Assessment of stent edge dissections by fractional flow reserve.

PubMed

Chung, Ju-Hyun; Ann, Soe Hee; Koo, Bon-Kwon; Nam, Chang-Wook; Doh, Joon-Hyung; Singh, Gillian Balbir; Kim, Hyung Il; Shin, Eun-Seok

2015-04-15

Edge dissections after intervention have been studied with imaging techniques, however, functional assessment has not been studied yet. We investigated the relationship between fractional flow reserve (FFR) and the angiographic type of stent edge dissections and tried to assess the use of FFR-guided management for edge dissection. 51 edge dissections assessed by FFR were included in this prospective observational study. FFR was measured for each type of edge dissection and compared with quantitative coronary angiographic findings. Clinical outcomes were evaluated based on FFR measurements. Edge dissections were classified as type A (47.1%; 24/51), type B (41.2%; 21/51), type C (2.0%; 1/51) and type D (9.8%; 5/51). Mean FFR in type A dissection was 0.87 ± 0.09, in type B 0.86 ± 0.07, in type C 0.72 and in type D 0.57 ± 0.08. All type C and D dissections (6/51) had FFR ≤ 0.8 and were treated with additional stents. Among the 45 type A and B dissections, 8 had a FFR ≤ 0.8 (17.8%), and 50% received additional stenting. All dissections with FFR >0.8 were left untreated except one long dissection case. There was no death, myocardial infarction or target lesion revascularization during hospitalization or the follow-up period (median 152 days; IQR 42-352 days). FFR correlates well with an angiographic type of edge dissection. Angiographic findings are sufficient for deciding the treatment of severe dissections such as types C and D, while FFR-guided management may be safe and effective for mild edge dissections such as types A and B. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

In-Bore 3-T MR-guided Transrectal Targeted Prostate Biopsy: Prostate Imaging Reporting and Data System Version 2–based Diagnostic Performance for Detection of Prostate Cancer

PubMed Central

Tan, Nelly; Lin, Wei-Chan; Khoshnoodi, Pooria; Asvadi, Nazanin H.; Yoshida, Jeffrey; Margolis, Daniel J. A.; Lu, David S. K.; Wu, Holden; Lu, David Y.; Huang, Jaioti

2017-01-01

Purpose To determine the diagnostic yield of in-bore 3-T magnetic resonance (MR) imaging–guided prostate biopsy and stratify performance according to Prostate Imaging Reporting and Data System (PI-RADS) versions 1 and 2. Materials and Methods This study was HIPAA compliant and institution review board approved. In-bore 3-T MR-guided prostate biopsy was performed in 134 targets in 106 men who (a) had not previously undergone prostate biopsy, (b) had prior negative biopsy findings with increased prostate-specific antigen (PSA) level, or (c) had a prior history of prostate cancer with increasing PSA level. Clinical, diagnostic 3-T MR imaging was performed with in-bore guided prostate biopsy, and pathology data were collected. The diagnostic yields of MR-guided biopsy per patient and target were analyzed, and differences between biopsy targets with negative and positive findings were determined. Results of logistic regression and areas under the curve were compared between PI-RADS versions 1 and 2. Results Prostate cancer was detected in 63 of 106 patients (59.4%) and in 72 of 134 targets (53.7%) with 3-T MR imaging. Forty-nine of 72 targets (68.0%) had clinically significant cancer (Gleason score ≥ 7). One complication occurred (urosepsis, 0.9%). Patients who had positive target findings had lower apparent diffusion coefficient values (875 × 10−6 mm2/sec vs 1111 × 10−6 mm2/sec, respectively; P < .01), smaller prostate volume (47.2 cm3 vs 75.4 cm3, respectively; P < .01), higher PSA density (0.16 vs 0.10, respectively; P < .01), and higher proportion of PI-RADS version 2 category 3–5 scores when compared with patients with negative target findings. MR targets with PI-RADS version 2 category 2, 3, 4, and 5 scores had a positive diagnostic yield of three of 23 (13.0%), six of 31 (19.4%), 39 of 50 (78.0%), and 24 of 29 (82.8%) targets, respectively. No differences were detected in areas under the curve for PI-RADS version 2 versus 1. Conclusion In-bore 3-T MR-guided biopsy is safe and effective for prostate cancer diagnosis when stratified according to PI-RADS versions 1 and 2. ©RSNA, 2016 PMID:27861110

Managing Process Improvement: A Guidebook for Implementing Change Version 01.00.06

DTIC Science & Technology

1993-12-01

and Competitive Position. Cambridge, 1982 Massachusetts: Massachusetts Institute of Technology. Egan, Gerard Change-Agent Skills B: Managing ... Innovation & Change. San 1988 Diego, California: Pfeiffer & Company. Fowler, Priscilla, and Software Engineering Group Guide. CMU/SEI-90-TR-24. Stan Rifkin

TES Validation Reports

Atmospheric Science Data Center

2014-06-30

... Reports: TES Data Versions: TES Validation Report Version 6.0 (PDF) R13 processing version; F07_10 file versions TES Validation Report Version 5.0 (PDF) R12 processing version; F06_08, F06_09 file ...

Logistics Company Partner 2.0.15 Tool: Quick Start Guide, 2015 Data Year - United States Version

EPA Pesticide Factsheets

This EPA document provides focused guidance and worksheets for SmartWay Logistics Company Partners on how to complete the SmartWay Logistics Tool and participate in the SmartWay program. (EPA publication # EPA-420-B-16-063)

Guidance for Product Category Rule Development, Version 1.0

EPA Science Inventory

Environmental claims based on life cycle assessment (LCA) can provide quantitative, full life cycle information on products in a format that can permit comparisons and thereby inform purchasing decisions. In recent years, a number of standards and guides have emerged for making b...

T-REX Version 1.5 User's Guide for Calculating Pesticide Residues on Avian and Mammalian Food Items - Appendix B - Initial Pesticide Residues on Arthropods

EPA Pesticide Factsheets

Obtain empirical data from the scientific literature and registrant-submitted studies to refine the initial residue assumptions of pesticides on arthropods that are simulated with TIM, T-REX, and T-HERPS

PEGASUS User's Guide. 5.1c

NASA Technical Reports Server (NTRS)

Suhs, Norman E.; Dietz, William E.; Rogers, Stuart E.; Nash, Steven M.; Onufer, Jeffrey T.

2000-01-01

PEGASUS 5.1 is the latest version of the PEGASUS series of mesh interpolation codes. It is a fully three-dimensional code. The main purpose for the development of this latest version was to significantly decrease the number of user inputs required and to allow for easier operation of the code. This guide is to be used with the user's manual for version 4 of PEGASUS. A basic description of methods used in both versions is described in the Version 4 manual. A complete list of all user inputs used in version 5.1 is given in this guide.

Logistics Company Partner 2.0.15 Tool: Data Entry and Troubleshooting Guide, 2015 Data Year - United States Version

EPA Pesticide Factsheets

This EPA document provides detailed data entry and troubleshooting guidance for SmartWay Logistics Company Partners on how to complete the SmartWay Logistics Tool and participate in the SmartWay program. (EPA publication # EPA-420-B-16-062)

USER'S GUIDE TO CLOSURE EVALUATION SYSTEM: CES BETA-TEST VERSION 1.0

EPA Science Inventory

The Closure Evaluation System (CES) is a decision support tool, developed by the U.S. EPA's Risk Reduction Engineering Laboratory, to assist reviewers and preparers of Resource Conservation and Recovery Act (RCRA) Part B permit applications. CES is designed to serve as a checklis...

SAGE FOR WINDOWS (WSAGE) VERSION 1.0 SOLVENT ALTERNATIVES GUIDE - USER'S GUIDE

EPA Science Inventory

The guide provides instructions for using the Solvent Alternatives Guide (SAGE) for Windows, version 1.0. The guide assumes that the user is familiar with the fundamentals of operating Windows 3.1 (or higher) on a personal computer under the DOS 5.0 (or higher) operating system. ...

SAGE FOR MACINTOSH (MSAGE) VERSION 1.0 SOLVENT ALTERNATIVES GUIDE - USER'S GUIDE

EPA Science Inventory

The guide provides instructions for using the Solvent Alternatives Guide (SAGE) for Macintosh, version 1.0. The guide assumes that the user is familiar with the fundamentals of operating a
Macintosh personal computer under the System 7.0 (or higher) operating system. SAGE for ...

75 FR 38026 - Medicare Program; Identification of Backward Compatible Version of Adopted Standard for E...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-01

... Programs (NCPDP) Prescriber/ Pharmacist Interface SCRIPT standard, Implementation Guide, Version 10... Prescriber/Pharmacist Interface SCRIPT standard, Version 8, Release 1 and its equivalent NCPDP Prescriber/Pharmacist Interface SCRIPT Implementation Guide, Version 8, Release 1 (hereinafter referred to as the...

SHEDS-Multimedia Model Version 3 (a) Technical Manual; (b) User Guide; and (c) Executable File to Launch SAS Program and Install Model

EPA Science Inventory

Reliable models for assessing human exposures are important for understanding health risks from chemicals. The Stochastic Human Exposure and Dose Simulation model for multimedia, multi-route/pathway chemicals (SHEDS-Multimedia), developed by EPA’s Office of Research and Developm...

Extending the Wireshark Network Protocol Analyser to Decode Link 16 Tactical Data Link Messages

DTIC Science & Technology

2014-01-01

Interoperability Workshop 2003, Paper No. 03F- SIW -002. 6. Boardman, B., (2008), Introduction to Tactical Data Links in the ADF, accessed from <http...2008, Paper No. 08E- SIW -046. 19. Lamping, U., (2013), Wireshark Developer’s Guide for Wireshark 1.11, accessed from <http://www.wireshark.org/docs

INM, integrated noise model, version 4.11 : user's guide, supplement

DOT National Transportation Integrated Search

1993-12-01

The Volpe National Transportation Systems Center, in support of the Federal Aviation Administration, Office of Environment and Energy, has developed Version 4.11 of the Integrated Noise Model (INM). This User's Guide is a supplement to INM, Version 3...

VizieR Online Data Catalog: M17 massive pms stars X-shooter spectra (Ramirez-Tannus+, 2017)

NASA Astrophysics Data System (ADS)

Ramirez-Tannus, M. C.; Kaper, L.; de Koter, A.; Tramper, F.; Bik, A.; Ellerbroek, L. E.; Ochsendorf, B. B.; Ramirez-Agudelo, O. H.; Sana, H.

2017-05-01

Normalized X-shooter spectra of the PMS and OB stars in M17 studied. The X-shooter spectra were obtained under good weather conditions with seeing ranging from 0.5" and 1" and clear sky. With the exception of the 2012 B289 spectrum and the 2009 B275 science verification spectrum, the spectrograph slit widths used were 1" (UVB, 300-590nm), 0.9" (VIS, 550-1020nm), and 0.4" (NIR, 1000-2480nm), resulting in a spectral resolving power of 5100, 8800, and 11300, respectively. The slit widths for the 2010 B275 observations were 1.6", 0.9", and 0.9" resulting in a resolving power of 3300, 8800, and 5600, respectively. For the 2012 B289 observations we used the 0.8", 0.7", and 0.4" slits corresponding to a resolving power of 6200, 11000, and 11300 for the UVB, VIS, and NIR arms, respectively. The spectra were taken in nodding mode and reduced using the X-shooter pipeline version 2.7.1 running under the ESO Reflex environment version 2.8.4. (2 data files).

Development and testing of the VITAMIN-B7/BUGLE-B7 coupled neutron-gamma multigroup cross-section libraries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Risner, J.M.; Wiarda, D.; Miller, T.M.

2011-07-01

The U.S. Nuclear Regulatory Commission's Regulatory Guide 1.190 states that calculational methods used to estimate reactor pressure vessel (RPV) fluence should use the latest version of the evaluated nuclear data file (ENDF). The VITAMIN-B6 fine-group library and BUGLE-96 broad-group library, which are widely used for RPV fluence calculations, were generated using ENDF/B-VI.3 data, which was the most current data when Regulatory Guide 1.190 was issued. We have developed new fine-group (VITAMIN-B7) and broad-group (BUGLE-B7) libraries based on ENDF/B-VII.0. These new libraries, which were processed using the AMPX code system, maintain the same group structures as the VITAMIN-B6 and BUGLE-96 libraries.more » Verification and validation of the new libraries were accomplished using diagnostic checks in AMPX, 'unit tests' for each element in VITAMIN-B7, and a diverse set of benchmark experiments including critical evaluations for fast and thermal systems, a set of experimental benchmarks that are used for SCALE regression tests, and three RPV fluence benchmarks. The benchmark evaluation results demonstrate that VITAMIN-B7 and BUGLE-B7 are appropriate for use in RPV fluence calculations and meet the calculational uncertainty criterion in Regulatory Guide 1.190. (authors)« less

Development and Testing of the VITAMIN-B7/BUGLE-B7 Coupled Neutron-Gamma Multigroup Cross-Section Libraries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Risner, Joel M; Wiarda, Dorothea; Miller, Thomas Martin

2011-01-01

The U.S. Nuclear Regulatory Commission s Regulatory Guide 1.190 states that calculational methods used to estimate reactor pressure vessel (RPV) fluence should use the latest version of the Evaluated Nuclear Data File (ENDF). The VITAMIN-B6 fine-group library and BUGLE-96 broad-group library, which are widely used for RPV fluence calculations, were generated using ENDF/B-VI data, which was the most current data when Regulatory Guide 1.190 was issued. We have developed new fine-group (VITAMIN-B7) and broad-group (BUGLE-B7) libraries based on ENDF/B-VII. These new libraries, which were processed using the AMPX code system, maintain the same group structures as the VITAMIN-B6 and BUGLE-96more » libraries. Verification and validation of the new libraries was accomplished using diagnostic checks in AMPX, unit tests for each element in VITAMIN-B7, and a diverse set of benchmark experiments including critical evaluations for fast and thermal systems, a set of experimental benchmarks that are used for SCALE regression tests, and three RPV fluence benchmarks. The benchmark evaluation results demonstrate that VITAMIN-B7 and BUGLE-B7 are appropriate for use in LWR shielding applications, and meet the calculational uncertainty criterion in Regulatory Guide 1.190.« less

Logistics, Multimodal, and Shipper Partner 2.0.15 Tools: Guide to Importing Carrier Data Using the Outside Data Import Function 2015 Data Year - United States Version

EPA Pesticide Factsheets

This document provides guidance for Logistics, Multi-modal, and Shippers on how to use outside data collection systems to populate the SmartWay tools carrier data and activity sections using an automated method. (EPA publication # EPA-420-B-16-057a)

45 CFR 162.1403 - Operating rules for health care claim status transaction.

Code of Federal Regulations, 2011 CFR

2011-10-01

... the following: (a) Except as specified in paragraph (b) of this section, the following CAQH CORE Phase... II CORE 250: Claim Status Rule, version 2.1.0, March 2011, and CORE v5010 Master Companion Guide, 00510, 1.2, March 2011. (Incorporated by reference in § 162.920). (2) Phase II CORE 270: Connectivity...

SBexpert users guide (version 2.0): a knowledge-based decision-support system for spruce beetle management.

Treesearch

Keith M. Reynolds; Edward H. Holsten

1997-01-01

SBexpert version 2.0 is a knowledge-based decision-support system for spruce beetle (Dendroctonus rufipennis (Kby.)) management developed for use in Microsoft (MS) Windows with the KnowledgePro Windows development language. Version 2.0 is a significant enhancement of version 1.0. The SBexpert users guide provides detailed instructions on the use of...

Transportation systems safety hazard analysis tool (SafetyHAT) user guide (version 1.0)

DOT National Transportation Integrated Search

2014-03-24

This is a user guide for the transportation system Safety Hazard Analysis Tool (SafetyHAT) Version 1.0. SafetyHAT is a software tool that facilitates System Theoretic Process Analysis (STPA.) This user guide provides instructions on how to download, ...

Effect of Relaxation With Guided Imagery on The Physical and Psychological Symptoms of Breast Cancer Patients Undergoing Chemotherapy.

PubMed

Chen, Shu-Fen; Wang, Hsiu-Ho; Yang, Hsing-Yu; Chung, Ue-Lin

2015-11-01

Breast cancer patients frequently experience psychological distress during the chemotherapy period. This study aimed to evaluate the effect of relaxation with guided imagery on patients with breast cancer. A two-group, pretest-posttest, quasi-experimental design with a randomized controlled trial was conducted. Sixty-five breast cancer patients from one medical center in Taiwan were enrolled in the study. These patients were randomly assigned to the experimental group (n = 32) or to the control group (n = 33). Both groups received chemotherapy self-care education, but the experimental group also received relaxation with guided imagery training. The training on relaxation with guided imagery was conducted before chemotherapy, and the patients were supplied with a compact disc detailing the performance of relaxation with guided imagery for 20 minutes daily at home for 7 days after chemotherapy. The experimental group showed significant decreases in insomnia (-0.34 ± 0.83, P < 0.05), pain (-0.28 ± 0.58, P < 0.05), anxiety (-3.56 ± 2.94, P < 0.00), and depression (-2.38 ± 2.70, P < 0.00) between the pretest and the posttest. Comparing the two groups, statistically significant differences were found in the overall symptom distress (B = 0.11, P < 0.05), insomnia (B = 0.50, P <0.05), depression (B = 0.38, P < 0.05), and numbness in physical symptoms (B = 0.38, P < 0.05), as well as in anxiety (B = 3.08, P < 0.00) and depression (B = 1.86, P < 0.00) in psychological distress. One week of relaxation with guided imagery can significantly improve the overall symptoms of distress, insomnia, depression, physical symptoms, and anxiety, and can decrease psychological distress. Relaxation with guided imagery had a positive effect on mediating anxiety and depression in breast cancer patients.

Ionospheric Response to Solar Flares Using an Improved Version of SAMI2

DTIC Science & Technology

2008-03-01

THE AIR FORCE AIR UNIVERSITY AIR FORCE INSTITUTE OF TECHNOLOGY Wright-Patterson Air Force Base, Ohio APPROVED FOR PUBLIC RELEASE; DISTRIBUTION ...Reich III, AAS, B.S. Captain, USAF March 2008 APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED AFrT/GAP/ENP/0&M08 Approved: IoNospHERrc RpspoxsE To...This region plays a key role in the absorption of HF-radio signals, especially very low frequency (VLF) signals used in military communications

Archive of single beam and swath bathymetry data collected nearshore of the Gulf Islands National Seashore, Mississippi, from West Ship Island, Mississippi, to Dauphin Island, Alabama: Methods and data report for USGS Cruises 08CCT01 and 08CCT02, July 2008, and 09CCT03 and 09CCT04, June 2009

USGS Publications Warehouse

DeWitt, Nancy T.; Flocks, James G.; Pendleton, Elizabeth A.; Hansen, Mark E.; Reynolds, B.J.; Kelso, Kyle W.; Wiese, Dana S.; Worley, Charles R.

2012-01-01

See the digital FACS equipment log for details about the acquisition equipment used. Raw datasets are stored digitally at the USGS St. Petersburg Coastal and Marine Science Center and processed systematically using Novatel's GrafNav version 7.6, SANDS version 3.7, SEA SWATHplus version 3.06.04.03, CARIS HIPS AND SIPS version 3.6, and ESRI ArcGIS version 9.3.1. For more information on processing refer to the Equipment and Processing page. Chirp seismic data were also collected during these surveys and are archived separately.

Processes Asunder: Acquisition & Planning Misfits

DTIC Science & Technology

2009-03-26

Establishing six Business Enterprise Priorities ( BEPs ) to focus the Department’s business transformation efforts, which now guide DoD investment decisions...three phases which look very much like Milestone A, B, and C of the previously existing Life Cycle Management Framework . With this obvious redundancy...February 2002). 30 6 Defense Acquisition University, “Integrated Defense Acquisition, Technology, & Logistics Life Cycle Management Framework , version 5.2

MISR-Versioning-V23

Atmospheric Science Data Center

2018-02-21

... MISR-Versioning-V23   Version Number: F13_0023 (aerosol), F08_0023 (land) Production Start Date: 11/1/2017 Product Updates:   This is a major revision to aerosol and land surface products, including both product format and algorithm ...

Shoulder patient-specific guide: First experience in 10 patients indicates room for improvement.

PubMed

Berhouet, J; Rol, M; Spiry, C; Slimane, M; Chevalier, C; Favard, L

2018-02-01

Implantation of the glenoid component of a total shoulder prosthesis can be facilitated by using a patient-specific guide (PSG) designed to ensure replication of the preoperatively planned position. The objective of this study was to assess the reliability and accuracy of a PSG in replicating the planned glenoid component position during total shoulder arthroplasty (TSA). Additional criteria should be used for 3D preoperative planning and PSG design to further improve the accuracy of glenoid component positioning. We studied 10 patients who underwent TSA with use of a PSG to position the glenoid component after preoperative 3D planning. Postoperative glenoid version and tilt were measured and compared to the planned values. We also used new criteria to assess implant rotation and global 3D position, as well as accuracy of the 3D pilot hole for the glenoid guide-pin. Mean errors in glenoid position were -1.7°±4.4° for version, -0.4°±4.9° for tilt, and 6.0°±13.5° for rotation. Mean difference in global orientation of the glenoid implant versus the planned value was 4.9°±2.5°. Mean 3D discrepancy in glenoid pilot hole position was 2.9±0.5mm; the discrepancy was greater in the mediolateral direction (1.9±0.9mm) than in the supero-inferior (1.1±1.2mm) and antero-posterior (0.8±1.2mm) directions. The poor performance of the PSG in controlling rotation and reaming may explain the difference in global glenoid position compared to the planned value. Improvements in PSG design to incorporate these two parameters deserve consideration. II, prospective cohort study. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Police Allocation Manual User's Guide: Determination of the Number and Allocation of Personnel for Patrol Services for State Police Departments (Special Version - April 1993)

DOT National Transportation Integrated Search

1993-04-01

The Police Allocation Manual User's Guide (herein after referred to as the Guide) : is intended as a companion document to the Police Allocation Manual (PAM), : Special Version, which can be used to determine the number and allocation of : personnel ...

User's Guide for Evaluating Subsurface Vapor Intrusion into Buildings

EPA Pesticide Factsheets

This revised version of the User's Guide corresponds with the release of Version 3.1 of the Johnson and Ettinger (1991) model (J E) spreadsheets for estimating subsurface vapor intrusion into buildings.

Guide to NavyFOAM V1.0

DTIC Science & Technology

2011-04-01

NavyFOAM has been developed using an open-source CFD software tool-kit ( OpenFOAM ) that draws heavily upon object-oriented programming. The...numerical methods and the physical models in the original version of OpenFOAM have been upgraded in an effort to improve accuracy and robustness of...computational fluid dynamics OpenFOAM , Object Oriented Programming (OOP) (CFD), NavyFOAM, 16. SECURITY CLASSIFICATION OF: a. REPORT UNCLASSIFIED b

UAEMIAAE

Atmospheric Science Data Center

2013-12-19

UAEMIAAE Aerosol product. ( File version details ) File version  F07_0015  has better ... properties. File version  F08_0016  has improved cloud screening procedure resulting in better aerosol optical depth. ... Coverage:  August - October 2004 File Format:  HDF-EOS Tools:  FTP Access: Data Pool ...

FHWA traffic noise model, version 1.0 : user's guide

DOT National Transportation Integrated Search

1998-01-01

This User's Guide is for the Federal Highway Administration's Traffic Noise Model (FHWA TNM), Version 1.0 -- the FHWAs computer program for highway traffic noise prediction and analysis. Two companion reports, a Technical Manual and a data repor...

Patient-specific targeting guides compared with traditional instrumentation for glenoid component placement in shoulder arthroplasty: a multi-surgeon study in 70 arthritic cadaver specimens.

PubMed

Throckmorton, Thomas W; Gulotta, Lawrence V; Bonnarens, Frank O; Wright, Stephen A; Hartzell, Jeffrey L; Rozzi, William B; Hurst, Jason M; Frostick, Simon P; Sperling, John W

2015-06-01

The purpose of this study was to compare the accuracy of patient-specific guides for total shoulder arthroplasty (TSA) with traditional instrumentation in arthritic cadaver shoulders. We hypothesized that the patient-specific guides would place components more accurately than standard instrumentation. Seventy cadaver shoulders with radiographically confirmed arthritis were randomized in equal groups to 5 surgeons of varying experience levels who were not involved in development of the patient-specific guidance system. Specimens were then randomized to patient-specific guides based off of computed tomography scanning, standard instrumentation, and anatomic TSA or reverse TSA. Variances in version or inclination of more than 10° and more than 4 mm in starting point were considered indications of significant component malposition. TSA glenoid components placed with patient-specific guides averaged 5° of deviation from the intended position in version and 3° in inclination; those with standard instrumentation averaged 8° of deviation in version and 7° in inclination. These differences were significant for version (P = .04) and inclination (P = .01). Multivariate analysis of variance to compare the overall accuracy for the entire cohort (TSA and reverse TSA) revealed patient-specific guides to be significantly more accurate (P = .01) for the combined vectors of version and inclination. Patient-specific guides also had fewer instances of significant component malposition than standard instrumentation did. Patient-specific targeting guides were more accurate than traditional instrumentation and had fewer instances of component malposition for glenoid component placement in this multi-surgeon cadaver study of arthritic shoulders. Long-term clinical studies are needed to determine if these improvements produce improved functional outcomes. Copyright © 2015 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

Evaluation of a Tethered Kite Anemometer.

DTIC Science & Technology

1981-02-01

Solar Eclipse , Part I - Atmospheric Sciences Laboratory Field Program Summary," ASL-TR-0059, May 1980 131. Miller, Walter B., "User’s Guide for Passive...the smaller kite and 500 m with the larger version. Therefore, the kite has been evaluated with reference to methods of obtaining winds to equivalent...advantage over remote sensors where noise can be mistakenly identified as signal , and complex mathematical algorithms are often required to obtain

National Assessment of Educational Progress: 1983-84 Public-Use Data Tapes, Version 3.1. Users' Guide.

ERIC Educational Resources Information Center

Barone, John L.; And Others

This document is the users' guide for Version 3.1 of the Public-Use data tapes compiled by the National Assessment of Educational Progress (NAEP), 1983-84. The Public-Use tapes are produced to allow outside researchers access to the NAEP data. The tapes accompanying this guide contain data assessing student achievement in reading and writing at…

[Revision of the primary care version of the ICD-10. Mental disorders].

PubMed

Varela-González, O; López-Ibor, J J

2007-01-01

Although the difficulty of applying psychiatric classifications to primary care has been widely criticized, there have been few investigations up to now to define and systematize the real demands in regards to these nosological systems. Recently, the revised version of the Mental and Behavior Disorders Chapter of the ICD 10 has been published. The new tool is the result of an elaboration process mainly developed by a group of 971 primary care physicians coordinated by 55 psychiatrists. The project was organized into three phases: a) evaluation of the current version and collection of proposals for change; b) definition of objectives for an optimized version; and c) writing a proposal of revised text. The result is a text that is more assimilable to a diagnostic and therapeutic guide than a mere coding system, more adapted to the role that the primary care physician can play in each disorder, more up-dated (especially in the treatment section) and more specific in many aspects.

Assessment of the effects and limitations of the 1998 to 2008 Abbreviated Injury Scale map using a large population-based dataset.

PubMed

Palmer, Cameron S; Franklyn, Melanie

2011-01-07

Trauma systems should consistently monitor a given trauma population over a period of time. The Abbreviated Injury Scale (AIS) and derived scores such as the Injury Severity Score (ISS) are commonly used to quantify injury severities in trauma registries. To reflect contemporary trauma management and treatment, the most recent version of the AIS (AIS08) contains many codes which differ in severity from their equivalents in the earlier 1998 version (AIS98). Consequently, the adoption of AIS08 may impede comparisons between data coded using different AIS versions. It may also affect the number of patients classified as major trauma. The entire AIS98-coded injury dataset of a large population based trauma registry was retrieved and mapped to AIS08 using the currently available AIS98-AIS08 dictionary map. The percentage of codes which had increased or decreased in severity, or could not be mapped, was examined in conjunction with the effect of these changes to the calculated ISS. The potential for free text information accompanying AIS coding to improve the quality of AIS mapping was explored. A total of 128280 AIS98-coded injuries were evaluated in 32134 patients, 15471 patients of whom were classified as major trauma. Although only 4.5% of dictionary codes decreased in severity from AIS98 to AIS08, this represented almost 13% of injuries in the registry. In 4.9% of patients, no injuries could be mapped. ISS was potentially unreliable in one-third of patients, as they had at least one AIS98 code which could not be mapped. Using AIS08, the number of patients classified as major trauma decreased by between 17.3% and 30.3%. Evaluation of free text descriptions for some injuries demonstrated the potential to improve mapping between AIS versions. Converting AIS98-coded data to AIS08 results in a significant decrease in the number of patients classified as major trauma. Many AIS98 codes are missing from the existing AIS map, and across a trauma population the AIS08 dataset estimates which it produces are of insufficient quality to be used in practice. However, it may be possible to improve AIS98 to AIS08 mapping to the point where it is useful to established registries.

Assessment of the effects and limitations of the 1998 to 2008 Abbreviated Injury Scale map using a large population-based dataset

PubMed Central

2011-01-01

Background Trauma systems should consistently monitor a given trauma population over a period of time. The Abbreviated Injury Scale (AIS) and derived scores such as the Injury Severity Score (ISS) are commonly used to quantify injury severities in trauma registries. To reflect contemporary trauma management and treatment, the most recent version of the AIS (AIS08) contains many codes which differ in severity from their equivalents in the earlier 1998 version (AIS98). Consequently, the adoption of AIS08 may impede comparisons between data coded using different AIS versions. It may also affect the number of patients classified as major trauma. Methods The entire AIS98-coded injury dataset of a large population based trauma registry was retrieved and mapped to AIS08 using the currently available AIS98-AIS08 dictionary map. The percentage of codes which had increased or decreased in severity, or could not be mapped, was examined in conjunction with the effect of these changes to the calculated ISS. The potential for free text information accompanying AIS coding to improve the quality of AIS mapping was explored. Results A total of 128280 AIS98-coded injuries were evaluated in 32134 patients, 15471 patients of whom were classified as major trauma. Although only 4.5% of dictionary codes decreased in severity from AIS98 to AIS08, this represented almost 13% of injuries in the registry. In 4.9% of patients, no injuries could be mapped. ISS was potentially unreliable in one-third of patients, as they had at least one AIS98 code which could not be mapped. Using AIS08, the number of patients classified as major trauma decreased by between 17.3% and 30.3%. Evaluation of free text descriptions for some injuries demonstrated the potential to improve mapping between AIS versions. Conclusions Converting AIS98-coded data to AIS08 results in a significant decrease in the number of patients classified as major trauma. Many AIS98 codes are missing from the existing AIS map, and across a trauma population the AIS08 dataset estimates which it produces are of insufficient quality to be used in practice. However, it may be possible to improve AIS98 to AIS08 mapping to the point where it is useful to established registries. PMID:21214906

Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) Version 3.0 User Guide

EPA Science Inventory

User Guide to describe the complete functionality of the Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) Version 3.0 online tool. The US Environmental Protection Agency Sequence Alignment to Predict Across Species Susceptibility tool (SeqAPASS; https://seqa...

Spike Neuromorphic VLSI-Based Bat Echolocation for Micro-Aerial Vehicle Guidance

DTIC Science & Technology

2007-03-31

IFinal 03/01/04 - 02/28/07 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Neuromorphic VLSI-based Bat Echolocation for Micro-aerial 5b.GRANTNUMBER Vehicle...uncovered interesting new issues in our choice for representing the intensity of signals. We have just finished testing the first chip version of an echo...timing-based algorithm (’openspace’) for sonar-guided navigation amidst multiple obstacles. 15. SUBJECT TERMS Neuromorphic VLSI, bat echolocation

Software Capability Evaluation (SCE) Version 2.0 Implementation Guide

DTIC Science & Technology

1994-02-01

Affected By SCE B-40 Figure 3-1 SCE Usage Decision Making Criteria 3-44 Figure 3-2 Estimated SCE Labor For One Source Selection 3-53 Figure 3-3 SCE...incorporated into the source selection sponsoring organization’s technical/management team for incorporation into acquisition decisions . The SCE team...expertise, past performance, and organizational capacity in acquisition decisions . The Capability Maturity Model Basic Concepts The CMM is based on the

Nuclear Engine System Simulation (NESS). Version 2.0: Program user's guide

NASA Technical Reports Server (NTRS)

Pelaccio, Dennis G.; Scheil, Christine M.; Petrosky, Lyman

1993-01-01

This Program User's Guide discusses the Nuclear Thermal Propulsion (NTP) engine system design features and capabilities modeled in the Nuclear Engine System Simulation (NESS): Version 2.0 program (referred to as NESS throughout the remainder of this document), as well as its operation. NESS was upgraded to include many new modeling capabilities not available in the original version delivered to NASA LeRC in Dec. 1991, NESS's new features include the following: (1) an improved input format; (2) an advanced solid-core NERVA-type reactor system model (ENABLER 2); (3) a bleed-cycle engine system option; (4) an axial-turbopump design option; (5) an automated pump-out turbopump assembly sizing option; (6) an off-design gas generator engine cycle design option; (7) updated hydrogen properties; (8) an improved output format; and (9) personal computer operation capability. Sample design cases are presented in the user's guide that demonstrate many of the new features associated with this upgraded version of NESS, as well as design modeling features associated with the original version of NESS.

Guide for Regional Integrated Assessments: Handbook of Methods and Procedures, Version 5.1. Appendix 1

NASA Technical Reports Server (NTRS)

Rosenzweig, Cynthia E.; Jones, James W.; Hatfield, Jerry; Antle, John; Ruane, Alex; Boote, Ken; Thorburn, Peter; Valdivia, Roberto; Porter, Cheryl; Janssen, Sander;

Fixed-frequency and Frequency-agile (au, HTS) Microstrip Bandstop Filters for L-band Applications

NASA Technical Reports Server (NTRS)

Saenz, Eileen M.; Subramanyam, Guru; VanKeuls, Fred W.; Chen, Chonglin; Miranda, Felix A.

2001-01-01

In this work, we report on the performance of a highly selective, compact 1.83 x 2.08 cm(exp 2) (approx. 0.72 x 0.82 in(exp 2) microstrip line bandstop filter of YBa2CU3O(7-delta) (YBCO) on LaAlO3 (LAO) substrate. The filter is designed for a center frequency of 1.623 GHz for a bandwidth at 3 dB from reference baseline of less than 5.15 MHz, and a bandstop rejection of 30 dB or better. The design and optimization of the filter was performed using Zeland's IE3D circuit simulator. The optimized design was used to fabricate gold (Au) and High-Temperature Superconductor (HTS) versions of the filter. We have also studied an electronically tunable version of the same filter. Tunability of the bandstop characteristics is achieved by the integration of a thin film conductor (Au or HTS) and the nonlinear dielectric ferroelectric SrTiO3 in a conductor/ferroelectric/dielectric modified microstrip configuration. The performance of these filters and comparison with the simulated data will be presented.

USER'S GUIDE TO THE PERSONAL COMPUTER VERSION OF THE BIOGENIC EMISSIONS INVENTORY SYSTEM (PC-BEIS2)

EPA Science Inventory

The document is a user's guide for an updated Personal Computer version of the Biogenic Emissions Inventory System (PC-BEIS2), allowing users to estimate hourly emissions of biogenic volatile organic compounds (BVOCs) and soil nitrogen oxide emissions for any county in the contig...

Web-Based Interactive Electronic Technical Manual (IETM) Common User Interface Style Guide, Version 2.0

DTIC Science & Technology

2003-07-01

Technical Report WEB-BASED INTERACTIVE ELECTRONIC TECHNICAL MANUAL (IETM) COMMON USER INTERFACE STYLE GUIDE Version 2.0 – July 2003 by L. John Junod ...ACKNOWLEDGEMENTS The principal authors of this document were: John Junod – NSWC, Carderock Division, Phil Deuell – AMSEC LLC, Kathleen Moore

CSMP Mathematics for Kindergarten, Teacher's Guide [and] Worksheets. Final Experimental Version.

ERIC Educational Resources Information Center

Vandeputte, Christiane

This guide represents the final experimental version of an extended pilot project which was conducted in the United States between 1973 and 1976. The manner of presentation and the pedagogical ideas and tools are based on the works of Georges and Frederique Papy. They are recognized as having introduced colored arrow drawings…

Contributions to the revision of the 'Guide to the expression of uncertainty in measurement'

NASA Astrophysics Data System (ADS)

Kyriazis, G. A.

2015-01-01

Some inconsistencies of the current version of the 'Guide to the expression of uncertainty in measurement' are discussed and suggestions to make this document consistent are commented. The paper is written taking into account the terminology of the third version of the 'International vocabulary of metrology'.

Low loss InGaAs/InP multiple quantum well waveguides

NASA Astrophysics Data System (ADS)

Koren, U.; Miller, B. I.; Koch, T. L.; Boyd, G. D.; Capik, R. J.

1986-12-01

Double heterostructure planar waveguides with an InGaAs/InP multiple quantum well (MQW) core and InP cladding layers were grown by atmospheric pressure metalorganic chemical vapor deposition. Ridge waveguides had a low propagation loss of 0.8 dB/cm for 1.52 micron input light. The indices of refraction for the guided TE and TM modes have been measured and the bulk dispersion curves of the MQW material for the 1.46-1.55 micron wavelength region were derived.

Technical Reviews and Audits for Systems, Equipment and Computer Software. Volume 1

DTIC Science & Technology

2009-09-15

acquisitions and technology developments. 2. This new-issue SMC standard comprises the text of The Aerospace Corporation report number TOR-2007( 8583 )-6414...TRA) Deskbook – DUSD(S&T) (May 2005) 17. IMP & IMS Preparation and Use Guide Version 0.9 (21 October 2005) 18. ISO /IEC STD 15939 Software...1521B, TOR-2007( 8583 )-6414_Volume 1. 110.2 Purpose A. The guidelines contained herein implement the Department of Defense Directive 4120.21

HyRAM V1.0 User Guide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Groth, Katrina M.; Zumwalt, Hannah Ruth; Clark, Andrew Jordan

2016-03-01

Hydrogen Risk Assessment Models (HyRAM) is a prototype software toolkit that integrates data and methods relevant to assessing the safety of hydrogen fueling and storage infrastructure. The HyRAM toolkit integrates deterministic and probabilistic models for quantifying accident scenarios, predicting physical effects, and characterizing the impact of hydrogen hazards, including thermal effects from jet fires and thermal pressure effects from deflagration. HyRAM version 1.0 incorporates generic probabilities for equipment failures for nine types of components, and probabilistic models for the impact of heat flux on humans and structures, with computationally and experimentally validated models of various aspects of gaseous hydrogen releasemore » and flame physics. This document provides an example of how to use HyRAM to conduct analysis of a fueling facility. This document will guide users through the software and how to enter and edit certain inputs that are specific to the user-defined facility. Description of the methodology and models contained in HyRAM is provided in [1]. This User’s Guide is intended to capture the main features of HyRAM version 1.0 (any HyRAM version numbered as 1.0.X.XXX). This user guide was created with HyRAM 1.0.1.798. Due to ongoing software development activities, newer versions of HyRAM may have differences from this guide.« less

COATING ALTERNATIVES GUIDE (CAGE) USER'S GUIDE

EPA Science Inventory

The guide provides instructions for using the Coating Alternatives GuidE (CAGE) software program, version 1.0. It assumes that the user is familiar with the fundamentals of operating an IBM-compatible personal computer (PC) under the Microsoft disk operating system (MS-DOS). CAGE...

SAGE 2.1: SOLVENT ALTERNATIVES GUIDE: USER'S GUIDE

EPA Science Inventory

The guide provides instruction for using the SAGE (Solvent Alternatives GuidE) software system, version 2.1. SAGE recommends solvent replacements in cleaning and degreasing operations. It leads the user through a question-and-answer session. The user's responses allow the system ...

Transonic control effectiveness for full and partial span elevon configurations on a 0.0165 scale model space shuttle orbiter tested in the LaRC 8-foot transonic wind tunnel (LA48)

NASA Technical Reports Server (NTRS)

1977-01-01

A transonic pressure tunnel test is reported on an early version of the space shuttle orbiter (designated 089B-139) 0.0165 scale model to systematically determine both longitudinal and lateral control effectiveness associated with various combinations of inboard, outboard, and full span wing trailing edge controls. The test was conducted over a Mach number range from 0.6 to 1.08 at angles of attack from -2 deg to 23 deg at 0 deg sideslip.

Maxdose-SR and popdose-SR routine release atmospheric dose models used at SRS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jannik, G. T.; Trimor, P. P.

MAXDOSE-SR and POPDOSE-SR are used to calculate dose to the offsite Reference Person and to the surrounding Savannah River Site (SRS) population respectively following routine releases of atmospheric radioactivity. These models are currently accessed through the Dose Model Version 2014 graphical user interface (GUI). MAXDOSE-SR and POPDOSE-SR are personal computer (PC) versions of MAXIGASP and POPGASP, which both resided on the SRS IBM Mainframe. These two codes follow U.S. Nuclear Regulatory Commission (USNRC) Regulatory Guides 1.109 and 1.111 (1977a, 1977b). The basis for MAXDOSE-SR and POPDOSE-SR are USNRC developed codes XOQDOQ (Sagendorf et. al 1982) and GASPAR (Eckerman et. almore » 1980). Both of these codes have previously been verified for use at SRS (Simpkins 1999 and 2000). The revisions incorporated into MAXDOSE-SR and POPDOSE-SR Version 2014 (hereafter referred to as MAXDOSE-SR and POPDOSE-SR unless otherwise noted) were made per Computer Program Modification Tracker (CPMT) number Q-CMT-A-00016 (Appendix D). Version 2014 was verified for use at SRS in Dixon (2014).« less

Testing of a novel pin array guide for accurate three-dimensional glenoid component positioning.

PubMed

Lewis, Gregory S; Stevens, Nicole M; Armstrong, April D

2015-12-01

A substantial challenge in total shoulder replacement is accurate positioning and alignment of the glenoid component. This challenge arises from limited intraoperative exposure and complex arthritic-driven deformity. We describe a novel pin array guide and method for patient-specific guiding of the glenoid central drill hole. We also experimentally tested the hypothesis that this method would reduce errors in version and inclination compared with 2 traditional methods. Polymer models of glenoids were created from computed tomography scans from 9 arthritic patients. Each 3-dimensional (3D) printed scapula was shrouded to simulate the operative situation. Three different methods for central drill alignment were tested, all with the target orientation of 5° retroversion and 0° inclination: no assistance, assistance by preoperative 3D imaging, and assistance by the pin array guide. Version and inclination errors of the drill line were compared. Version errors using the pin array guide (3° ± 2°) were significantly lower than version errors associated with no assistance (9° ± 7°) and preoperative 3D imaging (8° ± 6°). Inclination errors were also significantly lower using the pin array guide compared with no assistance. The new pin array guide substantially reduced errors in orientation of the central drill line. The guide method is patient specific but does not require rapid prototyping and instead uses adjustments to an array of pins based on automated software calculations. This method may ultimately provide a cost-effective solution enabling surgeons to obtain accurate orientation of the glenoid. Copyright © 2015 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

User's Guide to the Western Root Disease Model, Version 3.0

Treesearch

Susan J. Frankel

1998-01-01

Effects of Armillaria spp., Phellinus weirii, Heterobasidion annosum, or bark beetles on stand dynamics are represented by the Western Root Disease Model,Version 3.0. This model, which operates in conjunction with the Forest Vegetation Simulator, can be used to evaluate the effects of many silvicultural practices. This guide contains instructions for use, detailed...

Age Matters: Student Experiences with Audio Learning Guides in University-Based Continuing Education

ERIC Educational Resources Information Center

Mercer, Lorraine; Pianosi, Birgit

2012-01-01

The primary objective of this research was to explore the experiences of undergraduate distance education students using sample audio versions (provided on compact disc) of the learning guides for their courses. The results of this study indicated that students responded positively to the opportunity to have word-for-word audio versions of their…

SBexpert users guide (version 1.0): a knowledge-based decision-support system for spruce beetle management.

Treesearch

Keith M. Reynolds; Edward H. Holsten; Richard A. Werner

1994-01-01

SBexpert version 1.0 is a knowledge-based decision-support system for spruce beetle (Dendroctonus rutipennis (Kby.)) management developed for use in Microsoft Windows with the KnowledgePro Windows development language. The SBexpert users guide provides detailed instructions on the use of all SBexpert features. SBexpert has four main topics (...

Detection of early psychotic symptoms: Validation of the Spanish version of the "Symptom Onset in Schizophrenia (SOS) inventory".

PubMed

Mezquida, Gisela; Cabrera, Bibiana; Martínez-Arán, Anabel; Vieta, Eduard; Bernardo, Miguel

2018-03-01

The period of subclinical signs that precedes the onset of psychosis is referred to as the prodrome or high-risk mental state. The "Symptom Onset in Schizophrenia (SOS) inventory" is an instrument to characterize and date the initial symptoms of a psychotic illness. The present study aims to provide reliability and validity data for clinical and research use of the Spanish version of the SOS. Thirty-six participants with a first-episode of psychosis meeting DSM-IV criteria for schizophrenia/schizoaffective/schizophreniform disorder were administered the translated SOS and other clinical assessments. The internal validity, intrarater and interrater reliability were studied. We found strong interrater reliability. To detect the presence/absence of prodromal symptoms, Kappa coefficients ranged between 0.8 and 0.7. Similarly, the raters obtained an excellent level of agreement regarding the onset of each symptom and the duration of symptoms until first treatment (intraclass correlation coefficients between 0.9 and 1.0). Cronbach's alpha was 0.9-1.0 for all the items. The interrater reliability and concurrent validity were also excellent in both cases. This study provides robust psychometric properties of the Spanish version of the SOS. The translated version is adequate in terms of good internal validity, intrarater and interrater reliability, and is as time-efficient as the original version. Copyright © 2017 Elsevier B.V. All rights reserved.

Subject Categorization Guide for Defense Science and Technology

DTIC Science & Technology

1986-10-01

transfer 06/08 Cherries 20/05 Charged particles 08/06 Chesapeake Bay 20/11 Charpy impact tests 12/03 Chi square test 21/02 Charring 06/03 Chickens 14/05... Mexico 11/06 Metal films 08/06 Mexico Gulf 13/09 Metal forming brakes 08/07 Mica 13/09 Metal forming presses 09/01 Mirl capacitors 13/05 Metal joints 06...Nobolium COMPouO~S 08/06 Now Mexico 06/13 Nocardia 08/06 New York 04101 Noctllu(cent clouds 08/06 New York City(New York) 04/02 08/06 New Zealand 06/03

COATING ALTERNATIVES GUIDE (CAGE) USER'S GUIDE (EPA/600/R-01/030)

EPA Science Inventory

The guide provides instructions for using the Coating Alternatives GuidE (CAGE) software program, version 1.0. It assumes that the user is familiar with the fundamentals of operating an IBM-compatible personal computer (PC) under the Microsoft disk operating system (MS-DOS). CAGE...

Aircraft/Air Traffic Management Functional Analysis Model. Version 2.0; User's Guide

NASA Technical Reports Server (NTRS)

Etheridge, Melvin; Plugge, Joana; Retina, Nusrat

1998-01-01

The Aircraft/Air Traffic Management Functional Analysis Model, Version 2.0 (FAM 2.0), is a discrete event simulation model designed to support analysis of alternative concepts in air traffic management and control. FAM 2.0 was developed by the Logistics Management Institute (LMI) a National Aeronautics and Space Administration (NASA) contract. This document provides a guide for using the model in analysis. Those interested in making enhancements or modification to the model should consult the companion document, Aircraft/Air Traffic Management Functional Analysis Model, Version 2.0 Technical Description.

Previous MOVES Versions and Documentation

EPA Pesticide Factsheets

Find all software, user guides, and download and installation instructions for MOVES2010a and MOVES2010. Note that these version are not valid for SIP and transportation conformity purposes: MOVES2014 and MOVES2014a are the latest versions.

NHTSA data reference guide version 4. Volume 3, component tests

DOT National Transportation Integrated Search

1997-04-01

This guide documents the format of magnetic media (3.5 inch high density diskettes) to be submitted : to the National Highway Traffic Safety Administration (NHTSA) for component tests. This guide is : designated Volume III. NHTSA Data Reference Guide...

CSMP Mathematics for the Intermediate Grades Part IV, Teacher's Guide. General Introduction. Workbooks. Experimental Version.

ERIC Educational Resources Information Center

Armstrong, Richard; And Others

This guide represents the final experimental version of a pilot project which was conducted in the United States between 1973 and 1976. The ideas and the manner of presentation are based on the works of Georges and Frederique Papy. They are recognized for having introduced colored arrow drawings ("papygrams") and models of our numeration…

CSMP Mathematics for the Intermediate Grades Part I, Teacher's Guide. General Introduction. Workbooks. Experimental Version.

ERIC Educational Resources Information Center

Kaufman, Burt; And Others

This guide represents the final experimental version of an extended pilot project which was conducted in the United States between 1973 and 1976. The manner of presentation and pedagogical ideas and tools are based on the works of George and Frederique Papy. They are recognized as having introduced colored arrow drawings ("papygrams")…

CSMP Mathematics for the Intermediate Grades Part III, Teacher's Guide [and] Worksheets. General Introduction. Workbooks. Experimental Version.

ERIC Educational Resources Information Center

Harpel, Jim; And Others

This guide represents the final experimental version of a pilot project which was conducted in the United States between 1973 and 1976. The ideas and the manner of presentation are based on the works of Georges and Frederique Papy. They are recognized for having introduced colored arrow drawings ("papygrams") and models of our numeration…

CSMP Mathematics for the Intermediate Grades Part I, Teacher's Guide [and] Worksheets. The World of Numbers. Experimental Version.

ERIC Educational Resources Information Center

CEMREL, Inc., St. Ann, MO.

This guide represents the final experimental version of an extended pilot project which was conducted in the United States between 1973 and 1976. The manner of presentation and pedagogical ideas and tools are based on the works of Georges and Frederique Papy. They are recognized as having introduced colored arrow drawings ("papygrams")…

CSMP Mathematics for the Intermediate Grades Part III, Teacher's Guide. The World of Numbers. Experimental Version.

ERIC Educational Resources Information Center

CEMREL, Inc., St. Ann, MO.

This guide represents the final experimental version of a pilot project which was conducted in the United States between 1973 and 1976. The ideas and the manner of presentation are based on the works of Georges and Frederique Papy. They are recognized for having introduced colored arrow drawings ("papygrams") and models of our numeration…

CSMP Mathematics for the Intermediate Grades Part II, Teacher's Guide. General Introduction. Workbooks. Experimental Version.

ERIC Educational Resources Information Center

Harpel, Jim; And Others

This guide represents the final experimental version of a pilot project which was conducted in the United States between 1973 and 1976. The ideas and the manner of presentation are based on the works of Georges and Frederique Papy. They are recognized for having introduced colored arrow drawings ("papygrams") and models of our numeration…

CSMP Mathematics for the Intermediate Grades Part IV, Teacher's Guide. The World of Numbers. Experimental Version.

ERIC Educational Resources Information Center

CEMREL, Inc., St. Ann, MO.

This guide represents the final experimental version of a pilot project which was conducted in the United States between 1973 and 1976. The ideas and the manner of presentation are based on the works of Georges and Frederique Papy. They are recognized for having introduced colored arrow drawings ("papygrams") and models of our numeration…

Conversion and improvement of the Rutherford Laboratory's magnetostatic computer code GFUN3D to the NMFECC CDC 7600

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tucker, T.C.

1980-06-01

The implementation of a version of the Rutherford Laboratory's magnetostatic computer code GFUN3D on the CDC 7600 at the National Magnetic Fusion Energy Computer Center is reported. A new iteration technique that greatly increases the probability of convergence and reduces computation time by about 30% for calculations with nonlinear, ferromagnetic materials is included. The use of GFUN3D on the NMFE network is discussed, and suggestions for future work are presented. Appendix A consists of revisions to the GFUN3D User Guide (published by Rutherford Laboratory( that are necessary to use this version. Appendix B contains input and output for some samplemore » calculations. Appendix C is a detailed discussion of the old and new iteration techniques.« less

RXRα transcriptional inhibitors from the stems of Calophyllum membranaceum.

PubMed

Ming, Meng; Zhang, Xue; Chen, Hai-Feng; Zhu, Ling-Juan; Zeng, De-Quan; Yang, Jian; Wu, Guang-Xun; Wu, Yu-Zhuo; Yao, Xin-Sheng

2016-01-01

Bioassay-guided fractionation of the 60% ethanol extract of the stems of Calophyllum membranaceum using the RXRα transcription activation assay led to the isolation of two new chromanones, calopolyanic acid methyl ester (1) and isopinetoric acid methyl ester (2), two new xanthones, calophylixanthones A-B (3-4), and one new C-glycoside, calophymembranside C (5), along with 13 known compounds. Their structures were elucidated on the basis of extensive spectroscopic data. Compounds 5, 11 and 18 showed transcriptional inhibitory activity of RXRα with 50% inhibitory concentration (IC50) values of 29.95 ± 1.08, 31.06 ± 9.02, and 25.88 ± 1.62 μM, respectively. Copyright © 2015 Elsevier B.V. All rights reserved.

