Sample records for guanosine monophosphate pathway

  1. Inhibition of the nitric oxide/cyclic guanosine monophosphate pathway limited the cardioprotective effect of post-conditioning in hearts with apical myocardial infarction.


    Correa, Francisco; Buelna-Chontal, Mabel; Chagoya, Victoria; García-Rivas, Gerardo; Vigueras, Rosa María; Pedraza-Chaverri, José; García-Niño, Wylly Ramsés; Hernández-Pando, Rogelio; León-Contreras, Juan Carlos; Zazueta, Cecilia


    Reperfusion damage involves opening of the mitochondrial permeability transition pore (mPTP) and loss of ATP synthesis. Several cardioprotective pathways are activated by ischemic or pharmacological post-conditioning (PC). The mechanisms that are activated by PC in no co-morbidity murine models include: activation of rescue kinases, oxidative stress reduction, glycolytic flux regulation and preservation of ATP synthesis. However, relatively scarce efforts have been made to define whether the efficacy of PC signaling is blunted by risk factors or systemic diseases associated with ischemic heart pathology. Experimental evidence has shown that the nitric oxide (NO)/cyclic guanosine monophosphate (cGMP) signaling is a main mechanism activated by PC in hearts without pathological history. In this work we evaluated the participation of the NO pathway, through downstream kinase activation and inhibition of mPTP in hearts with previous infarct. Myocardial infarction was induced with a single dose of isoproterenol (85 mg/kg i.p.) to male Wistar rats. After 24 h, the hearts were mounted into the Langendorff system and subjected to 30 min of ischemia and 60 min of reperfusion. PC consisted of 5 cycles of 30 s of reperfusion/30 s of ischemia, then the hearts were reperfused with or without inhibitors of the NO/cGMP pathway. PC activates the NO/cGMP pathway, as increased cGMP and NO levels were detected in isoproterenol-treated hearts. The cardioprotective effect of PC was abolished with both L-NAME (inhibitor of constitutive NO synthase) and ODQ (inhibitor of soluble guanylate cyclase), whereas the NO donor (DETA-NO) restored cardioprotection even in the presence of L-NAME or ODQ. We also found that mitochondrial structure and function was preserved in PC hearts. We conclude that PC exerts cardioprotection in hearts with previous infarct by maintaining mitochondrial structure and function through NO-dependent pathway. PMID:26387613

  2. Elevated intracranial dopamine impairs the glutamate-nitric oxide-cyclic guanosine monophosphate pathway in cortical astrocytes in rats with minimal hepatic encephalopathy

    PubMed Central



    In a previous study by our group memory impairment in rats with minimal hepatic encephalopathy (MHE) was associated with the inhibition of the glutamate-nitric oxide-cyclic guanosine monophosphate (Glu-NO-cGMP) pathway due to elevated dopamine (DA). However, the effects of DA on the Glu-NO-cGMP pathway localized in primary cortical astrocytes (PCAs) had not been elucidated in rats with MHE. In the present study, it was identified that when the levels of DA in the cerebral cortex of rats with MHE and high-dose DA (3 mg/kg)-treated rats were increased, the co-localization of N-methyl-d-aspartate receptors subunit 1 (NMDAR1), calmodulin (CaM), nitric oxide synthase (nNOS), soluble guanylyl cyclase (sGC) and cyclic guanine monophosphate (cGMP) with the glial fibrillary acidic protein (GFAP), a marker protein of astrocytes, all significantly decreased, in both the MHE and high-dose DA-treated rats (P<0.01). Furthermore, NMDA-induced augmentation of the expression of NMDAR1, CaM, nNOS, sGC and cGMP localized in PCAs was decreased in MHE and DA-treated rats, as compared with the controls. Chronic exposure of cultured cerebral cortex PCAs to DA treatment induced a dose-dependent decrease in the concentration of intracellular calcium, nitrites and nitrates, the formation of cGMP and the expression of NMDAR1, CaM, nNOS and sGC/cGMP. High doses of DA (50 μM) significantly reduced NMDA-induced augmentation of the formation of cGMP and the contents of NMDAR1, CaM, nNOS, sGC and cGMP (P<0.01). These results suggest that the suppression of DA on the Glu-NO-cGMP pathway localized in PCAs contributes to memory impairment in rats with MHE. PMID:25059564

  3. Elevated intracranial dopamine impairs the glutamate‑nitric oxide‑cyclic guanosine monophosphate pathway in cortical astrocytes in rats with minimal hepatic encephalopathy.


    Ding, Saidan; Huang, Weilong; Ye, Yiru; Yang, Jianjing; Hu, Jiangnan; Wang, Xiaobin; Liu, Leping; Lu, Qin; Lin, Yuanshao


    In a previous study by our group memory impairment in rats with minimal hepatic encephalopathy (MHE) was associated with the inhibition of the glutamate‑nitric oxide‑cyclic guanosine monophosphate (Glu‑NO‑cGMP) pathway due to elevated dopamine (DA). However, the effects of DA on the Glu‑NO‑cGMP pathway localized in primary cortical astrocytes (PCAs) had not been elucidated in rats with MHE. In the present study, it was identified that when the levels of DA in the cerebral cortex of rats with MHE and high‑dose DA (3 mg/kg)‑treated rats were increased, the co‑localization of N‑methyl‑d‑aspartate receptors subunit 1 (NMDAR1), calmodulin (CaM), nitric oxide synthase (nNOS), soluble guanylyl cyclase (sGC) and cyclic guanine monophosphate (cGMP) with the glial fibrillary acidic protein (GFAP), a marker protein of astrocytes, all significantly decreased, in both the MHE and high‑dose DA‑treated rats (P<0.01). Furthermore, NMDA‑induced augmentation of the expression of NMDAR1, CaM, nNOS, sGC and cGMP localized in PCAs was decreased in MHE and DA‑treated rats, as compared with the controls. Chronic exposure of cultured cerebral cortex PCAs to DA treatment induced a dose‑dependent decrease in the concentration of intracellular calcium, nitrites and nitrates, the formation of cGMP and the expression of NMDAR1, CaM, nNOS and sGC/cGMP. High doses of DA (50 µM) significantly reduced NMDA‑induced augmentation of the formation of cGMP and the contents of NMDAR1, CaM, nNOS, sGC and cGMP (P<0.01). These results suggest that the suppression of DA on the Glu‑NO‑cGMP pathway localized in PCAs contributes to memory impairment in rats with MHE. PMID:25059564

  4. Involvement of nitric oxide-cyclic guanosine monophosphate pathway in the antidepressant-like effect of tropisetron and ondansetron in mice forced swimming test and tail suspension test.


    Haj-Mirzaian, Arya; Kordjazy, Nastaran; Amiri, Shayan; Haj-Mirzaian, Arvin; Amini-Khoei, Hossien; Ostadhadi, Sattar; Dehpour, AhmadReza


    Antidepressant-like effects of 5-hydroxytryptamine subtype 3 (5-HT3) antagonists including tropisetron and ondansetron have been previously demonstrated in the literature. It was reported that stimulation of 5-HT3 receptors activate the nitric oxide-cyclic guanosine monophosphate (NO-cGMP) pathway, which is involved in regulation of behavioral and emotional functions. In our study, treating animals with tropisetron (5, 10, and 30mg/kg) and ondansetron (0.01 and 0.1µg/kg) significantly decreased the immobility time in forced swimming test (FST) and tail-suspension test (TST). Co-administration of subeffective doses of tropisetron (1mg/kg) and ondansetron (0.001µg/kg) with subeffective dose of l-NAME (10mg/kg, nonselective NO synthase (NOS) inhibitor) and 7-nitroindazole (25mg/kg, neural NOS inhibitor) exerted antidepressant-like effect in FST and TST, while aminoguanidine (50mg/kg, inducible NOS inhibitor) did not enhance the antidepressant-like effect of 5-HT3 antagonists. Besides, l-arginine (750mg/kg, NO precursor) and sildenafil (5mg/kg, phosphodiesterase inhibitor) suppressed the anti-immobility effect of 5-HT3 antagonists. None of the treatments altered the locomotor behavior of mice in open-field test. Also, hippocampal (but not cortical) nitrite level was significantly lower in tropisetron and ondansetron-treated mice compared with saline-injected mice. Also, co-administration of 7-nitroindazole with tropisetron or ondansetron caused a significant decrease in hippocampal nitrite levels. In conclusion, we suggest that antidepressant-like effect of tropisetron and ondansetron are partially mediated by modulation of NO-cGMP pathway. PMID:27001377

  5. Nitric oxide and cyclic guanosine monophosphate signaling in the eye.


    Murad, Ferid


    This brief review describes the components and pathways utilized in nitric oxide (NO) and cyclic guanosine monophosphate (cGMP) signaling. Since the discovery of the effects of NO and cGMP on smooth muscle relaxation about 30 years ago, the field has expanded in many directions such that many, but not all, biochemical and biological effects seem to be regulated by these unique signaling molecules. While many of the effects of NO are due to activation of soluble guanylyl cyclase (sGC) that can be considered the receptor for NO, cGMP, in turn, can activate a cGMP-dependent protein kinase (PKG) to phosphorylate an array of proteins. Some of the effects of cGMP can be independent of PKG and are due to effects on ion channels or cyclic nucleotide phosphodiesterases. Also, some of the effects of NO can be independent of sGC activation. The isoenzymes and macromolecules that participate in these signaling pathways can serve as molecular targets to identify compounds that increase or decrease their activation and thus serve as chemical leads for discovering novel drugs for a variety of diseases. Some examples are given. However, with about 90,000 publications in the field since our first reports in 1977, this brief review can only give the readers a sample of the excitement and opportunities we have found in this cell signaling system. PMID:18443613


    PubMed Central

    Demain, A. L.; Miller, I. M.; Hendlin, D.


    Demain, A. L. (Merck Sharp & Dohme Research Laboratories, Rahway, N.J.), I. M. Miller, and D. Hendlin. Production of extracellular guanosine-5'-monophosphate by Bacillus subtilis. J. Bacteriol. 88:991–995. 1964.—Wild-type Bacillus subtilis colonies were found to feed purineless mutants. A strain with high feeding capacity was selected for study, with a guanineless mutant of B. subtilis used as the assay organism. The factor was excreted during its growth phase in a complex medium containing starch and soybean meal extract. Nutritional studies led to the development of a defined medium to be used for biochemical studies and to aid in the isolation of the factor. Starch was replaced by maltose and the soybean meal extract by Mn++. Production of the factor was sensitive to the pH of the medium during growth. Practically its entire extracellular accumulation occurred before visible lysis. The factor was identified as guanosine-5'-monophosphate derived by extracellular enzymatic hydrolysis of excreted ribonucleic acid. PMID:14219064

  7. Antinociceptive Effect of Vardenafil on Carrageenan-Induced Hyperalgesia in Rat: involvement of Nitric Oxide/Cyclic Guanosine Monophosphate/Calcium Channels Pathway.


    Gediz, Ezgi İkiz; Nacitarhan, Cahit; Minareci, Edibe; Sadan, Gulay


    In this study, we aimed to investigate the peripheral antinociception effects of specific phosphodiesterase 5 (PDE-5) inhibitor vardenafil on carrageenan-induced nociception in rats, and the role of calcium besides the L-arginine- nitric oxide (NO)- cyclic guanosine monophophate (cGMP) pathway in these effects. Hyperalgesia was induced by the intraplantar injection of 0.1 mL fresh carrageenan solution to right hind-paw whereas, saline as a vehicle of carrageenan was injected to the left paw. This procedure was used for measuring mechanic nociception pressure via an analgesimeter. Pressure which produced nociception was measured before (0 minute) and after(15, 30, 60 and 120 minutes) carrageenan injection. Local administration of vardenafil produced a dose-dependent antinociceptive effect. Pretreatment with N(W)-nitro-L-arginine methyl ester (L-NAME, nitric oxide synthase inhibitor), oxadiazolo (4, 3, a) quinoxalin -1-one (ODQ, inhibitor of guanylyl cyclase) or A23187 (calcium ionophore) decreased the effect of vardenafil. In contrast, L-arginine (nitric oxide donor) seemed to potentiate the vardenafil-induced antinociception. Our results suggest that phosphodiesterase type-5 inhibitor vardenafil may offer a new therapeutic tool to treat pain. It's effect was probably result from L-arginine/NO-cGMP pathway activation and Ca + 2 channels are also involved. PMID:26664380

  8. Antinociceptive Effect of Vardenafil on Carrageenan-Induced Hyperalgesia in Rat: involvement of Nitric Oxide/Cyclic Guanosine Monophosphate/Calcium Channels Pathway

    PubMed Central

    Gediz, Ezgi İkiz; Nacitarhan, Cahit; Minareci, Edibe; Sadan, Gulay


    In this study, we aimed to investigate the peripheral antinociception effects of specific phosphodiesterase 5 (PDE-5) inhibitor vardenafil on carrageenan-induced nociception in rats, and the role of calcium besides the L-arginine- nitric oxide (NO)- cyclic guanosine monophophate (cGMP) pathway in these effects. Hyperalgesia was induced by the intraplantar injection of 0.1 mL fresh carrageenan solution to right hind-paw whereas, saline as a vehicle of carrageenan was injected to the left paw. This procedure was used for measuring mechanic nociception pressure via an analgesimeter. Pressure which produced nociception was measured before (0 minute) and after(15, 30, 60 and 120 minutes) carrageenan injection. Local administration of vardenafil produced a dose-dependent antinociceptive effect. Pretreatment with NW-nitro-L-arginine methyl ester (L-NAME, nitric oxide synthase inhibitor), oxadiazolo (4, 3, a) quinoxalin -1-one (ODQ, inhibitor of guanylyl cyclase) or A23187 (calcium ionophore) decreased the effect of vardenafil. In contrast, L-arginine (nitric oxide donor) seemed to potentiate the vardenafil-induced antinociception. Our results suggest that phosphodiesterase type-5 inhibitor vardenafil may offer a new therapeutic tool to treat pain. It’s effect was probably result from L-arginine/NO-cGMP pathway activation and Ca + 2 channels are also involved. PMID:26664380

  9. Ag(+)-mediated assembly of 5'-guanosine monophosphate.


    Loo, Kristine; Degtyareva, Natalya; Park, Jihae; Sengupta, Bidisha; Reddish, Michaeal; Rogers, Christopher C; Bryant, Andrea; Petty, Jeffrey T


    Polymorphic forms of nucleic acids provide platforms for new nanomaterials, and transition metal cations give access to alternative arrangements of nucleobases by coordinating with electron-rich functional groups. Interaction of Ag(+) with 5'-guanosine monophosphate (5'-GMP) is considered in this work. Ag(+) promotes nucleotide stacking and aggregation, as indicated by the increased viscosity of 5'-GMP solutions with Ag(+), magnification of the circular dichroism response of guanine by Ag(+), and exothermic reactions between Ag(+) and guanine derivatives. Isothermal titration calorimetry studies show that the reaction is favored starting at 10 microM 5'-GMP. Utilizing the exothermic heat change associated with reaction of Ag(+) with 5'-GMP, local structure within the aggregate was assessed. On the basis of the salt dependence of the reaction and comparison with the corresponding nucleoside, the dianionic phosphate of 5'-GMP is one binding site for Ag(+), although this electrostatic interaction is not a dominant contribution to the overall heat change. Another binding site is the N7 on the nucleobase, as determined via studies with 7-deazaguanosine. Besides this binding site, Ag(+) also associates with the O6, as earlier studies deduced from the shift in the carbonyl stretching frequency associated with adduct formation. With these two binding sites on the nucleobase, the empirical stoichiometry of approximately 1 Ag(+):nucleobase derived from the calorimetry studies indicates that Ag(+) coordinates two nucleobases. The proposed structural model is a Ag(+)-mediated guanine dimer within a base stacked aggregate. PMID:20205377

  10. Novel Characteristics of Trypanosoma brucei Guanosine 5'-monophosphate Reductase Distinct from Host Animals

    PubMed Central

    Kimura, Chihiro; Shinohara, Takahiro; Tomiyama, Ai; Imamura, Akira; Kuwamura, Mitsuru; Nishimura, Kazuhiko; Fujimori, Ko; Shuto, Satoshi; Ishibashi, Osamu; Kubata, Bruno Kilunga; Inui, Takashi


    The metabolic pathway of purine nucleotides in parasitic protozoa is a potent drug target for treatment of parasitemia. Guanosine 5’-monophosphate reductase (GMPR), which catalyzes the deamination of guanosine 5’-monophosphate (GMP) to inosine 5’-monophosphate (IMP), plays an important role in the interconversion of purine nucleotides to maintain the intracellular balance of their concentration. However, only a few studies on protozoan GMPR have been reported at present. Herein, we identified the GMPR in Trypanosoma brucei, a causative protozoan parasite of African trypanosomiasis, and found that the GMPR proteins were consistently localized to glycosomes in T. brucei bloodstream forms. We characterized its recombinant protein to investigate the enzymatic differences between GMPRs of T. brucei and its host animals. T. brucei GMPR was distinct in having an insertion of a tandem repeat of the cystathionine β-synthase (CBS) domain, which was absent in mammalian and bacterial GMPRs. The recombinant protein of T. brucei GMPR catalyzed the conversion of GMP to IMP in the presence of NADPH, and showed apparent affinities for both GMP and NADPH different from those of its mammalian counterparts. Interestingly, the addition of monovalent cations such as K+ and NH4+ to the enzymatic reaction increased the GMPR activity of T. brucei, whereas none of the mammalian GMPR’s was affected by these cations. The monophosphate form of the purine nucleoside analog ribavirin inhibited T. brucei GMPR activity, though mammalian GMPRs showed no or only a little inhibition by it. These results suggest that the mechanism of the GMPR reaction in T. brucei is distinct from that in the host organisms. Finally, we demonstrated the inhibitory effect of ribavirin on the proliferation of trypanosomes in a dose-dependent manner, suggesting the availability of ribavirin to develop a new therapeutic agent against African trypanosomiasis. PMID:26731263

  11. Increasing the function of the glutamate-nitric oxide-cyclic guanosine monophosphate pathway increases the ability to learn a Y-maze task.


    Llansola, Marta; Hernandez-Viadel, Mariluz; Erceg, Slaven; Montoliu, Carmina; Felipo, Vicente


    N-methyl-D-aspartate (NMDA) receptors play a crucial role in learning. However, the molecular mechanisms by which NMDA receptors contribute to learning processes are not known in detail. Activation of NMDA receptors leads to increased calcium in the postsynaptic neuron. Calcium binds to calmodulin and activates neuronal nitric oxide synthase, increasing nitric oxide (NO), which activates soluble guanylate cyclase, increasing cGMP. Part of this cGMP is released to the extracellular space. Several reports indicate that impairment of this glutamate-NO-cGMP pathway reduces the ability to learn a Y-maze conditional discrimination task by rats. The aim of this work was to assess whether enhancing the function of this pathway increases the ability to learn this task. Prenatal exposure to the polybrominated diphenylether PBDE-99 during embryonic days 2-9 or 11-19 enhances the function of the glutamate-NO-cGMP pathway in cerebellum in vivo as assessed by microdialysis in freely moving rats. This was associated with an increase in the ability to learn the Y-maze task. Rats prenatally exposed to PBDE need fewer trials than control rats to learn the Y-maze task. These results show that the function of the glutamate-NO-cGMP modulates the ability of rats to learn the Y-maze task, that the function of the pathway under physiological conditions is not optimal for learning, and that performance in the Y-maze task may be improved by enhancing slightly the function of the pathway and cGMP formation. PMID:19326454

  12. In Search of Enzymes with a Role in 3′, 5′-Cyclic Guanosine Monophosphate Metabolism in Plants

    PubMed Central

    Gross, Inonge; Durner, Jörg


    In plants, nitric oxide (NO)-mediated 3′, 5′-cyclic guanosine monophosphate (cGMP) synthesis plays an important role during pathogenic stress response, stomata closure upon osmotic stress, the development of adventitious roots and transcript regulation. The NO-cGMP dependent pathway is well characterized in mammals. The binding of NO to soluble guanylate cyclase enzymes (GCs) initiates the synthesis of cGMP from guanosine triphosphate. The produced cGMP alters various cellular responses, such as the function of protein kinase activity, cyclic nucleotide gated ion channels and cGMP-regulated phosphodiesterases. The signal generated by the second messenger is terminated by 3′, 5′-cyclic nucleotide phosphodiesterase (PDEs) enzymes that hydrolyze cGMP to a non-cyclic 5′-guanosine monophosphate. To date, no homologues of mammalian cGMP-synthesizing and degrading enzymes have been found in higher plants. In the last decade, six receptor proteins from Arabidopsis thaliana have been reported to have guanylate cyclase activity in vitro. Of the six receptors, one was shown to be a NO dependent guanylate cyclase enzyme (NOGC1). However, the role of these proteins in planta remains to be elucidated. Enzymes involved in the degradation of cGMP remain elusive, albeit, PDE activity has been detected in crude protein extracts from various plants. Additionally, several research groups have partially purified and characterized PDE enzymatic activity from crude protein extracts. In this review, we focus on presenting advances toward the identification of enzymes involved in the cGMP metabolism pathway in higher plants. PMID:27200049

  13. Fluorescent Sensing of Guanine and Guanosine Monophosphate with Conjugated Receptors Incorporating Aniline and Naphthyridine Moieties.


    Lu, Shao-Hung; Phang, Riping; Fang, Jim-Min


    Ethyne-linked naphthyridine-aniline conjugated molecules are selective sensors of decylguanine in dichloromethane and guanosine monophosphate in water (Kass = 16 000 M(-1)). The 2-acetamido-1,8-naphthyridine moiety binds with guanine in a DAA-ADD triply hydrogen-bonded motif. The aniline moiety enhances an electron-donating effect, and the substituent is tuned to attain extra hydrogen bonds, π-π stacking, and electrostatic interactions. The proposed binding modes are supported by a Job plot, ESI-MS, (1)H NMR, UV-vis, and fluorescence spectral analyses. PMID:27018895

  14. [Cyclic Guanosine Monophosphate as a Mediator in Processes of Stress Signaling Transduction in Higher Plants].


    Dubovskaya, L V; Bakakina, Y S; Volotovski, I D


    Currently, biophysical mechanisms of stress signaling transduction became an object of consideration of researchers in connection with the urgent necessity to develop new techniques to enhance the sustainability and productivity of agricultural crops. The development of sensitive methods for the determination of cyclic guanosine monophosphate (cGMP) and comparative analysis of cGMP-dependent events in biological systems has contributed to progress in the understanding of the functioning of cGMP in plant cells. Currently, it is shown that cGMP as a secondary mediator is involved in such vital processes of growth and development of plants as seed germination, cell division, development of chloroplasts, flowering and regulation of stomatal movements. This review summarizes the available data in the literature about the role of cGMP in the responses of plant organisms to the action of stress factors of abiotic and biotic nature and its interaction with other intracellular mediators. With the use of existing ideas about the biophysical mechanisms of stress in plants, the basic elements of cGMP-dependent signal transduction system in a plant cell are considered. PMID:26394467

  15. Involvement of Cyclic Guanosine Monophosphate-Dependent Protein Kinase I in Renal Antifibrotic Effects of Serelaxin

    PubMed Central

    Wetzl, Veronika; Schinner, Elisabeth; Kees, Frieder; Hofmann, Franz; Faerber, Lothar; Schlossmann, Jens


    Introduction: Kidney fibrosis has shown to be ameliorated through the involvement of cyclic guanosine monophosphate (cGMP) and its dependent protein kinase I (cGKI). Serelaxin, the recombinant form of human relaxin-II, increases cGMP levels and has shown beneficial effects on kidney function in acute heart failure patients. Antifibrotic properties of serelaxin are supposed to be mediated via relaxin family peptide receptor 1 and subsequently enhanced nitric oxide/cGMP to inhibit transforming growth factor-β (TGF-β) signaling. This study examines the involvement of cGKI in the antifibrotic signaling of serelaxin. Methods and Results: Kidney fibrosis was induced by unilateral ureteral obstruction in wildtype (WT) and cGKI knock-out (KO) mice. After 7 days, renal antifibrotic effects of serelaxin were assessed. Serelaxin treatment for 7 days significantly increased cGMP in the kidney of WT and cGKI-KO. In WT, renal fibrosis was reduced through decreased accumulation of collagen1A1, total collagen, and fibronectin. The profibrotic connective tissue growth factor as well as myofibroblast differentiation were reduced and matrix metalloproteinases-2 and -9 were positively modulated after treatment. Moreover, Smad2 as well as extracellular signal-regulated kinase 1 (ERK1) phosphorylation were decreased, whereas phosphodiesterase (PDE) 5a phosphorylation was increased. However, these effects were not observed in cGKI-KO. Conclusion: Antifibrotic renal effects of serelaxin are mediated via cGMP/cGKI to inhibit Smad2- and ERK1-dependent TGF-β signaling and increased PDE5a phosphorylation. PMID:27462268

  16. Adenosine 3′:5′-cyclic monophosphate- and guanosine 3′:5′-cyclic monophosphate-dependent protein kinases: Possible homologous proteins

    PubMed Central

    Lincoln, Thomas M.; Corbin, Jackie D.


    The properties of purified mammalian adenosine 3′:5′-cyclic monophosphate (cAMP)- and guanosine 3′:5′-cyclic monophosphate (cGMP)-dependent protein kinases were compared. Several physical characteristics of the two enzymes were similar, including size, shape, affinity for cyclic nucleotide binding, and Km for ATP. In addition, the amino acid composition of the two proteins indicated a close composition homology (70-90%). Both cyclic nucleotide-dependent protein kinases catalyzed phosphorylation of rat liver pyruvate kinase (EC and fructose 1,6-diphosphatase (EC, rabbit skeletal muscle glycogen synthase (EC and phosphorylase b kinase (EC, and calf thymus histone H2b. The phosphorylation of several synthetic peptides and of trypsin-sensitive and trypsin-insensitive sites in glycogen synthase suggested similar recognition sites on the protein substrates for the two kinases. The cAMP-dependent protein kinase was the better catalyst with each protein or peptides substrate. The results suggest that the two enzymes evolved from a common ancestral protein. Images PMID:198777

  17. Human monocyte killing of Staphylococcus aureus: modulation by agonists of cyclic adenosine 3',5'-monophosphate and cyclic guanosine 3',5'-monophosphate.

    PubMed Central

    O'Dorisio, M S; Vandenbark, G R; LoBuglio, A F


    This study was designed to test whether cyclic nucleotides play a role in the regulation of bacterial killing by human monocytes. Agents were tested for their ability to activate monocyte adenylate or guanylate cyclase in cell-free preparations, to increase cyclic adenosine 3',5'-monophosphate (cAMP) or cyclic guanosine 3',5'-monophosphate (cGMP) in intact human monocytes, and to modulate monocyte-induced killing of Staphylococcus aureus in vitro. Prostaglandin E1 and cholera toxin activated monocyte adenylate cyclase and inhibited monocyte killing of S. aureus. An adenylate cyclase inhibitor, RMI 12330A, reversed the prostaglandin E1-mediated inhibition of bacterial killing, thus implicating cAMP as the intracellular mediator of this inhibition. In contrast, monocyte cGMP levels were increased 5- and 17-fold by 5-hydroxytryptamine and N-methyl-N' -nitro-N-nitrosoguanidine, respectively, but neither agent was effective in modulating monocyte bactericidal activity. Thus, modulation of bactericidal activity in human monocytes did not conform to the yin/yang theory of opposing actions by cAMP and cGMP, for although monocyte-mediated killing of S. aureus was inhibited by cAMP agonists, it was not enhanced by cGMP agonists. PMID:44704

  18. Sum-frequency generation spectroscopy of self-assembled structures of Guanosine 5‧-monophosphate on mica

    NASA Astrophysics Data System (ADS)

    Kunstelj, Klemen; Spindler, Lea; Federiconi, Francesco; Bonn, Mischa; Drevenšek-Olenik, Irena; Čopič, Martin


    The structure and ordering of Guanosine 5'-monophosphate (GMP) films self-assembled on mica from GMP salt solutions were studied by infrared-visible sum-frequency generation spectroscopy (IR-VIS SFG) and atomic force microscopy (AFM). We find that the surface self-assembly of GMP can be tuned through the concentration of the GMP solution as well as the nature of the counter ion. At low concentrations of the ammonium and the sodium GMP salt solutions, the self-assembled films are very similar, while at higher concentrations the SFG signal of ammonium GMP samples is dominated by a contribution not originating from azimuthally symmetric layers, which signifies that a helical bulk structure might be present.

  19. Human taste and umami receptor responses to chemosensorica generated by Maillard-type N²-alkyl- and N²-arylthiomethylation of guanosine 5'-monophosphates.


    Suess, Barbara; Brockhoff, Anne; Degenhardt, Andreas; Billmayer, Sylvia; Meyerhof, Wolfgang; Hofmann, Thomas


    Structural modification of the exocyclic amino function of guanosine 5'-monophosphate (5'-GMP) by Maillard-type reactions with reducing carbohydrates was recently found to increase the umami-enhancing activity of the nucleotide upon S-N(2)-1-carboxyalkylation and S-N(2)-(1-alkylamino)carbonylalkylation, respectively. Since the presence of sulfur atoms in synthetic N(2)-alkylated nucleotides was reported to be beneficial for sensory activity, a versatile Maillard-type modification of 5'-GMP upon reaction with glycine's Strecker aldehyde formaldehyde and organic thiols was performed in the present study. A series of N(2)-(alkylthiomethyl)guanosine and N(2)-(arylthiomethyl)guanosine 5'-monophosphates was generated and the compounds were evaluated to what extent they enhance the umami response to monosodium L-glutamate in vivo by a paired-choice comparison test using trained human volunteers and in vitro by means of cell-based umami taste receptor assay. Associated with a high umami-enhancing activity (β-value 5.1), N(2)-(propylthiomethyl)guanosine 5'-monophosphate could be generated when 5'-GMP reacted with glucose, glycine, and the onion-derived odorant 1-propanethiol, thus opening a valuable avenue to produce high-potency umami-enhancing chemosensorica from food-derived natural products by kitchen-type chemistry. PMID:25375264

  20. Structural Basis of Differential Ligand Recognition by Two Classes of bis-(3-5)-cyclic Dimeric Guanosine Monophosphate-binding Riboswitches

    SciTech Connect

    K Smith; C Shanahan; E Moore; A Simon; S Strobel


    The bis-(3'-5')-cyclic dimeric guanosine monophosphate (c-di-GMP) signaling pathway regulates biofilm formation, virulence, and other processes in many bacterial species and is critical for their survival. Two classes of c-di-GMP-binding riboswitches have been discovered that bind this second messenger with high affinity and regulate diverse downstream genes, underscoring the importance of RNA receptors in this pathway. We have solved the structure of a c-di-GMP-II riboswitch, which reveals that the ligand is bound as part of a triplex formed with a pseudoknot. The structure also shows that the guanine bases of c-di-GMP are recognized through noncanonical pairings and that the phosphodiester backbone is not contacted by the RNA. Recognition is quite different from that observed in the c-di-GMP-I riboswitch, demonstrating that at least two independent solutions for RNA second messenger binding have evolved. We exploited these differences to design a c-di-GMP analog that selectively binds the c-di-GMP-II aptamer over the c-di-GMP-I RNA. There are several bacterial species that contain both types of riboswitches, and this approach holds promise as an important tool for targeting one riboswitch, and thus one gene, over another in a selective fashion.

  1. Lanthanum inhibition of Vibrio cholerae and Escherichia coli enterotoxin-induced enterosorption and its effects on intestinal mucosa cyclic adenosine 3',5'-monophosphate and cyclic guanosine 3',5'-monophosphate levels.

    PubMed Central

    Leitch, G J; Amer, M S


    Several trivalent cations, including lanthanum (La3+), inhibited the secretion (enterosorption) induced by the enterotoxins of Vibrio cholerae and Escherichia coli in the rabbit ileum in vivo. High concentrations (greater than 10 mM) of La3+ were required to inhibit cholera enterotoxin (CE)-induced enterosorption, probably because of the adsorption of the La3+ often potentiated the CE-induced enterosorption. If luminal La3+ exposure followed CE exposure, some recovery of the enterosorptive response was observed. The longer the lag between the CE exposure and the La3+ exposure, the greater was the recovery of the enterosorptive response. Lanthanum inhibited HCO3- secretion more than Cl- secretion. By altering the luminal fluid pH at the time of La3+ exposure, it was found that La3+ was adsorbed to negatively charged luminal sites, having an apparent pK between 2.5 and 3.0. Although La3+ antagonized the enterosorptive response to CE, it mimicked rather than antagonized the cyclic adenosine 3',5'-monophosphate elevation and cyclic guanosine 3',5'-monophosphate depression induced by the toxin. It is therefore concluded that the La3+ inhibition of the CE-induced enterosorption must have occurred at a site following the generation of the cyclic nucleotides. Cholera enterotoxin caused complex time-dependent changes in the mucosal cyclic adenosine 3',5'-monophosphate and cyclic guanosine 3',5'-monophosphate levels, as revealed by studying tissue cyclic adenosine 3',5'-monophosphate/cyclic guanosine 3',5'-monophosphate ratios. The possible roles these two cyclic nucleotides may play in the pathogenesis of the cholera diarrhea are discussed. PMID:164410

  2. Analysis of nitric oxide-cyclic guanosine monophosphate signaling during metamorphosis of the nudibranch Phestilla sibogae Bergh (Gastropoda: Opisthobranchia).


    Bishop, Cory D; Pires, Anthony; Norby, Shong-Wan; Boudko, Dmitri; Moroz, Leonid L; Hadfield, Michael G


    The gas nitric oxide (NO), and in some cases its downstream second messenger, cyclic guanosine monophosphate (cGMP) function in different taxa to regulate the timing of life-history transitions. Increased taxonomic sampling is required to foster conclusions about the evolution and function of NO/cGMP signaling during life-history transitions. We report on the function and localization of NO and cGMP signaling during metamorphosis of the nudibranch Phestilla sibogae. Pharmacological manipulation of NO or cGMP production in larvae modulated responses to a natural settlement cue from the coral Porites compressa in a manner that suggest inhibitory function for NO/cGMP signaling. However, these treatments were not sufficient to induce metamorphosis in the absence of cue, a result unique to this animal. We show that induction of metamorphosis in response to the settlement cue is associated with a reduction in NO production. We documented the expression of putative NO synthase (NOS) and the production of cGMP during larval development and observed no larval cells in which NOS and cGMP were both detected. The production of cGMP in a bilaterally symmetrical group of cells fated to occupy the distal tip of rhinophores is correlated with competence to respond to the coral settlement cue. These results suggest that endogenous NO and cGMP are involved in modulating responses of P. sibogae to a natural settlement cue. We discuss these results with respect to habitat selection and larval ecology. PMID:18460091

  3. Alterations in the Cerebellar (Phospho)Proteome of a Cyclic Guanosine Monophosphate (cGMP)-dependent Protein Kinase Knockout Mouse*

    PubMed Central

    Corradini, Eleonora; Vallur, Raghavan; Raaijmakers, Linsey M.; Feil, Susanne; Feil, Robert; Heck, Albert J. R.; Scholten, Arjen


    The cyclic nucleotide cyclic guanosine monophosphate (cGMP) plays an important role in learning and memory, but its signaling mechanisms in the mammalian brain are not fully understood. Using mass-spectrometry-based proteomics, we evaluated how the cerebellum adapts its (phospho)proteome in a knockout mouse model of cGMP-dependent protein kinase type I (cGKI). Our data reveal that a small subset of proteins in the cerebellum (∼3% of the quantified proteins) became substantially differentially expressed in the absence of cGKI. More changes were observed at the phosphoproteome level, with hundreds of sites being differentially phosphorylated between wild-type and knockout cerebellum. Most of these phosphorylated sites do not represent known cGKI substrates. An integrative computational network analysis of the data indicated that the differentially expressed proteins and proteins harboring differentially phosphorylated sites largely belong to a tight network in the Purkinje cells of the cerebellum involving important cGMP/cAMP signaling nodes (e.g. PDE5 and PKARIIβ) and Ca2+ signaling (e.g. SERCA3). In this way, removal of cGKI could be linked to impaired cerebellar long-term depression at Purkinje cell synapses. In addition, we were able to identify a set of novel putative (phospho)proteins to be considered in this network. Overall, our data improve our understanding of cerebellar cGKI signaling and suggest novel players in cGKI-regulated synaptic plasticity. PMID:24925903

  4. Influence of salt additives on phase transformation of guanosine 5-monophosphate disodium in anti-solvent crystallization

    NASA Astrophysics Data System (ADS)

    Nguyen, Anh-Tuan; Kang, Jeongki; Kim, Woo-Sik


    The influence of sodium chloride (NaCl) as an additive on the anti-solvent crystallization of guanosine 5-monophosphate disodium (GMP-2Na) was investigated in continuous Couette-Taylor (CT) and batch mixing tank (MT) crystallizers. The anti-solvent crystallization initially precipitated amorphous solids of GMP-2Na, which then slowly transformed into hydrate crystals in the solution. However, the phase transformation of GMP-2Na was markedly promoted by the sodium chloride additive due to the common ion effect. While the normal phase transformation in the batch MT crystallizer required over 120 min of crystallization time without using the sodium chloride additive, the process was completed within 60 min when a small amount of the salt additive was added. The phase transformation was also significantly accelerated in the continuous CT crystallizer. Without using the sodium chloride additive, 7 min of the mean residence time was required for the production of 100% hydrate GMP crystals. However, when using the sodium chloride additive, a mean residence time of only 2 min was sufficient to completely transform the amorphous solids of GMP-2Na into hydrate crystals due to the common ion effect combined with the effective fluid motion of the Taylor vortex for the mass transfer.

  5. Indolyl-3-butyric acid-induced Arabidopsis stomatal opening mediated by 3',5'-cyclic guanosine-monophosphate.


    Cousson, A


    It has been pharmacologically suggested that 3',5'-cyclic guanosine-monophosphate (cGMP) mediates indolyl-3-butyric acid (IBA)-induced stomatal opening. In Arabidopsis thaliana (L.) Heynh., such investigations compared the wild type (Columbia and Ws ecotypes) to mutants knockout for either GTP-binding protein (G protein) α subunit 1 (gpa1-4), putative G protein-coupled receptor 1 (gcr1-5), calcineurin B-like isoform 1 (cbl1) or 9 (cbl9), or the NADPH oxidases AtrbohD and AtrbohF (atrbohD/F). Stomatal opening to IBA or the permeant cGMP analogue, 8-bromo-cGMP (8-Br-cGMP) was abolished in the atrbohD/F mutant. The IBA response was fully or partially suppressed, respectively, in the gcr1-5 mutant, or the gpa1-4 and cbl1 mutants. In the cbl9 mutant, the response to IBA or 8-Br-cGMP, respectively, was partially or fully suppressed. Phenylarsine oxide (PAO) affected the IBA response, which the cbl1 mutant overlapped or the gpa1-4 and cbl9 mutants increased up to 100% inhibition. 6-anilino-5,8-quinolinedione, mas17, the (Rp)-diastereomer of 8-bromo-3',5'-cyclic guanosine monophosphorothioate (Rp-8-Br-cGMPS), nicotinamide, ruthenium red (RRed), 1,2-bis(o-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid (BAPTA), cyclosporine A (CsA) and FK506 converged to affect the IBA response, which the gpa1-4 and cbl9 mutants overlapped or the cbl1 mutant and PAO increased up to 100% inhibition. Rp-8-Br-cGMPS, nicotinamide, RRed, BAPTA, CsA or FK506 paralled the cbl9 and atrbohD/F mutants to abolish the 8-Br-cGMP response. Based on so far revealed features of these mutants and pharmacological compounds, these results confirmed cGMP as a Ca(2+)-mobilizing second messenger for apoplastic auxin whose perception and transduction would implicate a seven-transmembrane receptor - G protein - guanylyl cyclase unit at the guard cell plasma membrane. PMID:20951600

  6. Analysis of nitric oxide-cyclic guanosine monophosphate signaling during metamorphosis of the nudibranch Phestilla sibogae Bergh (Gastropoda: Opisthobranchia)

    PubMed Central

    Bishop, Cory D.; Pires, Anthony; Norby, Shong-Wan; Boudko, Dmitri; Moroz, Leonid L.; Hadfield, Michael G.


    SUMMARY The gas nitric oxide (NO), and in some cases its downstream second messenger, cyclic guanosine monophosphate (cGMP) function in different taxa to regulate the timing of life-history transitions. Increased taxonomic sampling is required to foster conclusions about the evolution and function of NO/cGMP signaling during life-history transitions. We report on the function and localization of NO and cGMP signaling during metamorphosis of the nudibranch Phestilla sibogae. Pharmacological manipulation of NO or cGMP production in larvae modulated responses to a natural settlement cue from the coral Porites compressa in a manner that suggest inhibitory function for NO/cGMP signaling. However, these treatments were not sufficient to induce metamorphosis in the absence of cue, a result unique to this animal. We show that induction of metamorphosis in response to the settlement cue is associated with a reduction in NO production. We documented the expression of putative NO synthase (NOS) and the production of cGMP during larval development and observed no larval cells in which NOS and cGMP were both detected. The production of cGMP in a bilaterally symmetrical group of cells fated to occupy the distal tip of rhinophores is correlated with competence to respond to the coral settlement cue. These results suggest that endogenous NO and cGMP are involved in modulating responses of P. sibogae to a natural settlement cue. We discuss these results with respect to habitat selection and larval ecology. PMID:18460091

  7. Xenopus oocyte resting potential, muscarinic responses and the role of calcium and guanosine 3',5'-cyclic monophosphate.

    PubMed Central

    Dascal, N; Landau, E M; Lass, Y


    Resting potential (r.p.) and muscarinic response mechanisms were studied in Xenopus laevis oocytes using the voltage-clamp technique. Insertion of micro-electrodes into the oocyte produced a 'shunt' membrane conductance which partially sealed after a few minutes. The oocyte resting potential (measured with a single intracellular electrode) ranged from -40 to -60 mV. Ouabain and low K+ solution depolarized both follicles and denuded oocytes. The electrogenic Na+-K+ pump was more active in the latter. In the presence of ouabain, the r.p. agreed with the constant field theory. alpha (PNa+/PK+) was 0.12 in follicles and 0.24 in denuded oocytes. beta (PCl-/PK+) was 0.4 in both. At [Na+]o lower than 70 mM, the r.p. deviated considerably from the constant field predictions. The relatively large value of alpha indicated the major role of Na+ in oocyte r.p. determination. The oocyte muscarinic response was separated into four distinct components: the fast depolarizing Cl- current, 'D1'; the slow depolarizing Cl- current, 'D2'; the slow hyperpolarizing K+ current, 'H'; and the large membrane Cl- current fluctuation, 'F'. The H response reversal potential showed a Nernst relationship to [K+] and was selectively blocked by intracellular injection of tetraethylammonium (TEA). The D1 and D2 reversal potential showed a Nernst relationship to [Cl-]. In Ca2+-deficient, EGTA-containing medium, D2 and F were abolished and D1 and H were reduced. Verapamil inhibited all responses. Increasing [Ca2+]o caused a significant increase in D1, D2 and F response amplitudes. Intracellular injection of 0.6-10 pmol guanosine 3',5'-cyclic monophosphate, induced a large outward K+ current, similar to the muscarinic H response. PMID:6086916

  8. Kinetic dissection of individual steps in the poly(C)-directed oligoguanylate synthesis from guanosine 5'-monophosphate 2-methylimidazolide

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.; Bernasconi, C. F.; Alberas, D. J.; Baird, E. E.


    A kinetic study of oligoguanylate synthesis on a polycytidylate template, poly(C), as a function of the concentration of the activated monomer, guanosine 5'-monophosphate 2-methylimidazolide, 2-MeImpG, is reported. Reactions were run with 0.005-0.045 M 2-MeImpG in the presence of 0.05 M poly(C) at 23 degrees C. The kinetic results are consistent with a reaction scheme (eq 1) that consists of a series of consecutive steps, each step representing the addition of one molecule of 2-MeImpG to the growing oligomer. This scheme allows the calculation of second-order rate constants for every step by analyzing the time-dependent growth of each oligomer. Computer simulations of the course of reaction based on the determined rate constants and eq 1 are in excellent agreement with the product distributions seen in the HPLC profiles. In accord with an earlier study (Fakhrai, H.; Inoue, T.; Orgel, L. E. Tetrahedron 1984, 40, 39), rate constants, ki, for the formation of the tetramer and longer oligomers up to the 16-mer were found to be independent of length and somewhat higher than k3 (formation of trimer), which in turn is much higher than k2 (formation of dimer). The ki (i > or = 4), k3, and k2 values are not true second-order rate constants but vary with monomer concentration. Mechanistic models for the dimerization (Scheme I) and elongation reactions (Scheme II) are proposed that are consistent with our results. These models take into account that the monomer associates with the template in a cooperative manner. Our kinetic analysis allowed the determination of rate constants for the elementary processes of covalent bond formation between two monomers (dimerization) and between an oligomer and a monomer (elongation) on the template. A major conclusion from our study is that bond formation between two monomer units or between a primer and a monomer is assisted by the presence of additional next-neighbor monomer units. This is consistent with recent findings with hairpin

  9. A Cyclic Guanosine Monophosphate–Dependent Pathway Can Regulate Net Hepatic Glucose Uptake in Vivo

    PubMed Central

    An, Zhibo; Winnick, Jason J.; Moore, Mary C.; Farmer, Ben; Smith, Marta; Irimia, Jose M.; Roach, Peter J.; Cherrington, Alan D.


    We previously showed that hepatic nitric oxide regulates net hepatic glucose uptake (NHGU), an effect that can be eliminated by inhibiting hepatic soluble guanylate cyclase (sGC), suggesting that the sGC pathway is involved in the regulation of NHGU. The aim of the current study was to determine whether hepatic cyclic guanosine monophosphate (cGMP) reduces NHGU. Studies were performed on conscious dogs with transhepatic catheters. A hyperglycemic-hyperinsulinemic clamp was established in the presence of portal vein glucose infusion. 8-Br-cGMP (50 µg/kg/min) was delivered intraportally, and either the glucose load to the liver (CGMP/GLC; n = 5) or the glucose concentration entering the liver (CGMP/GCC; n = 5) was clamped at 2× basal. In the control group, saline was given intraportally (SAL; n = 10), and the hepatic glucose concentration and load were doubled. 8-Br-cGMP increased portal blood flow, necessitating the two approaches to glucose clamping in the cGMP groups. NHGU (mg/kg/min) was 5.8 ± 0.5, 2.7 ± 0.5, and 4.8 ± 0.3, whereas the fractional extraction of glucose was 11.0 ± 1, 5.5 ± 1, and 8.5 ± 1% during the last hour of the study in SAL, CGMP/GLC, and CGMP/GCC, respectively. The reduction of NHGU in response to 8-Br-cGMP was associated with increased AMP-activated protein kinase phosphorylation. These data indicate that changes in liver cGMP can regulate NHGU under postprandial conditions. PMID:22688328

  10. The cystathionine-β-synthase domains on the guanosine 5''-monophosphate reductase and inosine 5'-monophosphate dehydrogenase enzymes from Leishmania regulate enzymatic activity in response to guanylate and adenylate nucleotide levels.


    Smith, Sabrina; Boitz, Jan; Chidambaram, Ehzilan Subramanian; Chatterjee, Abhishek; Ait-Tihyaty, Maria; Ullman, Buddy; Jardim, Armando


    The Leishmania guanosine 5'-monophosphate reductase (GMPR) and inosine 5'-monophosphate dehydrogenase (IMPDH) are purine metabolic enzymes that function maintaining the cellular adenylate and guanylate nucleotide. Interestingly, both enzymes contain a cystathionine-β-synthase domain (CBS). To investigate this metabolic regulation, the Leishmania GMPR was cloned and shown to be sufficient to complement the guaC (GMPR), but not the guaB (IMPDH), mutation in Escherichia coli. Kinetic studies confirmed that the Leishmania GMPR catalyzed a strict NADPH-dependent reductive deamination of GMP to produce IMP. Addition of GTP or high levels of GMP induced a marked increase in activity without altering the Km values for the substrates. In contrast, the binding of ATP decreased the GMPR activity and increased the GMP Km value 10-fold. These kinetic changes were correlated with changes in the GMPR quaternary structure, induced by the binding of GMP, GTP, or ATP to the GMPR CBS domain. The capacity of these CBS domains to mediate the catalytic activity of the IMPDH and GMPR provides a regulatory mechanism for balancing the intracellular adenylate and guanylate pools. PMID:26853689

  11. Selective blockade of phosphodiesterase types 2, 5 and 9 results in cyclic 3′5′ guanosine monophosphate accumulation in retinal pigment epithelium cells

    PubMed Central

    Diederen, R M H; Heij, E C La; Ittersum, M Markerink‐van; Kijlstra, A; Hendrikse, F; de Vente, J


    Aim To investigate which phosphodiesterase (PDE) is involved in regulating cyclic 3′5′ guanosine monophosphate breakdown in retinal pigment epithelium (RPE) cells. Methods cGMP content in the cultured RPE cells (D407 cell line) was evaluated by immunocytochemistry in the presence of non‐selective or isoform‐selective PDE inhibitors in combination with the particulate guanylyl cyclase stimulator atrial natriuretic peptide (ANP) or the soluble guanylyl cyclase stimulator sodium nitroprusside (SNP). mRNA expression of PDE2, PDE5 and PDE9 was studied in cultured human RPE cells and rat RPE cell layers using non‐radioactive in situ hybridisation. Results In the absence of PDE inhibitors, cGMP levels in cultured RPE cells are very low. cGMP accumulation was readily detected in cultured human RPE cells after incubation with Bay60–7550 as a selective PDE2 inhibitor, sildenafil as a selective PDE5 inhibitor or Sch51866 as a selective PDE9 inhibitor. In the presence of PDE inhibition, cGMP content increased markedly after stimulation of the particulate guanylyl cyclase. mRNA of PDE2,PDE5 and PDE9 was detected in all cultured human RPE cells and also in rat RPE cell layers. Conclusions PDE2, PDE5 and PDE9 have a role in cGMP metabolism in RPE cells. PMID:16943225

  12. Modulating the Cyclic Guanosine Monophosphate Substrate Selectivity of the Phosphodiesterase 3 Inhibitors by Pyridine, Pyrido[2,3-d]pyrimidine Derivatives and Their Effects upon the Growth of HT-29 Cancer Cell Line

    PubMed Central

    Abadi, Ashraf Hassan; Hany, Marwa Saeed; Elsharif, Shimaa Awadain; Eissa, Amal Abdel Haleem; Gary, Bernard DeWayne; Tinsley, Heather Nicole; Piazza, Gary Anthony


    Analogues with the scaffolds of 3-cyano-4-alkoxyphenyl-6-bromoaryl-2-pyridone and 2-amino-3-cyano-4-alkoxyphenyl-6-bromoarylpyridine were synthesized. Cyclization of the 2-amino derivatives with formic acid and formamide gave the corresponding pyrido[2,3-d]pyrimidin-4(3H)-one and the pyrido[2,3-d]pyrimidin-4-amine derivatives, respectively. Active phosphodiesterase 3 (PDE3) inhibitors were identified from each of the four aforementioned scaffolds. This is the first report that pyrido[2,3-d]pyrimidin-4(3H)-one and pyrido[2,3-d]pyrimidin-4-amine derivatives can inhibit PDE3. The analogues with the pyridone and pyrido[2,3-d]pyrimidin-4(3H)-one scaffolds inhibited both cAMP and cyclic guanosine monophosphate (cGMP) hydrolysis by PDE3, while the amine containing scaffolds were more selective for cGMP hydrolysis. This observation may set the base for substrate-selective pharmacological modulation of this important class of drug targets and with less side effects, particularly tachcardia. The dual inhibitors of PDE3 were more potent inhibitor towards the growth of HT-29 cancer cell lines. PMID:23546000

  13. Affinity of guanosine derivatives for polycytidylate revisited

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.; Hurley, T. B.; Baird, E. E.


    Evidence is presented for complexation of guanosine 5'-monophosphate 2-methylimidazolide (2-MeImpG) with polycytidylate (poly(C)) at pH 8.0 and 23 degrees C in the presence of 1.0 M NaCl2 and 0.2 M MgCl2 in water. The association of 2-MeImpG with poly(C) was investigated using UV-vis spectroscopy as well as by monitoring the kinetics of the nucleophilic substitution reaction of the imidazole moiety by amines. The results of both methods are consistent with moderately strong poly(C) 2-MeImpG complexation and the spectrophotometric measurements allowed the construction of a binding isotherm with a concentration of 2-MeImpG equal to 5.55 +/- 0.15 mM at half occupancy. UV spectroscopy was employed to establish the binding of other guanosine derivatives on poly(C). These derivatives are guanosine 5'-monophosphate (5'GMP), guanosine 5'-monophosphate imidazolide (ImpG), and guanosine 5'-monophosphate morpholidate (morpG). Within experimental error these guanosine derivatives exhibit the same affinity for poly(C) as 2-MeImpG.

  14. Xylazine Activates Adenosine Monophosphate-Activated Protein Kinase Pathway in the Central Nervous System of Rats.


    Shi, Xing-Xing; Yin, Bai-Shuang; Yang, Peng; Chen, Hao; Li, Xin; Su, Li-Xue; Fan, Hong-Gang; Wang, Hong-Bin


    Xylazine is a potent analgesic extensively used in veterinary and animal experimentation. Evidence exists that the analgesic effect can be inhibited using adenosine 5'-monophosphate activated protein kinase (AMPK) inhibitors. Considering this idea, the aim of this study was to investigate whether the AMPK signaling pathway is involved in the central analgesic mechanism of xylazine in the rat. Xylazine was administrated via the intraperitoneal route. Sprague-Dawley rats were sacrificed and the cerebral cortex, cerebellum, hippocampus, thalamus and brainstem were collected for determination of liver kinase B1 (LKB1) and AMPKα mRNA expression using quantitative real-time polymerase chain reaction (qPCR), and phosphorylated LKB1 and AMPKα levels using western blot. The results of our study showed that compared with the control group, xylazine induced significant increases in AMPK activity in the cerebral cortex, hippocampus, thalamus and cerebellum after rats received xylazine (P < 0.01). Increased AMPK activities were accompanied with increased phosphorylation levels of LKB1 in corresponding regions of rats. The protein levels of phosphorylated LKB1 and AMPKα in these regions returned or tended to return to control group levels. However, in the brainstem, phosphorylated LKB1 and AMPKα protein levels were decreased by xylazine compared with the control (P < 0.05). In conclusion, our data indicates that xylazine alters the activities of LKB1 and AMPK in the central nervous system of rats, which suggests that xylazine affects the regulatory signaling pathway of the analgesic mechanism in the rat brain. PMID:27049320

  15. Guanosine controls inflammatory pathways to afford neuroprotection of hippocampal slices under oxygen and glucose deprivation conditions.


    Dal-Cim, Tharine; Ludka, Fabiana K; Martins, Wagner C; Reginato, Charlise; Parada, Esther; Egea, Javier; López, Manuela G; Tasca, Carla I


    Guanosine (GUO) is an endogenous modulator of glutamatergic excitotoxicity and has been shown to promote neuroprotection in in vivo and in vitro models of neurotoxicity. This study was designed to understand the neuroprotective mechanism of GUO against oxidative damage promoted by oxygen/glucose deprivation and reoxygenation (OGD). GUO (100 μM) reduced reactive oxygen species production and prevented mitochondrial membrane depolarization induced by OGD. GUO also exhibited anti-inflammatory actions as inhibition of nuclear factor kappa B activation and reduction of inducible nitric oxide synthase induction induced by OGD. These GUO neuroprotective effects were mediated by adenosine A1 receptor, phosphatidylinositol-3 kinase and MAPK/ERK. Furthermore, GUO recovered the impairment of glutamate uptake caused by OGD, an effect that occurred via a Pertussis toxin-sensitive G-protein-coupled signaling, blockade of adenosine A2A receptors (A2A R), but not via A1 receptor. The modulation of glutamate uptake by GUO also involved MAPK/ERK activation. In conclusion, GUO, by modulating adenosine receptor function and activating MAPK/ERK, affords neuroprotection of hippocampal slices subjected to OGD by a mechanism that implicates the following: (i) prevention of mitochondrial membrane depolarization, (ii) reduction of oxidative stress, (iii) regulation of inflammation by inhibition of nuclear factor kappa B and inducible nitric oxide synthase, and (iv) promoting glutamate uptake. PMID:23713463

  16. Xylazine Activates Adenosine Monophosphate-Activated Protein Kinase Pathway in the Central Nervous System of Rats

    PubMed Central

    Shi, Xing-Xing; Yin, Bai-Shuang; Yang, Peng; Chen, Hao; Li, Xin; Su, Li-Xue; Fan, Hong-Gang; Wang, Hong-Bin


    Xylazine is a potent analgesic extensively used in veterinary and animal experimentation. Evidence exists that the analgesic effect can be inhibited using adenosine 5’-monophosphate activated protein kinase (AMPK) inhibitors. Considering this idea, the aim of this study was to investigate whether the AMPK signaling pathway is involved in the central analgesic mechanism of xylazine in the rat. Xylazine was administrated via the intraperitoneal route. Sprague-Dawley rats were sacrificed and the cerebral cortex, cerebellum, hippocampus, thalamus and brainstem were collected for determination of liver kinase B1 (LKB1) and AMPKα mRNA expression using quantitative real-time polymerase chain reaction (qPCR), and phosphorylated LKB1 and AMPKα levels using western blot. The results of our study showed that compared with the control group, xylazine induced significant increases in AMPK activity in the cerebral cortex, hippocampus, thalamus and cerebellum after rats received xylazine (P < 0.01). Increased AMPK activities were accompanied with increased phosphorylation levels of LKB1 in corresponding regions of rats. The protein levels of phosphorylated LKB1 and AMPKα in these regions returned or tended to return to control group levels. However, in the brainstem, phosphorylated LKB1 and AMPKα protein levels were decreased by xylazine compared with the control (P < 0.05). In conclusion, our data indicates that xylazine alters the activities of LKB1 and AMPK in the central nervous system of rats, which suggests that xylazine affects the regulatory signaling pathway of the analgesic mechanism in the rat brain. PMID:27049320

  17. The role of surface energy in guanosine nucleotide alignment: an intriguing scenario.


    Tone, Caterina M; De Santo, Maria P; Ciuchi, Federica


    In this paper we report how the confining surfaces and the ionic effects of different concentration of guanosine solution can be used to vary the alignment of liquid crystal phases of guanosine nucleotides. Liquid crystal phases of guanosine 5'-monophosphate ammonium salt and guanosine 5'-monophosphate free acid in pure water, with and without silver sulphate, were studied by polarized optical microscope. A periodic modulation of the texture was observed. This modulation depends on both on the concentration and on the presence of silver ions in the liquid crystal phase. We demonstrate that, according to the surface energy of the alignment layers, it is possible to homeotropically align the guanosine chromonic phase without applying any external magnetic field. Finally, we report the formation of spherical, vesicle-like guanosine 5'-monophosphate aggregates, when the solution was confined between two hydrophobic surfaces containing exposed Si groups. PMID:24832053

  18. Activation of Cyclic Adenosine Monophosphate Pathway Increases the Sensitivity of Cancer Cells to the Oncolytic Virus M1.


    Li, Kai; Zhang, Haipeng; Qiu, Jianguang; Lin, Yuan; Liang, Jiankai; Xiao, Xiao; Fu, Liwu; Wang, Fang; Cai, Jing; Tan, Yaqian; Zhu, Wenbo; Yin, Wei; Lu, Bingzheng; Xing, Fan; Tang, Lipeng; Yan, Min; Mai, Jialuo; Li, Yuan; Chen, Wenli; Qiu, Pengxin; Su, Xingwen; Gao, Guangping; Tai, Phillip W L; Hu, Jun; Yan, Guangmei


    Oncolytic virotherapy is a novel and emerging treatment modality that uses replication-competent viruses to destroy cancer cells. Although diverse cancer cell types are sensitive to oncolytic viruses, one of the major challenges of oncolytic virotherapy is that the sensitivity to oncolysis ranges among different cancer cell types. Furthermore, the underlying mechanism of action is not fully understood. Here, we report that activation of cyclic adenosine monophosphate (cAMP) signaling significantly sensitizes refractory cancer cells to alphavirus M1 in vitro, in vivo, and ex vivo. We find that activation of the cAMP signaling pathway inhibits M1-induced expression of antiviral factors in refractory cancer cells, leading to prolonged and severe endoplasmic reticulum (ER) stress, and cell apoptosis. We also demonstrate that M1-mediated oncolysis, which is enhanced by cAMP signaling, involves the factor, exchange protein directly activated by cAMP 1 (Epac1), but not the classical cAMP-dependent protein kinase A (PKA). Taken together, cAMP/Epac1 signaling pathway activation inhibits antiviral factors and improves responsiveness of refractory cancer cells to M1-mediated virotherapy. PMID:26373347

  19. Involvement of NMDA receptors and L-arginine/nitric oxide/cyclic guanosine monophosphate pathway in the antidepressant-like effects of topiramate in mice forced swimming test.


    Ostadhadi, Sattar; Khan, Muhammad Imran; Norouzi-Javidan, Abbas; Chamanara, Mohsen; Jazaeri, Farahnaz; Zolfaghari, Samira; Dehpour, Ahmad-Reza


    Topiramate (TPM) is an agent primarily used in the treatment of epilepsy. Using mice model of forced swimming test (FST) the current study was basically aimed to investigate the influence of TPM on depression by inhibiting NMDA receptor and nitric oxide-cGMP production. When TPM was administered in a dose of 20 and 30 mg/kg by i.p. route it reduced the immobility time during FST. However this effect of TPM (30 mg/kg, i.p.) in the FST was abolished when the mice were pretreated either with NMDA (75 mg/kg, i.p.), or l-arginine (750 mg/kg, i.p. NO precursor), or sildenafil (5mg/kg, i.p. Phosphodiesterase 5 inhibitor). The immobility time in the FST was reduced after administration of L-NAME (10mg/kg, i.p, a non-specific NOS inhibitor), 7-nitoinidazol (30 mg/kg, i.p. a nNOS inhibitor) or MK-801 (0.05 mg/kg, i.p, a NMDA receptor antagonist) in combination with a subeffective dose of TPM (10mg/kg, i.p.) as compared with single use of either drug. Co-administrated of lower doses of MK-801 (0.01 mg/kg) or L-NAME (1mg/kg) failed to effect immobility time. However, simultaneous administration of these two agents in the same doses with subeffective dose of TPM (10mg/kg, i.p.), reduced the immobility time during FST. None of these drugs were found to have a profound effect on the locomotor activity per se during the open field test. Taken together, our data demonstrates that TPM exhibit antidepressant-like effect which is accomplished either due to inhibition of NMDA receptors or NO-cGMP production. PMID:26988103

  20. Analgesic and anti-inflammatory activities of Citrus aurantium L. blossoms essential oil (neroli): involvement of the nitric oxide/cyclic-guanosine monophosphate pathway.


    Khodabakhsh, Pariya; Shafaroodi, Hamed; Asgarpanah, Jinous


    The analgesic and anti-inflammatory properties of Citrus aurantium L. blossoms essential oil (neroli) were investigated in mice and rats. The analgesic activity of neroli was assessed by acetic acid-induced writhing and Eddy's hot plate methods, while acute and chronic anti-inflammatory effects were investigated by inflammatory paw edema in rat and the cotton pellet-induced granuloma tissue model, respectively. Mechanistic studies were conducted using L-nitro arginine methyl ester (L-NAME), an inhibitor of NO synthase. Neroli significantly decreased the number of acetic acid-induced writhes in mice compared to animals that received vehicle only. Also, it exhibited a central analgesic effect, as evidenced by a significant increase in reaction time in the hot plate method. The oil also significantly reduced carrageenan-induced paw edema in rats. The inhibitory activity of neroli (especially at 40 mg/kg) was found to be very close to the standard drug, diclofenac sodium (50 mg/kg). In cotton pellet-induced granuloma, neroli was effective regarding the transudate and granuloma formation amount. Neroli was analyzed by gas chromatography (GC) and gas chromatography-mass spectrometry (GC-MS) and twenty-three constituents, representing 91.0 % of the oil, were identified. The major components of neroli were characterized as linalool (28.5 %), linalyl acetate (19.6 %), nerolidol (9.1 %), E,E-farnesol (9.1 %), α-terpineol (4.9 %), and limonene (4.6 %), which might be responsible for these observed activities. The results suggest that neroli possesses biologically active constituent(s) that have significant activity against acute and especially chronic inflammation, and have central and peripheral antinociceptive effects which support the ethnomedicinal claims of the use of the plant in the management of pain and inflammation. PMID:25762161

  1. Plant Purine Nucleoside Catabolism Employs a Guanosine Deaminase Required for the Generation of Xanthosine in Arabidopsis[W

    PubMed Central

    Dahncke, Kathleen; Witte, Claus-Peter


    Purine nucleotide catabolism is common to most organisms and involves a guanine deaminase to convert guanine to xanthine in animals, invertebrates, and microorganisms. Using metabolomic analysis of mutants, we demonstrate that Arabidopsis thaliana uses an alternative catabolic route employing a highly specific guanosine deaminase (GSDA) not reported from any organism so far. The enzyme is ubiquitously expressed and deaminates exclusively guanosine and 2’-deoxyguanosine but no other aminated purines, pyrimidines, or pterines. GSDA belongs to the cytidine/deoxycytidylate deaminase family of proteins together with a deaminase involved in riboflavin biosynthesis, the chloroplastic tRNA adenosine deaminase Arg and a predicted tRNA-specific adenosine deaminase 2 in A. thaliana. GSDA is conserved in plants, including the moss Physcomitrella patens, but is absent in the algae and outside the plant kingdom. Our data show that xanthosine is exclusively generated through the deamination of guanosine by GSDA in A. thaliana, excluding other possible sources like the dephosphorylation of xanthosine monophosphate. Like the nucleoside hydrolases NUCLEOSIDE HYDROLASE1 (NSH1) and NSH2, GSDA is located in the cytosol, indicating that GMP catabolism to xanthine proceeds in a mostly cytosolic pathway via guanosine and xanthosine. Possible implications for the biosynthetic route of purine alkaloids (caffeine and theobromine) and ureides in other plants are discussed. PMID:24130159

  2. Mitogenic signaling pathways of growth factors can be distinguished by the involvement of pertussis toxin-sensitive guanosine triphosphate-binding protein and of protein kinase C.

    PubMed Central

    Nishizawa, N; Okano, Y; Chatani, Y; Amano, F; Tanaka, E; Nomoto, H; Nozawa, Y; Kohno, M


    We have examined the possible involvements of pertussis toxin (PT)-sensitive guanosine triphosphate (GTP)-binding protein (Gp) and protein kinase C (PKC) in the mitogenic signaling pathways of various growth factors by the use of PT-pretreated and/or 12-O-tetradecanoyl phorbol-13-acetate (TPA)-pretreated mouse fibroblasts. Effects of PT pretreatment (inactivation of PT-sensitive Gp) and TPA pretreatment (depletion of PKC) on mitogen-induced DNA synthesis varied significantly and systematically in response to growth factors: mitogenic responses of cells to thrombin, bombesin, and bradykinin were almost completely abolished both in PT- and TPA-pretreated cells; responses to epidermal growth factor (EGF), platelet-derived growth factor (PDGF), and vanadate were reduced to approximately 50% both in PT- and TPA-pretreated cells compared with native cells; response to basic fibroblast growth factor (bFGF) was not affected in PT-pretreated cells but was inhibited to some extent in TPA-pretreated cells. Thus, growth factors examined have been classified into three groups with regard to the involvements of PT-sensitive Gp and PKC in their signal transduction pathways. Binding of each growth factor to its receptor was not affected significantly by pretreatment of cells with PT or TPA. Inhibitory effects of PT and TPA pretreatment on each mitogen-induced DNA synthesis were not additive, suggesting that the functions of PT-sensitive Gp and PKC lie on an identical signal transduction pathway. Although all three groups of mitogens activated PKC, signaling of each growth factor depends to a varying extent on the function of PKC. Our results indicate that a single peptide growth factor such as EGF, PDGF, or bFGF acts through multiple signaling pathways to induce cell proliferation. Images PMID:2129194

  3. Transforming growth factor-β inhibits IQ motif containing guanosine triphosphatase activating protein 1 expression in lung fibroblasts via the nuclear factor-κB signaling pathway.


    Zong, Chuanyue; Zhang, Xianlong; Xie, Ying; Cheng, Jiawen


    IQ motif containing guanosine triphosphatase activating protein 1 (IQGAP1) is associated with idiopathic pulmonary fibrogenesis (IPF); however, characterization of the expression of IQGAP1 in lung fibroblasts has remained elusive. The present study therefore evaluated IQGAP1 expression in mouse and human lung fibroblasts under fibrotic conditions via western blot analysis. It was revealed that IQGAP1 expression levels were significantly decreased in lung fibroblasts isolated from bleomycin-challenged mice than in those of control mice. Transforming growth factor-β (TGF-β) induced differentiation, as well as decreased expression of IQGAP1 in WI-38 cells human lung fibroblasts. Furthermore, inhibition of nuclear factor (NF)-κB activation restored the TGF-β-induced inhibition of IQGAP1 expression in WI-38 cells. In lysophosphatidic acid (LPA)-challenged WI-38 cells, the expression of IQGAP1 was also decreased, while neutralized anti-TGF-β antibody treatment restored the LPA-induced inhibition of IQGAP1 expression. These data indicated that TGF-β inhibited IQGAP1 expression in lung fibroblasts via the NF-κB signaling pathway, presenting a potential novel therapeutic target for the treatment of IPF. PMID:25684348

  4. Roles of insulin, guanosine 5'-[gamma-thio]triphosphate and phorbol 12-myristate 13-acetate in signalling pathways of GLUT4 translocation.

    PubMed Central

    Todaka, M; Hayashi, H; Imanaka, T; Mitani, Y; Kamohara, S; Kishi, K; Tamaoka, K; Kanai, F; Shichiri, M; Morii, N; Narumiya, S; Ebina, Y


    Insulin, guanosine 5'-[gamma-thio]triphosphate (GTP[S] and phorbol 12-myristate 13-acetate (PMA) trigger the translocation of Gl UT4 (type 4 glucose transporter; insulin-sensitive glucose transporter) from an intracellular pool to the cell surface. We have developed a highly sensitive and quantitative method to detect GLUT4 immunologically on the surface of intact 3T3-L1 adipocytes and Chinese hamster ovary (CHO) cells, using c-myc epitope-tagged GLUT4 (GLUT4myc). We examined the roles of insulin, GTP[S] and PMA in the signalling pathways of GLUT4 translocation in the CHO cell system. Among small molecular GTP-binding proteins, ras, rab3D, rad and rho seem to be candidates as signal transmitters of insulin-stimulated GLUT4 translocation. Overexpression of wild-type H-ras and the dominant negative mutant H-rass17N in our cell system respectively enhanced and blocked insulin-stimulated activation of mitogen-activated protein kinase, but did not affect insulin-stimulated GLUT4 translocation. Overexpression of rab3D or rad in the cells did not affect GLUT4 translocation triggered by insulin, GTP[S] or PMA. Treatment with Botulinum C3 exoenzyme, a specific inhibitor of rho, had no effect on GLUT4 translocation induced by insulin, GTP[S] or PMA. Therefore these small molecular GTP-binding proteins are not likely to be involved in GLUT4 translocation. In addition, insulin, GTP[S] and PMA apparently stimulate GLUT4 translocation through independent pathways. PMID:8645171

  5. Cyclic guanosine monophosphate compartmentation in rat cardiac myocytes

    PubMed Central

    Castro, Liliana R.V.; Verde, Ignacio; Cooper, Dermot M.; Fischmeister, Rodolphe


    Background Cyclic GMP is the common second messenger for the cardiovascular effects of nitric oxide (NO) and natriuretic peptides, such as ANP or BNP, which activate, respectively, the soluble and particulate form of guanylyl cyclase. Yet, natriuretic peptides and NO-donors exert different effects on cardiac and vascular smooth muscle function. We therefore tested whether these differences are due to an intracellular compartmentation of cGMP, and evaluated the role of phosphodiesterase (PDE) subtypes in this process. Methods and Results Subsarcolemmal cGMP signals were monitored in adult rat cardiomyocytes by expression of the rat olfactory CNG channel α subunit and recording of the associated cGMP-gated current (ICNG). ANP (10 nM) or BNP (10 nM) induced a clear activation of ICNG while NO-donors (SNAP, SNP, DEANO, SIN-1, spermine NO, all at 100 μM) had little effect. The ICNG current was strongly potentiated by non-selective PDE inhibition with IBMX (100 μM) and by the PDE2 inhibitors EHNA (10 μM) and Bay 60–7550 (50 nM). Surprisingly, sildenafil, a PDE5 inhibitor, produced a dose-dependent increase of ICNG activated by NO-donors but had no effect (at 100 nM) on the current elicited by ANP. Conclusions These results indicate that, in rat cardiomyocytes: i) the ‘particulate’ cGMP pool is readily accessible at the plasma membrane, while the ‘soluble’ pool is not; ii) PDE5 controls the ‘soluble’ but not the ‘particulate’ pool, whereas the latter is under the exclusive control of PDE2. Differential spatiotemporal distributions of cGMP may therefore contribute to the specific effects of natriuretic peptides and NO-donors on cardiac function. PMID:16651469

  6. Does cyclic guanosine monophosphate induce autophagy in thyroid malignant carcinoma through down-regulation of cyclic guanosine monophosphate phosphodiesterase?


    Spoto, G; Esposito, A; Santoleri, F; Rubini, C; Rutjes, A W S; Fioroni, M; Ferrante, M; Petrini, M


    The aim of this study was to evaluate whether or not the expression of cGMP- phosphodiesterases (cGMP-PDE) varies in different thyroid pathologies and to elucidate the relationship between the expression of cGMP-PDE, cGMP, and autophagy. Fifty-four thyroid biopsy samples, excised to perform the biopsy, were split into two parts and randomly assigned: one part was microscopically examined and histological classified, and the other was frozen and analysed in order to evaluate the cGMP-PDE activity. Intracellular cGMP was also measured. A strong expression of intracellular cGMP and cGMP-PDE activity was observed in carcinoma in respect to controls and benign pathologies. The level of cGMP-PDE in papillary carcinoma without lymph node involvement (N-) was approximately four-fold higher compared to those with lymph node invasion (N±). On the contrary, the cGMP was one and a half times higher in N± than N-. Our results are promising, although further epigenetical studies are needed to confirm this association. A correlation between the cGMP-degrading activity and the severity of thyroid pathology has been shown. The decrease of cGMP-PDE and the increase of cGMP in N± papillar carcinoma could be an autophagic stimulus, a defence mechanism of the body, against the cancer that is expanding and invading other tissues and organs. PMID:27358155

  7. p210 bcr-abl confers overexpression of inosine monophosphate dehydrogenase: an intrinsic pathway to drug resistance mediated by oncogene.


    Gharehbaghi, K; Burgess, G S; Collart, F R; Litz-Jackson, S; Huberman, E; Jayaram, H N; Boswell, H S


    The p210 bcr-abl fusion protein tyrosine kinase oncogene has been implicated in the pathogenesis of chronic granulocytic leukemia (CGL). Specific intracellular functions performed by p210 bcr-abl have recently been delineated. We considered the possibility that p210 bcr-abl may also regulate the abundance of inosine 5'-monophosphate dehydrogenase (IMPDH) which is a rate-limiting enzyme for de novo guanylate synthesis. We performed studies of the inhibition of IMPDH by tiazofurin, which acts as a competitive inhibitor through its active species that mimics nicotinamide adenine dinucleotide (NAD), i.e. thiazole-4-carboxamide adenine dinucleotide (TAD). The mean inhibitory concentration (IC50) of tiazofurin for cellular proliferation inhibition was 2.3-2.8-fold greater in cells expressing p210 bcr-abl than in their corresponding parent cells proliferating under the influence of growth factors or in growth factor-independent derivative cells not expressing detectable p210 bcr-abl. IMPDH activity was 1.5-2.3-fold greater within cells expressing p210 bcr-abl than in their parent cells. This increase in enzyme activity was a result of 2-fold increased IMPDH protein as determined by immunoblotting. In addition, an increase in the Km value for NAD utilization by IMPDH was observed in p210 bcr-abl transformed cells, but this increase was within the range of resident NAD concentrations observed in the cells. Increased IMPDH protein in p210 bcr-abl transformed cells was traced to an increased level of IMP dehydrogenase II messenger RNA. Thus, regulation of IMPDH gene expression is mediated at least in part by the bcr-abl gene product and may therefore be indicative of a specific mechanism of intrinsic resistance to tiazofurin. PMID:7520100

  8. p210 Bcr-Abl confers overexpression of inosine monophosphate dehydrogenase : an intrinsic pathway to drug resistance mediated by oncogene.

    SciTech Connect

    Gharehbaghi, K.; Burgess, G. S.; Collart, F. R.; Litz-Jackson, S.; Huberman, E.; Jayaram, H. N.; Boswell, H. S.; Center for Mechanistic Biology and Biotechnology; Lab. for Experimental Oncology; Indiana Univ. School of Medicine


    The p210 bcr-abl fusion protein tyrosine kinase oncogene has been implicated in the pathogenesis of chronic granulocytic leukemia (CGL). Specific intracellular functions performed by p210 bcr-abl have recently been delineated. We considered the possibility that p210 bcr-abl may also regulate the abundance of inosine 5'-monophosphate dehydrogenase (IMPDH) which is a rate-limiting enzyme for de novo guanylate synthesis. We performed studies of the inhibition of IMPDH by tiazofurin, which acts as a competitive inhibitor through its active species that mimics nicotinamide adenine dinucleotide (NAD), i.e. thiazole-4-carboxamide adenine dinucleotide (TAD). The mean inhibitory concentration (IC50) of tiazofurin for cellular proliferation inhibition was 2.3-2.8-fold greater in cells expressing p210 bcr-abl than in their corresponding parent cells proliferating under the influence of growth factors or in growth factor-independent derivative cells not expressing detectable p210 bcr-abl. IMPDH activity was 1.5-2.3-fold greater within cells expressing p210 bcr-abl than in their parent cells. This increase in enzyme activity was a result of 2-fold increased IMPDH protein as determined by immunoblotting. In addition, an increase in the Km value for NAD utilization by IMPDH was observed in p210 bcr-abl transformed cells, but this increase was within the range of resident NAD concentrations observed in the cells. Increased IMPDH protein in p210 bcr-abl transformed cells was traced to an increased level of IMP dehydrogenase II messenger RNA. Thus, regulation of IMPDH gene expression is mediated at least in part by the bcr-abl gene product and may therefore be indicative of a specific mechanism of intrinsic resistance to tiazofurin.

  9. Kinetics of the template-directed oligomerization of guanosine 5'-phosphate-2-methylimidazolide: Effect of temperature on individual steps of reactionion

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.; Bernasconi, C. F.; Alberas, D. J.


    Non-enzymatic, template-directed reactions have been proposed as models for prebiological polynucleotide synthesis. Chemically activated mononucleotides react in the presence of a polynucleotide, acting as the template in a Watson-Crick base-pairing fashing, and form the complementary daughter polynucleotide. Phosphoimidazolide-activated nucleotides have been used successfully as substrates in these reactions. The kinetics of the guanosine 5'-monophosphate-2-methylimidazolide (2-MelmpG) reaction in aqueous pH 8.0 solutions in the presence and in the absence of polycytidylate (poly(C)) were studied, acting as the template at 6, 23, and 37 C. In the absence of the template, the major reaction pathway of 2-MelmpG is hydrolysis of the P-N bond to form the unreactive guanosine 5'-monophosphate (5'-GMP) and 2-methylimidazole. Concentrated solution of 2-MelmpG (greater than 0.02 M) in the absence of the template form only a small amount dinucleotide, (pG)2, but in the presence of poly(C), oligoguanylates, (pG)n with 2 less than or = n less than or = 40, can be detected. We were able to determine the rate constants for individual steps of this reaction. A summary of the conclusions is presented.

  10. Glycolytic pathway (GP), kreb's cycle (KC), and hexose monophosphate shunt (HMS) activity in myocardial subcellular fractions exposed to cannabinoids

    SciTech Connect

    Watson, A.T.; Manno, B.R.; King, J.W.; Fowler, M.R.; Dempsey, C.A.; Manno, J.E.


    Delta-9-tetrahydrocannabinol ( 9/-THC), the primary psychoactive component of marihuana, and its active metabolite 9/-tetrahydrocannabinol ( 9/-THC) have been reported to produce a direct cardiac depressant effect. Studies in isolated perfused rat hearts have indicated a decreased force of contraction (inotropic response) when 9/-THC or 9/-THC was administered in microgram amounts. The mechanism and site of action have not been explained or correlated with associated metabolic pathways. The purpose of this study was to investigate the effects of cannabinoids on major myocardial energy producing pathways, GP and KC, and a non-energy producing pathway, HMS. Cardiac ventricular tissue from male Sprague-Dawley rats (250-300 g) was excised and homogenized for subcellular fractionation. KC, GP and HMS activity was assayed in the appropriate fractions by measuring /sup 14/CO/sub 2/ generation from /sup 14/C-2-pyruvate, /sup 14/C-6-glucose and /sup 14/C-1-glucose respectively. Duplicate assays (n=8) were performed on tissue exposed to saline (control), empty liposomes (vehicle) and four doses each of 9/-THC and 9/-THC. Changes in metabolic activity and decreases in cardiac contractile performance may be associated.

  11. Adenosine 5'-monophosphate-activated protein kinase regulates IL-10-mediated anti-inflammatory signaling pathways in macrophages.


    Zhu, Yanfang Peipei; Brown, Jonathan R; Sag, Duygu; Zhang, Lihua; Suttles, Jill


    AMP-activated protein kinase (AMPK) is a conserved serine/threonine kinase with a critical function in the regulation of metabolic pathways in eukaryotic cells. Recently, AMPK has been shown to play an additional role as a regulator of inflammatory activity in leukocytes. Treatment of macrophages with chemical AMPK activators, or forced expression of a constitutively active form of AMPK, results in polarization to an anti-inflammatory phenotype. In addition, we reported previously that stimulation of macrophages with anti-inflammatory cytokines such as IL-10, IL-4, and TGF-β results in rapid activation of AMPK, suggesting that AMPK contributes to the suppressive function of these cytokines. In this study, we investigated the role of AMPK in IL-10-induced gene expression and anti-inflammatory function. IL-10-stimulated wild-type macrophages displayed rapid activation of PI3K and its downstream targets Akt and mammalian target of rapamycin complex (mTORC1), an effect that was not seen in macrophages generated from AMPKα1-deficient mice. AMPK activation was not impacted by treatment with either the PI3K inhibitor LY294002 or the JAK inhibitor CP-690550, suggesting that IL-10-mediated activation of AMPK is independent of PI3K and JAK activity. IL-10 induced phosphorylation of both Tyr(705) and Ser(727) residues of STAT3 in an AMPKα1-dependent manner, and these phosphorylation events were blocked by inhibition of Ca(2+)/calmodulin-dependent protein kinase kinase β, an upstream activator of AMPK, and by the mTORC1 inhibitor rapamycin, respectively. The impaired STAT3 phosphorylation in response to IL-10 observed in AMPKα1-deficient macrophages was accompanied by reduced suppressor of cytokine signaling 3 expression and an inadequacy of IL-10 to suppress LPS-induced proinflammatory cytokine production. Overall, our data demonstrate that AMPKα1 is required for IL-10 activation of the PI3K/Akt/mTORC1 and STAT3-mediated anti-inflammatory pathways regulating macrophage

  12. Targeting energy metabolic and oncogenic signaling pathways in triple-negative breast cancer by a novel adenosine monophosphate-activated protein kinase (AMPK) activator.


    Lee, Kuen-Haur; Hsu, En-Chi; Guh, Jih-Hwa; Yang, Hsiao-Ching; Wang, Dasheng; Kulp, Samuel K; Shapiro, Charles L; Chen, Ching-Shih


    The antitumor activities of the novel adenosine monophosphate-activated protein kinase (AMPK) activator, OSU-53, were assessed in in vitro and in vivo models of triple-negative breast cancer. OSU-53 directly stimulated recombinant AMPK kinase activity (EC(50), 0.3 μM) and inhibited the viability and clonogenic growth of MDA-MB-231 and MDA-MB-468 cells with equal potency (IC(50), 5 and 2 μM, respectively) despite lack of LKB1 expression in MDA-MB-231 cells. Nonmalignant MCF-10A cells, however, were unaffected. Beyond AMPK-mediated effects on mammalian target of rapamycin signaling and lipogenesis, OSU-53 also targeted multiple AMPK downstream pathways. Among these, the protein phosphatase 2A-dependent dephosphorylation of Akt is noteworthy because it circumvents the feedback activation of Akt that results from mammalian target of rapamycin inhibition. OSU-53 also modulated energy homeostasis by suppressing fatty acid biosynthesis and shifting the metabolism to oxidation by up-regulating the expression of key regulators of mitochondrial biogenesis, such as a peroxisome proliferator-activated receptor γ coactivator 1α and the transcription factor nuclear respiratory factor 1. Moreover, OSU-53 suppressed LPS-induced IL-6 production, thereby blocking subsequent Stat3 activation, and inhibited hypoxia-induced epithelial-mesenchymal transition in association with the silencing of hypoxia-inducible factor 1a and the E-cadherin repressor Snail. In MDA-MB-231 tumor-bearing mice, daily oral administration of OSU-53 (50 and 100 mg/kg) suppressed tumor growth by 47-49% and modulated relevant intratumoral biomarkers of drug activity. However, OSU-53 also induced protective autophagy that attenuated its antiproliferative potency. Accordingly, cotreatment with the autophagy inhibitor chloroquine increased the in vivo tumor-suppressive activity of OSU-53. OSU-53 is a potent, orally bioavailable AMPK activator that acts through a broad spectrum of antitumor activities. PMID

  13. Pathways of Nucleotide Biosynthesis in Mycoplasma mycoides subsp. mycoides

    PubMed Central

    Mitchell, Alana; Finch, Lloyd R.


    By measuring the specific activity of nucleotides isolated from ribonucleic acid after the incorporation of 14C-labeled precursors under various conditions of growth, we have defined the major pathways of ribonucleotide synthesis in Mycoplasma mycoides subsp. mycoides. M. mycoides did not possess pathways for the de novo synthesis of nucleotides but was capable of interconversion of nucleotides. Thus, uracil provided the requirement for both pyrimidine ribonucleotides. Thymine is also required, suggesting that the methylation step is unavailable. No use was made of cytosine. Uridine was rapidly degraded to uracil. Cytidine competed effectively with uracil to provide most of the cytidine nucleotide and also provided an appreciable proportion of uridine nucleotide. In keeping with these results, there was a slow deamination of cytidine to uridine with further degradation to uracil in cultures of M. mycoides. Guanine was capable of meeting the full requirement of the organism for purine nucleotide, presumably by conversion of guanosine 5′-monophosphate to adenosine 5′-monophosphate via the intermediate inosine 5′-monophosphate. When available with guanine, adenine effectively gave a complete provision of adenine nucleotide, whereas hypoxanthine gave a partial provision. Neither adenine nor hypoxanthine was able to act as a precursor for the synthesis of guanine nucleotide. Exogenous guanosine, inosine, and adenosine underwent rapid cleavage to the corresponding bases and so show a pattern of utilization similar to that of the latter. PMID:324972

  14. Myricetin is a novel inhibitor of human inosine 5'-monophosphate dehydrogenase with anti-leukemia activity.


    Pan, Huiling; Hu, Qian; Wang, Jingyuan; Liu, Zehui; Wu, Dang; Lu, Weiqiang; Huang, Jin


    Human inosine 5'-monophosphate dehydrogenase (hIMPDH) is a rate-limiting enzyme in the de novo biosynthetic pathway of purine nucleotides, playing crucial roles in cellular proliferation, differentiation, and transformation. Dysregulation of hIMPDH expression and activity have been found in a variety of human cancers including leukemia. In this study, we found that myricetin, a naturally occurring phytochemical existed in berries, wine and tea, was a novel inhibitor of human type 1 and type 2 IMPDH (hIMPDH1/2) with IC50 values of 6.98 ± 0.22 μM and 4.10 ± 0.14 μM, respectively. Enzyme kinetic analysis using Lineweaver-Burk plot revealed that myricetin is a mix-type inhibitor for hIMPDH1/2. Differential scanning fluorimetry and molecular docking simulation data demonstrate that myricetin is capable of binding with hIMPDH1/2. Myricetin treatment exerts potent anti-proliferative and pro-apoptotic effects on K562 human leukemia cells in a dose-dependent manner. Importantly, cytotoxicity of myricetin on K562 cells were markedly attenuated by exogenous addition of guanosine, a salvage pathway of maintaining intracellular pool of guanine nucleotides. Taking together, these results indicate that natural product myricetin exhibits potent anti-leukemia activity by interfering with purine nucleotides biosynthetic pathway through the suppression of hIMPDH1/2 catalytic activity. PMID:27378425

  15. Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction.


    Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana


    Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final

  16. The deazapurine biosynthetic pathway revealed: In vitro enzymatic synthesis of preQ0 from guanosine-5′-triphosphate in four steps†

    PubMed Central

    McCarty, Reid M.; Somogyi, Árpád; Lin, Guangxin; Jacobsen, Neil E.; Bandarian, Vahe


    Deazapurine-containing secondary metabolites comprise a broad range of structurally diverse nucleoside analogs found throughout biology including various antibiotics produced by species of Streptomyces bacteria and the hypermodified tRNA bases queuosine and archaeosine. Despite early interest in deazapurines as antibiotic, antiviral, and antineoplastic agents, the biosynthetic route toward deazapurine production has remained largely elusive for more than 40 years. Here we present the first in vitro preparation of the deazapurine nucleoside, preQ0, by the successive action of four enzymes. The pathway includes the conversion of the recently identified biosynthetic intermediate, 6-carboxy-5,6,7,8-tetrahydropterin, to a novel intermediate, 7-carboxy-7-deazaguanine (CDG), by an unusual transformation catalyzed by B. subtilis QueE, a member of the radical SAM enzyme superfamily. The carboxylate moiety on CDG is converted subsequently to a nitrile to yield preQ0 by either B. subtilis QueC or S. rimosus ToyM in an ATP-dependent reaction, in which ammonia serves as the nitrogen source. The results presented here are consistent with early radiotracer studies on deazapurine biosynthesis and provide a unified pathway for the production of deazapurines in nature. PMID:19354300

  17. Extracellular guanosine regulates extracellular adenosine levels

    PubMed Central

    Cheng, Dongmei; Jackson, Travis C.; Verrier, Jonathan D.; Gillespie, Delbert G.


    The aim of this investigation was to test the hypothesis that extracellular guanosine regulates extracellular adenosine levels. Rat preglomerular vascular smooth muscle cells were incubated with adenosine, guanosine, or both. Guanosine (30 μmol/l) per se had little effect on extracellular adenosine levels. Extracellular adenosine levels 1 h after addition of adenosine (3 μmol/l) were 0.125 ± 0.020 μmol/l, indicating rapid disposition of extracellular adenosine. Extracellular adenosine levels 1 h after addition of adenosine (3 μmol/l) plus guanosine (30 μmol/l) were 1.173 ± 0.061 μmol/l, indicating slow disposition of extracellular adenosine. Cell injury increased extracellular levels of endogenous adenosine and guanosine, and the effects of cell injury on endogenous extracellular adenosine were modulated by altering the levels of endogenous extracellular guanosine with exogenous purine nucleoside phosphorylase (converts guanosine to guanine) or 8-aminoguanosine (inhibits purine nucleoside phosphorylase). Extracellular guanosine also slowed the disposition of extracellular adenosine in rat preglomerular vascular endothelial cells, mesangial cells, cardiac fibroblasts, and kidney epithelial cells and in human aortic and coronary artery vascular smooth muscle cells and coronary artery endothelial cells. The effects of guanosine on adenosine levels were not mimicked or attenuated by 5-iodotubericidin (adenosine kinase inhibitor), erythro-9-(2-hydroxy-3-nonyl)-adenine (adenosine deaminase inhibitor), 5-aminoimidazole-4-carboxamide (guanine deaminase inhibitor), aristeromycin (S-adenosylhomocysteine hydrolase inhibitor), low sodium (inhibits concentrative nucleoside transporters), S-(4-nitrobenzyl)−6-thioinosine [inhibits equilibrative nucleoside transporter (ENT) type 1], zidovudine (inhibits ENT type 2), or acadesine (known modulator of adenosine levels). Guanosine also increases extracellular inosine, uridine, thymidine, and cytidine, yet decreases

  18. Inosine 5'-monophosphate dehydrogenase of Escherichia coli. Purification by affinity chromatography, subunit structure and inhibition by guanosine 5'-monophosphate.

    PubMed Central

    Gilbert, H J; Lowe, C R; Drabble, W T


    Escherichia coli IMP dehydrogenase (EC was purified by affinity chromatography on immobilized nucleotides. The enzyme binds to agarose-bound 8-(6-aminohexyl)-AMP, N6-(6-aminohexyl)-AMP and 8-(8-amino-octyl)-IMP but not to immobilized NAD+ or Cibacron Blue F3G-A. AMP proved to be an effective eluent. A large-scale purification scheme in which 8-(6-aminohexyl)-AMP-agarose was used resulted in a homogeneous preparation of IMP dehydrogenase. The enzyme was also purified by immunoprecipitation with monospecific antisera. Sodium dodecyl sulphate/polyacrylamide-gel electrophoresis, N-terminal amino acid analysis and tryptic 'finger-printing' demonstrated that IMP dehydrogenase comprises identical subunits of mol.wt. 58000. Trypsin and Pronase cleave the 58000-mol.wt. subunit into peptides of mol.wts. 42000 and 14000, with a concomitant decrease in enzyme activity. These observations rationalize much of the contradictory data on the subunit composition of the enzyme found in the literature. GMP appears to be a competitive inhibitor with respect to IMP, with no evidence for regulatory behaviour being found. The two purification procedures were also used to purify inactive mutant enzymes from guaB mutant strains of E. coli. PMID:44191


    PubMed Central

    Bemer, Meagan J.; Risler, Linda J.; Phillips, Brian R.; Wang, Joanne; Storer, Barry E.; Sandmaier, Brenda M.; Duan, Haichuan; Raccor, Brianne S.; Boeckh, Michael J.; McCune, Jeannine S.


    Mycophenolic acid, the active metabolite of mycophenolate mofetil (MMF), inhibits inosine monophosphate dehydrogenase (IMPDH) activity. IMPDH is the rate-limiting enzyme involved in de novo synthesis of guanosine nucleotides and catalyzes the oxidation of inosine 5’- monophosphate (IMP) to xanthosine 5’-monophosphate (XMP). We developed a highly sensitive liquid chromatography–mass spectrometry method to quantitate XMP concentrations in peripheral blood mononuclear cells (PMNC) isolated from the recipient pretransplant and used this method to determine IMPDH activity in 86 nonmyeloablative allogeneic hematopoietic cell transplantation (HCT) patients. The incubation procedure and analytical method yielded acceptable within-sample and within-individual variability. Considerable between-individual variability was observed (12.2-fold). Low recipient pretransplant IMPDH activity was associated with increased day +28 donor T-cell chimerism, more acute graft-versus-host disease (GVHD), lower neutrophil nadirs, and more cytomegalovirus reactivation, but not with chronic GVHD, relapse, non-relapse mortality, or overall mortality. We conclude that quantitation of the recipient’s pretransplant IMPDH activity in PMNC lysate could provide a useful biomarker to evaluate a recipient’s sensitivity to MMF, but confirmatory studies are needed. Further trials should be conducted to confirm our findings and to optimize postgrafting immunosuppression in nonmyeloablative HCT recipients. PMID:24923537

  20. Human gonadotropin-releasing hormone receptor gene transcription: up-regulation by 3',5'-cyclic adenosine monophosphate/protein kinase A pathway.


    Cheng, K W; Leung, P C


    Transient transfection of mouse gonadotrope-derived (alphaT3-1) cells with a 2297 bp human GnRHR promoter-luciferase construct (p2300-LucF) showed a dose- and time-dependent increase in the human gonodotropin-releasing hormone receptor (GnRHR) promoter activity after forskolin treatment. An average of 4.8-fold increase in promoter activity was observed after 12 h of 10 microM forskolin treatment. This effect was mimicked by administration of cholera toxin, cAMP analog or pituitary adenylate cyclase activating polypeptide 38 (PACAP). A specific adenylate cyclase (AC) inhibitor (ACI) or protein kinase A (PKA) inhibitor (PKAI) pretreatment reversed the forskolin- and PACAP-induced increase in the human GnRHR promoter activity. These results not only confirm the stimulatory effect of Cyclic adenosine monophosphate (cAMP) in human GnRHR promoter activation, but also suggest that hormones or neurotransmitters that activate adenylate cyclase in pituitary gonadotropes may increase the expression of human GnRHR gene in transcriptional level. Progressive 5' deletion assays identified a 412 bp fragment (-577 to 167) in the human GnRHR 5'-flanking region that is essential in maintaining the basal responsiveness to cAMP. Mutagenesis coupled with functional studies have identified two putative AP-1/CREB binding sites, namely hGR-AP/CRE-1 and hGR-AP/CRE-2 that participated in mediating the cAMP-stimulatory effect. Mutation of the putative hGR-AP/CRE-1 and hGR-CRE-2 resulted in a 38 and 32% decrease in the forskolin-induced stimulation. However, mutation of both binding sites did not completely abolish the cAMP-stimulatory effect, suggesting that multiple transcription factor binding sites were involved in full response in cAMP stimulation. The binding of CREB to these motifs was confirmed by gel mobility shift assay and antibody supershift assay. PMID:11476937

  1. Vasoactive intestinal peptide attenuates liver ischemia/reperfusion injury in mice via the cyclic adenosine monophosphate-protein kinase a pathway.


    Ji, Haofeng; Zhang, Yu; Liu, Yuanxing; Shen, Xiu-Da; Gao, Feng; Nguyen, Terry T; Busuttil, Ronald W; Waschek, James A; Kupiec-Weglinski, Jerzy W


    Hepatic ischemia/reperfusion injury (IRI), an exogenous, antigen-independent, local inflammation response, occurs in multiple clinical settings, including liver transplantation, hepatic resection, trauma, and shock. The nervous system maintains extensive crosstalk with the immune system through neuropeptide and peptide hormone networks. This study examined the function and therapeutic potential of the vasoactive intestinal peptide (VIP) neuropeptide in a murine model of liver warm ischemia (90 minutes) followed by reperfusion. Liver ischemia/reperfusion (IR) triggered an induction of gene expression of intrinsic VIP; this peaked at 24 hours of reperfusion and coincided with a hepatic self-healing phase. Treatment with the VIP neuropeptide protected livers from IRI; this was evidenced by diminished serum alanine aminotransferase levels and well-preserved tissue architecture and was associated with elevated intracellular cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) signaling. The hepatocellular protection rendered by VIP was accompanied by diminished neutrophil/macrophage infiltration and activation, reduced hepatocyte necrosis/apoptosis, and increased hepatic interleukin-10 (IL-10) expression. Strikingly, PKA inhibition restored liver damage in otherwise IR-resistant VIP-treated mice. In vitro, VIP not only diminished macrophage tumor necrosis factor α/IL-6/IL-12 expression in a PKA-dependent manner but also prevented necrosis/apoptosis in primary mouse hepatocyte cultures. In conclusion, our findings document the importance of VIP neuropeptide-mediated cAMP-PKA signaling in hepatic homeostasis and cytoprotection in vivo. Because the enhancement of neural modulation differentially regulates local inflammation and prevents hepatocyte death, these results provide the rationale for novel approaches to managing liver IRI in transplant patients. PMID:23744729

  2. Regulation of Phospholipid Synthesis in Escherichia coli by Guanosine Tetraphosphate

    PubMed Central

    Merlie, John P.; Pizer, Lewis I.


    Phospholipid synthesis has been reported to be subject to stringent control in Escherichia coli. We present evidence that demonstrates a strict correlation between guanosine tetraphosphate accumulation and inhibition of phospholipid synthesis. In vivo experiments designed to examine the pattern of phospholipid labeling with 32P-inorganic phosphate and 32P-sn-glycerol-3-phosphate suggest that regulation must occur at the glycerol-3-phosphate acyltransferase step. Assay of phospholipid synthesis by cell-free extracts and semipurified preparations revealed that guanosine tetraphosphate inhibits at least two enzymes specific for the biosynthetic pathway, sn-glycerol-3-phosphate acyltransferase as well as sn-glycerol-3-phosphate phosphatidyl transferase. These findings provide a biochemical basis for the stringent control of lipid synthesis as well as regulation of steady-state levels of phospholipid in growing cells. Images PMID:4583220

  3. Nucleotides as nucleophiles: reactions of nucleotides with phosphoimidazolide activated guanosine

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.; Rosenbach, M. T.; Hurley, T. B.


    An earlier study of the reaction of phosphoimidazolide activated nucleosides (ImpN) in aqueous phosphate buffers indicated two modes of reaction of the phosphate monoanion and dianion. The first mode is catalysis of the hydrolysis of the P-N bond in ImpN's which leads to imidazole and nucleoside 5'-monophosphate. The second represents a nucleophilic substitution of the imidazole to yield the nucleoside 5'-diphosphate. This earlier study thus served as a model for the reaction of ImpN with nucleoside monophosphates (pN) because the latter can be regarded as phosphate derivatives. In the present study we investigated the reaction of guanosine 5'-phosphate-2-methylimidazolide, 2-MeImpG, in the presence of pN (N = guanosine, adenosine and uridine) in the range 6.9 less than or equal to pH less than or equal to 7.7. We observed that pN's do act as nucleophiles to form NppG, and as general base to enhance the hydrolysis of the P-N bond in 2-MeImpG, i.e. pN show the same behavior as inorganic phosphate. The kinetic analysis yields the following rate constants for the dianion pN2-: knpN = 0.17 +/- 0.02 M-1 h-1 for nucleophilic attack and khpN = 0.11 +/- 0.07 M-1 h-1 for general base catalysis of the hydrolysis. These rate constants which are independent of the nucleobase compare with kp.2 = 0.415 M-1 h-1 and khp2. = 0.217 M-1 h-1 for the reactions of HPO4(2-). In addition, this study shows that under conditions where pN presumably form stacks, the reaction mechanism remains unchanged although in quantitative terms stacked pN are somewhat less reactive. Attack by the 2'-OH and 3'-OH groups of the ribose moiety in amounts greater than or equal to 1% is not observed; this is attributed to the large difference in nucleophilicity in the neutral pH range between the phosphate group and the ribose hydroxyls. This nucleophilicity rank is not altered by stacking.

  4. Conservation and divergence of the cyclic adenosine monophosphate-protein kinase A (cAMP–PKA) pathway in two plant-pathogenic fungi: Fusarium graminearum and F. verticillioides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cyclic AMP (cAMP)-PKA pathway is a central signaling cascade that transmits extracellular stimuli and governs cell responses through the second messenger cAMP. The importance of cAMP signaling in fungal biology has been well documented. Two key conserved components, adenylate cyclase (AC) and ca...

  5. Regulation by guanosine 3':5'-cyclic monophosphate of phospholipid methylation during chemotaxis in Dictyostelium discoideum.

    PubMed Central

    Alemany, S; García Gil, M; Mato, J M


    In Dictyostelium discoideum, the chemoattractant cyclic AMP activates the enzyme guanylate cyclase, giving a brief up to 10-fold increase in the intracellular cyclic GMP content. The addition of physiological cyclic GMP concentrations to a homogenate of D. discoideum cells markedly increased the incorporation of the 3H-labeled methyl group from S-adenosyl-L-[methyl-3H]methionine into mono- and dimethylated phosphatidylethanolamine and phosphatidylcholine. Lipid methylation was inhibited by S-adenosyl-L-homocysteine, which inhibits transmethylation. When whole cells prelabeled with L-[methyl-3H]methionine were exposed to cyclic AMP, a rapid transient increase in the amount of [methyl-3H]phosphatidylcholine was observed. The time course of [methyl-3H]phosphatidylcholine formation agrees with its being mediated by the intracellular increase in cyclic GMP originating during chemotactic stimulation. Addition of the 8-Br derivative of cyclic GMP to whole cells also increased the levels of labeled phosphatidylcholine. It is therefore likely that cyclic GMP contributes to chemotaxis by regulating membrane function via phospholipid methylation. PMID:6261233

  6. Tissue distribution and metabolism of guanosine in rats following intraperitoneal injection.


    Giuliani, P; Ballerini, P; Ciccarelli, R; Buccella, S; Romano, S; D'Alimonte, I; D' Alimonte, I; Poli, A; Beraudi, A; Peña, E; Jiang, S; Rathbone, M P; Caciagli, F; Di Iorio, P


    Guanosine has long been known as an endogenous purine nucleoside deeply involved in the modulation of several intracellular processes, especially G-protein activity. More recently, it has been reported to act as an extracellular signaling molecule released from neurons and, more markedly, from astrocytes either in basal conditions or after different kinds of stimulation including hypoxia. Moreover, in vivo studies have shown that guanosine plays an important role as both a neuroprotective and neurotrophic agent in the central nervous system. Specific high-affinity binding sites for this nucleoside have been found on membrane preparations from rat brain. The present study was undertaken to investigate the distribution and metabolic profiles of guanosine after administering the nucleoside to gain a better understanding of the biological effects of this potential drug candidate. Rats were given an intraperitonal (i.p.) injection of 2, 4, 8 or 16 mg/kg of guanosine combined with 0.05% of [3H]guanosine. Plasma samples were collected 7.5, 15, 30, 60 and 90 min after the guanosine-mixture administration and analyzed by either a liquid scintillation counter or by HPLC connected to a UV and to an on-line radiochemical detector to measure the levels of guanosine and its metabolic products guanine, xanthine and uric acid. The levels of guanosine, guanine and xanthine were also measured in brain, lung, heart, kidney and liver tissue homogenates at the defined time points after the injection of 8 mg/kg of the guanosine-mixture. We found that the levels of radioactivity in plasma increased linearly in a dose- and time-dependent manner. Guanosine was widely distributed in all tissues examined in the present study, at almost twice its usual levels. In addition, guanine levels dramatically increased in all the organs. Interestingly, enzymatic analysis of the plasma samples showed the presence of a soluble purine nucleoside phosphorylase, a key enzyme in the purine salvage pathway

  7. Guanosine nucleotide precursor for flavinogenesis of Eremothecium Ashbyii.


    Mitsuda, H; Nakajima, K


    The purine precursor in the riboflavin biosynthetic pathway in Eremothecium ashbyii was examined using a guanine analogue, 8-azaguanine, with non-growing cell systems. 1. Riboflavin formation in the culture filtrate was determined at 0, 5, 10 and 20 hr after start of the incubation of the non-growing cells in the presence of xanthine or 8-azaguanine (1 mM, respectively). At 20 hr of incubation, the addition of xanthine stimulated riboflavin formation by 36% and the addition of 8-azaguanine inhibited the formation by 57%. 2. Acid soluble nucleotide pools in the cells were followed at 0, 5, 10 and 20 hr of the incubation period in the presence of xanthine or 8-azaguanine by means of anion exchange column chromatography. The result showed that the GTP pool changed markedly despite the fact that the adenosine nucleotide pool was almost constant irrespective of the presence or absence of these purines till 10 hr of incubation. But, the decrease of the former was overcome in part by the addition of flavinogenic xanthine. Furthermore, the total amounts of GTP and guanosine accumulated in cells in the presence of 8-azaguanine reached the maximum already at 5 hr, attaining a level twice as much as the GTP contents of the control. 3. The role of guanosine nucleotide pool in riboflavin formation was further examined using 8-azaguanine. In this experiment the drug was added to the suspension of non-growing cells at 3 hr or 6 hr after the incubation was started and the reaction was continued till the 12th hr. A more clear-cut correlationship between riboflavin formation and guanosine nucleotide pool was oberved by this experiment. The guanosine nucleotide pool (consisting of GMP, GDP and GTP) increased simultaneously with the inhibition of riboflavin formation. Of the guanosine nucleotides pools, the GMP pool increased 2.7 times above normal upon the addition of 8-azaguanine during the incubation for 6 hr and 5.3 fold for 9 hr. While, the GTP pool increased 1.9 fold above

  8. A long-acting β2-adrenergic agonist increases the expression of muscarine cholinergic subtype-3 receptors by activating the β2-adrenoceptor cyclic adenosine monophosphate signaling pathway in airway smooth muscle cells

    PubMed Central



    The persistent administration of β2-adrenergic (β2AR) agonists has been demonstrated to increase the risk of severe asthma, partly due to the induction of tolerance to bronchoprotection via undefined mechanisms. The present study investigated the potential effect of the long-acting β2-adrenergic agonist, formoterol, on the expression of muscarinic M3 receptor (M3R) in rat airway smooth muscle cells (ASMCs). Primary rat ASMCs were isolated and characterized following immunostaining with anti-α-smooth muscle actin antibodies. The protein expression levels of M3R and phospholipase C-β1 (PLCβ1) were characterized by western blot analysis and the production of inositol 1,4,5-trisphosphate (IP3) was determined using an enzyme-linked immunosorbent assay. Formoterol increased the protein expression of M3R in rat ASMCs in a time- and dose-dependent manner, which was significantly inhibited by the β2AR antagonist, ICI118,551 and the cyclic adenosine monophosphate (cAMP) inhibitor, SQ22,536. The increased protein expression of M3R was positively correlated with increased production of PLCβ1 and IP3. Furthermore, treatment with the glucocorticoid, budesonide, and the PLC inhibitor, U73,122, significantly suppressed the formoterol-induced upregulated protein expression levels of M3R and PLCβ1 and production of IP3. The present study demonstrated that formoterol mediated the upregulation of M3R in the rat ASMCs by activating the β2AR-cAMP signaling pathway, resulting in increased expression levels of PLCβ1 and IP3, which are key to inducing bronchoprotection tolerance. Administration of glucocorticoids or a PLC antagonist prevented formoterol-induced bronchoprotection tolerance by suppressing the protein expression of M3R. PMID:25672589

  9. Analysis of Nucleotide 5'-Monophosphates in Infant Formulas by HPLC-UV: Collaborative Study, Final Action 2011.20.


    Gill, Brendon D; Indyk, Harvey E


    A collaborative study was conducted on AOAC First Action Method 2011.20: 5'-Mononucleotides in Infant Formula and Adult/Pediatric Nutritional Formula. After the successful analysis of National Institute of Standards and Technology (NIST) 1849a Standard Reference Material (SRM) as a practice sample, 12 laboratories participated in the analysis of duplicate samples of six different infant formula products. The samples were dissolved in high-salt solution to inhibit protein and fat interactions, with the nucleotides [uridine 5'-monophosphate (UMP), inosine 5'-monophosphate (IMP), adenosine 5'-monophosphate (AMP), guanosine 5'-monophosphate (GMP), and cytidine 5'-monophosphate (CMP)] separated from the sample matrix by strong-anion exchange SPE, followed by chromatographic analysis using a C18 stationary phase with gradient elution, UV detection, and quantitation by an internal standard technique using thymidine 5'-monophosphate. For nucleotide-supplemented products, precision is within the Standard Method Performance RequirementsSM (SMPR) 2011.008 target reproducibility limit of ≤11%, with the reproducibility RSD (RSDR) estimated at 7.1-8.7% for CMP, 7.9-9.0% for UMP, 2.8-7.7% for GMP, 5.5-10.3% for IMP, and 2.7-6.2% for AMP, and Horwitz ratio (HorRat) values of 0.9-1.0 for CMP, 0.9-1.0 for UMP, 0.3-0.7 for GMP, 0.6-1.0 for IMP, and 0.3-0.7 for AMP. PMID:26268980

  10. Recipient pretransplant inosine monophosphate dehydrogenase activity in nonmyeloablative hematopoietic cell transplantation.


    Bemer, Meagan J; Risler, Linda J; Phillips, Brian R; Wang, Joanne; Storer, Barry E; Sandmaier, Brenda M; Duan, Haichuan; Raccor, Brianne S; Boeckh, Michael J; McCune, Jeannine S


    Mycophenolic acid, the active metabolite of mycophenolate mofetil (MMF), inhibits inosine monophosphate dehydrogenase (IMPDH) activity. IMPDH is the rate-limiting enzyme involved in de novo synthesis of guanosine nucleotides and catalyzes the oxidation of inosine 5'-monophosphate to xanthosine 5'-monophosphate (XMP). We developed a highly sensitive liquid chromatography-mass spectrometry method to quantitate XMP concentrations in peripheral blood mononuclear cells (PMNCs) isolated from the recipient pretransplant and used this method to determine IMPDH activity in 86 nonmyeloablative allogeneic hematopoietic cell transplantation (HCT) patients. The incubation procedure and analytical method yielded acceptable within-sample and within-individual variability. Considerable between-individual variability was observed (12.2-fold). Low recipient pretransplant IMPDH activity was associated with increased day +28 donor T cell chimerism, more acute graft-versus-host disease (GVHD), lower neutrophil nadirs, and more cytomegalovirus reactivation but not with chronic GVHD, relapse, nonrelapse mortality, or overall mortality. We conclude that quantitation of the recipient's pretransplant IMPDH activity in PMNC lysate could provide a useful biomarker to evaluate a recipient's sensitivity to MMF. Further trials should be conducted to confirm our findings and to optimize postgrafting immunosuppression in nonmyeloablative HCT recipients. PMID:24923537

  11. A positive entropy change for guanosine binding and for the chemical step in the Tetrahymena ribozyme reaction.


    McConnell, T S; Cech, T R


    The ribozyme derived from the group I intron of Tetrahymena thermophila binds an exogenous guanosine nucleotide, which acts as the nucleophile in the sequence-specific cleavage of oligonucleotides. By examining the temperature dependence of the reaction under conditions where Km = Kd, we conclude the following: (1) Guanosine 5'-monophosphate (pG) binds to the closed ribozyme-oligonucleotide substrate complex with a positive entropy change (delta S degree' = +23 eu) and an enthalpy change (delta H degree') close to zero. This is contrary to the expectation that binding would cause increased order (negative delta S degree) and be driven by a negative delta H degree. (2) Inosine and 2-aminopurine riboside, each lacking two hydrogen-bonding moieties relative to guanosine, also bind with a positive entropy value and an unfavorable (positive) delta H degree'. From this result, we suggest that the hydrogen-bonding moieties make an enthalpic contribution to guanosine binding overcoming an intrinsic unfavorable delta H. (3) At 0 degree C, there is equally tight binding of pG in the presence and absence of oligonucleotide substrate bound to the ribozyme. Thus, energetic interactions responsible for the thermodynamic coupling between pG and oligonucleotide substrate binding seen at higher temperatures are indirect. (4) The activation barrier of the chemical step is stabilized by a positive delta S++ (+31 to 39 eu). This stabilization is seen in four reactions using substrates with two different leaving groups in the presence and absence of pG, suggesting that the entropic contribution is inherent to the active site. The positive delta S values for the chemical step and for the binding of pG can be explained by a conformational change or release of water. Thus, although hydrogen bonding contributes to binding of nucleotides to this RNA enzyme as previously thought, it is these other events which produce a positive delta S that provide the energetic driving force for binding

  12. Genetics Home Reference: adenosine monophosphate deaminase deficiency


    Skip to main content Your Guide to Understanding Genetic Conditions Enable Javascript for addthis links to activate. ... Conditions Genes Chromosomes & mtDNA Resources Help Me Understand Genetics Home Health Conditions adenosine monophosphate deaminase deficiency adenosine ...

  13. Inhibitory effects of total saponin from Korean Red Ginseng on [Ca2+]i mobilization through phosphorylation of cyclic adenosine monophosphate-dependent protein kinase catalytic subunit and inositol 1,4,5-trisphosphate receptor type I in human platelets

    PubMed Central

    Shin, Jung-Hae; Kwon, Hyuk-Woo; Cho, Hyun-Jeong; Rhee, Man Hee; Park, Hwa-Jin


    Background Intracellular Ca2+([Ca2+]i) is a platelet aggregation-inducing molecule. Therefore, understanding the inhibitory mechanism of [Ca2+]i mobilization is very important to evaluate the antiplatelet effect of a substance. This study was carried out to understand the Ca2+-antagonistic effect of total saponin from Korean Red Ginseng (KRG-TS). Methods We investigated the Ca2+-antagonistic effect of KRG-TS on cyclic nucleotides-associated phosphorylation of inositol 1,4,5-trisphosphate receptor type I (IP3RI) and cyclic adenosine monophosphate (cAMP)-dependent protein kinase (PKA) in thrombin (0.05 U/mL)-stimulated human platelet aggregation. Results The inhibition of [Ca2+]i mobilization by KRG-TS was increased by a PKA inhibitor (Rp-8-Br-cAMPS), which was more stronger than the inhibition by a cyclic guanosine monophosphate (cGMP)-dependent protein kinase (PKG) inhibitor (Rp-8-Br-cGMPS). In addition, Rp-8-Br-cAMPS inhibited phosphorylation of PKA catalytic subunit (PKAc) (Thr197) by KRG-TS. The phosphorylation of IP3RI (Ser1756) by KRG-TS was very strongly inhibited by Rp-8-Br-cAMPS compared with that by Rp-8-Br-cGMPS. These results suggest that the inhibitory effect of [Ca2+]i mobilization by KRG-TS is more strongly dependent on a cAMP/PKA pathway than a cGMP/PKG pathway. KRG-TS also inhibited the release of adenosine triphosphate and serotonin. In addition, only G-Rg3 of protopanaxadiol in KRG-TS inhibited thrombin-induced platelet aggregation. Conclusion These results strongly indicate that KRG-TS is a potent beneficial compound that inhibits [Ca2+]i mobilization in thrombin–platelet interactions, which may result in the prevention of platelet aggregation-mediated thrombotic disease. PMID:26869828

  14. cGMP/cGMP-dependent protein kinase pathway modulates nicotine-induced currents through the activation of α-bungarotoxin-insensitive nicotinic acetylcholine receptors from insect neurosecretory cells.


    Mannai, Safa; Bitri, Lofti; Thany, Steeve H


    Insect neurosecretory cells, called dorsal unpaired median neurons, are known to express two α-bungarotoxin-insensitive nicotinic acetylcholine receptor (nAChR) subtypes, nAChR1 and nAChR2. It was demonstrated that nAChR1 was sensitive to cAMP/cAMP-dependent protein kinase (PKA) regulation, resulting in a modulation of nicotine currents. In this study, we show that cyclic guanosine monophosphate (cGMP)/cGMP-dependent protein kinase (PKG) pathway modulates nicotine-induced currents, as increased cGMP affects the second compound of the biphasic current-voltage curve, corresponding to the nAChR2 receptors. Indeed, maintaining the guanosine triphosphate level with 100 μM guanosine triphosphate-γ-S increased nicotine currents through nAChR2. We also demonstrated that inhibition of PKG activity with 0.2 μM (8R,9S,11S)-(-)-9-methoxy-carbamyl-8-methyl-2,3,9,10-tetrahydro-8,11-epoxy-1H,8H,11H-2,7b,11a-trizadibenzo-(a,g)-cycloocta-(c,d,e)-trinden-1-one (KT5823), a PKG specific inhibitor, reduced nicotine-induced current amplitudes. KT5823 effect on nicotine currents is associated with calcium (Ca(2+) ) activity because inhibition of Ca(2+) concentration with cadmium chloride (CdCl2 ) abolished KT5823-induced inhibition mediated by nAChR2. However, specific inhibition of nitric oxide-guanylyl cyclase (GC) complex by 10 μM 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ) significantly increased nicotine-induced current amplitudes on both nAChR1 and nAChR2. These results suggest that nicotine-induced currents mediated by both α-bungarotoxin-insensitive nAChR1 and nAChR2 are coupled to the cGMP/PKG pathway. We propose that nicotinic acetylcholine receptor activation induces an increase in intracellular calcium (Ca(2+) ) concentration. Elevation of intracellular Ca(2+) results in the formation of Ca(2+) -calmodulin (CaM) complex, which activates guanylyl cyclase (GC) and/or adenylyl cyclase (AC). Ca(2+) -CaM complex could activate Ca(2+) calmodulin kinase II which

  15. Guanosine effect on cholesterol efflux and apolipoprotein E expression in astrocytes.


    Ballerini, Patrizia; Ciccarelli, Renata; Di Iorio, Patrizia; Buccella, Silvana; D'Alimonte, Iolanda; Giuliani, Patricia; Masciulli, Arianna; Nargi, Eleonora; Beraudi, Alina; Rathbone, Michel P; Caciagli, Francesco


    The main source of cholesterol in the central nervous system (CNS) is represented by glial cells, mainly astrocytes, which also synthesise and secrete apolipoproteins, in particular apolipoprotein E (ApoE), the major apolipoprotein in the brain, thus generating cholesterol-rich high density lipoproteins (HDLs). This cholesterol trafficking, even though still poorly known, is considered to play a key role in different aspects of neuronal plasticity and in the stabilisation of synaptic transmission. Moreover, cell cholesterol depletion has recently been linked to a reduction in amyloid beta formation. Here we demonstrate that guanosine, which we previously reported to exert several neuroprotective effects, was able to increase cholesterol efflux from astrocytes and C6 rat glioma cells in the absence of exogenously added acceptors. In this effect the phosphoinositide 3 kinase/extracellular signal-regulated kinase 1/2 (PI3K/ERK1/2) pathway seems to play a pivotal role. Guanosine was also able to increase the expression of ApoE in astrocytes, whereas it did not modify the levels of ATP-binding cassette protein A1 (ABCA1), considered the main cholesterol transporter in the CNS. Given the emerging role of cholesterol balance in neuronal repair, these effects provide evidence for a role of guanosine as a potential pharmacological tool in the modulation of cholesterol homeostasis in the brain. PMID:18404467

  16. 2'-Modified Guanosine Analogs for the Treatment of HCV.


    Girijavallabhan, Vinay; Arasappan, Ashok; Bennett, Frank; Chen, Kevin; Dang, Qun; Huang, Ying; Kerekes, Angela; Nair, Latha; Pissarnitski, Dmitri; Verma, Vishal; Alvarez, Carmen; Chen, Ping; Cole, David; Esposite, Sara; Huang, Yuhua; Hong, Qingmei; Liu, Zhidan; Pan, Weidong; Pu, Haiyan; Rossman, Randall; Truong, Quang; Vibulbhan, Bancha; Wang, Jun; Zhao, Zhiqiang; Olsen, David; Stamford, Andrew; Bogen, Stephane; Njoroge, F George


    Novel 2'-modified guanosine nucleosides were synthesized from inexpensive starting materials in 7-10 steps via hydroazidation or hydrocyanation reactions of the corresponding 2'-olefin. The antiviral effectiveness of the guanosine nucleosides was evaluated by converting them to the corresponding 5'-O-triphosphates (compounds 38-44) and testing their biochemical inhibitory activity against the wild-type NS5B polymerase. PMID:27104963

  17. Discovery of Inhibitors of Leishmania β-1,2-Mannosyltransferases Using a Click-Chemistry-Derived Guanosine Monophosphate Library

    PubMed Central

    van der Peet, Phillip; Ralton, Julie E.; McConville, Malcolm J.; Williams, Spencer J.


    Leishmania spp. are a medically important group of protozoan parasites that synthesize a novel intracellular carbohydrate reserve polymer termed mannogen. Mannogen is a soluble homopolymer of β-1,2-linked mannose residues that accumulates in the major pathogenic stages in the sandfly vector and mammalian host. While several steps in mannogen biosynthesis have been defined, none of the enzymes have been isolated or characterized. We report the development of a simple assay for the GDP-mannose–dependent β-1,2-mannosyltransferases involved in mannogen synthesis. This assay utilizes octyl α-d-mannopyranoside to prime the formation of short mannogen oligomers up to 5 mannose residues. This assay was used to screen a focussed library of 44 GMP-triazole adducts for inhibitors. Several compounds provided effective inhibition of mannogen β-1,2-mannosyltransferases in a cell-free membrane preparation. This assay and inhibitor compounds will be useful for dissecting the role of different mannosyltransferases in regulating de novo biosynthesis and elongation reactions in mannogen metabolism. PMID:22393429

  18. Early glycogen synthase kinase-3β and protein phosphatase 2A independent tau dephosphorylation during global brain ischaemia and reperfusion following cardiac arrest and the role of the adenosine monophosphate kinase pathway.


    Majd, Shohreh; Power, John H T; Koblar, Simon A; Grantham, Hugh J M


    Abnormal tau phosphorylation (p-tau) has been shown after hypoxic damage to the brain associated with traumatic brain injury and stroke. As the level of p-tau is controlled by Glycogen Synthase Kinase (GSK)-3β, Protein Phosphatase 2A (PP2A) and Adenosine Monophosphate Kinase (AMPK), different activity levels of these enzymes could be involved in tau phosphorylation following ischaemia. This study assessed the effects of global brain ischaemia/reperfusion on the immediate status of p-tau in a rat model of cardiac arrest (CA) followed by cardiopulmonary resuscitation (CPR). We reported an early dephosphorylation of tau at its AMPK sensitive residues, Ser(396) and Ser(262) after 2 min of ischaemia, which did not recover during the first two hours of reperfusion, while the tau phosphorylation at GSK-3β sensitive but AMPK insensitive residues, Ser(202) /Thr(205) (AT8), as well as the total amount of tau remained unchanged. Our data showed no alteration in the activities of GSK-3β and PP2A during similar episodes of ischaemia of up to 8 min and reperfusion of up to 2 h, and 4 weeks recovery. Dephosphorylation of AMPK followed the same pattern as tau dephosphorylation during ischaemia/reperfusion. Catalase, another AMPK downstream substrate also showed a similar pattern of decline to p-AMPK, in ischaemic/reperfusion groups. This suggests the involvement of AMPK in changing the p-tau levels, indicating that tau dephosphorylation following ischaemia is not dependent on GSK-3β or PP2A activity, but is associated with AMPK dephosphorylation. We propose that a reduction in AMPK activity is a possible early mechanism responsible for tau dephosphorylation. PMID:27177932

  19. GMP synthase is essential for viability and infectivity of Trypanosoma brucei despite a redundant purine salvage pathway.


    Li, Qiong; Leija, Christopher; Rijo-Ferreira, Filipa; Chen, Jun; Cestari, Igor; Stuart, Kenneth; Tu, Benjamin P; Phillips, Margaret A


    The causative agent of human African trypanosomiasis, Trypanosoma brucei, lacks de novo purine biosynthesis and depends on purine salvage from the host. The purine salvage pathway is redundant and contains two routes to guanosine-5'-monophosphate (GMP) formation: conversion from xanthosine-5'-monophosphate (XMP) by GMP synthase (GMPS) or direct salvage of guanine by hypoxanthine-guanine phosphoribosyltransferase (HGPRT). We show recombinant T. brucei GMPS efficiently catalyzes GMP formation. Genetic knockout of GMPS in bloodstream parasites led to depletion of guanine nucleotide pools and was lethal. Growth of gmps null cells was only rescued by supraphysiological guanine concentrations (100 μM) or by expression of an extrachromosomal copy of GMPS. Hypoxanthine was a competitive inhibitor of guanine rescue, consistent with a common uptake/metabolic conversion mechanism. In mice, gmps null parasites were unable to establish an infection demonstrating that GMPS is essential for virulence and that plasma guanine is insufficient to support parasite purine requirements. These data validate GMPS as a potential therapeutic target for treatment of human African trypanosomiasis. The ability to strategically inhibit key metabolic enzymes in the purine pathway unexpectedly bypasses its functional redundancy by exploiting both the nature of pathway flux and the limited nutrient environment of the parasite's extracellular niche. PMID:26043892

  20. GMP synthase is essential for viability and infectivity of Trypanosoma brucei despite a redundant purine salvage pathway

    PubMed Central

    Li, Qiong; Leija, Christopher; Rijo-Ferreira, Filipa; Chen, Jun; Cestari, Igor; Stuart, Kenneth; Tu, Benjamin P.; Phillips, Margaret A.


    Summary The causative agent of human African trypanosomiasis, Trypanosoma brucei, lacks de novo purine biosynthesis and depends on purine salvage from the host. The purine salvage pathway is redundant and contains two routes to guanosine-5′-monophosphate (GMP) formation: conversion from xanthosine-5′-monophosphate (XMP) by GMP synthase (GMPS) or direct salvage of guanine by hypoxanthine-guanine phosphoribosyltransferase (HGPRT). We show recombinant T. brucei GMPS efficiently catalyzes GMP formation. Genetic knockout of GMPS in bloodstream parasites led to depletion of guanine nucleotide pools and was lethal. Growth of gmps null cells was only rescued by supraphysiological guanine concentrations (100 μM) or by expression of an extrachromosomal copy of GMPS. Hypoxanthine was a competitive inhibitor of guanine rescue, consistent with a common uptake/metabolic conversion mechanism. In mice, gmps null parasites were unable to establish an infection demonstrating that GMPS is essential for virulence and that plasma guanine is insufficient to support parasite purine requirements. These data validate GMPS as a potential therapeutic target for treatment of HAT. The ability to strategically inhibit key metabolic enzymes in the purine pathway unexpectedly bypasses its functional redundancy by exploiting both the nature of pathway flux and the limited nutrient environment of the parasite's extracellular niche. PMID:26043892

  1. Guanosine protects glial cells against 6-hydroxydopamine toxicity.


    Giuliani, Patricia; Ballerini, Patrizia; Buccella, Silvana; Ciccarelli, Renata; Rathbone, Michel P; Romano, Silvia; D'Alimonte, Iolanda; Caciagli, Francesco; Di Iorio, Patrizia; Pokorski, Mieczyslaw


    Increasing body of evidence indicates that neuron-neuroglia interaction may play a key role in determining the progression of neurodegenerative diseases including Parkinson's disease (PD), a chronic pathological condition characterized by selective loss of dopaminergic (DA) neurons in the substantia nigra. We have previously reported that guanosine (GUO) antagonizes MPP(+)-induced cytotoxicity in neuroblastoma cells and exerts neuroprotective effects against 6-hydroxydopamine (6-OHDA) and beta-amyloid-induced apoptosis of SH-SY5Y cells. In the present study we demonstrate that GUO protected C6 glioma cells, taken as a model system for astrocytes, from 6-OHDA-induced neurotoxicity. We show that GUO, either alone or in combination with 6-OHDA activated the cell survival pathways ERK and PI3K/Akt. The involvement of these signaling systems in the mechanism of the nucleoside action was strengthened by a reduction of the protective effect when glial cells were pretreated with U0126 or LY294002, the specific inhibitors of MEK1/2 and PI3K, respectively. Since the protective effect on glial cell death of GUO was not affected by pretreatment with a cocktail of nucleoside transporter blockers, GUO transport and its intracellular accumulation were not at play in our in vitro model of PD. This fits well with our data which pointed to the presence of specific binding sites for GUO on rat brain membranes. On the whole, the results described in the present study, along with our recent evidence showing that GUO when administered to rats via intraperitoneal injection is able to reach the brain and with previous data indicating that it stimulates the release of neurotrophic factors, suggest that GUO, a natural compound, by acting at the glial level could be a promising agent to be tested against neurodegeneration. PMID:25310956

  2. Hypoxanthine-guanine phosphoribosyltransferase and inosine 5'-monophosphate dehydrogenase activities in three mammalian species: aquatic (Mirounga angustirostris), semi-aquatic (Lontra longicaudis annectens) and terrestrial (Sus scrofa).


    Barjau Pérez-Milicua, Myrna; Zenteno-Savín, Tania; Crocker, Daniel E; Gallo-Reynoso, Juan P


    Aquatic and semiaquatic mammals have the capacity of breath hold (apnea) diving. Northern elephant seals (Mirounga angustirostris) have the ability to perform deep and long duration dives; during a routine dive, adults can hold their breath for 25 min. Neotropical river otters (Lontra longicaudis annectens) can hold their breath for about 30 s. Such periods of apnea may result in reduced oxygen concentration (hypoxia) and reduced blood supply (ischemia) to tissues. Production of adenosine 5'-triphosphate (ATP) requires oxygen, and most mammalian species, like the domestic pig (Sus scrofa), are not adapted to tolerate hypoxia and ischemia, conditions that result in ATP degradation. The objective of this study was to explore the differences in purine synthesis and recycling in erythrocytes and plasma of three mammalian species adapted to different environments: aquatic (northern elephant seal) (n = 11), semiaquatic (neotropical river otter) (n = 4), and terrestrial (domestic pig) (n = 11). Enzymatic activity of hypoxanthine-guanine phosphoribosyltransferase (HGPRT) was determined by spectrophotometry, and activity of inosine 5'-monophosphate dehydrogenase (IMPDH) and the concentration of hypoxanthine (HX), inosine 5'-monophosphate (IMP), adenosine 5'-monophosphate (AMP), adenosine 5'-diphosphate (ADP), ATP, guanosine 5'-diphosphate (GDP), guanosine 5'-triphosphate (GTP), and xanthosine 5'-monophosphate (XMP) were determined by high-performance liquid chromatography (HPLC). The activities of HGPRT and IMPDH and the concentration of HX, IMP, AMP, ADP, ATP, GTP, and XMP in erythrocytes of domestic pigs were higher than in erythrocytes of northern elephant seals and river otters. These results suggest that under basal conditions (no diving, sleep apnea or exercise), aquatic, and semiaquatic mammals have less purine mobilization than their terrestrial counterparts. PMID:26283971

  3. Guanosine Protects Against Cortical Focal Ischemia. Involvement of Inflammatory Response.


    Hansel, Gisele; Tonon, André Comiran; Guella, Felipe Lhywinskh; Pettenuzzo, Letícia Ferreira; Duarte, Thiago; Duarte, Marta Maria Medeiros Frescura; Oses, Jean Pierre; Achaval, Matilde; Souza, Diogo Onofre


    Stroke is the major cause of death and the most frequent cause of disability in the adult population worldwide. Guanosine plays an important neuroprotective role in several cerebral ischemic models and is involved in the modulation of oxidative responses and glutamatergic parameters. Because the excessive reactive oxygen species produced during an ischemic event can trigger an inflammatory response, the purpose of this study was to evaluate the hypothesis that guanosine is neuroprotective against focal cerebral ischemia, inhibits microglia/macrophages activation, and mediates an inflammatory response ameliorating the neural damage. Permanent focal cerebral ischemia was induced in adult rats, and guanosine was administered immediately, 1, 3, and 6 h after surgery. Twenty-four hours after ischemia, the asymmetry scores were evaluated by the cylinder test; neuronal damage was evaluated by Fluoro-Jade C (FJC) staining and propidium iodide (PI) incorporation; microglia and immune cells were evaluated by anti-Iba-1 antibody; and inflammatory parameters such as interleukins (IL): IL-1, IL-6, IL-10; tumor necrosis factors alpha (TNF-α); and interferon-gamma (INF-γ) were evaluated in the brain tissue and cerebrospinal fluid. The ischemic event increased the levels of Iba-1-positive cells and pro-inflammatory cytokines and decreased IL-10 levels (an anti-inflammatory cytokine) in the lesion periphery. The guanosine treatment attenuated the changes in these inflammatory parameters and also reduced the infarct volume, PI incorporation, and number of FJC-positive cells, improving the functional recovery. Thus, guanosine may have been a promising therapeutic agent for the treatment of ischemic brain injury by reduction of inflammatory process triggered in an ischemic event. PMID:25394382

  4. Recognition of guanosine by dissimilar tRNA methyltransferases.


    Sakaguchi, Reiko; Giessing, Anders; Dai, Qing; Lahoud, Georges; Liutkeviciute, Zita; Klimasauskas, Saulius; Piccirilli, Joseph; Kirpekar, Finn; Hou, Ya-Ming


    Guanosines are important for biological activities through their specific functional groups that are recognized for RNA or protein interactions. One example is recognition of N(1) of G37 in tRNA by S-adenosyl-methionine (AdoMet)-dependent tRNA methyltransferases to synthesize m(1)G37-tRNA, which is essential for translational fidelity in all biological domains. Synthesis of m(1)G37-tRNA is catalyzed by TrmD in bacteria and by Trm5 in eukarya and archaea, using unrelated and dissimilar structural folds. This raises the question of how dissimilar proteins recognize the same guanosine. Here we probe the mechanism of discrimination among functional groups of guanosine by TrmD and Trm5. Guanosine analogs were systematically introduced into tRNA through a combination of chemical and enzymatic synthesis. Single turnover kinetic assays and thermodynamic analysis of the effect of each analog on m(1)G37-tRNA synthesis reveal that TrmD and Trm5 discriminate functional groups differently. While both recognize N(1) and O(6) of G37, TrmD places a much stronger emphasis on these functional groups than Trm5. While the exocyclic 2-amino group of G37 is important for TrmD, it is dispensable for Trm5. In addition, while an adjacent G36 is obligatory for TrmD, it is nonessential for Trm5. These results depict a more rigid requirement of guanosine functional groups for TrmD than for Trm5. However, the sensitivity of both enzymes to analog substitutions, together with an experimental revelation of their low cellular concentrations relative to tRNA substrates, suggests a model in which these enzymes rapidly screen tRNA by direct recognition of G37 in order to monitor the global state of m(1)G37-tRNA. PMID:22847817

  5. Measurement of intercolumnar forces between parallel guanosine four-stranded helices.

    PubMed Central

    Mariani, P; Saturni, L


    The deoxyguanosine-5'-monophosphate in aqueous solution self-associates into stable structures, which include hexagonal and cholesteric columnar phases. The structural unit is a four-stranded helix, composed of a stacked array of Hoogsteen-bonded guanosine quartets. We have measured by osmotic stress method the force per unit length versus interaxial distance between helices in the hexagonal phase under various ionic conditions. Two contributions have been recognized: the first one is purely electrostatic, is effective at large distances, and shows a strong dependence on the salt concentration of the solution. The second contribution is short range, dominates at interaxial separations smaller than about 30-32 A, and rises steeply as the columns approach each other, preventing the coalescence of the helices. This repulsion has an exponential nature and shows a magnitude and a decay length insensitive to the ionic strength of the medium. Because these features are distinctive of the hydration force detected between phospholipid bilayers or between several linear macromolecules (DNA, polysaccharides, collagen), we conclude that the dominant force experienced by deoxyguanosine helices approaching contact is hydration repulsion. The observed decay length of about 0.7 A has been rationalized to emerge from the coupling between the 3-A decay length of water solvent and the helically ordered structure of the hydrophilic groups on the opposing surfaces. The present results agree with recent measurements, also showing the dependence of the hydration force decay on the structure of interacting surfaces and confirm the correlations between force and structure. Images FIGURE 1 PMID:8744324

  6. P2Y2 receptor up-regulation induced by guanosine or UTP in rat brain cultured astrocytes.


    Ballerini, P; Di Iorio, P; Caciagli, F; Rathbone, M P; Jiang, S; Nargi, E; Buccella, S; Giuliani, P; D'Alimonte, I; Fischione, G; Masciulli, A; Romano, S; Ciccarelli, R


    Among P2 metabotropic ATP receptors, P2Y2 subtype seems to be peculiar as its upregulation triggers important biological events in different cells types. In non-stimulated cells including astrocytes, P2Y2 receptors are usually expressed at levels lower than P2Y1 sites, however the promoter region of the P2Y2 receptors has not yet been studied and little is known about the mechanisms underlying the regulation of the expression of this ATP receptor. We showed that not only UTP and ATP are the most potent and naturally occurring agonist for P2Y2 sites, but also guanosine induced an up-regulation of astrocyte P2Y2 receptor mRNA evaluated by Northern blot analysis. We also focused our attention on this nucleoside since in our previous studies it was reported to be released by cultured astrocytes and to exert different neuroprotective effects. UTP and guanosine-evoked P2Y2 receptor up-regulation in rat brain cultured astrocytes was linked to an increased P2Y2-mediated intracellular calcium response, thus suggesting an increased P2Y2 activity. Actinomycin D, a RNA polymerase inhibitor, abrogated both UTP and guanosine-mediated P2Y2 up-regulation, thus indicating that de novo transcription was required. The effect of UTP and guanosine was also evaluated in astrocytes pretreated with different inhibitors of signal transduction pathways including ERK, PKC and PKA reported to be involved in the regulation of other cell surface receptor mRNAs. The results show that ERK1-2/MAPK pathway play a key role in the P2Y2 receptor up-regulation mediated by either UTP or guanosine. Moreover, our data suggest that PKA is also involved in guanosine-induced transcriptional activation of P2Y2 mRNA and that increased intracellular calcium levels and PKC activation may also mediate P2Y2 receptor up-regulation triggered by UTP. The extracellular release of ATP under physiological and pathological conditions has been widely studied. On the contrary, little is known about the release of

  7. Partial 13C isotopic enrichment of nucleoside monophosphates: useful reporters for NMR structural studies

    PubMed Central

    Kishore, Anita I.; Mayer, Michael R.; Prestegard, James H.


    Analysis of the 13C isotopic labeling patterns of nucleoside monophosphates (NMPs) extracted from Escherichia coli grown in a mixture of C-1 and C-2 glucose is presented. By comparing our results to previous observations on amino acids grown in similar media, we have been able to rationalize the labeling pattern based on the well-known biochemistry of nucleotide biosynthesis. Except for a few notable absences of label (C4 in purines and C3′ in ribose) and one highly enriched site (C1′ in ribose), most carbons are randomly enriched at a low level (an average of 13%). These sparsely labeled NMPs give less complex NMR spectra than their fully isotopically labeled analogs due to the elimination of most 13C–13C scalar couplings. The spectral simplicity is particularly advantageous when working in ordered systems, as illustrated with guanosine diphosphate (GDP) bound to ADP ribosylation factor 1 (ARF1) aligned in a liquid crystalline medium. In this system, the absence of scalar couplings and additional long-range dipolar couplings significantly enhances signal to noise and resolution. PMID:16254075

  8. Phosphatidylinositol 3-Monophosphate Is Involved in Toxoplasma Apicoplast Biogenesis

    PubMed Central

    Tawk, Lina; Dubremetz, Jean-François; Montcourrier, Philippe; Chicanne, Gaëtan; Merezegue, Fabrice; Richard, Véronique; Payrastre, Bernard; Meissner, Markus; Vial, Henri J.; Roy, Christian


    Apicomplexan parasites cause devastating diseases including malaria and toxoplasmosis. They harbour a plastid-like, non-photosynthetic organelle of algal origin, the apicoplast, which fulfils critical functions for parasite survival. Because of its essential and original metabolic pathways, the apicoplast has become a target for the development of new anti-apicomplexan drugs. Here we show that the lipid phosphatidylinositol 3-monophosphate (PI3P) is involved in apicoplast biogenesis in Toxoplasma gondii. In yeast and mammalian cells, PI3P is concentrated on early endosomes and regulates trafficking of endosomal compartments. Imaging of PI3P in T. gondii showed that the lipid was associated with the apicoplast and apicoplast protein-shuttling vesicles. Interference with regular PI3P function by over-expression of a PI3P specific binding module in the parasite led to the accumulation of vesicles containing apicoplast peripheral membrane proteins around the apicoplast and, ultimately, to the loss of the organelle. Accordingly, inhibition of the PI3P-synthesising kinase interfered with apicoplast biogenesis. These findings point to an unexpected implication for this ubiquitous lipid and open new perspectives on how nuclear encoded proteins traffic to the apicoplast. This study also highlights the possibility of developing specific pharmacological inhibitors of the parasite PI3-kinase as novel anti-apicomplexan drugs. PMID:21379336

  9. Phosphatidylinositol 3-monophosphate is involved in toxoplasma apicoplast biogenesis.


    Tawk, Lina; Dubremetz, Jean-François; Montcourrier, Philippe; Chicanne, Gaëtan; Merezegue, Fabrice; Richard, Véronique; Payrastre, Bernard; Meissner, Markus; Vial, Henri J; Roy, Christian; Wengelnik, Kai; Lebrun, Maryse


    Apicomplexan parasites cause devastating diseases including malaria and toxoplasmosis. They harbour a plastid-like, non-photosynthetic organelle of algal origin, the apicoplast, which fulfils critical functions for parasite survival. Because of its essential and original metabolic pathways, the apicoplast has become a target for the development of new anti-apicomplexan drugs. Here we show that the lipid phosphatidylinositol 3-monophosphate (PI3P) is involved in apicoplast biogenesis in Toxoplasma gondii. In yeast and mammalian cells, PI3P is concentrated on early endosomes and regulates trafficking of endosomal compartments. Imaging of PI3P in T. gondii showed that the lipid was associated with the apicoplast and apicoplast protein-shuttling vesicles. Interference with regular PI3P function by over-expression of a PI3P specific binding module in the parasite led to the accumulation of vesicles containing apicoplast peripheral membrane proteins around the apicoplast and, ultimately, to the loss of the organelle. Accordingly, inhibition of the PI3P-synthesising kinase interfered with apicoplast biogenesis. These findings point to an unexpected implication for this ubiquitous lipid and open new perspectives on how nuclear encoded proteins traffic to the apicoplast. This study also highlights the possibility of developing specific pharmacological inhibitors of the parasite PI3-kinase as novel anti-apicomplexan drugs. PMID:21379336

  10. Hypoxanthine-guanine phosphoribosyltransferase and inosine 5′-monophosphate dehydrogenase activities in three mammalian species: aquatic (Mirounga angustirostris), semi-aquatic (Lontra longicaudis annectens) and terrestrial (Sus scrofa)

    PubMed Central

    Barjau Pérez-Milicua, Myrna; Zenteno-Savín, Tania; Crocker, Daniel E.; Gallo-Reynoso, Juan P.


    Aquatic and semiaquatic mammals have the capacity of breath hold (apnea) diving. Northern elephant seals (Mirounga angustirostris) have the ability to perform deep and long duration dives; during a routine dive, adults can hold their breath for 25 min. Neotropical river otters (Lontra longicaudis annectens) can hold their breath for about 30 s. Such periods of apnea may result in reduced oxygen concentration (hypoxia) and reduced blood supply (ischemia) to tissues. Production of adenosine 5′-triphosphate (ATP) requires oxygen, and most mammalian species, like the domestic pig (Sus scrofa), are not adapted to tolerate hypoxia and ischemia, conditions that result in ATP degradation. The objective of this study was to explore the differences in purine synthesis and recycling in erythrocytes and plasma of three mammalian species adapted to different environments: aquatic (northern elephant seal) (n = 11), semiaquatic (neotropical river otter) (n = 4), and terrestrial (domestic pig) (n = 11). Enzymatic activity of hypoxanthine-guanine phosphoribosyltransferase (HGPRT) was determined by spectrophotometry, and activity of inosine 5′-monophosphate dehydrogenase (IMPDH) and the concentration of hypoxanthine (HX), inosine 5′-monophosphate (IMP), adenosine 5′-monophosphate (AMP), adenosine 5′-diphosphate (ADP), ATP, guanosine 5′-diphosphate (GDP), guanosine 5′-triphosphate (GTP), and xanthosine 5′-monophosphate (XMP) were determined by high-performance liquid chromatography (HPLC). The activities of HGPRT and IMPDH and the concentration of HX, IMP, AMP, ADP, ATP, GTP, and XMP in erythrocytes of domestic pigs were higher than in erythrocytes of northern elephant seals and river otters. These results suggest that under basal conditions (no diving, sleep apnea or exercise), aquatic, and semiaquatic mammals have less purine mobilization than their terrestrial counterparts. PMID:26283971

  11. Regulatory role for the arginine-nitric oxide pathway in metabolism of energy substrates.


    Jobgen, Wenjuan Shi; Fried, Susan K; Fu, Wenjiang J; Meininger, Cynthia J; Wu, Guoyao


    Nitric oxide (NO) is synthesized from L-arginine by NO synthase in virtually all cell types. Emerging evidence shows that NO regulates the metabolism of glucose, fatty acids and amino acids in mammals. As an oxidant, pathological levels of NO inhibit nearly all enzyme-catalyzed reactions through protein oxidation. However, as a signaling molecule, physiological levels of NO stimulate glucose uptake as well as glucose and fatty acid oxidation in skeletal muscle, heart, liver and adipose tissue; inhibit the synthesis of glucose, glycogen, and fat in target tissues (e.g., liver and adipose); and enhance lipolysis in adipocytes. Thus, an inhibition of NO synthesis causes hyperlipidemia and fat accretion in rats, whereas dietary arginine supplementation reduces fat mass in diabetic fatty rats. The putative underlying mechanisms may involve multiple cyclic guanosine-3',5'-monophosphate-dependent pathways. First, NO stimulates the phosphorylation of adenosine-3',5'-monophosphate-activated protein kinase, resulting in (1) a decreased level of malonyl-CoA via inhibition of acetyl-CoA carboxylase and activation of malonyl-CoA decarboxylase and (2) a decreased expression of genes related to lipogenesis and gluconeogenesis (glycerol-3-phosphate acyltransferase, sterol regulatory element binding protein-1c and phosphoenolpyruvate carboxykinase). Second, NO increases the phosphorylation of hormone-sensitive lipase and perilipins, leading to the translocation of the lipase to the neutral lipid droplets and, hence, the stimulation of lipolysis. Third, NO activates expression of peroxisome proliferator-activated receptor-gamma coactivator-1alpha, thereby enhancing mitochondrial biogenesis and oxidative phosphorylation. Fourth, NO increases blood flow to insulin-sensitive tissues, promoting substrate uptake and product removal via the circulation. Modulation of the arginine-NO pathway through dietary supplementation with L-arginine or L-citrulline may aid in the prevention and

  12. Nucleotides as nucleophiles - Reactions of nucleotides with phosphoimidazolide activated guanosine

    NASA Technical Reports Server (NTRS)

    Kanavarioti, Anastassia; Rosenbach, Morgan T.; Hurley, T. B.


    On the basis of recently discovered RNAs with catalytic capabilities resembling those of enzymes, it is postulated that an 'RNA world' may have played a determining role in prebiotic chemistry and led evolution from prebiological to biological systems. The advent of the RNA world thus postulated, however, entails the preexistence of ribomononucleotides, and presumes that their reactions resulted in templatelike oligonucleotides. Attention is presently given to the reaction of nucleoside monophosphates with the phosphoimidazolide-activated nucleosides that (1) have successfully been used in place of the natural nucleoside triphosphates and (2) for whose prebiotic existence there is now some evidence.

  13. Mechanisms involved in the antinociception induced by systemic administration of guanosine in mice

    PubMed Central

    Schmidt, AP; Böhmer, AE; Schallenberger, C; Antunes, C; Tavares, RG; Wofchuk, ST; Elisabetsky, E; Souza, DO


    Background and purpose: It is well known that adenine-based purines exert multiple effects on pain transmission. However, less attention has been given to the potential effects of guanine-based purines on pain transmission. The aim of this study was to investigate the effects of intraperitoneal (i.p.) and oral (p.o.) administration of guanosine on mice pain models. Additionally, investigation into the mechanisms of action of guanosine, its potential toxicity and cerebrospinal fluid (CSF) purine levels were also assessed. Experimental approach: Mice received an i.p. or p.o. administration of vehicle (0.1 mM NaOH) or guanosine (up to 240 mg·kg−1) and were evaluated in several pain models. Key results: Guanosine produced dose-dependent antinociceptive effects in the hot-plate, glutamate, capsaicin, formalin and acetic acid models, but it was ineffective in the tail-flick test. Additionally, guanosine produced a significant inhibition of biting behaviour induced by i.t. injection of glutamate, AMPA, kainate and trans-ACPD, but not against NMDA, substance P or capsaicin. The antinociceptive effects of guanosine were prevented by selective and non-selective adenosine receptor antagonists. Systemic administration of guanosine (120 mg·kg−1) induced an approximately sevenfold increase on CSF guanosine levels. Guanosine prevented the increase on spinal cord glutamate uptake induced by intraplantar capsaicin. Conclusions and implications: This study provides new evidence on the mechanism of action of the antinociceptive effects after systemic administration of guanosine. These effects seem to be related to the modulation of adenosine A1 and A2A receptors and non-NMDA glutamate receptors. PMID:20132210

  14. DNAzyme-mediated catalysis with only guanosine and cytidine nucleotides

    PubMed Central

    Schlosser, Kenny; Li, Yingfu


    Single-stranded DNA molecules have the capacity to adopt catalytically active structures known as DNAzymes, although the fundamental limits of this ability have not been determined. Starting with a parent DNAzyme composed of all four types of standard nucleotides, we conducted a search of the surrounding sequence space to identify functional derivatives with catalytic cores composed of only three, and subsequently only two types of nucleotides. We provide the first report of a DNAzyme that contains only guanosine and cytidine deoxyribonucleotides in its catalytic domain, which consists of just 13 nucleotides. This DNAzyme catalyzes the Mn2+-dependent cleavage of an RNA phosphodiester bond ∼5300-fold faster than the corresponding uncatalyzed reaction, but ∼10 000-fold slower than the parent. The demonstration of a catalytic DNA molecule made from a binary nucleotide alphabet broadens our understanding of the fundamental limits of nucleic-acid-mediated catalysis. PMID:19050014

  15. Kinetics of the hydrolysis of guanosine 5'-phospho-2-methylimidazolide

    NASA Technical Reports Server (NTRS)

    Kanavarioti, Anastassia


    The hydrolysis kinetics of guanosine 5'-phospho-2-methylimidazolide (2-MeImpG) in aqueous buffered solutions of various pH's was studied at 75 and 37 C, using spectrophotometric and HPLC techniques. The hydrolysis was found to be very slow even at low pH. At 75 C and pH at or below l.0, two kinetic processes were observed: the more rapid one was attributed to the hydrolysis of the phosphoimidazolide P-N bond; the second, much slower one, was attributed to the cleavage of the glycosidic bond. It is noted that the P-N hydrolysis in phosphoimidazolides is very slow compared to other phosphoramidates, and that this might be one of the reasons why the phosphoimidazolides showed an extraordinary ability to form long oligomers under template-directed conditions.

  16. Mycophenolic acid inhibits inosine 5'-monophosphate dehydrogenase and suppresses production of pro-inflammatory cytokines, nitric oxide, and LDH in macrophages.


    Jonsson, Charlotte A; Carlsten, Hans


    Mycophenolic acid (MPA) inhibits reversibly inosine 5(')-monophosphate dehydrogenase, an enzyme involved in the de novo synthesis of guanine nucleotides. Previously, mycophenolate mofetil (MMF), the pro-drug of MPA, was shown to exert beneficial effects on the systemic lupus erythematosus (SLE)-like disease in MRLlpr/lpr mice. In this study MPA's immunomodulating effects in vitro on the murine macrophage cell line IC-21 were investigated. The cells were exposed to MPA together with lipopolysaccharide and IFN-gamma. Cytokine, NO(2)(-), and lactate dehydrogenase levels in supernatants and cell lysates were analysed as well as the proliferation of IC-21 cells. MPA exposure reduced the total levels of all molecules investigated and suppressed the proliferation. All MPA-induced effects were reversed by the addition of guanosine to the cultures. Since macrophages play a role in lupus nephritis, our results indicate that modulation of macrophages may be involved in the ameliorating effects of MMF in SLE. PMID:12381354

  17. Cyclic adenosine monophosphate phosphodiesterase in brain: effect on anxiety.


    Beer, B; Chasin, M; Clody, D E; Vogel, J R


    Drugs that reduce anxiety may be mediated by cyclic adenosine monophosphate in the brain because (i) potent anxiety-reducing drugs are also potent inhibitors of brain phosphodiesterase activity; (ii) dibutyryl cyclic adenosine monophosphate has the ability to reduce anxiety; (iii) the methylxanthines show significant anxiety-reducing effects; (iv) theophylline and chlordiazepoxide produce additive anxiety-reducing activity; and (v) there is a significant correlation between the anxiety-reducing property of drugs and their ability to inhibit phosphodiesterase activity in the brain. PMID:4402069

  18. A short review on structure and role of cyclic-3’,5’-adenosine monophosphate-specific phosphodiesterase 4 as a treatment tool

    PubMed Central

    Eskandari, Nahid; Mirmosayyeb, Omid; Bordbari, Gazaleh; Bastan, Reza; Yousefi, Zahra; Andalib, Alireza


    Cyclic nucleotide phosphodiesterases (PDEs) are known as a super-family of enzymes which catalyze the metabolism of the intracellular cyclic nucleotides, cyclic-3’,5’-adenosine monophosphate (cAMP), and cyclic-3’,5’-guanosine monophosphate that are expressed in a variety of cell types that can exert various functions based on their cells distribution. The PDE4 family has been the focus of vast research efforts over recent years because this family is considered as a prime target for therapeutic intervention in a number of inflammatory diseases such as asthma, chronic obstructive pulmonary disease, and rheumatoid arthritis, and it should be used and researched by pharmacists. This is because the major isoform of PDE that regulates inflammatory cell activity is the cAMP-specific PDE, PDE4. This review discusses the relationship between PDE4 and its inhibitor drugs based on structures, cells distribution, and pharmacological properties of PDE4 which can be informative for all pharmacy specialists. PMID:26645022

  19. Biochemical characterization of recombinant guaA-encoded guanosine monophosphate synthetase (EC from Mycobacterium tuberculosis H37Rv strain.


    Franco, Tathyana Mar A; Rostirolla, Diana C; Ducati, Rodrigo G; Lorenzini, Daniel M; Basso, Luiz A; Santos, Diógenes S


    Administration of the current tuberculosis (TB) vaccine to newborns is not a reliable route for preventing TB in adults. The conversion of XMP to GMP is catalyzed by guaA-encoded GMP synthetase (GMPS), and deletions in the Shiguella flexneri guaBA operon led to an attenuated auxotrophic strain. Here we present the cloning, expression, and purification of recombinant guaA-encoded GMPS from Mycobacterium tuberculosis (MtGMPS). Mass spectrometry data, oligomeric state determination, steady-state kinetics, isothermal titration calorimetry (ITC), and multiple sequence alignment are also presented. The homodimeric MtGMPS catalyzes the conversion of XMP, MgATP, and glutamine into GMP, ADP, PP(i), and glutamate. XMP, NH(4)(+), and Mg(2+) displayed positive homotropic cooperativity, whereas ATP and glutamine displayed hyperbolic saturation curves. The activity of ATP pyrophosphatase domain is independent of glutamine amidotransferase domain, whereas the latter cannot catalyze hydrolysis of glutamine to NH(3) and glutamate in the absence of substrates. ITC data suggest random order of binding of substrates, and PP(i) is the last product released. Sequence comparison analysis showed conservation of both Cys-His-Glu catalytic triad of N-terminal Class I amidotransferase and of amino acid residues of the P-loop of the N-type ATP pyrophosphatase family. PMID:22119138

  20. Dual specificity and novel structural folding of yeast phosphodiesterase-1 for hydrolysis of second messengers cyclic adenosine and guanosine 3',5'-Monophosphate


    Tian, Yuanyuan; Cui, Wenjun; Huang, Manna; Robinson, Howard; Wan, Yiqian; Wang, Yousheng; Ke, Hengming


    Cyclic nucleotide phosphodiesterases (PDEs) decompose second messengers cAMP and cGMP that play critical roles in many physiological processes. PDE1 of Saccharomyces cerevisiae has been subcloned and expressed in Escherichia coli. Recombinant yPDE1 has a KM of 110 μM and a kcat of 16.9 s⁻¹ for cAMP and a KM of 105 μM and a kcat of 11.8 s₅⁻¹ for cGMP. Thus, the specificity constant (kcat/KMcAMP)/(kcat/KMcGMP) of 1.4 indicates a dual specificity of yPDE1 for hydrolysis of both cAMP and cGMP. The crystal structures of unliganded yPDE1 and its complex with GMP at 1.31 Å resolution reveal a new structural foldingmore » that is different from those of human PDEs but is partially similar to that of some other metalloenzymes such as metallo-β-lactamase. In spite of their different structures and divalent metals, yPDE1 and human PDEs may share a common mechanism for hydrolysis of cAMP and cGMP.« less

  1. 3'-5' cyclic-guanosine monophosphate increase in rat brain hippocampus after gamma-hydroxybutyrate administration. Prevention by valproate and naloxone

    SciTech Connect

    Vayer, P.; Gobaille, S.; Mandel, P.; Maitre, M.


    An increase (123%) of cyclic GMP (cGMP) was observed in the hippocampus of the rat killed by microwave irradiation 45 min after administration of 500 mg/kg el-hydroxybutyrate (GHB) IP. This increase is time and dose dependent. No modification in cyclic nucleotide content was observed in striatum and in cerebellum. As the role of GHB has been implicated in neurotransmission, the fact that this compound increases cyclic GMP accumulation in hippocampus in vivo may represent a mechanism by which the actions of GHB are mediated at the cellular level. Valproate (400 mg/kg) or naloxone (10 mg/kg) pretreatment completely abolish the cGMP increase due to GHB. A GABAergic and/or opiate phenomenon may be involved in the mechanism of GHB induced increase of cGMP. 34 references, 4 figures.

  2. Human UMP-CMP kinase 2, a novel nucleoside monophosphate kinase localized in mitochondria.


    Xu, Yunjian; Johansson, Magnus; Karlsson, Anna


    Enzyme deficiency in the salvage pathway of deoxyribonucleotide synthesis in mitochondria can cause mtDNA depletion syndromes. We have identified a human mitochondrial UMP-CMP kinase (UMP-CMPK, cytidylate kinase; EC, designated as UMP-CMP kinase 2 (UMP-CMPK2). The C-terminal domain of this 449-amino acid protein contains all consensus motifs of a nucleoside monophosphate kinase. Phylogenetic analysis showed that UMP-CMPK2 belonged to a novel nucleoside monophosphate kinase family, which was closer to thymidylate kinase than to cytosolic UMP-CMP kinase. Subcellular localization with green fluorescent protein fusion proteins illustrated that UMP-CMPK2 was localized in the mitochondria of HeLa cells and that the mitochondrial targeting signal was included in the N-terminal 22 amino acids. The enzyme was able to phosphorylate dUMP, dCMP, CMP, and UMP with ATP as phosphate donor, but the kinetic properties were different compared with the cytosolic UMP-CMPK. Its efficacy to convert dUMP was highest, followed by dCMP, whereas CMP and UMP were the poorest substrates. It also phosphorylated the monophosphate forms of the nucleoside analogs ddC, dFdC, araC, BVDU, and FdUrd, which suggests that UMP-CMPK2 may be involved in mtDNA depletion caused by long term treatment with ddC or other pyrimidine analogs. UMP-CMPK2 mRNA expression was exclusively detected in chronic myelogenous leukemia K-562 and lymphoblastic leukemia MOLT-4 among eight studied cancer cell lines. Particular high expression in leukemia cells, dominant expression in bone marrow, and tight correlation with macrophage activation and inflammatory response suggest that UMP-CMPK2 may have other functions in addition to the supply of substrates for mtDNA synthesis. PMID:17999954

  3. Increased riboflavin production by manipulation of inosine 5'-monophosphate dehydrogenase in Ashbya gossypii.


    Buey, Rubén M; Ledesma-Amaro, Rodrigo; Balsera, Mónica; de Pereda, José María; Revuelta, José Luis


    Guanine nucleotides are the precursors of essential biomolecules including nucleic acids and vitamins such as riboflavin. The enzyme inosine-5'-monophosphate dehydrogenase (IMPDH) catalyzes the ratelimiting step in the guanine nucleotide de novo biosynthetic pathway and plays a key role in controlling the cellular nucleotide pools. Thus, IMPDH is an important metabolic bottleneck in the guanine nucleotide synthesis, susceptible of manipulation by means of metabolic engineering approaches. Herein, we report the functional and structural characterization of the IMPDH enzyme from the industrial fungus Ashbya gossypii. Our data show that the overexpression of the IMPDH gene increases the metabolic flux through the guanine pathway and ultimately enhances 40 % riboflavin production with respect to the wild type. Also, IMPDH disruption results in a 100-fold increase of inosine excretion to the culture media. Our results contribute to the developing metabolic engineering toolbox aiming at improving the production of metabolites with biotechnological interest in A. gossypii. PMID:26150243

  4. Alkylation of guanosine and 4-(p-nitrobenzyl)-pyridine by styrene oxide analogues in vitro.


    Hemminki, K; Heinonen, T; Vainio, H


    In vitro alkylation activity of styrene oxide (SO) and three of its analogues, 4-vinyltoluene oxide (VTO), 3,5-dimethylstyrene oxide (DMSO), and 4-nitrostyrene oxide (NSO) was assayed using 4-(p-nitrobenzyl)pyridine (NBP) and guanosine as nucleophiles. Hydrolysis rates were also determined. The half-lives of VTO, DMSO, SO, and NSO were 8, 11, 40, and 60 h, respectively in aqueous solution. The rate of NBP alkylation correlated with the rate of hydrolysis. By contrast, the rates of guanosine alkylation were quite different: SO greater than VTO greater than DMSO. NSO did not react with guanosine. Fluorescence an ultraviolet spectroscopic data on the guanosine adducts indicated that SO, VTO, and DMSO formed main alkyl products at N-7. PMID:7325798

  5. Guanosine potentiates the antiproliferative effect of cytosine-beta-D-arabinofuranoside in melanoma cell lines.


    Sidi, Y; Panet, C; Cyjon, A; Fenig, E; Beery, E; Nordenberg, J


    Guanosine is shown to potentiate markedly the antiproliferative effect of cytosine-beta-D-arabinoside (ara-C) on B16 F10 mouse and SKMEL-28 human melanoma cell lines. Several metabolic consequences of the synergistic interaction between ara-C and guanosine on cell growth were determined in B16 F10 mouse melanoma cells. Treatment of the cells with guanosine for 24 hr resulted in an increase in the percentage of cells in the S phase of the cell cycle, a threefold increase in intracellular GTP concentration, and an increase in the incorporation of ara-C into acid-insoluble material and phosphorylated metabolites. These findings suggest that guanosine potentiates the growth-inhibitory effect of ara-C in B16 F10 melanoma cells by increasing the intracellular concentration of its active metabolites. PMID:8402221

  6. Differences in responsiveness of intrapulmonary artery and vein to arachidonic acid: mechanism of arterial relaxation involves cyclic guanosine 3':5'-monophosphate and cyclic adenosine 3':5'-monophosphate

    SciTech Connect

    Ignarro, L.J.; Harbison, R.G.; Wood, K.S.; Wolin, M.S.; McNamara, D.B.; Hyman, A.L.; Kadowitz, P.J.


    The objective of this study was to examine the relationship between responses of bovine intrapulmonary artery and vein to arachidonic acid and cyclic nucleotide levels in order to better understand the mechanism of relaxation elicited by arachidonic acid and acetylcholine. Arachidonic acid relaxed phenylephrine-precontracted arterial rings and elevated both cyclic GMP and cyclic AMP levels in arteries with intact endothelium. In contrast, endothelium-damaged arterial rings contracted to arachidonic acid without demonstrating significant changes in cyclic nucleotide levels. Indomethacin partially inhibited endothelium-dependent relaxation and abolished cyclic AMP accumulation whereas methylene blue, a guanylate cyclase inhibitor, partially inhibited relaxation and abolished cyclic GMP accumulation in response to arachidonic acid. All vessel responses were blocked by a combination of the two inhibitors. Prostaglandin (PG) I2 relaxed arterial rings and elevated cyclic AMP levels whereas PGE2 and PGF2 alpha caused contraction, suggesting that the indomethacin-sensitive component of arachidonic acid-elicited relaxation is due to PGI2 formation and cyclic AMP accumulation. The methylene blue-sensitive component is attributed to an endothelium-dependent but cyclooxygenase-independent generation of a substance causing cyclic GMP accumulation. Intrapulmonary veins contracted to arachidonic acid with no changes in cyclic nucleotide levels and PGI2 was without effect. Homogenates of intrapulmonary artery and vein formed 6-keto-PGF1 alpha, PGF2 alpha and PGE2 from (/sup 14/C)arachidonic acid, which was inhibited by indomethacin. Thus, bovine intrapulmonary vein may not possess receptors for PGI2.

  7. Cavernosum smooth muscle relaxation induced by Schisandrol A via the NO-cGMP signaling pathway.


    Liu, W; Choi, B R; Bak, Y O; Zhang, L T; Zhou, L X; Huang, Y R; Zhao, C; Park, J K


    To evaluate the effect of Schisandrol A on rabbit corpus cavernosum smooth muscle and elucidate the potential mechanism. Penises were obtained from healthy male New Zealand White rabbits (2.5-3.0 kg). The pre-contracted penis with phenylephrine (Phe, 10 µM) was treated with accumulative concentrations of Schisandrol A (10-7, 10-6, 10-5 and 10-4 M). The change in intracavernosum pressure (ICP) and tension was recorded, cyclic nucleotides in the cavernosum tissue were measured by radioimmunoassay, mRNA level and expression of endothelial nitric oxide synthase (eNOS) and neuronal NOS (nNOS) were measured by real time PCR and western blot respectively. The corpus cavernosum smooth muscle relaxation induced by Schisandrol A was in a dose-dependent manner. Pre-treatment with NOS inhibitor (Nω nitro-L-arginine-methyl ester, L-NAME) or guanylyl cyclase inhibitor (1H-(1,2,4)oxadiazolo(4,3-a)quinoxalin-1-one, ODQ) significantly diminished the relaxation. The cyclic guanosine monophosphate (cGMP) level was significantly increased in the cavernosum tissue. Real time PCR and western blot showed the mRNA level and expression of eNOS and nNOS was also upregulated. Schisandrol A relaxes the cavernosum smooth muscle by activating NO-cGMP signaling pathway. It may be a new promising treatment for erectile dysfunction and cardiovascular disease. PMID:27064883

  8. The nitric oxide pathway and possible therapeutic options in pre-eclampsia

    PubMed Central

    Johal, Tamanrit; Lees, Christoph C; Everett, Thomas R; Wilkinson, Ian B


    Pre-eclampsia is a serious multisystem disorder with diverse clinical manifestations. Although not causal, endothelial dysfunction and reduced nitric oxide bioavailability are likely to play an important role in the maternal and fetal pathophysiology of this condition. Lack of treatment modalities that can target the underlying pathophysiological changes and reverse the endothelial dysfunction frequently leads to iatrogenic preterm delivery of the fetus, causing neonatal morbidity and mortality, and the condition itself is associated with short- and longer term maternal morbidity and mortality. Drugs that target various components of the nitric oxide–soluble guanylyl cyclase pathway can help to increase NO bioavailability. The purpose of this review is to outline the current status of clinical research involving these therapeutic modalities in the context of pre-eclampsia, with the focus being on the following: nitric oxide donors, including organic nitrates and S-nitrosothiols; l-arginine, the endogenous precursor of NO; inhibitors of cyclic guanosine 3′,5′-monophosphate breakdown, including sildenafil; and other novel inhibitors of NO donor metabolism. The advantages and limitations of each modality are outlined, and scope for development into established therapeutic options for pre-eclampsia is explored. PMID:24313856

  9. The Endothelium-Dependent Nitric Oxide-cGMP Pathway.


    Mónica, F Z; Bian, K; Murad, F


    Nitric oxide (NO)-cyclic 3'-5' guanosine monophosphate (cGMP) signaling plays a critical role on smooth muscle tone, platelet activity, cardiac contractility, renal function and fluid balance, and cell growth. Studies of the 1990s established endothelium dysfunction as one of the major causes of cardiovascular diseases. Therapeutic strategies that benefit NO bioavailability have been applied in clinical medicine extensively. Basic and clinical studies of cGMP regulation through activation of soluble guanylyl cyclase (sGC) or inhibition of cyclic nucleotide phosphodiesterase type 5 (PDE5) have resulted in effective therapies for pulmonary hypertension, erectile dysfunction, and more recently benign prostatic hyperplasia. This section reviews (1) how endothelial dysfunction and NO deficiency lead to cardiovascular diseases, (2) how soluble cGMP regulation leads to beneficial effects on disorders of the circulation system, and (3) the epigenetic regulation of NO-sGC pathway components in the cardiovascular system. In conclusion, the discovery of the NO-cGMP pathway revolutionized the comprehension of pathophysiological mechanisms involved in cardiovascular and other diseases. However, considering the expression "from bench to bedside" the therapeutic alternatives targeting NO-cGMP did not immediately follow the marked biochemical and pathophysiological revolution. Some therapeutic options have been effective and released on the market for pulmonary hypertension and erectile dysfunction such as inhaled NO, PDE5 inhibitors, and recently sGC stimulators. The therapeutic armamentarium for many other disorders is expected in the near future. There are currently numerous active basic and clinical research programs in universities and industries attempting to develop novel therapies for many diseases and medical applications. PMID:27451093

  10. Phosphodiesterase-2 inhibitor reverses corticosterone-induced neurotoxicity and related behavioural changes via cGMP/PKG dependent pathway.


    Xu, Ying; Pan, Jianchun; Chen, Ling; Zhang, Chong; Sun, Jiao; Li, Jianxin; Nguyen, Linda; Nair, Neetu; Zhang, Hanting; O'Donnell, James M


    Phosphodiesterase 2 (PDE2) is an enzyme responsible for hydrolysis of cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP) to restrict intracellular signalling of these second messenger molecules. This study investigated how PDE2 inhibitor Bay 60-7550 affects the dysregulated glucocorticoid signalling in neuronal cells and regulates depressive behaviours after chronic stress in mice. We found that exposure of hippocampal neurons to corticosterone resulted in time- and concentration-dependent increases in PDE2 expression. These intriguing findings were confirmed in the hippocampal cell line HT-22. After corticosterone exposure for 24 h, HT-22 cells showed a concentration-dependent increase in mRNA levels for PDE2 subtypes, PDE2A1 and 2A3, as well as for the total PDE2A protein expression. Bay 60-7550 was found to reverse the cell lesion induced by corticosterone (50 μm). This neuroprotective effect was blocked by pretreatment with protein kinase G inhibitor KT5823, but not protein kinase A inhibitor H89, suggesting the involvement of cGMP-dependent signalling. Although Bay 60-7550 treatment for 24 h did not change the levels of phosphorylated mitogen-activated protein kinases ERK1/2 (pERK) and phosphorylated cAMP response element-binding protein (pCREB), it down-regulated pERK at 2 h and up-regulated a CREB co-activator, CREB-binding protein, at 24 h. Both of these effects were blocked by KT 5823. Furthermore, Bay 60-7550 reversed corticosterone-induced down-regulation of brain-derived neurotrophic factor protein levels 24 h after corticosterone exposure. In behavioural testing, Bay 60-7550 produced antidepressant-like effects and reduced corticosterone levels in stressed mice, further supporting the involvement of a PDE2-dependent pathway in mediating Bay 60-7550's effect during stress hormone insults. PMID:22850435

  11. The crystal structure and mechanism of orotidine 5'-monophosphate decarboxylase.


    Appleby, T C; Kinsland, C; Begley, T P; Ealick, S E


    The crystal structure of Bacillus subtilis orotidine 5'-monophosphate (OMP) decarboxylase with bound uridine 5'-monophosphate has been determined by multiple wavelength anomalous diffraction phasing techniques and refined to an R-factor of 19.3% at 2.4 A resolution. OMP decarboxylase is a dimer of two identical subunits. Each monomer consists of a triosephosphate isomerase barrel and contains an active site that is located across one end of the barrel and near the dimer interface. For each active site, most of the residues are contributed by one monomer with a few residues contributed from the adjacent monomer. The most highly conserved residues are located in the active site and suggest a novel catalytic mechanism for decarboxylation that is different from any previously proposed OMP decarboxylase mechanism. The uridine 5'-monophosphate molecule is bound to the active site such that the phosphate group is most exposed and the C5-C6 edge of the pyrimidine base is most buried. In the proposed catalytic mechanism, the ground state of the substrate is destabilized by electrostatic repulsion between the carboxylate of the substrate and the carboxylate of Asp60. This repulsion is reduced in the transition state by shifting negative charge from the carboxylate to C6 of the pyrimidine, which is close to the protonated amine of Lys62. We propose that the decarboxylation of OMP proceeds by an electrophilic substitution mechanism in which decarboxylation and carbon-carbon bond protonation by Lys62 occur in a concerted reaction. PMID:10681442

  12. Differential effects of chronic hyperammonemia on modulation of the glutamate-nitric oxide-cGMP pathway by metabotropic glutamate receptor 5 and low and high affinity AMPA receptors in cerebellum in vivo.


