing, DNA-binding protein in nuclear extracts of normal human cells. The resulted DNA/protein complexes caused the two retarded mobility shifts. Four xeroderma pigmentosum complementation group E (XPE) fibroblast strains derived from unrelated Japanese families were not deficient in such a DNA damage recognition/binding protein because of the normal complex formation and gel mobility shifts, although we confirmed the reported lack of the protein in the European XPE (XP2RO and XP3RO) cells. Thus, the absence of this binding protein is not always commonly observed in all the XPE strains, and the partially repair-deficient and intermediately UV-hypersensitive phenotype of XPE cells are much similar whether or not they lack the protein.

  13. Distinct Structural Features of the Peroxide Response Regulator from Group A Streptococcus Drive DNA Binding

    PubMed Central

    Hammel, Michal; Nix, Jay C.; Tseng, Hsiao-Ling; Tsou, Chih-Cheng; Fei, Chun-Hsien; Chiou, Huo-Sheng; Jeng, U-Ser; Lin, Yee-Shin; Chuang, Woei-Jer; Wu, Jiunn-Jong; Wang, Shuying

    2014-01-01

    Group A streptococcus (GAS, Streptococcus pyogenes) is a strict human pathogen that causes severe, invasive diseases. GAS does not produce catalase, but has an ability to resist killing by reactive oxygen species (ROS) through novel mechanisms. The peroxide response regulator (PerR), a member of ferric uptake regulator (Fur) family, plays a key role for GAS to cope with oxidative stress by regulating the expression of multiple genes. Our previous studies have found that expression of an iron-binding protein, Dpr, is under the direct control of PerR. To elucidate the molecular interactions of PerR with its cognate promoter, we have carried out structural studies on PerR and PerR-DNA complex. By combining crystallography and small-angle X-ray scattering (SAXS), we confirmed that the determined PerR crystal structure reflects its conformation in solution. Through mutagenesis and biochemical analysis, we have identified DNA-binding residues suggesting that PerR binds to the dpr promoter at the per box through a winged-helix motif. Furthermore, we have performed SAXS analysis and resolved the molecular architecture of PerR-DNA complex, in which two 30 bp DNA fragments wrap around two PerR homodimers by interacting with the adjacent positively-charged winged-helix motifs. Overall, we provide structural insights into molecular recognition of DNA by PerR and define the hollow structural arrangement of PerR-30bpDNA complex, which displays a unique topology distinct from currently proposed DNA-binding models for Fur family regulators. PMID:24586487

  14. Fetal DNA in maternal plasma: application to non-invasive blood group genotyping of the fetus.

    PubMed

    Lo, Y M

    2001-06-01

    The non-invasive determination of fetal genetic characteristics, including blood group types, is a long-sought goal of modern genetics. Previous work on the use of fetal cells in maternal blood has been hampered by the rarity of such cells. The recent discovery of cell-tree fetal DNA in maternal blood has opened up new possibilities for non-invasive prenatal diagnosis. It is particularly useful that fetal DNA is present in relatively high concentrations in maternal plasma, making its robust detection possible using modern technology. Large-scale clinical trials and standardization of protocols still need to be carried out. However, there is optimism that the accurate and safe prenatal determination of fetal blood group types may be achieved in routine clinical practice in the near future.

  15. Mitochondrial DNA control region analysis of three ethnic groups in the Republic of Macedonia

    PubMed Central

    Jankova-Ajanovska, Renata; Zimmermann, Bettina; Huber, Gabriela; Röck, Alexander W.; Bodner, Martin; Jakovski, Zlatko; Janeska, Biljana; Duma, Aleksej; Parson, Walther

    2014-01-01

    A total of 444 individuals representing three ethnic groups (Albanians, Turks and Romanies) in the Republic of Macedonia were sequenced in the mitochondrial control region. The mtDNA haplogroup composition differed between the three groups. Our results showed relatively high frequencies of haplogroup H12 in Albanians (8.8%) and less in Turks (3.3%), while haplogroups M5a1 and H7a1a were dominant in Romanies (13.7% and 10.3%, respectively) but rare in the former two. This highlights the importance of regional sampling for forensic mtDNA databasing purposes. These population data will be available on EMPOP under accession numbers EMP00644 (Albanians), EMP00645 (Romanies) and EMP00646 (Turks). PMID:25051224

  16. Mitochondrial DNA control region analysis of three ethnic groups in the Republic of Macedonia.

    PubMed

    Jankova-Ajanovska, Renata; Zimmermann, Bettina; Huber, Gabriela; Röck, Alexander W; Bodner, Martin; Jakovski, Zlatko; Janeska, Biljana; Duma, Aleksej; Parson, Walther

    2014-11-01

    A total of 444 individuals representing three ethnic groups (Albanians, Turks and Romanies) in the Republic of Macedonia were sequenced in the mitochondrial control region. The mtDNA haplogroup composition differed between the three groups. Our results showed relatively high frequencies of haplogroup H12 in Albanians (8.8%) and less in Turks (3.3%), while haplogroups M5a1 and H7a1a were dominant in Romanies (13.7% and 10.3%, respectively) but rare in the former two. This highlights the importance of regional sampling for forensic mtDNA databasing purposes. These population data will be available on EMPOP under accession numbers EMP00644 (Albanians), EMP00645 (Romanies) and EMP00646 (Turks).

  17. DNA barcodes from four loci provide poor resolution of taxonomic groups in the genus Crataegus

    PubMed Central

    Zarrei, Mehdi; Talent, Nadia; Kuzmina, Maria; Lee, Jeanette; Lund, Jensen; Shipley, Paul R.; Stefanović, Saša; Dickinson, Timothy A.

    2015-01-01

    DNA barcodes can facilitate identification of organisms especially when morphological characters are limited or unobservable. To what extent this potential is realized in specific groups of plants remains to be determined. Libraries of barcode sequences from well-studied authoritatively identified plants represented by herbarium voucher specimens are needed in order for DNA barcodes to serve their intended purpose, where this is possible, and to understand the reasons behind their failure to do so, when this occurs. We evaluated four loci, widely regarded as universal DNA barcodes for plants, for their utility in hawthorn species identification. Three plastid regions, matK, rbcLa and psbA-trnH, and the internal transcribed spacer 2 (ITS2) of nuclear ribosomal DNA discriminate only some of the species of Crataegus that can be recognized on the basis of their morphology etc. This is, in part, because in Rosaceae tribe Maleae most individual plastid loci yield relatively little taxonomic resolution and, in part, because the effects of allopolyploidization have not been eliminated by concerted evolution of the ITS regions. Although individual plastid markers provided generally poor resolution of taxonomic groups in Crataegus, a few species were notable exceptions. In contrast, analyses of concatenated sequences of the 3 plastid barcode loci plus 11 additional plastid loci gave a well-resolved maternal phylogeny. In the ITS2 tree, different individuals of some species formed groups with taxonomically unrelated species. This is a sign of lineage sorting due to incomplete concerted evolution in ITS2. Incongruence between the ITS2 and plastid trees is best explained by hybridization between different lineages within the genus. In aggregate, limited between-species variation in plastid loci, hybridization and a lack of concerted evolution in ITS2 all combine to limit the utility of standard barcoding markers in Crataegus. These results have implications for authentication

  18. Xeroderma Pigmentosum Group A Protein Loads as a Separate Factor onto DNA Lesions

    PubMed Central

    Rademakers, Suzanne; Volker, Marcel; Hoogstraten, Deborah; Nigg, Alex L.; Moné, Martijn J.; van Zeeland, Albert A.; Hoeijmakers, Jan H. J.; Houtsmuller, Adriaan B.; Vermeulen, Wim

    2003-01-01

    Nucleotide excision repair (NER) is the main DNA repair pathway in mammals for removal of UV-induced lesions. NER involves the concerted action of more than 25 polypeptides in a coordinated fashion. The xeroderma pigmentosum group A protein (XPA) has been suggested to function as a central organizer and damage verifier in NER. How XPA reaches DNA lesions and how the protein is distributed in time and space in living cells are unknown. Here we studied XPA in vivo by using a cell line stably expressing physiological levels of functional XPA fused to green fluorescent protein and by applying quantitative fluorescence microscopy. The majority of XPA moves rapidly through the nucleoplasm with a diffusion rate different from those of other NER factors tested, arguing against a preassembled XPA-containing NER complex. DNA damage induced a transient (∼5-min) immobilization of maximally 30% of XPA. Immobilization depends on XPC, indicating that XPA is not the initial lesion recognition protein in vivo. Moreover, loading of replication protein A on NER lesions was not dependent on XPA. Thus, XPA participates in NER by incorporation of free diffusing molecules in XPC-dependent NER-DNA complexes. This study supports a model for a rapid consecutive assembly of free NER factors, and a relatively slow simultaneous disassembly, after repair. PMID:12897146

  19. Specialization of the DNA-Cleaving Activity of a Group I Ribozyme Through In Vitro Evolution

    NASA Technical Reports Server (NTRS)

    Tsang, Joyce; Joyce, Gerald F.

    1996-01-01

    In an earlier study, an in vitro evolution procedure was applied to a large population of variants of the Tetrahymena group 1 ribozyme to obtain individuals with a 10(exp 5)-fold improved ability to cleave a target single-stranded DNA substrate under simulated physiological conditions. The evolved ribozymes also showed a twofold improvement, compared to the wild-type, in their ability to cleave a single-stranded RNA substrate. Here, we report continuation of the in vitro evolution process using a new selection strategy to achieve both enhanced DNA and diminished RNA-cleavage activity. Our strategy combines a positive selection for DNA cleavage with a negative selection against RNA binding. After 36 "generations" of in vitro evolution, the evolved population showed an approx. 100-fold increase in the ratio of DNA to RNA-cleavage activity. Site-directed mutagenesis experiment confirmed the selective advantage of two covarying mutations within the catalytic core of ribozyme that are largely responsible for this modified behavior. The population of ribozymes has now undergone a total of 63 successive generations of evolution, resulting in an average 28 mutations relative to the wild-type that are responsible for the altered phenotype.

  20. SUMOylation of xeroderma pigmentosum group C protein regulates DNA damage recognition during nucleotide excision repair

    PubMed Central

    Akita, Masaki; Tak, Yon-Soo; Shimura, Tsutomu; Matsumoto, Syota; Okuda-Shimizu, Yuki; Shimizu, Yuichiro; Nishi, Ryotaro; Saitoh, Hisato; Iwai, Shigenori; Mori, Toshio; Ikura, Tsuyoshi; Sakai, Wataru; Hanaoka, Fumio; Sugasawa, Kaoru

    2015-01-01

    The xeroderma pigmentosum group C (XPC) protein complex is a key factor that detects DNA damage and initiates nucleotide excision repair (NER) in mammalian cells. Although biochemical and structural studies have elucidated the interaction of XPC with damaged DNA, the mechanism of its regulation in vivo remains to be understood in more details. Here, we show that the XPC protein undergoes modification by small ubiquitin-related modifier (SUMO) proteins and the lack of this modification compromises the repair of UV-induced DNA photolesions. In the absence of SUMOylation, XPC is normally recruited to the sites with photolesions, but then immobilized profoundly by the UV-damaged DNA-binding protein (UV-DDB) complex. Since the absence of UV-DDB alleviates the NER defect caused by impaired SUMOylation of XPC, we propose that this modification is critical for functional interactions of XPC with UV-DDB, which facilitate the efficient damage handover between the two damage recognition factors and subsequent initiation of NER. PMID:26042670

  1. Somatic mosaicism for DNA repair capacity in fibroblasts derived from a group A xeroderma pigmentosum patient

    SciTech Connect

    Chang, H.R.; Ishizaki, K.; Sasaki, M.S.; Toguchida, J.; Kato, M.; Nakamura, Y.; Kawamura, S.; Moriguchi, T.; Ikenaga, M. )

    1989-10-01

    A female Japanese xeroderma pigmentosum (XP) patient with severe skin lesions and various neurologic abnormalities was assigned to complementation group A by conventional cell fusion studies. Ultraviolet (UV)-irradiated skin fibroblasts showed a biphasic survival curve, as measured by colony-forming ability. The surviving fraction decreased rapidly up to 2 J/m2 of UV, with a steep slope of D(O) (mean lethal dose) = 0.95 J/m2. At much higher doses it decreased more slowly, with D(O) = 3.5 J/m2. To elucidate the cause of this unique survival response, we isolated a large number of independent clones from single colonies and measured their responses to UV. Of 81 clones analyzed, ten showed a marked resistance to killing by UV, which was only slightly more sensitive than normal cells, and these clones had a rate of unscheduled DNA synthesis (UDS) that was about 45% of normal cells. By contrast, the remaining 71 clones were extremely sensitive to UV, typical of XP group A strains, and had a UDS level 1%-3% of normals. Analysis of restriction fragment length polymorphism using seven polymorphic DNA probes indicated that the UV-resistant clones were derived from the same individual as the UV-sensitive clones. These results clearly demonstrate that this patient's fibroblast cells consist of two types with differing responses to UV, and provide direct evidence of somatic mosaicism for DNA repair capacity in an XP patient.

  2. Mitochondrial DNA polymorphisms in Gelao ethnic group residing in Southwest China.

    PubMed

    Liu, Chang; Wang, Sha-Yan; Zhao, Mian; Xu, Zhi-Yong; Hu, Yu-Hua; Chen, Feng; Zhang, Ruan-Zhang; Gao, Guo-Feng; Yu, Yue-Sheng; Kong, Qing-Peng

    2011-01-01

    Gelao ethnic group, an aboriginal population residing in southwest China, has undergone a long and complex evolutionary process. To investigate the genetic structure of this ancient ethnic group, mitochondrial DNA (mtDNA) polymorphisms of 102 Gelao individuals were collected and analyzed in this study. With the aid of the information extracted from control-region hypervariable segments (HVSs) I and II as well as some necessary coding-region segments, phylogenetic status of all mtDNAs under study were determined by means of classifying into various defined haplogroups. The southern-prevalent haplogroups B, R9, and M7 account for 45.1% of the gene pool, whereas northern-prevalent haplogroups A, D, G, N9, and M8 consist of 39.2%. Haplogroup distribution indicates that the Gelao bears signatures of southern populations and possesses some regional characters. In the PC map, Gelao clusters together with populations with Bai-Yue tribe origin as well as the local Han and the Miao. The results demonstrate the complexity of Gelao population and the data can well supplement the China mtDNA database.

  3. Mitochondrial DNA variability among six South American Amerindian villages from the Pano linguistic group.

    PubMed

    Mendes-Junior, Celso T; Simoes, Aguinaldo L

    2014-01-01

    Although scattered throughout a large geographic area, the members of the Pano linguistic group present strong ethnic, linguistic, and cultural homogeneity, a feature that causes them to be considered components of a same "Pano" tribe. Nevertheless, the genetic homogeneity between Pano villages has not yet been examined. To study the genetic structure of the Pano linguistic group, four major Native American mitochondrial DNA (mtDNA) founder haplogroups were analyzed in 77 Amerindians from six villages of four Pano tribes (Katukina, Kaxináwa, Marúbo, and Yaminawa) located in the Brazilian Amazon. The central position of these tribes in the continent makes them relevant for attempts to reconstruct population movements in South America. Except for a single individual that presented an African haplogroup L, all remaining individuals presented one of the four Native American haplogroups. Significant heterogeneity was observed across the six Pano villages. Although Amerindian populations are usually characterized by considerable interpopulational diversity, the high heterogeneity level observed is unexpected if the strong ethnic, linguistic, and cultural homogeneity of the Pano linguistic group is taken into account. The present findings indicate that the ethnic, linguistic, and cultural homogeneity does not imply genetic homogeneity. Even though the genetic heterogeneity uncovered may be a female-specific process, the most probable explanation for that is the joint action of isolation and genetic drift as major factors influencing the genetic structure of the Pano linguistic group.

  4. An unusual case of Streptococcus anginosus group pyomyositis diagnosed using direct 16S ribosomal DNA sequencing.

    PubMed

    Walkty, Andrew; Embil, John M; Nichol, Kim; Karlowsky, James

    2014-01-01

    Bacteria belonging to the Streptococcus anginosus group (Streptococcus intermedius, Streptococcus constellatus and Streptococcus anginosus) are capable of causing serious pyogenic infections, with a tendency for abscess formation. The present article reports a case of S anginosus group pyomyositis in a 47-year-old man. The pathogen was recovered from one of two blood cultures obtained from the patient, but speciation was initially not performed because the organism was considered to be a contaminant (viridans streptococci group). The diagnosis was ultimately confirmed using 16S ribosomal DNA sequencing of purulent fluid obtained from a muscle abscess aspirate. The present case serves to emphasize that finding even a single positive blood culture of an organism belonging to the S anginosus group should prompt careful evaluation of the patient for a pyogenic focus of infection. It also highlights the potential utility of 16S ribosomal DNA amplification and sequencing in direct pathogen detection from aspirated fluid in cases of pyomyositis in which antimicrobial therapy was initiated before specimen collection.

  5. Conformational influence of the ribose 2'-hydroxyl group: crystal structures of DNA-RNA chimeric duplexes

    NASA Technical Reports Server (NTRS)

    Egli, M.; Usman, N.; Rich, A.

    1993-01-01

    We have crystallized three double-helical DNA-RNA chimeric duplexes and determined their structures by X-ray crystallography at resolutions between 2 and 2.25 A. The two self-complementary duplexes [r(G)d(CGTATACGC)]2 and [d(GCGT)r(A)d(TACGC)]2, as well as the Okazaki fragment d(GGGTATACGC).r(GCG)d(TATACCC), were found to adopt A-type conformations. The crystal structures are non-isomorphous, and the crystallographic environments for the three chimeras are different. A number of intramolecular interactions of the ribose 2'-hydroxyl groups contribute to the stabilization of the A-conformation. Hydrogen bonds between 2'-hydroxyls and 5'-oxygens or phosphate oxygens, in addition to the previously observed hydrogen bonds to 1'-oxygens of adjacent riboses and deoxyriboses, are observed in the DNA-RNA chimeric duplexes. The crystalline chimeric duplexes do not show a transition between the DNA A- and B-conformations. CD spectra suggest that the Okazaki fragment assumes an A-conformation in solution as well. In this molecule the three RNA residues may therefore lock the complete decamer in the A-conformation. Crystals of an all-DNA strand with the same sequence as the self-complementary chimeras show a morphology which is different from those of the chimera crystals. Moreover, the oligonucleotide does not match any of the sequence characteristics of DNAs usually adopting the A-conformation in the crystalline state (e.g., octamers with short alternating stretches of purines and pyrimidines). In DNA-RNA chimeric duplexes, it is therefore possible that a single RNA residue can drive the conformational equilibrium toward the A-conformation.

  6. Investigation on interaction of DNA and several cationic surfactants with different head groups by spectroscopy, gel electrophoresis and viscosity technologies.

    PubMed

    Guo, Qing; Zhang, Zhaohong; Song, Youtao; Liu, Shuo; Gao, Wei; Qiao, Heng; Guo, Lili; Wang, Jun

    2017-02-01

    In this study, the interaction between DNA and several cationic surfactants with different head groups such as ethyl hexadecyl dimethyl ammonium bromide (EHDAB), hexadecyl dimethyl benzyl ammonium chloride (HDBAC), and cetyl pyridinium bromide (CPB) were investigated by UV-vis absorption, fluorescence and circular dichroism (CD) spectroscopy, gel electrophoresis, and viscosity technologies. The results show that these cationic surfactants can interact with DNA and major binding modes are electrostatic and hydrophobic. Also, CPB and HDBAC molecules interact with DNA by partial intercalation, and CPB has slightly stronger intercalation than HDBAC, while EHDAB interacts with DNA by non-intercalation. The different head groups of the surfactant molecules can influence the interaction strength. CPB has the stronger interaction with DNA than the others. Moreover, surfactant concentration, the ratio of DNA and fluorescence probe, ionic strength can influence the interaction. The surfactants may interact with DNA by the competition reactions with BR for DNA-BR. The increase of ionic strength may favor the surface binding between DNA and surfactants to some extent. This work provides deep mechanistic insight on the toxicity of cationic surfactants with different head groups to DNA molecules.

  7. Single step plasmid DNA purification using methacrylate monolith bearing combination of ion-exchange and hydrophobic groups.

    PubMed

    Smrekar, Vida; Smrekar, Franc; Strancar, Aleš; Podgornik, Aleš

    2013-02-08

    Purification of high quantities of human grade plasmid DNA is one of the most intensive production steps. Because of that several methods have been proposed, among them also chromatographic purification using methacrylate monoliths. Recently, a process comprising the combination of hydrophobic interaction (HIC) monolith and ion-exchange monolith was developed. In this work both chemistries were tried to be introduced on a single monolith. Methacrylate monoliths bearing octylamine groups, combination of butyl (C4) grafted methacrylate groups and diethylaminoethyl (DEAE) groups as well as grafted chains bearing both C4 and DEAE groups were prepared. All monoliths were investigated for their ionic and protein capacity and compared to conventional epoxy, C4, and DEAE methacrylate monoliths. Octylamine monolith and monolith bearing combination of C4 grafted methacrylate groups and DEAE groups were found to be the most promising candidates and were further tested for plasmid DNA (pDNA) dynamic binding capacity under ion-exchange (IEX) and HIC binding conditions and ability to separate open circular (OC) from supercoiled (SC) pDNA forms and RNA from pDNA. Since monolith bearing combination of grafted C4 methacrylate groups and DEAE groups was superior in all three tested features, exhibiting pDNA dynamic binding capacity of 4.7 mg/ml under IEX conditions and 2.1mg/ml under HIC conditions, it was used for the development of a single step purification method and tested with pure pDNA as well as with cell lysate. Developed method removed over 99% of RNA, host cell proteins (HCP) and genomic DNA (gDNA) demonstrating capacity to purify around 1.5mg of pDNA/ml of monolith from cell lysate.

  8. Capture-recapture of white-tailed deer using DNA from fecal pellet-groups

    USGS Publications Warehouse

    Goode, Matthew J; Beaver, Jared T; Muller, Lisa I; Clark, Joseph D.; van Manen, Frank T.; Harper, Craig T; Basinger, P Seth

    2014-01-01

    Traditional methods for estimating white-tailed deer population size and density are affected by behavioral biases, poor detection in densely forested areas, and invalid techniques for estimating effective trapping area. We evaluated a noninvasive method of capture—recapture for white-tailed deer (Odocoileus virginianus) density estimation using DNA extracted from fecal pellets as an individual marker and for gender determination, coupled with a spatial detection function to estimate density (spatially explicit capture—recapture, SECR). We collected pellet groups from 11 to 22 January 2010 at randomly selected sites within a 1-km2 area located on Arnold Air Force Base in Coffee and Franklin counties, Tennessee. We searched 703 10-m radius plots and collected 352 pellet-group samples from 197 plots over five two-day sampling intervals. Using only the freshest pellets we recorded 140 captures of 33 different animals (15M:18F). Male and female densities were 1.9 (SE = 0.8) and 3.8 (SE = 1.3) deer km-2, or a total density of 5.8 deer km-2 (14.9 deer mile-2). Population size was 20.8 (SE = 7.6) over a 360-ha area, and sex ratio was 1.0 M: 2.0 F (SE = 0.71). We found DNA sampling from pellet groups improved deer abundance, density and sex ratio estimates in contiguous landscapes which could be used to track responses to harvest or other management actions.

  9. Microsatellite DNA suggests that group size affects sex-biased dispersal patterns in red colobus monkeys.

    PubMed

    Miyamoto, Michael M; Allen, Julie M; Gogarten, Jan F; Chapman, Colin A

    2013-05-01

    Dispersal is a major life history trait of social organisms influencing the behavioral and genetic structure of their groups. Unfortunately, primate dispersal is difficult to quantify, because of the rarity of these events and our inability to ascertain if individuals dispersed or died when they disappear. Socioecological models have been partially developed to understand the ecological causes of different dispersal systems and their social consequences. However, these models have yielded confusing results when applied to folivores. The folivorous red colobus monkey (Procolobus rufomitratus) in Kibale National Park, Uganda is thought to exhibit female-biased dispersal, although both sexes have been observed to disperse and there remains considerable debate over the selective pressures favoring the transfers of males and females and the causes of variation in the proportion of each sex to leave the natal group. We circumvent this problem by using microsatellite DNA data to investigate the prediction that female dispersal will be more frequent in larger groups as compared to smaller ones. The rationale for this prediction is that red colobus exhibit increased within-group competition in bigger groups, which should favor higher female dispersal rates and ultimately lower female relatedness. Genetic data from two unequally sized neighboring groups of red colobus demonstrate increased female relatedness within the smaller group, suggesting females are less likely to disperse when there is less within-group competition. We suggest that the dispersal system is mediated to some degree by scramble competition and group size. Since red colobus group sizes have increased throughout Kibale by over 50% in the last decade, these changes may have major implications for the genetic structure and ultimately the population viability of this endangered primate.

  10. Microsatellite DNA Suggests that Group Size Affects Sex-biased Dispersal Patterns in Red Colobus Monkeys

    PubMed Central

    Miyamoto, Michael M.; Allen, Julie M.; Gogarten, Jan F.; Chapman, Colin A.

    2013-01-01

    Dispersal is a major life history trait of social organisms influencing the behavioral and genetic structure of their groups. Unfortunately, primate dispersal is difficult to quantify, because of the rarity of these events and our inability to ascertain if individuals dispersed or died when they disappear. Socioecological models have been partially developed to understand the ecological causes of different dispersal systems and their social consequences. However, these models have yielded confusing results when applied to folivores. The folivorous red colobus monkey (Procolobus rufomitratus) in Kibale National Park, Uganda is thought to exhibit female-biased dispersal, although both sexes have been observed to disperse and there remains considerable debate over the selective pressures favoring the transfers of males and females and the causes of variation in the proportion of each sex to leave the natal group. We circumvent this problem by using microsatellite DNA data to investigate the prediction that female dispersal will be more frequent in larger groups as compared to smaller ones. The rationale for this prediction is that red colobus exhibit increased within-group competition in bigger groups, which should favor higher female dispersal rates and ultimately lower female relatedness. Genetic data from two unequally sized neighboring groups of red colobus demonstrate increased female relatedness within the smaller group, suggesting females are less likely to disperse when there is less within-group competition. We suggest that the dispersal system is mediated to some degree by scramble competition and group size. Since red colobus group sizes have increased throughout Kibale by over 50% in the last decade, these changes may have major implications for the genetic structure and ultimately the population viability of this endangered primate. PMID:23307485

  11. Complex Evolutionary History of the Aeromonas veronii Group Revealed by Host Interaction and DNA Sequence Data

    PubMed Central

    Faucher, Joshua; Horneman, Amy J.; Gogarten, J. Peter; Graf, Joerg

    2011-01-01

    Aeromonas veronii biovar sobria, Aeromonas veronii biovar veronii, and Aeromonas allosaccharophila are a closely related group of organisms, the Aeromonas veronii Group, that inhabit a wide range of host animals as a symbiont or pathogen. In this study, the ability of various strains to colonize the medicinal leech as a model for beneficial symbiosis and to kill wax worm larvae as a model for virulence was determined. Isolates cultured from the leech out-competed other strains in the leech model, while most strains were virulent in the wax worms. Three housekeeping genes, recA, dnaJ and gyrB, the gene encoding chitinase, chiA, and four loci associated with the type three secretion system, ascV, ascFG, aexT, and aexU were sequenced. The phylogenetic reconstruction failed to produce one consensus tree that was compatible with most of the individual genes. The Approximately Unbiased test and the Genetic Algorithm for Recombination Detection both provided further support for differing evolutionary histories among this group of genes. Two contrasting tests detected recombination within aexU, ascFG, ascV, dnaJ, and gyrB but not in aexT or chiA. Quartet decomposition analysis indicated a complex recent evolutionary history for these strains with a high frequency of horizontal gene transfer between several but not among all strains. In this study we demonstrate that at least for some strains, horizontal gene transfer occurs at a sufficient frequency to blur the signal from vertically inherited genes, despite strains being adapted to distinct niches. Simply increasing the number of genes included in the analysis is unlikely to overcome this challenge in organisms that occupy multiple niches and can exchange DNA between strains specialized to different niches. Instead, the detection of genes critical in the adaptation to specific niches may help to reveal the physiological specialization of these strains. PMID:21359176

  12. Complex evolutionary history of the Aeromonas veronii group revealed by host interaction and DNA sequence data.

    PubMed

    Silver, Adam C; Williams, David; Faucher, Joshua; Horneman, Amy J; Gogarten, J Peter; Graf, Joerg

    2011-02-16

    Aeromonas veronii biovar sobria, Aeromonas veronii biovar veronii, and Aeromonas allosaccharophila are a closely related group of organisms, the Aeromonas veronii Group, that inhabit a wide range of host animals as a symbiont or pathogen. In this study, the ability of various strains to colonize the medicinal leech as a model for beneficial symbiosis and to kill wax worm larvae as a model for virulence was determined. Isolates cultured from the leech out-competed other strains in the leech model, while most strains were virulent in the wax worms. Three housekeeping genes, recA, dnaJ and gyrB, the gene encoding chitinase, chiA, and four loci associated with the type three secretion system, ascV, ascFG, aexT, and aexU were sequenced. The phylogenetic reconstruction failed to produce one consensus tree that was compatible with most of the individual genes. The Approximately Unbiased test and the Genetic Algorithm for Recombination Detection both provided further support for differing evolutionary histories among this group of genes. Two contrasting tests detected recombination within aexU, ascFG, ascV, dnaJ, and gyrB but not in aexT or chiA. Quartet decomposition analysis indicated a complex recent evolutionary history for these strains with a high frequency of horizontal gene transfer between several but not among all strains. In this study we demonstrate that at least for some strains, horizontal gene transfer occurs at a sufficient frequency to blur the signal from vertically inherited genes, despite strains being adapted to distinct niches. Simply increasing the number of genes included in the analysis is unlikely to overcome this challenge in organisms that occupy multiple niches and can exchange DNA between strains specialized to different niches. Instead, the detection of genes critical in the adaptation to specific niches may help to reveal the physiological specialization of these strains.

  13. Renormalisation group determination of the order of the DNA denaturation transition

    NASA Astrophysics Data System (ADS)

    Romero-Enrique, J. M.; de los Santos, F.; Muñoz, M. A.

    2010-02-01

    We report on the nature of the thermal-denaturation transition of homogeneous DNA as determined from a renormalisation group analysis of the Peyrard-Bishop-Dauxois model. Our approach is based on an analogy with the phenomenon of critical wetting that goes further than previous qualitative comparisons, and shows that the transition is continuous for the average base-pair separation. However, since the range of universal critical behaviour appears to be very narrow, numerically observed denaturation transitions may look first-order, as it has been reported in the literature.

  14. Inheritance of the group I rDNA intron in Tetrahymena pigmentosa.

    PubMed

    Nielsen, H; Simon, E M; Engberg, J

    1992-01-01

    We have previously argued from phylogenetic sequence data that the group I intron in the rRNA genes of Tetrahymena was acquired by different Tetrahymena species at different times during evolution. We have now approached the question of intron mobility experimentally by crossing intron+ and intron- strains looking for a strong polarity in the inheritance of the intron (intron homing). Based on the genetic analysis we find that the intron in T. pigmentosa is inherited as a neutral character and that intron+ and intron- alleles segregate in a Mendelian fashion with no sign of intron homing. In an analysis of vegetatively growing cells containing intron+ and intron- rDNA, initially in the same macronucleus, we similarly find no evidence of intron homing. During the course of this work, we observed to our surprise that progeny clones from some crosses contained three types of rDNA. One possible explanation is that T. pigmentosa has two rdn loci in contrast to the single locus found in T. thermophila. Some of the progeny clones from the genetic analysis were expanded for several hundred generations, and allelic assortment of the rDNA was demonstrated by subcloning analysis.

  15. Dichotomous Life of DNA Binding High Mobility Group Box1 Protein in Human Health and Disease.

    PubMed

    Lohani, Neelam; Rajeswari, Moganty R

    2016-01-01

    The High mobility group box 1 (HMGB1) protein is an extremely versatile, highly conserved nuclear protein, with its unique intracellular and extracellular functions mediated by its relatively simple domain structure. Within the nucleus, HMGB1 binds to DNA minor groove in a nonspecific manner and causes bends in the double helix thus helps in recruiting a number of DNA binding protein and transcription factors, to facilitate transcription of various genes. HMGB1 also helps in DNA repair, chromatin remodeling, V (D) J recombination, and assembly of nucleosome on the chromatin. On contrary, under pathological conditions HMGB1 displays inflammatory response by interaction with specific cell surface receptors like RAGE, TLR-4, TLR9, and TLR2 and activates NF-kB downstream signaling pathways. The upregulation of HMGB1 is directly associated with the pathogenesis of cancer, sepsis, ischemia, hemorrhagic shock, anorexia, rheumatic disease, periodontal disease etc. Therefore, HMGB1 has been considered as a promising target in the treatment of various human diseases. The interest in HMGB1 is evident and reflected in the exponential increase in the recent publications, and therefore there is a need for an update on the understanding of the role of HMGB1 in pathogenesis and its potential application of HMGB1 as a therapeutic target in a number of human diseases.

  16. Genetic Variation Among Vegetative Compatibility Groups of Fusarium oxysporum f. sp. cubense Analyzed by DNA Fingerprinting.

    PubMed

    Bentley, S; Pegg, K G; Moore, N Y; Davis, R D; Buddenhagen, I W

    1998-12-01

    ABSTRACT Genetic variation within a worldwide collection of 208 isolates of Fu-sarium oxysporum f. sp. cubense, representing physiological races 1, 2, 3, and 4 and the 20 reported vegetative compatibility groups (VCGs), was analyzed using modified DNA amplification fingerprinting. Also characterized were 133 isolates that did not belong to any of the reported VCGs of F. oxysporum f. sp. cubense including race 3 isolates from a Heliconia species and isolates from a symptomatic wild banana species growing in the jungle in peninsular Malaysia. The DNA fingerprint patterns were generally VCG specific, irrespective of geographic or host origin. A total of 33 different genotypes were identified within F. oxysporum f. sp. cu-bense; 19 genotypes were distinguished among the isolates that belonged to the 20 reported VCGs, and 14 new genotypes were identified among the isolates that did not belong to any of the existing VCGs. DNA fingerprinting analysis also allowed differentiation of nine clonal lineages within F. oxysporum f. sp. cubense. Five of these lineages each contained numerous closely related VCGs and genotypes, and the remaining four lineages each contained a single genotype. The genetic diversity and geographic distribution of several of these lineages of F. oxysporum f. sp. cubense suggests that they have coevolved with edible bananas and their wild diploid progenitors in Asia. DNA fingerprinting analysis of isolates from the wild pathosystem provides further evidence for the coevolution hypothesis. The genetic isolation and limited geographic distribution of four of the lineages of F. oxysporum f. sp. cubense suggests that the pathogen has also arisen independently, both within and outside of the center of origin of the host.

  17. Adsorption and desorption of DNA tuned by hydroxyl groups in graphite oxides-based solid extraction material.

    PubMed

    Akceoglu, Garbis Atam; Li, Oi Lun; Saito, Nagahiro

    2015-12-01

    The extraction of DNA is the most crucial method used in molecular biology. Up to date silica matrices has been widely applied as solid support for selective DNA adsorption and extraction. However, since adsorption force of SiOH functional groups is much greater than that of desorption force, the DNA extraction efficiency of silica surfaces is limited. In order to increase the DNA extraction yield, a new surface with different functional groups which possess of greater desorption property is required. In this study, we proposed cellulose/graphite oxide (GO) composite as an alternative material for DNA adsorption and extraction. GO/Cellulose composite provides the major adsorption and desorption of DNA by COH, which belongs to alkyl or phenol type of OH functional group. Compared to SiOH, COH is less polarized and reactive, therefore the composite might provide a higher desorption of DNA during the elution process. The GO/cellulose composite were prepared in spherical structure by mixing urea, cellulose, NaOH, Graphite oxide and water. The concentration of GO within the composites were controlled to be 0-4.15 wt.%. The extraction yield of DNA increased with increasing weight percentage of GO. The highest yield was achieved at 4.15 wt.% GO, where the extraction efficiency was reported as 660.4 ng/μl when applying 2M GuHCl as the binding buffer. The absorbance ratios between 260 nm and 280 nm (A260/A280) of the DNA elution was demonstrated as 1.86, indicating the extracted DNA consisted of high purity. The results proved that GO/cellulose composite provides a simple method for selective DNA extraction with high extraction efficiency of pure DNA.

  18. Rapid discrimination and classification of the Lactobacillus plantarum group based on a partial dnaK sequence and DNA fingerprinting techniques.

    PubMed

    Huang, Chien-Hsun; Lee, Fwu-Ling; Liou, Jong-Shian

    2010-03-01

    The Lactobacillus plantarum group comprises five very closely related species. Some species of this group are considered to be probiotic and widely applied in the food industry. In this study, we compared the use of two different molecular markers, the 16S rRNA and dnaK gene, for discriminating phylogenetic relationships amongst L. plantarum strains using sequencing and DNA fingerprinting. The average sequence similarity for the dnaK gene (89.2%) among five type strains was significantly less than that for the 16S rRNA (99.4%). This result demonstrates that the dnaK gene sequence provided higher resolution than the 16S rRNA and suggests that the dnaK could be used as an additional phylogenetic marker for L. plantarum. Species-specific profiles of the Lactobacillus strains were obtained with RAPD and RFLP methods. Our data indicate that phylogenetic relationships between these strains are easily resolved using sequencing of the dnaK gene or DNA fingerprinting assays.

  19. Conducting polymer based DNA biosensor for the detection of the Bacillus cereus group species

    NASA Astrophysics Data System (ADS)

    Velusamy, Vijayalakshmi; Arshak, Khalil; Korostynska, Olga; Oliwa, Kamila; Adley, Catherine

    2009-05-01

    Biosensor designs are emerging at a significant rate and play an increasingly important role in foodborne pathogen detection. Conducting polymers are excellent tools for the fabrication of biosensors and polypyrrole has been used in the detection of biomolecules due to its unique properties. The prime intention of this paper was to pioneer the design and fabrication of a single-strand (ss) DNA biosensor for the detection of the Bacillus cereus (B.cereus) group species. Growth of B. cereus, results in production of several highly active toxins. Therefore, consumption of food containing >106 bacteria/gm may results in emetic and diarrhoeal syndromes. The most common source of this bacterium is found in liquid food products, milk powder, mixed food products and is of particular concern in the baby formula industry. The electrochemical deposition technique, such as cyclic voltammetry, was used to develop and test a model DNA-based biosensor on a gold electrode electropolymerized with polypyrrole. The electrically conducting polymer, polypyrrole is used as a platform for immobilizing DNA (1μg) on the gold electrode surface, since it can be more easily deposited from neutral pH aqueous solutions of pyrrolemonomers. The average current peak during the electrodeposition event is 288μA. There is a clear change in the current after hybridization of the complementary oligonucleotide (6.35μA) and for the noncomplementary oligonucleotide (5.77μA). The drop in current after each event was clearly noticeable and it proved to be effective.

  20. A locus of group A Streptococcus involved in invasive disease and DNA transfer.

    PubMed

    Hidalgo-Grass, Carlos; Ravins, Miriam; Dan-Goor, Mary; Jaffe, Joseph; Moses, Allon E; Hanski, Emanuel

    2002-10-01

    Group A streptococcus (GAS) causes diseases ranging from benign to severe infections such as necrotizing fasciitis (NF). The reasons for the differences in severity of streptococcal infections are unexplained. We developed the polymorphic-tag-lengths-transposon-mutagenesis (PTTM) method to identify virulence genes in vivo. We applied PTTM on an emm14 strain isolated from a patient with NF and screened for mutants of decreased virulence, using a mouse model of human soft-tissue infection. A mutant that survived in the skin but was attenuated in its ability to reach the spleen and to cause a lethal infection was identified. The transposon was inserted into a small open reading frame (ORF) in a locus termed sil, streptococcal invasion locus. sil contains at least five genes (silA-E) and is highly homologous to the quorum-sensing competence regulons of Streptococcus pneumoniae. silA and silB encode a putative two-component system whereas silD and silE encode two putative ABC transporters. silC is a small ORF of unknown function preceded by a combox promoter. Insertion and deletion mutants of sil had a diminished lethality in the animal model. Virulence of a deletion mutant of silC was restored when injected together with the avirulent emm14-deletion mutant, but not when these mutants were injected into opposite flanks of a mouse. DNA transfer between these mutants occurred in vivo but could not account for the complementation of virulence. DNA exchange between the emm14-deletion mutant and mutants of sil occurred also in vitro, at a frequency of approximately 10-8 for a single antibiotic marker. Whereas silC and silD mutants exchanged markers with the emm14 mutant, silB mutant did not. Thus, we identified a novel locus, which controls GAS spreading into deeper tissues and could be involved in DNA transfer.

  1. The Architectural Chromatin Factor High Mobility Group A1 Enhances DNA Ligase IV Activity Influencing DNA Repair

    PubMed Central

    Costantini, Silvia; Pegoraro, Silvia; Ros, Gloria; Penzo, Carlotta; Triolo, Gianluca; Demarchi, Francesca; Sgarra, Riccardo; Vindigni, Alessandro; Manfioletti, Guidalberto

    2016-01-01

    The HMGA1 architectural transcription factor is an oncogene overexpressed in the vast majority of human cancers. HMGA1 is a highly connected node in the nuclear molecular network and the key aspect of HMGA1 involvement in cancer development is that HMGA1 simultaneously confers cells multiple oncogenic hits, ranging from global chromatin structural and gene expression modifications up to the direct functional alterations of key cellular proteins. Interestingly, HMGA1 also modulates DNA damage repair pathways. In this work, we provide evidences linking HMGA1 with Non-Homologous End Joining DNA repair. We show that HMGA1 is in complex with and is a substrate for DNA-PK. HMGA1 enhances Ligase IV activity and it counteracts the repressive histone H1 activity towards DNA ends ligation. Moreover, breast cancer cells overexpressing HMGA1 show a faster recovery upon induction of DNA double-strand breaks, which is associated with a higher survival. These data suggest that resistance to DNA-damaging agents in cancer cells could be partially attributed to HMGA1 overexpression thus highlighting the relevance of considering HMGA1 expression levels in the selection of valuable and effective pharmacological regimens. PMID:27723831

  2. The Architectural Chromatin Factor High Mobility Group A1 Enhances DNA Ligase IV Activity Influencing DNA Repair.

    PubMed

    Pellarin, Ilenia; Arnoldo, Laura; Costantini, Silvia; Pegoraro, Silvia; Ros, Gloria; Penzo, Carlotta; Triolo, Gianluca; Demarchi, Francesca; Sgarra, Riccardo; Vindigni, Alessandro; Manfioletti, Guidalberto

    2016-01-01

    The HMGA1 architectural transcription factor is an oncogene overexpressed in the vast majority of human cancers. HMGA1 is a highly connected node in the nuclear molecular network and the key aspect of HMGA1 involvement in cancer development is that HMGA1 simultaneously confers cells multiple oncogenic hits, ranging from global chromatin structural and gene expression modifications up to the direct functional alterations of key cellular proteins. Interestingly, HMGA1 also modulates DNA damage repair pathways. In this work, we provide evidences linking HMGA1 with Non-Homologous End Joining DNA repair. We show that HMGA1 is in complex with and is a substrate for DNA-PK. HMGA1 enhances Ligase IV activity and it counteracts the repressive histone H1 activity towards DNA ends ligation. Moreover, breast cancer cells overexpressing HMGA1 show a faster recovery upon induction of DNA double-strand breaks, which is associated with a higher survival. These data suggest that resistance to DNA-damaging agents in cancer cells could be partially attributed to HMGA1 overexpression thus highlighting the relevance of considering HMGA1 expression levels in the selection of valuable and effective pharmacological regimens.

  3. Interaction between DNA and Drugs Having Protonable Basic Groups: Characterization through Affinity Constants, Drug Release Kinetics, and Conformational Changes.

    PubMed

    Alarcón, Liliana P; Baena, Yolima; Manzo, Rubén H

    2017-01-04

    This paper reports the in vitro characterization of the interaction between the phosphate groups of DNA and the protonated species of drugs with basic groups through the determination of the affinity constants, the reversibility of the interaction, and the effect on the secondary structure of the macromolecule. Affinity constants of the counterionic condensation DNA-drug were in the order of 10⁶. The negative electrokinetic potential of DNA decreased with the increase of the proportion of loading drugs. The drugs were slowly released from the DNA-drug complexes and had release kinetics consistent with the high degree of counterionic condensation. The circular dichroism profile of DNA was not modified by complexation with atenolol, lidocaine, or timolol, but was significantly altered by the more lipophilic drugs benzydamine and propranolol, revealing modifications in the secondary structure of the DNA. The in vitro characterization of such interactions provides a physicochemical basis that would contribute to identify the effects of this kind of drugs in cellular cultures, as well as side effects observed under their clinical use. Moreover, this methodology could also be projected to the fields of intracellular DNA transfection and the use of DNA as a carrier of active drugs.

  4. Functional analysis of DNA bending and unwinding by the high mobility group domain of LEF-1

    PubMed Central

    Giese, Klaus; Pagel, John; Grosschedl, Rudolf

    1997-01-01

    LEF-1 (lymphoid enhancer-binding factor 1) is a cell type-specific member of the family of high mobility group (HMG) domain proteins that recognizes a specific nucleotide sequence in the T cell receptor (TCR) α enhancer. In this study, we extend the analysis of the DNA-binding properties of LEF-1 and examine their contributions to the regulation of gene expression. We find that LEF-1, like nonspecific HMG-domain proteins, can interact with irregular DNA structures such as four-way junctions, albeit with lower efficiency than with specific duplex DNA. We also show by a phasing analysis that the LEF-induced DNA bend is directed toward the major groove. In addition, we find that the interaction of LEF-1 with a specific binding site in circular DNA changes the linking number of DNA and unwinds the double helix. Finally, we identified two nucleotides in the LEF-1-binding site that are important for protein-induced DNA bending. Mutations of these nucleotides decrease both the extent of DNA bending and the transactivation of the TCRα enhancer by LEF-1, suggesting a contribution of protein-induced DNA bending to the function of TCRα enhancer. PMID:9371763

  5. Doping Level of Boron-Doped Diamond Electrodes Controls the Grafting Density of Functional Groups for DNA Assays.

    PubMed

    Švorc, Ĺubomír; Jambrec, Daliborka; Vojs, Marian; Barwe, Stefan; Clausmeyer, Jan; Michniak, Pavol; Marton, Marián; Schuhmann, Wolfgang

    2015-09-02

    The impact of different doping levels of boron-doped diamond on the surface functionalization was investigated by means of electrochemical reduction of aryldiazonium salts. The grafting efficiency of 4-nitrophenyl groups increased with the boron levels (B/C ratio from 0 to 20,000 ppm). Controlled grafting of nitrophenyldiazonium was used to adjust the amount of immobilized single-stranded DNA strands at the surface and further on the hybridization yield in dependence on the boron doping level. The grafted nitro functions were electrochemically reduced to the amine moieties. Subsequent functionalization with a succinic acid introduced carboxyl groups for subsequent binding of an amino-terminated DNA probe. DNA hybridization significantly depends on the probe density which is in turn dependent on the boron doping level. The proposed approach opens new insights for the design and control of doped diamond surface functionalization for the construction of DNA hybridization assays.

  6. An ancient DNA test of a founder effect in Native American ABO blood group frequencies.

    PubMed

    Halverson, Melissa S; Bolnick, Deborah A

    2008-11-01

    Anthropologists have assumed that reduced genetic diversity in extant Native Americans is due to a founder effect that occurred during the initial peopling of the Americas. However, low diversity could also be the result of subsequent historical events, such as the population decline following European contact. In this study, we show that autosomal DNA from ancient Native American skeletal remains can be used to investigate the low level of ABO blood group diversity in the Americas. Extant Native Americans exhibit a high frequency of blood type O, which may reflect a founder effect, genetic drift associated with the historical population decline, or natural selection in response to the smallpox epidemics that occurred following European contact. To help distinguish between these possibilities, we determined the ABO genotypes of 15 precontact individuals from eastern North America. The precontact ABO frequencies were not significantly different from those observed in extant Native Americans from the same region, but they did differ significantly from the ABO frequencies in extant Siberian populations. Studies of other precontact populations are needed to better test the three hypotheses for low ABO blood group diversity in the Americas, but our findings are most consistent with the hypothesis of a founder effect during the initial settlement of this continent.

  7. A human ortholog of archaeal DNA repair protein Hef is defective in Fanconi anemia complementation group M.

    PubMed

    Meetei, Amom Ruhikanta; Medhurst, Annette L; Ling, Chen; Xue, Yutong; Singh, Thiyam Ramsing; Bier, Patrick; Steltenpool, Jurgen; Stone, Stacie; Dokal, Inderjeet; Mathew, Christopher G; Hoatlin, Maureen; Joenje, Hans; de Winter, Johan P; Wang, Weidong

    2005-09-01

    Fanconi anemia is a genetic disease characterized by genomic instability and cancer predisposition. Nine genes involved in Fanconi anemia have been identified; their products participate in a DNA damage-response network involving BRCA1 and BRCA2 (refs. 2,3). We previously purified a Fanconi anemia core complex containing the FANCL ubiquitin ligase and six other Fanconi anemia-associated proteins. Each protein in this complex is essential for monoubiquitination of FANCD2, a key reaction in the Fanconi anemia DNA damage-response pathway. Here we show that another component of this complex, FAAP250, is mutant in individuals with Fanconi anemia of a new complementation group (FA-M). FAAP250 or FANCM has sequence similarity to known DNA-repair proteins, including archaeal Hef, yeast MPH1 and human ERCC4 or XPF. FANCM can dissociate DNA triplex, possibly owing to its ability to translocate on duplex DNA. FANCM is essential for monoubiquitination of FANCD2 and becomes hyperphosphorylated in response to DNA damage. Our data suggest an evolutionary link between Fanconi anemia-associated proteins and DNA repair; FANCM may act as an engine that translocates the Fanconi anemia core complex along DNA.

  8. Increased UV resistance in xeroderma pigmentosum group A cells after transformation with a human genomic DNA clone

    SciTech Connect

    Rinaldy, A.; Bellew, T.; Egli, E.; Lloyd, R.S. )

    1990-09-01

    Xeroderma pigmentosum (XP) is an autosomal recessive disease in which the major clinical manifestation is a 2,000-fold enhanced probability of developing sunlight-induced skin tumors, and the molecular basis for the disease is a defective DNA excision repair system. To clone the gene defective XP complementation group A (XP-A), cDNA clones were isolated by a competition hybridization strategy in which the corresponding mRNAs were more abundant in cells of the obligately heterozygous parents relative to cells to the homozygous proband affected with the disease. In this report, a human genomic DNA clone that contains this cDNA was transformed into two independent homozygous XP-A cell lines, and these transformants displayed partial restoration of resistance to the killing effects of UV irradiation. The abundance of mRNA corresponding to this cDNA appears to correlate well with the observed UV cell survival. The results of unscheduled DNA synthesis after UV exposure indicate that the transformed cells are repair proficient relative to that of the control XP-A cells. However, using this same genomic DNA, transformation of an XP-F cell line did not confer any enhancement of UV survival or promote unscheduled DNA synthesis after UV exposure.

  9. Localization of xeroderma pigmentosum group A protein and replication protein A on damaged DNA in nucleotide excision repair

    PubMed Central

    Krasikova, Yuliya S.; Rechkunova, Nadejda I.; Maltseva, Ekaterina A.; Petruseva, Irina O.; Lavrik, Olga I.

    2010-01-01

    The interaction of xeroderma pigmentosum group A protein (XPA) and replication protein A (RPA) with damaged DNA in nucleotide excision repair (NER) was studied using model dsDNA and bubble-DNA structure with 5-{3-[6-(carboxyamido-fluoresceinyl)amidocapromoyl]allyl}-dUMP lesions in one strand and containing photoreactive 5-iodo-dUMP residues in defined positions. Interactions of XPA and RPA with damaged and undamaged DNA strands were investigated by DNA–protein photocrosslinking and gel shift analysis. XPA showed two maximums of crosslinking intensities located on the 5′-side from a lesion. RPA mainly localized on undamaged strand of damaged DNA duplex and damaged bubble-DNA structure. These results presented for the first time the direct evidence for the localization of XPA in the 5′-side of the lesion and suggested the key role of XPA orientation in conjunction with RPA binding to undamaged strand for the positioning of the NER preincision complex. The findings supported the mechanism of loading of the heterodimer consisting of excision repair cross-complementing group 1 and xeroderma pigmentosum group F proteins by XPA on the 5′-side from the lesion before damaged strand incision. Importantly, the proper orientation of XPA and RPA in the stage of preincision was achieved in the absence of TFIIH and XPG. PMID:20693538

  10. mtDNA variation in East Africa unravels the history of Afro-Asiatic groups.

    PubMed

    Boattini, Alessio; Castrì, Loredana; Sarno, Stefania; Useli, Antonella; Cioffi, Manuela; Sazzini, Marco; Garagnani, Paolo; De Fanti, Sara; Pettener, Davide; Luiselli, Donata

    2013-03-01

    East Africa (EA) has witnessed pivotal steps in the history of human evolution. Due to its high environmental and cultural variability, and to the long-term human presence there, the genetic structure of modern EA populations is one of the most complicated puzzles in human diversity worldwide. Similarly, the widespread Afro-Asiatic (AA) linguistic phylum reaches its highest levels of internal differentiation in EA. To disentangle this complex ethno-linguistic pattern, we studied mtDNA variability in 1,671 individuals (452 of which were newly typed) from 30 EA populations and compared our data with those from 40 populations (2970 individuals) from Central and Northern Africa and the Levant, affiliated to the AA phylum. The genetic structure of the studied populations--explored using spatial Principal Component Analysis and Model-based clustering--turned out to be composed of four clusters, each with different geographic distribution and/or linguistic affiliation, and signaling different population events in the history of the region. One cluster is widespread in Ethiopia, where it is associated with different AA-speaking populations, and shows shared ancestry with Semitic-speaking groups from Yemen and Egypt and AA-Chadic-speaking groups from Central Africa. Two clusters included populations from Southern Ethiopia, Kenya and Tanzania. Despite high and recent gene-flow (Bantu, Nilo-Saharan pastoralists), one of them is associated with a more ancient AA-Cushitic stratum. Most North-African and Levantine populations (AA-Berber, AA-Semitic) were grouped in a fourth and more differentiated cluster. We therefore conclude that EA genetic variability, although heavily influenced by migration processes, conserves traces of more ancient strata.

  11. Acinetobacter variabilis sp. nov. (formerly DNA group 15 sensu Tjernberg & Ursing), isolated from humans and animals.

    PubMed

    Krizova, Lenka; McGinnis, Jana; Maixnerova, Martina; Nemec, Matej; Poirel, Laurent; Mingle, Lisa; Sedo, Ondrej; Wolfgang, William; Nemec, Alexandr

    2015-03-01

    We aimed to define the taxonomic status of 16 strains which were phenetically congruent with Acinetobacter DNA group 15 described by Tjernberg & Ursing in 1989. The strains were isolated from a variety of human and animal specimens in geographically distant places over the last three decades. Taxonomic analysis was based on an Acinetobacter-targeted, genus-wide approach that included the comparative sequence analysis of housekeeping, protein-coding genes, whole-cell profiling based on matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS), an array of in-house physiological and metabolic tests, and whole-genome comparative analysis. Based on analyses of the rpoB and gyrB genes, the 16 strains formed respective, strongly supported clusters clearly separated from the other species of the genus Acinetobacter. The distinctness of the group at the species level was indicated by average nucleotide identity values of ≤82 % between the whole genome sequences of two of the 16 strains (NIPH 2171(T) and NIPH 899) and those of the known species. In addition, the coherence of the group was also supported by MALDI-TOF MS. All 16 strains were non-haemolytic and non-gelatinase-producing, grown at 41 °C and utilized a rather limited number of carbon sources. Virtually every strain displayed a unique combination of metabolic and physiological features. We conclude that the 16 strains represent a distinct species of the genus Acinetobacter, for which the name Acinetobacter variabilis sp. nov. is proposed to reflect its marked phenotypic heterogeneity. The type strain is NIPH 2171(T) ( = CIP 110486(T) = CCUG 26390(T) = CCM 8555(T)).

  12. Group-specific primers for DNA-based detection of springtails (Hexapoda: Collembola) within predator gut contents.

    PubMed

    Kuusk, A K; Agustí, N

    2008-05-01

    Group-specific, degenerate polymerase chain reaction primers for DNA-based detection of springtails (Hexapoda: Collembola) within predator gut contents have been developed for the first time. Primers were designed from 18S rDNA and amplified fragments of 272 bp and 177 bp from 17 springtail species collected in agricultural habitats. Specificity tests against 41 nontarget species revealed no cross-reactivity. Group-specific polymerase chain reaction is advantageous when working in species-rich habitats and these primers could facilitate studies of trophic links between springtails and generalist arthropod predators worldwide.

  13. Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds

    SciTech Connect

    Mastroianni, Alexander; Claridge, Shelley; Alivisatos, A. Paul

    2009-03-30

    Nanostructures constructed from metal and semiconductor nanocrystals conjugated to, and organized by DNA are an emerging class of material with collective optical properties. We created discrete pyramids of DNA with gold nanocrystals at the tips. By taking small angle X-ray scattering (SAXS) measurments from solutions of these pyramids we confirmed that this pyramidal geometry creates structures which are more rigid in solution than linear DNA. We then took advantage of the tetrahedral symmetry to demonstrate construction of chiral nanostructures.

  14. Development of a DNA aptamer that binds specifically to group A Streptococcus serotype M3.

    PubMed

    Alfavian, Hanif; Mousavi Gargari, Seyed Latif; Rasoulinejad, Samaneh; Medhat, Arvin

    2017-02-01

    Group A streptococcus (GAS) is an important Gram-positive pathogen that causes various human diseases ranging from peripheral lesions to invasive infections. The M protein is one of the main virulence factors present on the cell surface and is associated with invasive GAS infections. Compared with other M types, serotype M3 has a predominant role in lethal infections and demonstrates epidemic behaviors, including streptococcal toxic shock syndrome, bacteremia, and necrotizing fasciitis. Traditional methods for M typing are time-consuming, tedious, contradictory, and generally restricted to reference laboratories. Therefore, development of a new M-typing technique is needed. Aptamers with the ability to detect their target with a high degree of accuracy and specificity can be ideal candidates for specific M-typing of Streptococcus pyogenes. In this study DNA aptamers with a high binding affinity towards S. pyogenes serotype M3 were selected through 12 iterative rounds of the Systematic Evolution of Ligands by EXponential (SELEX) enrichment procedure using live cells as a target. We monitored the progress of the SELEX procedure by flow cytometry analysis. Of several aptamer sequences analyzed, 12L18A showed the highest binding efficiency towards S. pyogenes type M3, with an apparent dissociation constant (Kd) of 7.47 ± 1.72 pmol/L being the lowest. Therefore the isolated aptamer can be used in any tool, such as a biosensor, for the detection of S. pyogenes and can be used in the development of a novel M-typing system.

  15. Report on the second EDNAP collaborative STR exercise. European DNA Profiling Group.

    PubMed

    Kimpton, C; Gill, P; D'Aloja, E; Andersen, J F; Bar, W; Holgersson, S; Jacobsen, S; Johnsson, V; Kloosterman, A D; Lareu, M V

    1995-01-30

    The European DNA Profiling Group (EDNAP) has previously carried out collaborative exercises to determine which STR systems will produce results that can be reproduced by different laboratories. The first EDNAP exercise involving STR systems focused on different types of loci: a simple locus with six common alleles (HUMTH01) and a complex locus with > 35 alleles (ACTBP2). Generally the simpler STR system was found to be readily amenable for use across a wide range of different technologies, whereas a more complex locus presented difficulties. The second EDNAP STR exercise was intended to take the process of investigation a stage further. Some laboratories are developing automation, coupled with fluorescent methods of detection and multiplex applications, whereas others use manual methods involving visual detection techniques such as silver staining. The purpose of this exercise was to determine whether loci amenable to multiplexing with automation (as a quadruplex reaction) could also be successfully used with manual methods, either by multiplexing in duplex reactions or alternatively by using just a single pair of PCR primers.

  16. Interlaboratory concordance of DNA sequence analysis to detect reverse transcriptase mutations in HIV-1 proviral DNA. ACTG Sequencing Working Group. AIDS Clinical Trials Group.

    PubMed

    Demeter, L M; D'Aquila, R; Weislow, O; Lorenzo, E; Erice, A; Fitzgibbon, J; Shafer, R; Richman, D; Howard, T M; Zhao, Y; Fisher, E; Huang, D; Mayers, D; Sylvester, S; Arens, M; Sannerud, K; Rasheed, S; Johnson, V; Kuritzkes, D; Reichelderfer, P; Japour, A

    1998-11-01

    Thirteen laboratories evaluated the reproducibility of sequencing methods to detect drug resistance mutations in HIV-1 reverse transcriptase (RT). Blinded, cultured peripheral blood mononuclear cell pellets were distributed to each laboratory. Each laboratory used its preferred method for sequencing proviral DNA. Differences in protocols included: DNA purification; number of PCR amplifications; PCR product purification; sequence/location of PCR/sequencing primers; sequencing template; sequencing reaction label; sequencing polymerase; and use of manual versus automated methods to resolve sequencing reaction products. Five unknowns were evaluated. Thirteen laboratories submitted 39043 nucleotide assignments spanning codons 10-256 of HIV-1 RT. A consensus nucleotide assignment (defined as agreement among > or = 75% of laboratories) could be made in over 99% of nucleotide positions, and was more frequent in the three laboratory isolates. The overall rate of discrepant nucleotide assignments was 0.29%. A consensus nucleotide assignment could not be made at RT codon 41 in the clinical isolate tested. Clonal analysis revealed that this was due to the presence of a mixture of wild-type and mutant genotypes. These observations suggest that sequencing methodologies currently in use in ACTG laboratories to sequence HIV-1 RT yield highly concordant results for laboratory strains; however, more discrepancies among laboratories may occur when clinical isolates are tested.

  17. Topological incongruence between nuclear and chloroplast DNA trees suggesting hybridization in the urophyllum group of the genus Fagopyrum (Polygonaceae).

    PubMed

    Nishimoto, Yuriko; Ohnishi, Ohmi; Hasegawa, Masami

    2003-04-01

    We performed phylogenetic analyses of Fagopyrum species in the urophyllum group based on nucleotide sequences of two nuclear genes, FLORICAULA/LEAFY (FLO/LFY) and AGAMOUS (AG), and three segments of chloroplast DNA (cpDNA), rbcL-accD, trnK intron, and trnC-rpoB spacer. The FLO/LFY and AG sequences turned out to be phylogenetically more informative at the intrageneric level than the cpDNA sequences. Congruence among these gene trees, inferred by a maximum-likelihood (ML) method, demonstrated that topologies were partially incongruent between the nuclear and chloroplast DNA phylogenies. The nuclear DNA sequence data supported a monophyletic relation of F. statice, F. gilesii, and F. jinshaense, whereas the former two species formed another monophyletic relation with the F. capillatum-F. gracilipes-F. gracilipedoides-F. rubifolium clade excluding F. jinshaense in the synthetic cpDNA phylogeny. In addition, two divergent sequences of FLO/LFY were found in F. rubifolium (tetraploid). One of these was sister to F. gracilipedoides and another was sister to F. statice, and a monophyletic relation of these two genes was rejected by a bootstrap analysis. These results suggest that hybridization may have occurred during diversification of Fagopyrum species in the urophyllum group, and that F. rubifolium is possibly allotetraploid species.

  18. Xeroderma pigmentosum complementation group A protein is driven to nucleotide excision repair sites by the electrostatic potential of distorted DNA.

    PubMed

    Camenisch, Ulrike; Dip, Ramiro; Vitanescu, Mirela; Naegeli, Hanspeter

    2007-12-01

    The presumed DNA-binding cleft of xeroderma pigmentosum group A (XPA) protein, a key regulatory subunit of the eukaryotic nucleotide excision repair complex, displays a distinctive array of 6 positively charged amino acid side chains. Here, the molecular function of these closely spaced electropositive residues has been tested by systematic site-directed mutagenesis. After the introduction of single amino acid substitutions, the mutants were probed for protein-DNA interactions in electrophoretic mobility shift and photochemical crosslinking assays. This analysis led to the identification of a critical hot-spot for DNA substrate recognition composed of two neighboring lysines at codons 141 and 179 of the human XPA sequence. The replacement of other basic side chains in the DNA interaction domain conferred more moderate defects of substrate binding. When the function of XPA was tested as a fusion product with either mCherry or green-fluorescent protein, a glutamate substitution of one of the positively charged residues at positions 141 and 179 was sufficient to decrease DNA repair activity in human fibroblasts. Thus, the removal of a single cationic side chain abolished DNA-binding activity and significant excision repair defects could be induced by single charge inversions on the XPA surface, indicating that this molecular sensor participates in substrate recognition by monitoring the electrostatic potential of distorted DNA repair sites.

  19. Primary and secondary structure analyses of the rDNA group-I introns of the Zygnematales (Charophyta).

    PubMed

    Bhattacharya, D; Damberger, S; Surek, B; Melkonian, M

    1996-02-01

    The Zygnematales (Charophyta) contain a group-I intron (subgroupIC1) within their nuclear-encoded small subunit ribosomal DNA (SSU rDNA) coding region. This intron, which is inserted after position 1506 (relative to the SSU rDNA of Escherichia coli), is proposed to have been vertically inherited since the origin of the Zygnematales approximately 350-400 million years ago. Primary and secondary structure analyses were carried out to model group-I intron evolution in the Zygnematales. Secondary structure analyses support genetic data regarding sequence conservation within regions known to be functionally important for in vitro self-splicing of group-I introns. Comparisons of zygnematalean group-I intron secondary structures also provided some new insights into sequences that may have important roles in in vivo RNA splicing. Sequence analyses showed that sequence divergence rates and the nucleotide compositions of introns and coding regions within any one taxon varied widely, suggesting that the "1506" group-I introns and rDNA coding regions in the Zygnematales evolve independently.