Debunking Astronomical Fiction Science: A Resource Guide

NASA Astrophysics Data System (ADS)

Fraknoi, A.

2010-08-01

This resource guide is for educators who receive questions about controversial topics and want readings or websites to brush up on the facts or to recommend to students or the public. This is by no means a complete list, but a short guide of some of the key resources that may be of help. A version of this was distributed at the meeting during the oral session. Longer version of this list can be found online at http://www.astrosociety.org/education/resources/pseudobib.html.

NASA Scope and Subject Category Guide

NASA Technical Reports Server (NTRS)

2011-01-01

This guide provides a simple, effective tool to assist aerospace information analysts and database builders in the high-level subject classification of technical materials. Each of the 76 subject categories comprising the classification scheme is presented with a description of category scope, a listing of subtopics, cross references, and an indication of particular areas of NASA interest. The guide also includes an index of nearly 3,000 specific research topics cross referenced to the subject categories. The portable document format (PDF) version of the guide contains links in the index from each input subject to its corresponding categories. In addition to subject classification, the guide can serve as an aid to searching databases that use the classification scheme, and is also an excellent selection guide for those involved in the acquisition of aerospace literature. The CD-ROM contains both HTML and PDF versions.

SAGE 2.0 SOLVENT ALTERNATIVES GUIDE - USER'S GUIDE

EPA Science Inventory

The guide provides instruction for using the SAGE (Solvent Alternatives Guide) software system, version 2.O. It assumes that the user is familiar with the fundamentals of operating a personal computer under the Microsoft disk operating system (MS-DOS). AGE recommends solvent repl...

NHTSA data reference guide version 4. Volume 4, signal waveform generator tests

DOT National Transportation Integrated Search

1997-09-01

This guide documents the format of magnetic media (3.5 inch high density diskettes) to be submitted : to the National Highway Traffic Safety Administration (NHTSA) for SWG tests. This guide is : designated Volume IV. NHTSA Data Reference Guide (Signa...

U.S. Army weapon systems human-computer interface style guide. Version 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Avery, L.W.; O`Mara, P.A.; Shepard, A.P.

1997-12-31

A stated goal of the US Army has been the standardization of the human computer interfaces (HCIs) of its system. Some of the tools being used to accomplish this standardization are HCI design guidelines and style guides. Currently, the Army is employing a number of HCI design guidance documents. While these style guides provide good guidance for the command, control, communications, computers, and intelligence (C4I) domain, they do not necessarily represent the more unique requirements of the Army`s real time and near-real time (RT/NRT) weapon systems. The Office of the Director of Information for Command, Control, Communications, and Computers (DISC4),more » in conjunction with the Weapon Systems Technical Architecture Working Group (WSTAWG), recognized this need as part of their activities to revise the Army Technical Architecture (ATA), now termed the Joint Technical Architecture-Army (JTA-A). To address this need, DISC4 tasked the Pacific Northwest National Laboratory (PNNL) to develop an Army weapon systems unique HCI style guide, which resulted in the US Army Weapon Systems Human-Computer Interface (WSHCI) Style Guide Version 1. Based on feedback from the user community, DISC4 further tasked PNNL to revise Version 1 and publish Version 2. The intent was to update some of the research and incorporate some enhancements. This document provides that revision. The purpose of this document is to provide HCI design guidance for the RT/NRT Army system domain across the weapon systems subdomains of ground, aviation, missile, and soldier systems. Each subdomain should customize and extend this guidance by developing their domain-specific style guides, which will be used to guide the development of future systems within their subdomains.« less

Development and validation of a complementary map to enhance the existing 1998 to 2008 Abbreviated Injury Scale map

PubMed Central

2011-01-01

Introduction Many trauma registries have used the Abbreviated Injury Scale 1990 Revision Update 98 (AIS98) to classify injuries. In the current AIS version (Abbreviated Injury Scale 2005 Update 2008 - AIS08), injury classification and specificity differ substantially from AIS98, and the mapping tools provided in the AIS08 dictionary are incomplete. As a result, data from different AIS versions cannot currently be compared. The aim of this study was to develop an additional AIS98 to AIS08 mapping tool to complement the current AIS dictionary map, and then to evaluate the completed map (produced by combining these two maps) using double-coded data. The value of additional information provided by free text descriptions accompanying assigned codes was also assessed. Methods Using a modified Delphi process, a panel of expert AIS coders established plausible AIS08 equivalents for the 153 AIS98 codes which currently have no AIS08 map. A series of major trauma patients whose injuries had been double-coded in AIS98 and AIS08 was used to assess the maps; both of the AIS datasets had already been mapped to another AIS version using the AIS dictionary maps. Following application of the completed (enhanced) map with or without free text evaluation, up to six AIS codes were available for each injury. Datasets were assessed for agreement in injury severity measures, and the relative performances of the maps in accurately describing the trauma population were evaluated. Results The double-coded injuries sustained by 109 patients were used to assess the maps. For data conversion from AIS98, both the enhanced map and the enhanced map with free text description resulted in higher levels of accuracy and agreement with directly coded AIS08 data than the currently available dictionary map. Paired comparisons demonstrated significant differences between direct coding and the dictionary maps, but not with either of the enhanced maps. Conclusions The newly-developed AIS98 to AIS08 complementary map enabled transformation of the trauma population description given by AIS98 into an AIS08 estimate which was statistically indistinguishable from directly coded AIS08 data. It is recommended that the enhanced map should be adopted for dataset conversion, using free text descriptions if available. PMID:21548991

Development and validation of a complementary map to enhance the existing 1998 to 2008 Abbreviated Injury Scale map.

PubMed

Palmer, Cameron S; Franklyn, Melanie; Read-Allsopp, Christine; McLellan, Susan; Niggemeyer, Louise E

2011-05-08

Many trauma registries have used the Abbreviated Injury Scale 1990 Revision Update 98 (AIS98) to classify injuries. In the current AIS version (Abbreviated Injury Scale 2005 Update 2008 - AIS08), injury classification and specificity differ substantially from AIS98, and the mapping tools provided in the AIS08 dictionary are incomplete. As a result, data from different AIS versions cannot currently be compared. The aim of this study was to develop an additional AIS98 to AIS08 mapping tool to complement the current AIS dictionary map, and then to evaluate the completed map (produced by combining these two maps) using double-coded data. The value of additional information provided by free text descriptions accompanying assigned codes was also assessed. Using a modified Delphi process, a panel of expert AIS coders established plausible AIS08 equivalents for the 153 AIS98 codes which currently have no AIS08 map. A series of major trauma patients whose injuries had been double-coded in AIS98 and AIS08 was used to assess the maps; both of the AIS datasets had already been mapped to another AIS version using the AIS dictionary maps. Following application of the completed (enhanced) map with or without free text evaluation, up to six AIS codes were available for each injury. Datasets were assessed for agreement in injury severity measures, and the relative performances of the maps in accurately describing the trauma population were evaluated. The double-coded injuries sustained by 109 patients were used to assess the maps. For data conversion from AIS98, both the enhanced map and the enhanced map with free text description resulted in higher levels of accuracy and agreement with directly coded AIS08 data than the currently available dictionary map. Paired comparisons demonstrated significant differences between direct coding and the dictionary maps, but not with either of the enhanced maps. The newly-developed AIS98 to AIS08 complementary map enabled transformation of the trauma population description given by AIS98 into an AIS08 estimate which was statistically indistinguishable from directly coded AIS08 data. It is recommended that the enhanced map should be adopted for dataset conversion, using free text descriptions if available.

A user's guide to Sandia's latin hypercube sampling software : LHS UNIX library/standalone version.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Swiler, Laura Painton; Wyss, Gregory Dane

2004-07-01

This document is a reference guide for the UNIX Library/Standalone version of the Latin Hypercube Sampling Software. This software has been developed to generate Latin hypercube multivariate samples. This version runs on Linux or UNIX platforms. This manual covers the use of the LHS code in a UNIX environment, run either as a standalone program or as a callable library. The underlying code in the UNIX Library/Standalone version of LHS is almost identical to the updated Windows version of LHS released in 1998 (SAND98-0210). However, some modifications were made to customize it for a UNIX environment and as a librarymore » that is called from the DAKOTA environment. This manual covers the use of the LHS code as a library and in the standalone mode under UNIX.« less

Weather integration in TMC operations : a self-evaluation and planning guide.

DOT National Transportation Integrated Search

2009-04-01

This flyer describes how Traffic Management Centers (TMC) can integrate weather information into their daily operations, and is based on the Road Weather Management Program publication, Self-Evaluation and Planning Guide (FHWA-JPO-08-057). The Guide ...

Conceptual Architecture for Obtaining Cyber Situational Awareness

DTIC Science & Technology

2014-06-01

1-893723-17-8. [10] SKYBOX SECURITY. Developer´s Guide. Skybox View. Manual.Version 11. 2010. [11] SCALABLE Network. EXata communications...E. Understanding command and control. Washington, D.C.: CCRP Publication Series, 2006. 255 p. ISBN 1-893723-17-8. • [10] SKYBOX SECURITY. Developer...s Guide. Skybox View. Manual.Version 11. 2010. • [11] SCALABLE Network. EXata communications simulation platform. Available: <http://www.scalable

CSMP Mathematics for the Upper Primary Grades Part II, Teacher's Guide [and] Worksheets. General Introduction. The World of Numbers. Final Experimental Version.

ERIC Educational Resources Information Center

Heidema, Clare; Schweitzer, Janis

This guide represents the final experimental version of a pilot project conducted in the United States between 1973 and 1976. The ideas and manner of presentation are based on the works of Georges and Frederique Papy. They are recognized as having introduced colored arrow drawings ("papygrams") and models of our numeration system (the…

CSMP Mathematics for the Intermediate Grades Part II, Teacher's Guide [and] Worksheets. The World of Numbers. Experimental Version.

ERIC Educational Resources Information Center

CEMREL, Inc., St. Ann, MO.

This guide represents the final experimental version of a pilot project which was conducted in the United States between 1973 and 1976. The ideas and the manner of presentation are based on the works of Georges and Frederique Papy. They are recognized for having introduced colored arrow drawings ("papygrams") and models of our numeration…

CSMP Mathematics for the Upper Primary Grades Part I, Teacher's Guide [and] Worksheets. General Introduction. The World of Numbers. Final Experimental Version.

ERIC Educational Resources Information Center

Heidema, Clare; Schweitzer, Janis

This guide represents the final experimental version of a pilot project conducted in the United States between 1973 and 1976. The ideas and manner of presentation are based on the works of Georges and Frederique Papy. They are recognized as having introduced colored arrow drawings ("papygrams") and models of our numeration system (the…

Summary: Update to ASTM Guide E 1523 to Charge Control and Charge Referencing Techniques in X-ray Photoelectron Spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baer, Donald R.

2005-04-22

An updated version of the ASTM guide E1523 to the methods to charge control and charge referencing techniques in x-ray photoelectron spectroscopy has been released by ASTM. The guide is meant to acquaint x-ray photoelectron spectroscopy (XPS) users with the various charge control and charge referencing techniques that are and have been used in the acquisition and interpretation of XPS data from surfaces of insulating specimens. The current guide has been expanded to include new references as well as recommendations for reporting information on charge control and charge referencing. The previous version of the document had been published in 1997.

Theory development in health care informatics: Information and communication technology acceptance model (ICTAM) improves the explanatory and predictive power of technology acceptance models.

PubMed

An, Ji-Young

2006-01-01

The purpose of this web-based study was to explain and predict consumers' acceptance and usage behavior of Internet health information and services. Toward this goal, the Information and Communication Technology Acceptance Model (ICTAM) was developed and tested. Individuals who received a flyer through the LISTSERV of HealthGuide were eligible to participate. The study population was eighteen years old and older who had used Internet health information and services for a minimum of 6 months. For the analyses, SPSS (version 13.0) and AMOS (version 5.0) were employed. More than half of the respondents were women (n = 110, 55%). The average age of the respondents was 35.16 years (S.D. = 10.07). A majority reported at least some college education (n = 126, 63%). All of the observed factors accounted for 75.53% of the total variance explained. The fit indices of the structural model were within an acceptable range: chi2/df = 2.38 (chi2 = 1786.31, df = 752); GFI = .71; RMSEA = .08; CFI = .86; NFI = .78. The results of this study provide empirical support for the continued development of ICTAM in the area of health consumers' information and communication technology acceptance.

Heliport noise model (HNM) version 1 user's guide

DOT National Transportation Integrated Search

1988-02-01

This document contains the instructions to execute the Heliport Noise Model (HNM), Version 1. HNM Version 1 is a computer tool for determining the total impact of helicopter noise at and around heliports. The model runs on IBM PC/XT/AT personal compu...

Molecular Testing Guideline for Selection of Lung Cancer Patients for EGFR and ALK Tyrosine Kinase Inhibitors

PubMed Central

Lindeman, Neal I.; Cagle, Philip T.; Beasley, Mary Beth; Chitale, Dhananjay Arun; Dacic, Sanja; Giaccone, Giuseppe; Jenkins, Robert Brian; Kwiatkowski, David J.; Saldivar, Juan-Sebastian; Squire, Jeremy; Thunnissen, Erik; Ladanyi, Marc

2014-01-01

Objective To establish evidence-based recommendations for the molecular analysis of lung cancers that are required to guide EGFR- and ALK-directed therapies, addressing which patients and samples should be tested, and when and how testing should be performed. Participants Three cochairs without conflicts of interest were selected, one from each of the 3 sponsoring professional societies: College of American Pathologists, International Association for the Study of Lung Cancer, and Association for Molecular Pathology. Writing and advisory panels were constituted from additional experts from these societies. Evidence Three unbiased literature searches of electronic databases were performed to capture articles published from January 2004 through February 2012, yielding 1533 articles whose abstracts were screened to identify 521 pertinent articles that were then reviewed in detail for their relevance to the recommendations. Evidence was formally graded for each recommendation. Consensus Process Initial recommendations were formulated by the cochairs and panel members at a public meeting. Each guideline section was assigned to at least 2 panelists. Drafts were circulated to the writing panel (version 1), advisory panel (version 2), and the public (version 3) before submission (version 4). Conclusions The 37 guideline items address 14 subjects, including 15 recommendations (evidence grade A/B). The major recommendations are to use testing for EGFR mutations and ALK fusions to guide patient selection for therapy with an epidermal growth factor receptor (EGFR) or anaplastic lymphoma kinase (ALK) inhibitor, respectively, in all patients with advanced-stage adenocarcinoma, regardless of sex, race, smoking history, or other clinical risk factors, and to prioritize EGFR and ALK testing over other molecular predictive tests. As scientific discoveries and clinical practice outpace the completion of randomized clinical trials, evidence-based guidelines developed by expert practitioners are vital for communicating emerging clinical standards. Already, new treatments targeting genetic alterations in other, less common driver oncogenes are being evaluated in lung cancer, and testing for these may be addressed in future versions of these guidelines. PMID:23551194

Molecular Testing Guideline for Selection of Lung Cancer Patients for EGFR and ALK Tyrosine Kinase Inhibitors

PubMed Central

Lindeman, Neal I.; Cagle, Philip T.; Beasley, Mary Beth; Chitale, Dhananjay Arun; Dacic, Sanja; Giaccone, Giuseppe; Jenkins, Robert Brian; Kwiatkowski, David J.; Saldivar, Juan-Sebastian; Squire, Jeremy; Thunnissen, Erik; Ladanyi, Marc

2014-01-01

Objective To establish evidence-based recommendations for the molecular analysis of lung cancers that are that are required to guide EGFR- and ALK-directed therapies, addressing which patients and samples should be tested, and when and how testing should be performed. Participants Three cochairs without conflicts of interest were selected, one from each of the 3 sponsoring professional societies: College of American Pathologists, International Association for the Study of Lung Cancer, and Association for Molecular Pathology. Writing and advisory panels were constituted from additional experts from these societies. Evidence Three unbiased literature searches of electronic databases were performed to capture articles published published from January 2004 through February 2012, yielding 1533 articles whose abstracts were screened to identify 521 pertinent articles that were then reviewed in detail for their relevance to the recommendations. Evidence was formally graded for each recommendation. Consensus Process Initial recommendations were formulated by the cochairs and panel members at a public meeting. Each guideline section was assigned to at least 2 panelists. Drafts were circulated to the writing panel (version 1), advisory panel (version 2), and the public (version 3) before submission (version 4). Conclusions The 37 guideline items address 14 subjects, including 15 recommendations (evidence grade A/B). The major recommendations are to use testing for EGFR mutations and ALK fusions to guide patient selection for therapy with an epidermal growth factor receptor (EGFR) or anaplastic lymphoma kinase (ALK) inhibitor, respectively, in all patients with advanced-stage adenocarcinoma, regardless of sex, race, smoking history, or other clinical risk factors, and to prioritize EGFR and ALK testing over other molecular predictive tests. As scientific discoveries and clinical practice outpace the completion of randomized clinical trials, evidence-based guidelines developed by expert practitioners are vital for communicating emerging clinical standards. Already, new treatments targeting genetic alterations in other, less common driver oncogenes are being evaluated in lung cancer, and testing for these may be addressed in future versions of these guidelines. PMID:23552377

CSMP Mathematics for the Upper Primary Grades Part I, Teacher's Guide. The Languages of Strings and Arrows. Geometry and Measurement. Workbooks. Final Experimental Version.

ERIC Educational Resources Information Center

CEMREL, Inc., St. Ann, MO.

This guide represents the final experimental version of a pilot project conducted in the Unites States between 1973 and 1976. The ideas and manner of presentation are based on the works of Georges and Frederique Papy. They are recognized as having introduced colored arrow drawings ("papygrams") and models of our numeration system (the…

CSMP Mathematics for the Upper Primary Grades Part II, Teacher's Guide. The Languages of Strings and Arrows. Geometry and Measurement. Workbooks. Final Experimental Version.

ERIC Educational Resources Information Center

CEMREL, Inc., St. Ann, MO.

This guide represents the final experimental version of an extended pilot project which was conducted in the United States between 1973 and 1976. The manner of presentation and the pedagogical ideas and tools are based on the works of Georges and Frederique Papy. They are recognized as having introduced colored arrow drawings…

CSMP Mathematics for the Intermediate Grades Part II, Teacher's Guide. The Languages of Strings and Arrows. Geometry and Measurement. Probability and Statistics. Experimental Version.

ERIC Educational Resources Information Center

CEMREL, Inc., St. Ann, MO.

This guide represents the final experimental version of a pilot project which was conducted in the United States between 1973 and 1976. The ideas and the manner of presentation are based on the works of Georges and Frederique Papy. They are recognized for having introduced colored arrow drawings ("papygrams") and models of our numeration…

CSMP Mathematics for the Intermediate Grades Part III, Teacher's Guide. The Languages of Strings and Arrows. Geometry and Measurement. Probability and Statistics. Experimental Version.

ERIC Educational Resources Information Center

CEMREL, Inc., St. Ann, MO.

This guide represents the final experimental version of a pilot project which was conducted in the United States between 1973 and 1976. The ideas and the manner of presentation are based on the works of Georges and Frederique Papy. They are recognized for having introduced colored arrow drawings ("papygrams") and models of our numeration…

Economic and Societal Factors Instructional Guide. Spanish Student Materials.

ERIC Educational Resources Information Center

Hendrix, Mary W.; And Others

This document is the Spanish language version of the student materials component designed to accompany the Economic and Societal Factors Instructional Guide. Page numbers are consistent with the numbering in that guide. The guide's nine units deal with the following topics: (1) job acquisition (sources of employment, job application, completing…

User's Guide for RESRAD-OFFSITE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gnanapragasam, E.; Yu, C.

2015-04-01

The RESRAD-OFFSITE code can be used to model the radiological dose or risk to an offsite receptor. This User’s Guide for RESRAD-OFFSITE Version 3.1 is an update of the User’s Guide for RESRAD-OFFSITE Version 2 contained in the Appendix A of the User’s Manual for RESRAD-OFFSITE Version 2 (ANL/EVS/TM/07-1, DOE/HS-0005, NUREG/CR-6937). This user’s guide presents the basic information necessary to use Version 3.1 of the code. It also points to the help file and other documents that provide more detailed information about the inputs, the input forms and features/tools in the code; two of the features (overriding the source termmore » and computing area factors) are discussed in the appendices to this guide. Section 2 describes how to download and install the code and then verify the installation of the code. Section 3 shows ways to navigate through the input screens to simulate various exposure scenarios and to view the results in graphics and text reports. Section 4 has screen shots of each input form in the code and provides basic information about each parameter to increase the user’s understanding of the code. Section 5 outlines the contents of all the text reports and the graphical output. It also describes the commands in the two output viewers. Section 6 deals with the probabilistic and sensitivity analysis tools available in the code. Section 7 details the various ways of obtaining help in the code.« less

Solid waste projection model: Model version 1. 0 technical reference manual

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilkins, M.L.; Crow, V.L.; Buska, D.E.

1990-11-01

The Solid Waste Projection Model (SWPM) system is an analytical tool developed by Pacific Northwest Laboratory (PNL) for Westinghouse Hanford Company (WHC). The SWPM system provides a modeling and analysis environment that supports decisions in the process of evaluating various solid waste management alternatives. This document, one of a series describing the SWPM system, contains detailed information regarding the software utilized in developing Version 1.0 of the modeling unit of SWPM. This document is intended for use by experienced software engineers and supports programming, code maintenance, and model enhancement. Those interested in using SWPM should refer to the SWPM Modelmore » User's Guide. This document is available from either the PNL project manager (D. L. Stiles, 509-376-4154) or the WHC program monitor (B. C. Anderson, 509-373-2796). 8 figs.« less

Diclofenac Suppository as a Preemptive Analgesia in Ultrasound-guided Biopsy of Prostate: Randomized Controlled Trial.

PubMed

Haroon, Naveed; Ather, M Hammad; Khan, Salma; Kumar, Pirkash; Salam, Basit

2015-10-01

To compare preprocedure Diclofenac suppository and Xylocaine gel with Xylocaine gel only in patients undergoing transrectal ultrasound (TRUS)-guided biopsy of prostate for pain. It is a randomized controlled trial conducted on patients undergoing TRUS-guided biopsy for clinical or biochemical suspicion of prostate cancer following a written informed consent and Ethics Review Committee approval. Patients were randomized into 2 groups. Group A included those patients who received Diclofenac suppository 2 hours before in combination with 10 mL of 2% Xylocaine gel 5 minutes before biopsy. Group B received Xylocaine gel only. A visual analog scale was used to measure the pain scores at the time of TRUS probe insertion, just after taking biopsy cores and 2 hours after biopsy. A total of 100 patients were recruited in the study with 50 patients each in group A and B. Mean age of group A was 69.1 ± 10 years and 67.3 ± 8.1 years for group B. The mean pain score for group A and B at the time of probe insertion was 0.08 ± 0.27 and 0.34 ± 0.63 (P = .032), immediately after taking biopsy cores was 1.46 ± 1.15 and 4.68 ± 0.77 (P = .000), and 2 hours after biopsy was 0.14 ± 0.45 vs 2.40 ± 0.81 (P = .000), respectively. The mean pain score at the time of TRUS probe insertion, immediately after taking biopsy cores, and 2 hours after biopsy is statistically significantly higher in group B. Copyright © 2015 Elsevier Inc. All rights reserved.

MueLu User's Guid for Trilinos Version 11.12.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Jonathan Joseph; Prokopenko, Andrey; Wiesner, Tobias A.

This is the official user guide for the M UE L U multigrid library in Trilinos version 11.12. This guide provides an overview of M UE L U , its capabilities, and instructions for new users who want to start using M UE L U with a minimum of effort. Detailed information is given on how to drive M UE L U through its XML interface. Links to more advanced use cases are given. This guide gives information on how to achieve good parallel performance, as well as how to introduce new algorithms. Finally, readers will find a comprehensive listingmore » of available M UE L U options. Any options not documented in this manual should be considered strictly experimental.« less

A User''s Guide to the Zwikker-Kosten Transmission Line Code (ZKTL)

NASA Technical Reports Server (NTRS)

Kelly, J. J.; Abu-Khajeel, H.

1997-01-01

This user's guide documents updates to the Zwikker-Kosten Transmission Line Code (ZKTL). This code was developed for analyzing new liner concepts developed to provide increased sound absorption. Contiguous arrays of multi-degree-of-freedom (MDOF) liner elements serve as the model for these liner configurations, and Zwikker and Kosten's theory of sound propagation in channels is used to predict the surface impedance. Transmission matrices for the various liner elements incorporate both analytical and semi-empirical methods. This allows standard matrix techniques to be employed in the code to systematically calculate the composite impedance due to the individual liner elements. The ZKTL code consists of four independent subroutines: 1. Single channel impedance calculation - linear version (SCIC) 2. Single channel impedance calculation - nonlinear version (SCICNL) 3. Multi-channel, multi-segment, multi-layer impedance calculation - linear version (MCMSML) 4. Multi-channel, multi-segment, multi-layer impedance calculation - nonlinear version (MCMSMLNL) Detailed examples, comments, and explanations for each liner impedance computation module are included. Also contained in the guide are depictions of the interactive execution, input files and output files.

User’s Guide for COMBIMAN Programs (COMputerized BIomechanical MAN-Model). Version 4.

DTIC Science & Technology

1981-01-01

103 2.2.23 STATE SWITCH Function (PFK29) 105 2.2.24 RESTART PROGRAM Function (PFK30) 110 2.2.25 END PROGRAM Function (PFK31) il 2.3 EXECUTING THE JOB...108 40 Transformation Equation Developed for Positioning Stomach Link (Set State Switch 72 ON) 109 41 JOB CONTROL CARDS to Execute CBM04. 114 42...154 50b Program CBMAM Survey Member Dimension Definition Cards. 154 51 Example of Survey, or Type 1, Member. 155 52 Job Control Cards to Execute CBMAM

NHTSA data reference guide version 4. Volume 1, vehicle tests

DOT National Transportation Integrated Search

1997-04-01

This guide documents the format of magnetic media (3.5 inch high density diskettes) to be submitted : to the National Highway Traffic Safety Administration (NHTSA) for vehicle crash tests. This guide is : designated Volume I. NHTSA Data Reference Gui...

Ultrasound-guided fine needle aspiration versus core needle biopsy: comparison of post-biopsy hematoma rates and risk factors.

PubMed

Chae, In Hye; Kim, Eun-Kyung; Moon, Hee Jung; Yoon, Jung Hyun; Park, Vivian Y; Kwak, Jin Young

2017-07-01

To compare post-biopsy hematoma rates between ultrasound guided-fine needle aspiration and ultrasound guided-core needle biopsy, and to investigate risk factors for post-biopsy hematoma. A total of 5304 thyroid nodules which underwent ultrasound guided biopsy were included in this retrospective study. We compared clinical and US features between patients with and without post-biopsy hematoma. Associations between these features and post-biopsy hematoma were analyzed. Post-biopsy hematoma rate was 0.8% (43/5121) for ultrasound guided-fine needle aspiration and 4.9% (9/183) for ultrasound guided-core needle biopsy (P < 0.001). For ultrasound guided-fine needle aspiration, gender, age, size, presence of vascularity, and suspicious US features were not associated with post-biopsy hematoma according to experience level. Post-biopsy hematoma occurred significantly more with ultrasound guided-core needle biopsy (9/179, 5.0%) than with ultrasound guided-fine needle aspiration (9/1138, 0.8%) (P < 0.001) in experienced performers and ultrasound guided-core needle biopsy was the only significant risk factor for post-biopsy hematoma (adjusted Odds Ratio, 6.458, P < 0.001). Post-biopsy hematoma occurred significantly more in ultrasound guided-core needle biopsy than in ultrasound guided-fine needle aspiration and ultrasound guided-core needle biopsy was the only independent factor of post-biopsy hematoma in thyroid nodules.

Method of Characteristic (MOC) Nozzle Flowfield Solver - User’s Guide and Input Manual Version 2.0

DTIC Science & Technology

2018-01-01

TECHNICAL REPORT RDMR-SS-17-13 METHOD OF CHARACTERISTIC (MOC) NOZZLE FLOWFIELD SOLVER—USER’S GUIDE AND INPUT MANUAL VERSION 2.0 Kevin D. Kennedy...System Simulation and Development Directorate Aviation and Missile Research , Development, and Engineering Center January 2018 Distribution Statement...DOCUMENTS, DESTROY BY ANY METHOD THAT WILL PREVENT DISCLOSURE OF CONTENTS OR RECONSTRUCTION OF THE DOCUMENT. DISCLAIMER THE FINDINGS IN THIS REPORT

[External cephalic version of breech fetus after 36 weeks of gestation - evaluation of efectiveness and complications].

PubMed

Hruban, L; Janků, P; Jordánová, K; Gerychová, R; Huser, M; Ventruba, P; Roztočil, A

2017-01-01

Evaluation of success rate and the safety of external cephalic version after 36 weeks of gestation. Retrospective analysis. Department of Obstetrics and Gynecology, Masaryk University, University Hospital Brno. A retrospective analysis of external cephalic version attempts performed on a group of 638 singleton breech pregnancies after 36 weeks gestation in the years 2003-2016 at the Department of Gynecology and Obstetrics, Masaryk University, Brno. The effectiveness, number and type of complications, mode of delivery and perinatal result were observed. The effectiveness of external cephalic version from breech to head presentation was 47.8% (305 cases). After a successful external cephalic version 238 patients (78.0%) gave birth vaginally. After unsuccessful cephalic version 130 patients (39.0%) gave birth vaginally. The number of serious complications did not exceed 0,9% and did not affect perinatal outcomes. External cephalic version-related emergency cesarean deliveries occurred in 6 cases (2 placental abruption, 4 abnormal cardiotocography). The fetal outcome was good in all these cases. The death of the fetus in connection with the external version has not occurred in our file. Spontaneous discharge of amniotic fluid within 24 hours after procedure occurred in 5 cases (0.8%). The spontaneous onset of labor within 24 hours of procedure occurred in 5 cases (0.8%). The pH value of a. umbilicalis < 7.00 occurred in 2 cases in the group with a successful external version and in the group with unsuccessful external version in 9 cases. The Apgar score in the 5th minute < 5 was both in the successful and unsuccessful group in 1 case. The external cephalic version of the fetus in the case of breech presentation after the 36th week of pregnancy is an effective and safe alternative for women who have a fear of the vaginal breech delivery. Performing the external cephalic version can reduce the rate of elective caesarean sections due to breech presentation at term.

Fetomaternal hemorrhage during external cephalic version.

PubMed

Boucher, Marc; Marquette, Gerald P; Varin, Jocelyne; Champagne, Josette; Bujold, Emmanuel

2008-07-01

To estimate the frequency and volume of fetomaternal hemorrhage during external cephalic version for term breech singleton fetuses and to identify risk factors involved with this complication. A prospective observational study was performed including all patients undergoing a trial of external cephalic version for a breech presentation of at least 36 weeks of gestation between 1987 and 2001 in our center. A search for fetal erythrocytes using the standard Kleihauer-Betke test was obtained before and after each external cephalic version. The frequency and volume of fetomaternal hemorrhage were calculated. Putative risk factors for fetomaternal hemorrhage were evaluated by chi(2) test and Mann-Whitney U test. A Kleihauer-Betke test result was available before and after 1,311 trials of external cephalic version. The Kleihauer-Betke test was positive in 67 (5.1%) before the procedure. Of the 1,244 women with a negative Kleihauer-Betke test before external cephalic version, 30 (2.4%) had a positive Kleihauer-Betke test after the procedure. Ten (0.8%) had an estimated fetomaternal hemorrhage greater than 1 mL, and one (0.08%) had an estimated fetomaternal hemorrhage greater than 30 mL. The risk of fetomaternal hemorrhage was not influenced by parity, gestational age, body mass index, number of attempts at version, placental location, or amniotic fluid index. The risk of detectable fetomaternal hemorrhage during external cephalic version was 2.4%, with fetomaternal hemorrhage more than 30 mL in less than 0.1% of cases. These data suggest that the performance of a Kleihauer-Betke test is unwarranted in uneventful external cephalic version and that in Rh-negative women, no further Rh immune globulin is necessary other than the routine 300-microgram dose at 28 weeks of gestation and postpartum. II.

Efficacy of Adjunctive Sleep Interventions for PTSD

DTIC Science & Technology

2009-03-01

MURI; BAA 08-019: Topic #1; PI: M. Hall, University of Pittsburgh). This multidisciplinary translational project focuses on investigating sleep...rate variability (high & low frequency) CAPS Part 2 PTSD symptom checklist (civilian version) Beck Depression Inventory Beck Anxiety...be completed by a CNRC RN) PTSD symptom checklist (civilian version) Beck Depression Inventory Beck Anxiety Inventory Inventory of

40 CFR 52.1470 - Identification of plan.

Code of Federal Regulations, 2014 CFR

2014-07-01

...). 445.513 “Fossil fuel” defined 12/4/76 49 FR 11626 (3/27/84) Most recently approved version was... produced by burning of fossil fuels 10/31/05 73 FR 20536 (4/16/08) Most recently approved version was... for each source; form of application; issuance or denial; posting 5/4/06 77 FR 59321 (9/27/12...

CVISN guide to top-level design : preliminary version P1.1

DOT National Transportation Integrated Search

1999-06-25

The CVISN (Commercial Vehicle Information Systems and Networks) guide to top-level design shows the initial steps in the process of deploying CVISN in a state. For purposes of these guides, top-level design encompasses setting the scope of the projec...

VizieR Online Data Catalog: GJ 1214b optical and near-IR transit phot. (Angerhausen+, 2017)

NASA Astrophysics Data System (ADS)

Angerhausen, D.; Dreyer, C.; Placek, B.; Csizmadia, Sz.; Eigmueller, P.; Godolt, M.; Kitzmann, D.; Mallonn, M.; Becklin, E.; Collins, P.; Dunham, E. W.; Grenfell, J. L.; Hamilton, R. T.; Kabath, P.; Logsdon, S. E.; Mandell, A.; Mandushev, G.; McElwain, M.; McLean, I. S.; Pfueller, E.; Rauer, H.; Savage, M.; Shenoy, S.; Vacca, W. D.; van Cleve, J. E.; Wiedemann, M.; Wolf, J.

2017-11-01

The joint US-German Cycle 2 Guest Investigator (GI) programme - US-proposal: Angerhausen (2013); Germanproposal: Dreyer (2013) - was performed on SOFIAs flight number 149 on UT February 27, 2014. Observations were simultaneously conducted in two optical HIPO channels: open blue at 0.3-0.6um and Sloan z' at 0.9-m; and one infrared FLITECAM fiter: Paschen-α cont. at 1.9um. Complementary data were also obtained with the optical focal plane guiding camera FPI+ in the Sloan i' band (0.8um). (5 data files).

KSC-08pd0764

NASA Image and Video Library

2008-03-20

KENNEDY SPACE CENTER, FLA. - In the Astrotech payload processing facility, General Dynamics technicians guide one of twin solar arrays toward NASA's Gamma-Ray Large Area Space Telescope, or GLAST. The telescope will launch aboard a Delta II rocket May 16 from Launch Pad 17-B on Cape Canaveral Air Force Station. A powerful space observatory, the GLAST will explore the most extreme environments in the universe, and answer questions about supermassive black hole systems, pulsars and the origin of cosmic rays. It also will study the mystery of powerful explosions known as gamma-ray bursts. Photo credit: NASA/Chris Rhodes

Rotary engine performance computer program (RCEMAP and RCEMAPPC): User's guide

NASA Technical Reports Server (NTRS)

Bartrand, Timothy A.; Willis, Edward A.

1993-01-01

This report is a user's guide for a computer code that simulates the performance of several rotary combustion engine configurations. It is intended to assist prospective users in getting started with RCEMAP and/or RCEMAPPC. RCEMAP (Rotary Combustion Engine performance MAP generating code) is the mainframe version, while RCEMAPPC is a simplified subset designed for the personal computer, or PC, environment. Both versions are based on an open, zero-dimensional combustion system model for the prediction of instantaneous pressures, temperature, chemical composition and other in-chamber thermodynamic properties. Both versions predict overall engine performance and thermal characteristics, including bmep, bsfc, exhaust gas temperature, average material temperatures, and turbocharger operating conditions. Required inputs include engine geometry, materials, constants for use in the combustion heat release model, and turbomachinery maps. Illustrative examples and sample input files for both versions are included.

Quantifying Heuristic Bias: Anchoring, Availability, and Representativeness.

PubMed

Richie, Megan; Josephson, S Andrew

2018-01-01

Construct: Authors examined whether a new vignette-based instrument could isolate and quantify heuristic bias. Heuristics are cognitive shortcuts that may introduce bias and contribute to error. There is no standardized instrument available to quantify heuristic bias in clinical decision making, limiting future study of educational interventions designed to improve calibration of medical decisions. This study presents validity data to support a vignette-based instrument quantifying bias due to the anchoring, availability, and representativeness heuristics. Participants completed questionnaires requiring assignment of probabilities to potential outcomes of medical and nonmedical scenarios. The instrument randomly presented scenarios in one of two versions: Version A, encouraging heuristic bias, and Version B, worded neutrally. The primary outcome was the difference in probability judgments for Version A versus Version B scenario options. Of 167 participants recruited, 139 enrolled. Participants assigned significantly higher mean probability values to Version A scenario options (M = 9.56, SD = 3.75) than Version B (M = 8.98, SD = 3.76), t(1801) = 3.27, p = .001. This result remained significant analyzing medical scenarios alone (Version A, M = 9.41, SD = 3.92; Version B, M = 8.86, SD = 4.09), t(1204) = 2.36, p = .02. Analyzing medical scenarios by heuristic revealed a significant difference between Version A and B for availability (Version A, M = 6.52, SD = 3.32; Version B, M = 5.52, SD = 3.05), t(404) = 3.04, p = .003, and representativeness (Version A, M = 11.45, SD = 3.12; Version B, M = 10.67, SD = 3.71), t(396) = 2.28, p = .02, but not anchoring. Stratifying by training level, students maintained a significant difference between Version A and B medical scenarios (Version A, M = 9.83, SD = 3.75; Version B, M = 9.00, SD = 3.98), t(465) = 2.29, p = .02, but not residents or attendings. Stratifying by heuristic and training level, availability maintained significance for students (Version A, M = 7.28, SD = 3.46; Version B, M = 5.82, SD = 3.22), t(153) = 2.67, p = .008, and residents (Version A, M = 7.19, SD = 3.24; Version B, M = 5.56, SD = 2.72), t(77) = 2.32, p = .02, but not attendings. Authors developed an instrument to isolate and quantify bias produced by the availability and representativeness heuristics, and illustrated the utility of their instrument by demonstrating decreased heuristic bias within medical contexts at higher training levels.

Treatment of child anxiety disorders via guided parent-delivered cognitive-behavioural therapy: randomised controlled trial.

PubMed

Thirlwall, Kerstin; Cooper, Peter J; Karalus, Jessica; Voysey, Merryn; Willetts, Lucy; Creswell, Cathy

2013-12-01

Promising evidence has emerged of clinical gains using guided self-help cognitive-behavioural therapy (CBT) for child anxiety and by involving parents in treatment; however, the efficacy of guided parent-delivered CBT has not been systematically evaluated in UK primary and secondary settings. To evaluate the efficacy of low-intensity guided parent-delivered CBT treatments for children with anxiety disorders. A total of 194 children presenting with a current anxiety disorder, whose primary carer did not meet criteria for a current anxiety disorder, were randomly allocated to full guided parent-delivered CBT (four face-to-face and four telephone sessions) or brief guided parent-delivered CBT (two face-to-face and two telephone sessions), or a wait-list control group (trial registration: ISRCTN92977593). Presence and severity of child primary anxiety disorder (Anxiety Disorders Interview Schedule for DSM-IV, child/parent versions), improvement in child presentation of anxiety (Clinical Global Impression - Improvement scale), and change in child anxiety symptoms (Spence Children's Anxiety Scale, child/parent version and Child Anxiety Impact scale, parent version) were assessed at post-treatment and for those in the two active treatment groups, 6 months post-treatment. Full guided parent-delivered CBT produced superior diagnostic outcomes compared with wait-list at post-treatment, whereas brief guided parent-delivered CBT did not: at post-treatment, 25 (50%) of those in the full guided CBT group had recovered from their primary diagnosis, compared with 16 (25%) of those on the wait-list (relative risk (RR) 1.85, 95% CI 1.14-2.99); and in the brief guided CBT group, 18 participants (39%) had recovered from their primary diagnosis post-treatment (RR = 1.56, 95% CI 0.89-2.74). Level of therapist training and experience was unrelated to child outcome. Full guided parent-delivered CBT is an effective and inexpensive first-line treatment for child anxiety.

2008/12 Baccalaureate and Beyond Longitudinal Study (B&B:08/12). Data File Documentation. NCES 2015-141

ERIC Educational Resources Information Center

Cominole, Melissa; Shepherd, Bryan; Siegel, Peter

2015-01-01

This publication describes the methods and procedures used in the 2008/12 Baccalaureate and Beyond Longitudinal Study (B&B:08/12). These graduates, who completed the requirements for a bachelor's degree during the 2007-08 academic year, were first interviewed as part of the 2008 National Postsecondary Student Aid Study (NPSAS:08), and then…

System administrator`s guide to CDPS. Version 1.0

DOE Office of Scientific and Technical Information (OSTI.GOV)

Didier, B.T.; Portwood, M.H.

The System Administrator`s Guide to CDPS is intended for those responsible for setting up and maintaining the hardware and software of a Common Mapping Standard (CMS) Date Production System (CDPS) installation. This guide assists the system administrator in performing typical administrative functions. It is not intended to replace the Ultrix Documentation Set that should be available for a DCPS installation. The Ultrix Documentation Set will be required to provide details on referenced Ultrix commands as well as procedures for performing Ultrix maintenance functions. There are six major sections in this guide. Section 1 introduces the system administrator to CDPS andmore » describes the assumptions that are made by this guide. Section 2 describes the CDPS platform configuration. Section 3 describes the platform preparation that is required to install the CDPS software. Section 4 describes the CPS software and its installation procedures. Section 5 describes the CDS software and its installation procedures. Section 6 describes various operation and maintenance procedures. Four appendices are also provided. Appendix A contains a list of used acronyms. Appendix B provides a terse description of common Ultrix commands that are used in administrative functions. Appendix C provides sample CPS and CDS configuration files. Appendix D provides a required list and a recommended list of Ultrix software subsets for installation on a CDPS platform.« less

Ethnoveterinary application of Morinda citrifolia fruit puree on a commercial heifer rearing facility with endemic salmonellosis.

PubMed

Brooks, V J; De Wolfe, T J; Paulus, T J; Xu, J; Cai, J; Keuler, N S; Godbee, R G; Peek, S F; McGuirk, S M; Darien, B J

2012-01-01

We have previously reported that Morinda citrifolia (noni) puree modulates neonatal calves developmental maturation of the innate and adaptive immune system. In this study, the effect of noni puree on respiratory and gastrointestinal (GI), health in preweaned dairy calves on a farm with endemic salmonellosis was examined. Two clinical trials were conducted whereby each trial evaluated one processing technique of noni puree. Trials 1 and 2 tested noni versions A and B, respectively. Puree analysis and trial methods were identical to each other, with the calf as the experimental unit. Calves were designated to 1 of 3 treatment groups in each trial and received either: 0, 15 or 30 mL every 12 hr of noni supplement for the first 3 weeks of life. Health scores, weaning age, weight gain from admission to weaning, and weaned by 6 weeks, were used as clinical endpoints for statistical analysis. In trial 1, calves supplemented with 15 mL noni puree of version A every 12 hr had a higher probability of being weaned by 6 weeks of age than control calves (P = 0.04). In trial 2, calves receiving 30 mL of version B every 12 hr had a 54.5% reduction in total medical treatments by 42 days of age when compared to controls (P = 0.02). There was a trend in reduced respiratory (61%), and GI (52%) medical treatments per calf when compared to controls (P = 0.06 and 0.08, respectively). There were no differences in weight gain or mortality for any treatment group in either trial.

Colorado Fathers' Resource Guide = Guia de Recursos para los Padres en Colorado.

ERIC Educational Resources Information Center

Colorado Foundation for Families and Children, Denver.

Developed through the Colorado Fatherhood Connection, this guide, in English- and Spanish-language versions, provides suggestions and resources for fathers as well as tips on discipline, communication, and activities fathers can do with their children. Topics addressed in the guide include characteristics of responsible fatherhood, characteristics…

Career Opportunities Instructional Guide. Spanish Student Materials.

ERIC Educational Resources Information Center

Hendrix, Mary W.; And Others

This document is the Spanish language version of the student materials component designed to accompany the Career Opportunities Instructional Guide. Page numbers are consistent with numbering in that guide. Seventeen units are provided. The materials in Unit 1 concern various aspects of locating information about occupations; Unit 2 provides an…

Nuclear Computerized Library for Assessing Reactor Reliability (NUCLARR). Version 3.5, Quick Reference Guide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilbert, B.G.; Richards, R.E.; Reece, W.J.

1992-10-01

This Reference Guide contains instructions on how to install and use Version 3.5 of the NRC-sponsored Nuclear Computerized Library for Assessing Reactor Reliability (NUCLARR). The NUCLARR data management system is contained in compressed files on the floppy diskettes that accompany this Reference Guide. NUCLARR is comprised of hardware component failure data (HCFD) and human error probability (HEP) data, both of which are available via a user-friendly, menu driven retrieval system. The data may be saved to a file in a format compatible with IRRAS 3.0 and commercially available statistical packages, or used to formulate log-plots and reports of data retrievalmore » and aggregation findings.« less

A Guide to Two Cultures: American. A Guide to Two Cultures: Indochinese. Publication 8.

ERIC Educational Resources Information Center

Interagency Task Force for Indochina Refugees, Washington, DC.

This guide was adapted from an article by Arthur Gordon originally titled "How to Understand Those Mystifying Americans." Each page of the text is divided into two parts, with the English version given on one side and the Vietnamese on the other. The guide is composed of two main sections. The first is addressed to Indochinese refugees…

MERCHANT OF VENICE. LITERATURE CURRICULUM III, TEACHER VERSION.

ERIC Educational Resources Information Center

KITZHABER, ALBERT R.

THIS TEACHING GUIDE ON "THE MERCHANT OF VENICE" WAS PREPARED FOR USE IN A NINTH-GRADE LITERATURE CURRICULUM. THE PURPOSE OF THE GUIDE WAS TO ILLUMINATE THE PLAY AS A WHOLE, AND TO SUGGEST TO THE TEACHER SOME USEFUL PRINCIPLES FOR FRAMING QUESTIONS AND GUIDING DISCUSSIONS IN THE CLASSROOM. THE GUIDE WAS NOT TO BE USED, HOWEVER, AS A BASE…

A new look at the WHOQOL as health-related quality of life instrument among visually impaired people using Rasch analysis.

PubMed

Gothwal, Vijaya K; Srinivas, Marmamula; Rao, Gullapalli N

2013-05-01

To examine the psychometric characteristics of the World Health Organization quality of life instrument-modified Indian version (modified WHOQOL) and its subscales in adults with visual impairment (VI) using Rasch analysis. Cross-sectional data were of people aged ≥40 years with VI (n = 1,333) who responded to the modified WHOQOL in the Andhra Pradesh Eye Disease Study, India. Rasch analysis was used to explore the instrument and its subscales for key indices such as measurement precision by person separation reliability, PSR (i.e., discrimination between strata of participants' health-related QOL [HRQOL], recommended minimum value 0.8), unidimensionality (i.e., measurement of a single construct), and targeting (i.e., matching of item difficulty to participants' HRQOL). Rasch-guided iterative approach including category re-organization to enable threshold ordering and item deletion to overcome multidimensionality resulted in a unidimensional 9-item WHOQOL and a 6-item level of independence (LOI) subscale with adequate PSR (0.81 and 0.82, respectively). Targeting was sub-optimal for both (-1.58 logits for WHOQOL and -2.55 logits for the subscale). Remaining subscales were dysfunctional. The WHOQOL and LOI subscale can be improved and shortened, and the Rasch-revised versions are likely to assess the HROQL of VI patients best because of their brevity, reliability, and unidimensionality.

Supplement to The User's Guide for The Stand Prognosis Model-version 5.0

Treesearch

William R. Wykoff

1986-01-01

Differences between Prognosis Model versions 4.0 and 5.0 are described. Additions to version 5.0 include an event monitor that schedules activities contingent on stand characteristics, a regeneration establishment model that predicts the structure of the regeneration stand following treatment, and a COVER model that predicts shrub development and total canopy cover....

42 CFR 423.160 - Standards for electronic prescribing.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Council for Prescription Drug Programs Prescriber/Pharmacist Interface SCRIPT Standard, Implementation... National Council for Prescription Drug Programs Prescriber/Pharmacist Interface SCRIPT Standard... Prescriber/Pharmacist Interface SCRIPT Standard, Implementation Guide Version 8, Release 1 (Version 8.1...

42 CFR 423.160 - Standards for electronic prescribing.

Code of Federal Regulations, 2013 CFR

2013-10-01

... National Council for Prescription Drug Programs Prescriber/Pharmacist Interface SCRIPT Standard... National Council for Prescription Drug Programs Prescriber/Pharmacist Interface SCRIPT Standard... Prescriber/Pharmacist Interface SCRIPT Standard, Implementation Guide Version 8, Release 1 (Version 8.1...

42 CFR 423.160 - Standards for electronic prescribing.

Code of Federal Regulations, 2014 CFR

2014-10-01

... National Council for Prescription Drug Programs Prescriber/Pharmacist Interface SCRIPT Standard... National Council for Prescription Drug Programs Prescriber/Pharmacist Interface SCRIPT Standard... Prescriber/Pharmacist Interface SCRIPT Standard, Implementation Guide Version 8, Release 1 (Version 8.1...

Watershed Health Assessment Tools Investigating Fisheries WHAT IF Version 2: A Manager’s Guide to New Features

EPA Pesticide Factsheets

The CVI Watershed Health Assessment Tool Investigating Fisheries, WHAT IF version 2, currently contains five components: Regional Prioritization Tool, Hydrologic Tool, Clustering Tool, Habitat Suitability Tool, BASS model

The 1991 version of the plume impingement computer program. Volume 2: User's input guide

NASA Technical Reports Server (NTRS)

Bender, Robert L.; Somers, Richard E.; Prendergast, Maurice J.; Clayton, Joseph P.; Smith, Sheldon D.

1991-01-01

The Plume Impingement Program (PLIMP) is a computer code used to predict impact pressures, forces, moments, heating rates, and contamination on surfaces due to direct impingement flowfields. Typically, it has been used to analyze the effects of rocket exhaust plumes on nearby structures from ground level to the vacuum of space. The program normally uses flowfields generated by the MOC, RAMP2, SPF/2, or SFPGEN computer programs. It is capable of analyzing gaseous and gas/particle flows. A number of simple subshapes are available to model the surfaces of any structure. The original PLIMP program has been modified many times of the last 20 years. The theoretical bases for the referenced major changes, and additional undocumented changes and enhancements since 1988 are summarized in volume 1 of this report. This volume is the User's Input Guide and should be substituted for all previous guides when running the latest version of the program. This version can operate on VAX and UNIX machines with NCAR graphics ability.

Production version of the extended NASA-Langley Vortex Lattice FORTRAN computer program. Volume 1: User's guide

NASA Technical Reports Server (NTRS)

Lamar, J. E.; Herbert, H. E.

1982-01-01

The latest production version, MARK IV, of the NASA-Langley vortex lattice computer program is summarized. All viable subcritical aerodynamic features of previous versions were retained. This version extends the previously documented program capabilities to four planforms, 400 panels, and enables the user to obtain vortex-flow aerodynamics on cambered planforms, flowfield properties off the configuration in attached flow, and planform longitudinal load distributions.

PESTAN: Pesticide Analytical Model Version 4.0 User's Guide

EPA Pesticide Factsheets

The principal objective of this User's Guide to provide essential information on the aspects such as model conceptualization, model theory, assumptions and limitations, determination of input parameters, analysis of results and sensitivity analysis.

EPA Homeowner's Guide to Septic Systems for Tribal Communities

EPA Pesticide Factsheets

In cooperation with the Indian Health Service (IHS), EPA has developed a tailored version of the original SepticSmart Homeowner's Guide to reflect the unique factors of Tribal communities and homeowners on Tribal lands.

Aviation Environmental Design Tool (AEDT): Version 2c: User Guide

DOT National Transportation Integrated Search

2016-09-12

The Federal Aviation Administration, Office of Environment and Energy (FAA-AEE) has developed the Aviation Environmental Design Tool (AEDT) version 2c software system with the support of the following development team: FAA, National Aeronautics and S...

Aviation Environmental Design Tool (AEDT) user guide version 2a

DOT National Transportation Integrated Search

2014-01-23

The Federal Aviation Administration, Office of Environment and Energy (FAA-AEE) has developed the Aviation : Environmental Design Tool (AEDT) version 2a software system with the support of the following development team: : FAA, National Aeronautics a...