    Cabrera-Pastor, Andrea; Llansola, Marta; Reznikov, Vitaliy; Boix, Jordi; Felipo, Vicente


    Previous studies show that chronic hyperammonemia impairs learning ability of rats by impairing the glutamate-nitric oxide (NO)-cyclic guanosine mono-phosphate (cGMP) pathway in cerebellum. Three types of glutamate receptors cooperate in modulating the NO-cGMP pathway: metabotropic glutamate receptor 5 (mGluR5), (RS)-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and N-methyl-d-aspartic acid (NMDA) receptors. The aim of this work was to assess whether hyperammonemia alters the modulation of this pathway by mGluR5 and AMPA receptors in cerebellum in vivo. The results support that in control rats: (1) low AMPA concentrations (0.1mM) activate nearly completely Ca(2+)-permeable (glutamate receptor subunit 2 (GluR2)-lacking) AMPA receptors and the NO-cGMP pathway; (2) higher AMPA concentrations (0.3 mM) also activate Ca(2+)-impermeable (GluR2-containing) AMPA receptors, leading to activation of NMDA receptors and of NO-cGMP pathway. Moreover, the data support that chronic hyperammonemia: (1) reduces glutamate release and activation of the glutamate-NO-cGMP pathway by activation of mGluR5; (2) strongly reduces the direct activation by AMPA receptors of the NO-cGMP pathway, likely due to reduced entry of Ca(2+) through GluR2-lacking, high affinity AMPA receptors; (3) strongly increases the indirect activation of the NO-cGMP pathway by high affinity AMPA receptors, likely due to increased entry of Na(+) through GluR2-lacking AMPA receptors and NMDA receptors activation; (4) reduces the indirect activation of the NO-cGMP pathway by low affinity AMPA receptors, likely due to reduced activation of NMDA receptors. PMID:22521775

  13. Systems Pharmacology and Rational Polypharmacy: Nitric Oxide−Cyclic GMP Signaling Pathway as an Illustrative Example and Derivation of the General Case

    PubMed Central

    Garmaroudi, Farshid S.; Handy, Diane E.; Liu, Yang-Yu; Loscalzo, Joseph


    Impaired nitric oxide (NO˙)-cyclic guanosine 3', 5'-monophosphate (cGMP) signaling has been observed in many cardiovascular disorders, including heart failure and pulmonary arterial hypertension. There are several enzymatic determinants of cGMP levels in this pathway, including soluble guanylyl cyclase (sGC) itself, the NO˙-activated form of sGC, and phosphodiesterase(s) (PDE). Therapies for some of these disorders with PDE inhibitors have been successful at increasing cGMP levels in both cardiac and vascular tissues. However, at the systems level, it is not clear whether perturbation of PDE alone, under oxidative stress, is the best approach for increasing cGMP levels as compared with perturbation of other potential pathway targets, either alone or in combination. Here, we develop a model-based approach to perturbing this pathway, focusing on single reactions, pairs of reactions, or trios of reactions as targets, then monitoring the theoretical effects of these interventions on cGMP levels. Single perturbations of all reaction steps within this pathway demonstrated that three reaction steps, including the oxidation of sGC, NO˙ dissociation from sGC, and cGMP degradation by PDE, exerted a dominant influence on cGMP accumulation relative to other reaction steps. Furthermore, among all possible single, paired, and triple perturbations of this pathway, the combined perturbations of these three reaction steps had the greatest impact on cGMP accumulation. These computational findings were confirmed in cell-based experiments. We conclude that a combined perturbation of the oxidatively-impaired NO˙-cGMP signaling pathway is a better approach to the restoration of cGMP levels as compared with corresponding individual perturbations. This approach may also yield improved therapeutic responses in other complex pharmacologically amenable pathways. PMID:26985825

  14. Liraglutide prevents and reverses monocrotaline-induced pulmonary arterial hypertension by suppressing ET-1 and enhancing eNOS/sGC/PKG pathways

    PubMed Central

    Lee, Mei-Yueh; Tsai, Kun-Bow; Hsu, Jong-Hau; Shin, Shyi-Jang; Wu, Jiunn-Ren; Yeh, Jwu-Lai


    Liraglutide, a glucagon-like peptide-1 receptor (GLP-1R) agonist, is widely used to treat diabetes. However, its effect on pulmonary arterial hypertension (PAH) is unknown. In this study, we investigated its effects on rats with monocrotaline (MCT)-induced PAH and mechanisms on rat pulmonary artery smooth muscle cells (PASMCs). Liraglutide was investigated for both prevention and treatment of MCT-induced PAH. The hemodynamic and body weight changes, right heart hypertrophy, lung morphology, immune-reactivity of endothelial nitric oxide synthase (eNOS), endothelin-1 and cyclic guanosine monophosphate (cGMP) levels, protein expressions of eNOS, soluble guanylyl cyclase (sGCα), protein kinase G (PKG) and Rho kinase (ROCK) II pathway were measured in both in vivo and in vitro. Cell migration and cell cycle were also determined. Liraglutide both prevented and reversed MCT-induced PAH, right ventricle hypertrophy and pulmonary vascular wall remodeling. Protein expression of ROCK II was increased while eNOS, sGC and PKG were decreased. Pretreatment with liraglutide inhibited platelet-derived growth factor (PDGF)-BB stimulated PASMCs migration, which were associated with cell-cycle arrest at G0/G1 phase. Liraglutide may have both preventive and therapeutic effects on MCT-induced PAH, through the eNOS/sGC/PKG and Rho kinase pathways. Thus, liraglutide may have a therapeutic role in pulmonary vascular remodelling. PMID:27581840

  15. Liraglutide prevents and reverses monocrotaline-induced pulmonary arterial hypertension by suppressing ET-1 and enhancing eNOS/sGC/PKG pathways.


    Lee, Mei-Yueh; Tsai, Kun-Bow; Hsu, Jong-Hau; Shin, Shyi-Jang; Wu, Jiunn-Ren; Yeh, Jwu-Lai


    Liraglutide, a glucagon-like peptide-1 receptor (GLP-1R) agonist, is widely used to treat diabetes. However, its effect on pulmonary arterial hypertension (PAH) is unknown. In this study, we investigated its effects on rats with monocrotaline (MCT)-induced PAH and mechanisms on rat pulmonary artery smooth muscle cells (PASMCs). Liraglutide was investigated for both prevention and treatment of MCT-induced PAH. The hemodynamic and body weight changes, right heart hypertrophy, lung morphology, immune-reactivity of endothelial nitric oxide synthase (eNOS), endothelin-1 and cyclic guanosine monophosphate (cGMP) levels, protein expressions of eNOS, soluble guanylyl cyclase (sGCα), protein kinase G (PKG) and Rho kinase (ROCK) II pathway were measured in both in vivo and in vitro. Cell migration and cell cycle were also determined. Liraglutide both prevented and reversed MCT-induced PAH, right ventricle hypertrophy and pulmonary vascular wall remodeling. Protein expression of ROCK II was increased while eNOS, sGC and PKG were decreased. Pretreatment with liraglutide inhibited platelet-derived growth factor (PDGF)-BB stimulated PASMCs migration, which were associated with cell-cycle arrest at G0/G1 phase. Liraglutide may have both preventive and therapeutic effects on MCT-induced PAH, through the eNOS/sGC/PKG and Rho kinase pathways. Thus, liraglutide may have a therapeutic role in pulmonary vascular remodelling. PMID:27581840

  16. Mutation of Archaeal Isopentenyl Phosphate Kinase Highlights Mechanism and Guides Phosphorylation of Additional Isoprenoid Monophosphates

    PubMed Central


    The biosynthesis of isopentenyl diphosphate (IPP) from either the mevalonate (MVA) or the 1-deoxy-d-xylulose 5-phosphate (DXP) pathway provides the key metabolite for primary and secondary isoprenoid biosynthesis. Isoprenoid metabolism plays crucial roles in membrane stability, steroid biosynthesis, vitamin production, protein localization, defense and communication, photoprotection, sugar transport, and glycoprotein biosynthesis. Recently, an alternative branch of the MVA pathway was discovered in the archaeon Methanocaldococcus jannaschii involving a small molecule kinase, isopentenyl phosphate kinase (IPK). IPK belongs to the amino acid kinase (AAK) superfamily. In vitro, IPK phosphorylates isopentenyl monophosphate (IP) in an ATP and Mg2+-dependent reaction producing IPP. Here, we describe crystal structures of IPK from M. jannaschii refined to nominal resolutions of 2.0−2.8 Å. Notably, an active site histidine residue (His60) forms a hydrogen bond with the terminal phosphate of both substrate and product. This His residue serves as a marker for a subset of the AAK family that catalyzes phosphorylation of phosphate or phosphonate functional groups; the larger family includes carboxyl-directed kinases, which lack this active site residue. Using steady-state kinetic analysis of H60A, H60N, and H60Q mutants, the protonated form of the Nε2 nitrogen of His60 was shown to be essential for catalysis, most likely through hydrogen bond stabilization of the transition state accompanying transphosphorylation. Moreover, the structures served as the starting point for the engineering of IPK mutants capable of the chemoenzymatic synthesis of longer chain isoprenoid diphosphates from monophosphate precursors. PMID:20392112

  17. Nucleic acid molecules encoding isopentenyl monophosphate kinase, and methods of use


    Croteau, Rodney B.; Lange, Bernd M.


    A cDNA encoding isopentenyl monophosphate kinase (IPK) from peppermint (Mentha x piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of isopentenyl monophosphate kinase (SEQ ID NO:2), from peppermint (Mentha x piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for isopentenyl monophosphate kinase, or for a base sequence sufficiently complementary to at least a portion of isopentenyl monophosphate kinase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding isopentenyl monophosphate kinase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant isopentenyl monophosphate kinase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant isopentenyl monophosphate kinase may be used to obtain expression or enhanced expression of isopentenyl monophosphate kinase in plants in order to enhance the production of isopentenyl monophosphate kinase, or isoprenoids derived therefrom, or may be otherwise employed for the regulation or expression of isopentenyl monophosphate kinase, or the production of its products.

  18. Procyanidin C1 Causes Vasorelaxation Through Activation of the Endothelial NO/cGMP Pathway in Thoracic Aortic Rings

    PubMed Central

    Byun, Eui-Baek; Sung, Nak-Yun; Yang, Mi-So; Song, Du-Sup; Byun, Eui-Hong; Kim, Jae-Kyung; Park, Jong-Heum; Song, Beom-Seok; Lee, Ju-Woon; Park, Sang-Hyun; Byun, Myung-Woo


    Abstract The aim of this study was to clarify the efficacy of procyanidin C1 (Pro C1) for modulating vascular tone. Pro C1 induced a potent vasorelaxant effect on phenylephrine-constricted endothelium-intact thoracic aortic rings, but had no effect on denuded thoracic aortic rings. Moreover, Pro C1 caused a significant increase in nitric oxide (NO) production in endothelial cells. Pro C1-induced vasorelaxation and Pro C1-induced NO production were significantly decreased in the presence of a nonspecific potassium channel blocker (tetraethylammonium chloride [TEA]), an endothelial NO synthase inhibitor (NG-monomethyl-L-arginine [L-NMMA]), and a store-operated calcium entry inhibitor (2-aminoethyl diphenylborinate [2-APB]). Pro C1-induced vasorelaxation was also completely abolished by an inhibitor of soluble guanyl cyclase, which suggests that the Pro C1 effects observed involved cyclic guanosine monophosphate (cGMP) production. Interestingly, Pro C1 significantly enhanced basal cGMP levels. Taken together, these results indicate that Pro C1-induced vasorelaxation is associated with the activation of the calcium-dependent NO/cGMP pathway, involving potassium channel activation. Thus, Pro C1 may represent a novel and potentially therapeutically relevant compound for the treatment of cardiovascular diseases. PMID:24971771

  19. Procyanidin C1 causes vasorelaxation through activation of the endothelial NO/cGMP pathway in thoracic aortic rings.


    Byun, Eui-Baek; Sung, Nak-Yun; Yang, Mi-So; Song, Du-Sup; Byun, Eui-Hong; Kim, Jae-Kyung; Park, Jong-Heum; Song, Beom-Seok; Lee, Ju-Woon; Park, Sang-Hyun; Byun, Myung-Woo; Kim, Jae-Hun


    The aim of this study was to clarify the efficacy of procyanidin C1 (Pro C1) for modulating vascular tone. Pro C1 induced a potent vasorelaxant effect on phenylephrine-constricted endothelium-intact thoracic aortic rings, but had no effect on denuded thoracic aortic rings. Moreover, Pro C1 caused a significant increase in nitric oxide (NO) production in endothelial cells. Pro C1-induced vasorelaxation and Pro C1-induced NO production were significantly decreased in the presence of a nonspecific potassium channel blocker (tetraethylammonium chloride [TEA]), an endothelial NO synthase inhibitor (N(G)-monomethyl-L-arginine [L-NMMA]), and a store-operated calcium entry inhibitor (2-aminoethyl diphenylborinate [2-APB]). Pro C1-induced vasorelaxation was also completely abolished by an inhibitor of soluble guanyl cyclase, which suggests that the Pro C1 effects observed involved cyclic guanosine monophosphate (cGMP) production. Interestingly, Pro C1 significantly enhanced basal cGMP levels. Taken together, these results indicate that Pro C1-induced vasorelaxation is associated with the activation of the calcium-dependent NO/cGMP pathway, involving potassium channel activation. Thus, Pro C1 may represent a novel and potentially therapeutically relevant compound for the treatment of cardiovascular diseases. PMID:24971771

  20. A putative role for inosine 5' monophosphate dehydrogenase (IMPDH) in Leishmania amazonensis programmed cell death.


    Pitaluga, A N; Moreira, M E C; Traub-Csekö, Y M


    Leishmania amazonensis undergoes apoptosis-like programmed cell death (PCD) under heat shock conditions. We identified a potential role for inosine 5' monophosphate dehydrogenase (IMPDH) in L. amazonensis PCD. Trypanosomatids do not have a "de novo" purine synthesis pathway, relying on the salvage pathway for survival. IMPDH, a key enzyme in the purine nucleotide pathway, is related to cell growth and apoptosis. Since guanine nucleotide depletion triggers cell cycle arrest and apoptosis in several organisms we analyzed the correlation between IMPDH and apoptosis-like death in L. amazonensis. The L. amazonensis IMPDH inhibition effect on PCD was evaluated through gene expression analysis, mitochondrial depolarization and detection of Annexin-V labeled parasites. We demonstrated a down-regulation of impdh expression under heat shock treatment, which mimics the natural mammalian host infection. Also, IMPDH inhibitors ribavirin and mycophenolic acid (MPA) prevented cell growth and generated an apoptosis-like phenotype in sub-populations of L. amazonensis promastigotes. Our results are in accordance with previous results showing that a subpopulation of parasites undergoes apoptosis-like cell death in the nutrient poor environment of the vector gut. Here, we suggest the involvement of purine metabolism in previously observed apoptosis-like cell death during Leishmania infection. PMID:25499513

  1. Nonenzymatic template-directed synthesis on hairpin oligonucleotides. II - Templates containing cytidine and guanosine residues

    NASA Technical Reports Server (NTRS)

    Wu, Taifeng; Orgel, Leslie E.


    Hairpin oligonucleotides were prepared with 5-prime-terminal single-stranded sequments containing cytidylate (C) and guanylate (G) residues. It was found that incubation of these hairpin oligonucleotides with a mixutre of cytidine and guanosine 5-prime-phosphoro (2-methyl)imidazolides results in sequence-specific addition of C and G residues to the 3-prime terminus of the hairpin.

  2. An improved method for the enzymatic transformation of nucleosides into 5'-monophosphates.


    Barai, Vladimir N; Kvach, Sergei V; Zinchenko, Anatoli I; Mikhailopulo, Igor A


    An improved method to transform nucleosides into 5'-monophosphates using nucleoside phosphotransferase from Erwinia herbicola is reported. The method is based on the shift in the equilibrium state of the reaction to the formation of desired product due to its precipitation by Zn2+. Under optimal conditions, the extent of nucleoside transformations into nucleoside-5'-monophosphates were 41-91% (mol). PMID:15672226

  3. Suppression of spreading depression-like events in locusts by inhibition of the NO/cGMP/PKG pathway.


    Armstrong, Gary A B; Rodgers, Corinne I; Money, Tomas G A; Robertson, R Meldrum


    Despite considerable research attention focused on mechanisms underlying neural spreading depression (SD), because of its association with important human CNS pathologies, such as stroke and migraine, little attention has been given to explaining its occurrence and regulation in invertebrates. In the locust metathoracic ganglion (MTG), an SD-like event occurs during heat and anoxia stress, which results in cessation of neuronal output for the duration of the applied stress. SD-like events were characterized by an abrupt rise in extracellular potassium ion concentration ([K(+)](o)) from a baseline concentration of approximately 8 to >30 mm, which returned to near baseline concentrations after removal of the applied stress. After return to baseline [K(+)](o), neuronal output (ventilatory motor pattern activity) from the MTG recovered. Unlike mammalian neurons, which depolarize almost completely during SD, locust neurons only partially depolarized. SD-like events in the locust CNS were suppressed by pharmacological inhibition of the nitric oxide/cyclic guanosine monophosphate/protein kinase G (NO/cGMP/PKG) pathway and were exacerbated by its activation. Also, environmental stressors such as heat and anoxia increased production of nitric oxide in the locust CNS. Finally, for the intact animal, manipulation of the pathway affected the speed of recovery from suffocation by immersion under water. We propose that SD-like events in locusts provide an adaptive mechanism for surviving extreme environmental conditions. The highly conserved nature of the NO/cGMP/PKG signaling pathway suggests that it may be involved in modulating SD in other organisms, including mammals. PMID:19553462

  4. The vasodilatory effect of sulfur dioxide via SGC/cGMP/PKG pathway in association with sulfhydryl-dependent dimerization.


    Yao, Qiuyu; Huang, Yaqian; Liu, Angie Dong; Zhu, Mingzhu; Liu, Jia; Yan, Hui; Zhang, Qingyou; Geng, Bin; Gao, Yuansheng; Du, Shuxu; Huang, Pan; Tang, Chaoshu; Du, Junbao; Jin, Hongfang


    The present study was designed to explore the role of soluble guanylate cyclase (sGC)/cyclic guanosine monophosphate (cGMP)/PKG pathway in sulfur dioxide (SO2)-induced vasodilation. We showed that SO2 induced a concentration-dependent relaxation of phenylephrine (PE)-precontracted rat aortic rings in association with an increase in cGMP concentration, whereas l-aspartic acid β-hydroxamate (HDX), an inhibitor of SO2 synthase, contracted rings in a dose-dependent manner. Pretreatment of aortic rings with the sGC inhibitor ODQ (30 μM) attenuated the vasodilatory effects of SO2, suggesting the involvement of cGMP pathway in SO2-induced vasodilation. Mechanistically, SO2 upregulated the protein levels of sGC and PKG dimers, while HDX inhibited it, indicating SO2 could promote cGMP synthesis through sGC activation. Furthermore, the dimerization of sGC and PKG and vasodilation induced by SO2 in precontracted rings were significantly prevented by thiol reductants dithiothreitol (DTT). In addition, SO2 reduced the activity of phosphodiesterase type 5 (PDE5), a cGMP-specific hydrolytic enzyme, implying that SO2 elevated cGMP concentration by inhibiting its hydrolysis. Hence, SO2 exerted its vasodilatory effects at least partly by promoting disulfide-dependent dimerization of sGC and PKG, resulting in an activated sGC/cGMP/PKG pathway in blood vessels. These findings revealed a new mode of action and mechanisms by which SO2 regulated the vascular tone. PMID:27009048

  5. Icariin Inhibits Pulmonary Hypertension Induced by Monocrotaline through Enhancement of NO/cGMP Signaling Pathway in Rats

    PubMed Central

    Li, Li-sheng; Luo, Yun-mei; Liu, Juan; Zhang, Yu; Fu, Xiao-xia; Yang, Dan-li


    It has been reported that icariin (ICA) increased contents of nitric oxide (NO) and cyclic guanosine monophosphate (cGMP) by improving expression of endothelial nitric oxide synthase (eNOS) and inhibition of phosphodiesterase type 5 (PDE5). In addition, dysfunction of the NO/cGMP pathway may play a crucial role in the pathogenesis of pulmonary hypertension (PH). In this study, the potential protective effects of ICA on PH induced by monocrotaline (MCT, 50 mg/kg) singly subcutaneous injection were investigated and the possible mechanisms involved in NO/cGMP pathway were explored in male Sprague Dawley rats. The results showed that ICA (20, 40, and 80 mg/kg/d) treatment by intragastric administration could significantly ameliorate PH and upregulate the expression of eNOS gene and downregulate the expression of PDE5 gene in MCT-treated rats. Both ICA (40 mg/kg/d) and L-arginine (200 mg/kg/d), a precursor of NO as positive control, notably increased the contents of NO and cGMP in lung tissue homogenate, which were inversed by treatment with NG-nitro-L-arginine-methyl ester (L-NAME), a NOS inhibitor, and L-NAME-treatment could also inhibit the protective effects of ICA (40 mg/kg/d) on mean pulmonary artery pressure and artery remodeling and tends to inhibit right ventricle hypertrophy index. In summary, ICA is effective in protecting against MCT-induced PH in rats through enhancement of NO/cGMP signaling pathway in rats. PMID:27366192

  6. Adenosine Monophosphate-Based Detection of Bacterial Spores

    NASA Technical Reports Server (NTRS)

    Kern, Roger G.; Chen, Fei; Venkateswaran, Kasthuri; Hattori, Nori; Suzuki, Shigeya


    A method of rapid detection of bacterial spores is based on the discovery that a heat shock consisting of exposure to a temperature of 100 C for 10 minutes causes the complete release of adenosine monophosphate (AMP) from the spores. This method could be an alternative to the method described in the immediately preceding article. Unlike that method and related prior methods, the present method does not involve germination and cultivation; this feature is an important advantage because in cases in which the spores are those of pathogens, delays involved in germination and cultivation could increase risks of infection. Also, in comparison with other prior methods that do not involve germination, the present method affords greater sensitivity. At present, the method is embodied in a laboratory procedure, though it would be desirable to implement the method by means of a miniaturized apparatus in order to make it convenient and economical enough to encourage widespread use.

  7. Isolation and characterization of the orotidine 5'-monophosphate decarboxylase domain of the multifunctional protein uridine 5'-monophosphate synthase.


    Floyd, E E; Jones, M E


    The multifunctional protein uridine 5'-monophosphate (UMP) synthase catalyzes the final two reactions of the de novo biosynthesis of UMP in mammalian cells by the sequential action of orotate phosphoribosyltransferase (EC and orotidine 5'-monophosphate (OMP) decarboxylase (EC This protein is composed of one or two identical subunits; the monomer weighs of 51,500 daltons. UMP synthase from mouse Ehrlich ascites cells can exist as three distinct species as determined by sucrose density gradient centrifugation: a 3.6 S monomer, a 5.1 S dimer, and a 5.6 S conformationally altered dimer. Limited digestion of each of these three species with trypsin produced a 28,500-dalton peptide that was relatively resistant to further proteolysis. The peptide appears to be one of the two enzyme domains of UMP synthase for it retained only OMP decarboxylase activity. Similar results were obtained when UMP synthase was digested with elastase. OMP decarboxylase activity was less stable for the domain than for UMP synthase; the domain can rapidly lose activity upon storage or upon dilution. The size of the mammalian OMP decarboxylase domain is similar to that of yeast OMP decarboxylase. If the polypeptides which are cleaved from UMP synthase by trypsin are derived exclusively from either the amino or the carboxyl end of UMP synthase, then the size of a fragment possessing the orotate phosphoribosyltransferase domain could be as large as 23,000 daltons which is similar in size to the orotate phosphoribosyltransferase of yeast and of Escherichia coli. PMID:3839509

  8. Novel bimodular DNA aptamers with guanosine quadruplexes inhibit phylogenetically diverse HIV-1 reverse transcriptases

    PubMed Central

    Michalowski, Daniel; Chitima-Matsiga, Rebecca; Held, Daniel M.; Burke, Donald H.


    DNA aptamers RT5, RT6 and RT47 form a group of related sequences that inhibit HIV-1 reverse transcriptase (RT). The essential inhibitory structure is identified here as bimodular, with a 5′ stem–loop module physically connected to a 3′-guanosine quadruplex module. The stem–loop tolerates considerable sequence plasticity. Connections between the guanosine triplets in the quadruplex could be simplified to a single nucleotide or a nonnucleic acid linker, such as hexaethylene glycol. All 12 quadruplex guanosines are required in an aptamer retaining most of the original loop sequence from RT6; only 11 are required for aptamer R1T (single T residue in intra-quadruplex loops). Circular dichroism (CD) spectroscopy gave ellipticity minima and maxima at 240 nm and 264 nm, indicating a parallel arrangement of the quadruplex strands. The simplified aptamers displayed increased overall stability. An aptamer carrying the original intra-quadruplex loops from RT6 inhibited RT in K+ buffers but not in Na+ buffers and displayed significant CD spectral broadening in Na+ buffers, while R1T inhibited RT in both buffers and displayed less broadening in Na+ buffers. The bimodular ssDNA aptamers inhibited RT from diverse primate lentiviruses with low nM IC50 values. These data provide insight into the requirements for broad-spectrum RT inhibition by nucleic acid aptamers. PMID:18996899

  9. Voltammetric determination of adenosine and guanosine using fullerene-C(60)-modified glassy carbon electrode.


    Goyal, Rajendra N; Gupta, Vinod K; Oyama, Munetaka; Bachheti, Neeta


    A fullerene-C(60)-modified glassy carbon electrode (GCE) is used for the simultaneous determination of adenosine and guanosine by differential pulse voltammetry. Compared to a bare glassy carbon electrode, the modified electrode exhibits an apparent shift of the oxidation potentials in the cathodic direction and a marked enhancement in the voltammetric peak current response for both the biomolecules. Linear calibration curves are obtained over the concentration range 0.5muM-1.0mM in 0.1M phosphate buffer solution at pH 7.2 with a detection limit of 3.02x10(-7)M and 1.45x10(-7)M for individual determination of adenosine and guanosine, respectively. The interference studies showed that the fullerene-C(60)-modified glassy carbon electrode exhibited excellent selectivity in the presence of hypoxanthine, xanthine, uric acid and ascorbic acid. The proposed procedure was successfully applied to detect adenosine and guanosine in human blood plasma and urine, without any preliminary pre-treatment. PMID:19071420

  10. Remyelination after chronic spinal cord injury is associated with proliferation of endogenous adult progenitor cells after systemic administration of guanosine.


    Jiang, Shucui; Ballerini, Patrizia; Buccella, Silvana; Giuliani, Patricia; Jiang, Cai; Huang, Xinjie; Rathbone, Michel P


    Axonal demyelination is a consistent pathological sequel to chronic brain and spinal cord injuries and disorders that slows or disrupts impulse conduction, causing further functional loss. Since oligodendroglial progenitors are present in the demyelinated areas, failure of remyelination may be due to lack of sufficient proliferation and differentiation of oligodendroglial progenitors. Guanosine stimulates proliferation and differentiation of many types of cells in vitro and exerts neuroprotective effects in the central nervous system (CNS). Five weeks after chronic traumatic spinal cord injury (SCI), when there is no ongoing recovery of function, intraperitoneal administration of guanosine daily for 2 weeks enhanced functional improvement correlated with the increase in myelination in the injured cord. Emphasis was placed on analysis of oligodendrocytes and NG2-positive (NG2+) cells, an endogenous cell population that may be involved in oligodendrocyte replacement. There was an increase in cell proliferation (measured by bromodeoxyuridine staining) that was attributable to an intensification in progenitor cells (NG2+ cells) associated with an increase in mature oligodendrocytes (determined by Rip+ staining). The numbers of astroglia increased at all test times after administration of guanosine whereas microglia only increased in the later stages (14 days). Injected guanosine and its breakdown product guanine accumulated in the spinal cords; there was more guanine than guanosine detected. We conclude that functional improvement and remyelination after systemic administration of guanosine is due to the effect of guanosine/guanine on the proliferation of adult progenitor cells and their maturation into myelin-forming cells. This raises the possibility that administration of guanosine may be useful in the treatment of spinal cord injury or demyelinating diseases such as multiple sclerosis where quiescent oligodendroglial progenitors exist in demyelinated plaques. PMID

  11. Remyelination after chronic spinal cord injury is associated with proliferation of endogenous adult progenitor cells after systemic administration of guanosine

    PubMed Central

    Ballerini, Patrizia; Buccella, Silvana; Giuliani, Patricia; Jiang, Cai; Huang, Xinjie; Rathbone, Michel P.


    Axonal demyelination is a consistent pathological sequel to chronic brain and spinal cord injuries and disorders that slows or disrupts impulse conduction, causing further functional loss. Since oligodendroglial progenitors are present in the demyelinated areas, failure of remyelination may be due to lack of sufficient proliferation and differentiation of oligodendroglial progenitors. Guanosine stimulates proliferation and differentiation of many types of cells in vitro and exerts neuroprotective effects in the central nervous system (CNS). Five weeks after chronic traumatic spinal cord injury (SCI), when there is no ongoing recovery of function, intraperitoneal administration of guanosine daily for 2 weeks enhanced functional improvement correlated with the increase in myelination in the injured cord. Emphasis was placed on analysis of oligodendrocytes and NG2-positive (NG2+) cells, an endogenous cell population that may be involved in oligodendrocyte replacement. There was an increase in cell proliferation (measured by bromodeoxyuridine staining) that was attributable to an intensification in progenitor cells (NG2+ cells) associated with an increase in mature oligodendrocytes (determined by Rip+ staining). The numbers of astroglia increased at all test times after administration of guanosine whereas microglia only increased in the later stages (14 days). Injected guanosine and its breakdown product guanine accumulated in the spinal cords; there was more guanine than guanosine detected. We conclude that functional improvement and remyelination after systemic administration of guanosine is due to the effect of guanosine/guanine on the proliferation of adult progenitor cells and their maturation into myelin-forming cells. This raises the possibility that administration of guanosine may be useful in the treatment of spinal cord injury or demyelinating diseases such as multiple sclerosis where quiescent oligodendroglial progenitors exist in demyelinated plaques

  12. Recognition of Nucleoside Monophosphate Substrates by Haemophilus influenzae Class C Acid Phosphatase

    PubMed Central

    Singh, Harkewal; Schuermann, Jonathan P.; Reilly, Thomas J.; Calcutt, Michael J.; Tanner, John J.


    Summary The e (P4) phosphatase from Haemophilus influenzae functions in a vestigial NAD+ utilization pathway by dephosphorylating NMN to nicotinamide riboside. P4 is also the prototype of class C acid phosphatases, which are nonspecific 5′-, 3′-nucleotidases localized to the bacterial outer membrane. To understand substrate recognition by P4 and other class C phosphatases, we have determined the crystal structures of a substrate-trapping mutant P4 enzyme complexed with NMN, 5′-AMP, 3′-AMP, and 2′-AMP. The structures reveal an anchor-shaped substrate-binding cavity comprising a conserved hydrophobic box that clamps the nucleotide base, a buried phosphoryl binding site, and three solvent-filled pockets that contact the ribose and hydrogen-bonding edge of the base. The span between the hydrophobic box and phosphoryl site is optimal for recognizing nucleoside monophosphates, which explains the general preference for this class of substrate. The base makes no hydrogen bonds with the enzyme, which is consistent with observed lack of base specificity. Two solvent-filled pockets flanking the ribose are key to the dual recognition of 5′- and 3′-nucleotides. These pockets minimize the enzyme’s direct interactions with the ribose and provide sufficient space to accommodate 5′ substrates in an anti conformation and 3′ substrates in a syn conformation. Finally, the structures suggest that class B and C acid phosphatases share a common strategy for nucleotide recognition. PMID:20934434

  13. Recognition of Nucleoside Monophosphate Substrates by Haemophilus influenzae Class C Acid Phosphatase

    SciTech Connect

    Singh, Harkewal; Schuermann, Jonathan P.; Reilly, Thomas J.; Calcutt, Michael J.; Tanner, John J.


    The e (P4) phosphatase from Haemophilus influenzae functions in a vestigial NAD{sup +} utilization pathway by dephosphorylating nicotinamide mononucleotide to nicotinamide riboside. P4 is also the prototype of class C acid phosphatases (CCAPs), which are nonspecific 5{prime},3{prime}-nucleotidases localized to the bacterial outer membrane. To understand substrate recognition by P4 and other class C phosphatases, we have determined the crystal structures of a substrate-trapping mutant P4 enzyme complexed with nicotinamide mononucleotide, 5{prime}-AMP, 3{prime}-AMP, and 2{prime}-AMP. The structures reveal an anchor-shaped substrate-binding cavity comprising a conserved hydrophobic box that clamps the nucleotide base, a buried phosphoryl binding site, and three solvent-filled pockets that contact the ribose and the hydrogen-bonding edge of the base. The span between the hydrophobic box and the phosphoryl site is optimal for recognizing nucleoside monophosphates, explaining the general preference for this class of substrate. The base makes no hydrogen bonds with the enzyme, consistent with an observed lack of base specificity. Two solvent-filled pockets flanking the ribose are key to the dual recognition of 5{prime}-nucleotides and 3{prime}-nucleotides. These pockets minimize the enzyme's direct interactions with the ribose and provide sufficient space to accommodate 5{prime} substrates in an anti conformation and 3{prime} substrates in a syn conformation. Finally, the structures suggest that class B acid phosphatases and CCAPs share a common strategy for nucleotide recognition.

  14. Recognition of nucleoside monophosphate substrates by Haemophilus influenzae class C acid phosphatase.


    Singh, Harkewal; Schuermann, Jonathan P; Reilly, Thomas J; Calcutt, Michael J; Tanner, John J


    The e (P4) phosphatase from Haemophilus influenzae functions in a vestigial NAD(+) utilization pathway by dephosphorylating nicotinamide mononucleotide to nicotinamide riboside. P4 is also the prototype of class C acid phosphatases (CCAPs), which are nonspecific 5',3'-nucleotidases localized to the bacterial outer membrane. To understand substrate recognition by P4 and other class C phosphatases, we have determined the crystal structures of a substrate-trapping mutant P4 enzyme complexed with nicotinamide mononucleotide, 5'-AMP, 3'-AMP, and 2'-AMP. The structures reveal an anchor-shaped substrate-binding cavity comprising a conserved hydrophobic box that clamps the nucleotide base, a buried phosphoryl binding site, and three solvent-filled pockets that contact the ribose and the hydrogen-bonding edge of the base. The span between the hydrophobic box and the phosphoryl site is optimal for recognizing nucleoside monophosphates, explaining the general preference for this class of substrate. The base makes no hydrogen bonds with the enzyme, consistent with an observed lack of base specificity. Two solvent-filled pockets flanking the ribose are key to the dual recognition of 5'-nucleotides and 3'-nucleotides. These pockets minimize the enzyme's direct interactions with the ribose and provide sufficient space to accommodate 5' substrates in an anti conformation and 3' substrates in a syn conformation. Finally, the structures suggest that class B acid phosphatases and CCAPs share a common strategy for nucleotide recognition. PMID:20934434

  15. Inosine monophosphate dehydrogenase expression: transcriptional regulation of the type I and type II genes.


    Zimmermann, A; Gu, J J; Spychala, J; Mitchell, B S


    Inosine 5'-monophosphate dehydrogenase (IMPDH) is an essential rate-limiting enzyme in the de novo guanine nucleotide synthetic pathway that catalyzes the conversion of IMP to XMP. Enzyme activity is accounted for by the expression of two distinct but closely related genes termed IMPDH I and II. Increased IMPDH activity has been linked to both cellular proliferation and neoplastic transformation and generally ascribed to an increase in the expression of the type II gene. We have characterized the type I and type II genes and identified elements important in the transcriptional regulation of both genes. The type II IMPDH gene contains a 466 bp 5' flanking region spanning the translation start site that contains several transcription factor binding sites and mediates increased transcription of a CAT reporter gene in peripheral blood T lymphocytes when these cells are induced to proliferate. The single functional IMPDH type I gene contains exon-intron boundaries and exon structures that are nearly identical to those in the type II gene. In contrast to the type II gene, however, it contains two putative promoter sites, each with the potential for transcriptional regulation. We conclude that these two genes most probably arose from an early gene duplication event and that their highly conserved structures and differential regulation at the transcriptional level argue strongly for a significant role for each gene in cellular metabolism, growth, and differentiation. PMID:8869741

  16. Effects of hydrogen peroxide on voltage-dependent K+ currents in human cardiac fibroblasts through protein kinase pathways

    PubMed Central

    Bae, Hyemi; Lee, Donghee; Kim, Young-Won; Choi, Jeongyoon; Lee, Hong Jun; Kim, Sang-Wook; Kim, Taeho; Noh, Yun-Hee; Ko, Jae-Hong; Bang, Hyoweon


    Human cardiac fibroblasts (HCFs) have various voltage-dependent K+ channels (VDKCs) that can induce apoptosis. Hydrogen peroxide (H2O2) modulates VDKCs and induces oxidative stress, which is the main contributor to cardiac injury and cardiac remodeling. We investigated whether H2O2 could modulate VDKCs in HCFs and induce cell injury through this process. In whole-cell mode patch-clamp recordings, application of H2O2 stimulated Ca2+-activated K+ (KCa) currents but not delayed rectifier K+ or transient outward K+ currents, all of which are VDKCs. H2O2-stimulated KCa currents were blocked by iberiotoxin (IbTX, a large conductance KCa blocker). The H2O2-stimulating effect on large-conductance KCa (BKCa) currents was also blocked by KT5823 (a protein kinase G inhibitor) and 1 H-[1, 2, 4] oxadiazolo-[4, 3-a] quinoxalin-1-one (ODQ, a soluble guanylate cyclase inhibitor). In addition, 8-bromo-cyclic guanosine 3', 5'-monophosphate (8-Br-cGMP) stimulated BKCa currents. In contrast, KT5720 and H-89 (protein kinase A inhibitors) did not block the H2O2-stimulating effect on BKCa currents. Using RT-PCR and western blot analysis, three subtypes of KCa channels were detected in HCFs: BKCa channels, small-conductance KCa (SKCa) channels, and intermediate-conductance KCa (IKCa) channels. In the annexin V/propidium iodide assay, apoptotic changes in HCFs increased in response to H2O2, but IbTX decreased H2O2-induced apoptosis. These data suggest that among the VDKCs of HCFs, H2O2 only enhances BKCa currents through the protein kinase G pathway but not the protein kinase A pathway, and is involved in cell injury through BKCa channels. PMID:27162486

  17. Effects of non-surgical periodontal treatment on the L-arginine-nitric oxide pathway and oxidative status in platelets.


    Siqueira, Mariana Alves de Sá; Fischer, Ricardo Guimarães; Pereira, Natália Rodrigues; Martins, Marcela Anjos; Moss, Monique Bandeira; Mendes-Ribeiro, Antônio Cláudio; Figueredo, Carlos Marcelo da Silva; Brunini, Tatiana Marlowe Cunha


    Several studies have suggested an increase of cardiovascular disease (CVD) risk on periodontitis patients. An enhancement has been demonstrated on both platelet activation and oxidative stress on periodontitis patients, which may contribute for this association. Therefore, the aim of this study was to evaluate the effects of non-surgical periodontal treatment on the l-arginine-nitric oxide (NO)-cyclic guanosine monophosphate (cGMP) pathway and oxidative status in platelets. A total of eight periodontitis patients and eight controls were included in this study. Clinical, laboratory and experimental evaluations were performed on baseline and 90 days after periodontal treatment (except for western blot analysis). The clinical periodontal evaluation included measurements of probing pocket depth (PPD), clinical attachment loss (CAL), % of sites with plaque and % of sites with bleeding on probing. We evaluated: l-[(3)H]arginine influx; nitric oxide synthase (NOS) and arginase enzymes activity and expression; expression of guanylate cyclase and phosphodiesterase-5 enzymes; cGMP levels; platelet aggregation; oxidative status through superoxide dismutase (SOD) and catalase activities, and measurement of reactive oxygen species (ROS) levels and C-reactive protein (CRP) levels. The initial results showed an activation of both l-arginine influx and via system y (+ )L associated with reduced intraplatelet cGMP levels in periodontitis patients and increased systemic levels of CRP. After periodontal treatment, there was a significant reduction of the % of sites with PPD 4-5mm, % of sites with CAL 4-5 mm, and an enhancement in cGMP levels and SOD activity. Moreover, CRP levels were reduced after treatment. Therefore, alterations in the intraplatelet l-arginine-NO-cGMP pathway and oxidant-antioxidant balance associated with a systemic inflammatory response may lead to platelet dysfunction, which may contribute to a higher risk of CVD in periodontitis. PMID:23918883

  18. Gastrointestinal pain: unraveling a novel endogenous pathway through uroguanylin/guanylate cyclase-C/cGMP activation.


    Silos-Santiago, Inmaculada; Hannig, Gerhard; Eutamene, Helene; Ustinova, Elena E; Bernier, Sylvie G; Ge, Pei; Graul, Christopher; Jacobson, Sarah; Jin, Hong; Liong, Elaine; Kessler, Marco M; Reza, Tammi; Rivers, Samuel; Shea, Courtney; Tchernychev, Boris; Bryant, Alexander P; Kurtz, Caroline B; Bueno, Lionel; Pezzone, Michael A; Currie, Mark G


    The natural hormone uroguanylin regulates intestinal fluid homeostasis and bowel function through activation of guanylate cyclase-C (GC-C), resulting in increased intracellular cyclic guanosine-3',5'-monophosphate (cGMP). We report the effects of uroguanylin-mediated activation of the GC-C/cGMP pathway in vitro on extracellular cGMP transport and in vivo in rat models of inflammation- and stress-induced visceral hypersensitivity. In vitro exposure of intestinal Caco-2 cells to uroguanylin stimulated bidirectional, active extracellular transport of cGMP into luminal and basolateral spaces. cGMP transport was significantly and concentration dependently decreased by probenecid, an inhibitor of cGMP efflux pumps. In ex vivo Ussing chamber assays, uroguanylin stimulated cGMP secretion from the basolateral side of rat colonic epithelium into the submucosal space. In a rat model of trinitrobenzene sulfonic acid (TNBS)-induced visceral hypersensitivity, orally administered uroguanylin increased colonic thresholds required to elicit abdominal contractions in response to colorectal distension (CRD). Oral administration of cGMP mimicked the antihyperalgesic effects of uroguanylin, significantly decreasing TNBS- and restraint stress-induced visceromotor response to graded CRD in rats. The antihyperalgesic effects of cGMP were not associated with increased colonic spasmolytic activity, but were linked to significantly decreased firing rates of TNBS-sensitized colonic afferents in rats in response to mechanical stimuli. In conclusion, these data suggest that the continuous activation of the GC-C/cGMP pathway along the intestinal tract by the endogenous hormones guanylin and uroguanylin results in significant reduction of gastrointestinal pain. Extracellular cGMP produced on activation of GC-C is the primary mediator in this process via modulation of sensory afferent activity. PMID:23748116

  19. Bacillus anthracis Inosine 5′-Monophosphate Dehydrogenase in Action: The First Bacterial Series of Structures of Phosphate Ion-, Substrate-, and Product-Bound Complexes

    PubMed Central

    Makowska-Grzyska, Magdalena; Kim, Youngchang; Wu, Ruiying; Wilton, Rosemarie; Gollapalli, Deviprasad R.; Wang, Ximi K.; Zhang, Rongguang; Jedrzejczak, Robert; Mack, Jamey C.; Maltseva, Natalia; Mulligan, Rory; Binkowski, T. Andrew; Gornicki, Piotr; Kuhn, Misty L.; Anderson, Wayne F.; Hedstrom, Lizbeth; Joachimiak, Andrzej


    Inosine 5′-monophosphate dehydrogenase (IMPDH) catalyzes the first unique step of the GMP branch of the purine nucleotide biosynthetic pathway. This enzyme is found in organisms of all three kingdoms. IMPDH inhibitors have broad clinical applications in cancer treatment, as antiviral drugs and as immunosuppressants, and have also displayed antibiotic activity. We have determined three crystal structures of Bacillus anthracis IMPDH, in a phosphate ion-bound (termed “apo”) form and in complex with its substrate, inosine 5′-monophosphate (IMP), and product, xanthosine 5′-monophosphate (XMP). This is the first example of a bacterial IMPDH in more than one state from the same organism. Furthermore, for the first time for a prokaryotic enzyme, the entire active site flap, containing the conserved Arg-Tyr dyad, is clearly visible in the structure of the apoenzyme. Kinetic parameters for the enzymatic reaction were also determined, and the inhibitory effect of XMP and mycophenolic acid (MPA) has been studied. In addition, the inhibitory potential of two known Cryptosporidium parvum IMPDH inhibitors was examined for the B. anthracis enzyme and compared with those of three bacterial IMPDHs from Campylobacter jejuni, Clostridium perfringens, and Vibrio cholerae. The structures contribute to the characterization of the active site and design of inhibitors that specifically target B. anthracis and other microbial IMPDH enzymes. PMID:22788966

  20. Deoxypyrimidine monophosphate bypass therapy for thymidine kinase 2 deficiency

    PubMed Central

    Garone, Caterina; Garcia-Diaz, Beatriz; Emmanuele, Valentina; Lopez, Luis C; Tadesse, Saba; Akman, Hasan O; Tanji, Kurenai; Quinzii, Catarina M; Hirano, Michio


    Autosomal recessive mutations in the thymidine kinase 2 gene (TK2) cause mitochondrial DNA depletion, multiple deletions, or both due to loss of TK2 enzyme activity and ensuing unbalanced deoxynucleotide triphosphate (dNTP) pools. To bypass Tk2 deficiency, we administered deoxycytidine and deoxythymidine monophosphates (dCMP+dTMP) to the Tk2 H126N (Tk2−/−) knock-in mouse model from postnatal day 4, when mutant mice are phenotypically normal, but biochemically affected. Assessment of 13-day-old Tk2−/− mice treated with dCMP+dTMP 200 mg/kg/day each (Tk2−/−200dCMP/dTMP) demonstrated that in mutant animals, the compounds raise dTTP concentrations, increase levels of mtDNA, ameliorate defects of mitochondrial respiratory chain enzymes, and significantly prolong their lifespan (34 days with treatment versus 13 days untreated). A second trial of dCMP+dTMP each at 400 mg/kg/day showed even greater phenotypic and biochemical improvements. In conclusion, dCMP/dTMP supplementation is the first effective pharmacologic treatment for Tk2 deficiency. Subject Categories Genetics, Gene Therapy & Genetic Disease; Metabolism PMID:24968719

  1. Bioconjugation of zirconium uridine monophosphate: application to myoglobin direct electrochemistry.


    Qiao, Yuanbiao; Jian, Fangfang; Bai, Qian


    Porous nano-granule of zirconium uridine monophosphate, Zr(UMP)2.H2O is, for the first time, synthesized under mild experimental conditions and applied to the bioconjugation of myoglobin (Mb) to realize its direct electron transfer. UV-vis and resonance Raman spectroscopies prove that Mb in the Zr(UMP)2.H2O film maintains its secondary structure similar to the native state. The conjugation film of the Mb-Zr(UMP)2.H2O on the glassy carbon (GC) electrode gives a well-defined and quasi-reversible cyclic voltammogram, which reflects the direct electron transfer of the heme Fe III/Fe II couple of Mb. On the basis of the satisfying bioelectrocatalysis of the nano-conjugation of Mb and genetic substrate, a kind of mediator-free biosensor for H2O2 is developed. The linear range for H2O2 detection is estimated to be 3.92-180.14 microM. The apparent Michaelis-Menten constant (Km) and the detection limit based on the signal-to-noise ratio of 3 are found to be 196.1 microM and 1.52 microM, respectively. Both the apparent Michaelis-Menten constant and the detection limit herein are much lower than currently reported values from other Mb films. This kind of sensor possesses excellent stability, long-term life (more than 20 days) and good reproducibility. PMID:18180152

  2. In Silico Design for Adenosine Monophosphate-Activated Protein Kinase Agonist from Traditional Chinese Medicine for Treatment of Metabolic Syndromes

    PubMed Central

    Tang, Hsin-Chieh


    Adenosine monophosphate-activated protein kinase (AMPK) acts as a master mediator of metabolic homeostasis. It is considered as a significant millstone to treat metabolic syndromes including obesity, diabetes, and fatty liver. It can sense cellular energy or nutrient status by switching on the catabolic pathways. Investigation of AMPK has new findings recently. AMPK can inhibit cell growth by the way of autophagy. Thus AMPK has become a hot target for small molecular drug design of tumor inhibition. Activation of AMPK must undergo certain extent change of the structure. Through the methods of structure-based virtual screening and molecular dynamics simulation, we attempted to find out appropriate small compounds from the world's largest TCM Database@Taiwan that had the ability to activate the function of AMPK. Finally, we found that two TCM compounds, eugenyl_beta-D-glucopyranoside and 6-O-cinnamoyl-D-glucopyranose, had the qualification to be AMPK agonist. PMID:24899913

  3. Disruption of Nucleotide Homeostasis by the Antiproliferative Drug 5-Aminoimidazole-4-carboxamide-1-β-d-ribofuranoside Monophosphate (AICAR).


    Ceschin, Johanna; Hürlimann, Hans Caspar; Saint-Marc, Christelle; Albrecht, Delphine; Violo, Typhaine; Moenner, Michel; Daignan-Fornier, Bertrand; Pinson, Benoît


    5-Aminoimidazole-4-carboxamide-1-β-D-ribofuranoside monophosphate (AICAR) is a natural metabolite with potent anti-proliferative and low energy mimetic properties. At high concentration, AICAR is toxic for yeast and mammalian cells, but the molecular basis of this toxicity is poorly understood. Here, we report the identification of yeast purine salvage pathway mutants that are synthetically lethal with AICAR accumulation. Genetic suppression revealed that this synthetic lethality is in part due to low expression of adenine phosphoribosyl transferase under high AICAR conditions. In addition, metabolite profiling points to the AICAR/NTP balance as crucial for optimal utilization of glucose as a carbon source. Indeed, we found that AICAR toxicity in yeast and human cells is alleviated when glucose is replaced by an alternative carbon source. Together, our metabolic analyses unveil the AICAR/NTP balance as a major factor of AICAR antiproliferative effects. PMID:26283791

  4. Mitochondrial Oxidative Stress Corrupts Coronary Collateral Growth by Activating Adenosine Monophosphate Activated Kinase-α Signaling

    PubMed Central

    Pung, Yuh Fen; Sam, Wai Johnn; Stevanov, Kelly; Enrick, Molly; Chen, Chwen-Lih; Kolz, Christopher; Thakker, Prashanth; Hardwick, James P.; Chen, Yeong-Renn; Dyck, Jason R.B.; Yin, Liya; Chilian, William M.


    Objective Our goal was to determine the mechanism by which mitochondrial oxidative stress impairs collateral growth in the heart. Approach and Results Rats were treated with rotenone (mitochondrial complex I inhibitor that increases reactive oxygen species production) or sham-treated with vehicle and subjected to repetitive ischemia protocol for 10 days to induce coronary collateral growth. In control rats, repetitive ischemia increased flow to the collateral-dependent zone; however, rotenone treatment prevented this increase suggesting that mitochondrial oxidative stress compromises coronary collateral growth. In addition, rotenone also attenuated mitochondrial complex I activity and led to excessive mitochondrial aggregation. To further understand the mechanistic pathway(s) involved, human coronary artery endothelial cells were treated with 50 ng/ mL vascular endothelial growth factor, 1 µmol/L rotenone, and rotenone/vascular endothelial growth factor for 48 hours. Vascular endothelial growth factor induced robust tube formation; however, rotenone completely inhibited this effect (P<0.05 rotenone versus vascular endothelial growth factor treatment). Inhibition of tube formation by rotenone was also associated with significant increase in mitochondrial superoxide generation. Immunoblot analyses of human coronary artery endothelial cells with rotenone treatment showed significant activation of adenosine monophosphate activated kinase (AMPK)-α and inhibition of mammalian target of rapamycin and p70 ribosomal S6 kinase. Activation of AMPK-α suggested impairments in energy production, which was reflected by decrease in O2 consumption and bioenergetic reserve capacity of cultured cells. Knockdown of AMPK-α (siRNA) also preserved tube formation during rotenone, suggesting the negative effects were mediated by the activation of AMPK-α. Conversely, expression of a constitutively active AMPK-α blocked tube formation. Conclusions We conclude that activation of AMPK

  5. Relationship between antitumor effect and metabolites of 5-fluorouracil in combination treatment with 5-fluorouracil and guanosine in ascites Sarcoma 180 tumor system

    SciTech Connect

    Iigo, M.; Kuretani, K.; Hoshi, A.


    The antitumor activity of (6-14C)5-fluorouracil ((6-14C)FUra) against ascites Sarcoma 180 was significantly enhanced by coadministration of guanosine, and slightly by adenosine, but not by cytidine or uridine. In advanced ascites Sarcoma 180, guanosine also enhanced the action of FUra, but adenosine, uridine, and cytidine did not. The potentiation of antitumor activity by guanosine was reversed by addition of cytidine. The antitumor activity of FUra was significantly potentiated when guanosine was administered either 0 to 15 min before or 5 min after FUra. Changes in metabolites of FUra after potentiation by guanosine were investigated. The potentiation of antitumor activity of FUra by guanosine was considered to be due to an increase in incorporation of FUra into FUra-nucleotides and RNA in the tumor cells.

  6. Use of phosphoimidazolide-activated guanosine to investigate the nucleophilicity of spermine and spermidine

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.; Baird, E. E.; Smith, P. J.


    Guanosine 5'-phosphate 2-methylimidazolide (2-MeImpG), a labile phosphoimidazolide analog of guanosine triphosphate, was used to test the reactivity of the natural polyamines (PAs), spermine (spm) and spermidine (spd). The products are the guanosine 5'-phosphate-polyamine derivatives (PA-pG: spd-pG and spm-pG) which are quite stable in the range 4 < pH < 11. Our study is the first of which we are aware that reports on the nucleophilicity of these amines. The main findings are as follows. (i) HPLC analysis of the products indicates the formation of only two of the three possible spd products and only one of the two possible spm products. These results can be explained if only the primary amino groups of the two polyamines are reactive, while the secondary amino groups are rendered unreactive by a steric effect. The reactions of 2-MeImpG and other phosphoimidazolide derivatives of nucleosides (ImpNs) with primary and secondary monoamines support this interpretation (Kanavarioti et al. J. Org. Chem. 1995, 60, 632). (ii) The product ratio of the two spd-pG adducts derived from the primary amino groups varies between 2.40 and 0.71 in the range 6.1 < or equal to pH < or equal to 11.9. Such small variation in the product ratio can only be rationalized by the similar, but not identical, basicity of the two primary amino groups and provides strong support for a previously reported model for polyamine ionization (Onasch et. al. Biophys. Chem. 1984, 19, 245). (iii) On the basis of our kinetic determinations conditions at which the nucleophilicity of these amines is at a minimum and at which other interactions with ImpNs could be tested can be chosen.

  7. The combination of organoselenium compounds and guanosine prevents glutamate-induced oxidative stress in different regions of rat brains.


    Dalla Corte, Cristiane L; Bastos, Luíza L; Dobrachinski, Fernando; Rocha, João B T; Soares, Félix A A


    This study was designed to investigate the protective effects of the combination of guanosine and 2 organoselenium compounds (ebselen and diphenyl diselenide) against glutamate-induced oxidative stress in different regions of rat brains. Glutamate caused an increase in reactive oxygen species (ROS) generation and a decrease in [(3)H]-glutamate uptake in striatal, cortical, and hippocampal slices. Guanosine, ebselen, and diphenyl diselenide prevented glutamate-induced ROS production in striatal, cortical and hippocampal slices. The combination of guanosine with organoselenium compounds was more effective against glutamate-induced ROS production than the individual compounds alone. Guanosine prevented [(3)H]-glutamate uptake inhibition in striatal, cortical, and hippocampal slices. Thus, protection against the harmful effects of glutamate is possibly due to the combination of the antioxidant properties of organoselenium compounds and the stimulatory effect of guanosine on glutamate uptake. In conclusion, the combination of antioxidants and glutamatergic system modulators could be considered a potential therapy against the prooxidant effects of glutamate. PMID:22133308

  8. Guanosine reduces apoptosis and inflammation associated with restoration of function in rats with acute spinal cord injury

    PubMed Central

    Bendjelloul, Farid; Ballerini, Patrizia; D’Alimonte, Iolanda; Nargi, Elenora; Jiang, Cai; Huang, Xinjie; Rathbone, Michel P.


    Spinal cord injury results in progressive waves of secondary injuries, cascades of noxious pathological mechanisms that substantially exacerbate the primary injury and the resultant permanent functional deficits. Secondary injuries are associated with inflammation, excessive cytokine release, and cell apoptosis. The purine nucleoside guanosine has significant trophic effects and is neuroprotective, antiapoptotic in vitro, and stimulates nerve regeneration. Therefore, we determined whether systemic administration of guanosine could protect rats from some of the secondary effects of spinal cord injury, thereby reducing neurological deficits. Systemic administration of guanosine (8 mg/kg per day, i.p.) for 14 consecutive days, starting 4 h after moderate spinal cord injury in rats, significantly improved not only motor and sensory functions, but also recovery of bladder function. These improvements were associated with reduction in the inflammatory response to injury, reduction of apoptotic cell death, increased sparing of axons, and preservation of myelin. Our data indicate that the therapeutic action of guanosine probably results from reducing inflammation resulting in the protection of axons, oligodendrocytes, and neurons and from inhibiting apoptotic cell death. These data raise the intriguing possibility that guanosine may also be able to reduce secondary pathological events and thus improve functional outcome after traumatic spinal cord injury in humans. PMID:18404454

  9. Characterization of a monoclonal antibody to thymidine glycol monophosphate

    SciTech Connect

    Chen, B.X.; Hubbard, K.; Ide, H.; Wallace, S.S.; Erlanger, B.F. )


    A monoclonal antibody specific for thymine glycol (TG) in irradiated or OsO4-treated DNA was obtained by immunizing with thymidine glycol monophosphate (TMP-glycol) conjugated to bovine serum albumin by a carbodiimide procedure. Screening by dot-immunobinding and enzyme-linked immunosorbant assay (ELISA) procedures gave eight clones that bound OsO4- treated DNA. One of them, 2.6F.6B.6C, an IgG2a kappa, was characterized further. Hapten inhibition studies with OsO4-treated DNA showed that the antibody was specific for TMP-glycol. Among the various inhibitors tested, inhibition was in the order TMP-glycol greater than 5,6-dihydrothymidine phosphate greater than TMP greater than thymidine glycol greater than TG. Inhibition by 5,6-dihydrothymidine, thymidine, thymine, AMP, and CMP was negligible. In OsO4-treated DNA, as few as 0.5 TG per 10,000 bp were detectable by direct ELISA. Inhibition assays could detect as few as 1.5 TG per 10,000 bp. The antibody was equally reactive with native or denatured DNA containing TG. Among the X-irradiated homopolymers dC, dA, dG, and dT, only dT reacted with the antibody. Using an ELISA, the antibody could detect damage in irradiated DNA at the level of 20 Gy. Thus the antibody is of potential use in assays for DNA damage caused by X rays or other agents that damage DNA by free radical interactions.

  10. The Synthesis of Guanosine 5′-Diphosphate l-Fucose from Guanosine 5′-Diphosphate 3,5-d-[3H]Mannose Catalyzed by an Enzyme Extract from Fruits of the Flax

    PubMed Central

    Barber, George A.


    An enzyme system from fruits of the flax plant is described that catalyzes the synthesis of the sugar nucleotide guanosine 5′-diphosphate l-fucose from guanosine 5′-diphosphate d-mannose with the intermediate formation of guanosine 5′-diphosphate 4-keto-6-deoxy-d-mannose. Tritium from-[3H]H2O was incorporated into the l-fucose portion of the sugar nucleotide in the course of the reaction, and tritium at the 3,5-carbons of the d-mannose moiety of GDP-d-mannose was exchanged with protons in the medium. These results support a mechanism of synthesis analogous to that proposed for the formation of l-rhamnose and other 6-deoxy sugars. PMID:16661431

  11. Structural Basis for Recognition of Guanosine by a Synthetic Tricyclic Cytosine Analogue: Guanidinium G-Clamp

    SciTech Connect

    Wilds, C.J.; Maier, M.A.; Manoharan, M.; Egli, M.


    An oligonucleotide analogue containing a novel heterocyclic analogue, the guanidinium G-clamp, was designed to allow formation of five H-bonds to guanosine. The guanidinium group was introduced postsynthetically by treatment of the deprotected oligonucleotide containing a free amino group with a solution of 1H-pyrazole-1-carboxamidine and purified by a combination of size-exclusion chromatography and reversed-phase HPLC. A single incorporation of this modification into an oligodeoxynucleotide sequence was found to increase duplex stability by 13{sup o} and 16{sup o} per modification to RNA and DNA, respectively. Crystals of a self-complementary decamer sequence containing this modification were grown and diffracted to 1-{angstrom} resolution. The structure was solved by molecular replacement and revealed that the modification forms additional H-bonds to O(6) and N(7) of guanosine through the amino and imino N-atoms, respectively. The origins of enhanced duplex stability are also attributed to increased stacking interactions mediated by the phenoxazine moiety of the G-clamp and formation of H-bond networks between the positively charged guanidinium group, H{sub 2}O molecules, and negatively charged O-atoms from phosphates on the adjacent strand.

  12. The roles of initiation factor 2 and guanosine triphosphate in initiation of protein synthesis

    PubMed Central

    Antoun, Ayman; Pavlov, Michael Y.; Andersson, Kerstin; Tenson, Tanel; Ehrenberg, Måns


    The role of IF2 from Escherichia coli was studied in vitro using a system for protein synthesis with purified components. Stopped flow experiments with light scattering show that IF2 in complex with guanosine triphosphate (GTP) or a non-cleavable GTP analogue (GDPNP), but not with guanosine diphosphate (GDP), promotes fast association of ribosomal subunits during initiation. Biochemical experiments show that IF2 promotes fast formation of the first peptide bond in the presence of GTP, but not GDPNP or GDP, and that IF2–GDPNP binds strongly to post-initiation ribosomes. We conclude that the GTP form of IF2 accelerates formation of the 70S ribosome from subunits and that GTP hydrolysis accelerates release of IF2 from the 70S ribosome. The results of a recent report, suggesting that GTP and GDP promote initiation equally fast, have been addressed. Our data, indicating that eIF5B and IF2 have similar functions, are used to rationalize the phenotypes of GTPase-deficient mutants of eIF5B and IF2. PMID:14532131

  13. Kinetics and mechanism of the acid-catalyzed hydrolysis of a hypermodified nucleoside wyosine and its 5'-monophosphate.

    PubMed Central

    Golankiewicz, B; Zielonacka-Lis, E; Folkman, W


    The rates of acid-catalyzed hydrolysis of a hypermodified nucleoside, wyosine and its 5'-monophosphate were determined at various pH, temperature and buffer concentrations. The results show that despite distinct differences in structure and the glycosyl bond stability, the hydrolysis of wyosine proceeds via cleavage of the C-N bond by A-1 mechanism, analogously to simple nucleosides. Unlike majority of other monophosphates studied so far, wyosine 5'-monophosphate is not more stable than respective nucleoside. PMID:4000960

  14. Deciphering the photochemical mechanisms describing the UV-induced processes occurring in solvated guanine monophosphate

    NASA Astrophysics Data System (ADS)

    Altavilla, Salvatore; Segarra-Martí, Javier; Nenov, Artur; Conti, Irene; Rivalta, Ivan; Garavelli, Marco


    The photophysics and photochemistry of water-solvated guanine monophosphate (GMP) are here characterized by means of a multireference quantum-chemical/molecular mechanics theoretical approach (CASPT2//CASSCF/AMBER) in order to elucidate the main photo-processes occurring upon UV-light irradiation. The effect of the solvent and of the phosphate group on the energetics and structural features of this system are evaluated for the first time employing high-level ab initio methods and thoroughly compared to those in vacuo previously reported in the literature and to the experimental evidence to assess to which extent they influence the photoinduced mechanisms. Solvated electronic excitation energies of solvated GMP at the Franck-Condon (FC) region show a red shift for the ππ* La and Lb states, whereas the energy of the oxygen lone-pair nπ* state is blue-shifted. The main photoinduced decay route is promoted through a ring-puckering motion along the bright lowest-lying La state towards a conical intersection (CI) with the ground state, involving a very shallow stationary point along the minimum energy pathway in contrast to the barrierless profile found in gas-phase, the point being placed at the end of the minimum energy path (MEP) thus endorsing its ultrafast deactivation in accordance with time-resolved transient and photoelectron spectroscopy experiments. The role of the nπ* state in the solvated system is severely diminished as the crossings with the initially populated La state and also with the Lb state are placed too high energetically to partake prominently in the deactivation photo-process. The proposed mechanism present in solvated and in vacuo DNA/RNA chromophores validates the intrinsic photostability mechanism through CI-mediated non-radiative processes accompanying the bright excited-state population towards the ground state and subsequent relaxation back to the FC region.

  15. Lack of nitric oxide- and guanosine 3′:5′-cyclic monophosphate-dependent regulation of α-thrombin-induced calcium transient in endothelial cells of spontaneously hypertensive rat hearts

    PubMed Central

    Failli, Paola; Fazzini, Alessandro; Ruocco, Carlo; Mazzetti, Luca; Cecchi, Enrica; Giovannelli, Lisa; Marra, Fabio; Milani, Stefano; Giotti, Alberto


    While the expression and/or activity of endothelial nitric oxide synthase (eNOS) has been characterized in spontaneously hypertensive (SHR) and normotensive Wistar Kyoto rat (WKY) hearts, in coronary endothelial cells (ECs) from both strains, the effect of NO on intracellular calcium concentration ([Ca2+]i) is still unknown. Coronary microvascular ECs were isolated from SHR and WKY and characterized. Immunocytochemistry and Western blot analysis showed that eNOS was similarly expressed in ECs from both strains. Measuring [Ca2+]i by imaging analysis of fura-2-loaded cells, we demonstrated that α-thrombin (3−180 U l−1) induced a superimposable dose-dependent calcium transient in ECs from both strains. In WKY ECs, S-nitroso-N-acetyl-DL-penicillamine (SNAP) dose-dependently (10–100 μM) and 0.1 μM atrial natriuretic factor (ANF) reduced the maximum and the decay time of α-thrombin-induced calcium transient. The inhibitory effects of SNAP and ANF were prevented by blocking cyclic GMP-dependent protein kinase. Non selective eNOS inhibitors prolonged the decay time of α-thrombin-induced calcium transient, while the selective inducible NOS inhibitor 1400 W was ineffective. SNAP (100 μM) and 0.1 μM ANF increased cyclic GMP content up to 22.9 and 42.3 fold respectively. In SHR ECs, α-thrombin-induced calcium transient was not modified by SNAP, ANF or eNOS inhibition. SNAP (100 μM) and 0.1 μM ANF increased cyclic GMP content up to 9.3 and 51 fold respectively. In WKY ECs, SNAP dose-dependently (10–100 μM) reduced also bradykinin-induced calcium transient, while in SHR ECs was ineffective. We concluded that in SHR ECs, the cyclic GMP-dependent regulation of calcium transient is lost. PMID:10928946

  16. Cinnamyl alcohol attenuates vasoconstriction by activation of K+ channels via NO-cGMP-protein kinase G pathway and inhibition of Rho-kinase

    PubMed Central

    Kang, Yun Hwan; Yang, In Jun; Morgan, Kathleen G.


    Cinnamyl alcohol (CAL) is known as an antipyretic, and a recent study showed its vasodilatory activity without explaining the mechanism. Here we demonstrate the vasodilatory effect and the mechanism of action of CAL in rat thoracic aorta. The change of tension in aortic strips treated with CAL was measured in an organ bath system. In addition, vascular strips or human umbilical vein endothelial cells (HUVECs) were used for biochemical experiments such as Western blot and nitrite and cyclic guanosine monophosphate (cGMP) measurements. CAL attenuated the vasoconstriction of phenylephrine (PE, 1 µM)-precontracted aortic strips in an endothelium-dependent manner. CAL-induced vasorelaxation was inhibited by pretreatment with NG-nitro-L-arginine methyl ester (L-NAME; 10-4 M), methylene blue (MB; 10-5 M) and 1 H-[1,2,4]-oxadiazolole-[4,3-a] quinoxalin-10one, (ODQ; 10-6 or 10-7 M) in the endothelium-intact aortic strips. Atrial natriuretic peptide (ANP; 10-8 or 10-9 M) did not affect the vasodilatory effect of CAL. The phosphorylation of endothelial nitric oxide synthase (eNOS) and generation of nitric oxide (NO) were stimulated by CAL treatment in HUVECs and inhibited by treatment with L-NAME. In addition, cGMP and PKG1 activation in aortic strips treated with CAL were also significantly inhibited by L-NAME. Furthermore, CAL relaxed Rho-kinase activator calpeptin-precontracted aortic strips, and the vasodilatory effect of CAL was inhibited by the ATP-sensitive K+ channel inhibitor glibenclamide (Gli; 10-5 M) and the voltage-dependent K+ channel inhibitor 4-aminopyridine (4-AP; 2 × 10-4 M). These results suggest that CAL induces vasorelaxation by activating K+ channels via the NO-cGMP-PKG pathway and the inhibition of Rho-kinase. PMID:23178275

  17. The involvement of NMDA receptor/NO/cGMP pathway in the antidepressant like effects of baclofen in mouse force swimming test.


    Khan, Muhammad Imran; Ostadhadi, Sattar; Zolfaghari, Samira; Ejtemaei Mehr, Shahram; Hassanzadeh, Gholamreza; Dehpour, Ahmad-Reza


    In the current study, the involvement of N-methyl-d-aspartate receptor (NMDAR) and nitric oxide (NO)/cyclic guanosine monophosphate (cGMP) system in the antidepressant-like effects of baclofen was evaluated by using animal model in forced swimming test. Followed by an open field test for the evaluation of locomotor activity, the immobility time for mice in force swimming test was recorded. Only the last four min was analyzed. Administration of Baclofen (0.5 and 1mg/kg, i.p.) reduced the immobility interval in the FST. Prior administration of l-arginine (750mg/kg, i.p.,) a nitric oxide synthase substrate or sildenafil (5mg/kg, i.p.) a phosphodiesterase 5 into mice suppressed the antidepressant-like activity of baclofen (1mg/kg, i.p.).Co-treatment of 7-nitroindazole (50mg/kg, i.p.,) an inhibitor of neuronal nitric oxide synthase, L-NAME (10mg/kg, i.p.,) a non-specific inhibitor of nitric oxide synthase or MK-801 (0.05mg/kg, i.p.) an NMDA receptor antagonist with subeffective dose of baclofen (0.1mg/kg, i.p.), reduced the immobility time in the FST as compared to the drugs when used alone. Co-administrated of lower doses of MK-801 (0.01mg/kg) or l-NAME (1mg/kg) failed to effect immobility time however, simultaneous administration of these two agents in same dose with subeffective dose of baclofen (0.1mg/kg, i.p.), minimized the immobility time in the FST. Thus, our results support the role of NMDA receptors and l-arginine-NO-GMP pathway in the antidepressant-like action of baclofen. PMID:26679225

  18. Nitroxyl inhibits overt pain-like behavior in mice: role of cGMP/PKG/ATP-sensitive potassium channel signaling pathway

    PubMed Central

    Staurengo-Ferrari, Larissa; Zarpelon, Ana C.; Longhi-Balbinot, Daniela T.; Marchesi, Mario; Cunha, Thiago M.; Alves-Filho, José C.; Cunha, Fernando Q.; Ferreira, Sergio H.; Casagrande, Rubia; Miranda, Katrina M.; Verri, Waldiceu A.


    Background Several lines of evidence have indicated that nitric oxide (NO) plays complex and diverse roles in modulation of pain/analgesia. However, the roles of charged and uncharged congeners of NO are less well understood. In the present study, the antinociceptive effect of the nitroxyl (HNO) donor, Angeli’s salt (Na2N2O3; AS) was investigated in models of overt pain-like behavior. Moreover, whether the antinociceptive effect of nitroxyl was dependent on the activation of cGMP (cyclic guanosine monophosphate)/PKG (protein kinase G)/ATP-sensitive potassium channels was addressed. Methods The antinociceptive effect of AS was evaluated on phenyl-p-benzoquinone (PBQ)- and acetic acid-induced writhings and via the formalin test. In addition, pharmacological treatments targeting guanylate cyclase (ODQ), PKG (KT5923) and ATP-sensitive potassium channel (glybenclamide) were used. Results PBQ and acetic acid induced significant writhing responses over 20 min. The nociceptive response in these models were significantly reduced in a dose-dependent manner by subcutaneous pre-treatment with AS. Furthermore, AS also inhibited both phases of the formalin test. Subsequently, the inhibitory effect of AS in writhing and flinching responses were prevented by ODQ, KT5823 and glybenclamide, although these inhibitors alone did not alter the writhing score. Furthermore, pretreatment with L-cysteine, an HNO scavenger, confirmed that the antinociceptive effect of AS depends on HNO. Conclusion The present study demonstrates the efficacy of a nitroxyl donor and its analgesic mechanisms in overt pain-like behavior by activating the cGMP/PKG/ATP-sensitive potassium channel (K+) signaling pathway. PMID:24948073

  19. DNA 3' pp 5' G de-capping activity of aprataxin: effect of cap nucleoside analogs and structural basis for guanosine recognition


    Chauleau, Mathieu; Jacewicz, Agata; Shuman, Stewart


    DNA3' pp 5'G caps synthesized by the 3'-PO4/5'-OH ligase RtcB have a strong impact on enzymatic reactions at DNA 3'-OH ends. Aprataxin, an enzyme that repairs A5'pp5'DNA ends formed during abortive ligation by classic 3'-OH/5'-PO4 ligases, is also a DNA 3' de-capping enzyme, converting DNAppG to DNA3'p and GMP. By taking advantage of RtcB's ability to utilize certain GTP analogs to synthesize DNAppN caps, we show that aprataxin hydrolyzes inosine and 6-O-methylguanosine caps, but is not adept at removing a deoxyguanosine cap. We report a 1.5 Å crystal structure of aprataxin in a complex with GMP, which reveals that: (i)more » GMP binds at the same position and in the same anti nucleoside conformation as AMP; and (ii) aprataxin makes more extensive nucleobase contacts with guanine than with adenine, via a hydrogen bonding network to the guanine O6, N1, N2 base edge. Alanine mutations of catalytic residues His147 and His149 abolish DNAppG de-capping activity, suggesting that the 3' de-guanylylation and 5' de-adenylylation reactions follow the same pathway of nucleotidyl transfer through a covalent aprataxin-(His147)–NMP intermediate. Alanine mutation of Asp63, which coordinates the guanosine ribose hydroxyls, impairs DNAppG de-capping.« less

  20. Oligomerization of activated D- and L-guanosine mononucleotides on templates containing D- and L-deoxycytidylate residues

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Pitsch, S.; Orgel, L. E.; Bada, J. L. (Principal Investigator)


    The oligomerization of activated D- and L- and racemic guanosine-5'-phosphoro-2-methylimidazole on short templates containing D- and L-deoxycytidylate has been studied. Results obtained with D-oligo(dC)s as templates are similar to those previously reported for experiments with a poly(C) template. When one L-dC or two consecutive L-dCs are introduced into a D-template, regiospecific synthesis of 3'-5' oligo(G)s proceeds to the end of the template, but three consecutive L-dCs block synthesis. Alternating D-,L-oligomers do not facilitate oligomerization of the D-, L-, and racemic 2-guanosine-5'-phosphoro-2-methylimidazole. We suggest that once a "predominately D-metabolism" existed, occasional L-residues in a template would not have led to the termination of self-replication.

  1. Nonenzymatic template-directed synthesis on hairpin oligonucleotides. 2. Templates containing cytidine and guanosine residues

    NASA Technical Reports Server (NTRS)

    Wu, T.; Orgel, L. E.


    We have prepared hairpin oligonucleotides in which a 5'-terminal single-stranded segment contains cytidylate (C) and guanylate (G) residues. When these hairpin substrates are incubated with a mixture of cytidine 5'-phosphoro(2-methly)imidazolide (2-MeImpC) and guanosine 5'-phosphoro(2-methyl)imidazolide (2-MeImpG), the 5'-terminal segment acts as a template to facilitate sequence-specific addition of G and C residues to the 3'-terminus of the hairpin. If an isolated G residue is present at the 3'-end of the template strand, it is copied regiospecifically in the presence of 2-MeImpC and 2-MeImpG to give a product containing an isolated C residue linked to its G neighbors by 3'-5'-internucleotide bonds. However, if only 2-MeImpC is present in the reaction mixture, very little reaction occurs. Thus, the presence of 2-MeImpG catalyzes the incorporation of C. If the template strand contains a short sequence of G residues, it is copied in the presence of a mixture of 2-MeImpC and 2-MeImpG. If only 2-MeImpC is present in the reaction mixture, efficient synthesis occurs to give a final product containing one fewer C residue than the number of G residues in the template.

  2. Phosphonylated Acyclic Guanosine Analogues with the 1,2,3-Triazole Linker.


    Głowacka, Iwona E; Andrei, Graciela; Schols, Dominique; Snoeck, Robert; Piotrowska, Dorota G


    A novel series of {4-[(2-amino-6-chloro-9H-purin-9-yl)methyl]-1H-1,2,3-triazol-1-yl}alkylphosphonates and {4-[(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)methyl]-1H-1,2,3-triazol-1-yl}alkylphosphonates as acyclic analogues of guanosine were synthesized and assessed for antiviral activity against a broad range of DNA and RNA viruses and for their cytostatic activity toward three cancerous cell lines (HeLa, L1210 and CEM). They were devoid of antiviral activity; however, several phosphonates were found slightly cytostatic against HeLa cells at an IC50 in the 80-210 µM range. Compounds (1R,2S)-17k and (1S,2S)-17k showed the highest inhibitory effects (IC50=15-30 µM) against the proliferation of murine leukemia (L1210) and human T-lymphocyte (CEM) cell lines. PMID:26501246

  3. Codelivery of VEGF siRNA and Gemcitabine Monophosphate in a Single Nanoparticle Formulation for Effective Treatment of NSCLC

    PubMed Central

    Zhang, Yuan; Schwerbrock, Nicole MJ; Rogers, Arlin B; Kim, William Y; Huang, Leaf


    There is an urgent need for new therapeutics for the treatment of aggressive and metastatic refractory human non-small–cell lung cancer (NSCLC). Antiangiogenesis therapy and chemotherapy are the two major treatment options. Unfortunately, both types of therapies when used individually have their disadvantages. Integrating antiangiogenesis therapy with chemotherapy is expected to target the tumor's vascular endothelial cells and the tumor cells simultaneously. In this study, we coformulated Vascular endothelial growth factor (VEGF) siRNA targeting VEGFs and gemcitabine monophosphate (GMP) into a single cell-specific, targeted lipid/calcium/phosphate (LCP) nanoparticle formulation. Antitumor effect of the combination therapy using LCP loaded with both VEGF siRNA and GMP was evaluated in both subcutaneous and orthotopic xenograft models of NSCLC with systemic administration. The improved therapeutic response, as compared with either VEGF siRNA or GMP therapy alone, was supported by the observation of 30–40% induction of tumor cell apoptosis, eightfold reduction of tumor cell proliferation and significant decrease of tumor microvessel density (MVD). The combination therapy led to dramatic inhibition of tumor growth, with little in vivo toxicity. In addition, the current studies demonstrated the possibility of incorporating multiple nucleic acid molecules and phosphorylated small-molecule drugs, targeting to different pathways, into a single nanoparticle formulation for profound therapeutic effect. PMID:23774791

  4. Triiodothyronine causes rapid reversal of alpha 1/cyclic adenosine monophosphate synergism on brown adipocyte respiration and type II deiodinase activity.


    Noronha, M; Raasmaja, A; Moolten, N; Larsen, P R


    Previous studies have shown that thyroid status affects the response of brown adipose tissue (BAT) to the sympathetic nervous system. For example, hypothyroidism is associated with the development of a marked synergism between alpha 1- and beta-adrenergic pathways to stimulate type II iodothyronine 5'-deiodinase activity. Hypothyroidism also attenuates the respiratory response (thermogenesis) of isolated brown adipocytes to norepinephrine. To explore the interactions of the sympathetic nervous system and thyroid status in these cells, we compared the thermogenic and 5'-deiodinase responses to adrenergic agonists in isolated brown adipocytes from hypothyroid rats during treatment with 3,5,3'-triiodothyronine (T3). The fivefold synergism of alpha 1- and beta-adrenergic catecholamines to increase the deiodinase activity was progressively reduced, reaching a control euthyroid value of unity after 5 days of T3 treatment. Hypothyroidism reduced both the O2max (twofold to threefold) and increased the concentration of agonist required for 50% stimulation (10-fold) for both norepinephrine and forskolin. In hypothyroid cells, there was a twofold synergism between the alpha 1-agonist cirazoline and forskolin to increase respiration, which was blocked by prazosin and reproduced by the calcium ionophore, A23187. This synergistic effect of the alpha 1-agonist was lost within 2 days of T3 administration. These studies identify a second Ca(2+)-dependent intra-adrenergic synergism, which functions to ameliorate the reduced cyclic adenosine monophosphate (cAMP) responsiveness of the hypothyroid brown adipocyte. PMID:1683679

  5. Probing the interplay between the two steps of group I intron splicing: competition of exogenous guanosine with omega G.


    Zarrinkar, P P; Sullenger, B A


    One largely unexplored question about group I intron splicing is how the cleavage and ligation steps of the reaction are coordinated. We describe a simple in vitro trans-splicing model system in which both steps take place, including the exchange of ligands in the guanosine-binding site that must occur between the two steps. Using this model system, we show that the switch is accomplished by modulating the relative affinity of the binding site for the two ligands. While the terminal guanosine of the intron (omegaG) and exogenous guanosine compete for binding during the first step of splicing, no competition is apparent during the second step, when omegaG is bound tightly. These results help explain how the ribozyme orchestrates progression through the splicing reaction. In addition to providing a new tool to ask basic questions about RNA catalysis, the trans-splicing model system will also facilitate the development of therapeutically useful group I ribozymes that can repair mutant mRNAs. PMID:9922174

  6. L-theanine elicits an umami taste with inosine 5'-monophosphate.


    Narukawa, Masataka; Morita, Kanako; Hayashi, Yukako


    We investigated the taste synergy between L-theanine and the flavour enhancer, inosine 5'-monophosphate (IMP), by using a human sensory evaluation. When L-theanine was added to IMP, only the umami taste was enhanced. We then investigated this synergistic effect of L-theanine in mice by gustatory nerve recording. We confirmed the synergism between L-theanine and IMP for the umami taste. PMID:18997398

  7. Avirulent uracil auxotrophs based on disruption of orotidine-5'-monophosphate decarboxylase elicit protective immunity to Toxoplasma gondii.


    Fox, Barbara A; Bzik, David J


    The orotidine-5'-monophosphate decarboxylase (OMPDC) gene, encoding the final enzyme of the de novo pyrimidine biosynthesis pathway, was deleted using Toxoplasma gondii KU80 knockouts to develop an avirulent nonreverting pyrimidine auxotroph strain. Additionally, to functionally address the role of the pyrimidine salvage pathway, the uridine phosphorylase (UP) salvage activity was knocked out and a double knockout of UP and OMPDC was also constructed. The nonreverting DeltaOMPDC, DeltaUP, and DeltaOMPDC DeltaUP knockout strains were evaluated for pyrimidine auxotrophy, for attenuation of virulence, and for their ability to elicit potent immunity to reinfection. The DeltaUP knockout strain was replication competent and virulent. In contrast, the DeltaOMPDC and DeltaOMPDC DeltaUP strains were uracil auxotrophs that rapidly lost their viability during pyrimidine starvation. Replication of the DeltaOMPDC strain but not the DeltaOMPDC DeltaUP strain was also partially rescued in vitro with uridine or cytidine supplementation. Compared to their hypervirulent parental type I strain, the DeltaOMPDC and DeltaOMPDC DeltaUP knockout strains exhibited extreme attenuation in murine virulence (approximately 8 logs). Genetic complementation of the DeltaOMPDC strain using a functional OMPDC allele restored normal replication and type I parental strain virulence phenotypes. A single immunization of mice with either the live critically attenuated DeltaOMPDC strain or the DeltaOMPDC DeltaUP knockout strain effectively induced potent protective immunity to lethal challenge infection. The avirulent nonreverting DeltaOMPDC and DeltaOMPDC DeltaUP strains provide new tools for the dissection of the host response to infection and are promising candidates for safe and effective Th1 vaccine platforms that can be easily genetically engineered. PMID:20605980

  8. Injection of guanosine and adenosine nucleotides into Limulus ventral photoreceptor cells

    PubMed Central

    Bolsover, S. R.; Brown, J. E.


    1. Several nucleotide and nucleotide analogues had striking effects when pressure-injected into Limulus ventral photoreceptor cells. The poorly hydrolysable GTP analogues guanosine 5′-0-(3-thiotriphosphate) (GTPγS), guanylyl imidodiphosphate (Gpp[NH]p) and guanylyl (β, γ methylene) diphosphonate (Gpp[CH2]p) produced large increases in the frequency of `discrete events' that were recorded from photoreceptors in darkness. This effect was only observed after the injected cell was exposed to light. Injection of the ATP analogue ATPγS had effects similar to those of the GTP analogues. 2. We conclude that GTPγS, Gpp[NH]p, Gpp[CH2]p and ATPγS act at a common site to cause a light-dependent, long-term activation of the excitation mechanism of the photoreceptor. 3. Injection of GTP or GDP at pH 4.8 was followed by a smooth, transient depolarization that was observed neither when GTP at pH 7.5 was injected nor when ATP, 5′GMP or 2-[N-morpholino] ethane sulphonic acid (MES) were injected at pH 4.8. The reversal potential of the current induced by GTP injection was significantly more positive than the reversal potential of the light-induced current. 4. We conclude that GTP injection induces changes of membrane conductance either in addition to, or different from, the light-induced change of membrane conductance. 5. Injection of the ATP analogue adenylyl imidodiphosphate (App[NH]p), and the pyrophosphate analogue imidodiphosphate (p[NH]p) produced a drastic decrease in the sensitivity of photoreceptors to light. This decrease in sensitivity was partially reversed when the concentration of calcium ions in the bathing medium was reduced. 6. We suggest that App[NH]p and p[NH]p injections act by increasing the cytoplasmic concentration of calcium ions. PMID:7153930

  9. Role of Increased Guanosine Triphosphate Cyclohydrolase-1 Expression and Tetrahydrobiopterin Levels upon T Cell Activation

    PubMed Central

    Chen, Wei; Li, Li; Brod, Torben; Saeed, Omar; Thabet, Salim; Jansen, Thomas; Dikalov, Sergey; Weyand, Cornelia; Goronzy, Jorg; Harrison, David G.


    Tetrahydrobiopterin (BH4) is an essential co-factor for the nitric-oxide (NO) synthases, and in its absence these enzymes produce superoxide (O2˙̄) rather than NO. The rate-limiting enzyme for BH4 production is guanosine triphosphate cyclohydrolase-1 (GTPCH-1). Because endogenously produced NO affects T cell function, we sought to determine whether antigen stimulation affected T cell GTPCH-1 expression and ultimately BH4 levels. Resting T cells had minimal expression of inducible NOS (NOS2), endothelial NOS (NOS3), and GTPCH-1 protein and nearly undetectable levels of BH4. Anti-CD3 stimulation of T cells robustly stimulated the coordinated expression of NOS2, NOS3, and GTPCH-1 and markedly increased both GTPCH-1 activity and T cell BH4 levels. The newly expressed GTPCH-1 was phosphorylated on serine 72 and pharmacological inhibition of casein kinase II reduced GTPCH-1 phosphorylation and blunted the increase in T cell BH4. Inhibition of GTPCH-1 with diaminohydroxypyrimidine (1 mmol/liter) prevented T cell BH4 accumulation, reduced NO production, and increased T cell O2˙̄ production, due to both NOS2 and NOS3 uncoupling. GTPCH-1 inhibition also promoted TH2 polarization in memory CD4 cells. Ovalbumin immunization of mice transgenic for an ovalbumin receptor (OT-II mice) confirmed a marked increase in T cell BH4 in vivo. These studies identify a previously unidentified consequence of T cell activation, promoting BH4 levels, NO production, and modulating T cell cytokine production. PMID:21343293

  10. Regulation of Escherichia coli aspartate transcarbamylase synthesis by guanosine tetraphosphate and pyrimidine ribonucleoside triphosphates.


    Turnbough, C L


    The effects of guanosine tetraphosphate (ppGpp) and pyrimidine ribonucleoside triphosphates on Escherichia coli aspartate transcarbamylase (ATCase) synthesis were examined. To determine the effect of ppGpp, a stringent (relA+) and relaxed (relA) isogenic pair of E. coli K-12 strains was starved for isoleucine, and the residual rate of synthesis of this enzyme was measured. It was necessary to starve the strains for uracil before the isoleucine limitation to maintain similar, low levels of UTP, the putative pyrimidine effector of ATCase synthesis. The isoleucine starvation of the stringent strain caused an immediate 10-fold increase in the intracellular concentration of ppGpp, which was coincident with the cessation of the synthesis of the enzyme. The elevated level of ppGpp then decayed until it reached an intracellular concentration similar to that found in unstarved cells. Enzyme synthesis resumed at this time. In the relaxed strain, the intracellular concentration of ppGpp did not increase upon isoleucine starvation and synthesis of the enzyme was not repressed. These experiments strongly indicated that ppGpp acts as a negative effector of ATCase synthesis. The repression of ATCase synthesis by ppGpp was demonstrated directly by using a Salmonella typhimurium (relA) in vitro coupled transcription-translation system with a lambda specialized transducing phage carrying the E. coli K-12 operon encoding the subunits of this enzyme (pyrBI) as a source of DNA. This in vitro system was also used to measure the effects of UTP and CTP on ATCase synthesis. Increasing the concentration of UTP in the in vitro reaction mixture resulted in strong repression of this synthesis, whereas increasing the CTP concentration did not affect synthesis significantly. Possible mechanisms for the regulation of pyr gene expression, including attenuation control, are discussed. PMID:6337130

  11. Positive control of lac operon expression in vitro by guanosine 5'-diphosphate 3'-diphosphate.


    Primakoff, P; Artz, S W


    Maximal expression of the Escherichia coli lactose operon in a coupled in vitro transcription-translation system from a Salmonella typhimurium relA mutant was strongly dependent upon addition of guanosine 5'-diphosphate 3'-diphosphate (ppGpp). Without added ppGpp, at saturating 3',5'-cyclic AMP (cAMP) concentrations, synthesis of beta-galactosidase (beta-D-galactoside galactohydrolase, EC was reproducibly only 5-7% of that which can be obtained with 0.5-0.8 mM ppGpp. Experiments in which transcription was uncoupled from translation indicated that this 14- to 20-fold stimulation by ppGpp occurred at the level of transcription. When coupled beta-galactosidase synthesis was primed with a template containing a well-characterized mutant lac promoter (lacP(r)L8UV5), the dependence on ppGpp was greatly reduced. This result provides an important experimental control previously unavailable for verifying the significance of ppGpp effects on gene regulation in vitro; it indicates that activation of lacP(+) expression by ppGpp is specifically an effect of increased transcription initiations. Furthermore, the large ppGpp stimulation of lacP(+) DNA enabled the level of expression of this template to approach that of lacP(r)L8UV5 DNA, an observation expected from results in vivo but not obtained with other transcription-translation systems in vitro. The importance of these results is considered with respect to previous ideas on the physiological role of ppGpp as a supercontrol molecule in bacterial regulation. PMID:109832

  12. Gas-Phase Conformations and Energetics of Protonated 2^'-DEOXYADENOSINE-5^'-MONOPHOSPHATE and ADENOSINE-5^'-MONOPHOSPHATE: Irmpd Action Spectroscopy and Theoretical Studies

    NASA Astrophysics Data System (ADS)

    Wu, Ranran; Nei, Y.-W.; He, Chenchen; Hamlow, Lucas; Berden, Giel; Oomens, J.; Rodgers, M. T.