  20. Molecular cloning of a mouse DNA repair gene that complements the defect of group-A xeroderma pigmentosum

    SciTech Connect

    Tanaka, K.; Satokata, I.; Ogita, Z.; Uchida, T.; Okada, Y.

    1989-07-01

    For isolation of the gene responsible for xeroderma pigmentosum (XP) complementation group A, plasmid pSV2gpt and genomic DNA from a mouse embryo were cotransfected into XP2OSSV cells, a group-A XP cell line. Two primary UV-resistant XP transfectants were isolated from about 1.6 X 10(5) pSV2gpt-transformed XP colonies. pSV2gpt and genomic DNA from the primary transfectants were again cotransfected into XP2OSSV cells and a secondary UV-resistant XP transfectant was obtained by screening about 4.8 X 10(5) pSV2gpt-transformed XP colonies. The secondary transfectant retained fewer mouse repetitive sequences. A mouse gene that complements the defect of XP2OSSV cells was cloned into an EMBL3 vector from the genome of a secondary transfectant. Transfections of the cloned DNA also conferred UV resistance on another group-A XP cell line but not on XP cell lines of group C, D, F, or G. Northern blot analysis of poly(A)+ RNA with a subfragment of cloned mouse DNA repair gene as the probe revealed that an approximately 1.0 kilobase mRNA was transcribed in the donor mouse embryo and secondary transfectant, and approximately 1.0- and approximately 1.3-kilobase mRNAs were transcribed in normal human cells, but none of these mRNAs was detected in three strains of group-A XP cells. These results suggest that the cloned DNA repair gene is specific for group-A XP and may be the mouse homologue of the group-A XP human gene.

  1. Molecular cloning of a mouse DNA repair gene that complements the defect of group-A xeroderma pigmentosum.

    PubMed Central

    Tanaka, K; Satokata, I; Ogita, Z; Uchida, T; Okada, Y

    1989-01-01

    For isolation of the gene responsible for xeroderma pigmentosum (XP) complementation group A, plasmid pSV2gpt and genomic DNA from a mouse embryo were cotransfected into XP2OSSV cells, a group-A XP cell line. Two primary UV-resistant XP transfectants were isolated from about 1.6 X 10(5) pSV2gpt-transformed XP colonies. pSV2gpt and genomic DNA from the primary transfectants were again cotransfected into XP2OSSV cells and a secondary UV-resistant XP transfectant was obtained by screening about 4.8 X 10(5) pSV2gpt-transformed XP colonies. The secondary transfectant retained fewer mouse repetitive sequences. A mouse gene that complements the defect of XP2OSSV cells was cloned into an EMBL3 vector from the genome of a secondary transfectant. Transfections of the cloned DNA also conferred UV resistance on another group-A XP cell line but not on XP cell lines of group C, D, F, or G. Northern blot analysis of poly(A)+ RNA with a subfragment of cloned mouse DNA repair gene as the probe revealed that an approximately 1.0 kilobase mRNA was transcribed in the donor mouse embryo and secondary transfectant, and approximately 1.0- and approximately 1.3-kilobase mRNAs were transcribed in normal human cells, but none of these mRNAs was detected in three strains of group-A XP cells. These results suggest that the cloned DNA repair gene is specific for group-A XP and may be the mouse homologue of the group-A XP human gene. Images PMID:2748601

  2. Discrimination of the Bacillus cereus group members by pattern analysis of random amplified polymorphic DNA-PCR.

    PubMed

    Kuwana, Ritsuko; Imamura, Daisuke; Takamatsu, Hiromu; Watabe, Kazuhito

    2012-06-01

    We tried to discriminate 16 strains of the Bacillus cereus group including B. cereus, B. thuringiensis, B. mycoides, B. pseudomycoides, and B. weihenstephanensis strains by the pattern analysis of Random Amplified Polymorphic DNA (RAPD) -PCR. Eight oligonucleotides primers were prepared and the polymorphic patterns of the DNA of each strain were compared with those of others. The primers E and F gave different patterns of RAPD-PCR products in all strains of the B. cereus group, so these primers are effective tools for the discrimination of closely related strains. All eight primers showed different polymorphic patterns of DNA for the four strains of B. cereus isolated from the kitchen of a private home, which verifies the advantage of the RAPD-PCR analysis for the discrimination of isolated strains of B. cereus from the environment.

  3. Transforming Region of Group A, B, and C Adenoviruses: DNA Homology Studies with Twenty-Nine Human Adenovirus Serotypes

    PubMed Central

    Mackey, Jesse K.; Wold, William S. M.; Rigden, Patricia; Green, Maurice

    1979-01-01

    The 31 human adenovirus (Ad) serotypes form five groups based upon DNA genome homologies: group A (Ad12, 18, 31), group B (Ad3, 7, 11, 14, 16, 21), group C (Ad1, 2, 5, 6), group D (Ad8, 9, 10, 13, 15, 17, 19, 20, 22-30), and group E (Ad4) (M. Green, J. Mackey, W. Wold, and P. Rigden, Virology, in press). Group A Ads are highly oncogenic in newborn hamsters, group B Ads are weakly oncogenic, and other Ads are nononcogenic. However, most or all Ads transform cultured cells. We have studied the homology of Ad5, Ad7, and Ad12 transforming restriction endonuclease DNA fragments with DNAs of 29 Ad types. Ad5 HindIII-G (map position 0-7.3), Ad7 XhoI-C (map position 0-10.8), and Ad12 (strain Huie) EcoRI-C (map position 0-16) and SalI-C (map position 0-10.6) fragments were purified, labeled in vitro (nick translation), and annealed with DNAs of Ad1 to Ad16, Ad18 to Ad24, and Ad26 to Ad31. Hybrids were assayed by using hydroxylapatite. Ad5 HindIII-G hybridized 98 to 100% with DNAs of group C Ads, but only 1 to 15% with DNAs of other types. Ad7 XhoI-C fragment hybridized 85 to 99% with DNAs of group B Ads, but only 6 to 21% with DNAs of other types. Ad12 (Huie) EcoRI-C hybridized 53 to 68% with DNAs of five other Ad12 strains, 53% with Ad18 DNA, 56% with Ad31 DNA, but only 3 to 13% with DNAs of other types. In vitro-labeled Ad12 (Huie) SalI-C hybridized 35 to 71% with DNAs of 6 other Ad12 strains, 44% with Ad18 DNA, 52% with Ad31 DNA, but only 2 to 7% with DNAs Ad7, Ad2, Ad26, or Ad4. When assayed using S-1 nuclease, SalI-C annealed 17 to 44% with DNAs of group A Ads. The melting temperatures of the hybrids of Ad5 HindIII-G with all group C Ad DNAs were 84°C in 0.12 M sodium phosphate (pH 6.8). The melting temperature of the Ad12 (Huie) EcoRI-C hybrid with Ad12 (Huie) DNA was 83°C, but was only 71 to 77°C with DNAs of other group A Ads. Thus, group C and group B Ads both have very homologous transforming regions that are not represented in DNAs of non-group C Ads or non-group

  4. Patterns of C-heterochromatin and telomeric DNA in two representative groups of small apes, the genera Hylobates and Symphalangus.

    PubMed

    Wijayanto, Hery; Hirai, Yuriko; Kamanaka, Yosirou; Katho, Akira; Sajuthi, Dondin; Hirai, Hirohisa

    2005-01-01

    The course of chromosome evolution in small apes is still not clear, though painting analyses have opened the way for elucidating the puzzle. Even the C-banding pattern of the lar-group of gibbons (the genus Hylobates) is not clarified yet, although our previous studies suggested that lar-group gibbons have a unique C-banding pattern. We therefore made observations to establish C-banded karyotypes of the agile gibbons included in the lar-group. The data were compared with those of siamangs (the genus Symphalangus), which carry distinctive C-bands, to determine the chromosomal patterns in each group. C-banded chromosomes of agile gibbons showed several terminal, interstitial and paracentric bands, whose patterns are specific for each chromosome, whereas the C-bands of siamangs were located only at the terminal and centromeric regions in most chromosomes. Moreover, the C-bands of agile gibbons and siamangs were shown to be G+C-rich and A+T-rich DNA, respectively, by DAPI/C-band sequential staining. Additionally, PRINS labelling with a telomere primer revealed that agile gibbons have telomeric DNA only at chromosome ends where there is no C-band (non-telomeric heterochromatin), whereas the telomeric DNA of siamangs is located in the terminal C-banded regions (telomeric heterochromatin). Although the evolutionary mechanisms in small apes are still unknown, C-banding patterns and distribution of telomeric DNA sequences should provide valuable data to deduce the evolutionary pathways of small apes.

  5. DNA polymorphism analysis of candidate genes for type 2 diabetes mellitus in a Mexican ethnic group.

    PubMed

    Flores-Martínez, S E; Islas-Andrade, S; Machorro-Lazo, M V; Revilla, M C; Juárez, R E; Mújica-López, K I; Morán-Moguel, M C; López-Cardona, M G; Sánchez-Corona, J

    2004-01-01

    Type 2 diabetes mellitus is a complex metabolic disorder resulting from the action and interaction of many genetic and environmental factors. It has been reported that polymorphisms in genes involved in the metabolism of glucose are associated with the susceptibility to develop type 2 diabetes mellitus. Although the risk of developing type 2 diabetes mellitus increases with age, as well as with obesity and hypertension, its prevalence and incidence are different among geographical regions and ethnic groups. In Mexico, a higher prevalence and incidence has been described in the south of the country, and differences between urban and rural communities have been observed. We studied 73 individuals from Santiago Jamiltepec, a small indigenous community from Oaxaca State, Mexico. This population has shown a high prevalence of type 2 diabetes mellitus, and the aim of this study was to analyze the relationship between the Pst I (insulin gene), Nsi I (insulin receptor gene) and Gly972Arg (insulin receptor substrate 1 gene) polymorphisms and type 2 diabetes mellitus, obesity and hypertension in this population. Clinical evaluation consisted of BMI and blood pressure measurements, and biochemical assays consisted of determination of fasting plasma insulin and glucose levels. PCR and restriction enzyme digestion analysis were applied to genomic DNA to identify the three polymorphisms. From statistical analysis carried out here, individually, the Pst I, Nsi I and Gly972Arg polymorphisms were not associated with the type 2 diabetes, obese or hypertensive phenotypes in this population. Nevertheless, there was an association between the Nsi I and Pst I polymorphisms and increased serum insulin levels.

  6. NMR Scalar Couplings across Intermolecular Hydrogen Bonds between Zinc-Finger Histidine Side Chains and DNA Phosphate Groups.

    PubMed

    Chattopadhyay, Abhijnan; Esadze, Alexandre; Roy, Sourav; Iwahara, Junji

    2016-10-10

    NMR scalar couplings across hydrogen bonds represent direct evidence for the partial covalent nature of hydrogen bonds and provide structural and dynamic information on hydrogen bonding. In this article, we report heteronuclear (15)N-(31)P and (1)H-(31)P scalar couplings across the intermolecular hydrogen bonds between protein histidine (His) imidazole and DNA phosphate groups. These hydrogen-bond scalar couplings were observed for the Egr-1 zinc-finger-DNA complex. Although His side-chain NH protons are typically undetectable in heteronuclear (1)H-(15)N correlation spectra due to rapid hydrogen exchange, this complex exhibited two His side-chain NH signals around (1)H 14.3 ppm and (15)N 178 ppm at 35 °C. Through various heteronuclear multidimensional NMR experiments, these signals were assigned to two zinc-coordinating His side chains in contact with DNA phosphate groups. The data show that the Nδ1 atoms of these His side chains are protonated and exhibit the (1)H-(15)N cross-peaks. Using heteronuclear (1)H, (15)N, and (31)P NMR experiments, we observed the hydrogen-bond scalar couplings between the His (15)Nδ1/(1)Hδ1 and DNA phosphate (31)P nuclei. These results demonstrate the direct involvement of the zinc-coordinating His side chains in the recognition of DNA by the Cys2His2-class zinc fingers in solution.

  7. Aeromonas jandaei (formerly genospecies DNA group 9 A. sobria), a new sucrose-negative species isolated from clinical specimens.

    PubMed Central

    Carnahan, A; Fanning, G R; Joseph, S W

    1991-01-01

    A large numerical taxonomy study conducted in 1988 of 165 mostly clinical Aeromonas strains from diverse geographic sources produced a cluster (S = 84%, SSM) of four sucrose-negative strains that included the DNA definition strain for DNA group 9 A. sobria (CDC 0787-80). These four strains, together with five additional strains received in 1989, were subjected to DNA-DNA hybridization (hydroxyapatite, 32P, 60 and 75 degrees C), and all eight strains were closely related to the ninth labeled DNA group 9 definition strain CDC 0787-80 (73 to 86% relatedness at 60 degrees C and 68 to 80% relatedness at 75 degrees C; percent divergence, 2.0 to 3.5). Type strains and DNA definition strains for all other established Aeromonas species were only 35 to 72% related (60 degrees C) to CDC 0787-80. We propose the name Aeromonas jandaei for this highly related group of nine strains, formerly known as DNA group 9 A. sobria. The type strain was designated ATCC 49568 (CDC 0787-80). The nine strains were examined at 36 degrees C and were found to be resistant to 0/129 (vibriostatic agent) and uniformly positive for oxidase, gas production from glucose, indole, lysine decarboxylase, arginine dihydrolase, o-nitrophenyl-beta-D-galactopyranoside, motility (25 degrees C), nitrate reduction, citrate utilization, hemolysis on sheep blood agar, and growth in Trypticase soy broth with no added NaCl. They all fermented D-glucose, D-mannitol, and mannose but did not ferment sucrose, cellobiose, L-arabinose, inositol, salicin, or D-sorbitol. They were uniformly negative for esculin and urea hydrolysis, elastase production, ornithine decarboxylation, and the string test. The antibiogram of A. jandaei resembled that of other aeromonads (resistance to ampicillin and cephalothin), but it differed from most other aeromonads because of resistance to single dilution of colistin and differed from clinical A. veronii biogroup sorbria (formerly A. sobria) by its nearly uniform resistance to cephalothin

  8. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  9. Efimov-like phase of a three-stranded DNA and the renormalization-group limit cycle

    NASA Astrophysics Data System (ADS)

    Pal, Tanmoy; Sadhukhan, Poulomi; Bhattacharjee, Somendra M.

    2015-04-01

    A three-stranded DNA with short range base pairings only is known to exhibit a classical analog of the quantum Efimov effect, viz., a three-chain bound state at the two-chain melting point where no two are bound. By using a nonperturbative renormalization-group method for a rigid duplex DNA and a flexible third strand, with base pairings and strand exchange, we show that the Efimov-DNA is associated with a limit cycle type behavior of the flow of an effective three-chain interaction. The analysis also shows that thermally generated bubbles play an essential role in producing the effect. A toy model for the flow equations shows the limit cycle in an extended three-dimensional parameter space of the two-chain coupling and a complex three-chain interaction.

  10. Design and testing of a functional group-specific DNA probe for the study of natural populations of acetogenic bacteria.

    PubMed Central

    Lovell, C R; Hui, Y

    1991-01-01

    The acetogens, although phylogenetically diverse, can be characterized by their possession of the acetyl coenzyme A (acetyl-CoA) pathway for autotrophic CO2 fixation. The gene encoding formyltetrahydrofolate synthetase, a key enzyme of the acetyl-CoA pathway, was previously cloned from the thermophilic acetogen Clostridium thermoaceticum and has now been tested as a group-specific probe for acetogens. Stable hybrids were formed between the probe and single DNA fragments from eight known acetogens representing six genera. A hybrid was also formed between the probe and a DNA fragment from one sulfate reducer known to be capable of both autotrophic CO2 fixation and acetate catabolism. No such hybrid was formed between the probe and DNA from a homoacetate fermenter not known to use the acetyl-CoA pathway, with two known formyltetrahydrofolate synthetase-producing purine fermenters, or with DNA from 27 other species representing 16 genera of organisms that do not use the acetyl-CoA pathway. DNA purified from cells extracted from horse manure was also screened with the acetogen probe. Six hybrids, indicating at least six detectable acetogen "strains," were observed. Images PMID:1768134

  11. Blood Group Determination using DNA extracted from Exfoliated Primary Teeth at Various Time Durations and Temperatures: A PCR Study

    PubMed Central

    Bhat, Sham S; Salman, Afreen; Hegde, Sundeep

    2016-01-01

    Aim To determine polymerase chain reaction (PCR)-based blood group on tooth pulp obtained from teeth stored for 1 month, 6 months, and 1 year following extraction and to evaluate the stability of deoxyribonucleic acid (DNA) in primary tooth subjected to a temperature of 200°C ± 5°C for 15 minutes. Materials and methods Dental pulp tissue was collected from 40 exfoliated primary teeth stored for various time durations and temperature and preserved at 4°C till DNA extraction was carried out. Deoxyribonucleic acid was extracted using silica membrane-based spin-column procedure of QIAamp DNA minikit from BioRad. Deoxyribonucleic acid was subjected to PCR amplification and monoplex allele-specific PCR primers for ABO genotyping. Statistical analysis used The data were analyzed by comparison (based on percentage). Results In our study, overall, 85% samples showed a DNA yield. Cent percent results were obtained for samples studied at the end of 1 month followed by 90 and 80% for samples studied for 6 months and 1 year respectively. Heated samples showed 70% result. Conclusion Polymerase chain reaction was found to be an effective method for blood group determination for teeth stored at various time durations and temperatures. However, as the time interval increased, the number of positive results obtained decreased. How to cite this article Pai RK, Bhat SS, Salman A, Hegde S. Blood Group Determination using DNA extracted from Exfoliated Primary Teeth at Various Time Durations and Temperatures: A PCR Study. Int J Clin Pediatr Dent 2016;9(4):308-312. PMID:28127161

  12. Genetic polymorphism of Malassezia furfur isolates from Han and Tibetan ethnic groups in China using DNA fingerprinting.

    PubMed

    Zhang, Hao; Zhang, Ruifeng; Ran, Yuping; Dai, Yaling; Lu, Yao; Wang, Peng

    2010-12-01

    Reported isolation rates of Malassezia yeast from human skin show geographic variations. In China, the populations of the Han (1,182.95 million) and Tibetan (5.41 million) ethnic groups are distributed over 9.6 and 3.27 million square kilometers respectively, making biodiversity research feasible and convenient. Malassezia furfur clinical strains (n = 29) isolated from different individuals, with or without associated dermatoses, of these two ethnic groups (15 Han and 12 Tibetan) were identified and analyzed with DNA fingerprinting using single primers specific to minisatellites. Using the Bionumerics software, we found that almost all M. furfur clinical isolates and type strains formed five distinct group clusters according to their associated skin diseases and the ethnic groups of the patients. These findings are the first to focus on the genetic diversity and relatedness of M. furfur in the Tibetan and Han ethnic groups in China and reveal genetic variation associated with related diseases, host ethnicity and geographic origin.

  13. A Randomly Amplified Polymorphic DNA Marker Specific for the Bacillus cereus Group Is Diagnostic for Bacillus anthracis

    PubMed Central

    Daffonchio, Daniele; Borin, Sara; Frova, Giuseppe; Gallo, Romina; Mori, Elena; Fani, Renato; Sorlini, Claudia

    1999-01-01

    Aiming to develop a DNA marker specific for Bacillus anthracis and able to discriminate this species from Bacillus cereus, Bacillus thuringiensis, and Bacillus mycoides, we applied the randomly amplified polymorphic DNA (RAPD) fingerprinting technique to a collection of 101 strains of the genus Bacillus, including 61 strains of the B. cereus group. An 838-bp RAPD marker (SG-850) specific for B. cereus, B. thuringiensis, B. anthracis, and B. mycoides was identified. This fragment included a putative (366-nucleotide) open reading frame highly homologous to the ypuA gene of Bacillus subtilis. The restriction analysis of the SG-850 fragment with AluI distinguished B. anthracis from the other species of the B. cereus group. PMID:10049896

  14. DNA binding by a new metallointercalator that contains a proflavine group bearing a hanging chelating unit.

    PubMed

    Bazzicalupi, Carla; Bencini, Andrea; Bianchi, Antonio; Biver, Tarita; Boggioni, Alessia; Bonacchi, Sara; Danesi, Andrea; Giorgi, Claudia; Gratteri, Paola; Ingraín, Antonio Marchal; Secco, Fernando; Sissi, Claudia; Valtancoli, Barbara; Venturini, Marcella

    2008-01-01

    The new bifunctional molecule 3,6-diamine-9-[6,6-bis(2-aminoethyl)-1,6-diaminohexyl]acridine (D), which is characterised by both an aromatic moiety and a separate metal-complexing polyamine centre, has been synthesised. The characteristics of D and its ZnII complex ([ZnD]) (protonation and metal-complexing constants, optical properties and self-aggregation phenomena) have been analysed by means of NMR spectroscopy, potentiometric, spectrophotometric and spectrofluorimetric techniques. The equilibria and kinetics of the binding process of D and [ZnD] to calf thymus DNA have been investigated at I=0.11 M (NaCl) and 298.1 K by using spectroscopic methods and the stopped-flow technique. Static measurements show biphasic behaviour for both D-DNA and [ZnD]-DNA systems; this reveals the occurrence of two different binding processes depending on the polymer-to-dye molar ratio (P/D). The binding mode that occurs at low P/D values is interpreted in terms of external binding with a notable contribution from the polyamine residue. The binding mode at high P/D values corresponds to intercalation of the proflavine residue. Stopped-flow, circular dichroism and supercoiled-DNA unwinding experiments corroborate the proposed mechanism. Molecular-modelling studies support the intercalative process and evidence the influence of NH+...O interactions between the protonated acridine nitrogen atom and the oxygen atoms of the polyanion; these interactions play a key role in determining the conformation of DNA adducts.

  15. Characterization of Giardia lamblia groups A and B from North India by isoenzyme and random amplified polymorphic DNA analysis.

    PubMed

    Paintlia, A S; Mahajan, R C; Chakraborti, A; Sehgal, R; Ganguly, N K

    1999-06-01

    Giardia lamblia (syn. G. intestinalis) infection in young adults leads to acute/chronic diarrhea in some individuals and is asymptomatic in others. Recently, G. lamblia strains have been characterized as group A (symptomatic) and group B (asymptomatic or control) by advanced isoenzyme and molecular biology studies. In the present brief pilot study, ten G. lamblia isolates obtained from five symptomatic (group A) and five asymptomatic (group B) persons were characterized by isoenzyme and random amplified polymorphic DNA (RAPD) analysis. Isoenzyme analysis demonstrated remarkable homogeneity in seven enzyme patterns, the exception, being that of phosphoglucomutase, for which two zymodemes (I and III) were observed. In contrast, RAPD analysis showed homogeneity for eight primers; exceptions were two primers, A02 and B05, which separated group A G. lamblia isolates into two rapdemes (A(R1) and A(R2)) and group B G. lamblia isolates into four rapdemes (B(R1), B(R2), B(R3) and B(R4)). Further phenetic analysis showed average genetic distances of 0.105 within group A and 0.121 within group B G. lamblia isolates according to Jaccord's distance scale, which suggests that both lineages appear to consist of a range of variants with no significant (P < 0.05) genetic diversity. The two techniques demonstrated a positive association with regard to differentiation between group A and group B G. lamblia isolates. These very preliminary results indicate that RAPD analysis could be a potentially useful substitute for isoenzyme analysis.

  16. Lay perceptions of predictive testing for diabetes based on DNA test results versus family history assessment: a focus group study

    PubMed Central

    2011-01-01

    Background This study assessed lay perceptions of issues related to predictive genetic testing for multifactorial diseases. These perceived issues may differ from the "classic" issues, e.g. autonomy, discrimination, and psychological harm that are considered important in predictive testing for monogenic disorders. In this study, type 2 diabetes was used as an example, and perceptions with regard to predictive testing based on DNA test results and family history assessment were compared. Methods Eight focus group interviews were held with 45 individuals aged 35-70 years with (n = 3) and without (n = 1) a family history of diabetes, mixed groups of these two (n = 2), and diabetes patients (n = 2). All interviews were transcribed and analysed using Atlas-ti. Results Most participants believed in the ability of a predictive test to identify people at risk for diabetes and to motivate preventive behaviour. Different reasons underlying motivation were considered when comparing DNA test results and a family history risk assessment. A perceived drawback of DNA testing was that diabetes was considered not severe enough for this type of risk assessment. In addition, diabetes family history assessment was not considered useful by some participants, since there are also other risk factors involved, not everyone has a diabetes family history or knows their family history, and it might have a negative influence on family relations. Respect for autonomy of individuals was emphasized more with regard to DNA testing than family history assessment. Other issues such as psychological harm, discrimination, and privacy were only briefly mentioned for both tests. Conclusion The results suggest that most participants believe a predictive genetic test could be used in the prevention of multifactorial disorders, such as diabetes, but indicate points to consider before both these tests are applied. These considerations differ with regard to the method of assessment (DNA test or obtaining

  17. Antitumor activities and interaction with DNA of oxaliplatin-type platinum complexes with linear or branched alkoxyacetates as leaving groups.

    PubMed

    Yin, Runting; Gou, Shaohua; Liu, Xia; Lou, Liguang

    2011-08-01

    Five oxaliplatin-typed platinum complexes containing trans-1R, 2R-diaminocyclohexane chelating platinum cores, characteristic of linear or branched alkoxycarboxylates as leaving groups, were biologically evaluated. These compounds showed higher antitumor activity, lower toxicity in vivo than cisplatin or oxaliplatin. And the results revealed that the antitumor activity and interaction with DNA of these compounds were highly related to the nature of leaving groups. Among these complexes, 5a, cis-(trans-1R, 2R-diaminocyclohexane) bis (2-tert-butoxyacetate) platinum(II), showed the highest antitumor activity and the lowest toxicity.

  18. Interspersed DNA repeats bcr1-bcr18 of Bacillus cereus group bacteria form three distinct groups with different evolutionary and functional patterns.

    PubMed

    Kristoffersen, Simen M; Tourasse, Nicolas J; Kolstø, Anne-Brit; Økstad, Ole Andreas

    2011-02-01

    Many short (<400 bp) interspersed sequence repeats exist in bacteria, yet little is known about their origins, mode of generation, or possible function. Here, we present a comprehensive analysis of 18 different previously identified repeated DNA elements, bcr1-bcr18 (Økstad OA, Hegna I, Lindback T, Rishovd AL, Kolstø AB. 1999. Genome organization is not conserved between Bacillus cereus and Bacillus subtilis. Microbiology. 145:621-631.; Tourasse NJ, Helgason E, Økstad OA, Hegna IK, Kolstø AB. 2006. The Bacillus cereus group: novel aspects of population structure and genome dynamics. J Appl Microbiol. 101:579-593.), in 36 sequenced genomes from the Bacillus cereus group of bacteria. This group consists of genetically closely related species with variable pathogenic specificity toward different hosts and includes among others B. anthracis, B. cereus, and B. thuringiensis. The B. cereus group repeat elements could be classified into three categories with different properties: Group A elements (bcr1-bcr3) exhibited highly variable copy numbers ranging from 4 to 116 copies per strain, showed a nonconserved chromosomal distribution pattern between strains, and displayed several features characteristic of mobile elements. Group B repeats (bcr4-bcr6) were present in 0-10 copies per strain and were associated with strain-specific genes and disruptions of genome synteny, implying a possible contribution to genome rearrangements and/or horizontal gene transfer events. bcr5, in particular, was associated with large gene clusters showing resemblance to integrons. In agreement with their potentially mobile nature or involvement in horizontal transfers, the sequences of the repeats from Groups A and B (bcr1-bcr6) followed a phylogeny different from that of the host strains. Conversely, repeats from Group C (bcr7-bcr18) had a conserved chromosomal location and orthologous gene neighbors in the investigated B. cereus group genomes, and their phylogeny matched that of the host

  19. Role of DNA Repair Factor Xeroderma Pigmentosum Protein Group C in Response to Replication Stress As Revealed by DNA Fragile Site Affinity Chromatography and Quantitative Proteomics.

    PubMed

    Beresova, Lucie; Vesela, Eva; Chamrad, Ivo; Voller, Jiri; Yamada, Masayuki; Furst, Tomas; Lenobel, Rene; Chroma, Katarina; Gursky, Jan; Krizova, Katerina; Mistrik, Martin; Bartek, Jiri

    2016-12-02

    Replication stress (RS) fuels genomic instability and cancer development and may contribute to aging, raising the need to identify factors involved in cellular responses to such stress. Here, we present a strategy for identification of factors affecting the maintenance of common fragile sites (CFSs), which are genomic loci that are particularly sensitive to RS and suffer from increased breakage and rearrangements in tumors. A DNA probe designed to match the high flexibility island sequence typical for the commonly expressed CFS (FRA16D) was used as specific DNA affinity bait. Proteins significantly enriched at the FRA16D fragment under normal and replication stress conditions were identified using stable isotope labeling of amino acids in cell culture-based quantitative mass spectrometry. The identified proteins interacting with the FRA16D fragment included some known CFS stabilizers, thereby validating this screening approach. Among the hits from our screen so far not implicated in CFS maintenance, we chose Xeroderma pigmentosum protein group C (XPC) for further characterization. XPC is a key factor in the DNA repair pathway known as global genomic nucleotide excision repair (GG-NER), a mechanism whose several components were enriched at the FRA16D fragment in our screen. Functional experiments revealed defective checkpoint signaling and escape of DNA replication intermediates into mitosis and the next generation of XPC-depleted cells exposed to RS. Overall, our results provide insights into an unexpected biological role of XPC in response to replication stress and document the power of proteomics-based screening strategies to elucidate mechanisms of pathophysiological significance.

  20. Microinjection of partially purified protein factor restores DNA damage specifically in group A of xeroderma pigmentosum cells

    SciTech Connect

    Yamaizumi, M.; Sugano, T.; Asahina, H.; Okada, Y.; Uchida, T.

    1986-03-01

    Microinjection of cell extracts prepared from both human placenta and HeLa cells into xeroderma pigmentosum (XP) cells of complementation group A restores unscheduled DNA synthesis (UDS) in these cells after UV irradiation. These cells also showed normal resistance to UV irradiation. The half-life of the factors in the cell extracts corresponding to the UDS activity (factor A) was 14 hr in XP cells of group A, and the maximal level of UDS was exerted 2 hr after microinjection. The factors were sensitive to protease treatment but not to RNase treatment and were found to be approx. = 160 and approx. = 90 kDa by gel filtration. These two fractions of the factor(s) acted specifically in XP cells of complementation group A among complementation groups A, B, C, D, F, G, and probably E and H.

  1. A novel virus genome discovered in an extreme environment suggests recombination between unrelated groups of RNA and DNA viruses

    PubMed Central

    2012-01-01

    Background Viruses are known to be the most abundant organisms on earth, yet little is known about their collective origin and evolutionary history. With exceptionally high rates of genetic mutation and mosaicism, it is not currently possible to resolve deep evolutionary histories of the known major virus groups. Metagenomics offers a potential means of establishing a more comprehensive view of viral evolution as vast amounts of new sequence data becomes available for comparative analysis. Results Bioinformatic analysis of viral metagenomic sequences derived from a hot, acidic lake revealed a circular, putatively single-stranded DNA virus encoding a major capsid protein similar to those found only in single-stranded RNA viruses. The presence and circular configuration of the complete virus genome was confirmed by inverse PCR amplification from native DNA extracted from lake sediment. The virus genome appears to be the result of a RNA-DNA recombination event between two ostensibly unrelated virus groups. Environmental sequence databases were examined for homologous genes arranged in similar configurations and three similar putative virus genomes from marine environments were identified. This result indicates the existence of a widespread but previously undetected group of viruses. Conclusions This unique viral genome carries implications for theories of virus emergence and evolution, as no mechanism for interviral RNA-DNA recombination has yet been identified, and only scant evidence exists that genetic exchange occurs between such distinct virus lineages. Reviewers This article was reviewed by EK, MK (nominated by PF) and AM. For the full reviews, please go to the Reviewers' comments section. PMID:22515485

  2. Cockayne syndrome group B protein regulates DNA double-strand break repair and checkpoint activation.

    PubMed

    Batenburg, Nicole L; Thompson, Elizabeth L; Hendrickson, Eric A; Zhu, Xu-Dong

    2015-05-12

    Mutations of CSB account for the majority of Cockayne syndrome (CS), a devastating hereditary disorder characterized by physical impairment, neurological degeneration and segmental premature aging. Here we report the generation of a human CSB-knockout cell line. We find that CSB facilitates HR and represses NHEJ. Loss of CSB or a CS-associated CSB mutation abrogating its ATPase activity impairs the recruitment of BRCA1, RPA and Rad51 proteins to damaged chromatin but promotes the formation of 53BP1-Rif1 damage foci in S and G2 cells. Depletion of 53BP1 rescues the formation of BRCA1 damage foci in CSB-knockout cells. In addition, knockout of CSB impairs the ATM- and Chk2-mediated DNA damage responses, promoting a premature entry into mitosis. Furthermore, we show that CSB accumulates at sites of DNA double-strand breaks (DSBs) in a transcription-dependent manner. The kinetics of DSB-induced chromatin association of CSB is distinct from that of its UV-induced chromatin association. These results reveal novel, important functions of CSB in regulating the DNA DSB repair pathway choice as well as G2/M checkpoint activation.

  3. The electrokinetic characterization of gold nanoparticles, functionalized with cationic functional groups, and its' interaction with DNA.

    PubMed

    Lazarus, Geraldine Genevive; Revaprasadu, Neerish; López-Viota, Julián; Singh, Moganavelli

    2014-09-01

    Gold nanoparticles have attracted strong biomedical interest for drug delivery due to their low toxic nature, surface plasmon resonance and capability of increasing the stability of the payload. However, gene transfection represents another important biological application. Considering that cellular barriers keep enclosed their secret to deliver genes using nanoparticles, an important step can be achieved by studying the functionalization of nanoparticles with DNA. In the present contribution the synthesis of nanoparticles consisting of a gold core coated with one or more layers of amino acid (l-lysine), and cationic polyelectrolytes (poly-ethyleneimine and poly-l-lysine) is reported. All nanoparticles were subjected to dynamic light scattering, electrophoretic mobility measurements, UV-vis optical spectrophotometry analysis and transmission electron microscopy imaging. In addition, the adsorption of DNA plasmid (pSGS) with linear and supercoiled configurations was studied for those gold nanoparticles under the most suitable surface modifications. Preliminary results showed that the gold nanoparticles functionalized with poly-ethyleneimine and poly-l-lysine, respectively, and bound to linear DNA configurations, present in absolute value a higher electrophoretic mobility irrespective of the pH of the media, compared to the supercoiled and nicked configuration. The findings from this study suggest that poly-ethyleneimine and poly-l-lysine functionalized gold nanoparticles are biocompatible and may be promising in the chemical design and future optimization of nanostructures for biomedical applications such as gene and drug delivery.

  4. Cockayne syndrome group B protein regulates DNA double-strand break repair and checkpoint activation

    PubMed Central

    Batenburg, Nicole L; Thompson, Elizabeth L; Hendrickson, Eric A; Zhu, Xu-Dong

    2015-01-01

    Mutations of CSB account for the majority of Cockayne syndrome (CS), a devastating hereditary disorder characterized by physical impairment, neurological degeneration and segmental premature aging. Here we report the generation of a human CSB-knockout cell line. We find that CSB facilitates HR and represses NHEJ. Loss of CSB or a CS-associated CSB mutation abrogating its ATPase activity impairs the recruitment of BRCA1, RPA and Rad51 proteins to damaged chromatin but promotes the formation of 53BP1-Rif1 damage foci in S and G2 cells. Depletion of 53BP1 rescues the formation of BRCA1 damage foci in CSB-knockout cells. In addition, knockout of CSB impairs the ATM- and Chk2-mediated DNA damage responses, promoting a premature entry into mitosis. Furthermore, we show that CSB accumulates at sites of DNA double-strand breaks (DSBs) in a transcription-dependent manner. The kinetics of DSB-induced chromatin association of CSB is distinct from that of its UV-induced chromatin association. These results reveal novel, important functions of CSB in regulating the DNA DSB repair pathway choice as well as G2/M checkpoint activation. PMID:25820262

  5. Multiple Group I Introns in the Small-Subunit rDNA of Botryosphaeria dothidea: Implication for Intraspecific Genetic Diversity

    PubMed Central

    Xu, Chao; Wang, Chunsheng; Sun, Xinyao; Zhang, Rong; Gleason, Mark L.; Eiji, Tanaka; Sun, Guangyu

    2013-01-01

    Botryosphaeria dothidea is a widespread and economically important pathogen on various fruit trees, and it often causes die-back and canker on limbs and fruit rot. In characterizing intraspecies genetic variation within this fungus, group I introns, rich in rDNA of fungi, may provide a productive region for exploration. In this research, we analysed complete small subunit (SSU) ribosomal DNA (rDNA) sequences of 37 B. dothidea strains, and found four insertions, designated Bdo.S943, Bdo.S1199-A, Bdo.S1199-B and Bdo.S1506, at three positions. Sequence analysis and structure prediction revealed that both Bdo.S943 and Bdo.S1506 belonged to subgroup IC1 of group I introns, whereas Bdo.S1199-A and Bdo.S1199-B corresponded to group IE introns. Moreover, Bdo.S1199-A was found to host an open reading frame (ORF) for encoding the homing endonuclease (HE), whereas Bdo.S1199-B, an evolutionary descendant of Bdo.S1199-A, included a degenerate HE. The above four introns were novel, and were the first group I introns observed and characterized in this species. Differential distribution of these introns revealed that all strains could be separated into four genotypes. Genotype III (no intron) and genotype IV (Bdo.S1199-B) were each found in only one strain, whereas genotype I (Bdo.S1199-A) and genotype II (Bdo.S943 and Bdo.S1506) occurred in 95% of the strains. There is a correlation between B. dothidea genotypes and hosts or geographic locations. Thus, these newly discovered group I introns can help to advance understanding of genetic differentiation within B. dothidea. PMID:23844098

  6. Multiple group I introns in the small-subunit rDNA of Botryosphaeria dothidea: implication for intraspecific genetic diversity.

    PubMed

    Xu, Chao; Wang, Chunsheng; Sun, Xinyao; Zhang, Rong; Gleason, Mark L; Eiji, Tanaka; Sun, Guangyu

    2013-01-01

    Botryosphaeria dothidea is a widespread and economically important pathogen on various fruit trees, and it often causes die-back and canker on limbs and fruit rot. In characterizing intraspecies genetic variation within this fungus, group I introns, rich in rDNA of fungi, may provide a productive region for exploration. In this research, we analysed complete small subunit (SSU) ribosomal DNA (rDNA) sequences of 37 B. dothidea strains, and found four insertions, designated Bdo.S943, Bdo.S1199-A, Bdo.S1199-B and Bdo.S1506, at three positions. Sequence analysis and structure prediction revealed that both Bdo.S943 and Bdo.S1506 belonged to subgroup IC1 of group I introns, whereas Bdo.S1199-A and Bdo.S1199-B corresponded to group IE introns. Moreover, Bdo.S1199-A was found to host an open reading frame (ORF) for encoding the homing endonuclease (HE), whereas Bdo.S1199-B, an evolutionary descendant of Bdo.S1199-A, included a degenerate HE. The above four introns were novel, and were the first group I introns observed and characterized in this species. Differential distribution of these introns revealed that all strains could be separated into four genotypes. Genotype III (no intron) and genotype IV (Bdo.S1199-B) were each found in only one strain, whereas genotype I (Bdo.S1199-A) and genotype II (Bdo.S943 and Bdo.S1506) occurred in 95% of the strains. There is a correlation between B. dothidea genotypes and hosts or geographic locations. Thus, these newly discovered group I introns can help to advance understanding of genetic differentiation within B. dothidea.

  7. Promising genomic transfectant into Xeroderma pigmentosum group A with highly amplified mouse DNA and intermediate UV resistance turns revertant

    SciTech Connect

    Blum, M.; Baumann, I.; Lohrer, H.; Rahmsdorf, H.J.; Herrlich, P.

    1989-04-28

    Following transfection of genomic mouse DNA into an SV40 transformed fibroblast cell line from a patient with Xeroderma pigmentosum (complementation group A, XPA), a single UV resistant cell clone was isolated out of a total of 10(4) independent transfectants. The recipient XPA cell line has as yet not produced spontaneous revertants among 2.2 x 10(8) cells. The isolated cell clone contains 50-70 kb of mouse sequences which are heavily amplified (500-fold), and has acquired both intermediate resistance to UV killing and intermediate unscheduled DNA synthesis (UDS) capacity. By continued passage without selective pressure, cells were generated, which had lost both the dominant marker gene and repetitive mouse sequences. Single colonies of these cells were still intermediately resistant to UV suggesting that either undetected unique mouse DNA had segregated from the bulk of repetitive DNA, or, more likely, that the initially isolated transfectant was a spontaneous revertant. This documents that a persuasive clone isolated can still be a false positive (spontaneous revertant) and that an extremely laborious approach may lead into a dead end.

  8. Preparation of carboxyl group-modified palladium nanoparticles in an aqueous solution and their conjugation with DNA

    NASA Astrophysics Data System (ADS)

    Wang, Zhifei; Li, Hongying; Zhen, Shuang; He, Nongyue

    2012-05-01

    The use of nanomaterials in biomolecular labeling and their corresponding detection has been attracting much attention, recently. There are currently very few studies on palladium nanoparticles (Pd NPs) due to their lack of appropriate surface functionalities for conjugation with DNA. In this paper, we thus firstly present an approach to prepare carboxyl group-modified Pd NPs (with an average size of 6 nm) by the use of 11-mercaptoundecanoic acid (MUDA) as a stabilizer in the aqueous solution. The effect of the various reducing reaction conditions on the morphology of the Pd NPs was investigated. The particles were further characterized by TEM, UV-vis, FT-IR and XPS techniques. DNA was finally covalently conjugated to the surface of the Pd NPs through the activation of the carboxyl group, which was confirmed by agarose gel electrophoresis and fluorescence analysis. The resulting Pd NPs-DNA conjugates show high single base pair mismatch discrimination capabilities. This work therefore sets a good foundation for further applications of Pd NPs in bio-analytical research.

  9. Comparison of base composition analysis and Sanger sequencing of mitochondrial DNA for four U.S. population groups.

    PubMed

    Kiesler, Kevin M; Coble, Michael D; Hall, Thomas A; Vallone, Peter M

    2014-01-01

    A set of 711 samples from four U.S. population groups was analyzed using a novel mass spectrometry based method for mitochondrial DNA (mtDNA) base composition profiling. Comparison of the mass spectrometry results with Sanger sequencing derived data yielded a concordance rate of 99.97%. Length heteroplasmy was identified in 46% of samples and point heteroplasmy was observed in 6.6% of samples in the combined mass spectral and Sanger data set. Using discrimination capacity as a metric, Sanger sequencing of the full control region had the highest discriminatory power, followed by the mass spectrometry base composition method, which was more discriminating than Sanger sequencing of just the hypervariable regions. This trend is in agreement with the number of nucleotides covered by each of the three assays.

  10. Three Group-I introns in 18S rDNA of Endosymbiotic Algae of Paramecium bursaria from Japan

    NASA Astrophysics Data System (ADS)

    Hoshina, Ryo; Kamako, Shin-ichiro; Imamura, Nobutaka

    2004-08-01

    In the nuclear encoded small subunit ribosomal DNA (18S rDNA) of symbiotic alga of Paramecium bursaria (F36 collected in Japan) possesses three intron-like insertions (Hoshina et al., unpubl. data, 2003). The present study confirmed these exact lengths and insertion sites by reverse transcription-PCR. Two of them were inserted at Escherichia coli 16S rRNA genic position 943 and 1512 that are frequent intron insertion positions, but another insertion position (nearly 1370) was the first finding. Their secondary structures suggested they belong to Group-I intron; one belongs to subgroup IE, others belong to subgroup IC1. Similarity search indicated these introns are ancestral ones.

  11. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  12. Rapid Plant Identification Using Species- and Group-Specific Primers Targeting Chloroplast DNA

    PubMed Central

    Staudacher, Karin; Schallhart, Nikolaus; Mitterrutzner, Evi; Steiner, Eva-Maria; Thalinger, Bettina; Traugott, Michael

    2012-01-01

    Plant identification is challenging when no morphologically assignable parts are available. There is a lack of broadly applicable methods for identifying plants in this situation, for example when roots grow in mixture and for decayed or semi-digested plant material. These difficulties have also impeded the progress made in ecological disciplines such as soil- and trophic ecology. Here, a PCR-based approach is presented which allows identifying a variety of plant taxa commonly occurring in Central European agricultural land. Based on the trnT-F cpDNA region, PCR assays were developed to identify two plant families (Poaceae and Apiaceae), the genera Trifolium and Plantago, and nine plant species: Achillea millefolium, Fagopyrum esculentum, Lolium perenne, Lupinus angustifolius, Phaseolus coccineus, Sinapis alba, Taraxacum officinale, Triticum aestivum, and Zea mays. These assays allowed identification of plants based on size-specific amplicons ranging from 116 bp to 381 bp. Their specificity and sensitivity was consistently high, enabling the detection of small amounts of plant DNA, for example, in decaying plant material and in the intestine or faeces of herbivores. To increase the efficacy of identifying plant species from large number of samples, specific primers were combined in multiplex PCRs, allowing screening for multiple species within a single reaction. The molecular assays outlined here will be applicable manifold, such as for root- and leaf litter identification, botanical trace evidence, and the analysis of herbivory. PMID:22253728

  13. Rapid plant identification using species- and group-specific primers targeting chloroplast DNA.

    PubMed

    Wallinger, Corinna; Juen, Anita; Staudacher, Karin; Schallhart, Nikolaus; Mitterrutzner, Evi; Steiner, Eva-Maria; Thalinger, Bettina; Traugott, Michael

    2012-01-01

    Plant identification is challenging when no morphologically assignable parts are available. There is a lack of broadly applicable methods for identifying plants in this situation, for example when roots grow in mixture and for decayed or semi-digested plant material. These difficulties have also impeded the progress made in ecological disciplines such as soil- and trophic ecology. Here, a PCR-based approach is presented which allows identifying a variety of plant taxa commonly occurring in Central European agricultural land. Based on the trnT-F cpDNA region, PCR assays were developed to identify two plant families (Poaceae and Apiaceae), the genera Trifolium and Plantago, and nine plant species: Achillea millefolium, Fagopyrum esculentum, Lolium perenne, Lupinus angustifolius, Phaseolus coccineus, Sinapis alba, Taraxacum officinale, Triticum aestivum, and Zea mays. These assays allowed identification of plants based on size-specific amplicons ranging from 116 bp to 381 bp. Their specificity and sensitivity was consistently high, enabling the detection of small amounts of plant DNA, for example, in decaying plant material and in the intestine or faeces of herbivores. To increase the efficacy of identifying plant species from large number of samples, specific primers were combined in multiplex PCRs, allowing screening for multiple species within a single reaction. The molecular assays outlined here will be applicable manifold, such as for root- and leaf litter identification, botanical trace evidence, and the analysis of herbivory.

  14. Integrated DNA methylation and copy-number profiling identify three clinically and biologically relevant groups of anaplastic glioma.

    PubMed

    Wiestler, Benedikt; Capper, David; Sill, Martin; Jones, David T W; Hovestadt, Volker; Sturm, Dominik; Koelsche, Christian; Bertoni, Anna; Schweizer, Leonille; Korshunov, Andrey; Weiß, Elisa K; Schliesser, Maximilian G; Radbruch, Alexander; Herold-Mende, Christel; Roth, Patrick; Unterberg, Andreas; Hartmann, Christian; Pietsch, Torsten; Reifenberger, Guido; Lichter, Peter; Radlwimmer, Bernhard; Platten, Michael; Pfister, Stefan M; von Deimling, Andreas; Weller, Michael; Wick, Wolfgang

    2014-10-01

    The outcome of patients with anaplastic gliomas varies considerably. Whether a molecular classification of anaplastic gliomas based on large-scale genomic or epigenomic analyses is superior to histopathology for reflecting distinct biological groups, predicting outcomes and guiding therapy decisions has yet to be determined. Epigenome-wide DNA methylation analysis, using a platform which also allows the detection of copy-number aberrations, was performed in a cohort of 228 patients with anaplastic gliomas (astrocytomas, oligoastrocytomas, and oligodendrogliomas), including 115 patients of the NOA-04 trial. We further compared these tumors with a group of 55 glioblastomas. Unsupervised clustering of DNA methylation patterns revealed two main groups correlated with IDH status: CpG island methylator phenotype (CIMP) positive (77.5 %) or negative (22.5 %). CIMP(pos) (IDH mutant) tumors showed a further separation based on copy-number status of chromosome arms 1p and 19q. CIMP(neg) (IDH wild type) tumors showed hallmark copy-number alterations of glioblastomas, and clustered together with CIMP(neg) glioblastomas without forming separate groups based on WHO grade. Notably, there was no molecular evidence for a distinct biological entity representing anaplastic oligoastrocytoma. Tumor classification based on CIMP and 1p/19q status was significantly associated with survival, allowing a better prediction of outcome than the current histopathological classification: patients with CIMP(pos) tumors with 1p/19q codeletion (CIMP-codel) had the best prognosis, followed by patients with CIMP(pos) tumors but intact 1p/19q status (CIMP-non-codel). Patients with CIMP(neg) anaplastic gliomas (GBM-like) had the worst prognosis. Collectively, our data suggest that anaplastic gliomas can be grouped by IDH and 1p/19q status into three molecular groups that show clear links to underlying biology and a significant association with clinical outcome in a prospective trial cohort.

  15. Complementation of DNA repair defect in xeroderma pigmentosum cells of group C by the transfer of human chromosome 5

    SciTech Connect

    Kaur, G.P.; Athwal, R.S. )

    1993-01-01

    Complementation of DNA excision repair defect in xeroderma pigmentosum cells of group C (XP-C) has been achieved by the transfer of human chromosome 5. Individual human chromosomes tagged with a selectable marker were transferred to XP-C cells by microcell fusion from mouse-human hybrid cell lines each bearing a single different human chromosome. Analysis of the chromosome transfer clones revealed that introduction of chromosome 5 into XP-C cells corrected the DNA repair defect as well as UV-sensitive phenotypes, while chromosomes 2, 6, 7, 9, 13, 15, 17, and 21 failed to complement. The introduced chromosome 5 in complemented UV[sup r] clones was distinguished from the parental XP-C chromosomes by polymorphism for dinucleotide (CA)[sub n] repeats at two loci, D5S117 and D5S209. In addition, an intact marked chromosome 5 was rescued into mouse cells from a complemented UV[sup r] clone by microcell fusion. Five subclones of a complemented clone that had lost the marked chromosome 5 exhibited UV-sensitive and repair-deficient phenotypes identical to parental XP-C cells. Concordant loss of the transferred chromosome and reappearance of XP-C phenotype further confirmed the presence of a DNA repair gene on human chromosome 5. 38 refs., 7 figs., 1 tab.

  16. Population genetics of coagulant factor IX: frequencies of two DNA polymorphisms in five ethnic groups.

    PubMed Central

    Lubahn, D B; Lord, S T; Bosco, J; Kirshtein, J; Jeffries, O J; Parker, N; Levtzow, C; Silverman, L M; Graham, J B

    1987-01-01

    Two frequently used restriction-enzyme polymorphisms (RFLPs) of coagulant F.IX, TaqI and XmnI, have been examined in five ethnic groups: white Americans, black Americans, East Indians, Chinese, and Malays. There is a distinct "cline" in the frequencies of both polymorphisms, from white Americans to Malays. The rarer type 2 alleles of both polymorphisms, in which middle recognition sites are present--and which in our sample reach their highest frequencies in white Americans--are marginally higher in four groups of Europeans previously reported by others. The frequencies of the rarer alleles are significantly higher in Europeans than in black Americans and East Indians, and these alleles are essentially absent in Chinese and Malays. The frequency of heterozygosity diminishes in the same order, being zero in Malays for both polymorphisms. The polymorphisms are in strong linkage disequilibrium, and in all groups the type 1 allele for TaqI is disproportionately accompanied by the type 1 allele for XmnI. The paucity of type 2 alleles and the low rate of heterozygosity in four non-European groups suggest that the polymorphisms will be of little diagnostic value south of Gibraltar and east of Suez. This prediction is confirmed by the observed haplotype frequencies in the black American and the Oriental groups. PMID:2884869

  17. Group I introns in small subunit ribosomal DNA of several Phaeosphaeria species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a study of small subunit ribosomal RNA (SSU-rRNA) gene sequences in Phaeosphaeria species, group I introns were found in 9 of 10 P. avenaria f.sp. avenaria (Paa) isolates, 1 of 2 Phaeosphaeria sp. (P-rye) isolates from Polish rye (Sn48-1), 1 Phaeosphaeria sp. from dallis grass (P-dg) (S-93-48) an...

  18. The RNA polymerase I transactivator upstream binding factor requires its dimerization domain and high-mobility-group (HMG) box 1 to bend, wrap, and positively supercoil enhancer DNA.

    PubMed Central

    Putnam, C D; Copenhaver, G P; Denton, M L; Pikaard, C S

    1994-01-01

    Upstream binding factor (UBF) is an important transactivator of RNA polymerase I and is a member of a family of proteins that contain nucleic acid binding domains named high-mobility-group (HMG) boxes because of their similarity to HMG chromosomal proteins. UBF is a highly sequence-tolerant DNA-binding protein for which no binding consensus sequence has been identified. Therefore, it has been suggested that UBF may recognize preformed structural features of DNA, a hypothesis supported by UBF's ability to bind synthetic DNA cruciforms, four-way junctions, and even tRNA. We show here that full-length UBF can also bend linear DNA to mediate circularization of probes as small as 102 bp in the presence of DNA ligase. Longer probes in the presence of UBF become positively supercoiled when ligated, suggesting that UBF wraps the DNA in a right-handed direction, opposite the direction of DNA wrapping around a nucleosome. The dimerization domain and HMG box 1 are necessary and sufficient to circularize short probes and supercoil longer probes in the presence of DNA ligase. UBF's sequence tolerance coupled with its ability to bend and wrap DNA makes UBF an unusual eukaryotic transcription factor. However, UBF's ability to bend DNA might explain how upstream and downstream rRNA gene promoter domains interact. UBF-induced DNA wrapping could also be a mechanism by which UBF counteracts histone-mediated gene repression. Images PMID:7935371

  19. The Detection of Spotted Fever Group Rickettsia DNA in Tick Samples From Pastoral Communities in Kenya.

    PubMed

    Koka, Hellen; Sang, Rosemary; Kutima, Helen Lydia; Musila, Lillian

    2017-01-10

    In this study, ticks from pastoral communities in Kenya were tested for Rickettsia spp. infections in geographical regions where the presence of tick-borne arboviruses had previously been reported. Rickettsial and arbovirus infections have similar clinical features which makes differential diagnosis challenging when both diseases occur. The tick samples were tested for Rickettsia spp. by conventional PCR using three primer sets targeting the gltA, ompA, and ompB genes followed by amplicon sequencing. Of the tick pools screened, 25% (95/380) were positive for Rickettsia spp. DNA using the gltA primer set. Of the tick-positive pools, 60% were ticks collected from camels. Rickettsia aeschlimannii and R. africae were the main Rickettsia spp. detected in the tick pools sequenced. The findings of this study indicate that multiple Rickettsia species are circulating in ticks from pastoral communities in Kenya and could contribute to the etiology of febrile illness in these areas. Diagnosis and treatment of rickettsial infections should be a public health priority in these regions.

  20. Testing the validity of Northern European species in the Chrysis ignita species group (Hymenoptera: Chrysididae) with DNA barcoding.

    PubMed

    Soon, Villu; Budrys, Eduardas; Orlovskytė, Svetlana; Paukkunen, Juho; Odegaard, Frode; Ljubomirov, Toshko; Saarma, Urmas

    2014-04-10

    Containing more than a hundred species, the Chrysis ignita species group is the largest and one of the most taxonomically challenging groups in its genus. It has not been possible to resolve the taxonomy of the group using traditional methods due to the lack of robust diagnostic morphological characters. Here we present the results of a molecular analysis designed to delimit species in the Chrysis ignita group for the first time; using mitochondrial sequence data for 364 in-group specimens consisting of all 18 species known to occur in Northern Europe. Two mitochondrial loci were analysed: a COI gene fragment, and a continuous DNA sequence consisting of 16S rRNA, tRNAVal, 12S rRNA and ND4. Two approaches were employed for delimiting species: (1) genetic distance analysis based on the standard COI barcode sequences and; (2) phylogenetic analysis of the COI fragment together with rRNA genes. Both analyses yielded trees with similar topology, but support values for nodes were higher using the second approach. Fifteen species were distinguished in all analyses: Chrysis angustula Schenck, 1856, C. brevitarsis Thomson, 1870, C. clarinicollis Linsenmaier, 1951, C. corusca Valkeila, 1971, C. fulgida Linnaeus, 1761, C. ignita (Linnaeus, 1758), C. impressa Schenck, 1856, C. iris Christ, 1791, C. leptomandibularis Niehuis, 2000, C. longula Abeille de Perrin, 1879, C. ruddii Shuckard, 1837, C. schencki Linsenmaier, 1968, C. subcoriacea Linsenmaier, 1959, C. terminata Dahlbom, 1854 and C. vanlithi Linsenmaier, 1959. The specific status of C. mediata Linsenmaier, 1951 and C. solida Haupt, 1957 was not resolved. Included unidentified specimens grouped in three clusters, two of which are distinctly delimited and apparently represent cryptic species. The specific status of the unidentified samples in the third cluster remained unclear. Moreover, our data suggest the existence of additional cryptic species currently lumped under the names C. pseudobrevitarsis Linsenmaier

  1. DNA fingerprinting and anastomosis grouping reveal similar genetic diversity in Rhizoctonia species infecting turfgrasses in the transition zone of USA.

    PubMed

    Amaradasa, B S; Horvath, B J; Lakshman, D K; Warnke, S E

    2013-01-01

    Rhizoctonia blight is a common and serious disease of many turfgrass species. The most widespread causal agent, Thanatephorus cucumeris (anamorph: R. solani), consists of several genetically different subpopulations. In addition, Waitea circinata varieties zeae, oryzae and circinata (anamorph: Rhizoctonia spp.) also can cause the disease. Accurate identification of the causal pathogen is important for effective management of the disease. It is challenging to distinguish the specific causal pathogen based on disease symptoms or macroscopic and microscopic morphology. Traditional methods such as anastomosis reactions with tester isolates are time consuming and sometimes difficult to interpret. In the present study universally primed PCR (UP-PCR) fingerprinting was used to assess genetic diversity of Rhizoctonia spp. infecting turfgrasses. Eighty-four Rhizoctonia isolates were sampled from diseased turfgrass leaves from seven distinct geographic areas in Virginia and Maryland. Rhizoctonia isolates were characterized by ribosomal DNA internal transcribed spacer (rDNA-ITS) region and UP-PCR. The isolates formed seven clusters based on ITS sequences analysis and unweighted pair group method with arithmetic mean (UPGMA) clustering of UP-PCR markers, which corresponded well with anastomosis groups (AGs) of the isolates. Isolates of R. solani AG 1-IB (n = 18), AG 2-2IIIB (n = 30) and AG 5 (n = 1) clustered separately. Waitea circinata var. zeae (n = 9) and var. circinata (n = 4) grouped separately. A cluster of six isolates of Waitea (UWC) did not fall into any known Waitea variety. The binucleate Rhizoctonia-like fungi (BNR) (n = 16) clustered into two groups. Rhizoctonia solani AG 2-2IIIB was the most dominant pathogen in this study, followed by AG 1-IB. There was no relationship between the geographic origin of the isolates and clustering of isolates based on the genetic associations. To our knowledge this is the first time UP-PCR was used to characterize Rhizoctonia

  2. Synthesis and DNA transfection properties of new head group modified malonic acid diamides.

    PubMed

    Wölk, Christian; Heinze, Martin; Kreideweiss, Patrick; Dittrich, Matthias; Brezesinski, Gerald; Langner, Andreas; Dobner, Bodo

    2011-05-16

    Malonic acid diamides with two long hydrophobic alkyl chains and a basic polar head group as a new class of non-viral gene transferring compounds have shown high transfection efficiency and moderate toxicity. Based on the results obtained with saturated and unsaturated alkyl residues new derivatives with a more complex head group structure have been synthesized. For this purpose, cationic respectively basic groups were introduced by one or two lysine residues bound via tris(aminoethyl)amine spacer to the malonic acid diamide backbone. By studying in vitro gene delivery an increase of transfection efficacy was observed when using lipids with at least one unsaturated alkyl chain. This leads to cationic lipids exhibiting comparable or even higher transfection efficacies compared to the commercially available transfection agents LipofectAmine™ and SuperFect™. Phase transitions and phase structures of selected compounds have been analyzed and discussed in terms of transfection abilities. Particle size and zeta potential of liposomes and lipoplexes were also determined.

  3. Molecular phylogenetic analysis of the genus Gyrodactylus (Platyhelminthes: Monogenea) inferred from rDNA ITS region: subgenera versus species groups.

    PubMed

    Matejusová, I; Gelnar, M; Verneau, O; Cunningham, C O; Littlewood, D T J

    2003-12-01

    Analyses of small subunit ribosomal RNA gene sequences of representatives of major taxa of Monopisthocotylea were performed to identify the sister group of Gyrodactylus. Nuclear ribosomal DNA sequences from the complete internal transcribed spacer (ITS) region were used to infer phylogeny of 37 Gyrodactylus species and Gyrodactyloides bychowskii, Macrogyrodactylus polypteri and Gyrdicotylus gallieni, using maximum likelihood, parsimony and Bayesian inference. The genus Gyrodactylus appeared to be a monophyletic group in all analyses, based on the present data set. Within the genus, there were 3 major groups recognized by high bootstrap values and posterior probabilities. None of the 6 subgenera appeared to be monophyletic, and the most basal subgenus G. (Gyrodactylus) was paraphyletic. Characteristics of the excretory system of Gyrodactylus do not seem to be conservative enough to reveal subgenera within Gyrodactylus and we suggest abandoning existing subgenera as indicators of phylogeny. The grouping of species based on the morphology of the ventral bar and marginal hooks seems to have sufficient power to infer relationships between the Gyrodactylus species.

  4. DNA-based typing of Kell, Kidd, MNS, Dombrock, Colton, and Yt blood group systems in the French Basques.

    PubMed

    Touinssi, Mhammed; Chiaroni, Jacques; Degioanni, Anna; Granier, Thomas; Dutour, Olivier; Bailly, Pascal; Bauduer, Frédéric

    2008-01-01

    The Basques demonstrate peculiar characteristics regarding blood group systems. Although ABO, Rhesus, and Duffy have been extensively studied in this population, the distribution of other groups remains largely unknown. Therefore, we evaluated the frequency of less-explored- or still noninvestigated blood groups using DNA-based assays and interpreted these data in the view of population genetics. Polymorphisms of KEL (Kell), SLCA14A1 (Kidd), GYPA/GYPB (MNS), ART4 (Dombrock), AQP1 (Colton), and ACHE (Yt) blood group genes were determined from a sample of more than 100 autochthonous French Basques using allele-specific primer PCR (PCR-ASP) methods. Our results were compared with those previously obtained by the use of serology from both Basque and non-Basque European populations. MNS*1 and JK*1 allele frequencies were comparable with those reported from Basque samples. Conversely, the KEL*1 allele frequency differed significantly. To our knowledge, this is the first time that the other three systems are studied in the Basque population. DO*1 and CO*1 allele frequencies, being respectively 0.35 and 0.96, were significantly inferior to those published from various European populations. There were some discrepancies regarding these six blood systems when comparing molecular typing with serology. These findings may be explained by differences in either criteria for individual selection or technical assays. Nevertheless, these results constitute additional data to be included in the chapter of Basque biological anthropology.

  5. Effect of point substitutions within the minimal DNA-binding domain of xeroderma pigmentosum group A protein on interaction with DNA intermediates of nucleotide excision repair.

    PubMed

    Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I

    2014-06-01

    Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants.

  6. DNA polymerase gene sequences indicate western and forest tent caterpillar viruses form a new taxonomic group within baculoviruses.

    PubMed

    Nielsen, Cydney B; Cooper, Dawn; Short, Steven M; Myers, Judith H; Suttle, Curtis A

    2002-11-01

    Baculoviruses infect larval lepidopterans, and thus have potential value as microbial controls of agricultural and forest pests. Understanding their genetic relatedness and host specificity is relevant to the risk assessment of viral insecticides if non-target impacts are to be avoided. DNA polymerase gene sequences have been demonstrated to be useful for inferring genetic relatedness among dsDNA viruses. We have adopted this approach to examine the relatedness among natural isolates of two uncharacterized caterpillar-infecting baculoviruses, Malacosoma californicum pluviale nucleopolyhedrovirus (McplMNPV) and Malacosoma disstria nucleopolyhedrovirus (MadiMNPV), which infect two closely related host species with little to no cross-infectivity. We designed two degenerate primers (BVP1 and BVP2) based on protein motifs conserved among baculoviruses. McplMNPV and MadiMNPV viral DNA was obtained from naturally infected caterpillars collected from geographically distinct sites in the Southern Gulf Islands and Prince George regions of British Columbia, Canada. Sequencing of 0.9 kb PCR amplicons from six McplMNPV and six MadiMNPV isolates obtained from a total of eight sites, revealed very low nucleotide variation among McplMNPV isolates (99.2-100% nucleotide identity) and among MadiMNPV isolates (98.9-100% nucleotide identity). Greater nucleotide variation was observed between viral isolates from the two different caterpillar species (only 84.7-86.1% nucleotide identity). Both maximum parsimony and maximum likelihood phylogenetic analyses support placement of McplMNPV and MadiMNPV in a clade that is distinct from other groups of baculoviruses.