FHWA Traffic Noise Model, version 1.0 technical manual

DOT National Transportation Integrated Search

1998-02-01

This Technical Manual is for the Federal Highway Administrations Traffic Noise Model (FHWA TNM), Version 1.0 -- the FHWAs computer program for highway traffic noise prediction and analysis. Two companion reports, a Users Guide and a data r...

Integrated noise model (INM) version 7.0 user's guide

DOT National Transportation Integrated Search

2007-04-01

The Federal Aviation Administration, Office of Environment and Energy, Noise Division (AEE-100) has developed Version 7.0 of the Integrated Noise Model (INM) with support from the ATAC Corporation and the Department of Transportation Volpe National T...

2008/09 Baccalaureate and Beyond Longitudinal Study (B&B:08/09). Full-Scale Methodology Report. NCES 2014-041

ERIC Educational Resources Information Center

Wine, Jennifer; Janson, Natasha; Siegel, Peter; Bennett, Christopher

2013-01-01

This report documents the methodological procedures and evaluations of the 2008/09 Baccalaureate and Beyond Longitudinal Study (B&B:08/09). RTI, with the assistance of MPR, conducted B&B:08/09 for the National Center for Education Statistics (NCES) of the U.S. Department of Education. Chapter 1 describes the background, legislative…

The Case for Representative Democracy: What Americans Should Know about Their Legislatures.

ERIC Educational Resources Information Center

Rosenthal, Alan; Kurtz, Karl T.; Hibbing, John; Loomis, Burdett

This guide is a revised and adapted version of a previous monograph, "A New Public Perspective on Representative Democracy: A Guide for Legislative Interns." The guide focuses on civic perspective: how citizens view the political institutions, processes, and people that are fundamental to representative democracy in the United States. It…

User's guide to SILVAH

Treesearch

Peter D. Knopp; Susan L. Stout

2014-01-01

This user's guide for the SILVAH computer program, version 6.2, supersedes the 1992 user's guide (Gen. Tech. Rep. NE-162). Designed for stand-alone Windows-based personal computers, SILVAH recommends a silvicultural prescription for a forest stand based on a summary and analysis of field inventory data. The program also includes a simulator that can be used...

FHWA Traffic Noise Model user's guide (version 2.0 addendum).

DOT National Transportation Integrated Search

2002-03-01

In March 1998, the Federal Highway Administration (FHWA) Office of Natural : Environment, released the FHWA Traffic Noise Model (FHWA TNM) Version 1.0, a : state-of-the-art computer program for highway traffic noise prediction and : analysis. Since t...

Integrated Noise Model (INM) version 5.0 user's guide

DOT National Transportation Integrated Search

1995-08-01

The Federal Aviation Administration, Office of Environment and Energy (AEE-120) has : developed Version 5.0 of the Integrated Noise Model (INM) with support from the ATAC : Corporation, the U.S. Department of Transportation John A. Volpe National : T...

HNM, heliport noise model : version 2.2 user's guide

DOT National Transportation Integrated Search

1994-02-01

The John A. Volpe National Transportation Systems Center (Volpe Center), in support of : the Federal Aviation Administration, Office of Environment and Energy, has developed : Version 2.2 of the Heliport Noise Model (HNM). The HNM is a computer progr...

Generically Used Expert Scheduling System (GUESS): User's Guide Version 1.0

NASA Technical Reports Server (NTRS)

Liebowitz, Jay; Krishnamurthy, Vijaya; Rodens, Ira

1996-01-01

This user's guide contains instructions explaining how to best operate the program GUESS, a generic expert scheduling system. GUESS incorporates several important features for a generic scheduler, including automatic scheduling routines to generate a 'first' schedule for the user, a user interface that includes Gantt charts and enables the human scheduler to manipulate schedules manually, diagnostic report generators, and a variety of scheduling techniques. The current version of GUESS runs on an IBM PC or compatible in the Windows 3.1 or Windows '95 environment.

40 CFR 600.405-08 - Dealer requirements.

Code of Federal Regulations, 2010 CFR

2010-07-01

... FUEL ECONOMY AND CARBON-RELATED EXHAUST EMISSIONS OF MOTOR VEHICLES Fuel Economy Regulations for 1977 and Later Model Year Automobiles-Dealer Availability of Fuel Economy Information § 600.405-08 Dealer... sale a copy of the annual Fuel Economy Guide containing the information specified in § 600.407. The...

40 CFR 600.405-08 - Dealer requirements.

Code of Federal Regulations, 2011 CFR

2011-07-01

... FUEL ECONOMY AND CARBON-RELATED EXHAUST EMISSIONS OF MOTOR VEHICLES Fuel Economy Regulations for 1977 and Later Model Year Automobiles-Dealer Availability of Fuel Economy Information § 600.405-08 Dealer... sale a copy of the annual Fuel Economy Guide containing the information specified in § 600.407. The...

40 CFR 600.407-08 - Booklets displayed by dealers.

Code of Federal Regulations, 2011 CFR

2011-07-01

... POLICY FUEL ECONOMY AND CARBON-RELATED EXHAUST EMISSIONS OF MOTOR VEHICLES Fuel Economy Regulations for 1977 and Later Model Year Automobiles-Dealer Availability of Fuel Economy Information § 600.407-08... § 600.405 may be either (1) The printed copy of the annual Fuel Economy Guide published by the...

Xyce Parallel Electronic Simulator : reference guide, version 2.0.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoekstra, Robert John; Waters, Lon J.; Rankin, Eric Lamont

This document is a reference guide to the Xyce Parallel Electronic Simulator, and is a companion document to the Xyce Users' Guide. The focus of this document is (to the extent possible) exhaustively list device parameters, solver options, parser options, and other usage details of Xyce. This document is not intended to be a tutorial. Users who are new to circuit simulation are better served by the Xyce Users' Guide.

Xyce™ Parallel Electronic Simulator Reference Guide Version 6.8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keiter, Eric R.; Aadithya, Karthik Venkatraman; Mei, Ting

This document is a reference guide to the Xyce Parallel Electronic Simulator, and is a companion document to the Xyce Users' Guide. The focus of this document is (to the extent possible) exhaustively list device parameters, solver options, parser options, and other usage details of Xyce . This document is not intended to be a tutorial. Users who are new to circuit simulation are better served by the Xyce Users' Guide.

Water Remedial Investigation Report, Version 3.3. Volume 2

DTIC Science & Technology

1989-07-01

the Third Quarter FY 1987 water table contour map, S(Page 9 of 13) Water Level "KaU._ID LiaMAUan 26143 5175.9 26145 -999,9 27002 5095.3 27003 5098.0...26125 5146.9 26127 5164.6 26133 5147.0 26143 5175.9 4 26145 5140.9 ID 27001 5093.2 27002 5094.8 27003 51.08 -1 27004 B-105 20,43.7 27005 5094.2 27006...ML Po 1IM A- T .0 cO16 Folcm Iscale ’ 𔃾 IV*- C. [LA \\S Y4 6 It. ISO . 4:- 4~ 1A . 6 IAT sti ~~~~~ If*1 l H 44 - . C-99 0 S S 0 040 0 s HtHLm.01 0O

FHWA Traffic Noise Model version 1.1 user's guide (Addendum)

DOT National Transportation Integrated Search

2000-09-30

In March 1998, the Federal Highway Administration (FHWA) Office of Natural Environment, released the FHWA Traffic Noise Model (FHWA TNM) Version 1.0, a state-of-the-art computer program for highway traffic noise prediction and analysis. Since then, t...

Dynamically Allocated Virtual Clustering Management System Users Guide

DTIC Science & Technology

2016-11-01

provides usage instructions for the DAVC version 2.0 web application. 15. SUBJECT TERMS DAVC, Dynamically Allocated Virtual Clustering...This report provides usage instructions for the DAVC version 2.0 web application. This report is separated into the following sections, which detail

HYDROLOGIC EVALUATION OF LANDFILL PERFORMANCE (HELP) MODEL - USER'S GUIDE FOR VERSION 3

EPA Science Inventory

This report documents the solution methods and process descriptions used in the Version 3 of the HELP model. Program documentation including program options, system and operating requirements, file structures, program structure and variable descriptions are provided in a separat...

Aviation Environmental Design Tool (AEDT) AEDT Standard Input File (ASIF) reference guide version 2a

DOT National Transportation Integrated Search

2014-01-01

The Federal Aviation Administration, Office of Environment and Energy (FAA-AEE) has developed the Aviation : Environmental Design Tool (AEDT) version 2a software system with the support of the following development team: : FAA, National Aeronautics a...

FHWA Traffic Noise Model user's guide (version 2.5 addendum)

DOT National Transportation Integrated Search

2004-04-30

In March 1998, the Federal Highway Administration (FHWA), Office of Natural and Human Environment, released the FHWA Traffic Noise Model (TNM), Version 1.0, a state-of-the-art computer model for highway traffic noise prediction and analysis. Since th...

Scout 2008 Version 1.0 User Guide

EPA Science Inventory

The Scout 2008 version 1.0 software package provides a wide variety of classical and robust statistical methods that are not typically available in other commercial software packages. A major part of Scout deals with classical, robust, and resistant univariate and multivariate ou...

KABAM Version 1.0 User's Guide and Technical Documentation - Appendix H - Methods for Estimating Metabolism Rate Constant

EPA Pesticide Factsheets

Appendix H of KABAM Version 1.0 documentation related to estimating the metabolism rate constant. KABAM is a simulation model used to predict pesticide concentrations in aquatic regions for use in exposure assessments.

Intersection life cycle cost comparison tool user guide version 1.0.

DOT National Transportation Integrated Search

2016-05-01

The Intersection Life Cycle Cost Comparison Tool User Guide was developed as part of North : Carolina Department of Transportation Research Project No. 201411: Evaluation of Life Cycle : Impacts of Intersection Control Type Selection. : This sprea...

Guide to Documenting and Managing Cost and Performance Information for Remediation Projects - Revised Version

EPA Pesticide Factsheets

This Guide to Documenting and Managing Cost and Performance Information for Remediation Projects provides the recommended procedures for documenting the results of completed and on-going full-scale and demonstration-scale remediation projects.

2013 Vehicle Theft Prevention Quick Reference Guide for the Law Enforcement Community

DOT National Transportation Integrated Search

2013-08-01

"This and future versions of the Vehicle TheftPrevention Quick Reference Guide for the Law Enforcement Community will provide comprehensive information for vehicle lines. The parts-marking requirements have been : extended to include: : all passe...

Reducing Hispanic Teenage Pregnancy and Family Poverty: A Replication Guide. Final Version.

ERIC Educational Resources Information Center

Perez, Sonia M.; Duany, Luis A.

This guide was designed to help Hispanic American community-based organizations develop and establish a teenage pregnancy prevention or teenage parenting program for Hispanic American adolescents. The guide does not assume prior knowledge of the scope of the teenage pregnancy problem in the United States, but it does underscore the critical role…

Guia de ideas para la Planificacion y Aplicacion de Proyectos Intergeneracionales (Guide of Ideas for Planning and Implementing Intergenerational Projects)

ERIC Educational Resources Information Center

Pinto, Teresa Almeida; Marreel, Iris; Hatton-Yeo, Alan

2009-01-01

This version of "Guide of Ideas for Planning and Implementing Intergenerational Projects," written in Spanish, is for all professionals that are or wish to be enrolled in the development of intergenerational activities. This "Guide" is the main product of the Project MATES--Mainstreaming Intergenerational Solidarity,…

THE MERCHANT OF VENICE. LITERATURE CURRICULUM III, STUDENT VERSION.

ERIC Educational Resources Information Center

KITZHABER, ALBERT R.

A GUIDE WAS PRODUCED FOR STUDENT USE IN NINTH-GRADE STUDY OF "THE MERCHANT OF VENICE." THE GUIDE PRESENTED SEVERAL ALTERNATE APPROACHES FOR UNDERSTANDING THE PLAY AND LEARNING ITS CONTENT. A MAJOR EMPHASIS OF THE GUIDE WAS PLACED ON THREE FORMS OF STUDENT QUESTIONS, RELATED TO SPECIFIC ACTS AND SCENES, THE CHARACTERS IN THE DRAMA, AND…

Guia de Ideias para Planear e Implementar Projectos Intergeracionais (Guide of Ideas for Planning and Implementing Intergenerational Projects)

ERIC Educational Resources Information Center

Pinto, Teresa Almeida; Marreel, Iris; Hatton-Yeo, Alan

2009-01-01

This version of "Guide of Ideas for Planning and Implementing Intergenerational Projects," written in Portuguese, is for all professionals that are or wish to be enrolled in the development of intergenerational activities. This "Guide" is the main product of the Project MATES--Mainstreaming Intergenerational Solidarity,…

TES/Aura L3 Nitric Acid (HNO3) Daily V4 (TL3HNOD)

Atmospheric Science Data Center

2018-02-28

... 37 x 23 km Spatial Resolution:  2.3 x 23 km Temporal Coverage:  08/22/2004 - 04/10/2005 ... Guide Documents:  Data User's Guide (PDF):  Level 3 Level 3 Algorithms, Requirements, & Products (PDF) ...

Fabrication of planar waveguide in KNSBN crystal by swift heavy ion beam irradiation

NASA Astrophysics Data System (ADS)

Guan, Jing; Wang, Lei; Qin, Xifeng

2013-11-01

We report on the fabrication of the planar waveguides in the KNSBN crystal by using 17 MeV C5+ ions at a fluence of 2 × 1014 ions/cm2. After implantation, near surface regions of the crystal, there has a positive extraordinary refractive index (ne) change and the light inside the waveguides can propagate in a non-leaky manner. The two-dimensional modal profiles of the planar waveguides, measured by using the end-coupling arrangement, are in good agreement with the reconstructed modal distributions. The propagation loss for C5+ irradiated waveguide is ∼0.8 dB/cm at 633 nm and ∼0.72 dB/cm at 1064 nm. The waveguide gives good confinement of waveguide modes, which exhibits acceptable guiding qualities for potential applications in integrated optics.

FAA Air Transportation Modernization and Safety Improvement Act

THOMAS, 111th Congress

Rep. Rangel, Charles B. [D-NY-15

2009-03-18

08/10/2010 Became Public Law No: 111-226. (TXT | PDF) (All Actions) Notes: As enacted, the bill funds education jobs and Medicaid, but in a previous version funded aviation programs. The title shown at the top of the page is that of the last version of the bill that contained a title. Tracker: This bill has the status Became LawHere are the steps for Status of Legislation:

Software Design Description for the Polar Ice Prediction System (PIPS) Version 3.0

DTIC Science & Technology

2008-11-05

Naval Research Laboratory Stennis Space Center, MS 39529-5004 NRL/MR/7320--08-9150 Approved for public release; distribution is unlimited. Software ...collection of information, including suggestions for reducing this burden to Department of Defense, Washington Headquarters Services , Directorate for...THIS PAGE 18. NUMBER OF PAGES 17. LIMITATION OF ABSTRACT Software Design Description for the Polar Ice Prediction System (PIPS) Version 3.0 Pamela G

Software Design Description for the Navy Coastal Ocean Model (NCOM) Version 4.0

DTIC Science & Technology

2008-12-31

Naval Research Laboratory Stennis Space Center, MS 39529-5004 NRL/MR/7320--08-9149 Approved for public release; distribution is unlimited. Software ...suggestions for reducing this burden to Department of Defense, Washington Headquarters Services , Directorate for Information Operations and Reports (0704...LIMITATION OF ABSTRACT Software Design Description for the Navy Coastal Ocean Model (NCOM) Version 4.0 Paul Martin, Charlie N. Barron, Lucy F

Shore Shapers: Introducing children and the general public to biogeomorphological processes and geodiversity

NASA Astrophysics Data System (ADS)

Naylor, Larissa; Coombes, Martin; Sewell, Jack; White, Anissia

2014-05-01

Coastal processes shape the coast into a variety of eye-catching and enticing landforms that attract people to marvel at, relax and enjoy coastal geomorphology. Field guides to explain these processes (and the geodiversity that results) to the general public and children are few and far between. In contrast, there is a relative wealth of resources and organised activities introducing people to coastal wildlife, especially on rocky shores. These biological resources typically focus on the biology and climatic controls on their distribution, rather than how the biology interacts with its physical habitat. As an outcome of two recent rock coast biogeomorphology projects (www.biogeomorph.org/coastal/coastaldefencedbiodiversity and www.biogeomorph.org/coastal/bioprotection ), we produced the first known guide to understanding how biogeomorphological processes help create coastal landforms. The 'Shore Shapers' guide (www.biogeomorph.org/coastal/shoreshapers) is designed to: a) bring biotic-geomorphic interactions to life and b) introduce some of the geomorphological and geological controls on biogeomorphic processes and landform development. The guide provides scientific information in an accessible and interactive way - to help sustain children's interest and extend their learning. We tested a draft version of our guide with children, the general public and volunteers on rocky shore rambles using social science techniques and of 74 respondents, 75.6% were more interested in understanding how rock pools (i.e. coastal landforms) develop after seeing the guide. Respondents' opinions about key bioprotective species also changed as a result of seeing the guide - 58% of people found barnacles unattractive before they saw the guide whilst 36% of respondents were more interested in barnacles after seeing the guide. These results demonstrate that there is considerable interest in more educational materials on coastal biogeomorphology and geodiversity.

ECONOMIC GROWTH ANALYSIS SYSTEM: USER'S GUIDE VERSION 2.0

EPA Science Inventory

The two-volume report describes the development of and provides information needed to operate, the Economic Growth Analysis System (E-GAS) Version 2.0 model. The model will be used to project emissions inventories of volatile organic compounds (VOCs), oxides of nitrogen (NOx), a...

ECONOMIC GROWTH ANALYSIS SYSTEM: USER'S GUIDE - VERSION 3.0

EPA Science Inventory

The two-volume report describes the development of, and provides information needed to operate, the Economic Growth Analysis System (E-GAS) Version 3.0 model. The model will be used to project emissions inventories of volatile organic compounds, oxides of nitrogen, and carbon mon...

Integrated corridor management : implementation guide and lessons learned (final report version 2.0).

DOT National Transportation Integrated Search

2015-09-01

This implementation guide is intended for use by adopters of integrated corridor management (ICM) approaches and strategies to address congestion and travel time reliability issues within specific travel corridors. It introduces the topic of ICM and ...

GEMPAK5 user's guide, version 5.0

NASA Technical Reports Server (NTRS)

Desjardins, Mary L.; Brill, Keith F.; Schotz, Steven S.

1991-01-01

GEMPAK is a general meteorological software package used to analyze and display conventional meteorological data as well as satellite derived parameters. The User's Guide describes the GEMPAK5 programs and input parameters and details the algorithms used for the meteorological computations.

Pilot testing of SHRP 2 reliability data and analytical products: Washington. [supporting datasets

DOT National Transportation Integrated Search

2014-01-01

The Washington site used the reliability guide from Project L02, analysis tools for forecasting reliability and estimating impacts from Project L07, Project L08, and Project C11 as well as the guide on reliability performance measures from the Projec...

Advanced Tools Webinar Series Presents: Regulatory Issues and Case Studies of Advanced Tools

EPA Science Inventory

U.S. EPA has released A Guide for Assessing Biodegradation and Source Identification of Organic Ground Water Contaminants using Compound Specific Isotope Analysis (CSIA) [EPA 600/R-08/148 | December 2008 | www.epa.gov/ada]. The Guide provides recommendations for sample collecti...

Xyce parallel electronic simulator reference guide, Version 6.0.1.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keiter, Eric R; Mei, Ting; Russo, Thomas V.

2014-01-01

This document is a reference guide to the Xyce Parallel Electronic Simulator, and is a companion document to the Xyce Users Guide [1] . The focus of this document is (to the extent possible) exhaustively list device parameters, solver options, parser options, and other usage details of Xyce. This document is not intended to be a tutorial. Users who are new to circuit simulation are better served by the Xyce Users Guide [1] .

Xyce parallel electronic simulator reference guide, version 6.0.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keiter, Eric R; Mei, Ting; Russo, Thomas V.

2013-08-01

This document is a reference guide to the Xyce Parallel Electronic Simulator, and is a companion document to the Xyce Users Guide [1] . The focus of this document is (to the extent possible) exhaustively list device parameters, solver options, parser options, and other usage details of Xyce. This document is not intended to be a tutorial. Users who are new to circuit simulation are better served by the Xyce Users Guide [1] .

Food Intakes Converted to Retail Commodities Databases 2003-08: Methodology and User Guide

USDA-ARS?s Scientific Manuscript database

The purpose for developing the Food Intakes Converted to Retail Commodities Databases (FICRCD) 2003-08 is to convert foods consumed in What We Eat In America, National Health and Nutrition Examination Survey (WWEIA, NHANES) 2003-2004, 2005-2006, and 2007-2008 to respective amounts of retail-level fo...

The learning effects of different presentations of worked examples on medical students' breaking-bad-news skills: A randomized and blinded field trial.

PubMed

Schmitz, Felix Michael; Schnabel, Kai Philipp; Bauer, Daniel; Bachmann, Cadja; Woermann, Ulrich; Guttormsen, Sissel

2018-02-24

Effective instructional approaches are needed to enable undergraduates to optimally prepare for the limited training time they receive with simulated patients (SPs). This study examines the learning effects of different presentation formats of a worked example on student SP communication. Sixty-seven fourth-year medical students attending a mandatory communication course participated in this randomized field trial. Prior to the course, they worked through an e-learning module that introduced the SPIKES protocol for delivering bad news to patients. In this module, a single worked example was presented to one group of students in a text version, to a second group in a video version, and to a third group in a video version enriched with text hints denoting the SPIKES steps. The video-with-hints group broke bad news to SPs significantly more appropriately than either of the other groups. Although no further condition-related effects were revealed, students who learned from the text version most frequently (although non-significantly) ignored unpleasant emotions (standardised emotional cues and concerns) expressed by the SPs. The learning effect was strongest when the video-based worked example was accompanied by hints. Video-related learning approaches that embed attention-guiding hints can effectively prepare undergraduates for SP encounters. Copyright © 2018 Elsevier B.V. All rights reserved.

Otitis Media with Effusion in Young Children. Clinical Practice Guideline, Quick Reference Guide for Clinicians, [and] Parent Guide, Consumer Version, Number 12.

ERIC Educational Resources Information Center

Agency for Health Care Policy and Research (DHHS/PHS), Rockville, MD.

Otitis media with effusion and its related hearing loss have been associated with delayed language development, particularly if the disease is recurrent or of long duration, although available data are insufficient to establish a causal linkage. This guide presents recommendations based on extensive reviews of the relevant medical and…

Zone Nationale D'Etude de L'Environnment: Un Guide (National Environmental Study Area: A Guide).

ERIC Educational Resources Information Center

National Park Service (Dept. of Interior), Washington, DC.

This booklet, the French version of SE 014 817, is a guide for teachers and resource managers who are interested in establishing National Environmental Study Areas (NESA) or interested in receiving NESA recognition for their on-going environmental study area programs. It outlines the characteristics and procedures of the program; the nature,…

Odyssey Celebrates the Legacy of Mark Twain with "The Prince and the Pauper." Guide for Educators.

ERIC Educational Resources Information Center

KIDSNET, Washington, DC.

This study guide covers the new television version of one of Mark Twain's most popular stories, "The Prince and the Pauper," the classic tale of two boys whose curiosity about each other's lives leads them to switch places and, in the process, learn valuable lessons about outward appearances and true compassion. The guide summarizes the…

Structural dynamics payload loads estimates: User guide

NASA Technical Reports Server (NTRS)

Shanahan, T. G.; Engels, R. C.

1982-01-01

This User Guide with an overview of an integration scheme to determine the response of a launch vehicle with multiple payloads. Chapter II discusses the software package associated with the integration scheme together with several sample problems. A short cut version of the integration technique is also discussed. The Guide concludes with a list of references and the listings of the subroutines.

Synthetic Engineering of Spider Silk Fiber as Implantable Optical Waveguides for Low-Loss Light Guiding.

PubMed

Qiao, Xin; Qian, Zhigang; Li, Junjie; Sun, Hongji; Han, Yao; Xia, Xiaoxia; Zhou, Jin; Wang, Chunlan; Wang, Yan; Wang, Changyong

2017-05-03

A variety of devices used for biomedical engineering have been fabricated using protein polymer because of their excellent properties, such as strength, toughness, biocompatibility, and biodegradability. In this study, we fabricated an optical waveguide using genetically engineered spider silk protein. This method has two significant advantages: (1) recombinant spider silk optical waveguide exhibits excellent optical and biological properties and (2) biosynthesis of spider silk protein can overcome the limitation to the research on spider silk optical waveguide due to the low yield of natural spider silk. In detail, two kinds of protein-based optical waveguides made from recombinant spider silk protein and regenerative silkworm silk protein were successfully prepared. Results suggested that the recombinant spider silk optical waveguide showed a smoother surface and a higher refractive index when compared with regenerative silkworm silk protein. The optical loss of recombinant spider silk optical waveguide was 0.8 ± 0.1 dB/cm in air and 1.9 ± 0.3 dB/cm in mouse muscles, which were significantly lower than those of regenerative silkworm silk optical waveguide. Moreover, recombinant spider silk optical waveguide can meet the demand to guide and efficiently deliver light through biological tissue. In addition, recombinant spider silk optical waveguide showed low toxicity to cells in vitro and low-level inflammatory reaction with surrounding tissue in vivo. Therefore, recombinant spider silk optical waveguide is a promising implantable device to guide and deliver light with low loss.

NASA AVOSS Fast-Time Models for Aircraft Wake Prediction: User's Guide (APA3.8 and TDP2.1)

NASA Technical Reports Server (NTRS)

Ahmad, Nash'at N.; VanValkenburg, Randal L.; Pruis, Matthew J.; Limon Duparcmeur, Fanny M.

2016-01-01

NASA's current distribution of fast-time wake vortex decay and transport models includes APA (Version 3.8) and TDP (Version 2.1). This User's Guide provides detailed information on the model inputs, file formats, and model outputs. A brief description of the Memphis 1995, Dallas/Fort Worth 1997, and the Denver 2003 wake vortex datasets is given along with the evaluation of models. A detailed bibliography is provided which includes publications on model development, wake field experiment descriptions, and applications of the fast-time wake vortex models.

USERS MANUAL: LANDFILL GAS EMISSIONS MODEL - VERSION 2.0

EPA Science Inventory

The document is a user's guide for a computer model, Version 2.0 of the Landfill Gas Emissions Model (LandGEM), for estimating air pollution emissions from municipal solid waste (MSW) landfills. The model can be used to estimate emission rates for methane, carbon dioxide, nonmet...

AIRPOL-4A : an introduction and user's guide.

DOT National Transportation Integrated Search

1976-01-01

This report details the mechanics of implementing the computer program AIRPOL-4A. AIRPOL-4A supersedes AIRPOL-4. The upgrade from version 4 to version 4A is a result of the new emissions guidelines contained in Supplement 5 to AP-42, April 1975, by t...

Aviation Environmental Design Tool (AEDT): Version 2c Service pack 1: AEDT Standard Input File (ASIF) Reference Guide

DOT National Transportation Integrated Search

2016-12-01

The Federal Aviation Administration, Office of Environment and Energy (FAA-AEE) has developed the Aviation Environmental Design Tool (AEDT) version 2c software system with the support of the following development team: FAA, National Aeronautics and S...

Advanced Transportation Institute 2008.

DOT National Transportation Integrated Search

2009-02-01

The seventh version of the Advanced Transportation Institute (ATI-08) was conducted in 2008 to encourage high school students to pursue careers in the field of transportation engineering. The University Transportation Center for Alabama partnered wit...

National Stormwater Calculator User's Guide – VERSION 1.1

EPA Science Inventory

This document is the user's guide for running EPA's National Stormwater Calculator (http://www.epa.gov/nrmrl/wswrd/wq/models/swc/). The National Stormwater Calculator is a simple to use tool for computing small site hydrology for any location within the US.

GEMPAK5. Part 2: GEMPLT programmer's guide, version 5.0

NASA Technical Reports Server (NTRS)

Desjardins, Mary L.; Brill, Keith F.; Schotz, Steven S.

1991-01-01

GEMPAK is a general meteorological software package used to analyze and display conventional meteorological data as well as satellite derived parameters. The GEMPAK Programmer's Guide describes the subroutines which can be used in the GEMPAK graphics and transformation subsystem, GEMPLT.

An Office Building Occupants Guide to Indoor Air Quality - Printable Version

EPA Pesticide Factsheets

This guide is intended to help people who work in office buildings learn about the factors that contribute to indoor air quality and comfort problems and the roles of building managers and occupants in maintaining a good indoor environment.

Patriot Script 1.0.13 User Guide for PEM 1.3.2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cleland, Timothy James; Kubicek, Deborah Ann; Stroud, Phillip David

2015-11-02

This document provides an updated user guide for Patriot Script Version 1.0.13, for release with PEM 1.3.1 (LAUR-1422817) that adds description and instructions for the new excursion capability (see section 4.5.1).

Xyce parallel electronic simulator reference guide, version 6.1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keiter, Eric R; Mei, Ting; Russo, Thomas V.

2014-03-01

This document is a reference guide to the Xyce Parallel Electronic Simulator, and is a companion document to the Xyce Users Guide [1] . The focus of this document is (to the extent possible) exhaustively list device parameters, solver options, parser options, and other usage details of Xyce. This document is not intended to be a tutorial. Users who are new to circuit simulation are better served by the Xyce Users Guide [1] .

Isolation of HIV-1-Neutralizing Mucosal Monoclonal Antibodies from Human Colostrum

PubMed Central

Friedman, James; Alam, S. Munir; Shen, Xiaoying; Xia, Shi-Mao; Stewart, Shelley; Anasti, Kara; Pollara, Justin; Fouda, Genevieve G.; Yang, Guang; Kelsoe, Garnett; Ferrari, Guido; Tomaras, Georgia D.; Haynes, Barton F.; Liao, Hua-Xin

2012-01-01

Background Generation of potent anti-HIV antibody responses in mucosal compartments is a potential requirement of a transmission-blocking HIV vaccine. HIV-specific, functional antibody responses are present in breast milk, and these mucosal antibody responses may play a role in protection of the majority of HIV-exposed, breastfeeding infants. Therefore, characterization of HIV-specific antibodies produced by B cells in milk could guide the development of vaccines that elicit protective mucosal antibody responses. Methods We isolated B cells from colostrum of an HIV-infected lactating woman with a detectable neutralization response in milk and recombinantly produced and characterized the resulting HIV-1 Envelope (Env)-specific monoclonal antibodies (mAbs). Results The identified HIV-1 Env-specific colostrum mAbs, CH07 and CH08, represent two of the first mucosally-derived anti-HIV antibodies yet to be reported. Colostrum mAb CH07 is a highly-autoreactive, weakly-neutralizing gp140-specific mAb that binds to linear epitopes in the gp120 C5 region and gp41 fusion domain. In contrast, colostrum mAb CH08 is a nonpolyreactive CD4-inducible (CD4i) gp120-specific mAb with moderate breadth of neutralization. Conclusions These novel HIV-neutralizing mAbs isolated from a mucosal compartment provide insight into the ability of mucosal B cell populations to produce functional anti-HIV antibodies that may contribute to protection against virus acquisition at mucosal surfaces. PMID:22624058

GEMPAK5. Part 1: GEMPAK5 programmer's guide, version 5.0

NASA Technical Reports Server (NTRS)

Desjardins, Mary L.; Brill, Keith F.; Schotz, Steven S.

1991-01-01

GEMPAK is a general meteorological software package used to analyze and display conventional meteorological data as well as satellite derived parameters. The Programmer's Guide describes the subroutines which can be used to build new GEMPAK programs. Part 1 contains GEMPAK subroutines.

DNA Multiple Sequence Alignment Guided by Protein Domains: The MSA-PAD 2.0 Method.

PubMed

Balech, Bachir; Monaco, Alfonso; Perniola, Michele; Santamaria, Monica; Donvito, Giacinto; Vicario, Saverio; Maggi, Giorgio; Pesole, Graziano

2018-01-01

Multiple sequence alignment (MSA) is a fundamental component in many DNA sequence analyses including metagenomics studies and phylogeny inference. When guided by protein profiles, DNA multiple alignments assume a higher precision and robustness. Here we present details of the use of the upgraded version of MSA-PAD (2.0), which is a DNA multiple sequence alignment framework able to align DNA sequences coding for single/multiple protein domains guided by PFAM or user-defined annotations. MSA-PAD has two alignment strategies, called "Gene" and "Genome," accounting for coding domains order and genomic rearrangements, respectively. Novel options were added to the present version, where the MSA can be guided by protein profiles provided by the user. This allows MSA-PAD 2.0 to run faster and to add custom protein profiles sometimes not present in PFAM database according to the user's interest. MSA-PAD 2.0 is currently freely available as a Web application at https://recasgateway.cloud.ba.infn.it/ .

Summary: Update to ASTM guide E 1523 to charge control and charge referencing techniques in x-ray photoelectron spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baer, D.R.

2005-05-01

An updated version of the American Society for Testing and Materials (ASTM) guide E 1523 to the methods to charge control and charge referencing techniques in x-ray photoelectron spectroscopy has been released by ASTM [Annual Book of ASTM Standards Surface Analysis (American Society for Testing and Materials, West Conshohocken, PA, 2004), Vol. 03.06]. The guide is meant to acquaint x-ray photoelectron spectroscopy (XPS) users with the various charge control and charge referencing techniques that are and have been used in the acquisition and interpretation of XPS data from surfaces of insulating specimens. The current guide has been expanded to includemore » new references as well as recommendations for reporting information on charge control and charge referencing. The previous version of the document had been published in 1997 [D. R. Baer and K. D. Bomben, J. Vac. Sci. Technol. A 16, 754 (1998)].« less

Ada Compiler Validation Summary Report. Certificate Number: 900228W1. 11003, Verdix Corporation VADS Sun3 SunOS, VAda-110-1313, Version 6.0 Sun3/280 = Sun3/280

DTIC Science & Technology

1991-01-17

Number: 90-03-08- VRX See Section 3.1 for any additional information about the testing environment. As a result of this validation effort, Validation...20301,Q:’ I.. AVF Control Number: AVF-VSR-365.0191 17 January 1991 90-03-08- VRX Ada COMPILER VALIDATION SUMMARY REPORT: Certificate Number: 900228W1.11003

US Army Weapon Systems Human-Computer Interface (WSHCI) style guide, Version 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Avery, L.W.; O`Mara, P.A.; Shepard, A.P.

1996-09-30

A stated goal of the U.S. Army has been the standardization of the human computer interfaces (HCIS) of its system. Some of the tools being used to accomplish this standardization are HCI design guidelines and style guides. Currently, the Army is employing a number of style guides. While these style guides provide good guidance for the command, control, communications, computers, and intelligence (C4I) domain, they do not necessarily represent the more unique requirements of the Army`s real time and near-real time (RT/NRT) weapon systems. The Office of the Director of Information for Command, Control, Communications, and Computers (DISC4), in conjunctionmore » with the Weapon Systems Technical Architecture Working Group (WSTAWG), recognized this need as part of their activities to revise the Army Technical Architecture (ATA). To address this need, DISC4 tasked the Pacific Northwest National Laboratory (PNNL) to develop an Army weapon systems unique HCI style guide. This document, the U.S. Army Weapon Systems Human-Computer Interface (WSHCI) Style Guide, represents the first version of that style guide. The purpose of this document is to provide HCI design guidance for RT/NRT Army systems across the weapon systems domains of ground, aviation, missile, and soldier systems. Each domain should customize and extend this guidance by developing their domain-specific style guides, which will be used to guide the development of future systems within their domains.« less

Sierra/SolidMechanics 4.48 User's Guide: Addendum for Shock Capabilities.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Plews, Julia A.; Crane, Nathan K; de Frias, Gabriel Jose

This is an addendum to the Sierra/SolidMechanics 4.48 User's Guide that documents additional capabilities available only in alternate versions of the Sierra/SolidMechanics (Sierra/SM) code. These alternate versions are enhanced to provide capabilities that are regulated under the U.S. Department of State's International Traffic in Arms Regulations (ITAR) export-control rules. The ITAR regulated codes are only distributed to entities that comply with the ITAR export-control requirements. The ITAR enhancements to Sierra/SM in- clude material models with an energy-dependent pressure response (appropriate for very large deformations and strain rates) and capabilities for blast modeling. Since this is an addendum to the standardmore » Sierra/SM user's guide, please refer to that document first for general descriptions of code capability and use.« less

Baccalaureate and Beyond: A First Look at the Employment Experiences and Lives of College Graduates, 4 Years On (B&B:08/12). NCES 2014-141

ERIC Educational Resources Information Center

Cataldi, Emily Forrest; Siegel, Peter; Shepherd, Bryan; Cooney, Jennifer

2014-01-01

This report presents initial findings about the employment outcomes of bachelor's degree recipients approximately 4 years after they completed their 2007-08 degrees. These findings are based on data from the second follow-up of the Baccalaureate and Beyond Longitudinal Study (B&B:08/12), a nationally representative longitudinal sample survey…

Identification and Localization of Minimal MHC-restricted CD8+ T Cell Epitopes within the Plasmodium falciparum AMA1 Protein

DTIC Science & Technology

2010-08-24

A01/A02 B44/B44 002 A01/A02 B08/B44 005 A01/A02 B08/ B27 008 A02/A03 B27 / B27 012 A01/A03 B44/B58 Low resolution molecular HLA typing permitted...Fourteen 8-10-mer epitopes were predicted to bind to HLA supertypes A01 (3 epitopes), A02 (4 epitopes), B08 (2 epitopes) and B44 (5 epitopes). Nine...of seven HLA alleles. These HLA alleles belong to four HLA supertypes that have a phenotypic frequency between 23% - 100% in different human

Archived Appendices | NREL

Science.gov Websites

or NREL Procurement. Appendix B-1 (08/01/12) Standard Terms and Conditions for (1) Cost Sharing, (2 ) Cost Reimbursement, and (3) Cost Plus Fixed Fee. Appendix B-2 (08/01/12) Fixed-Price or Fixed Unit Conditions for Cost Type Subcontracts with Educational Institutions Appendix B-10 (08/01/12) Standard Terms

"Family Guides" to Timely Topics in Space Science

NASA Astrophysics Data System (ADS)

Morrow, C.; McLain, B.; Wilkerson, A.; Garvin-Doxas, K.; Dyches, P.

We have undertaken the development, field testing, and dissemination of a new series of ``Family Guides'' on timely topics of notable interest in space science and astronomy. Each Guide includes an innovative collection of puzzles, pictures, poetry, and projects, all designed to stimulate enjoyable co-learning, inquiry-based experiences between kids aged 6-12 and the caring adults in their lives. The Guides are primarily intended for use in informal educational settings, including at home, with after-school programs, in youth groups, and in programs for children, school-groups, or families that are conducted in museums, planetariums, and nature centers. We are learning that classroom teachers also express interest in the Guide's activities as a means to engage students attention toward more formal lessons. The Guides endeavor to be accessible to those who are not familiar with astronomy. They provide background on questions commonly asked by children. The interactive activities challenge common misconceptions. The Guides' also coach adults how to lead inquiry with kids instead of telling or prescribing answers. The Guides' resource sections provide leads to more information and additional products related to family learning. We released the field test version of the Family Guide to the Sun in late summer 2003. In January 2004 we released the field test version of the Family Guide to Mars in time for use with educational programs associated with the Mars Exploration Rover landings. We are in the planning stages for a Family Guide to Saturn and for a Family Guide to the Search for Life Elsewhere. These later Guides will build on the base of understanding we construct from the field testing of the earlier Guides. This paper will provide details of the Guides' contents as well as results from field testing in various educational settings. We are proposing for funds to translate the Family Guide to Mars and the Family Guide the Sun into both French and Spanish.

Target position uncertainty during visually guided deep-inspiration breath-hold radiotherapy in locally advanced lung cancer.

PubMed

Scherman Rydhög, Jonas; Riisgaard de Blanck, Steen; Josipovic, Mirjana; Irming Jølck, Rasmus; Larsen, Klaus Richter; Clementsen, Paul; Lars Andersen, Thomas; Poulsen, Per Rugaard; Fredberg Persson, Gitte; Munck Af Rosenschold, Per

2017-04-01

The purpose of this study was to estimate the uncertainty in voluntary deep-inspiration breath-hold (DIBH) radiotherapy for locally advanced non-small cell lung cancer (NSCLC) patients. Perpendicular fluoroscopic movies were acquired in free breathing (FB) and DIBH during a course of visually guided DIBH radiotherapy of nine patients with NSCLC. Patients had liquid markers injected in mediastinal lymph nodes and primary tumours. Excursion, systematic- and random errors, and inter-breath-hold position uncertainty were investigated using an image based tracking algorithm. A mean reduction of 2-6mm in marker excursion in DIBH versus FB was seen in the anterior-posterior (AP), left-right (LR) and cranio-caudal (CC) directions. Lymph node motion during DIBH originated from cardiac motion. The systematic- (standard deviation (SD) of all the mean marker positions) and random errors (root-mean-square of the intra-BH SD) during DIBH were 0.5 and 0.3mm (AP), 0.5 and 0.3mm (LR), 0.8 and 0.4mm (CC), respectively. The mean inter-breath-hold shifts were -0.3mm (AP), -0.2mm (LR), and -0.2mm (CC). Intra- and inter-breath-hold uncertainty of tumours and lymph nodes were small in visually guided breath-hold radiotherapy of NSCLC. Target motion could be substantially reduced, but not eliminated, using visually guided DIBH. Copyright © 2017 Elsevier B.V. All rights reserved.

Modification of a School Programme in the Deutsches Museum to Enhance Students' Attitudes and Understanding

NASA Astrophysics Data System (ADS)

Stavrova, Olga; Urhahne, Detlef

2010-11-01

The study examines the nature, conditions, and outcomes of student learning from an organised guided tour in the Deutsches Museum in Munich. The instructional methods that best support students' cognitive and affective learning as well as how students' motivational and emotional states influence their achievement were investigated. A sample of 96 secondary school students took part in two different versions of a guided tour on an energy topic. The tours varied in the degree of support of students' active involvement, group work, and the variety of general activities offered during the tour. The data collected indicate that both tour versions led to an increase in student understanding of the visit topic to nearly the same extent. However, the version stimulating students' active participation, group work, and including a larger variety of activities aroused more positive attitudes. Students of the modified school programme showed higher interest and intrinsic motivation, felt more competent, and were less bored after the guided tour. In addition, the results suggest that students' visit-related emotional states predict the degree of their post-visit topic understanding, even when demographics and prior knowledge are taken into consideration.

xLPR Sim Editor 1.0 User's Guide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mariner, Paul E.

2017-03-01

The United States Nuclear Regulatory Commission in cooperation with the Electric Power Research Institute contracted Sandia National Laboratories to develop the framework of a probabilistic fracture mechanics assessment code called xLPR ( Extremely Low Probability of Rupture) Version 2.0 . The purpose of xLPR is to evaluate degradation mechanisms in piping systems at nuclear power plants and to predict the probability of rupture. This report is a user's guide for xLPR Sim Editor 1.0 , a graphical user interface for creating and editing the xLPR Version 2.0 input file and for creating, editing, and using the xLPR Version 2.0 databasemore » files . The xLPR Sim Editor, provides a user - friendly way for users to change simulation options and input values, s elect input datasets from xLPR data bases, identify inputs needed for a simulation, and create and modify an input file for xLPR.« less

User's guide for Northeast Stand Exam Program (NEST Version 2.1).

Treesearch

Thomas M. Schuler; Brian T. Simpson

1991-01-01

Explains the Northeast Stand Exam (NEST Version 2.1) program. The NEST program was designed for use on the Polycorder 600 Series electronic portable data recorder to record data collected from the standard permanent plot as described by the Stand Culture and Stand Establishment Working Groups of the Northeastern Forest Experiment Station.

Unit: Tuning in With Our Senses, Inspection Set, National Trial Print.

ERIC Educational Resources Information Center

Australian Science Education Project, Toorak, Victoria.

A preliminary version of this trial draft of a unit prepared for Australian secondary science students was previously announced as ED 049 931 under the short title of "Messengers." The teachers' guide is an overprinted version of the students' booklet, and lists objectives for each section of the materials, indicates possible teaching…

USER'S GUIDE: Strategic Waste Minimization Initiative (SWAMI) Version 2.0 - A Software Tool to Aid in Process Analysis for Pollution Prevention

EPA Science Inventory

The Strategic WAste Minimization Initiative (SWAMI) Software, Version 2.0 is a tool for using process analysis for identifying waste minimization opportunities within an industrial setting. The software requires user-supplied information for process definition, as well as materia...

ICCS 2009 User Guide for the International Database. Supplement 1: International Version of the ICCS 2009 Questionnaires

ERIC Educational Resources Information Center

Brese, Falk; Jung, Michael; Mirazchiyski, Plamen; Schulz, Wolfram; Zuehlke, Olaf

2011-01-01

This document presents Supplement 1 of "The International Civic and Citizenship Education Study (ICCS) 2009 International Database," which includes data for all questionnaires administered as part of the ICCS 2009 assessment. This supplement contains the international version of the ICCS 2009 questionnaires in the following seven…

The Effect of Different Textual Narrations on Students' Explanations at the Submicroscopic Level in Chemistry

ERIC Educational Resources Information Center

Al-Balushi, Sulaiman M.

2013-01-01

The effect of different textual versions (macroscopic (control), submicroscopic, and guided imagery) of the explanation of a chemical phenomenon on students' submicroscopic explanation of a related phenomenon was examined. The sample included 152 pre-service science teachers. The three textual versions of the explanation were distributed randomly…

A users' guide to the trace contaminant control simulation computer program

NASA Technical Reports Server (NTRS)

Perry, J. L.

1994-01-01

The Trace Contaminant Control Simulation computer program is a tool for assessing the performance of various trace contaminant control technologies for removing trace chemical contamination from a spacecraft cabin atmosphere. The results obtained from the program can be useful in assessing different technology combinations, system sizing, system location with respect to other life support systems, and the overall life cycle economics of a trace contaminant control system. The user's manual is extracted in its entirety from NASA TM-108409 to provide a stand-alone reference for using any version of the program. The first publication of the manual as part of TM-108409 also included a detailed listing of version 8.0 of the program. As changes to the code were necessary, it became apparent that the user's manual should be separate from the computer code documentation and be general enough to provide guidance in using any version of the program. Provided in the guide are tips for input file preparation, general program execution, and output file manipulation. Information concerning source code listings of the latest version of the computer program may be obtained by contacting the author.

USER'S GUIDE FOR GLOED VERSION 1.0 - THE GLOBAL EMISSIONS DATABASE

EPA Science Inventory

The document is a user's guide for the EPA-developed, powerful software package, Global Emissions Database (GloED). GloED is a user-friendly, menu-driven tool for storing and retrieving emissions factors and activity data on a country-specific basis. Data can be selected from dat...

Volpe Center Acoustics Facility time-space-position-information system differential global positioning system user's guide, version 1.2

DOT National Transportation Integrated Search

2000-07-01

This document is a users guide for the VolpeCenter AcousticsFacilitys(VCAF)Time-Space-Position-Information : (TSPI) System. The VCAF TSPI system is a differential global positioning system (dGPS) which may be utilized : for highly accurate vehi...

USER'S GUIDE TO FLEXIBLE MEMBRANE LINER ADVISORY EXPERT SYSTEM: FLEX VERSION 3.0

EPA Science Inventory

The guide is a user manual for the Flexible Membrane Liner Advisory Expert System (FLEX). The system assists in determining if a proposed synthetic liner material will be chemically resistant to a proposed or anticipated leachate from a hazardous waste land disposal site. More sp...

MYTHS--LITERATURE CURRICULUM I, STUDENT VERSION.

ERIC Educational Resources Information Center

KITZHABER, ALBERT

PRESENTED HERE WAS A STUDY GUIDE FOR STUDENT USE IN A SEVENTH-GRADE LITERATURE CURRICULUM. INTRODUCTORY MATERIAL WAS PRESENTED ON GREEK MYTHS, NORSE MYTHOLOGY, AND AMERICAN INDIAN MYTHOLOGY. STUDY QUESTIONS, SUGGESTED ACTIVITIES, AND A REFERENCE BOOK OF MYTHS WERE PRESENTED. AN ACCOMPANYING GUIDE WAS PREPARED FOR TEACHERS (ED 010 140). (WN)

Human factors design guide update (report number DOT/FAA/CT-96/01) : a revision to chapter 5--automation guidelines.

DOT National Transportation Integrated Search

2001-12-01

This document contains an updated and expanded version of the Automation chapter of the Human Factors Design Guide. A research : team of human factors experts evaluated the existing guidelines for relevance, clarity, and usability. The research team ...

SIMULATION TOOL KIT FOR INDOOR AIR QUALITY AND INHALATION EXPOSURE (IAQX) VERSION 1.0 USER'S GUIDE

EPA Science Inventory

The User's Guide describes a Microsoft Windows-based indoor air quality (IAQ) simulation software package designed Simulation Tool Kit for Indoor Air Quality and Inhalation Exposure, or IAQX for short. This software complements and supplements existing IAQ simulation programs and...

City: Images of America. Elementary Version.

ERIC Educational Resources Information Center

Franklin, Edward; And Others

Designed to accompany an audiovisual filmstrip series devoted to presenting a visual history of life in America, this guide contains an elementary social studies (grades 2-6) unit on the American city over the last century. Using authentic visuals including paintings, posters, advertising, documentary photography, and cartoons, the guide offers…

77 FR 21359 - MARPOL Annex I Amendments

Federal Register 2010, 2011, 2012, 2013, 2014

2012-04-09

... the docket, go to http://www.regulations.gov , select the Advanced Docket Search option on the right... the Docket Management Facility. C. Privacy Act Anyone can search the electronic form of comments... are proposing to amend Sec. 156.111 by updating the versions of the STS Transfer Guide and the Guide...

Interim Terrain Data (ITD) and Vector Product Interim Terrain Data (VITD) user's guide

DOT National Transportation Integrated Search

1996-09-01

This guide is intended to be a convenient reference for users of these types of terrain analysis data. ITD is a digitized version of the standard 1:50,000-scale tactical terrain analysis data base (TTADB) product produced by the Defense Mapping Agenc...

A Community for All Generations -- Teens and Adults Working Together. A Guide for Public Dialogue and Problem Solving. Version 1.0.

ERIC Educational Resources Information Center

Campbell, Sarah vL.

This document is intended to create an opportunity for teens and adults to talk together and find ways to make their community a place where young people can grow up successfully. The discussion guide begins with a brief statement of purpose and a brief explanation of study circles and their objectives. The remainder of the guide consists of…

Evaluating patient-reported outcome measurement comparability between paper and alternate versions, using the lung function questionnaire as an example.

PubMed

Dalal, Anand A; Nelson, Lauren; Gilligan, Theresa; McLeod, Lori; Lewis, Sandy; DeMuro-Mercon, Carla

2011-01-01

The goal of this study was to provide recommended steps to assess measurement comparability using a crossover study design and to demonstrate these steps using a short patient-reported outcome (PRO) instrument as an example. The example PRO instrument was administered via paper, Web, interactive voice response system, and interview; a randomized crossover design was used to gather data across the multiple administration types. Participants completed the PRO instrument, demographic and health questions, and a short preference questionnaire. Evaluation included comparisons of the item-level responses and agreement, comparison of mean scale scores, score classifications, and questions designed to collect usability and administration preference. Here the authors provide a four-step evaluation guide to evaluate measurement comparability and illustrate these steps using a case-finding tool. In the example, item-level kappa statistics between the paper and the alternate versions ranged from good to excellent, intraclass correlation coefficient for mean scores were above 0.70, and the rate of disagreement ranged from 2% to 14%. In addition, although participants had an administration preference, they reported few difficulties with the versions they were assigned. The steps described in this article provide a guide for evaluating whether to combine scores across administration versions to simplify analyses and interpretation under a crossover design. The guide recommends the investigation of item-level responses, summary scores, and participant usability/preference when comparing versions, with each step providing unique information to support comprehensive evaluation and informed decisions regarding whether to combine data. Copyright © 2011 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc. All rights reserved.

30 CFR Appendix to Subpart B - Optional Form for Certifying Mine Rescue Teams

Code of Federal Regulations, 2012 CFR

2012-07-01

... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Optional Form for Certifying Mine Rescue Teams... EDUCATION AND TRAINING MINE RESCUE TEAMS Mine Rescue Teams for Underground Coal Mines Pt. 49, Subpt. B, App. Appendix to Subpart B—Optional Form for Certifying Mine Rescue Teams ER08FE08.000 ER08FE08.001 ...

30 CFR Appendix to Subpart B - Optional Form for Certifying Mine Rescue Teams

Code of Federal Regulations, 2010 CFR

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Optional Form for Certifying Mine Rescue Teams... EDUCATION AND TRAINING MINE RESCUE TEAMS Mine Rescue Teams for Underground Coal Mines Pt. 49, Subpt. B, App. Appendix to Subpart B—Optional Form for Certifying Mine Rescue Teams ER08FE08.000 ER08FE08.001 ...

30 CFR Appendix to Subpart B - Optional Form for Certifying Mine Rescue Teams

Code of Federal Regulations, 2011 CFR

2011-07-01

... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Optional Form for Certifying Mine Rescue Teams... EDUCATION AND TRAINING MINE RESCUE TEAMS Mine Rescue Teams for Underground Coal Mines Pt. 49, Subpt. B, App. Appendix to Subpart B—Optional Form for Certifying Mine Rescue Teams ER08FE08.000 ER08FE08.001 ...