    Nature uses protonation to alter the structures and reactivities of molecules to facilitate various biological functions and chemical transformations. For example, in nucleobase repair and salvage processes, protonation facilitates nucleobase removal by lowering the activation barrier for glycosidic bond cleavage. Systematic studies of the structures of protonated 2'-deoxyribonucleotides and ribonucleotides may provide insight into the roles protonation plays in altering the nucleobase orientation relative to the glycosidic bond and sugar puckering. In this study, infrared multiple photon dissociation (IRMPD) action spectroscopy experiments in conjunction with electronic structure calculations are performed to probe the effects of protonation on the structures and stabilities of 2^'-deoxyadenosine-5^'-monophosphate (pdAdo) and adenosine-5^'-monophosphate (pAdo). Photodissociation as a function of IR wavelength is measured to generate the IRMPD action spectra. Geometry optimizations and frequency analyses performed at the B3LYP/6-311+G(d,p) level of theory are used to characterize the stable low-energy structures and to generate their linear IR spectra. Single point energy calculations performed at the B3LYP/6-311+G(2d,2p) and MP2(full)/6-311+G(2d,2p) levels of theory provide relative stabilities of the optimized conformations. The structures accessed in the experiments are determined by comparing the calculated linear IR spectra for the stable low-energy conformers computed to the measured IRMPD action spectra. The effects of the 2^'-hydroxyl moiety are elucidated by comparing the structures and IRMPD spectra of [pAdo+H]+ to those of its DNA analogue. Comparisons are also made to the deprotonated forms of these nucleotides and the protonated forms of the analogous nucleosides to elucidate the effects of protonation and the phosphate group on the structures.

  13. Hydrogen Sulfide Regulates Ca2+ Homeostasis Mediated by Concomitantly Produced Nitric Oxide via a Novel Synergistic Pathway in Exocrine Pancreas

    PubMed Central

    Moustafa, Amira


    Abstract Aim: The present study was designed to explore the effects of hydrogen sulfide (H2S) on Ca2+ homeostasis in rat pancreatic acini. Results: Sodium hydrosulfide (NaHS; an H2S donor) induced a biphasic increase in the intracellular Ca2+ concentration ([Ca2+]i) in a dose-dependent manner. The NaHS-induced [Ca2+]i elevation persisted with an EC50 of 73.3 μM in the absence of extracellular Ca2+ but was abolished by thapsigargin, indicating that both Ca2+ entry and Ca2+ release contributed to the increase. The [Ca2+]i increase was markedly inhibited in the presence of NG-monomethyl L-arginine or 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (cPTIO), and diaminofluorescein-2/diaminofluorescein-2 triazole (DAF-2/DAF-2T) fluorometry demonstrated that nitric oxide (NO) was also produced by H2S in a dose-dependent manner with an EC50 of 64.8 μM, indicating that NO was involved in the H2S effect. The H2S-induced [Ca2+]i increase was inhibited by pretreatment with U73122, xestospongin C, 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one, KT5823, and GP2A, indicating that phospholipase C (PLC), the inositol 1,4,5-trisphosphate (IP3) receptor, soluble guanylate cyclase (sGC), protein kinase G (PKG), and Gq-protein play roles as intermediate components in the H2S-triggered intracellular signaling. Innovation: To our knowledge, our study is the first one highlighting the effect of H2S on intracellular Ca2+ dynamics in pancreatic acinar cells. Moreover, a novel cascade was presumed to function via the synergistic interaction between H2S and NO. Conclusion: We conclude that H2S affects [Ca2+]i homeostasis that is mediated by H2S-evoked NO production via an endothelial nitric oxide synthase (eNOS)-NO-sGC-cyclic guanosine monophosphate-PKG-Gq-protein-PLC-IP3 pathway to induce Ca2+ release, and this pathway is identical to the one we recently proposed for a sole effect of NO and the two gaseous molecules synergistically function to regulate Ca2+ homeostasis

  14. Effect of DDAH/ADMA/NOS regulation pathway on cavernae corporum cavernosorum rat penis of different age.


    Wang, J-H; Chen, D; Zhang, K-Q; Zhang, H; Fu, Q


    The effect of DDAH/ADMA/NOS pathway in penile tissue of rats of different age was investigated to better understand the mechanism of age-related erectile dysfunction (ED). The Sprague Dawley male rats were assigned as the young group (3 month old, n = 10) and the old group (18 month old, n = 10) respectively. Intracavernous pressure (ICP) was measured before and after papaverine intracavernous injection. Pathology structure of penile tissue was evaluated under transmission electron microscope. The expression amounts of asymmetric dimethylarginine (ADMA) and cyclic guanosine monophosphate (cGMP) in penile tissue were detected by ELISA; the expression levels of isoform-specific DDAH and NOS were assessed via Western blot. Compared with the young group, the ICP in the old group rat decreased significantly (33.46 ± 5.37 versus 39.71 ± 3.67 mmHg, P = 0.02) after papaverine injection. Diffused fibrosis and impairment of endothelial cell were observed in corpus cavernosum in the old group rats. Higher level of ADMA (10.83 ± 0.96 versus 7.51 ± 1.39 μmol per gpro, P = 3.14 × 10(-4) ) and lower level of cGMP (29.42 ± 3.84 versus 47.09 ± 6.07 nmol per gpro, P = 1.57 × 10(-6) ) were detected in penile tissue of the old group compared with those of the young group. Expression of DDAH1, DDAH2, endothelial NOS (eNOS) and neuronal NOS(nNOS) all decreased significantly in penile tissue of the old group rat. The DDAH/ADMA/NOS regulation pathway changes dramatically accompanying with lower ICP in old group rat compared with those of the young group. Such findings in rats are suggestive in understanding the mechanism of age-related ED in humans. PMID:26011316

  15. N-H stretching vibrations of guanosine-cytidine base pairs in solution: ultrafast dynamics, couplings, and line shapes.


    Fidder, Henk; Yang, Ming; Nibbering, Erik T J; Elsaesser, Thomas; Röttger, Katharina; Temps, Friedrich


    Dynamics and couplings of N-H stretching vibrations of chemically modified guanosine-cytidine (G·C) base pairs in chloroform are investigated with linear infrared spectroscopy and ultrafast two-dimensional infrared (2D-IR) spectroscopy. Comparison of G·C absorption spectra before and after H/D exchange reveals significant N-H stretching absorption in the region from 2500 up to 3300 cm(-1). Both of the local stretching modes ν(C)(NH(2))(b) of the hydrogen-bonded N-H moiety of the cytidine NH(2) group and ν(G)(NH) of the guanosine N-H group contribute to this broad absorption band. Its complex line shape is attributed to Fermi resonances of the N-H stretching modes with combination and overtones of fingerprint vibrations and anharmonic couplings to low-frequency modes. Cross-peaks in the nonlinear 2D spectra between the 3491 cm(-1) free N-H oscillator band and the bands centered at 3145 and 3303 cm(-1) imply N-H···O═C hydrogen bond character for both of these transitions. Time evolution illustrates that the 3303 cm(-1) band is composed of a nearly homogeneous band absorbing at 3301 cm(-1), ascribed to ν(G)(NH(2))(b), and a broad inhomogeneous band peaking at 3380 cm(-1) with mainly guanosine carbonyl overtone character. Kinetics and signal strengths indicate a <0.2 ps virtually complete population transfer from the excited ν(G)(NH(2))(b) mode to the ν(G)(NH) mode at 3145 cm(-1), suggesting lifetime broadening as the dominant source for the homogeneous line shape of the 3301 cm(-1) transition. For the 3145 cm(-1) band, a 0.3 ps population lifetime was obtained. PMID:23317104

  16. Guanosine and its modified derivatives are endogenous ligands for TLR7.


    Shibata, Takuma; Ohto, Umeharu; Nomura, Shosaku; Kibata, Kayoko; Motoi, Yuji; Zhang, Yan; Murakami, Yusuke; Fukui, Ryutaro; Ishimoto, Tatsushi; Sano, Shigetoshi; Ito, Tomoki; Shimizu, Toshiyuki; Miyake, Kensuke


    Toll-like receptor (TLR) 7and 8 were considered to recognize single-strand RNA (ssRNA) from viruses. Although these receptors also respond to synthetic small chemical ligands, such as CL075 and R848, it remains to be determined whether these receptors sense natural small molecules or not. In the structure of human TLR8 (huTLR8) with ssRNA, there are two ligand-binding sites: one binds a uridine and the other binds an oligoribonucleotide (ORN). This finding demonstrates that huTLR8 recognizes degradation products of ssRNA, suggesting the presence of natural small ligands. We here show that TLR7 works as the sensor for guanosine (G)/2'-deoxyguanosine (dG) in the presence of ORN where ORN strengthens TLR7 interaction with G/dG. In addition, modified nucleosides such as 7-methylguanosine, 8-hydroxyguanosine (8-OHG) and 8-hydroxydeoxyguanosine (8-OHdG) activated TLR7 with ORNs. Importantly, 8-OHdG-a well-known oxidative DNA damage marker with unknown function-induced strong cytokine production comparable to G and dG both in mouse and human immune cells. Although 8-OHdG bound TLR7/ORN with lower affinity than dG did in isothermal titration calorimetry, administered 8-OHdG was metabolically more stable than dG in the serum, indicating that 8-OHdG acts on TLR7 as an endogenous ligand in vivo To address a role of G analogs in the disease state, we also examined macrophages from Unc93b1 (D34A/D34A) mice, which suffer from TLR7-dependent systemic inflammation, and found that Unc93b1 (D34A/D34A) macrophages showed significantly enhanced response to G alone or 8-OHdG with ORN. In conclusion, our results provide evidence that G, dG, 8-OHG and 8-OHdG are novel endogenous ligands for TLR7. PMID:26489884

  17. DNA 3' pp 5' G de-capping activity of aprataxin: effect of cap nucleoside analogs and structural basis for guanosine recognition

    SciTech Connect

    Chauleau, Mathieu; Jacewicz, Agata; Shuman, Stewart


    DNA3' pp 5'G caps synthesized by the 3'-PO4/5'-OH ligase RtcB have a strong impact on enzymatic reactions at DNA 3'-OH ends. Aprataxin, an enzyme that repairs A5'pp5'DNA ends formed during abortive ligation by classic 3'-OH/5'-PO4 ligases, is also a DNA 3' de-capping enzyme, converting DNAppG to DNA3'p and GMP. By taking advantage of RtcB's ability to utilize certain GTP analogs to synthesize DNAppN caps, we show that aprataxin hydrolyzes inosine and 6-O-methylguanosine caps, but is not adept at removing a deoxyguanosine cap. We report a 1.5 Å crystal structure of aprataxin in a complex with GMP, which reveals that: (i) GMP binds at the same position and in the same anti nucleoside conformation as AMP; and (ii) aprataxin makes more extensive nucleobase contacts with guanine than with adenine, via a hydrogen bonding network to the guanine O6, N1, N2 base edge. Alanine mutations of catalytic residues His147 and His149 abolish DNAppG de-capping activity, suggesting that the 3' de-guanylylation and 5' de-adenylylation reactions follow the same pathway of nucleotidyl transfer through a covalent aprataxin-(His147)–NMP intermediate. Alanine mutation of Asp63, which coordinates the guanosine ribose hydroxyls, impairs DNAppG de-capping.

  18. Histone deacetylases 6 increases the cyclic adenosine monophosphate level and promotes renal cyst growth.


    Wu, Ming; Mei, Changlin


    Autosomal dominant polycystic kidney disease (ADPKD) is characterized by abnormal enhanced cell proliferation and fluid secretion, which are triggered by increased levels of cyclic adenosine monophosphate (cAMP). Cebotaru et al. showed that a HDAC6 inhibitor reduced the cAMP level and inhibited cyst formation in Pkd1 knockout mice, which may become a new potential therapeutic agent for ADPKD. This study also raised several intriguing questions that might advance our understanding of the molecular pathogenesis of ADPKD. PMID:27312442

  19. Postirradiation administration of adenosine monophosphate combined with dipyridamole reduces early cellular damage in mice

    SciTech Connect

    Bohacek, J.; Hosek, B.; Pospisil, M. )


    The administration of dipyridamole and adenosine 5'-monophosphate (AMP) to mice 5 to 25 min after 1 Gy of total-body gamma irradiation was found to decrease cellular damage, as indicated by the thymidine level in plasma and the amount of saline soluble polynucleotides in the thymus. The drug combination used did not influence similar cytotoxic effects of hydrocortisone. Furthermore, it was shown that the addition of dipyridamole and AMP to in vitro irradiated suspensions of thymocytes enhanced the rejoining processes of DNA strand breaks. Receptor-mediated action of extracellular adenosine may be responsible for the therapeutic effects observed.

  20. Investigations of structural, dielectric and optical properties on silicon ion irradiated glycine monophosphate single crystals

    NASA Astrophysics Data System (ADS)

    Kanagasekaran, T.; Mythili, P.; Bhagavannarayana, G.; Kanjilal, D.; Gopalakrishnan, R.


    The 50 MeV silicon ion irradiation induced modifications on structural, optical and dielectric properties of solution grown glycine monophosphate (GMP) crystals were studied. The high-resolution X-ray diffraction study shows the unaltered value of integrated intensity on irradiation. The dielectric constant as a function of frequency and temperature was studied. UV-visible studies reveal the decrease in bandgap values on irradiation and presence of F-centers. The fluorescence spectrum shows the existence of some energy levels, which remains unaffected after irradiation. The scanning electron micrographs reveal the defects formed on irradiation.

  1. Determination of the lowest-energy oxidation site in nucleotides: 2'-deoxythymidine 5'-monophosphate anion.


    Rubio, Mercedes; Roca-Sanjuan, Daniel; Merchan, Manuela; Serrano-Andrés, Luis


    High level ab initio computations anticipate nucleobases as the most favorable sites for oxidation in nucleotides. At the CASPT2 level, the lowest ionization channel for the 2'-deoxythymidine 5'-monophosphate anion is related to a pi-orbital of the thymine base. The present findings lead to revision of the recent assignments of the photodetachment photoelectron spectra of mononucleotide anions in the gas phase and support the classical view of the nucleobase being the main actor in the oxidation process of both nucleosides and nucleotides. PMID:16722723

  2. Light-driven artificial enzymes for selective oxidation of guanosine triphosphate using water-soluble POSS network polymers.


    Jeon, Jong-Hwan; Tanaka, Kazuo; Chujo, Yoshiki


    The light-driven artificial enzymes were constructed to realize unnatural reactions concerning bio-significant molecules. In this manuscript, the guanosine triphosphate (GTP)-selective oxidation is reported using the network polymers composed of polyhedral oligomeric silsesquioxane (POSS). We synthesized the water-soluble POSS network polymer containing the naphthyridine ligands to capture GTP inside the networks and the ruthenium complexes to oxidize the captured GTP under light irradiation. Initially, the binding affinities of the guanosine nucleosides to the naphthyridine ligand inside the POSS network polymer were evaluated from the emission quenching experiments. Accordingly, it was observed that the naphthyridine ligand can form the stable complex only with GTP (K(a) = 5.5 × 10(6) M(-1)). These results indicate that only GTP can be captured by the network polymer. Next, the photo-catalytic activity of the ruthenium complex-modified POSS network polymer was investigated. Finally, it was revealed that the network polymer can decompose GTP efficiently under light irradiation. This is the first example, to the best of our knowledge, to offer not only the GTP-selective host polymers but also the light-driven artificial enzyme for GTP oxidation. PMID:25026217

  3. Hydrolysis of Guanosine Triphosphate (GTP) by the Ras·GAP Protein Complex: Reaction Mechanism and Kinetic Scheme.


    Khrenova, Maria G; Grigorenko, Bella L; Kolomeisky, Anatoly B; Nemukhin, Alexander V


    Molecular mechanisms of the hydrolysis of guanosine triphosphate (GTP) to guanosine diphosphate (GDP) and inorganic phosphate (Pi) by the Ras·GAP protein complex are fully investigated by using modern modeling tools. The previously hypothesized stages of the cleavage of the phosphorus-oxygen bond in GTP and the formation of the imide form of catalytic Gln61 from Ras upon creation of Pi are confirmed by using the higher-level quantum-based calculations. The steps of the enzyme regeneration are modeled for the first time, providing a comprehensive description of the catalytic cycle. It is found that for the reaction Ras·GAP·GTP·H2O → Ras·GAP·GDP·Pi, the highest barriers correspond to the process of regeneration of the active site but not to the process of substrate cleavage. The specific shape of the energy profile is responsible for an interesting kinetic mechanism of the GTP hydrolysis. The analysis of the process using the first-passage approach and consideration of kinetic equations suggest that the overall reaction rate is a result of the balance between relatively fast transitions and low probability of states from which these transitions are taking place. Our theoretical predictions are in excellent agreement with available experimental observations on GTP hydrolysis rates. PMID:26374425

  4. An industrial process for selective synthesis of 7-methyl guanosine 5'-diphosphate: versatile synthon for synthesis of mRNA cap analogues.


    Kore, Anilkumar R; Parmar, Gaurang


    We report an industrial scale facile synthesis of 7-methyl guanosine 5'-diphosphate, which plays an important role in synthesis of various mRNA cap analogs. An efficient and selective methylation at position 7 of guanosine 5'-diphosphate was achieved by dissolving guanosine 5'-diphosphate in water and drops wise addition of dimethyl sulfate over a period of 1 h at room temperature. The reaction was completed within 2 h and resulted in more than a 96% yield. The desired product, 7-methyl GDP was purified by using BPG column on AKTA Purifier 100. Certainly, this method has advantages over the known methylation method, in terms of yield, economy, safety, and environmental concerns. PMID:16629126

  5. [Phosphodiesterase-5 inhibitors for the treatment of pulmonary arterial hypertension].


    Beltrán-Gámez, Miguel E; Sandoval-Zárate, Julio; Pulido, Tomás


    In experimental and clinical cardiology, phosphodiesterase type 5 (PDE-5) inhibitors have brought scientific interest as a therapeutic tool in pulmonary arterial hypertension (PAH) management in recent years. Phosphodiesterases are a superfamily of enzymes that inactivate cyclic adenosine monophosphate and cyclic guanosine monophosphate, the second messengers of prostacyclin and nitric oxide. The rationale for the use of PDE-5 inhibitors in PAH is based on their capacity to overexpresss the nitric oxide pathway pursued inhibition of cyclic guanosine monophosphate hydrolysis. By increasing cyclic guanosine monophosphate levels it promotes vasodilation, antiproliferative and pro-apoptotic effects that may reverse pulmonary vascular remodeling. There is also evidence that these drugs may directly enhance right ventricular contractility through an increase in cyclic adenosine monophosphate mediated by the inhibition of the cyclic guanosine monophosphate -sensitive PDE-3. Sildenafil, tadalafil and vardenafil are 3 specific PDE-5 inhibitors in current clinical use, which share similar mechanisms of action but present some significant differences regarding potency, selectivity for PDE-5 and pharmacokinetic properties. Sildenafil received approval in 2005 by the Food and Drug Administration and the European Medicines Agency and tadalafil in 2009 by the Food and Drug Administration and the European Medicines Agency for the treatment of PAH in patients classified as NYHA/WHO functional class II and III. In Mexico, sildenafil and tadalafil were approved by Comisión Federal de Protección contra Riesgos Sanitarios for this indication in 2010 and 2011, respectively. PMID:26047999



    Mukhina, T M; Nikolaienko, T Yu


    Recent studies on Escherichia coli bacteria cultivation, in which DNA thymine was replaced with 5-chlorouracil have refreshed the problem of understanding the changes to physical properties of DNA monomers resultant from chemical modifications. These studies have shown that the replacement did not affect the normal activities and division of the bacteria, but has significantly reduced its life span. In this paper a comparative analysis was carried out by the methods of computational experiment of a set of 687 possible conformers of natural monomeric DNA unit (2'-deoxyribonucleotide thymidine monophosphate) and 660 conformers of 5-chloro-2'-deoxyuridine monophosphate - a similar molecules in which the natural nitrogenous base thymine is substituted with 5-chlorouracil. Structures of stable conformers of the modified deoxyribonucleotide have been obtained and physical factors, which determine their variation from the conformers of the unmodified molecule have been analyzed. A comparative analysis of the elastic properties of conformers of investigated molecules and non-covalent interactions present in them was conducted. The results can be usedfor planning experiments on synthesis of artficial DNA suitable for incorporation into living organisms. PMID:26255348

  7. Structural Studies of Thiamin Monophosphate Kinase in Complex with Substrates and Products.

    SciTech Connect

    McCulloch, K.M.; Kinsland, C.; Begley, T.P.; Ealick, S E.


    Thiamin monophosphate kinase (ThiL) catalyzes the ATP-dependent phosphorylation of thiamin monophosphate (TMP) to form thiamin pyrophosphate (TPP), the active form of vitamin B1. ThiL is a member of a small ATP binding superfamily that also includes the purine biosynthetic enzymes, PurM and PurL, NiFe hydrogenase maturation protein, HypE, and selenophosphate synthase, SelD. The latter four enzymes are believed to utilize phosphorylated intermediates during catalysis. To understand the mechanism of ThiL and its relationship to the other superfamily members, we determined the structure of Aquifex aeolicus ThiL (AaThiL) with nonhydrolyzable AMP-PCP and TMP, and also with the products of the reaction, ADP and TPP. The results suggest that AaThiL utilizes a direct, inline transfer of the {gamma}-phosphate of ATP to TMP rather than a phosphorylated enzyme intermediate. The structure of ThiL is compared to those of PurM, PurL, and HypE, and the ATP binding site is compared to that of PurL, for which nucleotide complexes are available.

  8. Lipid peroxides as endogenous oxidants forming 8-oxo-guanosine and lipid-soluble antioxidants as suppressing agents

    PubMed Central

    Kanazawa, Kazuki; Sakamoto, Miku; Kanazawa, Ko; Ishigaki, Yoriko; Aihara, Yoshiko; Hashimoto, Takashi; Mizuno, Masashi


    The oxidation of guanosine to 8-oxo-2'-deoxyguanosine (8-oxo-dG) in DNA is closely associated with induction of various diseases, but the endogenous oxidant species involved remains unclear. Hydrogen peroxides (H2O2) have been considered to be the oxidant, while lipid peroxides are another possible oxidant because generated easily in bio-membranes surrounding DNA. The oxidant potency was compared between lipid peroxides and H2O2. Linoleic acid hydroperoxides (LOOH) formed 8-oxo-dG at a higher level than H2O2 in guanosine or double-stranded DNA. In the presence of a physiological concentration of Fe2+ to produce hydroxyl radicals, LOOH was also a stronger oxidant. In a lipid micelle, LOOH markedly produced 8-oxo-dG at a concentration one-tenth of that of H2O2. Upon adding to rat hepatic mitochondria, phosphatidylcholine hydroperoxides produced 8-oxo-dG abundantly. Employing HepG2 cells after pretreated with glutathione peroxidase inhibitor, LOOH formed 8-oxo-dG more abundantly than H2O2. Then, antioxidants to suppress the 8-oxo-dG formation were examined, when the nuclei of pre-incubated HepG2 with antioxidants were exposed to LOOH. Water-soluble ascorbic acid, trolox, and N-acetyl cysteine showed no or weak antioxidant potency, while lipid-soluble 2,6-dipalmitoyl ascorbic acid, α-tocopherol, and lipid-soluble phytochemicals exhibited stronger potency. The present study shows preferential formation of 8-oxo-dG upon LOOH and the inhibition by lipid-soluble antioxidants. PMID:27499574

  9. Lipid peroxides as endogenous oxidants forming 8-oxo-guanosine and lipid-soluble antioxidants as suppressing agents.


    Kanazawa, Kazuki; Sakamoto, Miku; Kanazawa, Ko; Ishigaki, Yoriko; Aihara, Yoshiko; Hashimoto, Takashi; Mizuno, Masashi


    The oxidation of guanosine to 8-oxo-2'-deoxyguanosine (8-oxo-dG) in DNA is closely associated with induction of various diseases, but the endogenous oxidant species involved remains unclear. Hydrogen peroxides (H2O2) have been considered to be the oxidant, while lipid peroxides are another possible oxidant because generated easily in bio-membranes surrounding DNA. The oxidant potency was compared between lipid peroxides and H2O2. Linoleic acid hydroperoxides (LOOH) formed 8-oxo-dG at a higher level than H2O2 in guanosine or double-stranded DNA. In the presence of a physiological concentration of Fe(2+) to produce hydroxyl radicals, LOOH was also a stronger oxidant. In a lipid micelle, LOOH markedly produced 8-oxo-dG at a concentration one-tenth of that of H2O2. Upon adding to rat hepatic mitochondria, phosphatidylcholine hydroperoxides produced 8-oxo-dG abundantly. Employing HepG2 cells after pretreated with glutathione peroxidase inhibitor, LOOH formed 8-oxo-dG more abundantly than H2O2. Then, antioxidants to suppress the 8-oxo-dG formation were examined, when the nuclei of pre-incubated HepG2 with antioxidants were exposed to LOOH. Water-soluble ascorbic acid, trolox, and N-acetyl cysteine showed no or weak antioxidant potency, while lipid-soluble 2,6-dipalmitoyl ascorbic acid, α-tocopherol, and lipid-soluble phytochemicals exhibited stronger potency. The present study shows preferential formation of 8-oxo-dG upon LOOH and the inhibition by lipid-soluble antioxidants. PMID:27499574

  10. Structural determinants for the inhibitory ligands of orotidine-5′-monophosphate decarboxylase

    SciTech Connect

    Meza-Avina, Maria Elena; Wei, Lianhu; Liu, Yan; Poduch, Ewa; Bello, Angelica M.; Mishra, Ram K.; Pai, Emil F.; Kotra, Lakshmi P.


    In recent years, orotidine-5{prime}-monophosphate decarboxylase (ODCase) has gained renewed attention as a drug target. As a part of continuing efforts to design novel inhibitors of ODCase, we undertook a comprehensive study of potent, structurally diverse ligands of ODCase and analyzed their structural interactions in the active site of ODCase. These ligands comprise of pyrazole or pyrimidine nucleotides including the mononucleotide derivatives of pyrazofurin, barbiturate ribonucleoside, and 5-cyanouridine, as well as, in a computational approach, 1,4-dihydropyridine-based non-nucleoside inhibitors such as nifedipine and nimodipine. All these ligands bind in the active site of ODCase exhibiting distinct interactions paving the way to design novel inhibitors against this interesting enzyme. We propose an empirical model for the ligand structure for rational modifications in new drug design and potentially new lead structures.

  11. TAOK3 Phosphorylates the Methylenecyclopropane Nucleoside MBX 2168 to its Monophosphate

    PubMed Central

    Komazin-Meredith, Gloria; Cardinale, Steven C.; Comeau, Katelyn; Magalhaes, Kevin J.; Hartline, Caroll B.; Williams, John D.; Opperman, Timothy J.; Prichard, Mark N.; Bowlin, Terry L.


    Monohydroxymethyl methylenecyclopropane nucleosides (MCPNs) with ether or thioether substituents at the 6-position show promise as broad-spectrum herpes virus inhibitors. Their proposed mechanism of action involves sequential phosphorylation to a triphosphate, which can then inhibit viral DNA polymerase. The inhibition of herpes simplex virus (HSV) by these compounds is not dependent on the viral thymidine kinase (TK), which is known to phosphorylate acyclovir (ACV), a standard treatment for HSV infections. Previous studies on the mechanism of action of these compounds against human cytomegalovirus (HCMV) implicated a host kinase in addition to HCMV UL97 kinase in performing the initial phosphorylation. After first eliminating other candidate HSV-1 encoded kinases (UL13 and US3) as well as potential host nucleoside kinases, using activity-based fractionation, we have now identified the host serine-threonine protein kinase TAOK3 as the kinase responsible for transforming the representative monohydroxymethyl MCPN analog MBX 2168 to its monophosphate. PMID:25857706

  12. Adenosine 3',5'-monophosphate waves in dictyostelium discoideum: a demonstration by isotope dilution-fluorography

    SciTech Connect

    Tomchik, K.J.; Devreotes, P.N.


    The distribution of adenosine 3',5'-monophosphate (cyclic AMP) in fields of aggregating amoebae of Dictyostelium discoidenum was examined by a novel isotope dilution-fluorographic technique. Cellular cyclic AMP was visualized by its competition with exogenous /sup 3/H-labeled cyclic AMP for high-affinity binding sites on protein kinase immobilized on a Millipore filter used to blot the monolayer. The cyclic AMP was distributed in spiral or concentric circular wave patterns which centered on the foci of the aggregations. These patterns were correlated with those of cell shape change that propagate through the monolayers. These observations support the hypothesis that the aggregation process in Dictyostelium is mediated by the periodic relay of cyclic AMP signals and suggest a simple scheme for the dynamics of the aggregation process.

  13. Corticosteroid-Responsive Pulmonary Toxicity Associated with Fludarabine Monophosphate: A Case Report

    PubMed Central

    Rudzianskiene, Milda; Griniute, Rasa; Juozaityte, Elona; Inciura, Arturas; Rudzianskas, Viktoras; Emilia Kiavialaitis, Greta


    Fludarabine monophosphate is an effective drug for the treatment of lymphoid malignancies. Myelosuppression, opportunistic infections, and autoimmune hemolytic anemia are the most common side effects of fludarabine. Herein we report a 55-year-old female that presented with fever and dyspnea after completing her third cycle of FMD (fludarabine, mitoxantrone, and dexamethasone) chemotherapy for stage IV non-Hodgkin follicular lymphoma. Chest X-ray revealed bilateral pneumofibrotic changes and chest CT showed bilateral diffuse interstitial changes with fibrotic alterations. No evidence of infectious agents was noted. The patient had a reduced carbon monoxide transfer factor (45%). Her symptoms and radiographic findings resolved following treatment with prednisolone. The literature contains several cases of fludarabine-associated interstitial pulmonary toxicity that responded to steroid therapy. Fludarabine-induced pulmonary toxicity is reversible with cessation of the drug and administration of glucocorticosteroids. Conflict of interest:None declared. PMID:24385727

  14. Structural Determinants for Inhibitory Ligands of Orotidine-5′-Monophosphate Decarboxylase

    PubMed Central

    Meza-Avina, Maria Elena; Wei, Lianhu; Liu, Yan; Poduch, Ewa; Bello, Angelica M.; Mishra, Ram K.; Pai, Emil F.; Kotra, Lakshmi P.


    In recent years, orotidine-5′-monophosphate decarboxylase (ODCase) has gained renewed attention as a drug target. As a part of continuing efforts to design novel inhibitors of ODCase, we undertook a comprehensive study of potent, structurally diverse ligands of ODCase and analyzed their structural interactions in the active site of ODCase. These ligands comprise of pyrazole or pyrimidine nucleotides including the mononucleotide derivatives of pyrazofurin, barbiturate ribonucleoside, and 5-cyanouridine, as well as, in a computational approach, 1,4-dihydropyridine-based non-nucleoside inhibitors such as nifedipine and nimodipine. All these ligands bind in the active site of ODCase exhibiting distinct interactions paving the way to design novel inhibitors against this interesting enzyme. We propose an empirical model for the ligand structure for rational modifications in new drug design and potentially new lead structures. PMID:20452222

  15. Neomycin inhibits the phosphatidylinositol monophosphate and phosphatidylinositol bisphosphate stimulation of plasma membrane ATPase activity

    SciTech Connect

    Chen, Qiuyun; Boss, W.F. )


    The inositol phospholipids, phosphatidylinositol monophosphate (PIP) and phosphatidylinositol bisphosphate (PIP{sub 2}), have been shown to increase the vanadate-sensitive ATPase activity of plant plasma membranes. In this paper, the authors show the effect of various concentrations of phosphatidyinositol, PIP, and PIP{sub 2} on the plasma membrane vanadate-sensitive ATPase activity. PIP and PIP{sub 2} at concentrations at 10 nanomoles per 30 microgram membrane protein per milliliter of reaction mixture caused a twofold and 1.8-fold increase in the ATPase activity, respectively. The effect of these negatively charged phospholipids on the ATPase activity was inhibited by adding the positively charged aminoglycoside, neomycin. Neomycin did not affect the endogenous plasma membrane ATPase activity in the absence of exogenous lipids.

  16. TAOK3 phosphorylates the methylenecyclopropane nucleoside MBX 2168 to its monophosphate.


    Komazin-Meredith, Gloria; Cardinale, Steven C; Comeau, Katelyn; Magalhaes, Kevin J; Hartline, Caroll B; Williams, John D; Opperman, Timothy J; Prichard, Mark N; Bowlin, Terry L


    Monohydroxymethyl methylenecyclopropane nucleosides (MCPNs) with ether or thioether substituents at the 6-position show promise as broad-spectrum herpes virus inhibitors. Their proposed mechanism of action involves sequential phosphorylation to a triphosphate, which can then inhibit viral DNA polymerase. The inhibition of herpes simplex virus (HSV) by these compounds is not dependent on the viral thymidine kinase (TK), which is known to phosphorylate acyclovir (ACV), a standard treatment for HSV infections. Previous studies on the mechanism of action of these compounds against human cytomegalovirus (HCMV) implicated a host kinase in addition to HCMV UL97 kinase in performing the initial phosphorylation. After first eliminating other candidate HSV-1 encoded kinases (UL13 and US3) as well as potential host nucleoside kinases, using activity-based fractionation, we have now identified the host serine-threonine protein kinase TAOK3 as the kinase responsible for transforming the representative monohydroxymethyl MCPN analog MBX 2168 to its monophosphate. PMID:25857706

  17. Adenosine monophosphate deaminase 3 activation shortens erythrocyte half-life and provides malaria resistance in mice.


    Hortle, Elinor; Nijagal, Brunda; Bauer, Denis C; Jensen, Lora M; Ahn, Seong Beom; Cockburn, Ian A; Lampkin, Shelley; Tull, Dedreia; McConville, Malcolm J; McMorran, Brendan J; Foote, Simon J; Burgio, Gaetan


    The factors that determine red blood cell (RBC) lifespan and the rate of RBC aging have not been fully elucidated. In several genetic conditions, including sickle cell disease, thalassemia, and G6PD deficiency, erythrocyte lifespan is significantly shortened. Many of these diseases are also associated with protection from severe malaria, suggesting a role for accelerated RBC senescence and clearance in malaria resistance. Here, we report a novel, N-ethyl-N-nitrosourea-induced mutation that causes a gain of function in adenosine 5'-monophosphate deaminase (AMPD3). Mice carrying the mutation exhibit rapid RBC turnover, with increased erythropoiesis, dramatically shortened RBC lifespan, and signs of increased RBC senescence/eryptosis, suggesting a key role for AMPD3 in determining RBC half-life. Mice were also found to be resistant to infection with the rodent malaria Plasmodium chabaudi. We propose that resistance to P. chabaudi is mediated by increased RBC turnover and higher rates of erythropoiesis during infection. PMID:27465915

  18. Site-selective DNA hydrolysis by Ce(IV)-EDTA with the use of one oligonucleotide additive bearing two monophosphates.


    Chen, Wen; Komiyama, Makoto


    Two deoxyuridine derivatives each bearing a monophosphate group at the 5-position with a C3 linker, were incorporated into an oligonucleotide. By using this modified oligonucleotide, a bulge was formed at a predetermined position in a DNA substrate, and two monophosphate groups were placed at both junctions of the bulge. Upon treatment of the mixture with Ce(IV)-EDTA at pH 7.0, the phosphodiester linkages at the bulge site were selectively and efficiently hydrolyzed. The monophosphate groups introduced into the bulge site greatly accelerated site-selective DNA scission. Compared with the previously reported two-additive system, which combines two oligonucleotide additives each with a monophosphate at their termini, the present one-additive system is simpler and more convenient. Furthermore, site-selective DNA hydrolysis by using this one-additive system is successful even at high reaction temperatures (e.g., 55 degrees C). This reflects the thermodynamic stability of the duplexes formed between the substrate and the additive DNA. PMID:16196014

  19. Adsorption of nucleotides on biomimetic apatite: The case of adenosine 5‧ monophosphate (AMP)

    NASA Astrophysics Data System (ADS)

    Hammami, K.; Feki, H. El; Marsan, O.; Drouet, C.


    This work investigates the interaction between the nucleotide adenosine 5‧ monophosphate molecule (AMP) and a biomimetic nanocrystalline carbonated apatite as a model for bone mineral. The analogy of the apatite phase used in this work with biological apatite was first pointed out by complementary techniques. AMP adsorption isotherms were then investigated. Obtained data were fitted to a Sips isotherm with an exponent greater than one suggesting positive cooperativity among adsorbed molecules. The data were compared to a previous study relative to the adsorption of another nucleotide, cytidine monophosphate (CMP) onto a similar substrate, evidencing some effect of the chemical nature of the nucleic base. An enhanced adsorption was observed under acidic (pH 6) conditions as opposed to pH 7.4, which parallels the case of DNA adsorption on biomimetic apatite. An estimated standard Gibbs free energy associated to the adsorption process (ΔG°ads ≅ -22 kJ/mol) intermediate between "physisorption" and "chemisorption" was found. The analysis of the solids after adsorption pointed to the preservation of the main characteristics of the apatite substrate but shifts or enhancements of Raman bands attributed to AMP showed the existence of chemical interactions involving both the phosphate and adenine parts of AMP. This contribution adds to the works conducted in view of better understanding the interaction of DNA/RNA and their constitutive nucleotides and the surface of biomimetic apatites. It could prove helpful in disciplines such as bone diagenesis (DNA/apatite interface in aged bones) or nanomedicine (setup of DNA- or RNA-loaded apatite systems). Also, the adsorption of nucleic acids on minerals like apatites could have played a role in the preservation of such biomolecules in the varying conditions known to exist at the origin of life on Earth, underlining the importance of dedicated adsorption studies.

  20. Involvement of nitric oxide pathway in the PAF-induced relaxation of rat thoracic aorta.

    PubMed Central

    Moritoki, H.; Hisayama, T.; Takeuchi, S.; Miyano, H.; Kondoh, W.


    1. The mechanism of the vasorelaxant effect of platelet activating factor (PAF) on rat thoracic aorta and the effect of aging on the PAF-induced relaxation were investigated. 2. PAF at concentrations causing relaxation induced marked increases in guanosine 3':5'-cyclic monophosphate (cyclic GMP) production, but did not induce an increase in adenosine 3':5'-cyclic monophosphate (cyclic AMP). 3. Removal of the endothelium by mechanical rubbing, and treatment with the PAF antagonists CV-3988, CV-6209 and FR-900452, the nitric oxide biosynthesis inhibitor, NG-nitro L-arginine, the radical scavenger, haemoglobin, and the soluble guanylate cyclase inhibitor, methylene blue, inhibited PAF-induced relaxation and abolished or attenuated PAF-stimulated cyclic GMP production. 4. The relaxation was greatest in arteries from rats aged 4 weeks. With an increase in age, the response of the arteries to PAF was attenuated. 5. Endothelium-dependent cyclic GMP production also decreased with increase in age of the rats. 6. These results suggest that PAF stimulates production of nitric oxide from L-arginine by acting on the PAF receptors in the endothelium, which in turn stimulates soluble guanylate cyclase in the smooth muscle cells, and so increases production of cyclic GMP, thus relaxing the arteries. Age-associated decrease in PAF-induced relaxation may result from a reduction of cyclic GMP formation. PMID:1358382

  1. Oxidatively damaged guanosine in white blood cells and in urine of welders: associations with exposure to welding fumes and body iron stores.


    Pesch, Beate; Lotz, Anne; Koch, Holger M; Marczynski, Boleslaw; Casjens, Swaantje; Käfferlein, Heiko U; Welge, Peter; Lehnert, Martin; Heinze, Evelyn; Van Gelder, Rainer; Hahn, Jens-Uwe; Behrens, Thomas; Raulf, Monika; Hartwig, Andrea; Weiss, Tobias; Brüning, Thomas


    The International Agency for Research on Cancer considers the carcinogenicity of welding fume of priority for re-evaluation. Genotoxic effects in experimental animals are still inconclusive. Here, we investigated the association of personal exposure to metals in respirable welding fumes during a working shift with oxidatively damaged guanosine in DNA of white blood cells (WBC) and in postshift urine samples from 238 welders. Medians of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo) were 2.35/10(6) dGuo in DNA of WBC and 4.33 µg/g creatinine in urine. The median of 8-oxo-7,8-dihydroguanosine (8-oxoGuo) was 7.03 µg/g creatinine in urine. The extent of both urinary parameters was higher in welders applying techniques with high particle emission rates to stainless steel than in tungsten inert gas welders (8-oxodGuo: 9.96 vs. 4.49 µg/L, 8-oxoGuo: 15.7 vs. 7.7 µg/L), but this apparent difference diminished after creatinine adjustment. We applied random intercept models to estimate the influence of airborne and systemic exposure to metals on oxidatively damaged guanosine in WBC and urine together with covariates. We observed a highly significant nonlinear association of urinary 8-oxoGuo with serum ferritin (P < 0.0001) and higher 8-oxoGuo concentrations for respirable iron >1,000 µg/m(3) compared to ≤57 µg/m(3). Similar effects were found for manganese. Airborne chromium but not nickel was associated with all oxidatively modified guanosine measures, whereas urinary chromium as well as nickel showed associations with urinary modified guanosines. In summary, oxidatively damaged urinary guanosine was associated with airborne and systemic exposure to metals in welders and showed a strong relation to body iron stores. PMID:25107450

  2. Enhanced Production of Adenosine Triphosphate by Pharmacological Activation of Adenosine Monophosphate-Activated Protein Kinase Ameliorates Acetaminophen-Induced Liver Injury.


    Hwang, Jung Hwan; Kim, Yong-Hoon; Noh, Jung-Ran; Choi, Dong-Hee; Kim, Kyoung-Shim; Lee, Chul-Ho


    The hepatic cell death induced by acetaminophen (APAP) is closely related to cellular adenosine triphosphate (ATP) depletion, which is mainly caused by mitochondrial dysfunction. Adenosine monophosphate (AMP)-activated protein kinase (AMPK) is a key sensor of low energy status. AMPK regulates metabolic homeostasis by stimulating catabolic metabolism and suppressing anabolic pathways to increase cellular energy levels. We found that the decrease in active phosphorylation of AMPK in response to APAP correlates with decreased ATP levels, in vivo. Therefore, we hypothesized that the enhanced production of ATP via AMPK stimulation can lead to amelioration of APAP-induced liver failure. A769662, an allosteric activator of AMPK, produced a strong synergistic effect on AMPK Thr172 phosphorylation with APAP in primary hepatocytes and liver tissue. Interestingly, activation of AMPK by A769662 ameliorated the APAP-induced hepatotoxicity in C57BL/6N mice treated with APAP at a dose of 400 mg/kg intraperitoneally. However, mice treated with APAP alone developed massive centrilobular necrosis, and APAP increased their serum alanine aminotransferase and aspartate aminotransferase levels. Furthermore, A769662 administration prevented the loss of intracellular ATP without interfering with the APAP-mediated reduction of mitochondrial dysfunction. In contrast, inhibition of glycolysis by 2-deoxy-glucose eliminated the beneficial effects of A769662 on APAP-mediated liver injury. In conclusion, A769662 can effectively protect mice against APAP-induced liver injury through ATP synthesis by anaerobic glycolysis. Furthermore, stimulation of AMPK may have potential therapeutic application for APAP overdose. PMID:26434492

  3. Enhanced Production of Adenosine Triphosphate by Pharmacological Activation of Adenosine Monophosphate-Activated Protein Kinase Ameliorates Acetaminophen-Induced Liver Injury

    PubMed Central

    Hwang, Jung Hwan; Kim, Yong-Hoon; Noh, Jung-Ran; Choi, Dong-Hee; Kim, Kyoung-Shim; Lee, Chul-Ho


    The hepatic cell death induced by acetaminophen (APAP) is closely related to cellular adenosine triphosphate (ATP) depletion, which is mainly caused by mitochondrial dysfunction. Adenosine monophosphate (AMP)-activated protein kinase (AMPK) is a key sensor of low energy status. AMPK regulates metabolic homeostasis by stimulating catabolic metabolism and suppressing anabolic pathways to increase cellular energy levels. We found that the decrease in active phosphorylation of AMPK in response to APAP correlates with decreased ATP levels, in vivo. Therefore, we hypothesized that the enhanced production of ATP via AMPK stimulation can lead to amelioration of APAP-induced liver failure. A769662, an allosteric activator of AMPK, produced a strong synergistic effect on AMPK Thr172 phosphorylation with APAP in primary hepatocytes and liver tissue. Interestingly, activation of AMPK by A769662 ameliorated the APAP-induced hepatotoxicity in C57BL/6N mice treated with APAP at a dose of 400 mg/kg intraperitoneally. However, mice treated with APAP alone developed massive centrilobular necrosis, and APAP increased their serum alanine aminotransferase and aspartate aminotransferase levels. Furthermore, A769662 administration prevented the loss of intracellular ATP without interfering with the APAP-mediated reduction of mitochondrial dysfunction. In contrast, inhibition of glycolysis by 2-deoxy-glucose eliminated the beneficial effects of A769662 on APAP-mediated liver injury. In conclusion, A769662 can effectively protect mice against APAP-induced liver injury through ATP synthesis by anaerobic glycolysis. Furthermore, stimulation of AMPK may have potential therapeutic application for APAP overdose. PMID:26434492

  4. Comparative Structural Dynamics of tRNA(Phe) with Respect to Hinge Region Methylated Guanosine: A Computational Approach.


    Sonawane, Kailas D; Bavi, Rohit S; Sambhare, Susmit B; Fandilolu, Prayagraj M


    Transfer RNAs (tRNAs) contain various uniquely modified nucleosides thought to be useful for maintaining the structural stability of tRNAs. However, their significance for upholding the tRNA structure has not been investigated in detail at the atomic level. In this study, molecular dynamic simulations have been performed to assess the effects of methylated nucleic acid bases, N (2)-methylguanosine (m(2)G) and N (2)-N (2)-dimethylguanosine (m 2 (2) G) at position 26, i.e., the hinge region of E. coli tRNA(Phe) on its structure and dynamics. The results revealed that tRNA(Phe) having unmodified guanosine in the hinge region (G26) shows structural rearrangement in the core of the molecule, resulting in lack of base stacking interactions, U-turn feature of the anticodon loop, and TΨC loop. We show that in the presence of the unmodified guanosine, the overall fold of tRNA(Phe) is essentially not the same as that of m(2)G26 and m 2 (2) G26 containing tRNA(Phe). This structural rearrangement arises due to intrinsic factors associated with the weak hydrogen-bonding patterns observed in the base triples of the tRNA(Phe) molecule. The m(2)G26 and m 2 (2) G26 containing tRNA(Phe) retain proper three-dimensional fold through tertiary interactions. Single-point energy and molecular electrostatics potential calculation studies confirmed the structural significance of tRNAs containing m(2)G26 and m 2 (2) G26 compared to tRNA with normal G26, showing that the mono-methylated (m(2)G26) and dimethylated (m 2 (2) G26) modifications are required to provide structural stability not only in the hinge region but also in the other parts of tRNA(Phe). Thus, the present study allows us to better understand the effects of modified nucleosides and ionic environment on tRNA folding. PMID:27216172

  5. Guanosine may increase absence epileptic activity by means of A2A adenosine receptors in Wistar Albino Glaxo Rijswijk rats.


    Lakatos, Renáta Krisztina; Dobolyi, Árpád; Todorov, Mihail Ivilinov; Kékesi, Katalin A; Juhász, Gábor; Aleksza, Magdolna; Kovács, Zsolt


    The non-adenosine nucleoside guanosine (Guo) was demonstrated to decrease quinolinic acid(QA)-induced seizures, spontaneously emerged absence epileptic seizures and lipopolysaccharide(LPS)-evoked induction of absence epileptic seizures suggesting its antiepileptic potential. It was also described previously that intraperitoneal (i.p.) injection of 20 and 50mg/kg Guo decreased the number of spike-wave discharges (SWDs) in a well investigated model of human absence epilepsy, the Wistar Albino Glaxo Rijswijk (WAG/Rij) rats during 4th (20mg/kg Guo) and 3rd as well as 4th (50mg/kg Guo) measuring hours. Guanosine can potentially decrease SWD number by means of its putative receptors but absence epileptic activity changing effects of Guo by means of increased extracellular adenosine (Ado) cannot be excluded. An increase in the dose of i.p. injected Guo is limited by its low solubility in saline, therefore, we addressed in the present study whether higher doses of Guo, diluted in sodium hydroxide (NaOH) solution, have more potent antiepileptic effect in WAG/Rij rats. We confirmed that i.p. 50mg/kg Guo decreased but, surprisingly, i.p. 100mg/kg Guo enhanced the number of SWDs in WAG/Rij rats. Combined i.p. injection of a non-selective Ado receptor antagonist theophylline (5mg/kg) or a selective Ado A2A receptor (A2AR) antagonist SCH 58261 (7-(2-phenylethyl)-5-amino-2-(2-furyl)-pyrazolo-[4,3-e]-1,2,4-triazolo[1,5-c]pyrimidine) (1mg/kg) and a cyclooxygenase 1 and 2/COX-1 and COX-2 inhibitor indomethacin (10mg/kg) with 100mg/kg Guo decreased the SWD number compared to i.p. 100mg/kg Guo alone. The results suggest that i.p. 100mg/kg Guo can increase SWD number by means of the adenosinergic system. PMID:27154620

  6. Antidepressant effect of pramipexole in mice forced swimming test: A cross talk between dopamine receptor and NMDA/nitric oxide/cGMP pathway.


    Ostadhadi, Sattar; Imran Khan, Muhammad; Norouzi-Javidan, Abbas; Dehpour, Ahmad-Reza


    Pramipexole is a dopamine D2 receptor agonist indicated for treating Parkinson disorder. This study was aimed to investigate the effect of pramipexole in forced swimming test (FST) in mice and the possible involvement of activation of D2 receptors and inhibition of N-methyl-d-aspartate (NMDA) receptors and nitric oxide-cyclic guanosine monophosphate (NO-cGMP) on this effect. Intraperitoneal administration of pramipexole (1-3mg/kg) reduced the immobility time in the FST similar to fluoxetine (20mg/kg, i.p.). This effect of pramipexole (1mg/kg, i.p.) was ceased when mice were pretreated with haloperidol (0.15mg/kg, i.p,) and sulpiride (5mg/kg, i.p) as D2 receptor antagonists, NMDA (75mg/kg,i.p.), l-arginine (750mg/kg, i.p., a substrate for nitric oxide synthase) or sildenafil (5mg/kg, i.p., a phosphodiesterase 5 inhibitor). The administration of MK-801 (0.05mg/kg, i.p., a NMDA receptor antagonist) l-NG-Nitro arginine methyl ester (l-NAME, 10mg/kg, i.p., a non-specific nitric oxide synthase (NOS) inhibitor), 7-nitroindazole (30mg/kg, i.p., a neuronal NOS inhibitor) and methylene blue (10mg/kg, i.p.), an inhibitor of both NOS and soluble guanylyl cyclase (sGC) in combination with the sub-effective dose of pramipexole (0.3mg/kg, i.p.) reduced the immobility. Altogether, our data suggest that the antidepressant-like effect of pramipexole is dependent on the activation of D2 receptor and inhibition of either NMDA receptors and/or NO-cGMP synthesis. These results contribute to the understanding of the mechanisms underlying the antidepressant-like effect of pramipexole and reinforce the role of D2 receptors, NMDA receptors and l-arginine-NO-GMP pathway in the antidepressant mechanism of this agent. PMID:27261607

  7. Theoretical vibrational spectroscopy of intermediates and the reaction mechanism of the guanosine triphosphate hydrolysis by the protein complex Ras-GAP

    NASA Astrophysics Data System (ADS)

    Khrenova, Maria G.; Grigorenko, Bella L.; Nemukhin, Alexander V.


    The structures and vibrational spectra of the reacting species upon guanosine triphosphate (GTP) hydrolysis to guanosine diphosphate and inorganic phosphate (Pi) trapped inside the protein complex Ras-GAP were analyzed following the results of QM/MM simulations. The frequencies of the phosphate vibrations referring to the reactants and to Pi were compared to those observed in the experimental FTIR studies. A good correlation between the theoretical and experimental vibrational data provides a strong support to the reaction mechanism of GTP hydrolysis by the Ras-GAP enzyme system revealed by the recent QM/MM modeling. Evolution of the vibrational bands associated with the inorganic phosphate Pi during the elementary stages of GTP hydrolysis is predicted.

  8. Theoretical vibrational spectroscopy of intermediates and the reaction mechanism of the guanosine triphosphate hydrolysis by the protein complex Ras-GAP.


    Khrenova, Maria G; Grigorenko, Bella L; Nemukhin, Alexander V


    The structures and vibrational spectra of the reacting species upon guanosine triphosphate (GTP) hydrolysis to guanosine diphosphate and inorganic phosphate (Pi) trapped inside the protein complex Ras-GAP were analyzed following the results of QM/MM simulations. The frequencies of the phosphate vibrations referring to the reactants and to Pi were compared to those observed in the experimental FTIR studies. A good correlation between the theoretical and experimental vibrational data provides a strong support to the reaction mechanism of GTP hydrolysis by the Ras-GAP enzyme system revealed by the recent QM/MM modeling. Evolution of the vibrational bands associated with the inorganic phosphate Pi during the elementary stages of GTP hydrolysis is predicted. PMID:27214270

  9. Syntheses of 5'-Nucleoside Monophosphate Derivatives with Unique Aminal, Hemiaminal, and Hemithioaminal Functionalities: A New Class of 5'-Peptidyl Nucleotides.


    De, Swarup; Groaz, Elisabetta; Margamuljana, Lia; Herdewijn, Piet


    A number of synthetically useful transformations have been developed to generate novel 5'-peptidyl nucleoside monophosphate analogues that incorporate sensitive phosphoaminal, -hemiaminal or -hemithioaminal functionalities. The strategies adopted entailed the coupling between dipeptides, which enclose a reactive Cα-functionalized glycine residue and phosphate or phosphorothioate moieties. These developments led to potentially powerful and general methodologies for the preparation of α-phosphorylated pseudopeptides as well as nucleoside monophosphate mimics. The resulting conjugates are of interest for a variety of important applications, which range from drug development to synthetic biology, as pronucleotides or artificial building blocks for the enzymatic synthesis of xenobiotic information systems. The potential of all dipeptide-TMP conjugates as pyrophosphate mimics in the DNA polymerization reaction was tested, and the influence of the nature of the linker was evaluated by in vitro chain elongation assay in the presence of wild-type microbial DNA polymerases. PMID:27136602

  10. Peroxynitrite-Dependent Zinc Release and Inactivation of Guanosine 5′-Triphosphate Cyclohydrolase 1 Instigate Its Ubiquitination in Diabetes

    PubMed Central

    Zhao, Yu; Wu, Jiliang; Zhu, Huaiping; Song, Ping; Zou, Ming-Hui


    Aberrant degradation of guanosine 5′-triphosphate cyclohydrolase 1 (GTPCH1) with consequent deficiency of tetrahydrobiopterin is considered the primary cause for endothelial dysfunction in diabetes. How GTPCH1 becomes susceptible to the degradation remains unknown. We hypothesized that oxidation and release of the zinc ion by peroxynitrite (ONOO−), a potent oxidant generated by nitric oxide and superoxide anions, instigates GTPCH1 ubiquitination and degradation. Zinc contents, GTPCH1 ubiquitination, and GTPCH1 activity were assayed in purified GTPCH1, endothelial cells, and hearts from diabetic mice. Exogenous ONOO− dose-dependently released zinc, inhibited its activity, and increased the ubiquitin binding affinity of GTPCH1 in vitro and in endothelial cells. Consistently, high glucose (30 mmol/L) inhibited GTPCH1 activity with increased ubiquitination, which was inhibited by antioxidants. Furthermore, mutation of the zinc-binding cysteine (141) (C141R or C141A) significantly reduced GTPCH1 activity and reduced its half-life but increased GTPCH1 ubiquitination, indicating an essential role of the zinc ion in maintaining the catalytic activity and stability of GTPCH1. Finally, GTPCH1 ubiquitination and degradation markedly increased in parallel with decreased GTPCH1 activity in the aortas and hearts of diabetic mice, both of which were attenuated by the inhibitors of ONOO− in mice in vivo. Taken together, we conclude that ONOO− releases zinc and inhibits GTPCH1, resulting in its ubiquitination and degradation of the enzyme. PMID:23974923

  11. Length of guanosine homopolymeric repeats modulates promoter activity of subfamily II tpr genes of Treponema pallidum ssp. pallidum.


    Giacani, Lorenzo; Lukehart, Sheila; Centurion-Lara, Arturo


    In Treponema pallidum, homopolymeric guanosine repeats of varying length are present upstream of both Subfamily I (tprC, D, F and I) and II (tprE, G and J) tpr genes, a group of potential virulence factors, immediately upstream of the +1 nucleotide. To investigate the influence of these poly-G sequences on promoter activity, tprE, G, J, F and I promoter regions containing homopolymeric tracts with different numbers of Gs, the ribosomal binding site and start codon were cloned in frame with the green fluorescent protein reporter gene (GFP), and promoter activity was measured both as fluorescence emission from Escherichia coli cultures transformed with the different plasmid constructs and using quantitative RT-PCR. For tprJ, G and E-derived clones, fluorescence was significantly higher with constructs containing eight Gs or fewer, while plasmids containing the same promoters with none or more Gs gave modest or no signal above the background. In contrast, tprF/I-derived clones induced similar levels of fluorescence regardless of the number of Gs within the promoter. GFP mRNA quantification showed that all of the promoters induced measurable transcription of the GFP gene; however, only for Subfamily II promoters was message synthesis inversely correlated to the number of Gs in the construct. PMID:17683506

  12. Non-adenosine nucleoside inosine, guanosine and uridine as promising antiepileptic drugs: a summary of current literature.


    Kovacs, Zsolt; Kekesi, Katalin A; Juhasz, Gabor; Barna, Janos; Heja, Laszlo; Lakatos, Renata; Dobolyi, Arpad


    Adenosine (Ado) and some non-adenosine (non-Ado) nucleosides including inosine (Ino), guanosine (Guo) and uridine (Urd) are modulatory molecules in the central nervous system (CNS), regulating different physiological and pathophysiological processes in the brain such as sleep and epilepsy. Indeed, different drugs effective on adenosinergic system (e.g., Ado metabolism inhibitors, agonists and antagonists of Ado receptors) are being used in drug development for the treatment of epileptic disorders. Although (i) endogenous Ino, Guo and Urd showed anticonvulsant/antiepileptic effects (e.g., in quinolinic acid - induced seizures and in different epilepsy models such as hippocampal kindling models), and (ii) there is a need to generate new and more effective antiepileptic drugs for the treatment of drug-resistant epilepsies, our knowledge about antiepileptic influence of non-Ado nucleosides is far from complete. Thus, in this review article, we give a short summary of anticonvulsant/antiepileptic effects and mechanisms evoked by Ino, Guo, and Urd. Finally, we discuss some non-Ado nucleoside derivatives and their structures, which may be candidates as potential antiepileptic agents. PMID:25382017

  13. Intranasal guanosine administration presents a wide therapeutic time window to reduce brain damage induced by permanent ischemia in rats.


    Ramos, Denise Barbosa; Muller, Gabriel Cardozo; Rocha, Guilherme Botter Maio; Dellavia, Gustavo Hirata; Almeida, Roberto Farina; Pettenuzzo, Leticia Ferreira; Loureiro, Samanta Oliveira; Hansel, Gisele; Horn, Ângelo Cássio Magalhães; Souza, Diogo Onofre; Ganzella, Marcelo


    In addition to its intracellular roles, the nucleoside guanosine (GUO) also has extracellular effects that identify it as a putative neuromodulator signaling molecule in the central nervous system. Indeed, GUO can modulate glutamatergic neurotransmission, and it can promote neuroprotective effects in animal models involving glutamate neurotoxicity, which is the case in brain ischemia. In the present study, we aimed to investigate a new in vivo GUO administration route (intranasal, IN) to determine putative improvement of GUO neuroprotective effects against an experimental model of permanent focal cerebral ischemia. Initially, we demonstrated that IN [(3)H] GUO administration reached the brain in a dose-dependent and saturable pattern in as few as 5 min, presenting a higher cerebrospinal GUO level compared with systemic administration. IN GUO treatment started immediately or even 3 h after ischemia onset prevented behavior impairment. The behavior recovery was not correlated to decreased brain infarct volume, but it was correlated to reduced mitochondrial dysfunction in the penumbra area. Therefore, we showed that the IN route is an efficient way to promptly deliver GUO to the CNS and that IN GUO treatment prevented behavioral and brain impairment caused by ischemia in a therapeutically wide time window. PMID:26695181

  14. Synthesis of the coenzymes adenosine diphosphate glucose, guanosine diphosphate glucose, and cytidine diphosphoethanolamine under primitive Earth conditions

    NASA Technical Reports Server (NTRS)

    Mar, A.; Oro, J.


    The nonenzymatic synthesis of the coenzymes adenosine diphosphate glucose (ADPG), guanosine diphosphate glucose (GDPG), and cytidine diphosphoethanolamine (CDP-ethanolamine) has been carried out under conditions considered to have been prevalent on the early Earth. The production of these compounds was performed by allowing simple precursor molecules to react under aqueous solutions, at moderate temperatures and short periods of time, with mediation by cyanamide or urea. These two condensing agents are considered to have been present in significant amounts on the primitive Earth and have been previously used in the nonenzymatic synthesis of several other important biochemical compounds. In our experiments, ADPG was obtained by heating glucose-1-phosphate (G1P) and ATP in the presence of cyanamide for 24 h at 70 degrees C. The reaction of G1P and GTP under the same conditions yielded GDPG. The cyanamide-mediated production of CDP-ethanolamine was carried out by reacting a mixture of ethanolamine phosphate and CTP for 24 h at 70 degrees C. The separation and identification of the reaction products was carried out by paper chromatography, thin-layer chromatography, high performance thin-layer chromatography, high performance liquid chromatography, both normal and reverse-phase, UV spectroscopy, enzymatic assays, and acid hydrolysis. Due to the mild conditions employed, and to the relative ease of these reactions, these studies offer a simple attractive system for the nonenzymatic synthesis of phosphorylated high-energy metabolic intermediates under conditions considered to have been prevalent on the ancient Earth.

  15. Cyclic diguanylate monophosphate directly binds to human siderocalin and inhibits its antibacterial activity

    PubMed Central

    Li, Weihui; Cui, Tao; Hu, Lihua; Wang, Ziqing; Li, Zongqiang; He, Zheng-Guo


    Cyclic diguanylate monophosphate (c-di-GMP) is a well-conserved second messenger in bacteria. During infection, the innate immune system can also sense c-di-GMP; however, whether bacterial pathogens utilize c-di-GMP as a weapon to fight against host defense for survival and possible mechanisms underlying this process remain poorly understood. Siderocalin (LCN2) is a key antibacterial component of the innate immune system and sequesters bacterial siderophores to prevent acquisition of iron. Here we show that c-di-GMP can directly target the human LCN2 protein to inhibit its antibacterial activity. We demonstrate that c-di-GMP specifically binds to LCN2. In addition, c-di-GMP can compete with bacterial ferric siderophores to bind LCN2. Furthermore, c-di-GMP can significantly reduce LCN2-mediated inhibition on the in vitro growth of Escherichia coli. Thus, LCN2 acts as a c-di-GMP receptor. Our findings provide insight into the mechanism by which bacteria utilize c-di-GMP to interfere with the innate immune system for survival. PMID:26390966

  16. The effect of polystyrene beads on cyclic 3',5'-adenosine monophosphate concentration in leukocytes.


    Manganiello, V; Evans, W H; Stossel, T P; Mason, R J; Vaughan, M


    After incubation with polystyrene latex beads for 5 min. the cyclic 3',5'-adenosine monophosphate (cyclic AMP) content of human peripheral blood leukocyte suspensions was increased severalfold. Preparations enriched in mononuclear cells and containing only 0-20% polymorphonuclear leukocytes (PMN) and no visible platelets exhibited a quantitatively similar response. Purified fractions of cells containing 85-90% PMN responded to polystyrene beads with a much smaller increase in cyclic AMP content. Phagocytosis of paraffin oil emulsion in the unfractionated mixed human leukocyte preparation was associated with little or no change in cyclic AMP levels. There was no change in cyclic AMP content of rabbit alveolar macrophages or guinea pig PMN during phagocytosis of polystyrene beads. All of these observations are consistent with the view that particle uptake per se does not increase cyclic AMP levels in phagocytic cells. It seems probable that the increase in cyclic AMP concentration that results when unfractionated human blood leukocytes are incubated with polystyrene beads occurs in cells other than PMN. PMID:4331596

  17. A Mixed-Valent Molybdenum Monophosphate with a Layer Structure: KMo 3P 2O 14

    NASA Astrophysics Data System (ADS)

    Guesdon, A.; Borel, M. M.; Leclaire, A.; Grandin, A.; Raveau, B.


    A new mixed-valent molybdenum monophosphate with a layer structure KMo 3P 2O 14 has been isolated. It crystallizes in the space group P2 1/ m with a = 8.599(2) Å, b = 6.392(2) Å, c = 10.602(1) Å, and β = 111.65(2)°. The layers [Mo 3P 2O 14] ∞ are parallel to (100) and consist of [MoPO 8] ∞ chains running along limitb→ , in which one MoO 6 octahedron alternates with one PO 4 tetrahedron. In fact, four [MoPO 8] ∞ chains share the corners of their polyhedra and the edges of their octahedra, forming [Mo 4P 4O 24] ∞ columns which are linked through MoO 5 bipyramids along limitc→. The K + ions interleaved between these layers are surrounded by eight oxygens, forming bicapped trigonal prisms KO 8. Besides the unusual trigonal bipyramids MoO 5, this structure is also characterized by a tendency to the localization of the electrons, since one octahedral site is occupied by Mo(V), whereas the other octahedral site and the trigonal bipyramid are occupied by Mo(VI). The similarity of this structure with pure octahedral layer structures suggests the possibility of generating various derivatives, and of ion exchange properties.

  18. Stacking-unstacking of the dinucleoside monophosphate guanylyl-3',5'-uridine studied with molecular dynamics.


    Norberg, J; Nilsson, L


    Molecular dynamics simulations were carried out on two conformations of the dinucleoside monophosphate guanylyl-3',5'-uridine (GpU) in aqueous solution with one sodium counterion. One stacked conformation and one with the C3'-O3'-P-O5' backbone torsion angle twisted 180 degrees to create an unstacked conformation. We observed a relatively stable behavior of the stacked conformation, which remained stacked throughout the simulation, whereas the unstacked conformation showed major changes in the backbone torsion and glycosidic angles. During the simulation the unstacked conformation transformed into a more stacked form and then back again to an unstacked one. The calculated correlation times for rotational diffusion from the molecular dynamics simulations are in agreement with fluorescence anisotropy and nuclear magnetic resonance data. As expected, the correlation times for rotational diffusion of the unstacked conformation were observed to be longer than for the stacked conformation. The 2'OH group may contribute in stabilizing the stacked conformation, where the O2'-H...O4' hydrogen bond occurred in 82.7% of the simulation. PMID:7948694


    PubMed Central

    Li, Hong; Mager, Donald E.; Sandmaier, Brenda M.; Storer, Barry E.; Boeckh, Michael J.; Bemer, Meagan J.; Phillips, Brian R.; Risler, Linda J.; McCune, Jeannine S.


    A novel approach to personalizing postgrafting immunosuppression in hematopoietic cell transplant (HCT) recipients is evaluating inosine monophosphate dehydrogenase (IMPDH) activity as a drug-specific biomarker of mycophenolic acid (MPA)-induced immunosuppression. This prospective study evaluated total MPA, unbound MPA, and total MPA glucuronide plasma concentrations and IMPDH activity in peripheral blood mononuclear cells (PMNC) at five time points after the morning dose of oral mycophenolate mofetil (MMF) on day +21 in 56 nonmyeloablative HCT recipients. Substantial interpatient variability in the pharmacokinetics and pharmacodynamics was observed and accurately characterized by the population pharmacokinetic/dynamic model. IMPDH activity decreased with increasing MPA plasma concentration, with maximum inhibition coinciding with maximum MPA concentration in most patients. The overall relationship between MPA concentration and IMPDH activity was described by a direct inhibitory Emax model with an IC50 = 3.23 mg/L total MPA and 57.3 ng/mL unbound MPA. The day +21 IMPDH area under the effect curve (AUEC) was associated with cytomegalovirus reactivation, non-relapse mortality, and overall mortality. In conclusion, a pharmacokinetic/dynamic model was developed that relates plasma MPA concentrations with PMNC IMPDH activity after an MMF dose in HCT recipients. Future studies should validate this model and confirm that day +21 IMPDH AUEC is a predictive biomarker. PMID:24727337

  20. Radiolysis in aqueous solution of dinucleoside monophosphates by high-energy electrons and fission neutrons.


    Vaishnav, Y N; Swenberg, C E


    The radiation chemistry in aqueous solution of the dinucleoside monophosphate d-[CpT] and its sequence isomer d-[TpC] in air or nitrogen was examined using different qualities and quantities of radiations. High-performance liquid chromatography and gas chromatography-mass spectrometry were used to analyze the high-energy electron (13.2 MeV) exposure products or fission-neutron exposure products of d-[CpT] and d-[TpC]. A comparison of product profiles obtained from irradiated d-[CpT] and d-[TpC] suggests that, at relatively low radiation doses (50-250 Gy), products are formed by N-glycosidic or phosphodiester bond-cleavage, while at higher doses (500-1000 Gy) additional products were detected as a consequence of ring-modification mechanisms. The plots of radiation dose-yield and corresponding calculated G values of the released undamaged bases and nucleosides from d-[CpT] and d-[TpC] suggest a base-sequence dependence and a quality- and quantity-dependent response to ionizing radiation. Although the product quantities formed from sequence isomers were slightly different, we found no qualitative differences in the product formed at the lowest doses examined. PMID:8434108

  1. Coordinating properties of uridine 5'-monophosphate with selected Ln(3+) ions in ionic micellar media.


    Sudhiranjan Singh, M; Homendra, Naorem; Lonibala, R K


    Coordinating properties of uridine 5'-monophosphate (UMP) towards trivalent La, Pr, Nd, Sm, Eu and Gd ions in presence of cationic and anionic micelles have been investigated by potentiometric pH-titration and spectroscopic methods. Stability constants of the 2:1 complexes have been determined and the change in free energy, enthalpy and entropy associated with the complexation are also calculated. Nd(III) complexes isolated from aqueous and aqueous-micellar media do not show any significant structural difference. Formation of Ln(III) complexes in all cases completes below pH 7.5 showing that UMP best interacts with Ln(3+) ions at the physiological pH range 7.3-7.5. The nucleobase is not involved in the complexation and the metal ion coordination of UMP is through the phosphate moiety only. Coordinating tendency of UMP with lanthanides, Nd(III) ion in particular, at different pH is also discussed. Luminescent properties of Eu(III) complex and its decay lifetime are also presented. This information may prove helpful regarding the use of lanthanides as biological probes for calcium/magnesium ions. PMID:23001701

  2. A Screening Pipeline for Antiparasitic Agents Targeting Cryptosporidium Inosine Monophosphate Dehydrogenase

    PubMed Central

    Sharling, Lisa; Liu, Xiaoping; Gollapalli, Deviprasad R.; Maurya, Sushil K.; Hedstrom, Lizbeth; Striepen, Boris


    Background The protozoan parasite Cryptosporidium parvum is responsible for significant disease burden among children in developing countries. In addition Cryptosporidiosis can result in chronic and life-threatening enteritis in AIDS patients, and the currently available drugs lack efficacy in treating these severe conditions. The discovery and development of novel anti-cryptosporidial therapeutics has been hampered by the poor experimental tractability of this pathogen. While the genome sequencing effort has identified several intriguing new targets including a unique inosine monophosphate dehydrogenase (IMPDH), pursuing these targets and testing inhibitors has been frustratingly difficult. Methodology and Principal Findings Here we have developed a pipeline of tools to accelerate the in vivo screening of inhibitors of C. parvum IMPDH. We have genetically engineered the related parasite Toxoplasma gondii to serve as a model of C. parvum infection as the first screen. This assay provides crucial target validation and a large signal window that is currently not possible in assays involving C. parvum. To further develop compounds that pass this first filter, we established a fluorescence-based assay of host cell proliferation, and a C. parvum growth assay that utilizes automated high-content imaging analysis for enhanced throughput. Conclusions and Significance We have used these assays to evaluate C. parvum IMPDH inhibitors emerging from our ongoing medicinal chemistry effort and have identified a subset of 1,2,3-triazole ethers that exhibit excellent in vivo selectivity in the T. gondii model and improved anti-cryptosporidial activity. PMID:20706578

  3. Structural and functional characterization of the Mycobacterium tuberculosis uridine monophosphate kinase: insights into the allosteric regulation†

    PubMed Central

    Labesse, Gilles; Benkali, Khaled; Salard-Arnaud, Isabelle; Gilles, Anne-Marie; Munier-Lehmann, Hélène


    Nucleoside Monophosphate Kinases (NMPKs) family are key enzymes in nucleotide metabolism. Bacterial UMPKs depart from the main superfamily of NMPKs. Having no eukaryotic counterparts they represent attractive therapeutic targets. They are regulated by GTP and UTP, while showing different mechanisms in Gram(+), Gram(–) and archaeal bacteria. In this work, we have characterized the mycobacterial UMPK (UMPKmt) combining enzymatic and structural investigations with site-directed mutagenesis. UMPKmt exhibits cooperativity toward ATP and an allosteric regulation by GTP and UTP. The crystal structure of the complex of UMPKmt with GTP solved at 2.5 Å, was merely identical to the modelled apo-form, in agreement with SAXS experiments. Only a small stretch of residues was affected upon nucleotide binding, pointing out the role of macromolecular dynamics rather than major structural changes in the allosteric regulation of bacterial UMPKs. We further probe allosteric regulation by site-directed mutagenesis. In particular, a key residue involved in the allosteric regulation of this enzyme was identified. PMID:21149268

  4. A Fluorometric Activity Assay for Light-Regulated Cyclic-Nucleotide-Monophosphate Actuators.


    Schumacher, Charlotte Helene; Körschen, Heinz G; Nicol, Christopher; Gasser, Carlos; Seifert, Reinhard; Schwärzel, Martin; Möglich, Andreas


    As a transformative approach in neuroscience and cell biology, optogenetics grants control over manifold cellular events with unprecedented spatiotemporal definition, reversibility, and noninvasiveness. Sensory photoreceptors serve as genetically encoded, light-regulated actuators and hence embody the cornerstone of optogenetics. To expand the scope of optogenetics, ever more naturally occurring photoreceptors are being characterized, and synthetic photoreceptors with customized, light-regulated function are being engineered. Perturbational control over intracellular cyclic-nucleotide-monophosphate (cNMP) levels is achieved via sensory photoreceptors that catalyze the making and breaking of these second messengers in response to light. To facilitate discovery, engineering and quantitative characterization of such light-regulated cNMP actuators, we have developed an efficient fluorometric assay. Both the formation and the hydrolysis of cNMPs are accompanied by proton release which can be quantified with the fluorescent pH indicator 2',7'-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein (BCECF). This assay equally applies to nucleotide cyclases, e.g., blue-light-activated bPAC, and to cNMP phosphodiesterases, e.g., red-light-activated LAPD. Key benefits include potential for parallelization and automation, as well as suitability for both purified enzymes and crude cell lysates. The BCECF assay hence stands to accelerate discovery and characterization of light-regulated actuators of cNMP metabolism. PMID:26965118

  5. Control of cyclic adenosine 3',5'-monophosphate levels by depolarizing agents in fungi.

    PubMed Central

    Trevillyan, J M; Pall, M L


    It has been reported that diverse treatments which depolarize the plasma membrane of Neurospora crassa produce rapid increases in cyclic adenosine 3',5'-monophosphate (cyclic AMP) levels. In the current study, membrane active antibiotics, which are known or putative depolarizing agents, were found to produce similar cyclic AMP increases, not only in N. crassa, but also in the distantly related fungi Saccharomyces cerevisiae and Mucor racemosus. Uncouplers of oxidative phosphorylation, which have been found to depolarize Neurospora, also produced cyclic AMP increases in all three fungi. The time course of the cyclic AMP response to these various treatments was similar in all three fungi. The fungal studies and studies on depolarized central nervous tissue suggest that cyclic AMP increases may be produced in response to plasma membrane depolarization in diverse eucaryotic cells. A model is proposed for eucaryotic microorganisms in which membrane depolarization serves as a signal of breakdown of the plasma membrane integrity. The subsequent cyclic AMP increase, in turn, may mediate cellular response to help protect the plasma membrane from chemical and mechanical threats to its integrity. PMID:220213

  6. Preliminary X-ray crystallographic analysis of Tritrichomonas foetus inosine-5'-monophosphate dehydrogenase.


    Whitby, F G; Huete-Perez, J; Luecke, H; Wang, C C


    Inosine-5'-monophosphate dehydrogenase (IMPDH) from the protozoan parasite Tritrichomonas foetus has been expressed in E. coli and crystallized. Crystals were grown to 0.1 mm in each dimension in 18 to 72 h using ammonium sulfate and low-molecular-weight polyethylene glycols. The crystals belong to the cubic space group P432 with unit cell edge = 157.25 A. The enzyme is a homotetramer with each monomer having a molecular weight of 55,534 Da. There is one monomer per asymmetric unit, based on a volume/mass ratio of 2.7 A3/Da and self-rotation analysis. The crystals are adequately stable to allow a complete data set to be collected from a single crystal. Complete native data sets have been collected to 2.3 A resolution at 4 degrees C using synchrotron radiation. High-quality complete data extending to 3.0 A resolution have been collected from crystals of four putative derivatives, and the data appear to be isomorphous with that of the native crystals in each case. Efforts to solve the derivatives for use in MIR phasing are underway. PMID:8749858

  7. Stimulation of cyclic adenosine monophosphate accumulation causes breakdown of the blood-retinal barrier.


    Sen, H A; Campochiaro, P A


    Pigmented rabbits were given an intravitreous injection of 0.1 ml of various concentrations of test drug, and vitreous fluorophotometry was done 6 and 24 hr after injection. Dibutyryl cyclic adenosine monophosphate (AMP) and 8-bromo-cyclic AMP caused reversible intravitreous fluorescein leakage only at relatively high concentrations. Adrenergic agents that are effective stimulators of adenylate cyclase (epinephrine, isoproterenol, and norepinephrine) caused transient intravitreous fluorescein leakage (2.3-3.1-fold above baseline) that was significantly greater than that caused by phenylephrine (1.1-fold above baseline), an adrenergic agent that is a poor stimulator of adenylate cyclase. Prostaglandins E1 and E2, which are good stimulators of adenylate cyclase, caused striking disruption of the blood-ocular barriers, and prostaglandins that are not good stimulators of adenylate cyclase had little or no effect on these barriers. The magnitude of the prostaglandin E1 effect (9.3-fold above baseline) was similar to that of N-ethylcarboxamidoadenosine (NECA), the most potent adenosine agonist, and was greater than one would predict based on its effect on adenylate cyclase in vitro. Prostaglandin E1, like NECA, also caused retinal vasodilation and hemorrhages. These data suggest that stimulation of intracellular cyclic AMP accumulation may be a common feature of mediators that cause breakdown of the blood-retinal barrier, but there may be another as yet unexplained feature shared by PGE1 and NECA that makes them particularly effective and capable of causing retinal vasodilation and hemorrhages. PMID:1647374

  8. Selective and potent urea inhibitors of Cryptosporidium parvum inosine 5′ monophosphate dehydrogenase

    PubMed Central

    Gorla, Suresh Kumar; Kavitha, Mandapati; Zhang, Minjia; Liu, Xiaoping; Sharling, Lisa; Gollapalli, Deviprasad R.; Striepen, Boris; Hedstrom, Lizbeth; Cuny, Gregory D.


    Cryptosporidium parvum and related species are zoonotic intracellular parasites of the intestine. Cryptosporidium is a leading cause of diarrhea in small children around the world. Infection can cause severe pathology in children and immunocompromised patients. This waterborne parasite is resistant to common methods of water treatment and therefore a prominent threat to drinking and recreation water even in countries with strong water safety systems. The drugs currently used to combat these organisms are ineffective. Genomic analysis revealed that the parasite relies solely on inosine-5′-monophosphate dehydrogenase (IMPDH) for the biosynthesis of guanine nucleotides. Herein, we report a selective urea-based inhibitor of C. parvum IMPDH (CpIMPDH) identified by high throughput screening. We performed a SAR study of these inhibitors with some analogues exhibiting high potency (IC50 < 2 nM) against CpIMPDH, excellent selectivity > 1000-fold versus human IMPDH type 2 and good stability in mouse liver microsomes. A subset of inhibitors also displayed potent antiparasitic activity in a Toxoplasma gondii model. PMID:22950983

  9. Novel interactions of fluorinated nucleotide derivatives targeting orotidine-5′-monophosphate decarboxylase

    PubMed Central

    Lewis, Melissa; Avina, Maria Elena Meza; Wei, Lianhu; Crandall, Ian E.; Bello, Angelica Mara; Poduch, Ewa; Liu, Yan; Paige, Christopher J.; Kain, Kevin C.; Pai, Emil F.; Kotra, Lakshmi P.


    Fluorinated nucleosides and nucleotides are of considerable interest to medicinal chemists due to their antiviral, anticancer, and other biological activities. However, their direct interactions at target binding sites are not well understood. A new class of 2′-deoxy-2′-fluoro-C6-substituted uridine and UMP derivatives were synthesized and evaluated as inhibitors of orotidine-5′-monophosphate decarboxylase (ODCase). These compounds were synthesized from the key intermediate, fully-protected 2′-deoxy-2′-fluorouridine. Among the synthesized compounds, 2′-deoxy-2′-fluoro-6-iodo-UMP covalently inhibited human ODCase with a second-order rate constant of 0.62 ± 0.02 M−1sec−1. Interestingly, the 6-cyano-2′-fluoro derivative covalently interacted with ODCase defying the conventional thinking, where its ribosyl derivative undergoes transformation into BMP by ODCase. This confirms that the 2′-fluoro moiety influences the chemistry at the C6 position of the nucleotides, thus interactions in the active site of ODCase. Molecular interactions of the 2′-fluorinated nucleotides are compared to those with the 3′-fluorinated nucleotides bound to the corresponding target enzyme, and the carbohydrate moieties were shown to bind in different conformations. PMID:21417464

  10. Attempts to detect cyclic adenosine 3':5'-monophosphate in higher plants by three assay methods.


    Bressan, R A; Ross, C W


    Endogenous levels of cyclic adenosine-3':5'-monophosphate in coleoptile first leaf segments of oat (Avena sativa L.), potato (Solanum tuberosum L.) tubers, tobacco (Nicotiana tabacum L.) callus, and germinating seeds of lettuce (Lactuca sativa L.) were measured with a modified Gilman binding assay and a protein kinase activation assay. The incorporation of adenosine-8-(14)C into compounds with properties similar to those of cyclic AMP was also measured in studies with germinating lettuce seeds. The binding assay proved reliable for mouse and rat liver analyses, but was nonspecific for plant tissues. It responded to various components from lettuce and potato tissues chromatographically similar to but not identical with cyclic AMP. The protein kinase activation assay was much more specific, but it also exhibited positive responses in the presence of compounds not chromatographically identical to cyclic AMP. The concentrations of cyclic AMP in the plant tissues tested were at the lower limits of detection and characterization obtainable with these assays. The estimates of maximal levels were much lower than reported in many previous studies. PMID:16659419

  11. A Facile and Sensitive Method for Quantification of Cyclic Nucleotide Monophosphates in Mammalian Organs: Basal Levels of Eight cNMPs and Identification of 2',3'-cIMP

    PubMed Central

    Jia, Xin; Fontaine, Benjamin M.; Strobel, Fred; Weinert, Emily E.


    A sensitive, versatile and economical method to extract and quantify cyclic nucleotide monophosphates (cNMPs) using LC-MS/MS, including both 3',5'-cNMPs and 2',3'-cNMPs, in mammalian tissues and cellular systems has been developed. Problems, such as matrix effects from complex biological samples, are addressed and have been optimized. This protocol allows for comparison of multiple cNMPs in the same system and was used to examine the relationship between tissue levels of cNMPs in a panel of rat organs. In addition, the study reports the first identification and quantification of 2',3'-cIMP. The developed method will allow for quantification of cNMPs levels in cells and tissues with varying disease states, which will provide insight into the role(s) and interplay of cNMP signalling pathways. PMID:25513747

  12. Crystallization and preliminary crystallographic analysis of orotidine 5′-monophosphate decarboxylase from the human malaria parasite Plasmodium falciparum

    SciTech Connect

    Krungkrai, Sudaratana R.; Tokuoka, Keiji; Kusakari, Yukiko; Inoue, Tsuyoshi; Adachi, Hiroaki; Matsumura, Hiroyoshi; Takano, Kazufumi; Murakami, Satoshi; Mori, Yusuke; Kai, Yasushi; Krungkrai, Jerapan; Horii, Toshihiro


    Orotidine 5′-monophosphate decarboxylase of human malaria parasite P. falciparum was crystallized by the seeding method in a hanging drop using PEG 3000 as a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation. Orotidine 5′-monophosphate (OMP) decarboxylase (OMPDC; EC catalyzes the final step in the de novo synthesis of uridine 5′-monophosphate (UMP) and defects in the enzyme are lethal in the malaria parasite Plasmodium falciparum. Active recombinant P. falciparum OMPDC (PfOMPDC) was crystallized by the seeding method in a hanging drop using PEG 3000 as a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation at the Swiss Light Source. The crystal exhibits trigonal symmetry (space group R3), with hexagonal unit-cell parameters a = b = 201.81, c = 44.03 Å. With a dimer in the asymmetric unit, the solvent content is 46% (V{sub M} = 2.3 Å{sup 3} Da{sup −1})

  13. A guanosine quadruplex and two stable hairpins flank a major cleavage site in insulin-like growth factor II mRNA.

    PubMed Central

    Christiansen, J; Kofod, M; Nielsen, F C


    Insulin-like growth factor II (IGF-II) mRNAs are cleaved by an endonucleolytic event in a conserved part of their 3' untranslated region that is predicted to exhibit a complex higher-order RNA structure. In the present study, we have examined the putative secondary structures of in vitro transcripts from the conserved part of human and rat mRNAs by enzymatic and chemical probing. The results show that the cleavage site is situated between two highly structured domains. The upstream domain consists of two large hairpins, whereas the downstream domain is guanosine-rich. The guanosine-rich domain adopts a compact unimolecular conformation in Na+ or K+ but not in Li+, and it completely arrests reverse transcription in K+ but only partially in Na+, indicating the presence of an intramolecular guanosine quadruplex. The flanking higher-order structures may ensure that the cleavage site is not sequestered in stable RNA structures, thus allowing interactions with RNA or proteins at posttranscriptional stages of IGF-II expression. Images PMID:7838726

  14. Avirulent Uracil Auxotrophs Based on Disruption of Orotidine-5′-Monophosphate Decarboxylase Elicit Protective Immunity to Toxoplasma gondii ▿ †

    PubMed Central

    Fox, Barbara A.; Bzik, David J.