  7. Novel function of the Fanconi anemia group J or RECQ1 helicase to disrupt protein-DNA complexes in a replication protein A-stimulated manner.

    PubMed

    Sommers, Joshua A; Banerjee, Taraswi; Hinds, Twila; Wan, Bingbing; Wold, Marc S; Lei, Ming; Brosh, Robert M

    2014-07-18

    Understanding how cellular machinery deals with chromosomal genome complexity is an important question because protein bound to DNA may affect various cellular processes of nucleic acid metabolism. DNA helicases are at the forefront of such processes, yet there is only limited knowledge how they remodel protein-DNA complexes and how these mechanisms are regulated. We have determined that representative human RecQ and Fe-S cluster DNA helicases are potently blocked by a protein-DNA interaction. The Fanconi anemia group J (FANCJ) helicase partners with the single-stranded DNA-binding protein replication protein A (RPA) to displace BamHI-E111A bound to duplex DNA in a specific manner. Protein displacement was dependent on the ATPase-driven function of the helicase and unique properties of RPA. Further biochemical studies demonstrated that the shelterin proteins TRF1 and TRF2, which preferentially bind the telomeric repeat found at chromosome ends, effectively block FANCJ from unwinding the forked duplex telomeric substrate. RPA, but not the Escherichia coli single-stranded DNA-binding protein or shelterin factor Pot1, stimulated FANCJ ejection of TRF1 from the telomeric DNA substrate. FANCJ was also able to displace TRF2 from the telomeric substrate in an RPA-dependent manner. The stimulation of helicase-catalyzed protein displacement is also observed with the DNA helicase RECQ1, suggesting a conserved functional interaction of RPA-interacting helicases. These findings suggest that partnerships between RPA and interacting human DNA helicases may greatly enhance their ability to dislodge proteins bound to duplex DNA, an activity that is likely to be highly relevant to their biological roles in DNA metabolism.

  8. Japanese Wolves are Genetically Divided into Two Groups Based on an 8-Nucleotide Insertion/Deletion within the mtDNA Control Region.

    PubMed

    Ishiguro, Naotaka; Inoshima, Yasuo; Yanai, Tokuma; Sasaki, Motoki; Matsui, Akira; Kikuchi, Hiroki; Maruyama, Masashi; Hongo, Hitomi; Vostretsov, Yuri E; Gasilin, Viatcheslav; Kosintsev, Pavel A; Quanjia, Chen; Chunxue, Wang

    2016-02-01

    The mitochondrial DNA (mtDNA) control region (198- to 598-bp) of four ancient Canis specimens (two Canis mandibles, a cranium, and a first phalanx) was examined, and each specimen was genetically identified as Japanese wolf. Two unique nucleotide substitutions, the 78-C insertion and the 482-G deletion, both of which are specific for Japanese wolf, were observed in each sample. Based on the mtDNA sequences analyzed, these four specimens and 10 additional Japanese wolf samples could be classified into two groups- Group A (10 samples) and Group B (4 samples)-which contain or lack an 8-bp insertion/deletion (indel), respectively. Interestingly, three dogs (Akita-b, Kishu 25, and S-husky 102) that each contained Japanese wolf-specific features were also classified into Group A or B based on the 8-bp indel. To determine the origin or ancestor of the Japanese wolf, mtDNA control regions of ancient continental Canis specimens were examined; 84 specimens were from Russia, and 29 were from China. However, none of these 113 specimens contained Japanese wolf-specific sequences. Moreover, none of 426 Japanese modern hunting dogs examined contained these Japanese wolf-specific mtDNA sequences. The mtDNA control region sequences of Groups A and B appeared to be unique to grey wolf and dog populations.

  9. Drosophila Polycomb-group regulated chromatin inhibits the accessibility of a trans-activator to its target DNA.

    PubMed Central

    Zink, D; Paro, R

    1995-01-01

    The genes of the Polycomb-group (Pc-G) are responsible for maintaining the inactive expression state of homeotic genes. They act through specific cis-regulatory DNA elements termed PREs (Pc-G Response Elements). Multimeric complexes containing the Pc-G proteins are thought to induce heterochromatin-like structures, which stably and heritably inactivate transcription. We have tested the functional role of the FAB fragment, a PRE of the bithorax complex. We find that this element behaves as an orientation dependent silencer, capable of inducing mosaic gene expression on neighboring genes. Transgenic fly lines were constructed containing a PRE adjacent to a reporter gene inducible by the yeast GAL4 trans-activator. The competition between the activator and Pc-G-containing chromatin was visualized on polytene chromosomes using immunocytochemistry. The Pc-G protein Polycomb and GAL4 have mutually exclusive binding patterns, supporting the notion that Pc-G-induced chromatin structures can prevent activators from binding to their target sequences. However, this antagonistic function can be overcome by high doses of GAL4, even in the absence of DNA replication. Images PMID:8521823

  10. Problems in Mitochondrial DNA forensics: while interpreting length heteroplasmy conundrum of various Sindhi and Baluchi ethnic groups of Pakistan.

    PubMed

    Bhatti, Shahzad; Aslam Khan, Muhammad; Abbas, Sana; Attimonelli, Marcella; Gonzalez, Gerardo Rodriguez; Aydin, Hikmet Hakan; de Souza, Erica Martinha Silva

    2017-04-09

    The insight heterodox genetics of mtDNA infer new perspectives at the level of human mitochondrial control region heteroplasmy, which is substantial in evolutionary as well as forensic interpretation. The main goal of this study is to interrogate the recurrence and resolve the ambiguity of blurry spectrum of heteroplasmy in the human mtDNA control region of 50 Baluchi and 116 Sindhi unrelated individuals. Sanger sequencing was employed classically, that was further investigated by minisequencing. Only 20% Baluchi and 25.8% Sindhi were homoplasmic, whereas rest of 80% Baluchi and 74.1% Sindhi exhibited at least one heteroplasmy within the specimen. In total, 166 individuals have length heteroplasmy (LH) found at positions 16189, 303-315, 568-573, and 514-524, whilst point mutation heteroplasmy (PMH) was detected at positions 73, 16093, 16189, and 16234, respectively. Overall LH was observed albeit high frequency in Sindhi ethnic group (82%) rather than Baluchi's (37%), whereas PMH accumulation was relatively extensive (24%) in Baluchi's than Sindhi's (11.2%). The obtained results ascertained that growing knowledge of heteroplasmy assisted to develop consciences in the forensic community that heteroplasmy plays a pivotal role in the legal interpretation on a regular basis and knowledge of its biological underpinnings has a vital niche in the forensic science. Limited studies have focused on heteroplasmy, yet scientific attention should be given, in order to determine its magnitude in different ethnic boundaries.

  11. Autonomously replicating macronuclear DNA pieces are the physical basis of genetic coassortment groups in Tetrahymena thermophila.

    PubMed Central

    Wong, L; Klionsky, L; Wickert, S; Merriam, V; Orias, E; Hamilton, E P

    2000-01-01

    The macronucleus of the ciliate Tetrahymena thermophila contains a fragmented somatic genome consisting of several hundred identifiable chromosome pieces. These pieces are generated by site-specific fragmentation of the germline chromosomes and most of them are represented at an average of 45 copies per macronucleus. In the course of successive divisions of an initially heterozygous macronucleus, the random distribution of alleles of loci carried on these copies eventually generates macronuclei that are pure for one allele or the other. This phenomenon is called phenotypic assortment. We have previously reported the existence of loci that assort together (coassort) and hypothesized that these loci reside on the same macronuclear piece. The work reported here provides new, rigorous genetic support for the hypothesis that macronuclear autonomously replicating chromosome pieces are the physical basis of coassortment groups. Thus, coassortment allows the mapping of the somatic genome by purely genetic means. The data also strongly suggest that the random distribution of alleles in the Tetrahymena macronucleus is due to the random distribution of the MAC chromosome pieces that carry them. PMID:10880474

  12. Conflict amongst chloroplast DNA sequences obscures the phylogeny of a group of Asplenium ferns.

    PubMed

    Shepherd, Lara D; Holland, Barbara R; Perrie, Leon R

    2008-07-01

    A previous study of the relationships amongst three subgroups of the Austral Asplenium ferns found conflicting signal between the two chloroplast loci investigated. Because organelle genomes like those of chloroplasts and mitochondria are thought to be non-recombining, with a single evolutionary history, we sequenced four additional chloroplast loci with the expectation that this would resolve these relationships. Instead, the conflict was only magnified. Although tree-building analyses favoured one of the three possible trees, one of the alternative trees actually had one more supporting site (six versus five) and received greater support in spectral and neighbor-net analyses. Simulations suggested that chance alone was unlikely to produce strong support for two of the possible trees and none for the third. Likelihood permutation tests indicated that the concatenated chloroplast sequence data appeared to have experienced recombination. However, recombination between the chloroplast genomes of different species would be highly atypical, and corollary supporting observations, like chloroplast heteroplasmy, are lacking. Wider taxon sampling clarified the composition of the Austral group, but the conflicting signal meant analyses (e.g., morphological evolution, biogeographic) conditional on a well-supported phylogeny could not be performed.

  13. Survey of chimeric IStron elements in bacterial genomes: multiple molecular symbioses between group I intron ribozymes and DNA transposons

    PubMed Central

    Tourasse, Nicolas J.; Stabell, Fredrik B.; Kolstø, Anne-Brit

    2014-01-01

    IStrons are chimeric genetic elements composed of a group I intron associated with an insertion sequence (IS). The group I intron is a catalytic RNA providing the IStron with self-splicing ability, which renders IStron insertions harmless to the host genome. The IS element is a DNA transposon conferring mobility, and thus allowing the IStron to spread in genomes. IStrons are therefore a striking example of a molecular symbiosis between unrelated genetic elements endowed with different functions. In this study, we have conducted the first comprehensive survey of IStrons in sequenced genomes that provides insights into the distribution, diversity, origin and evolution of IStrons. We show that IStrons have a restricted phylogenetic distribution limited to two bacterial phyla, the Firmicutes and the Fusobacteria. Nevertheless, diverse IStrons representing two major groups targeting different insertion site motifs were identified. This taken with the finding that while the intron components of all IStrons belong to the same structural class, they are fused to different IS families, indicates that multiple intron–IS symbioses have occurred during evolution. In addition, introns and IS elements related to those that were at the origin of IStrons were also identified. PMID:25324310

  14. The effect of leaving groups on binding and reactivity in enzyme-free copying of DNA and RNA

    PubMed Central

    Kervio, Eric; Sosson, Marilyne; Richert, Clemens

    2016-01-01

    The template-directed incorporation of nucleotides at the terminus of a growing primer is the basis of the transmission of genetic information. Nature uses polymerases-catalyzed reactions, but enzyme-free versions exist that employ nucleotides with organic leaving groups. The leaving group affects yields, but it was not clear whether inefficient extensions are due to poor binding, low reactivity toward the primer, or rapid hydrolysis. We have measured the binding of a total of 15 different activated nucleotides to DNA or RNA sequences. Further, we determined rate constants for the chemical step of primer extension involving methylimidazolides or oxyazabenzotriazolides of deoxynucleotides or ribonucleotides. Binding constants range from 10 to >500 mM and rate constants from 0.1 to 370 M−1 h−1. For aminoterminal primers, a fast covalent step and slow hydrolysis are the main factors leading to high yields. For monomers with weakly pairing bases, the leaving group can improve binding significantly. A detailed mechanistic picture emerges that explains why some enzyme-free primer extensions occur in high yield, while others remain recalcitrant to copying without enzymatic catalysis. A combination of tight binding and rapid extension, coupled with slow hydrolysis induces efficient enzyme-free copying. PMID:27235418

  15. Use of single-strand conformation polymorphism of amplified 16S rDNA for grouping of bacteria isolated from foods.

    PubMed

    Takahashi, Hajime; Kimura, Bon; Tanaka, Yuichiro; Mori, Mayumi; Yokoi, Asami; Fujii, Tateo

    2008-04-01

    The grouping method for isolated strains from foods using single-strand conformation polymorphism (SSCP) after PCR amplification of a portion of 16S rDNA was developed. This method was able to group the strains from various food samples based on 16S rDNA sequence. As 97.8% of the isolated strains from various foods were grouped correctly, use of the PCR-SSCP method enables the prompt and labor-saving analysis of microbial population of food-derived bacterial strains. Advantages in speed and accuracy of bacterial population identification by the PCR-SSCP method have practical application for food suppliers and testing laboratories.

  16. MtDNA phylogeny and biogeography of Copelatinae, a highly diverse group of tropical diving beetles (Dytiscidae).

    PubMed

    Balke, Michael; Ribera, Ignacio; Vogler, Alfried P

    2004-09-01

    Copelatinae is a diverse lineage of diving beetles (Dytiscidae) frequently encountered in wet tropical and subtropical forests, but phylogenetic relationships are very poorly understood. We performed a phylogenetic and biogeographic analysis of this worldwide distributed group based on 50 species including a representative sample of major taxonomic groups and biogeographical regions. DNA sequences were obtained for the mitochondrial genes cytochrome oxidase I, cytochrome b, and 16S rRNA, for a total of 1575 aligned nucleotide positions. We found Copelatinae to be monophyletic, placed in a derived position and not sister to all remaining dytiscids, as had been suggested by earlier authors. The largest genus, Copelatus with some 460 known species was paraphyletic with respect to the smaller genera Lacconectus and Aglymbus. Among the major lineages of Copelatus, the subgenus Papuadytes was consistently recovered as sister to all other species (including Lacconectus and Aglymbus) with the possible exception of two western Palearctic taxa. We propose that the subgenus Papuadytes is removed from Copelatus and assigned generic status. Likewise, the two western Palearctic Copelatus are removed from this genus, and assigned the available genus name Liopterus. Our best phylogenetic hypothesis retrieved Afrotropical and New Guinean plus Australian species of Copelatus as monophyletic. Asian species were paraphyletic with respect to a species from Sulawesi which grouped with the species from New Guinea. Asian species were also paraphyletic with respect to Oriental Lacconectus, which was grouped with a clade of Neotropical species. Neotropical Copelatus form at least two separate lineages. The biogeographical evolution of Papuadytes is consistent with the relative age of the landmasses in the Austral region. Basal species are Australian, and successively derived ones are from New Caledonia and New Guinea. One species apparently dispersed from New Caledonia to China. Assuming a

  17. Phylogeny and chromosomal variations in East Asian Carex, Siderostictae group (Cyperaceae), based on DNA sequences and cytological data.

    PubMed

    Yano, Okihito; Ikeda, Hiroshi; Jin, Xiao-Feng; Hoshino, Takuji

    2014-01-01

    Carex (Cyperaceae) is one of the largest genera of the flowering plants, and comprises more than 2,000 species. In Carex, section Siderostictae with broader leaves distributed in East Asia is thought to be an ancestral group. We aimed to clarify the phylogenetic relationships and chromosomal variations within the section Siderostictae, and to examine the relationship of broad-leaved species of the sections Hemiscaposae and Surculosae from East Asia, inferred from DNA sequences and cytological data. Our results indicate that a monophyletic Siderostictae clade, including the sections Hemiscaposae, Siderostictae and Surculosae, as the earliest diverging group in the tribe Cariceae. Low chromosome numbers, 2n = 12 or 24, with large sizes were observed in these three sections. Our results suggest that the genus Carex might have originated or relictly restricted in the East Asia. Geographical distributions of diploid species are restricted in narrower areas, while those of tetraploid species are wider in East Asia. It is concluded that chromosomal variations in Siderostictae clade may have been caused by polyploidization and that tetraploid species may have been able to exploit their habitats by polyploidization.

  18. Nucleic Acids Research Group (NRG): The Importance of DNA Extraction in Metagenomics: The Gatekeeper to Accurate Results!

    PubMed Central

    Carmical, R.; Nadella, V.; Herbert, Z.; Beckloff, N.; Chittur, S.; Rosato, C.; Perera, A.; Auer, H.; Robinson, M.; Tighe, S.; Holbrook, Jennifer

    2013-01-01

    It is well recognized that the field of metagenomics is becoming a critical tool for studying previously unobtainable population dynamics at both an identification of species level and a functional or transcriptional level. Because the power to resolve microbial information is so important for identifying the components in an mixed sample, metagenomics can be used to study nearly any possible environment or system including clinical, environmental, and industrial, to name a few. Clinically, it may be used to determine sub-populations colonizing regions of the body or determining a rare infection to assist in treatment strategies. Environmentally it may be used to identify microbial populations within a soil, water or air sample, or within a bioreactor to characterize a population- based functional process. The possibilities are endless. However, the accuracy of a metagenomics dataset relies on three important “gatekeepers” including 1) The ability to effectively extract all DNA or RNA from every cell within a sample, 2) The reliability of the methods used for deep or high-throughput sequencing, and 3) The software used to analyze the data. Since DNA extraction is the first step in the technical process of metagenomics, the Nucleic Acid Research Group (NARG) conducted a study to evaluate extraction methods using a synthetic microbial sample. The synthetic microbial sample was prepared from 10 known bacteria at specific concentrations and ranging in diversity. Samples were extracted in duplicate using various popular kit based methods as well as several homebrew protocols then analyzed by NextGen sequencing on an Illumina HiSeq. Results of the study include determining the percent recovery of those organisms by comparing to the known quantity in the original synthetic mix.

  19. Frequent discordance between morphology and mitochondrial DNA in a species group of European water beetles (Coleoptera: Dytiscidae).

    PubMed

    Bilton, David T; Turner, Lucy; Foster, Garth N

    2017-01-01

    The Hydroporus memnonius species group includes both widespread and range restricted diving beetle taxa in the western Palaearctic, some of which have been divided into a number of geographical subspecies. Of these, Hydroporus necopinatus is distributed in the far west of Europe, from central Spain to southern Britain, and has been split into three subspecies, occurring in Iberia (necopinatus sst.), France (robertorum) and England (roni) respectively-the last of these being a rare example of an insect taxon apparently endemic to northern Europe. Here we explore inter-relationships between populations and subspecies of H. necopinatus and related members of the Hydroporus melanarius subgroup, using mitochondrial COI sequence data. We reveal widespread discordance between mitochondrial DNA sequence variation and morphology in areas where H. necopinatus and H. melanarius come into contact, consistent with historical introgressive hybridization between these taxa. In light of this discordance, the lack of clear genetic divergence between H. necopinatus subspecies, and the fact that both robertorum and roni are morphologically intermediate between H. necopinatus sstr. and H. melanarius, we suggest that these taxa may be of hybridogenic origin, rather than representing discrete evolutionary lineages.

  20. Frequent discordance between morphology and mitochondrial DNA in a species group of European water beetles (Coleoptera: Dytiscidae)

    PubMed Central

    Turner, Lucy; Foster, Garth N.

    2017-01-01

    The Hydroporus memnonius species group includes both widespread and range restricted diving beetle taxa in the western Palaearctic, some of which have been divided into a number of geographical subspecies. Of these, Hydroporus necopinatus is distributed in the far west of Europe, from central Spain to southern Britain, and has been split into three subspecies, occurring in Iberia (necopinatus sst.), France (robertorum) and England (roni) respectively—the last of these being a rare example of an insect taxon apparently endemic to northern Europe. Here we explore inter-relationships between populations and subspecies of H. necopinatus and related members of the Hydroporus melanarius subgroup, using mitochondrial COI sequence data. We reveal widespread discordance between mitochondrial DNA sequence variation and morphology in areas where H. necopinatus and H. melanarius come into contact, consistent with historical introgressive hybridization between these taxa. In light of this discordance, the lack of clear genetic divergence between H. necopinatus subspecies, and the fact that both robertorum and roni are morphologically intermediate between H. necopinatus sstr. and H. melanarius, we suggest that these taxa may be of hybridogenic origin, rather than representing discrete evolutionary lineages. PMID:28289570

  1. The accessibility of thiophosphorylated groups in DNA fragments to the enzymatic activity of ligases and restriction endonuclease Bbs I.

    PubMed

    Schenk, J A; Heymann, S; Micheel, B

    1995-08-01

    The aim of this paper was to test the possibility to ligate and hydrolyse DNA sequences containing thiomodified ends and bonds. T4 DNA ligase was shown to ligate DNA fragments regardless of whether it contains phosphorylated or thiophosphorylated 5'-end. But the cleavage of an internally thiomodified phosphodiester bond was found to be totally inhibited when using the non-palindromic restrictase Bbs I. The special properties of this restriction endonuclease should allow the development of an oriented cloning strategy when combined with T4 ligase and a thiophosphorylation of DNA fragments.

  2. Spectroscopic study on the interaction of ct-DNA with manganese Salen complex containing triphenyl phosphonium groups.

    PubMed

    Dehkordi, Maryam Nejat; Bordbar, Abdol-Khalegh; Lincoln, Per; Mirkhani, Valiollah

    2012-05-01

    The DNA binding properties of a bulky and hydrophobic Schiff base complex of manganese(III) [N,N'-bis(5-(triphenyl phosphonium methyl)salicylidene)-1,2-ethylene diamine chloride Mn(III) acetate] was examined by spectroscopic techniques. UV-vis titration data indicate both hypo and hyperchromic effect with addition of DNA to complex. A competitive binding study showed that the enhanced emission intensity of ethidium bromide (EB) in the presence of DNA was quenched by adding Mn Salen complex. This finding indicates that Mn Salen complex displaces EB from its binding site in DNA. Helix melting studies indicate improvement in the helix stability, and an increase in the melting temperature. The analysis of CD spectra represents the structural changes in DNA due to the binding of Mn Salen complex. The binding constant has been calculated using absorbance and fluorescence data. The results also represent that the binding process proceeds by strong electrostatic and hydrophobic interactions.

  3. Spectroscopic study on the interaction of ct-DNA with manganese Salen complex containing triphenyl phosphonium groups

    NASA Astrophysics Data System (ADS)

    Dehkordi, Maryam Nejat; Bordbar, Abdol-Khalegh; Lincoln, Per; Mirkhani, Valiollah

    2012-05-01

    The DNA binding properties of a bulky and hydrophobic Schiff base complex of manganese(III) [N,N'-bis(5-(triphenyl phosphonium methyl)salicylidene)-1,2-ethylene diamine chloride Mn(III) acetate] was examined by spectroscopic techniques. UV-vis titration data indicate both hypo and hyperchromic effect with addition of DNA to complex. A competitive binding study showed that the enhanced emission intensity of ethidium bromide (EB) in the presence of DNA was quenched by adding Mn Salen complex. This finding indicates that Mn Salen complex displaces EB from its binding site in DNA. Helix melting studies indicate improvement in the helix stability, and an increase in the melting temperature. The analysis of CD spectra represents the structural changes in DNA due to the binding of Mn Salen complex. The binding constant has been calculated using absorbance and fluorescence data. The results also represent that the binding process proceeds by strong electrostatic and hydrophobic interactions.

  4. New pyridinium-based fluorescent dyes: A comparison of symmetry and side-group effects on G-Quadruplex DNA binding selectivity and application in live cell imaging.

    PubMed

    Lu, Yu-Jing; Hu, Dong-Ping; Zhang, Kun; Wong, Wing-Leung; Chow, Cheuk-Fai

    2016-07-15

    A series of C1-, C2-and C3-symmetric pyridinium conjugates with different styrene-like side groups were synthesized and were utilized as G-quadruplex selective fluorescent probes. The new compounds were well-characterized. Their selectivity, sensitivity, and stability towards G-quadruplex were studied by fluorescence titration, native PAGE experiments, FRET and circular dichroism (CD) analyses. These new compounds investigated in the fluorescence assays were preferentially bound with G-quadruplex DNA compared with other type of nucleic acids and it is fascinating to realize the effects of molecular symmetry and associated side groups showing unexpectedly great influence on the fluorescent signal enhancement for the discrimination of G-quadruplexes DNA from other nucleic acids. This may correlate with the pocket symmetry and shape of the G-quadruplex DNA inherently. Among the compounds, a C2-symmetric dye (2,6-bis-((E)-2-(1H-indol-3-yl)-vinyl)-1-methylpyridin-1-ium iodide) with indolyl-groups substituted was screened out from the series giving the best selectivity and sensitivity towards G-quadruplexes DNA, particularly telo21, due to its high equilibrium binding constant (K=2.17×10(5)M(-1)). In addition, the limit of detection (LOD) of the dye to determine telo21 DNA in bioassays was found as low as 33nM. The results of the study give insight and certain crucial factors, such as molecular symmetry and the associated side groups, on developing of effective fluorescent dyes for G-quadruplex DNA applications including G-quadruplex structure stabilization, biosensing and clinical applications. The compound was also demonstrated as a very selective G-quadruplex fluorescent agent for living cell staining and imaging.

  5. Nonenzymatic methylation of DNA by the intracellular methyl group donor S-adenosyl-L-methionine is a potentially mutagenic reaction.

    PubMed Central

    Rydberg, B; Lindahl, T

    1982-01-01

    Incubation of DNA with S-adenosyl-L-methionine (SAM) in neutral aqueous solution leads to base modification, with formation of small amounts of 7-methylguanine and 3-methyladenine. The products have been identified by high performance liquid chromatography of DNA hydrolysates and by the selective release of free 3-methyladenine from SAM-treated DNA by a specific DNA glycosylase. We conclude that SAM acts as a weak DNA-alkylating agent. Several control experiments including extensive purification of [3H-methyl]SAM preparations and elimination of the alkylating activity by pretreatment of SAM with a phage T3-induced SAM cleaving enzyme, have been performed to determine that the activity observed was due to SAM itself and not to a contaminating substance. We estimate that SAM, at an intracellular concentration of 4 X 10(-5) M, causes DNA alkylation at a level similar to that expected from continuous exposure of cells to 2 X 10(-8) M methyl methane-sulphonate. This ability of SAM to act as a methyl donor in a nonenzymatic reaction could result in a background of mutagenesis and carcinogenesis. The data provide an explanation for the apparently universal occurrence of multiple DNA repair enzymes specific for methylation damage. PMID:7188181

  6. Ultraviolet-B-induced DNA damage and ultraviolet-B tolerance mechanisms in species with different functional groups coexisting in subalpine moorlands.

    PubMed

    Wang, Qing-Wei; Kamiyama, Chiho; Hidema, Jun; Hikosaka, Kouki

    2016-08-01

    High doses of ultraviolet-B (UV-B; 280-315 nm) radiation can have detrimental effects on plants, and especially damage their DNA. Plants have DNA repair and protection mechanisms to prevent UV-B damage. However, it remains unclear how DNA damage and tolerance mechanisms vary among field species. We studied DNA damage and tolerance mechanisms in 26 species with different functional groups coexisting in two moorlands at two elevations. We collected current-year leaves in July and August, and determined accumulation of cyclobutane pyrimidine dimer (CPD) as UV-B damage and photorepair activity (PRA) and concentrations of UV-absorbing compounds (UACs) and carotenoids (CARs) as UV-B tolerance mechanisms. DNA damage was greater in dicot than in monocot species, and higher in herbaceous than in woody species. Evergreen species accumulated more CPDs than deciduous species. PRA was higher in Poaceae than in species of other families. UACs were significantly higher in woody than in herbaceous species. The CPD level was not explained by the mechanisms across species, but was significantly related to PRA and UACs when we ignored species with low CPD, PRA and UACs, implying the presence of another effective tolerance mechanism. UACs were correlated negatively with PRA and positively with CARs. Our results revealed that UV-induced DNA damage significantly varies among native species, and this variation is related to functional groups. DNA repair, rather than UV-B protection, dominates in UV-B tolerance in the field. Our findings also suggest that UV-B tolerance mechanisms vary among species under evolutionary trade-off and synergism.

  7. Prognostic Correlations between ABO Blood Group and Pre-Treatment Plasma Epstein-Barr Virus DNA in Patients with Nasopharyngeal Carcinoma Receiving Intensity-Modulated Radiotherapy

    PubMed Central

    Li, Wen-Fei; Zhang, Yuan; Liu, Li-Zhi; Tian, Li; Lin, Ai-Hua; Sun, Ying; Ma, Jun

    2016-01-01

    Purpose The objective of this study is to assess the prognostic value of ABO blood group in nasopharyngeal carcinoma (NPC) treated by intensity-modulated radiotherapy (IMRT). Patients and Methods We retrospectively reviewed the data on 1397 patients with non-metastatic, newly diagnosed NPC treated using IMRT. Patient survival between different ABO blood groups were compared using log-rank test. Cox hazards model was adopted to establish independent prognostic factors. Results In our study, the distribution of the A, B, AB and O blood groups was 26.6% (372/1397), 26.2% (366/1397), 5.2% (73/1397) and 42.0% (586/1397), respectively. The cut-off value of pre-treatment Epstein-Barr virus (EBV) DNA based on disease-free survival (DFS) was 1355 copies/ml (area under curve [AUC], 0.649; sensitivity, 0.76; specificity, 0.496) for the whole cohort. Estimated four-year DFS, overall survival (OS), distant metastasis-free survival (DMFS) and locoregional relapse-free survival (LRRFS) rates were 81.7%, 89.2%, 89.4% and 92.3% for blood group A; 82.1%, 89.3%, 89.0% and 92.0% for group B; 83.3%, 88.1%, 86.2% and 95.5% for group AB, 80.9%, 90.7%, 88.4% and 90.2% for group O (P > 0.05 for all rates). Multivariate analysis revealed ABO blood group was not an independent prognostic factor for DFS, OS, DMFS or LRRFS (P > 0.05 for all rates) after adjusting for plasma EBV DNA in either the whole cohort or subgroup analysis by gender. Conclusions The prognostic value of ABO blood group may be limited for patients with NPC in the era of IMRT, and no substantial correlation between ABO blood group and plasma EBV DNA was observed. PMID:27835689

  8. Display of amino groups on substrate surfaces by simple dip-coating of methacrylate-based polymers and its application to DNA immobilization.

    PubMed

    Shimomura, Ayane; Nishino, Takashi; Maruyama, Tatsuo

    2013-01-22

    The implementation of a reactive functional group onto a material surface is of great importance. Reactive functional groups (e.g., an amino group and a hydroxyl group) are usually hydrophilic, which makes it difficult to display them on a dry polymer surface. We here propose a novel method for displaying amino groups on the surfaces of polymeric substrates through dip-coating of a methacrylate-based copolymer. We synthesized copolymers composed of methyl methacrylate and 2-aminoethyl methacrylate with different protecting groups or ion-complexes on their amino groups, then dip-coated the copolymers onto a poly(methyl methacrylate) (PMMA) substrate. Evaluation using a cleavable fluorescent compound, which was synthesized in the present study to quantify a small amount (pmol/cm(2)) of amino groups on a solid surface, revealed that the protection of amino groups affected their surface segregation in the copolymer coating. p-Toluenesulfonate ion-complex and tert-butoxycarbonyl (Boc) protection of amino groups were found to effectively display amino groups on the surface (more than 70 pmol/cm(2)). The density of amino groups displayed on a surface can be easily controlled by mixing the copolymer and PMMA before dip-coating. Dip-coating of the copolymer with Boc protection on various polymeric substrates also successfully displayed amino groups on their surfaces. Finally, we demonstrated that the amino groups displayed can be utilized for the immobilization of a DNA oligonucleotide on a substrate surface.

  9. DNA barcoding of the ichthyofauna of Pánuco-Tamesí complex: evidence for taxonomic conflicts in some groups.

    PubMed

    Mejía, Omar; León-Romero, Yatzil; Soto-Galera, Eduardo

    2012-12-01

    The Pánuco-Tamesí complex in eastern Mexico is globally recognized as an important ecoregion due to its high level of endemism. In this study, DNA barcodes were generated for 152 individuals of 31 species. Additionally, 170 DNA barcodes for the related species available in the Barcode of Life Database (BOLD) system were included to test the ability of barcoding technique to discriminate between the closely related species. DNA barcoding allowed the discrimination of 79.2% of the analyzed species; poor resolution was observed in four genera in which the levels of resolution ranged from 16.6% in the genus Herichthys to 77.7% in the genus Xiphophorus. The results of this study demonstrate that DNA barcoding is a useful exploratory tool but fails to discriminate between closely related species.

  10. PEG-mediated one-pot multicomponent reactions for the efficient synthesis of functionalized dihydropyridines and their functional group dependent DNA cleavage activity.

    PubMed

    Pal, Suman; Singh, Vandana; Das, Prolay; Choudhury, Lokman H

    2013-06-01

    Polyethylene glycol (PEG) has been found to be an inexpensive, non-toxic and useful medium for the one pot synthesis of highly functionalized dihydropyridines using multicomponent reactions (MCRs) at room temperature under catalyst free conditions. The notable features of this protocol are: mild reaction condition, applicability to wide range of substrates, reusability of the PEG and good yields. The interaction of the synthesized compounds with pUC19 plasmid DNA was also analyzed. Some of the synthesized compounds showed interesting functional group dependent nuclease activity for plasmid DNA cleavage under physiological conditions.

  11. Fetal blood group genotyping from DNA from maternal plasma: an important advance in the management and prevention of haemolytic disease of the fetus and newborn.

    PubMed

    Daniels, G; Finning, K; Martin, P; Soothill, P

    2004-11-01

    The cloning of blood group genes and subsequent identification of the molecular bases of blood group polymorphisms has made it possible to predict blood group phenotypes from DNA with a reasonable degree of accuracy. The major application of this technology, which has now become the standard of care, is the determination of a fetal RHD genotype in women with anti-D, to assess whether the fetus is at risk of haemolytic disease of the fetus and newborn (HDFN). Initially, the procurement of fetal DNA required the invasive procedures of amniocentesis or chorionic villus sampling. Since the discovery of fetal DNA in maternal plasma in 1997, the technology of detecting an RHD gene in this very small quantity of fetal DNA has developed rapidly, so that non-invasive fetal D typing can now be provided as a diagnostic service for D-negative pregnant women with anti-D. Within a few years, it is probable that fetuses of all D-negative pregnant women will be tested for RHD, to establish whether the mother requires antenatal anti-D immunoglobulin prophylaxis.

  12. A comparison of different pre-lysis methods and extraction kits for recovery of Streptococcus agalacticae (Lancefield group B Streptococcus) DNA from whole blood.

    PubMed

    Burke, Rachael M; McKenna, James P; Cox, Ciara; Coyle, Peter V; Shields, Michael D; Fairley, Derek J

    2016-10-01

    Sub-optimal recovery of bacterial DNA from whole blood samples can limit the sensitivity of molecular assays to detect pathogenic bacteria. We compared 3 different pre-lysis protocols (none, mechanical pre-lysis and achromopeptidase pre-lysis) and 5 commercially available DNA extraction platforms for direct detection of Group B Streptococcus (GBS) in spiked whole blood samples, without enrichment culture. DNA was extracted using the QIAamp Blood Mini kit (Qiagen), UCP Pathogen Mini kit (Qiagen), QuickGene DNA Whole Blood kit S (Fuji), Speed Xtract Nucleic Acid Kit 200 (Qiagen) and MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics Corp). Mechanical pre-lysis increased yields of bacterial genomic DNA by 51.3 fold (95% confidence interval; 31.6-85.1, p<0.001) and pre-lysis with achromopeptidase by 6.1 fold (95% CI; 4.2-8.9, p<0.001), compared with no pre-lysis. Differences in yield due to pre-lysis were 2-3 fold larger than differences in yield between extraction methods. Including a pre-lysis step can improve the limits of detection of GBS using PCR or other molecular methods without need for culture.

  13. Fanconi anemia complementation group D2 (FANCD2) functions independently of BRCA2- and RAD51-associated homologous recombination in response to DNA damage.

    PubMed

    Ohashi, Akihiro; Zdzienicka, Malgorzata Z; Chen, Junjie; Couch, Fergus J

    2005-04-15

    The BRCA2 breast cancer tumor suppressor is involved in the repair of double strand breaks and broken replication forks by homologous recombination through its interaction with DNA repair protein Rad51. Cells defective in BRCA2.FANCD1 are extremely sensitive to mitomycin C (MMC) similarly to cells deficient in any of the Fanconi anemia (FA) complementation group proteins (FANC). These observations suggest that the FA pathway and the BRCA2 and Rad51 repair pathway may be linked, although a functional connection between these pathways in DNA damage signaling remains to be determined. Here, we systematically investigated the interaction between these pathways. We show that in response to DNA damage, BRCA2-dependent Rad51 nuclear focus formation was normal in the absence of FANCD2 and that FANCD2 nuclear focus formation and mono-ubiquitination appeared normal in BRCA2-deficient cells. We report that the absence of BRCA2 substantially reduced homologous recombination repair of DNA breaks, whereas the absence of FANCD2 had little effect. Furthermore, we established that depletion of BRCA2 or Rad51 had a greater effect on cell survival in response to MMC than depletion of FANCD2 and that depletion of BRCA2 in FANCD2 mutant cells further sensitized these cells to MMC. Our results suggest that FANCD2 mediates double strand DNA break repair independently of Rad51-associated homologous recombination.

  14. Efficient Condensation of DNA into Environmentally Responsive Polyplexes Produced from Block Catiomers Carrying Amine or Diamine Groups.

    PubMed

    Albuquerque, Lindomar J C; Annes, Kelly; Milazzotto, Marcella P; Mattei, Bruno; Riske, Karin A; Jäger, Eliézer; Pánek, Jiří; Štěpánek, Petr; Kapusta, Peter; Muraro, Paulo I R; De Freitas, Augusto G O; Schmidt, Vanessa; Giacomelli, Cristiano; Bonvent, Jean-Jacques; Giacomelli, Fernando C

    2016-01-19

    The intracellular delivery of nucleic acids requires a vector system as they cannot diffuse across lipid membranes. Although polymeric transfecting agents have been extensively investigated, none of the proposed gene delivery vehicles fulfill all of the requirements needed for an effective therapy, namely, the ability to bind and compact DNA into polyplexes, stability in the serum environment, endosome-disrupting capacity, efficient intracellular DNA release, and low toxicity. The challenges are mainly attributed to conflicting properties such as stability vs efficient DNA release and toxicity vs efficient endosome-disrupting capacity. Accordingly, investigations aimed at safe and efficient therapies are still essential to achieving gene therapy clinical success. Taking into account the mentioned issues, herein we have evaluated the DNA condensation ability of poly(ethylene oxide)113-b-poly[2-(diisopropylamino)ethyl methacrylate]50 (PEO113-b-PDPA50), poly(ethylene oxide)113-b-poly[2-(diethylamino)ethyl methacrylate]50 (PEO113-b-PDEA50), poly[oligo(ethylene glycol)methyl ether methacrylate]70-b-poly[oligo(ethylene glycol)methyl ether methacrylate10-co-2-(diethylamino)ethyl methacrylate47-co-2-(diisopropylamino)ethyl methacrylate47] (POEGMA70-b-P(OEGMA10-co-DEA47-co-DPA47), and poly[oligo(ethylene glycol)methyl ether methacrylate]70-b-poly{oligo(ethylene glycol)methyl ether methacrylate10-co-2-methylacrylic acid 2-[(2-(dimethylamino)ethyl)methylamino]ethyl ester44} (POEGMA70-b-P(OEGMA10-co-DAMA44). Block copolymers PEO113-b-PDEA50 and POEGMA70-b-P(OEGMA10-co-DEA47-co-DPA47) were evidenced to properly condense DNA into particles with a desirable size for cellular uptake via endocytic pathways (R(H) ≈ 65-85 nm). The structure of the polyplexes was characterized in detail by scattering techniques and atomic force microscopy. The isothermal titration calorimetric data revealed that the polymer/DNA binding is endothermic; therefore, the process in entropically driven

  15. [Genetic diversity and relatives of the goitered gazelle (Gazella subgutturosa) groups from Uzbekistan, Turkmenistan, and Azerbaijan: analysis of the D-loop of mitochondrial DNA].

    PubMed

    Sorokin, P A; Soldatova, N V; Lukarevskiĭ, V S; Kholodova, M V

    2011-01-01

    Polymorphism of the nucleotide sequence of a hypervariable fragment of the D-loop (985 bp) of mtDNA in 76 Goitered gazelles of subspecies Gazella subgutturosa subgutturosa from Uzbekistan, Turkmenistan, and Azerbaijan was studied. The genetic similarity of gazelles from Turkmenistan and Uzbekistan has been identified. The population of gazelles from Shirvanskaya steppe reserve (Azerbaijan) is unique and strictly isolated from other groups studied. A high haplotypic (H = 0.9649 +/- 0.0091) and relatively low nucleotide diversity (pi = 0.0212 +/- 0.0105) were noted for all investigated groups of gazelle based on this mtDNA fragment, which is probably related to ecological peculiarities of the species and the history of formation of regional populations.

  16. Identification of a group of cryptic marine limpet species, Cellana karachiensis (Mollusca: Patellogastropoda) off Veraval coast, India, using mtDNA COI sequencing.

    PubMed

    Joseph, Sneha; Poriya, Paresh; Vakani, Bhavik; Singh, S P; Kundu, Rahul

    2016-01-01

    Present communication reports the phylogenetic relationship between three groups of a marine limpet having different color banding patterns using COI sequencing. Samples were sequenced for mtDNA COI gene using universal primer. Comparative BLAST revealed that all three types were around 99.59% identical with Cellana karachiensis, first record of this species from Indian coasts. Apart from the morphological variations, the mtDNA COI gene analysis revealed around 1% nucleotide variations between these three types. The observed dissimilarity in COI sequences was possibly too little to consider these types as three different species. The derivation of amino acid positions indicated that these types could possibly be a complex of three cryptic species of C. karachiensis. The study proposes that the Oman and Indian populations of C. karachiensis might have derived by allopatric speciation due to geographical isolation. The group of these three cryptic species, sharing same habitat between themselves, possibly showed sympatric speciation.

  17. Structure-function relationships in human testis-determining factor SRY: an aromatic buttress underlies the specific DNA-bending surface of a high mobility group (HMG) box.

    PubMed

    Racca, Joseph D; Chen, Yen-Shan; Maloy, James D; Wickramasinghe, Nalinda; Phillips, Nelson B; Weiss, Michael A

    2014-11-21

    Human testis determination is initiated by SRY, a Y-encoded architectural transcription factor. Mutations in SRY cause 46 XY gonadal dysgenesis with female somatic phenotype (Swyer syndrome) and confer a high risk of malignancy (gonadoblastoma). Such mutations cluster in the SRY high mobility group (HMG) box, a conserved motif of specific DNA binding and bending. To explore structure-function relationships, we constructed all possible substitutions at a site of clinical mutation (W70L). Our studies thus focused on a core aromatic residue (position 15 of the consensus HMG box) that is invariant among SRY-related HMG box transcription factors (the SOX family) and conserved as aromatic (Phe or Tyr) among other sequence-specific boxes. In a yeast one-hybrid system sensitive to specific SRY-DNA binding, the variant domains exhibited reduced (Phe and Tyr) or absent activity (the remaining 17 substitutions). Representative nonpolar variants with partial or absent activity (Tyr, Phe, Leu, and Ala in order of decreasing side-chain volume) were chosen for study in vitro and in mammalian cell culture. The clinical mutation (Leu) was found to markedly impair multiple biochemical and cellular activities as respectively probed through the following: (i) in vitro assays of specific DNA binding and protein stability, and (ii) cell culture-based assays of proteosomal degradation, nuclear import, enhancer DNA occupancy, and SRY-dependent transcriptional activation. Surprisingly, however, DNA bending is robust to this or the related Ala substitution that profoundly impairs box stability. Together, our findings demonstrate that the folding, trafficking, and gene-regulatory function of SRY requires an invariant aromatic "buttress" beneath its specific DNA-bending surface.

  18. A high mobility group box 1 (HMGB1) gene from Chlamys farreri and the DNA-binding ability and pro-inflammatory activity of its recombinant protein.

    PubMed

    Wang, Mengqiang; Wang, Lingling; Guo, Ying; Zhou, Zhi; Yi, Qilin; Zhang, Daoxiang; Zhang, Huan; Liu, Rui; Song, Linsheng

    2014-02-01

    High-mobility group box 1 (HMGB1) protein, a highly conserved DNA binding protein, plays an important role in maintaining nucleosome structures, transcription, and inflammation. In the present research, a cDNA of 1268 bp for the Zhikong scallop Chlamys farreri HMGB1 (designed as CfHMGB1) was cloned via rapid amplification of cDNA ends (RACE) technique and expression sequence tag (EST) analysis. The complete cDNA sequence of CfHMGB1 contained an open reading frame (ORF) of 648 bp, which encoded a protein of 215 amino acids. The amino acid sequence of CfHMGB1 shared 53-57% similarity with other identified HMGB1s. There were two HMG domains, two low complexity regions and a conserved acidic tail in the amino acid sequence of CfHMGB1. The mRNA transcripts of CfHMGB1 were constitutively expressed in all the tested tissues, including haemocytes, muscle, mantle, gill, hepatopancreas, kidney and gonad, with the highest expression level in hepatopancreas. The mRNA expression profiles of CfHMGB1 in haemocytes after the stimulation with different pathogen-associated molecular patterns (PAMPs), including lipopolysaccharide (LPS), peptidoglycan (PGN) and glucan (Glu), were similar with an up-regulation in the early stage and then recovered to the original level. The recombinant CfHMGB1 protein could bind double-stranded DNA and induce the release of TNF-α activity in mixed primary culture of scallop haemocytes. These results collectively indicated that CfHMGB1, with DNA-binding ability and pro-inflammatory activity, could play an important role in the immune response of scallops.

  19. The Polycomb Group Protein EZH2 Impairs DNA Damage Repair Gene Expression in Human Uterine Fibroids1

    PubMed Central

    Yang, Qiwei; Nair, Sangeeta; Laknaur, Archana; Ismail, Nahed; Diamond, Michael P.; Al-Hendy, Ayman

    2016-01-01

    Uterine fibroids are benign, smooth muscle tumors that occur in approximately 70%–80% of women by age 50 yr. The cellular and molecular mechanism(s) by which uterine fibroids (UFs) develop are not fully understood. Accumulating evidence demonstrates that several genetic abnormalities, including deletions, rearrangements, translocations, as well as mutations, have been found in UFs. These genetic anomalies suggest that low DNA damage repair capacity may be involved in UF formation. The objective of this study was to determine whether expression levels of DNA damage repair-related genes were altered, and how they were regulated in the pathogenesis of UFs. Expression levels of DNA repair-related genes RAD51 and BRCA1 were deregulated in fibroid tissues as compared to adjacent myometrial tissues. Expression levels of chromatin protein enhancer of zeste homolog 2 (EZH2) were higher in a subset of fibroids as compared to adjacent myometrial tissues by both immunohistochemistry and Western blot analysis. Treatment with an inhibitor of EZH2 markedly increased expression levels of RAD51 and BRCA1 in fibroid cells and inhibited cell proliferation paired with cell cycle arrest. Restoring the expression of RAD51 and BRCA1 by treatment with EZH2 inhibitor was dependent on reducing the enrichment of trimethylation of histone 3 lysine 27 epigenetic mark in their promoter regions. This study reveals the important role of EZH2-regulated DNA damage-repair genes via histone methylation in fibroid biology, and may provide novel therapeutic targets for the medical treatment of women with symptomatic UFs. PMID:26888970

  20. A review of the collaborative exercises on DNA typing of the Spanish and Portuguese ISFH Working Group. International Society for Forensic Haemogenetics.

    PubMed

    Gómez, J; Rodriguez-Calvo, M S; Albarrán, C; Amorim, A; Andradas, J; Cabrero, C; Calvet, R; Corach, D; Crespillo, M; Doutremépuich, C; García, O; Geada, H; Gené, M; Jimenez, S; Lorente, J A; Marques-Santos, S M; Martínez-Jarreta, B; Martínez de Pancorbo, M; Montes, F; Ruíz de la Cuesta, J M; Sanz, P; Terra-Pinheiro, M F; Vide, M C; Carracedo, A

    1997-01-01

    Since 1992 the Spanish and Portuguese Working Group (GEP) of the International Society for Forensic Haemogenetics (ISFH) has been organizing collaborative exercises on DNA profiling with the aim of making progress on standardization and discussing technical and statistical problems in DNA analysis. A total of four exercises (GEP-92 to GEP-95) have been carried out until now. A consequence of these exercises was the creation of a quality control programme in Spain and Portugal in 1995 which was carried out simultaneously with the GEP-95 exercise. The number of participating laboratories increased from 10 in the first exercise (GEP-92) to 19 in the last exercise (GEP-95). Despite this increasing number of participating laboratories, results remained satisfactory. In the last exercises, all the laboratories used PCR-based DNA polymorphisms with an increasing number of markers obtaining good results. SLPs were used by only 30% of laboratories in the last two exercises but the results indicated a good level of expertise in most of these laboratories. The reasons for these successful results are the common use of the EDNAP protocol for SLP analysis and commercially available kits or common sequenced allelic ladders for PCR-based DNA polymorphisms.

  1. The nicking homing endonuclease I-BasI is encoded by a group I intron in the DNA polymerase gene of the Bacillus thuringiensis phage Bastille

    PubMed Central

    Landthaler, Markus; Shub, David A.

    2003-01-01

    Here we describe the discovery of a group I intron in the DNA polymerase gene of Bacillus thuringiensis phage Bastille. Although the intron insertion site is identical to that of the Bacillus subtilis phages SPO1 and SP82 introns, the Bastille intron differs from them substantially in primary and secondary structure. Like the SPO1 and SP82 introns, the Bastille intron encodes a nicking DNA endonuclease of the H-N-H family, I-BasI, with a cleavage site identical to that of the SPO1-encoded enzyme I-HmuI. Unlike I-HmuI, which nicks both intron-minus and intron-plus DNA, I-BasI cleaves only intron-minus alleles, which is a characteristic of typical homing endonucleases. Interestingly, the C-terminal portions of these H-N-H phage endonucleases contain a conserved sequence motif, the intron-encoded endonuclease repeat motif (IENR1) that also has been found in endonucleases of the GIY-YIG family, and which likely comprises a small DNA-binding module with a globular ββααβ fold, suggestive of module shuffling between different homing endonuclease families. PMID:12799434

  2. The nicking homing endonuclease I-BasI is encoded by a group I intron in the DNA polymerase gene of the Bacillus thuringiensis phage Bastille.

    PubMed

    Landthaler, Markus; Shub, David A

    2003-06-15

    Here we describe the discovery of a group I intron in the DNA polymerase gene of Bacillus thuringiensis phage Bastille. Although the intron insertion site is identical to that of the Bacillus subtilis phages SPO1 and SP82 introns, the Bastille intron differs from them substantially in primary and secondary structure. Like the SPO1 and SP82 introns, the Bastille intron encodes a nicking DNA endonuclease of the H-N-H family, I-BasI, with a cleavage site identical to that of the SPO1-encoded enzyme I-HmuI. Unlike I-HmuI, which nicks both intron-minus and intron-plus DNA, I-BasI cleaves only intron-minus alleles, which is a characteristic of typical homing endonucleases. Interestingly, the C-terminal portions of these H-N-H phage endonucleases contain a conserved sequence motif, the intron-encoded endonuclease repeat motif (IENR1) that also has been found in endonucleases of the GIY-YIG family, and which likely comprises a small DNA-binding module with a globular betabetaalphaalphabeta fold, suggestive of module shuffling between different homing endonuclease families.

  3. DNA profiling analysis of 100 consecutive de novo acute myeloid leukemia cases reveals patterns of genomic instability that affect all cytogenetic risk groups.

    PubMed

    Suela, J; Alvarez, S; Cifuentes, F; Largo, C; Ferreira, B I; Blesa, D; Ardanaz, M; García, R; Marquez, J A; Odero, M D; Calasanz, M J; Cigudosa, J C

    2007-06-01

    We have carried out a high-resolution whole genome DNA profiling analysis on 100 bone marrow samples from a consecutive series of de novo acute myeloid leukemia (AML) cases. After discarding copy number changes that are known to be genetic polymorphisms, we found that genomic aberrations (GA) in the form of gains or losses of genetic material were present in 74% of the samples, with a median of 2 GA per case (range 0-35). In addition to the cytogenetically detected aberration, GA were present in cases from all cytogenetic prognostic groups: 79% in the favorable group, 60% in the intermediate group (including 59% of cases with normal karyotype) and 83% in the adverse group. Five aberrant deleted regions were recurrently associated with cases with a highly aberrant genome (e.g., a 1.5 Mb deletion at 17q11.2 and a 750 kb deletion at 5q31.1). Different degrees of genomic instability showed a statistically significant impact on survival curves, even within the normal karyotype cases. This association was independent of other clinical and genetic parameters. Our study provides, for the first time, a detailed picture of the nature and frequency of DNA copy number aberrations in de novo AML.

  4. DNA repair in normal human and xeroderma pigmentosum group A fibroblasts following treatment with various methanesulfonates and the demonstration of a long-patch repair component

    SciTech Connect

    Snyder, R.D.; Regan, J.D.

    1982-01-01

    Excision repair of DNA in normal and xeroderma pigmentosum complementation group A fibroblasts were examined following treatment with methyl-, ethyl-, and isopropyl methanesulfonate. Studies utilizing repair synthesis methods and inhibition with arabinofuranosyl cytosine revealed two distinct phases of repair; one commencing and terminating within the first 3-5 h after the treatment, and a second much longer phase extending from 9-35 h post-treatment. Both phases of repair have a long-patch component, which establishes for the first time the existence of this mode of repair in response to alkane sulfonate damage. While xeroderma cells display somewhat fewer alkaline labile sites in their DNA following alkylation treatment than do their normal counterparts, researchers are unable to demonstrate a deficiency of these cells in either of the two phases of repair.

  5. RAD25 (SSL2), the yeast homolog of the human xeroderma pigmentosum group B DNA repair gene, is essential for viability

    SciTech Connect

    Park, E.; Prakash, L. ); Guzder, S.N.; Prakash, S. ); Koken, M.H.M.; Jaspers-Dekker, I.; Weeda, G.; Hoeijmakers, H.J. )

    1992-12-01

    Xeroderma pigmentosum (XP) patients are extremely sensitive to ultraviolet (UV) light and suffer from a high incidence of skin cancers, due to a defect in nucleotide excision repair. The disease is genetically heterogeneous, and seven complementation groups, A-G, have been identified. Homologs of human excision repair genes ERCC1, XPDC/ERCC2, and XPAC have been identified in the yeast Saccharomyces cerevisiae. Since no homolog of human XPBC/ERCC3 existed among the known yeast genes, we cloned the yeast homolog by using XPBC cDNA as a hybridization probe. The yeast homolog, RAD25 (SSL2), encodes a protein of 843 amino acids (M[sub r] 95,356). The RAD25 (SSL2)- and XPCX-encoded proteins share 55% identical and 72% conserved amino acid residues, and the two proteins resemble one another in containing the conserved DNA helicase sequence motifs. A nonsense mutation at codon 799 that deletes the 45 C-terminal amino acid residues in RAD25 (SSL2) confers UV sensitivity. This mutation shows epistasis with genes in the excision repair group, whereas a synergistic increase in UN sensitivity occurs when it is combined with mutations in genes in other DNA repair pathways, indicating that RAD25 (SSL2) functions in excision repair but not in other repair pathways. We also show that RAD25 (SSL2) is an essential gene. A mutation of the Lys[sup 392] residue to arginine in the conserved Walker type A nucleotide-binding motif is lethal, suggesting an essential role of the putative RAD 25 (SSL2) ATPase/DNA helicase activity in viability. 40 refs., 3 figs., 1 tab.

  6. The group 10 allergen of Dermatophagoides farinae (Acari: Pyroglyphidae): cDNA cloning, sequence analysis, and expression in Escherichia coli BL21.

    PubMed

    Cui, Yubao; Zhou, Ying; Wang, Yungang; Ma, Guifang; Yang, Li

    2013-01-01

    Dermatophagoides farinae Hughes, American house dust mite, is highly allergenic, producing symptoms in people worldwide. Identifying and cloning the allergens in this species may enable better diagnostic and therapeutic approaches. Here, we cloned, sequenced, and expressed the full-length cDNA encoding D. farinae group 10 allergen (Der f 10) isolated from dust mites in China. Bioinformatic analysis indicated that the 888 bp sequence encoded a cytoskeleton protein 295 amino acids long, with a molecular weight of approximately equal 34 kDa. Sequence alignment with the group 10 allergens of Pyroglyphidae, Acaridae, and Glycyphagidae families revealed that the group 10 allergen from D. farinae is 95% similar to D. pteronyssinus Trouessart and Psoroptes ovis (Hering). These findings lay the groundwork for future studies, including large-scale production of recombinant Der f 10 allergen for diagnostic and therapeutic agents.

  7. Allelic frequency distributions of 21 non-combined DNA index system STR loci in a Russian ethnic minority group from Inner Mongolia, China*

    PubMed Central

    Wang, Hong-dan; Shen, Chun-mei; Liu, Wen-juan; Zhang, Yu-dang; Yang, Guang; Yan, Jiang-wei; Qin, Hai-xia; Zhu, Bo-feng

    2013-01-01

    We studied the allelic frequency distributions and statistical forensic parameters of 21 new short tandem repeat (STR) loci and the amelogenin locus, which are not included in the combined DNA index system (CODIS), in a Russian ethnic minority group from the Inner Mongolia Autonomous Region, China. A total of 114 bloodstain samples from unrelated individuals were extracted and co-amplified with four fluorescence-labeled primers in a multiplex polymerase chain reaction (PCR) system. Using capillary electrophoresis, the PCR products of the 21 STR loci were separated and genotyped. A total of 161 alleles were observed in the Russian ethnic minority group, and corresponding allelic frequencies ranged from 0.0044 to 0.5965. The 21 non-CODIS STR loci of the Russian ethnic minority group were characterized by high genetic diversity and therefore may be useful for elucidating the population’s genetic background, for individual identification, and for paternity testing in forensic practice. PMID:23733431

  8. Universal Plant DNA Barcode Loci May Not Work in Complex Groups: A Case Study with Indian Berberis Species

    PubMed Central

    Roy, Sribash; Tyagi, Antariksh; Shukla, Virendra; Kumar, Anil; Singh, Uma M.; Chaudhary, Lal Babu; Datt, Bhaskar; Bag, Sumit K.; Singh, Pradhyumna K.; Nair, Narayanan K.; Husain, Tariq; Tuli, Rakesh

    2010-01-01

    Background The concept of DNA barcoding for species identification has gained considerable momentum in animals because of fairly successful species identification using cytochrome oxidase I (COI). In plants, matK and rbcL have been proposed as standard barcodes. However, barcoding in complex genera is a challenging task. Methodology and Principal Findings We investigated the species discriminatory power of four reportedly most promising plant DNA barcoding loci (one from nuclear genome- ITS, and three from plastid genome- trnH-psbA, rbcL and matK) in species of Indian Berberis L. (Berberidaceae) and two other genera, Ficus L. (Moraceae) and Gossypium L. (Malvaceae). Berberis species were delineated using morphological characters. These characters resulted in a well resolved species tree. Applying both nucleotide distance and nucleotide character-based approaches, we found that none of the loci, either singly or in combinations, could discriminate the species of Berberis. ITS resolved all the tested species of Ficus and Gossypium and trnH-psbA resolved 82% of the tested species in Ficus. The highly regarded matK and rbcL could not resolve all the species. Finally, we employed amplified fragment length polymorphism test in species of Berberis to determine their relationships. Using ten primer pair combinations in AFLP, the data demonstrated incomplete species resolution. Further, AFLP analysis showed that there was a tendency of the Berberis accessions to cluster according to their geographic origin rather than species affiliation. Conclusions/Significance We reconfirm the earlier reports that the concept of universal barcode in plants may not work in a number of genera. Our results also suggest that the matK and rbcL, recommended as universal barcode loci for plants, may not work in all the genera of land plants. Morphological, geographical and molecular data analyses of Indian species of Berberis suggest probable reticulate evolution and thus barcode markers may

  9. Ancient DNA from Hunter-Gatherer and Farmer Groups from Northern Spain Supports a Random Dispersion Model for the Neolithic Expansion into Europe

    PubMed Central

    Hervella, Montserrat; Izagirre, Neskuts; Alonso, Santos; Fregel, Rosa; Alonso, Antonio; Cabrera, Vicente M.; de la Rúa, Concepción

    2012-01-01

    Background/Principal Findings The phenomenon of Neolithisation refers to the transition of prehistoric populations from a hunter-gatherer to an agro-pastoralist lifestyle. Traditionally, the spread of an agro-pastoralist economy into Europe has been framed within a dichotomy based either on an acculturation phenomenon or on a demic diffusion. However, the nature and speed of this transition is a matter of continuing scientific debate in archaeology, anthropology, and human population genetics. In the present study, we have analyzed the mitochondrial DNA diversity in hunter-gatherers and first farmers from Northern Spain, in relation to the debate surrounding the phenomenon of Neolithisation in Europe. Methodology/Significance Analysis of mitochondrial DNA was carried out on 54 individuals from Upper Paleolithic and Early Neolithic, which were recovered from nine archaeological sites from Northern Spain (Basque Country, Navarre and Cantabria). In addition, to take all necessary precautions to avoid contamination, different authentication criteria were applied in this study, including: DNA quantification, cloning, duplication (51% of the samples) and replication of the results (43% of the samples) by two independent laboratories. Statistical and multivariate analyses of the mitochondrial variability suggest that the genetic influence of Neolithisation did not spread uniformly throughout Europe, producing heterogeneous genetic consequences in different geographical regions, rejecting the traditional models that explain the Neolithisation in Europe. Conclusion The differences detected in the mitochondrial DNA lineages of Neolithic groups studied so far (including these ones of this study) suggest different genetic impact of Neolithic in Central Europe, Mediterranean Europe and the Cantabrian fringe. The genetic data obtained in this study provide support for a random dispersion model for Neolithic farmers. This random dispersion had a different impact on the various

  10. HPV E6/E7 mRNA versus HPV DNA biomarker in cervical cancer screening of a group of Macedonian women.

    PubMed

    Duvlis, Sotirija; Popovska-Jankovic, Katerina; Arsova, Zorica Sarafinovska; Memeti, Shaban; Popeska, Zaneta; Plaseska-Karanfilska, Dijana

    2015-09-01

    High risk types of human papillomaviruses E6/E7 oncogenes and their association with tumor suppressor genes products are the key factors of cervical carcinogenesis. This study proposed them as specific markers for cervical dysplasia screening. The aim of the study is to compare the clinical and prognostic significance of HPV E6/E7 mRNA as an early biomarker versus HPV DNA detection and cytology in triage of woman for cervical cancer. The study group consists of 413 women: 258 NILM, 26 ASC-US, 81 LSIL, 41 HSIL, and 7 unsatisfactory cytology. HPV4AACE screening, real-time multiplex PCR and MY09/11 consensus PCR primers methods were used for the HPV DNA detection. The real-time multiplex nucleic acid sequence-based assay (NucliSENS EasyQ HPV assay) was used for HPV E6/E7 mRNA detection of the five most common high risk HPV types in cervical cancer (16, 18, 31, 33, and 45). The results show that HPV E6/E7 mRNA testing had a higher specificity 50% (95% CI 32-67) and positive predictive value (PPV) 62% (95% CI 46-76) for CIN2+ compared to HPV DNA testing that had specificity of 18% (95% CI 7-37) and PPV 52% (95% CI 39-76) respectively. The higher specificity and PPV of HPV E6/E7 mRNA testing are valuable in predicting insignificant HPV DNA infection among cases with borderline cytological finding. It can help in avoiding aggressive procedures (biopsies and over-referral of transient HPV infections) as well as lowering patient's anxiety and follow up period.

  11. Repair of damaged DNA by extracts from a xeroderma pigmentosum complementation group A revertant and expression of a protein absent in its parental cell line.

    PubMed

    Jones, C J; Cleaver, J E; Wood, R D

    1992-03-11

    Cells derived from individuals with mutations in the xeroderma pigmentosum complementation group A gene (XP-A gene) are hypersensitive to UV light and have a severe defect in nucleotide excision repair of damaged DNA. UV-resistant revertant cell lines can arise from XP-A cells in culture. Cells of one such revertant, XP129, were previously shown to remove (6-4) photoproducts from irradiated DNA, but to have poor repair of cyclobutane pyrimidine dimers. To analyze the biochemical nature of the reversion, whole cell extracts were prepared from the SV40-immortalized fibroblast cell lines XP12RO (an XP-A cell line), the revertant XP129 (derived from XP12RO), and 1BR.3N (from a normal individual). The ability of extracts to carry out repair synthesis in UV-irradiated DNA was examined, and immunoblots were performed using antiserum that recognizes XP-A protein. XP12RO extracts exhibited a very low level of repair and no detectable XP-A protein, but repair activity could be conferred by adding purified XP-A protein to the reaction mixture. XP129 extracts have essentially normal repair synthesis consistent with the observation that most repair of UV-irradiated DNA by extracts appears to occur at (6-4) photoproducts. An XP-A polypeptide of normal size was present in XP129, but in reduced amounts. The results indicate that in XP129 a mutational event has converted the inactive XP12RO XP-A gene into a form which expresses an active XP-A protein.

  12. DNA fingerprinting and anastomosis grouping reveal similar genetic diversity in Rhizoctonia species infecting turfgrasses in the transition zone of USA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rhizoctonia blight (sensu lato) is a common and serious disease of many turfgrass species. The most widespread causal agent, R. solani, consists of several genetically different subpopulations. Though hyphal anastomosis reactions have been used to group Rhizoctonia species, they are time consuming a...