Cognitive control in context: working memory capacity and proactive control.

PubMed

Redick, Thomas S

2014-01-01

Working memory is important for maintaining critical information in an active state to guide future behavior. The executive-attention theory of working memory capacity (WMC; Engle & Kane, 2004) argues that goal maintenance is important for response selection when stimuli are associated with competing responses. Braver, Burgess, and Gray (2007) have labeled this type of preparatory activity proactive control. Previous WMC studies have not allowed individuals to use goal information to prepare a specific response in advance of the stimulus. The current experiment used different versions of a cue-probe task to examine the relationship between individual differences in WMC and proactive control. Across three versions of the AX version of the Continuous Performance Test, the proportion of targets was manipulated to affect both the predictive validity of the A cue and the prepotency of the target response to X probes. The results indicated that the high-WMC individuals used the cue information to prepare responses in advance only when a specific probe was likely to occur. In contrast, the performance of the low-WMC individuals was less dependent upon the cue and more contingent upon overall response frequencies. The results indicate that individual differences in WMC are related to proactive control and anticipation, and important for translating cognition into action. © 2013 Elsevier B.V. All rights reserved.

Safe zones and a technical guide for cerclage wiring of the femur: a computed topographic angiogram (CTA) study.

PubMed

Apivatthakakul, Theerachai; Siripipattanamongkol, P; Oh, Chang-Wug; Sananpanich, K; Phornphutkul, C

2018-01-01

Cerclage wiring for reduction of complex femoral shaft fractures can create iatrogenic vascular injury. To describe the anatomical relation of blood vessels to the femur and develop a technical guide for safe passage of cerclage wire. CT lower-limb angiographs (CTA) of 80 patients were reviewed and analysed to identify the superficial femoral artery (SFA) and the deep femoral artery (DFA) as well as the relation of those arteries to the femoral cortex. The total length of the femur was measured and divided into eight equal segments (seven levels). At each level, the medial half of the femur was divided into eight sectors labelled A through H and the position of the SFA and DFA was recorded. The shortest distance between the femoral cortex and the SFA and DFA at each level was measured. The data was analysed using STATA version 10.0. The average total femoral length from the tip of greater trochanter to lateral joint line was 402.98 ± 26.16 cm. The average distances from the SFA to the femur (d1) for levels 1 through 7 were 37.20 ± 5.0, 32.09 ± 4.74, 27.13 ± 4.19, 27.71 ± 5.46, 23.71 ± 4.40, 13.63 ± 3.59 and 10.08 ± 3.09 mm, respectively. The average distances between the DFA and the femur (d2) for levels 1 through 3 were 26.70 ± 4.13, 14.76 ± 3.27 and 9.58 ± 3.79 mm, respectively. The position of the SFA is located in sectors B through E at levels 1-3 and in sectors E through H at levels 4-7 and the position of the DFA located in sectors B through F at levels 1-3. Cerclage wiring should be started from the posterior intermuscular septum at the linea aspera. The safe area is the proximal half (midshaft) of the femur where the SFA and DFA lie at a safe distance from the femur. Between the midshaft and the distal 1/4, insertion of the passer must be done meticulously with the tip kept close to posteromedial cortex. Below the distal 1/4, the tip of the passer should be kept close to the posterior cortex to avoid injury to the SFA and the sciatic nerve.

Solar Access Public Capital (SAPC) Working Group: Best Practices in PV Operations and Maintenance; Version 1.0, March 2015; Period of Performance, January 1, 2014 - December 31, 2015

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keating, T. J.; Walker, A.; Ardani, K.

2015-03-01

This PV O&M Best Practices Guide is designed to improve solar asset transparency for investors and rating agencies, provide an industry framework for quality management, and reduce transaction costs in the solar asset securitization process. The PV O&M Best Practices Guide is intended to outline the minimum requirements for third-party ownership providers (“Providers”). Adherence to the guide is voluntary. Providers that adhere to the guide are responsible for selfcertifying that they have fulfilled the guide requirements.

Sistemas Eolicos Pequenos para Generacion de Electridad (Spanish version of Small Wind Electric Systems: A U.S. Consumer's Guide) (in Spanish)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

2005-07-01

This Spanish version of the popular Small Wind Electric Systems: A U.S. Consumer's Guide provides consumers with information to help them determine whether a small wind electric system can provide all or a portion of the energy they need for their home or business based on their wind resource, energy needs, and economics. Topics include how to make a home more energy efficient, how to choose the correct turbine size, the parts of a wind electric system, how to determine whether enough wind resource exists, how to choose the best site for a turbine, how to connect a system tomore » the utility grid, and whether it's possible to become independent of the utility grid using wind energy. In addition, the cover of the guide contains a list of contacts for more information.« less

IBHVG2 (Interior Ballistics of High Velocity Guns, Version 2)--A User’s Guide

DTIC Science & Technology

1987-07-01

AT GAGE LOCATIONS - BREECH, CA 0 38 -- > ORIGINAL PROJECTILE BASE, AND AT 10 INCHES OF TRAVEL CARD 39 -*SGUN CARD 40-- NAMEaE1SS-MN 198’ CNAMu1150...03 SAMIE AS RPT 0 Wr’C usr*s Un14lassile _____ V~nNAUS1&1 n c’’ e Isn D UA (301) 27蔶 SLCl3R- 10 -A DD FOM 147. . AR ;3 APF4 Z70tiQfli*m b mosw itw...004vlted xi t CAS .’Np~ A( All othof Eatt n$ 4( )M,’ UNCLASSI FIED Noec Lert lntentiontly bllank CONTENTS L INTRODUCTION ............. . . . . 4 IL

Remote (250 km) fiber Bragg grating multiplexing system.

PubMed

Fernandez-Vallejo, Montserrat; Rota-Rodrigo, Sergio; Lopez-Amo, Manuel

2011-01-01

We propose and demonstrate two ultra-long range fiber Bragg grating (FBG) sensor interrogation systems. In the first approach four FBGs are located 200 km from the monitoring station and a signal to noise ratio of 20 dB is obtained. The second improved version is able to detect the four multiplexed FBGs placed 250 km away, offering a signal to noise ratio of 6-8 dB. Consequently, this last system represents the longest range FBG sensor system reported so far that includes fiber sensor multiplexing capability. Both simple systems are based on a wavelength swept laser to scan the reflection spectra of the FBGs, and they are composed by two identical-lengths optical paths: the first one intended to launch the amplified laser signal by means of Raman amplification and the other one is employed to guide the reflection signal to the reception system.

Solar Advisor Model User Guide for Version 2.0

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilman, P.; Blair, N.; Mehos, M.

2008-08-01

The Solar Advisor Model (SAM) provides a consistent framework for analyzing and comparing power system costs and performance across the range of solar technologies and markets, from photovoltaic systems for residential and commercial markets to concentrating solar power and large photovoltaic systems for utility markets. This manual describes Version 2.0 of the software, which can model photovoltaic and concentrating solar power technologies for electric applications for several markets. The current version of the Solar Advisor Model does not model solar heating and lighting technologies.

Records and Reports Guide

DTIC Science & Technology

2017-07-01

2017 to incorporate revised factors from the DEOMI Organizational Climate Survey (DEOCS) version 4.0 to version 4.1. This update primarily effects...begins with a survey , such as the DEOMI Organizational Climate Survey (DEOCS). Once survey themes, indicators, or concerns are identified, other...climate assessment to verify indicators and concerns identified through other assessment methods ( surveys , observations, and interviews

45 CFR 162.920 - Availability of implementation specifications and operating rules.

Code of Federal Regulations, 2014 CFR

2014-10-01

...: Eligibility and Benefit Real Time Companion Guide Rule, version 1.1.0, March 2011, as referenced in § 162.1203...: Eligibility and Benefits Real Time Response Time Rule, version 1.1.0, March 2011, as referenced in § 162.1203... operating rules. 162.920 Section 162.920 Public Welfare Department of Health and Human Services...

45 CFR 162.920 - Availability of implementation specifications and operating rules.

Code of Federal Regulations, 2012 CFR

2012-10-01

...: Eligibility and Benefit Real Time Companion Guide Rule, version 1.1.0, March 2011, as referenced in § 162.1203...: Eligibility and Benefits Real Time Response Time Rule, version 1.1.0, March 2011, as referenced in § 162.1203... operating rules. 162.920 Section 162.920 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES...

75 FR 24711 - Food and Drug Administration Modernization Act of 1997: Modifications to the List of Recognized...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-05

... newer version Indicators - Guidance for the Selection, Use and Interpretation of Results I. Tissue Engineering 15-6 15-16 ASTM F2450-09 Standard Guide for Assessing Withdrawn and replaced Microstructure of Polymeric Scaffolds for with newer version Use in Tissue Engineered Medical Products\\1\\ 15-9 15-17 ASTM...

ROUGHING IT. THE OLD MAN AND THE SEA. SHORT STORIES. POEMS. LITERATURE CURRICULUM III, TEACHER VERSION.

ERIC Educational Resources Information Center

KITZHABER, ALBERT R.

A TEACHER VERSION OF A LITERATURE CURRICULUM GUIDE WAS PROVIDED FOR TWAIN'S "ROUGHING IT," HEMINGWAY'S "THE OLD MAN AND THE SEA," FOUR SHORT STORIES, AND 20 LYRIC POEMS. THE SHORT STORIES INCLUDED WERE (1) "THE MONKEY'S PAW" BY W.W. JACOBS, (2) "PAUL'S CASE" BY WILLA CATHER, (3) "THE CASK OF…

TIMSS 2011 User Guide for the International Database. Supplement 1: International Version of the TIMSS 2011 Background and Curriculum Questionnaires

ERIC Educational Resources Information Center

Foy, Pierre, Ed.; Arora, Alka, Ed.; Stanco, Gabrielle M., Ed.

2013-01-01

The TIMSS 2011 International Database includes data for all questionnaires administered as part of the TIMSS 2011 assessment. This supplement contains the international version of the TIMSS 2011 background questionnaires and curriculum questionnaires in the following 10 sections: (1) Fourth Grade Student Questionnaire; (2) Fourth Grade Home…

TEDS-M 2008 User Guide for the International Database. Supplement 1: International Version of the TEDS-M Questionnaires

ERIC Educational Resources Information Center

Brese, Falk, Ed.

2012-01-01

The Teacher Education Study in Mathematics (TEDS-M) International Database includes data for all questionnaires administered as part of the TEDS-M study. These consisted of questionnaires administered to future teachers, educators, and institutions with teacher preparation programs. This supplement contains the international version of the TEDS-M…

Extremely High Peak Power Pulsed RF and UWB EMR Effects on Genomic Transcription - Microarray Assessment

DTIC Science & Technology

2008-06-26

Homo sapiens decorin variant C mRNA, complete cds. 2.117 PKNOX2 HUM408A08B Human fetal brain (TFujiwara) Homo sapiens cDNA clone GEN -408A08 5’, mRNA...mRNA, complete cds. 2.117 PKNOX2 HUM408A08B Human fetal brain (TFujiwara) Homo sapiens cDNA clone GEN -408A08 5’, mRNA sequence. 2.076 SEC23B...RAS oncogene family ; RAB33B, member RAS oncogene family 205300_s_at 0.37 U1SNRNPBP U11/U12 snRNP 35K 220728_at 0.349 218689_at 0.342 FANCF Fanconi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Malczynski, Leonard A.

This guide addresses software quality in the construction of Powersim{reg_sign} Studio 8 system dynamics simulation models. It is the result of almost ten years of experience with the Powersim suite of system dynamics modeling tools (Constructor and earlier Studio versions). It is a guide that proposes a common look and feel for the construction of Powersim Studio system dynamics models.

The Cutting Edge: Workplace English. Instructional Guide.

ERIC Educational Resources Information Center

El Paso Community Coll., TX. Literacy Center.

The instructional guide for the Cutting Edge workplace literacy program, a cooperative project of El Paso Community College (Texas) and Levi Strauss and Company, is an expanded version of one appendix the project handbook. It describes and provides an instructional model for the three-part, job-specific, video-based program of English as a Second…

A Leader's Guide to Exploring Parenting = Manual Del Orientador para Explorando el Arte de ser Padres.

ERIC Educational Resources Information Center

Littlejohn (Roy) Associates, Inc., Washington, DC.

This document, provided here in separate English and Spanish versions, offers guidelines for leaders implementing the "Exploring Parenting" series of workshops with Head Start parents. The guide is divided into four sections. Section 1, "Introduction," outlines the philosophy undergirding the Exploring Parenting series and…

TIMSS 2011 User Guide for the International Database. Supplement 2: National Adaptations of International Background Questionnaires

ERIC Educational Resources Information Center

Foy, Pierre, Ed.; Arora, Alka, Ed.; Stanco, Gabrielle M., Ed.

2013-01-01

This supplement describes national adaptations made to the international version of the TIMSS 2011 background questionnaires. This information provides users with a guide to evaluate the availability of internationally comparable data for use in secondary analyses involving the TIMSS 2011 background variables. Background questionnaire adaptations…

Unit: Sticking Together, First Trial Materials, Inspection Set.

ERIC Educational Resources Information Center

Australian Science Education Project, Toorak, Victoria.

These materials, including teacher's guide, student test booklet and laboratory guide, student workbook, test booklet, and a booklet explaining the answers to the questions in the test booklet, are first trial versions of a unit that will form part of the Australian Science Education Project instructional materials for grades seven through ten.…

METAPHOR: Programmer's guide, Version 1

NASA Technical Reports Server (NTRS)

Furchtgott, D. G.

1979-01-01

The internal structure of the Michigan Evaluation Aid for Perphormability (METAPHOR), an interactive software package to facilitate performability modeling and evaluation is described. Revised supplemented guides are prepared in order to maintain an up-to-date documentation of the system. Programmed tools to facilitate each step of performability model construction and model solution are given.

NED-2 User's Guide

Treesearch

Mark J. Twery; Peter D. Knopp; Scott A. Thomasma; Donald E. Nute

2011-01-01

This is the user's guide for NED-2, which is the latest version of NED, a forest ecosystem management decision support system. This software is part of a family of software products intended to help resource managers develop goals, assess current and future conditions, and produce sustainable management plans for forest properties. Designed for stand-alone Windows...

NED-2 reference guide

Treesearch

Mark J. Twery; Peter D. Knopp; Scott A. Thomasma; Donald E. Nute

2012-01-01

This is the reference guide for NED-2, which is the latest version of NED, a forest ecosystem management decision support system. This software is part of a family of software products intended to help resource managers develop goals, assess current and future conditions, and produce sustainable management plans for forest properties. Designed for stand-alone Windows-...

A Guided Summary Completion Test for Long Academic Texts.

ERIC Educational Resources Information Center

Bensoussan, Marsha

Because testing comprehension of long (5- to 10-page) second-language texts is more complex than testing shorter texts, an alternative form of second language reading comprehension test is needed. In a guided summary completion test, students are presented with a greatly shortened version of the text (e.g., one-paragraph summary), containing…

23 CFR 650.315 - Inventory.

Code of Federal Regulations, 2010 CFR

2010-04-01

... for collection by the FHWA as requested. A tabulation of this data is contained in the SI&A sheet distributed by the FHWA as part of the “Recording and Coding Guide for the Structure Inventory and Appraisal... version. Report the data using FHWA established procedures as outlined in the “Recording and Coding Guide...

The Middle East Content Priority Teaching Guide.

ERIC Educational Resources Information Center

Fix, Jerrold E.

Variations of a social studies unit on Middle Eastern culture, history, and geography are presented to aid secondary school classroom teachers as they develop and implement Middle Eastern area studies educational programs. The guide is presented in four parts, each of which represents one version of the unit. Teachers are directed to select the…

Xyce™ Parallel Electronic Simulator Reference Guide, Version 6.5

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keiter, Eric R.; Aadithya, Karthik V.; Mei, Ting

2016-06-01

This document is a reference guide to the Xyce Parallel Electronic Simulator, and is a companion document to the Xyce Users’ Guide. The focus of this document is (to the extent possible) exhaustively list device parameters, solver options, parser options, and other usage details of Xyce. This document is not intended to be a tutorial. Users who are new to circuit simulation are better served by the Xyce Users’ Guide. The information herein is subject to change without notice. Copyright © 2002-2016 Sandia Corporation. All rights reserved.

[Effect of artificial media opacities on Frisén ring perimetry and conventional light sense perimetry. A comparative study].

PubMed

Meyer, J H; Funk, J

1994-04-01

In this study we compare the influence of blurring by diffusor foils (Bangerter) on visual acuity and on the thresholds of ring and light sense perimetry. Light sense perimetry was performed using the G1 program of the Octopus 1-2-3 perimeter [1], and ring perimetry with the "ring" test, version 2.20 (High-Tech-Vision) designed by Frisén [4]. Ten eyes of ten healthy persons with a visual acuity of 1.25 or better were examined at six different levels corresponding to visual acuities between 1.6 and hand movements. With both perimeters sensitivity decreased with decreasing visual acuity. At good visual acuities (1.2-1.6) no changes were found in either ring perimetry or light sense perimetry. At acuity levels of 0.8 and below a more pronounced decrease in sensitivity was found with the ring perimeter than with the light sense perimeter. At the level of hand movements there were only absolute scotomas in the ring perimeter, while the Octopus 1-2-3 still detected a baseline sensitivity. Sensitivity was correlated with the logarithm of the visual acuity with both perimeters (Octopus 1-2-3: r = 0.99, P < 0.001; ring perimeter: r = 0.98, P < 0.001). The decrease in sensitivity per log-unit of visual acuity was 9.43 dB (Octopus 1-2-3) or 5.19 dB (ring perimeter). The ring perimeter, at least in its currently available version giving an absolute scotoma at mean scores > 14 dB, is obviously more sensitive to media opacities than the Octopus 1-2-3. This may be of importance in the clinical evaluation of the test results.

Nonstrategic Nuclear Weapons

DTIC Science & Technology

2012-12-19

full scope” life extension program for the B61 bomb, the weapon that is currently deployed in Europe, “to ensure its functionality with the F-35...This life extension program will consolidate four versions of the B61 bomb, including the B61 -3 and B61 - 4 that are currently deployed in Europe, into...one version, the B61 -12. Reports indicate that this new version will reuse the nuclear components of the older bombs, but will include enhanced

Nonstrategic Nuclear Weapons

DTIC Science & Technology

2014-01-03

NPR also indicated that the United States would conduct a “full scope” life extension program for the B61 bomb, the weapon that is currently deployed...in Europe, “to ensure its functionality with the F-35.” This life extension program will consolidate four versions of the B61 bomb, including the B61 ...3 and B61 - 4 that are currently deployed in Europe, into one version, the B61 -12. Reports indicate that this new version will reuse the nuclear

Prospective Evaluation of PI-RADS™ Version 2 Using the International Society of Urological Pathology Prostate Cancer Grade Group System.

PubMed

Mehralivand, Sherif; Bednarova, Sandra; Shih, Joanna H; Mertan, Francesca V; Gaur, Sonia; Merino, Maria J; Wood, Bradford J; Pinto, Peter A; Choyke, Peter L; Turkbey, Baris

2017-09-01

The PI-RADS™ (Prostate Imaging Reporting and Data System), version 2 scoring system, introduced in 2015, is based on expert consensus. In the same time frame ISUP (International Society of Urological Pathology) introduced a new pathological scoring system for prostate cancer. Our goal was to prospectively evaluate the cancer detection rates for each PI-RADS, version 2 category and compare them to ISUP group scores in patients undergoing systematic biopsy and magnetic resonance imaging-transrectal ultrasound fusion guided biopsy. A total of 339 treatment naïve patients prospectively underwent multiparametric magnetic resonance imaging evaluated with PI-RADS, version 2 with subsequent systematic and fusion guided biopsy from May 2015 to May 2016. ISUP scores were applied to pathological specimens. An ISUP score of 2 or greater (ie Gleason 3 + 4 or greater) was defined as clinically significant prostate cancer. Cancer detection rates were determined for each PI-RADS, version 2 category as well as for the T2 weighted PI-RADS, version 2 categories in the peripheral zone. The cancer detection rate for PI-RADS, version 2 categories 1, 2, 3, 4 and 5 was 25%, 20.2%, 24.8%, 39.1% and 86.9% for all prostate cancer, and 0%, 9.6%, 12%, 22.1% and 72.4% for clinically significant prostate cancer, respectively. On T2-weighted magnetic resonance imaging the cancer detection rate in the peripheral zone was significantly higher for PI-RADS, version 2 category 4 than for overall PI-RADS, version 2 category 4 in the peripheral zone (all prostate cancer 36.6% vs 48.1%, p = 0.001, and clinically significant prostate cancer 22.9% vs 32.6%, p = 0.002). The cancer detection rate increases with higher PI-RADS, version 2 categories. Copyright © 2017 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Sbexpert users guide (version 1.0): A knowledge-based decision-support system for spruce beetle management. Forest Service general technical report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reynolds, K.M.; Holsten, E.H.; Werner, R.A.

1995-03-01

SBexpert version 1.0 is a knowledge-based decision-support system for management of spruce beetle developed for use in Microsoft Windows. The users guide provides detailed instructions on the use of all SBexpert features. SBexpert has four main subprograms; introduction, analysis, textbook, and literature. The introduction is the first of the five subtopics in the SBexpert help system. The analysis topic is an advisory system for spruce beetle management that provides recommendation for reducing spruce beetle hazard and risk to spruce stands and is the main analytical topic in SBexpert. The textbook and literature topics provide complementary decision support for analysis.

SEAPAK user's guide, version 2.0. Volume 1: System description

NASA Technical Reports Server (NTRS)

Mcclain, Charles R.; Darzi, Michael; Firestone, James K.; Fu, Gary; Yeh, Eueng-Nan; Endres, Daniel L.

1991-01-01

The SEAPAK is a user interactive satellite data analysis package that was developed for the processing and interpretation of Nimbus-7/Coastal Zone Color Scanner (CZCS) and the NOAA Advanced Very High Resolution Radiometer (AVHRR) data. Significant revisions were made to version 1.0 of the guide, and the ancillary environmental data analysis module was expanded. The package continues to emphasize user friendliness and user interactive data analyses. Additionally, because the scientific goals of the ocean color research being conducted have shifted to large space and time scales, batch processing capabilities for both satellite and ancillary environmental data analyses were enhanced, thus allowing large quantities of data to be ingested and analyzed in background.

Fluorescence Lyman-Alpha Stratospheric Hygrometer (FLASH): application on meteorological balloons, long duration balloons and unmanned aerial vehicles.

NASA Astrophysics Data System (ADS)

Lykov, Alexey; Khaykin, Sergey; Yushkov, Vladimir; Efremov, Denis; Formanyuk, Ivan; Astakhov, Valeriy

The FLASH instrument is based on the fluorescent method, which uses H2O molecules photodissociation at a wavelength lambda=121.6 nm (Lalpha - hydrogen emission) followed by the measurement of the fluorescence of excited OH radicals. The source of Lyman-alpha radiation is a hydrogen discharge lamp while the detector of OH fluorescence at 308 -316 nm is a photomultiplier run in photon counting mode. The intensity of the fluorescent light as well as the instrument readings is directly proportional to the water vapor mixing ratio under stratospheric conditions with negligible oxygen absorption. Initially designed for rocket-borne application, FLASH has evolved into a light-weight balloon sonde (FLASH-B) for measurements in the upper troposphere and stratosphere on board meteorological and small plastic balloons. This configuration has been used in over 100 soundings at numerous tropical mid-latitude and polar locations within various international field campaigns. An airborne version of FLASH instrument is successfully utilized onboard stratospheric M55-Geophysica aircraft and tropospheric airborne laboratory YAK42-Roshydromet. The hygrometer was modified for application onboard stratospheric long-duration balloons (FLASH-LDB version). This version was successfully used onboard CNES super-pressure balloon launched from SSC Esrange in March 2007 and flown during 10 days. Special design for polar long duration balloon PoGOLite was created for testing work during polar day in June 2013. Installation and measurement peculiarities as well as observational results are presented. Observations of water vapour using FLASH-B instrument, being of high quality are rather costly as the payload recovery is often complicated and most of the time impossible. Following the goal to find a cost-efficient solution, FLASH was adapted for use onboard Unmanned Aerial Vehicles (UAV). This solution was only possible thanks to compactness and light-weight (0.5 kg) of FLASH instrument. The hygrometer was installed at the nose of a small GPS-controlled glider, which was lifted by a meteorological balloon into the stratosphere and released by a remote command. GPS-based flight control guides and lands the UAV at the launch point thereby allowing multiple usage of its payload. Another sounding platform allowing for multiple usage of the FLASH instrument is a GPS-guided paraglide. The results of measurements acquired in the test flights using different types of balloon-lifted UAVs are presented.

Factors influencing discomfort during anterior ultrasound-guided injection for hip arthrography.

PubMed

Hsu, Yi-Chih; Wu, Yu-Cheng; Kao, Hao-Lun; Pan, Ru-Yu; Lee, Meei-Shyuan; Huang, Guo-Shu

2013-09-01

Although ultrasound (US)-guided injection techniques for magnetic resonance arthrography of the hip have been used with increasing frequency to diagnose internal joint derangements, little is known about patient tolerance, which is relevant information for patients. The objective of this study was to evaluate prospectively the association between possible influencing factors and discomfort felt during the performance of anterior US-guided injection techniques targeting the femoral head-neck junction during hip arthrography. Forty-four consecutive patients (21 women and 23 men; mean age, 41 years) undergoing magnetic resonance hip arthrography were sequentially assigned to receive injection alternating between fixed and freehand US-guided injection. Discomfort was assessed using a visual analog scale and relative ratings. Patient body mass index, extra-articular contrast leakage, the duration of the procedure, the needle advancement distance, and the fixed trajectory of the needle were assessed. Pearson's correlation coefficients and multiple logistic regression analysis were used to determine the association. Puncture was successfully accomplished in all cases, and no relevant complications were reported. The only significant relationships were between discomfort and the time required for needle manipulation (r = 0.8) and fixed US-guided injection (r = 0.6; p < 0.001). Compared with the freehand technique, the fixed technique resulted in significantly less pain and took significantly less time to perform (p < 0.001). The procedure time during needle manipulation in the fixed US-guided injections (4.0 ± 0.9 seconds) was significantly less than that in the freehand US-guided injections (19.4 ± 17.6 seconds; p < 0.001). No significant relationships were found between discomfort and other parameters (r < 0.3, p > 0.05). The procedure time appears to be the most important factor influencing patient discomfort. Fixed US-guided injection is a time-saving technique that alleviates procedure-related discomfort. Copyright © 2013. Published by Elsevier B.V.

Internet-based interface for STRMDEPL08

USGS Publications Warehouse

Reeves, Howard W.; Asher, A. Jeremiah

2010-01-01

The core of the computer program STRMDEPL08 that estimates streamflow depletion by a pumping well with one of four analytical solutions was re-written in the Javascript software language and made available through an internet-based interface (web page). In the internet-based interface, the user enters data for one of the four analytical solutions, Glover and Balmer (1954), Hantush (1965), Hunt (1999), and Hunt (2003), and the solution is run for constant pumping for a desired number of simulation days. Results are returned in tabular form to the user. For intermittent pumping, the interface allows the user to request that the header information for an input file for the stand-alone executable STRMDEPL08 be created. The user would add the pumping information to this header information and run the STRMDEPL08 executable that is available for download through the U.S. Geological Survey. Results for the internet-based and stand-alone versions of STRMDEPL08 are shown to match.

Visual Sample Plan Version 7.0 User's Guide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matzke, Brett D.; Newburn, Lisa LN; Hathaway, John E.

2014-03-01

User's guide for VSP 7.0 This user's guide describes Visual Sample Plan (VSP) Version 7.0 and provides instructions for using the software. VSP selects the appropriate number and location of environmental samples to ensure that the results of statistical tests performed to provide input to risk decisions have the required confidence and performance. VSP Version 7.0 provides sample-size equations or algorithms needed by specific statistical tests appropriate for specific environmental sampling objectives. It also provides data quality assessment and statistical analysis functions to support evaluation of the data and determine whether the data support decisions regarding sites suspected of contamination.more » The easy-to-use program is highly visual and graphic. VSP runs on personal computers with Microsoft Windows operating systems (XP, Vista, Windows 7, and Windows 8). Designed primarily for project managers and users without expertise in statistics, VSP is applicable to two- and three-dimensional populations to be sampled (e.g., rooms and buildings, surface soil, a defined layer of subsurface soil, water bodies, and other similar applications) for studies of environmental quality. VSP is also applicable for designing sampling plans for assessing chem/rad/bio threat and hazard identification within rooms and buildings, and for designing geophysical surveys for unexploded ordnance (UXO) identification.« less

Go for broke: The role of somatic states when asked to lose in the Iowa Gambling Task.

PubMed

Wright, Rebecca J; Rakow, Tim; Russo, Riccardo

2017-02-01

The Somatic Marker Hypothesis (SMH) posits that somatic states develop and guide advantageous decision making by "marking" disadvantageous options (i.e., arousal increases when poor options are considered). This assumption was tested using the standard Iowa Gambling Task (IGT) in which participants win/lose money by selecting among four decks of cards, and an alternative version, identical in both structure and payoffs, but with the aim changed to lose as much money as possible. This "lose" version of the IGT reverses which decks are advantageous/disadvantageous; and so reverses which decks should be marked by somatic responses - which we assessed via skin conductance (SC). Participants learned to pick advantageously in the original (Win) IGT and in the (new) Lose IGT. Using multilevel regression, some variability in anticipatory SC across blocks was found but no consistent effect of anticipatory SC on disadvantageous deck selections. Thus, while we successfully developed a new way to test the central claims of the SMH, we did not find consistent support for the SMH. Copyright © 2016 The Author(s). Published by Elsevier B.V. All rights reserved.

45 CFR 162.1203 - Operating rules for eligibility for a health plan transaction.

Code of Federal Regulations, 2011 CFR

2011-10-01

... plan transaction: (1) Phase I CORE 152: Eligibility and Benefit Real Time Companion Guide Rule, version... § 162.920). (5) Phase I CORE 156: Eligibility and Benefits Real Time Response Rule, version 1.1.0, March... 45 Public Welfare 1 2011-10-01 2011-10-01 false Operating rules for eligibility for a health plan...

45 CFR 162.1203 - Operating rules for eligibility for a health plan transaction.

Code of Federal Regulations, 2013 CFR

2013-10-01

... plan transaction: (1) Phase I CORE 152: Eligibility and Benefit Real Time Companion Guide Rule, version... § 162.920). (5) Phase I CORE 156: Eligibility and Benefits Real Time Response Rule, version 1.1.0, March... 45 Public Welfare 1 2013-10-01 2013-10-01 false Operating rules for eligibility for a health plan...

45 CFR 162.1203 - Operating rules for eligibility for a health plan transaction.

Code of Federal Regulations, 2014 CFR

2014-10-01

... plan transaction: (1) Phase I CORE 152: Eligibility and Benefit Real Time Companion Guide Rule, version... § 162.920). (5) Phase I CORE 156: Eligibility and Benefits Real Time Response Rule, version 1.1.0, March... 45 Public Welfare 1 2014-10-01 2014-10-01 false Operating rules for eligibility for a health plan...

45 CFR 162.1203 - Operating rules for eligibility for a health plan transaction.

Code of Federal Regulations, 2012 CFR

2012-10-01

... plan transaction: (1) Phase I CORE 152: Eligibility and Benefit Real Time Companion Guide Rule, version... § 162.920). (5) Phase I CORE 156: Eligibility and Benefits Real Time Response Rule, version 1.1.0, March... 45 Public Welfare 1 2012-10-01 2012-10-01 false Operating rules for eligibility for a health plan...

User's guide to Version 2 of the Regeneration Establishment Model: Part of the Prognosis Model

Treesearch

Dennis E. Ferguson; Nicholas L. Crookston

1991-01-01

This publication describes how to use version 2 of the Regeneration Establishment Model, a computer-based simulator that is part of the Prognosis Model for Stand Development. Conifer regeneration is predicted following harvest and site preparation for forests in western Montana, central Idaho, and northern Idaho. The influence of western spruce budworm (Choristoneura...

ROUGHING IT. THE OLD MAN AND THE SEA. SHORT STORIES. LYRIC POETRY. LITERATURE CURRICULUM III, STUDENT VERSION.

ERIC Educational Resources Information Center

KITZHABER, ALBERT R.

A STUDENT VERSION OF A LITERATURE CURRICULUM GUIDE WAS PROVIDED FOR TWAIN'S "ROUGHING IT," HEMINGWAY'S "THE OLD MAN AND THE SEA," FOUR SHORT STORIES, AND 20 LYRIC POEMS. THE SHORT STORIES INCLUDED WERE (1) "THE MONKEY'S PAW" BY W.W. JACOBS, (2) "PAUL'S CASE" BY WILLA CATHER, (3) "THE CASK OF…

PIRLS 2011 User Guide for the International Database. Supplement 1: International Version of the PIRLS 2011, Background Questionnaires and Curriculum Questionnaire

ERIC Educational Resources Information Center

Foy, Pierre, Ed.; Drucker, Kathleen T., Ed.

2013-01-01

The PIRLS 2011 international database includes data for all questionnaires administered as part of the PIRLS 2011 assessment. This supplement contains the international version of the PIRLS 2011 background questionnaires and curriculum questionnaires in the following 5 sections: (1) Student Questionnaire; (2) Home Questionnaire (Learning to Read…

Early Readers = Lo Que los padres necesitan saber sobre los...Lectores Precoces. What Parents Need To Know about...Series.

ERIC Educational Resources Information Center

Siegle, Del, Ed.

This pamphlet (Practitioner's Guide), in both an English version and Spanish version, is intended for parents of precocious readers. Research facts on early reading are briefly summarized. Implications for the classroom and home are offered and include a discussion of early school entrance, principles of reading instruction, and ways the parent…

Effects of Nutrients and Physical Forcing on Satellite-Derived Optical Properties Near the Mississippi River Delta

DTIC Science & Technology

2007-07-17

receiving system and NRL’s Automated Processing System (APS) (Martinolich 2005). APS Version 3.4 utilized atmospheric correction algorithms proscribed by... Automated Processing System User’s Guide Version 3.4, edited by N.R. Laboratory. Rabalais, N.N., R.E. Turner, and W.J. Wiseman, Jr. 2002. Hypoxia in the

Begonia semperflorens FB08-59 and FB08-163 clonal germplasm

USDA-ARS?s Scientific Manuscript database

FB08-59 is a dark-foliage, red-flowered wax begonia clone adapted to hot humid summers. It is the product of a recurrent selection breeding procedure to combine and improve the environmental tolerances identified in B. semperflorens ’Kaylen’ and B. cucullata arenosicola into a dark-foliaged, perenn...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, GE; Diefenderfer, HL

The Estuary/Ocean Subgroup (EOS) is part of the research, monitoring, and evaluation (RME) effort that the Action Agencies (Bonneville Power Administration (BPA), U.S. Army Corps of Engineers, U.S. Bureau of Reclamation) developed in response to obligations arising from the Endangered Species Act as applied to operation of the Federal Columbia River Power System (FCRPS). The goal of the EOS project is to facilitate activities of the estuary/ocean RME subgroup as it coordinates design and implementation of federal RME in the lower Columbia River and estuary. In fiscal year 2008 (FY08), EOS project accomplishments included (1) subgroup meetings; (2) participation inmore » the estuary work group of the Pacific Northwest Aquatic Monitoring Partnership; (3) project management via BPA's project tracking system, Pisces; (4) quarterly project status reports; and (5) a major revision to the Estuary RME document and its subsequent regional release (new version January 2008). Many of the estuary RME recommendations in this document were incorporated into the Biological Opinion on FCRPS operations (May 2008). In summary, the FY08 EOS project resulted in expanded, substantive coordination with other regional RME forums, a new version of the federal Estuary RME program document, and implementation coordination. This annual report is a FY08 deliverable for the project titled Facilitation of the Estuary/Ocean Subgroup.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Gary E.; Diefenderfer, Heida L.

The Estuary/Ocean Subgroup (EOS) is part of the research, monitoring, and evaluation (RME) effort that the Action Agencies (Bonneville Power Administration, U.S. Army Corps of Engineers, U.S. Bureau of Reclamation) developed in response to obligations arising from the Endangered Species Act as applied to operation of the Federal Columbia River Power System (FCRPS). The goal of the EOS project is to facilitate activities of the estuary/ocean RME subgroup as it coordinates design and implementation of federal RME in the lower Columbia River and estuary. In fiscal year 2008 (FY08), EOS project accomplishments included 1) subgroup meetings; 2) participation in themore » estuary work group of the Pacific Northwest Aquatic Monitoring Partnership; 3) project management via the project tracking system, Pisces; 4) quarterly project status reports; and 5) a major revision to the Estuary RME document and its subsequent regional release (new version January 2008). Many of the estuary RME recommendations in this document were incorporated into the Biological Opinion on hydrosystem operations (May 2008). In summary, the FY08 EOS project resulted in expanded, substantive coordination with other regional RME forums, a new version of the federal Estuary RME program document, and implementation coordination. This annual report is a FY08 deliverable for the project titled Facilitation of the Estuary/Ocean Subgroup.« less

A Research-Inspired and Computer-Guided Clinical Interview for Mathematics Assessment: Introduction, Reliability and Validity

ERIC Educational Resources Information Center

Ginsburg, Herbert P.; Lee, Young-Sun; Pappas, Sandra

2016-01-01

Formative assessment involves the gathering of information that can guide the teaching of individual or groups of children. This approach requires a sound understanding of children's thinking and learning, as well as an effective method for gaining the information. We propose that formative assessment should employ a version of clinical…

Areas Nacionales de Estudio Ambiental: Una Guia. (National Environmental Study Area: A Guide).

ERIC Educational Resources Information Center

National Park Service (Dept. of Interior), Washington, DC.

This booklet, the Spanish version of SE 014 817, is a guide for teachers and resource managers who are interested in establishing National Environmental Study Areas (NESA) or interested in receiving NESA recognition for their on-going environmental study area programs. It outlines the characteristics and procedures of the program; the nature,…

Walking with Grandfather and Great Wolf and Little Mouse Sister. Teacher's Guide.

ERIC Educational Resources Information Center

Lethbridge Univ. (Alberta).

Written for use with videotaped versions of the stories "Walking with Grandfather" and "Great Wolf and Little Mouse Sister," this guide presents 20 lessons that teachers can adapt for students of various ages and use in integrated units or other curriculum approaches. The introductory material describes the use and philosophy of the video stories,…

CSMP Mathematics for the First Grade Part II, Teacher's Guide [and] Worksheets. Final Experimental Version.

ERIC Educational Resources Information Center

Saunders, Kevin; Schweitzer, Janis

This Teacher's Guide for first-grade mathematics is an outgrowth of an extended pilot project conducted nationwide between 1973 and 1976. The manner of presentation and the pedagogical ideas and tools are based on the works of Georges and Frederique Papy. They are recognized as having introduced colored arrow drawings ("papygrams") and…

CSMP Mathematics for the First Grade Part I, Teacher's Guide [and] Worksheets. Final Experimental Version.

ERIC Educational Resources Information Center

Saunders, Kevin; And Others

This Teacher's Guide for first-grade mathematics is an outgrowth of an extended pilot project conducted nationwide between 1973 and 1976. The manner of presentation and the pedagogical ideas and tools are based on the works of Georges and Frederique Papy. They are recognized as having introduced colored arrow drawings ("papygrams") and…

COMBIMAN Programs (COMputerized BIomechanical MAN-Model). Version 8 (User’s Guide)

DTIC Science & Technology

1989-02-01

prgrams The guide is based on the program as of January 1989. It deals with the conventions used to develop and analyze crew stations, the generation of the...END ACTION: This is a safety to prevent ending the program if PFK 31 is accidentally depressed. Select END COMBIMAN if you intended to end the program

Students' Attitudes, Self-Efficacy and Experiences in a Modified Process-Oriented Guided Inquiry Learning Undergraduate Chemistry Classroom

ERIC Educational Resources Information Center

Vishnumolakala, Venkat Rao; Southam, Daniel C.; Treagust, David F.; Mocerino, Mauro; Qureshi, Sheila

2017-01-01

This one-semester, mixed methods study underpinning social cognition and theory of planned behaviour investigated the attitudes, self-efficacy, and experiences of 559 first year undergraduate chemistry students from two cohorts in modified process-oriented guided inquiry learning (POGIL) classes. Versions of attitude toward the study of chemistry…

Stop & Look with Willy Whistle [and] Walking with Your Eyes. A Teacher's Guide for the Video.

ERIC Educational Resources Information Center

National Highway Traffic Safety Administration (DOT), Washington, DC.

These two teacher's guides accompany two videotape presentations on pedestrian safety for children, focusing particularly on avoiding the "dart-out" accident. "Stop and Look with Willy Whistle," which targets children from kindergarten through third grade, is an updated version of the film "Willy Whistle.""Walking with Your Eyes," which targets…

Propagation Characteristics Of Weakly Guiding Optical Fibers

NASA Technical Reports Server (NTRS)

Manshadi, Farzin

1992-01-01

Report discusses electromagnetic propagation characteristics of weakly guiding optical-fiber structures having complicated shapes with cross-sectional dimensions of order of wavelength. Coupling, power-dividing, and transition dielectric-waveguide structures analyzed. Basic data computed by scalar-wave, fast-Fourier-transform (SW-FFT) technique, based on numerical solution of scalar version of wave equation by forward-marching fast-Fourier-transform method.

Intellectual Function in Mexican Children Living in a Mining Area and Environmentally Exposed to Manganese

PubMed Central

Riojas-Rodríguez, Horacio; Solís-Vivanco, Rodolfo; Schilmann, Astrid; Montes, Sergio; Rodríguez, Sandra; Ríos, Camilo; Rodríguez-Agudelo, Yaneth

2010-01-01

Background Excessive exposure to manganese (Mn), an essential trace element, has been shown to be neurotoxic, especially when inhaled. Few studies have examined potential effects of Mn on cognitive functions of environmentally exposed children. Objective This study was intended to estimate environmental exposure to Mn resulting from mining and processing and to explore its association with intellectual function of school-age children. Methods Children between 7 and 11 years of age from the Molango mining district in central Mexico (n = 79) and communities with similar socioeconomic conditions that were outside the mining district (n = 93) participated in the cross-sectional evaluation. The revised version of the Wechsler Intelligence Scale for Children adapted for the Mexican population was applied. Concentrations of Mn in blood (MnB) and hair (MnH) were used as biomarkers of exposure. Results Exposed children had significantly higher median values for MnH (12.6 μg/g) and MnB (9.5 μg/L) than did nonexposed children (0.6 μg/g and 8.0 μg/L, respectively). MnH was inversely associated with Verbal IQ [β = −0.29; 95% confidence interval (CI), −0.51 to −0.08], Performance IQ (β = −0.08; 95% CI, −0.32 to 0.16), and Total Scale IQ (β = −0.20; 95% CI, −0.42 to 0.02). MnB was inversely but nonsignificantly associated with Total and Verbal IQ score. Age and sex significantly modified associations of MnH, with the strongest inverse associations in young girls and little evidence of associations in boys at any age. Associations with MnB did not appear to be modified by sex but appeared to be limited to younger study participants. Conclusions The findings from this study suggest that airborne Mn environmental exposure is inversely associated with intellectual function in young school-age children. PMID:20936744

Intellectual function in Mexican children living in a mining area and environmentally exposed to manganese.

PubMed

Riojas-Rodríguez, Horacio; Solís-Vivanco, Rodolfo; Schilmann, Astrid; Montes, Sergio; Rodríguez, Sandra; Ríos, Camilo; Rodríguez-Agudelo, Yaneth

2010-10-01

Excessive exposure to manganese (Mn), an essential trace element, has been shown to be neurotoxic, especially when inhaled. Few studies have examined potential effects of Mn on cognitive functions of environmentally exposed children. This study was intended to estimate environmental exposure to Mn resulting from mining and processing and to explore its association with intellectual function of school-age children. Children between 7 and 11 years of age from the Molango mining district in central Mexico (n = 79) and communities with similar socioeconomic conditions that were outside the mining district (n = 93) participated in the cross-sectional evaluation. The revised version of the Wechsler Intelligence Scale for Children adapted for the Mexican population was applied. Concentrations of Mn in blood (MnB) and hair (MnH) were used as biomarkers of exposure. Exposed children had significantly higher median values for MnH (12.6 μg/g) and MnB (9.5 μg/L) than did nonexposed children (0.6 μg/g and 8.0 μg/L, respectively). MnH was inversely associated with Verbal IQ [β = -0.29; 95% confidence interval (CI), -0.51 to -0.08], Performance IQ (β = -0.08; 95% CI, -0.32 to 0.16), and Total Scale IQ (β = -0.20; 95% CI, -0.42 to 0.02). MnB was inversely but nonsignificantly associated with Total and Verbal IQ score. Age and sex significantly modified associations of MnH, with the strongest inverse associations in young girls and little evidence of associations in boys at any age. Associations with MnB did not appear to be modified by sex but appeared to be limited to younger study participants. The findings from this study suggest that airborne Mn environmental exposure is inversely associated with intellectual function in young school-age children.

45 CFR 170.299 - Incorporation by reference.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Drug Programs Prescriber/Pharmacist Interface SCRIPT Standard, Implementation Guide, Version 8, Release.... (1) National Council for Prescription Drug Programs Prescriber/Pharmacist Interface SCRIPT Standard...

Louisiana SIP: LAC 33:III Ch 23 Subchap B, §2303--Aluminum Plants, §2303 Standards for Horizontal Stud Soderberg Primary Aluminum Plants and Prebake Primary Aluminum Plants; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAad34 - Revised)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch 23 Subchap B, §2303--Aluminum Plants, §2303 Standards for Horizontal Stud Soderberg Primary Aluminum Plants and Prebake Primary Aluminum Plants; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAad34 - Revised)

Classifier-Guided Sampling for Complex Energy System Optimization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Backlund, Peter B.; Eddy, John P.

2015-09-01

This report documents the results of a Laboratory Directed Research and Development (LDRD) effort enti tled "Classifier - Guided Sampling for Complex Energy System Optimization" that was conducted during FY 2014 and FY 2015. The goal of this proj ect was to develop, implement, and test major improvements to the classifier - guided sampling (CGS) algorithm. CGS is type of evolutionary algorithm for perform ing search and optimization over a set of discrete design variables in the face of one or more objective functions. E xisting evolutionary algorithms, such as genetic algorithms , may require a large number of omore » bjecti ve function evaluations to identify optimal or near - optimal solutions . Reducing the number of evaluations can result in significant time savings, especially if the objective function is computationally expensive. CGS reduce s the evaluation count by us ing a Bayesian network classifier to filter out non - promising candidate designs , prior to evaluation, based on their posterior probabilit ies . In this project, b oth the single - objective and multi - objective version s of the CGS are developed and tested on a set of benchm ark problems. As a domain - specific case study, CGS is used to design a microgrid for use in islanded mode during an extended bulk power grid outage.« less

Dynamic Polymorphic Reconfiguration to Effectively Cloak a Circuit’s Function

DTIC Science & Technology

2011-03-24

86 B . RSA Traces . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89 2.1...56 22 SEMA of Separate Square and Multiply Trace with key (E B5) - RSA Version B ...56 23 Separate Square and Multiply Trace after signal processing - RSA Version B

40 CFR 180.613 - Flonicamid; tolerances for residues.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., meat 0.08 Cattle, meat byproducts 0.08 Egg 0.04 Goat, fat 0.03 Goat, meat 0.08 Goat, meat byproducts 0.08 Horse, fat 0.03 Horse, meat 0.08 Horse, meat byproducts 0.08 Milk 0.03 Poultry, fat 0.03 Poultry, meat 0.03 Poultry, meat byproducts 0.03 Sheep, fat 0.03 Sheep, meat 0.08 Sheep, meat byproducts 0.08 (b...

Appendix 2. Guide for Running AgMIP Climate Scenario Generation Tools with R in Windows, Version 2.3

NASA Technical Reports Server (NTRS)

Hudson, Nicholas; Ruane, Alexander Clark

2013-01-01

This Guide explains how to create climate series and climate change scenarios by using the AgMip Climate team's methodology as outlined in the AgMIP Guide for Regional Assessment: Handbook of Methods and Procedures. It details how to: install R and the required packages to run the AgMIP Climate Scenario Generation scripts, and create climate scenarios from CMIP5 GCMs using a 30-year baseline daily weather dataset. The Guide also outlines a workflow that can be modified for application to your own climate data.

Ada style guide (version 1.1)

NASA Technical Reports Server (NTRS)

Seidewitz, Edwin V.; Agresti, William; Ferry, Daniel; Lavallee, David; Maresca, Paul; Nelson, Robert; Quimby, Kelvin; Rosenberg, Jacob; Roy, Daniel; Shell, Allyn

1987-01-01

Ada is a programming language of considerable expressive power. The Ada Language Reference Manual provides a thorough definition of the language. However, it does not offer sufficient guidance on the appropriate use of Ada's powerful features. For this reason, the Goddard Space Flight Center Ada User's Group has produced this style guide which addresses such program style issues. The guide covers three areas of Ada program style: the structural decomposition of a program; the coding and the use of specific Ada features; and the textural formatting of a program.

Intracorneal ring segments implantation followed by same-day topography-guided PRK and corneal collagen CXL in low to moderate keratoconus.

PubMed

Al-Tuwairqi, Waleed; Sinjab, Mazen M

2013-01-01

To evaluate the safety and efficacy of intrastromal corneal ring segments (ICRS) implantation followed by same-day topography-guided photorefractive keratectomy (PRK) and ultraviolet-A/riboflavin collagen cross-linking (CXL) in patients with low to moderate keratoconus. Patients with low to moderate keratoconus and contact lens intolerance were included in the study. All patients first underwent femtosecond laser-enabled placement of ICRS (Keraring, Mediphacos) (first step). Same-day topography-guided PRK and CXL (second step) were subsequently performed in all patients after the refraction was stable (average 6 months [range: 3 to 11 months]). Thirteen eyes from 13 patients were included in the study. Based on values before the first step and 6 months after the second step, significant improvements were noted in uncorrected distance visual acuity (0.7±0.32 logMAR vs 0.08±0.08 logMAR), corrected distance visual acuity (CDVA) (0.16±0.19 logMAR vs 0.02±0.04 log-MAR), sphere (-3.65±3.08 diopters [D] vs 0.06±1.6 D), astigmatism (-3.31±1.5 D vs -0.98±0.75 D), average K (47.28±1.99 D vs 41.42±3.22 D), and coma (2.36±1.23 μm vs 1.47±0.68 μm) (P<.05). Approximately 63% of eyes gained ⩾2 lines of CDVA, whereas no change in CDVA was reported in ∼27% of eyes. No eyes lost lines of CDVA. The combination of ICRS implantation followed by sequential same-day topography-guided PRK/CXL may be a reasonable option for improving visual acuity in patients with low to moderate keratoconus. Copyright 2013, SLACK Incorporated.

MODFLOW-2000, the U.S. Geological Survey modular ground-water model : user guide to the LMT6 package, the linkage with MT3DMS for multi-species mass transport modeling

USGS Publications Warehouse

Zheng, Chunmiao; Hill, Mary Catherine; Hsieh, Paul A.

2001-01-01

MODFLOW-2000, the newest version of MODFLOW, is a computer program that numerically solves the three-dimensional ground-water flow equation for a porous medium using a finite-difference method. MT3DMS, the successor to MT3D, is a computer program for modeling multi-species solute transport in three-dimensional ground-water systems using multiple solution techniques, including the finite-difference method, the method of characteristics (MOC), and the total-variation-diminishing (TVD) method. This report documents a new version of the Link-MT3DMS Package, which enables MODFLOW-2000 to produce the information needed by MT3DMS, and also discusses new visualization software for MT3DMS. Unlike the Link-MT3D Packages that coordinated previous versions of MODFLOW and MT3D, the new Link-MT3DMS Package requires an input file that, among other things, provides enhanced support for additional MODFLOW sink/source packages and allows list-directed (free) format for the flow model produced flow-transport link file. The report contains four parts: (a) documentation of the Link-MT3DMS Package Version 6 for MODFLOW-2000; (b) discussion of several issues related to simulation setup and input data preparation for running MT3DMS with MODFLOW-2000; (c) description of two test example problems, with comparison to results obtained using another MODFLOW-based transport program; and (d) overview of post-simulation visualization and animation using the U.S. Geological Survey?s Model Viewer.

Television Viewing = Lo que los padres de estudiantes dotados necesitan saber sobre ver...television. What Parents of Gifted Students Need To Know about...Series.

ERIC Educational Resources Information Center

Siegle, Del, Ed.

This booklet (Practitioner's Guide), in both an English version and a Spanish version, is intended to help parents apply the findings of research to parental mediation of television viewing by their children, including gifted children. Research facts are briefly summarized and implications for the home are drawn. Suggestions for parents are…

Change Detection via Selective Guided Contrasting Filters

NASA Astrophysics Data System (ADS)

Vizilter, Y. V.; Rubis, A. Y.; Zheltov, S. Y.