    The orotidine-5′-monophosphate decarboxylase (OMPDC) gene, encoding the final enzyme of the de novo pyrimidine biosynthesis pathway, was deleted using Toxoplasma gondii KU80 knockouts to develop an avirulent nonreverting pyrimidine auxotroph strain. Additionally, to functionally address the role of the pyrimidine salvage pathway, the uridine phosphorylase (UP) salvage activity was knocked out and a double knockout of UP and OMPDC was also constructed. The nonreverting ΔOMPDC, ΔUP, and ΔOMPDC ΔUP knockout strains were evaluated for pyrimidine auxotrophy, for attenuation of virulence, and for their ability to elicit potent immunity to reinfection. The ΔUP knockout strain was replication competent and virulent. In contrast, the ΔOMPDC and ΔOMPDC ΔUP strains were uracil auxotrophs that rapidly lost their viability during pyrimidine starvation. Replication of the ΔOMPDC strain but not the ΔOMPDC ΔUP strain was also partially rescued in vitro with uridine or cytidine supplementation. Compared to their hypervirulent parental type I strain, the ΔOMPDC and ΔOMPDC ΔUP knockout strains exhibited extreme attenuation in murine virulence (∼8 logs). Genetic complementation of the ΔOMPDC strain using a functional OMPDC allele restored normal replication and type I parental strain virulence phenotypes. A single immunization of mice with either the live critically attenuated ΔOMPDC strain or the ΔOMPDC ΔUP knockout strain effectively induced potent protective immunity to lethal challenge infection. The avirulent nonreverting ΔOMPDC and ΔOMPDC ΔUP strains provide new tools for the dissection of the host response to infection and are promising candidates for safe and effective Th1 vaccine platforms that can be easily genetically engineered. PMID:20605980

  15. Autophagy as a Regulated Pathway of Cellular Degradation

    PubMed Central

    Klionsky, Daniel J.; Emr, Scott D.


    Macroautophagy is a dynamic process involving the rearrangement of subcellular membranes to sequester cytoplasm and organelles for delivery to the lysosome or vacuole where the sequestered cargo is degraded and recycled. This process takes place in all eukaryotic cells. It is highly regulated through the action of various kinases, phosphatases, and guanosine triphosphatases (GTPases). The core protein machinery that is necessary to drive formation and consumption of intermediates in the macroautophagy pathway includes a ubiquitin-like protein conjugation system and a protein complex that directs membrane docking and fusion at the lysosome or vacuole. Macroautophagy plays an important role in developmental processes, human disease, and cellular response to nutrient deprivation. PMID:11099404

  16. The effects of cyclic adenosine 3',5'-monophosphate and other adenine nucleotides on body temperature.

    PubMed Central

    Dascombe, M J; Milton, A S


    1. Adenosine 3',5'-monophosphate (cAMP), its dibutyryl derivative (Db-cAMP) and other adenine nucleotides have been micro-injected into the hypothalamic region of the unanaesthetized cat and the effects on body temperature, and on behavioural and autonomic thermoregulatory activities observed. 2. Db-cAMP and cAMP both produced hypothermia when applied to the pre-optic anterior hypothalamus. With Db-cAMP the hypothermia was shown to be dose dependent between 50 and 500 mug (0-096-0-96 mumole). 3. AMP, ADP and ATP also produced hypothermia when injected into the pre-optic anterior hypothalamus. 4. The order of relative potencies of the adenine nucleotides with respect both to the hypothermia produced and to the autonomic thermoregulatory effects observed were similar. Db-cAMP was most potent and cAMP least. 5. Micro-injection into the pre-optic anterior hypothalamus of many substances including saline produced in most cats a non-specific rise in body temperature apparently the result of tissue damage. Intraperitoneal injection of 4-acetamidophenol (paracetamol 50 mg/kg) reduced or abolished this febrile response. 6. The hypothermic effect of the adenine nucleotides has been compared with the effects produced in these same cats by micro-injections of noradrenaline, 5-hydroxytryptamine, a mixture of acetylcholine and physostigmine (1:1), EDTA and excess Ca2+ ions. 7. It is concluded that as Db-cAMP and cAMP both produce hypothermia, it is unlikely that endogenous cAMP in the pre-optic anterior hypothalamus mediates the hyperthermic responses to pyrogens and prostaglandins. PMID:170396

  17. The effects of cyclic adenosine 3',5'-monophosphate and other adenine nucleotides on body temperature.


    Dascombe, M J; Milton, A S


    1. Adenosine 3',5'-monophosphate (cAMP), its dibutyryl derivative (Db-cAMP) and other adenine nucleotides have been micro-injected into the hypothalamic region of the unanaesthetized cat and the effects on body temperature, and on behavioural and autonomic thermoregulatory activities observed. 2. Db-cAMP and cAMP both produced hypothermia when applied to the pre-optic anterior hypothalamus. With Db-cAMP the hypothermia was shown to be dose dependent between 50 and 500 mug (0-096-0-96 mumole). 3. AMP, ADP and ATP also produced hypothermia when injected into the pre-optic anterior hypothalamus. 4. The order of relative potencies of the adenine nucleotides with respect both to the hypothermia produced and to the autonomic thermoregulatory effects observed were similar. Db-cAMP was most potent and cAMP least. 5. Micro-injection into the pre-optic anterior hypothalamus of many substances including saline produced in most cats a non-specific rise in body temperature apparently the result of tissue damage. Intraperitoneal injection of 4-acetamidophenol (paracetamol 50 mg/kg) reduced or abolished this febrile response. 6. The hypothermic effect of the adenine nucleotides has been compared with the effects produced in these same cats by micro-injections of noradrenaline, 5-hydroxytryptamine, a mixture of acetylcholine and physostigmine (1:1), EDTA and excess Ca2+ ions. 7. It is concluded that as Db-cAMP and cAMP both produce hypothermia, it is unlikely that endogenous cAMP in the pre-optic anterior hypothalamus mediates the hyperthermic responses to pyrogens and prostaglandins. PMID:170396

  18. Turning an antiviral into an anticancer drug: Nanoparticle delivery of acyclovir monophosphate

    PubMed Central

    Yao, Jing; Zhang, Yuan; Ramishetti, Srinivas; Wang, Yuhua; Huang, Leaf


    Anti-herpes simplex virus (HSV) drug acyclovir (ACV) is phosphorylated by the viral thymidine kinase (TK), but not the cellular TK. Phosphorylated ACV inhibits cellular DNA synthesis and kills the infected cells. We hypothesize that ACV monophosphate (ACVP), which is an activated metabolite of ACV, should be efficient in killing cells independent of HSV-TK. If so, ACVP should be a cytotoxic agent if properly delivered to the cancer cells. The Lipid/Calcium/Phosphate (LCP) nanoparticles (NPs) with a membrane/core structure were used to encapsulate ACVP to facilitate the targeted delivery of ACVP to the tumor. The LCP NPs showed entrapment efficiency of ~69%, the nano-scaled particle size and positive zeta potential. Moreover, ACVP-loaded LCP NPs (A-LCP NPs) exhibited concentration-dependent cytotoxicity against H460 cells and increased S-phase arrest. More importantly, a significant reduction of the tumor volume over 4 days following administration (p<0.05~0.005) of A-LCP NPs, suggests excellent in vivo efficacy. Whereas, two free drugs (ACV and ACVP) and blank LCP NPs showed little or no therapeutic effect. It was also found that the high efficacy of A-LCP NPs was associated with the ability to induce dramatic apoptosis of the tumor cells, as well as significantly inhibit tumor cell proliferation and cell cycle progression. In conclusion, with the help of LCP NPs, monophosphorylation modification of ACV can successfully modify an HSV-TK-dependent antiviral drug into an anti-tumor drug. PMID:23791977

  19. Cyclic Adenosine Monophosphate Accumulation and beta-Adrenergic Binding in Unweighted and Denervated Rat Soleus Muscle

    NASA Technical Reports Server (NTRS)

    Kirby, Christopher R.; Woodman, Christopher R.; Woolridge, Dale; Tischler, Marc E.


    Unweighting, but not denervation, of muscle reportedly "spares" insulin receptors, increasing insulin sensitivity. Unweighting also increases beta-adrenergic responses of carbohydrate metabolism. These differential characteristics were studied further by comparing cyclic adenosine monophosphate (cAMP) accumulation and beta-adrenergic binding in normal and 3-day unweighted or denervated soleus muscle. Submaximal amounts of isoproterenol, a p-agonist, increased cAMP accumulation in vitro and in vivo (by intramuscular (IM) injection) to a greater degree (P less than .05) in unweighted muscles. Forskolin or maximal isoproterenol had similar in vitro effects in all muscles, suggesting increased beta-adrenergic sensitivity following unweighting. Increased sensitivity was confirmed by a greater receptor density (B(sub max)) for iodo-125(-)-pindolol in particulate preparations of unweighted (420 x 10(exp -18) mol/mg muscle) than of control or denervated muscles (285 x 10(exp-18) mol/mg muscle). The three dissociation constant (Kd) values were similar (20.3 to 25.8 pmol/L). Total binding capacity (11.4 fmol/muscle) did not change during 3 days of unweighting, but diminished by 30% with denervation. This result illustrates the "sparing" and loss of receptors, respectively, in these two atrophy models. In diabetic animals, IM injection of insulin diminished CAMP accumulation in the presence of theophylline in unweighted muscle (-66% +/- 2%) more than in controls (-42% +'- 6%, P less than .001). These results show that insulin affects CAMP formation in muscle, and support a greater in vivo insulin response following unweighting atrophy. These various data support a role for lysosomal proteolysis in denervation, but not in unweighting, atrophy.

  20. Adenosine 3', 5'-cyclic monophosphate levels in Thermomonospora curvata during cellulase biosynthesis

    SciTech Connect

    Fennington, G.; Neubauer, D.; Stutzenberger, F.


    The enzymatic degradation of cellulose requires the synergistic activity of at least three enzymes: exo-beta-1,4-glucanase (EC3.2.1.91), endo-beta-1,4-glucanase (EC3.2.1.4), and beta-glucosidase (EC3.2.1.21). Despite extensive studies on a variety of cellulolytic bacteria and fungi, the mechanism(s) regulating the biosynthesis of this inducible catabolic enzyme complex remains unknown. The intracellular concentrations of cyclic nucleotides such as adenosine 3',5'-cyclic monophosphate (cAMP) have been shown to play a major role in mediating catabolite repression of enzyme biosynthesis. The cAMP acts through a cAMP receptor protein (termed CRP or CAP) which is a dimer having two identical subunits each capable of binding one molecule of cAMP. The N-terminal domain of the CRP binds the cAMP while the C-terminal domain binds to DNA at the promotor region of a cAMP-dependent operon and stimulates transcription by promoting the formation of a preinitiation complex between RNA polymerase and the DNA. Intracellular cAMP levels in E. coli (the prototype organism for such studies) are influenced by the type and availability of carbon source used for growth. High intracellular cAMP levels should lead to higher concentrations of cAMP-CRP complexes which should increase the transcription rates for cAMP-dependent operons (such as the lac operon of beta-galactosidase) and indeed the differential rate of beta-galactosidase biosynthesis correlates to intracellular cAMP levels. In the case of cellulase, catabolite repression by glucose or other readily metabolizable compounds closely controls production in an apparently similar manner and therefore a correlation may exist between enzyme biosynthesis and intracellular cAMP levels. This communication describes the fluctuation in cAMP levels during cellulase induction and repression in the thermophilic actinomycete, Thermomonospora curvata.

  1. Adsorption of nucleotides on biomimetic apatite: The case of cytidine 5' monophosphate (CMP).


    Choimet, Maëla; Tourrette, Audrey; Drouet, Christophe


    The chemical interaction between DNA macromolecules and hard tissues in vertebrate is of foremost importance in paleogenetics, as bones and teeth represent a major substrate for the genetic material after cell death. Recently, the empirical hypothesis of DNA "protection" over time thanks to its adsorption on hard tissues was revisited from a physico-chemical viewpoint. In particular, the existence of a strong interaction between phosphate groups of DNA backbone and the surface of apatite nanocrystals (mimicking bone/dentin mineral) was evidenced on an experimental basis. In the field of nanomedicine, DNA or RNA can be used for gene transport into cells, and apatite nanocarriers then appear promising. In order to shed some more light on interactions between DNA molecules and apatite, the present study focuses on the adsorption of a "model" nucleotide, cytidine 5' monophosphate (CMP), on a carbonated biomimetic apatite sample. The follow-up of CMP kinetics of adsorption pointed out the rapidity of interaction with stabilization reached within few minutes. The adsorption isotherm could be realistically fitted to the Sips model (Langmuir-Freundlich) suggesting the influence of surface heterogeneities and adsorption cooperativity in the adsorption process. The desorption study pointed out the reversible character of CMP adsorption on biomimetic apatite. This contribution is intended to prove helpful in view of better apprehending the molecular interaction of DNA fragments and apatite compounds, independently of the application domain, such as bone diagenesis or nanomedicine. This study may also appear informative for researchers interested in the origins of life on Earth and the occurrence and behavior of primitive biomolecules. PMID:26117294

  2. Repetitive mechanical strain suppresses macrophage uptake of immunoglobulin G complexes and enhances cyclic adenosine monophosphate synthesis.

    PubMed Central

    Mattana, J.; Sankaran, R. T.; Singhal, P. C.


    Uptake of immunoglobulin G (IgG) complexes by macrophages (M phi) may play an important role in disease states characterized by increased levels of circulating immune complexes. In sites such as the glomerular mesangium M phi may be subjected to repetitive mechanical strain, although in vitro studies of M phi endocytosis are typically carried out with cells grown on rigid surfaces. We undertook the present study to determine whether repetitive mechanical strain could modulate M phi endocytosis of IgG complexes. IgG complex uptake was significantly diminished in M phi that were subjected to repetitive mechanical strain using parameters corresponding to peak and minimal intraglomerular pressures compared with control, and uptake varied according to the amount of mechanical strain applied. There was no significant difference in surface binding of IgG between M phi subjected to strain and those not. Mechanical strain did not significantly influence the rate of IgG complex degradation. Inhibition of nitric oxide synthase and guanylate cyclase activity did not alter the effect of mechanical strain, although this effect was potentiated by 3-isobutyl-1-methylxanthine (IBMX). Angiotensin II, which has been shown to reduce adenosine 3',5'-cyclic monophosphate (cAMP) production in M phi, significantly attenuated the suppressive effect of mechanical strain on IgG complex uptake as well as another inhibitor of cAMP generation, indomethacin. Enzyme immunoassay demonstrated significantly enhanced levels of cAMP in M phi that were subjected to mechanical strain compared with control, an effect that was potentiated by IBMX and attenuated by angiotensin II and indomethacin. These results demonstrate that repetitive mechanical strain significantly reduces IgG complex uptake by M phi, most likely by enhancing cAMP synthesis. Such an effect might play a significant role in macromolecule handling by M phi in sites in which they are subjected to repetitive mechanical deformation such as

  3. Novel adenosine 3 prime ,5 prime -cyclic monophosphate dependent protein kinases in a marine diatom

    SciTech Connect

    Lin, P.P.C.; Volcani, B.E. )


    Two novel adenosine 3{prime},5{prime}-cyclic monophosphate (cAMP) dependent protein kinases have been isolated from the diatom Cylindrotheca fusiformis. The kinases, designated I and II, are eluted from DEAE-Sephacel at 0.10 and 0.15 M NaCl. They have a high affinity for cAMP and are activated by micromolar cAMP. They exhibit maximal activity at 5 mM Mg{sup 2+} and pH 8 with the preferred phosphate donor ATP and phosphate acceptor histone H1. They phosphorylate sea urchin sperm histone H1 on a single serine site in the sequence Arg-Lys-Gly-Ser({sup 32}P)-Ser-Asn-Ala-Arg and have an apparent M{sub r} of 75,000 as determined by gel filtration and sucrose density sedimentation. In the kinase I preparation a single protein band with an apparent M{sub r} of about 78,000 is photolabeled with 8-azido({sup 32}P)cAMP and is also phosphorylated with ({gamma}-{sup 32}P)ATP in a cAMP-dependent manner, after autoradiography following sodium dodecyl sulfate gel electrophoresis. The rate of phosphorylation of the 78,000-dalton band is independent of the enzyme concentration. The results indicate that (i) these diatom cAMP-dependent protein kinases are monomeric proteins, possessing both the cAMP-binding regulatory and catalytic domains on the same polypeptide chain, (ii) the enzymes do not dissociate into smaller species upon activation by binding cAMP, and (iii) self-phosphorylation of the enzymes by an intrapeptide reaction is cAMP dependent. The two diatom cAMP kinases are refractory to the heat-stable protein kinase modulator from rabbit muscle, but they respond differently to proteolytic degradation and to inhibition by arachidonic acid and several microbial alkaloids.

  4. Surface complexation modeling of uranium(VI) sorbed onto lanthanum monophosphate.


    Ordoñez-Regil, E; Drot, R; Simoni, E


    Sorption/desorption are basic processes in the field of contaminant transport. In order to develop mechanistically accurate thermodynamic sorption models, the simulation of retention data has to take into account molecular scale informations provided by structural investigations. In this way, the uranyl sorption constants onto lanthanum monophosphate (LaPO(4)) were determined on the basis of a previously published structural investigation. The surface complexation modeling of U(VI) retention onto LaPO(4) has been performed using the constant capacitance model included in the FITEQLv3.2 program. The electrical behavior of the solid surface was investigated using electrophoretic measurements and potentiometric titration experiments. The point of zero charge was found to be 3.5 and surface complexation modeling has made it possible to calculate the surface acidity constants. The fitting procedure was done with respect to the spectroscopic results, which have shown that LaPO(4) presents two kinds of reactive surface sites (lanthanum atoms and phosphate groups). The uranyl sorption edges were determined for two surface coverages: 40 and 20% of the surface sites that are occupied, assuming complete sorption. The modeling of these experimental data was realized by considering two uranyl species ("free" uranyl and uranyl nitrate complex) sorbed only onto phosphate surface groups according to the previously published structural investigation. The obtained sorption constants present similar values for both surface complexes and make it possible to fit both sorption edges: logK(U)=9.4 for z.tbnd;P(OH)(2)+UO(2)(2+)<-->z.tbnd;P(OH)(2)UO(2)(2+) and logK(UN)=9.7 for z.tbnd;P(OH)(2)+UO(2)NO(3)(+)<-->z.tbnd;P(OH)(2)UO(2)NO(3)(+). PMID:12909028

  5. Triazole-containing monophosphate mRNA cap analogs as effective translation inhibitors

    PubMed Central

    Piecyk, Karolina; Lukaszewicz, Maciej; Darzynkiewicz, Edward


    Synthetic analogs of the 5′ end of mRNA (cap structure) are widely used in molecular studies on mechanisms of cellular processes such as translation, intracellular transport, splicing, and turnover. The best-characterized cap binding protein is translation initiation factor 4E (eIF4E). Recognition of the mRNA cap by eIF4E is a critical, rate-limiting step for efficient translation initiation and is considered a major target for anticancer therapy. Here, we report a facile methodology for the preparation of N2-triazole-containing monophosphate cap analogs and present their biological evaluation as inhibitors of protein synthesis. Five analogs possessing this unique hetero-cyclic ring spaced from the m7-guanine of the cap structure at a distance of one or three carbon atoms and/or additionally substituted by various groups containing the benzene ring were synthesized. All obtained compounds turned out to be effective translation inhibitors with IC50 similar to dinucleotide triphosphate m7GpppG. As these compounds possess a reduced number of phosphate groups and, thereby, a negative charge, which may support their cell penetration, this type of cap analog might be promising in terms of designing new potential therapeutic molecules. In addition, an exemplary dinucleotide from a corresponding mononucleotide containing benzyl substituted 1,2,3-triazole was prepared and examined. The superior inhibitory properties of this analog (10-fold vs. m7GpppG) suggest the usefulness of such compounds for the preparation of mRNA transcripts with high translational activity. PMID:25150228

  6. Inosine monophosphate dehydrogenase variability in renal transplant patients on long-term mycophenolate mofetil therapy

    PubMed Central

    Chiarelli, Laurent R; Molinaro, Mariadelfina; Libetta, Carmelo; Tinelli, Carmine; Cosmai, Laura; Valentini, Giovanna; Canton, Antonio Dal; Regazzi, Mario


    AIMS Long-term mycophenolate mofetil (MMF) therapy may induce inosine 5′-monophosphate dehydrogenase (IMPDH) activity in peripheral blood mononuclear cells (PBMCs), thus decreasing MMF immunosuppressive properties. Pharmacodynamic monitoring was used to investigate whether biological activity is altered after long-term therapy. METHODS IMPDH activity was measured in PBMC samples from 54 stable kidney transplant patients, already on MMF (for at least 3 months), before (t0) and 2 h after (t2) MMF morning dose administration; levels were monitored for up to 15 months, together with total mycophenolic acid (MPA) and free MPA concentrations. RESULTS During the 15 months' monitoring, t0 IMPDH activity in transplant recipients increased from 5.9 ± 3.7 nmol h−1 mg−1[95% confidence interval (CI) 4.9, 6.9] to 9.0 ± 3.9 nmol h−1 mg−1 (95% CI 7.2, 10.8), with an intra- and interpatient variability of 28% and 42%. Five patients experienced acute rejection during the follow-up: t0 IMPDH activity was increased during rejection vs. nonrejection, and the trend was significantly higher in rejecting than in nonrejecting subjects for the whole monitoring period. CONCLUSIONS Even though a correlation has been found between IMPDH activity and rejection, its efficacy as a predictive tool in long-term transplant outcomes may be affected by high interpatient variability; on the other hand, continuous monitoring of the IMPDH trend could make an effective prognostic parameter of rejection. Other trials also including pre-transplant data on both IMPDH expression and activity are warranted to better assess their role as biomarkers for MPA effect in clinical practice. PMID:20078611

  7. Semaphorin 3A activates the guanosine triphosphatase Rab5 to promote growth cone collapse and organize callosal axon projections.


    Wu, Kong-Yan; He, Miao; Hou, Qiong-Qiong; Sheng, Ai-Li; Yuan, Lei; Liu, Fei; Liu, Wen-Wen; Li, Guangpu; Jiang, Xing-Yu; Luo, Zhen-Ge


    Axon guidance (pathfinding) wires the brain during development and is regulated by various attractive and repulsive cues. Semaphorin 3A (Sema3A) is a repulsive cue, inducing the collapse of axon growth cones. In the mammalian forebrain, the corpus callosum is the major commissure that transmits information flow between the two hemispheres, and contralateral axons assemble into well-defined tracts. We found that the patterning of callosal axon projections in rodent layer II and III (L2/3) cortical neurons in response to Sema3A was mediated by the activation of Rab5, a small guanosine triphosphatase (GTPase) that mediates endocytosis, through the membrane fusion protein Rabaptin-5 and the Rab5 guanine nucleotide exchange factor (GEF) Rabex-5. Rabaptin-5 bound directly to Plexin-A1 in the Sema3A receptor complex [an obligate heterodimer formed by Plexin-A1 and neuropilin 1 (NP1)]; Sema3A enhanced this interaction in cultured neurons. Rabaptin-5 bridged the interaction between Rab5 and Plexin-A1. Sema3A stimulated endocytosis from the cell surface of callosal axon growth cones. In utero electroporation to reduce Rab5 or Rabaptin-5 impaired axon fasciculation or caused mistargeting of L2/3 callosal projections in rats. Overexpression of Rabaptin-5 or Rab5 rescued the defective callosal axon fasciculation or mistargeting of callosal axons caused by the loss of Sema3A-Plexin-A1 signaling in rats expressing dominant-negative Plexin-A1 or in NP1-deficient mice. Thus, our findings suggest that Rab5, its effector Rabaptin-5, and its regulator Rabex-5 mediate Sema3A-induced axon guidance during brain development. PMID:25161316

  8. Semaphorin 3A activates the guanosine triphosphatase Rab5 to promote growth cone collapse and organize callosal axon projections

    PubMed Central

    Wu, Kong-Yan; He, Miao; Hou, Qiong-Qiong; Sheng, Ai-Li; Yuan, Lei; Liu, Fei; Liu, Wen-Wen; Li, Guangpu; Jiang, Xing-Yu; Luo, Zhen-Ge


    Axon guidance (pathfinding) wires the brain during development and is regulated by various attractive and repulsive cues. Semaphorin 3A (Sema3A) is a repulsive cue, inducing the collapse of axon growth cones. In the mammalian forebrain, the corpus callosum is the major commissure that transmits information flow between the two hemispheres, and contralateral axons assemble into well-defined tracts. We found that the patterning of callosal axon projections in rodent layer II and III (L2/3) cortical neurons in response to Sema3A was mediated by the activation of Rab5, a small guanosine triphosphatase (GTPase) that mediates endocytosis, through the membrane fusion protein Rabaptin-5 and the Rab5 guanine nucleotide exchange factor (GEF) Rabex-5. Rabaptin-5 bound directly to Plexin-A1 in the Sema3A receptor complex [an obligate heterodimer formed by Plexin-A1 and neuropilin 1 (NP1)]; Sema3A enhanced this interaction in cultured neurons. Rabaptin-5 bridged the interaction between Rab5 and Plexin-A1. Sema3A stimulated endocytosis from the cell surface of callosal axon growth cones. In utero electroporation to reduce Rab5 or Rabaptin-5 impaired axon fasciculation or caused mistargeting of L2/3 callosal projections in rats. Over-expression of Rabaptin-5 or Rab5 rescued the defective callosal axon fasciculation or mistargeting of callosal axons caused by the loss of Sema3A–Plexin-A1 signaling in rats expressing dominant-negative Plexin-A1 or in NP1-deficient mice. Thus, our findings suggest that Rab5, its effector Rabaptin-5, and its regulator Rabex-5 mediate Sema3A-induced axon guidance during brain development. PMID:25161316

  9. Dynamics and couplings of N-H stretching excitations of guanosine-cytidine base pairs in solution.


    Yang, Ming; Szyc, Łukasz; Röttger, Katharina; Fidder, Henk; Nibbering, Erik T J; Elsaesser, Thomas; Temps, Friedrich


    N-H stretching vibrations of hydrogen-bonded guanosine-cytidine (G·C) base pairs in chloroform solution are studied with linear and ultrafast nonlinear infrared (IR) spectroscopy. Assignment of the IR-active bands in the linear spectrum is made possible by combining structural information on the hydrogen bonds in G·C base pairs with literature results of density functional theory calculations, and empirical relations connecting frequency shifts and intensity of the IR-active vibrations. A local mode representation of N-H stretching vibrations is adopted, consisting of ν(G)(NH(2))(f) and ν(C)(NH(2))(f) modes for free NH groups of G and C, and of ν(G)(NH(2))(b), ν(G)(NH), and ν(C)(NH(2))(b) modes associated with N-H stretching motions of hydrogen-bonded NH groups. The couplings and relaxation dynamics of the N-H stretching excitations are studied with femtosecond mid-infrared two-dimensional (2D) and pump-probe spectroscopy. The N-H stretching vibrations of the free NH groups of G and C have an average population lifetime of 2.4 ps. Besides a vibrational population lifetime shortening to subpicosecond values observed for the hydrogen-bonded N-H stretching vibrations, the 2D spectra reveal vibrational excitation transfer from the ν(G)(NH(2))(b) mode to the ν(G)(NH) and/or ν(C)(NH(2))(b) modes. The underlying intermode vibrational couplings are on the order of 10 cm(-1). PMID:21244064

  10. Absence epileptic activity changing effects of non-adenosine nucleoside inosine, guanosine and uridine in Wistar Albino Glaxo Rijswijk rats.


    Kovács, Z; Kékesi, K A; Dobolyi, Á; Lakatos, R; Juhász, G


    Adenosine (Ado) and non-adenosine (non-Ado) nucleosides such as inosine (Ino), guanosine (Guo) and uridine (Urd) may have regionally different roles in the regulation of physiological and pathophysiological processes in the central nervous system (CNS) such as epilepsy. It was demonstrated previously that Ino and Guo decreased quinolinic acid (QA)-induced seizures and Urd reduced penicillin-, bicuculline- and pentylenetetrazole (PTZ)-induced seizures. It has also been demonstrated that Ino and Urd may exert their effects through GABAergic system by altering the function of GABA(A) type of gamma-aminobutyric acid receptors (GABAA receptors) whereas Guo decreases glutamate-induced excitability through glutamatergic system, which systems (GABAergic and glutamatergic) are involved in pathomechanisms of absence epilepsy. Thus, we hypothesized that Ino and Guo, similarly to the previously described effect of Urd, might also decrease absence epileptic activity. We investigated in the present study whether intraperitoneal (i.p.) application of Ino (500 and 1000mg/kg), Guo (20 and 50mg/kg), Urd (500 and 1000mg/kg), GABA(A) receptor agonist muscimol (1 and 3mg/kg), GABA(A) receptor antagonist bicuculline (2 and 4mg/kg), non-selective Ado receptor antagonist theophylline (5 and 10mg/kg) and non-competitive N-methyl-d-aspartate (NMDA) receptor antagonist (+)-5-methyl-10,11-dihydro-5H-dibenzo (a,d) cyclohepten-5,10-imine maleate (MK-801, 0.0625 and 0.1250mg/kg) alone and in combination have modulatory effects on absence epileptic activity in Wistar Albino Glaxo Rijswijk (WAG/Rij) rats. We found that Guo decreased the number of spike-wave discharges (SWDs) whereas Ino increased it dose-dependently. We strengthened that Urd can decrease absence epileptic activity. Our results suggest that Guo, Urd and their analogs could be potentially effective drugs for treatment of human absence epilepsy. PMID:26037802

  11. Mast cell degranulation is negatively regulated by the Munc13-4-binding small-guanosine triphosphatase Rab37

    PubMed Central

    Higashio, Hironori; Satoh, Yoh-ichi; Saino, Tomoyuki


    Mast cell degranulation is regulated by the small guanosine triphosphatases (GTPases) Rab27a and Rab27b, which have distinct and opposing roles: Rab27b acts as a positive regulator through its effector protein Munc13-4, a non-neuronal isoform of the vesicle-priming Munc13 family of proteins, whereas Rab27a acts as a negative regulator through its effector protein melanophilin, by maintaining integrity of cortical filamentous actin (F-actin), a barrier to degranulation. Here we investigated the role of Rab37, one of the Rab GTPases assumed to be implicated in regulated secretion during mast cell degranulation. Using the RBL-2H3 mast cell line, we detected Rab37 on the secretory granules and found that antigen-induced degranulation was extensively increased by either knockdown of Rab37 or overexpression of a dominant-active Rab37 mutant. This hypersecretion phenotype in the Rab37-knockdown cells was suppressed by simultaneous knockdown of Rab27a and Rab27b or of Munc13-4, but not by disruption of cortical F-actin. We further found that Rab37 interacted with Munc13-4 in a GTP-independent manner and formed a Rab27-Munc13-4-Rab37 complex. These results suggest that Rab37 is a Munc13-4-binding protein that inhibits mast cell degranulation through its effector protein, by counteracting the vesicle-priming activity of the Rab27-Munc13-4 system. PMID:26931073

  12. Guanosine 3′,5′-bispyrophosphate coordinates global gene expression during glucose-lactose diauxie in Escherichia coli

    PubMed Central

    Traxler, Matthew F.; Chang, Dong-Eun; Conway, Tyrrell


    Guanosine 3′,5′-bispyrophosphate (ppGpp), also known as “magic spot,” has been shown to bind prokaryotic RNA polymerase to down-regulate ribosome production and increase transcription of amino acid biosynthesis genes during the stringent response to amino acid starvation. Because many environmental growth perturbations cause ppGpp to accumulate, we hypothesize ppGpp to have an overarching role in regulating the genetic program that coordinates transitions between logarithmic growth (feast) and growth arrest (famine). We used the classic glucose-lactose diauxie as an experimental system to investigate the temporal changes in transcription that accompany growth arrest and recovery in wild-type Escherichia coli and in mutants that lack RelA (ppGpp synthetase) and other global regulators, i.e., RpoS and Crp. In particular, diauxie was delayed in the relA mutant and was accompanied by a 15% decrease in the number of carbon sources used and a 3-fold overall decrease in the induction of RpoS and Crp regulon genes. Thus the data significantly expand the previously known role of ppGpp and support a model wherein the ppGpp-dependent redistribution of RNA polymerase across the genome is the driving force behind control of the stringent response, general stress response, and starvation-induced carbon scavenging. Our conceptual model of diauxie describes these global control circuits as dynamic, interconnected, and dependent upon ppGpp for the efficient temporal coordination of gene expression that programs the cell for transitions between feast and famine. PMID:16467149

  13. Contribution of NMDA, GABAA and GABAB receptors and l-arginine-NO-cGMP, MEK1/2 and CaMK-II pathways in the antidepressant-like effect of 7-fluoro-1,3-diphenylisoquinoline-1-amine in mice.


    Pesarico, Ana Paula; Stangherlin, Eluza Curte; Rosa, Suzan Gonçalves; Mantovani, Anderson C; Zeni, Gilson; Nogueira, Cristina Wayne


    It has been reported that the antidepressant-like effect of 7-fluoro-1,3-diphenylisoquinoline-1-amine (FDPI) may result from the modulation of brain monoaminergic systems. However, the mechanisms of FDPI action are not fully understood. The aim of this study was to investigate the contribution of N-methyl-d-aspartate (NMDA) and gamma-aminobutyric acid (GABA) systems as well as l-arginine-nitric oxide-(NO)-cyclic guanosine monophosphate-(cGMP), mitogen-activated protein/extracellular signal-regulated kinase (MEK1/2) and Ca(2+)/calmodulin-dependent protein kinase II (CaMK-II) signaling pathways in the antidepressant-like effect of FDPI in the mouse forced swimming test (FST). The levels of NO and uptake of [(3)H]glutamate and [(3)H]GABA were determined in prefrontal cortices of Swiss mice. Pretreatments with NMDA (0.1 pmol/site, i.c.v., a NMDA receptor agonist), bicuculline (1mg/kg, i.p., a GABAA receptor antagonist), phaclofen (2mg/kg, i.p., a GABAB receptor antagonist) and l-arginine (750mg/kg, i.p., a NO precursor), KN-62 (1μg/site, a CaMK-II inhibitor), U0126 (5μg/site, a MEK1/2 inhibitor) and PD09058 (5μg/site, a MEK1/2 inhibitor) blocked the antidepressant-like effect of FDPI, at a dose of 1mg/kg, in the FST. ODQ (30 pmol/site, i.c.v., a soluble guanylate cyclase (sGC) inhibitor) in combination with a sub-effective dose of FDPI (0.1mg/kg, i.g.) reduced the immobility time in the FST. The administration of FDPI (50mg/kg) to mice increased the glutamate uptake and reduced NO levels in the prefrontal cortex of mice. The results suggest a contribution of NMDA, GABAA and GABAB receptors and l-arginine-NO-cGMP pathway in the antidepressant-like action of FDPI in mice, and this effect is related to CaMK-II and MEK 1/2 activation. PMID:27112660

  14. Purine salvage pathways of Bacillus subtilis and effect of guanine on growth of GMP reductase mutants.


    Endo, T; Uratani, B; Freese, E


    We have isolated numerous mutants containing mutations in the salvage pathways of purine synthesis. The mutations cause deficiencies in adenine phosphoribosyltransferase (adeF), in hypoxanthine-guanine phosphoribosyltransferase (guaF), in adenine deaminase (adeC), in inosine-guanosine phosphorylase, (guaP), and in GMP reductase (guaC). The physiological properties of mutants containing one or more of these mutations and corresponding enzyme measurements have been used to derive a metabolic chart of the purine salvage pathway of Bacillus subtilis. PMID:6408059

  15. Purine salvage pathways of Bacillus subtilis and effect of guanine on growth of GMP reductase mutants.

    PubMed Central

    Endo, T; Uratani, B; Freese, E


    We have isolated numerous mutants containing mutations in the salvage pathways of purine synthesis. The mutations cause deficiencies in adenine phosphoribosyltransferase (adeF), in hypoxanthine-guanine phosphoribosyltransferase (guaF), in adenine deaminase (adeC), in inosine-guanosine phosphorylase, (guaP), and in GMP reductase (guaC). The physiological properties of mutants containing one or more of these mutations and corresponding enzyme measurements have been used to derive a metabolic chart of the purine salvage pathway of Bacillus subtilis. PMID:6408059

  16. Metformin inhibits growth of human non-small cell lung cancer cells via liver kinase B-1-independent activation of adenosine monophosphate-activated protein kinase

    PubMed Central



    Metformin, the most widely administered oral anti-diabetic therapeutic agent, exerts its glucose-lowering effect predominantly via liver kinase B1 (LKB1)-dependent activation of adenosine monophosphate-activated protein kinase (AMPK). Accumulating evidence has demonstrated that metformin possesses potential antitumor effects. However, whether the antitumor effect of metformin is via the LKB1/AMPK signaling pathway remains to be determined. In the current study, the effects of metformin on proliferation, cell cycle progression, and apoptosis of human non-small cell lung cancer (NSCLC) H460 (LKB1-null) and H1299 (LKB1-positive) cells were assessed, and the role of LKB1/AMPK signaling in the anti-growth effects of metformin were investigated. Cell viability was determined using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, cell cycle distribution and apoptosis were assessed by flow cytometry, and protein expression levels were measured by western blotting. Metformin inhibited proliferation, induced significant cell cycle arrest at the G0–G1 phase and increased apoptosis in NSCLC cells in a time- and concentration-dependent manner, regardless of the level of LKB1 protein expression. Furthermore, knockdown of LKB1 with short hairpin RNA (shRNA) did not affect the antiproliferative effect of metformin in the H1299 cells. Metformin stimulated AMPK phosphorylation and subsequently suppressed the phosphorylation of mammalian target of rapamycin and its downstream effector, 70-kDa ribosomal protein S6 kinase in the two cell lines. These effects were abrogated by silencing AMPK with small interfering RNA (siRNA). In addition, knockdown of AMPK with siRNA inhibited the effect of metformin on cell proliferation in the two cell lines. These results provide evidence that the growth inhibition of metformin in NSCLC cells is mediated by LKB1-independent activation of AMPK, indicating that metformin may be a potential therapeutic agent for the treatment of

  17. Arabidopsis phosphatidylinositol monophosphate 5-kinase 2 is involved in root gravitropism through regulation of polar auxin transport by affecting the cycling of PIN proteins.


    Mei, Yu; Jia, Wen-Jing; Chu, Yu-Jia; Xue, Hong-Wei


    Phosphatidylinositol monophosphate 5-kinase (PIP5K) catalyzes the synthesis of PI-4,5-bisphosphate (PtdIns(4,5)P(2)) by phosphorylation of PI-4-phosphate at the 5 position of the inositol ring, and is involved in regulating multiple developmental processes and stress responses. We here report on the functional characterization of Arabidopsis PIP5K2, which is expressed during lateral root initiation and elongation, and whose expression is enhanced by exogenous auxin. The knockout mutant pip5k2 shows reduced lateral root formation, which could be recovered with exogenous auxin, and interestingly, delayed root gravity response that could not be recovered with exogenous auxin. Crossing with the DR5-GUS marker line and measurement of free IAA content confirmed the reduced auxin accumulation in pip5k2. In addition, analysis using the membrane-selective dye FM4-64 revealed the decelerated vesicle trafficking caused by PtdIns(4,5)P(2) reduction, which hence results in suppressed cycling of PIN proteins (PIN2 and 3), and delayed redistribution of PIN2 and auxin under gravistimulation in pip5k2 roots. On the contrary, PtdIns(4,5)P(2) significantly enhanced the vesicle trafficking and cycling of PIN proteins. These results demonstrate that PIP5K2 is involved in regulating lateral root formation and root gravity response, and reveal a critical role of PIP5K2/PtdIns(4,5)P(2) in root development through regulation of PIN proteins, providing direct evidence of crosstalk between the phosphatidylinositol signaling pathway and auxin response, and new insights into the control of polar auxin transport. PMID:21894193

  18. Cyclic adenosine 3', 5'-monophosphate in cerebrospinal fluid during thermoregulation and fever.

    PubMed Central

    Dascombe, M J; Milton, A S


    1. Samples of cerebrospinal fluid (c.s.f.) have been taken from the cisterna magna of unanaesthetized cats, whilst rectal temperature was recorded, during exposure of the animals to various ambient temperatures and during fever induced by pyrogen. The concentration of adenosine 3', 5'-monophosphate (cyclic AMP) in samples of c.s.f. has been assayed. 2. Cats exposed to low ambient temperatures (-2 to +2 degrees C) for 3 h maintained body temperature by both behavioural and autonomic heat gain activity. Exposure of cats to high ambient temperatures (44 - 45 degrees C) for 3.5 h caused a rise in body temperatures of about 2.5 degrees C, despite behavioural and autonomic heat loss activity. Neither cold nor heat stress had a significant effect on c.s.f. cyclic AMP. 3. Fever induced by intravenous Shigella dysenteriae (2 and 20 mug/kg) was associated with a dose-related increase in the concentration of cyclic AMP in c.s.f. Paracetamol (75 mg/kg) injected I.P. before the onset of fever, suppressed the increase in both temperature and c.s.f. cyclic AMP in response to pyrogen. Paracetamol (50 and 100 mg/kg), injected after the onset of fever, caused a fall in temperature, which was not associated with a decrease in the concentration of cyclic AMP in c.s.f. 4. Fever induced in cats by intravenous Shigella dysenteriae (20 mug/kg) was associated with an increase in the concentration of cyclic AMP in plasma as well as in c.s.f. 5. The sodium salt of cyclic AMP (0.1-10 mg/kg) injected I.V. into unanaesthetized cats caused a dose-related hypothermia, which was associated with autonomic heat loss activity and a dose-related increase in the concentration of cyclic AMP in cisternal c.s.f., which was not mimicked by adenosine. 6. It is concluded that the raised concentrations of cyclic AMP in c.s.f., in response to pyrogen I.V., do not mediate fever in the cat and that the concentration of cyclic AMP in cisternal c.s.f. may be affected by changes in the plasma concentration of the

  19. Mechanism of the Orotidine 5′-Monophosphate Decarboxylase-Catalyzed Reaction: Evidence for Substrate Destabilization

    SciTech Connect

    Chan, K.; Wood, M; Fedorov, A; Fedorov, E; Imker, H; Amyes, T; Richard, J; Almo, S; Gerlt, J


    The reaction catalyzed by orotidine 5'-monophosphate decarboxylase (OMPDC) involves a stabilized anionic intermediate, although the structural basis for the rate acceleration (kcat/knon, 7.1 x 1016) and proficiency (kcat/KM)/knon, 4.8 x 1022 M-1 is uncertain. That the OMPDCs from Methanothermobacter thermautotrophicus (MtOMPDC) and Saccharomyces cerevisiae (ScOMPDC) catalyze the exchange of H6 of the UMP product with solvent deuterium allows an estimate of a lower limit on the rate acceleration associated with stabilization of the intermediate and its flanking transition states (=1010). The origin of the 'missing' contribution, =107 (1017 total - =1010), is of interest. Based on structures of liganded complexes, unfavorable electrostatic interactions between the substrate carboxylate group and a proximal Asp (Asp 70 in MtOMPDC and Asp 91 in ScOMPDC) have been proposed to contribute to the catalytic efficiency. We investigated that hypothesis by structural and functional characterization of the D70N and D70G mutants of MtOMPDC and the D91N mutant of ScOMPDC. The substitutions for Asp 70 in MtOMPDC significantly decrease the value of kcat for decarboxylation of FOMP (a more reactive substrate analogue) but have little effect on the value of kex for exchange of H6 of FUMP with solvent deuterium; the structures of wild-type MtOMPDC and its mutants are superimposable when complexed with 6-azaUMP. In contrast, the D91N mutant of ScOMPDC does not catalyze exchange of H6 of FUMP; the structures of wild-type ScOMPDC and its D91N mutant are not superimposable when complexed with 6-azaUMP, with differences in both the conformation of the active site loop and the orientation of the ligand vis vis the active site residues. We propose that the differential effects of substitutions for Asp 70 of MtOMPDC on decarboxylation and exchange provide additional evidence for a carbanionic intermediate as well as the involvement of Asp 70 in substrate destabilization.

  20. Rate and Equilibrium Constants for an Enzyme Conformational Change during Catalysis by Orotidine 5′-Monophosphate Decarboxylase

    PubMed Central


    The caged complex between orotidine 5′-monophosphate decarboxylase (ScOMPDC) and 5-fluoroorotidine 5′-monophosphate (FOMP) undergoes decarboxylation ∼300 times faster than the caged complex between ScOMPDC and the physiological substrate, orotidine 5′-monophosphate (OMP). Consequently, the enzyme conformational changes required to lock FOMP at a protein cage and release product 5-fluorouridine 5′-monophosphate (FUMP) are kinetically significant steps. The caged form of ScOMPDC is stabilized by interactions between the side chains from Gln215, Tyr217, and Arg235 and the substrate phosphodianion. The control of these interactions over the barrier to the binding of FOMP and the release of FUMP was probed by determining the effect of all combinations of single, double, and triple Q215A, Y217F, and R235A mutations on kcat/Km and kcat for turnover of FOMP by wild-type ScOMPDC; its values are limited by the rates of substrate binding and product release, respectively. The Q215A and Y217F mutations each result in an increase in kcat and a decrease in kcat/Km, due to a weakening of the protein–phosphodianion interactions that favor fast product release and slow substrate binding. The Q215A/R235A mutation causes a large decrease in the kinetic parameters for ScOMPDC-catalyzed decarboxylation of OMP, which are limited by the rate of the decarboxylation step, but much smaller decreases in the kinetic parameters for ScOMPDC-catalyzed decarboxylation of FOMP, which are limited by the rate of enzyme conformational changes. By contrast, the Y217A mutation results in large decreases in kcat/Km for ScOMPDC-catalyzed decarboxylation of both OMP and FOMP, because of the comparable effects of this mutation on rate-determining decarboxylation of enzyme-bound OMP and on the rate-determining enzyme conformational change for decarboxylation of FOMP. We propose that kcat = 8.2 s–1 for decarboxylation of FOMP by the Y217A mutant is equal to the rate constant for cage formation

  1. Induction of Viral, 7-Methyl-Guanosine Cap-Independent Translation and Oncolysis by Mitogen-Activated Protein Kinase-Interacting Kinase-Mediated Effects on the Serine/Arginine-Rich Protein Kinase

    PubMed Central

    Brown, Michael C.; Bryant, Jeffrey D.; Dobrikova, Elena Y.; Shveygert, Mayya; Bradrick, Shelton S.; Chandramohan, Vidyalakshmi; Bigner, Darell D.


    ABSTRACT Protein synthesis, the most energy-consuming process in cells, responds to changing physiologic priorities, e.g., upon mitogen- or stress-induced adaptations signaled through the mitogen-activated protein kinases (MAPKs). The prevailing status of protein synthesis machinery is a viral pathogenesis factor, particularly for plus-strand RNA viruses, where immediate translation of incoming viral RNAs shapes host-virus interactions. In this study, we unraveled signaling pathways centered on the ERK1/2 and p38α MAPK-interacting kinases MNK1/2 and their role in controlling 7-methyl-guanosine (m7G) “cap”-independent translation at enterovirus type 1 internal ribosomal entry sites (IRESs). Activation of Raf-MEK-ERK1/2 signals induced viral IRES-mediated translation in a manner dependent on MNK1/2. This effect was not due to MNK's known functions as eukaryotic initiation factor (eIF) 4G binding partner or eIF4E(S209) kinase. Rather, MNK catalytic activity enabled viral IRES-mediated translation/host cell cytotoxicity through negative regulation of the Ser/Arg (SR)-rich protein kinase (SRPK). Our investigations suggest that SRPK activity is a major determinant of type 1 IRES competency, host cell cytotoxicity, and viral proliferation in infected cells. IMPORTANCE We are targeting unfettered enterovirus IRES activity in cancer with PVSRIPO, the type 1 live-attenuated poliovirus (PV) (Sabin) vaccine containing a human rhinovirus type 2 (HRV2) IRES. A phase I clinical trial of PVSRIPO with intratumoral inoculation in patients with recurrent glioblastoma (GBM) is showing early promise. Viral translation proficiency in infected GBM cells is a core requirement for the antineoplastic efficacy of PVSRIPO. Therefore, it is critically important to understand the mechanisms controlling viral cap-independent translation in infected host cells. PMID:25187541

  2. Enhanced Antitumor Activity of Monophosphate Ester Prodrugs of Gemcitabine: In Vitro and In Vivo Evaluation.


    Qi, Huixin; Lu, Jia; Li, Jiajun; Wang, Meiyu; Xu, Yunting; Wang, Yedong; Zhang, Hongjian


    The prodrug strategy has been explored frequently for a number of marked drugs to obtain better pharmaceutical properties and efficacy and safety profiles. For gemcitabine, a nucleoside analog that has been used widely as a chemotherapeutic agent for the treatment of a variety of cancers, the protection of the amino group from extensive deamination and increase of permeability have been used for oral prodrug development. In the present study, several novel and proprietary monophosphate ester prodrugs of gemcitabine representing different "tail" structures were evaluated for their antiproliferation activities in various tumor cell lines. As compared to LY2334737, a prototype oral prodrug of gemcitabine, the monophosphate ester prodrugs exhibited superior in vitro antiproliferation activity. Among those, compound-3 emerged as a promising prodrug candidate. Data revealed that cellular concentrations of compound-3 were correlated well with its antiproliferation activity and its cellular uptake did not involve human equilibrative nucleoside transporter, suggesting a potential to treat gemcitabine resistant tumors. Compound-3 demonstrated equal or better antitumor efficacy after oral administration as compared to intraperitoneally injected gemcitabine. Taken together, compound-3 has the potential for further development as an orally active antitumor agent. PMID:26994559

  3. Potential of mean force calculations of the stacking-unstacking process in single-stranded deoxyribodinucleoside monophosphates.

    PubMed Central

    Norberg, J; Nilsson, L


    The free energy of the stacking-unstacking process of deoxyribodinucleoside monophosphates in aqueous solution has been investigated by potential of mean force calculations along a reaction coordinate, defined by the distance between the glycosidic nitrogen atoms of the bases. The stacking-unstacking process of a ribodinucleoside monophosphate was observed to be well characterized by this coordinate, which has the advantage that it allows for a dynamical backbone and flexible bases. All 16 naturally occurring DNA dimers composed of the adenine, cytosine, guanine, or thymine bases in both the 5' and the 3' positions were studied. From the free-energy profiles we observed the deepest minima for the stacked states of the purine-purine dimers, but good stacking was also observed for the purine-pyrimidine and pyrimidine-purine dimers. Substantial stacking ability was found for the dimers composed of a thymine base and a purine base and also for the deoxythymidylyl-3',5'-deoxythymidine dimer. Very poor stacking was observed for the dCpdC dimer. Conformational properties and solvent accessibility are discussed for the stacked and unstacked dimers. The potential of mean force profiles of the stacking-unstacking process for the DNA dimers are compared with the RNA dimers. PMID:8599635

  4. A New Subfamily of Polyphosphate Kinase 2 (Class III PPK2) Catalyzes both Nucleoside Monophosphate Phosphorylation and Nucleoside Diphosphate Phosphorylation

    PubMed Central

    Motomura, Kei; Hirota, Ryuichi; Okada, Mai; Ikeda, Takeshi; Ishida, Takenori


    Inorganic polyphosphate (polyP) is a linear polymer of tens to hundreds of phosphate (Pi) residues linked by “high-energy” phosphoanhydride bonds as in ATP. PolyP kinases, responsible for the synthesis and utilization of polyP, are divided into two families (PPK1 and PPK2) due to differences in amino acid sequence and kinetic properties. PPK2 catalyzes preferentially polyP-driven nucleotide phosphorylation (utilization of polyP), which is important for the survival of microbial cells under conditions of stress or pathogenesis. Phylogenetic analysis suggested that the PPK2 family could be divided into three subfamilies (classes I, II, and III). Class I and II PPK2s catalyze nucleoside diphosphate and nucleoside monophosphate phosphorylation, respectively. Here, we demonstrated that class III PPK2 catalyzes both nucleoside monophosphate and nucleoside diphosphate phosphorylation, thereby enabling us to synthesize ATP from AMP by a single enzyme. Moreover, class III PPK2 showed broad substrate specificity over purine and pyrimidine bases. This is the first demonstration that class III PPK2 possesses both class I and II activities. PMID:24532069

  5. Metformin attenuates graft-versus-host disease via restricting mammalian target of rapamycin/signal transducer and activator of transcription 3 and promoting adenosine monophosphate-activated protein kinase-autophagy for the balance between T helper 17 and Tregs.


    Park, Min-Jung; Lee, Seon-Yeong; Moon, Su-Jin; Son, Hye-Jin; Lee, Sung-Hee; Kim, Eun-Kyung; Byun, Jae-Kyeong; Shin, Dong Yun; Park, Sung-Hwan; Yang, Chul-Woo; Cho, Mi-La


    Acute graft-versus-host disease (aGVHD), caused by donor T cell-mediated injury to host tissues, is a problem in allogeneic bone marrow transplantation. The transition from naïve to effector T cells is accompanied by shift in metabolism main pathway; from glucose oxidative phosphorylation to aerobic glycolysis. Adenosine monophosphate-activated protein kinase (AMPK) is a serine/threonine kinase that is a metabolic sensor that helps maintain cellular energy homeostasis. Although AMPK activation can exert anti-inflammatory properties by negatively regulating pro-inflammatory mediators, its role as a therapeutic potential of graft-versus-host disease development remains unclear. In this study, we found that the intraperitoneal administration of metformin, which activates AMPK signaling significantly, ameliorated the clinical severity of aGHVD and lethality. This was associated with reductions in type I T helper (Th1) and Th17 and rises in Th2 and regulatory T (Treg) cell. The enhanced signal transducer and activator of transcription 3 activation noted during the development of aGVHD was reduced by metformin treatment. Furthermore, metformin-treated Th17 cells became converted into Treg cells via enhanced autophagy. The reduction in mortality associated with metformin treatment was associated with inhibition of the mammalian target of rapamycin/signal transducer and activator of transcription 3 pathway. These results suggest that metformin might be of significant use in the treatment of patients with aGVHD. PMID:27126953

  6. Regulation of Maltodextrin Phosphorylase Synthesis in Escherichia coli by Cyclic Adenosine 3′, 5′-Monophosphate and Glucose1

    PubMed Central

    Chao, Julie; Weathersbee, Carolyn J.


    Cyclic adenosine 3′, 5′-monophosphate (AMP) stimulates maltodextrin phosphorylase synthesis in Escherichia coli cells induced with maltose. A maximal effect occurs at 2 to 3 mM cyclic AMP. The action of cyclic AMP is specific, inasmuch as adenosine triphosphate, 3′-AMP, 5′-AMP, adenosine, and dibutyryl cyclic AMP are inactive. Glucose, α-methyl glucoside, 2-deoxyglucose, and pyridoxal 5′-phosphate repress maltodextrin phosphorylase synthesis. This repression is reversed by cyclic AMP. The action of cyclic AMP appears to be at the transcriptional level, since cyclic AMP fails to stimulate phosphorylase production in induced cells in which messenger ribonucleic acid synthesis has been arrested by rifampin or by inducer removal. The two other enzymes involved in the metabolism of maltose, amylomaltase and maltose permease, are also induced in this strain of E. coli and affected by glucose and cyclic AMP in a manner similar to phosphorylase. PMID:4358043

  7. Photo-cycle dynamics of LOV1-His domain of phototropin from Chlamydomonas reinhardtii with roseoflavin monophosphate cofactor

    NASA Astrophysics Data System (ADS)

    Tyagi, A.; Penzkofer, A.; Mathes, T.; Hegemann, P.


    The wild-type phototropin protein phot from the green alga Chlamydomonas reinhardtii consists of two N-terminal LOV domains LOV1 and LOV2 with flavin mononucleotide (FMN) cofactor and a C-terminal serine-threonine kinase domain. It controls multiple steps in the sexual lifecycle of the alga. Here the LOV1-His domain of phot with modified cofactor is studied. FMN is replaced by roseoflavin monophosphate (8-dimethylamino-8-demethyl-FMN, RoFMN). The modified LOV1 domain is called RoLOV1. The photo-dynamics consequences of the cofactor change are studied. The absorption, emission, and photo-cyclic behaviour of LOV1-His and RoLOV1-His are compared. A spectroscopic characterisation of the cofactors FMN and RoFMN (roseoflavin) is given.

  8. Stereoselective aminoacylation of a dinucleoside monophosphate by the imidazolides of DL-alanine and N-(tert-butoxycarbonyl)-DL-alanine

    NASA Technical Reports Server (NTRS)

    Profy, A. T.; Usher, D. A.


    The aminoacylation of diinosine monophosphate was studied experimentally. When the acylating agent was the imidazolide of N-(tert-butoxycarbonyl)-DL-alanine, a 40 percent enantiomeric excess of the isomer was incorporated at the 2' site and the positions of equilibrium for the reversible 2'-3' migration reaction differed for the D and L enantiomers. The reactivity of the nucleoside hydroxyl groups was found to decrease on the order 2'(3') less than internal 2' and less than 5', and the extent of the reaction was affected by the concentration of the imidazole buffer. Reaction of IpI with imidazolide of unprotected DL-alanine, by contrast, led to an excess of the D isomer at the internal 2' site. Finally, reaction with the N-carboxy anhydride of DL-alanine occurred without stereoselection. These results are found to be relevant to the study of the evolution of optical chemical activity and the origin of genetically directed protein synthesis.

  9. Investigation on the occurrence and significance of cyclic adenosine 3':5'-monophosphate in phytoplankton and natural aquatic communities

    SciTech Connect

    Francko, D.A.


    This study demonstrates, on the basis of several analyanalytical criteria, that the production and extracellular release of cyclic adenosine 3':5'-monophosphate (cAMP) is widespread among phytoplankton species. The production and release of CAMP varied markedly among different species grown under similar environmental conditions, and intraspecifically during the life cycle of a given algal species. This investigation marks the first time cAMP has been investigated in natural aquatic systems. An examination of epilimnetic lakewater samples from Lawrence Lake, a hardwater oligotrophic lake, and Wintergreen Lake, a hardwater hypereutrophic lake, both in southwestern Michigan, demonstrated that cAMP existed in both particulate-associated and dissolved forms in these systems.

  10. PCR screening for carriers of bovine leukocyte adhesion deficiency (BLAD) and uridine monophosphate synthase (DUMPS) in Argentine Holstein cattle.


    Poli, M A; Dewey, R; Semorile, L; Lozano, M E; Albariño, C G; Romanowski, V; Grau, O


    BLAD (Bovine Leukocyte Adhesion Deficiency) and DUMPS (Deficiency of Uridine Monophosphate Synthase) are monogenic autosomal, recessive inherited diseases of Holstein cattle. Single nucleotide changes (point mutations) responsible for the genetic disorders were detected by polymerase chain reaction coupled with restriction fragment length polymorphism assays (PCR-RFLP). Using oligonucleotide primers, DNA fragments of predicted sizes were amplified, and the products' specificity was assessed by nucleotide sequencing. Mutations were detected in DNA samples from bovine blood and semen by the presence or absence of restriction sites within the PCR amplification products (Taq I, Hae III for BLAD, Ava I for DUMPS). The test included 104 bulls and 950 cows of Argentinean Holstein breed. Defective alleles frequencies were as follows: 2.88% BLAD in bulls used in artificial insemination, 1.79% in cows; 0.96% DUMPS in bulls and 0.11% in cows. PMID:8693839

  11. Adenosine 3',5'-monophosphate in relation to inhibition of cervical smooth muscle activity in early pregnant women.


    Norström, A; Bryman, I


    Contractile activity was registered in strips of cervical tissue obtained by needle biopsy from women in the first trimester of pregnancy. Dibutyryl cyclic adenosine-3',5'-monophosphate (5 x 10(-6) mol/l), isobutyryl methylxanthine (10(-4) mol/l), and forskolin (10(-5)-10(-4) mol/l), the latter two drugs known to increase the levels of endogenous cAMP, inhibited spontaneous muscle activity. The levels of tissue cAMP were determined in strips during relaxation induced by prostaglandin E2 or purified porcine relaxin and compared with cAMP levels in strips from the same women during contractile activity. Exposure to prostaglandin E2 but not to relaxin was followed by increased levels of cAMP. It is suggested that cAMP has a role as a second messenger in the prostaglandin E2-mediated relaxation of cervical smooth muscle. PMID:1654721

  12. Biochemical Genetic Pathways that Modulate Aging in Multiple Species

    PubMed Central

    Bitto, Alessandro; Wang, Adrienne M.; Bennett, Christopher F.; Kaeberlein, Matt


    The mechanisms underlying biological aging have been extensively studied in the past 20 years with the avail of mainly four model organisms: the budding yeast Saccharomyces cerevisiae, the nematode Caenorhabditis elegans, the fruitfly Drosophila melanogaster, and the domestic mouse Mus musculus. Extensive research in these four model organisms has identified a few conserved genetic pathways that affect longevity as well as metabolism and development. Here, we review how the mechanistic target of rapamycin (mTOR), sirtuins, adenosine monophosphate-activated protein kinase (AMPK), growth hormone/insulin-like growth factor 1 (IGF-1), and mitochondrial stress-signaling pathways influence aging and life span in the aforementioned models and their possible implications for delaying aging in humans. We also draw some connections between these biochemical pathways and comment on what new developments aging research will likely bring in the near future. PMID:26525455

  13. Modification and translocation of Rac/Rop guanosine 5'-triphosphate-binding proteins of Scoparia dulcis in response to stimulation with methyl jasmonate.


    Mitamura, Toshiaki; Yamamura, Yoshimi; Kurosaki, Fumiya


    Translocation of two Rac/Rop guanosine 5'-triphosphate-binding proteins from Scoparia dulcis, Sdrac-1 and Sdrac-2, was examined employing transformed belladonna which overproduces these proteins as glutathione-S-transferase-tagged forms. The transferase activities of the fused proteins in microsomal fraction of belladonna markedly increased by the incubation with methyl jasmonate either in Sdrac-1 or Sdrac-2 transformant, while low and constant activities were observed in the untreated control. Recombinant Sdrac-2 protein was found to bind to prenyl chain in the presence of cell extracts prepared from methyl jasmonate-treated S. dulcis, however, Sdrac-1 was palmitoylated by the addition of the cell extracts. These results suggest that both Sdrac-1 and Sdrac-2 translocate to plant membranes by the stimulation with methyl jasmonate, however, targeting of these proteins is triggered by the independent modification mechanisms, palmitoylation for Sdrac-1 and prenylation for Sdrac-2. PMID:21628882

  14. Cloning and characterization of Sdga gene encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex in Scoparia dulcis.


    Shite, Masato; Yamamura, Yoshimi; Hayashi, Toshimitsu; Kurosaki, Fumiya


    A homology-based cloning strategy yielded Sdga, a cDNA clone presumably encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex, from leaf tissues of Scoparia dulcis. Phylogenetic tree analysis of G-protein alpha-subunits from various biological sources suggested that, unlike in animal cells, classification of Galpha-proteins into specific subfamilies could not be applicable to the proteins from higher plants. Restriction digests of genomic DNA of S. dulcis showed a single hybridized signal in Southern blot analysis, suggesting that Sdga is a sole gene encoding Galpha-subunit in this plant. The expression level of Sdga appeared to be maintained at almost constant level after exposure of the leaves to methyl jasmonate as analyzed by reverse-transcription polymerase chain reaction. These results suggest that Sdga plays roles in methyl jasmonate-induced responses of S. dulcis without a notable change in the transcriptional level. PMID:18981590

  15. Crystal Structure of the Thermus thermophilus 16 S rRNA Methyltransferase RsmC in Complex with Cofactor and Substrate Guanosine*S⃞

    PubMed Central

    Demirci, Hasan; Gregory, Steven T.; Dahlberg, Albert E.; Jogl, Gerwald


    Post-transcriptional modification is a ubiquitous feature of ribosomal RNA in all kingdoms of life. Modified nucleotides are generally clustered in functionally important regions of the ribosome, but the functional contribution to protein synthesis is not well understood. Here we describe high resolution crystal structures for the N2-guanine methyltransferase RsmC that modifies residue G1207 in 16 S rRNA near the decoding site of the 30 S ribosomal subunit. RsmC is a class I S-adenosyl-l-methionine-dependent methyltransferase composed of two methyltransferase domains. However, only one S-adenosyl-l-methionine molecule and one substrate molecule, guanosine, bind in the ternary complex. The N-terminal domain does not bind any cofactor. Two structures with bound S-adenosyl-l-methionine and S-adenosyl-l-homocysteine confirm that the cofactor binding mode is highly similar to other class I methyltransferases. Secondary structure elements of the N-terminal domain contribute to cofactor-binding interactions and restrict access to the cofactor-binding site. The orientation of guanosine in the active site reveals that G1207 has to disengage from its Watson-Crick base pairing interaction with C1051 in the 16 S rRNA and flip out into the active site prior to its modification. Inspection of the 30 S crystal structure indicates that access to G1207 by RsmC is incompatible with the native subunit structure, consistent with previous suggestions that this enzyme recognizes a subunit assembly intermediate. PMID:18667428

  16. Guanosine 2-NH2 groups of Escherichia coli RNase P RNA involved in intramolecular tertiary contacts and direct interactions with tRNA.

    PubMed Central

    Heide, C; Pfeiffer, T; Nolan, J M; Hartmann, R K


    We have identified by nucleotide analog interference mapping (NAIM) exocyclic NH2 groups of guanosines in RNase P RNA from Escherichia coli that are important for tRNA binding. The majority of affected guanosines represent phylogenetically conserved nucleotides. Several sites of interference could be assigned to direct contacts with the tRNA moiety, whereas others were interpreted as reflecting indirect effects on tRNA binding due to the disruption of tertiary contacts within the catalytic RNA. Our results support the involvement of the 2-NH2 groups of G292/G293 in pairing with C74 and C75 of tRNA CCA-termini, as well as formation of two consecutive base triples involving C75 and A76 of CCA-ends interacting with G292/A258 and G291/G259, respectively. Moreover, we present first biochemical evidence for two tertiary contacts (L18/P8 and L8/P4) within the catalytic RNA, whose formation has been postulated previously on the basis of phylogenetic comparative analyses. The tRNA binding interference data obtained in this and our previous studies are consistent with the formation of a consecutive nucleotide triple and quadruple between the tetraloop L18 and helix P8. Formation of the nucleotide triple (G316 and A94:U104 in wild-type E. coli RNase P RNA) is also supported by mutational analysis. For the mutant RNase P RNA carrying a G94:C104 double mutation, an additional G316-to-A mutation resulted in a restoration of binding affinity for mature and precursor tRNA. PMID:9917070

  17. Diabetic complications within the context of aging: Nicotinamide adenine dinucleotide redox, insulin C-peptide, sirtuin 1-liver kinase B1-adenosine monophosphate-activated protein kinase positive feedback and forkhead box O3.


    Ido, Yasuo


    Recent research in nutritional control of aging suggests that cytosolic increases in the reduced form of nicotinamide adenine dinucleotide and decreasing nicotinamide adenine dinucleotide metabolism plays a central role in controlling the longevity gene products sirtuin 1 (SIRT1), adenosine monophosphate-activated protein kinase (AMPK) and forkhead box O3 (FOXO3). High nutrition conditions, such as the diabetic milieu, increase the ratio of reduced to oxidized forms of cytosolic nicotinamide adenine dinucleotide through cascades including the polyol pathway. This redox change is associated with insulin resistance and the development of diabetic complications, and might be counteracted by insulin C-peptide. My research and others' suggest that the SIRT1-liver kinase B1-AMPK cascade creates positive feedback through nicotinamide adenine dinucleotide synthesis to help cells cope with metabolic stress. SIRT1 and AMPK can upregulate liver kinase B1 and FOXO3, key factors that help residential stem cells cope with oxidative stress. FOXO3 directly changes epigenetics around transcription start sites, maintaining the health of stem cells. 'Diabetic memory' is likely a result of epigenetic changes caused by high nutritional conditions, which disturb the quiescent state of residential stem cells and impair tissue repair. This could be prevented by restoring SIRT1-AMPK positive feedback through activating FOXO3. PMID:27181414

  18. Evaluation of the metal-ion-coordinating differences between the 2'-, 3'- and 5'-monophosphates of adenosine.


    Massoud, S S; Sigel, H


    The stability constants of the 1:1 complexes formed between Mg2+, Ca2+, Sr2+, Ba2+, Mn2+, Co2+, Ni2+, Cu2+, Zn2+ or Cd2+ and 2'AMP2-, 3'AMP2- or 5'AMP2- were determined by potentiometric pH titration in aqueous solution (I = 0.1 M, NaNO3; 25 degrees C). The experimental conditions were carefully selected such that self-association of the nucleotides and their complexes is negligibly small; i.e. it was made certain that the properties of the monomeric divalent-metal-ion--AMP [M(AMP)] complexes were studied. Based on recent measurements with simple phosphate monoesters, R-MP2- where R is a non-coordinating residue [Massoud, S. S. & Sigel, H. (1988) Inorg. Chem. 27, 1447-1453], it is shown that all the M(AMP) complexes of the alkaline earth ions, with the possible exception of Mg(5'AMP), have exactly the stability expected for a sole-phosphate coordination of the metal ion. The same property is revealed for the complexes with Mn2+, Co2+, Zn2+ or Cd2+ and 3'AMP2-; in case of Ni(3'AMP) and Cu(3'AMP) a slight stability increase just at the edge of the experimental-error limits is indicated. This slight stability increase is attributed to the formation of a macrochelate (possibly with N-3); in fact, additional information confirms macrochelation for Cu(3'AMP). About 45% of Cu(2'AMP) exists in aqueous solution as a macrochelate (probably involving N-3); the other M(2'AMP) complexes (M2+ = Mn2+, Co2+, Ni2+, Zn2+, Cd2+) form (if at all) only traces of a base-backbound species. Most pronounced is macrochelate formation with 5'AMP2-: all mentioned 3d ions and Zn2+ or Cd2+ form to some extent macrochelates via N-7 (the structures of these closed species are indicated). In case of M(5'AMP) the base-binding site is certain: replacement of N-7 by a CH unit (tubercidin 5'-monophosphate) eliminates any increased complex stability, whereas formation of the 1,N6-etheno bridge to form 1,N6-ethenoadenosine 5'-monophosphate results in the phenanthroline-like N-6,N-7 site which

  19. Calf-ovary protein kinases dependent on adenosine 3':5' -monophosphate. Analysis by electrophoresis and electro-focusing on polyacrylamide get.


    Salokangas, A; Talmadge, K; Bechtel, E; Eppenberger, U; Chrambach, A


    High resolving power and quantitative application polyacrylamide-gel electrophopresis at various pore sizes and electrofocusing provide resolution of a calf-ovarian protein-kinase system at an increased level of magnification, as well as optimal preparative routes. Three protein kinases dependent on adenosine 3':5' -monophosphate are distinguished by polyacrylamide gel electrophoresis in calf ovarian cytosol. These enzymes which are observed in the pH range 7.5--10.2, appear to be aggregates of a commonsubmit or monomer. The three kinases are, by the criteria of polyacylamide gel electrophoresis, distinct from three adenosine-3':5' -monophosphate-binding proteins found in the calf ovarian system. Analysis by electrofocusing on polyacrylamide gel shows that conventionally purified preparations of the major kinase of cytosol contain an overwhelming majority of contaminant proteins. PMID:191253

  20. Favism: effect of divicine on rat erythrocyte sulfhydryl status, hexose monophosphate shunt activity, morphology, and membrane skeletal proteins.


    McMillan, D C; Bolchoz, L J; Jollow, D J


    Favism is an acute anemic crisis that can occur in susceptible individuals who ingest fava beans. The fava bean pyrimidine aglycone divicine has been identified as a hemotoxic constituent; however, its mechanism of toxicity remains unknown. We have shown recently that divicine can induce a favic-like response in rats and that divicine is directly toxic to rat red cells. In the present study, we have examined the effect of hemotoxic concentrations of divicine on rat erythrocyte sulfhydryl status, hexose monophosphate (HMP) shunt activity, morphology, and membrane skeletal proteins. In vitro exposure of rat red cells to divicine markedly stimulated HMP shunt activity and resulted in depletion of reduced glutathione with concomitant formation of glutathione-protein mixed-disulfides. Examination of divicine-treated red cells by scanning electron microscopy revealed transformation of the cells to an extreme echinocytic morphology. SDS-PAGE and immunoblotting analysis of the membrane skeletal proteins indicated that hemotoxicity was associated with the apparent loss of skeletal protein bands 2.1, 3, and 4.2, and the appearance of membrane-bound hemoglobin. Treatment of divicine-damaged red cells with dithiothreitol reversed the protein changes, which indicated that the observed alterations were due primarily to the formation of disulfide-linked hemoglobin-skeletal protein adducts. The data suggest that oxidative modification of hemoglobin and membrane skeletal proteins by divicine may be key events in the mechanism underlying favism. PMID:11452148

  1. Investigation of the enzymatic mechanism of yeast orotidine-5'-monophosphate decarboxylase using sup 13 C kinetic isotope effects

    SciTech Connect

    Smiley, J.A.; Bell, J.B.; Jones, M.E. ); Paneth, P.; O'Leary, M.H. )


    Orotidine-5'-monophosphate decarboxylase (ODCase) from Saccharomyces cerevisiae displays an observed {sup 13}C kinetic isotope effect of 1.0247 {plus minus} 0.0008 at 25 C, pH 6.8. The observed isotope effect is sensitive to changes in the reaction medium, such as pH, temperature, or glycerol content. The value of 1.0494 {plus minus} 0.0006 measured at pH 4.0, 25 C, is not altered significantly by temperature or glycerol, and thus the intrinsic isotope effect for the reaction is apparently being observed under these conditions and decarboxylation is almost entirely rate-determining. These data require a catalytic mechanism with freely reversible binding and one in which a very limited contribution to the overall rate is made by chemical steps preceding decarboxylation; the zwitterion mechanism of Beak and Siegel, which involves only protonation of the pyrimidine ring, is such a mechanism. With use of an intrinsic isotope effect of 1.05, a partitioning factor of less than unity is calculated for ODCase at pH 6.0, 25 C. A quantitative kinetic analysis using this result excludes the possibility of an enzymatic mechanism involving covalent attachment of an enzyme nucleophile to C-5 of the pyrimidine ring. These data fit a kinetic model in which an enzyme proton necessary for catalysis is titrated at high pH, thus providing evidence for the catalytic mechanism of Beak and Siegal.

  2. Pharmacokinetic and pharmacodynamic analysis of inosine monophosphate dehydrogenase activity in hematopoietic cell transplantation recipients treated with mycophenolate mofetil.


    Li, Hong; Mager, Donald E; Sandmaier, Brenda M; Storer, Barry E; Boeckh, Michael J; Bemer, Meagan J; Phillips, Brian R; Risler, Linda J; McCune, Jeannine S


    A novel approach to personalizing postgrafting immunosuppression in hematopoietic cell transplantation (HCT) recipients is evaluating inosine monophosphate dehydrogenase (IMPDH) activity as a drug-specific biomarker of mycophenolic acid (MPA)-induced immunosuppression. This prospective study evaluated total MPA, unbound MPA, and total MPA glucuronide plasma concentrations and IMPDH activity in peripheral blood mononuclear cells (PMNCs) at 5 time points after the morning dose of oral mycophenolate mofetil (MMF) on day +21 in 56 nonmyeloablative HCT recipients. Substantial interpatient variability in pharmacokinetics and pharmacodynamics was observed and accurately characterized by the population pharmacokinetic-dynamic model. IMPDH activity decreased with increasing MPA plasma concentration, with maximum inhibition coinciding with maximum MPA concentration in most patients. The overall relationship between MPA concentration and IMPDH activity was described by a direct inhibitory maximum effect model with an IC50 of 3.23 mg/L total MPA and 57.3 ng/mL unbound MPA. The day +21 IMPDH area under the effect curve (AUEC) was associated with cytomegalovirus reactivation, nonrelapse mortality, and overall mortality. In conclusion, a pharmacokinetic-dynamic model was developed that relates plasma MPA concentrations with PMNC IMPDH activity after an MMF dose in HCT recipients. Future studies should validate this model and confirm that day +21 IMPDH AUEC is a predictive biomarker. PMID:24727337

  3. Photoinduced electron transfer occurs between 2-aminopurine and the DNA nucleic acid monophosphates: results from cyclic voltammetry and fluorescence quenching.


    Narayanan, Madhavan; Kodali, Goutham; Xing, Yangjun; Stanley, Robert J


    2-Aminopurine (2AP) is a fluorescent adenine analogue that is useful in part because its substantial fluorescence quantum yield is sensitive to base stacking with native bases in ss- and ds-DNA. However, the degree of quenching is sequence dependent and the mechanism of quenching is still a matter of some debate. Here we show that the most likely quenching mechanism in aqueous solution involves photoinduced electron transfer (PET), as revealed by cyclic voltammetry (CV) performed in aprotic organic solvents. These potentials were used with spectroscopic data to obtain excited-state reduction and oxidation potentials. Stern-Volmer (S-V) experiments using the native base monophosphate nucleotides (NMPs) rGMP, rAMP, rCMP, and dTMP were performed in aqueous solution to obtain quenching rate constants kq. The results suggest that 2AP* can act as either an electron donor or an electron acceptor depending on the particular NMP but that PET proceeds for all NMPs tested. PMID:20734496

  4. Cilostazol Improves Developmental Competence of Pig Oocytes by Increasing Intraoocyte Cyclic Adenosine Monophosphate Level and Delaying Meiotic Resumption.


    Elahi, F; Lee, H; Lee, Y; Park, B; Lee, J; Hyun, S-H; Lee, E


    Cilostazol (CLZ) is a cyclic adenosine monophosphate (cAMP) modulator that influences the steady state of the meiotic stage. This study was conducted to determine the effects of CLZ treatment during in vitro maturation (IVM) on developmental competence of pig oocytes. Immature oocytes were exposed to 0 (control), 0.5, 2 and 4 μm CLZ during the first 22 h of IVM. Nuclear maturation, intraoocyte glutathione content and embryo cleavage after parthenogenesis (PA) and somatic cell nuclear transfer (SCNT) were not influenced by CLZ at any concentrations. However, 4 μm CLZ significantly (p < 0.05) improved blastocyst formation after PA (52.1% vs 38.7-46.0%) and SCNT relative to other concentrations (40.8% vs 25.0-30.7%). The mean cell numbers of SCNT blastocysts were significantly increased by 4 μm CLZ compared to the control (42.6 cells vs 35.3 cells/blastocyst). CLZ treatment significantly increased the intraoocyte cAMP level and effectively arrested oocytes at the germinal vesicle (GV) and GV break down stages compared to the control (74.5% vs 45.4%). Our results demonstrated that improved developmental competence of PA and SCNT pig embryos occurred via better synchronization of nuclear and cytoplasmic maturation induced by increased cAMP and delayed meiotic resumption after CLZ treatment. PMID:26834044

  5. Coordination properties of adenosine-5'-monophosphate and related ligands towards Me2Sn(IV)2+ in aqueous solution.


    Jankovics, H; Nagy, L; Buzás, N; Pellerito, L; Barbieri, R


    The coordination of Me2Sn(IV)2+ to adenosine-5'-monophosphate (AMP) and the related compounds D-ribose-5-phosphate (R5P), D-glucose-1-phosphate (G1P) and D-glucose-6-phosphate (G6P) in aqueous solution was investigated by means of potentiometric titration, and 1H-, 31P-NMR and Mössbauer spectroscopic methods in the pH range 2-11 (I=0.1 M NaClO4, 298 K). The complex of AMP and Me2Sn(IV)2+ precipitated at low pH was characterised by elemental analysis, FT-IR and Mössbauer spectroscopic methods. From a comparison of the pK values obtained in the presence and absence of metal ion and the stability constants for the different systems, the coordination of [N] is excluded, while bidentate coordination of the phosphate group is presumed. Mössbauer spectroscopic measurements recorded in the glassy state confirmed bidentate coordination of the phosphate and the formation of mixed hydroxo complexes in the weakly acidic, neutral and strongly basic pH range. With increasing pH, the phosphate groups were replaced by the deprotonated alcoholic [O] atoms of the sugar moiety. The solid complex proved to be tbp structure with bidentate phosphate coordination. PMID:12230988

  6. Directed breeding of an Arthrobacter mutant for high-yield production of cyclic adenosine monophosphate by N + ion implantation

    NASA Astrophysics Data System (ADS)

    Song, He; Chen, Xiaochun; Cao, Jiaming; Fang, Ting; Bai, Jianxin; Xiong, Jian; Ying, Hanjie


    To obtain a cyclic adenosine monophosphate (cAMP) high-yield production strain, Arthrobacter NG-1 was mutated by N + ion implantation with an energy level of 10 keV and dose of 7×10 15 ions/cm 2. Combined with directed screening methods, a xanthine-defective and 8-azaguanine (8-AG)-resistant mutant Arthrobacter A302 was selected. The concentration of cAMP produced by this mutant was 41.7% higher than that of the original strain and reached 9.78 g/L. Through ten-generation investigation, the capability of cAMP production of A302 was found to be stable. Compared with the original strain, the special activities of key enzymes in A302, which influenced the cAMP biosynthesis, was analyzed. IMP dehydrogenase activity was defective, whereas PRPP amidotransferase, sAMP synthetase and adenylate cyclase activities were increased by 61.5%, 147% and 21.7%, respecitively, which might explain the mutagenesis mechanism by N + ions implantation under the enzymatic level.

  7. An evaluation of short-term corticosteroid response in perennial allergic rhinitis using histamine and adenosine monophosphate nasal challenge

    PubMed Central

    Wilson, Andrew M; Sims, Erika J; Orr, Linda C; Robb, Fiona; Lipworth, Brian J


    Aims To evaluate the role of AMP nasal challenge as a measure of short-term treatment response in patients receiving intranasal corticosteroids. Adenosine monophosphate (AMP) challenge has been shown to be a good inflammatory surrogate in the lower airways, but it has not been properly evaluated as a nasal challenge test. Methods Fourteen patients with perennial allergic rhinitis (PAR) were randomized to receive 2 weeks treatment with placebo (PL) or 200 µg intranasal mometasone furoate (MF) once daily in a randomized single-blind crossover study. AMP (25–800 mg ml−1) and histamine (0.25–8 mg ml−1) nasal challenge testing were performed after each treatment period with 30% decrease in minimal cross-sectional area (MCA). Domiciliary symptom data were collected. Results There was a significant (P < 0.05) improvement in PC30 MCA and nasal volume with AMP but not with histamine comparing MF vs PL. This amounted to a 2.8 (95% CI 1.5, 4.0) and 0.7 (95% CI −0.5, 1.9) doubling-dose change for AMP and histamine challenges, respectively. There were significant (P < 0.05) improvements in nasal symptoms and quality of life. Conclusions AMP nasal challenge using acoustic rhinometry may be a useful test to assess short-term treatment response in patient with PAR. PMID:12680883

  8. Investigation on the occurrence and significance of cyclic adenosine 3':5'-monophosphate in phytoplankton and natural aquatic communities

    SciTech Connect

    Francko, D.A.


    This study is an investigation into the occurrence and potential functions of cyclic adenosine 3':5'-monophosphate (cAMP), a potent and ubiquitous metabolic regulatory molecule in heterotrophic organisms, in phytoplankton and in natural aquatic communities. Laboratory-cultured phytoplankton were grown under both optimal and suboptimal nutrient regimes under constant temperature and illumination regimes. Cellular and extracellular cAMP production, characterized by a number of biochemical techniques, was correlated with growth rate dynamics, chlorophyll a synthesis, /sup 14/C-bicarbonate uptake, alkaline phosphatase activity, and heterocyst formation. The blue-green alga Anabaena flos-aquae was used as a model system in the examination of these metabolic variables. Additionally, this alga was used to test the effects of perturbation of cAMP levels on the aforementioned metabolic variables. Investigations on the occurrence and seasonal dynamics of cAMP in aquatic systems were conducted on Lawrence Lake, a hardwater oligotrophic lake, and on Wintergreen Lake, a hardwater hypereutrophic lake, both in southwestern Michigan. Putative cAMP from both systems was characterized by several biochemical techniques. Weekly sampling of particulate and dissolved cAMP in the epilimnia of both lakes was correlated with data on the rates of primary productivity, alkaline phosphatase activity, chlorophyll a synthesis and changes in phytoplankton community structure.

  9. A Mycobacterium smegmatis mutant with a defective inositol monophosphate phosphatase gene homolog has altered cell envelope permeability.

    PubMed Central

    Parish, T; Liu, J; Nikaido, H; Stoker, N G


    A bacteriophage infection mutant (strain LIMP7) of Mycobacterium smegmatis was isolated following transposon mutagenesis. The mutant showed an unusual phenotype, in that all phages tested produced larger plaques on this strain compared to the parent strain. Other phenotypic characteristics of the mutant were slower growth, increased clumping in liquid culture, increased resistance to chloramphenicol and erythromycin, and increased sensitivity to isoniazid and several beta-lactam antibiotics. Permeability studies showed decreases in the accumulation of lipophilic molecules (norfloxacin and chenodeoxycholate) and a small increase with hydrophilic molecules (cephaloridine); taken together, these characteristics indicate an altered cell envelope. The DNA adjacent to the transposon in LIMP7 was cloned and was shown to be highly similar to genes encoding bacterial and mammalian inositol monophosphate phosphatases. Inositol is important in mycobacteria as a component of the major thiol mycothiol and also in the cell wall, with phosphatidylinositol anchoring lipoarabinomannan (LAM) in the cell envelope. In LIMP7, levels of phosphatidylinositol dimannoside, the precursor of LAM, were less than half of those in the wild-type strain, confirming that the mutation had affected the synthesis of inositol-containing molecules. The impA gene is located within the histidine biosynthesis operon in both M. smegmatis and Mycobacterium tuberculosis, lying between the hisA and hisF genes. PMID:9401044

  10. Computer-assisted combinatorial design of bicyclic thymidine analogs as inhibitors of Mycobacterium tuberculosis thymidine monophosphate kinase.


    Frecer, Vladimir; Seneci, Pierfausto; Miertus, Stanislav


    Thymidine monophosphate kinase (TMPK(mt)) is an essential enzyme for nucleotide metabolism in Mycobacterium tuberculosis, and thus an attractive target for novel antituberculosis agents. In this work, we have explored the chemical space around the 2',3'-bicyclic thymidine nucleus by designing and in silico screening of a virtual focused library selected via structure based methods to identify more potent analogs endowed with favorable ADME-related properties. In all the library members we have exchanged the ribose ring of the template with a cyclopentane moiety that is less prone to enzymatic degradation. In addition, we have replaced the six-membered 2',3'-ring by a number of five-membered and six-membered heterocyclic rings containing alternative proton donor and acceptor groups, to exploit the interaction with the carboxylate groups of Asp9 and Asp163 as well as with several cationic residues present in the vicinity of the TMPK(mt) binding site. The three-dimensional structure of the TMPK(mt) complexed with 5-hydroxymethyl-dUMP, an analog of dTMP, was employed to develop a QSAR model, to parameterize a scoring function specific for the TMPK(mt) target and to select analogues which display the highest predicted binding to the target. As a result, we identified a small highly focused combinatorial subset of bicyclic thymidine analogues as virtual hits that are predicted to inhibit the mycobacterial TMPK in the submicromolar concentration range and to display favorable ADME-related properties. PMID:21082329

  11. Bicyclol promotes toll-like 2 receptor recruiting inosine 5'-monophosphate dehydrogenase II to exert its anti-inflammatory effect.


    Zhang, You-Wen; Guo, Yan-Shen; Bao, Xiu-Qi; Sun, Hua; Zhang, Dan


    The aim was to investigate potential targets and anti-inflammatory mechanisms of bicyclol, which has been extensively used in clinic for decades in China. Tar-Fis-Dock, virtual molecular docking system, showed that inosine 5'-monophosphate dehydrogenase II (IMPDH II) has the highest probability of binding to bicyclol. To investigate the possible role of IMPDH II in mechanisms of bicyclol, recombinant enzyme models, mice splenic lymphocytes, and human lymphocytes were used. Bicyclol (1-5 μM) significantly inhibited the proliferation of mice splenic lymphocytes stimulated by concanavalin A (conA). However, bicyclol did not show inhibitory effects on proliferation of human peripheral blood mononuclear cells (hPBMC) induced by phytohemagglutinin (PHA). IMPDH II enzyme kinetic model showed that bicyclol only had a slight regulatory effect on IMPDH II enzyme activity. These results revealed that bicyclol may be not a conventional inhibitor of IMPDH II. Further studies showed that bicyclol could promote recruitment of IMPDH II by active toll-like 2 receptor (TLR2) complex. Such effects lead to the reduction of nuclear factor κB (NF-κB) expression, increase in I-κB expression, and decrease in cytokine release, including tumor necrosis factor α (TNF-α) and interleukin 1β (IL-1β). It may be a new mechanism of bicyclol for its anti-inflammatory effect. PMID:26744808

  12. Structure and function of cytidine monophosphate kinase from Yersinia pseudotuberculosis, essential for virulence but not for survival

    PubMed Central

    Walker, Nicola J.; Clark, Elizabeth A.; Ford, Donna C.; Bullifent, Helen L.; McAlister, Erin V.; Duffield, Melanie L.; Acharya, K. Ravi; Oyston, Petra C. F.