  13. A diverse group of small circular ssDNA viral genomes in human and non-human primate stools

    PubMed Central

    Ng, Terry Fei Fan; Zhang, Wen; Sachsenröder, Jana; Kondov, Nikola O.; da Costa, Antonio Charlys; Vega, Everardo; Holtz, Lori R.; Wu, Guang; Wang, David; Stine, Colin O.; Antonio, Martin; Mulvaney, Usha S.; Muench, Marcus O.; Deng, Xutao; Ambert-Balay, Katia; Pothier, Pierre; Vinjé, Jan; Delwart, Eric

    2015-01-01

    Viral metagenomics sequencing of fecal samples from outbreaks of acute gastroenteritis from the US revealed the presence of small circular ssDNA viral genomes encoding a replication initiator protein (Rep). Viral genomes were ∼2.5 kb in length, with bi-directionally oriented Rep and capsid (Cap) encoding genes and a stem loop structure downstream of Rep. Several genomes showed evidence of recombination. By digital screening of an in-house virome database (1.04 billion reads) using BLAST, we identified closely related sequences from cases of unexplained diarrhea in France. Deep sequencing and PCR detected such genomes in 7 of 25 US (28 percent) and 14 of 21 French outbreaks (67 percent). One of eighty-five sporadic diarrhea cases in the Gambia was positive by PCR. Twenty-two complete genomes were characterized showing that viruses from patients in the same outbreaks were closely related suggesting common origins. Similar genomes were also characterized from the stools of captive chimpanzees, a gorilla, a black howler monkey, and a lemur that were more diverse than the human stool-associated genomes. The name smacovirus is proposed for this monophyletic viral clade. Possible tropism include mammalian enteric cells or ingested food components such as infected plants. No evidence of viral amplification was found in immunodeficient mice orally inoculated with smacovirus-positive stool supernatants. A role for smacoviruses in diarrhea, if any, remains to be demonstrated. PMID:27774288

  14. MtDNA Haplogroup A10 Lineages in Bronze Age Samples Suggest That Ancient Autochthonous Human Groups Contributed to the Specificity of the Indigenous West Siberian Population

    PubMed Central

    Pilipenko, Aleksandr S.; Trapezov, Rostislav O.; Zhuravlev, Anton A.; Molodin, Vyacheslav I.; Romaschenko, Aida G.

    2015-01-01

    Background The craniometric specificity of the indigenous West Siberian human populations cannot be completely explained by the genetic interactions of the western and eastern Eurasian groups recorded in the archaeology of the area from the beginning of the 2nd millennium BC. Anthropologists have proposed another probable explanation: contribution to the genetic structure of West Siberian indigenous populations by ancient human groups, which separated from western and eastern Eurasian populations before the final formation of their phenotypic and genetic features and evolved independently in the region over a long period of time. This hypothesis remains untested. From the genetic point of view, it could be confirmed by the presence in the gene pool of indigenous populations of autochthonous components that evolved in the region over long time periods. The detection of such components, particularly in the mtDNA gene pool, is crucial for further clarification of early regional genetic history. Results and Conclusion We present the results of analysis of mtDNA samples (n = 10) belonging to the A10 haplogroup, from Bronze Age populations of West Siberian forest-steppe (V—I millennium BC), that were identified in a screening study of a large diachronic sample (n = 96). A10 lineages, which are very rare in modern Eurasian populations, were found in all the Bronze Age groups under study. Data on the A10 lineages’ phylogeny and phylogeography in ancient West Siberian and modern Eurasian populations suggest that A10 haplogroup underwent a long-term evolution in West Siberia or arose there autochthonously; thus, the presence of A10 lineages indicates the possible contribution of early autochthonous human groups to the genetic specificity of modern populations, in addition to contributions of later interactions of western and eastern Eurasian populations. PMID:25950581

  15. Elevated levels of STAT1 in Fanconi anemia group A lymphoblasts correlate with the cells’ sensitivity to DNA interstrand crosslinking drugs

    PubMed Central

    Prieto-Remón, Inés; Sánchez-Carrera, Dámaso; López-Duarte, Mónica; Richard, Carlos; Pipaón, Carlos

    2013-01-01

    Progressive bone marrow failure starting in the first decade of life is one of the main characteristics of Fanconi anemia. Along with the bone marrow failure, this pathology is characterized by congenital malformations, endocrine dysfunction and an extraordinary predisposition to develop cancer. The fact that hematopoietic progenitor cells from subjects with Fanconi anemia are sensitive to both DNA-interstrand crosslinking agents and inflammatory cytokines, which are aberrantly overproduced in these patients, has led to different explanations for the causes of the bone marrow failure. We analyzed STAT1 expression in lymphoblastoid cell lines derived from patients with Fanconi anemia group A and correlated this with aspects of the Fanconi anemia phenotype such as sensitivity to genotoxic agents or to inhibitory cytokines. We provide evidence of overexpression of STAT1 in FANCA-deficient cells which has both transcriptional and post-translational components, and is related to the constitutive activation of ERK in Fanconi anemia group A cells, since it can be reverted by treatment with U0126. STAT1 phosphorylation was not defective in the lymphoblasts, so these cells accumulated higher levels of active STAT1 in response to interferon gamma, probably in relation to their greater sensitivity to this cytokine. On the other hand, inhibition of STAT1 by genetic or chemical means reverted the hypersensitivity of Fanconi anemia group A lymphoblasts to DNA interstrand crosslinking agents. Our data provide an explanation for the mixed sensitivity of Fanconi anemia group A cells to both genotoxic stress and inflammatory cytokines and indicate new targets for the treatment of bone marrow failure in these patients. PMID:23585528

  16. The bcr1 DNA Repeat Element Is Specific to the Bacillus cereus Group and Exhibits Mobile Element Characteristics

    PubMed Central

    Økstad, Ole Andreas; Tourasse, Nicolas J.; Stabell, Fredrik B.; Sundfær, Cathrine K.; Egge-Jacobsen, Wolfgang; Risøen, Per Arne; Read, Timothy D.; Kolstø, Anne-Brit

    2004-01-01

    Bacillus cereus strains ATCC 10987 and ATCC 14579 harbor a ∼155-bp repeated element, bcr1, which is conserved in B. cereus, B. anthracis, B. thuringiensis, and B. mycoides but not in B. subtilis and B. licheniformis. In this study, we show by Southern blot hybridizations that bcr1 is present in all 54 B. cereus group strains tested but absent in 11 Bacillus strains outside the group, suggesting that bcr1 may be specific and ubiquitous to the B. cereus group. By comparative analysis of the complete genome sequences of B. cereus ATCC 10987, B. cereus ATCC 14579, and B. anthracis Ames, we show that bcr1 is exclusively present in the chromosome but absent from large plasmids carried by these strains and that the numbers of full-length bcr1 repeats for these strains are 79, 54, and 12, respectively. Numerous copies of partial bcr1 elements are also present in the three genomes (91, 128, and 53, respectively). Furthermore, the genomic localization of bcr1 is not conserved between strains with respect to chromosomal position or organization of gene neighbors, as only six full-length bcr1 loci are common to at least two of the three strains. However, the intergenic sequence surrounding a specific bcr1 repeat in one of the three strains is generally strongly conserved in the other two, even in loci where bcr1 is found exclusively in one strain. This finding indicates that bcr1 either has evolved by differential deletion from a very high number of repeats in a common ancestor to the B. cereus group or is moving around the chromosome. The identification of bcr1 repeats interrupting genes in B. cereus ATCC 10987 and ATCC 14579 and the presence of a flanking TTTAT motif in each end show that bcr1 exhibits features characteristic of a mobile element. PMID:15516586

  17. DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

    SciTech Connect

    Ono, A.; Kan, Lousing ); Chingnien Chen )

    1991-10-15

    The DNA oligomer analogues 3{prime}d (CTTTCTT) 5{prime}-P4-5{prime}d(TTCTTCTT)3{prime} (4), 5{prime}d-(TTTCTTTC) 3{prime}-P2-3{prime}d(CTTTCTTT)5{prime} (5), and 5{prime}d(TTTCTTTC)3{prime}-P2-3{prime}d(CTTTCTTT)5{prime}-P4-5{prime}d-(TTCTTCTT)3{prime} (6) (P2 = {Rho}*{Rho} and P4 = {Rho}*{Rho}*{Rho}{Rho}, where {Rho} = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5{prime}d(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'{center dot} 5{prime}d(TTCTTCTTAAAGAAAGGGCTTTCTTT)3{prime} (1), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5{prime}d(TTCTTCTT)3{prime}(2) and 5{prime}d(TTTCTTTC)3{prime} (3) and the linked oligomer analogues 4-6 with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was 1-5 >> 1-4 >1-(2, 3). The mixture of 1 and 6 showed two transitions corresponding to the dissociation of the third strand. These results are useful when considering the using of oligonucleotide analogues that can bind as third strands to DNA duplexes of higher complexity.

  18. Differential gene flow of mitochondrial and nuclear DNA markers among chromosomal races of Australian morabine grasshoppers (Vandiemenella, viatica species group).

    PubMed

    Kawakami, T; Butlin, R K; Adams, M; Saint, K M; Paull, D J; Cooper, S J B

    2007-12-01

    Recent theoretical developments have led to a renewed interest in the potential role of chromosomal rearrangements in speciation. Australian morabine grasshoppers (genus Vandiemenella, viatica species group) provide an excellent study system to test this potential role of chromosomal rearrangements because they show extensive chromosomal variation and formed the basis of a classic chromosomal speciation model. There are three chromosomal races, viatica19, viatica17, and P24(XY), on Kangaroo Island, South Australia, forming five parapatric populations with four putative contact zones among them. We investigate the extent to which chromosomal variation among these populations may be associated with barriers to gene flow. Population genetic and phylogeographical analyses using 15 variable allozyme loci and the elongation factor-1alpha (EF-1alpha) gene indicate that the three races represent genetically distinct taxa. In contrast, analyses of the mitochondrial cytochrome c oxidase subunit I (COI) gene show the presence of three distinctive and geographically localized groups that do not correspond with the distribution of the chromosomal races. These discordant population genetic patterns are likely to result from introgressive hybridization between the chromosomal races and range expansions/contractions. Overall, these results suggest that reduction of nuclear gene flow may be associated with chromosomal variation, or underlying genetic variation linked with chromosomal variation, whereas mitochondrial gene flow appears to be independent of this variation in these morabine grasshoppers. The identification of an intact contact zone between P24(XY) and viatica17 offers considerable potential for further investigation of molecular mechanisms that maintain distinct nuclear genomes among the chromosomal races.

  19. High-Mobility Group 1/2 Proteins Are Essential for Initiating Rolling-Circle-Type DNA Replication at a Parvovirus Hairpin Origin

    PubMed Central

    Cotmore, Susan F.; Tattersall, Peter

    1998-01-01

    Rolling-circle replication is initiated by a replicon-encoded endonuclease which introduces a single-strand nick into specific origin sequences, becoming covalently attached to the 5′ end of the DNA at the nick and providing a 3′ hydroxyl to prime unidirectional, leading-strand synthesis. Parvoviruses, such as minute virus of mice (MVM), have adapted this mechanism to amplify their linear single-stranded genomes by using hairpin telomeres which sequentially unfold and refold to shuttle the replication fork back and forth along the genome, creating a continuous, multimeric DNA strand. The viral initiator protein, NS1, then excises individual genomes from this continuum by nicking and reinitiating synthesis at specific origins present within the hairpin sequences. Using in vitro assays to study ATP-dependent initiation within the right-hand (5′) MVM hairpin, we have characterized a HeLa cell factor which is absolutely required to allow NS1 to nick this origin. Unlike parvovirus initiation factor (PIF), the cellular complex which activates NS1 endonuclease activity at the left-hand (3′) viral origin, the host factor which activates the right-hand hairpin elutes from phosphocellulose in high salt, has a molecular mass of around 25 kDa, and appears to bind preferentially to structured DNA, suggesting that it might be a member of the high-mobility group 1/2 (HMG1/2) protein family. This prediction was confirmed by showing that purified calf thymus HMG1 and recombinant human HMG1 or murine HMG2 could each substitute for the HeLa factor, activating the NS1 endonuclease in an origin-specific nicking reaction. PMID:9765384

  20. DNA Topoisomerase I Affects Polycomb Group Protein-Mediated Epigenetic Regulation and Plant Development by Altering Nucleosome Distribution in Arabidopsis[W

    PubMed Central

    Liu, Xigang; Gao, Lei; Dinh, Thanh Theresa; Shi, Ting; Li, Dongming; Wang, Ruozhong; Guo, Lin; Xiao, Langtao; Chen, Xuemei

    2014-01-01

    It has been perplexing that DNA topoisomerases, enzymes that release DNA supercoils, play specific roles in development. In this study, using a floral stem cell model in Arabidopsis thaliana, we uncovered a role for TOPOISOMERASE1α (TOP1α) in Polycomb Group (PcG) protein-mediated histone 3 lysine 27 trimethylation (H3K27me3) at, and transcriptional repression of, the stem cell maintenance gene WUSCHEL (WUS). We demonstrated that H3K27me3 deposition at other PcG targets also requires TOP1α. Intriguingly, the repression of some, as well as the expression of many, PcG target genes requires TOP1α. The mechanism that unifies the opposing effects of TOP1α appears to lie in its role in decreasing nucleosome density, which probably allows the binding of factors that either recruit PcG, as we demonstrated for AGAMOUS at the WUS locus, or counteract PcG-mediated regulation. Although TOP1α reduces nucleosome density at all genes, the lack of a 5′ nucleosome-free region is a feature that distinguishes PcG targets from nontargets and may condition the requirement for TOP1α for their expression. This study uncovers a connection between TOP1α and PcG, which explains the specific developmental functions of TOP1α. PMID:25070639

  1. Molecular phylogeny of the subgenus Ceratotropis (genus Vigna, Leguminosae) reveals three eco-geographical groups and Late Pliocene–Pleistocene diversification: evidence from four plastid DNA region sequences

    PubMed Central

    Javadi, Firouzeh; Tun, Ye Tun; Kawase, Makoto; Guan, Kaiyun; Yamaguchi, Hirofumi

    2011-01-01

    Background and Aims The subgenus Ceratotropis in the genus Vigna is widely distributed from the Himalayan highlands to South, Southeast and East Asia. However, the interspecific and geographical relationships of its members are poorly understood. This study investigates the phylogeny and biogeography of the subgenus Ceratotropis using chloroplast DNA sequence data. Methods Sequence data from four intergenic spacer regions (petA-psbJ, psbD-trnT, trnT-trnE and trnT-trnL) of chloroplast DNA, alone and in combination, were analysed using Bayesian and parsimony methods. Divergence times for major clades were estimated with penalized likelihood. Character evolution was examined by means of parsimony optimization and MacClade. Key Results Parsimony and Bayesian phylogenetic analyses on the combined data demonstrated well-resolved species relationships in which 18 Vigna species were divided into two major geographical clades: the East Asia–Southeast Asian clade and the Indian subcontinent clade. Within these two clades, three well-supported eco-geographical groups, temperate and subtropical (the East Asia–Southeast Asian clade) and tropical (the Indian subcontinent clade), are recognized. The temperate group consists of V. minima, V. nepalensis and V. angularis. The subtropical group comprises the V. nakashimae–V. riukiuensis–V. minima subgroup and the V. hirtella–V. exilis–V. umbellata subgroup. The tropical group contains two subgroups: the V. trinervia–V. reflexo-pilosa–V. trilobata subgroup and the V. mungo–V. grandiflora subgroup. An evolutionary rate analysis estimated the divergence time between the East Asia–Southeast Asia clade and the Indian subcontinent clade as 3·62 ± 0·3 million years, and that between the temperate and subtropical groups as 2·0 ± 0·2 million years. Conclusions The findings provide an improved understanding of the interspecific relationships, and ecological and geographical phylogenetic structure of the subgenus

  2. Correction of xeroderma pigmentosum complementation group D mutant cell phenotypes by chromosome and gene transfer: Involvement of the human ERCC2 DNA repair gene

    SciTech Connect

    Flejter, W.L.; McDaniel, L.D.; Johns, D.; Schultz, R.A. ); Friedberg, E.C. )

    1992-01-01

    Cultured cells from individuals afflicted with the genetically heterogeneous autosomal recessive disorder xeroderma pigmentosum (XP) exhibit sensitivity to UV radiation and defective nucleotide excision repair. Complementation of these mutant phenotypes after the introduction of single human chromosomes from repair-proficient cells into XP cells has provided a means of mapping the genes involved in this disease. The authors now report the phenotypic correction of XP cells from genetic complementation group D (XP-D) by a single human chromosome designated Tneo. Detailed molecular characterization of Tneo revealed a rearranged structure involving human chromosomes 16 and 19, including the excision repair cross-complementing 2 (ERCC2) gene from the previously described human DNA repair gene cluster at 19q13.2-q13.3. Direct transfer of a cosmid bearing the ERCC2 gene conferred UV resistance to XP-D cells.

  3. The role of water and K + ion in the charge transfer between PO4- groups of DNA and the lysine + and arginine + side chains of histone proteins

    NASA Astrophysics Data System (ADS)

    Bende, A.; Bogár, F.; Ladik, J.

    2008-09-01

    We have calculated the charge transfer (CT) between the PO4- group of DNA and the lysine (Lys) and arginine (Arg) positive side chains of histones in presence of water and K + ions. The calculations were performed at the HF + MP2 level, using the TZVP basis set. The calculations were corrected for basis set superposition error and besides Mulliken's population analysis we have introduced the - for charged systems more reliable - natural population analysis. The results show that the bare PO4--Lys and the PO4--Arg interactions become weaker, mainly, due to the presence of the K + ion. We have found 0.067 e CT for Lys and 0.050 e for Arg.

  4. The sequences of heat shock protein 40 (DnaJ) homologs provide evidence for a close evolutionary relationship between the Deinococcus-thermus group and cyanobacteria.

    PubMed

    Bustard, K; Gupta, R S

    1997-08-01

    The genes encoding for heat shock protein 40 (Hsp40 or DnaJ) homologs were cloned and sequenced from the archaebacterium Halobacterium cutirubrum and the eubacterium Deinococcus proteolyticus to add to sequences from the gene banks. These genes were identified downstream of the Hsp70 (or DnaK) genes in genomic fragments spanning this region and, as in other prokaryotic species, Hsp70-Hsp40 genes are likely part of the same operon. The Hsp40 homolog from D. proteolyticus was found to be lacking a central 204 base pair region present in H. cutirubrum that encodes for the four cysteine-rich domains of the repeat consensus sequence CxxCxGxG (where x is any amino acid), present in most Hsp40 homologs. The available sequences from various archaebacteria, eubacteria, and eukaryotes show that the same deletion is also present in the homologs from Thermus aquaticus and two cyanobacteria, but in no other species tested. This unique deletion and the clustering of homologs from the Deinococcus-Thermus group and cyanobacterial species in the Hsp40 phylogenetic trees suggest a close evolutionary relationship between these groups as was also shown recently for Hsp70 sequences (R.S. Gupta et al., J Bacteriol 179:345-357, 1997). Sequence comparisons indicate that the Hsp40 homologs are not as conserved as the Hsp70 sequences. Phylogenetic analysis provides no reliable information concerning evolutionary relationship between prokaryotes and eukaryotes and their usefulness in this regard is limited. However, in phylogenetic trees based on Hsp40 sequences, the two archaebacterial homologs showed a polyphyletic branching within Gram-positive bacteria, similar to that seen with Hsp70 sequences.

  5. A study of genetic polymorphisms in mitochondrial DNA hypervariable regions I and II of the five major ethnic groups and Vedda population in Sri Lanka.

    PubMed

    Ranasinghe, Ruwandi; Tennekoon, Kamani H; Karunanayake, Eric H; Lembring, Maria; Allen, Marie

    2015-11-01

    Diversity of the hypervariable regions (HV) I and II of the mitochondrial genome was studied in maternally unrelated Sri Lankans (N=202) from six ethnic groups (i.e.: Sinhalese, Sri Lankan Tamil, Muslim, Malay, Indian Tamil and Vedda). DNA was extracted from blood and buccal swabs and HVI and HVII regions were PCR amplified and sequenced. Resulting sequences were aligned and edited between 16024-16365 and 73-340 regions and compared with revised Cambridge reference sequences (rCRS). One hundred and thirty-five unique haplotypes and 22 shared haplotypes were observed. A total of 145 polymorphic sites and 158 polymorphisms were observed. Hypervariable region I showed a higher polymorphic variation than hypervariable region II. Nucleotide diversities were quite low and similar for all ethnicities apart from a slightly higher value for Indian Tamils and a much lower value for the Vedda population compared to the other groups. When the total population was considered South Asian (Indian) haplogroups were predominant, but there were differences in the distribution of phylo-geographical haplogroups between ethnic groups. Sinhalese, Sri Lankan Tamil and Vedda populations had a considerable presence of West Eurasian haplogroups. About 2/3rd of the Vedda population comprised of macro-haplogroup N or its subclades R and U, whereas macro-haplogroup M was predominant in all other populations. The Vedda population clustered separately from other groups and Sri Lankan Tamils showed a closer genetic affiliation to Sinhalese than to Indian Tamils. Thus this study provides useful information for forensic analysis and anthropological studies of Sri Lankans.

  6. Ectopic expression of DREF induces DNA synthesis, apoptosis, and unusual morphogenesis in the Drosophila eye imaginal disc: possible interaction with Polycomb and trithorax group proteins.

    PubMed

    Hirose, F; Ohshima, N; Shiraki, M; Inoue, Y H; Taguchi, O; Nishi, Y; Matsukage, A; Yamaguchi, M

    2001-11-01

    The promoters of Drosophila genes encoding DNA replication-related proteins contain transcription regulatory element DRE (5'-TATCGATA) in addition to E2F recognition sites. A specific DRE-binding factor, DREF, positively regulates DRE-containing genes. In addition, it has been reported that DREF can bind to a sequence in the hsp70 scs' chromatin boundary element that is also recognized by boundary element-associated factor, and thus DREF may participate in regulating insulator activity. To examine DREF function in vivo, we established transgenic flies in which ectopic expression of DREF was targeted to the eye imaginal discs. Adult flies expressing DREF exhibited a severe rough eye phenotype. Expression of DREF induced ectopic DNA synthesis in the cells behind the morphogenetic furrow, which are normally postmitotic, and abolished photoreceptor specifications of R1, R6, and R7. Furthermore, DREF expression caused apoptosis in the imaginal disc cells in the region where commitment to R1/R6 cells takes place, suggesting that failure of differentiation of R1/R6 photoreceptor cells might cause apoptosis. The DREF-induced rough eye phenotype was suppressed by a half-dose reduction of the E2F gene, one of the genes regulated by DREF, indicating that the DREF overexpression phenotype is useful to screen for modifiers of DREF activity. Among Polycomb/trithorax group genes, we found that a half-dose reduction of some of the trithorax group genes involved in determining chromatin structure or chromatin remodeling (brahma, moira, and osa) significantly suppressed and that reduction of Distal-less enhanced the DREF-induced rough eye phenotype. The results suggest a possibility that DREF activity might be regulated by protein complexes that play a role in modulating chromatin structure. Genetic crosses of transgenic flies expressing DREF to a collection of Drosophila deficiency stocks allowed us to identify several genomic regions, deletions of which caused enhancement or

  7. Molecular cloning, sequence, and expression of a human GDP-L-fucose:. beta. -D-galactoside 2-. alpha. -L-fucosyltransferase cDNA that can form the H blood group antigen

    SciTech Connect

    Larsen, R.D.; Ernst, L.K.; Nair, R.P.; Lowe, J.B. )

    1990-09-01

    The authors have previously used a gene-transfer scheme to isolate a human genomic DNA fragment that determines expression of a GDP-L-fucose:{beta}D-galactoside 2-{alpha}-L-fucosyltransferase. Although this fragment determined expression of an {alpha}(1,2)FT whose kinetic properties mirror those of the human H blood group {alpha}(1,2)FT, their precise nature remained undefined. They describe here the molecular cloning, sequence, and expression of a human of cDNA corresponding to these human genomic sequences. When expressed in COS-1 cells, the cDNA directs expression of cell surface H structures and a cognate {alpha}(1,2)FT activity with properties analogous to the human H blood group {alpha}(1,2)FT. The cDNA sequence predicts a 365-amino acid polypeptide characteristic of a type II transmembrane glycoprotein with a domain structure analogous to that of other glycosyltransferases but without significant primary sequence similarity to these or other known proteins. To directly demonstrate that the cDNA encodes an {alpha}(1,2)FT, the COOH-terminal domain predicted to be Golgi-resident was expressed in COS-1 cells as a catalytically active, secreted, and soluble protein A fusion peptide. Southern blot analysis showed that this cDNA identified DNA sequences syntenic to the human H locus on chromosome 19. These results strongly suggest that this cloned {alpha}(1,2)FT cDNA represents the product of the human H blood group locus.

  8. A novel trimeric Zn (II) complex based on 8-hydroxyquinoline with trifluoromethylbenzene group: Synthesis, crystal structure, photophysical properties and DNA binding

    NASA Astrophysics Data System (ADS)

    Huo, Yanping; Wang, Chunquan; Lu, Jiguo; Hu, Sheng; Li, Xiaoyang; Zhang, Li

    2015-10-01

    A novel 2-substituted-8-hydroxyquinoline ligand (E)-2-[2-(4-trifluoromethylphenyl)ethenyl]-8-hydroxyquinoline (3, HL) was synthesized and characterized by ESI-MS, NMR spectroscopy and elemental analysis. Using solvothermal method, a trimeric complex [Zn3L6] (4) was fabricated by self-assembly of Zn(II) ions with 3. X-ray structural analysis shows that 4 exhibits a trinuclear core, which was bridged and encapsulated by six 8-hydroxyquinolinate-based ligands. The supramolecular structure of 4 features a lamellar solid constructed by aromatic stacking interactions and nonclassical C-H···F hydrogen bonds derived from 4-trifluoromethylphenyl group of the 3. The coordination behavior of zinc salt and 3 in solution was performed by 1H NMR, UV-vis and Photoluminescence (PL). The experimental results show that the complex 4 emits yellow luminescence in the solid state. To investigate its properties further, we also studied the thermal stability, photophysical properties (fluorescent emission, lifetime) of complex 4, and the interactions between 4 and C60 or EtBr-DNA system.

  9. Variations of SSU rDNA group I introns in different isolates of Cordyceps militaris and the loss of an intron during cross-mating.

    PubMed

    Lian, Tiantian; Yang, Tao; Sun, Junde; Guo, Suping; Yang, Huaijun; Dong, Caihong

    2014-08-01

    Cordyceps militaris, the type species of genus Cordyceps, is one of the most popular mushrooms and a nutraceutical in eastern Asia. It is considered a model organism for the study of Cordyceps species because it can complete its life cycle when cultured in vitro. In the present study, the occurrence and sequence variation of SSU rDNA group I introns, Cmi.S943 and Cmi.S1199, among different isolates of C. militaris were analyzed. Based on the secondary structure predictions, the Cmi.S943 intron has been placed in subgroup IC1, and the Cmi.S1199 intron has been placed in subgroup IE. No significant similarity between Cmi.S943 and Cmi.S1199 suggested different origins. Three genotypes, based on the frequency and distribution of introns, were described to discriminate the 57 surveyed C. militaris strains. It was found that the genotype was related to the stroma characteristics. The stromata of all of the genotype II strains, which possessed only Cmi.S943, could produce perithecium. In contrast, the stromata of all genotype III strains, which had both Cmi.S943 and Cmi.S1199, could not produce perithecium. Cmi.S1199 showed the lowest level of intra-specific variation among the tested strains. Group I introns can be lost during strain cross-mating. Therefore, we presumed that during cross-mating and recombination, intron loss could be driven by positive Darwinian selection due to the energetic cost of transcribing long introns.

  10. DNA extraction for short tandem repeat typing from mixed samples using anti-human leukocyte CD45 and ABO blood group antibodies.

    PubMed

    Yano, Shizue; Honda, Katsuya; Kaminiwa, Junko; Nishi, Takeki; Iwabuchi, Yayoi; Sugano, Yukiko; Kurosu, Akira; Suzuki, Yasuhito

    2014-05-01

    DNA testing from mixed cell samples can be difficult to use successfully in criminal investigations. Here, we present a method for the extraction of DNA from mixed bloodstains involving plural contributors, after antibody-microbead captured cell separation. This method, together with the multiplex short tandem repeat typing presented, has proven highly successful in the recovery of DNA profiles corresponding to the ABO blood type. Methodological steps include magnetic separation using leukocyte specific CD45 antibody-coated microbeads and centrifugal separation of leukocyte agglutination by ABO antibody. The detection results of variable mixed ratio showed that the target DNA was detected accurately as low as 1:512 mixed ratio, regardless of the large amount of the background DNA present. The method presented here is applicable to PCR-based identification for various kinds of mixed samples.

  11. Cloning the genes and DNA binding properties of High Mobility Group B1 (HMGB1) proteins from the human blood flukes Schistosoma mansoni and Schistosoma japonicum.

    PubMed

    de Oliveira, Francisco Meirelles Bastos; de Abreu da Silva, Isabel Caetano; Rumjanek, Franklin David; Dias-Neto, Emmanuel; Guimarães, Pedro Edson Moreira; Verjovski-Almeida, Sergio; Stros, Michal; Fantappié, Marcelo Rosado

    2006-08-01

    The parasitic helminth Schistosoma mansoni contains three HMGB proteins, HMGB1, HMGB2 and HMGB3, of primary amino acid sequences highly similar to vertebrate proteins. In this report we describe the characterization of the HMGB1 proteins and their genes from S. mansoni and Schistosoma japonicum. The deduced amino acid sequences of HMGB1 proteins from both schistosome species are identical, and comprise 176 residues. The proteins contain the two evolutionarily highly conserved HMG-box domains, A and B, exhibiting 60% similarity to mammalian HMGB1. Unlike the human HMGB1 which contains an unbroken run of 30 glutamic or aspartic residues, the SmHMGB1 or SjHMGB1 proteins possess unusually short acidic C-terminal tails (5 acidic residues interrupted by 2 serines). Southern hybridization and DNA sequencing revealed a single copy HMGB1 gene, composed of 3 exons and two introns, in S. mansoni. The exon/intron boundaries are identical to those of the human HMGB1 gene, with the exception that the second exon of the SmHMGB1 gene which is not split into two exons as in the human HMGB1 gene. RNA blot analysis revealed that the SmHMGB1 gene is constitutively expressed in similar levels both in male and female worms. The single-sized mRNA for SmHMGB1 is consistent with the size derived from the cDNA. Although DNA binding properties of SmHMGB1 (or SjHMGB1) protein seem to be similar to those previously reported with human HMGB1, i.e., preferential binding to supercoiled DNA over linear DNA, specific recognition of DNA four-way junctions, DNA-induced supercoiling in the presence of topoisomerase I, and DNA bending, we have observed two important differences relative to those observed with the human HMGB1: (i) the inability of the isolated SmHMGB1 domain A to bend DNA (as revealed by T4 ligase-mediated circularization assay), and (ii) higher DNA supercoiling and bending potential of the SmHMGB1 protein as compared to its human counterpart. The latter finding may indicate that the

  12. Detection of human papillomavirus (HPV) DNA prevalence and p53 codon 72 (Arg72Pro) polymorphism in prostate cancer in a Greek group of patients.

    PubMed

    Michopoulou, Vasiliki; Derdas, Stavros P; Symvoulakis, Emmanouil; Mourmouras, Nikolaos; Nomikos, Alexandros; Delakas, Dimitris; Sourvinos, George; Spandidos, Demetrios A

    2014-12-01

    Prostate cancer is the most common neoplasm found in males and the second most frequent cause of cancer-related mortality in males in Greece. Among other pathogens, the detection frequency of human papillomavirus (HPV) has been found to be significantly increased in tumor tissues among patients with sexually transmitted diseases (STDs), depending on the geographical distribution of each population studied. The present study focused on the detection of HPV and the distribution of Arg72Pro p53 polymorphism in a cohort of healthy individuals, as well as prostate cancer patients. We investigated the presence of HPV in 50 paraffin-embedded prostate cancer tissues, as well as in 30 physiological tissue samples from healthy individuals by real-time PCR. Furthermore, the same group of patients was also screened for the presence of the Arg72Pro polymorphism of the p53 gene, a p53 polymorphism related to HPV. Out of the 30 control samples, only 1 was found positive for HPV (3.33 %). On the contrary, HPV DNA was detected in 8 out of the total 50 samples (16 %) in the prostate cancer samples. The distribution of the three genotypes, Arg/Arg, Arg/Pro, and Pro/Pro, was 69.6, 21.7, and 8.7 % in the cancer patients and 75.0, 17.86, and 7.14 % in healthy controls, respectively. No statistically significant association was observed between the HPV presence and the age, stage, p53 polymorphism status at codon 72, or PSA. The increased prevalence of HPV detected in the prostate cancer tissues is in agreement with that reported in previous studies, further supporting the association of HPV infection and prostate cancer.

  13. Phosphorus-nitrogen compounds: Part 28. Syntheses, structural characterizations, antimicrobial and cytotoxic activities, and DNA interactions of new phosphazenes bearing vanillinato and pendant ferrocenyl groups

    NASA Astrophysics Data System (ADS)

    Tümer, Yasemin; Asmafiliz, Nuran; Kılıç, Zeynel; Hökelek, Tuncer; Yasemin Koç, L.; Açık, Leyla; Yola, Mehmet Lütfi; Solak, Ali Osman; Öner, Yağmur; Dündar, Devrim; Yavuz, Makbule

    2013-10-01

    The gradually Cl replacement reactions of spirocyclic mono (1 and 2) and bisferrocenyl cyclotriphosphazenes (3-5) with the potassium salt of 4-hydroxy-3-methoxybenzaldehyde (potassium vanillinate) gave mono (1a-5a), geminal (gem-1b-5b), non-geminal (cis-1b, cis-5b and trans-2b-5b), tri (1c-5c) and tetra-substituted phosphazenes (1d-5d). Some phosphazenes have stereogenic P-center(s). The chirality of 4c was verified using chiral HPLC column. Electrochemical behaviors were influenced only by the number of ferrocene groups, but not the length of the amine chains and the substituent(s). The structures of the new phosphazenes were determined by FTIR, MS, 1H, 13C and 31P NMR, HSQC and HMBC spectral data. The solid-state structures of cis-1b and 4d were examined by single crystal X-ray diffraction techniques. The twelve phosphazene derivatives were screened for antimicrobial activity and the compounds 5a, cis-1b and 2c exhibited the highest antibacterial activity against G(+) and G(-) bacteria. In addition, it was found that overall gem-1b inhibited the growth of Mycobacterium tuberculosis. The compounds 1d, 2d and 4d were tested in HeLa cancer cell lines. Among these compounds, 2d had cytotoxic effect on HeLa cell in the first 48 h. Moreover, interactions between compounds 2a, gem-1b, gem-2b, cis-1b, 2c, 3c, 4c, 5c, 1d, 2d and 4d, and pBR322 plasmid DNA were investigated.

  14. Long-range repression by multiple polycomb group (PcG) proteins targeted by fusion to a defined DNA-binding domain in Drosophila.

    PubMed Central

    Roseman, R R; Morgan, K; Mallin, D R; Roberson, R; Parnell, T J; Bornemann, D J; Simon, J A; Geyer, P K

    2001-01-01

    A tethering assay was developed to study the effects of Polycomb group (PcG) proteins on gene expression in vivo. This system employed the Su(Hw) DNA-binding domain (ZnF) to direct PcG proteins to transposons that carried the white and yellow reporter genes. These reporters constituted naive sensors of PcG effects, as bona fide PcG response elements (PREs) were absent from the constructs. To assess the effects of different genomic environments, reporter transposons integrated at nearly 40 chromosomal sites were analyzed. Three PcG fusion proteins, ZnF-PC, ZnF-SCM, and ZnF-ESC, were studied, since biochemical analyses place these PcG proteins in distinct complexes. Tethered ZnF-PcG proteins repressed white and yellow expression at the majority of sites tested, with each fusion protein displaying a characteristic degree of silencing. Repression by ZnF-PC was stronger than ZnF-SCM, which was stronger than ZnF-ESC, as judged by the percentage of insertion lines affected and the magnitude of the conferred repression. ZnF-PcG repression was more effective at centric and telomeric reporter insertion sites, as compared to euchromatic sites. ZnF-PcG proteins tethered as far as 3.0 kb away from the target promoter produced silencing, indicating that these effects were long range. Repression by ZnF-SCM required a protein interaction domain, the SPM domain, which suggests that this domain is not primarily used to direct SCM to chromosomal loci. This targeting system is useful for studying protein domains and mechanisms involved in PcG repression in vivo. PMID:11333237

  15. The N-terminal Region of Chromodomain Helicase DNA-binding Protein 4 (CHD4) Is Essential for Activity and Contains a High Mobility Group (HMG) Box-like-domain That Can Bind Poly(ADP-ribose)*

    PubMed Central

    Silva, Ana P. G.; Ryan, Daniel P.; Galanty, Yaron; Low, Jason K. K.; Vandevenne, Marylene; Jackson, Stephen P.; Mackay, Joel P.

    2016-01-01

    Chromodomain Helicase DNA-binding protein 4 (CHD4) is a chromatin-remodeling enzyme that has been reported to regulate DNA-damage responses through its N-terminal region in a poly(ADP-ribose) polymerase-dependent manner. We have identified and determined the structure of a stable domain (CHD4-N) in this N-terminal region. The-fold consists of a four-α-helix bundle with structural similarity to the high mobility group box, a domain that is well known as a DNA binding module. We show that the CHD4-N domain binds with higher affinity to poly(ADP-ribose) than to DNA. We also show that the N-terminal region of CHD4, although not CHD4-N alone, is essential for full nucleosome remodeling activity and is important for localizing CHD4 to sites of DNA damage. Overall, these data build on our understanding of how CHD4-NuRD acts to regulate gene expression and participates in the DNA-damage response. PMID:26565020

  16. Chromosomal and mitochondrial diversity in Melitaea didyma complex (Lepidoptera, Nymphalidae): eleven deeply diverged DNA barcode groups in one non-monophyletic species?

    PubMed Central

    Pazhenkova, Elena A.; Lukhtanov, Vladimir A.

    2016-01-01

    Abstract It is generally accepted that cases of species’ polyphyly in COI trees arising as a result of deep intraspecific divergence are negligible, and the detected cases reflect misidentifications or/and methodological errors. Here we studied the problem of species’ non-monophyly through chromosomal and molecular analysis of butterfly taxa close to Melitaea didyma (Esper, 1779) (Lepidoptera, Nymphalidae). We found absence or low interspecific chromosome number variation and presence of intraspecific variation, therefore we conclude that in this group, chromosome numbers have relatively low value as taxonomic markers. Despite low karyotype variability, the group was found to have unexpectedly high mitochondrial haplotype diversity. These haplotypes were clustered in 23 highly diverged haplogroups. Twelve of these haplogroups are associated with nine traditionally recognized and morphologically distinct species Melitaea chitralensis Moore, 1901, Melitaea deserticola Oberthür, 1909, Melitaea didymoides Eversmann, 1847, Melitaea gina Higgins, 1941, Melitaea interrupta Colenati, 1846, Melitaea latonigena Eversmann, 1847, Melitaea mixta Evans, 1912, Melitaea saxatilis Christoph, 1873 and Melitaea sutschana Staudinger, 1892. The rest of the haplogroups (11 lineages) belong to a well-known west-palaearctic species Melitaea didyma. The last species is particularly unusual in the haplotypes we obtained. First, it is clearly polyphyletic with respect to COI gene. Second, the differentiation in COI gene between these mostly allopatric (but in few cases sympatric) eleven lineages is extremely high (up to 7.4%), i.e. much deeper than the “standard” DNA barcode species threshold (2.7–3%). This level of divergence normally could correspond not even to different species, but to different genera. Despite this divergence, the bearers of these haplogroups were found to be morphologically indistinguishable and, most importantly, to share absolutely the same ecological

  17. Sperm DNA oxidative damage and DNA adducts

    PubMed Central

    Jeng, Hueiwang Anna; Pan, Chih-Hong; Chao, Mu-Rong; Lin, Wen-Yi

    2015-01-01

    The objective of this study was to investigate DNA damage and adducts in sperm from coke oven workers who have been exposed to polycyclic aromatic hydrocarbons. A longitudinal study was conducted with repeated measurements during spermatogenesis. Coke-oven workers (n=112) from a coke-oven plant served the PAH-exposed group, while administrators and security personnel (n=67) served the control. Routine semen parameters (concentration, motility, vitality, and morphology) were analyzed simultaneously; the assessment of sperm DNA integrity endpoints included DNA fragmentation, bulky DNA adducts, and 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxo-dGuo). The degree of sperm DNA fragmentation was measured using the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) assay and sperm chromatin structure assay (SCSA). The PAH-exposed group had a significant increase in bulky DNA adducts and 8-oxo-dGuo compared to the control subjects (Ps = 0.002 and 0.045, respectively). Coke oven workers' percentages of DNA fragmentation and denaturation from the PAH-exposed group were not significantly different from those of the control subjects (Ps = 0.232 and 0.245, respectively). Routine semen parameters and DNA integrity endpoints were not correlated. Concentrations of 8-oxo-dGuo were positively correlated with percentages of DNA fragmentation measured by both TUNEL and SCSA (Ps = 0.045 and 0.034, respectively). However, the concentrations of 8-oxo-dGuo and percentages of DNA fragmentation did not correlate with concentrations of bulky DNA adducts. In summary, coke oven workers with chronic exposure to PAHs experienced decreased sperm DNA integrity. Oxidative stress could contribute to the degree of DNA fragmentation. Bulky DNA adducts may be independent of the formation of DNA fragmentation and oxidative adducts in sperm. Monitoring sperm DNA integrity is recommended as a part of the process of assessing the impact of occupational and environmental toxins on

  18. Evolution of eukaryotic single-stranded DNA viruses of the Bidnaviridae family from genes of four other groups of widely different viruses

    NASA Astrophysics Data System (ADS)

    Krupovic, Mart; Koonin, Eugene V.

    2014-06-01

    Single-stranded (ss)DNA viruses are extremely widespread, infect diverse hosts from all three domains of life and include important pathogens. Most ssDNA viruses possess small genomes that replicate by the rolling-circle-like mechanism initiated by a distinct virus-encoded endonuclease. However, viruses of the family Bidnaviridae, instead of the endonuclease, encode a protein-primed type B DNA polymerase (PolB) and hence break this pattern. We investigated the provenance of all bidnavirus genes and uncover an unexpected turbulent evolutionary history of these unique viruses. Our analysis strongly suggests that bidnaviruses evolved from a parvovirus ancestor from which they inherit a jelly-roll capsid protein and a superfamily 3 helicase. The radiation of bidnaviruses from parvoviruses was probably triggered by integration of the ancestral parvovirus genome into a large virus-derived DNA transposon of the Polinton (polintovirus) family resulting in the acquisition of the polintovirus PolB gene along with terminal inverted repeats. Bidnavirus genes for a receptor-binding protein and a potential novel antiviral defense modulator are derived from dsRNA viruses (Reoviridae) and dsDNA viruses (Baculoviridae), respectively. The unusual evolutionary history of bidnaviruses emphasizes the key role of horizontal gene transfer, sometimes between viruses with completely different genomes but occupying the same niche, in the emergence of new viral types.

  19. Evolution of eukaryotic single-stranded DNA viruses of the Bidnaviridae family from genes of four other groups of widely different viruses

    PubMed Central

    Krupovic, Mart; Koonin, Eugene V.

    2014-01-01

    Single-stranded (ss)DNA viruses are extremely widespread, infect diverse hosts from all three domains of life and include important pathogens. Most ssDNA viruses possess small genomes that replicate by the rolling-circle-like mechanism initiated by a distinct virus-encoded endonuclease. However, viruses of the family Bidnaviridae, instead of the endonuclease, encode a protein-primed type B DNA polymerase (PolB) and hence break this pattern. We investigated the provenance of all bidnavirus genes and uncover an unexpected turbulent evolutionary history of these unique viruses. Our analysis strongly suggests that bidnaviruses evolved from a parvovirus ancestor from which they inherit a jelly-roll capsid protein and a superfamily 3 helicase. The radiation of bidnaviruses from parvoviruses was probably triggered by integration of the ancestral parvovirus genome into a large virus-derived DNA transposon of the Polinton (polintovirus) family resulting in the acquisition of the polintovirus PolB gene along with terminal inverted repeats. Bidnavirus genes for a receptor-binding protein and a potential novel antiviral defense modulator are derived from dsRNA viruses (Reoviridae) and dsDNA viruses (Baculoviridae), respectively. The unusual evolutionary history of bidnaviruses emphasizes the key role of horizontal gene transfer, sometimes between viruses with completely different genomes but occupying the same niche, in the emergence of new viral types. PMID:24939392

  20. Reactions of 5-methylcytosine cation radicals in DNA and model systems: thermal deprotonation from the 5-methyl group vs. excited state deprotonation from sugar

    PubMed Central

    Adhikary, Amitava; Kumar, Anil; Palmer, Brian J.; Todd, Andrew D.; Heizer, Alicia N.; Sevilla, Michael D.

    2014-01-01

    Purpose To study the formation and subsequent reactions of the 5-methyl-2′-deoxycytidine cation radical (5-Me-2′-dC•+) in nucleosides and DNA-oligomers and compare to one electron oxidized thymidine. Materials and methods Employing electron spin resonance (ESR), cation radical formation and its reactions were investigated in 5-Me-2′-dC, thymidine (Thd) and their derivatives, in fully double stranded (ds) d[GC*GC*GC*GC*]2 and in the 5-Me-C/A mismatched, d[GGAC*AAGC:CCTAATCG], where C* = 5-Me-C. Results We report 5-Me-2′-dC•+ production by one-electron oxidation of 5-Me-2′-dC by Cl2•− via annealing in the dark at 155 K. Progressive annealing of 5-Me-2′-dC•+ at 155 K produces the allylic radical (C-CH2•). However, photoexcitation of 5-Me-2′-dC•+ by 405 nm laser or by photoflood lamp leads to only C3′• formation. Photoexcitation of N3-deprotonated thyminyl radical in Thd and its 5′-nucleotides leads to C3′• formation but not in 3′-TMP which resulted in the allylic radical (U-CH2•) and C5′• production. For excited 5-Me-2′,3′-ddC•+, absence of the 3′-OH group does not prevent C3′• formation. For d[GC*GC*GC*GC*]2 and d[GGAC*AAGC:CCTAATCG], intra-base paired proton transferred form of G cation radical (G(N1-H)•:C(+H+)) is found with no observable 5-Me-2′-dC•+ formation. Photoexcitation of (G(N1-H)•:C(+H+)) in d[GC*GC*GC*GC*]2 produced only C1′• and not the expected photoproducts from 5-Me-2′-dC•+. However, photoexcitation of (G(N1-H)•:C(+H+)) in d[GGAC*AAGC:CCTAATCG] led to C5′• and C1′• formation. Conclusions C-CH2• formation from 5-Me-2′-dC•+ occurs via ground state deprotonation from C5-methyl group on the base. In the excited 5-Me-2′-dC•+ and 5-Me-2′,3′-ddC•+, spin and charge localization at C3′ followed by deprotonation leads to C3′• formation. Thus, deprotonation from C3′ in the excited cation radical is kinetically controlled and sugar C-H bond energies are

  1. I-PfoP3I: A Novel Nicking HNH Homing Endonuclease Encoded in the Group I Intron of the DNA Polymerase Gene in Phormidium foveolarum Phage Pf-WMP3

    PubMed Central

    Kong, Shuanglei; Liu, Xinyao; Fu, Liwen; Yu, Xiangchun; An, Chengcai

    2012-01-01

    Homing endonucleases encoded in a group I self-splicing intron in a protein-coding gene in cyanophage genomes have not been reported, apart from some free-standing homing edonucleases. In this study, a nicking DNA endonuclease, I-PfoP3I, encoded in a group IA2 intron in the DNA polymerase gene of a T7-like cyanophage Pf-WMP3, which infects the freshwater cyanobacterium Phormidium foveolarum is described. The Pf-WMP3 intron splices efficiently in vivo and self-splices in vitro simultaneously during transcription. I-PfoP3I belongs to the HNH family with an unconventional C-terminal HNH motif. I-PfoP3I nicks the intron-minus Pf-WMP3 DNA polymerase gene more efficiently than the Pf-WMP4 DNA polymerase gene that lacks any intervening sequence in vitro, indicating the variable capacity of I-PfoP3I. I-PfoP3I cleaves 4 nt upstream of the intron insertion site on the coding strand of EXON 1 on both intron-minus Pf-WMP3 and Pf-WMP4 DNA polymerase genes. Using an in vitro cleavage assay and scanning deletion mutants of the intronless target site, the minimal recognition site was determined to be a 14 bp region downstream of the cut site. I-PfoP3I requires Mg2+, Ca2+ or Mn2+ for nicking activity. Phylogenetic analysis suggests that the intron and homing endonuclease gene elements might be inserted in Pf-WMP3 genome individually after differentiation from Pf-WMP4. To our knowledge, this is the first report of the presence of a group I self-splicing intron encoding a functional homing endonuclease in a protein-coding gene in a cyanophage genome. PMID:22952751

  2. The complete mitochondrial DNA sequence of the green alga Pseudendoclonium akinetum (Ulvophyceae) highlights distinctive evolutionary trends in the chlorophyta and suggests a sister-group relationship between the Ulvophyceae and Chlorophyceae.

    PubMed

    Pombert, Jean-François; Otis, Christian; Lemieux, Claude; Turmel, Monique

    2004-05-01

    The mitochondrial genome has undergone radical changes in both the Chlorophyta and Streptophyta, yet little is known about the dynamics of mtDNA evolution in either of these lineages. In the Chlorophyta, which comprises four of the five recognized classes of green algae (Prasinophyceae, Trebouxiophyceae, Ulvophyceae, and Chlorophyceae), the mitochondrial genome varies from 16 to 55 kb. This genome has retained a compact gene organization and a relatively complex gene repertoire ("ancestral" pattern) in the basal lineages represented by the Trebouxiophyceae and Prasinophyceae, whereas it has been reduced in size and gene complement and tends to evolve much more rapidly at the sequence level ("reduced-derived" pattern of evolution) in the Chlorophyceae and the lineage leading to the enigmatic chlorophyte Pedinomonas. To gain information about the evolutionary trends of mtDNA in the Ulvophyceae and also to gain insights into the phylogenetic relationships between ulvophytes and other chlorophytes, we have determined the mtDNA sequence of Pseudendoclonium akinetum. At 95,880 bp, Pseudendoclonium mtDNA is the largest green-algal mitochondrial genome sequenced to date and has the lowest gene density. These derived features are reminiscent of the "expanded" pattern exhibited by embryophyte mtDNAs, indicating that convergent evolution towards genome expansion has occurred independently in the Chlorophyta and Streptophyta. With 57 conserved genes, the gene repertoire of Pseudendoclonium mtDNA is slightly smaller than those of the prasinophyte Nephroselmis olivacea and the trebouxiophyte Prototheca wickerhamii. This ulvophyte mtDNA contains seven group I introns, four of which have homologs in green-algal mtDNAs displaying an "ancestral" or a "reduced-derived" pattern of evolution. Like its counterpart in the chlorophycean green alga Scenedesmus obliquus, it features numerous small, dispersed repeats in intergenic regions and introns. Its overall rate of sequence evolution

  3. The effects of linear assembly of two carbazole groups on acid-base and DNA-binding properties of a ruthenium(II) complex.

    PubMed

    Chen, Xi; Xue, Long-Xin; Ju, Chun-Chuan; Wang, Ke-Zhi

    2013-07-01

    A novel Ru(II) complex of [Ru(bpy)2(Hbcpip)](ClO4)2 {where bpy=2,2-bipyridine, Hbcpip=2-(4-(9H-3,9'-bicarbazol-9-yl)phenyl)-1H-imidazo[4,5-f][1,10]phenanthroline} is synthesized and characterized. Calf-thymus DNA-binding properties of the complex were studied by UV-vis absorption and luminescence titrations, steady-state emission quenching by [Fe(CN)6](4-), DNA competitive binding with ethidium bromide, thermal denaturation and DNA viscosity measurements. The results indicate that the complex partially intercalated into the DNA with a binding constant of (5.5±1.4)×10(5) M(-1) in buffered 50 mM NaCl. The acid-base properties of the complex were also studied by UV-visible and luminescence spectrophotometric pH titrations, and ground- and excited-state acidity ionization constant values were derived.

  4. A biosensing of Toxoplasma gondii DNA with CdTe/Fe3O4 dual functional quantum dot as reporter group

    NASA Astrophysics Data System (ADS)

    Liang, Chu; Xu, Shichao; Yang, Juan; Zhang, Jimei; Dai, Zhao; Sun, Bo; Sun, Shuqing; Feng, Tielin; Zi, Yan; Liu, Jingwei; Luo, Hao

    2009-07-01

    Toxoplasma gondii is an intestinal coccidium that parasitizes members of the cat family as definitive hosts and has a wide range of intermediate hosts. Infection is common in many warm-blooded animals, including humans, the early detection of Toxoplasma gondii was concerned in recent years. In the current research, we presented a fast, specific, and sensitive sensing probe to detect Toxoplasma gondii DNA based on mechanism of fluorescence energy transfer (FRET), and a magnetic-fluorescent CdTe/Fe3O4 core-shell quantum dots (mQDs) was utilized as energy donor, and a commercial quencher (BHQ-2) was used as energy acceptor, respectively. The CdTe/Fe3O4 mQDs were prepared by layer-by-layer (LBL) process at ambient temperature. The sensing probe was fabricated through labeling a stem-loop Toxoplasma gondii DNA oligonucleotide with mQDs at the 5' end and BHQ-2 at 3' end, respectively, and the resulting sensing probe can be simply isolated and purified from the reactant with a common magnet. Properties of mQDs and sensing probe were determined by transmission electron microscopy (TEM) and fluorescence spectrum (FS). The TEM data demonstrated that the size of mQDs was ~20nm. the FS data indicated fluorescence intensity (FI) was doubled after the complete complimentary target Toxoplasma gondii DNA was introduced comparing with the FI before addition of target Toxoplasma gondii DNA. Moreover, only weak FI change was observed when the target DNA with one-mismatch base pair was added, this result revealed the sensing probe has high sensitivity and specificity. The current sensing probe will has great potential applications in the life science and related research.

  5. Transcriptional Response of Human Neurospheres to Helper-Dependent CAV-2 Vectors Involves the Modulation of DNA Damage Response, Microtubule and Centromere Gene Groups

    PubMed Central

    Licursi, Valerio; Brito, Catarina; La Torre, Mattia; Alves, Paula M.; Simao, Daniel; Mottini, Carla; Salinas, Sara; Negri, Rodolfo; Tagliafico, Enrico; Kremer, Eric J.; Saggio, Isabella

    2015-01-01

    Brain gene transfer using viral vectors will likely become a therapeutic option for several disorders. Helper-dependent (HD) canine adenovirus type 2 vectors (CAV-2) are well suited for this goal. These vectors are poorly immunogenic, efficiently transduce neurons, are retrogradely transported to afferent structures in the brain and lead to long-term transgene expression. CAV-2 vectors are being exploited to unravel behavior, cognition, neural networks, axonal transport and therapy for orphan diseases. With the goal of better understanding and characterizing HD-CAV-2 for brain therapy, we analyzed the transcriptomic modulation induced by HD-CAV-2 in human differentiated neurospheres derived from midbrain progenitors. This 3D model system mimics several aspects of the dynamic nature of human brain. We found that differentiated neurospheres are readily transduced by HD-CAV-2 and that transduction generates two main transcriptional responses: a DNA damage response and alteration of centromeric and microtubule probes. Future investigations on the biochemistry of processes highlighted by probe modulations will help defining the implication of HD-CAV-2 and CAR receptor binding in enchaining these functional pathways. We suggest here that the modulation of DNA damage genes is related to viral DNA, while the alteration of centromeric and microtubule probes is possibly enchained by the interaction of the HD-CAV-2 fibre with CAR. PMID:26207738

  6. [Detection of transfusion transmitted virus (TTV) DNA in sera among three different population groups in Abidjan, Côte d'Ivoire in 2001].

    PubMed

    Ekaza, E; Ogniangué, N C; Kouassi-M'Bengue, A; Kamtchueng, F M; Bankolé, H S; Ehuié, P; Lohoues-Kouacou, J; Faye-Ketté, H; Dosso, M

    2004-05-01

    The aim of this study was to determine the transfusion transmitted Virus (TTV) prevalence in three groups of population from Abidjan, Côte d'Ivoire. The A group contained 39 multitransfused patients, the B group contained 10 blood donors supposed to be healthy persons which have never been transfused and the group C contained 43 patients with chronic liver pathology. In this last group, 33 patients had HBV positive serology and the 10 others, HCV positive serology. We used PCR to investigate TTV in patients serum. Detection rates were comprised between 67% and 82%. This is the first study to provide information about the high portage of TTV in ivorian population.

  7. DNA Nanotechnology-- Architectures Designed with DNA

    NASA Astrophysics Data System (ADS)

    Han, Dongran

    As the genetic information storage vehicle, deoxyribonucleic acid (DNA) molecules are essential to all known living organisms and many viruses. It is amazing that such a large amount of information about how life develops can be stored in these tiny molecules. Countless scientists, especially some biologists, are trying to decipher the genetic information stored in these captivating molecules. Meanwhile, another group of researchers, nanotechnologists in particular, have discovered that the unique and concise structural features of DNA together with its information coding ability can be utilized for nano-construction efforts. This idea culminated in the birth of the field of DNA nanotechnology which is the main topic of this dissertation. The ability of rationally designed DNA strands to self-assemble into arbitrary nanostructures without external direction is the basis of this field. A series of novel design principles for DNA nanotechnology are presented here, from topological DNA nanostructures to complex and curved DNA nanostructures, from pure DNA nanostructures to hybrid RNA/DNA nanostructures. As one of the most important and pioneering fields in controlling the assembly of materials (both DNA and other materials) at the nanoscale, DNA nanotechnology is developing at a dramatic speed and as more and more construction approaches are invented, exciting advances will emerge in ways that we may or may not predict.

  8. Ribosomal DNA sequence divergence and group I introns within the Leucostoma species L. cinctum, L. persoonii, and L. parapersoonii sp. nov., ascomycetes that cause Cytospora canker of fruit trees.

    PubMed

    Adams, Gerard C; Surve-Iyer, Rupa S; Iezzoni, Amy F

    2002-01-01

    Leucostoma species that are the causal agents of Cytospora canker of stone and pome fruit trees were studied in detail. DNA sequence of the internal transcribed spacer regions and the 5.8S of the nuclear ribosomal DNA operon (ITS rDNA) supplied sufficient characters to assess the phylogenetic relationships among species of Leucostoma, Valsa, Valsella, and related anamorphs in Cytospora. Parsimony analysis of the aligned sequence divided Cytospora isolates from fruit trees into clades that generally agreed with the morphological species concepts, and with some of the phenetic groupings (PG 1-6) identified previously by isozyme analysis and cultural characteristics. Phylogenetic analysis inferred that isolates of L. persoonii formed two well-resolved clades distinct from isolates of L. cinctum. Phylogenetic analysis of the ITS rDNA, isozyme analysis, and cultural characteristics supported the inference that L. persoonii groups PG 2 and PG 3 were populations of a new species apparently more genetically different from L. persoonii PG 1 than from isolates representative of L. massariana, L. niveum, L. translucens, and Valsella melastoma. The new species, L. parapersoonii, was described. A diverse collection of isolates of L. cinctum, L. persoonii, and L. parapersoonii were examined for genetic variation using restriction fragment length polymorphism (RFLP) analysis of the ITS rDNA and the five prime end of the large subunit of the rDNA (LSU rDNA). HinfI and HpaII endonucleases were each useful in dividing the Leucostoma isolates into RFLP profiles corresponding to the isozyme phenetic groups, PG 1-6. RFLP analysis was more effective than isozyme analysis in uncovering variation among isolates of L. persoonii PG 1, but less effective within L. cinctum populations. Isolates representative of seven of the L. persoonii formae speciales proposed by G. Défago in 1935 were found to be genetically diverse isolates of PG 1. Two large insertions, 415 and 309 nucleotides long, in

  9. Circular DNA by "Bis-Click" Ligation: Template-Independent Intramolecular Circularization of Oligonucleotides with Terminal Alkynyl Groups Utilizing Bifunctional Azides.

    PubMed

    Yang, Haozhe; Seela, Frank

    2016-01-22

    A highly effective and convenient "bis-click" strategy was developed for the template-independent circularization of single-stranded oligonucleotides by employing copper(I)-assisted azide-alkyne cycloaddition. Terminal triple bonds were incorporated at both ends of linear oligonucleotides. Alkynylated 7-deaza-2'-deoxyadenosine and 2'-deoxyuridine residues with different side chains were used in solid-phase synthesis with phosphoramidite chemistry. The bis-click ligation of linear 9- to 36-mer oligonucleotides with 1,4-bis(azidomethyl)benzene afforded circular DNA in a simple and selective way; azido modification of the oligonucleotide was not necessary. Short ethynyl side chains were compatible with the circularization of longer oligonucleotides, whereas octadiynyl residues were used for short 9-mers. Compared with linear duplexes, circular bis-click constructs exhibit a significantly increased duplex stability over their linear counterparts. The intramolecular bis-click ligation protocol is not limited to DNA, but may also be suitable for the construction of other macrocycles, such as circular RNAs, peptides, or polysaccharides.

  10. High-mobility-group a-like CarD binds to a DNA site optimized for affinity and position and to RNA polymerase to regulate a light-inducible promoter in Myxococcus xanthus.

    PubMed

    García-Heras, Francisco; Abellón-Ruiz, Javier; Murillo, Francisco J; Padmanabhan, S; Elías-Arnanz, Montserrat

    2013-01-01

    The CarD-CarG complex controls various cellular processes in the bacterium Myxococcus xanthus including fruiting body development and light-induced carotenogenesis. The CarD N-terminal domain, which defines the large CarD_CdnL_TRCF protein family, binds to CarG, a zinc-associated protein that does not bind DNA. The CarD C-terminal domain resembles eukaryotic high-mobility-group A (HMGA) proteins, and its DNA binding AT hooks specifically recognize the minor groove of appropriately spaced AT-rich tracts. Here, we investigate the determinants of the only known CarD binding site, the one crucial in CarD-CarG regulation of the promoter of the carQRS operon (P(QRS)), a light-inducible promoter dependent on the extracytoplasmic function (ECF) σ factor CarQ. In vitro, mutating either of the 3-bp AT tracts of this CarD recognition site (TTTCCAGAGCTTT) impaired DNA binding, shifting the AT tracts relative to P(QRS) had no effect or marginally lowered DNA binding, and replacing the native site by the HMGA1a binding one at the human beta interferon promoter (with longer AT tracts) markedly enhanced DNA binding. In vivo, however, all of these changes deterred P(QRS) activation in wild-type M. xanthus, as well as in a strain with the CarD-CarG pair replaced by the Anaeromyxobacter dehalogenans CarD-CarG (CarD(Ad)-CarG(Ad)). CarD(Ad)-CarG(Ad) is functionally equivalent to CarD-CarG despite the lower DNA binding affinity in vitro of CarD(Ad), whose C-terminal domain resembles histone H1 rather than HMGA. We show that CarD physically associates with RNA polymerase (RNAP) specifically via interactions with the RNAP β subunit. Our findings suggest that CarD regulates a light-inducible, ECF σ-dependent promoter by coupling RNAP recruitment and binding to a specific DNA site optimized for affinity and position.

  11. Nuclear DNA PCR-RFLPs that distinguish African and European honey bee groups of subspecies. II: Conversion of long PCR markers to standard PCR.

    PubMed

    Suazo, Alonso; Hall, H Glenn

    2002-08-01

    Nuclear DNA PCR-RFLPs previously found in amplifications of three long (> 5 kbp) anonymous regions of DNA were made analyzable using standard PCR procedures. RFLP analyses were simplified by restricting the amplifications to sections, within each locus, that contained most of the informative polymorphic sites. AluI digests of locus L-1 section 2 (L-1S2) revealed three suballeles of which one was African-specific (Apis mellifera scutellata Lepeletier) and one was east European-predominant (A. m. ligustica Spinola, A. m. carnica Pollman, and A. m. caucasica Gorbachev). Alleles found originally at locus L-2 with AvaI were determined in RFLP analysis of two sections, L-2S1int and L-2S2, resulting in two African-specific and two east European-predominant suballeles. Suballele identity was determined by the combination of banding patterns from both fragments. Polymorphisms revealed by HaeIII in locus L-2 were analyzed in amplifications and digests of L-2SM1int. an 830 bpfragment within L-2S1. Seven suballeles were found of which two were African-specific and three were east European-specific or predominant, including one suballele specific to the east European subspecies A. m. caucasica. In locus L-5, RFLPs were detected with HaeIII, DdeI, and SpeI. HaeIII polymorphisms were analyzed by amplification and digestion offragments L-5S1xt and L-5S1ter: Five suballeles were found of which three were African-specific and one east European-predominant. For DdeI, all five alleles originally found with long PCR could be identified in RFLP analyses of three sections. Two African-specific, one east European-specific, and one west European-predominant (A. m. mellifera L. and A. m. iberica Goetze) suballeles were found. A west European-predominant suballele was also found in RFLP analysis of L-5S3 with SpeI. Allele frequency data from Old World and US. populations are presented.

  12. DNA-cell conjugates

    DOEpatents

    Hsiao, Shih-Chia; Francis, Matthew B.; Bertozzi, Carolyn; Mathies, Richard; Chandra, Ravi; Douglas, Erik; Twite, Amy; Toriello, Nicholas; Onoe, Hiroaki

    2016-05-03

    The present invention provides conjugates of DNA and cells by linking the DNA to a native functional group on the cell surface. The cells can be without cell walls or can have cell walls. The modified cells can be linked to a substrate surface and used in assay or bioreactors.

  13. Internal repetition and intraindividual variation in the rDNA ITS1 of the anopheles punctulatus group (Diptera: Culicidae): multiple units and rates of turnover.