2017-05-01

Change detection scheme based on guided contrasting was previously proposed. Guided contrasting filter takes two images (test and sample) as input and forms the output as filtered version of test image. Such filter preserves the similar details and smooths the non-similar details of test image with respect to sample image. Due to this the difference between test image and its filtered version (difference map) could be a basis for robust change detection. Guided contrasting is performed in two steps: at the first step some smoothing operator (SO) is applied for elimination of test image details; at the second step all matched details are restored with local contrast proportional to the value of some local similarity coefficient (LSC). The guided contrasting filter was proposed based on local average smoothing as SO and local linear correlation as LSC. In this paper we propose and implement new set of selective guided contrasting filters based on different combinations of various SO and thresholded LSC. Linear average and Gaussian smoothing, nonlinear median filtering, morphological opening and closing are considered as SO. Local linear correlation coefficient, morphological correlation coefficient (MCC), mutual information, mean square MCC and geometrical correlation coefficients are applied as LSC. Thresholding of LSC allows operating with non-normalized LSC and enhancing the selective properties of guided contrasting filters: details are either totally recovered or not recovered at all after the smoothing. These different guided contrasting filters are tested as a part of previously proposed change detection pipeline, which contains following stages: guided contrasting filtering on image pyramid, calculation of difference map, binarization, extraction of change proposals and testing change proposals using local MCC. Experiments on real and simulated image bases demonstrate the applicability of all proposed selective guided contrasting filters. All implemented filters provide the robustness relative to weak geometrical discrepancy of compared images. Selective guided contrasting based on morphological opening/closing and thresholded morphological correlation demonstrates the best change detection result.

Aerospace Technologies of the 21st Century: New Technologies of Experimental Research and Simulation Held in Berlin, Germany on 8-9 June 2000

DTIC Science & Technology

2000-01-01

11. Gal-Or, B., U.S. PAT. Appl .. 08/516870/1, Aug. 18, 1995 & Isr. Pat. Appl . 113636, May 7,1995 by Gal- Or, Lichtsinder and Sherbaum.. 12. Gal-Or...B., U.S. PAT. Appl . 08/516870/2, Aug. 18, 1995 & Isr. Pat. Appl . 111265, Oct. 12,94 by Gal- Or, Lichtsinder and Sherbaum. 13. Gal-Or, B., U.S. PAT... Appl . 08/554087, Nov. 6,1995. 14. Gal-Or, B., ?Proposed Flight Testing Standards for Engine Thrust Vectoring to Maximize Kill Ra- tios, Post-Stall

Comparing two versions of the Karolinska Sleepiness Scale (KSS).

PubMed

Miley, Anna Åkerstedt; Kecklund, Göran; Åkerstedt, Torbjörn

2016-01-01

The Karolinska Sleepiness Scale (KSS) is frequently used to study sleepiness in various contexts. However, it exists in two versions, one with labels on every other step (version A), and one with labels on every step (version B) on the 9-point scale. To date, there are no studies examining whether these versions can be used interchangeably. The two versions were here compared in a 24 hr wakefulness study of 12 adults. KSS ratings were obtained every hour, alternating version A and B. Results indicated that the two versions are highly correlated, do not have different response distributions on labeled and unlabeled steps, and that the distributions across all steps have a high level of correspondence (Kappa = 0.73). It was concluded that the two versions are quite similar.

What Works Clearinghouse Study Review Guide Instructions for Reviewing Single-Case Designs Studies

ERIC Educational Resources Information Center

What Works Clearinghouse, 2016

2016-01-01

This document provides step-by-step instructions on how to complete the Study Review Guide (SRG, Version S3, V2) for single-case designs (SCDs). Reviewers will complete an SRG for every What Works Clearinghouse (WWC) review. A completed SRG should be a reviewer's independent assessment of the study, relative to the criteria specified in the review…

User Guide to the 1981 LC (Language Census) Database. Version 1.2.

ERIC Educational Resources Information Center

Kimbrough, Kenneth L.

This guide is designed to introduce potential users of the California Language Census data to a means of accessing that data using an online, interactive computer system known as "1981 LC." The language census is an actual count of the numbers of pupils with a primary language other than English in California public schools as of March 1…

Cutting through the Hype: The Essential Guide to School Reform. Revised, Expanded, and Updated Edition

ERIC Educational Resources Information Center

David, Jane L.; Cuban, Larry

2010-01-01

"Cutting Through the Hype: The Essential Guide to School Reform" is a revised, expanded, and updated version of the classic work by Jane L. David and Larry Cuban. It offers balanced analyses of 23 currently popular school reform strategies, from teacher performance pay and putting mayors in charge to turnaround schools and data-driven instruction.…

User’s Guide for T.E.S.T. (version 4.2) (Toxicity Estimation Software Tool) A Program to Estimate Toxicity from Molecular Structure

EPA Science Inventory

The user's guide describes the methods used by TEST to predict toxicity and physical properties (including the new mode of action based method used to predict acute aquatic toxicity). It describes all of the experimental data sets included in the tool. It gives the prediction res...

NetWeaver for EMDS user guide (version 1.1): a knowledge base development system.

Treesearch

Keith M. Reynolds

1999-01-01

The guide describes use of the NetWeaver knowledge base development system. Knowledge representation in NetWeaver is based on object-oriented fuzzy-logic networks that offer several significant advantages over the more traditional rulebased representation. Compared to rule-based knowledge bases, NetWeaver knowledge bases are easier to build, test, and maintain because...

TEDS-M 2008 User Guide for the International Database. Supplement 2: National Adaptations of the TEDS-M Questionnaires

ERIC Educational Resources Information Center

Brese, Falk, Ed.

2012-01-01

This supplement contains all adaptations made by countries to the international version of the TEDS-M questionnaires under careful supervision of and approval by the TEDS-M International Study Center at Michigan State University. This information provides users of the TEDS-M International Database with a guide to evaluate the availability of…

Programming Design Guide for Computer Implementation of Job Aid for Selecting Instructional Setting. Final Report.

ERIC Educational Resources Information Center

Schulz, Russel E.; And Others

This Programming Design Guide (PDG) was developed to permit the offline Job Aid for Selecting Instructional Setting, which is one of 13 job aids presently available for use with the Instructional Systems Development (ISD) model, to be available in an inquiry-type, online version. It is intended to provide computer programmers with all of the…

Quantification of hepatitis C virus RNA in serum by branched DNA-based signal amplification assays.

PubMed

Pawlotsky, J M; Martinot-Peignoux, M; Poveda, J D; Bastie, A; Le Breton, V; Darthuy, F; Rémiré, J; Erlinger, S; Dhumeaux, D; Marcellin, P

1999-05-01

The objective of the study was to compare the clinical sensitivity and specificity of versions 1.0 and 2.0 of the branched DNA (bDNA)-based hepatitis C virus (HCV) RNA quantification assay, and also to compare the values yielded by the two versions according to the HCV genotype. Serum samples from 268 patients tested routinely by a non-quantitative HCV RNA PCR assay (group A) were tested with version 2.0 of the bDNA assay. Samples from 342 HCV PCR-positive patients with chronic hepatitis C eligible for interferon treatment (group B) were tested with both version 1.0 and version 2.0 of the bDNA assay. Version 2.0 had a clinical sensitivity of 92% (95% confidence interval (CI): 87-97%) in group A and 89% (86-92%) in group B. In group B, the gain in sensitivity with bDNA 2.0 was 16% relative to bDNA 1.0 (P < 0.001). The log values of the two assays correlated with samples positive by both assays (r = 0.83, P < 0.0001), but the distribution of values was larger in samples containing HCV genotypes 2 and 3. The mean ratio of assay 2.0/assay 1.0 values was 1.69 +/- 1.44 (range: 0.33-13.43). The mean ratio was close to 1 with samples containing genotype 1 or 4, but ranged from 0.33 to more than 5. The mean ratio was close to 3 with samples containing genotype 2 or 3, and ranged from 0.5 to more than 13. HCV RNA levels were significantly lower in samples containing genotype 4 than in those containing other genotypes. Sera from 200 anti-HCV-negative, HCV RNA PCR-negative blood donors (group C), and from 164 anti-HCV-negative patients with symptoms of chronic liver disease (group D) were used to assess the clinical specificity of bDNA 2.0. In addition, samples with an HCV RNA titer between 0.2 (assay cutoff) and 0.5 MEq/ml from a group of 546 patients tested routinely for HCV RNA load by bDNA 2.0 (group E) were retested by bDNA 2.0 and by qualitative PCR. The specificity of bDNA 2.0 was 100% (98-100%) in group C and 99% (97-100%) in group D. Among the 41 samples from group E, 38 were positive by bDNA 2.0 retesting (36 were PCR-positive) and three were negative by bDNA 2.0 retesting (all were PCR-positive). It is concluded that version 2.0 of the bDNA assay is markedly more sensitive than version 1.0 and has a good specificity. In contrast with version 1.0, version 2.0 is not influenced by the HCV genotype. The relationship between values obtained with assays 1.0 and 2.0 on clinical specimens is not linear, indicating that HCV RNA titers cannot reliably be calculated from the results of version 1.0.

Bioassay-guided isolation of saikosaponins with agonistic activity on 5-hydroxytryptamine 2C receptor from Bupleurum chinense and their potential use for the treatment of obesity.

PubMed

Sun, Chang-Li; Geng, Chang-An; Huang, Xiao-Yan; Ma, Yun-Bao; Zheng, Xiao-Hong; Yang, Tong-Hua; Chen, Xing-Long; Yin, Xiu-Juan; Zhang, Xue-Mei; Chen, Ji-Jun

2017-06-01

5-Hydroxytryptamine 2C (5-HT 2C ) receptor is one of the major targets of anti-obesity agents, due to its role in regulation of appetite. In the present study, the 70% EtOH extract of the roots of Bupleurum chinense was revealed to have agonistic activity on 5-HT 2C receptor, and the subsequent bioassay-guided isolation led to identification of several saikosaponins as the active constituents with 5-HT 2C receptor agonistic activity in vitro and anti-obesity activity in vivo. The new compound, 22-oxosaikosaponin d (1), was determined by extensive spectroscopic analyses (HR-ESI-MS, IR, and 1D and 2D NMR). The primary structure-activity relationship study suggested that the intramolecular ether bond between C-13 and C-28 and the number of sugars at C-3 position were closely related to the 5-HT 2C receptor agonistic activity. Saikosaponin a (3), the main saponin in B. chinense, showed obviously agonistic activity on 5-HT 2C receptor with an EC 50 value of 21.08 ± 0.33 μmol·L -1 in vitro and could reduce food intake by 39.1% and 69.2%, and weight gain by 13.6% and 16.4%, respectively, at 3.0 and 6.0 mg·kg -1 in vivo. This investigation provided valuable information for the potential use of B. chinense as anti-obesity agent. Copyright © 2017 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

Linguistic Adaptation and Psychometric Properties of Tamil Version of General Oral Health Assessment Index-Tml.

PubMed

Appukuttan, D P; Vinayagavel, M; Balasundaram, A; Damodaran, L K; Shivaraman, P; Gunasshegaran, K

2015-01-01

Oral health has an impact on quality of life hence for research purpose validation of a Tamil version of General Oral Health Assessment Index would enable it to be used as a valuable tool among Tamil speaking population. In this study, we aimed to assess the psychometric properties of translated Tamil version of General Oral Health Assessment Index (GOHAI-Tml). Linguistic adaptation involved forward and backward blind translation process. Reliability was analyzed using test-retest, Cronbach alpha, and split half reliability. Inter-item and item-total correlation were evaluated using Spearman rank correlation. Convenience sampling was done, and 265 consecutive patients aged 20-70 years attending the outpatient department were recruited. Subjects were requested to fill a self-reporting questionnaire along with Tamil GOHAI version. Clinical examination was done on the same visit. Concurrent validity was measured by assessing the relationship between GOHAI scores and self-perceived oral health and general health status, satisfaction with oral health, need for dental treatment and esthetic satisfaction. Discriminant validity was evaluated by comparing the GOHAI scores with the objectively assessed clinical parameters. Exploratory factor analysis was done to examine the factor structure. Mean GOHAI-Tml was 52.7 (6.8, range 22-60, median 54). The mean number of negative impacts was 2 (2.4, range 0-11, median 1). The Spearman rank correlation for test-retest ranged from 0.8 to 0.9 (P < 0.001) for all the 12 items between visits. The Cronbach alpha for 265 samples was 0.8 suggesting good internal consistency and homogeneity between items. Item scale correlation ranged from 0.4 to 0.8 (P < 0.001). Concurrent and discriminant validity was established. Principal component analysis resulted in extraction of four factors which together accounted for 66.4% (7.9/12) variance. GOHAI-Tml has shown acceptable psychometric properties, so that it can be used as an efficient tool in identifying the impact of oral health on quality of life among the Tamil speaking population.

Atomoxetine treatment of attention-deficit/hyperactivity disorder in young adults with assessment of functional outcomes: a randomized, double-blind, placebo-controlled clinical trial.

PubMed

Durell, Todd M; Adler, Lenard A; Williams, Dave W; Deldar, Ahmed; McGough, James J; Glaser, Paul E; Rubin, Richard L; Pigott, Teresa A; Sarkis, Elias H; Fox, Bethany K

2013-02-01

Attention-deficit/hyperactivity disorder (ADHD) is associated with significant impairment in multiple functional domains. This trial evaluated efficacy in ADHD symptoms and functional outcomes in young adults treated with atomoxetine. Young adults (18-30 years old) with ADHD were randomized to 12 weeks of double-blind treatment with atomoxetine (n = 220) or placebo (n = 225). The primary efficacy measure of ADHD symptom change was Conners' Adult ADHD Rating Scale (CAARS): Investigator-Rated: Screening Version Total ADHD Symptoms score with adult prompts. Secondary outcomes scales included the Adult ADHD Quality of Life-29, Clinical Global Impression-ADHD-Severity, Patient Global Impression-Improvement, CAARS Self-Report, Behavior Rating Inventory of Executive Function-Adult Version Self-Report, and assessments of depression, anxiety, sleepiness, driving behaviors, social adaptation, and substance use. Atomoxetine was superior to placebo on CAARS: Investigator-Rated: Screening Version (atomoxetine [least-squares mean ± SE, -13.6 ± 0.8] vs placebo [-9.3 ± 0.8], 95% confidence interval [-6.35 to -2.37], P < 0.001), Clinical Global Impression-ADHD-Severity (atomoxetine [-1.1 ± 0.1] vs placebo [-0.7 ± 0.1], 95% confidence interval [-0.63 to -0.24], P < 0.001), and CAARS Self-Report (atomoxetine [-11.9 ± 0.8] vs placebo [-7.8 ± 0.7], 95% confidence interval [-5.94 to -2.15], P < 0.001) but not on Patient Global Impression-Improvement. In addition, atomoxetine was superior to placebo on Adult ADHD Quality of Life-29 and Behavior Rating Inventory of Executive Function-Adult Version Self-Report. Additional assessments failed to detect significant differences (P ≥ 0.05) between atomoxetine and placebo. The adverse event profile was similar to that observed in other atomoxetine studies. Nausea, decreased appetite, insomnia, dry mouth, irritability, dizziness, and dyspepsia were reported significantly more often with atomoxetine than with placebo. Atomoxetine reduced ADHD symptoms and improved quality of life and executive functioning deficits in young adults compared with placebo. Atomoxetine was also generally well tolerated.

[Simultaneous separation and detection of principal component isomer and related substances of raw material drug of ammonium glycyrrhizinate by RP-HPLC and structure confirmation].

PubMed

Zhao, Yan-Yan; Liu, Li-Yan; Han, Yuan-Yuan; Li, Yue-Qiu; Wang, Yan; Shi, Min-Jian

2013-08-01

A simple, fast and sensitive analytical method for the simultaneous separation and detection of 18alpha-glycyrrhizinic acid, 18beta-glycyrrhizinic acid, related substance A and related substance B by RP-HPLC and drug quality standard was established. The structures of principal component isomer and related substances of raw material drug of ammonium glycyrrhizinate have been confirmed. Reference European Pharmacopoeia EP7.0 version, British Pharmacopoeia 2012 version, National Drug Standards of China (WS 1-XG-2002), domestic and international interrelated literature were referred to select the composition of mobile phase. The experimental parameters including salt concentration, pH, addition quantities of organic solvent, column temperature and flow rate were optimized. Finally, the assay was conducted on a Durashell-C18 column (250 mm x 4.6 mm, 5 microm) with 0.01 mol x mL(-1) ammonium perchlorate (add ammonia to adjust the pH value to 8.2) -methanol (48 : 52) as mobile phase at the flow rate of 0.8 mL x min(-1), and the detection wavelength was set at 254 nm. The column temperature was 50 degrees C and the injection volume was 10 microL. The MS, NMR, UV and RP-HPLC were used to confirm the structures of principal component isomer and related substances of raw material drug of ammonium glycyrrhizinate. Under the optimized separation conditions, the calibration curves of 18 alpha-glycyrrhizinic acid, 18beta-glycyrrhizinic acid, related substance A and related substance B showed good linearity within the concentration of 0.50-100 microg x mL(-1) (r = 0.999 9). The detection limits for 18alpha-glycyrrhizinic acid, 18beta-glycyrrhizinic acid, related substance A and related substance B were 0.15, 0.10, 0.10, 0.15 microg x mL(-1) respectively. The method is sensitive, reproducible and the results are accurate and reliable. It can be used for chiral resolution of 18alpha-glycyrrhizinic acid, 18Pbeta-glycyrrhizinic acid, and detection content of principal component and related substances of raw material drug of ammonium glycyrrhizinate. It is concluded that the separation of principal component isomer of raw material drug of ammonium glycyrrhizinate and the validity of the substance's structure assignments of retention time being 1.2 in the European pharmacopoeia EP7.0 version, British pharmacopoeia 2012 version remains open to question. It may be of practical value for the quality control of raw material drug, preparation, and Chinese herbal medicine of ammonium glycyrrhizinate.

USSAERO computer program development, versions B and C

NASA Technical Reports Server (NTRS)

Woodward, F. A.

1980-01-01

Versions B and C of the unified subsonic and supersonic aerodynamic analysis program, USSAERO, are described. Version B incorporates a new symmetrical singularity method to provide improved surface pressure distributions on wings in subsonic flow. Version C extends the range of application of the program to include the analysis of multiple engine nacelles or finned external stores. In addition, nonlinear compressibility effects in high subsonic and supersonic flows are approximated using a correction based on the local Mach number at panel control points. Several examples are presented comparing the results of these programs with other panel methods and experimental data.

Building America Best Practices Series Volume 11. Builders Challenge Guide to 40% Whole-House Energy Savings in the Marine Climate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baechler, Michael C.; Gilbride, Theresa L.; Hefty, Marye G.

2010-09-01

This best practices guide is the eleventh in a series of guides for builders produced by the U.S. Department of Energy’s Building America Program. This guide book is a resource to help builders design and construct homes that are among the most energy-efficient available, while addressing issues such as building durability, indoor air quality, and occupant health, safety, and comfort. With the measures described in this guide, builders in the marine climate (portions of Washington, Oregon, and California) can achieve homes that have whole house energy savings of 40% over the Building America benchmark (a home built to mid-1990s buildingmore » practices roughly equivalent to the 1993 Model Energy Code) with no added overall costs for consumers. These best practices are based on the results of research and demonstration projects conducted by Building America’s research teams. The guide includes information for managers, designers, marketers, site supervisors, and subcontractors, as well as case studies of builders who are successfully building homes that cut energy use by 40% in the marine climate. This document is available on the web at www.buildingamerica.gov. This report was originally cleared 06-29-2010. This version is Rev 1 cleared in Nov 2010. The only change is the reference to the Energy Star Windows critieria shown on pg 8.25 was updated to match the criteria - Version 5.0, 04/07/2009, effective 01/04/2010.« less

AGARD (Advisory Group for Aerospace Research and Development) Guide to Aerospace and Defence Technical Report Series in NATO Countries.

DTIC Science & Technology

1987-05-01

am a01 a a 4 a amaa am s as. sae . a s s m ma m a in in I. c-n g ., Onu g n u U g a , u r(D E O n , in E rE n a L n n i a n a n a ug n n i an En a u g...08 C a C 0 w4 4*44* 4 >,06U66b.01.4.. C614 000 00 0L*C0 0@I. 00.- 0 10 CCC -1CC CC C -.4 014.1 " 0 4-A I a.~~’- ~’~4---- 4140 . 14 ~C 0ac30OOOO 4904 a.𔃾

Mercury and Chemical Management in Schools: An Instructor's Guide for Trainers in Schools in Southeast Asia. EPA 747-R-08-003

ERIC Educational Resources Information Center

US Environmental Protection Agency, 2008

2008-01-01

This instructor's guide is a tool to help instructors promote the concepts of safe mercury and chemical management in schools. It contains three types of materials: (1) Guidance for the instructor/facilitator on conducting the training course (Section I); (2) A copy of all presentations with talking points as appropriate (Section II); and (3)…

Melanoma Staging: Evidence-Based Changes in the American Joint Committee on Cancer Eighth Edition Cancer Staging Manual

PubMed Central

Gershenwald, Jeffrey E.; Scolyer, Richard A.; Hess, Kenneth R.; Sondak, Vernon K.; Long, Georgina V.; Ross, Merrick I.; Lazar, Alexander J.; Faries, Mark B.; Kirkwood, John M.; McArthur, Grant A.; Haydu, Lauren E.; Eggermont, Alexander M. M.; Flaherty, Keith T.; Balch, Charles M.; Thompson, John F.

2018-01-01

To update the melanoma staging system of the American Joint Committee on Cancer (AJCC) a large database was assembled comprising >46,000 patients from 10 centers worldwide with stages I, II, and III melanoma diagnosed since 1998. Based on analyses of this new database, the existing seventh edition AJCC stage IV database, and contemporary clinical trial data, the AJCC Melanoma Expert Panel introduced several important changes to the Tumor, Nodes, Metastasis (TNM) classification and stage grouping criteria. Key changes in the eighth edition AJCC Cancer Staging Manual include: 1) tumor thickness measurements to be recorded to the nearest 0.1 mm, not 0.01 mm; 2) definitions of T1a and T1b are revised (T1a, <0.8 mm without ulceration; T1b, 0.8–1.0 mm with or without ulceration or <0.8 mm with ulceration), with mitotic rate no longer a T category criterion; 3) pathological (but not clinical) stage IA is revised to include T1b N0 M0 (formerly pathologic stage IB); 4) the N category descriptors “microscopic” and “macroscopic” for regional node metastasis are redefined as “clinically occult” and “clinically apparent”; 5) prognostic stage III groupings are based on N category criteria and T category criteria (ie, primary tumor thickness and ulceration) and increased from 3 to 4 subgroups (stages IIIA–IIID); 6) definitions of N subcategories are revised, with the presence of microsatellites, satellites, or in-transit metastases now categorized as N1c, N2c, or N3c based on the number of tumor-involved regional lymph nodes, if any; 7) descriptors are added to each M1 subcategory designation for lactate dehydrogenase (LDH) level (LDH elevation no longer upstages to M1c); and 8) a new M1d designation is added for central nervous system metastases. This evidence-based revision of the AJCC melanoma staging system will guide patient treatment, provide better prognostic estimates, and refine stratification of patients entering clinical trials. PMID:29028110

A NetCDF version of the two-dimensional energy balance model based on the full multigrid algorithm

NASA Astrophysics Data System (ADS)

Zhuang, Kelin; North, Gerald R.; Stevens, Mark J.

A NetCDF version of the two-dimensional energy balance model based on the full multigrid method in Fortran is introduced for both pedagogical and research purposes. Based on the land-sea-ice distribution, orbital elements, greenhouse gases concentration, and albedo, the code calculates the global seasonal surface temperature. A step-by-step guide with examples is provided for practice.

ORA User’s Guide 2013

DTIC Science & Technology

2013-06-03

and a C++ computational backend . The most current version of ORA (3.0.8.5) software is available on the casos website: http://casos.cs.cmu.edu...optimizing a network’s design structure. ORA uses a Java interface for ease of use, and a C++ computational backend . The most current version of ORA...Eigenvector Centrality : Node most connected to other highly connected nodes. Assists in identifying those who can mobilize others Entity Class

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

PubMed

Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

2016-08-01

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Spectroscopy of the novae M31N_2008-08a and M31N_2008-08b

NASA Astrophysics Data System (ADS)

Di Mille, F.; Ciroi, S.; Orio, M.; Rafanelli, P.; Bianchini, A.; Nelson, T.; Andreuzzi, G.

2008-09-01

We obtained low resolution spectra of the two optical nova candidates in M31 (see ATEL #1654). The spectra were obtained with the 3.5-m Telescopio Nazionale Galileo of INAF equipped with the DOLORES spectrograph and camera (spectral range 330-790 nm, resolution 1.2 nm) on Aug 17.13 for 2008-08a and on Aug 17.17 for 2008-08b (8 days after the discovery of both novae, which were below the detection limits 2 days earlier).

Military Aircraft Modernization: A Better Solution to Manage the Fighter Shortfall - the Sole Answer is NOT the F-35 Program

DTIC Science & Technology

2017-04-21

oclc. org /eds/ detai I/ detai l?vid=5 &sid=5b9e08 b 7-0abf- 4502-a8 l d-42c5 l Od59863%40sessionmgr I 07 &hid= I 04&bdata=JnNpdGU9ZWRzLWxpdm...eds.b.ebscohost.com.nduezproxy.idm.oclc. org /eds/detail/detail?vid=9&sid=5b9e08b7-0abf-4502-a8 l d-42c5 l Od59863%40sessionmgr I 07 &hid= I 04&bdata...nduezproxy. i dm. ocl c. org / eds/pdfviewer/pdfvi ewer?vid = l 3&sid=5b9e08b7-0abf-4502-a8 l d-42c5 l Od59863%40sessionmgr l 07&hid= l 04 (accessed December

Your Child with Tuberculosis: A Guide for Parents and Guardians = Su Nino con Tuberculosis: Un Manual para Los Padres.

ERIC Educational Resources Information Center

Amaro, Rodolfo

Presented in both Spanish and English versions, this booklet is a guide for parents and guardians of children who have tuberculosis (TB). The booklet is organized around specific questions covering topics such as the causes and spread of TB, demographics of TB sufferers, detecting and curing TB, TB treatment and medications, research on the…

IPM Standards for Schools: A Program for Reducing Pest and Pesticide Risks in Schools and Other Sensitive Environments. Version 2.0.

ERIC Educational Resources Information Center

Green, Thomas A., Ed.

This guide presents Integrated Pest Management (IPM) practice standards for educational facilities to help schools become certified in providing effective and safe pest control. The guide is divided into two parts with three modules each for both buildings and grounds. The first module addresses building the IPM foundation to meet all legal…

MINIVER upgrade for the AVID system. Volume 2: LANMIN input guide

NASA Technical Reports Server (NTRS)

Engel, C. D.; Schmitz, C. P.

1983-01-01

In order to effectively incorporate MINIVER into the AVID system, several changes to MINIVER were made. The thermal conduction options in MINIVER were removed and a new Explicit Interactive Thermal Structures (EXITS) code was developed. Many upgrades to the MINIVER code were made and a new Langley version of MINIVER called LANMIN was created. A user input guide for LANMIN is provided.

ROMI-3: Rough-Mill Simulator Version 3.0: User's Guide

Treesearch

Joel M. Weiss; R. Edward Thomas; R. Edward Thomas

2005-01-01

ROMI-3 Rough-Mill Simulator is a software package that simulates current industrial practices for rip-first and chop-first lumber processing. This guide shows the user how to set up and examine the results of simulations of current or proposed mill practices. ROMI-3 accepts cutting bills with as many as 600 combined solid and/or panel part sizes. Plots of processed...

Building Your Baby's Brain: A Parent's Guide to the First Five Years = Como estimular el cerebro infantil: Una guia para padres de familia.

ERIC Educational Resources Information Center

Dodge, Diane Trister; Heroman, Cate

Noting that all parents can help their baby's brain to grow, this guide, in English- and Spanish-language versions, explores what science has learned about infant brain development and how parents and caregivers can influence cognitive development. Topics covered include: prenatal care, touching your baby, teaching about feelings and self-control,…

User's manual for three dimensional FDTD version B code for scattering from frequency-dependent dielectric materials

NASA Technical Reports Server (NTRS)

Beggs, John H.; Luebbers, Raymond J.; Kunz, Karl S.

1992-01-01

The Penn State Finite Difference Time Domain Electromagnetic Code Version B is a three dimensional numerical electromagnetic scattering code based upon the Finite Difference Time Domain Technique (FDTD). The supplied version of the code is one version of our current three dimensional FDTD code set. This manual provides a description of the code and corresponding results for several scattering problems. The manual is organized into 14 sections: introduction, description of the FDTD method, operation, resource requirements, Version B code capabilities, a brief description of the default scattering geometry, a brief description of each subroutine, a description of the include file, a discussion of radar cross section computations, a discussion of some scattering results, a sample problem setup section, a new problem checklist, references and figure titles.

Improvements to the CATS Cloud-Aerosol Data Products and Implications for the Space-Based Lidar Data Record

NASA Astrophysics Data System (ADS)

Yorks, J. E.; McGill, M. J.; Nowottnick, E. P.; Palm, S. P.; Hlavka, D. L.; Selmer, P. A.; Rodier, S. D.; Vaughan, M.; Pauly, R.

2017-12-01

The Cloud-Aerosol Transport System (CATS) is an elastic backscatter lidar that has generated over 175 billion laser pulses on-orbit from the International Space Station (ISS) since February 2015. The CATS instrument was designed to demonstrate new in-space technologies for future Earth Science missions while also providing properties of clouds and aerosols such as: layer height/thickness, backscatter, optical depth, extinction, and feature type. Despite the "tech demo" nature of CATS and the lack of a funded science team, the research community is increasingly embracing CATS data. New CATS data products, the most acurrate yet, were released in the summer of 2017. The major algorithm changes made in L1B Version 2-08 (V2-08) focused on the backscatter calibration and the inclusion of a new flag to notify users of granules with depolarization ratio values of poor quality. Several changes were made to the molecular folding correction factor and calibration algorithms that result in favorable comparisons between CATS, CALIPSO, and modeled Rayleigh 1064 nm backscatter profiles. Given that the 1064 nm attenuated total backscatter and depolarization ratio are used to retrieve nearly all L2O data products, the accuracy of the L2O products has also improved. Several changes were made in CATS L2O Version 2-00 data products to improve cloud and aerosol detection. The CATS L2O data now includes layer detection at both 5 and 60 km horizontal resolutions to increase daytime detection of thin cirrus and aerosol layers over land. Horizontal persistence tests prevent superficial "striping" that was visible in vertical feature mask images for horizontally homogeneous cloud and aerosol layers. Also, the absolute uncertainties for all the L2O parameters are now reported in the CATS data products. Given the uncertain status of continued CALIPSO operations, these updated CATS data products may be the only space-based lidar data record that continues into the 2018 timeframe.

FLASH_TISA_Terra+Aqua_Version3C

Atmospheric Science Data Center

2018-04-04

... Cloud Particle Phase Cloud Infrared Emissivity Cloud Base Pressure Surface (Radiative) Flux TOA Flux Surface Types Albedo LW Flux Order Data:  Earthdata Search:  Order Data Guide Documents:  ...

National Counterdrug Center (NCC) Simulation System Operational Requirements Document (ORD) Version 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Holter, Gregory M

2001-01-26

This Operational Requirements Document (ORD) describes the capabilities that need to be incorporated in the NCC interactive simulation system being developed under the auspices of the NCC development program. The ORD addresses the necessary capabilities (i.e. what the system needs to be able to do); it defines the envelope of situations and circumstances that the NCC system must be able to represent and operate within. The NCC system will be developed in modules over a period of several years. This ORD, Version 2, supersedes the previous version. Future updates of this ORD are anticipated to be issued as needed tomore » guide the development of later versions of the NCC system.« less

Cross-cultural adaptation of the German version of the spinal stenosis measure.

PubMed

Wertli, Maria M; Steurer, Johann; Wildi, Lukas M; Held, Ulrike

2014-06-01

To validate the German version of the spinal stenosis measure (SSM), a disease-specific questionnaire assessing symptom severity, physical function, and satisfaction with treatment in patients with lumbar spinal stenosis. After translation, cross-cultural adaptation, and pilot testing, we assessed internal consistency, test-retest reliability, construct validity, and responsiveness of the SSM subscales. Data from a large Swiss multi-center prospective cohort study were used. Reference scales for the assessment of construct validity and responsiveness were the numeric rating scale, pain thermometer, and the Roland Morris Disability Questionnaire. One hundred and eight consecutive patients were included in this validation study, recruited from five different centers. Cronbach's alpha was above 0.8 for all three subscales of the SSM. The objectivity of the SSM was assessed using a partial credit approach. The model showed a good global fit to the data. Of the 108 patients 78 participated in the test-retest procedure. The ICC values were above 0.8 for all three subscales of the SSM. Correlations with reference scales were above 0.7 for the symptom and function subscales. For satisfaction subscale, it was 0.66 or above. Clinically meaningful changes of the reference scales over time were associated with significantly more improvement in all three SSM subscales (p < 0.001). Conclusion: The proposed version of the SSM showed very good measurement properties and can be considered validated for use in the German language.

The measurement of cognitive reactivity to sad mood in patients remitted from major depressive disorder.

PubMed

Figueroa, Caroline A; Mocking, Roel J T; Mahmoud, Gelera A; Koeter, Maarten W; Bockting, Claudi L; van der Does, Willem; Ruhe, Henricus G; Schene, Aart H

2018-02-27

Cognitive reactivity (CR) to sad mood is a risk factor for major depressive disorder (MDD). CR is usually measured by assessing change on the Dysfunctional Attitudes Scale (DAS-change) after sad mood-induction. It has, however, been suggested that the versions of the DAS (A/B) are not interchangeable, impacting the reliability and validity of the change score. The Leiden Index of Depression Sensitivity-Revised (LEIDS-R) is an alternative self-report measure of CR. Studies examining the relationship between LEIDS-R and DAS-change have shown mixed results. We examined whether scores of these CR measures differed between remitted MDD and controls, the relationship between these CR measures, and the effect of order of DAS administration on DAS-change. Cross-sectional design with two groups (remitted MDD and controls). Sixty-eight MDD patients remitted from ≥2 previous episodes, not taking antidepressants, and 43 never-depressed controls participated in a mood-induction and filled in the DAS-A/B in randomized order before and after mood-induction, and LEIDS-R separately. LEIDS-R scores and pre-mood-induction DAS scores were significantly higher in remitted MDD than controls (p < .001, Cohen's d = 1.48; p = .001, Cohen's d = 0.66, respectively). DAS-change did not differ between these groups (p = .67, Cohen's d = 0.08). LEIDS-R correlated with DAS-change (r = .30, p = .042), but only in the group that filled in DAS-B before DAS-A. In remitted MDD, DAS-change was dependent on the order of DAS versions before and after mood-induction (10.6 ± 19.0 vs. -1.2 ± 10.5, for order B-A and A-B, respectively), with a significant group × order interaction (p = .012). Existing DAS versions are not interchangeable, which compromises the usefulness of mood-inductions in clinical practice. The LEIDS-R seems a valid measure of cognitive vulnerability to depression. Clinical implications: Cognitive reactivity (CR) is a risk factor of depressive recurrence. The current measurement of CR, by assessing change on the Dysfunctional Attitudes Scale (DAS) after mood-induction, is not reliable. The Leiden Index Depression Sensitivity-Revised (LEIDS-R) is an alternative CR measure. In contrast to mood-induction, it reliably assesses depression vulnerability. The use of mood-inductions for clinical/research purposes is unnecessary. We were not able to examine the effect of previous treatment, which could have affected results as psychological treatments probably have differential effects on CR. Examining un-medicated patients may have led to selection of a sample not completely representative for the general MDD population. We did not administer both parallel versions of the DAS (A/B) before and after mood-induction. This might have provided better understanding of their differential sensitivity to change. © 2018 The Authors. British Journal of Clinical Psychology published by John Wiley & Sons Ltd on behalf of British Psychological Society.

The NTCIP guide : updated version 3

DOT National Transportation Integrated Search

2002-10-01

The transportation community has long needed transportation systems that could be built using devices and components that were interchangeable and interoperable. The National Transportation Communications for ITS Protocol (NTCIP) family of standards ...

Computer Graphics Research Laboratory Quarterly Progress Report Number 49, July-September 1993

DTIC Science & Technology

1993-11-22

20 Texture Sampling and Strength Guided Motion: Jeffry S. Nimeroff 23 21 Radiosity : Min-Zhi Shao 24 22 Blended Shape Primitives: Douglas DeCarlo 25 23...placement. "* Extensions of radiosity rendering. "* A discussion of blended shape primitives and the applications in computer vision and computer...user. Radiosity : An improved version of the radiosity renderer is included. This version uses a fast over- relaxation progressive refinement algorithm

The Female Sexual Function Index (FSFI): linguistic validation of the Italian version.

PubMed

Filocamo, Maria Teresa; Serati, Maurizio; Li Marzi, Vincenzo; Costantini, Elisabetta; Milanesi, Martina; Pietropaolo, Amelia; Polledro, Patrizio; Gentile, Barbara; Maruccia, Serena; Fornia, Samanta; Lauri, Irene; Alei, Rosanna; Arcangeli, Paola; Sighinolfi, Maria Chiara; Manassero, Francesca; Andretta, Elena; Palazzetti, Anna; Bertelli, Elena; Del Popolo, Giulio; Villari, Donata

2014-02-01

Although several new measurements for female sexual dysfunction (FSD) have recently been developed, the Female Sexual Function Index (FSFI) remains the gold standard for screening and one of the most widely used questionnaires. The Italian translation of the FSFI has been used in several studies conducted in Italy, but a linguistic validation of the Italian version does not exist. The aim of this study was to perform a linguistic validation of the Italian version of the FSFI. A multicenter cross-sectional study conducted in 14 urological and gynecological clinics, uniformly distributed over Italian territory. We performed all steps necessary to determine the reliability and the test-retest reliability of the Italian version of the FSFI. The study population was a convenience sample of 409 Italian women. The reliability of the questionnaire was calculated using Cronbach's alpha, which was considered weak, moderate, or high if its value was found less than 0.6, between 0.6 and 0.8, or equal to or greater than 0.8, respectively. The test-retest reliability was assessed for all women in the sample by calculating Pearson's concordance correlation coefficient for each domain and for the total score, both at baseline and after 15 days (r range between -1.00 to +1.00, where +1.00 indicates the strongest positive association). Cronbach's alpha coefficients for total and domain score were sufficiently high, ranging from 0.92 to 0.97 for the total sample. The test-retest procedure revealed that the concordance correlation coefficient was very high both for FSFI-I total score (Pearson's P = 0.93) and for each domain (Pearson's P always >0.92). For the first time in the literature, our study has produced a validated and reliable Italian version of the FSFI questionnaire. Consequently, the Italian FSFI can be used as a reliable tool for preliminary screening for female sexual dysfunction for Italian women. © 2013 International Society for Sexual Medicine.

Development and Large-Scale Validation of an Instrument to Assess Arabic-Speaking Students' Attitudes Toward Science

NASA Astrophysics Data System (ADS)

Abd-El-Khalick, Fouad; Summers, Ryan; Said, Ziad; Wang, Shuai; Culbertson, Michael

2015-11-01

This study is part of a large-scale project focused on 'Qatari students' Interest in, and Attitudes toward, Science' (QIAS). QIAS aimed to gauge Qatari student attitudes toward science in grades 3-12, examine factors that impact these attitudes, and assess the relationship between student attitudes and prevailing modes of science teaching in Qatari schools. This report details the development and validation of the 'Arabic-Speaking Students' Attitudes toward Science Survey' (ASSASS), which was specifically developed for the purposes of the QIAS project. The theories of reasoned action and planned behavior (TRAPB) [Ajzen, I., & Fishbein, M. (2005). The influence of attitudes on behavior. In D. Albarracín, B. T. Johnson, & M. P. Zanna (Eds.), The handbook of attitudes (pp. 173-221). Mahwah, NJ: Erlbaum] guided the instrument development. Development and validation of the ASSASS proceeded in 3 phases. First, a 10-member expert panel examined an initial pool of 74 items, which were revised and consolidated into a 60-item version of the instrument. This version was piloted with 369 Qatari students from the target schools and grade levels. Analyses of pilot data resulted in a refined version of the ASSASS, which was administered to a national probability sample of 3027 participants representing all students enrolled in grades 3-12 in the various types of schools in Qatar. Of the latter, 1978 students completed the Arabic version of the instrument. Analyses supported a robust, 5-factor model for the instrument, which is consistent with the TRAPB framework. The factors were: Attitudes toward science and school science, unfavorable outlook on science, control beliefs about ability in science, behavioral beliefs about the consequences of engaging with science, and intentions to pursue science.

CSMP Mathematics for the Intermediate Grades Part IV, Teacher's Guide. The Languages of Strings and Arrows. Geometry and Measurement. Probability and Statistics.

ERIC Educational Resources Information Center

CEMREL, Inc., St. Ann, MO.

This guide represents the final experimental version of a pilot project which was conducted in the United States between 1973 and 1976. The ideas and the manner of presentation are based on the works of Georges and Frederique Papy. They are recognized for having introduced colored arrow drawings ("papygrams") and models of our numeration…

CSMP Mathematics for the Intermediate Grades. Part V. Teacher's Guide. The Languages of Strings and Arrows. Geometry and Measurement. Probability and Statistics. Experimental Version.

ERIC Educational Resources Information Center

CEMREL, Inc., St. Louis, MO.

This Comprehensive School Mathematics Program (CSMP) guide is divided into three major parts. The first, the Languages of Strings and Arrows, opens with a suggested lesson order. Major sections cover instructional approaches for: (1) Games with Strings, (2) Necklaces, and (3) The Table Game. A Series of appendices is included. Part 2, Geometry and…

A Parent's Guide to Infant/Toddler Programs = Guia para los padres sobre los programas de cuidado infantil de 0-3 anos.

ERIC Educational Resources Information Center

Dodge, Diane Trister; Dombro, Amy Laura; Colker, Laura J.

Information on how warm and responsive care can help shape infants' and toddlers' development and their ability to learn can be reassuring for concerned parents. This guide, in English and Spanish versions, presents quality child care as a partnership between the child caregiver and the parents with the primary goal of benefiting the child. The…

Transforming guided waves with metamaterial waveguide cores

NASA Astrophysics Data System (ADS)

Viaene, S.; Ginis, V.; Danckaert, J.; Tassin, P.

2016-04-01

Metamaterials make use of subwavelength building blocks to enhance our control on the propagation of light. To determine the required material properties for a given functionality, i.e., a set of desired light flows inside a metamaterial device, metamaterial designs often rely on a geometrical design tool known as transformation optics. In recent years, applications in integrated photonics motivated several research groups to develop two-dimensional versions of transformation optics capable of routing surface waves along graphene-dielectric and metal-dielectric interfaces. Although guided electromagnetic waves are highly relevant to applications in integrated optics, no consistent transformation-optical framework has so far been developed for slab waveguides. Indeed, the conventional application of transformation optics to dielectric slab waveguides leads to bulky three-dimensional devices with metamaterial implementations both inside and outside of the waveguide's core. In this contribution, we develop a transformationoptical framework that still results in thin metamaterial waveguide devices consisting of a nonmagnetic metamaterial core of varying thickness [Phys. Rev. B 93.8, 085429 (2016)]. We numerically demonstrate the effectiveness and versatility of our equivalence relations with three crucial functionalities: a beam bender, a beam splitter and a conformal lens. Our devices perform well on a qualitative (comparison of fields) and quantitative (comparison of transmitted power) level compared to their bulky counterparts. As a result, the geometrical toolbox of transformation optics may lead to a plethora of integrated metamaterial devices to route guided waves along optical chips.

User's manual for three dimensional FDTD version B code for scattering from frequency-dependent dielectric materials

NASA Technical Reports Server (NTRS)

Beggs, John H.; Luebbers, Raymond J.; Kunz, Karl S.

1991-01-01

The Penn State Finite Difference Time Domain Electromagnetic Scattering Code Version B is a three dimensional numerical electromagnetic scattering code based upon the Finite Difference Time Domain Technique (FDTD). The supplied version of the code is one version of our current three dimensional FDTD code set. This manual provides a description of the code and corresponding results for several scattering problems. The manual is organized into fourteen sections: introduction, description of the FDTD method, operation, resource requirements, Version B code capabilities, a brief description of the default scattering geometry, a brief description of each subroutine, a description of the include file (COMMONB.FOR), a section briefly discussing Radar Cross Section (RCS) computations, a section discussing some scattering results, a sample problem setup section, a new problem checklist, references and figure titles.

Structural/aerodynamic Blade Analyzer (SAB) User's Guide, Version 1.0

NASA Technical Reports Server (NTRS)

Morel, M. R.

1994-01-01

The structural/aerodynamic blade (SAB) analyzer provides an automated tool for the static-deflection analysis of turbomachinery blades with aerodynamic and rotational loads. A structural code calculates a deflected blade shape using aerodynamic loads input. An aerodynamic solver computes aerodynamic loads using deflected blade shape input. The two programs are iterated automatically until deflections converge. Currently, SAB version 1.0 is interfaced with MSC/NASTRAN to perform the structural analysis and PROP3D to perform the aerodynamic analysis. This document serves as a guide for the operation of the SAB system with specific emphasis on its use at NASA Lewis Research Center (LeRC). This guide consists of six chapters: an introduction which gives a summary of SAB; SAB's methodology, component files, links, and interfaces; input/output file structure; setup and execution of the SAB files on the Cray computers; hints and tips to advise the user; and an example problem demonstrating the SAB process. In addition, four appendices are presented to define the different computer programs used within the SAB analyzer and describe the required input decks.

Trace contaminant control simulation computer program, version 8.1

NASA Technical Reports Server (NTRS)

Perry, J. L.

1994-01-01

The Trace Contaminant Control Simulation computer program is a tool for assessing the performance of various process technologies for removing trace chemical contamination from a spacecraft cabin atmosphere. Included in the simulation are chemical and physical adsorption by activated charcoal, chemical adsorption by lithium hydroxide, absorption by humidity condensate, and low- and high-temperature catalytic oxidation. Means are provided for simulating regenerable as well as nonregenerable systems. The program provides an overall mass balance of chemical contaminants in a spacecraft cabin given specified generation rates. Removal rates are based on device flow rates specified by the user and calculated removal efficiencies based on cabin concentration and removal technology experimental data. Versions 1.0 through 8.0 are documented in NASA TM-108409. TM-108409 also contains a source file listing for version 8.0. Changes to version 8.0 are documented in this technical memorandum and a source file listing for the modified version, version 8.1, is provided. Detailed descriptions for the computer program subprograms are extracted from TM-108409 and modified as necessary to reflect version 8.1. Version 8.1 supersedes version 8.0. Information on a separate user's guide is available from the author.

Validation of the French version of the Burn Specific Health Scale-Brief (BSHS-B) questionnaire.

PubMed

Gandolfi, S; Auquit-Auckbur, I; Panunzi, S; Mici, E; Grolleau, J-L; Chaput, B

2016-11-01

The Burn Specific Health Scale-Brief questionnaire is a widely validated tool for estimating the health related quality of life and for assessing the best multidisciplinary management of burn patients. The aim of this study was to translate the BSHS-B into French and to investigate its reliability and validity. According to the procedure proposed by the Scientific Advisory Committee of the Medical Outcomes Trust, the Burn Specific Health Scale-Brief (BSHS-B) was translated from the English version into French. In order to test the reliability of the French version of the BSHS-B, 53 burn patients French speakers completed the BSHS-B and SF-36 questionnaires from two to four years after burn. Ten of them have been re-tested at 6 months after the first evaluation. To evaluate clinical utility of the BSHS-F, internal consistency, construct validity (using SF-36) and stability in time were assessed using Cronbach's alpha statistic, Spearman rank test, and intra-class correlation coefficient respectively. The French version of the BSHS-B Cronbach's alpha coefficient was 0.93 and was >0.80 for all the sub-domains. French version of the BSHS-B and the SF-36 were positively correlated, all the associations were statistically significant (p<0.01). Intra-class correlation coefficients for test-retest ranged between 0.95 and 0.99 for the sub-domains. The intra-class correlation coefficient (ICC) for the total score was 0.98. The French version of the BSHS-B shows a robust rate of internal consistency, construct validity and stability in time, supporting its application in routine clinical practice as well as in international studies. Copyright © 2016 Elsevier Ltd and ISBI. All rights reserved.

Phylogenetic and Evolutionary History of Influenza B Viruses, which Caused a Large Epidemic in 2011–2012, Taiwan

PubMed Central

Yang, Ji-Rong; Huang, Yuan-Pin; Chang, Feng-Yee; Hsu, Li-Ching; Lin, Yu-Cheng; Huang, Hsiang-Yi; Wu, Fu-Ting; Wu, Ho-Sheng; Liu, Ming-Tsan

2012-01-01

The annual recurrence of the influenza epidemic is considered to be primarily associated with immune escape due to changes to the virus. In 2011–2012, the influenza B epidemic in Taiwan was unusually large, and influenza B was predominant for a long time. To investigate the genetic dynamics of influenza B viruses during the 2011–2012 epidemic, we analyzed the sequences of 4,386 influenza B viruses collected in Taiwan from 2004 to 2012. The data provided detailed insight into the flux patterns of multiple genotypes. We found that a re-emergent TW08-I virus, which was the major genotype and had co-circulated with the two others, TW08-II and TW08-III, from 2007 to 2009 in Taiwan, successively overtook TW08-II in March and then underwent a lineage switch in July 2011. This lineage switch was followed by the large epidemic in Taiwan. The whole-genome compositions and phylogenetic relationships of the representative viruses of various genotypes were compared to determine the viral evolutionary histories. We demonstrated that the large influenza B epidemic of 2011–2012 was caused by Yamagata lineage TW08-I viruses that were derived from TW04-II viruses in 2004–2005 through genetic drifts without detectable reassortments. The TW08-I viruses isolated in both 2011–2012 and 2007–2009 were antigenically similar, indicating that an influenza B virus have persisted for 5 years in antigenic stasis before causing a large epidemic. The results suggest that in addition to the emergence of new variants with mutations or reassortments, other factors, including the interference of multi-types or lineages of influenza viruses and the accumulation of susceptible hosts, can also affect the scale and time of an influenza B epidemic. PMID:23071751

75 FR 23574 - Airworthiness Directives; CFM International, S.A. CFM56-5B1/P, -5B2/P, -5B3/P, -5B3/P1, -5B4/P...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-04

... high-pressure compressor (HPC) of both engines. That AD also requires removing from service any engine... monitoring of EGT margin deterioration on engines in service to prevent two engines on an airplane from... 75 [deg]C; Removes FADEC software version 5.B.Q and earlier versions from the engine as mandatory...

A comparison of modified versions of the Static-99 and the Sex Offender Risk Appraisal Guide.

PubMed

Nunes, Kevin L; Firestone, Philip; Bradford, John M; Greenberg, David M; Broom, Ian

2002-07-01

The predictive validity of 2 risk assessment instruments for sex offenders, modified versions of the Static-99 and the Sex Offender Risk Appraisal Guide, was examined and compared in a sample of 258 adult male sex offenders. In addition, the independent contributions to the prediction of recidivism made by each instrument and by various phallometric indices were explored. Both instruments demonstrated moderate levels of predictive accuracy for sexual and violent (including sexual) recidivism. They were not significantly different in terms of their predictive accuracy for sexual or violent recidivism, nor did they contribute independently to the prediction of sexual or violent recidivism. Of the phallometric indices examined, only the pedophile index added significantly to the prediction of sexual recidivism, but not violent recidivism, above the Static-99 alone.

Planetary Mission Entry Vehicles Quick Reference Guide. Version 3.0

NASA Technical Reports Server (NTRS)

Davies, Carol; Arcadi, Marla

2006-01-01

This is Version 3.0 of the planetary mission entry vehicle document. Three new missions, Re-entry F, Hayabusa, and ARD have been added to t he previously published edition (Version 2.1). In addition, the Huyge ns mission has been significantly updated and some Apollo data correc ted. Due to the changing nature of planetary vehicles during the desi gn, manufacture and mission phases, and to the variables involved in measurement and computation, please be aware that the data provided h erein cannot be guaranteed. Contact Carol Davies at cdavies@mail.arc. nasa.gov to correct or update the current data, or to suggest other missions.

77 FR 73302 - Extension of Dates for Certain Requirements and Amendment of Form 19b-4

Federal Register 2010, 2011, 2012, 2013, 2014

2012-12-10

... amending section A of the General Instructions for Form 19b-4 to state that blank electronic and PDF.... An electronic version of Form 19b-4 is available in EFFS. A PDF version of the Form is also available...

Dermatology Life Quality Index: influence of an illustrated version.