    The need for new antibiotics has become pressing in light of the emergence of antibiotic-resistant strains of human pathogens. Yersinia pestis, the causative agent of plague, is a public health threat and also an agent of concern in biodefence. It is a recently emerged clonal derivative of the enteric pathogen Yersinia pseudotuberculosis. Previously, we developed a bioinformatic approach to identify proteins that may be suitable targets for antimicrobial therapy and in particular for the treatment of plague. One such target was cytidine monophosphate (CMP) kinase, which is an essential gene in some organisms. Previously, we had thought CMP kinase was essential for Y. pseudotuberculosis, but by modification of the mutagenesis approach, we report here the production and characterization of a Δcmk mutant. The isogenic mutant had a growth defect relative to the parental strain, and was highly attenuated in mice. We have also elucidated the structure of the CMP kinase to 2.32 Å, and identified three key residues in the active site that are essential for activity of the enzyme. These findings will have implications for the development of novel CMP kinase inhibitors for therapeutic use. PMID:23271832

  13. Modification by nitrobenzylthioinosine-5'-monophosphate of pseudoisocytidine pharmacokinetics in mice and rats through inhibition of membrane transport.


    Kolassa, N; Paterson, A R; Chou, T C


    In isolated, perfused mouse livers, initial rates of uptake of [2-14C]pseudoisocytidine (PIC), measured during the first 15 secs of perfusion were markedly reduced when the perfusion medium contained 5 X 10(-6) M nitrobenzylthioinosine (NBMPR), a potent inhibitor of nucleoside transport. A similar inhibition of PIC uptake occurred when mice were treated with NBMPR-P (the 5'-monophosphate of NBMPR) at doses greater than 0.2 mg/kg ip injected 30 mins prior to the liver perfusion assay. However, in vivo studies showed that a late effect of NBMPR-P was enhancement in PIC levels in liver and other tissues in mice and rats, relative to levels in animals that had not received NBMPR-P. Increases in incorporation of PIC into RNA reflected the NBMPR-P-induced increases in tissue levels of PIC. NBMPR-P and other inhibitors of nucleoside transport may have therapeutic applications in manipulation of the pharmacokinetic behavior and toxicity of nucleoside drugs. PMID:6193878

  14. Study of the kinetic and physical properties of the orotidine-5'-monophosphate decarboxylase domain from mouse UMP synthase produced in Saccharomyces cerevisiae.


    Langdon, S D; Jones, M E


    In mammals, the bifunctional protein UMP synthase contains the final two enzymatic activities, orotate phosphoribosyltransferase and orotidine-5'-monophosphate decarboxylase (ODCase), for de novo biosynthesis of UMP. The plasmid pMEJ contains a cDNA for the ODCase domain of mouse Ehrlich ascites UMP synthase. The cDNA from pMEJ was joined to the Saccharomyces cerevisiae iso-1-cytochrome c (CYC1) promoter and the first four CYC1 coding nucleotides in the plasmid pODCcyc. ODCase-deficient yeast cells (HF200x1) transformed with pODCcyc expressed an active ODCase domain with a specific activity of 20 nmol/min/mg in cell extracts. The expressed ODCase domain has a lower affinity for the substrate orotidine 5'-monophosphate and the inhibitor 6-azauridine 5'-monophosphate than intact UMP synthase or an ODCase domain isolated after proteolysis of homogenous UMP synthase. Sucrose density gradient sedimentation experiments showed that the expressed ODCase domain forms a dimer in the presence of ligands which bind at the catalytic site. These studies support the existence of an ODCase structural domain which contains the ODCase catalytic site and a dimerization surface of UMP synthase, but the domain may not have the regulatory site required to form the altered dimer form. PMID:3308878

  15. Metabolite gene regulation: imidazole and imidazole derivatives which circumvent cyclic adenosine 3',5'-monophosphate in induction of the Escherichia coli L-arabinose operon.

    PubMed Central

    Kline, E L; Bankaitis, V A; Brown, C S; Montefiori, D C


    Imidazole, histidine, histamine, histidinol phosphate, urocanic acid, or imidazolepropionic acid were shown to induce the L-arabinose operon in the absence of cyclic adenosine 3',5'-monophosphate. Induction was quantitated by measuring the increased differential rate of synthesis of L-arabinose isomerase in Escherichia coli strains which carried a deletion of the adenyl cyclase gene. The crp gene product (cyclic adenosine 3',5'-monophosphate receptor protein) and the araC gene product (P2) were essential for induction of the L-arabinose operon by imidazole and its derivatives. These compounds were unable to circumvent the cyclic adenosine 3',5'-monophosphate in the induction of the lactose or the maltose operons. The L-arabinose regulon was catabolite repressed upon the addition of glucose to a strain carrying an adenyl cyclase deletion growing in the presence of L-arabinose with imidazole. These results demonstrated that several imidazole derivatives may be involved in metabolite gene regulation (23). Images PMID:6245056

  16. An Interplay among FIS, H-NS, and Guanosine Tetraphosphate Modulates Transcription of the Escherichia coli cspA Gene under Physiological Growth Conditions.


    Brandi, Anna; Giangrossi, Mara; Giuliodori, Anna M; Falconi, Maurizio


    CspA, the most characterized member of the csp gene family of Escherichia coli, is highly expressed not only in response to cold stress, but also during the early phase of growth at 37°C. Here, we investigate at molecular level the antagonistic role played by the nucleoid proteins FIS and H-NS in the regulation of cspA expression under non-stress conditions. By means of both probing experiments and immunological detection, we demonstrate in vitro the existence of binding sites for these proteins on the cspA regulatory region, in which FIS and H-NS bind simultaneously to form composite DNA-protein complexes. While the in vitro promoter activity of cspA is stimulated by FIS and repressed by H-NS, a compensatory effect is observed when both proteins are added in the transcription assay. Consistently with these findings, inactivation of fis and hns genes reversely affect the in vivo amount of cspA mRNA. In addition, by means of strains expressing a high level of the alarmone guanosine tetraphosphate ((p)ppGpp) and in vitro transcription assays, we show that the cspA promoter is sensitive to (p)ppGpp inhibition. The (p)ppGpp-mediated expression of fis and hns genes is also analyzed, thus clarifying some aspects of the regulatory loop governing cspA transcription. PMID:27252944

  17. Coordination of two sequential ester-transfer reactions: exogenous guanosine binding promotes the subsequent omegaG binding to a group I intron.


    Bao, Penghui; Wu, Qi-Jia; Yin, Ping; Jiang, Yanfei; Wang, Xu; Xie, Mao-Hua; Sun, Tao; Huang, Lin; Mo, Ding-Ding; Zhang, Yi


    Self-splicing of group I introns is accomplished by two sequential ester-transfer reactions mediated by sequential binding of two different guanosine ligands, but it is yet unclear how the binding is coordinated at a single G-binding site. Using a three-piece trans-splicing system derived from the Candida intron, we studied the effect of the prior GTP binding on the later omegaG binding by assaying the ribozyme activity in the second reaction. We showed that adding GTP simultaneously with and prior to the esterified omegaG in a substrate strongly accelerated the second reaction, suggesting that the early binding of GTP facilitates the subsequent binding of omegaG. GTP-mediated facilitation requires C2 amino and C6 carbonyl groups on the Watson-Crick edge of the base but not the phosphate or sugar groups, suggesting that the base triple interactions between GTP and the binding site are important for the subsequent omegaG binding. Strikingly, GTP binding loosens a few local structures of the ribozyme including that adjacent to the base triple, providing structural basis for a rapid exchange of omegaG for bound GTP. PMID:18978026

  18. tRNA recognition for modification: solution probing of tRNA complexed with Escherichia coli tRNA (guanosine-1) methyltransferase.


    Gabryszuk, J; Holmes, W M


    The interaction of Escherichia coli tRNA (guanosine-1) methyltransferase and tRNA(1Leu) transcripts has been probed using cleavage with iodine of phosphorothioate-substituted transcripts, lead acetate, and enzymes specific for single- and double-stranded RNA. All lytic agents protect the anticodon stem-loop and variable loop regions against cleavage, and some protection is also seen in core structures of the tRNA. Residues from both strands of the anticodon stem are protected against cleavage with iodine and lead by enzyme, yet positions G37 and G36, which are crucial for catalysis and binding, are not. This suggests that these residues may undergo structural perturbation in the presence of S-adenosyl methionine. Occupancy of the AdoMet site by the product S-adenosyl-homocysteine, a potent inhibitor of the enzyme, has little or no effect on tRNA binding or protection. Enhanced reactivity with lead is seen at residues located in the anticodon stem-loop, extra-loop, and core (C34, U47c, and G49), which suggests some perturbations in RNA structure might accompany binding. PMID:9409623

  19. An Interplay among FIS, H-NS, and Guanosine Tetraphosphate Modulates Transcription of the Escherichia coli cspA Gene under Physiological Growth Conditions

    PubMed Central

    Brandi, Anna; Giangrossi, Mara; Giuliodori, Anna M.; Falconi, Maurizio


    CspA, the most characterized member of the csp gene family of Escherichia coli, is highly expressed not only in response to cold stress, but also during the early phase of growth at 37°C. Here, we investigate at molecular level the antagonistic role played by the nucleoid proteins FIS and H-NS in the regulation of cspA expression under non-stress conditions. By means of both probing experiments and immunological detection, we demonstrate in vitro the existence of binding sites for these proteins on the cspA regulatory region, in which FIS and H-NS bind simultaneously to form composite DNA-protein complexes. While the in vitro promoter activity of cspA is stimulated by FIS and repressed by H-NS, a compensatory effect is observed when both proteins are added in the transcription assay. Consistently with these findings, inactivation of fis and hns genes reversely affect the in vivo amount of cspA mRNA. In addition, by means of strains expressing a high level of the alarmone guanosine tetraphosphate ((p)ppGpp) and in vitro transcription assays, we show that the cspA promoter is sensitive to (p)ppGpp inhibition. The (p)ppGpp-mediated expression of fis and hns genes is also analyzed, thus clarifying some aspects of the regulatory loop governing cspA transcription. PMID:27252944

  20. Cloning and characterization of a gene encoding Rac/Rop-like monomeric guanosine 5'-triphosphate-binding protein from Scoparia dulcis.


    Mitamura, Toshiaki; Shite, Masato; Yamamura, Yoshimi; Kurosaki, Fumiya


    A cDNA clone, designated Sd-racrop (969 bp), was isolated from seedlings of Scoparia dulcis. This gene contains an open reading frame encoding the protein of 197 amino acid residues with high homology to Rac/Rop small guanosine 5'-triphosphate-binding proteins from various plant sources. In Southern hybridization analysis, the restriction digests prepared from genomic DNA of S. dulcis showed a main signal together with a few weakly hybridized bands. The transcriptional level of Sd-racrop showed a transient decrease by exposure of the leaf tissues of S. dulcis to the ethylene-generating reagent 2-chloroethylphosphonic acid. However, an appreciable increase in gene expression was reproducibly observed upon treatment of the plant with methyl jasmonate. These results suggest that the Sd-racrop product plays roles in ethylene- and methyl jasmonate-induced responses of S. dulcis accompanying the change in the transcriptional level, however, the cellular events mediated by this protein toward these external stimuli would be regulated by various mechanisms. PMID:19483328

  1. AS-1411, a guanosine-rich oligonucleotide aptamer targeting nucleolin for the potential treatment of cancer, including acute myeloid leukemia.


    Mongelard, Fabien; Bouvet, Philippe


    In development by Antisoma plc, AS-1411 is the first oligodeoxynucleotide aptamer to reach phase I and II clinical trials for the potential treatment of cancers, including acute myelogenous leukemia (AML). As an aptamer, AS-1411 does not appear to engage in hybridization-requiring pathways such as antisense effect, siRNA or triple helix formation. Instead, AS-1411 appears to bind to nucleolin specifically, and is subsequently internalized into the tumor cell. Nucleolin is an abundant protein, with expression that is correlated with the proliferative status of the cell: nucleolin levels are higher in tumors and actively dividing cells. Because of the multifunctional nature of nucleolin, it is probable that many secondary targets are affected following treatment with AS-1411. AS-1411 has demonstrated preclinical growth inhibition activity against a wide variety of tumor cell lines at concentrations in the micromolar range, and resulted in good efficacy in mice xenografted with tumor cells of human origin. In a phase I clinical trial in patients with advanced, refractory cancers with metastases at multiple sites, AS-1411 was safe and well tolerated; in addition, one complete response and one ongoing partial response were reported in two patients with renal cell carcinoma. A phase II trial of AS-1411 in combination with cytarabine in patients with AML demonstrated the combination to be superior to cytarabine alone. Thus, AS-1411 appears to be a promising candidate for cancer treatment in these pathologies. A greater understanding of the mechanism of action of this agent is essential to aid in future research. PMID:20140822

  2. Cyclic adenosine monophosphate phosphodiesterase activity in peripheral blood mononuclear leucocytes from patients with atopic dermatitis: correlation with respiratory atopy.


    Sawai, T; Ikai, K; Uehara, M


    We determined the cyclic adenosine monophosphate phosphodiesterase (cAMP-PDE) activity in peripheral blood mononuclear leucocytes from 100 patients with atopic dermatitis (AD) aged 13-57 years (mean +/- SD, 29.8 +/- 17.7 years). The correlation between cAMP-PDE activity and clinical parameters such as the severity of eczema and a personal or family predisposition to atopic respiratory diseases (ARD) (asthma or allergic rhinitis) was examined. Although the enzymic activity varied from normal to very high in the AD patients, cAMP-PDE activity was significantly (P < 0.005) elevated in AD patients (42.1 +/- 22.0 units) as compared with the normal controls (12.4 +/- 5.6) and clinical control subjects (13.4 +/- 9.5). In contrast, we found no correlation between cAMP-PDE activity and the severity of eczema when AD patients were classified into four categories (remission, mild, moderate and severe) according to the extent of their skin involvement. Furthermore, we found that systemic corticosteroid therapy in severe AD patients did not alter the cAMP-PDE activity. cAMP-PDE activity was significantly (P < 0.01) higher in those AD patients who had a personal history of ARD (47.2 +/- 11.2) than in AD patients with a family history of ARD (37.2 +/- 17.4) and those without a personal or family history ('pure' AD) (34.4 +/- 19.8). Nevertheless, the cAMP-PDE activity was significantly higher even in 'pure' AD patients than in the controls. These results suggest that an elevation of cAMP-PDE activity is closely related to a predisposition to respiratory atopy, and does not follow inflammation in AD patients. PMID:9666832

  3. Complexes of Cu(II) Ions and Noncovalent Interactions in Systems with L-Aspartic Acid and Cytidine-5'-Monophosphate

    PubMed Central

    Bregier-Jarzebowska, Romualda; Gasowska, Anna; Lomozik, Lechosław


    Interactions between aspartic acid (Asp) and cytidine-5-monophosphate (CMP) in metal-free systems as well as the coordination of Cu(II) ions with the above ligands were studied. The composition and overall stability constants of the species formed in those systems were determined by the potentiometric method, and the interaction centres in the ligands were identified by the spectral methods UV-Vis, EPR, NMR, and IR. In metal-free systems, the formation of adducts, in which each ligand has both positive and negative reaction centres, was established. The main reaction centres in Asp are the oxygen atoms of carboxyl groups and the nitrogen atom of the amine group, while the main reaction centre in CMP at low pH is the N(3) atom. With increasing pH, the efficiency of the phosphate group of the nucleotide in the interactions significantly increases, and the efficiency of carboxyl groups in Asp decreases. The noncovalent reaction centres in the ligands are simultaneously the potential sites of metal-ion coordination. The mode of coordination in the complexes formed in the ternary systems was established. The sites of coordination depend clearly on the solution pH. In the molecular complexes ML⋯L, metallation involves the oxygen atoms of the carboxyl groups of the amino acid, while the protonated nucleotide is in the outer coordination sphere and interacts noncovalently with the anchoring CuHx(Asp) species. The influence of the metal ions on the weak interactions between the biomolecules was established. PMID:18682818

  4. Thiamine Diphosphate in Whole Blood, Thiamine and Thiamine Monophosphate in Breast-Milk in a Refugee Population

    PubMed Central

    Stuetz, Wolfgang; Carrara, Verena Ilona; McGready, Rose; Lee, Sue Jean; Biesalski, Hans Konrad; Nosten, François Henry


    Background The provision of high doses of thiamine may prevent thiamine deficiency in the post-partum period of displaced persons. Methodology/Principal Findings The study aimed to evaluate a supplementation regimen of thiamine mononitrate (100 mg daily) at the antenatal clinics in Maela refugee camp. Women were enrolled during antenatal care and followed after delivery. Samples were collected at 12 weeks post partum. Thiamine diphosphate (TDP) in whole blood and thiamine in breast-milk of 636 lactating women were measured. Thiamine in breast-milk consisted of thiamine monophosphate (TMP) in addition to thiamine, with a mean TMP to total thiamine ratio of 63%. Mean whole blood TDP (130 nmol/L) and total thiamine in breast-milk (755 nmol/L) were within the upper range reported for well-nourished women. The prevalence of women with low whole blood TDP (<65 nmol/L) was 5% and with deficient breast-milk total thiamine (<300 nmol/L) was 4%. Whole blood TDP predicted both breast-milk thiamine and TMP (R2 = 0.36 and 0.10, p<0.001). A ratio of TMP to total thiamine ≥63% was associated with a 7.5 and 4-fold higher risk of low whole blood TDP and deficient total breast-milk thiamine, respectively. Routine provision of daily 100 mg of thiamine mononitrate post-partum compared to the previous weekly 10 mg of thiamine hydrochloride resulted in significantly higher total thiamine in breast-milk. Conclusions/Significance Thiamine supplementation for lactating women in Maela refugee camp is effective and should be continued. TMP and its ratio to total thiamine in breast-milk, reported for the first time in this study, provided useful information on thiamine status and should be included in future studies of breast-milk thiamine. PMID:22768031

  5. Enzyme Architecture: Deconstruction of the Enzyme-Activating Phosphodianion Interactions of Orotidine 5′-Monophosphate Decarboxylase

    PubMed Central


    The mechanism for activation of orotidine 5′-monophosphate decarboxylase (OMPDC) by interactions of side chains from Gln215 and Try217 at a gripper loop and R235, adjacent to this loop, with the phosphodianion of OMP was probed by determining the kinetic parameters kcat and Km for all combinations of single, double, and triple Q215A, Y217F, and R235A mutations. The 12 kcal/mol intrinsic binding energy of the phosphodianion is shown to be equal to the sum of the binding energies of the side chains of R235 (6 kcal/mol), Q215 (2 kcal/mol), Y217 (2 kcal/mol), and hydrogen bonds to the G234 and R235 backbone amides (2 kcal/mol). Analysis of a triple mutant cube shows small (ca. 1 kcal/mol) interactions between phosphodianion gripper side chains, which are consistent with steric crowding of the side chains around the phosphodianion at wild-type OMPDC. These mutations result in the same change in the activation barrier to the OMPDC-catalyzed reactions of the whole substrate OMP and the substrate pieces (1-β-d-erythrofuranosyl)orotic acid (EO) and phosphite dianion. This shows that the transition states for these reactions are stabilized by similar interactions with the protein catalyst. The 12 kcal/mol intrinsic phosphodianion binding energy of OMP is divided between the 8 kcal/mol of binding energy, which is utilized to drive a thermodynamically unfavorable conformational change of the free enzyme, resulting in an increase in (kcat)obs for OMPDC-catalyzed decarboxylation of OMP, and the 4 kcal/mol of binding energy, which is utilized to stabilize the Michaelis complex, resulting in a decrease in (Km)obs. PMID:24958125

  6. Intestinal transport of thiamin and thiamin monophosphate in rat everted jejunal sacs: a comparative study using some potential inhibitors.


    Gastaldi, G; Casirola, D; Patrini, C; Ricci, V; Laforenza, U; Ferrari, G; Rindi, G


    Rat everted jejunal sacs were incubated for 15 and 30 min at 37 degrees C in oxygenated Krebs-Henseleit buffer, pH 7.4, containing 0.2 microM [3H]-thiamin (3H-T) or [3H]-thiamin monophosphate (3H-TMP) with and without 10 mM 1-phenylalanine (PAL) or 2.5 mM levamisole (LEV). The concentrations of 3H-T and its phosphoesters in sac wall and serosal fluid were determined by a radiometric method after electrophoretic separation. In separate experiments, thiamin pyrophosphokinase (TPKase) and thiamin pyrophosphatase (TPPase) activities were determined in mucosal scrapings, with and without PAL or LEV, by using a radiometric and a colorimetric method, respectively. 3H-TMP was transported partly unchanged by an active mechanism similarly to 3H-T, but less efficiently. During transport, 3H-TMP was also enzymatically transformed to thiamin (T) and thiamin pyrophosphate, which accumulated in the tissue. In the serosal fluid, the concentration of 3H-TMP exceeded that of 3H-T. Presence of PAL or LEV with 3H-T or 3H-TMP in the incubation medium reduced the serosal transport and the tissue content of T compounds. LEV caused a dose-dependent inhibition of TPKase without affecting TPPase, whereas PAL inhibited both activities to about the same extent. These results indicate that the transport of TMP involves a number of different processes similar to those responsible for T transport. The effects of PAL and LEV underline the importance of phosphorylation-dephosphorylation coupling. PMID:2474283

  7. Cyclic adenosine monophosphate response element-binding protein transcriptionally regulates CHCHD2 associated with the molecular pathogenesis of hepatocellular carcinoma.


    Song, Rui; Yang, Biao; Gao, Xuesong; Zhang, Jinqian; Sun, Lei; Wang, Peng; Meng, Yixing; Wang, Qi; Liu, Shunai; Cheng, Jun


    The function of the novel cell migration‑promoting factor, coiled‑coil‑helix‑coiled‑coil‑helix domain containing 2 (CHCHD2) in liver cancer remains to be elucidated. The aim of the present study was to elucidate the role of CHCHD2 in liver carcinogenesis. Immunohistochemistry was performed on patients with hepatocellular carcinoma (HCC) and suppression subtractive hybridization (SSH) was used for screening differentially expressed genes in the HepG2 cell cDNA library. Chronic hepatitis C virus (HCV) infection frequently leads to liver cancer. The HCV NS2 protein is a hydrophobic transmembrane protein that is associated with certain cellular proteins. Detailed characterization of the nonstructural protein 2 (NS2) of the HCV was performed with respect to its role in transregulatory activity in the HepG2 cell lines. A gel electrophoresis mobility shift assay and a chromatin immunoprecipitation assay were used to confirm the presence of cyclic adenosine monophosphate response element‑binding protein (CREB), a transcriptional factor, which specifically interacts with the CHCHD2 promoter. CHCHD2 was highly expressed in the HCC specimens and was consistent with tumor markers of HCC. CHCHD2 was identified by SSH in the HepG2 cells. NS2 upregulated the expression of CHCHD2 by monitoring its promoter activities. The promoter of CHCHD2 contained 350 bp between nucleotides ‑257 and +93 and was positively regulated by CREB. In conclusion, the results of the present study indicated that CHCHD2 may be a novel biomarker for HCC and that CREB is important in the transcriptional activation of CHCHD2 by HCV NS2. PMID:25625293

  8. Adenosine monophosphate-activated protein kinase (AMPK) activators for the prevention, treatment and potential reversal of pathological pain

    PubMed Central

    Price, Theodore J.; Das, Vaskar; Dussor, Gregory


    Pathological pain is an enormous medical problem that places a significant burden on patients and can result from an injury that has long since healed or be due to an unidentifiable cause. Although treatments exist, they often either lack efficacy or have intolerable side effects. More importantly, they do not reverse the changes in the nervous system mediating pathological pain, and thus symptoms often return when therapies are discontinued. Consequently, novel therapies are urgently needed that have both improved efficacy and disease-modifying properties. Here we highlight an emerging target for novel pain therapies, adenosine monophosphate-activated protein kinase (AMPK). AMPK is capable of regulating a variety of cellular processes including protein translation, activity of other kinases, and mitochondrial metabolism, many of which are thought to contribute to pathological pain. Consistent with these properties, preclinical studies show positive, and in some cases disease-modifying effects of either pharmacological activation or genetic regulation of AMPK in models of nerve injury, chemotherapy-induced peripheral neuropathy (CIPN), postsurgical pain, inflammatory pain, and diabetic neuropathy. Given the AMPK-activating ability of metformin, a widely prescribed and well-tolerated drug, these preclinical studies provide a strong rationale for both retrospective and prospective human pain trials with this drug. They also argue for the development of novel AMPK activators, whether orthosteric, allosteric, or modulators of events upstream of the kinase. Together, this review will present the case for AMPK as a novel therapeutic target for pain and will discuss future challenges in the path toward development of AMPK-based pain therapeutics. PMID:26521775

  9. Curcumin inhibits aerobic glycolysis in hepatic stellate cells associated with activation of adenosine monophosphate-activated protein kinase.


    Lian, Naqi; Jin, Huanhuan; Zhang, Feng; Wu, Li; Shao, Jiangjuan; Lu, Yin; Zheng, Shizhong


    Activation of hepatic stellate cells (HSCs) is characterized by expression of extracellular matrix and loss of adipogenic phenotype during liver fibrogenesis. Emerging evidence suggests that HSCs adopt aerobic glycolysis during activation. The present work aimed at investigating whether the anti-fibrogenic effects of curcumin was associated with interfering with glycolysis in HSCs. Primary rat HSCs were cultured in vitro. We demonstrated that inhibition of glycolysis by 2-deoxyglucose or galloflavin reduced the expression of α-smooth muscle actin (α-SMA) and α1(I)procollagen at both mRNA and protein levels, and increased the intracellular lipid contents and upregulated the gene and protein expression of adipogenic transcription factors C/EBPα and PPAR-γ in HSCs. Curcumin at 20 μM produced similar effects. Moreover, curcumin decreased the expression of hexokinase (HK), phosphofructokinase-2 (PFK2), and glucose transporter 4 (glut4), three key glycolytic parameters, at both mRNA and protein levels. Curcumin also reduced lactate production concentration-dependently in HSCs. Furthermore, curcumin increased the phosphorylation of adenosine monophosphate-activated protein kinase (AMPK), but AMPK inhibitor BML-275 significantly abolished the curcumin downregulation of HK, PFK2, and glut4. In addition, curcumin inhibition of α-SMA and α1(I)procollagen was rescued by BML-275, and curcumin upregulation of C/EBPα and PPAR-γ was abrogated by BML-275. These results collectively indicated that curcumin inhibited glycolysis in an AMPK activation-dependent manner in HSCs. We revealed a novel mechanism for curcumin suppression of HSC activation implicated in antifibrotic therapy. © 2016 IUBMB Life, 68(7):589-596, 2016. PMID:27278959

  10. Multiple Decay Mechanisms and 2D-UV Spectroscopic Fingerprints of Singlet Excited Solvated Adenine-Uracil Monophosphate.


    Li, Quansong; Giussani, Angelo; Segarra-Martí, Javier; Nenov, Artur; Rivalta, Ivan; Voityuk, Alexander A; Mukamel, Shaul; Roca-Sanjuán, Daniel; Garavelli, Marco; Blancafort, Lluís


    The decay channels of singlet excited adenine uracil monophosphate (ApU) in water are studied with CASPT2//CASSCF:MM potential energy calculations and simulation of the 2D-UV spectroscopic fingerprints with the aim of elucidating the role of the different electronic states of the stacked conformer in the excited state dynamics. The adenine (1) La state can decay without a barrier to a conical intersection with the ground state. In contrast, the adenine (1) Lb and uracil S(U) states have minima that are separated from the intersections by sizeable barriers. Depending on the backbone conformation, the CT state can undergo inter-base hydrogen transfer and decay to the ground state through a conical intersection, or it can yield a long-lived minimum stabilized by a hydrogen bond between the two ribose rings. This suggests that the (1) Lb , S(U) and CT states of the stacked conformer may all contribute to the experimental lifetimes of 18 and 240 ps. We have also simulated the time evolution of the 2D-UV spectra and provide the specific fingerprint of each species in a recommended probe window between 25 000 and 38 000 cm(-1) in which decongested, clearly distinguishable spectra can be obtained. This is expected to allow the mechanistic scenarios to be discerned in the near future with the help of the corresponding experiments. Our results reveal the complexity of the photophysics of the relatively small ApU system, and the potential of 2D-UV spectroscopy to disentangle the photophysics of multichromophoric systems. PMID:27113273

  11. ABCD of the phosphodiesterase family: interaction and differential activity in COPD

    PubMed Central

    Halpin, David MG


    Phosphodiesterases (PDEs) are important enzymes that hydrolyze the cyclic nucleotides adenosine 3′5′-cyclic monophosphate (cAMP) and guanosine 3′5′-cyclic mono-phosphate (cGMP) to their inactive 5′ monophosphates. They are highly conserved across species and as well as their role in signal termination, they also have a vital role in intracellular localization of cyclic nucleotide signaling and integration of the cyclic nucleotide pathways with other signaling pathways. Because of their pivotal role in intracellular signaling, they are now of considerable interest as therapeutic targets in a wide variety diseases, including COPD where PDE inhibitors may have bronchodilator, anti-inflammatory and pulmonary vasodilator actions. This review examines the diversity and cellular localization of the isoforms of PDE, the known and speculative relevance of this to the treatment of COPD, and the range of PDE inhibitors in development together with a discussion of their possible role in treating COPD. PMID:19281073

  12. The Anti-fibrotic Actions of Relaxin Are Mediated Through a NO-sGC-cGMP-Dependent Pathway in Renal Myofibroblasts In Vitro and Enhanced by the NO Donor, Diethylamine NONOate

    PubMed Central

    Wang, Chao; Kemp-Harper, Barbara K.; Kocan, Martina; Ang, Sheng Yu; Hewitson, Tim D.; Samuel, Chrishan S.


    Introduction: The anti-fibrotic hormone, relaxin, has been inferred to disrupt transforming growth factor (TGF)-β1/Smad2 phosphorylation (pSmad2) signal transduction and promote collagen-degrading gelatinase activity via a nitric oxide (NO)-dependent pathway. Here, we determined the extent to which NO, soluble guanylate cyclase (sGC) and cyclic guanosine monophosphate (cGMP) were directly involved in the anti-fibrotic actions of relaxin using a selective NO scavenger and sGC inhibitor, and comparing and combining relaxin’s effects with that of an NO donor. Methods and Results: Primary renal cortical myofibroblasts isolated from injured rat kidneys were treated with human recombinant relaxin (RLX; 16.8 nM), the NO donor, diethylamine NONOate (DEA/NO; 0.5–5 μM) or the combined effects of RLX (16.8 nM) and DEA/NO (5 μM) over 72 h. The effects of RLX (16.8 nM) and DEA/NO (5 μM) were also evaluated in the presence of the NO scavenger, hydroxocobalamin (HXC; 100 μM) or sGC inhibitor, ODQ (5 μM) over 72 h. Furthermore, the effects of RLX (30 nM), DEA/NO (5 μM) and RLX (30 nM) + DEA/NO (5 μM) on cGMP levels were directly measured, in the presence or absence of ODQ (5 μM). Changes in matrix metalloproteinase (MMP)-2, MMP-9 (cell media), pSmad2 and α-smooth muscle actin (α-SMA; a measure myofibroblast differentiation) (cell layer) were assessed by gelatin zymography and Western blotting, respectively. At the highest concentration tested, both RLX and DEA/NO promoted MMP-2 and MMP-9 levels by 25–33%, while inhibiting pSmad2 and α-SMA expression by up to 50% (all p < 0.05 vs. untreated and vehicle-treated cells). However, 5μM of DEA/NO was required to produce the effects seen with 16.8 nM of RLX over 72 h. The anti-fibrotic effects of RLX or DEA/NO alone were completely abrogated by HXC and ODQ (both p < 0.01 vs. RLX alone or DEA/NO alone), but were significantly enhanced when added in combination (all p < 0.05 vs. RLX alone). Additionally, the direct c

  13. Polyphosphate suppresses complement via the terminal pathway

    PubMed Central

    Wat, Jovian M.; Foley, Jonathan H.; Krisinger, Michael J.; Ocariza, Linnette Mae; Lei, Victor; Wasney, Gregory A.; Lameignere, Emilie; Strynadka, Natalie C.; Smith, Stephanie A.; Morrissey, James H.


    Polyphosphate, synthesized by all cells, is a linear polymer of inorganic phosphate. When released into the circulation, it exerts prothrombotic and proinflammatory activities by modulating steps in the coagulation cascade. We examined the role of polyphosphate in regulating the evolutionarily related proteolytic cascade complement. In erythrocyte lysis assays, polyphosphate comprising more than 1000 phosphate units suppressed total hemolytic activity with a concentration to reduce maximal lysis to 50% that was 10-fold lower than with monophosphate. In the ion- and enzyme-independent terminal pathway complement assay, polyphosphate suppressed complement in a concentration- and size-dependent manner. Phosphatase-treated polyphosphate lost its ability to suppress complement, confirming that polymer integrity is required. Sequential addition of polyphosphate to the terminal pathway assay showed that polyphosphate interferes with complement only when added before formation of the C5b-7 complex. Physicochemical analyses using native gels, gel filtration, and differential scanning fluorimetry revealed that polyphosphate binds to and destabilizes C5b,6, thereby reducing the capacity of the membrane attack complex to bind to and lyse the target cell. In summary, we have added another function to polyphosphate in blood, demonstrating that it dampens the innate immune response by suppressing complement. These findings further establish the complex relationship between coagulation and innate immunity. PMID:24335501

  14. The cAMP Pathway as Therapeutic Target in Autoimmune and Inflammatory Diseases

    PubMed Central

    Raker, Verena Katharina; Becker, Christian; Steinbrink, Kerstin


    Nucleotide signaling molecules contribute to the regulation of cellular pathways. In the immune system, cyclic adenosine monophosphate (cAMP) is well established as a potent regulator of innate and adaptive immune cell functions. Therapeutic strategies to interrupt or enhance cAMP generation or effects have immunoregulatory potential in autoimmune and inflammatory disorders. Here, we provide an overview of the cyclic AMP axis and its role as a regulator of immune functions and discuss the clinical and translational relevance of interventions with these processes. PMID:27065076

  15. Oocyte maturation and fertilization in marine nemertean worms: using similar sorts of signaling pathways as in mammals, but often with differing results.


    Stricker, Stephen A; Cline, Cory; Goodrich, David


    In marine worms belonging to the phylum Nemertea, oocyte maturation and fertilization are regulated by the same general kinds of signals that control such processes in mammals. However, unlike mammalian oocytes that develop within follicles, nemertean oocytes characteristically lack a surrounding sheath of follicle cells and often respond differently to maturation-related cues than do mammalian oocytes. For example, elevators of cyclic adenosine monophosphate (cAMP) or cyclic guanosine monophosphate (cGMP) levels promote the resumption of meiotic maturation (=germinal vesicle breakdown, GVBD) in nemertean oocytes, whereas increasing intraoocytic cAMP and cGMP typically blocks GVBD in mammals. Similarly, AMP-activated kinase (AMPK) signaling keeps nemertean oocytes from maturing, but in mouse oocytes, AMPK activation triggers GVBD. In addition, protein kinase C (PKC) activity is required for seawater-induced GVBD in nemerteans, whereas some PKCs have been shown to inhibit GVBD in mammals. Furthermore, although fertilization causes both types of oocytes to reorganize their endoplasmic reticulum and generate calcium oscillations that can involve soluble sperm factor activity and inositol 1,4,5-trisphosphate signaling, some discrepancies in the spatiotemporal patterns and underlying mechanisms of fertilization are also evident in nemerteans versus mammals. Thus, to characterize differences and similarities in gamete biology more fully, aspects of oocyte maturation and fertilization in marine nemertean worms are reviewed and briefly compared with related findings that have been published for mammalian oocytes. In addition, possible causes of the alternative responses displayed by oocytes in these two animal groups are addressed. PMID:23995739

  16. Modulation of neurotrophic signaling pathways by polyphenols

    PubMed Central

    Moosavi, Fatemeh; Hosseini, Razieh; Saso, Luciano; Firuzi, Omidreza


    Polyphenols are an important class of phytochemicals, and several lines of evidence have demonstrated their beneficial effects in the context of a number of pathologies including neurodegenerative disorders such as Alzheimer’s and Parkinson’s disease. In this report, we review the studies on the effects of polyphenols on neuronal survival, growth, proliferation and differentiation, and the signaling pathways involved in these neurotrophic actions. Several polyphenols including flavonoids such as baicalein, daidzein, luteolin, and nobiletin as well as nonflavonoid polyphenols such as auraptene, carnosic acid, curcuminoids, and hydroxycinnamic acid derivatives including caffeic acid phentyl ester enhance neuronal survival and promote neurite outgrowth in vitro, a hallmark of neuronal differentiation. Assessment of underlying mechanisms, especially in PC12 neuronal-like cells, reveals that direct agonistic effect on tropomyosin receptor kinase (Trk) receptors, the main receptors of neurotrophic factors including nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF) explains the action of few polyphenols such as 7,8-dihydroxyflavone. However, several other polyphenolic compounds activate extracellular signal-regulated kinase (ERK) and phosphoinositide 3-kinase (PI3K)/Akt pathways. Increased expression of neurotrophic factors in vitro and in vivo is the mechanism of neurotrophic action of flavonoids such as scutellarin, daidzein, genistein, and fisetin, while compounds like apigenin and ferulic acid increase cyclic adenosine monophosphate response element-binding protein (CREB) phosphorylation. Finally, the antioxidant activity of polyphenols reflected in the activation of Nrf2 pathway and the consequent upregulation of detoxification enzymes such as heme oxygenase-1 as well as the contribution of these effects to the neurotrophic activity have also been discussed. In conclusion, a better understanding of the neurotrophic effects of polyphenols and

  17. Human lower oesophageal sphincter relaxation is associated with raised cyclic nucleotide content.

    PubMed Central

    Barnette, M S; Barone, F C; Fowler, P J; Grous, M; Price, W J; Ormsbee, H S


    Increases in cyclic adenosine monophosphate and cyclic guanosine monophosphate content accompany relaxation of isolated strips of opossum and canine lower oesophageal sphincter muscle. The aim of this investigation was to characterise these responses in isolated muscle from the human lower oesophageal sphincter. Electrical stimulation of enteric neurons produced a frequency dependent relaxation of the human lower oesophageal sphincter that was sensitive to tetrodotoxin. Furthermore, as previously shown in the opossum and canine lower oesophageal sphincter, cyclic guanosine monophosphate content was significantly raised in muscle strips frozen during maximum electrical field stimulation whereas cyclic adenosine monophosphate content was unchanged. In addition, sodium nitroprusside (EC50 = 0.1 microM) produced a concentration dependent relaxation of human lower oesophageal sphincter, significantly increased cyclic guanosine monophosphate content, but did not alter cyclic adenosine monophosphate content. Zaprinast (M&B 22948) and SK&F 94120, selective inhibitors of cyclic guanosine monophosphate and cyclic adenosine monophosphate phosphodiesterases, respectively, both relaxed human lower oesophageal sphincter with a potency similar to that seen in the dog or opossum lower oesophageal sphincter. Finally, the 8-bromo analogues of both cyclic adenosine monophosphate (EC50 = 420 microM) and cyclic guanosine monophosphate (EC50 = 100 microM) relaxed the human lower oesophageal sphincter. These studies suggest that in the human, as well as the canine and opossum lower oesophageal sphincter, increases in cyclic nucleotide content are associated with relaxation and increases in cyclic guanosine monophosphate are associated with the relaxation induced by stimulation of enteric neurons. PMID:1846837

  18. Association of blood lead levels with urinary F2-8α Isoprostane and 8-hydroxy-2-deoxy-Guanosine concentrations in first-grade Uruguayan children

    PubMed Central

    Roy, Aditi; Queirolo, Elena; Peregalli, Fabiana; Mañay, Nelly; Martínez, Gabriela; Kordas, Katarzyna


    Oxidative stress (OS) is a potential molecular mechanism for lead-induced toxicities, yet, we have limited understanding of the relation between low-level lead (Pb) exposure and OS, especially in children. This cross-sectional study examines the association between blood lead level (BLL) and two OS markers—urinary F2-8α isoprostane or isoprostane (a marker of lipid peroxidation) and 8-hydroxy-2-deoxy-Guanosine or 8-OH-dG (a marker of DNA damage) in 211 children, aged 5–8 years, from Montevideo, Uruguay. The role of dietary intakes of vitamin C and zinc in modifying the relation between BLL and OS was also examined. The mean (SD) BLL of the study children was 4.7 (2.2) μg/dL, with 30.2% children having BLL ≥5 μg/dL, the current reference level set by the US Centre for Disease Control for identifying, monitoring and management of children with elevated BLL. In covariate-adjusted analysis, there was a weak positive association between BLL and urinary isoprostane (adjusted for specific gravity) [β = 0.09, p< 0.1]. No association was found between children’s BLL and urinary 8-OH-dG. Interactions between dietary intakes of vitamin C or zinc and BLL on OS biomarkers were not consistent. However, when BLL and vitamin C or BLL and zinc were modeled together, BLL was independently associated with isoprostane concentration [β = 0.10, p< 0.05] but vitamin C or zinc intake was not. These findings suggest that there may be a potential adverse effect of BLL on OS in children with low-level Pb exposure. There is a need to study the effects of Pb on other OS measures, as well as the role of OS in mediating low-level Pb toxicity on functional outcomes. PMID:25863186

  19. Neuroprotection Promoted by Guanosine Depends on Glutamine Synthetase and Glutamate Transporters Activity in Hippocampal Slices Subjected to Oxygen/Glucose Deprivation.


    Dal-Cim, Tharine; Martins, Wagner C; Thomaz, Daniel T; Coelho, Victor; Poluceno, Gabriela Godoy; Lanznaster, Débora; Vandresen-Filho, Samuel; Tasca, Carla I


    Guanosine (GUO) has been shown to act as a neuroprotective agent against glutamatergic excitotoxicity by increasing glutamate uptake and decreasing its release. In this study, a putative effect of GUO action on glutamate transporters activity modulation was assessed in hippocampal slices subjected to oxygen and glucose deprivation (OGD), an in vitro model of brain ischemia. Slices subjected to OGD showed increased excitatory amino acids release (measured by D-[(3)H]aspartate release) that was prevented in the presence of GUO (100 µM). The glutamate transporter blockers, DL-TBOA (10 µM), DHK (100 µM, selective inhibitor of GLT-1), and sulfasalazine (SAS, 250 µM, Xc(-) system inhibitor) decreased OGD-induced D-aspartate release. Interestingly, DHK or DL-TBOA blocked the decrease in glutamate release induced by GUO, whereas SAS did not modify the GUO effect. GUO protected hippocampal slices from cellular damage by modulation of glutamate transporters, however selective blockade of GLT-1 or Xc- system only did not affect this protective action of GUO. OGD decreased hippocampal glutamine synthetase (GS) activity and GUO recovered GS activity to control levels without altering the kinetic parameters of GS activity, thus suggesting GUO does not directly interact with GS. Additionally, the pharmacological inhibition of GS activity with methionine sulfoximine abolished the effect of GUO in reducing D-aspartate release and cellular damage evoked by OGD. Altogether, results in hippocampal slices subjected to OGD show that GUO counteracts the release of excitatory amino acids, stimulates the activity of GS, and decreases the cellular damage by modulation of glutamate transporters activity. PMID:26858177

  20. Kinetics of the interaction of translation factor SelB from Escherichia coli with guanosine nucleotides and selenocysteine insertion sequence RNA.


    Thanbichler, M; Bock, A; Goody, R S


    The kinetics of the interaction of GTP and GDP with SelB, the specific translation factor for the incorporation of selenocysteine into proteins, have been investigated using the stopped-flow method. Useful signals were obtained using intrinsic (i.e. tryptophan) fluorescence, the fluorescence of methylanthraniloyl derivatives of nucleotides, or fluorescence resonance energy transfer from tryptophan to the methylanthraniloyl group. The affinities of SelB for GTP (K(d) = 0.74 micrometer) and GDP (K(d) = 13.4 micrometer) were considerably lower than those of other translation factors. Of functional significance is the fact that the rate constant for GDP release from its complex with SelB (15 s(-)(1)) is many orders of magnitude larger than for elongation factor Tu, explaining why a GDP/GTP exchange factor is not required for the action of SelB. In contrast, the rate of release of GTP is 2 orders of magnitude slower and not significantly faster than for elongation factor Tu. Using a fluorescently labeled 17-nucleotide RNA minihelix that represents a binding site for the protein and that is part of the fdhF selenocysteine insertion sequence element positioned immediately downstream of the UGA triplet coding for selenocysteine incorporation, the kinetics of the interaction were studied. The high affinity of the interaction (K(d) approximately 1 nm) appeared to be increased even further when selenocysteyl-tRNA(Sec) was bound to SelB, but to be independent of the presence or nature of the guanosine nucleotide at the active site. These results suggest that the affinity of SelB for its RNA binding site is maximized when charged tRNA is bound and decreases to allow dissociation and reading of codons downstream of the selenocysteine codon after selenocysteine peptide bond formation. PMID:10781605

  1. Study of orotidine 5'-monophosphate decarboxylase in complex with the top three OMP, BMP, and PMP ligands by molecular dynamics simulation.


    Jamshidi, Shirin; Jalili, Seifollah; Rafii-Tabar, Hashem


    Catalytic mechanism of orotidine 5'-monophosphate decarboxylase (OMPDC), one of the nature most proficient enzymes which provides large rate enhancement, has not been fully understood yet. A series of 30 ns molecular dynamics (MD) simulations were run on X-ray structure of the OMPDC from Saccharomyces cerevisiae in its free form as well as in complex with different ligands, namely 1-(5'-phospho-D-ribofuranosyl) barbituric acid (BMP), orotidine 5'-monophosphate (OMP), and 6-phosphonouridine 5'-monophosphate (PMP). The importance of this biological system is justified both by its high rate enhancement and its potential use as a target in chemotherapy. This work focuses on comparing two physicochemical states of the enzyme (protonated and deprotonated Asp91) and three ligands (substrate OMP, inhibitor, and transition state analog BMP and substrate analog PMP). Detailed analysis of the active site geometry and its interactions is properly put in context by extensive comparison with relevant experimental works. Our overall results show that in terms of hydrogen bond occupancy, electrostatic interactions, dihedral angles, active site configuration, and movement of loops, notable differences among different complexes are observed. Comparison of the results obtained from these simulations provides some detailed structural data for the complexes, the enzyme, and the ligands, as well as useful insights into the inhibition mechanism of the OMPDC enzyme. Furthermore, these simulations are applied to clarify the ambiguous mechanism of the OMPDC enzyme, and imply that the substrate destabilization and transition state stabilization contribute to the mechanism of action of the most proficient enzyme, OMPDC. PMID:24559040

  2. LDL-cholesterol reduction in patients with hypercholesterolemia by modulation of adenosine triphosphate-citrate lyase and adenosine monophosphate-activated protein kinase

    PubMed Central

    Filippov, Sergey; Pinkosky, Stephen L.; Newton, Roger S.


    Purpose of review To review the profile of ETC-1002, as shown in preclinical and clinical studies, including LDL-cholesterol (LDL-C)-lowering activity and beneficial effects on other cardiometabolic risk markers as they relate to the inhibition of adenosine triphosphate-citrate lyase and the activation of adenosine monophosphate-activated protein kinase. Recent findings ETC-1002 is an adenosine triphosphate-citrate lyase inhibitor/adenosine monophosphate-activated protein kinase activator currently in Phase 2b clinical development. In seven Phase 1 and Phase 2a clinical studies, ETC-1002 dosed once daily for 2–12 weeks has lowered LDL-C and reduced high-sensitivity C-reactive protein by up to 40%, with neutral to positive effects on glucose levels, blood pressure, and body weight. Importantly, use of ETC-1002 in statin-intolerant patients has shown statin-like lowering of LDL-C without the muscle pain and weakness responsible for discontinuation of statin use by many patients. ETC-1002 has also been shown to produce an incremental benefit, lowering LDL-C as an add-on therapy to a low-dose statin. In over 300 individuals in studies of up to 12 weeks, ETC-1002 has been well tolerated with no serious adverse effects. Summary Because adenosine triphosphate-citrate lyase and adenosine monophosphate-activated protein kinase play central roles in regulating lipid and glucose metabolism, pharmacological modulation of these two enzymes could provide an important therapeutic alternative for statin-intolerant patients with hypercholesterolemia. PMID:24978142

  3. A mutualistic fungal symbiont of perennial ryegrass contains two different pyr4 genes, both expressing orotidine-5'-monophosphate decarboxylase.


    Collett, M A; Bradshaw, R E; Scott, D B


    A fragment of the Claviceps purpurea pyr4 gene, encoding orotidine-5'-monophosphate decarboxylase (OMP decarboxylase), was used to screen a genomic library from an isolate of a fungus, Acremonium sp. (designated Lp1), which grows as an endophyte in perennial ryegrass (Lolium perenne). Three positive clones, lambda MC11, lambda MC12 and lambda MC14, were isolated. Two of these clones, lambda MC12 and lambda MC14, were overlapping clones from the same locus, while lambda MC11 was from a different locus. Fragments of these clones which hybridised with C. purpurea pyr4 were sequenced and found to have similarity with pyr4 from other Pyrenomycete fungi. The pyr4 gene from lambda MC12 and lambda MC14 was designated pyr4-1 and that from lambda MC11 was designated pyr4-2. The predicted ORFs of the two genes were highly conserved, with 97.5% identity at the nucleotide level, the 5' non-coding sequences were the least conserved with 88.5% identity and the 3' non-coding sequences had 93.0% identity. RT-PCR analysis of total RNA from Lp1 demonstrated that transcripts from the two genes were present at similar levels, and hybridisation of pyr4-1 to Northern blots of total RNA from Lp1 showed that full-length transcripts were being produced. Genomic fragments containing pyr4 were transformed into a strain of Aspergillus nidulans which has a mutation in pyrG (encoding OMP decarboxylase). Both pyr4-1 and pyr4-2 complemented the pyrG mutation in A. nidulans, indicating that both encode functional OMP decarboxylases. It has been proposed [Schardl et al., Genetics 136 (1994) 1307-1317] that the two pyr4 in Lp1 arose by interspecific hybridisation, most likely between the ryegrass choke pathogen, Epichloë typhina, and another endophyte from perennial ryegrass, Acremonium lolii. Analysis by PCR amplification and direct sequencing of the variable 5' non-coding regions of pyr4, from possible ancestors to Lp1 supports this hypothesis. Comparisons of these sequences to the 5' non

  4. Design, Synthesis, and Evaluation of Anti-HBV Activity of Hybrid Molecules of Entecavir and Adefovir: Exomethylene Acycloguanine Nucleosides and Their Monophosphate Derivatives.


    Imoto, Shuhei; Kohgo, Satoru; Tokuda, Ryoh; Kumamoto, Hiroki; Aoki, Manabu; Amano, Masayuki; Kuwata-Higashi, Nobuyo; Mitsuya, Hiroaki; Haraguchi, Kazuhiro


    Exomethylene acycloguanine nucleosides 4, 6 and its monophosphate derivatives 5, 7, and 8 have been synthesized. Mitsunobu-type coupling of 2-N-acetyl-6-O-diphenylcarbamoylguanine (11) with primary alcohols proceeded regioselectively to furnish the desired N(9)-substituted products in moderate yield. Evaluation of 4-8 for anti-HBV activity in HepG2 cells revealed that the phosphonate derivative 8 was found to exhibit moderated activity (EC50 value of 0.29 μM), but cytotoxicity (CC50 value of 39 μM) against the host cells was also observed. PMID:26167667

  5. Characterization of radiation-induced products of thymidine 3{prime}-monophosphate and thymidylyl (3{prime}{yields}5{prime}) thymidine by high-performance liquid chromatography and laser-desorption fourier-transform mass spectrometry

    SciTech Connect

    Yoshida, H.; Hettich, R.L.


    High-performance liquid chromatography (HPLC) and laser-desorption Fourier-transform mass spectrometry (LD FTMS) have been applied for direct measurements of radiation-induced products of nucleic acid constituents containing thymidine. Laser desorption FTMS could be used for the direct detection (neither hydrolyzed nor derivatized) of X-ray-induced decomposition products of aqueous thymidine monophosphate. After these initial experiments, a variety of hydrogenated and hydroxylated thymine standards were acquired and examined by FTMS to assist in the identification of unknown radiation-induced decomposition products of thymine-containing nucleotides and dinucleotides. To extend these studies to dinucleotides, the radiation-induced products generated by the gamma radiolysis of thymidylyl (3{prime}{yields}5{prime}) thymidine (TpT) were isolated by reverse-phase HPLC and identified by LD FTMS. Thymine and thymidine 3{prime}-monophosphate were observed as the major products in this case. Several of the minor products of the HPLC profile were pooled in a single fraction and characterized simultaneously by LD FTMS. The resulting mass spectra indicated the presence of hydroxy-5,6-dihydothymidine monophosphate, 5,6-dihydrothymidine monophosphate and thymidine monophosphate, thymine glycol, hydroxy-5,6-dihydrothymine, 5-hydroxy-methyl-uracil and 5,6-dihydrothymine. The combination of HPLC purification and LD FTMS structural characterization provides a useful tool for the direct measurement of radiation-induced products of nucleotides and dinucleotides. 28 refs., 6 figs., 2 tabs.

  6. Nitrogen regulates CRY1 phosphorylation and circadian clock input pathways.


    Zhou, Yang-Hong; Zhang, Zhong-Wei; Zheng, Chong; Yuan, Shu; He, Yikun


    The delayed flowering phenotype caused by nitrogen (N) fertilizer application has been known for a long time, but we know little about the specific molecular mechanism for this phenomenon before. Our study indicated that low nitrogen increases the NADPH/NADP(+) and ATP/AMP ratios which affect adenosine monophosphate-activated protein kinase (AMPK) activity and phosphorylation and abundance of nuclear CRY1 protein. Then CRY1 acts in the N signal input pathway to the circadian clock. Here we further discuss: (1) the role of C/N ratio in flowering, (2) circadian oscillation of plant AMPK transcripts and proteins, (3) conservation of nutrition-mediated CRY1 phosphorylation and degradation, and (4) crosstalks between nitrogen signals and nitric oxide (NO) signals in flowering. PMID:27617369

  7. The cyclic AMP signaling pathway: Exploring targets for successful drug discovery (Review)

    PubMed Central



    During development of disease, complex intracellular signaling pathways regulate an intricate series of events, including resistance to external toxins, the secretion of cytokines and the production of pathological phenomena. Adenosine 3′,5′-cyclic monophosphate (cAMP) is a nucleotide that acts as a key second messenger in numerous signal transduction pathways. cAMP regulates various cellular functions, including cell growth and differentiation, gene transcription and protein expression. This review aimed to provide an understanding of the effects of the cAMP signaling pathway and the associated factors on disease occurrence and development by examining the information from a new perspective. These novel insights aimed to promote the development of novel therapeutic approaches and aid in the development of new drugs. PMID:27035868

  8. Solution structure of ligands involved in purine salvage pathway.


    Karnawat, Vishakha; Puranik, Mrinalini


    Analogues of intermediates involved in the purine salvage pathway can be exploited as potential drug molecules against enzymes of protozoan parasites. To develop such analogues we need knowledge of the solution structures, predominant tautomer at physiological pH and protonation-state of the corresponding natural ligand. In this regard, we have employed ultraviolet resonance Raman spectroscopy (UVRR) in combination with density functional theory (DFT) to study the solution structures of two relatively unexplored intermediates, 6-phosphoryl IMP (6-pIMP) and succinyl adenosine-5'-monophosphate (sAMP), of purine salvage pathway. These molecules are intermediates in a two step enzymatic process that converts inosine-5'-monpophosphate (IMP) to adenosine-5'-monophosphate (AMP). Experimental data on the molecular structure of these ligands is lacking. We report UVRR spectra of these two ligands, obtained at an excitation wavelength of 260 nm. Using isotope induced shifts and DFT calculations we assigned observed spectra to computed normal modes. We find that sAMP exists as neutral species at physiological pH and the predominant tautomer in solution bears proton at N10 position of purine ring. Though transient in solution, 6-pIMP is captured in the enzyme-bound form. This work provides the structural information of these ligands in solution state at physiological pH. We further compare these structures with the structures of AMP and IMP. Despite the presence of similar purine rings in AMP and sAMP, their UVRR spectra are found to be very different. Similarly, though the purine ring in 6-pIMP resembles that of IMP, UVRR spectra of the two molecules are distinct. These differences in the vibrational spectra provide direct information on the effects of exocyclic groups on the skeletal structures of these molecules. Our results identify key bands in the vibrational spectra of these ligands which may serve as markers of hydrogen bonding interactions upon binding to the active

  9. Gonadotropin stimulation of cyclic adenosine monophosphate and testosterone production without detectable high-affinity binding sites in purified Leydig cells from rat testis

    SciTech Connect

    Browne, E.S.; Bhalla, V.K. )


    Rat testicular interstitial cells were separated by three different gradient-density procedures and, with each, two biochemically and morphologically distinct cell fractions were isolated. The lighter density cells in fraction-I bound iodine 125-labeled human chorionic gonadotropin (hCG) with high-affinity (apparent equilibrium dissociation constant, Kd, approximately 10{sup {minus} 10} M) without producing either cyclic adenosine monophosphate or testosterone in response to hormone action. The heavier-density cells displayed morphologic features typical of Leydig cells and produced cyclic adenosine monophosphate and testosterone in the presence of hCG without detectable {sup 125}I-labeled hCG high-affinity binding. These cell fractions were further characterized by studies using deglycosylated hCG, a known antagonist to hCG action. Cell concentration-dependent studies with purified Leydig cells revealed that maximal testosterone production was achieved when lower cell concentrations (0.5 x 10(6) cells/250 microliters) were used for in vitro hCG stimulation assays. Under these conditions, the {sup 125}I-labeled hCG binding was barely detectable (2.24 fmol; 2,698 sites/cell). Furthermore, these studies revealed that the hCG-specific binding in Leydig cells is overestimated by the classic method for nonspecific binding correction using excess unlabeled hormone. An alternate method is presented.

  10. GhLTPG1, a cotton GPI-anchored lipid transfer protein, regulates the transport of phosphatidylinositol monophosphates and cotton fiber elongation

    PubMed Central

    Deng, Ting; Yao, Hongyan; Wang, Jin; Wang, Jun; Xue, Hongwei; Zuo, Kaijing


    The cotton fibers are seed trichomes that elongate from the ovule epidermis. Polar lipids are required for the quick enlargement of cell membrane and fiber cell growth, however, how lipids are transported from the ovules into the developing fibers remains less known. Here, we reported the functional characterization of GhLTPG1, a GPI-anchored lipid transport protein, during cotton fiber elongation. GhLTPG1 was abundantly expressed in elongating cotton fibers and outer integument of the ovules, and GhLTPG1 protein was located on cell membrane. Biochemical analysis showed that GhLTPG1 specifically bound to phosphatidylinositol mono-phosphates (PtdIns3P, PtdIns4P and PtdIns5P) in vitro and transported PtdInsPs from the synthesis places to the plasma membranes in vivo. Expression of GhLTPG1 in Arabidopsis caused an increased number of trichomes, and fibers in GhLTPG1-knockdown cotton plants exhibited significantly reduced length, decreased polar lipid content, and repression of fiber elongation-related genes expression. These results suggested that GhLTPG1 protein regulates the cotton fiber elongation through mediating the transport of phosphatidylinositol monophosphates. PMID:27311358

  11. GhLTPG1, a cotton GPI-anchored lipid transfer protein, regulates the transport of phosphatidylinositol monophosphates and cotton fiber elongation.


    Deng, Ting; Yao, Hongyan; Wang, Jin; Wang, Jun; Xue, Hongwei; Zuo, Kaijing


    The cotton fibers are seed trichomes that elongate from the ovule epidermis. Polar lipids are required for the quick enlargement of cell membrane and fiber cell growth, however, how lipids are transported from the ovules into the developing fibers remains less known. Here, we reported the functional characterization of GhLTPG1, a GPI-anchored lipid transport protein, during cotton fiber elongation. GhLTPG1 was abundantly expressed in elongating cotton fibers and outer integument of the ovules, and GhLTPG1 protein was located on cell membrane. Biochemical analysis showed that GhLTPG1 specifically bound to phosphatidylinositol mono-phosphates (PtdIns3P, PtdIns4P and PtdIns5P) in vitro and transported PtdInsPs from the synthesis places to the plasma membranes in vivo. Expression of GhLTPG1 in Arabidopsis caused an increased number of trichomes, and fibers in GhLTPG1-knockdown cotton plants exhibited significantly reduced length, decreased polar lipid content, and repression of fiber elongation-related genes expression. These results suggested that GhLTPG1 protein regulates the cotton fiber elongation through mediating the transport of phosphatidylinositol monophosphates. PMID:27311358

  12. INX-08189, a Phosphoramidate Prodrug of 6-O-Methyl-2′-C-Methyl Guanosine, Is a Potent Inhibitor of Hepatitis C Virus Replication with Excellent Pharmacokinetic and Pharmacodynamic Properties▿

    PubMed Central

    Vernachio, John H.; Bleiman, Blair; Bryant, K. Dawn; Chamberlain, Stanley; Hunley, Damound; Hutchins, Jeff; Ames, Brenda; Gorovits, Elena; Ganguly, Babita; Hall, Andrea; Kolykhalov, Alexander; Liu, Yule; Muhammad, Jerry; Raja, Nicholas; Walters, C. Robin; Wang, Jin; Williams, Karen; Patti, Joseph M.; Henson, Geoffrey; Madela, Karolina; Aljarah, Mohamed; Gilles, Arnaud; McGuigan, Christopher


    INX-08189 is an aryl-phosphoramidate of 6-O-methyl-2′-C-methyl guanosine. INX-08189 was highly potent in replicon assays, with a 50% effective concentration of 10 ± 6 nM against hepatitis C genotype 1b at 72 h. The inhibitory effect on viral replication was rapid, with a 50% effective concentration (EC50) of 35 ± 8 nM at 24 h. An intracellular 2′-C-methyl guanosine triphosphate (2′-C-MeGTP) concentration of 2.43 ± 0.42 pmol/106 cells was sufficient to achieve 90% inhibition of viral replication. In vitro resistance studies confirmed that the S282T mutation in the NS5b gene conferred an approximately 10-fold reduction in sensitivity to INX-08189. However, the complete inhibition of S282T mutant replicons still could be achieved with an EC90 of 344 ± 170 nM. Drug combination studies of INX-08189 and ribavirin indicated significant synergy in antiviral potency both in wild-type and S282T-expressing replicons. Genotype 1b replicons could be cleared after 14 days of culture when exposed to as little as 20 nM INX-08189. No evidence of mitochondrial toxicity was observed after 14 days of INX-08189 exposure in both HepG2 and CEM human cell lines. In vivo studies of rats and cynomolgus monkeys demonstrated that 2′-C-MeGTP concentrations in liver equivalent to the EC90 could be attained after a single oral dose of INX-08189. Rat liver 2′-C-MeGTP concentrations were proportional to dose, sustained for greater than 24 h, and correlated with plasma concentrations of the nucleoside metabolite 2′-C-methyl guanosine. The characteristics displayed by INX-08189 support its continued development as a clinical candidate for the treatment of chronic HCV infection. PMID:21357300

  13. INX-08189, a phosphoramidate prodrug of 6-O-methyl-2'-C-methyl guanosine, is a potent inhibitor of hepatitis C virus replication with excellent pharmacokinetic and pharmacodynamic properties.


    Vernachio, John H; Bleiman, Blair; Bryant, K Dawn; Chamberlain, Stanley; Hunley, Damound; Hutchins, Jeff; Ames, Brenda; Gorovits, Elena; Ganguly, Babita; Hall, Andrea; Kolykhalov, Alexander; Liu, Yule; Muhammad, Jerry; Raja, Nicholas; Walters, C Robin; Wang, Jin; Williams, Karen; Patti, Joseph M; Henson, Geoffrey; Madela, Karolina; Aljarah, Mohamed; Gilles, Arnaud; McGuigan, Christopher


    INX-08189 is an aryl-phosphoramidate of 6-O-methyl-2'-C-methyl guanosine. INX-08189 was highly potent in replicon assays, with a 50% effective concentration of 10±6 nM against hepatitis C genotype 1b at 72 h. The inhibitory effect on viral replication was rapid, with a 50% effective concentration (EC50) of 35±8 nM at 24 h. An intracellular 2'-C-methyl guanosine triphosphate (2'-C-MeGTP) concentration of 2.43±0.42 pmol/10(6) cells was sufficient to achieve 90% inhibition of viral replication. In vitro resistance studies confirmed that the S282T mutation in the NS5b gene conferred an approximately 10-fold reduction in sensitivity to INX-08189. However, the complete inhibition of S282T mutant replicons still could be achieved with an EC90 of 344±170 nM. Drug combination studies of INX-08189 and ribavirin indicated significant synergy in antiviral potency both in wild-type and S282T-expressing replicons. Genotype 1b replicons could be cleared after 14 days of culture when exposed to as little as 20 nM INX-08189. No evidence of mitochondrial toxicity was observed after 14 days of INX-08189 exposure in both HepG2 and CEM human cell lines. In vivo studies of rats and cynomolgus monkeys demonstrated that 2'-C-MeGTP concentrations in liver equivalent to the EC90 could be attained after a single oral dose of INX-08189. Rat liver 2'-C-MeGTP concentrations were proportional to dose, sustained for greater than 24 h, and correlated with plasma concentrations of the nucleoside metabolite 2'-C-methyl guanosine. The characteristics displayed by INX-08189 support its continued development as a clinical candidate for the treatment of chronic HCV infection. PMID:21357300

  14. Interaction of tRNA with tRNA (guanosine-1)methyltransferase: binding specificity determinants involve the dinucleotide G36pG37 and tertiary structure.


    Redlak, M; Andraos-Selim, C; Giege, R; Florentz, C; Holmes, W M


    The sequence G37pG36 is present in all tRNA species recognized and methylated by the Escherichia coli modification enzyme tRNA (guanosine-1)methyltransferase. We have examined whether this dinucleotide sequence provides the base specific recognition signal for this enzyme and have assessed the role of the remaining tRNA in recognition. E. coli tRNAHis and yeast tRNAAsp were substituted with G at positions 36 and 37 and were found to be excellent substrates for methylation. This suggested that the general tRNA structure can be specifically bound by the enzyme. In addition, heterologous tRNA species including fully modified tRNA1Leu are excellent inhibitors of tRNA1Leu transcript methylation. Analyses of structural variants of yeast tRNAAsp and E. coli tRNA1Leu demonstrate clearly that the core tertiary structures of tRNA are required for recognition and that G37 must be in the correct position in space relative to important contacts elsewhere in the molecule. This latter conclusion was reached because the addition of one to three stacked base pairs in the anticodon stem of tRNA1Leu dramatically alters activity. In this case, the G37 base is rotated away from the correct position in space relative to other tRNA contact sites. The acceptor stem structure is required for optimal activity since deletion of three or five base pairs is detrimental to activity; however, specific base sequence may not be important because (i) the addition of three stacked base pairs of different sequence had little effect on activity and (ii) heterologous tRNAs with little or no sequence homology in the acceptor stem are excellent substrates. Both poly G and GpG are potent and specific inhibitors of enzyme activity and are minimal substrates which can be methylated, forming m1G. Taken together, these studies suggest that 1MGT can bind the general tRNA structure and that the crucial base-pair contacts are G37 and G36. PMID:9220956

  15. Pharmacokinetic Profile and Acute Toxicological Properties of a Novel Radiosensitizer Cytosine-Phosphate-Guanosine Oligodeoxynucleotide 107 in Mice Following Intravenous and Orthotopic Administration.


    Cen, Yanyan; Li, Xiaoli; Yin, Zhiwei; Yan, Zifei; Liu, Dan; Peng, Wei; Pan, Feng; Zhou, Hong


    The synthetic cytosine-phosphate-guanosine oligodeoxynucleotide 107 (CpG ODN107) is a novel radiosensitizer for glioma treatment. However, the information related to its pharmacokinetics and toxicity remains unclear. Therefore, the plasma pharmacokinetics, distribution, elimination, and acute toxicity of CpG ODN107 in mice were investigated in the present experiments. The results from the liquid chromatography-tandem mass spectrometry (LC-MS/MS) assay showed that the plasma elimination half-life (t1/2β) of CpG ODN107 in BALB/c mice varied slightly with the dose, and it was 0.65, 0.49, and 0.50 h at the intravenous doses of 2.5, 5, and 10 mg/kg, respectively. CpG ODN107 rapidly and widely distributed in organs/tissues, except the brain and testes. The highest concentrations were found in the liver (28.6% of the administered dose after 0.5 h) and the kidneys (5.7% of the administered dose after 1 h). CpG ODN107 (0.3, 3, and 30 μg/mL) could highly bind to human and mouse plasma proteins in vitro. CpG ODN107 in the forms of prototype was excreted in urine (1.79%) and feces (0.91%), and its shortened metabolites were excreted in urine (2.1%) and feces (2.2%) within the first 24 h. The mice in vivo optical image showed CpG ODN107 labeled with Alexa Fluor 680 fluorochrome (AF680) accumulated in the brain after orthotopic injection, eliminated very slowly, and excreted in urine compared with poly T labeled with AF680. The median lethal dose (LD50) of CpG ODN107 was 75.7 mg/kg for mice; this dose only could produce apparent spleen and liver damage, in line with the distribution features of CpG ODN. In conclusion, our present pharmacokinetic and toxicity investigation will provide helpful information to further pharmacodynamic and pharmacokinetic research of CpG ODN107 and other oligodeoxynucleotide drugs in the future. PMID:26213852

  16. Signal transduction pathways leading to the production of IL-8 by human monocytes are differentially regulated by dexamethasone.

    PubMed Central

    Anttila, H S; Reitamo, S; Ceska, M; Hurme, M


    Previous studies have shown that IL-8 gene expression is enhanced by various stimuli, which induce different signal transduction pathways. A lipopolysaccharide (LPS)-induced pathway has been reported to be inhibited by glucocorticoids in monocytes. We have now examined the effect of dexamethasone on the LPS-induced and other signal transduction pathways leading to the production of IL-8 by human monocytes. Dexamethasone inhibited the production of IL-8 stimulated with a cyclic adenosine monophosphate analog or LPS. In contrast, dexamethasone had no significant effect on a phorbol ester (PMA)-stimulated IL-8 production. These results suggest that the signal transduction pathways leading to the production of IL-8 by human monocytes are differentially regulated by dexamethasone. PMID:1325308

  17. Effect of salinity on regulation mechanism of neuroendocrine-immunoregulatory network in Litopenaeus vannamei.


    Zhao, Qun; Pan, Luqing; Ren, Qin; Wang, Lin; Miao, Jingjing


    The effects of low salinity (transferred from 31‰ to 26‰, 21‰, and 16‰) on the regulation pathways of neuroendocrine-immunoregulatory network were investigated in Litopenaeus vannamei. The results showed that the hormones (corticotrophin-releasing hormone, adrenocorticotropic hormone) and biogenic amines (dopamine, noradrenaline, 5-hydroxytryptamine) concentrations in lower salinity groups increased significantly within 12 h. The gene expression of biogenic amine receptors showed that dopamine receptor D4 and α2 adrenergic receptor in lower salinity groups decreased significantly within 12 h, whereas the 5-HT7 receptor significantly increased within 1d. The second messenger synthetases (adenylyl cyclase, phospholipase C) and the second messengers (cyclic adenosine monophosphate, cyclic guanosine monophosphate) of lower salinity groups shared a similar trend in which adenylyl cyclase and cyclic adenosine monophosphate reached the maximum at 12 h, whereas phospholipase C and cyclic guanosine monophosphate reached the minimum. The immune parameters (total hemocyte count, phenoloxidase activity, phagocytic activity, crustin expression, antibacterial activity, C-type lectin expression, hemagglutinating activity) in lower salinity groups decreased significantly within 12 h. Except for the total hemocyte count, all the parameters recovered to the control levels afterwards. Therefore, it may be concluded that the neuroendocrine-immunoregulatory network plays a principal role in adapting to salinity changes as the main center for sensing the stress and causes immune response in L. vannamei. PMID:26766179

  18. Mannose, glucosamine and inositol monophosphate inhibit the effects of insulin on lipogenesis. Further evidence for a role for inositol phosphate-oligosaccharides in insulin action.

    PubMed Central

    Machicao, F; Mushack, J; Seffer, E; Ermel, B; Häring, H U


    The mechanism of insulin signalling is not yet understood in detail. Recently, a role for inositol phosphate (IP)-oligosaccharides as second messengers transmitting the insulin signal at the post-kinase level was proposed. To evaluate this hypothesis further, we studied whether IP-oligosaccharides isolated from 'haemodialysate' have insulin-like activity. We found that these compounds mimic, in a dose-dependent fashion, the following effects of insulin in adipocytes. (1) Lipogenesis. Incorporation of [3H]glucose into lipids (expressed in nmol/min per 10(6) cells): basal, 0.74 +/- 0.05; insulin (1 mu unit/ml), 4.43 +/- 0.21; IP-oligosaccharide (2 micrograms/ml), 4.07 +/- 0.19. (2) Inhibition of isoprenaline (isoproterenol) (1 microM)-stimulated cyclic AMP levels and lipolysis. Cyclic AMP (pmol/10(5) cells): basal 0.84 +/- 0.05; isoprenaline, 4.03 +/- 0.19; isoprenaline + insulin (200 mu units/ml), 2.06 +/- 0.7; isoprenaline + IP-oligosaccharides (2 micrograms/ml), 2.4 +/- 0.29. Inhibition of lipolysis (mumol of glycerol/mg of protein): isoprenaline (1 microM), 166 +/- 11; isoprenaline+insulin (150 mu units/ml), 53 +/- 3.5; isoprenaline+IP-oligosaccharides (2 micrograms/ml), 58 +/- 5. (3) Stimulation of 3-O-methylglucose transport; basal, 9 +/- 3%; insulin (1 mu unit/ml), 67 +/- 4%, IP-oligosaccharides (2 micrograms/ml), 54 +/- 2%. To identify the active molecules of the IP-oligosaccharide fraction, competition experiments were performed. IP-oligosaccharide effects on lipogenesis were blocked by inositol monophosphate, glucosamine and mannose. In contrast, these compounds did not inhibit IP-oligosaccharide effects on membrane-mediated functions (3-O-methylglucose transport, cyclic AMP levels, lipolysis). We also found that the effect of insulin on lipogenesis was blocked by mannose, glucosamine and inositol monophosphate, whereas the insulin effects on 3-O-methylglucose, cyclic AMP and lipolysis were unaffected. The following conclusions were reached. (1) IP

  19. Kinetic preference for the 3'-5'-linked dimer in the reaction of guanosine 5'-phosphorylmorpholinamide with deoxyguanosine 5'-phosphoryl-2-methylimidazolide as a function of poly(C) concentration

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.


    The formation of the internucleotide bond in diguanylate synthesis was studied in aqueous solution at pH 8 and 0.2 M Mg2+ in the presence and absence of polycytidylate, poly(C). The investigation was simplified by using guanosine 5'-phosphorylmorpholinamide, mor-pG, which can act only as a nucleophile, and deoxyguanosine 5'-phosphoryl-2-methylimidazolide, 2-MeImpdG, which can act only as an electrophile. The time-dependent product distribution was monitored by high-performance liquid chromatography (HPLC) and liquid chromatography mass spectrometry (LC/MS). In the absence of poly(C) the reaction between mor-pG and 2-MeImpdG yielded small amounts of the dimer mor-pGpdG with a regioselectivity of 2'-5':3'-5' = 3.5. In the presence of poly(C) dimer yields increased and a reversal in regioselectivity occurred; both effects were in proportion to the concentration of the polymer. The results can be quantitatively explained with the proposition that poly(C), acting as the template, catalyzes the reaction between template-bound monomers by about a factor of 4-5 over the reaction in solution and yields dimers with a regioselectivity of 2'-5':3'-5' approximately 0.33. These findings illustrate the intrinsic preference of guanosine monomers to correctly self-assemble on the appropriate template.

  20. Incidence of bovine leukocyte adhesion deficiency, complex vertebral malformation, and deficiency of uridine-5-monophosphate synthase carriers in Brazilian Girolando cattle.


    Paiva, D S; Fonseca, I; Pinto, I S B; Ianella, P; Campos, T A; Caetano, A R; Paiva, S R; Silva, M V G B; Martins, M F


    Among the various hereditary diseases that have been widely studied in dairy cattle, bovine leukocyte adhesion deficiency (BLAD), deficiency of uridine-5-monophosphate synthase (DUMPS), and complex vertebral malformation (CVM) are noteworthy because of their high impact on overall herd productivity as a consequence of increased calf mortality. The aim of this study was to verify the frequency of carriers of BLAD, CVM, and DUMPS mutant alleles in cows and bulls from the National Girolando Progeny Test carried out in Brazil by using polymerase chain reaction (PCR)-restriction fragment length polymorphism and allele-specific PCR assays. A total of 777 animals were genotyped for BLAD, 783 for CVM, and 122 for DUMPS. The frequencies of carriers for BLAD and CVM were 0.77 and 1.53%, respectively, whereas no carriers of DUMPS were observed. PMID:24065661

  1. Dielectric spectra broadening as a signature for dipole-matrix interaction. III. Water in adenosine monophosphate/adenosine-5'-triphosphate solutions.


    Puzenko, Alexander; Levy, Evgeniya; Shendrik, Andrey; Talary, Mark S; Caduff, Andreas; Feldman, Yuri


    In this, the third part of our series on the dielectric spectrum symmetrical broadening of water, we consider the nucleotide aqueous solutions. Where in Parts I [E. Levy et al., J. Chem. Phys. 136, 114502 (2012)] and II [E. Levy et al., J. Chem. Phys. 136, 114503 (2012)], the dipole-dipole or ion-dipole interaction had a dominant feature, now the interplay between these two types of dipole-matrix interactions will be considered. We present the results of high frequency dielectric measurements of different concentrations of adenosine monophosphate/adenosine-5'-triphosphate aqueous solutions. We observed the Cole-Cole broadening of the main relaxation peak of the solvent in the solutions. Moreover, depending on the nucleotide concentration, we observed both types of dipole-matrix interaction. The 3D trajectory approach (described in detail in Part I) is applied in order to highlight the differences between the two types of interaction. PMID:23181321

  2. The effects of triton X-100 on the transfer of mannose, glucose and n-acetylglusomine phosphate to dolichol monophosphate by preparations of rough and smooth endoplasmic reticulum and of mitochondria of rat liver.

    PubMed Central

    Coolbear, T; Mookerjea, S; Hemming, F W


    Triton X-100 and exogenous dolichol monophosphate have been used to investigate the nature of enzymes responsible for the transfer of mannose, glucose and N-acetylglucosamine phosphate from nucleotide donors to dolichol monophosphate in vesicles derived from rough and smooth endoplasmic reticulum and mitochondria. Mitochondria were shown to contain the highest specific activities of these enzymes. The responses of the glycosyltransferases to increasing concentrations of Triton X-100 and the effect on these responses of exogenous dolichol monophosphate suggest that the enzymes for mannose and glucose transfer are less hydrophobic, and therefore less intrinsic, in the membrane than the enzyme for N-acetylglucosamine phosphate transfer. In smooth vesicles the results are consistent with mannosyl- and glucosyl-transferases being located at both inner and outer faces of the membrane. In rough vesicles and in mitochondria mannosyl- and glucosyl-transferases were confirmed at the outer face. There is, however, only one site of N-acetylglucosamine phosphate transfer, this being more hydrophobically located in the membrane than the other sites of glycosyl transfer. Mitochondrial enzyme activity closely resembled that of rough endoplasmic reticulum in response to Triton X-100 and exogenous dolichol monophosphate, and is probably associated with the outer membrane. PMID:534537

  3. Adenosine 3',5'-cyclic monophosphate (cAMP)-dependent phosphoregulation of mitochondrial complex I is inhibited by nucleoside reverse transcriptase inhibitors

    SciTech Connect

    Lund, Kaleb C. Wallace, Kendall B.


    Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 {mu}M), AZT monophosphate (150 {mu}M), and 2',3'-dideoxycytidine (ddC; 1 {mu}M) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 {mu}M) and ddC (1 {mu}M). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-{gamma} activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug.

  4. Photodetachment of Zwitterions: Probing Intramolecular Coulomb Repulsion and Attraction in the Gas Phase Using Mono- Decarboxylated Pyridinium Dicarboxylates. Implications on the Mechanism of Orotidine 5' -Monophosphate Decarboxylase

    SciTech Connect

    Wang, Xue B.; Dacres, J E.; Yang, Xin; Lis, Lev; Bedell, Victoria M.; Wang, Lai S.; Kass, Steven R.


    Negative ion photoelectron spectra resulting from the decarboxylation of nine zwitterionic pyridinium dicarboxylates (D(x,y)) are reported. Structural assignments are made on the basis of analogy to the spectra of related species, labeling experiments with C-13- or H-2-containing substrates, independent syntheses, and comparison to density functional theory and ab initio (B3LYP and CCSD(T), respectively) results. In some cases, an acid-catalyzed isomerization of the D(xy)-CO2 ions was found to take place. Adiabatic detachment energies of the resulting zwitterionic ions were measured and are well reproduced by theory. The relative stabilities of the D(x,Y)- CO2 decarboxylation products are largely determined by their intramolecular electrostatic interactions, which are directly probed by the photoelectron spectra and were analyzed in terms of the resulting Coulombic forces. Expulsion of carbon dioxide from the D(x,y) ions was also used as an electrostatic model to probe the mechanism of the enzyme-catalyzed conversion of orotidine 5'-monophosphate (OMP) to uridine 5'-monophosphate (UMP). It was found that the loss of CO2 from these zwitterions; and from oxygen-protonated OMP is retarded by the presence of an additional anionic group. This suggests that the formation of a zwitterion intermediate in the enzyme-catalyzed transformation of OMP to UMP may have less of an energetic impact than commonly thought and could be a''red herring''. If so, the electrostatic stress mechanism proposed by Larsen et al. and Pai, Guo, and co-workers maybe followed.

  5. Mode of action of parathyroid hormone and cyclic adenosine 3′,5′-monophosphate on renal tubular phosphate reabsorption in the dog

    PubMed Central

    Agus, Zalman S.; Puschett, Jules B.; Senesky, Dorothy; Goldberg, Martin


    To evaluate the effects of parathyroid hormone and cyclic adenosine monophosphate on proximal tubular sodium and phosphate reabsorption, micropuncture studies were performed on dogs that received a highly purified preparation of parathyroid hormone (PTH), dibutyryl cyclic 3′,5′-adenosine monophosphate (cyclic AMP), 5′-AMP, and saline. PTH resulted in a 30-40% inhibition of sodium and phosphate reabsorption in the proximal tubule unassociated with a rise in either total kidney or single nephron glomerular filtration rate (GFR). The bulk of the phosphate rejected proximally was excreted in the final urine while sodium excretion rose minimally despite the marked proximal inhibition, consistent with the presence of reabsorptive sites in the distal nephron for sodium but not phosphate. The infusion of dibutyryl cyclic AMP either systemically or directly into the renal artery inhibited proximal sodium and phosphate reabsorption in the absence of changes in either total kidney or single nephron GFR, resembling the effects of PTH quantitatively and qualitatively. In contrast, another adenine nucleotide, 5′-AMP, did not inhibit the reabsorption of either sodium or phosphate. These observations support the thesis that renal effects of PTH are mediated via stimulation of renal cortical adenyl cyclase. The infusion of a moderate saline load, 25 ml/kg, also produced a similar inhibition of proximal tubular fractional sodium and phosphate reabsorption with a marked phosphaturia but only minimal natriuresis. Thus, changes in sodium and phosphate reabsorption occur in parallel in the proximal tubule when sodium reabsorption is inhibited either with volume expansion or with administration of “specific” phosphaturic agents such as PTH or cyclic AMP. These data are consistent with the thesis that phosphate reabsorption is dependent upon proximal tubular sodium reabsorption wherein the phosphaturic effect of PTH might be the result of a primary inhibition of proximal

  6. Photodetachment of zwitterions: probing intramolecular Coulomb repulsion and attraction in the gas phase using mono-decarboxylated pyridinium dicarboxylates. Implications on the mechanism of orotidine 5'-monophosphate decarboxylase.


    Wang, Xue-Bin; Dacres, Jelena E; Yang, Xin; Lis, Lev; Bedell, Victoria M; Wang, Lai-Sheng; Kass, Steven R


    Negative ion photoelectron spectra resulting from the decarboxylation of nine zwitterionic pyridinium dicarboxylates (D(x,y)) are reported. Structural assignments are made on the basis of analogy to the spectra of related species, labeling experiments with (13)C- or (2)H-containing substrates, independent syntheses, and comparison to density functional theory and ab initio (B3LYP and CCSD(T), respectively) results. In some cases, an acid-catalyzed isomerization of the D(x,y)-CO(2) ions was found to take place. Adiabatic detachment energies of the resulting zwitterionic ions were measured and are well reproduced by theory. The relative stabilities of the D(x,y)-CO(2) decarboxylation products are largely determined by their intramolecular electrostatic interactions, which are directly probed by the photoelectron spectra and were analyzed in terms of the resulting Coulombic forces. Expulsion of carbon dioxide from the D(x,y) ions was also used as an electrostatic model to probe the mechanism of the enzyme-catalyzed conversion of orotidine 5'-monophosphate (OMP) to uridine 5'-monophosphate (UMP). It was found that the loss of CO(2) from these zwitterions and from oxygen-protonated OMP is retarded by the presence of an additional anionic group. This suggests that the formation of a zwitterion intermediate in the enzyme-catalyzed transformation of OMP to UMP may have less of an energetic impact than commonly thought and could be a "red herring". If so, the electrostatic stress mechanism proposed by Larsen et al. and Pai, Guo, and co-workers maybe followed. PMID:12769593

  7. Cyclic adenosine 5'-monophosphate and calcium induce CD152 (CTLA-4) up-regulation in resting CD4+ T lymphocytes.


    Vendetti, Silvia; Riccomi, Antonella; Sacchi, Alessandra; Gatta, Lucia; Pioli, Claudio; De Magistris, Maria Teresa


    The CTLA-4 (CD152) molecule is up-regulated upon T cell activation and proliferation, and plays a critical role in the inhibition of immune responses. We show in this study that cAMP induces up-regulation of CD152 in human CD4(+) T lymphocytes. This effect occurs in the absence of the up-regulation of CD69 and CD25 activation markers and T cell proliferation. In addition, we found that the Ca(2+) ionophore ionomycin also up-regulates CD152, and that the combination of a cAMP analog or cAMP inducers with ionomycin further enhances the expression of CD152 in resting CD4(+) T lymphocytes. However, cyclosporin A, which inhibits Ca(2+)/calcineurin signaling pathway, fully prevented the ionomycin- but not the cAMP-induced up-regulation of CD152. The effects of cAMP and ionomycin involve increase of both CD152 mRNA transcripts, coding for the membrane and the soluble forms of CD152. Furthermore, we show that CD152 molecules are translocated to the membrane and are functional, as their engagement by specific mAbs prevented NF-kappaB activation by anti-CD3/CD28 stimulation. These findings demonstrate that at least two novel signal pathways regulate CTLA-4 gene expression and CD152 molecule up-regulation in human CD4(+) T lymphocytes, in the absence of full T cell activation. PMID:12444128

  8. Role of 3'-5'-cyclic adenosine monophosphate on the epidermal growth factor dependent survival in mammary epithelial cells.


    Grinman, Diego Y; Romorini, Leonardo; Presman, Diego M; Rocha-Viegas, Luciana; Coso, Omar A; Davio, Carlos; Pecci, Adali


    Epidermal growth factor (EGF) has been suggested to play a key role in the maintenance of epithelial cell survival during lactation. Previously, we demonstrated that EGF dependent activation of PI3K pathway prevents apoptosis in confluent murine HC11 cells cultured under low nutrient conditions. The EGF protective effect is associated with increased levels of the antiapoptotic protein Bcl-XL. Here, we identify the EGF-dependent mechanism involved in cell survival that converges in the regulation of bcl-X expression by activated CREB. EGF induces Bcl-XL expression through activation of a unique bcl-X promoter, the P1; being not only the PI3K/AKT signaling pathway but also the increase in cAMP levels and the concomitant PKA/CREB activation necessary for both bcl-XL upregulation and apoptosis avoidance. Results presented in this work suggest the existence of a novel connection between the EGF receptor and the adenylate cyclase that would have an impact in preventing apoptosis under low nutrient conditions. PMID:26522133

  9. Crystal structure of a nucleoside model for the inter-strand cross-link formed by the reaction of 2'-de-oxy-guanosine and an abasic site in duplex DNA.