    PubMed

    Bower, James E; Cooper, Robert D; Beebe, Nigel W

    2009-01-01

    The rapid divergence of repetitive sequences makes them desirable markers for phylogenetic studies of closely related groups, provided that a high level of sequence homogeneity has been maintained within species. Intraspecific polymorphisms are found in an increasing number of studies now, and this highlights the need to determine why these occur. In this study we examined intraindividual variation present in the first ribosomal internal transcribed spacer (ITS1) from a group of cryptic mosquito species. Individuals of the Anopheles punctulatus group contained multiple ITS1 length variants that ranged from 1.2 to 8.0 kb. Nucleotide and copy number variation for several homologous internal repeats is common, yet the intraspecific sequence divergence of cloned PCR isolates is comparable to that of other mosquito species (~0.2-1.5%). Most of the length variation is comprised of a 5'-ITS1 repeat that was identified as a duplication of a conserved ITS2 region. Secondary structure conservation for this repeat is pronounced and several repeat types that are highly homogenized have formed. Significant interspecific divergence indicates a high rate of evolutionary change for this spacer. A maximum likelihood tree constructed here was congruent with previous phylogenetic hypotheses and suggests that concerted evolution is also accompanied by interpopulation divergence. The lack of interindividual differences and the presence of homogenized internal repeats suggest that a high rate of turnover has reduced the overall level of variation. However, the intraindividual variation also appears to be maintained by the absence of a single turnover rate and the complex dynamics of ongoing recombination within the spacer.

  14. The 1998-1999 collaborative exercises and proficiency testing program on DNA typing of the Spanish and Portuguese Working Group of the International Society for Forensic Genetics (GEP-ISFG).

    PubMed

    Gómez, J; Carracedo, A

    2000-10-09

    A total of 28 laboratories (labs) submitted results for the 1998 collaborative exercise and the proficiency testing program of the Spanish and Portuguese Working Group of the International Society for Forensic Genetics (GEP-ISFG) group. This number increased to 46 labs in 1999. Six bloodstains were submitted, each one with 200 microl soaked in cotton except the sample no. 6 submitted for DNA quantification which had 2 microl. One of the samples was a mixed stain. A paternity testing case and a criminal case in the 1998 trial (GEP'98) and two paternity testing cases in 1999 (GEP'99) were included and the statistical evaluation of the evidence was requested in both cases. In the GEP'99 trial, a theoretical paternity testing case was included. A total of 52 DNA genetic markers were used by the participants in the GEP'98 trial, which increased to 101 in GEP'99. Despite this increasing number of participating labs, results remained quite satisfactory. All the labs used PCR-based DNA polymorphisms with an increasing number of markers, obtaining good results. SLPs were used by a decreasing number of labs but the results indicated a good level of expertise despite the different protocols used. Good results were also obtained for mtDNA despite the difficulties presented by the samples due to the presence of length heteroplasmy in some samples in both trials. The detection of heteroplasmy should, however, be improved. Similar conclusions were reached for both, the paternity and the criminal case by all the labs. Common methodologies for the statistical evaluation of the paternity case were used and the paternity index and the probability of paternity (with an a priori value of 0.5) reported by most of the labs. Also, a great uniformity was found in the evaluation of the criminal case despite the lack of a specific hypothesis in the design of the exercise. Some errors in statistical programs or in calculations were detected in a theoretical paternity case included in the GEP

  15. Development of a DNA vaccine for chicken infectious anemia and its immunogenicity studies using high mobility group box 1 protein as a novel immunoadjuvant indicated induction of promising protective immune responses.

    PubMed

    Sawant, Pradeep Mahadev; Dhama, Kuldeep; Rawool, Deepak Bhiva; Wani, Mohd Yaqoob; Tiwari, Ruchi; Singh, Shambhu Dayal; Singh, Raj Kumar

    2015-01-03

    Chicken infectious anaemia (CIA) is an economically important and emerging poultry disease reported worldwide. Current CIA vaccines have limitations like, the inability of the virus to grow to high titres in embryos/cell cultures, possession of residual pathogenicity and a risk of reversion to virulence. In the present study, a DNA vaccine, encoding chicken infectious anaemia virus (CIAV) VP1 and VP2 genes, was developed and co-administered with truncated chicken high mobility group box 1 (HMGB1ΔC) protein in young chicks for the evaluation of vaccine immune response. CIAV VP1 and VP2 genes were cloned in pTARGET while HMGB1ΔC in PET32b vector. In vitro expression of these gene constructs was evaluated by Western blotting. Further, recombinant HMGB1ΔC was evaluated for its biological activity. The CIAV DNA vaccine administration in specific pathogen free chicks resulted in moderately protective ELISA antibody titres in the range of 4322.87 ± 359.72 to 8288.19 ± 136.38, increased CD8(+) cells, and a higher titre was observed by co-administration of novel adjuvant (HMGB1ΔC) and booster immunizations. The use of vaccine with adjuvant showed achieving antibody titres nearly 8500, titre considered as highly protective, which indicates that co-immunization of HMGB1ΔC may have a strong adjuvant activity on CIAV DNA vaccine induced immune responses. The able potential of HMGB1 protein holding strong adjuvant activity could be exploited further with trials with vaccines for other important pathogens for achieving the required protective immune responses.

  16. The high mobility group protein HMG I(Y) can stimulate or inhibit DNA binding of distinct transcription factor ATF-2 isoforms.

    PubMed

    Du, W; Maniatis, T

    1994-11-22

    The high mobility group protein HMG I(Y) stimulates the binding of a specific isoform of the activating transcription factor 2 (ATF-2(195)) to the interferon beta (IFN-beta) gene promoter. HMG I(Y) specifically interacts with the basic-leucine zipper region of ATF-2(195), and HMG I(Y) binds to two sites immediately flanking the ATF-2 binding site of the IFN-beta promoter. Here, we show that HMG I(Y) can stimulate the binding of ATF-2(195), at least in part, by promoting ATF-2 dimerization. In addition, we report the characterization of a naturally occurring isoform of ATF-2 (ATF-2(192)) that binds specifically to the IFN-beta promoter but is unable to interact with HMG I(Y). Remarkably, HMG I(Y) inhibits the binding of ATF-2(192) to the IFN-beta promoter. Thus, the ability of HMG I(Y) to specifically interact with ATF-2 correlates with its ability to stimulate ATF-2 binding to the IFN-beta promoter. Comparisons of the amino acid sequences of the basic-leucine zipper domains of ATF-2(195) and ATF-2(192) suggest that HMG I(Y) interacts with a short stretch of basic amino acids near the amino terminus of the basic-leucine zipper domain of ATF-2(195).

  17. Analysis of a genome fragment of a deep-sea uncultivated Group II euryarchaeote containing 16S rDNA, a spectinomycin-like operon and several energy metabolism genes.

    PubMed

    Moreira, David; Rodríguez-Valera, Francisco; López-García, Purificación

    2004-09-01

    We have sequenced and analysed a 39.5 kbp genome fragment of a marine Group II euryarchaeote identified in a metagenomic library of 500 m deep plankton at the Antarctic Polar Front. The clone contains a 16S rRNA gene that is separated from the 23S rRNA gene in the genome. This appears to be a trait shared by Thermoplasmatales and Group II euryarchaeota. This genome fragment exhibits a compact organization, including a few overlapping genes in the canonical spectinomycin-like (spc) operon for ribosomal proteins that is immediately upstream the 16S rDNA. Most open reading frames (ORFs) encoded proteins involved in housekeeping processes and, as expected, exhibited a phylogenetic distribution congruent with that of the 16S rRNA. A considerable number of proteins with predicted transmembrane helices was identified. Among those, two proteins encoded by genes likely forming an operon appear to be part of a membrane terminal electron transport chain. One of these proteins has an unusual domain arrangement including ferredoxin, flavodoxin and one succinate dehydrogenase/fumarate reductase subunit. These proteins probably constitute a new succinate dehydrogenase-like oxidoreductase involved in what could be a novel pathway for energy metabolism in Group II euryarchaeota.

  18. DNA-DNA hybridization study of strains of Chryseobacterium, Elizabethkingia and Empedobacter and of other usually indole-producing non-fermenters of CDC groups IIc, IIe, IIh and IIi, mostly from human clinical sources, and proposals of Chryseobacterium bernardetii sp. nov., Chryseobacterium carnis sp. nov., Chryseobacterium lactis sp. nov., Chryseobacterium nakagawai sp. nov. and Chryseobacterium taklimakanense comb. nov.

    PubMed

    Holmes, B; Steigerwalt, A G; Nicholson, A C

    2013-12-01

    The taxonomic classification of 182 phenotypically similar isolates was evaluated using DNA-DNA hybridization and 16S rRNA gene sequence analysis. These bacterial isolates were mainly derived from clinical sources; all were Gram-negative non-fermenters and most were indole-producing. Phenotypically, they resembled species from the genera Chryseobacterium, Elizabethkingia or Empedobacter or belonged to CDC groups IIc, IIe, IIh and IIi. Based on these analyses, four novel species are described: Chryseobacterium bernardetii sp. nov. (type strain NCTC 13530(T) = CCUG 60564(T) = CDC G229(T)), Chryseobacterium carnis sp. nov. (type strain NCTC 13525(T) = CCUG 60559(T) = CDC G81(T)), Chryseobacterium lactis sp. nov. (type strain NCTC 11390(T) = CCUG 60566(T) = CDC KC1864(T)) and Chryseobacterium nakagawai sp. nov. (type strain NCTC 13529(T) = CCUG 60563(T) = CDC G41(T)). The new combination Chryseobacterium taklimakanense comb. nov. (type strain NCTC 13490(T) = X-65(T) = CCTCC AB 208154(T) = NRRL B-51322(T)) is also proposed to accommodate the reclassified Planobacterium taklimakanense.

  19. DNA Nanotechnology

    NASA Astrophysics Data System (ADS)

    Taniguchi, Masateru; Kawai, Tomoji

    2002-11-01

    DNA is one candidate of promising molecules for molecular electronic devices, since it has the double helix structure with pi-electron bases for electron transport, the address at 0.4 nm intervals, and the self-assembly. Electrical conductivity and nanostructure of DNA and modified DNA molecules are investigated in order to research the application of DNA in nanoelectronic devices. It has been revealed that DNA is a wide-gap semiconductor in the absence of doping. The conductivity of DNA has been controlled by chemical doping, electric field doping, and photo-doping. It has found that Poly(dG)[middle dot]Poly(dC) has the best conductivity and can function as a conducting nanowire. The pattern of DNA network is controlled by changing the concentration of the DNA solution.

  20. Mitochondrial DNA.

    ERIC Educational Resources Information Center

    Wright, Russell G.; Bottino, Paul J.

    1986-01-01

    Provides background information for teachers on mitochondrial DNA, pointing out that it may have once been a free-living organism. Includes a ready-to-duplicate exercise titled "Using Microchondrial DNA to Measure Evolutionary Distance." (JN)

  1. Conformation-dependent DNA attraction

    NASA Astrophysics Data System (ADS)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-05-01

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by

  2. Dna Sequencing

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  3. Molecular and cellular analysis of the DNA repair defect in a patient in Xeroderma pigmentosum complementation group D who has the clinical features of Xeroderma pigmentosum and Cockayne syndrome

    SciTech Connect

    Broughton, B.C.; Thompson, A.F.; Harcourt, S.A.; Cole, J.; Arlett, C.F.; Lehmann, A.R.; Vermeulen, W.; Hoeijmakers, J.H.J.; Botta, E.; Stefanini, M.

    1995-01-01

    Xeroderma pigmentosum (XP) and Cockayne syndrome (CS) are quite distinct genetic disorders that are associated with defects in excision repair of UV-induced DNA damage. A few patients have been described previously with the clinical features of both disorders. In this paper we describe an individual in this category who has unusual cellular responses to UV light. We show that his cultured fibroblasts and lymphocytes are extremely sensitive to irradiation with UV-C, despite a level of nucleotide excision repair that is 30%-40% that of normal cells. The deficiency is assigned to the XP-D complementation group, and we have identified two causative mutations in the XPD gene: a gly{yields}arg change at amino acid 675 in the allele inherited from the patient`s mother and a -1 frameshift at amino acid 669 in the allele inherited from his father. These mutations are in the C-terminal 20% of the 760-amino-acid XPD protein, in a region where we have recently identified several mutations in patients with trichothiodystrophy. 44 refs., 5 figs., 2 tabs.

  4. DNA Immunization

    PubMed Central

    Wang, Shixia; Lu, Shan

    2013-01-01

    DNA immunization was discovered in early 1990s and its use has been expanded from vaccine studies to a broader range of biomedical research, such as the generation of high quality polyclonal and monoclonal antibodies as research reagents. In this unit, three common DNA immunization methods are described: needle injection, electroporation and gene gun. In addition, several common considerations related to DNA immunization are discussed. PMID:24510291

  5. Cinnamate-based DNA photolithography

    NASA Astrophysics Data System (ADS)

    Feng, Lang; Romulus, Joy; Li, Minfeng; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian C.; Weck, Marcus; Chaikin, Paul

    2013-08-01

    As demonstrated by means of DNA nanoconstructs, as well as DNA functionalization of nanoparticles and micrometre-scale colloids, complex self-assembly processes require components to associate with particular partners in a programmable fashion. In many cases the reversibility of the interactions between complementary DNA sequences is an advantage. However, permanently bonding some or all of the complementary pairs may allow for flexibility in design and construction. Here, we show that the substitution of a cinnamate group for a pair of complementary bases provides an efficient, addressable, ultraviolet light-based method to bond complementary DNA covalently. To show the potential of this approach, we wrote micrometre-scale patterns on a surface using ultraviolet light and demonstrated the reversible attachment of conjugated DNA and DNA-coated colloids. Our strategy enables both functional DNA photolithography and multistep, specific binding in self-assembly processes.

  6. Chilean Pitavia more closely related to Oceania and Old World Rutaceae than to Neotropical groups: evidence from two cpDNA non-coding regions, with a new subfamilial classification of the family

    PubMed Central

    Groppo, Milton; Kallunki, Jacquelyn A.; Pirani, José Rubens; Antonelli, Alexandre

    2012-01-01

    Abstract The position of the plant genus Pitavia within an infrafamilial phylogeny of Rutaceae (rue, or orange family) was investigated with the use of two non-coding regions from cpDNA, the trnL-trnF region and the rps16 intron. The only species of the genus, Pitavia punctata Molina, is restricted to the temperate forests of the Coastal Cordillera of Central-Southern Chile and threatened by loss of habitat. The genus traditionally has been treated as part of tribe Zanthoxyleae (subfamily Rutoideae) where it constitutes the monogeneric tribe Pitaviinae. This tribe and genus are characterized by fruits of 1 to 4 fleshy drupelets, unlike the dehiscent fruits typical of the subfamily. Fifty-five taxa of Rutaceae, representing 53 genera (nearly one-third of those in the family) and all subfamilies, tribes, and almost all subtribes of the family were included. Parsimony and Bayesian inference were used to infer the phylogeny; six taxa of Meliaceae, Sapindaceae, and Simaroubaceae, all members of Sapindales, were also used as out-groups. Results from both analyses were congruent and showed Pitavia as sister to Flindersia and Lunasia, both genera with species scattered through Australia, Philippines, Moluccas, New Guinea and the Malayan region, and phylogenetically far from other Neotropical Rutaceae, such as the Galipeinae (Galipeeae, Rutoideae) and Pteleinae (Toddalieae, former Toddalioideae). Additionally, a new circumscription of the subfamilies of Rutaceae is presented and discussed. Only two subfamilies (both monophyletic) are recognized: Cneoroideae (including Dictyolomatoideae, Spathelioideae, Cneoraceae, and Ptaeroxylaceae) and Rutoideae (including not only traditional Rutoideae but also Aurantioideae, Flindersioideae, and Toddalioideae). As a consequence, Aurantioideae (Citrus and allies) is reduced to tribal rank as Aurantieae. PMID:23717188

  7. Patterning nanocrystals using DNA

    NASA Astrophysics Data System (ADS)

    Williams, Shara Carol

    One of the goals of nanotechnology is to enable programmed self-assembly of patterns made of various materials with nanometer-sized control. This dissertation describes the results of experiments templating arrangements of gold and semiconductor nanocrystals using 2'-deoxyribonucleic acid (DNA). Previously, simple DNA-templated linear arrangements of two and three nanocrystals structures have been made. Here, we have sought to assemble larger and more complex nanostructures. Cold-DNA conjugates with 50 to 100 bases self-assembled into planned arrangements using strands of DNA containing complementary base sequences. We used two methods to increase the complexity of the arrangements: using branched synthetic doublers within the DNA covalent backbone to create discrete nanocrystal groupings, and incorporating the nanocrystals into a previously developed DNA lattice structure that self-assembles from tiles made of DNA double-crossover molecules to create ordered nanoparticle arrays. In the first project, the introduction of a covalently-branched synthetic doubler reagent into the backbone of DNA strands created a branched DNA "trimer." This DNA trimer templated various structures that contained groupings of three and four gold nanoparticles, giving promising, but inconclusive transmission electron microscopy (TEM) results. Due to the presence of a variety of possible structures in the reaction mixtures, and due to the difficulty of isolating the desired structures, the TEM and gel electrophoresis results for larger structures having four particles, and for structures containing both 5 and 10 nm gold nanoparticles were inconclusive. Better results may come from using optical detection methods, or from improved sample preparation. In the second project, we worked toward making two-dimensional ordered arrays of nanocrystals. We replicated and improved upon previous results for making DNA lattices, increasing the size of the lattices to a length greater than 20 mum, and

  8. Patterning nanocrystals using DNA

    SciTech Connect

    Williams, Shara Carol

    2003-01-01

    One of the goals of nanotechnology is to enable programmed self-assembly of patterns made of various materials with nanometer-sized control. This dissertation describes the results of experiments templating arrangements of gold and semiconductor nanocrystals using 2'-deoxyribonucleic acid (DNA). Previously, simple DNA-templated linear arrangements of two and three nanocrystals structures have been made.[1] Here, we have sought to assemble larger and more complex nanostructures. Gold-DNA conjugates with 50 to 100 bases self-assembled into planned arrangements using strands of DNA containing complementary base sequences. We used two methods to increase the complexity of the arrangements: using branched synthetic doublers within the DNA covalent backbone to create discrete nanocrystal groupings, and incorporating the nanocrystals into a previously developed DNA lattice structure [2][3] that self-assembles from tiles made of DNA double-crossover molecules to create ordered nanoparticle arrays. In the first project, the introduction of a covalently-branched synthetic doubler reagent into the backbone of DNA strands created a branched DNA ''trimer.'' This DNA trimer templated various structures that contained groupings of three and four gold nanoparticles, giving promising, but inconclusive transmission electron microscopy (TEM) results. Due to the presence of a variety of possible structures in the reaction mixtures, and due to the difficulty of isolating the desired structures, the TEM and gel electrophoresis results for larger structures having four particles, and for structures containing both 5 and 10 nm gold nanoparticles were inconclusive. Better results may come from using optical detection methods, or from improved sample preparation. In the second project, we worked toward making two-dimensional ordered arrays of nanocrystals. We replicated and improved upon previous results for making DNA lattices, increasing the size of the lattices to a length greater than

  9. DNA ligases.

    PubMed

    Tabor, S

    2001-05-01

    DNA ligases catalyze the formation of phosphodiester bonds between juxtaposed 5' phosphate and a 3'-hydroxyl terminus in duplex DNA. This activity can repair single-stranded nicks in duplex DNA and join duplex DNA restriction fragments having either blunt ends or homologous cohesive ends. Two ligases are used for nucleic acid research and their reaction conditions and applications are described in this unit: E. coli ligase and T4 ligase. These enzymes differ in two important properties. One is the source of energy: T4 ligase uses ATP, while E. coli ligase uses NAD. Another important difference is their ability to ligate blunt ends; under normal reaction conditions, only T4 DNA ligase will ligate blunt ends.

  10. Deciphering the Positional Influence of the Hydroxyl Group in the Cinnamoyl Part of 3-Hydroxy Flavonoids for Structural Modification and Their Interaction with the Protonated and B Form of Calf Thymus DNA Using Spectroscopic and Molecular Modeling Studies.

    PubMed

    Pradhan, Ankur Bikash; Haque, Lucy; Bhuiya, Sutanwi; Ganguly, Aniruddha; Das, Suman

    2015-06-11

    Studies on the interaction of naturally occurring flavonoids with different polymorphic forms of nucleic acid are helpful for understanding the molecular aspects of binding mode and providing direction for the use and design of new efficient therapeutic agents. However, much less information is available on the interactions of these compounds with different polymorphic forms of DNA at the molecular level. In this report we investigated the interaction of two widely abundant dietary flavonoids quercetin (Q) and morin (M) with calf thymus (CT) DNA. Spectrophotometric, spectropolarimetric, viscosity measurement, and molecular docking simulation methods are used as tools to delineate the binding mode and probable location of the flavonoids and their effects on the stability and conformation of DNA. It is observed that in the presence of the protonated form of DNA the dual fluorescence of Q and M resulting from the excited-state intramolecular proton transfer (ESIPT) is modified significantly. Structural analysis showed Q and M binds weakly to the B form (groove binding) compared to the protonated form of CT DNA (electrostatic interaction). In both cases, Q binds strongly to both forms of DNA compared to M.

  11. Patenting DNA.

    PubMed

    Bobrow, Martin; Thomas, Sandy

    2002-12-01

    The protection of inventions based on human DNA sequences has been achieved mainly through application of the patent system. Over the past decade, there has been continuing debate about whether this use of intellectual property rights is acceptable. Companies and universities have been active during this period in filing thousands of patent applications. Although many have argued that to claim a DNA sequence in a patent is to claim a discovery, patent law allows discoveries that are useful to be claimed as part of an invention. As the technology to isolate DNA sequences has advanced, the criterion for inventiveness, necessary for any invention to be eligible for filing, has become more difficult to justify in the case of claims to DNA sequences. Moreover, the discovery that a gene is associated with a particular disease is, it is argued, to discover a fact about the world and undeserving of the status of an invention. Careful examination of the grounds for allowing the patenting of DNA sequences as research tools suggests such rewards will rarely be justified. The patenting of DNA sequences as chemical intermediates necessary for the manufacture of therapeutic proteins is, however, reasonable given that the information within the sequence is applied to produce a tangible substance which has application as a medicine. Despite the legal, technical and political complexities of applying the flexibilities with the current law, it is argued that much could be achieved in the area of patenting DNA by raising the thresholds for patentability.

  12. Comparison of Immunogenicity in Rhesus Macaques of Transmitted-Founder, HIV-1 Group M Consensus, and Trivalent Mosaic Envelope Vaccines Formulated as a DNA Prime, NYVAC, and Envelope Protein Boost

    PubMed Central

    Hulot, Sandrine L.; Korber, Bette; Giorgi, Elena E.; Vandergrift, Nathan; Saunders, Kevin O.; Balachandran, Harikrishnan; Mach, Linh V.; Lifton, Michelle A.; Pantaleo, Giuseppe; Tartaglia, Jim; Phogat, Sanjay; Jacobs, Bertram; Kibler, Karen; Perdiguero, Beatriz; Gomez, Carmen E.; Esteban, Mariano; Rosati, Margherita; Felber, Barbara K.; Pavlakis, George N.; Parks, Robert; Lloyd, Krissey; Sutherland, Laura; Scearce, Richard; Letvin, Norman L.; Seaman, Michael S.; Alam, S. Munir; Montefiori, David; Liao, Hua-Xin; Haynes, Barton F.

    2015-01-01

    ABSTRACT An effective human immunodeficiency virus type 1 (HIV-1) vaccine must induce protective antibody responses, as well as CD4+ and CD8+ T cell responses, that can be effective despite extraordinary diversity of HIV-1. The consensus and mosaic immunogens are complete but artificial proteins, computationally designed to elicit immune responses with improved cross-reactive breadth, to attempt to overcome the challenge of global HIV diversity. In this study, we have compared the immunogenicity of a transmitted-founder (T/F) B clade Env (B.1059), a global group M consensus Env (Con-S), and a global trivalent mosaic Env protein in rhesus macaques. These antigens were delivered using a DNA prime-recombinant NYVAC (rNYVAC) vector and Env protein boost vaccination strategy. While Con-S Env was a single sequence, mosaic immunogens were a set of three Envs optimized to include the most common forms of potential T cell epitopes. Both Con-S and mosaic sequences retained common amino acids encompassed by both antibody and T cell epitopes and were central to globally circulating strains. Mosaics and Con-S Envs expressed as full-length proteins bound well to a number of neutralizing antibodies with discontinuous epitopes. Also, both consensus and mosaic immunogens induced significantly higher gamma interferon (IFN-γ) enzyme-linked immunosorbent spot assay (ELISpot) responses than B.1059 immunogen. Immunization with these proteins, particularly Con-S, also induced significantly higher neutralizing antibodies to viruses than B.1059 Env, primarily to tier 1 viruses. Both Con-S and mosaics stimulated more potent CD8-T cell responses against heterologous Envs than did B.1059. Both antibody and cellular data from this study strengthen the concept of using in silico-designed centralized immunogens for global HIV-1 vaccine development strategies. IMPORTANCE There is an increasing appreciation for the importance of vaccine-induced anti-Env antibody responses for preventing HIV-1

  13. Multivalent Lipid--DNA Complexes: Distinct DNA Compaction Regimes

    NASA Astrophysics Data System (ADS)

    Evans, Heather M.; Ahmad, A.; Ewert, K.; Safinya, C. R.

    2004-03-01

    Cationic liposomes (CL), while intrinsically advantageous in comparison to viruses, still have limited success for gene therapy and require more study. CL spontaneously self-assemble with DNA via counterion release, forming small particles approximately 200nm in diameter. X-ray diffraction reveals CL-DNA structures that are typically a multilamellar organization of lipids with DNA intercalated between the layers. We explore the structural properties of CL-DNA complexes formed with new multivalent lipids (Ewert et al, J. Med. Chem. 2002; 45:5023) that range from 2+ to 16+. Contrary to a simple prediction for the DNA interaxial spacing d_DNA based on a geometrical space-filling model, these lipids show dramatic DNA compaction, down to d_DNA ˜ 25 ÅVariations in the membrane charge density, σ _M, lead to distinct spacing regimes. We propose that this DNA condensation is controlled by a unique locking mechanism between the DNA double helix and the large, multivalent lipid head groups. Funded by NSF DMR-0203755 and NIH GM-59288.

  14. Group X

    SciTech Connect

    Fields, Susannah

    2007-08-16

    This project is currently under contract for research through the Department of Homeland Security until 2011. The group I was responsible for studying has to remain confidential so as not to affect the current project. All dates, reference links and authors, and other distinguishing characteristics of the original group have been removed from this report. All references to the name of this group or the individual splinter groups has been changed to 'Group X'. I have been collecting texts from a variety of sources intended for the use of recruiting and radicalizing members for Group X splinter groups for the purpose of researching the motivation and intent of leaders of those groups and their influence over the likelihood of group radicalization. This work included visiting many Group X websites to find information on splinter group leaders and finding their statements to new and old members. This proved difficult because the splinter groups of Group X are united in beliefs, but differ in public opinion. They are eager to tear each other down, prove their superiority, and yet remain anonymous. After a few weeks of intense searching, a list of eight recruiting texts and eight radicalizing texts from a variety of Group X leaders were compiled.

  15. Group Flow and Group Genius

    ERIC Educational Resources Information Center

    Sawyer, Keith

    2015-01-01

    Keith Sawyer views the spontaneous collaboration of group creativity and improvisation actions as "group flow," which organizations can use to function at optimum levels. Sawyer establishes ideal conditions for group flow: group goals, close listening, complete concentration, being in control, blending egos, equal participation, knowing…

  16. DNA-Catalyzed Amide Hydrolysis

    PubMed Central

    Zhou, Cong; Avins, Joshua L.; Klauser, Paul C.; Brandsen, Benjamin M.; Lee, Yujeong; Silverman, Scott K.

    2016-01-01

    DNA catalysts (deoxyribozymes) for a variety of reactions have been identified by in vitro selection. However, for certain reactions this identification has not been achieved. One important example is DNA-catalyzed amide hydrolysis, for which a previous selection experiment instead led to DNA-catalyzed DNA phosphodiester hydrolysis. Subsequent efforts in which the selection strategy deliberately avoided phosphodiester hydrolysis led to DNA-catalyzed ester and aromatic amide hydrolysis, but aliphatic amide hydrolysis has been elusive. In the present study, we show that including modified nucleotides that bear protein-like functional groups (any one of primary amino, carboxyl, or primary hydroxyl) enables identification of amide-hydrolyzing deoxyribozymes. In one case, the same deoxyribozyme sequence without the modifications still retains substantial catalytic activity. Overall, these findings establish the utility of introducing protein-like functional groups into deoxyribozymes for identifying new catalytic function. The results also suggest the longer-term feasibility of deoxyribozymes as artificial proteases. PMID:26854515

  17. Dancing DNA.

    ERIC Educational Resources Information Center

    Pennisi, Elizabeth

    1991-01-01

    An imaging technique that uses fluorescent dyes and allows scientists to track DNA as it moves through gels or in solution is described. The importance, opportunities, and implications of this technique are discussed. (KR)

  18. DNA methylation profiling using bisulfite-based epityping of pooled genomic DNA.

    PubMed

    Docherty, Sophia J; Davis, Oliver S P; Haworth, Claire M A; Plomin, Robert; Mill, Jonathan

    2010-11-01

    DNA methylation plays a vital role in normal cellular function, with aberrant methylation signatures being implicated in a growing number of human pathologies and complex human traits. Methods based on the modification of genomic DNA with sodium bisulfite are considered the 'gold-standard' for DNA methylation profiling on genomic DNA; however they require large amounts of DNA and may be prohibitively expensive when used on the large sample sizes necessary to detect small effects. DNA pooling approaches are already widely used in large-scale studies of DNA sequence and gene expression. In this paper, we describe the application of this economical DNA pooling technique to the study of DNA methylation profiles. This method generates accurate quantitative assessments of group DNA methylation averages, reducing the time, cost and amount of DNA starting material required for large-scale epigenetic investigation of disease phenotypes.

  19. Isopermutation group

    SciTech Connect

    Muktibodh, A. S.

    2015-03-10

    The concept of ‘Isotopy’ as formulated by Ruggero Maria Santilli [1, 2, 3] plays a vital role in the development of Iso mathematics. Santilli defined iso-fields of characteristic zero. In this paper we extend this definition to define Iso-Galois fields [4] which are essentially of non-zero characteristic. Isotopically isomorphic realizations of a group define isopermutation group which gives a clear cut distinction between automorphic groups and isotopic groups.

  20. DNA adductomics.

    PubMed

    Balbo, Silvia; Turesky, Robert J; Villalta, Peter W

    2014-03-17

    Systems toxicology is a broad-based approach to describe many of the toxicological features that occur within a living system under stress or subjected to exogenous or endogenous exposures. The ultimate goal is to capture an overview of all exposures and the ensuing biological responses of the body. The term exposome has been employed to refer to the totality of all exposures, and systems toxicology investigates how the exposome influences health effects and consequences of exposures over a lifetime. The tools to advance systems toxicology include high-throughput transcriptomics, proteomics, metabolomics, and adductomics, which is still in its infancy. A well-established methodology for the comprehensive measurement of DNA damage resulting from every day exposures is not fully developed. During the past several decades, the (32)P-postlabeling technique has been employed to screen the damage to DNA induced by multiple classes of genotoxicants; however, more robust, specific, and quantitative methods have been sought to identify and quantify DNA adducts. Although triple quadrupole and ion trap mass spectrometry, particularly when using multistage scanning (LC-MS(n)), have shown promise in the field of DNA adductomics, it is anticipated that high-resolution and accurate-mass LC-MS(n) instrumentation will play a major role in assessing global DNA damage. Targeted adductomics should also benefit greatly from improved triple quadrupole technology. Once the analytical MS methods are fully mature, DNA adductomics along with other -omics tools will contribute greatly to the field of systems toxicology.

  1. Home Groups.

    ERIC Educational Resources Information Center

    Stahler, Theresa M.

    All students enrolled in the entry level foundations course in the College of Education of Kutztown University (Pennsylvania) participate in home groups, a cooperative learning strategy. Each student is assigned to a five- or six-person home group on the first day of class. Although group placements are made on the basis of class lists, every…

  2. Galaxy groups

    SciTech Connect

    Brent Tully, R.

    2015-02-01

    Galaxy groups can be characterized by the radius of decoupling from cosmic expansion, the radius of the caustic of second turnaround, and the velocity dispersion of galaxies within this latter radius. These parameters can be a challenge to measure, especially for small groups with few members. In this study, results are gathered pertaining to particularly well-studied groups over four decades in group mass. Scaling relations anticipated from theory are demonstrated and coefficients of the relationships are specified. There is an update of the relationship between light and mass for groups, confirming that groups with mass of a few times 10{sup 12}M{sub ⊙} are the most lit up while groups with more and less mass are darker. It is demonstrated that there is an interesting one-to-one correlation between the number of dwarf satellites in a group and the group mass. There is the suggestion that small variations in the slope of the luminosity function in groups are caused by the degree of depletion of intermediate luminosity systems rather than variations in the number per unit mass of dwarfs. Finally, returning to the characteristic radii of groups, the ratio of first to second turnaround depends on the dark matter and dark energy content of the universe and a crude estimate can be made from the current observations of Ω{sub matter}∼0.15 in a flat topology, with a 68% probability of being less than 0.44.

  3. Tunnelling microscopy of DNA

    NASA Astrophysics Data System (ADS)

    Selci, Stefano; Cricenti, Antonio

    1991-01-01

    Uncoated DNA molecules marked with an activated tris (1-aziridinyl) phosphine oxide (TAPO) solution were deposited on gold substrates and imaged in air with a high resolution Scanning Tunnelling Microscope (STM). The STM operated simultaneously in the constant-current and gap-modulated mode. Highly reproducible STM images have been obtained and interpreted in terms of expected DNA structure. The main periodicity, regularly presented in molecules several hundred Ångstrom long, ranges from 25 Å to 35 Å with an average diameter of 22 Å. Higher resolution images of the minor groove have revealed the phosphate groups along the DNA backbones. Constant-current images of TAPO deposited on gold show a crystalline structure of rows of molecules with a side-by-side spacing of 3 Å.

  4. What Is Mitochondrial DNA?

    MedlinePlus

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  5. GROUP INEQUALITY

    PubMed Central

    Bowles, Samuel; Loury, Glenn C.; Sethi, Rajiv

    2014-01-01

    We explore the combined effect of segregation in social networks, peer effects, and the relative size of a historically disadvantaged group on the incentives to invest in market-rewarded skills and the dynamics of inequality between social groups. We identify conditions under which group inequality will persist in the absence of differences in ability, credit constraints, or labor market discrimination. Under these conditions, group inequality may be amplified even if initial group differences are negligible. Increases in social integration may destabilize an unequal state and make group equality possible, but the distributional and human capital effects of this depend on the demographic composition of the population. When the size of the initially disadvantaged group is sufficiently small, integration can lower the long-run costs of human capital investment in both groups and result in an increase the aggregate skill share. In contrast, when the initially disadvantaged group is large, integration can induce a fall in the aggregate skill share as the costs of human capital investment rise in both groups. We consider applications to concrete cases and policy implications. PMID:25554727

  6. Whitehead Groups of Spinor Groups

    NASA Astrophysics Data System (ADS)

    Monastyrnyĭ, A. P.; Yanchevskiĭ, V. I.

    1991-02-01

    The Whitehead groups of spinor groups are studied. The known Kneser-Tits conjecture for spinor groups is reduced to a spinor analogue of the Tannaka-Artin problem, namely, to the question of whether the group K1Spin(D), where D is a division ring of exponent 2 , is trivial. A counterexample to the Kneser-Tits problem is constructed in the class of spinor groups. The group K1Spin(D) is computed. The stability of the Whitehead groups of spinor groups under purely transcendental extensions of the ground field is established. The R-equivalence on the k-points of spinor groups and the weak approximation problem are considered. The study of spinor group completes the study of the Whitehead groups of algebraic groups of classical type, that was started in studying reduced K-theory (V.P. Platonov) and was continued for reduced unitary K-theory (V.I. Yanchevskiĭ) and Hermitian K-theory (Platonov and Yanchevskiĭ). Bibliography: 50 titles.

  7. DNA vaccines

    NASA Astrophysics Data System (ADS)

    Gregersen, Jens-Peter

    2001-12-01

    Immunization by genes encoding immunogens, rather than with the immunogen itself, has opened up new possibilities for vaccine research and development and offers chances for new applications and indications for future vaccines. The underlying mechanisms of antigen processing, immune presentation and regulation of immune responses raise high expectations for new and more effective prophylactic or therapeutic vaccines, particularly for vaccines against chronic or persistent infectious diseases and tumors. Our current knowledge and experience of DNA vaccination is summarized and critically reviewed with particular attention to basic immunological mechanisms, the construction of plasmids, screening for protective immunogens to be encoded by these plasmids, modes of application, pharmacokinetics, safety and immunotoxicological aspects. DNA vaccines have the potential to accelerate the research phase of new vaccines and to improve the chances of success, since finding new immunogens with the desired properties is at least technically less demanding than for conventional vaccines. However, on the way to innovative vaccine products, several hurdles have to be overcome. The efficacy of DNA vaccines in humans appears to be much less than indicated by early studies in mice. Open questions remain concerning the persistence and distribution of inoculated plasmid DNA in vivo, its potential to express antigens inappropriately, or the potentially deleterious ability to insert genes into the host cell's genome. Furthermore, the possibility of inducing immunotolerance or autoimmune diseases also needs to be investigated more thoroughly, in order to arrive at a well-founded consensus, which justifies the widespread application of DNA vaccines in a healthy population.

  8. Ancient DNA

    PubMed Central

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    In the past two decades, ancient DNA research has progressed from the retrieval of small fragments of mitochondrial DNA from a few late Holocene specimens, to large-scale studies of ancient populations, phenotypically important nuclear loci, and even whole mitochondrial genome sequences of extinct species. However, the field is still regularly marred by erroneous reports, which underestimate the extent of contamination within laboratories and samples themselves. An improved understanding of these processes and the effects of damage on ancient DNA templates has started to provide a more robust basis for research. Recent methodological advances have included the characterization of Pleistocene mammal populations and discoveries of DNA preserved in ancient sediments. Increasingly, ancient genetic information is providing a unique means to test assumptions used in evolutionary and population genetics studies to reconstruct the past. Initial results have revealed surprisingly complex population histories, and indicate that modern phylogeographic studies may give misleading impressions about even the recent evolutionary past. With the advent and uptake of appropriate methodologies, ancient DNA is now positioned to become a powerful tool in biological research and is also evolving new and unexpected uses, such as in the search for extinct or extant life in the deep biosphere and on other planets. PMID:15875564

  9. Linking two DNA duplexes with a rigid linker for DNA nanotechnology

    PubMed Central

    Tashiro, Ryu; Iwamoto, Masahiro; Morinaga, Hironobu; Emura, Tomoko; Hidaka, Kumi; Endo, Masayuki; Sugiyama, Hiroshi

    2015-01-01

    DNA has recently emerged as a promising material for the construction of nanosized architectures. Chemically modified DNA has been suggested to be an important component of such architectural building blocks. We have designed and synthesized a novel H-shaped DNA oligonucleotide dimer that is cross-linked with a structurally rigid linker composed of phenylene and ethynylene groups. A rotatable DNA unit was constructed through the self-assembly of this H-shaped DNA component and two complementary DNA oligonucleotides. In addition to the rotatable unit, a locked DNA unit containing two H-shaped DNA components was also constructed. As an example of an extended locked structure, a hexagonal DNA origami dimer and oligomer were constructed by using H-shaped DNA as linkers. PMID:26130712

  10. Group Theatre.

    ERIC Educational Resources Information Center

    Clark, Brian

    The group interpretation approach to theatre production is defined as a method that will lead to production of plays that will appeal to "all the layers of the conscious and unconscious mind." In practice, it means that the group will develop and use resources of the theatre that orthodox companies too often ignore. The first two chapters of this…

  11. Important role of class I heat shock genes hrcA and dnaK in the heat shock response and the response to pH and NaCl stress of group I Clostridium botulinum strain ATCC 3502.

    PubMed

    Selby, Katja; Lindström, Miia; Somervuo, Panu; Heap, John T; Minton, Nigel P; Korkeala, Hannu

    2011-05-01

    Class I heat shock genes (HSGs) code for molecular chaperones which play a major role in the bacterial response to sudden increases of environmental temperature by assisting protein folding. Quantitative reverse transcriptase real-time PCR gene expression analysis of the food-borne pathogen Clostridium botulinum grown at 37°C showed that the class I HSGs grpE, dnaK, dnaJ, groEL, and groES and their repressor, hrcA, were expressed at constant levels in the exponential and transitional growth phases, whereas strong downregulation of all six genes was observed during stationary phase. After heat shock from 37 to 45°C, all HSGs were transiently upregulated. A mutant with insertionally inactivated hrcA expressed higher levels of class I HSGs during exponential growth than the wild type, followed by upregulation of only groES and groES after heat shock. Inactivation of hrcA or of dnaK encoding a major chaperone resulted in lower maximum growth temperatures than for the wild type and reduced growth rates under optimal conditions compared to the wild type. The dnaK mutant showed growth inhibition under all tested temperature, pH, and NaCl stress conditions. In contrast, the growth of an hrcA mutant was unaffected by mild temperature or acid stress compared to the wild-type strain, indicating that induced class I HSGs support growth under moderately nonoptimal conditions. We show that the expression of class I HSGs plays a major role for survival and growth of C. botulinum under the stressful environmental conditions that may be encountered during food processing or growth in food products, in the mammalian intestine, or in wounds.

  12. DNA Looping, Supercoiling and Tension

    NASA Astrophysics Data System (ADS)

    Finzi, Laura

    2007-11-01

    In complex organisms, activation or repression of gene expression by proteins bound to enhancer or silencer elements located several kilobases away from the promoter is a well recognized phenomenon. However, a mechanistic understanding of any of these multiprotein interactions is still incomplete. Part of the difficulty in characterizing long-range interactions is the complexity of the regulatory systems and also an underestimation of the effect of DNA supercoiling and tension. Supercoiling is expected to promote interactions between DNA sites because it winds the DNA into compact plectonemes in which distant DNA segments more frequently draw close. The idea that DNA is also under various levels of tension is becoming more widely accepted. Forces that stretch the double helix in vivo are the electrostatic repulsion among the negatively charged phosphate groups along the DNA backbone, the action of motor enzymes perhaps acting upon a topologically constrained sequence of DNA or chromosome segregation during cell mitosis following DNA replication. Presently, little is known about the tension acting on DNA in vivo, but characterization of how physiological regulatory processes, such as loop formation, depend on DNA tension in vitro will indicate the stretching force regimes likely to exist in vivo. In this light, the well studied CI protein of bacteriophage l, which was recently found to cause a of 3.8 kbp loop in DNA, is an ideal system in which to characterize long-range gene regulation. The large size of the loop lends itself to single-molecule techniques, which allow characterization of the dynamics of CI-mediated l DNA looping under controlled levels of supercoiling and tension. Such experiments are being used to discover the principles of long-range interactions in l and in more complex systems.

  13. DNA Music.

    ERIC Educational Resources Information Center

    Miner, Carol; della Villa, Paula

    1997-01-01

    Describes an activity in which students reverse-translate proteins from their amino acid sequences back to their DNA sequences then assign musical notes to represent the adenine, guanine, cytosine, and thymine bases. Data is obtained from the National Institutes of Health (NIH) on the Internet. (DDR)

  14. DNA Investigations.

    ERIC Educational Resources Information Center

    Mayo, Ellen S.; Bertino, Anthony J.

    1991-01-01

    Presents a simulation activity that allow students to work through the exercise of DNA profiling and to grapple with some analytical and ethical questions involving a couple arranging with a surrogate mother to have a baby. Can be used to teach the principles of restriction enzyme digestion, gel electrophoresis, and probe hybridization. (MDH)

  15. Synthetic DNA

    PubMed Central

    O’ Driscoll, Aisling; Sleator, Roy D.

    2013-01-01

    With world wide data predicted to exceed 40 trillion gigabytes by 2020, big data storage is a very real and escalating problem. Herein, we discuss the utility of synthetic DNA as a robust and eco-friendly archival data storage solution of the future. PMID:23514938

  16. Group Grammar

    ERIC Educational Resources Information Center

    Adams, Karen

    2015-01-01

    In this article Karen Adams demonstrates how to incorporate group grammar techniques into a classroom activity. In the activity, students practice using the target grammar to do something they naturally enjoy: learning about each other.

  17. Biophysical characterization of DNA binding from single molecule force measurements

    NASA Astrophysics Data System (ADS)

    Chaurasiya, Kathy R.; Paramanathan, Thayaparan; McCauley, Micah J.; Williams, Mark C.

    2010-09-01

    Single molecule force spectroscopy is a powerful method that uses the mechanical properties of DNA to explore DNA interactions. Here we describe how DNA stretching experiments quantitatively characterize the DNA binding of small molecules and proteins. Small molecules exhibit diverse DNA binding modes, including binding into the major and minor grooves and intercalation between base pairs of double-stranded DNA (dsDNA). Histones bind and package dsDNA, while other nuclear proteins such as high mobility group proteins bind to the backbone and bend dsDNA. Single-stranded DNA (ssDNA) binding proteins slide along dsDNA to locate and stabilize ssDNA during replication. Other proteins exhibit binding to both dsDNA and ssDNA. Nucleic acid chaperone proteins can switch rapidly between dsDNA and ssDNA binding modes, while DNA polymerases bind both forms of DNA with high affinity at distinct binding sites at the replication fork. Single molecule force measurements quantitatively characterize these DNA binding mechanisms, elucidating small molecule interactions and protein function.

  18. Biophysical characterization of DNA binding from single molecule force measurements

    PubMed Central

    Chaurasiya, Kathy R.; Paramanathan, Thayaparan; McCauley, Micah J.; Williams, Mark C.

    2010-01-01

    Single molecule force spectroscopy is a powerful method that uses the mechanical properties of DNA to explore DNA interactions. Here we describe how DNA stretching experiments quantitatively characterize the DNA binding of small molecules and proteins. Small molecules exhibit diverse DNA binding modes, including binding into the major and minor grooves and intercalation between base pairs of double-stranded DNA (dsDNA). Histones bind and package dsDNA, while other nuclear proteins such as high mobility group proteins bind to the backbone and bend dsDNA. Single-stranded DNA (ssDNA) binding proteins slide along dsDNA to locate and stabilize ssDNA during replication. Other proteins exhibit binding to both dsDNA and ssDNA. Nucleic acid chaperone proteins can switch rapidly between dsDNA and ssDNA binding modes, while DNA polymerases bind both forms of DNA with high affinity at distinct binding sites at the replication fork. Single molecule force measurements quantitatively characterize these DNA binding mechanisms, elucidating small molecule interactions and protein function. PMID:20576476

  19. DNA nanostructure immobilization to lithographic DNA arrays

    NASA Astrophysics Data System (ADS)

    Negrete, Omar D.

    Although DNA is well known for its genetic role in biology, DNA has also been sought-after as a material for the self-assembly of biological and electronic devices. Examples of DNA nanostructure construction include DNA tiled self-assembly and DNA Origami, where by controlling the sequence and concentration of DNA molecules, the rational design of geometric DNA nanostructures is possible. The assembly of DNA nanostructures takes place in solution and thus they are in disorder and require further organization to construct circuitry or devices. Hence, it is essential for future applications of this technology to develop methods to direct the placement of DNA nanostructures on a surface. To address this challenge my research examines the use of DNA microarrays to capture DNA nanostructures via DNA hybridization. Modern DNA arrays offer a high-density of sequence-specific molecular recognition sites where the addressable placement of DNA nanostructures can be achieved. Using Maskless Array Synthesizer (MAS) technology, I have characterized photolithographic DNA arrays for the hybridization of DNA complexes like large DNA molecules (> 1 kb), DNA-gold nanoparticle conjugates, and DNA Origami. Although modern photolithographic DNA arrays can possess a high-density of sequence (106/cm2), the printed DNA areas are on the order of tens of microns. Thus, I have also developed a method to reduce the DNA array spot size to nanoscale dimensions through the combined use of electron beam lithography with photolithographic DNA synthesis. This work addresses the key elements towards developing a surface patterning technology that takes advantage of DNA base-pairing for both molecular sub-assembly and surface patterning.

  20. Quantum dynamics of a hole migration through DNA: A single strand DNA model.

    PubMed

    Shirmovsky, S Eh

    2016-10-01

    A model predicting the behavior of a hole acting on the DNA strand was investigated. The hole-DNA interaction on the basis of a quantum-classical, non-linear DNA single strand model was described. The fact that a DNA molecule is formed by a furanose ring as its sugar, phosphate group and bases was taken into consideration. Based on the model, results were obtained for the probability of a hole location on the DNA base sequences, such as GTTGGG, GATGTGGG, GTTGTTGGG as well as on the sugar-phosphate groups mated with them.

  1. DNA phosphorothioate modifications influence the global transcriptional response and protect DNA from double-stranded breaks

    PubMed Central

    Gan, Rui; Wu, Xiaolin; He, Wei; Liu, Zhenhua; Wu, Shuangju; Chen, Chao; Chen, Si; Xiang, Qianrong; Deng, Zixin; Liang, Dequan; Chen, Shi; Wang, Lianrong

    2014-01-01

    The modification of DNA by phosphorothioate (PT) occurs when the non-bridging oxygen in the sugar-phosphate backbone of DNA is replaced with sulfur. This DNA backbone modification was recently discovered and is governed by the dndABCDE genes in a diverse group of bacteria and archaea. However, the biological function of DNA PT modifications is poorly understood. In this study, we employed the RNA-seq analysis to characterize the global transcriptional changes in response to PT modifications. Our results show that DNA without PT protection is susceptible to DNA damage caused by the dndFGHI gene products. The DNA double-stranded breaks then trigger the SOS response, cell filamentation and prophage induction. Heterologous expression of dndBCDE conferring DNA PT modifications at GPSA and GPST prevented the damage in Salmonella enterica. Our data provide insights into the physiological role of the DNA PT system. PMID:25319634

  2. Group Learning.

    ERIC Educational Resources Information Center

    Black, Susan

    1992-01-01

    Research suggests that cooperative learning works best when students are first taught group-processing skills, such as leadership, decision making, communication, trust building, and conflict management. Inadequate teacher training and boring assignments can torpedo cooperative learning efforts. Administrators should reassure teachers with…

  3. Prokaryotic DNA ligases unwind superhelical DNA.

    PubMed

    Ivanchenko, M; van Holde, K; Zlatanova, J

    1996-09-13

    We have studied the effect on DNA topology of binding of prokaryotic DNA ligases (T4 and E. coli) to superhelical or nicked circular DNA. Performing topoisomerase I-mediated relaxation in the presence of increasing amounts of T4 ligase led to a shift in the topoisomer distribution to increasingly more negative values. This result suggested that T4 ligase unwound the DNA and was further substantiated by ligation of nicked circular molecules by E. coli DNA ligase in the presence of increasing amounts of T4 ligase. Such an experiment was possible since the two DNA ligases require different cofactors for enzymatic activity. Performing a similar experiment with reverse partners, using E. coli DNA ligase as ligand, and T4 ligase as sealing agent, we observed that the E. coli enzyme also unwound the DNA. Thus, prokaryotic DNA ligases can be added to an ever-growing list of DNA-binding proteins that unwind the DNA upon binding.

  4. Local Group

    NASA Astrophysics Data System (ADS)

    Mateo, M.; Murdin, P.

    2000-11-01

    Not long after EDWIN HUBBLE established that galaxies are `island universes' similar to our home galaxy, the MILKY WAY, he realized that a few of these external galaxies are considerably closer to us than any others. In 1936 he first coined the term `Local Group' in his famous book The Realm of the Nebulae to identify our nearest galactic neighbors. More than 60 yr later, the galaxies of the Loca...

  5. Underrepresented groups

    NASA Technical Reports Server (NTRS)

    Peters, David A.

    1990-01-01

    The problem with the shortage of under represented groups in science and engineering is absolutely crucial, especially considering that U.S. will experience a shortage of 560,000 science and engineering personnel by the year 2010. Most studies by the National Science Foundation also concluded that projected shortages cannot be alleviated without significant increases in the involvement of Blacks, Hispanics, Native Americans, handicapped persons, and women.

  6. Group Connections: Whole Group Teaching.

    ERIC Educational Resources Information Center

    Griffiths, Dorothy

    2002-01-01

    A learner-centered approach to adult group instruction involved learners in investigating 20th-century events. The approach allowed learners to concentrate on different activities according to their abilities and gave them opportunities to develop basic skills and practice teamwork. (SK)

  7. Release of 3-methyladenine from linker and core DNA of chromatin by a purified DNA glycosylase

    SciTech Connect

    Heller, E.P.; Goldthwait, D.A.

    1983-12-01

    Oligonucleosomes were isolated from (/sub 14/C)thymidine-labeled HeLa cells by digestion of the nuclei with micrococcal nuclease and were then alkylated with (/sub 3/H)methylnitrosourea. Nucleosome core particles were also prepared by further digestion of the oligonucleosomes. The distribution of /sub 3/H-labeled methyl groups in the linker versus the core DNA was established by a determination of /sub 3/H:/sub 14/C ratios in oligonucleosome and core DNA. The ratios in the core DNA of 145 and 165 base pair DNA fragments were 5.2 and 5.4, respectively, while the ratio in the oligonucleosomal DNA was 8.2. Assuming an equal mixture (as determined) of 145 and 165 base pair fragments of DNA in the 185 base pair repeat, the relative concentration of /sub 3/H methyl groups in the linker versus the core DNA was 4.2. Thus, 45% of the /sub 3/H methyl groups were in the linker DNA, and 55% were in the core DNA. Some shielding of the DNA was evident during alkylation. The concentrations of alkyl groups on the linker and core DNA were 67 and 12% of that found on free DNA alkylated under comparable conditions. No evidence for preferential shielding of the major or minor groove was observed. The purified 3-methyladenine DNA glycosylase I of Escherichia coli released approximately 37% of the 3-methyladenine from the linker DNA and 13% from the core DNA. The limited enzymatic removal of 3-methyladenine in vitro compared to the efficient removal in vivo suggests that conformational changes of the oligonucleosome and core structure must occur for total repair.

  8. Comparison of three DNA extraction methods for recovery of soil protist DNA.

    PubMed

    Santos, Susana S; Nielsen, Tue Kjærgaard; Hansen, Lars H; Winding, Anne

    2015-08-01

    The use of molecular methods to investigate protist communities in soil is in rapid development this decade. Molecular analysis of soil protist communities is usually dependant on direct genomic DNA extraction from soil and inefficient or differential DNA extraction of protist DNA can lead to bias in downstream community analysis. Three commonly used soil DNA extraction methods have been tested on soil samples from three European Long-Term Observatories (LTOs) with different land-use and three protist cultures belonging to different phylogenetic groups in different growth stages. The methods tested were: ISOm-11063 (a version of the ISO-11063 method modified to include a FastPrep ®-24 mechanical lysis step), GnS-GII (developed by the GenoSol platform to extract soil DNA in large-scale soil surveys) and a commercial DNA extraction kit - Power Lyzer™ PowerSoil® DNA Isolation Kit (MoBio). DNA yield and quality were evaluated along with DNA suitability for amplification of 18S rDNA fragments by PCR. On soil samples, ISOm-11063 yields significantly higher DNA for two of the three soil samples, however, MoBio extraction favors DNA quality. This method was also more effective to recover copies of 18S rDNA numbers from all soil types. In addition and despite the lower yields, higher DNA quality was observed with DNA extracted from protist cultures with the MoBio method. Likewise, a bead-beating step shows to be a good solution for DNA extraction of soil protists, since the recovery of DNA from protist cultures and from the different soil samples with the ISOm method proved to be efficient in recovering PCR-amplifiable DNA. This study showed that soil DNA extraction methods provide biased results towards the cyst stages of protist organism.

  9. Gate-controlled conductance switching in DNA

    PubMed Central

    Xiang, Limin; Palma, Julio L.; Li, Yueqi; Mujica, Vladimiro; Ratner, Mark A.; Tao, Nongjian

    2017-01-01

    Extensive evidence has shown that long-range charge transport can occur along double helical DNA, but active control (switching) of single-DNA conductance with an external field has not yet been demonstrated. Here we demonstrate conductance switching in DNA by replacing a DNA base with a redox group. By applying an electrochemical (EC) gate voltage to the molecule, we switch the redox group between the oxidized and reduced states, leading to reversible switching of the DNA conductance between two discrete levels. We further show that monitoring the individual conductance switching allows the study of redox reaction kinetics and thermodynamics at single molecular level using DNA as a probe. Our theoretical calculations suggest that the switch is due to the change in the energy level alignment of the redox states relative to the Fermi level of the electrodes. PMID:28218275

  10. Gate-controlled conductance switching in DNA

    NASA Astrophysics Data System (ADS)

    Xiang, Limin; Palma, Julio L.; Li, Yueqi; Mujica, Vladimiro; Ratner, Mark A.; Tao, Nongjian

    2017-02-01

    Extensive evidence has shown that long-range charge transport can occur along double helical DNA, but active control (switching) of single-DNA conductance with an external field has not yet been demonstrated. Here we demonstrate conductance switching in DNA by replacing a DNA base with a redox group. By applying an electrochemical (EC) gate voltage to the molecule, we switch the redox group between the oxidized and reduced states, leading to reversible switching of the DNA conductance between two discrete levels. We further show that monitoring the individual conductance switching allows the study of redox reaction kinetics and thermodynamics at single molecular level using DNA as a probe. Our theoretical calculations suggest that the switch is due to the change in the energy level alignment of the redox states relative to the Fermi level of the electrodes.

  11. DNA biosensors based on self-assembled carbon nanotubes.

    PubMed

    Wang, S G; Wang, Ruili; Sellin, P J; Zhang, Qing

    2004-12-24

    DNA biosensors based on self-assembled multi-walled carbon nanotubes (MWNTs) were described in this paper, in which the probe DNA oligonucleotides were immobilized by forming covalent amide bonds between carboxyl groups at the nanotubes and amino groups at the ends of the DNA oligonucleotides. Hybridization between the probe and target DNA oligonucleotides was confirmed by the changes in the voltammetric peak of the indicator of methylene blue. Our results demonstrate that the DNA biosensors based on self-assembled MWNTs had a higher hybridization efficiency compared to those based on random MWNTs. In addition, the developed DNA biosensors also had a high selectivity of hybridization detection.

  12. DNA nanostructure meets nanofabrication.

    PubMed

    Zhang, Guomei; Surwade, Sumedh P; Zhou, Feng; Liu, Haitao

    2013-04-07

    Recent advances in DNA nanotechnology have made it possible to construct DNA nanostructures of almost arbitrary shapes with 2-3 nm of precision in their dimensions. These DNA nanostructures are ideal templates for bottom-up nanofabrication. This review highlights the challenges and recent advances in three areas that are directly related to DNA-based nanofabrication: (1) fabrication of large scale DNA nanostructures; (2) pattern transfer from DNA nanostructure to an inorganic substrate; and (3) directed assembly of DNA nanostructures.

  13. Electronic transport in methylated fragments of DNA

    NASA Astrophysics Data System (ADS)

    de Almeida, M. L.; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; de Moura, F. A. B. F.; Lyra, M. L.

    2015-11-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  14. Electronic transport in methylated fragments of DNA

    SciTech Connect

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L. Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  15. Cardiovascular group

    NASA Technical Reports Server (NTRS)

    Blomqvist, Gunnar

    1989-01-01

    As a starting point, the group defined a primary goal of maintaining in flight a level of systemic oxygen transport capacity comparable to each individual's preflight upright baseline. The goal of maintaining capacity at preflight levels would seem to be a reasonable objective for several different reasons, including the maintenance of good health in general and the preservation of sufficient cardiovascular reserve capacity to meet operational demands. It is also important not to introduce confounding variables in whatever other physiological studies are being performed. A change in the level of fitness is likely to be a significant confounding variable in the study of many organ systems. The principal component of the in-flight cardiovascular exercise program should be large-muscle activity such as treadmill exercise. It is desirable that at least one session per week be monitored to assure maintenance of proper functional levels and to provide guidance for any adjustments of the exercise prescription. Appropriate measurements include evaluation of the heart-rate/workload or the heart-rate/oxygen-uptake relationship. Respiratory gas analysis is helpful by providing better opportunities to document relative workload levels from analysis of the interrelationships among VO2, VCO2, and ventilation. The committee felt that there is no clear evidence that any particular in-flight exercise regimen is protective against orthostatic hypotension during the early readaptation phase. Some group members suggested that maintenance of the lower body muscle mass and muscle tone may be helpful. There is also evidence that late in-flight interventions to reexpand blood volume to preflight levels are helpful in preventing or minimizing postflight orthostatic hypotension.

  16. Adsorption of DNA binding proteins to functionalized carbon nanotube surfaces with and without DNA wrapping.

    PubMed

    Ishibashi, Yu; Oura, Shusuke; Umemura, Kazuo

    2017-02-15

    We examined the adsorption of DNA binding proteins on functionalized, single-walled carbon nanotubes (SWNTs). When SWNTs were functionalized with polyethylene glycol (PEG-SWNT), moderate adsorption of protein molecules was observed. In contrast, nanotubes functionalized with CONH2 groups (CONH2-SWNT) exhibited very strong interactions between the CONH2-SWNT and DNA binding proteins. Instead, when these SWNT surfaces were wrapped with DNA molecules (thymine 30-mers), protein binding was a little decreased. Our results revealed that DNA wrapped PEG-SWNT was one of the most promising candidates to realize DNA nanodevices involving protein reactions on DNA-SWNT surfaces. In addition, the DNA binding protein RecA was more adhesive than single-stranded DNA binding proteins to the functionalized SWNT surfaces.

  17. DNA sequencing using fluorescence background electroblotting membrane

    DOEpatents

    Caldwell, Karin D.; Chu, Tun-Jen; Pitt, William G.

    1992-01-01

    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through said smino groups contained on the surface thereof. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to said target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membrances may be reprobed numerous times.

  18. DNA sequencing using fluorescence background electroblotting membrane

    DOEpatents

    Caldwell, K.D.; Chu, T.J.; Pitt, W.G.

    1992-05-12

    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through amino groups contained on the surface. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to the target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membranes may be reprobed numerous times. No Drawings

  19. The centipede genus Eupolybothrus Verhoeff, 1907 (Chilopoda: Lithobiomorpha: Lithobiidae) in North Africa, a cybertaxonomic revision, with a key to all species in the genus and the first use of DNA barcoding for the group.

    PubMed

    Stoev, Pavel; Akkari, Nesrine; Zapparoli, Marzio; Porco, David; Enghoff, Henrik; Edgecombe, Gregory D; Georgiev, Teodor; Penev, Lyubomir

    2010-06-30

    The centipede genus Eupolybothrus Verhoeff, 1907 in North Africa is revised. A new cavernicolous species, Eupolybothruskahfi Stoev & Akkari, sp. n., is described from a cave in Jebel Zaghouan, northeast Tunisia. Morphologically, it is most closely related to Eupolybothrusnudicornis (Gervais, 1837) from North Africa and Southwest Europe but can be readily distinguished by the long antennae and leg-pair 15, a conical dorso-median protuberance emerging from the posterior part of prefemur 15, and the shape of the male first genital sternite. Molecular sequence data from the cytochrome c oxidase I gene (mtDNA-5' COI-barcoding fragment) exhibit 19.19% divergence between Eupolybothruskahfi and Eupolybothrusnudicornis, an interspecific value comparable to those observed among four other species of Eupolybothrus which, combined with a low intraspecific divergence (0.3-1.14%), supports the morphological diagnosis of Eupolybothruskahfi as a separate species. This is the first troglomorphic myriapod to be found in Tunisia, and the second troglomorph lithobiomorph centipede known from North Africa. Eupolybothrusnudicornis is redescribed based on abundant material from Tunisia and its post-embryonic development, distribution and habitat preferences recorded. Eupolybothruscloudsley-thompsoni Turk, 1955, a nominal species based on Tunisian type material, is placed in synonymy with Eupolybothrusnudicornis. To comply with the latest technological developments in publishing of biological information, the paper implements new approaches in cybertaxonomy, such as fine granularity XML tagging validated against the NLM DTD TaxPub for PubMedCentral and dissemination in XML to various aggregators (GBIF, EOL, Wikipedia), vizualisation of all taxa mentioned in the text via the dynamically created Pensoft Taxon Profile (PTP) page, data publishing, georeferencing of all localities via Google Earth, and ZooBank, GenBank and MorphBank registration of datasets. An interactive key to all valid

  20. Group evaporation

    NASA Technical Reports Server (NTRS)

    Shen, Hayley H.

    1991-01-01

    Liquid fuel combustion process is greatly affected by the rate of droplet evaporation. The heat and mass exchanges between gas and liquid couple the dynamics of both phases in all aspects: mass, momentum, and energy. Correct prediction of the evaporation rate is therefore a key issue in engineering design of liquid combustion devices. Current analytical tools for characterizing the behavior of these devices are based on results from a single isolated droplet. Numerous experimental studies have challenged the applicability of these results in a dense spray. To account for the droplets' interaction in a dense spray, a number of theories have been developed in the past decade. Herein, two tasks are examined. One was to study how to implement the existing theoretical results, and the other was to explore the possibility of experimental verifications. The current theoretical results of group evaporation are given for a monodispersed cluster subject to adiabatic conditions. The time evolution of the fluid mechanic and thermodynamic behavior in this cluster is derived. The results given are not in the form of a subscale model for CFD codes.

  1. Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA

    SciTech Connect

    Verebová, Valéria; Adamcik, Jozef; Danko, Patrik; Podhradský, Dušan; Miškovský, Pavol; Staničová, Jana

    2014-01-31

    Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone), with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode.