PubMed

Loo, W J; Diba, V; Chawla, M; Finlay, A Y

2003-02-01

An illustrated version of the Dermatology Life Quality Index (DLQI) was developed in order to improve the ease with which this standard questionnaire is answered. To compare the illustrated version with the text-only version of the DLQI. The two versions were administered to 206 patients attending Dermatology outpatient clinics. The time taken to complete either the illustrated or the text-only version was noted in 52 additional patients. One hundred and ninety-one of 206 patients completed both questionnaires satisfactorily. Their mean DLQI scores were 6.4 (median 4.0, lower quartile 1.0, upper quartile 11.0) for the illustrated version and 6.3 (median 4.0, lower quartile 1.0, upper quartile 10.0) for the text-only version. For the 98 patients who answered the illustrated version first, the mean DLQI scores were 6.9 (median 4.0, lower quartile 1.9, upper quartile 11.9) for the illustrated version and 6.4 (median 4.0, lower quartile 1.8, upper quartile 11.0) for the text-only version. For the 93 patients who answered the text-only version first, the mean DLQI scores were 5.9 (median 4.0, lower quartile 1.7, upper quartile 10.2) for the illustrated version and 6.2 (median 5.0, lower quartile 0.5, upper quartile 9.5) for the text-only version. The median time taken to complete the text-only version was 124 s (mean +/- SD 126 +/- 65, n = 27) and 88 s (mean +/- SD 101 +/- 52, n = 25) for the illustrated version (P = 0.08). There was a very close correlation (r = 0.98) between the scores of the text-only and the illustrated versions; 82.2% of patients either scored the same or had a DLQI score difference of only 1. One hundred and seven (59.8%) patients preferred using the illustrated version and 66 (36.9%) preferred the text-only version. One hundred and four (57.5%) found the illustrated version easier to use. The illustrated version was superior to the text-only version in terms of patient preference and ease of use, but it was not possible to demonstrate exact equivalence between the two versions.

78 FR 38750 - Self-Regulatory Organizations; NASDAQ OMX PHLX LLC; Notice of Filing of Proposed Rule Change...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-06-27

... (also known as origin code) refers to the participant types listed in Rule 1080.08(b) and Rule 1000(b..., and, therefore, is referring to the participant origin codes in Rule 1080.08(b) only. The proposed...-Regulatory Organizations; NASDAQ OMX PHLX LLC; Notice of Filing of Proposed Rule Change Relating to Which...

30 CFR Appendix to Subpart B of... - Optional Form for Certifying Mine Rescue Teams

Code of Federal Regulations, 2013 CFR

2013-07-01

... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Optional Form for Certifying Mine Rescue Teams... LABOR EDUCATION AND TRAINING MINE RESCUE TEAMS Mine Rescue Teams for Underground Coal Mines Pt. 49, Subpt. B, App. Appendix to Subpart B of Part 49—Optional Form for Certifying Mine Rescue Teams ER08FE08...

30 CFR Appendix to Subpart B of... - Optional Form for Certifying Mine Rescue Teams

Code of Federal Regulations, 2014 CFR

2014-07-01

... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Optional Form for Certifying Mine Rescue Teams... LABOR EDUCATION AND TRAINING MINE RESCUE TEAMS Mine Rescue Teams for Underground Coal Mines Pt. 49, Subpt. B, App. Appendix to Subpart B of Part 49—Optional Form for Certifying Mine Rescue Teams ER08FE08...

User guide for MODPATH Version 7—A particle-tracking model for MODFLOW

USGS Publications Warehouse

Pollock, David W.

2016-09-26

MODPATH is a particle-tracking post-processing program designed to work with MODFLOW, the U.S. Geological Survey (USGS) finite-difference groundwater flow model. MODPATH version 7 is the fourth major release since its original publication. Previous versions were documented in USGS Open-File Reports 89–381 and 94–464 and in USGS Techniques and Methods 6–A41.MODPATH version 7 works with MODFLOW-2005 and MODFLOW–USG. Support for unstructured grids in MODFLOW–USG is limited to smoothed, rectangular-based quadtree and quadpatch grids.A software distribution package containing the computer program and supporting documentation, such as input instructions, output file descriptions, and example problems, is available from the USGS over the Internet (http://water.usgs.gov/ogw/modpath/).

Checkout/demonstration application program for the SEL 840MP Multi-Processing Control System: Version 1 (MPCS/1)

NASA Technical Reports Server (NTRS)

Anderson, W. F.; Conway, J. R.; Keller, L. C.

1972-01-01

The characteristics of the application program were developed to verify and demonstrate the SEL 840MP Multi-Processing Control System - Version I (MPCS/1). The application program emphasizes the display support and task control capabilities. The application program is further intended to be used as an aid to familization with MPCS/1. It complements the information provided in the MPCS/1 Users Guide, Volume I and II.

[The Confusion Assessment Method: Transcultural adaptation of a French version].

PubMed

Antoine, V; Belmin, J; Blain, H; Bonin-Guillaume, S; Goldsmith, L; Guerin, O; Kergoat, M-J; Landais, P; Mahmoudi, R; Morais, J A; Rataboul, P; Saber, A; Sirvain, S; Wolfklein, G; de Wazieres, B

2018-05-01

The Confusion Assessment Method (CAM) is a validated key tool in clinical practice and research programs to diagnose delirium and assess its severity. There is no validated French version of the CAM training manual and coding guide (Inouye SK). The aim of this study was to establish a consensual French version of the CAM and its manual. Cross-cultural adaptation to achieve equivalence between the original version and a French adapted version of the CAM manual. A rigorous process was conducted including control of cultural adequacy of the tool's components, double forward and back translations, reconciliation, expert committee review (including bilingual translators with different nationalities, a linguist, highly qualified clinicians, methodologists) and pretesting. A consensual French version of the CAM was achieved. Implementation of the CAM French version in daily clinical practice will enable optimal diagnosis of delirium diagnosis and enhance communication between health professionals in French speaking countries. Validity and psychometric properties are being tested in a French multicenter cohort, opening up new perspectives for improved quality of care and research programs in French speaking countries. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Fractional flow reserve-guided revascularization: practical implications of a diagnostic gray zone and measurement variability on clinical decisions.

PubMed

Petraco, Ricardo; Sen, Sayan; Nijjer, Sukhjinder; Echavarria-Pinto, Mauro; Escaned, Javier; Francis, Darrel P; Davies, Justin E

2013-03-01

This study sought to evaluate the effects of fractional flow reserve (FFR) measurement variability on FFR-guided treatment strategy. Current appropriateness guidelines recommend the utilization of FFR to guide coronary revascularization based on a fixed cut-off of 0.8. This rigid approach does not take into account the intrinsic biological variability of a single FFR result and the clinical judgment of experienced interventional cardiologists. [corrected]. FFR reproducibility data from the landmark Deferral Versus Performance of PTCA in Patients Without Documented Ischemia (DEFER) trial was analyzed (two repeated FFR measurements in the same lesion, 10 min apart) and the standard deviation of the difference (SDD) between repeated measurements was calculated. The measurement certainty (probability that the FFR-guided revascularization strategy will not change if the test is repeated 10 min later) was subsequently established across the whole range of FFR values, from 0.2 to 1. Outside the [0.75 to 0.85] FFR range, measurement certainty of a single FFR result is >95%. However, closer to its cut-off, certainty falls to less than 80% within 0.77 to 0.83, reaching a nadir of 50% around 0.8. In clinical practice, that means that each time a single FFR value falls between 0.75 and 0.85, there is a chance that the FFR-derived revascularization recommendation will change if the measurement is repeated 10 min later, with this chance increasing the closer the FFR result is to 0.8. A measurement FFR gray-zone is found between 0.75 and 0.85]. Therefore, clinicians should make revascularization decisions based on broadened clinical judgment when a single FFR result falls within this uncertainty zone, particularly between 0.77 and 0.83, when measurement certainty falls to less than 80%. Copyright © 2013 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

ATLAS, an integrated structural analysis and design system. Volume 1: ATLAS user's guide

NASA Technical Reports Server (NTRS)

Dreisbach, R. L. (Editor)

1979-01-01

Some of the many analytical capabilities provided by the ATLAS Version 4.0 System in the logical sequence are described in which model-definition data are prepared and the subsequent computer job is executed. The example data presented and the fundamental technical considerations that are highlighted can be used as guides during the problem solving process. This guide does not describe the details of the ATLAS capabilities, but provides an introduction to the new user of ATLAS to the level at which the complete array of capabilities described in the ATLAS User's Manual can be exploited fully.

Federal Emergency Management Information System (FEMIS) system administration guide. Version 1.2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burford, M.J.; Burnett, R.A.; Curtis, L.M.

The Federal Emergency Management Information System (FEMIS) is an emergency management planning and analysis tool that is being developed under the direction of the US Army Chemical biological Defense Command. The FEMIS System Administration Guide defines FEMIS hardware and software requirements and gives instructions for installing the FEMIS system package. System administrators, database administrators, and general users can use this guide to install, configure, and maintain the FEMIS client software package. This document provides a description of the FEMIS environment; distribution media; data, communications, and electronic mail servers; user workstations; and system management.

A Guide for Parents and Families about What Your 10th Grader Should Be Learning in School This Year. Don't Fail Your Children = Una Guia para los Padres y Familias Acerca de Lo Que Su Hijo de Decimo Grado Debe Aprender en la Escuela Este Ano. No Le Falle a Sus Hijos.

ERIC Educational Resources Information Center

South Carolina State Education Oversight Committee, Columbia.

This guide, in English- and Spanish-language versions, shares with parents information about the South Carolina Curriculum Standards. The standards outline state requirements for children's learning and what students across the state should be able to do in certain subjects. The guide lists seven key reasons parents should be aware of the new…

A Guide for Parents and Families about What Your 5th Grader Should Be Learning in School This Year. Don't Fail Your Children = Una Guia para los Padres y Familias Acerca de Lo Que Su Hijo de 5to Grado Debe Aprender en la Escuela Este Ano. No Le Falle a Sus Hijos.

ERIC Educational Resources Information Center

South Carolina State Dept. of Education, Columbia.

This guide, in English- and Spanish-language versions, shares with parents information about the South Carolina Curriculum Standards. The standards outline state requirements for children's learning and what students across the state should be able to do in certain subjects. The guide lists seven key reasons parents should be aware of the new…

A Guide for Parents and Families about What Your Kindergartner Should Be Learning in School This Year. Don't Fail Your Children = Una Guia para los Padres y Familias Acerca de Lo Que Su Hijo de Jardin Infantil (Kindergarten) Debe Aprender en la Escuela Este Ano. No Le Falle a Sus Hijos.

ERIC Educational Resources Information Center

South Carolina State Dept. of Education, Columbia.

This guide, in English- and Spanish-language versions, shares with parents information about the South Carolina Curriculum Standards. The standards outline state requirements for children's learning and what students across the state should be able to do in certain subjects. The guide lists seven key reasons parents should be aware of the new…

A Guide for Parents and Families about What Your 6th Grader Should Be Learning in School This Year. Don't Fail Your Children = Una Guia para los Padres y Familias Acerca de Lo Que Su Hijo de 6to Grado Debe Aprender en la Escuela Este Ano. No Le Falle a Sus Hijos.

ERIC Educational Resources Information Center

South Carolina State Dept. of Education, Columbia.

This guide, in English- and Spanish-language versions, shares with parents information about the South Carolina Curriculum Standards. The standards outline state requirements for children's learning and what students across the state should be able to do in certain subjects. The guide lists seven key reasons parents should be aware of the new…

A Guide for Parents and Families about What Your 3rd Grader Should Be Learning in School This Year. Don't Fail Your Children = Una Guia para los Padres y Familias Acerca de Lo Que Su Hijo de 3er Grado Debe Aprender en la Escuela Este Ano. No Le Falle a Sus Hijos.

ERIC Educational Resources Information Center

South Carolina State Dept. of Education, Columbia.

This guide, in English- and Spanish-language versions, shares with parents information about the South Carolina Curriculum Standards. The standards outline state requirements for children's learning and what students across the state should be able to do in certain subjects. The guide lists seven key reasons parents should be aware of the new…

A Guide for Parents and Families about What Your 11th Grader Should Be Learning in School This Year. Don't Fail Your Children = Una Guia para los Padres y Familias Acerca de Lo Que Su Hijo de Grado 11 Debe Aprender en la Escuela Este Ano. No Le Falle a Sus Hijos.

ERIC Educational Resources Information Center

South Carolina State Dept. of Education, Columbia.

This guide, in English- and Spanish-language versions, shares with parents information about the South Carolina Curriculum Standards. The standards outline state requirements for children's learning and what students across the state should be able to do in certain subjects. The guide lists seven key reasons parents should be aware of the new…

A Guide for Parents and Families about What Your 9th Grader Should Be Learning in School This Year. Don't Fail Your Children = Una Guia para los Padres y Familias Acerca de Lo Que Su Hijo de Noveno Grado Debe Aprender en la Escuela Este Ano. No Le Falle a Sus Hijos.

ERIC Educational Resources Information Center

South Carolina State Dept. of Education, Columbia.

This guide, in English- and Spanish-language versions, shares with parents information about the South Carolina Curriculum Standards. The standards outline state requirements for children's learning and what students across the state should be able to do in certain subjects. The guide lists seven key reasons parents should be aware of the new…

A Guide for Parents and Families about What Your 7th Grader Should Be Learning in School This Year. Don't Fail Your Children = Una Guia para los Padres y Familias Acerca de Lo Que Su Hijo de Septimo Grado Debe Aprender en la Escuela Este Ano. No Le Falle a Sus Hijos.

ERIC Educational Resources Information Center

South Carolina State Dept. of Education, Columbia.

This guide, in English- and Spanish-language versions, shares with parents information about the South Carolina Curriculum Standards. The standards outline state requirements for children's learning and what students across the state should be able to do in certain subjects. The guide lists seven key reasons parents should be aware of the new…

A Guide for Parents and Families about What Your 1st Grader Should Be Learning in School This Year. Don't Fail Your Children = Una Guia para los Padres y Familias Acerca de Lo Que Su Hijo de 1er Grado Debe Aprender en la Escuela Este Ano. No Le Falle a Sus Hijos.

ERIC Educational Resources Information Center

South Carolina State Dept. of Education, Columbia.

This guide, in English- and Spanish-language versions, shares with parents information about the South Carolina Curriculum Standards. The standards outline state requirements for children's learning and what students across the state should be able to do in certain subjects. The guide lists seven key reasons parents should be aware of the new…

A Guide for Parents and Families about What Your 8th Grader Should Be Learning in School This Year. Don't Fail Your Children = Una Guia para los Padres y Familias Acerca de Lo Que Su Hijo de Octavo Grado Debe Aprender en la Escuela Este Ano. No Le Falle a Sus Hijos.

ERIC Educational Resources Information Center

South Carolina State Dept. of Education, Columbia.

This guide, in English- and Spanish-language versions, shares with parents information about the South Carolina Curriculum Standards. The standards outline state requirements for children's learning and what students across the state should be able to do in certain subjects. The guide lists seven key reasons parents should be aware of the new…

A Guide for Parents and Families about What Your 2nd Grader Should Be Learning in School This Year. Don't Fail Your Children = Una Guia para los Padres y Familias Acerca de Lo Que Su Hijo de 2do Grado Debe Aprender en la Escuela Este Ano. No Le Falle a Sus Hijos.

ERIC Educational Resources Information Center

South Carolina State Dept. of Education, Columbia.

This guide, in English- and Spanish-language versions, shares with parents information about the South Carolina Curriculum Standards. The standards outline state requirements for children's learning and what students across the state should be able to do in certain subjects. The guide lists seven key reasons parents should be aware of the new…

A Guide for Parents and Families about What Your 4th Grader Should Be Learning in School This Year. Don't Fail Your Children = Una Guia para los Padres y Familias Acerca de Lo Que Su Hijo de 4to Grado Debe Aprender en la Escuela Este Ano. No Le Falle a Sus Hijos.

ERIC Educational Resources Information Center

South Carolina State Dept. of Education, Columbia.

This guide, in English- and Spanish-language versions, shares with parents information about the South Carolina Curriculum Standards. The standards outline state requirements for children's learning and what students across the state should be able to do in certain subjects. The guide lists seven key reasons parents should be aware of the new…

Measurement properties of the English and Chinese versions of the Functional Assessment of Cancer Therapy-Breast (FACT-B) in Asian breast cancer patients.

PubMed

Ng, Raymond; Lee, Chun Fan; Wong, Nan Soon; Luo, Nan; Yap, Yoon Sim; Lo, Soo Kien; Chia, Whay Kuang; Yee, Alethea; Krishna, Lalit; Goh, Cynthia; Cheung, Yin Bun

2012-01-01

The objective of the study was to examine the measurement properties of and comparability between the English and Chinese versions of the Functional Assessment of Cancer Therapy-Breast (FACT-B) in breast cancer patients in Singapore. This is an observational study of 271 Singaporean breast cancer patients. The known-group validity of FACT-B total score and Trial Outcome Index (TOI) were assessed in relation to performance status, evidence of disease, and treatment status cross-sectionally; responsiveness to change was assessed in relation to change in performance status longitudinally. Internal consistency and test-retest reliability were evaluated by the Cronbach's alpha and intraclass correlation coefficient (ICC), respectively. Multiple regression analyses were performed to compare the scores on the two language versions, adjusting for covariates. The FACT-B total score and TOI demonstrated known-group validity in differentiating patients with different clinical status. They showed high internal consistency and test-retest reliability, with Cronbach's alpha ranging from 0.87 to 0.91 and ICC ranging from 0.82 to 0.89. The English version was responsive to the change in performance status. The Chinese version was shown to be responsive to decline in performance status but the sample size of Chinese-speaking patients who improved in performance status was too small (N = 6) for conclusive analysis about responsiveness to improvement. Two items concerning sexuality had a high item non-response rate (50.2 and 14.4%). No practically significant difference was found in the total score and TOI between the two language versions despite minor differences in two of the 37 items. The English and Chinese versions of the FACT-B are valid, responsive, and reliable instruments in assessing health-related quality of life in breast cancer patients in Singapore. Data collected from the English and Chinese versions can be pooled and either version could be used for bilingual patients.

Using RT-PCR and bDNA assays to measure non-clade B HIV-1 subtype RNA.

PubMed

Pasquier, C; Sandres, K; Salama, G; Puel, J; Izopet, J

1999-08-01

The performance of the new version of RT-PCR assay (Amplicor HIV-1 Monitor v1.5) was assessed. The quantification of non-B subtype HIV-1 plasma RNA (30A, 1C, 1D, 3E, 2F, 3G) obtained using Monitor v1.5 was compared to the former version of this assay (Monitor v1.0) and to the Quantiplex v2.0 bDNA assay. The new primers used in Monitor v1.5 were similar to the former version in both specificity and sensitivity. The new primers corrected the detection and quantification defect observed previously for HIV-1 non-B subtypes and gave slightly higher RNA concentrations than those measured using the bDNA assay (+0.39 log copies/ml).

The incorporation of plotting capability into the Unified Subsonic Supersonic Aerodynamic Analysis program, version B

NASA Technical Reports Server (NTRS)

Winter, O. A.

1980-01-01

The B01 version of the United Subsonic Supersonic Aerodynamic Analysis program is the result of numerous modifications and additions made to the B00 version. These modifications and additions affect the program input, its computational options, the code readability, and the overlay structure. The following are described: (1) the revised input; (2) the plotting overlay programs which were also modified, and their associated subroutines, (3) the auxillary files used by the program, the revised output data; and (4) the program overlay structure.

On the Global and Linear Convergence of the Generalized Alternating Direction Method of Multipliers

DTIC Science & Technology

2012-08-01

the less exact one is solved later — assigned as step 4 of Algorithm 2 — because at each iteration , the ADM updates the variables in the Gauss - Seidel ...k) and that of an accelerated version descends at O(1/k2). Then, work [14] establishes the same rates on a Gauss - Seidel version and requires only one... iteration Fig. 5.1. Convergence curves of ADM for the elastic net problem. 17 0 50 100 150 200 0.75 0.8 0.85 0.9 0.95 1 Iteration ‖u k + 1 − u ∗ ‖ 2 G / ‖u k

Climate change and forest trees in the Pacific Northwest: guide to vulnerability assessment methodology

Treesearch

W. Devine; C. Aubry; J. Miller; K. Potter; A. Bower

2012-01-01

This guide provides a step-by-step description of the methodology used to apply the Forest Tree Genetic Risk Assessment System (ForGRAS; Potter and Crane 2010) to the tree species of the Pacific Northwest in a recent climate change vulnerability assessment (Devine et al. 2012). We describe our modified version of the ForGRAS model, and we review the model’s basic...

SOS! Ayuda para Padres: Una Guia Practica para Manejar Problemas de Conducta Comunes y Corrientes. (SOS! Help for Parents: A Practical Guide for Handling Common Everyday Behavior Problems.) Leader's Guide.

ERIC Educational Resources Information Center

Clark, Lynn

This Spanish-language version of "SOS" provides parents with guidance for handling a variety of common behavior problems based on the behavior approach to child rearing and discipline. This approach suggests that good and bad behavior are both learned and can be changed, and proposes specific methods, skills, procedures, and strategies…

XML Schema Guide for Primary CDR Submissions

EPA Pesticide Factsheets

This document presents the extensible markup language (XML) schema guide for the Office of Pollution Prevention and Toxics’ (OPPT) e-CDRweb tool. E-CDRweb is the electronic, web-based tool provided by Environmental Protection Agency (EPA) for the submission of Chemical Data Reporting (CDR) information. This document provides the user with tips and guidance on correctly using the version 1.7 XML schema. Please note that the order of the elements must match the schema.

Running Behavioral Experiments with Human Participants: A Practical Guide (Revised Version)

DTIC Science & Technology

2010-01-20

R. (2000). Social research methods: Qualitative and quantitative approaches. Thousand Oaks, CA: Sage. This is a relatively large book. It covers...guide will be useful to anyone who is starting to run research studies, training people to run studies, or studying the experimental process. When...behavior. Running an experiment in exactly the same way regardless of who is conducting it or where (e.g., different research teams or laboratories) is

User's Guide for the Interactive Scheduling Program : Preliminary Calendar Version

DOT National Transportation Integrated Search

1978-08-01

The Office of Transportation Management of the Urban Mass Transportation Administration (UMTA), in conjunction with the Transportation Systems Center (TSC), designed and developed the Interactive Scheduling Program (ISP) to assist rail-transit operat...

Aviation Environmental Design Tool (AEDT): Version 2d: Installation Guide

DOT National Transportation Integrated Search

2017-09-01

Aviation Environmental Design Tool (AEDT) is a software system that models aircraft performance in space and time to estimate fuel consumption, emissions, noise, and air quality consequences. AEDT facilitates environmental review activities required ...

Recognizing and Addressing Limited PHarmaceutical literacy: Development of the RALPH interview guide.

PubMed

Vervloet, Marcia; van Dijk, Liset; Rademakers, Jany J D J M; Bouvy, Marcel L; De Smet, Peter A G M; Philbert, Daphne; Koster, Ellen S

2018-04-30

In the context of medication use, pharmaceutical literacy skills are crucial for appropriate and safe use of medication. Recognition of patients with inadequate pharmaceutical literacy in daily pharmacy practice is difficult. No instrument is yet available to support pharmacists herein. The aim of this study was therefore to develop an interview guide for pharmacists to Recognize and Address Limited PHarmaceutical literacy (RALPH). The RALPH interview guide was constructed in three phases: (1) development including a literature search, expert group discussion, and feasibility test with 15 patients; (2) pilot-test with 421 patients throughout 30 community pharmacies, and (3) final test with 508 patients to optimize the interview guide. The development phase resulted in a first interview guide comprising 15 questions: seven in the functional domain (understanding instructions), four in the communicative domain (finding and understanding medication information) and four in the critical domain (critically analyzing medication information). This version was pilot-tested in 30 pharmacies, with 147 patients during medication reviews and another 274 patients were interviewed while waiting to collect their medication. This test phase led to removal of questions that proved difficult to interpret and to rephrasing some questions. The second version including 11 questions was tested by 109 pharmacists trainees with 508 patients, resulting in the final RALPH interview guide comprising 10 questions, all directly linked to the patient's own medication: three in the functional, three in the communicative and four in the critical domain. Besides instructions on how to use the interview guide, recommendations are provided for pharmacists on how to support patients with limited pharmaceutical literacy skills. The practice-based RALPH interview guide supports pharmacists in recognizing patients with limited pharmaceutical literacy. With this insight, pharmacists can tailor their medication counseling to patients' pharmaceutical literacy level to better support patients in their medication use. Copyright © 2018. Published by Elsevier Inc.

Cultural adaptation of a pediatric functional assessment for rehabilitation outcomes research.

PubMed

Arestad, Kristen E; MacPhee, David; Lim, Chun Y; Khetani, Mary A

2017-09-15

Significant racial and ethnic health care disparities experienced by Hispanic children with special health care needs (CSHCN) create barriers to enacting culturally competent rehabilitation services. One way to minimize the impact of disparities in rehabilitation is to equip practitioners with culturally relevant functional assessments to accurately determine service needs. Current approaches to culturally adapting assessments have three major limitations: use of inconsistent translation processes; current processes assess for some, but not all, elements of cultural equivalence; and limited evidence to guide decision making about whether to undertake cultural adaptation with and without language translation. The aims of this observational study are (a) to examine similarities and differences of culturally adapting a pediatric functional assessment with and without language translation, and (b) to examine the feasibility of cultural adaptation processes. The Young Children's Participation and Environment Measure (YC-PEM), a pediatric functional assessment, underwent cultural adaptation (i.e., language translation and cognitive testing) to establish Spanish and English pilot versions for use by caregivers of young CSHCN of Mexican descent. Following language translation to develop a Spanish YC-PEM pilot version, 7 caregivers (4 Spanish-speaking; 3 English-speaking) completed cognitive testing to inform decisions regarding content revisions to English and Spanish YC-PEM versions. Participant responses were content coded to established cultural equivalencies. Coded data were summed to draw comparisons on the number of revisions needed to achieve cultural equivalence between the two versions. Feasibility was assessed according to process data and data quality. Results suggest more revisions are required to achieve cultural equivalence for the translated (Spanish) version of the YC-PEM. However, issues around how the participation outcome is conceptualized were identified in both versions. Feasibility results indicate that language translation processes require high resource investment, but may increase translation quality. However, use of questionnaires versus interview methods for cognitive testing may have limited data saturation. Results lend preliminary support to the need for and feasibility of cultural adaptation with and without language translation. Results inform decisions surrounding cultural adaptations with and without language translation and thereby enhance cultural competence and quality assessment of healthcare need within pediatric rehabilitation.

The Physics of the B Factories

NASA Astrophysics Data System (ADS)

Bevan, A. J.; Golob, B.; Mannel, Th.; Prell, S.; Yabsley, B. D.; Aihara, H.; Anulli, F.; Arnaud, N.; Aushev, T.; Beneke, M.; Beringer, J.; Bianchi, F.; Bigi, I. I.; Bona, M.; Brambilla, N.; Brodzicka, J.; Chang, P.; Charles, M. J.; Cheng, C. H.; Cheng, H.-Y.; Chistov, R.; Colangelo, P.; Coleman, J. P.; Drutskoy, A.; Druzhinin, V. P.; Eidelman, S.; Eigen, G.; Eisner, A. M.; Faccini, R.; Flood, K. T.; Gambino, P.; Gaz, A.; Gradl, W.; Hayashii, H.; Higuchi, T.; Hulsbergen, W. D.; Hurth, T.; Iijima, T.; Itoh, R.; Jackson, P. D.; Kass, R.; Kolomensky, Yu. G.; Kou, E.; Križan, P.; Kronfeld, A.; Kumano, S.; Kwon, Y. J.; Latham, T. E.; Leith, D. W. G. S.; Lüth, V.; Martinez-Vidal, F.; Meadows, B. T.; Mussa, R.; Nakao, M.; Nishida, S.; Ocariz, J.; Olsen, S. L.; Pakhlov, P.; Pakhlova, G.; Palano, A.; Pich, A.; Playfer, S.; Poluektov, A.; Porter, F. C.; Robertson, S. H.; Roney, J. M.; Roodman, A.; Sakai, Y.; Schwanda, C.; Schwartz, A. J.; Seidl, R.; Sekula, S. J.; Steinhauser, M.; Sumisawa, K.; Swanson, E. S.; Tackmann, F.; Trabelsi, K.; Uehara, S.; Uno, S.; van de Water, R.; Vasseur, G.; Verkerke, W.; Waldi, R.; Wang, M. Z.; Wilson, F. F.; Zupan, J.; Zupanc, A.; Adachi, I.; Albert, J.; Banerjee, Sw.; Bellis, M.; Ben-Haim, E.; Biassoni, P.; Cahn, R. N.; Cartaro, C.; Chauveau, J.; Chen, C.; Chiang, C. C.; Cowan, R.; Dalseno, J.; Davier, M.; Davies, C.; Dingfelder, J. C.; Echenard, B.; Epifanov, D.; Fulsom, B. G.; Gabareen, A. M.; Gary, J. W.; Godang, R.; Graham, M. T.; Hafner, A.; Hamilton, B.; Hartmann, T.; Hayasaka, K.; Hearty, C.; Iwasaki, Y.; Khodjamirian, A.; Kusaka, A.; Kuzmin, A.; Lafferty, G. D.; Lazzaro, A.; Li, J.; Lindemann, D.; Long, O.; Lusiani, A.; Marchiori, G.; Martinelli, M.; Miyabayashi, K.; Mizuk, R.; Mohanty, G. B.; Muller, D. R.; Nakazawa, H.; Ongmongkolkul, P.; Pacetti, S.; Palombo, F.; Pedlar, T. K.; Piilonen, L. E.; Pilloni, A.; Poireau, V.; Prothmann, K.; Pulliam, T.; Rama, M.; Ratcliff, B. N.; Roudeau, P.; Schrenk, S.; Schroeder, T.; Schubert, K. R.; Shen, C. P.; Shwartz, B.; Soffer, A.; Solodov, E. P.; Somov, A.; Starič, M.; Stracka, S.; Telnov, A. V.; Todyshev, K. Yu.; Tsuboyama, T.; Uglov, T.; Vinokurova, A.; Walsh, J. J.; Watanabe, Y.; Won, E.; Wormser, G.; Wright, D. H.; Ye, S.; Zhang, C. C.; Abachi, S.; Abashian, A.; Abe, K.; Abe, N.; Abe, R.; Abe, T.; Abrams, G. S.; Adam, I.; Adamczyk, K.; Adametz, A.; Adye, T.; Agarwal, A.; Ahmed, H.; Ahmed, M.; Ahmed, S.; Ahn, B. S.; Ahn, H. S.; Aitchison, I. J. R.; Akai, K.; Akar, S.; Akatsu, M.; Akemoto, M.; Akhmetshin, R.; Akre, R.; Alam, M. S.; Albert, J. N.; Aleksan, R.; Alexander, J. P.; Alimonti, G.; Allen, M. T.; Allison, J.; Allmendinger, T.; Alsmiller, J. R. G.; Altenburg, D.; Alwyn, K. E.; An, Q.; Anderson, J.; Andreassen, R.; Andreotti, D.; Andreotti, M.; Andress, J. C.; Angelini, C.; Anipko, D.; Anjomshoaa, A.; Anthony, P. L.; Antillon, E. A.; Antonioli, E.; Aoki, K.; Arguin, J. F.; Arinstein, K.; Arisaka, K.; Asai, K.; Asai, M.; Asano, Y.; Asgeirsson, D. J.; Asner, D. M.; Aso, T.; Aspinwall, M. L.; Aston, D.; Atmacan, H.; Aubert, B.; Aulchenko, V.; Ayad, R.; Azemoon, T.; Aziz, T.; Azzolini, V.; Azzopardi, D. E.; Baak, M. A.; Back, J. J.; Bagnasco, S.; Bahinipati, S.; Bailey, D. S.; Bailey, S.; Bailly, P.; van Bakel, N.; Bakich, A. M.; Bala, A.; Balagura, V.; Baldini-Ferroli, R.; Ban, Y.; Banas, E.; Band, H. R.; Banerjee, S.; Baracchini, E.; Barate, R.; Barberio, E.; Barbero, M.; Bard, D. J.; Barillari, T.; Barlow, N. R.; Barlow, R. J.; Barrett, M.; Bartel, W.; Bartelt, J.; Bartoldus, R.; Batignani, G.; Battaglia, M.; Bauer, J. M.; Bay, A.; Beaulieu, M.; Bechtle, P.; Beck, T. W.; Becker, J.; Becla, J.; Bedny, I.; Behari, S.; Behera, P. K.; Behn, E.; Behr, L.; Beigbeder, C.; Beiline, D.; Bell, R.; Bellini, F.; Bellodi, G.; Belous, K.; Benayoun, M.; Benelli, G.; Benitez, J. F.; Benkebil, M.; Berger, N.; Bernabeu, J.; Bernard, D.; Bernet, R.; Bernlochner, F. U.; Berryhill, J. W.; Bertsche, K.; Besson, P.; Best, D. S.; Bettarini, S.; Bettoni, D.; Bhardwaj, V.; Bhimji, W.; Bhuyan, B.; Biagini, M. E.; Biasini, M.; van Bibber, K.; Biesiada, J.; Bingham, I.; Bionta, R. M.; Bischofberger, M.; Bitenc, U.; Bizjak, I.; Blanc, F.; Blaylock, G.; Blinov, V. E.; Bloom, E.; Bloom, P. C.; Blount, N. L.; Blouw, J.; Bly, M.; Blyth, S.; Boeheim, C. T.; Bomben, M.; Bondar, A.; Bondioli, M.; Bonneaud, G. R.; Bonvicini, G.; Booke, M.; Booth, J.; Borean, C.; Borgland, A. W.; Borsato, E.; Bosi, F.; Bosisio, L.; Botov, A. A.; Bougher, J.; Bouldin, K.; Bourgeois, P.; Boutigny, D.; Bowerman, D. A.; Boyarski, A. M.; Boyce, R. F.; Boyd, J. T.; Bozek, A.; Bozzi, C.; Bračko, M.; Brandenburg, G.; Brandt, T.; Brau, B.; Brau, J.; Breon, A. B.; Breton, D.; Brew, C.; Briand, H.; Bright-Thomas, P. G.; Brigljević, V.; Britton, D. I.; Brochard, F.; Broomer, B.; Brose, J.; Browder, T. E.; Brown, C. L.; Brown, C. M.; Brown, D. N.; Browne, M.; Bruinsma, M.; Brunet, S.; Bucci, F.; Buchanan, C.; Buchmueller, O. L.; Bünger, C.; Bugg, W.; Bukin, A. D.; Bula, R.; Bulten, H.; Burchat, P. R.; Burgess, W.; Burke, J. P.; Button-Shafer, J.; Buzykaev, A. R.; Buzzo, A.; Cai, Y.; Calabrese, R.; Calcaterra, A.; Calderini, G.; Camanzi, B.; Campagna, E.; Campagnari, C.; Capra, R.; Carassiti, V.; Carpinelli, M.; Carroll, M.; Casarosa, G.; Casey, B. C. K.; Cason, N. M.; Castelli, G.; Cavallo, N.; Cavoto, G.; Cecchi, A.; Cenci, R.; Cerizza, G.; Cervelli, A.; Ceseracciu, A.; Chai, X.; Chaisanguanthum, K. S.; Chang, M. C.; Chang, Y. H.; Chang, Y. W.; Chao, D. S.; Chao, M.; Chao, Y.; Charles, E.; Chavez, C. A.; Cheaib, R.; Chekelian, V.; Chen, A.; Chen, E.; Chen, G. P.; Chen, H. F.; Chen, J.-H.; Chen, J. C.; Chen, K. F.; Chen, P.; Chen, S.; Chen, W. T.; Chen, X.; Chen, X. R.; Chen, Y. Q.; Cheng, B.; Cheon, B. G.; Chevalier, N.; Chia, Y. M.; Chidzik, S.; Chilikin, K.; Chistiakova, M. V.; Cizeron, R.; Cho, I. S.; Cho, K.; Chobanova, V.; Choi, H. H. F.; Choi, K. S.; Choi, S. K.; Choi, Y.; Choi, Y. K.; Christ, S.; Chu, P. H.; Chun, S.; Chuvikov, A.; Cibinetto, G.; Cinabro, D.; Clark, A. R.; Clark, P. J.; Clarke, C. K.; Claus, R.; Claxton, B.; Clifton, Z. C.; Cochran, J.; Cohen-Tanugi, J.; Cohn, H.; Colberg, T.; Cole, S.; Colecchia, F.; Condurache, C.; Contri, R.; Convert, P.; Convery, M. R.; Cooke, P.; Copty, N.; Cormack, C. M.; Dal Corso, F.; Corwin, L. A.; Cossutti, F.; Cote, D.; Cotta Ramusino, A.; Cottingham, W. N.; Couderc, F.; Coupal, D. P.; Covarelli, R.; Cowan, G.; Craddock, W. W.; Crane, G.; Crawley, H. B.; Cremaldi, L.; Crescente, A.; Cristinziani, M.; Crnkovic, J.; Crosetti, G.; Cuhadar-Donszelmann, T.; Cunha, A.; Curry, S.; D'Orazio, A.; Dû, S.; Dahlinger, G.; Dahmes, B.; Dallapiccola, C.; Danielson, N.; Danilov, M.; Das, A.; Dash, M.; Dasu, S.; Datta, M.; Daudo, F.; Dauncey, P. D.; David, P.; Davis, C. L.; Day, C. T.; De Mori, F.; De Domenico, G.; De Groot, N.; De la Vaissière, C.; de la Vaissière, Ch.; de Lesquen, A.; De Nardo, G.; de Sangro, R.; De Silva, A.; DeBarger, S.; Decker, F. J.; del Amo Sanchez, P.; Del Buono, L.; Del Gamba, V.; del Re, D.; Della Ricca, G.; Denig, A. G.; Derkach, D.; Derrington, I. M.; DeStaebler, H.; Destree, J.; Devmal, S.; Dey, B.; Di Girolamo, B.; Marco, E. Di; Dickopp, M.; Dima, M. O.; Dittrich, S.; Dittongo, S.; Dixon, P.; Dneprovsky, L.; Dohou, F.; Doi, Y.; Doležal, Z.; Doll, D. A.; Donald, M.; Dong, L.; Dong, L. Y.; Dorfan, J.; Dorigo, A.; Dorsten, M. P.; Dowd, R.; Dowdell, J.; Drásal, Z.; Dragic, J.; Drummond, B. W.; Dubitzky, R. S.; Dubois-Felsmann, G. P.; Dubrovin, M. S.; Duh, Y. C.; Duh, Y. T.; Dujmic, D.; Dungel, W.; Dunwoodie, W.; Dutta, D.; Dvoretskii, A.; Dyce, N.; Ebert, M.; Eckhart, E. A.; Ecklund, S.; Eckmann, R.; Eckstein, P.; Edgar, C. L.; Edwards, A. J.; Egede, U.; Eichenbaum, A. M.; Elmer, P.; Emery, S.; Enari, Y.; Enomoto, R.; Erdos, E.; Erickson, R.; Ernst, J. A.; Erwin, R. J.; Escalier, M.; Eschenburg, V.; Eschrich, I.; Esen, S.; Esteve, L.; Evangelisti, F.; Everton, C. W.; Eyges, V.; Fabby, C.; Fabozzi, F.; Fahey, S.; Falbo, M.; Fan, S.; Fang, F.; Fanin, C.; Farbin, A.; Farhat, H.; Fast, J. E.; Feindt, M.; Fella, A.; Feltresi, E.; Ferber, T.; Fernholz, R. E.; Ferrag, S.; Ferrarotto, F.; Ferroni, F.; Field, R. C.; Filippi, A.; Finocchiaro, G.; Fioravanti, E.; Firmino da Costa, J.; Fischer, P.-A.; Fisher, A. S.; Fisher, P. H.; Flacco, C. J.; Flack, R. L.; Flaecher, H. U.; Flanagan, J.; Flanigan, J. M.; Ford, K. E.; Ford, W. T.; Forster, I. J.; Forti, A. C.; Forti, F.; Fortin, D.; Foster, B.; Foulkes, S. D.; Fouque, G.; Fox, J.; Franchini, P.; Franco Sevilla, M.; Franek, B.; Frank, E. D.; Fransham, K. B.; Fratina, S.; Fratini, K.; Frey, A.; Frey, R.; Friedl, M.; Fritsch, M.; Fry, J. R.; Fujii, H.; Fujikawa, M.; Fujita, Y.; Fujiyama, Y.; Fukunaga, C.; Fukushima, M.; Fullwood, J.; Funahashi, Y.; Funakoshi, Y.; Furano, F.; Furman, M.; Furukawa, K.; Futterschneider, H.; Gabathuler, E.; Gabriel, T. A.; Gabyshev, N.; Gaede, F.; Gagliardi, N.; Gaidot, A.; Gaillard, J.-M.; Gaillard, J. R.; Galagedera, S.; Galeazzi, F.; Gallo, F.; Gamba, D.; Gamet, R.; Gan, K. K.; Gandini, P.; Ganguly, S.; Ganzhur, S. F.; Gao, Y. Y.; Gaponenko, I.; Garmash, A.; Garra Tico, J.; Garzia, I.; Gaspero, M.; Gastaldi, F.; Gatto, C.; Gaur, V.; Geddes, N. I.; Geld, T. L.; Genat, J.-F.; George, K. A.; George, M.; George, S.; Georgette, Z.; Gershon, T. J.; Gill, M. S.; Gillard, R.; Gilman, J. D.; Giordano, F.; Giorgi, M. A.; Giraud, P.-F.; Gladney, L.; Glanzman, T.; Glattauer, R.; Go, A.; Goetzen, K.; Goh, Y. M.; Gokhroo, G.; Goldenzweig, P.; Golubev, V. B.; Gopal, G. P.; Gordon, A.; Gorišek, A.; Goriletsky, V. I.; Gorodeisky, R.; Gosset, L.; Gotow, K.; Gowdy, S. J.; Graffin, P.; Grancagnolo, S.; Grauges, E.; Graziani, G.; Green, M. G.; Greene, M. G.; Grenier, G. J.; Grenier, P.; Griessinger, K.; Grillo, A. A.; Grinyov, B. V.; Gritsan, A. V.; Grosdidier, G.; Grosse Perdekamp, M.; Grosso, P.; Grothe, M.; Groysman, Y.; Grünberg, O.; Guido, E.; Guler, H.; Gunawardane, N. J. W.; Guo, Q. H.; Guo, R. S.; Guo, Z. J.; Guttman, N.; Ha, H.; Ha, H. C.; Haas, T.; Haba, J.; Hachtel, J.; Hadavand, H. K.; Hadig, T.; Hagner, C.; Haire, M.; Haitani, F.; Haji, T.; Haller, G.; Halyo, V.; Hamano, K.; Hamasaki, H.; Hamel de Monchenault, G.; Hamilton, J.; Hamilton, R.; Hamon, O.; Han, B. Y.; Han, Y. L.; Hanada, H.; Hanagaki, K.; Handa, F.; Hanson, J. E.; Hanushevsky, A.; Hara, K.; Hara, T.; Harada, Y.; Harrison, P. F.; Harrison, T. J.; Harrop, B.; Hart, A. J.; Hart, P. A.; Hartfiel, B. L.; Harton, J. L.; Haruyama, T.; Hasan, A.; Hasegawa, Y.; Hast, C.; Hastings, N. C.; Hasuko, K.; Hauke, A.; Hawkes, C. M.; Hayashi, K.; Hazumi, M.; Hee, C.; Heenan, E. M.; Heffernan, D.; Held, T.; Henderson, R.; Henderson, S. W.; Hertzbach, S. S.; Hervé, S.; Heß, M.; Heusch, C. A.; Hicheur, A.; Higashi, Y.; Higasino, Y.; Higuchi, I.; Hikita, S.; Hill, E. J.; Himel, T.; Hinz, L.; Hirai, T.; Hirano, H.; Hirschauer, J. F.; Hitlin, D. G.; Hitomi, N.; Hodgkinson, M. C.; Höcker, A.; Hoi, C. T.; Hojo, T.; Hokuue, T.; Hollar, J. J.; Hong, T. M.; Honscheid, K.; Hooberman, B.; Hopkins, D. A.; Horii, Y.; Hoshi, Y.; Hoshina, K.; Hou, S.; Hou, W. S.; Hryn'ova, T.; Hsiung, Y. B.; Hsu, C. L.; Hsu, S. C.; Hu, H.; Hu, T.; Huang, H. C.; Huang, T. J.; Huang, Y. C.; Huard, Z.; Huffer, M. E.; Hufnagel, D.; Hung, T.; Hutchcroft, D. E.; Hyun, H. J.; Ichizawa, S.; Igaki, T.; Igarashi, A.; Igarashi, S.; Igarashi, Y.; Igonkina, O.; Ikado, K.; Ikeda, H.; Ikeda, H.; Ikeda, K.; Ilic, J.; Inami, K.; Innes, W. R.; Inoue, Y.; Ishikawa, A.; Ishino, H.; Itagaki, K.; Itami, S.; Itoh, K.; Ivanchenko, V. N.; Iverson, R.; Iwabuchi, M.; Iwai, G.; Iwai, M.; Iwaida, S.; Iwamoto, M.; Iwasaki, H.; Iwasaki, M.; Iwashita, T.; Izen, J. M.; Jackson, D. J.; Jackson, F.; Jackson, G.; Jackson, P. S.; Jacobsen, R. G.; Jacoby, C.; Jaegle, I.; Jain, V.; Jalocha, P.; Jang, H. K.; Jasper, H.; Jawahery, A.; Jayatilleke, S.; Jen, C. M.; Jensen, F.; Jessop, C. P.; Ji, X. B.; John, M. J. J.; Johnson, D. R.; Johnson, J. R.; Jolly, S.; Jones, M.; Joo, K. K.; Joshi, N.; Joshi, N. J.; Judd, D.; Julius, T.; Kadel, R. W.; Kadyk, J. A.; Kagan, H.; Kagan, R.; Kah, D. H.; Kaiser, S.; Kaji, H.; Kajiwara, S.; Kakuno, H.; Kameshima, T.; Kaminski, J.; Kamitani, T.; Kaneko, J.; Kang, J. H.; Kang, J. S.; Kani, T.; Kapusta, P.; Karbach, T. M.; Karolak, M.; Karyotakis, Y.; Kasami, K.; Katano, G.; Kataoka, S. U.; Katayama, N.; Kato, E.; Kato, Y.; Kawai, H.; Kawai, M.; Kawamura, N.; Kawasaki, T.; Kay, J.; Kay, M.; Kelly, M. P.; Kelsey, M. H.; Kent, N.; Kerth, L. T.; Khan, A.; Khan, H. R.; Kharakh, D.; Kibayashi, A.; Kichimi, H.; Kiesling, C.; Kikuchi, M.; Kikutani, E.; Kim, B. H.; Kim, C. H.; Kim, D. W.; Kim, H.; Kim, H. J.; Kim, H. O.; Kim, H. W.; Kim, J. B.; Kim, J. H.; Kim, K. T.; Kim, M. J.; Kim, P.; Kim, S. K.; Kim, S. M.; Kim, T. H.; Kim, Y. I.; Kim, Y. J.; King, G. J.; Kinoshita, K.; Kirk, A.; Kirkby, D.; Kitayama, I.; Klemetti, M.; Klose, V.; Klucar, J.; Knecht, N. S.; Knoepfel, K. J.; Knowles, D. J.; Ko, B. R.; Kobayashi, N.; Kobayashi, S.; Kobayashi, T.; Kobel, M. J.; Koblitz, S.; Koch, H.; Kocian, M. L.; Kodyš, P.; Koeneke, K.; Kofler, R.; Koike, S.; Koishi, S.; Koiso, H.; Kolb, J. A.; Kolya, S. D.; Kondo, Y.; Konishi, H.; Koppenburg, P.; Koptchev, V. B.; Kordich, T. M. B.; Korol, A. A.; Korotushenko, K.; Korpar, S.; Kouzes, R. T.; Kovalskyi, D.; Kowalewski, R.; Kozakai, Y.; Kozanecki, W.; Kral, J. F.; Krasnykh, A.; Krause, R.; Kravchenko, E. A.; Krebs, J.; Kreisel, A.; Kreps, M.; Krishnamurthy, M.; Kroeger, R.; Kroeger, W.; Krokovny, P.; Kronenbitter, B.; Kroseberg, J.; Kubo, T.; Kuhr, T.; Kukartsev, G.; Kulasiri, R.; Kulikov, A.; Kumar, R.; Kumar, S.; Kumita, T.; Kuniya, T.; Kunze, M.; Kuo, C. C.; Kuo, T.-L.; Kurashiro, H.; Kurihara, E.; Kurita, N.; Kuroki, Y.; Kurup, A.; Kutter, P. E.; Kuznetsova, N.; Kvasnička, P.; Kyberd, P.; Kyeong, S. H.; Lacker, H. M.; Lae, C. K.; Lamanna, E.; Lamsa, J.; Lanceri, L.; Landi, L.; Lang, M. I.; Lange, D. J.; Lange, J. S.; Langenegger, U.; Langer, M.; Lankford, A. J.; Lanni, F.; Laplace, S.; Latour, E.; Lau, Y. P.; Lavin, D. R.; Layter, J.; Lebbolo, H.; LeClerc, C.; Leddig, T.; Leder, G.; Le Diberder, F.; Lee, C. L.; Lee, J.; Lee, J. S.; Lee, M. C.; Lee, M. H.; Lee, M. J.; Lee, S.-J.; Lee, S. E.; Lee, S. H.; Lee, Y. J.; Lees, J. P.; Legendre, M.; Leitgab, M.; Leitner, R.; Leonardi, E.; Leonidopoulos, C.; Lepeltier, V.; Leruste, Ph.; Lesiak, T.; Levi, M. E.; Levy, S. L.; Lewandowski, B.; Lewczuk, M. J.; Lewis, P.; Li, H.; Li, H. B.; Li, S.; Li, X.; Li, Y.; Gioi, L. Li; Libby, J.; Lidbury, J.; Lillard, V.; Lim, C. L.; Limosani, A.; Lin, C. S.; Lin, J. Y.; Lin, S. W.; Lin, Y. S.; Lindquist, B.; Lindsay, C.; Lista, L.; Liu, C.; Liu, F.; Liu, H.; Liu, H. M.; Liu, J.; Liu, R.; Liu, T.; Liu, Y.; Liu, Z. Q.; Liventsev, D.; Lo Vetere, M.; Locke, C. B.; Lockman, W. S.; Di Lodovico, F.; Lombardo, V.; London, G. W.; Lopes Pegna, D.; Lopez, L.; Lopez-March, N.; Lory, J.; LoSecco, J. M.; Lou, X. C.; Louvot, R.; Lu, A.; Lu, C.; Lu, M.; Lu, R. S.; Lueck, T.; Luitz, S.; Lukin, P.; Lund, P.; Luppi, E.; Lutz, A. M.; Lutz, O.; Lynch, G.; Lynch, H. L.; Lyon, A. J.; Lyubinsky, V. R.; MacFarlane, D. B.; Mackay, C.; MacNaughton, J.; Macri, M. M.; Madani, S.; Mader, W. F.; Majewski, S. A.; Majumder, G.; Makida, Y.; Malaescu, B.; Malaguti, R.; Malclés, J.; Mallik, U.; Maly, E.; Mamada, H.; Manabe, A.; Mancinelli, G.; Mandelkern, M.; Mandl, F.; Manfredi, P. F.; Mangeol, D. J. J.; Manoni, E.; Mao, Z. P.; Margoni, M.; Marker, C. E.; Markey, G.; Marks, J.; Marlow, D.; Marques, V.; Marsiske, H.; Martellotti, S.; Martin, E. C.; Martin, J. P.; Martin, L.; Martinez, A. J.; Marzolla, M.; Mass, A.; Masuzawa, M.; Mathieu, A.; Matricon, P.; Matsubara, T.; Matsuda, T.; Matsuda, T.; Matsumoto, H.; Matsumoto, S.; Matsumoto, T.; Matsuo, H.; Mattison, T. S.; Matvienko, D.; Matyja, A.; Mayer, B.; Mazur, M. A.; Mazzoni, M. A.; McCulloch, M.; McDonald, J.; McFall, J. D.; McGrath, P.; McKemey, A. K.; McKenna, J. A.; Mclachlin, S. E.; McMahon, S.; McMahon, T. R.; McOnie, S.; Medvedeva, T.; Melen, R.; Mellado, B.; Menges, W.; Menke, S.; Merchant, A. M.; Merkel, J.; Messner, R.; Metcalfe, S.; Metzler, S.; Meyer, N. T.; Meyer, T. I.; Meyer, W. T.; Michael, A. K.; Michelon, G.; Michizono, S.; Micout, P.; Miftakov, V.; Mihalyi, A.; Mikami, Y.; Milanes, D. A.; Milek, M.; Mimashi, T.; Minamora, J. S.; Mindas, C.; Minutoli, S.; Mir, L. M.; Mishra, K.; Mitaroff, W.; Miyake, H.; Miyashita, T. S.; Miyata, H.; Miyazaki, Y.; Moffitt, L. C.; Mohanty, G. B.; Mohapatra, A.; Mohapatra, A. K.; Mohapatra, D.; Moll, A.; Moloney, G. R.; Mols, J. P.; Mommsen, R. K.; Monge, M. R.; Monorchio, D.; Moore, T. B.; Moorhead, G. F.; Mora de Freitas, P.; Morandin, M.; Morgan, N.; Morgan, S. E.; Morganti, M.; Morganti, S.; Mori, S.; Mori, T.; Morii, M.; Morris, J. P.; Morsani, F.; Morton, G. W.; Moss, L. J.; Mouly, J. P.; Mount, R.; Mueller, J.; Müller-Pfefferkorn, R.; Mugge, M.; Muheim, F.; Muir, A.; Mullin, E.; Munerato, M.; Murakami, A.; Murakami, T.; Muramatsu, N.; Musico, P.; Nagai, I.; Nagamine, T.; Nagasaka, Y.; Nagashima, Y.; Nagayama, S.; Nagel, M.; Naisbit, M. T.; Nakadaira, T.; Nakahama, Y.; Nakajima, M.; Nakajima, T.; Nakamura, I.; Nakamura, T.; Nakamura, T. T.; Nakano, E.; Nakayama, H.; Nam, J. W.; Narita, S.; Narsky, I.; Nash, J. A.; Natkaniec, Z.; Nauenberg, U.; Nayak, M.; Neal, H.; Nedelkovska, E.; Negrini, M.; Neichi, K.; Nelson, D.; Nelson, S.; Neri, N.; Nesom, G.; Neubauer, S.; Newman-Coburn, D.; Ng, C.; Nguyen, X.; Nicholson, H.; Niebuhr, C.; Nief, J. Y.; Niiyama, M.; Nikolich, M. B.; Nisar, N. K.; Nishimura, K.; Nishio, Y.; Nitoh, O.; Nogowski, R.; Noguchi, S.; Nomura, T.; Nordby, M.; Nosochkov, Y.; Novokhatski, A.; Nozaki, S.; Nozaki, T.; Nugent, I. M.; O'Grady, C. P.; O'Neale, S. W.; O'Neill, F. G.; Oberhof, B.; Oddone, P. J.; Ofte, I.; Ogawa, A.; Ogawa, K.; Ogawa, S.; Ogawa, Y.; Ohkubo, R.; Ohmi, K.; Ohnishi, Y.; Ohno, F.; Ohshima, T.; Ohshima, Y.; Ohuchi, N.; Oide, K.; Oishi, N.; Okabe, T.; Okazaki, N.; Okazaki, T.; Okuno, S.; Olaiya, E. O.; Olivas, A.; Olley, P.; Olsen, J.; Ono, S.; Onorato, G.; Onuchin, A. P.; Onuki, Y.; Ooba, T.; Orimoto, T. J.; Oshima, T.; Osipenkov, I. L.; Ostrowicz, W.; Oswald, C.; Otto, S.; Oyang, J.; Oyanguren, A.; Ozaki, H.; Ozcan, V. E.; Paar, H. P.; Padoan, C.; Paick, K.; Palka, H.; Pan, B.; Pan, Y.; Panduro Vazquez, W.; Panetta, J.; Panova, A. I.; Panvini, R. S.; Panzenböck, E.; Paoloni, E.; Paolucci, P.; Pappagallo, M.; Paramesvaran, S.; Park, C. S.; Park, C. W.; Park, H.; Park, H. K.; Park, K. S.; Park, W.; Parry, R. J.; Parslow, N.; Passaggio, S.; Pastore, F. C.; Patel, P. M.; Patrignani, C.; Patteri, P.; Pavel, T.; Pavlovich, J.; Payne, D. J.; Peak, L. S.; Peimer, D. R.; Pelizaeus, M.; Pellegrini, R.; Pelliccioni, M.; Peng, C. C.; Peng, J. C.; Peng, K. C.; Peng, T.; Penichot, Y.; Pennazzi, S.; Pennington, M. R.; Penny, R. C.; Penzkofer, A.; Perazzo, A.; Perez, A.; Perl, M.; Pernicka, M.; Perroud, J.-P.; Peruzzi, I. M.; Pestotnik, R.; Peters, K.; Peters, M.; Petersen, B. A.; Petersen, T. C.; Petigura, E.; Petrak, S.; Petrella, A.; Petrič, M.; Petzold, A.; Pia, M. G.; Piatenko, T.; Piccolo, D.; Piccolo, M.; Piemontese, L.; Piemontese, M.; Pierini, M.; Pierson, S.; Pioppi, M.; Piredda, G.; Pivk, M.; Plaszczynski, S.; Polci, F.; Pompili, A.; Poropat, P.; Posocco, M.; Potter, C. T.; Potter, R. J. L.; Prasad, V.; Prebys, E.; Prencipe, E.; Prendki, J.; Prepost, R.; Prest, M.; Prim, M.; Pripstein, M.; Prudent, X.; Pruvot, S.; Puccio, E. M. T.; Purohit, M. V.; Qi, N. D.; Quinn, H.; Raaf, J.; Rabberman, R.; Raffaelli, F.; Ragghianti, G.; Rahatlou, S.; Rahimi, A. M.; Rahmat, R.; Rakitin, A. Y.; Randle-Conde, A.; Rankin, P.; Rashevskaya, I.; Ratkovsky, S.; Raven, G.; Re, V.; Reep, M.; Regensburger, J. J.; Reidy, J.; Reif, R.; Reisert, B.; Renard, C.; Renga, F.; Ricciardi, S.; Richman, J. D.; Ritchie, J. L.; Ritter, M.; Rivetta, C.; Rizzo, G.; Roat, C.; Robbe, P.; Roberts, D. A.; Robertson, A. I.; Robutti, E.; Rodier, S.; Rodriguez, D. M.; Rodriguez, J. L.; Rodriguez, R.; Roe, N. A.; Röhrken, M.; Roethel, W.; Rolquin, J.; Romanov, L.; Romosan, A.; Ronan, M. T.; Rong, G.; Ronga, F. J.; Roos, L.; Root, N.; Rosen, M.; Rosenberg, E. I.; Rossi, A.; Rostomyan, A.; Rotondo, M.; Roussot, E.; Roy, J.; Rozanska, M.; Rozen, Y.; Rozen, Y.; Rubin, A. E.; Ruddick, W. O.; Ruland, A. M.; Rybicki, K.; Ryd, A.; Ryu, S.; Ryuko, J.; Sabik, S.; Sacco, R.; Saeed, M. A.; Safai Tehrani, F.; Sagawa, H.; Sahoo, H.; Sahu, S.; Saigo, M.; Saito, T.; Saitoh, S.; Sakai, K.; Sakamoto, H.; Sakaue, H.; Saleem, M.; Salnikov, A. A.; Salvati, E.; Salvatore, F.; Samuel, A.; Sanders, D. A.; Sanders, P.; Sandilya, S.; Sandrelli, F.; Sands, W.; Sands, W. R.; Sanpei, M.; Santel, D.; Santelj, L.; Santoro, V.; Santroni, A.; Sanuki, T.; Sarangi, T. R.; Saremi, S.; Sarti, A.; Sasaki, T.; Sasao, N.; Satapathy, M.; Sato, Nobuhiko; Sato, Noriaki; Sato, Y.; Satoyama, N.; Satpathy, A.; Savinov, V.; Savvas, N.; Saxton, O. H.; Sayeed, K.; Schaffner, S. F.; Schalk, T.; Schenk, S.; Schieck, J. R.; Schietinger, T.; Schilling, C. J.; Schindler, R. H.; Schmid, S.; Schmitz, R. E.; Schmuecker, H.; Schneider, O.; Schnell, G.; Schönmeier, P.; Schofield, K. C.; Schott, G.; Schröder, H.; Schram, M.; Schubert, J.; Schümann, J.; Schultz, J.; Schumm, B. A.; Schune, M. H.; Schwanke, U.; Schwarz, H.; Schwiening, J.; Schwierz, R.; Schwitters, R. F.; Sciacca, C.; Sciolla, G.; Scott, I. J.; Seeman, J.; Seiden, A.; Seitz, R.; Seki, T.; Sekiya, A. I.; Semenov, S.; Semmler, D.; Sen, S.; Senyo, K.; Seon, O.; Serbo, V. V.; Serednyakov, S. I.; Serfass, B.; Serra, M.; Serrano, J.; Settai, Y.; Seuster, R.; Sevior, M. E.; Shakhova, K. V.; Shang, L.; Shapkin, M.; Sharma, V.; Shebalin, V.; Shelkov, V. G.; Shen, B. C.; Shen, D. Z.; Shen, Y. T.; Sherwood, D. J.; Shibata, T.; Shibata, T. A.; Shibuya, H.; Shidara, T.; Shimada, K.; Shimoyama, M.; Shinomiya, S.; Shiu, J. G.; Shorthouse, H. W.; Shpilinskaya, L. I.; Sibidanov, A.; Sicard, E.; Sidorov, A.; Sidorov, V.; Siegle, V.; Sigamani, M.; Simani, M. C.; Simard, M.; Simi, G.; Simon, F.; Simonetto, F.; Sinev, N. B.; Singh, H.; Singh, J. B.; Sinha, R.; Sitt, S.; Skovpen, Yu. I.; Sloane, R. J.; Smerkol, P.; Smith, A. J. S.; Smith, D.; Smith, D. S.; Smith, J. G.; Smol, A.; Snoek, H. L.; Snyder, A.; So, R. Y.; Sobie, R. J.; Soderstrom, E.; Soha, A.; Sohn, Y. S.; Sokoloff, M. D.; Sokolov, A.; Solagna, P.; Solovieva, E.; Soni, N.; Sonnek, P.; Sordini, V.; Spaan, B.; Spanier, S. M.; Spencer, E.; Speziali, V.; Spitznagel, M.; Spradlin, P.; Staengle, H.; Stamen, R.; Stanek, M.; Stanič, S.; Stark, J.; Steder, M.; Steininger, H.; Steinke, M.; Stelzer, J.; Stevanato, E.; Stocchi, A.; Stock, R.; Stoeck, H.; Stoker, D. P.; Stroili, R.; Strom, D.; Strother, P.; Strube, J.; Stugu, B.; Stypula, J.; Su, D.; Suda, R.; Sugahara, R.; Sugi, A.; Sugimura, T.; Sugiyama, A.; Suitoh, S.; Sullivan, M. K.; Sumihama, M.; Sumiyoshi, T.; Summers, D. J.; Sun, L.; Sun, S.; Sundermann, J. E.; Sung, H. F.; Susaki, Y.; Sutcliffe, P.; Suzuki, A.; Suzuki, J.; Suzuki, J. I.; Suzuki, K.; Suzuki, S.; Suzuki, S. Y.; Swain, J. E.; Swain, S. K.; T'Jampens, S.; Tabata, M.; Tackmann, K.; Tajima, H.; Tajima, O.; Takahashi, K.; Takahashi, S.; Takahashi, T.; Takasaki, F.; Takayama, T.; Takita, M.; Tamai, K.; Tamponi, U.; Tamura, N.; Tan, N.; Tan, P.; Tanabe, K.; Tanabe, T.; Tanaka, H. A.; Tanaka, J.; Tanaka, M.; Tanaka, S.; Tanaka, Y.; Tanida, K.; Taniguchi, N.; Taras, P.; Tasneem, N.; Tatishvili, G.; Tatomi, T.; Tawada, M.; Taylor, F.; Taylor, G. N.; Taylor, G. P.; Telnov, V. I.; Teodorescu, L.; Ter-Antonyan, R.; Teramoto, Y.; Teytelman, D.; Thérin, G.; Thiebaux, Ch.; Thiessen, D.; Thomas, E. W.; Thompson, J. M.; Thorne, F.; Tian, X. C.; Tibbetts, M.; Tikhomirov, I.; Tinslay, J. S.; Tiozzo, G.; Tisserand, V.; Tocut, V.; Toki, W. H.; Tomassini, E. W.; Tomoto, M.; Tomura, T.; Torassa, E.; Torrence, E.; Tosi, S.; Touramanis, C.; Toussaint, J. C.; Tovey, S. N.; Trapani, P. P.; Treadwell, E.; Triggiani, G.; Trincaz-Duvoid, S.; Trischuk, W.; Troost, D.; Trunov, A.; Tsai, K. L.; Tsai, Y. T.; Tsujita, Y.; Tsukada, K.; Tsukamoto, T.; Tuggle, J. M.; Tumanov, A.; Tung, Y. W.; Turnbull, L.; Turner, J.; Turri, M.; Uchida, K.; Uchida, M.; Uchida, Y.; Ueki, M.; Ueno, K.; Ujiie, N.; Ulmer, K. A.; Unno, Y.; Urquijo, P.; Ushiroda, Y.; Usov, Y.; Usseglio, M.; Usuki, Y.; Uwer, U.; Va'vra, J.; Vahsen, S. E.; Vaitsas, G.; Valassi, A.; Vallazza, E.; Vallereau, A.; Vanhoefer, P.; van Hoek, W. C.; Van Hulse, C.; van Winkle, D.; Varner, G.; Varnes, E. W.; Varvell, K. E.; Vasileiadis, G.; Velikzhanin, Y. S.; Verderi, M.; Versillé, S.; Vervink, K.; Viaud, B.; Vidal, P. B.; Villa, S.; Villanueva-Perez, P.; Vinograd, E. L.; Vitale, L.; Vitug, G. M.; Voß, C.; Voci, C.; Voena, C.; Volk, A.; von Wimmersperg-Toeller, J. H.; Vorobyev, V.; Vossen, A.; Vuagnin, G.; Vuosalo, C. O.; Wacker, K.; Wagner, A. P.; Wagner, D. L.; Wagner, G.; Wagner, M. N.; Wagner, S. R.; Wagoner, D. E.; Walker, D.; Walkowiak, W.; Wallom, D.; Wang, C. C.; Wang, C. H.; Wang, J.; Wang, J. G.; Wang, K.; Wang, L.; Wang, L. L.; Wang, P.; Wang, T. J.; Wang, W. F.; Wang, X. L.; Wang, Y. F.; Wappler, F. R.; Watanabe, M.; Watson, A. T.; Watson, J. E.; Watson, N. K.; Watt, M.; Weatherall, J. H.; Weaver, M.; Weber, T.; Wedd, R.; Wei, J. T.; Weidemann, A. W.; Weinstein, A. J. R.; Wenzel, W. A.; West, C. A.; West, C. G.; West, T. J.; White, E.; White, R. M.; Wicht, J.; Widhalm, L.; Wiechczynski, J.; Wienands, U.; Wilden, L.; Wilder, M.; Williams, D. C.; Williams, G.; Williams, J. C.; Williams, K. M.; Williams, M. I.; Willocq, S. Y.; Wilson, J. R.; Wilson, M. G.; Wilson, R. J.; Winklmeier, F.; Winstrom, L. O.; Winter, M. A.; Wisniewski, W. J.; Wittgen, M.; Wittlin, J.; Wittmer, W.; Wixted, R.; Woch, A.; Wogsland, B. J.; Won, E.; Wong, Q. K.; Wray, B. C.; Wren, A. C.; Wright, D. M.; Wu, C. H.; Wu, J.; Wu, S. L.; Wulsin, H. W.; Xella, S. M.; Xie, Q. L.; Xie, Y.; Xu, Z. Z.; Yéche, Ch.; Yamada, Y.; Yamaga, M.; Yamaguchi, A.; Yamaguchi, H.; Yamaki, T.; Yamamoto, H.; Yamamoto, N.; Yamamoto, R. K.; Yamamoto, S.; Yamanaka, T.; Yamaoka, H.; Yamaoka, J.; Yamaoka, Y.; Yamashita, Y.; Yamauchi, M.; Yan, D. S.; Yan, Y.; Yanai, H.; Yanaka, S.; Yang, H.; Yang, R.; Yang, S.; Yarritu, A. K.; Yashchenko, S.; Yashima, J.; Yasin, Z.; Yasu, Y.; Ye, S. W.; Yeh, P.; Yi, J. I.; Yi, K.; Yi, M.; Yin, Z. W.; Ying, J.; Yocky, G.; Yokoyama, K.; Yokoyama, M.; Yokoyama, T.; Yoshida, K.; Yoshida, M.; Yoshimura, Y.; Young, C. C.; Yu, C. X.; Yu, Z.; Yuan, C. Z.; Yuan, Y.; Yumiceva, F. X.; Yusa, Y.; Yushkov, A. N.; Yuta, H.; Zacek, V.; Zain, S. B.; Zallo, A.; Zambito, S.; Zander, D.; Zang, S. L.; Zanin, D.; Zaslavsky, B. G.; Zeng, Q. L.; Zghiche, A.; Zhang, B.; Zhang, J.; Zhang, J.; Zhang, L.; Zhang, L. M.; Zhang, S. Q.; Zhang, Z. P.; Zhao, H. W.; Zhao, M.; Zhao, Z. G.; Zheng, Y.; Zheng, Y. H.; Zheng, Z. P.; Zhilich, V.; Zhou, P.; Zhu, R. Y.; Zhu, Y. S.; Zhu, Z. M.; Zhulanov, V.; Ziegler, T.; Ziegler, V.; Zioulas, G.; Zisman, M.; Zito, M.; Zürcher, D.; Zwahlen, N.; Zyukova, O.; Živko, T.; Žontar, D.