    Catalano, Michael J; Ruddraraju, Kasi Viswanatharaju; Barnes, Charles L; Gates, Kent S


    The title compound, 9-[(2R,4S,5R)-4-hy-droxy-5-(hy-droxy-meth-yl)tetra-hydro-furan-2-yl]-2-{[(2R,4S,5R)-4-meth-oxy-5-(meth-oxy-meth-yl)tetra-hydro-furan-2-yl]amino}-1H-purin-6(9H)-one, C17H25N5O7, crystallizes with two independent mol-ecules (A and B) in the asymmetric unit. In the crystal, the guanosine moieties of mol-ecules A and B are linked by N-H⋯N and O-H⋯N hydrogen-bonding inter-actions, forming ribbons which are stacked to form columns along [100]. These columns are then linked by O-H⋯O hydrogen bonds between the ribose moieties and numerous C-H⋯O inter-actions to complete the three-dimensional structure. PMID:27308004

  10. Signaling pathway cross talk in Alzheimer’s disease

    PubMed Central


    Numerous studies suggest energy failure and accumulative intracellular waste play a causal role in the pathogenesis of several neurodegenerative disorders and Alzheimer’s disease (AD) in particular. AD is characterized by extracellular amyloid deposits, intracellular neurofibrillary tangles, cholinergic deficits, synaptic loss, inflammation and extensive oxidative stress. These pathobiological changes are accompanied by significant behavioral, motor, and cognitive impairment leading to accelerated mortality. Currently, the potential role of several metabolic pathways associated with AD, including Wnt signaling, 5' adenosine monophosphate-activated protein kinase (AMPK), mammalian target of rapamycin (mTOR), Sirtuin 1 (Sirt1, silent mating-type information regulator 2 homolog 1), and peroxisome proliferator-activated receptor gamma co-activator 1-α (PGC-1α) have widened, with recent discoveries that they are able to modulate several pathological events in AD. These include reduction of amyloid-β aggregation and inflammation, regulation of mitochondrial dynamics, and increased availability of neuronal energy. This review aims to highlight the involvement of these new set of signaling pathways, which we have collectively termed “anti-ageing pathways”, for their potentiality in multi-target therapies against AD where cellular metabolic processes are severely impaired. PMID:24679124

  11. Cyclic nucleotide signalling in kidney fibrosis

    PubMed Central

    Schinner, Elisabeth; Wetzl, Veronika; Schlossmann, Jens


    Kidney fibrosis is an important factor for the progression of kidney diseases, e.g., diabetes mellitus induced kidney failure, glomerulosclerosis and nephritis resulting in chronic kidney disease or end-stage renal disease. Cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP) were implicated to suppress several of the above mentioned renal diseases. In this review article, identified effects and mechanisms of cGMP and cAMP regarding renal fibrosis are summarized. These mechanisms include several signalling pathways of nitric oxide/ANP/guanylyl cyclases/cGMP-dependent protein kinase and cAMP/Epac/adenylyl cyclases/cAMP-dependent protein kinase. Furthermore, diverse possible drugs activating these pathways are discussed. From these diverse mechanisms it is expected that new pharmacological treatments will evolve for the therapy or even prevention of kidney failure. PMID:25622251

  12. Reduction Process of Tetraplatin in the Presence of Deoxyguanosine Monophosphate (dGMP): A Computational DFT Study.


    Šebesta, Filip; Burda, Jaroslav V


    The reduction mechanism of [Pt(IV) (dach)Cl4 ] (dach=diaminocyclohexyl) in the presence of dGMP was studied. The first step is substitution of a chloro ligand by dGMP, followed by nucleophilic attack of a phosphate or sugar oxygen atom to the C8-position of guanine. Subsequent reduction forms the [Pt(II) (dach)Cl2 ] complex. The whole process is completed by a hydrolysis. Two different pathways for the substitution reaction were examined: a direct associative and a Basolo-Pearson autocatalytic mechanism. All the explored structures were optimized at the B3LYP-D3/6-31G(d) level and by using the COSMO solvation model with Klamt's radii. Single-point energetics was determined at the B3LYP-GD3BJ/6-311++G(2df,2pd)/PCM/scaled-UAKS level. Activation barriers were used for an estimation of the rate constants and these were compared with experimental values. It was found that the rate-determining step is the nucleophilic attack with a slightly faster performance in the 3'-dGMP branch than in the case of 5'-dGMP with activation barriers of 21.1 and 20.4 kcal mol(-1) (experimental: 23.8 and 23.2 kcal mol(-1) ). The reduction reaction is connected with an electron flow from guanine. The product of the reduction reaction is a chelate structure, which dissociates within the last reaction step, that is, a hydrolysis reaction. The whole redox process (substitution, reduction, and hydrolysis) is exergonic by 34 and 28 kcal mol(-1) for 5'-dGMP and 3'-dGMP, respectively. PMID:26663432

  13. Role of hypothalamic adenosine 5'-monophosphate-activated protein kinase in the impaired counterregulatory response induced by repetitive neuroglucopenia.


    Alquier, Thierry; Kawashima, Junji; Tsuji, Youki; Kahn, Barbara B


    Antecedent hypoglycemia blunts counterregulatory responses that normally restore glycemia, a phenomenon known as hypoglycemia-associated autonomic failure (HAAF). The mechanisms leading to impaired counterregulatory responses are largely unknown. Hypothalamic AMP-activated protein kinase (AMPK) acts as a glucose sensor. To determine whether failure to activate AMPK could be involved in the etiology of HAAF, we developed a model of HAAF using repetitive intracerebroventricular (icv) injection of 2-deoxy-D-glucose (2DG) resulting in transient neuroglucopenia in normal rats. Ten minutes after a single icv injection of 2DG, both alpha1- and alpha2-AMPK activities were increased 30-50% in arcuate and ventromedial/dorsomedial hypothalamus but not in other hypothalamic regions, hindbrain, or cortex. Increased AMPK activity persisted in arcuate hypothalamus at 60 min after 2DG injection when serum glucagon and corticosterone levels were increased 2.5- to 3.4-fold. When 2DG was injected icv daily for 4 d, hypothalamic alpha1- and alpha2-AMPK responses were markedly blunted in arcuate hypothalamus, and alpha1-AMPK was also blunted in mediobasal hypothalamus 10 min after 2DG on d 4. Both AMPK isoforms were activated normally in arcuate hypothalamus at 60 min. Counterregulatory hormone responses were impaired by recurrent neuroglucopenia and were partially restored by icv injection of 5-aminoimidazole-4-carboxamide 1-beta-D-ribofuranoside, an AMPK activator, before 2DG. Glycogen content increased 2-fold in hypothalamus after recurrent neuroglucopenia, suggesting that glycogen supercompensation could be involved in down-regulating the AMPK glucose-sensing pathway in HAAF. Thus, activation of hypothalamic AMPK may be important for the full counterregulatory hormone response to neuroglucopenia. Furthermore, impaired or delayed AMPK activation in specific hypothalamic regions may play a critical role in the etiology of HAAF. PMID:17185376

  14. Low energy electron induced cytosine base release in 2′-deoxycytidine-3′-monophosphate via glycosidic bond cleavage: A time-dependent wavepacket study

    SciTech Connect

    Bhaskaran, Renjith; Sarma, Manabendra


    Low energy electron (LEE) induced cytosine base release in a selected pyrimidine nucleotide, viz., 2′-deoxycytidine-3′-monophosphate is investigated using ab initio electronic structure methods and time dependent quantum mechanical calculations. It has been noted that the cytosine base scission is comparatively difficult process than the 3′ C–O bond cleavage from the lowest π{sup *} shape resonance in energy region <1 eV. This is mainly due to the high activation energy barrier associated with the electron transfer from the π{sup *} orbital of the base to the σ{sup *} orbital of the glycosidic N–C bond. In addition, the metastable state formed after impinging LEE (0–1 eV) has very short lifetime (10 fs) which may decay in either of the two competing auto-detachment or dissociation process simultaneously. On the other hand, the selected N–C mode may cleave to form the cytosine base anion at higher energy regions (>2 eV) via tunneling of the glycosidic bond. Resonance states generated within this energy regime will exist for a duration of ∼35–55 fs. Comparison of salient features of the two dissociation events, i.e., 3′ C–O single strand break and glycosidic N–C bond cleavage in 3′-dCMPH molecule are also provided.

  15. Effect of combinations of acyclovir with vidarabine or its 5'-monophosphate on herpes simplex viruses in cell culture and in mice.

    PubMed Central

    Schinazi, R F; Peters, J; Williams, C C; Chance, D; Nahmias, A J


    The combination of various concentrations of acyclovir and vidarabine or its 5'-monophosphate usually produced an additive interaction with various strains of herpes simplex virus types 1 and 2 in Vero cells. Similarly, certain combinations of these drugs were more effective than the individual drugs in decreasing the mortality and increasing the mean day of death of mice inoculated intracerebrally with herpes simplex virus type 2. Neither antagonism nor interference was noted for any of the in vitro or in vivo combinations. The increased antiviral activity was determined not to be secondary to toxic effects of the drugs. Although viruses resistant to either vidarabine or acyclovir developed readily in cell culture, no evidence of cross-resistance was obtained. Furthermore, in the presence of the two drugs, mutants resistant to vidarabine, acyclovir, or vidarabine/acyclovir could not be isolated. These findings suggest that combinations with these antivirals, which are currently being evaluated singly for the therapy of severe forms of herpetic infection, could prove clinically useful if increasing numbers of resistant viral strains are observed. PMID:6182836

  16. Low energy electron induced cytosine base release in 2'-deoxycytidine-3'-monophosphate via glycosidic bond cleavage: A time-dependent wavepacket study

    NASA Astrophysics Data System (ADS)

    Bhaskaran, Renjith; Sarma, Manabendra


    Low energy electron (LEE) induced cytosine base release in a selected pyrimidine nucleotide, viz., 2'-deoxycytidine-3'-monophosphate is investigated using ab initio electronic structure methods and time dependent quantum mechanical calculations. It has been noted that the cytosine base scission is comparatively difficult process than the 3' C-O bond cleavage from the lowest π* shape resonance in energy region <1 eV. This is mainly due to the high activation energy barrier associated with the electron transfer from the π* orbital of the base to the σ* orbital of the glycosidic N-C bond. In addition, the metastable state formed after impinging LEE (0-1 eV) has very short lifetime (10 fs) which may decay in either of the two competing auto-detachment or dissociation process simultaneously. On the other hand, the selected N-C mode may cleave to form the cytosine base anion at higher energy regions (>2 eV) via tunneling of the glycosidic bond. Resonance states generated within this energy regime will exist for a duration of ˜35-55 fs. Comparison of salient features of the two dissociation events, i.e., 3' C-O single strand break and glycosidic N-C bond cleavage in 3'-dCMPH molecule are also provided.

  17. Developmental Competence of Vitrified-Warmed Bovine Oocytes at the Germinal-Vesicle Stage is Improved by Cyclic Adenosine Monophosphate Modulators during In Vitro Maturation

    PubMed Central

    Ezoe, Kenji; Yabuuchi, Akiko; Tani, Tetsuya; Mori, Chiemi; Miki, Tetsuya; Takayama, Yuko; Beyhan, Zeki; Kato, Yoko; Okuno, Takashi; Kobayashi, Tamotsu; Kato, Keiichi


    Cryopreservation of mature oocytes and embryos has provided numerous benefits in reproductive medicine. Although successful cryopreservation of germinal-vesicle stage (GV) oocytes holds promise for further advances in reproductive biology and clinical embryology fields, reports regarding cryopreservation of immature oocytes are limited. Oocyte survival and maturation rates have improved since vitrification is being performed at the GV stage, but the subsequent developmental competence of GV oocytes is still low. The purpose of this study was to evaluate the effects of supplementation of the maturation medium with cyclic adenosine monophosphate (cAMP) modulators on the developmental competence of vitrified-warmed GV bovine oocytes. GV oocytes were vitrified-warmed and cultured to allow for oocyte maturation, and then parthenogenetically activated or fertilized in vitro. Our results indicate that addition of a cAMP modulator forskolin (FSK) or 3-isobutyl-1-methylxanthine (IBMX) to the maturation medium significantly improved the developmental competence of vitrified-warmed GV oocytes. We also demonstrated that vitrification of GV oocytes led to a decline in cAMP levels and maturation-promoting factor (MPF) activity in the oocytes during the initial and final phases of maturation, respectively. Nevertheless, the addition of FSK or IBMX to the maturation medium significantly elevated cAMP levels and MPF activity during IVM. Taken together, our results suggest that the cryopreservation-associated meiotic and developmental abnormalities observed in GV oocytes may be ameliorated by an artificial increase in cAMP levels during maturation culture after warming. PMID:25965267

  18. Nitric oxide reacts with intracellular glutathione and activates the hexose monophosphate shunt in human neutrophils: evidence for S-nitrosoglutathione as a bioactive intermediary.

    PubMed Central

    Clancy, R M; Levartovsky, D; Leszczynska-Piziak, J; Yegudin, J; Abramson, S B


    We performed experiments to determine whether nitric oxide promoted the formation of intracellular S-nitrosothiol adducts in human neutrophils. At concentrations sufficient to inhibit chemoattractant-induced superoxide anion production, nitric oxide caused a depletion of measurable intracellular glutathione as determined by both the monobromobimane HPLC method and the glutathione reductase recycling assay. The depletion of glutathione could be shown to be due to the formation of intracellular S-nitrosoglutathione as indicated by the ability of sodium borohydride treatment of cytosol to result in the complete recovery of measurable glutathione. The formation of intracellular S-nitrosylated compounds was confirmed by the capacity of cytosol derived from nitric oxide-treated cells to ADP-ribosylate glyceraldehyde-3-phosphate dehydrogenase. Depletion of intracellular glutathione was accompanied by a rapid and concomitant activation of the hexose monophosphate shunt (HMPS) following exposure to nitric oxide. Kinetic studies demonstrated that nitric oxide-dependent activation of the HMPS was reversible and paralleled nitric oxide-induced glutathione depletion. Synthetic preparations of S-nitrosoglutathione shared with nitric oxide the capacity to inhibit superoxide anion production and activate the HMPS. These data suggest that nitric oxide may regulate cellular functions via the formation of intracellular S-nitrosothiol adducts and the activation of the HMPS. Images PMID:8170969

  19. Effect of prostaglandins and cyclic adenosine 3',5'-monophosphate modulators on herpes simplex virus growth and interferon response in human cells.

    PubMed Central

    Trofatter, K F; Daniels, C A


    Mechanisms whereby prostaglandins and other cyclic adenosine 3',5'-monophosphate (cAMP) modulators might enhance the growth of herpes simplex virus (HSV) in human skin fibroblasts were explored. Prostaglandins A1, B1, E1, E2, and F2 alpha, as well as isoproterenol, imidazole, carbamylcholine, and dibutyryl cAMP had no effect on HSV growth. On the other hand, the phosphodiesterase inhibitors 1-methyl-3-isobutylxanthine and theophylline delayed the growth, suppressed the cell-to-cell spread, but inhibited neither the adsorption nor the penetration of the virus. Although none of the cAMP-elevating reagents directly enhanced HSV growth, they were found to inhibit dose dependently the antiviral action of both type I and HSV antigen-induced human interferon preparations. Furthermore, these reagents suppressed the production of HSV antigen-induced interferon by immune human mononuclear leukocytes. These data support the hypothesis that prostaglandin elaboration in vivo could contribute to exacerbations of HSV infections by compromising the host's interferon defense system. PMID:6244226

  20. Application and optimization of the tenderization of pig Longissimus dorsi muscle by adenosine 5'-monophosphate (AMP) using the response surface methodology.


    Deng, Shaoying; Wang, Daoying; Zhang, Muhan; Geng, Zhiming; Sun, Chong; Bian, Huan; Xu, Weimin; Zhu, Yongzhi; Liu, Fang; Wu, Haihong


    Based on single factor experiments, NaCl concentration, adenosine 5'-monophosphate (AMP) concentration and temperature were selected as independent variables for a three-level Box-Behnken experimental design, and the shear force and cooking loss were response values for regression analysis. According to the statistical models, it showed that all independent variables had significant effects on shear force and cooking loss, and optimal values were at the NaCl concentration of 4.15%, AMP concentration of 22.27 mmol/L and temperature of 16.70°C, which was determined with three-dimensional response surface diagrams and contour plots. Under this condition, the observed shear force and cooking loss were 0.625 kg and 8.07%, respectively, exhibiting a good agreement with their predicted values, showing the good applicability and feasibility of response surface methodology (RSM) for improving pork tenderness. Compared with control pig muscles, AMP combined with NaCl treatment demonstrated significant effects on improvement of meat tenderness and reduction of cooking loss. Therefore, AMP could be regarded as an effective tenderization agent for pork. PMID:26212625

  1. Sensitivity of fructose-1,6-biphosphatase from yeast, liver and skeletal muscle to fructose-2,6-biphosphate and 5'-adenosine monophosphate.


    von Herrath, M; Holzer, H


    As a prerequisite for future studies on the possible effect of sulphite, an anti-microbial agent, on gluconeogenesis in yeast, a comparative study of fructose-1,6-bisphosphatase (FBPase), a key enzyme of gluconeogenesis, from yeast, liver and skeletal muscle is reported. In contrast to FBPase from yeast or liver, FBPase from skeletal muscle is approximately 1000-fold more sensitive to inhibition by 5' adenosine monophosphate and 30 to 250-fold less sensitive to inhibition by fructose-2,6-bisphosphate. The kinetic properties of the FBPases, determined by the ratios R(Mg2+/Mn2+) and R (pH 7/9) of the enzyme activities, measured at 10 mM Mg2+ and 2 mM Mn2+ and at pH 7.0 and 9.0, respectively, show a drastic difference between the skeletal muscle and the yeast or liver enzymes. The data support the idea that the enzymes from yeast and liver function in gluconeogenesis, whereas the enzyme from skeletal muscle is involved in other biological functions. PMID:3291467

  2. Measuring the dynamics of cyclic adenosine monophosphate level in living cells induced by low-level laser irradiation using bioluminescence resonance energy transfer.


    Huang, Yimei; Zheng, Liqin; Yang, Hongqin; Chen, Jiangxu; Wang, Yuhua; Li, Hui; Xie, Shusen; Zeng, Haishan


    Several studies demonstrated that the cyclic adenosine monophosphate (cAMP), an important second messenger, is involved in the mechanism of low-level laser irradiation (LLLI) treatment. However, most of these studies obtained the cAMP level in cell culture extracts or supernatant. In this study, the cAMP level in living cells was measured with bioluminescence resonance energy transfer (BRET). The effect of LLLI on cAMP level in living cells with adenosine receptors blocked was explored to identify the role of adenosine receptors in LLLI. The results showed that LLLI increased the cAMP level. Moreover, the rise of cAMP level was light dose dependent but wavelength independent for 658-, 785-, and 830-nm laser light. The results also exhibited that the adenosine receptors, a class of G protein-coupled receptor (GPCR), modulated the increase of cAMP level induced by LLLI. The cAMP level increased more significantly when the A3 adenosine receptors (A3R) were blocked by A3R antagonist compared with A1 adenosine receptor or A2a adenosine receptor blocked in HEK293T cells after LLLI, which was in good agreement with the adenosine receptors’ expressions. All these results suggested that measuring the cAMP level with BRET could be a useful technique to study the role of GPCRs in living cells under LLLI. PMID:25611980

  3. Cytidylate cyclase activity in mouse tissues: the enzymatic conversion of cytidine 5'-triphosphate to cytidine 3',5'-cyclic monophosphate (cyclic CMP).


    Yamamoto, I; Takai, T; Mori, S


    Cytidylate cyclase activity, which enzymatically converts cytidine 5'-triphosphate (CTP) to cytidine 3',5'-cyclic monophosphate (cyclic CMP), has been demonstrated in mouse tissue homogenates by use of a highly sensitive enzyme immunoassay (EIA) specific for cyclic CMP. Cyclic CMP formation is dependent on the amount of homogenate and on the incubation time. Although the enzyme activity was detected at wide ranges of pH from 6.8 to 11.5, the maximal activity was observed at around pH 9.4. The optimal temperature was 37 degrees C. Cytidylate cyclase activity was almost completely lost if the homogenates were heated at 90 degrees C for 3 min prior to use. The enzyme reaction exhibited typical Michaelis-Menten kinetics with an apparent Km for CTP of approx. 0.31 mM. Cyclic CMP formation was greatly enhanced with 4 mM Mn2+, Mg2+, Co2+; Mn2+ was the most effective. Fe2+ and Ca2+ were without effect. Cu2+ and Zn2+ at a concentration of 0.1 to 0.5 mM were inhibitory to Mn2+-dependent activity. Moreover, the enzyme activity was inhibited by several nucleotides including ATP, ADP, 5'-AMP, and GTP. Cytidylate cyclase activity was found to be present in all homogenates from a variety of mouse tissues examined except heart, with the highest level found in brain, and the lowest in liver. PMID:2557087

  4. Increased inosine 5{prime}-monophosphate dehydrogenase gene expression in replicating cells: A response to growth factors, not to changes in cell cycle parameters

    SciTech Connect

    Tsutani, Hiroshi; Collart, F.R.; Glesne, D.A.; Huberman, E. |


    The authors have analyzed levels of inosine 5{prime}-monophosphate dehydrogenase (IMPDH; E.C. type II mRNA levels in a human melanoma cell line, SK-MEL-131, and a Chinese hamster ovary cell line synchronously progressing through the cell cycle following treatment with aphidicolin. Following release from the aphidicolin block at the G{sub 1}-S phase boundary, the type II IMPDH gene was found to be constitutively expressed at a similar level during all stages of the cell cycle. To analyze growth regulation, as opposed to cell cycle regulation, stable SK-MEL-131 transfectants that express a type II IMPDH-promoted heterologous construct were assayed following deprivation of serum growth factors and after restimulation with fresh serum. Serum deprivation resulted in down-regulation of both steady state type II IMPDH mRNA levels and promoter activity, while restimulation with serum resulted in up-regulation of these parameters. These findings support the conclusion that the increase in IMPDH type II gene expression in replicating cells is mainly due to growth factor regulation rather than changes in cell cycle parameters and that this regulation is mediated primarily by a transcriptional mechanism. The increased level of IMPDH expression and activity found in many tumors may therefore also be due to a transcriptionally mediated response to growth factors.

  5. Adenosine Monophosphate-activated Protein Kinase Regulates Interleukin-1β Expression and Glial Glutamate Transporter Function in Rodents with Neuropathic Pain

    PubMed Central

    Maixner, Dylan W.; Yan, Xisheng; Gao, Mei; Yadav, Ruchi; Weng, Han-Rong


    Background Neuroinflammation and dysfunctional glial glutamate transporters (GTs) in the spinal dorsal horn (SDH) are implicated in the genesis of neuropathic pain. We determined if adenosine monophosphate-activated protein kinase (AMPK) in the SDH regulates these processes in rodents with neuropathic pain. Methods Hind paw withdrawal responses to radiant heat and mechanical stimuli were used to assess nociceptive behaviors. Spinal markers related to neuroinflammation and glial GTs were determined by Western blotting. AMPK activities were manipulated pharmacologically and genetically. Regulation of glial GTs was determined by measuring protein expression and activities of glial GTs. Results AMPK activities were reduced in the SDH of rats (n = 5) with thermal hyperalgesia induced by nerve injury, which were accompanied with the activation of astrocytes, increased production of interleukin-1beta and activities of glycogen synthase kinase 3β, and suppressed protein expression of glial glutamate transporter-1. Thermal hyperalgesia was reversed by spinal activation of AMPK in neuropathic rats (n = 10), and induced by inhibiting spinal AMPK in naïve rats (n = 7 to 8). Spinal AMPKα knockdown (n = 6) and AMPKα1 conditional knockout (n = 6) induced thermal hyperalgesia and mechanical allodynia. These genetic alterations mimicked the changes of molecular markers induced by nerve injury. Pharmacological activation of AMPK enhanced glial GT activity in mice with neuropathic pain (n = 8) and attenuated glial glutamate transporter-1 internalization induced by interleukin-1β (n = 4). Conclusion These findings suggest enhancing spinal AMPK activities could be an effective approach for the treatment of neuropathic pain. PMID:25710409

  6. Compartmentalized Cyclic Adenosine 3′,5′-Monophosphate at the Plasma Membrane Clusters PDE3A and Cystic Fibrosis Transmembrane Conductance Regulator into Microdomains

    PubMed Central

    Penmatsa, Himabindu; Zhang, Weiqiang; Yarlagadda, Sunitha; Li, Chunying; Conoley, Veronica G.; Yue, Junming; Bahouth, Suleiman W.; Buddington, Randal K.; Zhang, Guangping; Nelson, Deborah J.; Sonecha, Monal D.; Manganiello, Vincent; Wine, Jeffrey J.


    Formation of multiple-protein macromolecular complexes at specialized subcellular microdomains increases the specificity and efficiency of signaling in cells. In this study, we demonstrate that phosphodiesterase type 3A (PDE3A) physically and functionally interacts with cystic fibrosis transmembrane conductance regulator (CFTR) channel. PDE3A inhibition generates compartmentalized cyclic adenosine 3′,5′-monophosphate (cAMP), which further clusters PDE3A and CFTR into microdomains at the plasma membrane and potentiates CFTR channel function. Actin skeleton disruption reduces PDE3A–CFTR interaction and segregates PDE3A from its interacting partners, thus compromising the integrity of the CFTR-PDE3A–containing macromolecular complex. Consequently, compartmentalized cAMP signaling is lost. PDE3A inhibition no longer activates CFTR channel function in a compartmentalized manner. The physiological relevance of PDE3A–CFTR interaction was investigated using pig trachea submucosal gland secretion model. Our data show that PDE3A inhibition augments CFTR-dependent submucosal gland secretion and actin skeleton disruption decreases secretion. PMID:20089840

  7. The role of nitric oxide in the phosphorylation of cyclic adenosine monophosphate-responsive element-binding protein in the spinal cord after intradermal injection of capsaicin.


    Wu, Jing; Fang, Li; Lin, Qing; Willis, William D


    We investigated the involvement of nitric oxide (NO) in the phosphorylation of cyclic adenosine monophosphate-responsive element-binding protein (CREB) in the spinal cord of rats during central sensitization after intradermal capsaicin injection. CREB and phosphorylated CREB (p-CREB) were measured by immunoblotting. The level of p-CREB increased by 20 minutes, peaked between 20 and 60 minutes after capsaicin injection, and started to decrease after 150 minutes. CREB itself did not show an obvious change after capsaicin injection. The p-CREB expression on the ipsilateral side of the spinal dorsal horn, but not on the contralateral side, increased significantly after capsaicin injection. The increase in p-CREB induced by capsaicin injection was partially blocked by pretreatment with N(G)-nitro-L-arginine methyl ester (L-NAME), an NO synthase inhibitor, administered through a microdialysis fiber placed across the spinal cord. D-NAME, an inactive form of L-NAME, had no effect. CREB phosphorylation, not the level of CREB, was induced within 20 minutes by microdialysis administration of SIN-1, an NO donor. These results indicate that CREB phosphorylation in the spinal cord results from both endogenous and exogenous NO release and that p-CREB may play a role in central sensitization or in longer-term changes in gene expression induced by strong peripheral noxious stimulation. PMID:14622772

  8. Measuring the dynamics of cyclic adenosine monophosphate level in living cells induced by low-level laser irradiation using bioluminescence resonance energy transfer

    NASA Astrophysics Data System (ADS)

    Huang, Yimei; Zheng, Liqin; Yang, Hongqin; Chen, Jiangxu; Wang, Yuhua; Li, Hui; Xie, Shusen; Zeng, Haishan


    Several studies demonstrated that the cyclic adenosine monophosphate (cAMP), an important second messenger, is involved in the mechanism of low-level laser irradiation (LLLI) treatment. However, most of these studies obtained the cAMP level in cell culture extracts or supernatant. In this study, the cAMP level in living cells was measured with bioluminescence resonance energy transfer (BRET). The effect of LLLI on cAMP level in living cells with adenosine receptors blocked was explored to identify the role of adenosine receptors in LLLI. The results showed that LLLI increased the cAMP level. Moreover, the rise of cAMP level was light dose dependent but wavelength independent for 658-, 785-, and 830-nm laser light. The results also exhibited that the adenosine receptors, a class of G protein-coupled receptor (GPCR), modulated the increase of cAMP level induced by LLLI. The cAMP level increased more significantly when the A3 adenosine receptors (A3R) were blocked by A3R antagonist compared with A1 adenosine receptor or A2a adenosine receptor blocked in HEK293T cells after LLLI, which was in good agreement with the adenosine receptors' expressions. All these results suggested that measuring the cAMP level with BRET could be a useful technique to study the role of GPCRs in living cells under LLLI.

  9. Nanoparticles with Precise Ratiometric Co-Loading and Co-Delivery of Gemcitabine Monophosphate and Cisplatin for Treatment of Bladder Cancer

    PubMed Central

    Miao, Lei; Guo, Shutao; Zhang, Jing; Kim, William Y.; Huang, Leaf


    Combination chemotherapy is a common practice in clinical management of malignancy. Synergistic therapeutic outcome is only achieved when tumor cells are exposed to cells in an optimal ratio. However, due to diverse physicochemical properties of drugs, no free drug cocktails or nanomaterials are capable of co-loading and co-delivering drugs at an optimal ratio. Herein, we develop a novel nano-platform with precise ratiometric co-loading and co-delivery of two hydrophilic drugs for synergistic anti-tumor effects. Based on previous work, we utilize a solvent displacement method to ratiometrically load dioleoyl phosphatidic acid (DOPA)-gemcitabine monophosphate and DOPA coated cisplatin-precipitate nanocores into the same PLGA NP. These cores are designed to have similar hydrophobic surface properties. GMP and cisplatin are engineered into PLGA NP at an optimal synergistic ratio (5:1, mol:mol) with over 70% encapsulation efficiency and were ratiometrically taken up by tumor cells in vitro and in vivo. These PLGA NP exhibit synergistic anti-cancer effects in a stroma-rich bladder tumor model. A single injection of dual drugs in PLGA NP can significantly inhibit tumor growth. This nanomaterial-system solves problems related to ratiometric co-loading and co-delivery of different hydrophilic moieties and provides possibilities for co-loading hydrophilic drugs with hydrophobic drugs for combination therapy. PMID:25395922

  10. Level of 5-fluorodeoxyuridine 5'-monophosphate in cancerous tissue in patients with gastric cancer under preoperative administration of TS-1. A preliminary study.


    Yamamoto, S; Kubota, K


    Metabolizing enzymes such as thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) have long been known to be useful for predicting response and outcome in patients receiving 5-fluorouracil (5-FU). However, few studies have examined the cancerous tissue levels of 5-fluorodeoxyuridine 5'-monophosphate (FdUMP), a metabolite of 5-FU that has an important role in inhibiting DNA synthesis. In this study, for the first time to our knowledge, we measured concentrations of FdUMP in tumor specimens and surrounding non-cancerous tissue obtained at operation in 10 patients with gastric cancer who received TS-1 before surgery (80 mg/m2, 3 days). The FdUMP level in the cancerous tissue was significantly higher than that in the non-cancerous tissue (153.0 +/- 85.7 pmol/g tissue vs. 53.0 +/- 47.0 pmol/g tissue)(p = 0.0046). Furthermore, the TS level in tumor was significantly higher than that in non-cancerous tissue (6.362 +/- 5.106 pmol/g tissue vs. 2.092 +/- 2.050 pmol/g tissue) (p = 0.0310). The mean ratios of TS-bound FdUMP to TS and FdUMP concentrations in the cancerous tissues were 45.9% and 2.00%, respectively. Our results demonstrate that in cancerous tissue, TS-1 may produce high FdUMP concentration and suppress about half FdUMP concentration by forming ternary complexes. PMID:16270533

  11. Inhibition by morphine of prostaglandin E1-stimulated secretion and cyclic adenosine 3',5'-monophosphate formation in the rat jejunum in vivo.

    PubMed Central

    Beubler, E.; Lembeck, F.


    1 The effects were studied of prostaglandin E1 (PGE1), theophylline and morphine on net water flux and mucosal cyclic adenosine 3',5'-monophosphate (cyclic AMP) levels in the jejunum of anaesthetized rats in vivo. 2 Infusion of PGE1 (3.2 micrograms/min, i.a.) caused a reversal from net water absorption to net secretion and enhanced the mucosal cyclic AMP content by 54%. 3 Theophylline (5 mg/ml, intraluminal) similarly produced a reversal from net water absorption to net secretion and increased mucosal cyclic AMP content by 54%. Additional intra-arterial infusion of PGE1 resulted in a massive increase in net water secretion and an increase in mucosal cyclic AMP content by about 200%. 4 Pretreatment with morphine (10 mg/kg, s.c.) reduced the effect of PGE1 on net water flux and completely inhibited its effect on the mucosal cyclic AMP content. Naloxone (10 mg/kg, s.c.) abolished both effects of morphine. 5 A good correlation (r = 0.99) was demonstrated between mucosal cyclic AMP levels and net water flux. 6 The present results demonstrate that PGE1 stimulates intestinal fluid secretion by increasing mucosal cyclic AMP levels. The antidiarrhoeal effect of morphine can be explained by its inhibition of the PGE-mediated increase in cyclic AMP levels, which, in turn, leads to a reduction in intestinal secretion. PMID:6301596

  12. 5′-Adenosine Monophosphate-Induced Hypothermia Attenuates Brain Ischemia/Reperfusion Injury in a Rat Model by Inhibiting the Inflammatory Response

    PubMed Central

    Miao, Yi-Feng; Wu, Hui; Yang, Shao-Feng; Dai, Jiong; Qiu, Yong-Ming; Tao, Zhen-Yi; Zhang, Xiao-Hua


    Hypothermia treatment is a promising therapeutic strategy for brain injury. We previously demonstrated that 5′-adenosine monophosphate (5′-AMP), a ribonucleic acid nucleotide, produces reversible deep hypothermia in rats when the ambient temperature is appropriately controlled. Thus, we hypothesized that 5′-AMP-induced hypothermia (AIH) may attenuate brain ischemia/reperfusion injury. Transient cerebral ischemia was induced by using the middle cerebral artery occlusion (MCAO) model in rats. Rats that underwent AIH treatment exhibited a significant reduction in neutrophil elastase infiltration into neuronal cells and matrix metalloproteinase 9 (MMP-9), interleukin-1 receptor (IL-1R), tumor necrosis factor receptor (TNFR), and Toll-like receptor (TLR) protein expression in the infarcted area compared to euthermic controls. AIH treatment also decreased the number of terminal deoxynucleotidyl transferase dUTP nick end labeling- (TUNEL-) positive neuronal cells. The overall infarct volume was significantly smaller in AIH-treated rats, and neurological function was improved. By contrast, rats with ischemic brain injury that were administered 5′-AMP without inducing hypothermia had ischemia/reperfusion injuries similar to those in euthermic controls. Thus, the neuroprotective effects of AIH were primarily related to hypothermia. PMID:25873763

  13. The Nitric Oxide/Cyclic GMP Pathway in Organ Transplantation: Critical Role in Successful Lung Preservation

    NASA Astrophysics Data System (ADS)

    Pinsky, David J.; Naka, Yoshifumi; Chowdhury, Nepal C.; Liao, Hui; Oz, Mehmet C.; Michler, Robert E.; Kubaszewski, Eugeniusz; Malinski, Tadeusz; Stern, David M.


    Reestablishment of vascular homeostasis following ex vivo preservation is a critical determinant of successful organ transplantation. Because the nitric oxide (NO) pathway modulates pulmonary vascular tone and leukocyte/endothelial interactions, we hypothesized that reactive oxygen intermediates would lead to decreased NO (and hence cGMP) levels following pulmonary reperfusion, leading to increased pulmonary vascular resistance and leukostasis. Using an orthotopic rat model of lung transplantation, a porphyrinic microsensor was used to make direct in vivo measurements of pulmonary NO. NO levels measured at the surface of the transplanted lung plummeted immediately upon reperfusion, with levels moderately increased by topical application of superoxide dismutase. Because cGMP levels declined in preserved lungs after reperfusion, this led us to buttress the NO pathway by adding a membrane-permeant cGMP analog to the preservation solution. Compared with grafts stored in its absence, grafts stored with supplemental 8-Br-cGMP and evaluated 30 min after reperfusion demonstrated lower pulmonary vascular resistances with increased graft blood flow, improved arterial oxygenation, decreased neutrophil infiltration, and improved recipient survival. These beneficial effects were dose dependent, mimicked by the type V phosphodiesterase inhibitor 2-o-propoxyphenyl-8-azapurin-6-one, and inhibited by a cGMP-dependent protein kinase antagonist, the R isomer of 8-(4-chlorophenylthio)guanosine 3',5'-cyclic monophosphorothioate. Augmenting the NO pathway at the level of cGMP improves graft function and recipient survival following lung transplantation.

  14. Atrial natriuretic peptide frameshift mutation in familial atrial fibrillation.


    Hodgson-Zingman, Denice M; Karst, Margaret L; Zingman, Leonid V; Heublein, Denise M; Darbar, Dawood; Herron, Kathleen J; Ballew, Jeffrey D; de Andrade, Mariza; Burnett, John C; Olson, Timothy M


    Atrial fibrillation is a common arrhythmia that is hereditary in a small subgroup of patients. In a family with 11 clinically affected members, we mapped an atrial fibrillation locus to chromosome 1p36-p35 and identified a heterozygous frameshift mutation in the gene encoding atrial natriuretic peptide. Circulating chimeric atrial natriuretic peptide (ANP) was detected in high concentration in subjects with the mutation, and shortened atrial action potentials were seen in an isolated heart model, creating a possible substrate for atrial fibrillation. This report implicates perturbation of the atrial natriuretic peptide-cyclic guanosine monophosphate (cGMP) pathway in cardiac electrical instability. PMID:18614783

  15. 'Rod and ring' formation from IMP dehydrogenase is regulated through the one-carbon metabolic pathway.


    Calise, S John; Purich, Daniel L; Nguyen, Thuy; Saleem, Dania A; Krueger, Claire; Yin, Joyce D; Chan, Edward K L


    'Rods and rings' (RRs) are conserved, non-membrane-bound intracellular polymeric structures composed, in part, of inosine monophosphate dehydrogenase (IMPDH), a key enzyme leading to GMP and GTP biosynthesis. RR formation is induced by IMPDH inhibitors as well as glutamine deprivation. They also form upon treatment of cells with glutamine synthetase inhibitors. We now report that depriving cells of serine and glycine promotes RR formation, and we have traced these effects to dihydrofolate reductase (DHFR) and serine hydroxymethyltransferase-2 (SHMT2), pivotal enzymes in one-carbon metabolism and nucleotide biosynthesis. RR assembly is likewise induced upon DHFR inhibition by methotrexate or aminopterin as well as siRNA-mediated knockdown of DHFR or SHMT2. Because RR assembly occurs when guanine nucleotide biosynthesis is inhibited, and because RRs rapidly disassemble after the addition of guanine nucleotide precursors, RR formation might be an adaptive homeostatic mechanism, allowing IMPDH to sense changes in the one-carbon folate pathway. PMID:27343244

  16. Neurophysiology and itch pathways.


    Schmelz, Martin


    As we all can easily differentiate the sensations of itch and pain, the most straightforward neurophysiologic concept would consist of two specific pathways that independently encode itch and pain. Indeed, a neuronal pathway for histamine-induced itch in the peripheral and central nervous system has been described in animals and humans, and recently several non-histaminergic pathways for itch have been discovered in rodents that support a dichotomous concept differentiated into a pain and an itch pathway, with both pathways being composed of different "flavors." Numerous markers and mediators have been found that are linked to itch processing pathways. Thus, the delineation of neuronal pathways for itch from pain pathways seemingly proves that all sensory aspects of itch are based on an itch-specific neuronal pathway. However, such a concept is incomplete as itch can also be induced by the activation of the pain pathway in particular when the stimulus is applied in a highly localized spatial pattern. These opposite views reflect the old dispute between specificity and pattern theories of itch. Rather than only being of theoretic interest, this conceptual problem has key implication for the strategy to treat chronic itch as key therapeutic targets would be either itch-specific pathways or unspecific nociceptive pathways. PMID:25861773

  17. Enhanced Bacterial α(2,6)-Sialyltransferase Reaction through an Inhibition of Its Inherent Sialidase Activity by Dephosphorylation of Cytidine-5'-Monophosphate

    PubMed Central

    Kang, Ji-Yeon; Lim, Se-Jong; Kwon, Ohsuk; Lee, Seung-Goo; Kim, Ha Hyung; Oh, Doo-Byoung


    Bacterial α(2,6)-sialyltransferases (STs) from Photobacterium damsela, Photobacterium sp. JT-ISH-224, and P. leiognathi JT-SHIZ-145 were recombinantly expressed in Escherichia coli and their ST activities were compared directly using a galactosylated bi-antennary N-glycan as an acceptor substrate. In all ST reactions, there was an increase of sialylated glycans at shorter reaction times and later a decrease in prolonged reactions, which is related with the inherent sialidase activities of bacterial STs. These sialidase activities are greatly increased by free cytidine monophosphate (CMP) generated from a donor substrate CMP-N-acetylneuraminic acid (CMP-Neu5Ac) during the ST reactions. The decrease of sialylated glycans in prolonged ST reaction was prevented through an inhibition of sialidase activity by simple treatment of alkaline phosphatase (AP), which dephosphorylates CMP to cytidine. Through supplemental additions of AP and CMP-Neu5Ac to the reaction using the recombinant α(2,6)-ST from P. leiognathi JT-SHIZ-145 (P145-ST), the content of bi-sialylated N-glycan increased up to ~98% without any decrease in prolonged reactions. This optimized P145-ST reaction was applied successfully for α(2,6)-sialylation of asialofetuin, and this resulted in a large increase in the populations of multi-sialylated N-glycans compared with the reaction without addition of AP and CMP-Neu5Ac. These results suggest that the optimized reaction using the recombinant P145-ST readily expressed from E. coli has a promise for economic glycan synthesis and glyco-conjugate remodeling. PMID:26231036

  18. Taste perception of monosodium glutamate and inosine monophosphate by 129P3/J and C57BL/6ByJ mice.


    Murata, Yuko; Beauchamp, Gary K; Bachmanov, Alexander A


    Our previous studies have shown that in long-term two-bottle preference tests, mice from the C57BL/6ByJ (B6) inbred strain drink more monosodium glutamate (MSG) and inosine monophosphate (IMP) than mice from the 129P3/J (129) inbred strain. The goal of this study was to examine whether this variation in consumption could be attributed to strain differences in perception of the taste quality of MSG and IMP. We developed a conditioned taste aversion (CTA) in B6 and 129 mice to 100 mM MSG or 10 mM IMP and used a brief-access taste assay to examine CTA generalization. B6 and 129 mice did not differ in the generalization patterns following CTA to MSG: mice from both strains generalized CTA from MSG to NaCl. In contrast, strain differences in the generalization patterns were evident following the CTA to IMP: while mice from both strains generalized CTA from IMP to MSG, 129 mice tended to have stronger CTA generalization to saccharin and d-tryptophan, both of which are perceived as sweet by humans. These data suggest that the strain differences in MSG consumption are not due to variation in perception of the taste quality of MSG. Instead, the differential intake of IMP likely reflects strain differences in the way the taste quality of IMP is perceived. Our data suggest that mice perceive MSG and IMP as complex taste stimuli: some taste components are shared between these two substances, but their relative intensity seems to be different for MSG and IMP. The amiloride-sensitive salt taste component is more prevalent in MSG than in IMP taste, and in B6 compared with 129 mice. PMID:19666040

  19. Adenosine 5′-monophosphate ameliorates D-galactosamine/lipopolysaccharide-induced liver injury through an adenosine receptor-independent mechanism in mice

    PubMed Central

    Zhan, Y; Wang, Z; Yang, P; Wang, T; Xia, L; Zhou, M; Wang, Y; Wang, S; Hua, Z; Zhang, J


    D-galactosamine (GalN)/lipopolysaccharide (LPS)-induced lethality and acute liver failure is dependent on endogenously produced inflammatory cytokines. Adenosine has been proven to be a central role in the regulation of inflammatory response. It is not entirely clear that which adenosine action is actually crucial to limiting inflammatory tissue destruction. Here we showed that GalN/LPS challenge elevated hepatic adenosine and induced lethality in adenosine receptor-deficient mice with equal efficiency as wild-type mice. In GalN/LPS-treated mice, pretreatment with adenosine 5′-monophosphate (5′-AMP) significantly elevated hepatic adenosine level and reduced mortality through decreasing cytokine and chemokine production. In RAW264.7 cells, 5′-AMP treatment inhibited the production of inflammatory cytokines, which is not mediated through adenosine receptors. 5′-AMP failed to attenuate LPS-induced nuclear factor-κB (NF-κB) p65 nuclear translocation, but reduced LPS-induced recruitment of NF-κB p65 to inflammatory gene promoters and decreased LPS-induced enrichment of H3K4 dimethylation at the tumor necrosis factor-α (TNF-α) promoter, which was involved in 5′-AMP-induced elevation of cellular adenosine and a decline of methylation potential. In vitro biochemical analysis revealed that adenosine directly attenuated recruitment of NF-κB to the TNF-α and interleukin-6 promoters. Our findings demonstrate that 5′-AMP-inhibiting inflammatory response is not mediated by adenosine receptors and it may represent a potential protective agent for amelioration of LPS-induced liver injury. PMID:24407238

  20. Vasoactive intestinal peptide: A potent stimulator of adenosine 3′:5′-cyclic monophosphate accumulation in gut carcinoma cell lines in culture*

    PubMed Central

    Laburthe, M.; Rousset, M.; Boissard, C.; Chevalier, G.; Zweibaum, A.; Rosselin, G.


    Vasoactive intestinal peptide (VIP) is a potent and efficient stimulator of adenosine 3′:5′-cyclic monophosphate (cAMP) accumulation in a human colon carcinoma cell line, HT 29. cAMP accumulation is sensitive to a concentration of VIP as low as 3×10-12 M. Maximum VIP-induced cAMP levels were observed with 10-9 M VIP and are about 200 times above the basal levels. Half-maximum cAMP production was obtained at 3×10-10 M VIP. 125I-Labeled VIP was found to bind to HT 29 cells; this binding was competitively inhibited by concentrations of unlabeled VIP between 10-10 and 10-7 M. Half-maximum inhibition of binding was observed with 2×10-9 M VIP. Secretin also stimulated cAMP accumulation in HT 29 cells, but its effectiveness was 1/1000 that of VIP. The other peptides tested at 10-7 M, such as insulin, glucagon, bovine pancreatic polypeptide, somatostatin, octapeptide of cholecystokinin, neurotensin, and substance P, did not stimulate cAMP accumulation. Prostaglandin E1 and catecholamines stimulated cAMP production but were 1/2.3 and 1/5.5 as efficient as VIP, respectively. Another malignant cell line from the gut, the human rectal tumor cell line HRT 18, is also sensitive to VIP. In HRT 18 cells, VIP stimulated cAMP accumulation with a maximal effect at 10-8 M; half-maximum stimulation was observed at about 10-9 M. These results demonstrate the presence of VIP receptors in two malignant human intestinal cell lines (HT 29 and HRT 18) in culture and provide a model for studying the action of VIP on cell proliferation. PMID:208077

  1. On the interaction of caffeine with nucleic acids. III. 1H NMR studies of caffeine--5'-adenosine monophosphate and caffeine-poly(riboadenylate) interactions.


    Fritzsche, H; Petri, I; Schütz, H; Weller, K; Sedmera, P; Lang, H


    1) The self-association of both caffeine (Cf) and 5'-adenosine monophosphate (AMP) in aqueous solution has been reinvestigated by 1H NMR. The self-association process is characterized by an isodesmic model. The apparent self-association constants of the vertical stacking process are KCf = (10.6 +/- 1.0) M-1 and KAMP = (1.67 +/- 0.17) M-1. The arrangement of the monomeric units in the stacked aggregates is discussed in terms of isoshielding curves theoretically calculated by Giessner-Prettre and Pullman. Models are proposed which are consistent with these and further previous NMR data. 2) The interaction of Cf and AMP has been studied by 1H NMR. The apparent association constant of the complex Cf-AMP is KC-A = (7.3 +/- 1.2) M-1. Two models of the mutual arrangement of AMP and Cf in the complex are proposed on the basis of the calculated isoshielding curves considering both ring current and local atomic diamagnetic anisotropy effects. 3) The interaction of Cf and poly(riboadenylate), (rA)n, is indicated by a downfield shift of the H-8 line but an upfield shifts of the H-2 line in the 1H NMR spectra of (rA)n. The concentration dependence of the 1H NMR shifts of both Cf and (rA)n can be explained by the existence of two binding mechanisms. We suggest (i) partial insertion of Cf between adjacent base residues of ordered single-stranded regions of (rA)n and (ii) outside binding of Cf in form of monomeric Cf as well as of self-associated aggregates. The complex geometry of insertion proposed on the basis of the calculated isoshielding curves is characterized by a stronger overlapping of the Cf ring and the H-2 proton of (rA)n as compared to the H-8 proton. PMID:7357061

  2. Screening for bovine leukocyte adhesion deficiency, deficiency of uridine monophosphate synthase, complex vertebral malformation, bovine citrullinaemia, and factor XI deficiency in Holstein cows reared in Turkey

    PubMed Central


    Background Bovine leukocyte adhesion deficiency (BLAD), deficiency of uridine monophosphate synthase (DUMPS), complex vertebral malformation (CVM), bovine citrullinaemia (BC) and factor XI deficiency (FXID) are autosomal recessive hereditary disorders, which have had significant economic impact on dairy cattle breeding worldwide. In this study, 350 Holstein cows reared in Turkey were screened for BLAD, DUMPS, CVM, BC and FXID genotypes to obtain an indication on the importance of these defects in Turkish Holsteins. Methods Genomic DNA was obtained from blood and the amplicons of BLAD, DUMPS, CVM, BC and FXID were obtained by using PCR. PCR products were digested with TaqI, AvaI and AvaII restriction enzymes for BLAD, DUMPS, and BC, respectively. These digested products and PCR product of FXID were analyzed by agarose gel electrophoresis stained with ethidium bromide. CVM genotypes were detected by DNA sequencing. Additionally, all genotypes were confirmed by DNA sequencing to determine whether there was a mutant allele or not. Results Fourteen BLAD, twelve CVM and four FXID carriers were found among the 350 Holstein cows examined, while carriers of DUMPS and BC were not detected. The mutant allele frequencies were calculated as 0.02, 0.017, and 0.006 for BLAD, CVM and FXID, respectively with corresponding carrier prevalence of 4.0% (BLAD), 3.4% (CVM) and 1.2% (FXID). Conclusion This study demonstrates that carriers of BLAD, CVM and FXID are present in the Turkish Holstein population, although at a low frequency. The actual number of clinical cases is unknown, but sporadic cases may appear. As artificial insemination is widely used in dairy cattle breeding, carriers of BLAD, CVM and FXID are likely present within the population of breeding sires. It is recommended to screen breeding sires for these defective genes in order to avoid an unwanted spread within the population. PMID:20929557

  3. Adenosine Monophosphate-Activated Protein Kinase (AMPK) as a New Target for Antidiabetic Drugs: A Review on Metabolic, Pharmacological and Chemical Considerations

    PubMed Central

    Gruzman, Arie; Babai, Gali; Sasson, Shlomo


    In view of the epidemic nature of type 2 diabetes and the substantial rate of failure of current oral antidiabetic drugs the quest for new therapeutics is intensive. The adenosine monophosphate-activated protein kinase (AMPK) is an important regulatory protein for cellular energy balance and is considered a master switch of glucose and lipid metabolism in various organs, especially in skeletal muscle and liver. In skeletal muscles, AMPK stimulates glucose transport and fatty acid oxidation. In the liver, it augments fatty acid oxidation and decreases glucose output, cholesterol and triglyceride synthesis. These metabolic effects induced by AMPK are associated with lowering blood glucose levels in hyperglycemic individuals. Two classes of oral antihyperglycemic drugs (biguanidines and thiazolidinediones) have been shown to exert some of their therapeutic effects by directly or indirectly activating AMPK. However, side effects and an acquired resistance to these drugs emphasize the need for the development of novel and efficacious AMPK activators. We have recently discovered a new class of hydrophobic D-xylose derivatives that activates AMPK in skeletal muscles in a non insulin-dependent manner. One of these derivatives (2,4;3,5-dibenzylidene-D-xylose-diethyl-dithioacetal) stimulates the rate of hexose transport in skeletal muscle cells by increasing the abundance of glucose transporter-4 (GLUT-4) in the plasma membrane through activation of AMPK. This compound reduces blood glucose levels in diabetic mice and therefore offers a novel strategy of therapeutic intervention strategy in type 2 diabetes. The present review describes various classes of chemically-related compounds that activate AMPK by direct or indirect interactions and discusses their potential for candidate antihyperglycemic drug development. PMID:19557293

  4. Effect of the growth stage and cultivar on policosanol profiles of barley sprouts and their adenosine 5'-monophosphate-activated protein kinase activation.


    Seo, Woo Duck; Yuk, Heung Joo; Curtis-Long, Marcus J; Jang, Ki Chang; Lee, Jin Hwan; Han, Sang-Ik; Kang, Hang Won; Nam, Min Hee; Lee, Sung-Joon; Lee, Ji Hae; Park, Ki Hun


    Adenosine 5'-monophosphate-activated protein kinase (AMPK) is an intracellular sensor that can regulate glucose levels within the cell. For this reason, it is well-known to be a target for drugs against diabetes and obesity. AMPK was activated significantly by the hexane extract of barley sprouts. This AMPK activation emerges across the growth stages of the sprout, becoming most significant (3 times above the initial stages) 10 days after sprouting. After this time, the activation decreased between 13 and 20 days post-sprouting. Analysis of the hexane extracts by gas chromatography-mass spectrometry showed that the amounts of policosanols (PCs, which are linear, primary aliphatic alcohols with 20-30 carbons) in the plant dramatically increased between 5 days (109.7 mg/100 g) and 10 days (343.7 mg/100 g) post-sprouting and then levels fell back down, reaching 76.4 mg/100 g at 20 days post-sprouting. This trend is consistent with PCs being the active ingredient in the barley plants. We validate this by showing that hexacosanol is an activator of AMPK. The richest cultivar for PCs was found to be the Daejin cultivar. Cultivars had a significant effect on the total PC content (113.2-183.5 mg/100 g) within the plant up to 5 days post-sprouting. However this dependence upon the cultivar was not so apparent at peak stages of PC production (10 days post-sprouting). The most abundant PC in barley sprout, hexacosanol, contributed 62-80% of the total PC content at every stage. These results are valuable to determine the optimal times of harvest to obtain the highest yield of PCs. PMID:23301834

  5. The adipokine adiponectin has potent anti-fibrotic effects mediated via adenosine monophosphate-activated protein kinase: novel target for fibrosis therapy

    PubMed Central


    Introduction Fibrosis in scleroderma is associated with collagen deposition and myofibroblast accumulation. Peroxisome proliferator activated receptor gamma (PPAR-γ), a master regulator of adipogenesis, inhibits profibrotic responses induced by transforming growth factor-ß (TGF-β), and its expression is impaired in scleroderma. The roles of adiponectin, a PPAR-γ regulated pleiotropic adipokine, in regulating the response of fibroblasts and in mediating the effects of PPAR-γ are unknown. Methods Regulation of fibrotic gene expression and TGF-ß signaling by adiponectin and adenosine monophosphate protein-activated (AMP) kinase agonists were examined in normal fibroblasts in monolayer cultures and in three-dimensional skin equivalents. AdipoR1/2 expression on skin fibroblasts was determined by real-time quantitative PCR. Results Adiponectin, an adipokine directly regulated by PPAR-γ, acts as a potent anti-fibrotic signal in normal and scleroderma fibroblasts that abrogates the stimulatory effects of diverse fibrotic stimuli and reduces elevated collagen gene expression in scleroderma fibroblasts. Adiponectin responses are mediated via AMP kinase, a fuel-sensing cellular enzyme that is necessary and sufficient for down-regulation of fibrotic genes by blocking canonical Smad signaling. Moreover, we demonstrate that endogenous adiponectin accounts, at least in part, for the anti-fibrotic effects exerted by ligands of PPAR-γ. Conclusions These findings reveal a novel link between cellular energy metabolism and extracellular matrix homeostasis converging on AMP kinase. Since the levels of adiponectin as well as its receptor are impaired in scleroderma patients with progressive fibrosis, the present results suggest a potential role for defective adiponectin expression or function in progressive fibrogenesis in scleroderma and other chronic fibrosing conditions. Restoring the adiponectin signaling axis in fibroblasts might, therefore, represent a novel

  6. Are dinucleoside monophosphates relevant models for the study of DNA intrastrand cross-link lesions? The example of g[8-5m]T.


    Garrec, Julian; Dumont, Elise


    Oxidatively generated tandem lesions such as G[8-5m]T pose a potent threat to genome integrity. Direct experimental studies of the kinetics and thermodynamics of a specific lesion within DNA are very challenging, mostly due to the variety of products that can be formed in oxidative conditions. Dinucleoside monophosphates (DM) involving only the reactive nucleobases in water represent appealing alternative models on which most physical chemistry and structural techniques can be applied. However, it is not yet clear how relevant these models are. Here, we present QM/MM MD simulations of the cyclization step involved in the formation of G[8-5m]T from the guanine-thymine (GpT) DM in water, with the aim of comparing our results to our previous investigation of the same reaction in DNA ( Garrec , J. , Patel , C. , Rothlisberger , U. , and Dumont , E. ( 2012 ) J. Am. Chem. Soc. 134 , 2111 - 2119 ). We show that, despite the different levels of preorganization of the two systems, the corresponding reactions share many energetic and structural characteristics. The main difference lies in the angle between the G and T bases, which is slightly higher in the transition state (TS) and product of the reaction in water than in the reaction in DNA. This effect is due to the Watson-Crick H-bonds, which are absent in the {GpT+water} system and restrain the relative positioning of the reactive nucleobases in DNA. However, since the lesion is accommodated easily in the DNA macromolecule, the induced energetic penalty is relatively small. The high similarity between the two reactions strongly supports the use of GpT in water as a model of the corresponding reaction in DNA. PMID:24911289

  7. The Role of Gene Duplication in the Evolution of Purine Nucleotide Salvage Pathways

    NASA Astrophysics Data System (ADS)

    Becerra, Arturo; Lazcano, Antonio


    Purine nucleotides are formed de novo by a widespread biochemical route that may be of monophyletic origin, or are synthesized from preformed purine bases and nucleosides through different salvage pathways. Three monophyletic sets of purine salvage enzymes, each of which catalyzes mechanistically similar reactions, can be identified: (a) adenine-, xanthine-, hypoxanthine- and guanine-phosphoribosyltransferases, which are all homologous among themselves, as well as to nucleoside phosphorylases; (b) adenine deaminase, adenosine deaminase, and adenosine monophophate deaminase; and (c) guanine reductase and inosine monophosphate dehydrogenase. These homologies support the idea that substrate specificity is the outcome of gene duplication, and that the purine nucleotide salvage pathways were assembled by a patchwork process that probably took place before the divergence of the three cell domains (Bacteria, Archaea, and Eucarya). Based on the ability of adenine PRTase to catalyze the condensation of PRPP with 4-aminoimidazole-5-carboxamide (AICA), a simpler scheme of purine nucleotide biosynthesis is presented. This hypothetical route requires the prior evolution of PRPP biosynthesis. Since it has been argued that PRPP, nucleosides, and nucleotides are susceptible to hydrolysis, they are very unlikely prebiotic compounds. If this is the case, it implies that many purine salvage pathways appeared only after the evolution of phosphorylated sugar biosynthetic pathways made ribosides available.

  8. The nitric oxide-cyclic GMP pathway and synaptic plasticity in the rat superior cervical ganglion.

    PubMed Central

    Southam, E.; Charles, S. L.; Garthwaite, J.


    1. We have investigated the possibility that nitric oxide (NO) and soluble guanylyl cyclase, an enzyme that synthesizes guanosine 3':5'-cyclic monophosphate (cyclic GMP) in response to NO, contributes to plasticity of synaptic transmission in the rat isolated superior cervical ganglion (SCG). 2. Exposure of ganglia to the NO donor, nitroprusside, caused a concentration-dependent accumulation of cyclic GMP which was augmented in the presence of the phosphodiesterase inhibitor, 3-isobutyl-1-methylxanthine. The compound, 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ), a selective inhibitor of soluble guanylyl cyclase, completely blocked this cyclic GMP response. 3. As assessed by extracellular recording, nitroprusside (100 microM) and another NO donor, S-nitrosoglutathione (30 microM) increased the efficacy of ganglionic synaptic transmission in response to electrical stimulation of the preganglionic nerve, an effect that was reversible and which could be replicated by the cyclic GMP analogue, 8-bromo-cyclic GMP. Ganglionic depolarizations resulting from stimulation of nicotinic receptors with carbachol were not increased by nitroprusside. The potentiating actions of the NO donors on synaptic transmission, but not that of 8-bromo-cyclic GMP, were inhibited by ODQ. 4. Brief tetanic stimulation of the preganglionic nerve resulted in a long-term potentiation (LTP) of synaptic transmission that was unaffected by ODQ, either in the absence or presence of the NO synthase inhibitor, NG-nitro-L-arginine (L-NOARG, 100 microM). A lack of influence of L-NOARG was confirmed in intracellular recordings of LTP of the excitatory postsynaptic potential. Furthermore, under conditions where tetanically-induced LTP was saturated, nitroprusside was still able to potentiate synaptic transmission, as judged from extracellular recording. 5. We conclude that NO is capable of potentiating ganglionic neurotransmission and this effect is mediated through the stimulation of soluble guanylyl

  9. Nitric oxide synthetic pathway and cGMP levels are altered in red blood cells from end-stage renal disease patients.


    Di Pietro, Natalia; Giardinelli, Annalisa; Sirolli, Vittorio; Riganti, Chiara; Di Tomo, Pamela; Gazzano, Elena; Di Silvestre, Sara; Panknin, Christina; Cortese-Krott, Miriam M; Csonka, Csaba; Kelm, Malte; Ferdinandy, Péter; Bonomini, Mario; Pandolfi, Assunta


    Red blood cells (RBCs) enzymatically produce nitric oxide (NO) by a functional RBC-nitric oxide synthase (RBC-NOS). NO is a vascular key regulatory molecule. In RBCs its generation is complex and influenced by several factors, including insulin, acetylcholine, and calcium. NO availability is reduced in end-stage renal disease (ESRD) and associated with endothelial dysfunction. We previously demonstrated that, through increased phosphatidylserine membrane exposure, ESRD-RBCs augmented their adhesion to human cultured endothelium, in which NO bioavailability decreased. Since RBC-NOS-dependent NO production in ESRD is unknown, this study aimed to investigate RBC-NOS levels/activation, NO production/bioavailability in RBCs from healthy control subjects (C, N = 18) and ESRD patients (N = 27). Although RBC-NOS expression was lower in ESRD-RBCs, NO, cyclic guanosine monophosphate (cGMP), RBC-NOS Serine1177 phosphorylation level and eNOS/Calmodulin (CaM)/Heat Shock Protein-90 (HSP90) interaction levels were higher in ESRD-RBCs, indicating increased enzyme activation. Conversely, following RBCs stimulation with insulin or ionomycin, NO and cGMP levels were significantly lower in ESRD- than in C-RBCs, suggesting that uremia might reduce the RBC-NOS response to further stimuli. Additionally, the activity of multidrug-resistance-associated protein-4 (MRP4; cGMP-membrane transporter) was significantly lower in ESRD-RBCs, suggesting a possible compromised efflux of cGMP across the ESRD-RBCs membrane. This study for the first time showed highest basal RBC-NOS activation in ESRD-RBCs, possibly to reduce the negative impact of decreased NOS expression. It is further conceivable that high NO production only partially affects cell function of ESRD-RBCs maybe because in vivo they are unable to respond to physiologic stimuli, such as calcium and/or insulin. PMID:27206740

  10. Methanolic Extract of Clinacanthus nutans Exerts Antinociceptive Activity via the Opioid/Nitric Oxide-Mediated, but cGMP-Independent, Pathways.


    Abdul Rahim, Mohammad Hafiz; Zakaria, Zainul Amiruddin; Mohd Sani, Mohd Hijaz; Omar, Maizatul Hasyima; Yakob, Yusnita; Cheema, Manraj Singh; Ching, Siew Mooi; Ahmad, Zuraini; Abdul Kadir, Arifah


    The objectives of the present study were to determine the mechanisms of antinociceptive effect of methanol extract of Clinacanthus nutans (Acanthaceae) leaves (MECN) using various animal nociceptive models. The antinociceptive activity of orally administered 10% DMSO, 100 mg/kg acetylsalicylic acid (ASA), 5 mg/kg morphine, or MECN (100, 250, and 500 mg/kg) was determined using the acetic acid-induced abdominal constriction (ACT), formalin-induced paw licking (FT), and hot plate tests (HPT). The role of opioid and nitric oxide/cyclic guanosine monophosphate (NO/cGMP) systems was also investigated. The results showed that MECN produced a significant (p < 0.05) antinociceptive response in all nociceptive models with the recorded ED50 value of 279.3 mg/kg for the ACT, while, for the early and late phases of the FT, the value was >500 mg/kg or 227.7 mg/kg, respectively. This antinociceptive activity was fully antagonized by naloxone (a nonselective opioid antagonist) but was partially reversed by l-arginine (l-arg; a nitric oxide [NO] precursor), Nω-nitro-l-arginine methyl ester hydrochloride (l-NAME; an NO synthase inhibitor), or their combinations thereof. In contrast, 1H-[1,2,4]oxadiazole[4,3-a]quinoxalin-1-one (ODQ; a soluble guanylyl cyclase inhibitor) enhanced the extract's antinociception. UHPLC analysis revealed the presence of several flavonoid-based compounds with antinociceptive action. In conclusion, MECN exerted the peripherally and centrally mediated antinociceptive activity via the modulation of the opioid/NO-mediated, but cGMP-independent, systems. PMID:27190528

  11. Pharmacological evidence for the involvement of the NMDA receptor and nitric oxide pathway in the antidepressant-like effect of lamotrigine in the mouse forced swimming test.


    Ostadhadi, Sattar; Ahangari, Mohammad; Nikoui, Vahid; Norouzi-Javidan, Abbas; Zolfaghari, Samira; Jazaeri, Farahnaz; Chamanara, Mohsen; Akbarian, Reyhaneh; Dehpour, Ahmad-Reza


    Lamotrigine is an anticonvulsant agent that shows clinical antidepressant properties. The aim of the present study was to investigate the involvement of N-methyl-d-aspartate (NMDA) receptors and nitric oxide-cyclic guanosine monophosphate (NO-cGMP) synthesis in possible antidepressant-like effect of lamotrigine in forced swimming test (FST) in mice. Intraperitoneal administration of lamotrigine (10mg/kg) decreased the immobility time in the FST (P<0.01) without any effect on locomotor activity in the open-field test (OFT), while higher dose of lamotrigine (30mg/kg) reduced the immobility time in the FST (P<0.001) as well as the number of crossings in the OFT. Pretreatment of animals with NMDA (75mg/kg), l-arginine (750mg/kg, a substrate for nitric oxide synthase [NOS]) or sildenafil (5mg/kg, a phosphodiesterase [PDE] 5 inhibitor) reversed the antidepressant-like effect of lamotrigine (10mg/kg) in the FST. Injection of l-nitroarginine methyl ester (l-NAME, 10mg/kg, a non-specific NOS inhibitor), 7-nitroindazole (30mg/kg, a neuronal NOS inhibitor), methylene blue (20mg/kg, an inhibitor of both NOS and soluble guanylate cyclase [sGC]), or MK-801 (0.05mg/kg), ketamine (1mg/kg), and magnesium sulfate (10mg/kg) as NMDA receptor antagonists in combination with a sub-effective dose of lamotrigine (5mg/kg) diminished the immobility time of animals in the FST compared with either drug alone. None of the drugs produced significant effects on the locomotor activity in the OFT. Based on our findings, it is suggested that the antidepressant-like effect of lamotrigine might mediated through inhibition of either NMDA receptors or NO-cGMP synthesis. PMID:27470415

  12. Methanolic Extract of Clinacanthus nutans Exerts Antinociceptive Activity via the Opioid/Nitric Oxide-Mediated, but cGMP-Independent, Pathways

    PubMed Central

    Abdul Rahim, Mohammad Hafiz; Zakaria, Zainul Amiruddin; Mohd Sani, Mohd Hijaz; Omar, Maizatul Hasyima; Yakob, Yusnita; Cheema, Manraj Singh; Ching, Siew Mooi; Ahmad, Zuraini; Abdul Kadir, Arifah


    The objectives of the present study were to determine the mechanisms of antinociceptive effect of methanol extract of Clinacanthus nutans (Acanthaceae) leaves (MECN) using various animal nociceptive models. The antinociceptive activity of orally administered 10% DMSO, 100 mg/kg acetylsalicylic acid (ASA), 5 mg/kg morphine, or MECN (100, 250, and 500 mg/kg) was determined using the acetic acid-induced abdominal constriction (ACT), formalin-induced paw licking (FT), and hot plate tests (HPT). The role of opioid and nitric oxide/cyclic guanosine monophosphate (NO/cGMP) systems was also investigated. The results showed that MECN produced a significant (p < 0.05) antinociceptive response in all nociceptive models with the recorded ED50 value of 279.3 mg/kg for the ACT, while, for the early and late phases of the FT, the value was >500 mg/kg or 227.7 mg/kg, respectively. This antinociceptive activity was fully antagonized by naloxone (a nonselective opioid antagonist) but was partially reversed by l-arginine (l-arg; a nitric oxide [NO] precursor), Nω-nitro-l-arginine methyl ester hydrochloride (l-NAME; an NO synthase inhibitor), or their combinations thereof. In contrast, 1H-[1,2,4]oxadiazole[4,3-a]quinoxalin-1-one (ODQ; a soluble guanylyl cyclase inhibitor) enhanced the extract's antinociception. UHPLC analysis revealed the presence of several flavonoid-based compounds with antinociceptive action. In conclusion, MECN exerted the peripherally and centrally mediated antinociceptive activity via the modulation of the opioid/NO-mediated, but cGMP-independent, systems. PMID:27190528

  13. A new nonhydrolyzable reactive cGMP analogue, (Rp)-Guanosine-3′, 5′-cyclic-S-(4-bromo-2, 3-dioxobutyl)monophosphorothioate, which targets the cGMP binding site of human platelet PDE3A

    PubMed Central

    Hung, Su H.; Liu, Andy H.; Pixley, Robin A.; Francis, Penelope; Williams, LaTeeka D.; Matsko, Christopher M.; Barnes, Karine D.; Sivendran, Sharmila; Colman, Roberta F.; Colman, Robert W.


    The amino acids involved in substrate (cAMP) binding to human platelet cGMP-inhibited cAMP phosphodiesterase (PDE3A) are identified. Less is known about the inhibitor (cGMP) binding site. We have now synthesized a nonhydrolyzable reactive cGMP analog, Rp-guanosine-3′, 5′-cyclic-S-(4-bromo-2, 3-dioxobutyl)monophosphorothioate (Rp-cGMPS-BDB). Rp-cGMPS-BDB irreversibly inactivates PDE3A (KI = 43.4 ± 7.2 μM and kcart = 0.007 ± 0.0006 min−1). The effectiveness of protectants in decreasing the rate of inactivation by Rp-cGMPS-BDB is: Rp-cGMPS (Kd = 72 μM) > Sp-cGMPS (124), Sp-cAMPS (182) > GMP (1517), Rp-cAMPS (3762), AMP (4370 μM). NAD+, neither a substrate nor an inhibitor of PDE3A, does not protect. Nonhydrolyzable cGMP analogs exhibit greater affinity than the cAMP analogs. These results indicate that Rp-cGMPS-BDB targets favorably the cGMP binding site consistent with a docking model of PDE3A-Rp-cGMPS-BDB active site. We conclude that Rp-cGMPS-BDB is an effective active site-directed affinity label for PDE3A with potential for other cGMP-dependent enzymes. PMID:18394675

  14. Crystal structure of a nucleoside model for the inter­strand cross-link formed by the reaction of 2′-de­oxy­guanosine and an abasic site in duplex DNA

    PubMed Central

    Catalano, Michael J.; Ruddraraju, Kasi Viswanatharaju; Barnes, Charles L.; Gates, Kent S.


    The title compound, 9-[(2R,4S,5R)-4-hy­droxy-5-(hy­droxy­meth­yl)tetra­hydro­furan-2-yl]-2-{[(2R,4S,5R)-4-meth­oxy-5-(meth­oxy­meth­yl)tetra­hydro­furan-2-yl]amino}-1H-purin-6(9H)-one, C17H25N5O7, crystallizes with two independent mol­ecules (A and B) in the asymmetric unit. In the crystal, the guanosine moieties of mol­ecules A and B are linked by N—H⋯N and O—H⋯N hydrogen-bonding inter­actions, forming ribbons which are stacked to form columns along [100]. These columns are then linked by O—H⋯O hydrogen bonds between the ribose moieties and numerous C—H⋯O inter­actions to complete the three-dimensional structure. PMID:27308004

  15. Light- and guanosine 5'-3-O-(thio)triphosphate-sensitive localization of a G protein and its effector on detergent-resistant membrane rafts in rod photoreceptor outer segments.


    Seno, K; Kishimoto, M; Abe, M; Higuchi, Y; Mieda, M; Owada, Y; Yoshiyama, W; Liu, H; Hayashi, F


    Detergent-resistant membrane microdomains in the plasma membrane, known as lipid rafts, have been implicated in various cellular processes. We report here that a low-density Triton X-100-insoluble membrane (detergent-resistant membrane; DRM) fraction is present in bovine rod photoreceptor outer segments (ROS). In dark-adapted ROS, transducin and most of cGMP-phosphodiesterase (PDE) were detergent-soluble. When ROS membranes were exposed to light, however, a large portion of transducin localized in the DRM fraction. Furthermore, on addition of guanosine 5'-3-O-(thio)triphosphate (GTPgammaS) to light-bleached ROS, transducin became detergent-soluble again. PDE was not recruited to the DRM fraction after light stimulus alone, but simultaneous stimulation by light and GTPgammaS induced a massive translocation of all PDE subunits to the DRM. A cholesterol-removing reagent, methyl-beta-cyclodextrin, selectively but partially solubilized PDE from the DRM, suggesting that cholesterol contributes, at least in part, to the association of PDE with the DRM. By contrast, transducin was not extracted by the depletion of cholesterol. These data suggest that transducin and PDE are likely to perform their functions in phototransduction by changing their localization between two distinct lipid phases, rafts and surrounding fluid membrane, on disc membranes in an activation-dependent manner. PMID:11319214

  16. Inhibition of insulin release by synthetic peptides shows that the H3 region at the C-terminal domain of syntaxin-1 is crucial for Ca(2+)- but not for guanosine 5'-[gamma-thio]triphosphate-induced secretion.

    PubMed Central

    Martin, F; Salinas, E; Vazquez, J; Soria, B; Reig, J A


    Recently, we have described the presence and possible role of syntaxin in pancreatic beta-cells by using monoclonal antibodies [F. Martin, F. Moya, L. M. Gutierrez, J.A. Reig, B. Soria (1995) Diabetologia 38, 860-863]. In order to characterize further the importance of specific domains of this protein, the functional role of a particular region of the syntaxin-1 molecule has now been investigated by using two synthetic peptides, SynA and SynB, corresponding to two portions of the H3 region at the C-terminal domain of the protein, residues 229-251 and 197-219 respectively. Functional experiments carried out in permeabilized pancreatic beta-cells demonstrate that these peptides inhibit Ca(2+)-dependent insulin release in a dose-dependent manner. This effect is specific because peptides of the same composition but random sequence do not show the same effect. In contrast with this inhibitory effect on Ca(2+)-induced secretion, both peptides increase basal release. However, under the same conditions, SynA and SynB do not affect guanosine 5'-[gamma-thio]triphosphate-induced insulin release. These results demonstrate that specific portions of the H3 region of syntaxin-1 are involved in critical protein-protein interactions specifically during Ca(2+)-induced insulin secretion. PMID:8947488

  17. The cytohesin guanosine exchange factors (GEFs) are required to promote HGF-mediated renal recovery after acute kidney injury (AKI) in mice

    PubMed Central

    Reviriego-Mendoza, Marta M; Santy, Lorraine C


    The lack of current treatment and preventable measures for acute kidney injury (AKI) in hospitalized patients results in an increased mortality rate of up to 80% and elevated health costs. Additionally, if not properly repaired, those who survive AKI may develop fibrosis and long-term kidney damage. The molecular aspects of kidney injury and repair are still uncertain. Hepatocyte growth factor (HGF) promotes recovery of the injured kidney by inducing survival and migration of tubular epithelial cells to repopulate bare tubule areas. HGF-stimulated kidney epithelial cell migration requires the activation of ADP-ribosylation factor 6 (Arf6) and Rac1 via the cytohesin family of Arf-guanine-nucleotide exchange factors (GEFs), in vitro. We used an ischemia and reperfusion injury (IRI) mouse model to analyze the effects of modulating this signaling pathway on kidney recovery. We treated IRI mice with either HGF, the cytohesin inhibitor SecinH3, or a combination of both. As previously reported, HGF treatment promoted rapid improvement of kidney function as evidenced by creatinine (Cre) and blood urea nitrogen (BUN) levels. In contrast, simultaneous treatment with SecinH3 and HGF blocks the ability of HGF to promote kidney recovery. Immunohistochemistry showed that HGF treatment promoted recovery of tubule structure, and had enhanced levels of active, GTP-bound Arf6 and GTP-Rac1. SecinH3 treatment, however, caused a dramatic decrease in GTP-Arf6 and GTP-Rac1 levels when compared to kidney sections from HGF-treated IRI mice. Additionally, SecinH3 counteracted the renal reparative effects of HGF. Our results support the conclusion that cytohesin function is required for HGF-stimulated renal IRI repair. PMID:26116550

  18. Improvement of L-lysine production by Methylophilus methylotrophus from methanol via the Entner-Doudoroff pathway, originating in Escherichia coli.


    Ishikawa, Kohei; Gunji, Yoshiya; Yasueda, Hisashi; Asano, Kozo


    To improve the amino acid production by metabolic engineering, eliminating the pathway bottleneck is known to be very effective. The metabolic response of Methylophilus methylotrophus upon the addition of glucose and of pyruvate was investigated in batch cultivation. We found that the supply of pyruvate is a bottleneck in L-lysine production in M. methylotrophus from methanol as carbon source. M. methylotrophus has a ribulose monophosphate (RuMP) pathway for methanol assimilation, and consequently synthesized fructose-6-phosphate is metabolized to pyruvate via the Entner-Doudoroff (ED) pathway, and the ED pathway is thought to be the main pathway for pyruvate supply. An L-lysine producer of M. methylotrophus with an enhanced ED pathway was constructed by the introduction of the E. coli edd-eda operon encoding the enzyme involving the ED pathway. In this strain, the overall enzymatic activity of ED pathway, which is estimated by measuring the activities of 6-phosphogluconate dehydrogenase plus 2-keto-3-deoxy-6-phosphogluconate aldolase, was about 20 times higher than in the parent. This strain produced 1.2 times more L-lysine than the parent producer. Perhaps, then, the supply of pyruvate was a bottleneck in L-lysine production in the L-lysine producer of M. methylotrophus. PMID:18838820


    NASA Technical Reports Server (NTRS)

    Beratan, D. N.


    The key to understanding the mechanisms of many important biological processes such as photosynthesis and respiration is a better understanding of the electron transfer processes which take place between metal atoms (and other groups) fixed within large protein molecules. Research is currently focused on the rate of electron transfer and the factors that influence it, such as protein composition and the distance between metal atoms. Current models explain the swift transfer of electrons over considerable distances by postulating bridge-mediated tunneling, or physical tunneling pathways, made up of interacting bonds in the medium around and between donor and acceptor sites. The program PATHWAYS is designed to predict the route along which electrons travel in the transfer processes. The basic strategy of PATHWAYS is to begin by recording each possible path element on a connectivity list, including in each entry which two atoms are connected and what contribution the connection would make to the overall rate if it were included in a pathway. The list begins with the bonded molecular structure (including the backbone sequence and side chain connectivity), and then adds probable hydrogen bond links and through-space contacts. Once this list is completed, the program runs a tree search from the donor to the acceptor site to find the dominant pathways. The speed and efficiency of the computer search offers an improvement over manual techniques. PATHWAYS is written in FORTRAN 77 for execution on DEC VAX series computers running VMS. The program inputs data from four data sets and one structure file. The software was written to input BIOGRAF (old format) structure files based on x-ray crystal structures and outputs ASCII files listing the best pathways and BIOGRAF vector files containing the paths. Relatively minor changes could be made in the input format statements for compatibility with other graphics software. The executable and source code are included with the

  20. Targeting Phosphodiesterases in Anti-platelet Therapy

    PubMed Central

    Rondina, Matthew T.; Weyrich, Andrew S.


    There are two primary modes of platelet inhibition: blockade of membrane receptors or neutralization of intracellular pathways. Both means of inhibition have proven benefits in the prevention and resolution of atherothrombotic events. With regard to intracellular inhibition, phosphodiesterases (PDEs) are fundamental for platelet function. Platelets possess several PDEs (PDE2, PDE3 and PDE5) that catalyze the hydrolysis of cyclic adenosine 3′-5′-monophosphate (cAMP) and cyclic guanosine 3′-5′-monophosphate (cGMP), thereby limiting the levels of intracellular nucleotides. PDE inhibitors, such as cilostazol and dipyridamole, dampen platelet function by increasing cAMP and cGMP levels. This review focuses on the roles of PDE inhibitors in modulating platelet function, with particular attention paid to drugs that have anti-platelet clinical indications. PMID:22918733

  1. Dietary effects of adenosine monophosphate to enhance growth, digestibility, innate immune responses and stress resistance of juvenile red sea bream, Pagrus major.


    Hossain, Md Sakhawat; Koshio, Shunsuke; Ishikawa, Manabu; Yokoyama, Saichiro; Sony, Nadia Mahjabin


    Our study explored the dietary effects of adenosine monophosphate (AMP) to enhance growth, digestibility, innate immune responses and stress resistance of juvenile red sea bream. A semi-purified basal diet supplemented with 0% (Control), 0.1% (AMP-0.1), 0.2% (AMP-0.2), 0.4% (AMP-0.4) and 0.8% (AMP-0.8) purified AMP to formulate five experimental diets. Each diet was randomly allocated to triplicate groups of fish (mean initial weight 3.4 g) for 56 days. The results indicated that dietary AMP supplements tended to improve growth performances. One of the best ones was found in diet group AMP-0.2, followed by diet groups AMP-0.1, AMP-0.4 and AMP-0.8. The Apparent digestibility coefficients (dry matter, protein and lipid) also improved by AMP supplementation and the significantly highest dry matter digestibility was observed in diet group AMP-0.2. Fish fed diet groups AMP-0.2 and AMP-0.4 had significantly higher peroxidase and bactericidal activities than fish fed the control diet. Nitro-blue-tetrazolium (NBT) activity was found to be significantly (P < 0.05) greater in fish fed diet groups AMP-0.4 and AMP-0.8. Total serum protein, lysozyme activity and agglutination antibody titer were also increased (P > 0.05) by dietary supplementation. In contrast, catalase activity decreased with AMP supplementation. Moreover, the fish fed AMP supplemented diets had better improvement (P < 0.05) in body lipid contents, condition factor, hematocrit content and glutamyl oxaloacetic transaminase (GOT) level than the control group. Supplementation also improved both freshwater and oxidative stress resistances. Interestingly, the fish fed diet groups AMP-0.2 and AMP-0.4 showed the least oxidative stress condition. Finally it is concluded that, dietary AMP supplementation enhanced the growth, digestibility, immune response and stress resistance of red sea bream. The regression analysis revealed that a dietary AMP supplementation between 0.2 and 0.4% supported weight gain and

  2. Effects of single or combined histamine H1-receptor and leukotriene CysLT1-receptor antagonism on nasal adenosine monophosphate challenge in persistent allergic rhinitis

    PubMed Central

    Lee, Daniel K C; Jackson, Catherine M; Soutar, Patricia C; Fardon, Thomas C; Lipworth, Brian J


    Background The effects of single or combined histamine H1-receptor and leukotriene CysLT1-receptor antagonism on nasal adenosine monophosphate (AMP) challenge in allergic rhinitis are unknown. Objective We elected to study the effects of usual clinically recommended doses of fexofenadine (FEX), montelukast (ML) and FEX + ML combination, compared with placebo (PL), on nasal AMP challenge in patients with persistent allergic rhinitis. Methods Twelve patients with persistent allergic rhinitis (all skin prick positive to house dust mite) were randomized in a double-blind cross-over fashion to receive for 1 week either FEX 180 mg, ML 10 mg, FEX 180 mg +ML 10 mg combination, or PL, with nasal AMP challenge performed 12 h after dosing. There was a 1-week washout period between each randomized treatment. The primary outcome measure was the maximum percentage peak nasal inspiratory flow (PNIF) fall from baseline over a 60-min period after nasal challenge with a single 400 mg ml−1 dose of AMP. The area under the 60-min time–response curve (AUC) and nasal symptoms were measured as secondary outcomes. Results There was significant attenuation (P < 0.05) of the mean maximum percentage PNIF fall from baseline after nasal AMP challenge vs. PL, 48; with FEX, 37; 95% confidence interval for difference 2, 20; ML, 35 (4, 22); and FEX + ML, 32 (7, 24). The AUC (%.min) was also significantly attenuated (P < 0.05) vs. PL, 1893; with FEX, 1306 (30, 1143); ML, 1246 (214, 1078); and FEX + ML, 1153 (251, 1227). There were no significant differences for FEX vs. ML vs. FEX + ML comparing either the maximum or AUC response. The total nasal symptom score (out of 12) was also significantly improved (P < 0.05) vs. PL, 3.3; with FEX, 2.1 (0.3, 2.0); ML, 2.0 (0.5, 1.9); and FEX + ML, 2.5 (0.1, 1.4). Conclusion FEX and ML as monotherapy significantly attenuated the response to nasal AMP challenge and improved nasal symptoms compared with PL, while combination therapy conferred no additional

  3. Feedback inhibition of cyclic adenosine monophosphate-stimulated Na+ transport in the rabbit cortical collecting duct via Na(+)-dependent basolateral Ca++ entry.

    PubMed Central

    Breyer, M D


    Arginine vasopressin (AVP) transiently stimulates Na+ transport in the rabbit cortical collecting duct (CCD). However, the sustained effect of both AVP and its putative second messenger, cyclic adenosine monophosphate (cAMP), on Na+ transport in the rabbit CCD is inhibitory. Because maneuvers that increase [Ca++]i inhibit Na+ transport, the effects of AVP and cell-permeable cAMP analogues, on [Ca++]i were investigated in fura-2-loaded in vitro microperfused rabbit CCDs. Low-dose AVP (23-230 pM) selectively stimulated Ca++ influx, whereas 23 nM AVP additionally released calcium from intracellular stores. 8-chlorophenylthio-cAMP (8CPTcAMP) and 8-bromo-cAMP (8-Br-cAMP) also increased CCD [Ca++]i. The 8CPTcAMP-stimulated [Ca++]i increase was totally dependent on basolateral [Ca++]. In the absence of cAMP, peritubular Na+ removal produced a marked increase in [Ca++]i, which was also dependent on bath [Ca++], suggesting the existence of basolateral Na+/Ca++ exchange. Luminal Na+ removal in the absence of cAMP did not alter CCD [Ca++]i, but it completely blocked the cAMP-stimulated [Ca++]i increase. Thus the cAMP-dependent Ca++ increase is totally dependent on both luminal Na+ and basolateral Ca++, suggesting the [Ca++]i increase is secondary to cAMP effects on luminal Na+ entry and its coupling to basolateral Na+/Ca++ exchange. 8CPTcAMP inhibits lumen-to-bath 22Na flux [JNa(l-b)] in CCDs bathed in a normal Ca++ bath (2.4 mM). However, when bath Ca++ was lowered to 100 nM, a maneuver that also blocks the 8CPTcAMP [Ca++]i increase, 8CPTcAMP stimulated, rather than inhibited JNa(l-b). These results suggest that cAMP formation initially stimulates CCD Na+ transport, and that increased apical Na+ entry secondarily activates basolateral Ca++ entry. The cAMP-dependent [Ca++]i increase leads to inhibition Na+ transport in the rabbit CCD. PMID:1658041

  4. Simultaneous interaction with base and phosphate moieties modulates the phosphodiester cleavage of dinucleoside 3',5'-monophosphates by dinuclear Zn2+ complexes of di(azacrown) ligands.