  2. DNA ligase I, the replicative DNA ligase.

    PubMed

    Howes, Timothy R L; Tomkinson, Alan E

    2012-01-01

    Multiple DNA ligation events are required to join the Okazaki fragments generated during lagging strand DNA synthesis. In eukaryotes, this is primarily carried out by members of the DNA ligase I family. The C-terminal catalytic region of these enzymes is composed of three domains: a DNA binding domain, an adenylation domain and an OB-fold domain. In the absence of DNA, these domains adopt an extended structure but transition into a compact ring structure when they engage a DNA nick, with each of the domains contacting the DNA. The non-catalytic N-terminal region of eukaryotic DNA ligase I is responsible for the specific participation of these enzymes in DNA replication. This proline-rich unstructured region contains the nuclear localization signal and a PCNA interaction motif that is critical for localization to replication foci and efficient joining of Okazaki fragments. DNA ligase I initially engages the PCNA trimer via this interaction motif which is located at the extreme N-terminus of this flexible region. It is likely that this facilitates an additional interaction between the DNA binding domain and the PCNA ring. The similar size and shape of the rings formed by the PCNA trimer and the DNA ligase I catalytic region when it engages a DNA nick suggest that these proteins interact to form a double-ring structure during the joining of Okazaki fragments. DNA ligase I also interacts with replication factor C, the factor that loads the PCNA trimeric ring onto DNA. This interaction, which is regulated by phosphorylation of the non-catalytic N-terminus of DNA ligase I, also appears to be critical for DNA replication.

  3. DNA modifications: Another stable base in DNA

    NASA Astrophysics Data System (ADS)

    Brazauskas, Pijus; Kriaucionis, Skirmantas

    2014-12-01

    Oxidation of 5-methylcytosine has been proposed to mediate active and passive DNA demethylation. Tracking the history of DNA modifications has now provided the first solid evidence that 5-hydroxymethylcytosine is a stable epigenetic modification.

  4. DNA Damage and Pulmonary Hypertension

    PubMed Central

    Ranchoux, Benoît; Meloche, Jolyane; Paulin, Roxane; Boucherat, Olivier; Provencher, Steeve; Bonnet, Sébastien

    2016-01-01

    Pulmonary hypertension (PH) is defined by a mean pulmonary arterial pressure over 25 mmHg at rest and is diagnosed by right heart catheterization. Among the different groups of PH, pulmonary arterial hypertension (PAH) is characterized by a progressive obstruction of distal pulmonary arteries, related to endothelial cell dysfunction and vascular cell proliferation, which leads to an increased pulmonary vascular resistance, right ventricular hypertrophy, and right heart failure. Although the primary trigger of PAH remains unknown, oxidative stress and inflammation have been shown to play a key role in the development and progression of vascular remodeling. These factors are known to increase DNA damage that might favor the emergence of the proliferative and apoptosis-resistant phenotype observed in PAH vascular cells. High levels of DNA damage were reported to occur in PAH lungs and remodeled arteries as well as in animal models of PH. Moreover, recent studies have demonstrated that impaired DNA-response mechanisms may lead to an increased mutagen sensitivity in PAH patients. Finally, PAH was linked with decreased breast cancer 1 protein (BRCA1) and DNA topoisomerase 2-binding protein 1 (TopBP1) expression, both involved in maintaining genome integrity. This review aims to provide an overview of recent evidence of DNA damage and DNA repair deficiency and their implication in PAH pathogenesis. PMID:27338373

  5. Synthesis of DNA

    DOEpatents

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  6. DNA encoding a DNA repair protein

    DOEpatents

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-08-15

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  7. DNA systematics. Volume II

    SciTech Connect

    Dutta, S.K.

    1986-01-01

    This book discusses the following topics: PLANTS: PLANT DNA: Contents and Systematics. Repeated DNA Sequences and Polyploidy in Cereal Crops. Homology of Nonrepeated DNA Sequences in Phylogeny of Fungal Species. Chloropast DNA and Phylogenetic Relationships. rDNA: Evolution Over a Billion Years. 23S rRNA-derived Small Ribosomal RNAs: Their Structure and Evolution with Reference to Plant Phylogeny. Molecular Analysis of Plant DNA Genomes: Conserved and Diverged DNA Sequences. A Critical Review of Some Terminologies Used for Additional DNA in Plant Chromosomes and Index.

  8. Characterization of group A Streptococcus strains recovered from Mexican children with pharyngitis by automated DNA sequencing of virulence-related genes: unexpectedly large variation in the gene (sic) encoding a complement-inhibiting protein.

    PubMed Central

    Mejia, L M; Stockbauer, K E; Pan, X; Cravioto, A; Musser, J M

    1997-01-01

    Sequence variation was studied in several target genes in 54 strains of group A Streptococcus (GAS) cultured from children with pharyngitis in Mexico City. Although 16 distinct emm alleles were identified, only 4 had not been previously described. Virtually all bacteria (31 of 33 [94%] with the streptococcal pyrogenic exotoxin gene (speA) had emm1-related, emm3, or emm6 alleles. The gene (sic) encoding an extracellular GAS protein that inhibits complement function was unusually variable among isolates with the emm1 family of alleles, with a total of seven variants identified. The data suggest that many GAS strains infecting Mexican children are genetically similar to organisms commonly encountered in the United States and western Europe. Sequence variation in the sic gene is useful for rapid differentiation among GAS isolates with the emm1 family of alleles. PMID:9399523

  9. Automata representation for Abelian groups

    NASA Astrophysics Data System (ADS)

    Fong, Wan Heng; Gan, Yee Siang; Sarmin, Nor Haniza; Turaev, Sherzod

    2013-04-01

    A finite automaton is one of the classic models of recognition devices, which is used to determine the type of language a string belongs to. A string is said to be recognized by a finite automaton if the automaton "reads" the string from the left to the right starting from the initial state and finishing at a final state. Another type of automata which is a counterpart of sticker systems, namely Watson-Crick automata, is finite automata which can scan the double-stranded tapes of DNA strings using the complimentary relation. The properties of groups have been extended for the recognition of finite automata over groups. In this paper, two variants of automata, modified deterministic finite automata and modified deterministic Watson-Crick automata are used in the study of Abelian groups. Moreover, the relation between finite automata diagram over Abelian groups and the Cayley table is introduced. In addition, some properties of Abelian groups are presented in terms of automata.

  10. Catalytic editing properties of DNA polymerases.

    PubMed Central

    Canard, B; Cardona, B; Sarfati, R S

    1995-01-01

    Enzymatic incorporation of 2',3'-dideoxynucleotides into DNA results in chain termination. We report that 3'-esterified 2'-deoxynucleoside 5'-triphosphates (dNTPs) are false chain-terminator substrates since DNA polymerases, including human immunodeficiency virus reverse transcriptase, can incorporate them into DNA and, subsequently, use this new 3' end to insert the next correctly paired dNTP. Likewise, a DNA substrate with a primer chemically esterified at the 3' position can be extended efficiently upon incubation with dNTPs and T7 DNA polymerase lacking 3'-to-5' exonuclease activity. This enzyme is also able to use dTTP-bearing reporter groups in the 3' position conjugated through amide or thiourea bonds and cleave them to restore a DNA chain terminated by an amino group at the 3' end. Hence, a number of DNA polymerases exhibit wide catalytic versatility at the 3' end of the nascent DNA strand. As part of the polymerization mechanism, these capabilities extend the number of enzymatic activities associated with these enzymes and also the study of interactions between DNA polymerases and nucleotide analogues. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:7479898

  11. Relaxed specificity of prokaryotic DNA methyltransferases results in DNA site-specific modification of RNA/DNA heteroduplexes.

    PubMed

    Wons, Ewa; Mruk, Iwona; Kaczorowski, Tadeusz

    2015-11-01

    RNA/DNA hybrid duplexes regularly occur in nature, for example in transcriptional R loops. Their susceptibility to modification by DNA-specific or RNA-specific enzymes is, thus, a biologically relevant question, which, in addition, has possible biotechnological implications. In this study, we investigated the activity of four isospecific DNA methyltransferases (M.EcoVIII, M.LlaCI, M.HindIII, M.BstZ1II) toward an RNA/DNA duplex carrying one 5'-AAGCUU-3'/3'-TTCGAA-5' target sequence. The analyzed enzymes belong to the β-group of adenine N6-methyltransferases and recognize the palindromic DNA sequence 5'-AAGCTT-3'/3'-TTCGAA-5'. Under standard conditions, none of these isospecific enzymes could detectibly methylate the RNA/DNA duplex. However, the addition of agents that generally relax specificity, such as dimethyl sulfoxide (DMSO) and glycerol, resulted in substantial methylation of the RNA/DNA duplex by M.EcoVIII and M.LlaCI. Only the DNA strand of the RNA/DNA duplex was methylated. The same was not observed for M.HindIII or M.BstZ1II. This is, to our knowledge, the first report that demonstrates such activity by prokaryotic DNA methyltransferases. Possible applications of these findings in a laboratory practice are also discussed.

  12. Interconnecting Gold Islands with DNA Origami Nanotubes

    PubMed Central

    Ding, Baoquan; Wu, Hao; Xu, Wei; Zhao, Zhao; Liu, Yan; Yu, Hongbin; Yan, Hao

    2012-01-01

    Scaffolded DNA origami has recently emerged as a versatile, programmable method to fold DNA into arbitrarily shaped nanostructures that are spatially addressable, with sub-10 nm resolution. Toward functional DNA nanotechnology, one of the key challenges is to integrate the bottom up self-assembly of DNA origami with the top-down lithographic methods used to generate surface patterning. In this report we demonstrate that fixed length DNA origami nanotubes, modified with multiple thiol groups near both ends, can be used to connect surface patterned gold islands (tens of nanometers in diameter) fabricated by electron beam lithography (EBL). Atomic force microscopic imaging verified that the DNA origami nanotubes can be efficiently aligned between gold islands with various inter-island distances and relative locations. This development represents progress toward the goal of bridging bottom up and top down assembly approaches. PMID:21070012

  13. Energy transport in crystalline DNA composites

    SciTech Connect

    Xu, Zaoli; Xu, Shen; Tang, Xiaoduan; Wang, Xinwei

    2014-01-15

    This work reports on the synthesis of crystalline DNA-composited films and microfibers, and details the study of thermal energy transport in them. The transient electro-thermal technique is used to characterize the thermal transport in DNA composite microfibers, and the photothermal technique is used to explore the thermal transport in the thickness direction of DNA films. Compared with microfibers, the DNA films are found to have a higher thermal transport capacity, largely due to the carefully controlled crystallization process in film synthesis. In high NaCl concentration solutions, the bond of the Na{sup +} ion and phosphate group aligns the DNA molecules with the NaCl crystal structure during crystallization. This results in significant enhancement of thermal transport in the DNA films with aligned structure.

  14. Molecular DNA switches and DNA chips

    NASA Astrophysics Data System (ADS)

    Sabanayagam, Chandran R.; Berkey, Cristin; Lavi, Uri; Cantor, Charles R.; Smith, Cassandra L.

    1999-06-01

    We present an assay to detect single-nucleotide polymorphisms on a chip using molecular DNA switches and isothermal rolling- circle amplification. The basic principle behind the switch is an allele-specific oligonucleotide circularization, mediated by DNA ligase. A DNA switch is closed when perfect hybridization between the probe oligonucleotide and target DNA allows ligase to covalently circularize the probe. Mismatches around the ligation site prevent probe circularization, resulting in an open switch. DNA polymerase is then used to preferentially amplify the closed switches, via rolling-circle amplification. The stringency of the molecular switches yields 102 - 103 fold discrimination between matched and mismatched sequences.

  15. DNA vaccines: a simple DNA sensing matter?

    PubMed

    Coban, Cevayir; Kobiyama, Kouji; Jounai, Nao; Tozuka, Miyuki; Ishii, Ken J

    2013-10-01

    Since the introduction of DNA vaccines two decades ago, this attractive strategy has been hampered by its low immunogenicity in humans. Studies conducted to improve the immunogenicity of DNA vaccines have shown that understanding the mechanism of action of DNA vaccines might be the key to successfully improving their immunogenicity. Our current understanding is that DNA vaccines induce innate and adaptive immune responses in two ways: (1) encoded protein (or polypeptide) antigen(s) by the DNA plasmid can be expressed in stromal cells (i.e., muscle cells) as well as DCs, where these antigens are processed and presented to naïve CD4 or CD8 T cells either by direct or cross presentation, respectively; and (2) the transfected DNA plasmid itself may bind to an un-identified cytosolic DNA sensor and activate the TBK1-STING pathway and the production of type I interferons (IFNs) which function as an adjuvant. Recent studies investigating double-stranded cytosolic DNA sensor(s) have highlighted new mechanisms in which cytosolic DNA may release secondary metabolites, which are in turn recognized by a novel DNA sensing machinery. Here, we discuss these new metabolites and the possibilities of translating this knowledge into improved immunogenicity for DNA vaccines.

  16. DNA Repair by Reversal of DNA Damage

    PubMed Central

    Yi, Chengqi; He, Chuan

    2013-01-01

    Endogenous and exogenous factors constantly challenge cellular DNA, generating cytotoxic and/or mutagenic DNA adducts. As a result, organisms have evolved different mechanisms to defend against the deleterious effects of DNA damage. Among these diverse repair pathways, direct DNA-repair systems provide cells with simple yet efficient solutions to reverse covalent DNA adducts. In this review, we focus on recent advances in the field of direct DNA repair, namely, photolyase-, alkyltransferase-, and dioxygenase-mediated repair processes. We present specific examples to describe new findings of known enzymes and appealing discoveries of new proteins. At the end of this article, we also briefly discuss the influence of direct DNA repair on other fields of biology and its implication on the discovery of new biology. PMID:23284047

  17. Should arrestee DNA databases extend to misdemeanors?

    PubMed

    Joh, Elizabeth E

    2014-01-01

    In the United States, those groups of persons eligible for compulsory DNA sampling by law enforcement authorities continue to expand. The collection of DNA samples from felony arrestees will likely be adopted by many more states after the U.S. Supreme Court's 2013 decision in Maryland v. King, which upheld a state law permitting the compulsory and warrantless DNA sampling from those arrested of serious offenses. At the time of the decision, 28 states and the federal government already had arrestee DNA collection statutes in place. Nevada became the 29th state to collect DNA from arrestees in May 2013, and several others have bills under consideration. Should states collect DNA from misdemeanor arrestees as well? This article considers this as yet largely unrealized but nevertheless important potential expansion of arrestee DNA databases. The collection of DNA samples from those arrested of relatively minor offenses would increase the number of samples, and perhaps consequently the number of "hits." On balance, however, such an expansion of current DNA laws raises enough serious concerns-chiefly about police discretion, inequitable enforcement, and cost-that legislators should refrain from changing arrestee DNA laws in this way.

  18. Group-specific amplification of cDNA from DRB1 genes. Complete coding sequences of partially defined alleles and identification of the new alleles DRB1*040602, DRB1*111102, DRB1*080103, and DRB1*0113.

    PubMed

    Balas, Antonio; Vilches, Carlos; Rodríguez, Miguel A; Fernández, Begoña; Martinez, Maria Paz; de Pablo, Rosario; García-Sánchez, Félix; Vicario, Jose L

    2006-12-01

    We present here the complete coding sequences, previously unavailable, of the DRB1 alleles DRB1*030102, *0306, *040701, *0408, *1327, *1356, *1411, *1446, *1503, *1504, *0806, *0813, and *0818. For cDNA isolation, new group-specific primers located at the 5'UT and 3'UT regions were used to carry out allele-specific amplification and a convenient method for determining full-length sequences for DRB1 alleles. Complete coding sequencing of samples previously typed as DRB1*0406, DRB1*080101, and DRB1*1111 revealed new alleles with noncoding nucleotide changes at exons 1 and 3. In addition, we found a novel allele, DRB1*0113, whose second exon carries a sequence motif characteristic of DRB1*07 alleles. The predicted class II haplotypic associations of all alleles are reported and discussed.

  19. Quantitative DNA fiber mapping

    DOEpatents

    Gray, Joe W.; Weier, Heinz-Ulrich G.

    1998-01-01

    The present invention relates generally to the DNA mapping and sequencing technologies. In particular, the present invention provides enhanced methods and compositions for the physical mapping and positional cloning of genomic DNA. The present invention also provides a useful analytical technique to directly map cloned DNA sequences onto individual stretched DNA molecules.

  20. Mechanism of DNA loading by the DNA repair helicase XPD

    PubMed Central

    Constantinescu-Aruxandei, Diana; Petrovic-Stojanovska, Biljana; Penedo, J. Carlos; White, Malcolm F.; Naismith, James H.

    2016-01-01

    The xeroderma pigmentosum group D (XPD) helicase is a component of the transcription factor IIH complex in eukaryotes and plays an essential role in DNA repair in the nucleotide excision repair pathway. XPD is a 5′ to 3′ helicase with an essential iron–sulfur cluster. Structural and biochemical studies of the monomeric archaeal XPD homologues have aided a mechanistic understanding of this important class of helicase, but several important questions remain open. In particular, the mechanism for DNA loading, which is assumed to require large protein conformational change, is not fully understood. Here, DNA binding by the archaeal XPD helicase from Thermoplasma acidophilum has been investigated using a combination of crystallography, cross-linking, modified substrates and biochemical assays. The data are consistent with an initial tight binding of ssDNA to helicase domain 2, followed by transient opening of the interface between the Arch and 4FeS domains, allowing access to a second binding site on helicase domain 1 that directs DNA through the pore. A crystal structure of XPD from Sulfolobus acidocaldiarius that lacks helicase domain 2 has an otherwise unperturbed structure, emphasizing the stability of the interface between the Arch and 4FeS domains in XPD. PMID:26896802

  1. Poxvirus DNA Replication

    PubMed Central

    Moss, Bernard

    2013-01-01

    Poxviruses are large, enveloped viruses that replicate in the cytoplasm and encode proteins for DNA replication and gene expression. Hairpin ends link the two strands of the linear, double-stranded DNA genome. Viral proteins involved in DNA synthesis include a 117-kDa polymerase, a helicase–primase, a uracil DNA glycosylase, a processivity factor, a single-stranded DNA-binding protein, a protein kinase, and a DNA ligase. A viral FEN1 family protein participates in double-strand break repair. The DNA is replicated as long concatemers that are resolved by a viral Holliday junction endonuclease. PMID:23838441

  2. A novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori.

    PubMed

    Liu, Ziping; Su, Xingguang

    2017-01-15

    In this work, a novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori (H. pylori) DNA was developed. This strategy took advantage of DNA hybridization between single-stranded DNA (ssDNA, which had been designed as an aptamer specific for H. pylori DNA) and the complementary target H. pylori DNA, and the feature that ssDNA bound to graphene oxide (GO) with significantly higher affinity than double-stranded DNA (dsDNA). ssDNA were firstly covalent conjugated with CuInS2 quantum dots (QDs) by reaction between the carboxy group of QDs and amino group modified ssDNA, forming ssDNA-QDs genosensor. In the absence of the complementary target H. pylori DNA, GO could adsorb ssDNA-QDs DNA sensor and efficiently quench the fluorescence of ssDNA-QDs. While the complementary target H. pylori DNA was introduced, the ssDNA-QDs preferentially bound with the H. pylori DNA. The formation of dsDNA would alter the conformation of ssDNA and disturb the interaction between ssDNA and GO. Thus, the dsDNA-QDs/GO system exhibited a stronger fluorescence emission than that of the ssDNA-QDs/GO system. Under the optimized conditions, a linear correlation was established between the fluorescence intensity ratio I/I0 and the concentration of H. pylori DNA in the range of 1.25-875pmolL(-1) with a detection limit of 0.46pmolL(-1). The proposed method was applied to the determination of H. pylori DNA sequence in milk samples with satisfactory results.

  3. Cross-linking of DNA through HMGA1 suggests a DNA scaffold

    PubMed Central

    Vogel, Benjamin; Löschberger, Anna; Sauer, Markus; Hock, Robert

    2011-01-01

    Binding of proteins to DNA is usually considered 1D with one protein bound to one DNA molecule. In principle, proteins with multiple DNA binding domains could also bind to and thereby cross-link different DNA molecules. We have investigated this possibility using high-mobility group A1 (HMGA1) proteins, which are architectural elements of chromatin and are involved in the regulation of multiple DNA-dependent processes. Using direct stochastic optical reconstruction microscopy (dSTORM), we could show that overexpression of HMGA1a-eGFP in Cos-7 cells leads to chromatin aggregation. To investigate if HMGA1a is directly responsible for this chromatin compaction we developed a DNA cross-linking assay. We were able to show for the first time that HMGA1a can cross-link DNA directly. Detailed analysis using point mutated proteins revealed a novel DNA cross-linking domain. Electron microscopy indicates that HMGA1 proteins are able to create DNA loops and supercoils in linearized DNA confirming the cross-linking ability of HMGA1a. This capacity has profound implications for the spatial organization of DNA in the cell nucleus and suggests cross-linking activities for additional nuclear proteins. PMID:21596776

  4. Functionalizing Designer DNA Crystals

    NASA Astrophysics Data System (ADS)

    Chandrasekaran, Arun Richard

    nucleotides is usually pH dependent (pH < 6) four different TFOs were examined: TFO-1 was unmodified while TFOs 2-4 contained additional stabilizing analogues capable of extending triplex formation to pH 7. In addition, each of the TFOs contained a Cy5 dye at the 5'-end of the oligonucleotide to aid in characterization of TFO binding - crystals were obtained with all four variations of TFOs. Formation of DNA triplex in the motif was characterized by an electrophoretic mobility shift assay (EMSA), UV melting studies and FRET. Crystals containing TFO-1 (unmodified) and TFO-2 (with 2'-amino ethoxy modification) were isolated and flash-frozen in liquid nitrogen for X-ray data collection at beam line NSLS-X25. X-ray data was also collected for crystals of the 3-turn triangle without any TFO bound to it. Difference maps were done between the crystals with TFO against the one without to identify any additional electron density corresponding to the third strand in the triplex binding region. The data from the crystal containing TFO-2 was used to further analyze if the additional density can match the expected position of the TFO on the triangle motif. Since the additional density did not correspond to the entire binding region, 2Fo-Fc, 3Fo-2Fc and 4Fo-3Fc maps were done to check for missing pieces of the electron density. From the resulting 2Fo-Fc map, the asymmetric unit from the 3-turn triangle (31-bp duplex model based on previous structure 3UBI) was inserted into the density as a reference. However, the electron density corresponding to the TFO was still not continuous throughout the 13-nt triplex binding region and allowed only a partial fit of the TFO. The third nucleotide in positions 1, 3, 4, 6, 7 were fit into the density in the major groove of the underlying duplex with proper triplex configuration. The third chapter describes the triplex approach to position a functional group (the UV cross-linking agent psoralen) within a pre-formed DNA motif. Triplex formation and

  5. DNA Damage, DNA Repair, Aging, and Neurodegeneration.

    PubMed

    Maynard, Scott; Fang, Evandro Fei; Scheibye-Knudsen, Morten; Croteau, Deborah L; Bohr, Vilhelm A

    2015-09-18

    Aging in mammals is accompanied by a progressive atrophy of tissues and organs, and stochastic damage accumulation to the macromolecules DNA, RNA, proteins, and lipids. The sequence of the human genome represents our genetic blueprint, and accumulating evidence suggests that loss of genomic maintenance may causally contribute to aging. Distinct evidence for a role of imperfect DNA repair in aging is that several premature aging syndromes have underlying genetic DNA repair defects. Accumulation of DNA damage may be particularly prevalent in the central nervous system owing to the low DNA repair capacity in postmitotic brain tissue. It is generally believed that the cumulative effects of the deleterious changes that occur in aging, mostly after the reproductive phase, contribute to species-specific rates of aging. In addition to nuclear DNA damage contributions to aging, there is also abundant evidence for a causative link between mitochondrial DNA damage and the major phenotypes associated with aging. Understanding the mechanistic basis for the association of DNA damage and DNA repair with aging and age-related diseases, such as neurodegeneration, would give insight into contravening age-related diseases and promoting a healthy life span.

  6. Tumorigenic DNA viruses

    SciTech Connect

    Klein, G.

    1989-01-01

    The eighth volume of Advances in Viral Oncology focuses on the three major DNA virus groups with a postulated or proven tumorigenic potential: papillomaviruses, animal hepatitis viruses, and the Epstein-Bar virus. In the opening chapters, the contributors analyze the evidence that papillomaviruses and animal hepatitis viruses are involved in tumorigenesis and describe the mechanisms that trigger virus-host cell interactions. A detailed section on the Epstein-Barr virus (EBV) - comprising more than half the book - examines the transcription and mRNA processing patterns of the virus genome; the mechanisms by which EBV infects lymphoid and epithelial cells; the immunological aspects of the virus; the actions of EBV in hosts with Acquired Immune Deficiency Syndrome; and the involvement of EBV in the etiology of Burkitt's lymphoma.

  7. Retroviral Integrase Structure and DNA Recombination Mechanism

    PubMed Central

    Engelman, Alan; Cherepanov, Peter

    2015-01-01

    SUMMARY Due to the importance of human immunodeficiency virus type 1 (HIV-1) integrase as a drug target, the biochemistry and structural aspects of retroviral DNA integration have been the focus of intensive research during the past three decades. The retroviral integrase enzyme acts on the linear double-stranded viral DNA product of reverse transcription. Integrase cleaves specific phosphodiester bonds near the viral DNA ends during the 3′ processing reaction. The enzyme then uses the resulting viral DNA 3′-OH groups during strand transfer to cut chromosomal target DNA, which simultaneously joins both viral DNA ends to target DNA 5′-phosphates. Both reactions proceed via direct transesterification of scissile phosphodiester bonds by attacking nucleophiles: a water molecule for 3′ processing, and the viral DNA 3′-OH for strand transfer. X-ray crystal structures of prototype foamy virus integrase-DNA complexes revealed the architectures of the key nucleoprotein complexes that form sequentially during the integration process and explained the roles of active site metal ions in catalysis. X-ray crystallography furthermore elucidated the mechanism of action of HIV-1 integrase strand transfer inhibitors, which are currently used to treat AIDS patients, and provided valuable insights into the mechanisms of viral drug resistance. PMID:25705574

  8. Mammalian DNA helicase.

    PubMed Central

    Hübscher, U; Stalder, H P

    1985-01-01

    A forked DNA was constructed to serve as a substrate for DNA helicases. It contains features closely resembling a natural replication fork. The DNA was prepared in large amounts and was used to assay displacement activity during isolation from calf thymus DNA polymerases alpha holoenzyme. One form of DNA polymerase alpha holoenzyme is possibly involved leading strand replication at the replication fork and possesses DNA dependent ATPase activity (Ottiger, H.-P. and Hübscher, U. (1984) Proc. Natl. Acad. Sci. USA 81, 3993-3997). The enzyme can be separated from DNA polymerase alpha by velocity sedimentation in conditions of very low ionic strength and then be purified by chromatography on Sephacryl S-200 and ATP-agarose. At all stages of purification, DNA dependent ATPase and displacement activity profiles were virtually superimposable. The DNA dependent ATPase can displace a hybridized DNA fragment with a short single-stranded tail at its 3'hydroxyl end only in the presence of ATP, and this displacement relies on ATP hydrolysis. Furthermore, homogeneous single-stranded binding proteins from calf thymus as well as from other tissues cannot perform this displacement reaction. By all this token the DNA dependent ATPase appears to be a DNA helicase. It is suggested that this DNA helicase might act in concert with DNA polymerase alpha at the leading strand, possibly pushing the replication fork ahead of the polymerase. Images PMID:3162158

  9. DNA microarray technology. Introduction.

    PubMed

    Pollack, Jonathan R

    2009-01-01

    DNA microarray technology has revolutionized biological research by enabling genome-scale explorations. This chapter provides an overview of DNA microarray technology and its application to characterizing the physical genome, with a focus on cancer genomes. Specific areas discussed include investigations of DNA copy number alteration (and loss of heterozygosity), DNA methylation, DNA-protein (i.e., chromatin and transcription factor) interactions, DNA replication, and the integration of diverse genome-scale data types. Also provided is a perspective on recent advances and future directions in characterizing the physical genome.

  10. Direct electrical detection of DNA synthesis

    PubMed Central

    Pourmand, Nader; Karhanek, Miloslav; Persson, Henrik H. J.; Webb, Chris D.; Lee, Thomas H.; Zahradníková, Alexandra; Davis, Ronald W.

    2006-01-01

    Rapid, sequence-specific DNA detection is essential for applications in medical diagnostics and genetic screening. Electrical biosensors that use immobilized nucleic acids are especially promising in these applications because of their potential for miniaturization and automation. Current DNA detection methods based on sequencing by synthesis rely on optical readouts; however, a direct electrical detection method for this technique is not available. We report here an approach for direct electrical detection of enzymatically catalyzed DNA synthesis by induced surface charge perturbation. We discovered that incorporation of a complementary deoxynucleotide (dNTP) into a self-primed single-stranded DNA attached to the surface of a gold electrode evokes an electrode surface charge perturbation. This event can be detected as a transient current by a voltage-clamp amplifier. Based on current understanding of polarizable interfaces, we propose that the electrode detects proton removal from the 3′-hydroxyl group of the DNA molecule during phosphodiester bond formation. PMID:16614066

  11. Molecular Mechanisms of DNA Polymerase Clamp Loaders

    NASA Astrophysics Data System (ADS)

    Kelch, Brian; Makino, Debora; Simonetta, Kyle; O'Donnell, Mike; Kuriyan, John

    Clamp loaders are ATP-driven multiprotein machines that couple ATP hydrolysis to the opening and closing of a circular protein ring around DNA. This ring-shaped clamp slides along DNA, and interacts with numerous proteins involved in DNA replication, DNA repair and cell cycle control. Recently determined structures of clamp loader complexes from prokaryotic and eukaryotic DNA polymerases have revealed exciting new details of how these complex AAA+ machines perform this essential clamp loading function. This review serves as background to John Kuriyan's lecture at the 2010 Erice School, and is not meant as a comprehensive review of the contributions of the many scientists who have advanced this field. These lecture notes are derived from recent reviews and research papers from our groups.

  12. Strategies for RNA-Guided DNA Recombination

    NASA Astrophysics Data System (ADS)

    Angeleska, Angela; Jonoska, Nataša; Saito, Masahico; Landweber, Laura F.

    We present a model for homologous DNA recombination events guided by double-stranded RNA (dsRNA) templates, and apply this model to DNA rearrangements in some groups of ciliates, such as Stylonychia or Oxytricha. In these organisms, differentiation of a somatic macronucleus from a germline micronucleus involves extensive gene rearrangement, which can be modeled as topological braiding of the DNA, with the template-guided alignment proceeding through DNA branch migration. We show that a graph structure, which we refer to as an assembly graph, containing only 1- and 4-valent vertices can provide a physical representation of the DNA at the time of recombination. With this representation, 4-valent vertices correspond to the alignment of the recombination sites, and we model the actual recombination event as smoothing of these vertices.

  13. Field Effect Transistor Using Carbon Nanotubes and DNA as Electrical Gate

    NASA Astrophysics Data System (ADS)

    Abdalla, S.; Al-Marzouki, F. M.; Al-Ghamdi, Ahmed A.

    2017-02-01

    We present an electronic sensor in the molecular scale, which is very sensitive for detection and sensing of DNA characteristics and DNA activities in particular activities between DNA duplex and any protein. Here, the device shows that DNA is electronically inserted to be on the same time as an electrical device transducer and as a biological target in a carbon nanotube-DNA-carbon nanotube electronic sensor. We have performed a DNA binding through an amide group by the electron transfer through amide group. The presented device has shown an efficient and rapid procedure to bind the electrical vulnerability of DNA with the detection of enzymatic effectiveness leading to high efficient biosensor.

  14. Dendritic star polymers for efficient DNA binding and stimulus-dependent DNA release.

    PubMed

    Yin, Meizhen; Ding, Ke; Gropeanu, Radu A; Shen, Jie; Berger, Rüdiger; Weil, Tanja; Müllen, Klaus

    2008-11-01

    Water-soluble core-shell star polymers consisting of a dendritic polyphenylene core and an outer shell containing a defined number of amino groups have been synthesized via atom transfer radical polymerization (ATRP). All macromolecules efficiently interacted with a diverse set of DNA fragments, and stable complexes were formed and visualized by atomic force microscopy. The observed tight binding of DNA, which was found in the sub-nanomolar range, was mainly attributed to strong electrostatic interactions. Complex stoichiometries between the polyelectrolytes were controlled via the number of amino groups of the star polymers, and well-defined nanoscopic architectures were formed. DNA was released from the complexes after treatment with high concentrations of sodium chloride in aqueous solution. Such star polymers, which allow the binding and release of DNA, represent attractive candidates for the development of novel anion-exchange resins for DNA purification or as nonviral vector systems for gene delivery.

  15. Group typicality, group loyalty and cognitive development.

    PubMed

    Patterson, Meagan M

    2014-09-01

    Over the course of childhood, children's thinking about social groups changes in a variety of ways. Developmental Subjective Group Dynamics (DSGD) theory emphasizes children's understanding of the importance of conforming to group norms. Abrams et al.'s study, which uses DSGD theory as a framework, demonstrates the social cognitive skills underlying young elementary school children's thinking about group norms. Future research on children's thinking about groups and group norms should explore additional elements of this topic, including aspects of typicality beyond loyalty.

  16. Structural Organization of DNA.

    ERIC Educational Resources Information Center

    Banfalvi, Gaspar

    1986-01-01

    Explains the structural organization of DNA by providing information on the primary, secondary, tertiary, and higher organization levels of the molecule. Also includes illustrations and descriptions of sign-inversion and rotating models for supercoiling of DNA. (ML)

  17. Unusual DNA structures

    SciTech Connect

    Wells, R.D.; Harvey, S.C.

    1988-01-01

    The contents of this book are: Unusual DNS Structures and the Probes Used for Their Detection; The Specificity of Single Strand Specific Endonucleases; Chromatin STructure and DNA Structure at the hsp 26 Locus of Drosophilia; Cruciform Extrusion in Supercoiled DNA-Mechanisms and Contextual Influence; Torsional Stress, Unusual DNA Structures, and Eukaryotic Gene Expression; DNA Sequence and Structure: Bending to Biology. Cruciform Transitions Assayed Using a Psoralen Cross-linking Method: Applications to Measurements of DNA Torisonal Tension; NMR-Distance Geometry Studies of Helical Errors and Sequence Dependent Conformations of DNA in Solution; Hyperreactivity of the B-Z Junctions Probed by Two Aromatic Chemical Carcinogens; Inherently Curved DNA and Its Structural Elements; and DNA Flexibility Under Control: The Juma Algorithm and its Application to BZ Junctions.

  18. DNA tagged microparticles

    DOEpatents

    Farquar, George Roy; Leif, Roald N; Wheeler, Elizabeth

    2015-05-05

    A simulant that includes a carrier and DNA encapsulated in the carrier. Also a method of making a simulant including the steps of providing a carrier and encapsulating DNA in the carrier to produce the simulant.

  19. Modeling DNA Replication.

    ERIC Educational Resources Information Center

    Bennett, Joan

    1998-01-01

    Recommends the use of a model of DNA made out of Velcro to help students visualize the steps of DNA replication. Includes a materials list, construction directions, and details of the demonstration using the model parts. (DDR)

  20. Effect of DNA type on response of DNA biosensor for carcinogens

    NASA Astrophysics Data System (ADS)

    Sani, Nor Diyana bt. Md.; Heng, Lee Yook; Surif, Salmijah; Lazim, Azwani Mat

    2013-11-01

    Carcinogens are cancer causing chemicals that can bind to DNA and cause damage to the DNA. These chemicals are available everywhere including in water, air, soil and food. Therefore, a sensor that can detect the presence of these chemicals will be a very useful tool. Since carcinogens bind to DNA, DNA can be used as the biological element in a biosensor. This study has utilized different types of DNA in a biosensor for carcinogen detection. The DNAs include double stranded calf thymus DNA, single stranded calf thymus DNA and guanine rich single stranded DNA. The modified SPE was exposed to a carcinogen followed by interaction with methylene blue which acts as the electroactive indicator. The SPE was then analysed using differential pulse voltammetry (DPV). Optimization studies were conducted for MB concentration and accumulation time, DNA concentration, as well as effect of buffer concentration, buffer pH and ionic strength. The performance of the biosensor was tested on a group 1 carcinogen, formaldehyde. The results indicated that the usage of guanine rich single stranded DNA also gives higher response as carcinogens prefer to bind with guanine compared to other bases.

  1. Successive DNA extractions improve characterization of soil microbial communities

    PubMed Central

    de Hollander, Mattias; Smidt, Hauke; van Veen, Johannes A.

    2017-01-01

    Currently, characterization of soil microbial communities relies heavily on the use of molecular approaches. Independently of the approach used, soil DNA extraction is a crucial step, and success of downstream procedures will depend on how well DNA extraction was performed. Often, studies describing and comparing soil microbial communities are based on a single DNA extraction, which may not lead to a representative recovery of DNA from all organisms present in the soil. The use of successive DNA extractions might improve soil microbial characterization, but the benefit of this approach has only been limitedly studied. To determine whether successive DNA extractions of the same soil sample would lead to different observations in terms of microbial abundance and community composition, we performed three successive extractions, with two widely used commercial kits, on a range of clay and sandy soils. Successive extractions increased DNA yield considerably (1–374%), as well as total bacterial and fungal abundances in most of the soil samples. Analysis of the 16S and 18S ribosomal RNA genes using 454-pyrosequencing, revealed that microbial community composition (taxonomic groups) observed in the successive DNA extractions were similar. However, successive DNA extractions did reveal several additional microbial groups. For some soil samples, shifts in microbial community composition were observed, mainly due to shifts in relative abundance of a number of microbial groups. Our results highlight that performing successive DNA extractions optimize DNA yield, and can lead to a better picture of overall community composition. PMID:28168105

  2. Preservation of DNA integrity and neuronal degeneration.

    PubMed

    Francisconi, Simona; Codenotti, Mara; Ferrari-Toninelli, Giulia; Uberti, Daniela; Memo, Maurizio

    2005-04-01

    The mismatch repair system (MMR) is an important member of the DNA checkpoint, that includes a number of protein deputed to control genomic stability through cell cycle arrest, DNA repair, and apoptosis. Here we summarize some recent data from our and other groups underlining the contribution to neurodegeneration of MSH2, perhaps the most relevant component of the MMR system. These data suggest that this protein participates not only in the cancer prevention machinery for the body but also in neurodegenerative processes.

  3. Modeling biominerals formed by apatites and DNA.

    PubMed

    Revilla-López, Guillermo; Casanovas, Jordi; Bertran, Oscar; Turon, Pau; Puiggalí, Jordi; Alemán, Carlos

    2013-12-01

    Different aspects of biominerals formed by apatite and DNA have been investigated using computer modeling tools. Firstly, the structure and stability of biominerals in which DNA molecules are embedded into hydroxyapatite and fluoroapatite nanopores have been examined by combining different molecular mechanics methods. After this, the early processes in the nucleation of hydroxyapatite at a DNA template have been investigated using molecular dynamics simulations. Results indicate that duplexes of DNA adopting a B double helix can be encapsulated inside nanopores of hydroxyapatite without undergoing significant distortions in the inter-strand hydrogen bonds and the intra-strand stacking. This ability of hydroxyapatite is practically independent of the DNA sequence, which has been attributed to the stabilizing role of the interactions between the calcium atoms of the mineral and the phosphate groups of the biomolecule. In contrast, the fluorine atoms of fluoroapatite induce pronounced structural distortions in the double helix when embedded in a pore of the same dimensions, resulting in the loss of its most relevant characteristics. On the other hand, molecular dynamics simulations have allowed us to observe the formation of calcium phosphate clusters at the surface of the B-DNA template. Electrostatic interactions between the phosphate groups of DNA and Ca(2+) have been found to essential for the formation of stable ion complexes, which were the starting point of calcium phosphate clusters by incorporating PO3(4) from the solution.

  4. Nanopores: Flossing with DNA

    NASA Astrophysics Data System (ADS)

    Kasianowicz, John J.

    2004-06-01

    Passing a DNA strand many times back-and-forth through a protein nanopore would enable the interaction between them to be studied more closely. This may now be possible, using a dumbbell-shaped DNA-polymer complex, which may lead to a more reliable analysis of DNA sequences using nanopores.

  5. Three-Dimensional DNA Nanostructures Assembled from DNA Star Motifs.

    PubMed

    Tian, Cheng; Zhang, Chuan

    2017-01-01

    Tile-based DNA self-assembly is a promising method in DNA nanotechnology and has produced a wide range of nanostructures by using a small set of unique DNA strands. DNA star motif, as one of DNA tiles, has been employed to assemble varieties of symmetric one-, two-, three-dimensional (1, 2, 3D) DNA nanostructures. Herein, we describe the design principles, assembly methods, and characterization methods of 3D DNA nanostructures assembled from the DNA star motifs.

  6. Plasmid DNA hydrogels for biomedical applications.

    PubMed

    Costa, Diana; Valente, Artur J M; Miguel, M Graça; Queiroz, João

    2014-03-01

    In the last few years, our research group has focused on the design and development of plasmid DNA (pDNA) based systems as devices to be used therapeutically in the biomedical field. Biocompatible macro and micro plasmid DNA gels were prepared by a cross-linking reaction. For the first time, the pDNA gels have been investigated with respect to their swelling in aqueous solution containing different additives. Furthermore, we clarified the fundamental and basic aspects of the solute release mechanism from pDNA hydrogels and the significance of this information is enormous as a basic tool for the formulation of pDNA carriers for drug/gene delivery applications. The co-delivery of a specific gene and anticancer drugs, combining chemical and gene therapies in the treatment of cancer was the main challenge of our research. Significant progresses have been made with a new p53 encoding pDNA microgel that is suitable for the loading and release of pDNA and doxorubicin. This represents a strong valuable finding in the strategic development of systems to improve cancer cure through the synergetic effect of chemical and gene therapy.

  7. Electrochemical biosensing strategies for DNA methylation analysis.

    PubMed

    Hossain, Tanvir; Mahmudunnabi, Golam; Masud, Mostafa Kamal; Islam, Md Nazmul; Ooi, Lezanne; Konstantinov, Konstantin; Hossain, Md Shahriar Al; Martinac, Boris; Alici, Gursel; Nguyen, Nam-Trung; Shiddiky, Muhammad J A

    2017-02-17

    DNA methylation is one of the key epigenetic modifications of DNA that results from the enzymatic addition of a methyl group at the fifth carbon of the cytosine base. It plays a crucial role in cellular development, genomic stability and gene expression. Aberrant DNA methylation is responsible for the pathogenesis of many diseases including cancers. Over the past several decades, many methodologies have been developed to detect DNA methylation. These methodologies range from classical molecular biology and optical approaches, such as bisulfite sequencing, microarrays, quantitative real-time PCR, colorimetry, Raman spectroscopy to the more recent electrochemical approaches. Among these, electrochemical approaches offer sensitive, simple, specific, rapid, and cost-effective analysis of DNA methylation. Additionally, electrochemical methods are highly amenable to miniaturization and possess the potential to be multiplexed. In recent years, several reviews have provided information on the detection strategies of DNA methylation. However, to date, there is no comprehensive evaluation of electrochemical DNA methylation detection strategies. Herein, we address the recent developments of electrochemical DNA methylation detection approaches. Furthermore, we highlight the major technical and biological challenges involved in these strategies and provide suggestions for the future direction of this important field.

  8. The logic of DNA replication in double-stranded DNA viruses: insights from global analysis of viral genomes

    PubMed Central

    Kazlauskas, Darius; Krupovic, Mart; Venclovas, Česlovas

    2016-01-01

    Genomic DNA replication is a complex process that involves multiple proteins. Cellular DNA replication systems are broadly classified into only two types, bacterial and archaeo-eukaryotic. In contrast, double-stranded (ds) DNA viruses feature a much broader diversity of DNA replication machineries. Viruses differ greatly in both completeness and composition of their sets of DNA replication proteins. In this study, we explored whether there are common patterns underlying this extreme diversity. We identified and analyzed all major functional groups of DNA replication proteins in all available proteomes of dsDNA viruses. Our results show that some proteins are common to viruses infecting all domains of life and likely represent components of the ancestral core set. These include B-family polymerases, SF3 helicases, archaeo-eukaryotic primases, clamps and clamp loaders of the archaeo-eukaryotic type, RNase H and ATP-dependent DNA ligases. We also discovered a clear correlation between genome size and self-sufficiency of viral DNA replication, the unanticipated dominance of replicative helicases and pervasive functional associations among certain groups of DNA replication proteins. Altogether, our results provide a comprehensive view on the diversity and evolution of replication systems in the DNA virome and uncover fundamental principles underlying the orchestration of viral DNA replication. PMID:27112572

  9. Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

    USGS Publications Warehouse

    Freeman, S.; Pham, M.; Rodriguez, R.J.

    1993-01-01

    Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

  10. Group Cohesion in Experiential Growth Groups

    ERIC Educational Resources Information Center

    Steen, Sam; Vasserman-Stokes, Elaina; Vannatta, Rachel

    2014-01-01

    This article explores the effect of web-based journaling on changes in group cohesion within experiential growth groups. Master's students were divided into 2 groups. Both used a web-based platform to journal after each session; however, only 1 of the groups was able to read each other's journals. Quantitative data collected before and…

  11. The Many Sides of DNA.

    ERIC Educational Resources Information Center

    Flannery, Maura C.

    1997-01-01

    Explores the meaning of DNA. Discusses histories of DNA, literature on DNA, the contributions of Max Delbruck and Barbara McClintock, life, views of control, current research, and the language of DNA. Contains 24 references. (JRH)

  12. Signatures of DNA target selectivity by ETS transcription factors.

    PubMed

    Poon, Gregory M K; Kim, Hye Mi

    2017-03-16

    The ETS family of transcription factors is a functionally heterogeneous group of gene regulators that share a structurally conserved, eponymous DNA-binding domain. DNA target specificity derives from combinatorial interactions with other proteins as well as intrinsic heterogeneity among ETS domains. Emerging evidence suggests molecular hydration as a fundamental feature that defines the intrinsic heterogeneity in DNA target selection and susceptibility to epigenetic DNA modification. This perspective invokes novel hypotheses in the regulation of ETS proteins in physiologic osmotic stress, their pioneering potential in heterochromatin, and the effects of passive and pharmacologic DNA demethylation on ETS regulation.

  13. DNA-Mediated Electrochemistry

    PubMed Central

    Gorodetsky, Alon A.; Buzzeo, Marisa C.

    2009-01-01

    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  14. DNA Sequencing apparatus

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1992-01-01

    An automated DNA sequencing apparatus having a reactor for providing at least two series of DNA products formed from a single primer and a DNA strand, each DNA product of a series differing in molecular weight and having a chain terminating agent at one end; separating means for separating the DNA products to form a series bands, the intensity of substantially all nearby bands in a different series being different, band reading means for determining the position an This invention was made with government support including a grant from the U.S. Public Health Service, contract number AI-06045. The U.S. government has certain rights in the invention.

  15. Archaeal DNA replication.

    PubMed

    Kelman, Lori M; Kelman, Zvi

    2014-01-01

    DNA replication is essential for all life forms. Although the process is fundamentally conserved in the three domains of life, bioinformatic, biochemical, structural, and genetic studies have demonstrated that the process and the proteins involved in archaeal DNA replication are more similar to those in eukaryal DNA replication than in bacterial DNA replication, but have some archaeal-specific features. The archaeal replication system, however, is not monolithic, and there are some differences in the replication process between different species. In this review, the current knowledge of the mechanisms governing DNA replication in Archaea is summarized. The general features of the replication process as well as some of the differences are discussed.

  16. DNA Functionalization of Nanoparticles.

    PubMed

    Lu, Fang; Gang, Oleg

    2017-01-01

    DNA-nanoparticle conjugates are hybrid nanoscale objects that integrate different types of DNA molecules and inorganic nanoparticles with a typical architecture of a DNA shell around an inorganic core. Such incorporation provides particles with unique properties of DNA, addressability and recognition, but, at the same time, allows exploiting the properties of the particle's inorganic core. Thus, these hybrid nano-objects are advantageous for rational fabrication of functional materials and for biomedical applications. Here, we describe several established DNA functionalization procedures for different types of surface ligands and nanoparticle core materials.

  17. DNA structure and function.

    PubMed

    Travers, Andrew; Muskhelishvili, Georgi

    2015-06-01

    The proposal of a double-helical structure for DNA over 60 years ago provided an eminently satisfying explanation for the heritability of genetic information. But why is DNA, and not RNA, now the dominant biological information store? We argue that, in addition to its coding function, the ability of DNA, unlike RNA, to adopt a B-DNA structure confers advantages both for information accessibility and for packaging. The information encoded by DNA is both digital - the precise base specifying, for example, amino acid sequences - and analogue. The latter determines the sequence-dependent physicochemical properties of DNA, for example, its stiffness and susceptibility to strand separation. Most importantly, DNA chirality enables the formation of supercoiling under torsional stress. We review recent evidence suggesting that DNA supercoiling, particularly that generated by DNA translocases, is a major driver of gene regulation and patterns of chromosomal gene organization, and in its guise as a promoter of DNA packaging enables DNA to act as an energy store to facilitate the passage of translocating enzymes such as RNA polymerase.

  18. Small Molecules, Inhibitors of DNA-PK, Targeting DNA Repair, and Beyond

    PubMed Central

    Davidson, David; Amrein, Lilian; Panasci, Lawrence; Aloyz, Raquel

    2012-01-01

    design will not only assist in identifying novel functional moieties to replace the metabolically labile morpholino group but will also facilitate the design of molecules to target the DNA-PKcs/Ku80 interface or one of the autophosphorylation sites. PMID:23386830

  19. Supramolecular DNA assembly.

    PubMed

    McLaughlin, Christopher K; Hamblin, Graham D; Sleiman, Hanadi F

    2011-12-01

    The powerful self-assembly features of DNA make it a unique template to finely organize and control matter on the nanometre scale. While DNA alone offers a high degree of fidelity in its self-assembly, a new area of research termed 'supramolecular DNA assembly' has recently emerged. This field combines DNA building blocks with synthetic organic, inorganic and polymeric structures. It thus brings together the toolbox of supramolecular chemistry with the predictable and programmable nature of DNA. The result of this molecular partnership is a variety of hybrid architectures, that expand DNA assembly beyond the boundaries of Watson-Crick base pairing into new structural and functional properties. In this tutorial review we outline this emerging field of study, and describe recent research aiming to synergistically combine the properties inherent to DNA with those of a number of supramolecular scaffolds. This ultimately creates structures with numerous potential applications in materials science, catalysis and medicine.

  20. Oxygen-induced changes in mitochondrial DNA and DNA repair enzymes in aging rat lens.

    PubMed

    Zhang, Yi; Ouyang, Shan; Zhang, Lan; Tang, Xianling; Song, Zhen; Liu, Ping

    2010-01-01

    The treatment of patients with hyperbaric oxygen (HBO), vitrectomy and loss of vitreous gel during aging is associated with a high risk of subsequent development of nuclear cataract. Many studies proved that oxidation is the key reason of nuclear cataract. Reactive oxygen species (ROS) are formed in mitochondria as a by-product of normal metabolism and as a consequence of exposure to environmental compounds. Therefore, mitochondrial DNA (mtDNA) is at particularly high risk of ROS-induced damage. Oxidative damage to mtDNA has been implicated as a causative factor in a wide variety of degenerative diseases and aging. However, the effect of mtDNA damage to the lens has not been studied. The goals of the study were to identify if there was increased mtDNA damage in lens when the eye were exposed to hyperoxic or hypoxic conditions and also to evaluate the changes in gene expression of mtDNA base excision repair (mtBER) enzymes. Our data have shown that the damage of mtDNA, the expression of mtBER enzymes and the level of 8-OHdG in lens increased after inspired hyperoxia, which is likely associated with oxidative stress. However, there was no effect to mtDNA and mtBER enzymes in lens after inspired hypoxia. Nuclear cataract appeared rapidly at 14 month old rats in hyperoxia group, and lens kept transparency in other groups.

  1. DNA functionalization by dynamic chemistry

    PubMed Central

    Kanlidere, Zeynep; Jochim, Oleg; Cal, Marta

    2016-01-01

    Summary Dynamic combinatorial chemistry (DCC) is an attractive method to efficiently generate libraries of molecules from simpler building blocks by reversible reactions under thermodynamic control. Here we focus on the chemical modification of DNA oligonucleotides with acyclic diol linkers and demonstrate their potential for the deoxyribonucleic acid functionalization and generation of libraries of reversibly interconverting building blocks. The syntheses of phosphoramidite building blocks derived from D-threoninol are presented in two variants with protected amino or thiol groups. The threoninol building blocks were successfully incorporated via automated solid-phase synthesis into 13mer oligonucleotides. The amino group containing phosphoramidite was used together with complementary single-strand DNA templates that influenced the Watson–Crick base-pairing equilibrium in the mixture with a set of aldehyde modified nucleobases. A significant fraction of all possible base-pair mismatches was obtained, whereas, the highest selectivity (over 80%) was found for the guanine aldehyde templated by the complementary cytosine containing DNA. The elevated occurrence of mismatches can be explained by increased backbone plasticity derived from the linear threoninol building block as a cyclic deoxyribose analogue. PMID:27829920

  2. DNA barcoding amphibians and reptiles.

    PubMed

    Vences, Miguel; Nagy, Zoltán T; Sonet, Gontran; Verheyen, Erik

    2012-01-01

    Only a few major research programs are currently targeting COI barcoding of amphibians and reptiles (including chelonians and crocodiles), two major groups of tetrapods. Amphibian and reptile species are typically old, strongly divergent, and contain deep conspecific lineages which might lead to problems in species assignment with incomplete reference databases. As far as known, there is no single pair of COI primers that will guarantee a sufficient rate of success across all amphibian and reptile taxa, or within major subclades of amphibians and reptiles, which means that the PCR amplification strategy needs to be adjusted depending on the specific research question. In general, many more amphibian and reptile taxa have been sequenced for 16S rDNA, which for some purposes may be a suitable complementary marker, at least until a more comprehensive COI reference database becomes available. DNA barcoding has successfully been used to identify amphibian larval stages (tadpoles) in species-rich tropical assemblages. Tissue sampling, DNA extraction, and amplification of COI is straightforward in amphibians and reptiles. Single primer pairs are likely to have a failure rate between 5 and 50% if taxa of a wide taxonomic range are targeted; in such cases the use of primer cocktails or subsequent hierarchical usage of different primer pairs is necessary. If the target group is taxonomically limited, many studies have followed a strategy of designing specific primers which then allow an easy and reliable amplification of all samples.

  3. Group theories: relevance to group safety studies.

    PubMed

    Benevento, A L

    1998-01-01

    Promoting safety in the workplace has been attempted in a variety of ways. Increasingly, industries are using groups such as safety teams and quality circles to promote worker safety. Group influences on individual behavior and attitudes have long been studied in the social psychology literature, but the theories have not been commonly found outside the psychology arena. This paper describes the group theories of group polarization, risky shift, social loafing, groupthink and team think and attempts to apply these theories to existing studies that examine work group influences on safety. Interesting parallels were found but only one study examined group influences as their primary focus of research. Since groups are increasingly used for safety promotion, future research on safety that studies group influences with respect to current group theories is recommended.

  4. [DNA methylation and epigenetics].

    PubMed

    Vaniushin, B F

    2006-09-01

    In eukaryotic cells, nuclear DNA is subject to enzymatic methylation with the formation of 5-methylcytosine residues, mostly within the CG and CNG sequences. In plants and animals this DNA methylation is species-, tissue-, and organelle-specific. It changes (decreases) with age and is regulated by hormones. On the other hand, genome methylation can control hormonal signal. Replicative and post-replicative DNA methylation types are distinguished. They are mediated by multiple DNA methyltransferases with different site-specificity. Replication is accompanied by the appearance of hemimethylated DNA sites. Pronounced asymmetry of the DNA strand methylation disappears to the end of the cell cycle. A model of methylation-regulated DNA replication is proposed. DNA methylation controls all genetic processes in the cell (replication, transcription, DNA repair, recombination, and gene transposition). It is the mechanism of cell differentiation, gene discrimination and silencing. In animals, suppression of DNA methylation stops development (embryogenesis), switches on apoptosis, and is usually lethal. Disruption of DNA methylation pattern results in the malignant cell transformation and serves as one of the early diagnostic features of carcinogenesis. In malignant cell the pattern of DNA methylation, as well as the set of DNA methyltransferase activities, differs from that in normal cell. In plants inhibition of DNA methylation is accompanied by the induction of seed storage and florescence genes. In eukaryotes one and the same gene can be simultaneously methylated both at cytosine and adenine residues. It can be thus suggested, that the plant cell contains at least two different, and probably, interdependent systems of DNA methylation. The first eukaryotic adenine DNA methyltransferase was isolated from plants. This enzyme methylates DNA with the formation of N6-methyladenine residues in the sequence TGATCA (TGATCA-->TGm6ATCA). Plants possess AdoMet-dependent endonucleases

  5. Constructing Group Learning.

    ERIC Educational Resources Information Center

    Heimlich, Joe E.

    1996-01-01

    Presents guidelines for constructing group learning activities, describes group learning methods (discussion, gaming, role play, simulation, projects), and provides tips for facilitating group activities. (SK)

  6. Optimal Placement of Origins for DNA Replication

    NASA Astrophysics Data System (ADS)

    Karschau, Jens; Blow, J. Julian; de Moura, Alessandro P. S.

    2012-02-01

    DNA replication is an essential process in biology and its timing must be robust so that cells can divide properly. Random fluctuations in the formation of replication starting points, called origins, and the subsequent activation of proteins lead to variations in the replication time. We analyze these stochastic properties of DNA and derive the positions of origins corresponding to the minimum replication time. We show that under some conditions the minimization of replication time leads to the grouping of origins, and relate this to experimental data in a number of species showing origin grouping.

  7. Forensic DNA analysis.

    PubMed

    McDonald, Jessica; Lehman, Donald C

    2012-01-01

    Before the routine use of DNA profiling, blood typing was an important forensic tool. However, blood typing was not very discriminating. For example, roughly 30% of the United States population has type A-positive blood. Therefore, if A-positive blood were found at a crime scene, it could have come from 30% of the population. DNA profiling has a much better ability for discrimination. Forensic laboratories no longer routinely determine blood type. If blood is found at a crime scene, DNA profiling is performed. From Jeffrey's discovery of DNA fingerprinting to the development of PCR of STRs to the formation of DNA databases, our knowledge of DNA and DNA profiling have expanded greatly. Also, the applications for which we use DNA profiling have increased. DNA profiling is not just used for criminal case work, but it has expanded to encompass paternity testing, disaster victim identification, monitoring bone marrow transplants, detecting fetal cells in a mother's blood, tracing human history, and a multitude of other areas. The future of DNA profiling looks expansive with the development of newer instrumentation and techniques.

  8. Enzymatic initiation of DNA synthesis by yeast DNA polymerases.

    PubMed Central

    Plevani, P; Chang, L M

    1977-01-01

    Partially purified yeast RNA polymerases (RNA nucleotidyltransferases) initiate DNA synthesis by yeast DNA polymerase (DNA nucleotidyltransferase) I and to a lesser extent yeast DNA polymerase II in the replication of single-stranded DNA. The enzymatic initiation of DNA synthesis on phage fd DNA template occurs with dNTPs alone and is further stimulated by the presence of rNTPs in DNA polymerase I reactions. The presence of rNTPs has no effect on the RNA polymerase initiation of the DNA polymerase II reaction. RNA polymerases I and III are more efficient in initiation of DNA synthesis than RNA polymerase II. Analyses of the products of fd DNA replication show noncovalent linkage between the newly synthesized DNA and the template DNA, and covalent linkage between the newly synthesized RNA and DNA. PMID:325562

  9. Functional DNA Nanomaterials

    NASA Astrophysics Data System (ADS)

    Zhao, Zhao

    The discovery of DNA helical structure opened the door of modern molecular biology. Ned Seeman utilized DNA as building block to construct different nanoscale materials, and introduced a new field, know as DNA nanotechnology. After several decades of development, different DNA structures had been created, with different dimension, different morphology and even with complex curvatures. In addition, after construction of enough amounts DNA structure candidates, DNA structure template, with excellent spatial addressability, had been used to direct the assembly of different nanomaterials, including nanoparticles and proteins, to produce different functional nanomaterials. However there are still many challenges to fabricate functional DNA nanostructures. The first difficulty is that the present finite sized template dimension is still very small, usually smaller than 100nm, which will limit the application for large amount of nanomaterials assembly or large sized nanomaterials assembly. Here we tried to solve this problem through developing a new method, superorigami, to construct finite sized DNA structure with much larger dimension, which can be as large as 500nm. The second problem will be explored the ability of DNA structure to assemble inorganic nanomaterials for novel photonic or electronic properties. Here we tried to utilize DNA Origami method to assemble AuNPs with controlled 3D spacial position for possible chiral photonic complex. We also tried to assemble SWNT with discrete length for possible field effect transistor device. In addition, we tried to mimic in vivo compartment with DNA structure to study internalized enzyme behavior. From our results, constructed DNA cage origami can protect encapsulated enzyme from degradation, and internalized enzyme activity can be boosted for up to 10 folds. In summary, DNA structure can serve as an ideal template for construction of functional nanomaterials with lots of possibilities to be explored.

  10. Group Dynamic Processes in Email Groups

    ERIC Educational Resources Information Center

    Alpay, Esat

    2005-01-01

    Discussion is given on the relevance of group dynamic processes in promoting decision-making in email discussion groups. General theories on social facilitation and social loafing are considered in the context of email groups, as well as the applicability of psychodynamic and interaction-based models. It is argued that such theories may indeed…

  11. DNA hybridization activity of single-stranded DNA-conjugated gold nanoparticles used as probes for DNA detection

    NASA Astrophysics Data System (ADS)

    Kira, Atsushi; Matsuo, Kosuke; Nakajima, Shin-ichiro

    2016-02-01

    Colloidal nanoparticles (NPs) have potential applications in bio-sensing technologies as labels or signal enhancers. In order to meet demands for a development of biomolecular assays by a quantitative understanding of single-molecule, it is necessary to regulate accuracy of the NPs probes modified with biomolecules to optimize the characteristics of NPs. However, to our knowledge, there is little information about the structural effect of conjugated biomolecules to the NPs. In this study, we investigated the contribution of a density of single-stranded DNA (ssDNA) conjugating gold NP to hybridization activity. Hybridization activity decreased in accordance with increases in the density of attached ssDNAs, likely due to electrostatic repulsion generated by negatively charged phosphate groups in the ssDNA backbone. These results highlight the importance of controlling the density of ssDNAs attached to the surface of NPs used as DNA detection probes.

  12. The DNA-polymerase-X family: controllers of DNA quality?

    PubMed

    Ramadan, Kristijan; Shevelev, Igor; Hübscher, Ulrich

    2004-12-01

    Synthesis of the genetic material of the cell is achieved by a large number of DNA polymerases. Besides replicating the genome, they are involved in DNA-repair processes. Recent studies have indicated that certain DNA-polymerase-X-family members can synthesize unusual DNA structures, and we propose that these DNA structures might serve as 'flag wavers' for the induction of DNA-repair and/or DNA-damage-checkpoint pathways.

  13. Fern spore extracts can damage DNA

    PubMed Central

    Simán, S E; Povey, A C; Ward, T H; Margison, G P; Sheffield, E

    2000-01-01

    The carcinogenicity of the vegetative tissues of bracken fern (Pteridium) has long been established. More recently, the carcinogenic effects of the spores of bracken have also been recognized. Both vegetative tissues and spores of bracken can induce adducts in DNA in animal tissues, but the possible genotoxic or carcinogenic effects of spores from fern species other than bracken are unknown. The single-cell gel electrophoresis (‘comet’) assay was used to investigate whether fern spores can cause DNA damage in vitro. Extracts of spores from six fern species were administered to cultured human premyeloid leukaemia (K562) cells. Spore extracts of five fern species: Anemia phyllitidis, Dicksonia antarctica, Pteridium aquilinum, Pteris vittata and Sadleria pallida, induced significantly more DNA strand breaks than those in the control groups. Only in one species, Osmunda regalis, was the effect no different from that in the control groups. Using extracts from A. phyllitidis and P. vittata, the extent of DNA damage was increased by increasing the original dose 10 times, whereas an experiment in which exposure times were varied suggested that the highest levels of strand breaks appear after 2 h exposure. Simultaneous incubation with human S9 liver enzyme mix ablated the damaging effect of the extracts. Our data show that fern spore extracts can cause DNA damage in human cells in vitro. Considering the strong correlation between DNA damage and carcinogenic events, the observations made in this report may well have some implications for human health. © 2000 Cancer Research Campaign PMID:10883670

  14. Mitochondrial DNA hypomethylation in chrome plating workers.

    PubMed

    Yang, Linqing; Xia, Bo; Yang, Xueqin; Ding, Hong; Wu, Desheng; Zhang, Huimin; Jiang, Gaofeng; Liu, Jianjun; Zhuang, Zhixiong

    2016-01-22

    A matched case-control study was conducted to examine the relationship between chromium (Cr) exposure and variation in mitochondrial (mt) DNA methylation. We enrolled 29 pairs of subjects in this study; Cr exposure was confirmed in the cases by detecting blood Cr and other metal ion concentrations. DNA damage caused by Cr exposure was determined in terms of binucleated micronucleus frequency (BNMN) and mtDNA copy number. Finally, a Sequenom MassARRAY platform was applied to inspect the DNA methylation levels of mitochondrially encoded tRNA phenylalanine (MT-TF), mitochondrially encoded 12S RNA (MT-RNR1), and long interspersed nucleotide element-1 (LINE-1) genes. The blood Cr ion concentration and micronucleus frequency of the Cr-exposed group were higher than those of the control group, whereas the mtDNA copy number remained unchanged. The methylation levels of MT-TF and MT-RNR1 but not LINE-1 were significantly lower in Cr-exposed workers. Pearson correlation analysis showed that workers with higher blood Cr ion concentrations exhibited lower MT-TF and MT-RNR1 gene methylation, and multiple linear regression analysis indicated that CpG sites 1 and 2 in MT-TF and CpG site 6 in MT-RNR1 were affected. These results suggested that methylation level of mtDNA has the possibility of acting as an alternative effect biomarker for Cr exposure.