2014-11-01

This work is on the Physics of the B Factories. Part A of this book contains a brief description of the SLAC and KEK B Factories as well as their detectors, BaBar and Belle, and data taking related issues. Part B discusses tools and methods used by the experiments in order to obtain results. The results themselves can be found in Part C. Please note that version 3 on the archive is the auxiliary version of the Physics of the B Factories book. This uses the notation alpha, beta, gamma for the angles of the Unitarity Triangle. The nominal version uses the notation phi_1, phi_2 and phi_3. Please cite this work as Eur. Phys. J. C74 (2014) 3026.

76 FR 54218 - Third Party Testing for Certain Children's Products; Toys: Requirements for Accreditation of...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-08-31

....37, Yo-Yo Elastic Tether Toys. --Section 4.38, Magnets (except labeling and/or instructional... Spherical Ends. --Section 4.35, Pompoms. --Section 4.36, Hemispheric-Shaped Objects. --Section 4.37, Yo-Yo... 963-08''), and section 4.27 (toy chests) from ASTM International's F 963-07e1 version of the standard...

Sero-prevalence and factors associated with Hepatitis B and C co-infection in pregnant Nigerian women living with HIV Infection

PubMed Central

Ezechi, Oliver Chukwujekwu; Kalejaiye, Olufunto Olufela; Gab-Okafor, Chidinma Vivian; Oladele, David Ayola; Oke, Bamidele Oludare; Musa, Zaidat Adesola; Ekama, Sabdat Ozichu; Ohwodo, Harry; Agahowa, Endurance; Gbajabiamilla, Titilola; Ezeobi, Paschal Mbanefo; Okwuraiwe, Azuka; Audu R, Rosemary Ajuma; Okoye, Rosemary Nwakaego; David, Agatha Nkiru; Odunukwe, Nkiruka Nonyelum; Onwujekwe, Dan Ifeanyi; Ujah, Innocent Achanya

2014-01-01

Introduction Perinatal and horizontal transmission of Hepatitis B occur in areas of high endemicity as most infections are acquired in the first 5 years of life. Unless Hepatitis B and C infected pregnant women identified, and appropriate treatment provided, children born to these women are at high risk of chronic Hepatitis B (and C) virus infection. The objecive of this study was to determined the prevalence and the factors associated with Hepatitis B and C Virus infection in pregnant HIV positive Nigerians. Methods A cross sectional study among HIV Positive pregnant women seen at a large PMTCT clinic in Lagos Nigeria. The women were screened for Hepatitis B and C Virus infection at enrollment. HIV viral load, CD4 count, liver transaminases and hemoglobin levels were also determined. Data were managed with SPSS for windows version. Ethical approval was obtained from the Institutions Ethical Review Board. Results Of the 2391 studied subjects, 101(4.2%) and 37(1.5%) respectively were seropositive for Hepatitis B and C Virus infection. Twowomen (0. 08%) had triple infections. blood transfusion, (cOR: 2.3; 95% CI:1.1 - 4.6), history of induced abortion (cOR:2. 2;95% CI:1.3 - 3.6), and elevated baseline ALT (cOR:2. 2; 95%CI:2. 2;4.2) were significantly associated with HBV. History of induced abortion was the only factor found to be associated with HIV/ HCV (cOR: 1.9;95%CI:1. 3-3.9). Conclusion Hepatitis B Virus infection (4.2%) is relatively common in our environment and associated with induced abortion, blood transfusion and elevated baseline transaminase. Hepatitis C Virus infection (1.5%) is less common and associated with only history of induced abortion. PMID:25396023

User's guide for mapIMG 3--Map image re-projection software package

USGS Publications Warehouse

Finn, Michael P.; Mattli, David M.

2012-01-01

Version 0.0 (1995), Dan Steinwand, U.S. Geological Survey (USGS)/Earth Resources Observation Systems (EROS) Data Center (EDC)--Version 0.0 was a command line version for UNIX that required four arguments: the input metadata, the output metadata, the input data file, and the output destination path. Version 1.0 (2003), Stephen Posch and Michael P. Finn, USGS/Mid-Continent Mapping Center (MCMC--Version 1.0 added a GUI interface that was built using the Qt library for cross platform development. Version 1.01 (2004), Jason Trent and Michael P. Finn, USGS/MCMC--Version 1.01 suggested bounds for the parameters of each projection. Support was added for larger input files, storage of the last used input and output folders, and for TIFF/ GeoTIFF input images. Version 2.0 (2005), Robert Buehler, Jason Trent, and Michael P. Finn, USGS/National Geospatial Technical Operations Center (NGTOC)--Version 2.0 added Resampling Methods (Mean, Mode, Min, Max, and Sum), updated the GUI design, and added the viewer/pre-viewer. The metadata style was changed to XML and was switched to a new naming convention. Version 3.0 (2009), David Mattli and Michael P. Finn, USGS/Center of Excellence for Geospatial Information Science (CEGIS)--Version 3.0 brings optimized resampling methods, an updated GUI, support for less than global datasets, UTM support and the whole codebase was ported to Qt4.

40 CFR 600.107-08 - Fuel specifications.

Code of Federal Regulations, 2014 CFR

2014-07-01

... Exhaust Emission Test Procedures § 600.107-08 Fuel specifications. (a) The test fuel specifications for... given in paragraph (b) of this section. (b)(1) Diesel test fuel used for cold temperature FTP testing... alternative fuel for cold temperature FTP testing. (c) Test fuels representing fuel types for which there are...

40 CFR 600.107-08 - Fuel specifications.

Code of Federal Regulations, 2013 CFR

2013-07-01

... Exhaust Emission Test Procedures § 600.107-08 Fuel specifications. (a) The test fuel specifications for... given in paragraph (b) of this section. (b)(1) Diesel test fuel used for cold temperature FTP testing... alternative fuel for cold temperature FTP testing. (c) Test fuels representing fuel types for which there are...

40 CFR 600.107-08 - Fuel specifications.

Code of Federal Regulations, 2012 CFR

2012-07-01

... Exhaust Emission Test Procedures § 600.107-08 Fuel specifications. (a) The test fuel specifications for... given in paragraph (b) of this section. (b)(1) Diesel test fuel used for cold temperature FTP testing... alternative fuel for cold temperature FTP testing. (c) Test fuels representing fuel types for which there are...

Users Guide to BellhopDRDC_V4: Active and Passive Versions

DTIC Science & Technology

2010-10-01

tactique pour la planification et les opérations navales. Le premier est une version acoustique passive appelée BellhopDRDC_ray_TL_v4. Les résultats de...Importance L’Environment Modeling Manager est un système perfectionné dans le domaine de l’océanographie tactique pour le soutien à la planification et aux...Flag for using Thorpe volume attenuation T = use Thorpe attenuation, the preferred choice and default N = use no attenuation ‘S’ = surface loss

Technical report series on global modeling and data assimilation. Volume 1: Documentation of the Goddard Earth Observing System (GEOS) General Circulation Model, version 1

NASA Technical Reports Server (NTRS)

Suarez, Max J. (Editor); Takacs, Lawrence L.; Molod, Andrea; Wang, Tina

1994-01-01

This technical report documents Version 1 of the Goddard Earth Observing System (GEOS) General Circulation Model (GCM). The GEOS-1 GCM is being used by NASA's Data Assimilation Office (DAO) to produce multiyear data sets for climate research. This report provides a documentation of the model components used in the GEOS-1 GCM, a complete description of model diagnostics available, and a User's Guide to facilitate GEOS-1 GCM experiments.

Clinical comparison of Colgate Platinum Toothwhitening System and Rembrandt Gel Plus.

PubMed

Kowitz, G M; Nathoo, S A; Rustogi, K N; Chmielewski, M B; Liang, L J; Wong, R

1994-01-01

A 2-week, three-cell study was conducted to evaluate the tooth-whitening efficacy of the Colgate Platinum Professional Toothwhitening System vs Rembrandt Gel Plus (a regimen of products consisting of a 10% carbamide peroxide gel, a whitening toothpaste, and a mouthrinse), and a placebo paste. Seventy subjects completed this parallel, single-blind, three-compartment, randomized clinical study. The subjects were balanced into two groups based on a minimal shade of A3 on the Vita shade guide and assigned a product. The duration of product usage was 1 hour twice daily for 2 weeks. Change in tooth color was measured by reflectance spectroscopy using a colorimeter. The readings were taken in the L*, a*, b* color space at the initiation, at 1 week, and at 2 weeks of the study. Calculation of color change (delta E) was performed using the color difference equation established by the Commission Internationale de L'Eclairage. Visual evaluation of shade changes was performed using the Vita shade guide. Results from this clinical study showed that Colgate Platinum was 77.7% more effective at tooth whitening after 1 week and 41.8% more effective after 2 weeks of treatment vs the Rembrandt regimen. Results showed that the Colgate product is significantly superior vs Rembrandt at increasing tooth whiteness (increase in delta E). Shade guide changes showed an overall improvement of 7.08 Vita tabs for the Colgate product and 5.12 Vita tabs for the Rembrandt regimen.

STIR Version 1.0 User's Guide for Pesticide Inhalation Risk

EPA Pesticide Factsheets

STIR estimates inhalation-type exposure based on pesticide-specific information. It also estimates spray droplet exposure using the application method and rate and then compares these exposure estimates to avian and mammalian toxicity data.

Safety Policy and Procedure Manual (Electronic Version)

DOT National Transportation Integrated Search

1997-08-18

The state Secretary of Transportation has set a goal of zero accidents for the : North Carolina Department of Transportation (NCDOT). To guide the NCDOT towards : that goal, this safety manual sets for philosophy, goals, cardinal rules : (grounds for...

Software development to implement the TxDOT culvert rating guide.

DOT National Transportation Integrated Search

2013-05-01

This implementation project created CULVLR: Culvert Load Rating, Version 1.0.0, a Windows-based : desktop application software package that automates the process by which Texas Department of Transportation : (TxDOT) engineers and their consultants ...

ProUCL Version 4.0 Technical Guide

EPA Science Inventory

Statistical inference, including both estimation and hypotheses testing approaches, is routinely used to: estimate environmental parameters of interest, such as exposure point concentration (EPC) terms, not-to-exceed values, and background level threshold values (BTVs) for contam...

Publisher Correction: A cdk1 gradient guides surface contraction waves in oocytes.

PubMed

Bischof, Johanna; Brand, Christoph A; Somogyi, Kálmán; Májer, Imre; Thome, Sarah; Mori, Masashi; Schwarz, Ulrich S; Lénárt, Péter

2018-01-10

A Supplementary Information file from a different paper was inadvertently published with the original version of this Article. This file was replaced with the correct Supplementary Information file on 24 October 2017.

HWNOISE program users' guide

DOT National Transportation Integrated Search

1992-02-01

HWNOISE is a VNTSC-developed user friendly program written in : Microsoft Fortran version 4.01 for the IBM PC/AT and : compatibles to analyze acoustic data. This program is an : integral part of the Federal Highway Administration's Mobile : Noise Dat...

HWINPUT program users' guide

DOT National Transportation Integrated Search

1992-02-01

HWINPUT is a VNTSC-developed user friendly program written in : Microsoft Fortran version 4.01 for the IBM PC/AT. This program : is an integral part of the Federal Highway Administration's : Mobile Noise Data Gathering and Analysis Laboratory and is ...

Flight Deck Interval Management Display. [Elements, Information and Annunciations Database User Guide

NASA Technical Reports Server (NTRS)

Lancaster, Jeff; Dillard, Michael; Alves, Erin; Olofinboba, Olu

2014-01-01

The User Guide details the Access Database provided with the Flight Deck Interval Management (FIM) Display Elements, Information, & Annunciations program. The goal of this User Guide is to support ease of use and the ability to quickly retrieve and select items of interest from the Database. The Database includes FIM Concepts identified in a literature review preceding the publication of this document. Only items that are directly related to FIM (e.g., spacing indicators), which change or enable FIM (e.g., menu with control buttons), or which are affected by FIM (e.g., altitude reading) are included in the database. The guide has been expanded from previous versions to cover database structure, content, and search features with voiced explanations.

FINDS: A fault inferring nonlinear detection system programmers manual, version 3.0

NASA Technical Reports Server (NTRS)

Lancraft, R. E.

1985-01-01

Detailed software documentation of the digital computer program FINDS (Fault Inferring Nonlinear Detection System) Version 3.0 is provided. FINDS is a highly modular and extensible computer program designed to monitor and detect sensor failures, while at the same time providing reliable state estimates. In this version of the program the FINDS methodology is used to detect, isolate, and compensate for failures in simulated avionics sensors used by the Advanced Transport Operating Systems (ATOPS) Transport System Research Vehicle (TSRV) in a Microwave Landing System (MLS) environment. It is intended that this report serve as a programmers guide to aid in the maintenance, modification, and revision of the FINDS software.

Absolute branching fractions of Cabibbo-suppressed D→K Kmacr decays

NASA Astrophysics Data System (ADS)

Bonvicini, G.; Cinabro, D.; Dubrovin, M.; Lincoln, A.; Rademacker, J.; Asner, D. M.; Edwards, K. W.; Naik, P.; Reed, J.; Briere, R. A.; Ferguson, T.; Tatishvili, G.; Vogel, H.; Watkins, M. E.; Rosner, J. L.; Alexander, J. P.; Cassel, D. G.; Duboscq, J. E.; Ehrlich, R.; Fields, L.; Gibbons, L.; Gray, R.; Gray, S. W.; Hartill, D. L.; Heltsley, B. K.; Hertz, D.; Jones, C. D.; Kandaswamy, J.; Kreinick, D. L.; Kuznetsov, V. E.; Mahlke-Krüger, H.; Mohapatra, D.; Miyake, H.; Onyisi, P. U. E.; Patterson, J. R.; Peterson, D.; Riley, D.; Ryd, A.; Sadoff, A. J.; Shi, X.; Stroiney, S.; Sun, W. M.; Wilksen, T.; Athar, S. B.; Patel, R.; Yelton, J.; Rubin, P.; Eisenstein, B. I.; Karliner, I.; Mehrabyan, S.; Lowrey, N.; Selen, M.; White, E. J.; Wiss, J.; Mitchell, R. E.; Shepherd, M. R.; Besson, D.; Pedlar, T. K.; Cronin-Hennessy, D.; Gao, K. Y.; Hietala, J.; Kubota, Y.; Klein, T.; Lang, B. W.; Poling, R.; Scott, A. W.; Zweber, P.; Dobbs, S.; Metreveli, Z.; Seth, K. K.; Tomaradze, A.; Libby, J.; Powell, A.; Wilkinson, G.; Ecklund, K. M.; Love, W.; Savinov, V.; Lopez, A.; Mendez, H.; Ramirez, J.; Ge, J. Y.; Miller, D. H.; Shipsey, I. P. J.; Xin, B.; Adams, G. S.; Anderson, M.; Cummings, J. P.; Danko, I.; Hu, D.; Moziak, B.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C. S.; Thorndike, E. H.; Yang, F.; Artuso, M.; Blusk, S.; Khalil, S.; Li, J.; Mountain, R.; Nisar, S.; Randrianarivony, K.; Sultana, N.; Skwarnicki, T.; Stone, S.; Wang, J. C.; Zhang, L. M.

2008-05-01

Using 281pb-1 of data collected with the CLEO-c detector at the ψ(3770) resonance, we have studied Cabibbo-suppressed decays of D mesons to final states with two kaons. We present results for the absolute branching fractions of the modes D0→K+K-, D0→KS0KS0, and D+→K+KS0. We measure B(D0→K+K-)=(4.08±0.08±0.09)×10-3, B(D0→KS0KS0)=(1.46±0.32±0.09)×10-4, and B(D+→K+KS0)=(3.14±0.09±0.08)×10-3. We also determine the ratio B(D0→K+K-)/B(D0→π+π-)=2.89±0.05±0.06. For each measurement, the first uncertainty is statistical and the second uncertainty is systematic.

Spacecraft Orbit Design and Analysis (SODA), version 1.0 user's guide

NASA Technical Reports Server (NTRS)

Stallcup, Scott S.; Davis, John S.

1989-01-01

The Spacecraft Orbit Design and Analysis (SODA) computer program, Version 1.0 is described. SODA is a spaceflight mission planning system which consists of five program modules integrated around a common database and user interface. SODA runs on a VAX/VMS computer with an EVANS & SUTHERLAND PS300 graphics workstation. BOEING RIM-Version 7 relational database management system performs transparent database services. In the current version three program modules produce an interactive three dimensional (3D) animation of one or more satellites in planetary orbit. Satellite visibility and sensor coverage capabilities are also provided. One module produces an interactive 3D animation of the solar system. Another module calculates cumulative satellite sensor coverage and revisit time for one or more satellites. Currently Earth, Moon, and Mars systems are supported for all modules except the solar system module.

Ahorre Energía: Consejos sobre el ahorro de dinero y energía en el hogar (Spanish Brochure), Energy Savers Guide (in Spanish)

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

La versión en castellano de la guía del Departamento de Energía de los Estados Unidos que ayuda a consumidores a ahorrar energía y dinero en el hogar y en las carreteras. The Spanish-language version of U.S. Department of Energy's consumer guide to saving energy and money at home and on the road.

XML Schema Guide for Secondary CDR Submissions

EPA Pesticide Factsheets

This document presents the extensible markup language (XML) schema guide for the Office of Pollution Prevention and Toxics’ (OPPT) e-CDRweb tool. E-CDRweb is the electronic, web-based tool provided by Environmental Protection Agency (EPA) for the submission of Chemical Data Reporting (CDR) information. This document provides the user with tips and guidance on correctly using the version 1.1 XML schema for the Joint Submission Form. Please note that the order of the elements must match the schema.

Ahorre Energía: Consejos para ahorro dinero y energía en su hogar (Spanish Brochure), Energy Saver Guide (in Spanish)

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

La versión en castellano de la guía del Departamento de Energía de los Estados Unidos que ayuda a consumidores a ahorrar energía y dinero en su hogar y en las carreteras. The Spanish-language version of U.S. Department of Energy's Energy Saver consumer guide to saving energy and money at home and on the road.

Configuration Analysis Tool (CAT). System Description and users guide (revision 1)

NASA Technical Reports Server (NTRS)

Decker, W.; Taylor, W.; Mcgarry, F. E.; Merwarth, P.

1982-01-01

A system description of, and user's guide for, the Configuration Analysis Tool (CAT) are presented. As a configuration management tool, CAT enhances the control of large software systems by providing a repository for information describing the current status of a project. CAT provides an editing capability to update the information and a reporting capability to present the information. CAT is an interactive program available in versions for the PDP-11/70 and VAX-11/780 computers.

Successful Approaches to Helping Students--Including English Learners--Succeed in Elementary School. Parent Guide = Enfoques exitosos para ayudar a los estudiantes--incluyendo a los que aprenden ingles--a triunfar en la escuela primaria. Guia de padres

ERIC Educational Resources Information Center

EdSource, 2007

2007-01-01

This guide informs parents about some instructional practices that work well for all elementary school students, in particular English learners. It includes questions parents can ask teachers and principals to help them understand how their children's school approaches teaching and learning. Both English and Spanish versions of the document are…

ISPyB for BioSAXS, the gateway to user autonomy in solution scattering experiments.

PubMed

De Maria Antolinos, Alejandro; Pernot, Petra; Brennich, Martha E; Kieffer, Jérôme; Bowler, Matthew W; Delageniere, Solange; Ohlsson, Staffan; Malbet Monaco, Stephanie; Ashton, Alun; Franke, Daniel; Svergun, Dmitri; McSweeney, Sean; Gordon, Elspeth; Round, Adam

2015-01-01

Logging experiments with the laboratory-information management system ISPyB (Information System for Protein crystallography Beamlines) enhances the automation of small-angle X-ray scattering of biological macromolecules in solution (BioSAXS) experiments. The ISPyB interface provides immediate user-oriented online feedback and enables data cross-checking and downstream analysis. To optimize data quality and completeness, ISPyBB (ISPyB for BioSAXS) makes it simple for users to compare the results from new measurements with previous acquisitions from the same day or earlier experiments in order to maximize the ability to collect all data required in a single synchrotron visit. The graphical user interface (GUI) of ISPyBB has been designed to guide users in the preparation of an experiment. The input of sample information and the ability to outline the experimental aims in advance provides feedback on the number of measurements required, calculation of expected sample volumes and time needed to collect the data: all of this information aids the users to better prepare for their trip to the synchrotron. A prototype version of the ISPyBB database is now available at the European Synchrotron Radiation Facility (ESRF) beamline BM29 and is already greatly appreciated by academic users and industrial clients. It will soon be available at the PETRA III beamline P12 and the Diamond Light Source beamlines I22 and B21.

ISPyB for BioSAXS, the gateway to user autonomy in solution scattering experiments

PubMed Central

De Maria Antolinos, Alejandro; Pernot, Petra; Brennich, Martha E.; Kieffer, Jérôme; Bowler, Matthew W.; Delageniere, Solange; Ohlsson, Staffan; Malbet Monaco, Stephanie; Ashton, Alun; Franke, Daniel; Svergun, Dmitri; McSweeney, Sean; Gordon, Elspeth; Round, Adam

2015-01-01

Logging experiments with the laboratory-information management system ISPyB (Information System for Protein crystallography Beamlines) enhances the automation of small-angle X-ray scattering of biological macromolecules in solution (BioSAXS) experiments. The ISPyB interface provides immediate user-oriented online feedback and enables data cross-checking and downstream analysis. To optimize data quality and completeness, ISPyBB (ISPyB for BioSAXS) makes it simple for users to compare the results from new measurements with previous acquisitions from the same day or earlier experiments in order to maximize the ability to collect all data required in a single synchrotron visit. The graphical user interface (GUI) of ISPyBB has been designed to guide users in the preparation of an experiment. The input of sample information and the ability to outline the experimental aims in advance provides feedback on the number of measurements required, calculation of expected sample volumes and time needed to collect the data: all of this information aids the users to better prepare for their trip to the synchrotron. A prototype version of the ISPyBB database is now available at the European Synchrotron Radiation Facility (ESRF) beamline BM29 and is already greatly appreciated by academic users and industrial clients. It will soon be available at the PETRA III beamline P12 and the Diamond Light Source beamlines I22 and B21. PMID:25615862

TrkB Activators for the Treatment of Traumatic Vision Loss

DTIC Science & Technology

2017-06-01

em ( do i: 10 .1 08 9/ ne u. 20 17 .5 10...Im m un e Sy st em ( do i: 10 .1 08 9/ ne u. 20 17 .5 10 4) T hi s ar tic le h as b ee n pe er -r ev ie w ed a nd a cc ep te d fo r pu bl ic...Sy st em ( do i: 10 .1 08 9/ ne u. 20 17 .5 10 4) T hi s ar tic le h as b ee n pe er -r ev ie w ed a nd a cc ep te d fo r pu bl ic at io

Measurement of C P violation in B → J/ ψ KS0 decays at LHCb

NASA Astrophysics Data System (ADS)

Meier, F.; LHCb Collaboration

2016-07-01

Analysing a data sample corresponding to an integrated luminosity of 3 fb-1 of pp collisions collected by the LHCb detector at the LHC CP violation in B0→J/ψK0S and B0s→J/ψK0S is measured. The results S(B0→J/ψK0S) = -0.038 ± 0.035 {(stat)} ± 0.020 {(syst)} are consistent with the current world averages and with the Standard Model expectations. In B0s→J/ψK0s the results A_{ΔΓ(B0s→J/ψK0s) = 0.49 ±^{0.77}_{0.65} {(stat)} ± 0.06 {(syst)}, S(B0s→J/ψK0s) = -0.08 ± 0.40 {(stat)} ± 0.08 {(syst)}, C(B0s→J/ψK0s) = - 0.28 ± 0.41 {(stat)} ± 0.08 {(syst)} reflect the first determination of these C P observables paving a new way towards the control of penguin pollutions in the determination of sin 2β.

Standardised extract of Bacopa monniera (CDRI-08) improves contextual fear memory by differentially regulating the activity of histone acetylation and protein phosphatases (PP1α, PP2A) in hippocampus.

PubMed

Preethi, Jayakumar; Singh, Hemant K; Venkataraman, Jois Shreyas; Rajan, Koilmani Emmanuvel

2014-05-01

Contextual fear conditioning is a paradigm for investigating cellular mechanisms involved in hippocampus-dependent memory. Earlier, we showed that standardised extract of Bacopa monniera (CDRI-08) improves hippocampus-dependent learning in postnatal rats by elevating the level of serotonin (5-hydroxytryptamine, 5-HT), activate 5-HT3A receptors, and cyclic adenosine monophosphate (cAMP) response element binding (CREB) protein. In this study, we have further examined the molecular mechanism of CDRI-08 in hippocampus-dependent memory and compared to the histone deacetylase (HDACs) inhibitor sodium butyrate (NaB). To assess the hippocampus-dependent memory, wistar rat pups were subjected to contextual fear conditioning (CFC) following daily (postnatal days 15-29) administration of vehicle solution (0.5 % gum acacia + 0.9 % saline)/CDRI-08 (80 mg/kg, p.o.)/NaB (1.2 g/kg in PBS, i.p.). CDRI-08/NaB treated group showed enhanced freezing behavior compared to control group when re-exposed to the same context. Administration of CDRI-08/NaB resulted in activation of extracellular signal-regulated kinase ERK/CREB signaling cascade and up-regulation of p300, Ac-H3 and Ac-H4 levels, and down-regulation of HDACs (1, 2) and protein phosphatases (PP1α, PP2A) in hippocampus following CFC. This would subsequently result in an increased brain-derived neurotrophic factor (Bdnf) (exon IV) mRNA in hippocampus. Altogether, our results indicate that CDRI-08 enhances hippocampus-dependent contextual memory by differentially regulating histone acetylation and protein phosphatases in hippocampus.

The guided-mode resonance biosensor: principles, technology, and implementation

NASA Astrophysics Data System (ADS)

Magnusson, Robert; Lee, Kyu J.; Hemmati, Hafez; Ko, Yeong Hwan; Wenner, Brett R.; Allen, Jeffery W.; Allen, Monica S.; Gimlin, Susanne; Weidanz, Debra Wawro

2018-02-01

The guided-mode resonance (GMR) sensor operates with quasi-guided modes induced in periodic films. The resonance is enabled by 1D or 2D nanopatterns that are expeditiously fabricated. Optical sensors are needed in many fields including medical diagnostics, chemical analyses, and environmental monitoring. Inducing resonance in multiple modes enables extraction of complete bioreaction information including the biolayer thickness, biolayer refractive index, and any change in the refractive index in the background buffer solution. Thus, we refer to this version of the GMR sensor as the complete biosensor. We address the fundamentals, state of technological development, and implementation of this basic sensor modality.

Aviation Environmental Design Tool (AEDT): Technical Manual Version 2b, Service Pack 2

DOT National Transportation Integrated Search

2016-05-01

The Federal Aviation Administration, Office of Environment and Energy (FAA-AEE) has developed the Aviation Environmental Design Tool (AEDT) version 2b software system with the support of the following development team: FAA, National Aeronautics and S...

Aviation Environmental Design Tool (AEDT): technical manual, version 2b, service pack 3

DOT National Transportation Integrated Search

2016-05-03

The Federal Aviation Administration, Office of Environment and Energy (FAA-AEE) has developed the Aviation Environmental Design Tool (AEDT) version 2b software system with the support of the following development team: FAA, National Aeronautics and S...

Controlling exposure to chemicals: a simple guide.

PubMed

Hay, Alastair

2006-09-01

Controlling exposure to chemicals in the workplace has been made easier by the use of a guide published by the U.K. Health and Safety Executive (HSE). Known as COSHH (Control of Substances Hazardous to Health Regulations) Essentials, the guide is a simple five-step procedure to devise appropriate control strategies to reduce exposures to various substances under different conditions. U.K. health and safety law requires risk assessments prior to use of hazardous substances and installation of appropriate control strategies before work commences. A 1996 survey of 1500 safety managers and trade union safety representatives revealed that the majority had little understanding of occupational safety limits for chemicals. Small- and medium-sized companies had little understanding of limits, and most could not develop control strategies. A new approach was required. COSHH Essentials is it. Developed over 3 years by a working group of hygienists and toxicologists representing HSE, industry, trade unions, and independent experts, the guide is now available in both paper-based and internet versions. It applies a hazard banding approach validated by data for 111 substances that have well-founded U.K. occupational exposure limits. New users select an appropriate hazard band for chemicals based on risk phrases. Details about dustiness for powders or volatility for liquids are inserted, and the guide allocates substances to one of four exposure bands linked, in turn, to specific control strategies. Now accessible through the HSE web site, COSHH Essentials will offer control strategies for both single chemicals and whole processes. To date over 300,000 risk assessments have been carried out using the internet version of COSHH Essentials.

The Stochastic Human Exposure and Dose Simulation Model for Multimedia, Multipathway Chemicals: Residential Module Version 4: User Guide, June 2012

EPA Pesticide Factsheets

SHEDS - Multimedia is EPA's premier physically-based, probabilistic model, that can simulate cumulative or aggregate exposures for a population across a variety of multimedia, multipathway environmental chemicals.

FHWA roadway construction noise model, version 1.0 : user's guide

DOT National Transportation Integrated Search

2006-01-01

The Roadway Construction Noise Model (RCNM) is the Federal Highway Administrations (FHWA) national model for the prediction of construction noise. Due to the fact that construction is often conducted in close proximity to residences and businesses...

Virtual Beach 3: User's Guide

EPA Science Inventory

Virtual Beach version 3 (VB3) is a decision support tool that constructs site-specific statistical models to predict fecal indicator bacteria (FIB) concentrations at recreational beaches. VB3 is primarily designed for beach managers responsible for making decisions regarding beac...

Idaho AASHTOWare pavement ME design user's guide, version 1.1.

DOT National Transportation Integrated Search

2014-03-01

The AASHTOWare Pavement ME Design procedure is based on mechanistic-empirical (M-E) design concepts. This means that the design procedure calculates pavement responses such as stresses, strains, and deflections under axle loads and climatic condition...

Globus Quick Start Guide. Globus Software Version 1.1

NASA Technical Reports Server (NTRS)

1999-01-01

The Globus Project is a community effort, led by Argonne National Laboratory and the University of Southern California's Information Sciences Institute. Globus is developing the basic software infrastructure for computations that integrate geographically distributed computational and information resources.

Aviation Environmental Design Tool (AEDT): Version 2c Service Pack 2: Installation Guide

DOT National Transportation Integrated Search

2017-03-01

Aviation Environmental Design Tool (AEDT) is a software system that models aircraft performance in space and time to estimate fuel consumption, emissions, noise, and air quality consequences. AEDT facilitates environmental review activities required ...

Integrated Noise Model (INM) Version 6.0 User's Guide.

DOT National Transportation Integrated Search

1999-09-01

The FAA Office of Environment and Energy supports the assessment of aircraft noise impacts by developing and maintaining noise-evaluation models and methodologies. In particular, the FAA's Integrated Noise Model (INM) is widely used by the civilian a...

The Stochastic Human Exposure and Dose Simulation Model for Multimedia, Multipathway Chemicals: Dietary Module Version 1: User Guide, June 2012

EPA Pesticide Factsheets

SHEDS - Multimedia is EPA's premier physically-based, probabilistic model, that can simulate cumulative or aggregate exposures for a population across a variety of multimedia, multipathway environmental chemicals.

External cephalic version for breech presentation with or without spinal analgesia in nulliparous women at term: a randomized controlled trial.

PubMed

Weiniger, Carolyn F; Ginosar, Yehuda; Elchalal, Uriel; Sharon, Einav; Nokrian, Malka; Ezra, Yossef

2007-12-01

To compare the success of external cephalic version using spinal analgesia with no analgesia among nulliparas. A prospective randomized controlled trial was performed in a tertiary referral center delivery suite. Nulliparous women at term requesting external cephalic version for breech presentation were randomized to receive spinal analgesia (7.5 mg bupivacaine) or no analgesia before the external cephalic version. An experienced obstetrician performed the external cephalic version. Primary outcome was successful conversion to vertex presentation. Seventy-four women were enrolled, and 70 analyzed (36 spinal, 34 no analgesia). Successful external cephalic version occurred among 24 of 36 (66.7%) women randomized to receive spinal analgesia compared with 11 of 34 (32.4%) without, P=.004 (95% confidence interval [CI] of the difference: 0.0954-0.5513). External cephalic version with spinal analgesia resulted in a lower visual analog pain score, 1.76+/-2.74 compared with 6.84+/-3.08 without, P<.001. A secondary analysis logistic regression model demonstrated that the odds of external cephalic version success was 4.0-fold higher when performed with spinal analgesia P=.02 (95% CI, odds ratio [OR] 1.2-12.9). Complete breech presentation before attempting external cephalic version increased the odds of success 8.2-fold, P=.001 (95% CI, OR 2.2-30.3). Placental position, estimated fetal weight, and maternal weight did not contribute to the success rate when spinal analgesia was used. There were no cases of placental abruption or fetal distress. Administration of spinal analgesia significantly increases the success rate of external cephalic version among nulliparous women at term, which allows possible normal vaginal delivery. ClinicalTrials.gov, www.clinicaltrials.gov, NCT00119184 I.

Inconsistencies Between Two Cross-Cultural Adaptations of the Hospital Survey on Patient Safety Culture Into French.

PubMed

Boussat, Bastien; François, Patrice; Gandon, Gérald; Giai, Joris; Seigneurin, Arnaud; Perneger, Thomas; Labarère, José

2017-11-15

Two cross-cultural adaptations of the 12-dimension Hospital Survey on Patient Safety Culture (HSOPSC) into French coexist: the Occelli and Vlayen versions. The objective of this study was to assess the psychometric properties of the Occelli version in comparison with those reported for the Vlayen and the original US versions of this instrument. Using the original data from a cross-sectional study of 5,064 employees at a single university hospital in France, we examined the acceptability, internal consistency, factorial structure, and construct validity of the Occelli version of the HSOPSC. The response rate was 76.8% (n = 3888). Our study yielded lower missing value rates (median, 0.4% [range, 0.0%-2.4%] versus 0.8% [range, 0.2%-11.4%]) and lower dimension scores (median, 3.19 [range, 2.67-3.54] versus 3.42 [range, 2.92-3.96]) than those reported for the Vlayen version. Cronbach alphas (median, 0.64; range, 0.56-0.84) compared unfavorably with those reported for the Vlayen (median, 0.73; range, 0.57-0.86) and original US (median, 0.78; range, 0.63-0.84) versions. The results of the confirmatory factor analysis were consistent between the Vlayen and Occelli versions, making it possible to conduct surveys from the 12-dimensional structure with both versions. The inconsistencies observed between the Occelli and Vlayen versions of the HSOPSC may reflect either differences between the translations or heterogeneity in the study population and context. Current evidence does not clearly support the use of one version over the other. The two cross-cultural adaptations of the HSOPSC can be used interchangeably in French-speaking countries.

Emotional Intelligence and Callous-Unemotional Traits in Incarcerated Adolescents.

PubMed

Kahn, Rachel E; Ermer, Elsa; Salovey, Peter; Kiehl, Kent A

2016-12-01

Emotional intelligence (EI) is the ability to perceive, manage, and reason about emotions and to use this information to guide thinking and behavior adaptively. Youth with callous-unemotional (CU) traits demonstrate a variety of affective deficits, including impairment in recognition of emotion and reduced emotional responsiveness to distress or pain in others. We examined the association between ability EI and CU traits in a sample of incarcerated adolescents (n = 141) using an expert-rater device (Psychopathy Checklist Youth Version (PCL-YV; Manual for the Hare psychopathy checklist: Youth version. Multi-Health Systems, Toronto, 2003) and self-report assessments of CU traits. EI was assessed using the Mayer-Salovey-Caruso Emotional Intelligence Test-Youth Version, Research Version (MSCEIT-YV-R; MSCEIT YV: Mayer-Salovey-Caruso emotional intelligence test: Youth version, research version 1.0. Multi-Health Systems, Toronto, Ontario, 2005). Similar to findings in adult forensic populations, high levels of CU traits in incarcerated adolescents were associated with lower EI, particularly higher order EI skills. Identifying impairment on EI abilities may have important implications for emerging treatment and intervention developments for youth with high levels of CU traits.