    Wang, Qi; Lönnberg, Harri


    Five dinucleating ligands (1-5) and one trinucleating ligand (6) incorporating 1,5,9-triazacyclododecan-3-yloxy groups attached to an aromatic scaffold have been synthesized. The ability of the Zn(2+) complexes of these ligands to promote the transesterification of dinucleoside 3',5'-monophosphates to a 2',3'-cyclic phosphate derived from the 3'-linked nucleoside by release of the 5'-linked nucleoside has been studied over a narrow pH range, from pH 5.8 to 7.2, at 90 degrees C. The dinuclear complexes show marked base moiety selectivity. Among the four dinucleotide 3',5'-phosphates studied, viz. adenylyl-3',5'-adenosine (ApA), adenylyl-3',5'-uridine (ApU), uridylyl-3',5'-adenosine (UpA), and uridylyl-3',5'-uridine (UpU), the dimers containing one uracil base (ApU and UpA) are cleaved up to 2 orders of magnitude more readily than those containing either two uracil bases (UpU) or two adenine bases (ApA). The trinuclear complex (6), however, cleaves UpU as readily as ApU and UpA, while the cleavage of ApA remains slow. UV spectrophotometric and (1)H NMR spectroscopic studies with one of the dinucleating ligands (3) verify binding to the bases of UpU and ApU at less than millimolar concentrations, while no interaction with the base moieties of ApA is observed. With ApU and UpA, one of the Zn(2+)-azacrown moieties in all likelihood anchors the cleaving agent to the uracil base of the substrate, while the other azacrown moiety serves as a catalyst for the phosphodiester transesterification. With UpU, two azacrown moieties are engaged in the base moiety binding. The catalytic activity is, hence, lost, but it can be restored by addition of a third azacrown group on the cleaving agent. PMID:16910666

  5. Interfering with resistance to smoothened antagonists by inhibition of the PI3K pathway in medulloblastoma.


    Buonamici, Silvia; Williams, Juliet; Morrissey, Michael; Wang, Anlai; Guo, Ribo; Vattay, Anthony; Hsiao, Kathy; Yuan, Jing; Green, John; Ospina, Beatriz; Yu, Qunyan; Ostrom, Lance; Fordjour, Paul; Anderson, Dustin L; Monahan, John E; Kelleher, Joseph F; Peukert, Stefan; Pan, Shifeng; Wu, Xu; Maira, Sauveur-Michel; García-Echeverría, Carlos; Briggs, Kimberly J; Watkins, D Neil; Yao, Yung-mae; Lengauer, Christoph; Warmuth, Markus; Sellers, William R; Dorsch, Marion


    The malignant brain cancer medulloblastoma is characterized by mutations in Hedgehog (Hh) signaling pathway genes, which lead to constitutive activation of the G protein (heterotrimeric guanosine triphosphate-binding protein)-coupled receptor Smoothened (Smo). The Smo antagonist NVP-LDE225 inhibits Hh signaling and induces tumor regression in animal models of medulloblastoma. However, evidence of resistance was observed during the course of treatment. Molecular analysis of resistant tumors revealed several resistance mechanisms. We noted chromosomal amplification of Gli2, a downstream effector of Hh signaling, and, more rarely, point mutations in Smo that led to reactivated Hh signaling and restored tumor growth. Analysis of pathway gene expression signatures also, unexpectedly, identified up-regulation of phosphatidylinositol 3-kinase (PI3K) signaling in resistant tumors as another potential mechanism of resistance. Probing the relevance of increased PI3K signaling, we demonstrated that addition of the PI3K inhibitor NVP-BKM120 or the dual PI3K-mTOR (mammalian target of rapamycin) inhibitor NVP-BEZ235 to the initial treatment with the Smo antagonist markedly delayed the development of resistance. Our findings may be useful in informing treatment strategies for medulloblastoma. PMID:20881279

  6. Insights into the autotrophic CO2 fixation pathway of the archaeon Ignicoccus hospitalis: comprehensive analysis of the central carbon metabolism.


    Jahn, Ulrike; Huber, Harald; Eisenreich, Wolfgang; Hügler, Michael; Fuchs, Georg


    Ignicoccus hospitalis is an autotrophic hyperthermophilic archaeon that serves as a host for another parasitic/symbiotic archaeon, Nanoarchaeum equitans. In this study, the biosynthetic pathways of I. hospitalis were investigated by in vitro enzymatic analyses, in vivo (13)C-labeling experiments, and genomic analyses. Our results suggest the operation of a so far unknown pathway of autotrophic CO(2) fixation that starts from acetyl-coenzyme A (CoA). The cyclic regeneration of acetyl-CoA, the primary CO(2) acceptor molecule, has not been clarified yet. In essence, acetyl-CoA is converted into pyruvate via reductive carboxylation by pyruvate-ferredoxin oxidoreductase. Pyruvate-water dikinase converts pyruvate into phosphoenolpyruvate (PEP), which is carboxylated to oxaloacetate by PEP carboxylase. An incomplete citric acid cycle is operating: citrate is synthesized from oxaloacetate and acetyl-CoA by a (re)-specific citrate synthase, whereas a 2-oxoglutarate-oxidizing enzyme is lacking. Further investigations revealed that several special biosynthetic pathways that have recently been described for various archaea are operating. Isoleucine is synthesized via the uncommon citramalate pathway and lysine via the alpha-aminoadipate pathway. Gluconeogenesis is achieved via a reverse Embden-Meyerhof pathway using a novel type of fructose 1,6-bisphosphate aldolase. Pentosephosphates are formed from hexosephosphates via the suggested ribulose-monophosphate pathway, whereby formaldehyde is released from C-1 of hexose. The organism may not contain any sugar-metabolizing pathway. This comprehensive analysis of the central carbon metabolism of I. hospitalis revealed further evidence for the unexpected and unexplored diversity of metabolic pathways within the (hyperthermophilic) archaea. PMID:17400748

  7. Insights into the pyrimidine biosynthetic pathway of human malaria parasite Plasmodium falciparum as chemotherapeutic target.


    Krungkrai, Sudaratana R; Krungkrai, Jerapan


    Malaria is a major cause of morbidity and mortality in humans. Artemisinins remain as the first-line treatment for Plasmodium falciparum (P. falciparum) malaria although drug resistance has already emerged and spread in Southeast Asia. Thus, to fight this disease, there is an urgent need to develop new antimalarial drugs for malaria chemotherapy. Unlike human host cells, P. falciparum cannot salvage preformed pyrimidine bases or nucleosides from the extracellular environment and relies solely on nucleotides synthesized through the de novo biosynthetic pathway. This review presents significant progress on understanding the de novo pyrimidine pathway and the functional enzymes in the human parasite P. falciparum. Current knowledge in genomics and metabolomics are described, particularly focusing on the parasite purine and pyrimidine nucleotide metabolism. These include gene annotation, characterization and molecular mechanism of the enzymes that are different from the human host pathway. Recent elucidation of the three-dimensional crystal structures and the catalytic reactions of three enzymes: dihydroorotate dehydrogenase, orotate phosphoribosyltransferase, and orotidine 5'-monophosphate decarboxylase, as well as their inhibitors are reviewed in the context of their therapeutic potential against malaria. PMID:27262062

  8. A Dystroglycan/Plectin Scaffold Mediates Mechanical Pathway Bifurcation in Lung Epithelial Cells*

    PubMed Central

    Takawira, Desire; Budinger, G. R. Scott; Hopkinson, Susan B.; Jones, Jonathan C. R.


    In alveolar epithelial cells (AECs), the membrane-anchored proteoglycan dystroglycan (DG) is a mechanoreceptor that transmits mechanical stretch forces to activate independently the ERK1/2 and the adenosine 5′-monophosphate-activated protein kinase (AMPK) signaling cascades in a process called pathway bifurcation. We tested the hypothesis that the cytoskeleton cross-linker plectin, known to bind both DG and AMPK in muscle cells, acts as a scaffold to regulate DG-mediated mechanical stimulation and pathway bifurcation. We demonstrate that plectin and DG form a complex in AECs and that this complex interacts with ERK1/2 and AMPK. Plectin knockdown reduces DG interaction with AMPK but not with ERK1/2. Despite this, mechanoactivation of both signaling pathways is significantly attenuated in AECs deficient in plectin. Thus, DG has the dual role of mechanical receptor and scaffold for ERK1/2, whereas plectin acts as a scaffold for AMPK signaling but is also required for DG-mediated ERK1/2 activation. We conclude that the DG-plectin complex plays a central role in transmitting mechanical stress from the extracellular matrix to the cytoplasm. PMID:21149456

  9. BDNF selectively regulates GABAA receptor transcription by activation of the JAK/STAT pathway.


    Lund, Ingrid V; Hu, Yinghui; Raol, YogendraSinh H; Benham, Rebecca S; Faris, Ramona; Russek, Shelley J; Brooks-Kayal, Amy R


    The gamma-aminobutyric acid (GABA) type A receptor (GABA(A)R) is the major inhibitory neurotransmitter receptor in the brain. Its multiple subunits show regional, developmental, and disease-related plasticity of expression; however, the regulatory networks controlling GABA(A)R subunit expression remain poorly understood. We report that the seizure-induced decrease in GABA(A)R alpha1 subunit expression associated with epilepsy is mediated by the Janus kinase (JAK)/signal transducer and activator of transcription (STAT) pathway regulated by brain-derived neurotrophic factor (BDNF). BDNF- and seizure-dependent phosphorylation of STAT3 cause the adenosine 3',5'-monophosphate (cAMP) response element-binding protein (CREB) family member ICER (inducible cAMP early repressor) to bind with phosphorylated CREB at the Gabra1:CRE site. JAK/STAT pathway inhibition prevents the seizure-induced decrease in GABA(A)R alpha1 abundance in vivo and, given that BDNF is known to increase the abundance of GABA(A)R alpha4 in a JAK/STAT-independent manner, indicates that BDNF acts through at least two distinct pathways to influence GABA(A)R-dependent synaptic inhibition. PMID:18922788

  10. Pathways from Poverty.

    ERIC Educational Resources Information Center

    Baldwin, Barbara, Ed.


    Articles in this theme issue are based on presentations at the Pathways from Poverty Workshop held in Albuquerque, New Mexico, on May 18-25, 1995. The event aimed to foster development of a network to address rural poverty issues in the Western Rural Development Center (WRDC) region. Articles report on outcomes from the Pathways from Poverty…

  11. The Steroid Hormone 20-Hydroxyecdysone Enhances Gene Transcription through the cAMP Response Element-binding Protein (CREB) Signaling Pathway.


    Jing, Yu-Pu; Wang, Di; Han, Xiao-Lin; Dong, Du-Juan; Wang, Jin-Xing; Zhao, Xiao-Fan


    Animal steroid hormones regulate gene transcription through genomic pathways by binding to nuclear receptors. These steroid hormones also rapidly increase intracellular calcium and cyclic adenosine monophosphate (cAMP) levels and activate the protein kinase C (PKC) and protein kinase A (PKA) nongenomic pathways. However, the function and mechanism of the nongenomic pathways of the steroid hormones are unclear, and the relationship between the PKC and PKA pathways is also unclear. We propose that the steroid hormone 20-hydroxyecdysone (20E) activates the PKA pathway to enhance 20E-induced gene transcription in the lepidopteran insect Helicoverpa armigera The expression of the catalytic subunit 1 of PKA (PKAC1) increased during metamorphosis, and PKAC1 knockdown blocked pupation and repressed 20E-responsive gene expression. 20E regulated PKAC1 phosphorylation at threonine 200 and nuclear translocation through an ecdysone-responsive G-protein-coupled receptor 2. PKAC1 induced cAMP response element-binding protein (CREB) phosphorylation at serine 143, which bound to the cAMP response element on DNA to enhance 20E-responsive gene transcription. Through ecdysone-responsive G-protein-coupled receptor 2, 20E increased cAMP levels, which induced CREB PKA phosphorylation and 20E-responsive gene expression. This study demonstrates that the PKA/CREB pathway tightly and critically regulates 20E-induced gene transcription as well as its relationship with the 20E-induced PKC pathway. PMID:27129227

  12. A second pathway to degrade pyrimidine nucleic acid precursors in eukaryotes.


    Andersen, Gorm; Björnberg, Olof; Polakova, Silvia; Pynyaha, Yuriy; Rasmussen, Anna; Møller, Kasper; Hofer, Anders; Moritz, Thomas; Sandrini, Michael Paolo Bastner; Merico, Anna-Maria; Compagno, Concetta; Akerlund, Hans-Erik; Gojković, Zoran; Piskur, Jure


    Pyrimidine bases are the central precursors for RNA and DNA, and their intracellular pools are determined by de novo, salvage and catabolic pathways. In eukaryotes, degradation of uracil has been believed to proceed only via the reduction to dihydrouracil. Using a yeast model, Saccharomyces kluyveri, we show that during degradation, uracil is not reduced to dihydrouracil. Six loci, named URC1-6 (for uracil catabolism), are involved in the novel catabolic pathway. Four of them, URC3,5, URC6, and URC2 encode urea amidolyase, uracil phosphoribosyltransferase, and a putative transcription factor, respectively. The gene products of URC1 and URC4 are highly conserved proteins with so far unknown functions and they are present in a variety of prokaryotes and fungi. In bacteria and in some fungi, URC1 and URC4 are linked on the genome together with the gene for uracil phosphoribosyltransferase (URC6). Urc1p and Urc4p are therefore likely the core components of this novel biochemical pathway. A combination of genetic and analytical chemistry methods demonstrates that uridine monophosphate and urea are intermediates, and 3-hydroxypropionic acid, ammonia and carbon dioxide the final products of degradation. The URC pathway does not require the presence of an active respiratory chain and is therefore different from the oxidative and rut pathways described in prokaryotes, although the latter also gives 3-hydroxypropionic acid as the end product. The genes of the URC pathway are not homologous to any of the eukaryotic or prokaryotic genes involved in pyrimidine degradation described to date. PMID:18550080

  13. Carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increase affinity of nuclear mono-ubiquitinated annexin A1 for DNA containing 8-oxo-guanosine, and promote translesion DNA synthesis

    SciTech Connect

    Hirata, Aiko; Corcoran, George B.; Hirata, Fusao


    To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{sup 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.

  14. Changes in histone phosphorylation and associated early metabolic events in pig lymphocyte cultures transformed by phytohaemagglutinin or 6-N,2′-O-dibutyryladenosine 3′:5′-cyclic monophosphate

    PubMed Central

    Cross, Margaret E.; Ord, Margery G.


    1. Pig lymphocytes were transformed by dibutyryl cyclic AMP (6-N,2′-O-dibutyryladenosine 3′:5′-cyclic monophosphate) at concentrations of 0.01–0.1μm. The pattern of incorporation of label from [5-3H]uridine and [6-3H]thymidine into RNA and DNA respectively was identical with that obtained with unpurified phytohaemagglutinin. 2. Chlorpromazine (0.1μm) prevented the stimulation of [5-3H]uridine incorporation into RNA by phytohaemagglutinin, but only slightly lowered the lymphocyte response to dibutyryl cyclic AMP. 3. An increase in the size and specific radioactivity of the intracellular Pi pool was found immediately after stimulation by both phytohaemagglutinin and dibutyryl cyclic AMP. This was followed after some 30min by a rise in the specific radioactivity and concentration of ATP. 4. There was an immediate increase in the specific radioactivity of phosphate groups of histones; by about 45min after stimulation only the histones remaining after extraction of histone fraction F1 continued to incorporate 32P from [32P]Pi. 5. Histone kinase activity increased in the first 30min after stimulation; subsequently histone F1 kinase activity decreased, but activity with the other histones as substrate continued to increase for a further 30min. Kinase activation was effected by cyclic AMP (adenosine 3′:5′-cyclic monophosphate). 6. Histone phosphatase activity behaved similarly to that of the kinase. PMID:4331256

  15. Basic roles of key molecules connected with NMDAR signaling pathway on regulating learning and memory and synaptic plasticity.


    Wang, Hui; Peng, Rui-Yun


    With key roles in essential brain functions ranging from the long-term potentiation (LTP) to synaptic plasticity, the N-methyl-D-aspartic acid receptor (NMDAR) can be considered as one of the fundamental glutamate receptors in the central nervous system. The role of NMDA R was first identified in synaptic plasticity and has been extensively studied. Some molecules, such as Ca(2+), postsynaptic density 95 (PSD-95), calcium/calmodulin-dependent protein kinase II (CaMK II), protein kinase A (PKA), mitogen-activated protein kinase (MAPK) and cyclic adenosine monophosphate (cAMP) responsive element binding protein (CREB), are of special importance in learning and memory. This review mainly focused on the new research of key molecules connected with learning and memory, which played important roles in the NMDAR signaling pathway. PMID:27583167

  16. Comparison of three inhaled non-steroidal anti-inflammatory drugs on the airway response to sodium metabisulphite and adenosine 5'-monophosphate challenge in asthma.

    PubMed Central

    Wang, M.; Wisniewski, A.; Pavord, I.; Knox, A.; Tattersfield, A.


    BACKGROUND: Non-steroidal anti-inflammatory drugs (NSAIDs) are used to assess the role of prostaglandins in asthma but their effects on bronchoconstrictor challenges have been inconsistent. The effects of three nebulised nonsteroidal anti-inflammatory drugs on the airway response to inhaled sodium metabisulphite (MBS) and adenosine 5'-monophosphate (AMP) were compared in the same asthmatic subjects to see whether contractile prostaglandins were involved in MBS or AMP induced bronchoconstriction. A possible protective effect of the osmolarity or pH of the inhaled solutions was also assessed. METHODS: Two double blind placebo controlled studies were carried out. In study 1, 15 non-aspirin sensitive patients with mild asthma attended on four occasions and inhaled 5 ml of lysine aspirin (L-aspirin) 900 mg, indomethacin 50 mg, sodium salicylate 800 mg, or saline 20 minutes before an inhaled MBS challenge. On four further occasions 14 of the patients inhaled the same solutions followed by an inhaled AMP challenge. In study 2, 10 of the patients attended on four additional occasions and inhaled 5 ml of 0.9%, 3%, 10%, or 9.5% saline with indomethacin 50 mg 20 minutes before an inhaled MBS challenge. RESULTS: In study 1 inhaled lysine aspirin had a similar effect on MBS and AMP induced bronchoconstriction, increasing the provocative dose causing a 20% fall in FEV1 (PD20) by 1.29 (95% CI 0.54 to 2.03) and 1.23 (95% CI 0.53 to 1.93) doubling doses, respectively. Indomethacin increased the MBS PD20 and AMP PD20 by 0.64 (95% CI -0.1 to 1.38) and 0.99 (95% CI 0.29 to 1.69) doubling doses, respectively. Sodium salicylate had no significant effect on either challenge. The two solutions causing most inhibition were the most acidic and the most alkaline. In study 2 inhaled 9.5% saline with indomethacin (osmolarity 3005 mOsm/kg) increased the MBS PD20 by 1.1 doubling doses (95% CI 0.2 to 2.0) compared with only 0.09 (95% CI -0.83 to 1.0) and 0.04 (95% CI -0.88 to 0.95) doubling doses

  17. Effects of intermittent fasting on age-related changes on Na,K-ATPase activity and oxidative status induced by lipopolysaccharide in rat hippocampus.


    Vasconcelos, Andrea Rodrigues; Kinoshita, Paula Fernanda; Yshii, Lidia Mitiko; Marques Orellana, Ana Maria; Böhmer, Ana Elisa; de Sá Lima, Larissa; Alves, Rosana; Andreotti, Diana Zukas; Marcourakis, Tania; Scavone, Cristoforo; Kawamoto, Elisa Mitiko


    Chronic neuroinflammation is a common characteristic of neurodegenerative diseases, and lipopolysaccharide (LPS) signaling is linked to glutamate-nitric oxide-Na,K-ATPase isoforms pathway in central nervous system (CNS) and also causes neuroinflammation. Intermittent fasting (IF) induces adaptive responses in the brain that can suppress inflammation, but the age-related effect of IF on LPS modulatory influence on nitric oxide-Na,K-ATPase isoforms is unknown. This work compared the effects of LPS on the activity of α1,α2,3 Na,K-ATPase, nitric oxide synthase gene expression and/or activity, cyclic guanosine monophosphate, 3-nitrotyrosine-containing proteins, and levels of thiobarbituric acid-reactive substances in CNS of young and older rats submitted to the IF protocol for 30 days. LPS induced an age-related effect in neuronal nitric oxide synthase activity, cyclic guanosine monophosphate, and levels of thiobarbituric acid-reactive substances in rat hippocampus that was linked to changes in α2,3-Na,K-ATPase activity, 3-nitrotyrosine proteins, and inducible nitric oxide synthase gene expression. IF induced adaptative cellular stress-response signaling pathways reverting LPS effects in rat hippocampus of young and older rats. The results suggest that IF in both ages would reduce the risk for deficits on brain function and neurodegenerative disorders linked to inflammatory response in the CNS. PMID:25818175

  18. Deregulation of purine pathway in Bacillus subtilis and its use in riboflavin biosynthesis

    PubMed Central


    . Based on the deregulation of purine pathway at transcription and metabolic levels, an extended application is recommended for the yield of products, like inosine, guanosine, adenosine and folate which are directly stemming from purine pathway in B. subtilis. PMID:25023436

  19. Transformation pathways of liposomes.


    Hotani, H


    Liposomes undergoing transformation were observed by dark-field light microscopy in order to study the role of lipid in morphogenesis of biological vesicular structures. Liposomes were found to transform sequentially in a well-defined manner through one of several transformation pathways. A circular biconcave form was an initial shape in all the pathways and it transformed into a stable thin flexible filament or small spheres via a variety of regularly shaped vesicles which possessed geometrical symmetry. The transformation was reversible up to a certain point in each pathway. Osmotic pressure was found to be the driving force for the transformations. Biological membrane vesicles such as trypsinized red cell ghosts also transformed by similar pathways. PMID:6548263

  20. Updating the Wnt pathways

    PubMed Central

    Yu, Jia; Virshup, David M.


    In the three decades since the discovery of the Wnt1 proto-oncogene in virus-induced mouse mammary tumours, our understanding of the signalling pathways that are regulated by the Wnt proteins has progressively expanded. Wnts are involved in an complex signalling network that governs multiple biological processes and cross-talk with multiple additional signalling cascades, including the Notch, FGF (fibroblast growth factor), SHH (Sonic hedgehog), EGF (epidermal growth factor) and Hippo pathways. The Wnt signalling pathway also illustrates the link between abnormal regulation of the developmental processes and disease manifestation. Here we provide an overview of Wnt-regulated signalling cascades and highlight recent advances. We focus on new findings regarding the dedicated Wnt production and secretion pathway with potential therapeutic targets that might be beneficial for patients with Wnt-related diseases. PMID:25208913

  1. Identifying Branched Metabolic Pathways by Merging Linear Metabolic Pathways

    NASA Astrophysics Data System (ADS)

    Heath, Allison P.; Bennett, George N.; Kavraki, Lydia E.

    This paper presents a graph-based algorithm for identifying complex metabolic pathways in multi-genome scale metabolic data. These complex pathways are called branched pathways because they can arrive at a target compound through combinations of pathways that split compounds into smaller ones, work in parallel with many compounds, and join compounds into larger ones. While most previous work has focused on identifying linear metabolic pathways, branched metabolic pathways predominate in metabolic networks. Automatic identification of branched pathways has a number of important applications in areas that require deeper understanding of metabolism, such as metabolic engineering and drug target identification. Our algorithm utilizes explicit atom tracking to identify linear metabolic pathways and then merges them together into branched metabolic pathways. We provide results on two well-characterized metabolic pathways that demonstrate that this new merging approach can efficiently find biologically relevant branched metabolic pathways with complex structures.

  2. Inflammatory pathways in spondyloarthritis.


    Hreggvidsdottir, Hulda S; Noordenbos, Troy; Baeten, Dominique L


    Spondyloarthritis is the second most common form of chronic inflammatory arthritis and a unique hallmark of the disease is pathologic new bone formation. Several cytokine pathways have been genetically associated with ankylosing spondylitis (AS), the prototypic subtype of SpA, and additional evidence from human and animal studies support a role of these pathways in the disease. TNF has a key role in SpA as blockade significantly reduces inflammation and destruction, however the treatment does not halt new bone formation. New insights into the TNF pathway were recently obtained from an animal model specifically overexpressing the transmembrane form of TNF. This model leads to axial and peripheral new bone formation which is not seen in soluble TNF overexpression models, indicating different pathogenic roles of soluble and transmembrane TNF in arthritis development. Besides TNF, the IL-23/IL-17 axis is emerging as an important inflammatory pathway in SpA, as a SNP in the IL-23R locus has been associated with developing AS, mice overexpressing IL-23 develop SpA-like features and IL-17 blockade has been shown to be efficacious for AS patients in a phase II trial. In this review, we focus on the cytokine pathways that have recently been genetically associated with SpA, i.e. TNF, IL-1, IL-6 and IL-23/IL-17. We review the current genetic, experimental and human in vivo data available and discuss how these different pathways are involved in the pathophysiology of SpA. Additionally, we discuss how these pathways relate to the pathogenic new bone formation in SpA. PMID:23969080

  3. Correlation between vibrational frequencies and hydrogen bonding states of the guanine ring studied by UV resonance Raman spectroscopy of 2'-deoxy-3',5'-bis(triisopropylsilyl)guanosine dissolved in various solvents

    NASA Astrophysics Data System (ADS)

    Toyama, Akira; Hamuara, Mutsuo; Takeuchi, Hideo


    Ultraviolet resonance Raman spectra of 2'-deoxy-3',5'-bis(triisopropylsilyl)guanosine (TPS-dGuo) were recorded in non-hydrogen bonding, proton acceptor, and proton donor/acceptor solvents. Raman spectral changes observed on going from inert to proton acceptor solvents were ascribed to the hydrogen bonding at the proton donor sites of the guanine ring (N1H and C2NH 2), and the spectral changes associated with the solvent change from proton acceptor to donor/acceptor were ascribed to the hydrogen bonding at the proton acceptor sites (N3, C6O, and N7). A Raman band appearing at 1624 cm -1 in inert solvents is assigned mainly to the NH 2 scissors mode and its frequency changes to ≈ 1640 cm -1 in acceptor solvents, reflecting the hydrogen bonding at C2NH 2. Another band at 1581 cm -1, arising largely from the N1H bend, shows an upshift of ≈ 10 cm -1 upon hydrogen bonding at either N1H or acceptor sites. Hydrogen bonding at the acceptor sites also produces frequency shifts of other Raman bands (at 1710, 1565, 1528, 1481, and 1154 cm -1 in 1,2-dichloroethane solution). Among the Raman bands listed above, the 1710 cm -1 band due to the C6O stretch decreases in frequency, whereas the others increase. The downshift of the C6O stretching frequency is correlated with the strength of hydrogen bonding at C6O. The frequency of the 1481 cm -1 band increases with a decrease of the C6O stretching frequency, indicating that the 1481 cm -1 band is also a marker of hydrogen bonding at C6O. This finding is in sharp contrast to the previously proposed correlation with the hydrogen bonding at N7. The 1565 cm -1 band is assigned to a vibration mainly involving the N1C2N3 linkage, and its frequency increases with increasing strength of the hydrogen bond at N3. Three bands around 1315, 1180, and 1030 cm -1, which are known to be sensitive to the ribose ring puckering and glycosidic bond orientation, also show small frequency changes upon hydrogen

  4. Adenosine A1( )receptors are selectively coupled to Gα(i-3) in postmortem human brain cortex: Guanosine-5'-O-(3-[(35)S]thio)triphosphate ([(35)S]GTPγS) binding/immunoprecipitation study.


    Odagaki, Yuji; Kinoshita, Masakazu; Ota, Toshio; Meana, J Javier; Callado, Luis F; García-Sevilla, Jesús A


    By means of guanosine-5'-O-(3-[(35)S]thio)triphosphate ([(35)S]GTPγS) binding assay combined with immunoprecipitation using anti-Gα subunit antibody, we recently reported 5-HT2A receptor- and M1 muscarinic acetylcholine receptor-mediated Gαq activation in rat cerebral cortical membranes (Odagaki et al., 2014). In the present study, this method has been applied to postmortem human brains, with focusing on adenosine receptor-mediated G-protein activation. In the exploratory experiments using a series of agonists and the antibodies specific to each Gα subtypes in the presence of low (10 nM) or high (50 μM) concentration of GDP, the most prominent increases in specific [(35)S]GTPγS binding in the membranes prepared from human prefrontal cortex were obtained for the combinations of adenosine (1mM)/anti-Gαi-3 in the presence of 50 μM GDP as well as 5-HT (100 μM)/anti-Gαq and carbachol (1mM)/anti-Gαq in the presence of 10nM GDP. Adenosine-induced activation of Gαi-3 emerged only when GDP concentrations were increased higher than 10 μM, and the following experiments were performed in the presence of 300 μM GDP. Adenosine increased specific [(35)S]GTPγS binding to Gαi-3 in a concentration-dependent manner to 251.4% of the basal unstimulated binding, with an EC50 of 1.77 μM. The involvement of adenosine A1 receptor was verified by the experiments using selective agonists and antagonists at adenosine A1 or A3 receptor. Among the α subunits of Gi/o class (Gαi-1, Gαi-2, Gαi-3, and Gαo.), only Gαi-3 was activated by 1mM adenosine, indicating that human brain adenosine A1 receptor is coupled preferentially, if not exclusively, to Gαi-3. PMID:26213104

  5. Sex Difference in κ-Opioid Receptor (KOPR)-Mediated Behaviors, Brain Region KOPR Level and KOPR-Mediated Guanosine 5′-O-(3-[35S]Thiotriphosphate) Binding in the Guinea Pig

    PubMed Central

    Wang, Yu-Jun; Rasakham, Khampaseuth; Huang, Peng; Chudnovskaya, Darina; Cowan, Alan


    We examined whether sex differences in κ-opioid receptor (KOPR) pharmacology exist in guinea pigs, which are more similar to humans in the expression level and distribution of KOPR in the brain than rats and mice. The KOPR agonist trans-(±)-3,4-dichloro-N-methyl-N-(2-[1-pyrrolidinyl]-cyclohexyl)benzeneacetamide methanesulfonate (U50,488H) produced a dose-dependent increase in abnormal postures and immobility with more effects in males than females. Males also showed more U50,488H-induced antinociception in the paw pressure test than females. Pretreatment with the KOPR antagonist norbinaltorphimine blocked U50,488H-induced abnormal body postures and antinociception. In contrast, inhibition of cocaine-induced hyperambulation by U50,488H was more effective in females than males. Thus, sex differences in the effects of U50,488H are endpoint-dependent. We then examined whether sex differences in KOPR levels and KOPR-mediated G protein activation in brain regions may contribute to the observed differences using quantitative in vitro autoradiography of [3H](5a,7a,8b)-(−)-N-methyl-N-(7-(1-pyrrolidinyl)1-oxaspiro(4,5)dec-8-yl)benzeacetamide ([3H]U69,593) binding to the KOPR and U50,488H-stimulated guanosine 5′-O-(3-[35S]thiotriphosphate ([35S]GTPγS) binding. Compared with females, males exhibited more [3H]U69,593 binding in the deep layers of somatosensory and insular cortices, claustrum, endopiriform nucleus, periaqueductal gray, and substantial nigra. Concomitantly, U50,488H-stimulated [35S]GTPγS binding was greater in males than females in the superficial and deep layers of somatosensory and insular cortices, caudate putamen, claustrum, medial geniculate nucleus, and cerebellum. In contrast, compared with males, females showed more U50,488H-stimulated [35S]GTPγS binding in the dentate gyrus and a trend of higher [35S]GTPγS binding in the hypothalamus. These data demonstrate that males and females differ in KOPR expression and KOPR-mediated G protein activation

  6. Re-sensitization of radiation resistant colorectal cancer cells to radiation through inhibition of AMPK pathway

    PubMed Central



    Radiotherapy (RT) is commonly used to treat multi-tumors to attenuate the risk of recurrence. Despite impressive initial clinical responses, a large proportion of patients experience resistance to RT. Therefore, identification of functionally relevant biomarkers would be beneficial for radioresistant patients. Adenosine monophosphate-activated kinase (AMPK) is recognized as a mediator of tumor suppressor gene function. In the present study, radio-sensitive and -resistant colon cancer patient samples were compared and the AMPK pathway was observed to be highly activated in radioresistant patients. In addition, the protein and mRNA levels of AMPK were upregulated in radioresistant colon cancer cells in comparison to radiosensitive colon cancer cells. The present study provides evidence that activation of AMPK by metformin contributes to radioresistance. Inhibition of AMPK by either small interfering RNA or Compound C, which is a specific inhibitor of AMPK, re-sensitized radiation resistant cells. The data presented indicates a synergistic effect on radiation resistant cancer cells by the combination of Compound C and radiation. In summary, the present study proposes that inhibition of the AMPK pathway is a potential strategy for reversing radiation resistance and may contribute to the development of therapeutic anticancer drugs. PMID:27123089

  7. Sestrin2 is a leucine sensor for the mTORC1 pathway.


    Wolfson, Rachel L; Chantranupong, Lynne; Saxton, Robert A; Shen, Kuang; Scaria, Sonia M; Cantor, Jason R; Sabatini, David M


    Leucine is a proteogenic amino acid that also regulates many aspects of mammalian physiology, in large part by activating the mTOR complex 1 (mTORC1) protein kinase, a master growth controller. Amino acids signal to mTORC1 through the Rag guanosine triphosphatases (GTPases). Several factors regulate the Rags, including GATOR1, aGTPase-activating protein; GATOR2, a positive regulator of unknown function; and Sestrin2, a GATOR2-interacting protein that inhibits mTORC1 signaling. We find that leucine, but not arginine, disrupts the Sestrin2-GATOR2 interaction by binding to Sestrin2 with a dissociation constant of 20 micromolar, which is the leucine concentration that half-maximally activates mTORC1. The leucine-binding capacity of Sestrin2 is required for leucine to activate mTORC1 in cells. These results indicate that Sestrin2 is a leucine sensor for the mTORC1 pathway. PMID:26449471

  8. Pleiotropic action of CpG-ODN on endothelium and macrophages attenuates angiogenesis through distinct pathways

    PubMed Central

    Wu, Jiahui; Su, Wenru; Powner, Michael B.; Liu, Jian; Copland, David A.; Fruttiger, Marcus; Madeddu, Paolo; Dick, Andrew D.; Liu, Lei


    There is an integral relationship between vascular cells and leukocytes in supporting healthy tissue homeostasis. Furthermore, activation of these two cellular components is key for tissue repair following injury. Toll-like receptors (TLRs) play a role in innate immunity defending the organism against infection, but their contribution to angiogenesis remains unclear. Here we used synthetic TLR9 agonists, cytosine-phosphate-guanosine oligodeoxynucleotides (CpG-ODN), to investigate the role of TLR9 in vascular pathophysiology and identify potential therapeutic translation. We demonstrate that CpG-ODN stimulates inflammation yet inhibits angiogenesis. Regulation of angiogenesis by CpG-ODN is pervasive and tissue non-specific. Further, we noted that synthetic CpG-ODN requires backbone phosphorothioate but not TLR9 activation to render and maintain endothelial stalk cells quiescent. CpG-ODN pre-treated endothelial cells enhance macrophage migration but restrain pericyte mobilisation. CpG-ODN attenuation of angiogenesis, however, remains TLR9-dependent, as inhibition is lost in TLR9 deficient mice. Additionally, CpG-ODNs induce an M1 macrophage phenotype that restricts angiogenesis. The effects mediated by CpG-ODNs can therefore modulate both endothelial cells and macrophages through distinct pathways, providing potential therapeutic application in ocular vascular disease. PMID:27558877

  9. Clinical Pathway for Thyroidectomy.


    Villar del Moral, Jesús María; Soria Aledo, Víctor; Colina Alonso, Alberto; Flores Pastor, Benito; Gutiérrez Rodríguez, María Teresa; Ortega Serrano, Joaquín; Parra Hidalgo, Pedro; Ros López, Susana


    Clinical pathways are care plans applicable to patient care procedures that present variations in practice and a predictable clinical course. They are designed not as a substitute for clinical judgment, but rather as a means to improve the effectiveness and efficiency of the procedures. This clinical pathway is the result of a collaborative work of the Sections of Endocrine Surgery and Quality Management of the Spanish Association of Surgeons. It attempts to provide a framework for standardizing the performance of thyroidectomy, the most frequently performed operation in endocrine surgery. Along with the usual documents of clinical pathways (temporary matrix, variance tracking and information sheets, assessment indicators and a satisfaction questionnaire) it includes a review of the scientific evidence around different aspects of pre, intra and postoperative management. Among others, antibiotic and antithrombotic prophylaxis, preoperative preparation in hyperthyroidism, intraoperative neuromonitoring and systems for obtaining hemostasis are included, along with management of postoperative hypocalcemia. PMID:25732107

  10. Pathways to chromothripsis

    PubMed Central

    Ivkov, Robert; Bunz, Fred


    Chromothripsis is a recently recognized mode of genetic instability that generates chromosomes with strikingly large numbers of segmental re-arrangements. While the characterization of these derivative chromosomes has provided new insights into the processes by which cancer genomes can evolve, the underlying signaling events and molecular mechanisms remain unknown. In medulloblastomas, chromothripsis has been observed to occur in the context of mutational inactivation of p53 and activation of the canonical Hedgehog (Hh) pathway. Recent studies have illuminated mechanistic links between these 2 signaling pathways, including a novel PTCH1 homolog that is regulated by p53. Here, we integrate this new pathway into a hypothetical model for the catastrophic DNA breakage that appears to trigger profound chromosomal rearrangements. PMID:26178348

  11. β-NbPO 5 and β-TaPO 5: Bronzoïds, second members of the monophosphate tungsten bronze series (PO 2) 4(WO 3) 2 m

    NASA Astrophysics Data System (ADS)

    Chahboun, H.; Groult, D.; Hervieu, M.; Raveau, B.


    The oxides β-NbPO 5 and β-TaPO 5 have been studied by X-ray diffraction and high resolution electron microscopy. They exhibit different supercells based on an orthorhombic subcell with the parameters a0 = 11.27 Å, b0 = 5.28 Å, c0 = 6.62 Å. It is shown that their framework corresponds to the member m = 2 of the series of monophosphate tungsten bronzes (PO 2) 4(WO 3) 2 m with pentagonal tunnels (MPTB P). The structure can thus be described as built up from ReO 3-type slabs which are two octahedra wide and connected through phosphate planes. The stability of these bronzoïds is discussed with respect to that of the MPTB P compounds. The relationships between the structures of the α and β forms of NbPO 5 and TaPO 5 are studied.

  12. Nuclear magnetic resonance studies of cis-syn, trans-syn, and 6-4 photodimers of thymidylyl(3'-5')thymidine monophosphate and cis-syn photodimers of thymidylyl(3'-5')thymidine cyanoethyl phosphotriester

    SciTech Connect

    Kan, L.; Voituriez, L.; Cadet, J.


    Three out of four possible photodimers of thymidylyl(3'-5')thymidine monophosphates (i.e., cis-syn, 6-4, and one of the trans-syn) and two structural isomers (i.e., R and S forms) of cis-syn-thymidylyl(3'-5')thymidine cyanoethyl phosphotriester have been isolated and purified from the reaction mixtures after UV irradiation and studied by multinuclear magnetic resonance spectroscopy. All five inter thymine base linked photodimers have grossly similar structures which are quite different from those of the parent thymidylyl(3'-5')thymidine. The base of Tp- is in the syn conformation, and that of -pT is in the anti conformation. The sugar puckering of Tp- is dominated by the /sup 2/E conformer, but in -pT it is in /sup 4/E; except for the conformer around the C/sub 5/'-O/sub 5/' bond, the 6-4 isomer is very similar to those of cis-syn and trans-syn conformation. As expected, there are sugar-phosphate backbone distortions in the phosphotriesters, due to the neutralization of the negative charge of the phosphate. In general the structures of all five photodimers are very close to those of the cis-syn photodimer of thymidylyl(3'-5')thymidine monophosphate cyanoethyl ester as studied by X-ray diffraction. While the trans-syn photodimer has two structural isomers, only one (C/sub 6/(of Tp-)-R) was produced by the UV irradiation and studied.

  13. Optimized thymidylate kinase assay, based on enzymatically synthesized 5-(/sup 125/I)iododeoxyuridine monophosphate and its application to an immunological study of herpes simplex virus thymidine-thymidylate kinases

    SciTech Connect

    Karlstroem, A.R.G.; Gronowitz, J.S.


    The biological synthesis and purification of 5-(/sup 125/I)iododeoxyuridine monophosphate (IdUMP) are described. The specificity of IdUMP as substrate in the thymidylate monophosphate kinase (TMPK) assay is demonstrated, and a 100-fold gain in sensitivity as compared to the conventional TMPK assay is shown. TMPK measurements of isozymes derived from herpes simplex virus (HSV)-infected cells, uninfected cells, and tumor biopsies were performed. The results showed a significant difference in dependence of phosphate donor concentration present for TMPK activity from HSV-infected cells compared to the corresponding activity from uninfected cells, while only a minor difference in pH optima was observed for these enzyme activities. The increased sensitivity made it possible to detect and quantify HSV TMPK-blocking antibodies (ab) present in human sera. Sera from HSV ab-positive individuals were found to block the two HSV TMPKs to varying degrees and with different specificities. The immunological relationship between the TMPK and thymidine kinase (TK) induced by HSV-1 and HSV-2, respectively, was studied by comparing the capacities of different sera to block the two enzymatic activities. The results showed that the capacity to block HSV-1 TK and TMPK was proportional for all of the sera studied, while sera that preferentially blocked only the HSV-2 TMPK or HSV-2 TK were found. It was concluded that the HSV-2 TMPK and TK activities are less related than the corresponding activities for HSV-1 and that the HSV-2 enzyme activities are mediated by different catalytic sites.

  14. Pathways to School Success

    ERIC Educational Resources Information Center

    University of Pittsburgh Office of Child Development, 2012


    In 2006, the University of Pittsburgh Office of Child Development began implementing a multi-year school readiness project in several area schools. Evidence from both research and the field point to several key elements that foster school readiness and create pathways to school success for all children. This paper presents components of a…

  15. Pathways to Prosperity

    ERIC Educational Resources Information Center

    Symonds, William C.


    Symonds, director of the Pathways to Prosperity Project, asserts that the current U.S. system of preparing students for successful adult lives fails too many youth. Citing data showing that only 40 percent of young Americans earn an associate's or bachelor's degree by age 27--and that many employers say they see candidates who don't have…

  16. Dexter energy transfer pathways.


    Skourtis, Spiros S; Liu, Chaoren; Antoniou, Panayiotis; Virshup, Aaron M; Beratan, David N


    Energy transfer with an associated spin change of the donor and acceptor, Dexter energy transfer, is critically important in solar energy harvesting assemblies, damage protection schemes of photobiology, and organometallic opto-electronic materials. Dexter transfer between chemically linked donors and acceptors is bridge mediated, presenting an enticing analogy with bridge-mediated electron and hole transfer. However, Dexter coupling pathways must convey both an electron and a hole from donor to acceptor, and this adds considerable richness to the mediation process. We dissect the bridge-mediated Dexter coupling mechanisms and formulate a theory for triplet energy transfer coupling pathways. Virtual donor-acceptor charge-transfer exciton intermediates dominate at shorter distances or higher tunneling energy gaps, whereas virtual intermediates with an electron and a hole both on the bridge (virtual bridge excitons) dominate for longer distances or lower energy gaps. The effects of virtual bridge excitons were neglected in earlier treatments. The two-particle pathway framework developed here shows how Dexter energy-transfer rates depend on donor, bridge, and acceptor energetics, as well as on orbital symmetry and quantum interference among pathways. PMID:27382185

  17. Hedgehog Pathway Inhibition.


    Sekulic, Aleksandar; Von Hoff, Daniel


    The hedgehog (Hh) signaling pathway is aberrantly activated in a majority of basal cell carcinomas (BCC). Vismodegib and sonidegib are targeted inhibitors of Smoothened (SMO). Both drugs are approved for use in locally advanced BCC (laBCC), with vismodegib also approved for metastatic BCC (mBCC). PMID:26919418

  18. [Regulative mechanisms of mammalian target of rapamycin signaling pathway in glomerular hypertrophy in diabetic nephropathy and interventional effects of Chinese herbal medicine].


    Yang, Jing-Jing; Huang, Yan-ru; Wan, Yi-gang; Shen, Shan-mei; Mao, Zhi-min; Wu, Wei; Yao, Jian


    Glomerular hypertrophy is the main pathological characteristic in the early stage of diabetic nephropathy (DN), and its regulatory mechanism is closely related to mammalian target of rapamycin (mTOR) signaling pathway activity. mTOR includes mTOR complex 1 (mTORC1) and mTOR complex 2(mTORC2), in which, the upstream pathway of mTORC1 is phosphatidylinositol-3-kinase (PI3K)/serine-threonine kinase(Akt)/adenosine monophosphate activated protein kinase(AMPK), and the representative signaling molecules in the downstream pathway of mTORC1 are 4E-binding proteins(4EBP) and phosphoprotein 70 S6Kinase(p70S6K). Some Chinese herbal extracts could improve cell proliferation via intervening the expressions of the key molecules in the upstream or downstream of PIK/Akt/mTOR signaling pathway in vivo. As for glomerular mesangial cells(MC) and podocyte, mTOR plays an important role in regulating glomerular inherent cells, including adjusting cell cycle, energy metabolism and matrix protein synthesis. Rapamycin, the inhibitor of mTOR, could suppress glomerular inherent cell hypertrophy, cell proliferation, glomerular basement membrane (GBM) thickening and mesangial matrix deposition in model rats with DN. Some Chinese herbal extracts could alleviate glomerular lesions by intervening mTOR signaling pathway activity in renal tissue of DN animal models or in renal inherent cells in vivo and in vitro. PMID:26790279

  19. TAK-063, a PDE10A Inhibitor with Balanced Activation of Direct and Indirect Pathways, Provides Potent Antipsychotic-Like Effects in Multiple Paradigms.


    Suzuki, Kazunori; Harada, Akina; Suzuki, Hirobumi; Miyamoto, Maki; Kimura, Haruhide


    Phosphodiesterase 10A (PDE10A) inhibitors are expected to be novel drugs for schizophrenia through activation of both direct and indirect pathway medium spiny neurons. However, excess activation of the direct pathway by a dopamine D1 receptor agonist SKF82958 canceled antipsychotic-like effects of a dopamine D2 receptor antagonist haloperidol in methamphetamine (METH)-induced hyperactivity in rats. Thus, balanced activation of these pathways may be critical for PDE10A inhibitors. Current antipsychotics and the novel PDE10A inhibitor TAK-063, but not the selective PDE10A inhibitor MP-10, produced dose-dependent antipsychotic-like effects in METH-induced hyperactivity and prepulse inhibition in rodents. TAK-063 and MP-10 activated the indirect pathway to a similar extent; however, MP-10 caused greater activation of the direct pathway than did TAK-063. Interestingly, the off-rate of TAK-063 from PDE10A in rat brain sections was faster than that of MP-10, and a slower off-rate PDE10A inhibitor with TAK-063-like chemical structure showed an MP-10-like pharmacological profile. In general, faster off-rate enzyme inhibitors are more sensitive than slower off-rate inhibitors to binding inhibition by enzyme substrates. As expected, TAK-063 was more sensitive than MP-10 to binding inhibition by cyclic nucleotides. Moreover, an immunohistochemistry study suggested that cyclic adenosine monophosphate levels in the direct pathway were higher than those in the indirect pathway. These data can explain why TAK-063 showed partial activation of the direct pathway compared with MP-10. The findings presented here suggest that TAK-063's antipsychotic-like efficacy may be attributable to its unique pharmacological properties, resulting in balanced activation of the direct and indirect striatal pathways. PMID:26849714

  20. Survival strategies in the aquatic and terrestrial world: the impact of second messengers on cyanobacterial processes.


    Agostoni, Marco; Montgomery, Beronda L


    Second messengers are intracellular substances regulated by specific external stimuli globally known as first messengers. Cells rely on second messengers to generate rapid responses to environmental changes and the importance of their roles is becoming increasingly realized in cellular signaling research. Cyanobacteria are photooxygenic bacteria that inhabit most of Earth's environments. The ability of cyanobacteria to survive in ecologically diverse habitats is due to their capacity to adapt and respond to environmental changes. This article reviews known second messenger-controlled physiological processes in cyanobacteria. Second messengers used in these systems include the element calcium (Ca2+), nucleotide-based guanosine tetraphosphate or pentaphosphate (ppGpp or pppGpp, represented as (p)ppGpp), cyclic adenosine 3',5'-monophosphate (cAMP), cyclic dimeric GMP (c-di-GMP), cyclic guanosine 3',5'-monophosphate (cGMP), and cyclic dimeric AMP (c-di-AMP), and the gaseous nitric oxide (NO). The discussion focuses on processes central to cyanobacteria, such as nitrogen fixation, light perception, photosynthesis-related processes, and gliding motility. In addition, we address future research trajectories needed to better understand the signaling networks and cross talk in the signaling pathways of these molecules in cyanobacteria. Second messengers have significant potential to be adapted as technological tools and we highlight possible novel and practical applications based on our understanding of these molecules and the signaling networks that they control. PMID:25411927

  1. Survival Strategies in the Aquatic and Terrestrial World: The Impact of Second Messengers on Cyanobacterial Processes

    PubMed Central

    Agostoni, Marco; Montgomery, Beronda L.


    Second messengers are intracellular substances regulated by specific external stimuli globally known as first messengers. Cells rely on second messengers to generate rapid responses to environmental changes and the importance of their roles is becoming increasingly realized in cellular signaling research. Cyanobacteria are photooxygenic bacteria that inhabit most of Earth’s environments. The ability of cyanobacteria to survive in ecologically diverse habitats is due to their capacity to adapt and respond to environmental changes. This article reviews known second messenger-controlled physiological processes in cyanobacteria. Second messengers used in these systems include the element calcium (Ca2+), nucleotide-based guanosine tetraphosphate or pentaphosphate (ppGpp or pppGpp, represented as (p)ppGpp), cyclic adenosine 3’,5’-monophosphate (cAMP), cyclic dimeric GMP (c-di-GMP), cyclic guanosine 3’,5’-monophosphate (cGMP), and cyclic dimeric AMP (c-di-AMP), and the gaseous nitric oxide (NO). The discussion focuses on processes central to cyanobacteria, such as nitrogen fixation, light perception, photosynthesis-related processes, and gliding motility. In addition, we address future research trajectories needed to better understand the signaling networks and cross talk in the signaling pathways of these molecules in cyanobacteria. Second messengers have significant potential to be adapted as technological tools and we highlight possible novel and practical applications based on our understanding of these molecules and the signaling networks that they control. PMID:25411927

  2. Lactoferrin Promotes Early Neurodevelopment and Cognition in Postnatal Piglets by Upregulating the BDNF Signaling Pathway and Polysialylation.


    Chen, Yue; Zheng, Zhiqiang; Zhu, Xi; Shi, Yujie; Tian, Dandan; Zhao, Fengjuan; Liu, Ni; Hüppi, Petra S; Troy, Frederic A; Wang, Bing


    Lactoferrin (Lf) is a sialic acid (Sia)-rich, iron-binding milk glycoprotein that has multifunctional health benefits. Its potential role in neurodevelopment and cognition remains unknown. To test the hypothesis that Lf may function to improve neurodevelopment and cognition, the diet of postnatal piglets was supplemented with Lf from days 3 to 38. Expression levels of selected genes and their cognate protein profiles were quantitatively determined. The importance of our new findings is that Lf (1) upregulated several canonical signaling pathways associated with neurodevelopment and cognition; (2) influenced ~10 genes involved in the brain-derived neurotrophin factor (BDNF) signaling pathway in the hippocampus and upregulated the expression of polysialic acid, a marker of neuroplasticity, cell migration and differentiation of progenitor cells, and the growth and targeting of axons; (3) upregulated transcriptional and translational levels of BDNF and increased phosphorylation of the cyclic adenosine monophosphate (cAMP) response element-binding protein, CREB, a downstream target of the BDNF signaling pathway, and a protein of crucial importance in neurodevelopment and cognition; and (4) enhanced the cognitive function and learning of piglets when tested in an eight-arm radial maze. The finding that Lf can improve neural development and cognition in postnatal piglets has not been previously described. PMID:25146846

  3. Expression of Drosophila trpl cRNA in Xenopus laevis oocytes leads to the appearance of a Ca2+ channel activated by Ca2+ and calmodulin, and by guanosine 5'[gamma-thio]triphosphate.


    Lan, L; Bawden, M J; Auld, A M; Barritt, G J


    The effects of expression of the Drosophila melanogaster Trpl protein, which is thought to encode a putative Ca2+ channel [Phillips, Bull and Kelly (1992) Neuron 8, 631-642], on divalent cation inflow in Xenopus laevis oocytes were investigated. The addition of extracellular Ca2+ ([Ca2+]0) to oocytes injected with trpl cRNA and to mock-injected controls, both loaded with the fluorescent Ca2+ indicator fluo-3, induced a rapid initial and a slower sustained rate of increase in fluorescence, which were designated the initial and sustained rates of Ca2+ inflow respectively. Compared with mock-injected oocytes, trpl-cRNA-injected oocytes exhibited a higher resting cytoplasmic free Ca2+ concentration ([Ca2+]i), and higher initial and sustained rates of Ca2+ inflow in the basal (no agonist) states. The basal rate of Ca2+ inflow in trpl-cRNA-injected oocytes increased with (1) an increase in the time elapsed between injection of trpl cRNA and the measurement of Ca2+ inflow, (2) an increase in the amount of trpl cRNA injected and (3) an increase in [Ca2+]0. Gd3+ inhibited the trpl cRNA-induced basal rate of Ca2+ inflow, with a concentration of approx. 5 microM Gd3+ giving half-maximal inhibition. Expression of trpl cRNA also caused an increase in the basal rate of Mn2+ inflow. The increases in resting [Ca2+]1 and in the basal rate of Ca2+ inflow induced by expression of trpl cRNA were inhibited by the calmodulin inhibitors W13, calmodazolium and peptide (281-309) of (Ca2+ and calmodulin)-dependent protein kinase II. A low concentration of exogenous calmodulin (introduced by microinjection) activated, and a higher concentration inhibited, the trpl cRNA-induced increase in basal rate of Ca2+ inflow. The action of the high concentration of exogenous calmodulin was reversed by W13 and calmodazolium. When rates of Ca2+ inflow in trpl-cRNA-injected oocytes were compared with those in mock-injected oocytes, the guanosine 5'-[beta-thio]diphosphate-stimulated rate was greater, the

  4. PREX2 promotes the proliferation, invasion and migration of pancreatic cancer cells by modulating the PI3K signaling pathway

    PubMed Central

    Yang, Jianyi; Gong, Xuejun; Ouyang, Lu; He, Wen; Xiao, Rou; Tan, Li


    Phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchanger factor 2 (PREX2) is a novel regulator of the small guanosine triphosphatase Rac, and has been observed to be implicated in human cancer by inhibiting the activity of phosphatase and tensin homolog (PTEN), thus upregulating the activity of the phosphoinositide 3-kinase (PI3K) signaling pathway. However, the exact role of PREX2 in pancreatic cancer has not been reported to date. In the present study, the expression levels of PREX2 were observed to be frequently increased in pancreatic cancer specimens compared with those in their matched adjacent normal tissues. In addition, PREX2 expression was also frequently upregulated in several pancreatic cancer cell lines, including AsPC-1, BxPC-3, PANC-1 and CFAPC-1, compared with that in the normal pancreatic epithelial cell line HPC-Y5. Overexpression of PREX2 significantly promoted the proliferation, invasion and migration of pancreatic cancer PANC-1 cells, while small interfering RNA-induced knockdown of PREX2 expression significantly inhibited the proliferation, invasion and migration of these cells. Investigation of the molecular mechanism revealed that the overexpression of PREX2 upregulated the phosphorylation levels of PTEN, indicating that the activity of PTEN was reduced, which further increased the phosphorylation levels of AKT, which indicated that the activity of the PI3K signaling pathway was upregulated. By contrast, knockdown of PREX2 upregulated the activity of PTEN and inhibited the activity of the PI3K signaling pathway. In conclusion, the present study demonstrated that PREX2 regulates the proliferation, invasion and migration of pancreatic cancer cells, probably at least via modulation of the activity of PTEN and the PI3K signaling pathway. PMID:27446408

  5. AIP Career Pathways

    NASA Astrophysics Data System (ADS)

    Palchak, Amanda


    American Institute of Physics (AIP) Career Pathways is a new project funded by the National Science Foundation. One of the goals of AIP Career Pathways is to prepare students to compete for Science, Technology, Engineering, and Mathematics (STEM) careers with a bachelor's degree in physics. In order to do so, I reviewed and compiled useful resources on finding a STEM career with a bachelor's degree in physics. These resources not only supply the job seeker with job postings in STEM careers but also provide them with information on resumes, interviewing skills, and networking. Recently at the 2011 Industrial Physics Forum, I interviewed companies in the private sector to obtain a unique perspective on what types of skills potential employers expect an applicant to posses with a bachelor's degree in physics. Ultimately, these components will be used as supplements at student career workshops held at annual Society of Physics Students Zone Meetings.

  6. Molecular pathways in dystonia

    PubMed Central

    Bragg, D. Cristopher; Armata, Ioanna A.; Nery, Flavia C.; Breakefield, Xandra O.; Sharma, Nutan


    The hereditary dystonias comprise a set of diseases defined by a common constellation of motor deficits. These disorders are most likely associated with different molecular etiologies, many of which have yet to be elucidated. Here we discuss recent advances in three forms of hereditary dystonia, DYT1, DYT6 and DYT16, which share a similar clinical picture: onset in childhood or adolescence, progressive spread of symptoms with generalized involvement of body regions and a steady state affliction without treatment. Unlike DYT1, the genes responsible for DYT6 and DYT16 have only recently been identified, with relatively little information about the function of the encoded proteins. Nevertheless, recent data suggest that these proteins may fit together within interacting pathways involved in dopaminergic signaling, transcriptional regulation, and cellular stress responses. This review focuses on these molecular pathways, highlighting potential common themes among these dystonias which may serve as areas for future research. PMID:21134457

  7. Pathways of tau fibrillization.


    Kuret, Jeff; Chirita, Carmen N; Congdon, Erin E; Kannanayakal, Theresa; Li, Guibin; Necula, Mihaela; Yin, Haishan; Zhong, Qi


    New methods for analyzing tau fibrillization have yielded insights into the biochemical transitions involved in the process. Here we review the parallels between the sequential progression of tau fibrillization observed macroscopically in Alzheimer's disease (AD) lesions and the pathway of tau aggregation observed in vitro with purified tau preparations. In addition, pharmacological agents for further dissection of fibrillization mechanism and lesion formation are discussed. PMID:15615636

  8. Alternative Respiratory Pathway

    PubMed Central

    Siedow, James N.; Girvin, Mark E.


    Oxygen uptake during the first hours of imbibition in intact soybean and mung bean seeds showed a marked sensitivity to potassium cyanide but was unaffected by addition of either salicylhydroxamic acid or propyl gallate. However O2 uptake by finely ground seed particles was very sensitive to the addition of either compound. The results indicated that O2 uptake in intact, imbibing seeds was associated with a cyanide-sensitive process, most probably mitochondrial mediated respiration, and not the result of the cyanide-insensitive lipoxygenase activity which was readily detectable in ground seed particles. The antioxidant propyl gallate was found to inhibit specifically alternative pathway electron transfer in isolated mung bean mitochondria. Half-maximal inhibition occurred with 2 to 5 micromolar propyl gallate. Kinetic analysis indicated that propyl gallate inhibition of the alternative pathway occurred at, or very near, the site of inhibition of the alternative pathway by salicylhydroxamic acid. A high level of lipoxygenase activity was found to be associated with washed mitochondria isolated from a variety of etiolated plant tissues. Most of this lipoxygenase activity could be eliminated from mung bean mitochondria if the mitochondria were purified on a discontinuous sucrose gradient. This indicated that the mitochondrial-associated activity was probably the result of nonspecific adsorption of lipoxygenase onto the mitochondrial membranes during isolation. PMID:16661259

  9. Pathway and Resource Overview (Presentation)

    SciTech Connect

    Ruth, M. F.


    This presentation provides information about hydrogen pathway analysis, which is analysis of the total levelized cost (including return on investment). Well-to-wheels (WTW) energy use, and WTW emissions for hydrogen production, delivery, and distribution pathways.

  10. Pathways with PathWhiz.


    Pon, Allison; Jewison, Timothy; Su, Yilu; Liang, Yongjie; Knox, Craig; Maciejewski, Adam; Wilson, Michael; Wishart, David S


    PathWhiz ( is a web server designed to create colourful, visually pleasing and biologically accurate pathway diagrams that are both machine-readable and interactive. As a web server, PathWhiz is accessible from almost any place and compatible with essentially any operating system. It also houses a public library of pathways and pathway components that can be easily viewed and expanded upon by its users. PathWhiz allows users to readily generate biologically complex pathways by using a specially designed drawing palette to quickly render metabolites (including automated structure generation), proteins (including quaternary structures, covalent modifications and cofactors), nucleic acids, membranes, subcellular structures, cells, tissues and organs. Both small-molecule and protein/gene pathways can be constructed by combining multiple pathway processes such as reactions, interactions, binding events and transport activities. PathWhiz's pathway replication and propagation functions allow for existing pathways to be used to create new pathways or for existing pathways to be automatically propagated across species. PathWhiz pathways can be saved in BioPAX, SBGN-ML and SBML data exchange formats, as well as PNG, PWML, HTML image map or SVG images that can be viewed offline or explored using PathWhiz's interactive viewer. PathWhiz has been used to generate over 700 pathway diagrams for a number of popular databases including HMDB, DrugBank and SMPDB. PMID:25934797

  11. Pathways with PathWhiz

    PubMed Central

    Pon, Allison; Jewison, Timothy; Su, Yilu; Liang, Yongjie; Knox, Craig; Maciejewski, Adam; Wilson, Michael; Wishart, David S.


    PathWhiz ( is a web server designed to create colourful, visually pleasing and biologically accurate pathway diagrams that are both machine-readable and interactive. As a web server, PathWhiz is accessible from almost any place and compatible with essentially any operating system. It also houses a public library of pathways and pathway components that can be easily viewed and expanded upon by its users. PathWhiz allows users to readily generate biologically complex pathways by using a specially designed drawing palette to quickly render metabolites (including automated structure generation), proteins (including quaternary structures, covalent modifications and cofactors), nucleic acids, membranes, subcellular structures, cells, tissues and organs. Both small-molecule and protein/gene pathways can be constructed by combining multiple pathway processes such as reactions, interactions, binding events and transport activities. PathWhiz's pathway replication and propagation functions allow for existing pathways to be used to create new pathways or for existing pathways to be automatically propagated across species. PathWhiz pathways can be saved in BioPAX, SBGN-ML and SBML data exchange formats, as well as PNG, PWML, HTML image map or SVG images that can be viewed offline or explored using PathWhiz's interactive viewer. PathWhiz has been used to generate over 700 pathway diagrams for a number of popular databases including HMDB, DrugBank and SMPDB. PMID:25934797

  12. Parathyroid hormone induces E4bp4 messenger ribonucleic acid expression primarily through cyclic adenosine 3',5'-monophosphate signaling in osteoblasts.


    Ozkurt, Ibrahim C; Pirih, Flavia Q; Tetradis, Sotirios


    PTH binding to its receptor activates protein kinase A (PKA), protein kinase C (PKC), and calcium signaling to induce transcription of primary response genes in osteoblasts. Adenovirus E4 promoter-binding protein/nuclear factor regulated by IL-3 (E4BP4/NFIL3), a transcriptional repressor, is a PTH-induced primary response gene in primary mouse osteoblasts (MOBs). Here we investigate the signaling pathway(s) that lead to PTH induction of E4bp4 mRNA expression. Ten and 100 nm PTH induced maximum E4bp4 expression in MOBs. Forskolin (FSK), an adenylate cyclase inducer, 8-bromo-cAMP, a cAMP analog, and phorbol myristate acetate, a PKC activator, increased E4bp4 mRNA levels, whereas ionomycin, a calcium ionophore, had no effect. Pretreatment of cells with 30 microm H89, a PKA inhibitor, strongly inhibited PTH- and FSK-induced E4bp4 expression. In contrast, overnight pretreatment with 1 microm phorbol myristate acetate to down-regulate PKC signaling did not alter PTH and FSK effects. Moreover, PTH (3-34) that does not activate cAMP signaling did not increase E4bp4 expression. Prostaglandin E(2), which signals through cAMP, increased E4bp4 mRNA at all doses, whereas prostaglandin F(2alpha) that primarily activates PKC and calcium signaling, induced E4bp4 only at high doses and fluprostenol that only activates PKC and calcium signaling, had no effect. Finally, 80 microg/kg PTH (1-34) ip injection induced E4bp4 mRNA expression at 1 h in mice. In contrast, 80 microg/kg PTH (3-34) had no effect. Our data suggest that PTH-induced E4bp4 mRNA expression is mediated primarily through cAMP-PKA signaling in vitro and in vivo. In conjunction with our previous report, we hypothesize that E4bp4 attenuates transcription of osteoblastic genes possessing E4bp4 promoter binding sites. PMID:15087429

  13. Developmental pathways in colon cancer

    PubMed Central

    Bertrand, Fred E.; Angus, C. William; Partis, William J.; Sigounas, George


    A hallmark of cancer is reactivation/alteration of pathways that control cellular differentiation during developmental processes. Evidence indicates that WNT, Notch, BMP and Hedgehog pathways have a role in normal epithelial cell differentiation, and that alterations in these pathways accompany establishment of the tumorigenic state. Interestingly, there is recent evidence that these pathways are intertwined at the molecular level, and these nodes of intersection may provide opportunities for effective targeted therapies. This review will highlight the role of the WNT, Notch, BMP and Hedgehog pathways in colon cancer. PMID:23032367

  14. Improving Carbon Fixation Pathways

    PubMed Central

    Ducat, Daniel C.


    A recent resurgence in basic and applied research on photosynthesis has been driven in part by recognition that fulfilling future food and energy requirements will necessitate improvements in crop carbon-fixation efficiencies. Photosynthesis in traditional terrestrial crops is being reexamined in light of molecular strategies employed by photosynthetic microbes to enhance the activity of the Calvin cycle. Synthetic biology is well-situated to provide original approaches for compartmentalizing and enhancing photosynthetic reactions in a species independent manner. Furthermore, the elucidation of alternative carbon-fixation routes distinct from the Calvin cycle raises possibilities that alternative pathways and organisms can be utilized to fix atmospheric carbon dioxide into useful materials. PMID:22647231

  15. Growth hormone signaling pathways.


    Carter-Su, Christin; Schwartz, Jessica; Argetsinger, Lawrence S


    Over 20years ago, our laboratory showed that growth hormone (GH) signals through the GH receptor-associated tyrosine kinase JAK2. We showed that GH binding to its membrane-bound receptor enhances binding of JAK2 to the GHR, activates JAK2, and stimulates tyrosyl phosphorylation of both JAK2 and GHR. The activated JAK2/GHR complex recruits a variety of signaling proteins, thereby initiating multiple signaling pathways and cellular responses. These proteins and pathways include: 1) Stat transcription factors implicated in the expression of multiple genes, including the gene encoding insulin-like growth factor 1; 2) Shc adapter proteins that lead to activation of the grb2-SOS-Ras-Raf-MEK-ERK1,2 pathway; 3) insulin receptor substrate proteins implicated in the phosphatidylinositol-3-kinase and Akt pathway; 4) signal regulatory protein α, a transmembrane scaffold protein that recruits proteins including the tyrosine phosphatase SHP2; and 5) SH2B1, a scaffold protein that can activate JAK2 and enhance GH regulation of the actin cytoskeleton. Our recent work has focused on the function of SH2B1. We have shown that SH2B1β is recruited to and phosphorylated by JAK2 in response to GH. SH2B1 localizes to the plasma membrane, cytoplasm and focal adhesions; it also cycles through the nucleus. SH2B1 regulates the actin cytoskeleton and promotes GH-dependent motility of RAW264.7 macrophages. Mutations in SH2B1 have been found in humans exhibiting severe early-onset childhood obesity and insulin resistance. These mutations impair SH2B1 enhancement of GH-induced macrophage motility. As SH2B1 is expressed ubiquitously and is also recruited to a variety of receptor tyrosine kinases, our results raise the possibility that effects of SH2B1 on the actin cytoskeleton in various cell types, including neurons, may play a role in regulating body weight. PMID:26421979

  16. Improving carbon fixation pathways

    SciTech Connect

    Ducat, DC; Silver, PA


    A recent resurgence in basic and applied research on photosynthesis has been driven in part by recognition that fulfilling future food and energy requirements will necessitate improvements in crop carbon-fixation efficiencies. Photosynthesis in traditional terrestrial crops is being reexamined in light of molecular strategies employed by photosynthetic microbes to enhance the activity of the Calvin cycle. Synthetic biology is well-situated to provide original approaches for compartmentalizing and enhancing photosynthetic reactions in a species independent manner. Furthermore, the elucidation of alternative carbon-fixation routes distinct from the Calvin cycle raises possibilities that novel pathways and organisms can be utilized to fix atmospheric carbon dioxide into useful materials.

  17. The Reactome pathway knowledgebase.


    Croft, David; Mundo, Antonio Fabregat; Haw, Robin; Milacic, Marija; Weiser, Joel; Wu, Guanming; Caudy, Michael; Garapati, Phani; Gillespie, Marc; Kamdar, Maulik R; Jassal, Bijay; Jupe, Steven; Matthews, Lisa; May, Bruce; Palatnik, Stanislav; Rothfels, Karen; Shamovsky, Veronica; Song, Heeyeon; Williams, Mark; Birney, Ewan; Hermjakob, Henning; Stein, Lincoln; D'Eustachio, Peter


    Reactome ( is a manually curated open-source open-data resource of human pathways and reactions. The current version 46 describes 7088 human proteins (34% of the predicted human proteome), participating in 6744 reactions based on data extracted from 15 107 research publications with PubMed links. The Reactome Web site and analysis tool set have been completely redesigned to increase speed, flexibility and user friendliness. The data model has been extended to support annotation of disease processes due to infectious agents and to mutation. PMID:24243840

  18. A tyrosine-phosphorylated 55-kilodalton motility-associated bovine sperm protein is regulated by cyclic adenosine 3',5'-monophosphates and calcium.


    Vijayaraghavan, S; Trautman, K D; Goueli, S A; Carr, D W


    Sperm motility is regulated by protein phosphorylation. We have recently shown that a serine/threonine phosphatase system is involved in motility regulation. Two of the components of the phosphatase system, GSK-3 and PP1gamma2, are regulated by tyrosine phosphorylation. During our investigation of sperm tyrosine-phosphorylated proteins we discovered a 55-kDa protein whose tyrosine phosphorylation correlates closely to the motility state of sperm. This protein is tyrosine phosphorylated to a much higher degree in motile caudal than in immotile caput epididymal sperm. Motility inhibition of caudal epididymal sperm by protein kinase A (PKA) anchoring inhibition or by ionomycin-induced calcium overload led to the virtual disappearance of tyrosine phosphorylation of the 55-kDa protein. Conversely, treatment of sperm with motility activators, isobutylmethylxanthine or 8-bromo-cAMP, resulted in increased tyrosine phosphorylation of the protein. The protein was present in the soluble 100 000 x g supernatants of sperm extracts and was heat labile. Chromatography through diethylaminoethyl-cellulose and Western blot analysis showed that this 55-kDa protein is not a regulatory subunit of PKA or alpha-tubulin. Our results represent the identification of a soluble protein whose tyrosine phosphorylation varies directly with motility and suggest that motility regulation may involve cross talk between PKA, calcium, and tyrosine kinase pathways. PMID:9166697

  19. WikiPathways: capturing the full diversity of pathway knowledge

    PubMed Central

    Kutmon, Martina; Riutta, Anders; Nunes, Nuno; Hanspers, Kristina; Willighagen, Egon L.; Bohler, Anwesha; Mélius, Jonathan; Waagmeester, Andra; Sinha, Sravanthi R.; Miller, Ryan; Coort, Susan L.; Cirillo, Elisa; Smeets, Bart; Evelo, Chris T.; Pico, Alexander R.


    WikiPathways ( is an open, collaborative platform for capturing and disseminating models of biological pathways for data visualization and analysis. Since our last NAR update, 4 years ago, WikiPathways has experienced massive growth in content, which continues to be contributed by hundreds of individuals each year. New aspects of the diversity and depth of the collected pathways are described from the perspective of researchers interested in using pathway information in their studies. We provide updates on extensions and services to support pathway analysis and visualization via popular standalone tools, i.e. PathVisio and Cytoscape, web applications and common programming environments. We introduce the Quick Edit feature for pathway authors and curators, in addition to new means of publishing pathways and maintaining custom pathway collections to serve specific research topics and communities. In addition to the latest milestones in our pathway collection and curation effort, we also highlight the latest means to access the content as publishable figures, as standard data files, and as linked data, including bulk and programmatic access. PMID:26481357

  20. WikiPathways: capturing the full diversity of pathway knowledge.


    Kutmon, Martina; Riutta, Anders; Nunes, Nuno; Hanspers, Kristina; Willighagen, Egon L; Bohler, Anwesha; Mélius, Jonathan; Waagmeester, Andra; Sinha, Sravanthi R; Miller, Ryan; Coort, Susan L; Cirillo, Elisa; Smeets, Bart; Evelo, Chris T; Pico, Alexander R


    WikiPathways ( is an open, collaborative platform for capturing and disseminating models of biological pathways for data visualization and analysis. Since our last NAR update, 4 years ago, WikiPathways has experienced massive growth in content, which continues to be contributed by hundreds of individuals each year. New aspects of the diversity and depth of the collected pathways are described from the perspective of researchers interested in using pathway information in their studies. We provide updates on extensions and services to support pathway analysis and visualization via popular standalone tools, i.e. PathVisio and Cytoscape, web applications and common programming environments. We introduce the Quick Edit feature for pathway authors and curators, in addition to new means of publishing pathways and maintaining custom pathway collections to serve specific research topics and communities. In addition to the latest milestones in our pathway collection and curation effort, we also highlight the latest means to access the content as publishable figures, as standard data files, and as linked data, including bulk and programmatic access. PMID:26481357

  1. The Chordin Morphogenetic Pathway.


    De Robertis, Edward M; Moriyama, Yuki


    The ancestral Chordin/bone morphogenetic protein (BMP) signaling pathway that establishes dorsal-ventral (D-V) patterning in animal development is one of the best understood morphogenetic gradients, and is established by multiple proteins that interact with each other in the extracellular space-including several BMPs, Chordin, Tolloid, Ont-1, Crossveinless-2, and Sizzled. The D-V gradient is adjusted redundantly by regulating the synthesis of its components, by direct protein-protein interactions between morphogens, and by long-range diffusion. The entire embryo participates in maintaining the D-V BMP gradient, so that for each action in the dorsal side there is a reaction in the ventral side. A gradient of Chordin is formed in the extracellular matrix that separates ectoderm from endomesoderm, called Brachet's cleft in Xenopus. The Chordin/BMP pathway is self-organizing and able to scale pattern in the dorsal half of bisected embryos or in Spemann dorsal lip transplantation experiments. PMID:26970622

  2. Pathways of lateral spreading.


    Jacobi, U; Schanzer, S; Weigmann, H-J; Patzelt, A; Vergou, T; Sterry, W; Lademann, J


    In the case of topically applied substances, usually both lateral spreading and competitive penetration into the skin occur in parallel. In the present study, the pathways of lateral spreading were studied quantitatively and visually. The local distribution and lateral spreading of the UV filter substance butyl methoxydibenzoylmethane applied in an o/w emulsion was studied on the forearm and the back. The tape stripping procedure was used to determine the recovery rates inside and outside the area of application. The skin characteristics of transepidermal water loss, pH value, hydration of the stratum corneum and sebum rate were determined at both anatomic sites. Photography and laser scanning microscopy were used to visually investigate the lateral spreading of topically applied dyes. On the back, a preferred direction of lateral spreading parallel to the body axis was observed. This result was caused by differences in the network of furrows. The furrows functioned as a pathway for lateral spreading, whereas the follicles formed a reservoir for the topically applied substance. PMID:21455016

  3. The Reactome pathway Knowledgebase.


    Fabregat, Antonio; Sidiropoulos, Konstantinos; Garapati, Phani; Gillespie, Marc; Hausmann, Kerstin; Haw, Robin; Jassal, Bijay; Jupe, Steven; Korninger, Florian; McKay, Sheldon; Matthews, Lisa; May, Bruce; Milacic, Marija; Rothfels, Karen; Shamovsky, Veronica; Webber, Marissa; Weiser, Joel; Williams, Mark; Wu, Guanming; Stein, Lincoln; Hermjakob, Henning; D'Eustachio, Peter


    The Reactome Knowledgebase ( provides molecular details of signal transduction, transport, DNA replication, metabolism and other cellular processes as an ordered network of molecular transformations-an extended version of a classic metabolic map, in a single consistent data model. Reactome functions both as an archive of biological processes and as a tool for discovering unexpected functional relationships in data such as gene expression pattern surveys or somatic mutation catalogues from tumour cells. Over the last two years we redeveloped major components of the Reactome web interface to improve usability, responsiveness and data visualization. A new pathway diagram viewer provides a faster, clearer interface and smooth zooming from the entire reaction network to the details of individual reactions. Tool performance for analysis of user datasets has been substantially improved, now generating detailed results for genome-wide expression datasets within seconds. The analysis module can now be accessed through a RESTFul interface, facilitating its inclusion in third party applications. A new overview module allows the visualization of analysis results on a genome-wide Reactome pathway hierarchy using a single screen page. The search interface now provides auto-completion as well as a faceted search to narrow result lists efficiently. PMID:26656494

  4. Signaling Pathways in Melanogenesis

    PubMed Central

    D’Mello, Stacey A. N.; Finlay, Graeme J.; Baguley, Bruce C.; Askarian-Amiri, Marjan E.


    Melanocytes are melanin-producing cells found in skin, hair follicles, eyes, inner ear, bones, heart and brain of humans. They arise from pluripotent neural crest cells and differentiate in response to a complex network of interacting regulatory pathways. Melanins are pigment molecules that are endogenously synthesized by melanocytes. The light absorption of melanin in skin and hair leads to photoreceptor shielding, thermoregulation, photoprotection, camouflage and display coloring. Melanins are also powerful cation chelators and may act as free radical sinks. Melanin formation is a product of complex biochemical events that starts from amino acid tyrosine and its metabolite, dopa. The types and amounts of melanin produced by melanocytes are determined genetically and are influenced by a variety of extrinsic and intrinsic factors such as hormonal changes, inflammation, age and exposure to UV light. These stimuli affect the different pathways in melanogenesis. In this review we will discuss the regulatory mechanisms involved in melanogenesis and explain how intrinsic and extrinsic factors regulate melanin production. We will also explain the regulatory roles of different proteins involved in melanogenesis. PMID:27428965

  5. Signaling Pathways in Melanogenesis.


    D'Mello, Stacey A N; Finlay, Graeme J; Baguley, Bruce C; Askarian-Amiri, Marjan E


    Melanocytes are melanin-producing cells found in skin, hair follicles, eyes, inner ear, bones, heart and brain of humans. They arise from pluripotent neural crest cells and differentiate in response to a complex network of interacting regulatory pathways. Melanins are pigment molecules that are endogenously synthesized by melanocytes. The light absorption of melanin in skin and hair leads to photoreceptor shielding, thermoregulation, photoprotection, camouflage and display coloring. Melanins are also powerful cation chelators and may act as free radical sinks. Melanin formation is a product of complex biochemical events that starts from amino acid tyrosine and its metabolite, dopa. The types and amounts of melanin produced by melanocytes are determined genetically and are influenced by a variety of extrinsic and intrinsic factors such as hormonal changes, inflammation, age and exposure to UV light. These stimuli affect the different pathways in melanogenesis. In this review we will discuss the regulatory mechanisms involved in melanogenesis and explain how intrinsic and extrinsic factors regulate melanin production. We will also explain the regulatory roles of different proteins involved in melanogenesis. PMID:27428965

  6. AIP's Career Pathways Project

    NASA Astrophysics Data System (ADS)

    Avila, Jose


    The American Institute of Physics (AIP) Career Pathways Project, funded by the National Science Foundation, aims to increase the number of undergraduates going into STEM careers. The main purposes of this project are to show students the professional opportunities for a STEM career, understand what departments can do to better prepare physics bachelor's degree recipients to enter the workforce, understand what students can do to better prepare themselves, and develop resources based on these findings. I was chosen by the Society of Physics Students (SPS) to be the 2013 summer intern of the AIP's Career Pathways Project. In this talk I will discuss several resources I worked on with the Statistical Research Center of the American Institute of Physics and SPS. These resources include how to write a resume and cover letter, how to perform an informational interview, common job titles for physics bachelors, how to find career information in physics and STEM, how to search and use job postings, and how to network.

  7. Biochemical evidence for an alternate pathway in N-linked glycoprotein biosynthesis

    PubMed Central

    Larkin, Angelyn; Chang, Michelle M.; Whitworth, Garrett E.; Imperiali, Barbara


    Asparagine-linked glycosylation is a complex protein modification conserved among all three domains of life. Herein we report the in vitro analysis of N-linked glycosylation from the methanogenic archaeon Methanococcus voltae. Using a suite of synthetic and semisynthetic substrates, we show that AglK initiates N-linked glycosylation in M. voltae through the formation of α-linked dolichyl monophosphate N-acetylglucosamine (Dol-P-GlcNAc), which contrasts with the polyprenyl-diphosphate intermediates that feature in both eukaryotes and bacteria. Intriguingly, AglK exhibits high sequence homology to dolichyl-phosphate β-glucosyltransferases, including Alg5 in eukaryotes, suggesting a common evolutionary origin. The combined action of the first two enzymes, AglK and AglC, afforded an α-linked Dol-P-glycan that serves as a competent substrate for the archaeal oligosaccharyl transferase AglB. These studies provide the first biochemical evidence revealing that despite the apparent similarity of the overall pathways, there are actually two general strategies to achieve N-linked glycoproteins across the domains of life. PMID:23624439

  8. Mycophenolic Acid Inhibits Migration and Invasion of Gastric Cancer Cells via Multiple Molecular Pathways

    PubMed Central

    Dun, Boying; Sharma, Ashok; Teng, Yong; Liu, Haitao; Purohit, Sharad; Xu, Heng; Zeng, Lingwen; She, Jin-Xiong


    Mycophenolic acid (MPA) is the metabolized product and active element of mycophenolate mofetil (MMF) that has been widely used for the prevention of acute graft rejection. MPA potently inhibits inosine monophosphate dehydrogenase (IMPDH) that is up-regulated in many tumors and MPA is known to inhibit cancer cell proliferation as well as fibroblast and endothelial cell migration. In this study, we demonstrated for the first time MPA’s antimigratory and anti-invasion abilities of MPA-sensitive AGS (gastric cancer) cells. Genome-wide expression analyses using Illumina whole genome microarrays identified 50 genes with ≥2 fold changes and 15 genes with > 4 fold alterations and multiple molecular pathways implicated in cell migration. Real-time RT-PCR analyses of selected genes also confirmed the expression differences. Furthermore, targeted proteomic analyses identified several proteins altered by MPA treatment. Our results indicate that MPA modulates gastric cancer cell migration through down-regulation of a large number of genes (PRKCA, DOCK1, INF2, HSPA5, LRP8 and PDGFRA) and proteins (PRKCA, AKT, SRC, CD147 and MMP1) with promigratory functions as well as up-regulation of a number of genes with antimigratory functions (ATF3, SMAD3, CITED2 and CEAMCAM1). However, a few genes that may promote migration (CYR61 and NOS3) were up-regulated. Therefore, MPA’s overall antimigratory role on cancer cells reflects a balance between promigratory and antimigratory signals influenced by MPA treatment. PMID:24260584

  9. Regulation of renin processing and secretion: chemiosmotic control and novel secretory pathway.


    King, J A; Lush, D J; Fray, J C


    The renin-angiotensin-aldosterone system (RAAS) plays an important role in cardiovascular and electrolyte regulation in health and disease. Juxtaglomerular cells in the kidney regulate endocrine RAAS by physiologically controlling conversion of prorenin and secretion of renin. The classical baroceptor, neurogenic, and macula densa mechanisms regulate renin expression at the cellular level by Ca2+, adenosine 3',5'-cyclic monophosphate (cAMP), and chemiosmotic forces (K+, Cl-, and water flux coupled to H+ movement). The baroceptor mechanism (through Ca2+) activates K+ and Cl- channels in the surface membrane and deactivates a KCl-H+ exchange chemiosmotic transporter in the secretory granular membrane. The neurogenic mechanism (through cAMP) promotes prorenin processing to renin. The macula densa mechanism (through K+ and Cl-) involves the processing of prorenin to renin. Ca2+, by inhibiting the KCl-H+ exchange transporter, prevents secretory granules from engaging in chemiosmotically mediated exocytosis. cAMP, on the other hand, by stimulating H+ influx, provides the acidic granular environment for prorenin processing to renin. It is concluded that, in the presence of a favorable chemiosmotic environment, prorenin is processed to renin, which may then be secreted by regulative degranulation or divergence translocation, a novel secretory pathway used by several secretory proteins, including renin. PMID:7690183

  10. Metformin and rapamycin have distinct effects on the AKT pathway and proliferation in breast cancer cells.


    Zakikhani, Mahvash; Blouin, Marie-José; Piura, Esther; Pollak, Michael N


    Rapamycin and its analogues inhibit mTOR, which leads to decreased protein synthesis and decreased cancer cell proliferation in many experimental systems. Adenosine 5'- monophosphate-activated protein kinase (AMPK) activators such as metformin have similar actions, in keeping with the TSC2/1 pathway linking activation of AMPK to inhibition of mTOR. As mTOR inhibition by rapamycin is associated with attenuation of negative feedback to IRS-1, rapamycin is known to increase activation of AKT, which may reduce its anti-neoplastic activity. We observed that metformin exposure decreases AKT activation, an action opposite to that of rapamycin. We show that metformin (but not rapamycin) exposure leads to increased phosphorylation of IRS-1 at Ser(789), a site previously reported to inhibit downstream signaling and to be an AMPK substrate phosphorylated under conditions of cellular energy depletion. siRNA methods confirmed that reduction of AMPK levels attenuates both the IRS-1 Ser(789) phosphorylation and the inhibition of AKT activation associated with metformin exposure. Although both rapamycin and metformin inhibit mTOR (the former directly and the latter through AMPK signaling), our results demonstrate previously unrecognized differences between these agents. The data are consistent with the observation that maximal induction of apoptosis and inhibition of proliferation are greater for metformin than rapamycin. PMID:20135346

  11. Parathyroid hormone induces transcription of collagenase in rat osteoblastic cells by a mechanism using cyclic adenosine 3',5'-monophosphate and requiring protein synthesis

    NASA Technical Reports Server (NTRS)

    Scott, D. K.; Brakenhoff, K. D.; Clohisy, J. C.; Quinn, C. O.; Partridge, N. C.


    Collagenase is synthesized and secreted by rat osteoblastic cells in response to PTH. We have previously demonstrated that this effect involves a substantial increase in collagenase mRNA via transcription. Northern blots and nuclear run-on assays were performed to further investigate the induction of collagenase by PTH in the rat osteoblastic cell line UMR 106-01. Detectable amounts of collagenase mRNA were not apparent until 2 h of PTH treatment, showed the greatest abundance at 4 h, and declined to approximately 30% of maximum by 8 h. The changes in the rate of transcription of the collagenase gene in response to PTH paralleled and preceded the changes in the steady state mRNA levels. After an initial lag period of about 1 h, collagenase transcription rates increased from very low levels to a maximal response at 2 h, returning to about 50% of maximum by 10 h. The increased transcriptional rate of the collagenase gene was found to be dependent on the concentration of PTH, with a half-maximal response at approximately 7 x 10(-10) M rat PTH-(1-34) and a maximal effect with a dose of 10(-8) M. The PTH-mediated induction of collagenase transcriptional activity was completely abolished by cycloheximide, while transcription of the beta-actin gene was unaffected by the translation inhibitor. These data suggest that a protein factor(s) is required for PTH-mediated transcriptional induction of collagenase. Since PTH increases intracellular levels of several potential second messengers, agents that mimic these substances were employed to determine which signal transduction pathway is predominant in the PTH-mediated stimulation of collagenase transcription.(ABSTRACT TRUNCATED AT 250 WORDS).

  12. Identification of a new polyphosphoinositide in plants, phosphatidylinositol 5-monophosphate (PtdIns5P), and its accumulation upon osmotic stress.

    PubMed Central

    Meijer, H J; Berrie, C P; Iurisci, C; Divecha, N; Musgrave, A; Munnik, T


    Polyphosphoinositides play an important