  15. Circulating Cell Free DNA in the Diagnosis of Trophoblastic Tumors

    PubMed Central

    Openshaw, Mark R.; Harvey, Richard A.; Sebire, Neil J.; Kaur, Baljeet; Sarwar, Naveed; Seckl, Michael J.; Fisher, Rosemary A.

    2015-01-01

    Gestational trophoblastic neoplasia (GTN) represents a group of diseases characterized by production of human chorionic gonadotropin (hCG). Since non-gestational tumors may occasionally secrete hCG, histopathological diagnosis is important for appropriate clinical management. However, a histopathological diagnosis is not always available. We therefore investigated the feasibility of extracting cell free DNA (cfDNA) from the plasma of women with GTN for use as a “liquid biopsy” in patients without histopathological diagnosis. cfDNA was prepared from the plasma of 20 women with a diagnosis of GTN and five with hCG-secreting tumors of unknown origin. Genotyping of cfDNA from the patient, genomic DNA from her and her partner and DNA from the tumor tissue identified circulating tumor DNA (ctDNA) (from 9% to 53% of total cfDNA) in 12 of 20 patients with GTN. In one case without a tissue diagnosis, ctDNA enabled a diagnosis of GTN originating in a non-molar conception and in another a diagnosis of non-gestational tumor, based on the high degree of allelic instability and loss of heterozygosity in the ctDNA. In summary ctDNA can be detected in the plasma of women with GTN and can facilitate the diagnosis of both gestational and non-gestational trophoblastic tumors in cases without histopathological diagnosis. PMID:26981554

  16. Circulating Cell Free DNA in the Diagnosis of Trophoblastic Tumors.

    PubMed

    Openshaw, Mark R; Harvey, Richard A; Sebire, Neil J; Kaur, Baljeet; Sarwar, Naveed; Seckl, Michael J; Fisher, Rosemary A

    2016-02-01

    Gestational trophoblastic neoplasia (GTN) represents a group of diseases characterized by production of human chorionic gonadotropin (hCG). Since non-gestational tumors may occasionally secrete hCG, histopathological diagnosis is important for appropriate clinical management. However, a histopathological diagnosis is not always available. We therefore investigated the feasibility of extracting cell free DNA (cfDNA) from the plasma of women with GTN for use as a "liquid biopsy" in patients without histopathological diagnosis. cfDNA was prepared from the plasma of 20 women with a diagnosis of GTN and five with hCG-secreting tumors of unknown origin. Genotyping of cfDNA from the patient, genomic DNA from her and her partner and DNA from the tumor tissue identified circulating tumor DNA (ctDNA) (from 9% to 53% of total cfDNA) in 12 of 20 patients with GTN. In one case without a tissue diagnosis, ctDNA enabled a diagnosis of GTN originating in a non-molar conception and in another a diagnosis of non-gestational tumor, based on the high degree of allelic instability and loss of heterozygosity in the ctDNA. In summary ctDNA can be detected in the plasma of women with GTN and can facilitate the diagnosis of both gestational and non-gestational trophoblastic tumors in cases without histopathological diagnosis.

  17. Engineering of magnetic DNA nanoparticles for tumor-targeted therapy

    NASA Astrophysics Data System (ADS)

    Hosseinkhani, Hossein; Chen, Yi-Ru; He, Wenjie; Hong, Po-Da; Yu, Dah-Shyong; Domb, Abraham J.

    2013-01-01

    This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe2+ solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.

  18. DNA supercoiling during transcription

    PubMed Central

    Ma, Jie; Wang, Michelle D.

    2017-01-01

    The twin-supercoiled-domain model describes how transcription can drive DNA supercoiling, and how DNA supercoiling, in turn plays an important role in regulating gene transcription. In vivo and in vitro experiments have disclosed many details of the complex interactions in this relationship, and recently new insights have been gained with the help of genome-wide DNA supercoiling mapping techniques and single molecule methods. This review summarizes the general mechanisms of the interplay between DNA supercoiling and transcription, considers the biological implications, and focuses on recent important discoveries and technical advances in this field. We highlight the significant impact of DNA supercoiling in transcription, but also more broadly in all processes operating on DNA.

  19. Rifampin and vaccinia DNA.

    PubMed Central

    Esteban, M

    1977-01-01

    The effect of rifampin on the replication of vaccinia DNA was studied in mouse L cells by a cytochemical techinque and by alkaline sucrose sedimentation analysis of newly synthesized viral DNA molecules. By the use of a fluorescent DNA-binding compound (Hoechst 33258), the sequential appearance, size, and location of the viral "factories" in rifampin-treated, virus-infected cells were found to be indistinguishable from those observed in untreated, infected cells. Sedimentation analysis in alkaline scurose gradients of the viral DNA molecules labeled in pulse-chase experiments showed that formation of small fragments, elongation into "intermediate"-sized molecules, and maturation into full-length viral DNA and, finally, into cross-linked viral DNA molecules occurred in the absence or presence of rifampin. The results support the view that the primary effect of the drug is related to assembly or morphogenesis. Images PMID:833950

  20. Electrocatalysis in DNA Sensors

    PubMed Central

    Furst, Ariel; Hill, Michael G.; Barton, Jacqueline K.

    2014-01-01

    Electrocatalysis is often thought of solely in the inorganic realm, most often applied to energy conversion in fuel cells. However, the ever-growing field of bioelectrocatalysis has made great strides in advancing technology for both biofuel cells as well as biological detection platforms. Within the context of bioelectrocatalytic detection systems, DNA-based platforms are especially prevalent. One subset of these platforms, the one we have developed, takes advantage of the inherent charge transport properties of DNA. Electrocatalysis coupled with DNA-mediated charge transport has enabled specific and sensitive detection of lesions, mismatches and DNA-binding proteins. Even greater signal amplification from these platforms is now being achieved through the incorporation of a secondary electrode to the platform both for patterning DNA arrays and for detection. Here, we describe the evolution of this new DNA sensor technology. PMID:25435647

  1. DNA profiles from fingermarks.

    PubMed

    Templeton, Jennifer E L; Linacre, Adrian

    2014-11-01

    Criminal investigations would be considerably improved if DNA profiles could be routinely generated from single fingermarks. Here we report a direct DNA profiling method that was able to generate interpretable profiles from 71% of 170 fingermarks. The data are based on fingermarks from all 5 digits of 34 individuals. DNA was obtained from the fingermarks using a swab moistened with Triton-X, and the fibers were added directly to one of two commercial DNA profiling kits. All profiles were obtained without increasing the number of amplification cycles; therefore, our method is ideally suited for adoption by the forensic science community. We indicate the use of the technique in a criminal case in which a DNA profile was generated from a fingermark on tape that was wrapped around a drug seizure. Our direct DNA profiling approach is rapid and able to generate profiles from touched items when current forensic practices have little chance of success.

  2. Optical biosensing strategies for DNA methylation analysis.

    PubMed

    Nazmul Islam, Md; Yadav, Sharda; Hakimul Haque, Md; Munaz, Ahmed; Islam, Farhadul; Al Hossain, Md Shahriar; Gopalan, Vinod; Lam, Alfred K; Nguyen, Nam-Trung; Shiddiky, Muhammad J A

    2017-06-15

    DNA methylation is an epigenetic modification of DNA, where a methyl group is added at the fifth carbon of the cytosine base to form 5 methyl cytosine (5mC) without altering the DNA sequences. It plays important roles in regulating many cellular processes by modulating key genes expression. Alteration in DNA methylation patterns becomes particularly important in the aetiology of different diseases including cancers. Abnormal methylation pattern could contribute to the pathogenesis of cancer either by silencing key tumor suppressor genes or by activating oncogenes. Thus, DNA methylation biosensing can help in the better understanding of cancer prognosis and diagnosis and aid the development of therapies. Over the last few decades, a plethora of optical detection techniques have been developed for analyzing DNA methylation using fluorescence, Raman spectroscopy, surface plasmon resonance (SPR), electrochemiluminescence and colorimetric readouts. This paper aims to comprehensively review the optical strategies for DNA methylation detection. We also present an overview of the remaining challenges of optical strategies that still need to be focused along with the lesson learnt while working with these techniques.

  3. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  4. Mitochondrial DNA heterogeneity in Tunisian Berbers.

    PubMed

    Fadhlaoui-Zid, K; Plaza, S; Calafell, F; Ben Amor, M; Comas, D; Bennamar El gaaied, A

    2004-05-01

    Berbers live in groups scattered across North Africa whose origins and genetic relationships with their neighbours are not well established. The first hypervariable segment of the mitochondrial DNA (mtDNA) control region was sequenced in a total of 155 individuals from three Tunisian Berber groups and compared to other North Africans. The mtDNA lineages found belong to a common set of mtDNA haplogroups already described in North Africa. Besides the autochthonous North African U6 haplogroup, a group of L3 lineages characterized by the transition at position 16041 seems to be restricted to North Africans, suggesting that an expansion of this group of lineages took place around 10500 years ago in North Africa, and spread to neighbouring populations. Principal components and the coordinate analyses show that some Berber groups (the Tuareg, the Mozabite, and the Chenini-Douiret) are outliers within the North African genetic landscape. This outlier position is consistent with an isolation process followed by genetic drift in haplotype frequencies, and with the high heterogeneity displayed by Berbers compared to Arab samples as shown in the AMOVA. Despite this Berber heterogeneity, no significant differences were found between Berber and Arab samples, suggesting that the Arabization was mainly a cultural process rather than a demographic replacement.

  5. Engineering Clostridium Strain to Accept Unmethylated DNA

    PubMed Central

    Dong, Hongjun; Zhang, Yanping; Dai, Zongjie; Li, Yin

    2010-01-01

    It is difficult to genetically manipulate the medically and biotechnologically important genus Clostridium due to the existence of the restriction and modification (RM) systems. We identified and engineered the RM system of a model clostridial species, C. acetobutylicum, with the aim to allow the host to accept the unmethylated DNA efficiently. A gene CAC1502 putatively encoding the type II restriction endonuclease Cac824I was identified from the genome of C. acetobutylicum DSM1731, and disrupted using the ClosTron system based on group II intron insertion. The resulting strain SMB009 lost the type II restriction endonuclease activity, and can be transformed with unmethylated DNA as efficiently as with methylated DNA. The strategy reported here makes it easy to genetically modify the clostridial species using unmethylated DNA, which will help to advance the understanding of the clostridial physiology from the molecular level. PMID:20161730

  6. Biophysical properties of DNA in hydrated ionic liquids

    NASA Astrophysics Data System (ADS)

    Jumbri, Khairulazhar; Ahmad, Haslina; Abdulmalek, Emilia; Rahman, Mohd Basyaruddin Abdul

    2016-11-01

    The biophysical properties and behavior of natural calf thymus DNA in hydrated 1-ethyl-3-butylimidazolium bromide ionic liquid ([C2bim]Br) have been studied using spectroscopy technique. The effect of ionic liquid concentration and temperature towards the duplex B-DNA conformation were determined. The presence of ionic liquid causes higher duplex DNA stability with the DNA melting temperature of ˜56°C without any addition of buffer solutions. The electrostatic attraction between ionic liquid's cation and DNA phosphates groups was found play a main role in stabilizing native DNA structure. Understanding of the biophysical properties of DNA in this ionic media could be used as a platform for future development of specific solvent for nucleic acid nanotechnology.

  7. Getting Ready for the Dance: FANCJ Irons Out DNA Wrinkles

    PubMed Central

    Bharti, Sanjay Kumar; Awate, Sanket; Banerjee, Taraswi; Brosh, Robert M.

    2016-01-01

    Mounting evidence indicates that alternate DNA structures, which deviate from normal double helical DNA, form in vivo and influence cellular processes such as replication and transcription. However, our understanding of how the cellular machinery deals with unusual DNA structures such as G-quadruplexes (G4), triplexes, or hairpins is only beginning to emerge. New advances in the field implicate a direct role of the Fanconi Anemia Group J (FANCJ) helicase, which is linked to a hereditary chromosomal instability disorder and important for cancer suppression, in replication past unusual DNA obstacles. This work sets the stage for significant progress in dissecting the molecular mechanisms whereby replication perturbation by abnormal DNA structures leads to genomic instability. In this review, we focus on FANCJ and its role to enable efficient DNA replication when the fork encounters vastly abundant naturally occurring DNA obstacles, which may have implications for targeting rapidly dividing cancer cells. PMID:27376332

  8. Sequence specificity of DNA cleavage by Micrococcus luteus. gamma. endonuclease

    SciTech Connect

    Hentosh, P.; Henner, W.D.; Reynolds, R.J.

    1985-04-01

    DNA fragments of defined sequence have been used to determine the sites of cleavage by ..gamma..-endonuclease activity in extracts prepared from Micrococcus luteus. End-labeled DNA restriction fragments of pBR322 DNA that had been irradiated under nitrogen in the presence of potassium iodide or t-butanol were treated with M. luteus ..gamma.. endonuclease and analyzed on irradiated DNA preferentially at the positions of cytosines and thymines. DNA cleavage occurred immediately to the 3' side of pyrimidines in irradiated DNA and resulted in fragments that terminate in a 5'-phosphoryl group. These studies indicate that both altered cytosines and thymines may be important DNA lesions requiring repair after exposure to ..gamma.. radiation.

  9. Insights on protein-DNA recognition by coarse grain modelling.

    PubMed

    Poulain, P; Saladin, A; Hartmann, B; Prévost, C

    2008-11-30

    Coarse grain modelling of macromolecules is a new approach, potentially well adapted to answer numerous issues, ranging from physics to biology. We propose here an original DNA coarse grain model specifically dedicated to protein-DNA docking, a crucial, but still largely unresolved, question in molecular biology. Using a representative set of protein-DNA complexes, we first show that our model is able to predict the interaction surface between the macromolecular partners taken in their bound form. In a second part, the impact of the DNA sequence and electrostatics, together with the DNA and protein conformations on docking is investigated. Our results strongly suggest that the overall DNA structure mainly contributes in discriminating the interaction site on cognate proteins. Direct electrostatic interactions between phosphate groups and amino acid side chains strengthen the binding. Overall, this work demonstrates that coarse grain modeling can reveal itself a precious auxiliary for a general and complete description and understanding of protein-DNA association mechanisms.

  10. All that is gold does not glitter? Age, taxonomy, and ancient plant DNA quality

    PubMed Central

    Choi, JinHee; Lee, HyeJi

    2015-01-01

    More than 600 herbarium samples from four distantly related groups of flowering plants were used for DNA extraction and subsequent measurements of DNA purity and concentration. We did not find any significant relation between DNA purity and the age of the sample. However, DNA yields were different between plant groups studied. We believe that there there should be no reservations about “old” samples if the goal is to extract more DNA of better purity. We argue that the older herbarium samples are the mine for the future DNA studies, and have the value not less than the “fresh” specimens. PMID:26244108

  11. Disentangling DNA molecules.

    PubMed

    Vologodskii, Alexander

    2016-09-01

    The widespread circular form of DNA molecules inside cells creates very serious topological problems during replication. Due to the helical structure of the double helix the parental strands of circular DNA form a link of very high order, and yet they have to be unlinked before the cell division. DNA topoisomerases, the enzymes that catalyze passing of one DNA segment through another, solve this problem in principle. However, it is very difficult to remove all entanglements between the replicated DNA molecules due to huge length of DNA comparing to the cell size. One strategy that nature uses to overcome this problem is to create the topoisomerases that can dramatically reduce the fraction of linked circular DNA molecules relative to the corresponding fraction at thermodynamic equilibrium. This striking property of the enzymes means that the enzymes that interact with DNA only locally can access their topology, a global property of circular DNA molecules. This review considers the experimental studies of the phenomenon and analyzes the theoretical models that have been suggested in attempts to explain it. We describe here how various models of enzyme action can be investigated computationally. There is no doubt at the moment that we understand basic principles governing enzyme action. Still, there are essential quantitative discrepancies between the experimental data and the theoretical predictions. We consider how these discrepancies can be overcome.

  12. Phytoplasma plasmid DNA extraction.

    PubMed

    Andersen, Mark T; Liefting, Lia W

    2013-01-01

    Phytoplasma plasmids have generally been detected from DNA extracted from plants and insects using methods designed for the purification of total phytoplasma DNA. Methods include extraction from tissues that are high in phytoplasma titre, such as the phloem of plants, with the use of CsCl-bisbenzimide gradients that exploit the low G+C content of phytoplasma DNA. Many of the methods employed for phytoplasma purification have been described elsewhere in this book. Here we describe in detail two methods that are specifically aimed at isolating plasmid DNA.

  13. Multiprotein DNA Looping

    NASA Astrophysics Data System (ADS)

    Vilar, Jose M. G.; Saiz, Leonor

    2006-06-01

    DNA looping plays a fundamental role in a wide variety of biological processes, providing the backbone for long range interactions on DNA. Here we develop the first model for DNA looping by an arbitrarily large number of proteins and solve it analytically in the case of identical binding. We uncover a switchlike transition between looped and unlooped phases and identify the key parameters that control this transition. Our results establish the basis for the quantitative understanding of fundamental cellular processes like DNA recombination, gene silencing, and telomere maintenance.

  14. Forensic DNA testing.

    PubMed

    Butler, John M

    2011-12-01

    Forensic DNA testing has a number of applications, including parentage testing, identifying human remains from natural or man-made disasters or terrorist attacks, and solving crimes. This article provides background information followed by an overview of the process of forensic DNA testing, including sample collection, DNA extraction, PCR amplification, short tandem repeat (STR) allele separation and sizing, typing and profile interpretation, statistical analysis, and quality assurance. The article concludes with discussions of possible problems with the data and other forensic DNA testing techniques.

  15. Disentangling DNA molecules

    NASA Astrophysics Data System (ADS)

    Vologodskii, Alexander

    2016-09-01

    The widespread circular form of DNA molecules inside cells creates very serious topological problems during replication. Due to the helical structure of the double helix the parental strands of circular DNA form a link of very high order, and yet they have to be unlinked before the cell division. DNA topoisomerases, the enzymes that catalyze passing of one DNA segment through another, solve this problem in principle. However, it is very difficult to remove all entanglements between the replicated DNA molecules due to huge length of DNA comparing to the cell size. One strategy that nature uses to overcome this problem is to create the topoisomerases that can dramatically reduce the fraction of linked circular DNA molecules relative to the corresponding fraction at thermodynamic equilibrium. This striking property of the enzymes means that the enzymes that interact with DNA only locally can access their topology, a global property of circular DNA molecules. This review considers the experimental studies of the phenomenon and analyzes the theoretical models that have been suggested in attempts to explain it. We describe here how various models of enzyme action can be investigated computationally. There is no doubt at the moment that we understand basic principles governing enzyme action. Still, there are essential quantitative discrepancies between the experimental data and the theoretical predictions. We consider how these discrepancies can be overcome.

  16. DNA ELECTROPHORESIS AT SURFACES

    SciTech Connect

    RAFAILOVICH, MIRIAM; SOKOLOV, JONATHAN; GERSAPPE, DILIP

    2003-09-01

    During this year we performed two major projects: I. We developed a detailed theoretical model which complements our experiments on surface DNA electrophoresis. We found that it was possible to enhance the separation of DNA chains by imposing a chemical nanoscale pattern on the surface. This approach utilized the surface interaction effect of the DNA chains with the substrate and is a refinement to our previous method in which DNA chains were separated on homogeneous flat surfaces. By introducing the nano-patterns on the surface, the conformational changes of DNA chains of different lengths can be amplified, which results in the different friction strengths with the substrate surface. Our results also show that, when compared to the DNA electrophoresis performed on homogeneous flat surfaces, nanopatterned surfaces offer a larger window in choosing different surface interactions to achieve separation. II. In collaboration with a large international manufacturer of skin care products we also embarked on a project involving photo toxicity of titanium dioxide nanoparticles, which are a key ingredient in sunscreen and cosmetic lotions. The results clearly implicated the nanoparticles in catalyzing damage to chromosomal DNA. We then used this knowledge to develop a polymer/anti-oxidant coating which prevented the photocatalytic reaction on DNA while still retaining the UV absorptive properties of the nanoparticles. The standard gel electrophoresis was not sufficient in determining the extent of the DNA damage. The conclusions of this study were based predominantly on analysis obtained with the surface electrophoresis method.

  17. Polyphenols and DNA Damage: A Mixed Blessing

    PubMed Central

    Azqueta, Amaya; Collins, Andrew

    2016-01-01

    Polyphenols are a very broad group of chemicals, widely distributed in plant foods, and endowed with antioxidant activity by virtue of their numerous phenol groups. They are widely studied as putative cancer-protective agents, potentially contributing to the cancer preventive properties of fruits and vegetables. We review recent publications relating to human trials, animal experiments and cell culture, grouping them according to whether polyphenols are investigated in whole foods and drinks, in plant extracts, or as individual compounds. A variety of assays are in use to study genetic damage endpoints. Human trials, of which there are rather few, tend to show decreases in endogenous DNA damage and protection against DNA damage induced ex vivo in blood cells. Most animal experiments have investigated the effects of polyphenols (often at high doses) in combination with known DNA-damaging agents, and generally they show protection. High concentrations can themselves induce DNA damage, as demonstrated in numerous cell culture experiments; low concentrations, on the other hand, tend to decrease DNA damage. PMID:27918471

  18. Function of transcription factors at DNA lesions in DNA repair.

    PubMed

    Malewicz, Michal; Perlmann, Thomas

    2014-11-15

    Cellular systems for DNA repair ensure prompt removal of DNA lesions that threaten the genomic stability of the cell. Transcription factors (TFs) have long been known to facilitate DNA repair via transcriptional regulation of specific target genes encoding key DNA repair proteins. However, recent findings identified TFs as DNA repair components acting directly at the DNA lesions in a transcription-independent fashion. Together this recent progress is consistent with the hypothesis that TFs have acquired the ability to localize DNA lesions and function by facilitating chromatin remodeling at sites of damaged DNA. Here we review these recent findings and discuss how TFs may function in DNA repair.

  19. Ecological diversification in the Bacillus cereus Group.

    PubMed

    Guinebretière, Marie-Hélène; Thompson, Fabiano L; Sorokin, Alexei; Normand, Philippe; Dawyndt, Peter; Ehling-Schulz, Monika; Svensson, Birgitta; Sanchis, Vincent; Nguyen-The, Christophe; Heyndrickx, Marc; De Vos, Paul

    2008-04-01

    The Bacillus cereus Group comprises organisms that are widely distributed in the environment and are of health and economic interest. We demonstrate an 'ecotypic' structure of populations in the B. cereus Group using (i) molecular data from Fluorescent Amplified Fragment Length Polymorphism patterns, ribosomal gene sequences, partial panC gene sequences, 'psychrotolerant' DNA sequence signatures and (ii) phenotypic and descriptive data from range of growth temperature, psychrotolerance and thermal niches. Seven major phylogenetic groups (I to VII) were thus identified, with ecological differences that provide evidence for a multiemergence of psychrotolerance in the B. cereus Group. A moderate thermotolerant group (VII) was basal to the mesophilic group I, from which in turn distinct thermal lineages have emerged, comprising two mesophilic groups (III, IV), an intermediate group (V) and two psychrotolerant groups (VI, II). This stepwise evolutionary transition toward psychrotolerance was particularly well illustrated by the relative abundance of the 'psychrotolerant' rrs signature (as defined by Pruss et al.) copies accumulated in strains that varied according to the phylogenetic group. The 'psychrotolerant' cspA signature (as defined by Francis et al.) was specific to group VI and provided a useful way to differentiate it from the psychrotolerant group II. This study illustrates how adaptation to novel environments by the modification of temperature tolerance limits has shaped historical patterns of global ecological diversification in the B. cereus Group. The implications for the taxonomy of this Group and for the human health risk are discussed.

  20. A new specific DNA endonuclease activity in yeast mitochondria.

    PubMed

    Sargueil, B; Delahodde, A; Hatat, D; Tian, G L; Lazowska, J; Jacq, C

    1991-02-01

    Two group I intron-encoded proteins from the yeast mitochondrial genome have already been shown to have a specific DNA endonuclease activity. This activity mediates intron insertion by cleaving the DNA sequence corresponding to the splice junction of an intronless strain. We have discovered in mitochondrial extracts from the yeast strain 777-3A a new DNA endonuclease activity which cleaves the fused exon A3-exon A4 junction sequence of the CO XI gene.

  1. Using Environmental DNA for Invasive Species Surveillance and Monitoring.

    PubMed

    Mahon, Andrew R; Jerde, Christopher L

    2016-01-01

    The method employed for environmental DNA (eDNA) surveillance for detection and monitoring of rare species in aquatic systems has evolved dramatically since its first large-scale applications. Both active (targeted) and passive (total diversity) surveillance methods provide helpful information for management groups, but each has a suite of techniques that necessitate proper equipment training and use. The protocols described in this chapter represent some of the latest iterations in eDNA surveillance being applied in aquatic and marine systems.

  2. Markovian language model of the DNA and its information content

    PubMed Central

    Srivastava, S.; Baptista, M. S.

    2016-01-01

    This work proposes a Markovian memoryless model for the DNA that simplifies enormously the complexity of it. We encode nucleotide sequences into symbolic sequences, called words, from which we establish meaningful length of words and groups of words that share symbolic similarities. Interpreting a node to represent a group of similar words and edges to represent their functional connectivity allows us to construct a network of the grammatical rules governing the appearance of groups of words in the DNA. Our model allows us to predict the transition between groups of words in the DNA with unprecedented accuracy, and to easily calculate many informational quantities to better characterize the DNA. In addition, we reduce the DNA of known bacteria to a network of only tens of nodes, show how our model can be used to detect similar (or dissimilar) genes in different organisms, and which sequences of symbols are responsible for most of the information content of the DNA. Therefore, the DNA can indeed be treated as a language, a Markovian language, where a ‘word’ is an element of a group, and its grammar represents the rules behind the probability of transitions between any two groups. PMID:26909179

  3. Recombinant DNA technology in apple.

    PubMed

    Gessler, Cesare; Patocchi, Andrea

    2007-01-01

    This review summarizes the achievements of almost 20 years of recombinant DNA technology applied to apple, grouping the research results into the sections: developing the technology, insect resistance, fungal disease resistance, self-incompatibility, herbicide resistance, fire blight resistance, fruit ripening, allergens, rooting ability, and acceptance and risk assessment. The diseases fire blight, caused by Erwinia amylovora, and scab, caused by Venturia inaequalis, were and still are the prime targets. Shelf life improvement and rooting ability of rootstocks are also relevant research areas. The tools to create genetically modified apples of added value to producers, consumers, and the environment are now available.

  4. Oxidative DNA modifications.

    PubMed

    Poulsen, Henrik E

    2005-07-01

    Oxidative DNA modifications are frequent in mammalian DNA and have been suggested an important mechanism in carcinogenesis, diabetes and ageing. The foundations for this suggestion are: Evidence for the importance of oxidative DNA modifications in cancer development is: high levels of oxidative lesions in cancer tissue; highly conserved and specific DNA repair systems targeting oxidative lesions; high levels of oxidative DNA lesions in oxidative DNA repair knock-out animals; defective repair of oxidative lesions in cancer-prone progeria syndromes; reduced cancer incidence in populations with high dietary antioxidant intake; and increased oxidative stress to DNA in tobacco smokers. Conflicting evidence for a relation between oxidative stress to DNA and cancer is: disagreement about the true levels and occurrence of the oxidative lesions in vivo; failure to identify the localization of oxidative lesions in important genes, e.g. tumor suppressor and oncogenes; lack of evidence that the oxidative lesions induce mutations in vivo; no cancer development in animals knocked-out for specific DNA repair enzymes in spite of high tissue levels of oxidative lesions; and unchanged cancer rates after antioxidant interventions in large clinical controlled and randomized trials. The rate of DNA oxidation has been estimated from urinary excretion of repair products and it is evident that if these lesions were not repaired, a large part of DNA would be oxidized to a degree not compatible with living. The methodologies by which oxidative DNA modifications are measured cover a wide and different range, advantages and disadvantages will be presented. One particular problem is artificial oxidation, and methods to prevent such artifacts will be presented together with results from a large interlaboratory standardization program. The methodology by which the lesions can be measured is complicated and prone to artifacts during DNA isolation, digestion, derivatization and maybe even during

  5. Profiling oxidative DNA damage: effects of antioxidants.

    PubMed

    Box, Harold C; Patrzyc, Helen B; Budzinski, Edwin E; Dawidzik, Jean B; Freund, Harold G; Zeitouni, Nathalie C; Mahoney, Martin C

    2012-11-01

    The goal of this research was to determine whether antioxidant usage could be correlated with changes in DNA damage levels. Liquid Chromatography-tandem Mass Spectrometry (LC-MS/MS) was used to simultaneously measure five different oxidatively-induced base modifications in the DNA of WBC. Measurements of the five modifications were made before and after an 8-week trial during which participants took the SU.VI.MAX supplement. Levels of the five DNA modifications were compared among different groupings: users versus non-users of antioxidant supplements, before versus after the supplement intervention and men versus women. The statistical significance of differences between groups was most significant for pyrimidine base modifications and the observed trends reflect trends reported in epidemiological studies of antioxidant usage. A combination of modifications derived from pyrimidine bases is suggested as a superior indicator of oxidative stress.

  6. Environmental DNA (eDNA) detects the invasive rusty crayfish Orconectes rusticus at low abundances.

    PubMed

    Dougherty, Matthew M; Larson, Eric R; Renshaw, Mark A; Gantz, Crysta A; Egan, Scott P; Erickson, Daniel M; Lodge, David M

    2016-06-01

    Early detection is invaluable for the cost-effective control and eradication of invasive species, yet many traditional sampling techniques are ineffective at the low population abundances found at the onset of the invasion process. Environmental DNA (eDNA) is a promising and sensitive tool for early detection of some invasive species, but its efficacy has not yet been evaluated for many taxonomic groups and habitat types.We evaluated the ability of eDNA to detect the invasive rusty crayfish Orconectes rusticus and to reflect patterns of its relative abundance, in upper Midwest, USA, inland lakes. We paired conventional baited trapping as a measure of crayfish relative abundance with water samples for eDNA, which were analysed in the laboratory with a qPCR assay. We modelled detection probability for O. rusticus eDNA using relative abundance and site characteristics as covariates and also tested the relationship between eDNA copy number and O. rusticus relative abundance.We detected O. rusticus eDNA in all lakes where this species was collected by trapping, down to low relative abundances, as well as in two lakes where trap catch was zero. Detection probability of O. rusticus eDNA was well predicted by relative abundance of this species and lake water clarity. However, there was poor correspondence between eDNA copy number and O. rusticus relative abundance estimated by trap catches. Synthesis and applications. Our study demonstrates a field and laboratory protocol for eDNA monitoring of crayfish invasions, with results of statistical models that provide guidance of sampling effort and detection probabilities for researchers in other regions and systems. We propose eDNA be included as a tool in surveillance for invasive or imperilled crayfishes and other benthic arthropods.

  7. Low-Dose Formaldehyde Delays DNA Damage Recognition and DNA Excision Repair in Human Cells

    PubMed Central

    Luch, Andreas; Frey, Flurina C. Clement; Meier, Regula; Fei, Jia; Naegeli, Hanspeter

    2014-01-01

    Objective Formaldehyde is still widely employed as a universal crosslinking agent, preservative and disinfectant, despite its proven carcinogenicity in occupationally exposed workers. Therefore, it is of paramount importance to understand the possible impact of low-dose formaldehyde exposures in the general population. Due to the concomitant occurrence of multiple indoor and outdoor toxicants, we tested how formaldehyde, at micromolar concentrations, interferes with general DNA damage recognition and excision processes that remove some of the most frequently inflicted DNA lesions. Methodology/Principal Findings The overall mobility of the DNA damage sensors UV-DDB (ultraviolet-damaged DNA-binding) and XPC (xeroderma pigmentosum group C) was analyzed by assessing real-time protein dynamics in the nucleus of cultured human cells exposed to non-cytotoxic (<100 μM) formaldehyde concentrations. The DNA lesion-specific recruitment of these damage sensors was tested by monitoring their accumulation at local irradiation spots. DNA repair activity was determined in host-cell reactivation assays and, more directly, by measuring the excision of DNA lesions from chromosomes. Taken together, these assays demonstrated that formaldehyde obstructs the rapid nuclear trafficking of DNA damage sensors and, consequently, slows down their relocation to DNA damage sites thus delaying the excision repair of target lesions. A concentration-dependent effect relationship established a threshold concentration of as low as 25 micromolar for the inhibition of DNA excision repair. Conclusions/Significance A main implication of the retarded repair activity is that low-dose formaldehyde may exert an adjuvant role in carcinogenesis by impeding the excision of multiple mutagenic base lesions. In view of this generally disruptive effect on DNA repair, we propose that formaldehyde exposures in the general population should be further decreased to help reducing cancer risks. PMID:24722772

  8. Many Ways to Loop DNA

    PubMed Central

    Griffith, Jack D.

    2013-01-01

    In the 1960s, I developed methods for directly visualizing DNA and DNA-protein complexes using an electron microscope. This made it possible to examine the shape of DNA and to visualize proteins as they fold and loop DNA. Early applications included the first visualization of true nucleosomes and linkers and the demonstration that repeating tracts of adenines can cause a curvature in DNA. The binding of DNA repair proteins, including p53 and BRCA2, has been visualized at three- and four-way junctions in DNA. The trombone model of DNA replication was directly verified, and the looping of DNA at telomeres was discovered. PMID:24005675

  9. Clerocidin selectively modifies the gyrase-DNA gate to induce irreversible and reversible DNA damage

    PubMed Central

    Pan, Xiao Su; Dias, Miriam; Palumbo, Manlio; Fisher, L. Mark

    2008-01-01

    Clerocidin (CL), a microbial diterpenoid, reacts with DNA via its epoxide group and stimulates DNA cleavage by type II DNA topoisomerases. The molecular basis of CL action is poorly understood. We establish by genetic means that CL targets DNA gyrase in the Gram-positive bacterium Streptococcus pneumoniae, and promotes gyrase-dependent single- and double-stranded DNA cleavage in vitro. CL-stimulated DNA breakage exhibited a strong preference for guanine preceding the scission site (−1 position). Mutagenesis of −1 guanines to A, C or T abrogated CL cleavage at a strong pBR322 site. Surprisingly, for double-strand breaks, scission on one strand consistently involved a modified (piperidine-labile) guanine and was not reversed by heat, salt or EDTA, whereas complementary strand scission occurred at a piperidine-stable −1 nt and was reversed by EDTA. CL did not induce cleavage by a mutant gyrase (GyrA G79A) identified here in CL-resistant pneumococci. Indeed, mutations at G79 and at the neighbouring S81 residue in the GyrA breakage-reunion domain discriminated poisoning by CL from that of antibacterial quinolones. The results suggest a novel mechanism of enzyme inhibition in which the −1 nt at the gyrase-DNA gate exhibit different CL reactivities to produce both irreversible and reversible DNA damage. PMID:18723572

  10. Thermodynamics of cationic lipid binding to DNA and DNA condensation: roles of electrostatics and hydrophobicity.

    PubMed

    Matulis, Daumantas; Rouzina, Ioulia; Bloomfield, Victor A

    2002-06-26

    Alkylammonium binding to DNA was studied by isothermal titration calorimetry. Experimental data, obtained as functions of alkyl chain length, salt concentration, DNA concentration, and temperature, provided a detailed thermodynamic description of lipid-DNA binding reactions leading to DNA condensation. Lipid binding, counterion displacement, and DNA condensation were highly cooperative processes, driven by a large increase in entropy and opposed by a relatively small endothermic enthalpy at room temperature. Large negative heat capacity change indicated a contribution from hydrophobic interactions between aliphatic tails. An approximation of lipid-DNA binding as dominated by two factors-ionic and hydrophobic interactions-yielded a model that was consistent with experimental data. Chemical group contributions to the energetics of binding were determined and could be used to predict energetics of other lipid binding to DNA. Electrostatic and hydrophobic contributions to Gibbs free energy, enthalpy, entropy, and heat capacity could be distinguished by applying additivity principles. Binding of lipids with two, three, and four aliphatic tails was investigated and compared to single-tailed lipid binding. Structurally, the model suggests that lipid cationic headgroups and aliphatic tails distribute evenly and lay down on DNA surface without the formation of micelles.

  11. Molecular characterization of races and vegetative compatibility groups in Fusarium oxysporum f. sp. vasinfectum.

    PubMed Central

    Fernandez, D; Assigbese, K; Dubois, M P; Geiger, J P

    1994-01-01

    Restriction fragment length polymorphism (RFLP) and vegetative compatibility analyses were undertaken to assess genetic relationships among 52 isolates of Fusarium oxysporum f. sp. vasinfectum of worldwide origin and representing race A, 3, or 4 on cotton plants. Ten distinct vegetative compatibility groups (VCGs) were obtained, and isolates belonging to distinct races were never in the same VCG. Race A isolates were separated into eight VCGs, whereas isolates of race 3 were classified into a single VCG (0113), as were those of race 4 (0114). Ribosomal and mitochondrial DNA (rDNA and mtDNA) RFLPs separated four rDNA haplotypes and seven mtDNA haplotypes. Race A isolates displayed the most polymorphism, with three rDNA haplotypes and four mtDNA haplotypes; race 4 isolates formed a single rDNA group but exhibited three mtDNA haplotypes, while race 3 isolates had unique rDNA and mtDNA haplotypes. Two mtDNA molecules with distinct sizes were identified; the first (45-kb mtDNA) was found in all race A isolates and seven race 4 isolates, and the second (55-kb mtDNA) was found in all race 3 isolates and in two isolates of race 4. These two mtDNA molecules were closely related to mtDNAs of F. oxysporum isolates belonging to other formae speciales (conglutinans, lycopersici, matthioli, and raphani). Isolates within a VCG shared the same rDNA and mtDNA haplotypes, with the exception of VCG0114, in which three distinct mtDNA haplotypes were observed. Genetic relationships among isolates inferred from rDNA or mtDNA site restriction data were different, and there was not a strict correlation between race and RFLPs.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:7993090

  12. Curating DNA specimens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    DNA data are used in a variety of ethnobiological disciplines including archaeology, conservation, ecology, medicinal plants and natural products research, taxonomy and systematics, crop evolution and domestication, and genetic diversity. It frequently is convenient to store and share DNA among coop...

  13. Human Mitochondrial DNA Replication

    PubMed Central

    Holt, Ian J.; Reyes, Aurelio

    2012-01-01

    Elucidation of the process of DNA replication in mitochondria is in its infancy. For many years, maintenance of the mitochondrial genome was regarded as greatly simplified compared to the nucleus. Mammalian mitochondria were reported to lack all DNA repair systems, to eschew DNA recombination, and to possess but a single DNA polymerase, polymerase γ. Polγ was said to replicate mitochondrial DNA exclusively via one mechanism, involving only two priming events and a handful of proteins. In this “strand-displacement model,” leading strand DNA synthesis begins at a specific site and advances approximately two-thirds of the way around the molecule before DNA synthesis is initiated on the “lagging” strand. Although the displaced strand was long-held to be coated with protein, RNA has more recently been proposed in its place. Furthermore, mitochondrial DNA molecules with all the features of products of conventional bidirectional replication have been documented, suggesting that the process and regulation of replication in mitochondria is complex, as befits a genome that is a core factor in human health and longevity. PMID:23143808

  14. Behavior of supercoiled DNA.

    PubMed Central

    Strick, T R; Allemand, J F; Bensimon, D; Croquette, V

    1998-01-01

    We study DNA supercoiling in a quantitative fashion by micromanipulating single linear DNA molecules with a magnetic field gradient. By anchoring one end of the DNA to multiple sites on a magnetic bead and the other end to multiple sites on a glass surface, we were able to exert torsional control on the DNA. A rotating magnetic field was used to induce rotation of the magnetic bead, and reversibly over- and underwind the molecule. The magnetic field was also used to increase or decrease the stretching force exerted by the magnetic bead on the DNA. The molecule's degree of supercoiling could therefore be quantitatively controlled and monitored, and tethered-particle motion analysis allowed us to measure the stretching force acting on the DNA. Experimental results indicate that this is a very powerful technique for measuring forces at the picoscale. We studied the effect of stretching forces ranging from 0.01 pN to 100 pN on supercoiled DNA (-0.1 < sigma < 0.2) in a variety of ionic conditions. Other effects, such as stretching-relaxing hysteresis and the braiding of two DNA molecules, are discussed. PMID:9545060

  15. Characterization of muntjac DNA

    SciTech Connect

    Davis, R.C.

    1981-05-27

    Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange.

  16. Routine DNA testing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Routine DNA testing. It’s done once you’ve Marker-Assisted Breeding Pipelined promising Qantitative Trait Loci within your own breeding program and thereby established the performance-predictive power of each DNA test for your germplasm under your conditions. By then you are ready to screen your par...

  17. Stool DNA Test

    MedlinePlus

    ... result. A test is considered negative if DNA markers common to colon cancer or precancerous polyps and signs of blood are ... result. A test is considered positive if DNA markers common to colon cancer or precancerous polyps or signs of blood are ...

  18. Modeling DNA Replication Intermediates

    SciTech Connect

    Broyde, S.; Roy, D.; Shapiro, R.

    1997-06-01

    While there is now available a great deal of information on double stranded DNA from X-ray crystallography, high resolution NMR and computer modeling, very little is known about structures that are representative of the DNA core of replication intermediates. DNA replication occurs at a single strand/double strand junction and bulged out intermediates near the junction can lead to frameshift mutations. The single stranded domains are particularly challenging. Our interest is focused on strategies for modeling the DNA of these types of replication intermediates. Modeling such structures presents special problems in addressing the multiple minimum problem and in treating the electrostatic component of the force field. We are testing a number of search strategies for locating low energy structures of these types and we are also investigating two different distance dependent dielectric functions in the coulombic term of the force field. We are studying both unmodified DNA and DNA damaged by aromatic amines, carcinogens present in the environment in tobacco smoke, barbecued meats and automobile exhaust. The nature of the structure adopted by the carcinogen modified DNA at the replication fork plays a key role in determining whether the carcinogen will cause a mutation during replication that can initiate the carcinogenic process. In the present work results are presented for unmodified DNA.

  19. Recombinant DNA for Teachers.

    ERIC Educational Resources Information Center

    Duvall, James G., III

    1992-01-01

    A science teacher describes his experience at a workshop to learn to teach the Cold Spring Harbor DNA Science Laboratory Protocols. These protocols lead students through processes for taking E. coli cells and transforming them into a new antibiotic resistant strain. The workshop featured discussions of the role of DNA recombinant technology in…

  20. Can Groups Learn?

    ERIC Educational Resources Information Center

    Cohen, Elizabeth G.; Lotan, Rachel A.; Abram, Percy L.; Scarloss, Beth A.; Schultz, Susan E.

    2002-01-01

    Evaluated the work of sixth grade students' creative problem-solving groups, proposing that providing students with specific guidelines about what makes an exemplary group product would improve the character of the discussion and quality of the group product. Student groups did learn as a result of their discussions and creation of group products.…

  1. Small Groups in Action

    ERIC Educational Resources Information Center

    Suessmuth, Patrick

    1974-01-01

    Small groups can sometimes be difficult to set up and work with properly. A number of tips for small group instruction are divided into seven areas: (1) presenting tasks; (2) group seating; (3) task time; (4) answering questions; (5) teacher's role in observing groups; (6) group noise level patterns; and (7) serial take-ups. (BP)

  2. Aberrant DNA methylation reprogramming in bovine SCNT preimplantation embryos

    PubMed Central

    Zhang, Sheng; Chen, Xin; Wang, Fang; An, Xinglan; Tang, Bo; Zhang, Xueming; Sun, Liguang; Li, Ziyi

    2016-01-01

    DNA methylation reprogramming plays important roles in mammalian embryogenesis. Mammalian somatic cell nuclear transfer (SCNT) embryos with reprogramming defects fail to develop. Thus, we compared DNA methylation reprogramming in preimplantation embryos from bovine SCNT and in vitro fertilization (IVF) and analyzed the influence of vitamin C (VC) on the reprogramming of DNA methylation. The results showed that global DNA methylation followed a typical pattern of demethylation and remethylation in IVF preimplantation embryos; however, the global genome remained hypermethylated in SCNT preimplantation embryos. Compared with the IVF group, locus DNA methylation reprogramming showed three patterns in the SCNT group. First, some pluripotency genes (POU5F1 and NANOG) and repeated elements (satellite I and α-satellite) showed insufficient demethylation and hypermethylation in the SCNT group. Second, a differentially methylated region (DMR) of an imprint control region (ICR) in H19 exhibited excessive demethylation and hypomethylation. Third, some pluripotency genes (CDX2 and SOX2) were hypomethylated in both the IVF and SCNT groups. Additionally, VC improved the DNA methylation reprogramming of satellite I, α-satellite and H19 but not that of POU5F1 and NANOG in SCNT preimplantation embryos. These results indicate that DNA methylation reprogramming was aberrant and that VC influenced DNA methylation reprogramming in SCNT embryos in a locus-specific manner. PMID:27456302

  3. DNA isolation method is a source of global DNA methylation variability measured with LUMA. Experimental analysis and a systematic review.

    PubMed

    Soriano-Tárraga, Carolina; Jiménez-Conde, Jordi; Giralt-Steinhauer, Eva; Ois, Angel; Rodríguez-Campello, Ana; Cuadrado-Godia, Elisa; Fernández-Cadenas, Israel; Montaner, Joan; Lucas, Gavin; Elosua, Roberto; Roquer, Jaume

    2013-01-01

    In DNA methylation, methyl groups are covalently bound to CpG dinucleotides. However, the assumption that methyl groups are not lost during routine DNA extraction has not been empirically tested. To avoid nonbiological associations in DNA methylation studies, it is essential to account for potential batch effect bias in the assessment of this epigenetic mechanism. Our purpose was to determine if the DNA isolation method is an independent source of variability in methylation status. We quantified Global DNA Methylation (GDM) by luminometric methylation assay (LUMA), comparing the results from 3 different DNA isolation methods. In the controlled analysis (n = 9), GDM differed slightly for the same individual depending on extraction method. In the population analysis (n = 580) there were significant differences in GDM between the 3 DNA isolation methods (medians, 78.1%, 76.5% and 75.1%; p<0.001). A systematic review of published data from LUMA GDM studies that specify DNA extraction methods is concordant with our findings. DNA isolation method is a source of GDM variability measured with LUMA. To avoid possible bias, the method used should be reported and taken into account in future DNA methylation studies.

  4. Group Work: How to Use Groups Effectively

    ERIC Educational Resources Information Center

    Burke, Alison

    2011-01-01

    Many students cringe and groan when told that they will need to work in a group. However, group work has been found to be good for students and good for teachers. Employers want college graduates to have developed teamwork skills. Additionally, students who participate in collaborative learning get better grades, are more satisfied with their…

  5. Group Time: Building Language at Group Time

    ERIC Educational Resources Information Center

    Church, Ellen Booth

    2004-01-01

    This article features energizing and surprising activities for children at group time. In the drawing activity, children are asked to give instructions on how to draw a picture using vocabulary and descriptive language. In the mailbox activity, children will be surprised to discover that they have mail at group time. Mailboxes can be used for…

  6. DNA Barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera)

    PubMed Central

    Foottit, Robert G.; Maw, Eric; Hebert, P. D. N.

    2014-01-01

    Background Many studies have shown the suitability of sequence variation in the 5′ region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Methodology/Principal Findings Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. Conclusions/Significance This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage. PMID:25004106

  7. DNA replication in thermophiles.

    PubMed

    Majerník, A I; Jenkinson, E R; Chong, J P J

    2004-04-01

    DNA replication enzymes in the thermophilic Archaea have previously attracted attention due to their obvious use in methods such as PCR. The proofreading ability of the Pyrococcus furiosus DNA polymerase has resulted in a commercially successful product (Pfu polymerase). One of the many notable features of the Archaea is the fact that their DNA processing enzymes appear on the whole to be more like those found in eukaryotes than bacteria. These proteins also appear to be simpler versions of those found in eukaryotes. For these reasons, archaeal organisms make potentially interesting model systems to explore the molecular mechanisms of processes such as DNA replication, repair and recombination. Why archaeal DNA-manipulation systems were adopted over bacterial systems by eukaryotic cells remains a most interesting question that we suggest may be linked to thermophily.

  8. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA

    PubMed Central

    Hayner, Jaclyn N.; Douma, Lauren G.; Bloom, Linda B.

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3′OH (3′DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3′DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5′phosphate (5′P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5′DNA). The 5′P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3′DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5′DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3′DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. PMID:25159615

  9. Structural features of DNA interaction with caffeine and theophylline

    NASA Astrophysics Data System (ADS)

    Nafisi, Shohreh; Manouchehri, Firouzeh; Tajmir-Riahi, Heidar-Ali; Varavipour, Maryam

    2008-03-01

    Caffeine and theophylline are strong antioxidants that prevent DNA damage. The anticancer and antiviral activities of these natural products are implicated in their mechanism of actions. However, there has been no information on the interactions of these xanthine derivatives with individual DNA at molecular level. The aim of this study was to examine the stability and structural features of calf-thymus DNA complexes with caffeine and theophylline in aqueous solution, using constant DNA concentration (6.25 mM) and various caffeine or theophylline/DNA(P) ratios of 1/80, 1/40, 1/20, 1/10, 1/5, 1/2 and 1/1. FTIR, UV-visible spectroscopic methods were used to determine the ligand external binding modes, the binding constant and the stability of caffeine, theophylline-DNA complexes in aqueous solution. Spectroscopic evidence showed that the complexation of caffeine and theophylline with DNA occurred via G-C and A-T and PO 2 group with overall binding constants of K(caffeine-DNA) = 9.7 × 10 3 M -1 and K(theophylline-DNA) = 1.7 × 10 4 M -1. The affinity of ligand-DNA binding is in the order of theophylline > caffeine. A partial B to A-DNA transition occurs upon caffeine and theophylline complexation.

  10. Group B Strep Infection

    MedlinePlus

    ... Questions OverviewWhat is group B strep?Group B streptococcus, or group B strep for short, is a ... can develop an infection of the lungs (called pneumonia), bloodstream (called sepsis), or the fluid around the ...

  11. DNA supercoiling and its role in DNA decatenation and unknotting

    PubMed Central

    Witz, Guillaume; Stasiak, Andrzej

    2010-01-01

    Chromosomal and plasmid DNA molecules in bacterial cells are maintained under torsional tension and are therefore supercoiled. With the exception of extreme thermophiles, supercoiling has a negative sign, which means that the torsional tension diminishes the DNA helicity and facilitates strand separation. In consequence, negative supercoiling aids such processes as DNA replication or transcription that require global- or local-strand separation. In extreme thermophiles, DNA is positively supercoiled which protects it from thermal denaturation. While the role of DNA supercoiling connected to the control of DNA stability, is thoroughly researched and subject of many reviews, a less known role of DNA supercoiling emerges and consists of aiding DNA topoisomerases in DNA decatenation and unknotting. Although DNA catenanes are natural intermediates in the process of DNA replication of circular DNA molecules, it is necessary that they become very efficiently decatenated, as otherwise the segregation of freshly replicated DNA molecules would be blocked. DNA knots arise as by-products of topoisomerase-mediated intramolecular passages that are needed to facilitate general DNA metabolism, including DNA replication, transcription or recombination. The formed knots are, however, very harmful for cells if not removed efficiently. Here, we overview the role of DNA supercoiling in DNA unknotting and decatenation. PMID:20026582

  12. Complete sequence of Euglena gracilis chloroplast DNA.

    PubMed Central

    Hallick, R B; Hong, L; Drager, R G; Favreau, M R; Monfort, A; Orsat, B; Spielmann, A; Stutz, E

    1993-01-01

    We report the complete DNA sequence of the Euglena gracilis, Pringsheim strain Z chloroplast genome. This circular DNA is 143,170 bp, counting only one copy of a 54 bp tandem repeat sequence that is present in variable copy number within a single culture. The overall organization of the genome involves a tandem array of three complete and one partial ribosomal RNA operons, and a large single copy region. There are genes for the 16S, 5S, and 23S rRNAs of the 70S chloroplast ribosomes, 27 different tRNA species, 21 ribosomal proteins plus the gene for elongation factor EF-Tu, three RNA polymerase subunits, and 27 known photosynthesis-related polypeptides. Several putative genes of unknown function have also been identified, including five within large introns, and five with amino acid sequence similarity to genes in other organisms. This genome contains at least 149 introns. There are 72 individual group II introns, 46 individual group III introns, 10 group II introns and 18 group III introns that are components of twintrons (introns-within-introns), and three additional introns suspected to be twintrons composed of multiple group II and/or group III introns, but not yet characterized. At least 54,804 bp, or 38.3% of the total DNA content is represented by introns. PMID:8346031

  13. Simple & Safe Genomic DNA Isolation.

    ERIC Educational Resources Information Center

    Moss, Robert; Solomon, Sondra

    1991-01-01

    A procedure for purifying DNA using either bacteria or rat liver is presented. Directions for doing a qualitative DNA assay using diphenylamine and a quantitative DNA assay using spectroscopy are included. (KR)

  14. Studying DNA in the Classroom.

    ERIC Educational Resources Information Center

    Zarins, Silja

    1993-01-01

    Outlines a workshop for teachers that illustrates a method of extracting DNA and provides instructions on how to do some simple work with DNA without sophisticated and expensive equipment. Provides details on viscosity studies and breaking DNA molecules. (DDR)

  15. Developmental validation of the ParaDNA(®) Intelligence System-A novel approach to DNA profiling.

    PubMed

    Blackman, Stephen; Dawnay, Nick; Ball, Glyn; Stafford-Allen, Beccy; Tribble, Nicholas; Rendell, Paul; Neary, Kelsey; Hanson, Erin K; Ballantyne, Jack; Kallifatidis, Beatrice; Mendel, Julian; Mills, DeEtta K; Wells, Simon

    2015-07-01

    DNA profiling through the analysis of STRs remains one of the most widely used tools in human identification across the world. Current laboratory STR analysis is slow, costly and requires expert users and interpretation which can lead to instances of delayed investigations or non-testing of evidence on budget grounds. The ParaDNA(®) Intelligence System has been designed to provide a simple, fast and robust way to profile DNA samples in a lab or field-deployable manner. The system analyses 5-STRs plus amelogenin to deliver a DNA profile that enables users to gain rapid investigative leads and intelligent prioritisation of samples in human identity testing applications. Utilising an innovative sample collector, minimal training is required to enable both DNA analysts and nonspecialist personnel to analyse biological samples directly, without prior processing, in approximately 75min. The test uses direct PCR with fluorescent HyBeacon(®) detection of STR allele lengths to provide a DNA profile. The developmental validation study described here followed the Scientific Working Group on DNA Analysis Methods (SWGDAM) guidelines and tested the sensitivity, reproducibility, accuracy, inhibitor tolerance, and performance of the ParaDNA Intelligence System on a range of mock evidence items. The data collected demonstrate that the ParaDNA Intelligence System displays useful DNA profiles when sampling a variety of evidence items including blood, saliva, semen and touch DNA items indicating the potential to benefit a number of applications in fields such as forensic, military and disaster victim identification (DVI).

  16. Thymidine analogues for tracking DNA synthesis.

    PubMed

    Cavanagh, Brenton L; Walker, Tom; Norazit, Anwar; Meedeniya, Adrian C B

    2011-09-15

    Replicating cells undergo DNA synthesis in the highly regulated, S-phase of the cell cycle. Analogues of the pyrimidine deoxynucleoside thymidine may be inserted into replicating DNA, effectively tagging dividing cells allowing their characterisation. Tritiated thymidine, targeted using autoradiography was technically demanding and superseded by 5-bromo-2-deoxyuridine (BrdU) and related halogenated analogues, detected using antibodies. Their detection required the denaturation of DNA, often constraining the outcome of investigations. Despite these limitations BrdU alone has been used to target newly synthesised DNA in over 20,000 reviewed biomedical studies. A recent breakthrough in "tagging DNA synthesis" is the thymidine analogue 5-ethynyl-2'-deoxyuridine (EdU). The alkyne group in EdU is readily detected using a fluorescent azide probe and copper catalysis using 'Huisgen's reaction' (1,3-dipolar cycloaddition or 'click chemistry'). This rapid, two-step biolabelling approach allows the tagging and imaging of DNA within cells whilst preserving the structural and molecular integrity of the cells. The bio-orthogonal detection of EdU allows its application in more experimental assays than previously possible with other "unnatural bases". These include physiological, anatomical and molecular biological experimentation in multiple fields including, stem cell research, cancer biology, and parasitology. The full potential of EdU and related molecules in biomedical research remains to be explored.

  17. Inferring ethnicity from mitochondrial DNA sequence

    PubMed Central

    2011-01-01

    Background The assignment of DNA samples to coarse population groups can be a useful but difficult task. One such example is the inference of coarse ethnic groupings for forensic applications. Ethnicity plays an important role in forensic investigation and can be inferred with the help of genetic markers. Being maternally inherited, of high copy number, and robust persistence in degraded samples, mitochondrial DNA may be useful for inferring coarse ethnicity. In this study, we compare the performance of methods for inferring ethnicity from the sequence of the hypervariable region of the mitochondrial genome. Results We present the results of comprehensive experiments conducted on datasets extracted from the mtDNA population database, showing that ethnicity inference based on support vector machines (SVM) achieves an overall accuracy of 80-90%, consistently outperforming nearest neighbor and discriminant analysis methods previously proposed in the literature. We also evaluate methods of handling missing data and characterize the most informative segments of the hypervariable region of the mitochondrial genome. Conclusions Support vector machines can be used to infer coarse ethnicity from a small region of mitochondrial DNA sequence with surprisingly high accuracy. In the presence of missing data, utilizing only the regions common to the training sequences and a test sequence proves to be the best strategy. Given these results, SVM algorithms are likely to also be useful in other DNA sequence classification applications. PMID:21554759

  18. DNA Based Molecular Scale Nanofabrication

    DTIC Science & Technology

    2015-12-04

    water adsorption on DNA origami template and its impact on DNA-mediated chemical reactions. We also extended the concept of DNA-mediated reaction to...other nanoscale templates, (b) Studied the thermal and chemical stability of DNA origami template. The result shows that the DNA nanostructures can be...potentially used in very harsh chemical environments, (c) Studied the effect of DNA origami template on the growth of self-assembled monolayer (SAM

  19. Database for bacterial group II introns.

    PubMed

    Candales, Manuel A; Duong, Adrian; Hood, Keyar S; Li, Tony; Neufeld, Ryan A E; Sun, Runda; McNeil, Bonnie A; Wu, Li; Jarding, Ashley M; Zimmerly, Steven

    2012-01-01

    The Database for Bacterial Group II Introns (http://webapps2.ucalgary.ca/~groupii/index.html#) provides a catalogue of full-length, non-redundant group II introns present in bacterial DNA sequences in GenBank. The website is divided into three sections. The first section provides general information on group II intron properties, structures and classification. The second and main section lists information for individual introns, including insertion sites, DNA sequences, intron-encoded protein sequences and RNA secondary structure models. The final section provides tools for identification and analysis of intron sequences. These include a step-by-step guide to identify introns in genomic sequences, a local BLAST tool to identify closest intron relatives to a query sequence, and a boundary-finding tool that predicts 5' and 3' intron-exon junctions in an input DNA sequence. Finally, selected intron data can be downloaded in FASTA format. It is hoped that this database will be a useful resource not only to group II intron and RNA researchers, but also to microbiologists who encounter these unexpected introns in genomic sequences.

  20. DNA UVB dosimeters.

    PubMed

    Regan, J D; Yoshida, H

    1995-11-01

    DNA can be used to establish and monitor solar UVB dose. Since the principal molecular site of UVB damage in living organisms is DNA, it is logical to quantitate biologically effective solar UVB in DNA dosimeters. In addition to their particular sensitivity to UVB, DNA dosimeters have the advantage of a 2 pi geometry for collecting diffuse UVB radiation from all vectors, low cost, small size and portability, and no moving parts. Both molecular (cyclobutane pyrimidine dimers) and biological (bacteriophage plaques) dosimeters can be quantitated as endpoints to yield the total dose. DNA dosimeters integrate the absorbed energy of all UVB wavelengths (290-320 nm), are highly sensitive to the differential biological effectiveness of these wavelengths, and also integrate over time in hours, days or weeks of exposure. Our experiments have focused on the demonstration of DNA solar dosimeters in the ocean at various depths, the application of the dosimeters to the terrestrial monitoring of solar UVB under various conditions, and the development of a mini-dosimeter which uses nanograms of DNA and is assayed by polymerase chain reaction.

  1. DNA Import into Mitochondria.

    PubMed

    Konstantinov, Yu M; Dietrich, A; Weber-Lotfi, F; Ibrahim, N; Klimenko, E S; Tarasenko, V I; Bolotova, T A; Koulintchenko, M V

    2016-10-01

    In recent decades, it has become evident that the condition for normal functioning of mitochondria in higher eukaryotes is the presence of membrane transport systems of macromolecules (proteins and nucleic acids). Natural competence of the mitochondria in plants, animals, and yeasts to actively uptake DNA may be directly related to horizontal gene transfer into these organelles occurring at much higher rate compared to the nuclear and chloroplast genomes. However, in contrast with import of proteins and tRNAs, little is known about the biological role and molecular mechanism underlying import of DNA into eukaryotic mitochondria. In this review, we discuss current state of investigations in this area, particularly specificity of DNA import into mitochondria and its features in plants, animals, and yeasts; a tentative mechanism of DNA import across the mitochondrial outer and inner membranes; experimental data evidencing several existing, but not yet fully understood mechanisms of DNA transfer into mitochondria. Currently available data regarding transport of informational macromolecules (DNA, RNA, and proteins) into the mitochondria do not rule out that the mechanism of protein and tRNA import as well as tRNA and DNA import into the mitochondria may partially overlap.

  2. Quantitive DNA Fiber Mapping

    SciTech Connect

    Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-01-28

    Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

  3. DNA-PK assay

    DOEpatents

    Anderson, Carl W.; Connelly, Margery A.

    2004-10-12

    The present invention provides a method for detecting DNA-activated protein kinase (DNA-PK) activity in a biological sample. The method includes contacting a biological sample with a detectably-labeled phosphate donor and a synthetic peptide substrate defined by the following features to provide specific recognition and phosphorylation by DNA-PK: (1) a phosphate-accepting amino acid pair which may include serine-glutamine (Ser-Gln) (SQ), threonine-glutamine (Thr-Gln) (TQ), glutamine-serine (Gln-Ser) (QS), or glutamine-threonine (Gln-Thr) (QT); (2) enhancer amino acids which may include glutamic acid or glutamine immediately adjacent at the amino- or carboxyl- side of the amino acid pair and forming an amino acid pair-enhancer unit; (3) a first spacer sequence at the amino terminus of the amino acid pair-enhancer unit; (4) a second spacer sequence at the carboxyl terminus of the amino acid pair-enhancer unit, which spacer sequences may include any combination of amino acids that does not provide a phosphorylation site consensus sequence motif; and, (5) a tag moiety, which may be an amino acid sequence or another chemical entity that permits separating the synthetic peptide from the phosphate donor. A compostion and a kit for the detection of DNA-PK activity are also provided. Methods for detecting DNA, protein phosphatases and substances that alter the activity of DNA-PK are also provided. The present invention also provides a method of monitoring protein kinase and DNA-PK activity in living cells. -A composition and a kit for monitoring protein kinase activity in vitro and a composition and a kit for monitoring DNA-PK activities in living cells are also provided. A method for identifying agents that alter protein kinase activity in vitro and a method for identifying agents that alter DNA-PK activity in living cells are also provided.

  4. DNA methylation of retrotransposons, DNA transposons and genes in sugar beet (Beta vulgaris L.).

    PubMed

    Zakrzewski, Falk; Schmidt, Martin; Van Lijsebettens, Mieke; Schmidt, Thomas

    2017-03-03

    The methylation of cytosines shapes the epigenetic landscape of plant genomes, coordinates transgenerational epigenetic inheritance, represses activity of transposable elements (TEs), affects gene expression, and, hence, can influence the phenotype. Sugar beet (Beta vulgaris ssp. vulgaris), an important crop that accounts for 30% of the worldwide sugar needs, has a relatively small genome size (758 Mbp) consisting of approximately 485 Mbp repetitive DNA (64%) in particular, satellite DNA, retrotransposons, and DNA transposons. Genome-wide cytosine methylation in the sugar beet genome was studied in leaves and leaf-derived callus with a focus on repetitive sequences, including retrotransposons and DNA transposons, the major groups of repetitive DNA sequences and compared with gene methylation. Genes showed a specific methylation pattern for CG, CHG (H=A, C, and T), and CHH sites, whereas the TE pattern differed, depending on the classes 1 (retrotransposons) and 2 (DNA transposons), respectively. Along genes and TEs, the CG and CHG methylation was higher than that of adjacent genomic regions. In contrast to the relatively low CHH methylation in retrotransposons and genes, the level of CHH methylation in DNA transposons was strongly increased, pointing toward a functional role of asymmetric methylation in DNA transposon silencing. Comparison of genome-wide DNA methylation between sugar beet leaves and callus revealed a differential methylation upon tissue culture. Potential epialleles were hypomethylated (lower methylation) at CG and CHG sites in retrotransposons and genes and hypermethylated (higher methylation) at CHH sites in DNA transposons of callus when compared to leaves. This article is protected by copyright. All rights reserved.