Mitigation and Monitoring Plan for impacted wetlands at the Gunnison UMTRA Project site, Gunnison, Colorado. Revision 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1994-12-01

The Gunnison, Colorado, abandoned uranium mill site is one site being cleaned up by the DOE under UMTRCA authority. This site`s contaminated material is being transported to a disposal site on US Bureau of Land Management (BLM) land east of Gunnison. Remedial action activities have temporarily disturbed 0.8 acre (ac) (0.3 hectares [ha]) of wetlands and permanently eliminated 4.3 ac (1.7 ha). As required by the Clean Water Act, the US Army Corps of Engineers (USACE) prepared a Section 404 Permit that addresses the loss of wetlands as a result of remedial action at the Gunnison UMTRA Project site. Themore » 404 permit includes this report as an attachment and it describes the wetland mitigation and monitoring plan. The DOE formulated this plan in consultation with the BLM and the USACE. This report represents a revised version of the mitigation and monitoring plan (DOE, 1992b).« less

76 FR 46598 - Third Party Testing for Certain Children's Products; Toys: Requirements for Accreditation of...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-08-03

... Ends --Section 4.35, Pompoms --Section 4.36, Hemispheric-Shaped Objects --Section 4.37, Yo-Yo Elastic... --Section 4.36, Hemispheric-Shaped Objects --Section 4.37, Yo-Yo Elastic Tether Toys --Section 4.38, Magnets... F 963-08''), and section 4.27 (toy chests) from ASTM International's F 963-07[egr]1 version of the...

Harwell Subroutine Library. A Catalogue of Subroutines (1973),

DTIC Science & Technology

1973-07-01

up the equations AT Ax = ATb. There may be more than one right-hand size. Remark: If the solution is required see MAO9A. Versions: MAOA ; MAOBAD. Calls...Hermitian MEO8A source decks-modification of OEOIA real gene .’al to Hessenberg sparsity pattern TDO2A MC08A, MCI4A spherical co-ordinates GAOIA real

Using ACT Data as Part of a State Accountability System. Issues in College Readiness

ERIC Educational Resources Information Center

ACT, Inc., 2009

2009-01-01

Accountability in the nation's public schools has become a matter of considerable urgency since the 2001 amendment of the federal Elementary and Secondary Education Act (ESEA) of 1965. Under this most recent version of the ESEA, as of the 2007-08 academic year states and districts must assess the mathematics and reading proficiency of students…

Differences between Girls and Boys in Emerging Language Skills: Evidence from 10 Language Communities

ERIC Educational Resources Information Center

Eriksson, Marten; Marschik, Peter B.; Tulviste, Tiia; Almgren, Margareta; Perez Pereira, Miguel; Wehberg, Sonja; Marjanovic-Umek, Ljubica; Gayraud, Frederique; Kovacevic, Melita; Gallego, Carlos

2012-01-01

The present study explored gender differences in emerging language skills in 13,783 European children from 10 non-English language communities. It was based on a synthesis of published data assessed with adapted versions of the MacArthur-Bates Communicative Development Inventories (CDIs) from age 0.08 to 2.06. The results showed that girls are…

β-Glucan and dark chocolate: a randomized crossover study on short-term satiety and energy intake.

PubMed

Akyol, Asli; Dasgin, Halil; Ayaz, Aylin; Buyuktuncer, Zehra; Besler, H Tanju

2014-09-23

The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Study subjects (n = 25) were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON), oat β-glucan (B-GLU), dark chocolate (DARK) or oat β-glucan and dark chocolate (B-GLU + DARK) were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS) scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014). The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

β-Glucan and Dark Chocolate: A Randomized Crossover Study on Short-Term Satiety and Energy Intake

PubMed Central

Akyol, Asli; Dasgin, Halil; Ayaz, Aylin; Buyuktuncer, Zehra; Besler, H. Tanju

2014-01-01

Aim: The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Materials and Methods: Study subjects (n = 25) were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON), oat β-glucan (B-GLU), dark chocolate (DARK) or oat β-glucan and dark chocolate (B-GLU + DARK) were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS) scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. Results: VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014). Conclusion: The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects. PMID:25251294

Users guide for ENVSTD program Version 2. 0 and LTGSTD program Version 2. 0

DOE Office of Scientific and Technical Information (OSTI.GOV)

Crawley, D.B.; Riesen, P.K.; Briggs, R.S.

1989-02-01

On January 30, 1989, the US Department of Energy (DOE) promulgated 10 CFR Part 435, Subpart A, an Interim Rule entitled ''Energy Conservation Voluntary Performance Standards for New Commercial and Multi-Family High Rise Residential Buildings; Mandatory for New Federal Buildings.'' As a consequence, federal agencies must design all future federal commercial and multifamily high rise residential buildings in accordance with the Standards, or show that their current standards already meet or exceed the energy-efficiency requirements of the Standards. Although these newly enacted Standards do not regulate the design of nonfederal buildings, DOE recommends that all design professionals use the Standardsmore » as guidelines for designing energy-conserving buildings. To encourage private sector use, the Standards were presented in the January 30, 1989, Federal Register in the format typical of commercial standards rather than a federal regulation. As a further help, DOE supported the development of various microcomputer programs to ease the use of the Standards. Two of these programs/emdash/ENVSTD (Version 2.0) and LTGSTD (Version 2.0)/emdash/are detailed in this users guide and provided on the accompanying diskette. This package, developed by Pacific Northwest Laboratory (PNL), is intended to facilitate the designer's use of the Standards dealing specifically with a building's envelope and lighting system designs. Using these programs will greatly simplify the designer's task of performing the sometimes complex calculations needed to determine a design's compliance with the Standards. 3 refs., 6 figs.« less

The effect of enamel porcelain thickness on color and the ability of a shade guide to prescribe chroma.

PubMed

Jarad, F D; Moss, B W; Youngson, C C; Russell, M D

2007-04-01

To test the null hypothesis that there is no color change when enamel porcelain thickness is changed and to evaluate the ability of a shade guide to prescribe chroma. Three shades (3M1, 3M2 and 3M3) were selected from a Vitapan 3D master shade guide. Five disk specimens were prepared for each shade, consisting of three layers (opacious dentin, dentin and enamel) at thicknesses of 0.6, 0.8 and 0.6mm, respectively. The color of each disk was measured using a spectrophotometer. Enamel porcelain was reduced in thickness to 0.3mm and porcelain disks were remeasured. Reducing the enamel thickness of porcelain disk specimens significantly increased L) (p<0.05), b*, metric chroma and hue angle (p<0.001). For the three shades studied (3M1, 3M2 and 3M3) L* values were not significantly different (p>0.05) and chroma increased for 3M1 with the lowest chroma to 3M3 with the highest chroma, which is in line with the shade guide specifications. Although statistically significant (p<0.001) changes in hue angle between the three shades were small (less than 3 degrees overall). The difference in chroma between the three shades 3M1, 3M2 and 3M3 was greatest for the thin enamel layer than the thick enamel layer. A change in enamel thickness from 0.6 to 0.3mm resulted in a three-unit change in L* and metric chroma and a 4 degrees change in hue angle. A change in enamel porcelain thickness will have a greater effect on higher chromatic shades than those with lower chroma. The ability of the shade guide to prescribe chroma was demonstrated but this could be offset by an anomalous enamel thickness.

Evaluating Surface Flux Results from CERES-FLASHFlux

NASA Technical Reports Server (NTRS)

Wilber, Anne C.; Stackhouse, Paul W., Jr.; Kratz, David P.; Gupta, Shashi K.; Sawaengphokhai, Parnchai K.

2015-01-01

The Fast Longwave and Shortwave Radiative Flux (FLASHFlux) data product was developed to provide a rapid release version of the Clouds and Earth's Radiant Energy System (CERES) results, which could be made available to the research and applications communities within one week of the satellite observations by exchanging some accuracy for speed of processing. Unlike standard CERES products, FLASHFlux does not maintain a long-term consistent record. Therefore the latest algorithm changes and input data can be incorporated into processing. FLASHFlux released Version3A (January 2013) and Version 3B (August 2014) which include the latest meteorological product from Global Modeling and Assimilation Office (GMAO), GEOS FP-IT (5.9.1), the latest spectral response functions and gains for the CERES instruments, and aerosol climatology based on the latest MATCH data. Version 3B included a slightly updated calibration and some changes to the surface albedo over snow/ice. Typically FLASHFlux does not reprocess earlier versions when a new version is released. The combined record of Time Interpolated Space Averaged (TISA) surface flux results from Versions3A and 3B for July 2012 to October 2015 have been compared to the ground-based measurements. The FLASHFlux results are also compared to two other CERES gridded products, SYN1deg and EBAF surface fluxes.

Test-retest reliability and comparability of paper and computer questionnaires for the Finnish version of the Tampa Scale of Kinesiophobia.

PubMed

Koho, P; Aho, S; Kautiainen, H; Pohjolainen, T; Hurri, H

2014-12-01

To estimate the internal consistency, test-retest reliability and comparability of paper and computer versions of the Finnish version of the Tampa Scale of Kinesiophobia (TSK-FIN) among patients with chronic pain. In addition, patients' personal experiences of completing both versions of the TSK-FIN and preferences between these two methods of data collection were studied. Test-retest reliability study. Paper and computer versions of the TSK-FIN were completed twice on two consecutive days. The sample comprised 94 consecutive patients with chronic musculoskeletal pain participating in a pain management or individual rehabilitation programme. The group rehabilitation design consisted of physical and functional exercises, evaluation of the social situation, psychological assessment of pain-related stress factors, and personal pain management training in order to regain overall function and mitigate the inconvenience of pain and fear-avoidance behaviour. The mean TSK-FIN score was 37.1 [standard deviation (SD) 8.1] for the computer version and 35.3 (SD 7.9) for the paper version. The mean difference between the two versions was 1.9 (95% confidence interval 0.8 to 2.9). Test-retest reliability was 0.89 for the paper version and 0.88 for the computer version. Internal consistency was considered to be good for both versions. The intraclass correlation coefficient for comparability was 0.77 (95% confidence interval 0.66 to 0.85), indicating substantial reliability between the two methods. Both versions of the TSK-FIN demonstrated substantial intertest reliability, good test-retest reliability, good internal consistency and acceptable limits of agreement, suggesting their suitability for clinical use. However, subjects tended to score higher when using the computer version. As such, in an ideal situation, data should be collected in a similar manner throughout the course of rehabilitation or clinical research. Copyright © 2014 Chartered Society of Physiotherapy. Published by Elsevier Ltd. All rights reserved.

Selective excitation of LP01 and LP02 in dual-concentric cores fiber using an adiabatically tapered microstructured mode converter

NASA Astrophysics Data System (ADS)

Sammouda, Marwa; Taher, Aymen Belhadj; Bahloul, Faouzi; Bin, Philippe Di

2016-09-01

We propose to connect a single-mode fiber (SMF) to a dual-concentric cores fiber (DCCF) using an adiabatically tapered microstructured mode converter, and to evaluate the SMF LP01 mode and the DCCF LP01 and LP02 modes selective excitations performances. We theoretically and numerically study this selective excitation method by calculating the effective indices of the propagated modes, the adiabaticity criteria, the coupling loss, and the modes amplitudes along the tapered structure. This study shows that this method is able to achieve excellent selective excitations of the first two linearly polarized modes (LP01 and LP02) among the five guided modes in the DCCF with a negligible loss. The part of the LP01 and LP02 modes from the total power are 99% and 84% corresponding to 0.1 and 0.8 dB losses, respectively.

Lick Jupiter-Voyager reference star catalogue (Klemola, Morabito, and Taraji 1978): Documentation for the machine-readable version

NASA Technical Reports Server (NTRS)

Warren, Wayne H., Jr.

1990-01-01

The machine-readable version of the catalog, as it is currently being distributed from the Astronomical Data Center, is described. The catalog contains accurate equatorial coordinates for 4983 stars in a band of sky against which cameras of the Voyager spacecraft were pointed for observations in the region of Jupiter during the flyby. All of the reference stars are in the range 6 hr 00 min to 8 hr 04 min in right ascension (1950), declination zones +16 to +23 degrees, and 8 hr to 31 min to 8 hr 57 min, zones +08 to +14 degrees. Mean errors of the positions are about 0.4 sec.

Dental Shade Guide Variability for Hues B, C, and D Using Cross-Polarized Photography.

PubMed

Sampaio, Camila S; Gurrea, Jon; Gurrea, Marta; Bruguera, August; Atria, Pablo J; Janal, Malvin; Bonfante, Estevam A; Coelho, Paulo G; Hirata, Ronaldo

2018-04-20

This study evaluated the color variability of hues B, C, and D between the VITA Classical shade guide (Vita Zahnfabrik) and four other VITA-coded ceramic shade guides using a digital camera (Canon EOS 60D) and computer software (Adobe Photoshop CC). A cross-polarizing filter was used to standardize external light sources influencing color match. A total of 275 pictures were taken, 5 per shade tab, for 11 shades (B1, B2, B3, B4, C1, C2, C3, C4, D2, D3, and D4), from the following shade guides: VITA Classical (control); IPS e.max Ceram (Ivoclar Vivadent); IPS d.SIGN (Ivoclar Vivadent); Initial ZI (GC); and Creation CC (Creation Willi Geller). Pictures were evaluated using Adobe Photoshop CC for standardization of hue, chroma, and value between shade tabs. The VITA-coded shade guides evaluated here showed an overall unmatched shade in all their tabs when compared to the control, suggesting that shade selection should be made with the corresponding manufacturer guide of the ceramic intended for the final restoration.

Double coding and mapping using Abbreviated Injury Scale 1998 and 2005: identifying issues for trauma data.

PubMed

Palmer, Cameron S; Niggemeyer, Louise E; Charman, Debra

2010-09-01

The 2005 version of the Abbreviated Injury Scale (AIS05) potentially represents a significant change in injury spectrum classification, due to a substantial increase in the codeset size and alterations to the agreed severity of many injuries compared to the previous version (AIS98). Whilst many trauma registries around the world are moving to adopt AIS05 or its 2008 update (AIS08), its effect on patient classification in existing registries, and the optimum method of comparing existing data collections with new AIS05 collections are unknown. The present study aimed to assess the potential impact of adopting the AIS05 codeset in an established trauma system, and to identify issues associated with this change. A current subset of consecutive major trauma patients admitted to two large hospitals in the Australian state of Victoria were double-coded in AIS98 and AIS05. Assigned codesets were also mapped to the other AIS version using code lists supplied in the AIS05 manual, giving up to four AIS codes per injury sustained. Resulting codesets were assessed for agreement in codes used, injury severity and calculated severity scores. 602 injuries sustained by 109 patients were compared. Adopting AIS05 would lead to a decrease in the number of designated major trauma patients in Victoria, estimated at 22% (95% confidence interval, 15-31%). Differences in AIS level between versions were significantly more likely to occur amongst head and chest injuries. Data mapped to a different codeset performed better in paired comparisons than raw AIS98 and AIS05 codesets, with data mapping of AIS05 codes back to AIS98 giving significantly higher levels of agreement in AIS level, ISS and NISS than other potential comparisons, and resulting in significantly fewer conversion problems than attempting to map AIS98 codes to AIS05. This study provides new insights into AIS codeset change impact. Adoption of AIS05 or AIS08 in established registries will decrease major trauma patient numbers. Code mapping between AIS versions can improve comparisons between datasets in different AIS versions, although the injury profile of a trauma population will affect the degree of comparability. At present, mapping AIS05 data back to AIS98 is recommended. 2009 Elsevier Ltd. All rights reserved.

DESI-Detection of early-season invasives (software-installation manual and user's guide version 1.0)

USGS Publications Warehouse

Kokaly, Raymond F.

2011-01-01

This report describes a software system for detecting early-season invasive plant species, such as cheatgrass. The report includes instructions for installing the software and serves as a user's guide in processing Landsat satellite remote sensing data to map the distributions of cheatgrass and other early-season invasive plants. The software was developed for application to the semi-arid regions of southern Utah; however, the detection parameters can be altered by the user for application to other areas.

VORCAM: A computer program for calculating vortex lift effect of cambered wings by the suction analogy

NASA Technical Reports Server (NTRS)

Lan, C. E.; Chang, J. F.

1981-01-01

A user's guide to an improved version of Woodward's chord plane aerodynamic panel computer code is presumed. The guide can be applied to cambered wings exhibiting edge separated flow, including those with leading edge vortex flow at subsonic and supersonic speeds. New orientations for the rotated suction force are employed based on the momentum principal. The supersonic suction analogy method is improved by using an effective angle of attack defined through a semiempirical method.

MINOS 5.0 User’s Guide.

DTIC Science & Technology

1983-12-01

1111 1 MICROCOPY RESOLUTION TEST CHARTjNA IONAL BURE U OF STANDARDS 193-A LK7> systems 1-,i11 Optimization 2 tLaboratory MINOS 5.0 USER’S GUIDE by...encouragement from George Dantzig and the benefit of his modeling activity within SOL, notably on the energy-economic model PILOT . We thank him warmly for...provided by running various versions of MINOS during their work on PILOT . (We note that PILOT has grown to 1500 constraints and 4000 variables, and now has

Production and Testing of the VITAMIN-B7 Fine-Group and BUGLE-B7 Broad-Group Coupled Neutron/Gamma Cross-Section Libraries Derived from ENDF/B-VII.0 Nuclear Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Risner, J. M.; Wiarda, D.; Dunn, M. E.

2011-09-30

New coupled neutron-gamma cross-section libraries have been developed for use in light water reactor (LWR) shielding applications, including pressure vessel dosimetry calculations. The libraries, which were generated using Evaluated Nuclear Data File/B Version VII Release 0 (ENDF/B-VII.0), use the same fine-group and broad-group energy structures as the VITAMIN-B6 and BUGLE-96 libraries. The processing methodology used to generate both libraries is based on the methods used to develop VITAMIN-B6 and BUGLE-96 and is consistent with ANSI/ANS 6.1.2. The ENDF data were first processed into the fine-group pseudo-problem-independent VITAMIN-B7 library and then collapsed into the broad-group BUGLE-B7 library. The VITAMIN-B7 library containsmore » data for 391 nuclides. This represents a significant increase compared to the VITAMIN-B6 library, which contained data for 120 nuclides. The BUGLE-B7 library contains data for the same nuclides as BUGLE-96, and maintains the same numeric IDs for those nuclides. The broad-group data includes nuclides which are infinitely dilute and group collapsed using a concrete weighting spectrum, as well as nuclides which are self-shielded and group collapsed using weighting spectra representative of important regions of LWRs. The verification and validation of the new libraries includes a set of critical benchmark experiments, a set of regression tests that are used to evaluate multigroup crosssection libraries in the SCALE code system, and three pressure vessel dosimetry benchmarks. Results of these tests confirm that the new libraries are appropriate for use in LWR shielding analyses and meet the requirements of Regulatory Guide 1.190.« less

TerrPlant Version 1.2.2 User's Guide for Pesticide Exposure to Terrestrial Plants

EPA Pesticide Factsheets

Tier 1 model for screening-level assessments of pesticides. TerrPlant provides screening-level estimates of exposure to terrestrial plants from single pesticide applications. It does not consider exposures to plants from multiple pesticide applications.

User documentation for the MSK and OMS intelligent tutoring systems

NASA Technical Reports Server (NTRS)

Fink, Pamela K.; Herren, L. Tandy; Lincoln, David T.

1991-01-01

This user's guide describes how to use the Intelligent Tutoring Systems for the Manual Select Keyboard (MSK) and the Orbital Maneuvering System (OMS) and how to use the C code that runs the mockup version of the MSK.

The Stochastic Human Exposure and Dose Simulation Model for Multimedia, Multipathway Chemicals: Dietary Module Version 1: Quick Start Guide, May 2012

EPA Pesticide Factsheets

SHEDS - Multimedia is EPA's premier physically-based, probabilistic model, that can simulate cumulative or aggregate exposures for a population across a variety of multimedia, multipathway environmental chemicals.

EMPHASIS™/Nevada UTDEM User Guide Version 2.1.2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Turner, C. David; Pasik, Michael F.; Seidel, David B.

The Unstructured Time-Domain ElectroMagnetics (UTDEM) portion of the EMPHASIS suite solves Maxwell’s equations using finite-element techniques on unstructured meshes. This document provides user-specific information to facilitate the use of the code for applications of interest.

The Stochastic Human Exposure and Dose Simulation Model for Multimedia, Multipathway Chemicals: Residential Module Version 4: Quick Start Guide, April 2012

EPA Pesticide Factsheets

SHEDS - Multimedia is EPA's premier physically-based, probabilistic model, that can simulate cumulative or aggregate exposures for a population across a variety of multimedia, multipathway environmental chemicals.

Overview for geologic field-trip guides to Mount Mazama, Crater Lake Caldera, and Newberry Volcano, Oregon

USGS Publications Warehouse

Bacon, Charles R.; Donnelly-Nolan, Julie M.; Jensen, Robert A.; Wright, Heather M.

2017-08-16

These field-trip guides were written for the occasion of the International Association of Volcanology and Chemistry of the Earth’s Interior (IAVCEI) quadrennial scientific assembly in Portland, Oregon, in August 2017. The guide to Mount Mazama and Crater Lake caldera is an updated and expanded version of the guide (Bacon, 1989) for part of an earlier IAVCEI trip to the southern Cascade Range. The guide to Newberry Volcano describes the stops included in the 2017 field trip. Crater Lake and Newberry are the two best-preserved and most recent calderas in the Cascades Volcanic Arc. Although located in different settings in the arc, with Crater Lake on the arc axis and Newberry in the rear-arc, both volcanoes are located at the intersection of the arc and the northwest corner region of the extensional Basin and Range Province.

User's Guide for TOUGH2-MP - A Massively Parallel Version of the TOUGH2 Code

DOE Office of Scientific and Technical Information (OSTI.GOV)

Earth Sciences Division; Zhang, Keni; Zhang, Keni

TOUGH2-MP is a massively parallel (MP) version of the TOUGH2 code, designed for computationally efficient parallel simulation of isothermal and nonisothermal flows of multicomponent, multiphase fluids in one, two, and three-dimensional porous and fractured media. In recent years, computational requirements have become increasingly intensive in large or highly nonlinear problems for applications in areas such as radioactive waste disposal, CO2 geological sequestration, environmental assessment and remediation, reservoir engineering, and groundwater hydrology. The primary objective of developing the parallel-simulation capability is to significantly improve the computational performance of the TOUGH2 family of codes. The particular goal for the parallel simulator ismore » to achieve orders-of-magnitude improvement in computational time for models with ever-increasing complexity. TOUGH2-MP is designed to perform parallel simulation on multi-CPU computational platforms. An earlier version of TOUGH2-MP (V1.0) was based on the TOUGH2 Version 1.4 with EOS3, EOS9, and T2R3D modules, a software previously qualified for applications in the Yucca Mountain project, and was designed for execution on CRAY T3E and IBM SP supercomputers. The current version of TOUGH2-MP (V2.0) includes all fluid property modules of the standard version TOUGH2 V2.0. It provides computationally efficient capabilities using supercomputers, Linux clusters, or multi-core PCs, and also offers many user-friendly features. The parallel simulator inherits all process capabilities from V2.0 together with additional capabilities for handling fractured media from V1.4. This report provides a quick starting guide on how to set up and run the TOUGH2-MP program for users with a basic knowledge of running the (standard) version TOUGH2 code, The report also gives a brief technical description of the code, including a discussion of parallel methodology, code structure, as well as mathematical and numerical methods used. To familiarize users with the parallel code, illustrative sample problems are presented.« less

14 CFR 25.499 - Nose-wheel yaw and steering.

Code of Federal Regulations, 2010 CFR

2010-01-01

... nose wheel ground contact equal to 0.8 of the vertical ground reaction at that point are assumed. (b... lower drag reaction may be used if an effective drag force of 0.8 times the vertical reaction cannot be... not exceed the maximum drag reaction on one main gear, determined in accordance with § 25.493(b). (e...

14 CFR 25.499 - Nose-wheel yaw and steering.

Code of Federal Regulations, 2011 CFR

2011-01-01

... nose wheel ground contact equal to 0.8 of the vertical ground reaction at that point are assumed. (b... lower drag reaction may be used if an effective drag force of 0.8 times the vertical reaction cannot be... not exceed the maximum drag reaction on one main gear, determined in accordance with § 25.493(b). (e...

Study of high momentum eta' production in B --> eta'Xs.

PubMed

Aubert, B; Barate, R; Boutigny, D; Couderc, F; Gaillard, J-M; Hicheur, A; Karyotakis, Y; Lees, J P; Tisserand, V; Zghiche, A; Palano, A; Pompili, A; Chen, J C; Qi, N D; Rong, G; Wang, P; Zhu, Y S; Eigen, G; Ofte, I; Stugu, B; Abrams, G S; Borgland, A W; Breon, A B; Brown, D N; Button-Shafer, J; Cahn, R N; Charles, E; Day, C T; Gill, M S; Gritsan, A V; Groysman, Y; Jacobsen, R G; Kadel, R W; Kadyk, J; Kerth, L T; Kolomensky, Yu G; Kukartsev, G; LeClerc, C; Levi, M E; Lynch, G; Mir, L M; Oddone, P J; Orimoto, T J; Pripstein, M; Roe, N A; Ronan, M T; Shelkov, V G; Telnov, A V; Wenzel, W A; Ford, K; Harrison, T J; Hawkes, C M; Morgan, S E; Watson, A T; Watson, N K; Fritsch, M; Goetzen, K; Held, T; Koch, H; Lewandowski, B; Pelizaeus, M; Peters, K; Schmuecker, H; Steinke, M; Boyd, J T; Chevalier, N; Cottingham, W N; Kelly, M P; Latham, T E; Mackay, C; Wilson, F F; Abe, K; Cuhadar-Donszelmann, T; Hearty, C; Mattison, T S; McKenna, J A; Thiessen, D; Kyberd, P; McKemey, A K; Teodorescu, L; Blinov, V E; Bukin, A D; Golubev, V B; Ivanchenko, V N; Kravchenko, E A; Onuchin, A P; Serednyakov, S I; Skovpen, Yu I; Solodov, E P; Yushkov, A N; Best, D; Bruinsma, M; Chao, M; Eschrich, I; Kirkby, D; Lankford, A J; Mandelkern, M; Mommsen, R K; Roethel, W; Stoker, D P; Buchanan, C; Hartfiel, B L; Gary, J W; Layter, J; Shen, B C; Wang, K; del Re, D; Hadavand, H K; Hill, E J; MacFarlane, D B; Paar, H P; Rahatlou, Sh; Sharma, V; Berryhill, J W; Campagnari, C; Dahmes, B; Levy, S L; Long, O; Lu, A; Mazur, M A; Richman, J D; Verkerke, W; Beck, T W; Beringer, J; Eisner, A M; Heusch, C A; Lockman, W S; Schalk, T; Schmitz, R E; Schumm, B A; Seiden, A; Spradlin, P; Walkowiak, W; Williams, D C; Wilson, M G; Albert, J; Chen, E; Dubois-Felsmann, G P; Dvoretskii, A; Erwin, R J; Hitlin, D G; Narsky, I; Piatenko, T; Porter, F C; Ryd, A; Samuel, A; Yang, S; Jayatilleke, S; Mancinelli, G; Meadows, B T; Sokoloff, M D; Abe, T; Blanc, F; Bloom, P; Chen, S; Clark, P J; Ford, W T; Nauenberg, U; Olivas, A; Rankin, P; Roy, J; Smith, J G; van Hoek, W C; Zhang, L; Harton, J L; Hu, T; Soffer, A; Toki, W H; Wilson, R J; Zhang, J; Altenburg, D; Brandt, T; Brose, J; Colberg, T; Dickopp, M; Feltresi, E; Hauke, A; Lacker, H M; Maly, E; Müller-Pfefferkorn, R; Nogowski, R; Otto, S; Schubert, J; Schubert, K R; Schwierz, R; Spaan, B; Bernard, D; Bonneaud, G R; Brochard, F; Grenier, P; Thiebaux, Ch; Vasileiadis, G; Verderi, M; Bard, D J; Khan, A; Lavin, D; Muheim, F; Playfer, S; Andreotti, M; Azzolini, V; Bettoni, D; Bozzi, C; Calabrese, R; Cibinetto, G; Luppi, E; Negrini, M; Piemontese, L; Sarti, A; Treadwell, E; Baldini-Ferroli, R; Calcaterra, A; de Sangro, R; Finocchiaro, G; Patteri, P; Piccolo, M; Zallo, A; Buzzo, A; Capra, R; Contri, R; Crosetti, G; Lo Vetere, M; Macri, M; Monge, M R; Passaggio, S; Patrignani, C; Robutti, E; Santroni, A; Tosi, S; Bailey, S; Morii, M; Won, E; Dubitzky, R S; Langenegger, U; Bhimji, W; Bowerman, D A; Dauncey, P D; Egede, U; Gaillard, J R; Morton, G W; Nash, J A; Taylor, G P; Grenier, G J; Lee, S-J; Mallik, U; Cochran, J; Crawley, H B; Lamsa, J; Meyer, W T; Prell, S; Rosenberg, E I; Yi, J; Davier, M; Grosdidier, G; Höcker, A; Laplace, S; Le Diberder, F; Lepeltier, V; Lutz, A M; Petersen, T C; Plaszczynski, S; Schune, M H; Tantot, L; Wormser, G; Brigljević, V; Cheng, C H; Lange, D J; Simani, M C; Wright, D M; Bevan, A J; Coleman, J P; Fry, J R; Gabathuler, E; Gamet, R; Kay, M; Parry, R J; Payne, D J; Sloane, R J; Touramanis, C; Back, J J; Harrison, P F; Mohanty, G B; Brown, C L; Cowan, G; Flack, R L; Flaecher, H U; George, S; Green, M G; Kurup, A; Marker, C E; McMahon, T R; Ricciardi, S; Salvatore, F; Vaitsas, G; Winter, M A; Brown, D; Davis, C L; Allison, J; Barlow, N R; Barlow, R J; Hart, P A; Hodgkinson, M C; Lafferty, G D; Lyon, A J; Williams, J C; Farbin, A; Hulsbergen, W D; Jawahery, A; Kovalskyi, D; Lae, C K; Lillard, V; Roberts, D A; Blaylock, G; Dallapiccola, C; Flood, K T; Hertzbach, S S; Kofler, R; Koptchev, V B; Moore, T B; Saremi, S; Staengle, H; Willocq, S; Cowan, R; Sciolla, G; Taylor, F; Yamamoto, R K; Mangeol, D J J; Patel, P M; Robertson, S H; Lazzaro, A; Palombo, F; Bauer, J M; Cremaldi, L; Eschenburg, V; Godang, R; Kroeger, R; Reidy, J; Sanders, D A; Summers, D J; Zhao, H W; Brunet, S; Cote-Ahern, D; Taras, P; Nicholson, H; Cartaro, C; Cavallo, N; De Nardo, G; Fabozzi, F; Gatto, C; Lista, L; Paolucci, P; Piccolo, D; Sciacca, C; Baak, M A; Raven, G; Wilden, L; Jessop, C P; LoSecco, J M; Gabriel, T A; Allmendinger, T; Brau, B; Gan, K K; Honscheid, K; Hufnagel, D; Kagan, H; Kass, R; Pulliam, T; Ter-Antonyan, R; Wong, Q K; Brau, J; Frey, R; Igonkina, O; Potter, C T; Sinev, N B; Strom, D; Torrence, E; Colecchia, F; Dorigo, A; Galeazzi, F; Margoni, M; Morandin, M; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Tiozzo, G; Voci, C; Benayoun, M; Briand, H; Chauveau, J; David, P; de la Vaissière, Ch; Del Buono, L; Hamon, O; John, M J J; Leruste, Ph; Ocariz, J; Pivk, M; Roos, L; T'Jampens, S; Therin, G; Manfredi, P F; Re, V; Behera, P K; Gladney, L; Guo, Q H; Panetta, J; Anulli, F; Biasini, M; Peruzzi, I M; Pioppi, M; Angelini, C; Batignani, G; Bettarini, S; Bondioli, M; Bucci, F; Calderini, G; Carpinelli, M; Del Gamba, V; Forti, F; Giorgi, M A; Lusiani, A; Marchiori, G; Martinez-Vidal, F; Morganti, M; Neri, N; Paoloni, E; Rama, M; Rizzo, G; Sandrelli, F; Walsh, J; Haire, M; Judd, D; Paick, K; Wagoner, D E; Danielson, N; Elmer, P; Lu, C; Miftakov, V; Olsen, J; Smith, A J S; Varnes, E W; Bellini, F; Cavoto, G; Faccini, R; Ferrarotto, F; Ferroni, F; Gaspero, M; Mazzoni, M A; Morganti, S; Pierini, M; Piredda, G; Safai Tehrani, F; Voena, C; Christ, S; Wagner, G; Waldi, R; Adye, T; De Groot, N; Franek, B; Geddes, N I; Gopal, G P; Olaiya, E O; Xella, S M; Aleksan, R; Emery, S; Gaidot, A; Ganzhur, S F; Giraud, P-F; Hamel de Monchenault, G; Kozanecki, W; Langer, M; Legendre, M; London, G W; Mayer, B; Schott, G; Vasseur, G; Yeche, Ch; Zito, M; Purohit, M V; Weidemann, A W; Yumiceva, F X; Aston, D; Bartoldus, R; Berger, N; Boyarski, A M; Buchmueller, O L; Convery, M R; Cristinziani, M; Dong, D; Dorfan, J; Dujmic, D; Dunwoodie, W; Elsen, E E; Field, R C; Glanzman, T; Gowdy, S J; Hadig, T; Halyo, V; Hryn'ova, T; Innes, W R; Kelsey, M H; Kim, P; Kocian, M L; Leith, D W G S; Libby, J; Luitz, S; Luth, V; Lynch, H L; Marsiske, H; Messner, R; Muller, D R; O'Grady, C P; Ozcan, V E; Perazzo, A; Perl, M; Petrak, S; Ratcliff, B N; Roodman, A; Salnikov, A A; Schindler, R H; Schwiening, J; Simi, G; Snyder, A; Soha, A; Stelzer, J; Su, D; Sullivan, M K; Va'vra, J; Wagner, S R; Weaver, M; Weinstein, A J R; Wisniewski, W J; Wright, D H; Young, C C; Burchat, P R; Edwards, A J; Meyer, T I; Petersen, B A; Roat, C; Ahmed, M; Ahmed, S; Alam, M S; Ernst, J A; Saeed, M A; Saleem, M; Wappler, F R; Bugg, W; Krishnamurthy, M; Spanier, S M; Eckmann, R; Kim, H; Ritchie, J L; Satpathy, A; Schwitters, R F; Izen, J M; Kitayama, I; Lou, X C; Ye, S; Bianchi, F; Bona, M; Gallo, F; Gamba, D; Borean, C; Bosisio, L; Cossutti, F; Della Ricca, G; Dittongo, S; Grancagnolo, S; Lanceri, L; Poropat, P; Vitale, L; Vuagnin, G; Panvini, R S; Banerjee, Sw; Brown, C M; Fortin, D; Jackson, P D; Kowalewski, R; Roney, J M; Band, H R; Dasu, S; Datta, M; Eichenbaum, A M; Johnson, J R; Kutter, P E; Li, H; Liu, R; Di Lodovico, F; Mihalyi, A; Mohapatra, A K; Pan, Y; Prepost, R; Sekula, S J; von Wimmersperg-Toeller, J H; Wu, J; Wu, S L; Yu, Z; Neal, H

2004-08-06

We measure the branching fraction for the charmless semi-inclusive process B --> eta'Xs, where the eta' meson has a momentum in the range 2.0 to 2.7 GeV/c in the upsilon4S center-of-mass frame and Xs represents a system comprising a kaon and zero to four pions. We find B(B --> eta'Xs) = [3.9 +/- 0.8(stat) +/- 0.5(syst) +/- 0.8(model)] x 10(-4). We also obtain the Xs mass spectrum and find that it fits models predicting high masses.

Moon Munchies: Human Exploration Project Engineering Design Challenge--A Standards-Based Elementary School Model Unit Guide--Design, Build, and Evaluate (Lessons 1-6). Engineering By Design: Advancing Technological Literacy--A Standards-Based Program Series. EP-2007-08-92-MSFC

ERIC Educational Resources Information Center

Weaver, Kim M.

2005-01-01

In this unit, elementary students design and build a lunar plant growth chamber using the Engineering Design Process. The purpose of the unit is to help students understand and apply the design process as it relates to plant growth on the moon. This guide includes six lessons, which meet a number of national standards and benchmarks in…

In Situ Biological Treatment Test at Kelly Air Force Base. Volume 3. Appendices.

DTIC Science & Technology

1987-07-01

175 B-12 Results of Groundwater Acidity Monitoring. . . . . . . . 176 B-13 Results of Groundwater Alkalinity Monitoring . . . . . . 177 B- 14 ...Oichloroethylene 499 Vinyl chloride 850 1.2-cis dichloroethylene Pam jupe Table A-I. Results of 5/23/85 Groundwater Sampling (Continued) 14 aqualab inc. 9909...Sample No. : 08/134621 Matrix: NATURAL WATER Parameter Result Units CC SPECIAL SCAN 1400 ug/L Client I.D.: 14 ERG Sample No.: 08/134622 Matrix

Reliability and validity of the Incontinence Quiz-Turkish version.

PubMed

Kara, Kerime C; Çıtak Karakaya, İlkim; Tunalı, Nur; Karakaya, Mehmet G

2018-01-01

The aim of this study was to investigate the reliability and validity of the Turkish version of the Incontinence Quiz, which was developed by Branch et al. (1994), to assess women's knowledge of and attitudes toward urinary incontinence. Comprehensibility of the Turkish version of the 14-item Incontinence Quiz, which was prepared following translation-back translation procedures, was tested on a pilot group of eight women, and its internal reliability, test-retest reliability and construct validity were assessed in 150 women who attended the gynecology clinics of three hospitals in İçel, Turkey. Physical and sociodemographic characteristics and presence of incontinence complaints were also recorded. Data were analyzed at the 0.05 alpha level, using SPSS version 22. The scale had good reliability and validity. The internal reliability coefficient (Cronbach α) was 0.80, test-retest correlation coefficients were 0.83-0.94; and with regard to construct validity, Kaiser-Meyer-Olkin coefficient was 0.76 and Barlett sphericity test was 562.777 (P = 0.000). Turkish version of the Incontinence Quiz had a four-factor structure, with Eigenvalues ranging from 1.17 to 4.08. The Incontinence Quiz-Turkish version is a highly comprehensible, reliable and valid scale, which may be used to assess Turkish-speaking women's knowledge of and attitudes toward urinary incontinence. © 2017 Japan Society of Obstetrics and Gynecology.

User`s and reference guide to the INEL RML/analytical radiochemistry sample tracking database version 1.00

DOE Office of Scientific and Technical Information (OSTI.GOV)

Femec, D.A.

This report discusses the sample tracking database in use at the Idaho National Engineering Laboratory (INEL) by the Radiation Measurements Laboratory (RML) and Analytical Radiochemistry. The database was designed in-house to meet the specific needs of the RML and Analytical Radiochemistry. The report consists of two parts, a user`s guide and a reference guide. The user`s guide presents some of the fundamentals needed by anyone who will be using the database via its user interface. The reference guide describes the design of both the database and the user interface. Briefly mentioned in the reference guide are the code-generating tools, CREATE-SCHEMAmore » and BUILD-SCREEN, written to automatically generate code for the database and its user interface. The appendices contain the input files used by the these tools to create code for the sample tracking database. The output files generated by these tools are also included in the appendices.« less

INM. Integrated Noise Model Version 4.11. User’s Guide - Supplement

DTIC Science & Technology

1993-12-01

KB of Random Access Memory (RAM) or 3 MB of RAM, if operating the INM from a RAM disk, as discussed in Section 1.2.1 below; 0 Math co-processor, Series... accessible from the Data Base using the ACDB11.EXE computer program, supplied with the Version 4.11 release. With the exception of INM airplane numbers 1, 6...9214 10760 -- -.-- 27 7053 6215 9470 10703 --- --- - 28 SS7 5940 SS94 729S . ... ... 29 4223 4884 7897 9214 10760 ..... 30 sots 6474 7939 8774

Turbo FRMAC 2016 Version 7.1.0

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fulton, John; Gallagher, Linda K.; Madrid, Gregory J.

2016-08-01

The Turbo FRMAC (TF) software program is the software implementation of the science and methodologies utilized in the Federal Radiological Monitoring and Assessment Center (FRMAC). The software automates the calculations described in volumes 1 of "The Federal Manual for Assessing Environmental Data during a Radiological Emergency" (2015 version). In the event of the intentional or accidental release of radioactive material, the software is used to guide and govern the response of the Federal, State, Local, and Tribal governments. The manual, upon which the software is based, is unclassified and freely available on the Internet.

Improving safety climate through a communication and recognition program for construction: a mixed-methods study

PubMed Central

Sparer, Emily H; Catalano, Paul J; Herrick, Robert F; Dennerlein, Jack T

2016-01-01

Objectives This study aimed to evaluate the efficacy of a safety communication and recognition program (B-SAFE), designed to encourage improvement of physical working conditions and hazard reduction in construction. Methods A matched pair cluster randomized controlled trial was conducted on eight worksites (four received the B-SAFE intervention, four served as control sites) for approximately five months per site. Pre- and post-exposure worker surveys were collected at all sites (N=615, pre-exposure response rate of 74%, post-exposure response rate of 88%). Multi-level mixed-effect regression models evaluated the effect of B-SAFE on safety climate as assessed from surveys. Focus groups (N=6–8 workers/site) were conducted following data collection. Transcripts were coded and analyzed for thematic content using Atlas.ti (version 6). Results The mean safety climate score at intervention sites, as measured on a 0–50 point scale, increased 0.5 points (1%) between pre- and post-B-SAFE exposure, compared to control sites that decreased 0.8 points (1.6%). The intervention effect size was 1.64 (3.28%) (P-value=0.01) when adjusted for month the worker started on-site, total length of time on-site, as well as individual characteristics (trade, title, age, and race/ethnicity). At intervention sites, workers noted increased levels of safety awareness, communication, and teamwork compared to control sites. Conclusions B-SAFE led to many positive changes, including an improvement in safety climate, awareness, teambuilding, and communication. B-SAFE was a simple intervention that engaged workers through effective communication infrastructures and had a significant, positive effect on worksite safety. PMID:27158914

Augmented Reality Visualization with Use of Image Overlay Technology for MR Imaging–guided Interventions: Assessment of Performance in Cadaveric Shoulder and Hip Arthrography at 1.5 T

PubMed Central

Fritz, Jan; U-Thainual, Paweena; Ungi, Tamas; Flammang, Aaron J.; Fichtinger, Gabor; Iordachita, Iulian I.

2012-01-01

Purpose: To prospectively assess overlay technology in providing accurate and efficient targeting for magnetic resonance (MR) imaging–guided shoulder and hip joint arthrography. Materials and Methods: A prototype augmented reality image overlay system was used in conjunction with a clinical 1.5-T MR imager. A total of 24 shoulder joint and 24 hip joint injections were planned in 12 human cadavers. Two operators (A and B) participated, each performing procedures on different cadavers using image overlay guidance. MR imaging was used to confirm needle positions, monitor injections, and perform MR arthrography. Accuracy was assessed according to the rate of needle adjustment, target error, and whether the injection was intraarticular. Efficiency was assessed according to arthrography procedural time. Operator differences were assessed with comparison of accuracy and procedure times between the operators. Mann-Whitney U test and Fisher exact test were used to assess group differences. Results: Forty-five arthrography procedures (23 shoulders, 22 hips) were performed. Three joints had prostheses and were excluded. Operator A performed 12 shoulder and 12 hip injections. Operator B performed 11 shoulder and 10 hip injections. Needle adjustment rate was 13% (six of 45; one for operator A and five for operator B). Target error was 3.1 mm ± 1.2 (standard deviation) (operator A, 2.9 mm ± 1.4; operator B, 3.5 mm ± 0.9). Intraarticular injection rate was 100% (45 of 45). The average arthrography time was 14 minutes (range, 6–27 minutes; 12 minutes [range, 6–25 minutes] for operator A and 16 minutes [range, 6–27 min] for operator B). Operator differences were not significant with regard to needle adjustment rate (P = .08), target error (P = .07), intraarticular injection rate (P > .99), and arthrography time (P = .22). Conclusion: Image overlay technology provides accurate and efficient MR guidance for successful shoulder and hip arthrography in human cadavers. © RSNA, 2012 Supplemental material: http://radiology.rsna.org/lookup/suppl/doi:10.1148/radiol.12112640/-/DC1 PMID:22843764

A computed tomographic anatomical study of the upper sacrum. Application for a user guide of pelvic fixation with iliosacral screws in adult spinal deformity.

PubMed

Dubory, Arnaud; Bouloussa, Houssam; Riouallon, Guillaume; Wolff, Stéphane

2017-12-01

Widely used in traumatic pelvic ring fractures, the iliosacral (IS) screw technique for spino-pelvic fixation remains anecdotal in adult spinal deformity. The objective of this study was to assess anatomical variability of the adult upper sacrum and to provide a user guide of spino-pelvic fixation with IS screws in adult spinal deformity. Anatomical variability of the upper sacrum according to age, gender, height and weight was sought on 30 consecutive pelvic CT-scans. Thus, a user guide of spino-pelvic fixation with IS screws was modeled and assessed on ten CT-scans as described below. Two invariable landmarks usable during the surgical procedure were defined: point A (corresponding to the connector binding the IS screw to the spinal rod), equidistant from the first posterior sacral hole and the base of the S1 articular facet and 10 mm-embedded into the sacrum; point B (corresponding to the tip of the IS screw) located at the junction of the anterior third and middle third of the sacral endplate in the sagittal plane and at the middle of the endplate in the coronal plane. Point C corresponded to the intersection between the A-B direction and the external facet of the iliac wing. Three-dimensional reconstructions modeling the IS screw optimal direction according to the A-B-C straight line were assessed. Age had no effect on the anatomy of the upper sacrum. The distance between the base of the S1 superior articular facet and the top of the first posterior sacral hole was correlated with weight (r = 0.6; 95% CI [0.6-0.9]); p < 0.001). Sacral end-plate thickness increased for male patients (p < 0.001) and was strongly correlated with height (r = 0.6; 95% CI [0.29-0.75]); p < 0.001) and weight (r = 0.8; 95% CI [0.6-0.9]); p < 0.001). The thickness of the inferior part of the S1 vertebral body increased in male patients (p < 0.001). Other measured parameters slightly varied according to gender, height and weight. Simulating the described technique of pelvic fixation, no misplaced IS screw was found whatever the age, gender and morphologic parameters. This user guide of spinopelvic fixation with IS screws seems to be reliable and reproducible independently of age, gender and morphologic characteristics but needs clinical assessment. Level IV.

Assessing Attitudes towards Statistics among Medical Students: Psychometric Properties of the Serbian Version of the Survey of Attitudes Towards Statistics (SATS)

PubMed Central

Stanisavljevic, Dejana; Trajkovic, Goran; Marinkovic, Jelena; Bukumiric, Zoran; Cirkovic, Andja; Milic, Natasa

2014-01-01

Background Medical statistics has become important and relevant for future doctors, enabling them to practice evidence based medicine. Recent studies report that students’ attitudes towards statistics play an important role in their statistics achievements. The aim of the study was to test the psychometric properties of the Serbian version of the Survey of Attitudes Towards Statistics (SATS) in order to acquire a valid instrument to measure attitudes inside the Serbian educational context. Methods The validation study was performed on a cohort of 417 medical students who were enrolled in an obligatory introductory statistics course. The SATS adaptation was based on an internationally accepted methodology for translation and cultural adaptation. Psychometric properties of the Serbian version of the SATS were analyzed through the examination of factorial structure and internal consistency. Results Most medical students held positive attitudes towards statistics. The average total SATS score was above neutral (4.3±0.8), and varied from 1.9 to 6.2. Confirmatory factor analysis validated the six-factor structure of the questionnaire (Affect, Cognitive Competence, Value, Difficulty, Interest and Effort). Values for fit indices TLI (0.940) and CFI (0.961) were above the cut-off of ≥0.90. The RMSEA value of 0.064 (0.051–0.078) was below the suggested value of ≤0.08. Cronbach’s alpha of the entire scale was 0.90, indicating scale reliability. In a multivariate regression model, self-rating of ability in mathematics and current grade point average were significantly associated with the total SATS score after adjusting for age and gender. Conclusion Present study provided the evidence for the appropriate metric properties of the Serbian version of SATS. Confirmatory factor analysis validated the six-factor structure of the scale. The SATS might be reliable and a valid instrument for identifying medical students’ attitudes towards statistics in the Serbian educational context. PMID:25405489

Assessing attitudes towards statistics among medical students: psychometric properties of the Serbian version of the Survey of Attitudes Towards Statistics (SATS).

PubMed

Stanisavljevic, Dejana; Trajkovic, Goran; Marinkovic, Jelena; Bukumiric, Zoran; Cirkovic, Andja; Milic, Natasa

2014-01-01

Medical statistics has become important and relevant for future doctors, enabling them to practice evidence based medicine. Recent studies report that students' attitudes towards statistics play an important role in their statistics achievements. The aim of the study was to test the psychometric properties of the Serbian version of the Survey of Attitudes Towards Statistics (SATS) in order to acquire a valid instrument to measure attitudes inside the Serbian educational context. The validation study was performed on a cohort of 417 medical students who were enrolled in an obligatory introductory statistics course. The SATS adaptation was based on an internationally accepted methodology for translation and cultural adaptation. Psychometric properties of the Serbian version of the SATS were analyzed through the examination of factorial structure and internal consistency. Most medical students held positive attitudes towards statistics. The average total SATS score was above neutral (4.3±0.8), and varied from 1.9 to 6.2. Confirmatory factor analysis validated the six-factor structure of the questionnaire (Affect, Cognitive Competence, Value, Difficulty, Interest and Effort). Values for fit indices TLI (0.940) and CFI (0.961) were above the cut-off of ≥0.90. The RMSEA value of 0.064 (0.051-0.078) was below the suggested value of ≤0.08. Cronbach's alpha of the entire scale was 0.90, indicating scale reliability. In a multivariate regression model, self-rating of ability in mathematics and current grade point average were significantly associated with the total SATS score after adjusting for age and gender. Present study provided the evidence for the appropriate metric properties of the Serbian version of SATS. Confirmatory factor analysis validated the six-factor structure of the scale. The SATS might be reliable and a valid instrument for identifying medical students' attitudes towards statistics in the Serbian educational context.

High performance Nd-Fe-B permanent magnets without critical elements

DOE PAGES

Pathak, Arjun K.; Gschneidner, Jr., K. A.; Khan, M.; ...

2016-01-28

Scanning electron microscopy, and magnetization measurements reveal that as cast (Nd 1–xCe x) 2Fe 14B alloys contain significant amounts of α-Fe that can be dramatically reduced by annealing the alloys at 1000 °C for 3 days. The room temperature intrinsic coercivity, Hci, of (Nd 0.8Ce 0.2) 2.2Fe 14B melt spun ribbons was found to be 11 kOe, which is ~32 to ~10% higher in comparison to that of Nd 2Fe 14B (Hci = 8.3 kOe), and (Nd 0.8Ce 0.2) 2.0Fe 14B (Hci = 10 kOe), respectively. The substitution of Co for Fe in (Nd 0.8Ce 0.2) 2Fe 14–zCo zB significantlymore » increases both TC and the maximum energy product, (BH)max. Our study shows that both Co-containing and Co-free Ce-substituted Nd 2Fe 14B alloys have excellent magnetic properties at room temperature and above. As a result, the experimental results also demonstrate the potential of Nd-Ce-Fe-TM-B based alloys as alternative to expensive Dy-containing high performance rare earth magnets.« less

Developing iCare v.1.0: an academic electronic health record.

PubMed

Wyatt, Tami H; Li, Xueping; Indranoi, Chayawat; Bell, Matthew

2012-06-01

An electronic health record application, iCare v.1.0, was developed and tested that allows data input and retrieval while tracking student performance over time. The development and usability testing of iCare v.1.0 followed a rapid prototyping software development and testing model. Once the functionality was tested by engineers, the usability and feasibility testing began with a convenience sample of focus group members including undergraduate and graduate students and faculty. Three focus groups were created, and four subjects participated in each focus group (n = 12). Nielsen's usability heuristics and methods of evaluation were used to evaluate data captured from each focus group. Overall, users wanted a full-featured electronic health record with features that coached or guided users. The earliest versions of iCare v.1.0 did not provide help features and prompts to guide students but were later added. Future versions will incorporate a full-featured help section. The interface and design of iCare v.1.0 are similar to professional electronic health record applications. As a result of this usability study, future versions of iCare will include more robust help features along with advanced reporting and elements specific to specialty populations such as pediatrics and mental health services.

User's guide for Skylab dynamics program, SKYDYN

NASA Technical Reports Server (NTRS)

Hopkins, M. S.

1980-01-01

This user's manual describes the capabilities, required input data, and resulting output of SKYDYN, version of the 6 degree-of-freedom digital program REENTR which was extensively modified for the Honeywell CP-V system and was tailored to the specfic requirements for SKYLAB.

Virtual Beach v2.2 User Guide

EPA Science Inventory

Virtual Beach version 2.2 (VB 2.2) is a decision support tool. It is designed to construct site-specific Multi-Linear Regression (MLR) models to predict pathogen indicator levels (or fecal indicator bacteria, FIB) at recreational beaches. MLR analysis has outperformed persisten...