  5. DNA methyltransferase 1 mutations and mitochondrial pathology: is mtDNA methylated?

    PubMed Central

    Maresca, Alessandra; Zaffagnini, Mirko; Caporali, Leonardo; Carelli, Valerio; Zanna, Claudia

    2015-01-01

    Autosomal dominant cerebellar ataxia-deafness and narcolepsy (ADCA-DN) and Hereditary sensory neuropathy with dementia and hearing loss (HSN1E) are two rare, overlapping neurodegenerative syndromes that have been recently linked to allelic dominant pathogenic mutations in the DNMT1 gene, coding for DNA (cytosine-5)-methyltransferase 1 (DNMT1). DNMT1 is the enzyme responsible for maintaining the nuclear genome methylation patterns during the DNA replication and repair, thus regulating gene expression. The mutations responsible for ADCA-DN and HSN1E affect the replication foci targeting sequence domain, which regulates DNMT1 binding to chromatin. DNMT1 dysfunction is anticipated to lead to a global alteration of the DNA methylation pattern with predictable downstream consequences on gene expression. Interestingly, ADCA-DN and HSN1E phenotypes share some clinical features typical of mitochondrial diseases, such as optic atrophy, peripheral neuropathy, and deafness, and some biochemical evidence of mitochondrial dysfunction. The recent discovery of a mitochondrial isoform of DNMT1 and its proposed role in methylating mitochondrial DNA (mtDNA) suggests that DNMT1 mutations may directly affect mtDNA and mitochondrial physiology. On the basis of this latter finding the link between DNMT1 abnormal activity and mitochondrial dysfunction in ADCA-DN and HSN1E appears intuitive, however, mtDNA methylation remains highly debated. In the last years several groups demonstrated the presence of 5-methylcytosine in mtDNA by different approaches, but, on the other end, the opposite evidence that mtDNA is not methylated has also been published. Since over 1500 mitochondrial proteins are encoded by the nuclear genome, the altered methylation of these genes may well have a critical role in leading to the mitochondrial impairment observed in ADCA-DN and HSN1E. Thus, many open questions still remain unanswered, such as why mtDNA should be methylated, and how this process is regulated and

  6. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  7. Peripheral blood cell-free DNA is an alternative tumor DNA source reflecting disease status in myelodysplastic syndromes.

    PubMed

    Suzuki, Yasuhiro; Tomita, Akihiro; Nakamura, Fumika; Iriyama, Chisako; Shirahata-Adachi, Mizuho; Shimada, Kazuyuki; Akashi, Akimi; Ishikawa, Yuichi; Kaneda, Norio; Kiyoi, Hitoshi

    2016-09-01

    Genetic alterations in myelodysplastic syndromes (MDS) are critical for pathogenesis. We previously showed that peripheral blood cell-free DNA (PBcfDNA) may be more sensitive for genetic/epigenetic analyses than whole bone marrow (BM) cells and mononuclear cells in peripheral blood (PB). Here we analyzed the detailed features of PBcfDNA and its utility in genetic analyses in MDS. The plasma-PBcfDNA concentration in MDS and related diseases (N = 33) was significantly higher than that in healthy donors (N = 14; P = 0.041) and in International Prognostic Scoring System higher-risk groups than that in lower-risk groups (P = 0.034). The concentration of plasma-/serum-PBcfDNA was significantly correlated with the serum lactate dehydrogenase level (both P < 0.0001) and the blast cell count in PB (P = 0.034 and 0.025, respectively). One nanogram of PBcfDNA was sufficient for one assay of Sanger sequencing using optimized primer sets to amplify approximately 160-bp PCR products. PBcfDNA (approximately 50 ng) can also be utilized for targeted sequencing. Almost all mutations detected in BM-DNA were also detected using corresponding PBcfDNA. Analyses using serially harvested PBcfDNA from an RAEB-2 patient showed that the somatic mutations and a single nucleotide polymorphism that were detected before allogeneic transplantation were undetectable after transplantation, indicating that PBcfDNA likely comes from MDS clones that reflect the disease status. PBcfDNA may be a safer and easier alternative to obtain tumor DNA in MDS.

  8. Plasmid DNA manufacturing technology.

    PubMed

    Carnes, Aaron E; Williams, James A

    2007-01-01

    Today, plasmid DNA is becoming increasingly important as the next generation of biotechnology products (gene medicines and DNA vaccines) make their way into clinical trials, and eventually into the pharmaceutical marketplace. This review summarizes recent patents and patent applications relating to plasmid manufacturing, in the context of a comprehensive description of the plasmid manufacturing intellectual property landscape. Strategies for plasmid manufacturers to develop or in-license key plasmid manufacturing technologies are described with the endpoint of efficiently producing kg quantities of plasmid DNA of a quality that meets anticipated European and FDA quality specifications for commercial plasmid products.

  9. Biology of DNA restriction.

    PubMed Central

    Bickle, T A; Krüger, D H

    1993-01-01

    Our understanding of the evolution of DNA restriction and modification systems, the control of the expression of the structural genes for the enzymes, and the importance of DNA restriction in the cellular economy has advanced by leaps and bounds in recent years. This review documents these advances for the three major classes of classical restriction and modification systems, describes the discovery of a new class of restriction systems that specifically cut DNA carrying the modification signature of foreign cells, and deals with the mechanisms developed by phages to avoid the restriction systems of their hosts. PMID:8336674

  10. Focus: DNA probes

    SciTech Connect

    Not Available

    1986-11-01

    Progress in the development of DNA probes for the identification and quantitation of specific genetic sequences in biological samples is reviewed. Current research efforts in the development of DNA probes for the diagnosis of a wide variety of bacterial, viral, and other infectious diseases, such as herpes simplex and cytomegalovirus, and inherited genetic diseases such as cystic fibrosis and sickle cell anemia are discussed. Progress in development of DNA probe assays for cancer diagnosis, detection of Salmonella food poisoning, tissue typing (detection of histocompatibility antigens), mutagen screening, and animal diseases, among other applications is included.

  11. Curcumin binding to DNA and RNA.

    PubMed

    Nafisi, Shohreh; Adelzadeh, Maryam; Norouzi, Zeinab; Sarbolouki, Mohammad Nabi

    2009-04-01

    Curcumin, the yellow pigment from the rhizoma of Curcuma longa, is a widely studied phytochemical with a variety of biological activities. The ongoing research and clinical trials have proved that this natural phenolic compound has great and diverse pharmacological potencies. Beside its effective antioxidant, antiinflammatory, and antimicrobial/antiviral properties, curcumin is also considered as a cancer chemopreventive agent. While the antioxidant activity of curcumin is well documented, its interaction with DNA and RNA is not fully investigated. This study was designed to examine the interactions of curcumin with calf thymus DNA and yeast RNA in aqueous solution at physiological conditions, using constant DNA and RNA concentration (6.25 mM) and various curcumin/polynucleotide (phosphate) ratios of 1/120, 1/80, 1/40, 1/20, and 1/10. Fourier transform infrared (FTIR) and UV-visible spectroscopic methods were used to determine the ligand binding modes, the binding constants, and the stability of curcumin-DNA and curcumin-RNA complexes in aqueous solution. Spectroscopic evidence showed that curcumin binds to the major and minor grooves of DNA duplex and to RNA bases as well as to the back bone phosphate group with overall binding constants of K(curcumin-DNA) = 4.255 x 10(4) M(-1) and K(curcumin-RNA) = 1.262 x 10(4) M(-1). Major DNA and RNA aggregation occurred at high pigment concentration. No conformational changes were observed upon curcumin interaction with these biopolymers; that is, DNA remains in the B, and RNA retains its A-family structure.

  12. The Group Experience

    ERIC Educational Resources Information Center

    Wadsworth, John

    2008-01-01

    Knowledge of group dynamics and leadership activities is a component of the CORE Standards for the Master's degree curriculum in Rehabilitation Counseling. A group experience is often included as a learning activity in rehabilitation counselor education curricula as an instructional method of imparting knowledge of group dynamics. Group experience…

  13. Short thio-multi-walled carbon nanotubes and Au nanoparticles enhanced electrochemical DNA biosensor for DNA hybridization detection

    NASA Astrophysics Data System (ADS)

    Guo, Feng; Zhang, Jimei; Dai, Zhao; Zheng, Guo

    2010-07-01

    A novel and sensitive electrochemical DNA biosensor based on multi-walled carbon nanotubes functionalized with a thio group (MWNTs-SH) and gold nanoparticles (GNPs) for covalent DNA immobilization and enhanced hybridization detection is described. The key step for developing this novel DNA biosensor is to cut the pristine MWNT into short and generate lots of active sites simultaneously. With this approach, the target DNA could be quantified in a linear range from 8.5×10-10 to 1.5×10-5 mol/L, with a detection limit of 1.67×10-11 mol/L by 3σ.

  14. Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA

    NASA Technical Reports Server (NTRS)

    Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.

    1982-01-01

    The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.

  15. Toxoplasma gondii infection can induce retinal DNA damage: an experimental study

    PubMed Central

    El-Sayed, Nagwa Mostafa; Aly, Eman Mohamed

    2014-01-01

    AIM To detect whether Toxoplasma gondii (T. gondii) infection of mice can induce retinal DNA damage. METHODS A total of 20 laboratory-bred male Swiss albino mice were used and divided into four groups: control group (non-infected animals); T. gondii infected group; immunosuppressed infected group; and infected group treated with sulfadiazine and pyrimethamine. Mice eyes were collected 6wk post infection and retinas were obtained. Each retina was immediately processed for comet assay and the frequency of tailed nuclei (DNA damage) was calculated. In addition, retinal DNA damage was revealed by various comet assay parameters that were provided by the image analysis software including tail length, percentage of DNA in the tail, percentage of tailed cells and tail moment. RESULTS The obtained results showed that T. gondii infection induced a statistically significant increase in the frequency of tailed nuclei, tail length, percentage of DNA in the tail, and tail moment in mice retinal cells compared to the control group (which showed some degree of DNA damage). In immunosuppressed infected group, retinal DNA damage was severing and there was significant increase in various comet assay parameters compared to both control and infected groups. After treatment with sulfadiazine and pyrimethamine, retinal DNA damage decreased and all comet assay parameters showed a statistical significant decrease compared to infected groups. CONCLUSION T. gondii infection can induce DNA damage in mice retinal cells. PMID:24967186

  16. Complementary addressed modification and cleavage of a single stranded DNA fragment with alkylating oligonucleotide derivatives.

    PubMed Central

    Vlassov, V V; Zarytova, V F; Kutiavin, I V; Mamaev, S V; Podyminogin, M A

    1986-01-01

    A single stranded DNA fragment was modified with alkylating derivatives of oligonucleotides complementary to a certain nucleotide sequences in the fragment. The derivatives carried aromatic 2-chloroethylamino groups at their 3'- or 5'-terminal nucleotide residues. Some of the derivatives carried both alkylating group and intercalating phenazine group which stabilized complementary complexes. It was found that these oligonucleotide derivatives modify the DNA fragment in a specific way near the target complementary nucleotide sequences, and the DNA fragment can be cleaved at the alkylated nucleotides positions. Alkylating derivatives carrying phenazine groups were found to be the most efficient in reaction with the DNA fragment. Images PMID:3714471

  17. Distinct evolutionary histories of the DNA-A and DNA-B components of bipartite begomoviruses

    PubMed Central

    2010-01-01

    Background Viruses of the genus Begomovirus (family Geminiviridae) have genomes consisting of either one or two genomic components. The component of bipartite begomoviruses known as DNA-A is homologous to the genomes of all geminiviruses and encodes proteins required for replication, control of gene expression, overcoming host defenses, encapsidation and insect transmission. The second component, referred to as DNA-B, encodes two proteins with functions in intra- and intercellular movement in host plants. The origin of the DNA-B component remains unclear. The study described here was initiated to investigate the relationship between the DNA-A and DNA-B components of bipartite begomoviruses with a view to unraveling their evolutionary histories and providing information on the possible origin of the DNA-B component. Results Comparative phylogenetic and exhaustive pairwise sequence comparison of all DNA-A and DNA-B components of begomoviruses demonstrates that the two molecules have very distinct molecular evolutionary histories and likely are under very different evolutionary pressures. The analysis highlights that component exchange has played a far greater role in diversification of begomoviruses than previously suspected, although there are distinct differences in the apparent ability of different groups of viruses to utilize this "sexual" mechanism of genetic exchange. Additionally we explore the hypothesis that DNA-B originated as a satellite that was captured by the monopartite progenitor of all extant bipartite begomoviruses and subsequently evolved to become the integral (essential) genome component that we recognize today. The situation with present-day satellites associated with begomoviruses provides some clues to the processes and selection pressures that may have led to the "domestication" of a wild progenitor of the DNA-B component. Conclusions The analysis has highlighted the greater genetic variation of DNA-B components, in comparison to the DNA

  18. Structure of large dsDNA viruses

    PubMed Central

    Klose, Thomas; Rossmann, Michael G.

    2015-01-01

    Nucleocytoplasmic large dsDNA viruses (NCLDVs) encompass an ever-increasing group of large eukaryotic viruses, infecting a wide variety of organisms. The set of core genes shared by all these viruses includes a major capsid protein with a double jelly-roll fold forming an icosahedral capsid, which surrounds a double layer membrane that contains the viral genome. Furthermore, some of these viruses, such as the members of the Mimiviridae and Phycodnaviridae have a unique vertex that is used during infection to transport DNA into the host. PMID:25003382

  19. DNA Damage among Wood Workers Assessed with the Comet Assay.

    PubMed

    Bruschweiler, Evin Danisman; Wild, Pascal; Huynh, Cong Khanh; Savova-Bianchi, Dessislava; Danuser, Brigitta; Hopf, Nancy B

    2016-01-01

    Exposure to wood dust, a human carcinogen, is common in wood-related industries, and millions of workers are occupationally exposed to wood dust worldwide. The comet assay is a rapid, simple, and sensitive method for determining DNA damage. The objective of this study was to investigate the DNA damage associated with occupational exposure to wood dust using the comet assay (peripheral blood samples) among nonsmoking wood workers (n = 31, furniture and construction workers) and controls (n = 19). DNA damage was greater in the group exposed to composite wood products compared to the group exposed to natural woods and controls (P < 0.001). No difference in DNA damage was observed between workers exposed to natural woods and controls (P = 0.13). Duration of exposure and current dust concentrations had no effect on DNA damage. In future studies, workers' exposures should include cumulative dust concentrations and exposures originating from the binders used in composite wood products.

  20. DNA Damage among Wood Workers Assessed with the Comet Assay

    PubMed Central

    Bruschweiler, Evin Danisman; Wild, Pascal; Huynh, Cong Khanh; Savova-Bianchi, Dessislava; Danuser, Brigitta; Hopf, Nancy B.

    2016-01-01

    Exposure to wood dust, a human carcinogen, is common in wood-related industries, and millions of workers are occupationally exposed to wood dust worldwide. The comet assay is a rapid, simple, and sensitive method for determining DNA damage. The objective of this study was to investigate the DNA damage associated with occupational exposure to wood dust using the comet assay (peripheral blood samples) among nonsmoking wood workers (n = 31, furniture and construction workers) and controls (n = 19). DNA damage was greater in the group exposed to composite wood products compared to the group exposed to natural woods and controls (P < 0.001). No difference in DNA damage was observed between workers exposed to natural woods and controls (P = 0.13). Duration of exposure and current dust concentrations had no effect on DNA damage. In future studies, workers’ exposures should include cumulative dust concentrations and exposures originating from the binders used in composite wood products. PMID:27398027

  1. Bacterial group I introns: mobile RNA catalysts

    PubMed Central

    2014-01-01

    Group I introns are intervening sequences that have invaded tRNA, rRNA and protein coding genes in bacteria and their phages. The ability of group I introns to self-splice from their host transcripts, by acting as ribozymes, potentially renders their insertion into genes phenotypically neutral. Some group I introns are mobile genetic elements due to encoded homing endonuclease genes that function in DNA-based mobility pathways to promote spread to intronless alleles. Group I introns have a limited distribution among bacteria and the current assumption is that they are benign selfish elements, although some introns and homing endonucleases are a source of genetic novelty as they have been co-opted by host genomes to provide regulatory functions. Questions regarding the origin and maintenance of group I introns among the bacteria and phages are also addressed. PMID:24612670

  2. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

    SciTech Connect

    Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-05-17

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  3. FBI's DNA analysis program

    NASA Astrophysics Data System (ADS)

    Brown, John R.

    1994-03-01

    Forensic DNA profiling technology is a significant law enforcement tool due to its superior discriminating power. Applying the principles of population genetics to the DNA profile obtained in violent crime investigations results in low frequency of occurrence estimates for the DNA profile. These estimates often range from a frequency of occurrence of 1 in 50 unrelated individuals to 1 in a million unrelated individuals or even smaller. It is this power to discriminate among individuals in the population that has propelled forensic DNA technology to the forefront of forensic testing in violent crime cases. Not only is the technology extremely powerful in including or excluding a criminal suspect as the perpetrator, but it also gives rise to the potential of identifying criminal suspects in cases where the investigators of unknown suspect cases have exhausted all other available leads.

  4. Close encounters with DNA

    PubMed Central

    Maffeo, C.; Yoo, J.; Comer, J.; Wells, D. B.; Luan, B.; Aksimentiev, A.

    2014-01-01

    Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena and we review the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field. PMID:25238560

  5. DNA-templated nanofabrication.

    PubMed

    Becerril, Héctor A; Woolley, Adam T

    2009-02-01

    Nanofabrication, or the organizational control over matter at the nanometre scale, is an intriguing scientific challenge requiring multidisciplinary tools for its solution. DNA is a biomolecule that can be combined with other nanometre-scale entities through chemical self-assembly to form a broad variety of nanomaterials. In this tutorial review we present the principles that allow DNA to interact with other chemical species, and describe the challenges and potential applications of DNA as a template for making both biological and inorganic features with nanometre resolution. As such, this report should be of interest to chemists, surface and materials scientists, biologists, and nanotechnologists, as well as others who seek to use DNA in nanofabrication.

  6. Multiplex analysis of DNA

    DOEpatents

    Church, George M.; Kieffer-Higgins, Stephen

    1992-01-01

    This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.

  7. Making DNA Fingerprints.

    ERIC Educational Resources Information Center

    Nunley, Kathie F.

    1996-01-01

    Presents an activity to simulate electrophoresis using everyday items. Uses adding machine paper to construct a set of DNA fingerprints that can be used to solve crime cases designed by students in any biology class. (JRH)

  8. Retroviral DNA Integration

    PubMed Central

    2016-01-01

    The integration of a DNA copy of the viral RNA genome into host chromatin is the defining step of retroviral replication. This enzymatic process is catalyzed by the virus-encoded integrase protein, which is conserved among retroviruses and LTR-retrotransposons. Retroviral integration proceeds via two integrase activities: 3′-processing of the viral DNA ends, followed by the strand transfer of the processed ends into host cell chromosomal DNA. Herein we review the molecular mechanism of retroviral DNA integration, with an emphasis on reaction chemistries and architectures of the nucleoprotein complexes involved. We additionally discuss the latest advances on anti-integrase drug development for the treatment of AIDS and the utility of integrating retroviral vectors in gene therapy applications. PMID:27198982

  9. DNA damage and carcinogenesis

    SciTech Connect

    Stelow, R B

    1980-01-01

    Although cancer may arise as a result of many different types of molecular changes, there is little reason to doubt that changes to DNA are one of the more important ones in cancer initiation. Although DNA repair mechanisms seem able to eliminate a very large fraction of deleterious changes to DNA, we not only have little insight into the molecular mechanisms involved in such repair, but have a negligible amount of information to permit us to estimate the shape of dose response relations at low doses. The case of skin cancer is a special one, in that the average population is exposed to sufficient solar uv so that the effects of small increments in uv dose may be estimated. An approximate 85% reduction in DNA repair increases skin cancer incidence 10/sup 4/ fold.

  10. DNA sequencing conference, 2

    SciTech Connect

    Cook-Deegan, R.M.; Venter, J.C.; Gilbert, W.; Mulligan, J.; Mansfield, B.K.

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  11. DNA Vaccination in Chickens.

    PubMed

    Gupta, Shishir Kumar; Dey, Sohini; Chellappa, Madhan Mohan

    2016-01-01

    Robust and sustainable development of poultry industry requires prevention of deadly infectious diseases. Vigorous vaccination of the birds is a routine practice; however, the live and inactivated vaccines that are used have inherent disadvantages. New-generation vaccines such as DNA vaccines offer several advantages over conventional vaccines. DNA vaccines, which encode an antigen of interest or multiple antigens in the target host, are stable, easy to produce and administer, do not require cold chain maintenance, and are not affected by the maternal antibodies. In addition, DNA vaccines can also be administered in ovo, and thus, mass vaccination and early induction of immune response can effectively be achieved. In this chapter, we focus on the development of DNA vaccines against important infectious viral as well as parasitic diseases of poultry.

  12. Aniline mustard analogues of the DNA-intercalating agent amsacrine: DNA interaction and biological activity.

    PubMed

    Fan, J Y; Valu, K K; Woodgate, P D; Baguley, B C; Denny, W A

    1997-04-01

    Two series of analogues of the clinical antileukemic drug and DNA-intercalating ligand amsacrine have been prepared, containing aniline mustard sidechains of varying reactivity, linked either at the 4-position of the intercalating acridine chromophore (type A) or at the 1'-position of the 9-anilino group (type B). DNase I footprinting assays showed that compounds of type B had stronger reversible binding to DNA than did compounds of type A. Compounds of each type showed similar patterns of alkylation-induced cleavage of DNA, and alkylate at the N7 of guanines in runs of guanines (similar to the pattern for untargeted mustards) as well as some adenines. Both classes of compounds crosslinked DNA, although those bearing relatively inactive mustards did so only at high drug/base pair ratios. However, while the patterns of DNA alkylation were broadly similar, the compounds were considerably more cytotoxic than analogous untargeted mustards. Comparison of their cytotoxicities in wild-type and DNA repair-deficient lines indicated this toxicity was due to DNA crosslinks (except for the least reactive SO2-linked mustards). The 4-linked analogues showed slightly higher in vivo antileukemic activity than the corresponding 1'-linked analogues.

  13. Interaction of DNA and DNA-anti-DNA complexes to fibronectin

    SciTech Connect

    Gupta, R.C.; Simpson, W.A.; Raghow, R.; Hasty, K.

    1986-03-01

    Fibronectin (Fn) is a large multidomain glycoprotein found in the basement membrane, on cell surface and in plasma. The interactions of Fn with DNA may be significant in glomerular deposition of DNA-anti-DNA complexes in patients with systemic lupus erythematosus (SLE). The authors examined the binding of DNA and DNA-anti-DNA complexes to Fn by a solid phase assay in which Fn was coated to microtiter plates and reacted with (/sup 3/H)DNA or DNA complexes with a monoclonal anti-DNA antibody. The optimal interaction of DNA with Fn occurs at <0.1M NaCl suggesting that the binding is charge dependent; the specificity of this binding was shown by competitive inhibition and locking experiments using anti-Fn. The binding was maximum at pH 6.5 and in the absence of Ca/sup 2 +/. The addition of Clq enhanced the binding of DNA and DNA-anti-DNA complexes to Fn, whereas heparan sulfate inhibited such binding. The monomeric or aggregated IgC did not bind Fn but aggregated IgG bound to Fn in the presence of Clq. Furthermore, DNA-anti-DNA complexes in sera from active SLE patients bound Fn which was enhanced in the presence of Clq; DNase abolished this binding indicating that the interaction of these complexes was mediated by DNA. These observations may partially explain the molecular mechanism(s) of the deposition of DNA-anti-DNA complexes in basement membrane.

  14. Crystallization and X-ray diffraction analysis of the DNA-remodelling protein DnaD from Bacillus subtilis

    SciTech Connect

    Schneider, Sabine; Carneiro, Maria J. V. M.; Ioannou, Charikleia; Soultanas, Panos; Paoli, Max

    2007-02-01

    Crystallization and preliminary X-ray diffraction analysis of the two domains of DnaD from B. subtilis is reported. The DnaD protein is an essential component of the chromosome-replication machinery of the Gram-positive bacterium Bacillus subtilis and is part of the primosomal cascade that ultimately loads the replicative ring helicase DnaC onto DNA. Moreover, DnaD is a global regulator of DNA architecture, as it forms higher order nucleoprotein structures in order to open supercoiled DNA. Here, the crystallization and preliminary X-ray diffraction analysis of the two domains of DnaD from B. subtilis are reported. Crystals of the N-terminal domain are trigonal, with either P3{sub 1}21 or P3{sub 2}21 space-group symmetry, and diffracted X-rays to 2.0 Å resolution; crystals of the C-terminal domain are hexagonal, with space group P6{sub 1} or P6{sub 5}, and diffracted X-rays to 2.9 Å resolution in-house. Determination of the structure of the DnaD domains will provide insight into how remodelling of the nucleoid is associated with priming of replication in the model Gram-positive organism B. subtilis.

  15. Das DNA-Puzzle

    NASA Astrophysics Data System (ADS)

    Kirchner, Stefan

    Im Jahre 1953 wurde von James Watson und Francis Crick erstmalig der strukturelle Aufbau der sogenannten DNA (Desoxyribonukleinsäure) beschrieben, welche das Erbgut jedes Lebewesens enthält. Der wesentliche Teil des Erbguts wird dabei durch eine sehr lange Folge der vier Basen Adenin (A), Cytosin (C), Guanin (G) und Thymin (T) codiert. Seit einigen Jahren ist es möglich, die Folge der vier Basen zu einer gegebenen DNA zu bestimmen. Biologen bezeichnen diesen Vorgang als Sequenzierung.

  16. Blowing DNA bubbles.

    PubMed

    Severin, N; Zhuang, W; Ecker, C; Kalachev, A A; Sokolov, I M; Rabe, J P

    2006-11-01

    We report here experimental observations which indicate that topologically or covalently formed polymer loops embedded in an ultrathin liquid film on a solid substrate can be "blown" into circular "bubbles" during scanning force microscopy (SFM) imaging. In particular, supercoiled vector DNA has been unraveled, moved, stretched, and overstretched to two times its B-form length and then torn apart. We attribute the blowing of the DNA bubbles to the interaction of the tapping SFM tip with the ultrathin liquid film.

  17. Programming DNA tube circumferences.

    PubMed

    Yin, Peng; Hariadi, Rizal F; Sahu, Sudheer; Choi, Harry M T; Park, Sung Ha; Labean, Thomas H; Reif, John H

    2008-08-08

    Synthesizing molecular tubes with monodisperse, programmable circumferences is an important goal shared by nanotechnology, materials science, and supermolecular chemistry. We program molecular tube circumferences by specifying the complementarity relationships between modular domains in a 42-base single-stranded DNA motif. Single-step annealing results in the self-assembly of long tubes displaying monodisperse circumferences of 4, 5, 6, 7, 8, 10, or 20 DNA helices.

  18. Polycomb proteins remain bound to chromatin and DNA during DNA replication in vitro

    PubMed Central

    Francis, Nicole J.; Follmer, Nicole E.; Simon, Matthew D.; Aghia, George; Butler, Jeffrey D.

    2009-01-01

    Summary The transcriptional status of a gene can be maintained through multiple rounds of cell division during development. This epigenetic effect is believed to reflect heritable changes in chromatin folding and histone modifications or variants at target genes, but little is known about how these chromatin features are inherited through cell division. A particular challenge for maintaining transcription states is DNA replication, which disrupts or dilutes chromatin associated proteins and histone modifications. PRC1-class Polycomb Group protein complexes are essential for development, and are thought to heritably silence transcription by altering chromatin folding and histone modifications. It is not known whether these complexes and their effects are maintained during DNA replication or subsequently re-established. We find that when PRC1-class Polycomb complex-bound chromatin or DNA is replicated in vitro, Polycomb complexes remain bound to replicated templates. Retention of Polycomb proteins through DNA replication may contribute to maintenance of transcriptional silencing through cell division. PMID:19303136

  19. Physical interactions between DNA and sepiolite nanofibers, and potential application for DNA transfer into mammalian cells.

    PubMed

    Castro-Smirnov, Fidel Antonio; Piétrement, Olivier; Aranda, Pilar; Bertrand, Jean-Rémi; Ayache, Jeanne; Le Cam, Eric; Ruiz-Hitzky, Eduardo; Lopez, Bernard S

    2016-11-03

    Nanofibers of sepiolite, a natural silicate belonging to the clay minerals family, might constitute a potential promising nanocarrier for the non-viral transfer of bio-molecules. We show here that sepiolite nanofibers efficiently bind different types of DNA molecules through electrostatic interactions, hydrogen bonding, cation bridges, and van der Waals forces. Moreover, Fourier-transform infrared spectroscopy identified the external silanol groups as the main sites of interaction with the DNA. Furthermore, as a proof of concept, we show that sepiolite is able to stably transfer plasmid DNA into mammalian cells and that the efficiency can be optimized. Indeed, sonication of sepiolite 100-fold stimulated DNA transfection efficiency. These results open the way to the use of sepiolite-based biohybrids as a novel class of nanoplatform for gene transfer with potential clinical applications.

  20. Stability and proton transfer in DNA base pairs of AMD473-DNA adduct

    NASA Astrophysics Data System (ADS)

    Sarmah, Pubalee; Deka, Ramesh C.

    2011-05-01

    We investigate the energetics of four different adducts of cisplatin analogue cis-[PtCl 2(NH 3)(2-picoline)] (AMD473) with a duplex DNA using DFT/ONIOM methods to probe their stabilities. Further, we study the possibilities of proton transfer between DNA base pairs of the most stable drug-DNA adduct. The adduct b(2-picoline trans to 3'-G and 2-methyl group directs to the DNA major groove) is found to be the most stable configuration among all the possible adducts. From the proton transfer analysis we found that the single proton transfer between N1 position of guanine (G) and N3 position of cytosine (C) of each GC pair gives a structure energetically as stable as the original one.

  1. Physical interactions between DNA and sepiolite nanofibers, and potential application for DNA transfer into mammalian cells

    NASA Astrophysics Data System (ADS)

    Castro-Smirnov, Fidel Antonio; Piétrement, Olivier; Aranda, Pilar; Bertrand, Jean-Rémi; Ayache, Jeanne; Le Cam, Eric; Ruiz-Hitzky, Eduardo; Lopez, Bernard S.

    2016-11-01

    Nanofibers of sepiolite, a natural silicate belonging to the clay minerals family, might constitute a potential promising nanocarrier for the non-viral transfer of bio-molecules. We show here that sepiolite nanofibers efficiently bind different types of DNA molecules through electrostatic interactions, hydrogen bonding, cation bridges, and van der Waals forces. Moreover, Fourier-transform infrared spectroscopy identified the external silanol groups as the main sites of interaction with the DNA. Furthermore, as a proof of concept, we show that sepiolite is able to stably transfer plasmid DNA into mammalian cells and that the efficiency can be optimized. Indeed, sonication of sepiolite 100-fold stimulated DNA transfection efficiency. These results open the way to the use of sepiolite-based biohybrids as a novel class of nanoplatform for gene transfer with potential clinical applications.

  2. Physical interactions between DNA and sepiolite nanofibers, and potential application for DNA transfer into mammalian cells

    PubMed Central

    Castro-Smirnov, Fidel Antonio; Piétrement, Olivier; Aranda, Pilar; Bertrand, Jean-Rémi; Ayache, Jeanne; Le Cam, Eric; Ruiz-Hitzky, Eduardo; Lopez, Bernard S.

    2016-01-01

    Nanofibers of sepiolite, a natural silicate belonging to the clay minerals family, might constitute a potential promising nanocarrier for the non-viral transfer of bio-molecules. We show here that sepiolite nanofibers efficiently bind different types of DNA molecules through electrostatic interactions, hydrogen bonding, cation bridges, and van der Waals forces. Moreover, Fourier-transform infrared spectroscopy identified the external silanol groups as the main sites of interaction with the DNA. Furthermore, as a proof of concept, we show that sepiolite is able to stably transfer plasmid DNA into mammalian cells and that the efficiency can be optimized. Indeed, sonication of sepiolite 100-fold stimulated DNA transfection efficiency. These results open the way to the use of sepiolite-based biohybrids as a novel class of nanoplatform for gene transfer with potential clinical applications. PMID:27808269

  3. Characteristics of CDC group 1 and group 1-like coryneform bacteria isolated from clinical specimens.

    PubMed Central

    Funke, G; Lucchini, G M; Pfyffer, G E; Marchiani, M; von Graevenitz, A

    1993-01-01

    Fifteen strains of CDC group 1 coryneform and biochemically similar bacteria were isolated from clinical specimens. Of the 15 strains isolated, 11 were derived from abscesses and purulent lesions, mostly from the upper part of the body, and 3 were grown from blood cultures. Nine strains were associated with mixed anaerobic but no other aerobic flora. Seven strains exhibited the classical biochemical profile of CDC coryneform group 1; however, eight strains were unable to reduce nitrate and were called "group 1-like." Other reactions to differentiate CDC group 1 and group 1-like coryneform rods include alpha-hemolysis on human blood agar, fermentation of adonitol, and the presence of alkaline phosphatase. Fifteen strains showed marked CAMP reactions on different erythrocyte agars. Gas-liquid chromatography of volatile and nonvolatile fatty acids as well as cellular fatty acid patterns and the composition of cell wall components suggest that CDC group 1 and group 1-like coryneform bacteria do not belong to the genus Corynebacterium but possibly to the genus Actinomyces or Arcanobacterium. DNA-DNA hybridization studies revealed that group 1 and group 1-like strains represent different species. Images PMID:8263175

  4. Free Radical-Induced Chain Breakage in Irradiated Aqueous Solutions of DNA

    DTIC Science & Technology

    1974-03-01

    FIGURES Figure 1. Formation of ionic phosphate in irradiated solutions of calf thymus DNA after treatment with acid phospho- monoesterase...6 Figure 2. Formation of ionic phosphate In irradiated solutions of calf thymus DNA without enzyme treatment 7 LIST OF TABLES Table...time. Labile phosphate groups produced in irradiated DNA were assayed as inorganic phosphate ( phosphate ion) following incubation of samples with acid

  5. 76 FR 62816 - Office of Biotechnology Activities; Recombinant DNA Research: Action Under the NIH Guidelines for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-11

    ... HUMAN SERVICES National Institutes of Health Office of Biotechnology Activities; Recombinant DNA Research: Action Under the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines... recombinant DNA research. OBA is also specifying the risk group for several viruses not previously listed...

  6. DNA as a Binary Code: How the Physical Structure of Nucleotide Bases Carries Information

    ERIC Educational Resources Information Center

    McCallister, Gary

    2005-01-01

    The DNA triplet code also functions as a binary code. Because double-ring compounds cannot bind to double-ring compounds in the DNA code, the sequence of bases classified simply as purines or pyrimidines can encode for smaller groups of possible amino acids. This is an intuitive approach to teaching the DNA code. (Contains 6 figures.)

  7. DNA from soil mirrors plant taxonomic and growth form diversity.

    PubMed

    Yoccoz, N G; Bråthen, K A; Gielly, L; Haile, J; Edwards, M E; Goslar, T; Von Stedingk, H; Brysting, A K; Coissac, E; Pompanon, F; Sønstebø, J H; Miquel, C; Valentini, A; De Bello, F; Chave, J; Thuiller, W; Wincker, P; Cruaud, C; Gavory, F; Rasmussen, M; Gilbert, M T P; Orlando, L; Brochmann, C; Willerslev, E; Taberlet, P

    2012-08-01

    Ecosystems across the globe are threatened by climate change and human activities. New rapid survey approaches for monitoring biodiversity would greatly advance assessment and understanding of these threats. Taking advantage of next-generation DNA sequencing, we tested an approach we call metabarcoding: high-throughput and simultaneous taxa identification based on a very short (usually <100 base pairs) but informative DNA fragment. Short DNA fragments allow the use of degraded DNA from environmental samples. All analyses included amplification using plant-specific versatile primers, sequencing and estimation of taxonomic diversity. We tested in three steps whether degraded DNA from dead material in soil has the potential of efficiently assessing biodiversity in different biomes. First, soil DNA from eight boreal plant communities located in two different vegetation types (meadow and heath) was amplified. Plant diversity detected from boreal soil was highly consistent with plant taxonomic and growth form diversity estimated from conventional above-ground surveys. Second, we assessed DNA persistence using samples from formerly cultivated soils in temperate environments. We found that the number of crop DNA sequences retrieved strongly varied with years since last cultivation, and crop sequences were absent from nearby, uncultivated plots. Third, we assessed the universal applicability of DNA metabarcoding using soil samples from tropical environments: a large proportion of species and families from the study site were efficiently recovered. The results open unprecedented opportunities for large-scale DNA-based biodiversity studies across a range of taxonomic groups using standardized metabarcoding approaches.

  8. Influence of killing method on Lepidoptera DNA barcode recovery.

    PubMed

    Willows-Munro, Sandi; Schoeman, M Corrie

    2015-05-01

    The global DNA barcoding initiative has revolutionized the field of biodiversity research. Such large-scale sequencing projects require the collection of large numbers of specimens, which need to be killed and preserved in a way that is both DNA-friendly and which will keep voucher specimens in good condition for later study. Factors such as time since collection, correct storage (exposure to free water and heat) and DNA extraction protocol are known to play a role in the success of downstream molecular applications. Limited data are available on the most efficient, DNA-friendly protocol for killing. In this study, we evaluate the quality of DNA barcode (cytochrome oxidase I) sequences amplified from DNA extracted from specimens collected using three different killing methods (ethyl acetate, cyanide and freezing). Previous studies have suggested that chemicals, such as ethyl acetate and formaldehyde, degraded DNA and as such may not be appropriate for the collection of insects for DNA-based research. All Lepidoptera collected produced DNA barcodes of good quality, and our study found no clear difference in nucleotide signal strength, probability of incorrect base calling and phylogenetic utility among the three different treatment groups. Our findings suggest that ethyl acetate, cyanide and freezing can all be used to collect specimens for DNA analysis.

  9. Group Psychotherapy in Iceland.

    PubMed

    Ívarsson, Ómar

    2015-10-01

    In this overview of group psychotherapy in Iceland, an attempt will be made to describe how it is practiced today, give some glimpses into its earlier history, and clarify seven issues: (1) the standing of group psychotherapy in Iceland, its previous history, and the theoretical orientation of dynamic group therapy in the country; (2) the role of group therapy in the health care system; (3) how training in group therapy is organized; (4) the relationship between group psychotherapy research and clinical practice; (5) which issues/processes can be identified as unique to therapy groups in Iceland; and (6) how important are group-related issues within the social background of the country; and (7) what group work holds for the future.

  10. Variations in brain DNA

    PubMed Central

    Avila, Jesús; Gómez-Ramos, Alberto; Soriano, Eduardo

    2014-01-01

    It is assumed that DNA sequences are conserved in the diverse cell types present in a multicellular organism like the human being. Thus, in order to compare the sequences in the genome of DNA from different individuals, nucleic acid is commonly isolated from a single tissue. In this regard, blood cells are widely used for this purpose because of their availability. Thus blood DNA has been used to study genetic familiar diseases that affect other tissues and organs, such as the liver, heart, and brain. While this approach is valid for the identification of familial diseases in which mutations are present in parental germinal cells and, therefore, in all the cells of a given organism, it is not suitable to identify sporadic diseases in which mutations might occur in specific somatic cells. This review addresses somatic DNA variations in different tissues or cells (mainly in the brain) of single individuals and discusses whether the dogma of DNA invariance between cell types is indeed correct. We will also discuss how single nucleotide somatic variations arise, focusing on the presence of specific DNA mutations in the brain. PMID:25505410

  11. Transcription of mitochondrial DNA.

    PubMed

    Tabak, H F; Grivell, L A; Borst, P

    1983-01-01

    While mitochondrial DNA (mtDNA) is the simplest DNA in nature, coding for rRNAs and tRNAs, results of DNA sequence, and transcript analysis have demonstrated that both the synthesis and processing of mitochondrial RNAs involve remarkably intricate events. At one extreme, genes in animal mtDNAs are tightly packed, both DNA strands are completely transcribed (symmetric transcription), and the appearance of specific mRNAs is entirely dependent on processing at sites signalled by the sequences of the tRNAs, which abut virtually every gene. At the other extreme, gene organization in yeast (Saccharomyces) is anything but compact, with long stretches of AT-rich DNA interspaced between coding sequences and no obvious logic to the order of genes. Transcription is asymmetric and several RNAs are initiated de novo. Nevertheless, extensive RNA processing occurs due largely to the presence of split genes. RNA splicing is complex, is controlled by both mitochondrial and nuclear genes, and in some cases is accompanied by the formation of RNAs that behave as covalently closed circles. The present article reviews current knowledge of mitochondrial transcription and RNA processing in relation to possible mechanisms for the regulation of mitochondrial gene expression.

  12. DNA methylation and differentiation.

    PubMed Central

    Michalowsky, L A; Jones, P A

    1989-01-01

    The methylation of specific cytosine residues in DNA has been implicated in regulating gene expression and facilitating functional specialization of cellular phenotypes. Generally, the demethylation of certain CpG sites correlates with transcriptional activation of genes. 5-Azacytidine is an inhibitor of DNA methylation and has been widely used as a potent activator of suppressed genetic information. Treatment of cells with 5-azacytidine results in profound phenotypic alterations. The drug-induced hypomethylation of DNA apparently perturbs DNA-protein interactions that may consequently alter transcriptional activity and cell determination. The inhibitory effect of cytosine methylation may be exerted via altered DNA-protein interactions specifically or may be transduced by a change in the conformation of chromatin. Recent studies have demonstrated that cytosine methylation also plays a central role in parental imprinting, which in turn determines the differential expression of maternal and paternal genomes during embryogenesis. In other words, methylation is the mechanism whereby the embryo retains memory of the gametic origin of each component of genetic information. A memory of this type would probably persist during DNA replication and cell division as methylation patterns are stable and heritable. PMID:2466640

  13. DNA biosensors that reason.

    PubMed

    Sainz de Murieta, Iñaki; Rodríguez-Patón, Alfonso

    2012-08-01

    Despite the many designs of devices operating with the DNA strand displacement, surprisingly none is explicitly devoted to the implementation of logical deductions. The present article introduces a new model of biosensor device that uses nucleic acid strands to encode simple rules such as "IF DNA_strand(1) is present THEN disease(A)" or "IF DNA_strand(1) AND DNA_strand(2) are present THEN disease(B)". Taking advantage of the strand displacement operation, our model makes these simple rules interact with input signals (either DNA or any type of RNA) to generate an output signal (in the form of nucleotide strands). This output signal represents a diagnosis, which either can be measured using FRET techniques, cascaded as the input of another logical deduction with different rules, or even be a drug that is administered in response to a set of symptoms. The encoding introduces an implicit error cancellation mechanism, which increases the system scalability enabling longer inference cascades with a bounded and controllable signal-noise relation. It also allows the same rule to be used in forward inference or backward inference, providing the option of validly outputting negated propositions (e.g. "diagnosis A excluded"). The models presented in this paper can be used to implement smart logical DNA devices that perform genetic diagnosis in vitro.

  14. Peripheral blood mitochondrial DNA/nuclear DNA (mtDNA/nDNA) ratio as a marker of mitochondrial toxicities of stavudine containing antiretroviral therapy in HIV-infected Malawian patients.

    PubMed

    Kampira, Elizabeth; Dzobo, Kevin; Kumwenda, Johnstone; van Oosterhout, Joep J; Parker, M Iqbal; Dandara, Collet

    2014-07-01

    Mitochondrial toxicity is a major concern related to nucleoside reverse transcriptase inhibitors. Common manifestations are peripheral neuropathy and lipodystrophy. Depletion of mitochondria has been associated with mitochondrial dysfunction. We investigated whether mitochondria DNA (mtDNA) levels in peripheral blood can be used as biomarker of stavudine-associated mitochondrial toxicities. We enrolled 203 HIV-infected Malawian adult patients on stavudine-containing ART and 64 healthy controls of Bantu origin in a cross-sectional study. Total DNA was extracted from whole blood.The glyceraldehyde-3-phosphate dehydrogenase gene was used to estimate nuclear DNA (nDNA) levels and the ATP synthase-8 mitochondrial DNA gene to estimate mtDNA levels, from which mtDNA/nDNA ratios were determined. MtDNA subhaplogroups were established by sequencing. Among patients, peripheral neuropathy was present in 21% (43/203), lipodystrophy in 18% (20/112), elevated lactate level (>2.5 mmol/L) in 17% (19/113). Healthy controls had a higher median mtDNA/nDNA ratio when compared to HIV/AIDS patients (6.64 vs. 5.08; p=0.05), patients presenting with peripheral neuropathy (6.64 vs. 3.40, p=0.039), and patients with high lactate levels (6.64 vs. 0.68, p=0.024), respectively. Significant differences in median mtDNA/nDNA ratios were observed between patients with high and normal lactate levels (5.88 vs. 0.68, p=0.018). The median mtDNA/nDNA ratio of patients in subhaplogroup L0a2 was much lower (0.62 vs. 8.50, p=0.01) than that of those in subhaplogroup L2a. Our data indicate that peripheral blood mtDNA/nDNA ratio is a marker of mitochondrial toxicities of stavudine and is associated with elevated lactate levels and mtDNA subhaplogroups. This could open the prospect to select a substantial group of patients who will not have problematic side effects from stavudine, an affordable and effective antiretroviral drug that is being phased out in Africa due to its toxicity.

  15. Water modulates the ultraslow dynamics of hydrated ionic liquids near CG rich DNA: consequences for DNA stability.

    PubMed

    Saha, Debasis; Kulkarni, Mandar; Mukherjee, Arnab

    2016-11-30

    Ionic liquids are known to stabilize DNA for much longer than water can. While the source of this stability has commonly been attributed to thermodynamic aspects, we probe the dynamical aspects of the ionic liquids near DNA to further our understanding of this stability. Using molecular dynamics simulation, we calculated the mean residence time (MRT) of the cations of five different ionic liquids (ILs) in the grooves and around phosphate groups of AT and CG rich DNA segments. We find the residence time of different cations next to CG rich DNA to be much higher compared to that next to AT rich DNA, with a negligible difference with the variation of anions. The interaction energy between cations and DNA, however, shows exactly the opposite trend; it is much lower (indicating a stronger interaction) for AT than for CG. Investigation of DNA parameters reveals an insignificant difference for the DNA sequences under consideration. Analysis of water behavior provides a rationale for the long MRTs of cations; water molecules have been found to be denser and to possess higher MRT when next to CG-rich DNA, thus resulting in a crowded environment. Our results indicate that the dynamics influence the binding of ILs to different DNA sequences, possibly by modulating the entropy of the binding process.

  16. Exonuclease processivity of archaeal replicative DNA polymerase in association with PCNA is expedited by mismatches in DNA

    PubMed Central

    Yoda, Takuya; Tanabe, Maiko; Tsuji, Toshiyuki; Yoda, Takao; Ishino, Sonoko; Shirai, Tsuyoshi; Ishino, Yoshizumi; Takeyama, Haruko; Nishida, Hirokazu

    2017-01-01

    Family B DNA polymerases comprise polymerase and 3′ −>5′ exonuclease domains, and detect a mismatch in a newly synthesized strand to remove it in cooperation with Proliferating cell nuclear antigen (PCNA), which encircles the DNA to provide a molecular platform for efficient protein–protein and protein–DNA interactions during DNA replication and repair. Once the repair is completed, the enzyme must stop the exonucleolytic process and switch to the polymerase mode. However, the cue to stop the degradation is unclear. We constructed several PCNA mutants and found that the exonuclease reaction was enhanced in the mutants lacking the conserved basic patch, located on the inside surface of PCNA. These mutants may mimic the Pol/PCNA complex processing the mismatched DNA, in which PCNA cannot interact rigidly with the irregularly distributed phosphate groups outside the dsDNA. Indeed, the exonuclease reaction with the wild type PCNA was facilitated by mismatched DNA substrates. PCNA may suppress the exonuclease reaction after the removal of the mismatched nucleotide. PCNA seems to act as a “brake” that stops the exonuclease mode of the DNA polymerase after the removal of a mismatched nucleotide from the substrate DNA, for the prompt switch to the DNA polymerase mode. PMID:28300173

  17. The GROOP Effect: Groups Mimic Group Actions

    ERIC Educational Resources Information Center

    Tsai, Jessica Chia-Chin; Sebanz, Natalie; Knoblich, Gunther

    2011-01-01

    Research on perception-action links has focused on an interpersonal level, demonstrating effects of observing individual actions on performance. The present study investigated perception-action matching at an inter-group level. Pairs of participants responded to hand movements that were performed by two individuals who used one hand each or they…

  18. Novel DNA nanoparticles and networks.

    PubMed

    Seela, Frank; Jawalekar, Anup M; Sirivolu, Venkata R; Rosemeyer, Helmut; He, Yang; Leonard, Peter

    2005-01-01

    Joining the thrombin-binding aptamer 5-d(GGTTGGTGTGGTTGG) and the minihairpin 5-d(GCGAAGC) leads to new DNA nanoparticles, which are different from rod-like helical double-stranded DNA. Covalent interstrand cross-links in DNA duplexes generated by bifunctional alkadiyne chains were used to build-up the DNA networks.

  19. DNA as an Optical Material

    DTIC Science & Technology

    2011-07-01

    of DNA, and a natural DNA source is more appropriate. Currently available sources of natural DNA include fish sperm (e.g., from salmon or herring...harvesting of the fish’s waste milt and roe sacs. (Unlike meat and eggs , these elements are not used for cuisine.) From these, DNA is extracted and

  20. Nonlinear Model of the Specificity of DNA-Protein Interactions and Its Stability

    NASA Astrophysics Data System (ADS)

    Dwiputra, D.; Hidayat, W.; Khairani, R.; Zen, F. P.

    2016-08-01

    Specific DNA-protein interactions are fundamental processes of living cells. We propose a new model of DNA-protein interactions to explain the site specificity of the interactions. The hydrogen bonds between DNA base pairs and between DNA-protein peptide groups play a significant role in determination of the specific binding site. We adopt the Morse potential with coupling terms to construct the Hamiltonian of coupled oscillators representing the hydrogen bonds in which the depth of the potentials vary in the DNA chain. In this paper we investigate the stability of the model to determine the conditions satisfying the biological circumstances of the DNA-protein interactions.

  1. DNA polymerase gamma and mitochondrial disease: understanding the consequence of POLG mutations.

    PubMed

    Chan, Sherine S L; Copeland, William C

    2009-05-01

    DNA polymerase gamma is the only known DNA polymerase in human mitochondria and is essential for mitochondrial DNA replication and repair. It is well established that defects in mtDNA replication lead to mitochondrial dysfunction and disease. Over 160 coding variations in the gene encoding the catalytic subunit of DNA polymerase gamma (POLG) have been identified. Our group and others have characterized a number of the more common and interesting mutations, as well as those disease mutations in the DNA polymerase gamma accessory subunit. We review the results of these studies, which provide clues to the mechanisms leading to the disease state.

  2. Elastic Correlations in Nucleosomal DNA Structure

    NASA Astrophysics Data System (ADS)

    Mohammad-Rafiee, Farshid; Golestanian, Ramin

    2005-06-01

    The structure of DNA in the nucleosome core particle is studied using an elastic model that incorporates anisotropy in the bending energetics and twist-bend coupling. Using the experimentally determined structure of nucleosomal DNA [T. J. Richmond and C. A. Davey, Nature (London), NATUAS, 0028-0836 423, 145 (2003), 10.1038/nature01595], it is shown that elastic correlations exist between twist, roll, tilt, and stretching of DNA, as well as the distance between phosphate groups. The twist-bend coupling term is shown to be able to capture these correlations to a large extent, and a fit to the experimental data yields a new estimate of G=25 nm for the value of the twist-bend coupling constant.

  3. DNA barcodes for ecology, evolution, and conservation.

    PubMed

    Kress, W John; García-Robledo, Carlos; Uriarte, Maria; Erickson, David L

    2015-01-01

    The use of DNA barcodes, which are short gene sequences taken from a standardized portion of the genome and used to identify species, is entering a new phase of application as more and more investigations employ these genetic markers to address questions relating to the ecology and evolution of natural systems. The suite of DNA barcode markers now applied to specific taxonomic groups of organisms are proving invaluable for understanding species boundaries, community ecology, functional trait evolution, trophic interactions, and the conservation of biodiversity. The application of next-generation sequencing (NGS) technology will greatly expand the versatility of DNA barcodes across the Tree of Life, habitats, and geographies as new methodologies are explored and developed.

  4. DNA repair genes in the Megavirales pangenome.

    PubMed

    Blanc-Mathieu, Romain; Ogata, Hiroyuki

    2016-06-01

    The order 'Megavirales' represents a group of eukaryotic viruses with a large genome encoding a few hundred up to two thousand five hundred genes. Several members of Megavirales possess genes involved in major DNA repair pathways. Some of these genes were likely inherited from an ancient virus world and some others were derived from the genomes of their hosts. Here we examine molecular phylogenies of key DNA repair enzymes in light of recent hypotheses on the origin of Megavirales, and propose that the last common ancestors of the individual families of the order Megavirales already possessed DNA repair functions to achieve and maintain a moderately large genome and that this repair capacity gradually increased, in a family-dependent manner, during their recent evolution.

  5. Working with Groups.

    ERIC Educational Resources Information Center

    Morris, Joan, Ed.

    1984-01-01

    Describes nine Canadian programs for counseling groups of students. Topics include introducing computer-assisted guidance, future challenges for counselors, sociometry, sexuality, parent counseling, reluctant students, shyness, peer groups, education for living, and guidance advisory committees. (JAC)

  6. What Makes Groups Tick.

    ERIC Educational Resources Information Center

    Allcorn, Seth

    1985-01-01

    By reviewing this analysis of the behavior of both groups and individuals in groups, human resources managers can learn to tell whether committees, task forces, and departments may be encouraging or inhibiting the work they set out to do. (Author)

  7. Group B streptococcus - pregnancy

    MedlinePlus

    ... medlineplus.gov/ency/patientinstructions/000511.htm Group B streptococcus - pregnancy To use the sharing features on this page, please enable JavaScript. Group B streptococcus (GBS) is a type of bacteria that some ...

  8. The group selection controversy.

    PubMed

    Leigh, E G

    2010-01-01

    Many thought Darwinian natural selection could not explain altruism. This error led Wynne-Edwards to explain sustainable exploitation in animals by selection against overexploiting groups. Williams riposted that selection among groups rarely overrides within-group selection. Hamilton showed that altruism can evolve through kin selection. How strongly does group selection influence evolution? Following Price, Hamilton showed how levels of selection interact: group selection prevails if Hamilton's rule applies. Several showed that group selection drove some major evolutionary transitions. Following Hamilton's lead, Queller extended Hamilton's rule, replacing genealogical relatedness by the regression on an actor's genotypic altruism of interacting neighbours' phenotypic altruism. Price's theorem shows the generality of Hamilton's rule. All instances of group selection can be viewed as increasing inclusive fitness of autosomal genomes. Nonetheless, to grasp fully how cooperation and altruism evolve, most biologists need more concrete concepts like kin selection, group selection and selection among individuals for their common good.

  9. Gestalt Interactional Groups

    ERIC Educational Resources Information Center

    Harman, Robert L.; Franklin, Richard W.

    1975-01-01

    Gestalt therapy in groups is not limited to individual work in the presence of an audience. Describes several ways to involve gestalt groups interactionally. Interactions described focus on learning by doing and discovering, and are noninterpretive. (Author/EJT)

  10. Raman spectroscopy of topotecan, an inhibitor of DNA topoisomerase I

    NASA Astrophysics Data System (ADS)

    Mochalov, K. E.; Ustinova, O. A.; Strel'Tsov, S. A.; Grokhovskii, S. L.; Zhuze, A. L.; Nabiev, I. R.; Sukhanova, A. V.; Oleinikov, V. A.

    2002-10-01

    Topotecan (TPT), a water-soluble derivative of camptothecin (inhibitor of human DNA topoiomerase I), has found wide application in cancer chemotherapy. The central problem in using topotecan is the presence of lactone rings in its molecules, which undergo hydrolysis at a physiological pH yielding an inactive and even toxic form of the drug. The analysis of Raman spectra of TPT in H2O and D2O solutions made it possible to assign the spectral bands to the vibrations of particular molecular groups. Spectral features indicative of the opening of the lactone rings of the TPT molecules, deprotonation of the hydroxyl groups in their quinoline fragments, and of possible participation of the hydroxyl and carbonyl groups in H bonding are found. The data obtained are necessary to study the molecular mechanisms of TPT-DNA interaction and the formation of ternary complexes between TPT, DNA, and DNA topoisomerase I.

  11. Independent versus Cooperative Binding in Polyethylenimine–DNA and Poly(L-lysine)–DNA Polyplexes

    PubMed Central

    Ketola, Tiia-Maaria; Hanzlíková, Martina; Leppänen, Linda; Raviña, Manuela; Bishop, Corey J.; Green, Jordan J.; Urtti, Arto; Lemmetyinen, Helge; Yliperttula, Marjo; Vuorimaa-Laukkanen, Elina

    2013-01-01

    The mechanism of polyethylenimine–DNA and poly(L-lysine)–DNA complex formation at pH 5.2 and 7.4 was studied by a time-resolved spectroscopic method. The formation of a polyplex core was observed to be complete at approximately N/P = 2, at which point nearly all DNA phosphate groups were bound by polymer amine groups. The data were analyzed further both by an independent binding model and by a cooperative model for multivalent ligand binding to multisubunit substrate. At pH 5.2, the polyplex formation was cooperative at all N/P ratios, whereas for pH 7.4 at N/P < 0.6 the polyplex formation followed independent binding changing to cooperative binding at higher N/Ps. PMID:23941196

  12. Nail DNA and Possible Biomarkers: A Pilot Study

    PubMed Central

    Park, Joshua; Liang, Debbie; Kim, Jung Woo; Luo, Yongjun; Huang, Taesheng; Kim, Soo-Young

    2012-01-01

    Objectives Nail has been a substitute DNA source for genotyping. To investigate the integrity and consistency of nail DNA amplification for biomarker study, nail clippings from 12 subjects were collected at monthly intervals. The possibility of longer amplification and existence of GAPDH RNA/protein, were also investigated with three nail samples. Methods Three primer sets were designed for quantitative amplification of nuclear and mitochondrial genes and analysis of their consistency. The mean threshold cycles in amplification of the target genes were compared to test the consistency of polymerase chain reaction (PCR) performance among individual factors including age groups, sex, family, the nail source, and by the size of the amplification segments. Results The amplification of the target genes from nail DNA showed similar integrity and consistency between the nail sources, and among the serial collections. However, nail DNA from those in their forties showed earlier threshold cycles in amplification than those in their teens or seventies. Mitochondrial DNA (mtDNA) showed better DNA integrity and consistency in amplification of all three targets than did nuclear DNA (nucDNA). Over 9 kb of mtDNA was successfully amplified, and nested quantitative PCR showed reliable copy numbers (%) between the two loci. Reverse transcription PCR for mRNA and immunoblotting for GAPDH protein successfully reflected their corresponding amounts. Regarding the existence of RNA and protein in nails, more effective extraction and detection methods need to be set up to validate the feasibility in biomarker study. Conclusions Nail DNA might be a feasible intra-individual monitoring biomarker. Considering integrity and consistency in target amplification, mtDNA would be a better target for biomarker research than nucDNA. PMID:22880155

  13. Damage-specific DNA-binding proteins from human cells

    SciTech Connect

    Kanjilal, S.

    1992-01-01

    The primary objective of the study was to detect and characterize factors from human cells that bind DNA damaged by ultraviolet radiation. An application of the gel-shift assay was devised in which a DNA probe was UV-irradiated and compared with non-irradiated probe DNA for the ability to bind to such factors in cell extracts. UV-dose dependent binding proteins were identified. Formation of the DNA-protein complexes was independent of the specific sequence, form or source of the DNA. There was a marked preference for lesions on double stranded DNA over those on single stranded DNA. DNA irradiated with gamma rays did not compete with UV-irradiated DNA for the binding activities. Cell lines from patients with genetic diseases associated with disorders of the DNA repair system were screened for the presence of damaged-DNA-binding activities. Simultaneous occurrence of the clinical symptoms of some of these diseases had been previously documented and possible links between the syndromes proposed. However, supporting biochemical or molecular evidence for such associations were lacking. The data from the present investigations indicate that some cases of Xeroderma Pigmentosum group A, Cockayne's Syndrome, Bloom's Syndrome and Ataxia Telangiectasia, all of which exhibit sensitivity to UV or gamma radiation, share an aberrant damaged-DNA-binding factor. These findings support the hypothesis that some of the repair disorder diseases are closely related and may have arisen from a common defect. Partial purification of the binding activities from HeLa cells was achieved. Size-exclusion chromatography resolved the activities into various peaks, one of which was less damage-specific than the others as determined by competition studies using native or UV-irradiated DNA. Some of the activities were further separated by ion-exchange chromatography. On using affinity chromatography methods, the major damage-binding factor could be eluted in the presence of 2 M KCl and 1% NP-40.

  14. Stabilization of DNA Structures with Poly(ethylene sodium phosphate).

    PubMed

    Moriyama, Rui; Iwasaki, Yasuhiko; Miyoshi, Daisuke

    2015-09-10

    The structure and stability of biomolecules under molecular crowding conditions are of interest because such information clarifies how biomolecules behave under cell-mimicking conditions. The anionic surfaces of chromatin, which is composed of DNA strands and histone complexes, are concentrated in cell nuclei and thus generate a polyanionic crowding environment. In this study, we designed and synthesized an anionic polymer, poly(ethylene sodium phosphate) (PEP·Na), which has a nucleic acid phosphate backbone and created a cell nucleus-like environment. The effects of molecular crowding with PEP·Na on the thermodynamics of DNA duplexes, triplexes, and G-quadruplexes were systematically studied. Thermodynamic analysis demonstrated that PEP·Na significantly stabilized the DNA structures; e.g., a free energy change at 25 °C for duplex formation decreased from -6.6 to -12.8 kcal/mol with 20 wt % PEP·Na. Thermodynamic parameters further indicated that the factors for the stabilization of the DNA structures were dependent on sodium ion concentration. At lower polymer concentrations, the stabilization was attributed to a shielding of the electrostatic repulsion between DNA strands by the sodium ions of PEP·Na. In contrast, at higher polymer concentrations, the DNA structures were entropically stabilized by volume exclusion, which could be enhanced by electrostatic repulsion between phosphate groups in DNA strands and in PEP·Na. Additionally, increasing PEP·Na concentration resulted in increasing enthalpy of the DNA duplex but decreasing enthalpy of DNA G-quadruplex, indicating that the polymers also promoted dehydration of the DNA strands. Thus, polyanionic crowding affects the thermodynamics of DNA structures via the sodium ions, volume exclusion, and hydration. The stabilization of DNA by the cell nucleus-like polyanionic crowding provides new information regarding DNA structures and allows for modeling reactions in cell nuclei.

  15. From DNA to transistors

    NASA Astrophysics Data System (ADS)

    Braun, Erez; Keren, Kinneret

    2004-06-01

    The rapid advance in molecular biology and nanotechnology opens up the possibility to explore the interface between biology and electronics at the single-molecule level. We focus on the organization of molecular electronic circuits. Interconnecting an immense number of molecular devices into a functional circuit and constructing a framework for integrated molecular electronics requires new concepts. A promising avenue relies on bottom-up assembly where the information for the circuit connectivity and functionality is embedded in the molecular building blocks. Biology can provide concepts and mechanisms for advancing this approach, but there is no straightforward way to apply them to electronics since biological molecules are essentially electrically insulating. Bridging the chasm between biology and electronics therefore presents great challenges. Circuit organization on the molecular scale is considered and contrasted with the levels of organization presented by the living world. The discussion then focuses on our proposal to harness DNA and molecular biology to construct the scaffold for integrated molecular electronics. DNA metallization is used to convert the DNA scaffold into a conductive one. We present the framework of sequence-specific molecular lithography based on the biological mechanism of homologous genetic recombination and carried out by the bacterial protein RecA. Molecular lithography enables us to use the information encoded in the scaffold DNA molecules for directing the construction of an electronic circuit. We show that it can lead all the way from DNA molecules to working transistors in a test-tube. Carbon nanotubes are incorporated as the active electronic components in the DNA-templated transistors. Our approach can, in principle, be applied to the fabrication of larger-scale electronic circuits. The realization of complex DNA-based circuits will, however, require new concepts and additional biological machinery allowing, for example

  16. Practice and Group Learning

    ERIC Educational Resources Information Center

    Hager, Paul

    2014-01-01

    Although learning has always been a central topic for philosophy of education, little attention has been paid to the notion of group learning. This article outlines and discusses some plausible examples of group learning. Drawing on these examples, various principles and issues that surround the notion of group learning are identified and…

  17. Customizing Group Therapy.

    ERIC Educational Resources Information Center

    Chambliss, Catherine; Oxman, Elaine

    The group therapy context provides unparalleled opportunities for cost effective learning. However, within group meetings, therapists must strive to tailor psychological services to address the particular needs of individual patients. Creative means of customizing patients experiences within group are needed in order to address consumer needs…

  18. Internet Discussion Groups.

    ERIC Educational Resources Information Center

    Bull, Glen; Bull, Gina; Sigmon, Tim

    1997-01-01

    Discusses newsgroups, listservs, and Web-based discussion groups. Highlights include major categories of international USENET discussion groups; newsgroups versus mailing lists; newsreaders; news servers; newsgroup subscriptions; newsgroups versus Web discussion groups; linking newsgroups, mailing lists, and the Web; and setting up a news host. A…

  19. Parent Group Spotlight

    ERIC Educational Resources Information Center

    Parenting for High Potential, 2014

    2014-01-01

    This issue's "Parent Group Spotlight" features Deborah Simon, president of West Sound Gifted, Talented & Twice-Exceptional (WSGT2e), who started a parent group in Washington in 2013. In just one year, this small, but mighty group has held community forums, attended school board meetings, and helped influence local gifted programming.…

  20. Infant Group Care Risks.

    ERIC Educational Resources Information Center

    Kendall, Earline D.

    Children under 3 years of age who are in group care face special health risks. The U.S. Centers for Disease Control indicate the existence of a causal relationship between infant group day care and certain diseases that are spread through contact at day care centers. Children in group care who are still in diapers are especially vulnerable to…